Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
the present invention , in an exemplary embodiment , uses an nfet as a virtual rail clamp ( vrc ), such as voltage clamp 22 of fig2 , for a footer ( e . g ., pfet as a vrc for a header ). as is described in more detail below , using an nfet as a voltage clamp for a footer is seems to be a poor choice . nonetheless , as the disclosure will show , under the voltage ranges over which voltage clamping needs to be applied , an nfet can also work as a good voltage clamp . further , the disclosure will show that using a pfet or diode as a vrc requires costly modifications during manufacturing while using an nfet does not require any modifications to manufacturing . in addition , a method is disclosed to make the vrc implementation immune to manufacturing variability , which is becoming the most significant problem facing designers in addition to power with future technologies . the exemplary method for variability immunity can be modified in a manner obvious to those skilled in the art of powergating to be applicable to all forms of powergating , including powergating without vrc . before proceeding with a description of using one or more nfets as voltage clamps , additional information about circuits using voltages clams will be described . as previously discussed , a simple extension to power gating uses a voltage clamp 22 ( see fig2 ) in parallel to a power gating switch or footer 14 . fig2 shows the concept of power gating with a virtual rail voltage clamp using a generic voltage clamp circuit . the modified power gating scheme requires the use of voltage clamp circuitry 22 and variability control circuitry 74 in fig7 which will be explained later . the present description is on footers as the power gating device but the idea holds for header devices too . “ virtual ground ” refers to the node or rail where the ground terminal of the logic circuit connects to the power gating device , which in fig2 is the drain of the nfet footer 14 . during power gating , since the footer 14 is off , the voltage at the drain of the footer rises and approaches v dd / 2 which causes the output signal to assume an undetermined state if it was initially at logic state “ 0 ”. the addition of a rail voltage clamp ( vrc ) circuit 22 prevents the voltage at the virtual ground from rising above a certain predetermined value . the predetermined voltage at the virtual ground rail is referred to as v clamp . if v clamp is small enough and significantly smaller than v dd / 2 , then the output state loss associated with powergating without vrc can be prevented . some of the circuits used as voltage clamps for footers found in the prior art literature are diodes or pfets . the v - i curve of diodes , pfets and nfets are shown in fig3 . consider the curve for a diode . the diode which is operating in the forward biased mode hardly registers any current flow as long as the voltage is below its cutoff voltage . when the voltage across the diode exceeds the cutoff voltage the current through the diode increases rapidly . a very small change in voltage across the diode produces a large change in current . in other words , even when there is a large change in current through the diode , the large current change produces a small change in voltage which is what is desired of a voltage clamp . to better understand how the voltage clamp circuit works and how the steady state v clamp is determined , reference is made to the schematic in fig2 and the v - i curves in fig4 . note that the curves depend upon the relative sizes of the logic circuit that is being gated , the footer 14 size , the characteristics of the voltage clamp 22 , the input values for the gated logic 16 , and the like . the voltage at the virtual ground at any time is referred to as v gnd . the logic circuit 16 , the footer 14 , which is turned off , and the voltage clamp 22 have been simulated separately with v gnd as the controlling variable using spice software . the current through the logic circuit 16 either flows through the footers 14 or through the voltage clamps 33 . the difference of the currents through the logic circuit 16 and the footer 14 is the current through the voltage clamps 22 and is plotted as the dotted line ( i diff ) in fig4 . as v gnd increases , the voltage across the logic circuit 16 reduces and the leakage of the logic circuit 16 decreases rapidly while the current through the footer 14 changes minimally since the footer 16 is off . therefore , the net current ( i diff ) falls rapidly as v gnd rises . the current through the voltage clamp 22 , on the other hand , rises with increasing v gnd and is plotted as the solid line in fig4 ( i vc ). the characteristic of the solid line will depend upon the characteristics of the voltage clamp 22 . at steady state , the current through the voltage clamp 22 has to equal the difference of the current flowing out of the logic circuit and the current flowing into the footer device . hence , the point where the two curves meet in fig4 determines the operating point of the circuit in fig2 when the footer 14 is off . in fig4 , the operating point is defined by v gnd at 120 mv (= v clamp ) and i static or i leak of 0 . 3 ma . since the voltage at v gnd is forced to be at or very close to 120 mv in this case , if the output is at logic state “ 0 ”, then in the power gated state it does not go to v dd / 2 ( 500 millivolts in our experiments ) but stays close to 120 mv which is still considered logic state “ 0 ”. this clamping action ensures that the data at the output is not lost during power gating . power gating with vrc reduces leakage by 40 % or more compared to 90 % or more reduction when powergating without vrc . the advantages of power gating with virtual vrc requires reference to the list of problems associated with power gating without vrc enumerated above . power gating with vrc completely addresses problem 1 and problem 2 since state information is not lost due to vrc . vrc addresses problem 3 by eliminating the cycles required for storing and restoring latch states and also reducing the number of cycles required for powering up since it produces less noise on the power rails . the power management unit design ( problem 4 ) is simplified because state store / restore is not required and fence circuits do not have to be asserted / de - asserted . verification of power gating ( pg ) ( problem 5 ) is much simpler since the verification engineer does not have to deal with unknown states and the power management unit is simpler compared to a pg design . some common voltage clamp circuits are mentioned in the prior art . each of these circuits has its advantage and disadvantage . an exemplary novelty of the present invention resides in the use of a nfet as a voltage clamp circuit , although usually an nfet is not considered a good voltage clamp . before we proceed to discuss nfets as a voltage clamp circuit , a theorem will now be presented which shows that in terms of the leakage metric , all voltage clamp circuits are equally good . theorem : for a given logic circuit being power gated by a footer circuit , if the voltage clamp circuit is changed , but v clamp is kept fixed , then leakage from the logic circuit is the same regardless of the voltage clamp circuit being used . proof of the theorem assumes that the voltage between the power rails of the logic circuit being power gated is v dd and v clamp . since v clamp is fixed even though the voltage clamp circuit is changed , the leakage from the logic circuit being power gated has to remain constant . it should be noted that the above theorem does not consider the leakage from the voltage clamp circuitry itself which varies depending upon the characteristics of the voltage clamp circuitry . however , since the voltage clamp circuit itself is rather small , the leakage due to the clamp circuit will have a small effect on the total leakage . what is more important is the shape of the transfer curves of the devices at v clamp . two of the common devices that are used as voltage clamps are the diode and the pfet . as can be seen from fig3 , the diode has a cutoff voltage below which the current through it is very low . after the cutoff voltage , the voltage - current curve is very sharp . large changes in current lead to a small voltage change . since it is impossible to accurately determine the current from the logic circuit being power gated , i . e . the estimate may be significantly different from the actual value , the voltage across the clamp can not be predicted accurately either . but the sharp slope of a diode implies that even if the actual leakage current is different from the expected leakage current , v gnd will remain close to v clamp . hence the diode acts as a good voltage clamp device . the current through the pfet accelerates sharply after the source voltage crosses v th though the pfet curve in its active region is less steep than that of a diode . hence a pfet in its active region ( input “ 0 ”) has behavior similar to a diode and is also a good voltage clamp . in accordance with the present invention , one or more nfets are used as a voltage clamp . however , the nfet has never been considered an appropriate choice for a voltage clamp . the reason can be understood by referring to fig3 . an nfet has a v - i curve which is not as sharp as that of a diode or a pfet and also , it flattens out above 0 . 3 volts as the nfet goes into saturation . however , there are a number of reasons why using one or more nfets as voltage clamps is beneficial . first , according to the theorem above , given a v clamp , the efficacy of a voltage clamp is the same regardless of the voltage clamp device type . so the issue really is that v gnd may not actually be v clamp due to manufacturing variations and for the nfet , the difference between v gnd and v clamp might be the largest since its curve is the least steep . however , as long as v clamp is not high enough to be close to the voltage at which the nfet goes into saturation , the slope of the nfet &# 39 ; s v - i curve is acceptable . a desirable v clamp value will not be very high since a high value of v clamp would reduce noise margins and increase chances of state loss . secondly , there is a method , as will be described below , to force v gnd to v clamp . this method almost eliminates the dependence of the desirability of the voltage clamp on the slope of its v - i curve . for this reason , the nfet is no less attractive than a diode or a pfet as a voltage clamp . the diode which has the best characteristics for a voltage clamp in the absence of variability faces a real challenge from variability in future technology modes . the present invention includes a method to address the variability problem . the method can be used with a pfet or a nfet voltage clamp device in conjunction with footers and with all forms of powergating , but it can not be used with a diode . for brevity we only discuss variability immunity method for nfet voltage clamps in conjunction with footers . we also discuss why an nfet is a less expensive alternative to a pfet or diode when used as a voltage clamp . the advantage of the nfet over the diode or pfet becomes more apparent when considering manufacturability aspects . it should be clear that v clamp ( steady state voltage at the virtual ground rail ) has to be higher than v th for the pfet or v cutoff for the diode for the curves of the pfet or diode ( fig3 ) to intersect the v - i curve for the logic circuit being power gated ( fig4 ). if v th of the pfet is higher than the v clamp necessary to prevent state loss , a new pfet device has to be manufactured which has a lower v th than the pfets used for logic design . the same argument applies to the diode if v cutoff for the diode is higher than the desired v clamp . this is usually the case since a v th which is good for a voltage clamp will be significantly different from the v th required for logic design . in case of the technology that was used to do our experiments , the v th for the pfets were 0 . 3v while the v clamp desired was around 0 . 12v . however , increasing the number of thresholds for the devices increases manufacturing complexity and cost . since the nfet starts conducting when v gnd exceeds 0v , using a nfet device as a voltage clamp makes it unnecessary to introduce a device with a different threshold level . having an nfet as a voltage clamp does not increase manufacturing costs while using a diode or pfet for as a voltage clamp may increase manufacturing costs . as devices get smaller and faster , variability is becoming one of the most difficult problems facing designers . device models typically include a worst case , best case and nominal behavior . with exceedingly small device sizes in the 90 nm and smaller technologies , the difference between the worst case and best case behavior is widening to aggravating levels . even if the best case or nominal leakage numbers might be acceptable , the worst case leakage numbers might not be acceptable . similarly , the worst case v gnd may not be acceptable if it is too different from the desired v clamp . the aggregate behavior of the devices in a particular chip is not known until after manufacturing and testing . hence hardwiring the design for the worst case behavior is one possible solution but the solution is a pessimistic one . on the other hand , designing all chips for the nominal behavior can have a deleterious effect on chip yield if the manufactures chips have unacceptable behavior . one solution is to include knobs in the design which can be used to tweak the chip after manufacturing and during test . the consequences of device variability on leakage and v clamp and a method to address the problem in the scheme of power gating with vrc after manufacturing and during test will now be described . first consider the effect of variability of the logic circuit which is being power gated . referring to fig4 , assume that the curve for the voltage clamp circuitry ( ivc ) remains unchanged . as the leakage for the logic circuit increases or decreases from the estimated value , the corresponding curve ( idiff ) moves up or down in the y - axis direction . if leakage increases and the curve idiff moves up , the point at which the two curves intersect moves to the right , i . e ., v gnd in steady state , v act — clamp , is higher than the v clamp target , and vice - versa . now assume that the logic being power gated displays a fixed behavior while the footers and the voltage clamps display variable behavior . again referring to fig4 , if the voltage clamp circuitry produces more current for the same voltage than was estimated , v act — clamp goes down while i act — leak goes up . if the voltage clamp circuitry produces less current than estimated , v act — clamp goes up while i act — leak goes down . the worst case scenario is where both leakage i act — leak and v act — clamp increases beyond nominal values i leak and v clamp . if v gnd is lowered below v act — clamp , leakage would increase beyond i act — leak where i act — leak is already higher than i leak . if v act — clamp is less than v clamp and i act — leak is higher than i leak , parity can be restored by increasing v act — clamp since this action will reduce i act — leak and bring it back closer to i leak . in the case where v act — clamp is more than v clamp and i act — leak is less than i leak parity can be restored too if v gnd can be reduced to v clamp . the best case situation is where both i act — leak and v act — clamp are less than the nominal values . this situation may not require any corrective measure or may be used advantageously by reducing leakage further than i leak by increasing v gnd from v act — clamp to v clamp . we now discuss the aspect of the invention which is concerned with the control of v gnd or the leakage so that they stay close to the desired values v clamp and i leak after manufacture and test in essence making the powergated circuit immune to manufacturing variability . assume that both footers as well as voltage clamp devices are implemented using nfets . a logical footer is usually implemented as a grid of connected distributed footer devices . regardless of the way in which the footers are distributed in the layout , a distributed footer scheme will have a common virtual ground rail . the virtual ground rail is implemented as a grid connecting the ground pins of the logic devices being powergated to the drains of the distributed footers . the voltage clamp nfets are physically the same as any nfet footer and they are also connected in parallel to the nfet footers . the essential difference between the footers and the voltage clamp nfets is the voltage clamp nfets are always on while the footer nfets are on or off depending upon whether the logic circuit is in an active state or low leakage state respectively . let n f be the total number of nfets in the powergated circuit . let n vc be the number of voltage clamp nfets required to achieve v clamp at the virtual ground rails when the ( n f − n vc ) footers are turned off ( the n vc voltage clamps are always on ). i leak is the leakage when the footers are turned off while the vrc devices are on . from experimental results described below , it will be seen that n vc is usually a very small fraction of n f . we next describe steps to implement variability immunity to power gated circuits which have voltage clamp and footer nfets . assume that based on variability analysis and estimates , v act — clamp is expected to vary between v low — clamp and v high — clamp . divide the range ( v high — clamp − v low — clamp ) into smaller sub - ranges . for sub - ranges between v low — clamp and v clamp estimate the extra number of nfets compared to n vc which have to be turned off to raise v act — clamp to v clamp . for sub - ranges from v clamp to v high — clamp , estimate the extra number of nfets which have to be turned on to lower v act — clamp to v clamp . the estimates are performed using spice software simulations . the sub - ranges and as well as the number of nfets that have to be turned off or on are stored in a table which is called the vc_count table . also , let the maximum number of nfets which need to be used as voltage clamps be n max — vc . assume that n f is a number so that ( n f − n max — vc ) are required to reduce leakage from the powergated circuit . the algorithm for implementing a variability immune power gating circuit design is shown in fig5 and the algorithm to tune a variability immune power gating circuit is shown in fig6 . the algorithms are based on the above descriptions . the steps of the algorithm in fig5 for implementing a variability immune power gating circuit are first , add n f number of nfets to the logic circuit and connect them , as is known to one skilled in the art , as required to implement power gating . then , add n max - vc number of latches in a scan chain to the power gating circuit . the output of each latch controls one nfet added in the previous step . finally , connect the rest of the nfets ( n f − n max - vc ) to a separate control signal , s sleep — n , as is done in conventional power gating arrangements . the result is a variability immune power gating circuit design . an example power gated circuit which can be tuned for variability is shown in fig7 . the steps of the algorithm in fig6 to tune a power gating circuit are first , manufacture and test the circuit . find v act — clamp and i leak during the test phase . next , from a vc_cnt table find the number , n act - vc , of nfets that have to be used for voltage clamp purposes to achieve v clamp from the measured values of v act — clamp and i leak . create a scan pattern with n act — vc number of “ 1 ” s and rest “ 0 ” s to ensure that n act - vc nfets are turned on and behave as voltage clamps . finally , feed the scan pattern into the scan chain created using the algorithm in fig5 . the result is a power gating circuit corrected in the presence of variability to work as desired . it should be noted that the above algorithms are applicable to pfet voltage clamps in conjunction with headers also but not to diodes since diodes do not have any node which allows turning the diodes on or off . fig7 is a schematic block diagram illustrating the algorithm of fig5 and fig6 . n f nfets 72 are added to the logic circuit 70 as required to implement power gating . n max - vc latches 74 are added in a scan chain so that the output of each latch 74 controls the input of a respective one of the n f nfets 72 for causing those nfets to act as voltage clamps . the remaining ( n f − n max - vc ) nfets 76 are connected to and controlled by control signal s sleep — n in a manner well known to those skilled in the art for power gating . experiments were performed in ibm &# 39 ; s cmos11s ( 65 nm ) technology . the operating vdd was 1 . 0v . we used a 1 bit full adder circuit as the logic circuit to be power gated . assume that the footer size is given as a fraction of the size of the logic to be power gated , in this case as a fraction of the adder size . we used a value of 6 % to compute the footer size to be used with the full adder . let 6 % of the sum of the width of the devices in the adder be w . in our experiments , we used a single nfet device of width ( 1 − f )· w as a footer and a single nfet device of width f · w as a voltage clamp where f is a fraction . the width of the footer or vrc nfet varies according to the fraction f . when f is 0 , we have only a footer and no voltage clamp . if f is 1 , in essence we have no footers at all . all simulations were done using spice software . in fig8 , the variation of v clamp and i leak as a function of f is shown , where f is the percentage of the total nfets which are always on and act as voltage clamps . it will be observed that as more nfets are turned on , the leakage current ( i gnd ) increases while the voltage at the virtual ground rail ( v gndv ) decreases . even though we would like to reduce leakage as much as possible this would imply pushing up v clamp but pushing v clamp too much can push outputs which are at logic state “ 0 ” to an undetermined state . a safe value of v clamp has to be determined using knowledge of the worst case voltage tolerable as logic “ 0 ” and also keeping noise considerations in mind . in our experiments , we assumed 120 mv (= v clamp ) to be a safe value of v gnd and to achieve that value required a very small fraction of 1 % of the total nfets to be voltage clamps . fig9 is similar to fig8 except the fraction f is varied over the entire range from 0 . 0 to 1 . 0 . when the fraction f is 1 . 0 , it is equivalent to not having any footers at all , i . e . the circuit is not power gated . the current under this condition roughly corresponds to the leakage current if the circuit was not power gated and is about 0 . 68 ma . it does not exactly correspond because the circuit shown has some “ on ” nfets which would be absent in a circuit without power gating . in actual experiments to compute power saving , we use a full adder circuit without any nfets . assume that we have determined 120 mv to be a safe value for v clamp . from fig8 , we find the fraction f for which v clamp is 120 mv to be about 4 %. for this fraction of nfets which are on , i leak is approximately 0 . 32 ma . from the two leakage values that we derive , we can see that we can get leakage savings of ( 0 . 68 − 0 . 32 )/ 0 . 32 = 52 % for v clamp of 120 mv . a table with accurate power savings numbers using a adder without any nfets and a power gated adder is shown in table 1 . note that the “ no vc ” column corresponds to the situation where footers are used for powergating without any voltage clamps ( vc &# 39 ; s ). it should be noted that a certain amount of energy is dissipated to turn the footers on and off . in our calculations we have ignored these numbers . while there has been described and illustrated exemplary embodiments of power gating circuits able to have data retention and low manufacturing cost and variability immune properties and exemplary methods of implementing and tuning the circuits , it will be apparent to those skilled in the art that modifications and variations are possible without deviating from the broad principles and teachings of the present invention which shall be limited solely by the scope of the claims appended hereto .	7
with reference first to fig1 through 3 the automatic press line illustrated therein has two presses 20 and 22 disposed with a spacing therebetween . bridging the space between the two presses 20 and 22 is a transfer conveyor 24 such as a standard belt conveyor having an endless moving belt 26 . a work rest 28 is shown mounted on the conveyor belt 26 for holding thereon a workpiece w for transportation from one press to the other ( e . g . from press 20 to press 22 ). the reference numeral 30 generally denotes each of two loading / unloading devices herein shown mounted to the opposed ends of the presses 20 and 22 . in the illustrated embodiment the left hand one , as seen in fig1 and 2 , of the loading / unloading devices 30 functions to withdraw each workpiece w from the left hand press 20 and to deposit them onto the work rest 28 while the same is being held in the extreme left hand position on the transfer conveyor 24 . this conveyor transports the deposited workpiece to the extreme right hand position . then the right hand loading / unloading device picks up the workpiece from the work rest 28 and introduces it into the right hand press 22 . the transfer conveyor 34 may be mounted on a suitable carriage 31 for ready withdrawal from the space between the presses 20 and 22 as required . the two loading / unloading devices 30 are exactly identical in construction except that they are mounted in opposite directions to the presses 20 and 22 . accordingly the description of one loading / unloading device 30 applies to the other . fig4 through 7 illustrate in greater detail one of the loading / unloading devices 30 . these figures do not , however , include means for moving the device horizontally and vertically with respect to the press , such means being shown in detail in fig8 through 11 . it will be observed from fig4 through 7 that the representative loading / unloading device 30 has a generally boxlike support frame or enclosure 32 . mounted externally to the support frame 32 is a vertically elongated carriage 34 having a relatively narrow upper portion 36 and a wider lower portion 38 . the narrower upper portion 36 of the carriage 34 has a pair of fins 40 extending vertically on its opposite sides . these fins make rolling engagement with two sets of guide rolls 42 on the support frame 32 . the wider lower portion 38 of the carriage 34 has a like pair of fins 44 for rolling engagement with two sets of guide rolls 46 on the support frame 32 . thus the carriage 34 rolls up and down relative to the support frame 32 . the guide rolls 42 and 46 are so arranged as to bear the carriage 34 against displacement in any direction other than the vertical . a pair of limit stops 48 on the support frame 32 bound the opposite extremities of the vertical travel of the carriage 34 . the reference numeral 50 in fig5 and 6 generally denotes a drive mechanism ( hereinafter referred to as the vertical drive mechanism ) for the vertical displacement of the carriage 34 . the vertical drive mechanism 50 includes a bidirectional rotary actuator , preferably a servomotor 52 mounted within and secured to the support frame 32 . the servomotor 52 is coupled via a timing belt 54 to a speed reducer 56 also secured to the support frame 32 . the speed reducer 56 has a pinion 58 fixedly mounted on its output shaft 60 for positive engagement with an upstanding rack 62 secured to the carriage 34 via a slot 64 in the support frame 32 . it is thus seen that the carriage 34 travels up and down with the bidirectional rotation of the servomotor 52 . at 66 in fig4 is seen a fluid actuated cylinder operatively connected between support frame 32 and carriage 34 . this cylinder acts to counterbalance the load imposed upon the carriage 34 and hence to lessen the burden on the servomotor 52 . mounted to the carriage 34 is a parallelogram linkage 68 shown also in fig4 and 5 . the parallelogram linkage 68 comprises a top link 70 , a pair of side links 72 and 74 , and a bottom link 76 . as will be seen also from fig6 the top link 70 is shown as a flat plate of polygonal shape , having a plurality of rollers 78 for rolling engagement with a guide rail 80 extending vertically on the carriage 34 . accordingly the top link 70 rolls up and down along the guide rail 80 with respect to the carriage 34 . the arrangement of the rollers 78 in relation to the guide rail 78 is also well calculated to restrain the top link 70 from displacement in any direction other than the vertical . the pair of side links 72 and 74 of the parallelogram linkage 68 are of the same length and extend in a vertical plane in parallel spaced relationship to each other . the top ends of the side links 72 and 74 are pivotally coupled to the top link 70 in positions spaced apart in a horizontal direction or in the longitudinal direction of the press line . the bottom ends of the side links 72 and 74 are pivotally coupled to the bottom link 76 , also in positions thereon spaced apart horizontally in the longitudinal direction of the press line . affixed to the underside of the bottom link 76 via a holder 82 is a work carrier 84 for releasably holding and carrying each workpiece w to be loaded into or unloaded from the press 20 or 22 . the work carrier 84 of this particular embodiment has a plurality of suction cups 86 directed downwardly for causing adhesion of each workpiece w thereto by suction . the work carrier 84 with its suction cups 86 is to be moved vertically with the carriage 34 by the vertical drive mechanism 50 , and horizontally by the parallelogram linkage 68 having its own actuating means set forth hereafter . as shown in both fig4 and 5 , a drive lever 88 is employed for pivoting the pair of side links 72 and 74 of the parallelogram linkage 68 about their axes on the top link 70 . one end of the drive lever 88 is rigidly coupled to a spindle 90 which is rotatably mounted on the bottom end of the carriage 34 so as to extend normal to the plane of the parallelogram linkage 68 . the other end of the drive lever is pivotally coupled at 92 to the midpoint of the side link 72 of the parallelogram linkage 68 . the drive lever 88 has a length equal to half the length of each side link 72 or 74 of the parallelogram linkage 68 . consequently , with the oscillation of the drive lever 88 about the spindle 90 , the pair of side links 72 and 74 of the parallelogram linkage 68 swing back and forth in a vertical plane , with its top link 70 rolling up and down on the carriage 34 , to cause the desired horizontal reciprocation of the work carrier 84 . generally designated 94 in fig5 and 7 is a drive mechanism for bidirectionally pivoting the drive lever 88 about the spindle 90 and hence for causing the parallelogram linkage 68 to horizontally reciprocate the work carrier 84 . this second drive mechanism 94 will be hereinafter referred to as the horizontal drive mechanism in contradistinction to the vertical drive mechanism 50 . the horizontal drive mechanism 94 includes a bidirectional rotary actuator such as a servomotor 96 mounted to the support frame 32 . a drive linkage such as a timing belt 98 connects the servomotor 96 to a speed reducer 100 secured to the lower portion 38 of the carriage 34 . the pulleys 102 and 104 around which the timing belt 98 extends are of the same diameter . the speed reducer 100 has a pinion 106 fixedly mounted on its output shaft 108 . this pinion meshes with a sector gear 110 which rotates bidirectionally through a preassigned angle with the spindle 90 in a coaxial relation therewith . thus the drive lever 88 swings back and forth about the spindle 90 as the bidirectional rotation of the servomotor 96 is transmitted thereto via the timing belt 98 , speed reducer 100 , and intermeshing gears 106 and 110 . a problem arises , however , as the servomotor 96 is mounted to the support frame 32 and as the drive lever 88 travels up and down with the carriage 34 relative to the support frame . torque transmission from servomotor 96 to drive lever 88 must take place properly in spite of the vertical displacement of the carriage . a solution to the above problem is the slidable or rollable mounting of the servomotor 96 to the support frame 32 for displacement in a horizontal direction normal to the plane of the carriage 34 and of the parallelogram linkage 68 . in the illustrated embodiment the servomotor 96 is movable along a pair of guides 112 secured to the support frame 32 . a pair of turnbuckles 114 or like link means operately interconnect the body of the servomotor 96 and that of the speed reducer 100 so as to cause horizontal displacement of the servomotor with the vertical motion of the carriage 34 . although the electrical details of this and other loading / unloading devices 30 are not illustrated , it is understood that the servomotor 52 of the vertical drive mechanism 50 and the servomotor 96 of the horizontal drive mechanism 94 are under the control of separate closed path numerical controls ( cncs ). the vertical and horizontal strokes of the work carrier 84 are therefore variable independently of each other . a fluid actuated cylinder 116 is operatively connected between carriage 34 and drive lever 88 for counterbalancing the load to be exerted on the latter during work transfer . this cylinder serves to lessen the load on the servomotor 96 . with reference back to fig1 through 3 the support frame 32 of each loading / unloading device 30 is mounted to a wheeled , self propelled carriage 118 for movement therewith along a guide track 120 on the associated press 20 or 22 . the guide track 120 extends horizontally and at right angles with the direction of workpiece travel . the complete device of fig4 through 7 is movable along the guide track 120 and is further movable up and down relative to the self propelled carriage 118 , as discussed in further detail hereinbelow . as illustrated in detail in fig8 through 11 , the guide track 120 is provided by an elongate guide frame 122 secured to the press 20 or 22 . a guide rail 124 extends along the top edge of the guide frame 122 , and another guide rail 126 along its bottom edge . movable along this guide track , the carriage 118 has an upper , horizontally elongated boxlike portion 128 and a lower , vertically elongated boxlike portion 130 . the upper carriage portion 128 has a pair of wheels 132 overlying the upper guide rail 124 in rolling engagement therewith . the lower carriage portion 130 has two pairs of guide rolls 134 disposed on the opposite sides of the lower guide rail 126 and making rolling engagement therewith so as to prevent displacement of the carriage 118 in a direction at right angles with the guide track 120 . the guide frame 122 has a chain 136 affixed to its front face so as to extend horizontally . in engagement with this chain is a sprocket 138 housed in the lower carriage portion 130 and partly projecting rearwardly therefrom . a bidirectional propelling motor 140 on the upper carriage portion 128 is coupled in driving relationship to the sprocket 138 via a speed reducer 142 . thus , with the bidirectional rotation of the propelling motor 140 , the carriage 118 travels back and forth along the guide track 120 . the support frame 32 of each loading / unloading device 30 is mounted to the carriage 118 for vertical displacement . it will be observed from fig8 and 11 that the support frame 32 has a pair of rims 144 extending vertically along the opposite sides of its rear end . each rim 144 is in rolling engagement with two sets of vertically spaced apart guide rolls 146 on the carriage 118 . the guide rolls 146 are so arranged as to allow the vertical travel of the support frame 32 but to restrain the same from displacement in any other direction . employed for the vertical travel of the support frame 32 is a worm 148 rotatably housed in the lower carriage portion 130 and engaged with a nut 150 sleeved thereon . the nut 150 is secured to the support frame 32 via a bracket 152 projecting out of the lower carriage portion 130 through an opening 154 therein . the worm 148 is coupled via a speed reducer 156 to a bidirectional height adjustment motor 158 mounted on the upper carriage portion 128 in side by side relationship with the propelling motor 140 . the bidirectional rotation of the height adjustment motor 158 results in the up and down motion of the support frame 32 relative to the carriage 118 . the worm 148 has a downward extension 160 coupled to a vertical position sensor 162 via reduction gearing 164 . a pair of limit switches 166 are mounted within the lower carriage portion 130 for activation by a switch actuator 168 on the bracket 152 in the extreme positions of the vertical travel of the support frame 32 . the self propelled carriage 118 is further provided with a pair of brakes 170 best seen in fig1 . each brake 170 has an air cylinder 172 rigidly supported by the lower carriage portion 130 . the cylinder 172 has a ram 174 slidaby fitted therein for movement into frictional engagement with the lower guide rail 126 on the guide frame 122 under air pressure . the ram 174 may be provided with a lining of any suitable material as at 176 . the left hand loading / unloading device 30 of fig1 operates to unload the workpiece w that has been processed by the left hand press 20 . for the withdrawal of the workpiece w the work carrier 84 may be placed over the workpiece in the press 20 by turning the drive lever 88 in a clockwise direction , as viewed in fig1 by the horizontal drive mechanism 94 , with the carriage 34 raised by the vertical drive mechanism 50 . then the carriage 34 is lowered by the vertical drive mechanism 50 to press the suction cups 86 on the underside of the work carrier 84 against the workpiece w to cause adhesion thereof . then the work carrier 84 together with the workpiece w is raised by the vertical drive mechanism 50 and subsequently moved horizontally downstream by the horizontal drive mechanism 94 until the workpiece comes to a predetermined position just over the work rest 28 on the upstream end of the transfer conveyor 24 . released from the suction cups 86 in this position , the workpiece w is deposited on the work rest 28 , thereby to be carried to the downstream end of the transfer conveyor 24 . the right hand loading / unloading device 30 of fig1 operates in essentially the same manner to pick up the workpiece w from the work rest 28 and to load the same into the next press 22 . it will be seen , then , that each loading / unloading device 30 finds use not only for the transfer of workpieces from press to press but also for the loading and unloading of the workpieces into and from the complete press line . particular attention is called to the operation of the carriage 34 and parallelogram linkage 68 , together with the associated vertical drive mechanism 50 and horizontal drive mechanism 94 , of each loading / unloading device 30 . as the carriage 34 travels up and down , the servomotor 96 of the horizontal drive mechanism 94 reciprocates horizontally , being coupled to the carriage via the turnbuckles 114 . thus the working length of the timing belt 98 connecting the servomotor 96 and the speed reducer 100 remain unchanged . it will also be appreciated that the parallelogram linkage 68 with its drive lever 88 is well designed to make possible the desired horizontal travel of the work carrier 84 . the vertical position of the support frame 32 of each loading / unloading device 30 is adjustable to the associated press 20 or 22 by the height adjustment motor 158 , as will be apparent from a consideration of fig8 and 9 . the support frame 32 moves vertically relative to the self propelled carriage 118 . further the support frame 32 is movable with the carriage 118 along the horizontal guide track 120 as the carriage is self propelled with its motor driven sprocket 138 in engagement with the fixed chain 136 . the brakes 170 lock the carriage 118 against accidental displacement in any desired position on the guide track 120 . the loading / unloading device 30 may thus be readily retracted from its working position for a die change or other purposes . notwithstanding the above detailed disclosure it is to be understood that this embodiment represents but one possible application of the present invention . additional applications of the invention , then , as well as modifications or alterations of the construction disclosed herein , may be resorted to without departing from the spirit or scope of the invention as expressed in the following claims .	8
the present invention is directed to a system and method that enables communication ( i . e ., audio conferencing ) between a linked packet - switched server architecture for internet protocol ( ip )- based clients and a circuit - switched server architecture for phone - based clients . in a preferred embodiment of the present invention , a service provider supplies the linkage infrastructure ( i . e ., full duplex dial - up or ip link ), agreement terms , and facilities so that clients ( i . e ., participants ) who subscribe to their conferencing services can take part in a multi - party audio conference application . the service provider would also provide customer , service , support , and billing as will be apparent to one skilled in the relevant art ( s ) after reading the description herein . clients would connect to their respective servers using whatever equipment and protocol they currently have access to , and the invention would provide seamless linkage among the various clients . referring to fig1 , a block diagram illustrating the system architecture of an embodiment of the present invention , showing connectivity among the various components , is shown . more specifically , fig1 illustrates a linked multipoint control unit ( mcu ) architecture 100 for packet - switched ( ip - based ) personal computer system clients and circuit - switched ( phone - based ) client conferencing . architecture 100 includes a plurality of pc - based clients 102 ( shown as clients 102 a - 102 n ) which connect to an ip - based mcu 104 . architecture 100 also includes a plurality of telephone - based clients 112 ( shown as clients 112 a - 112 n ) which connect to a phone - based mcu 110 . the connection between ip mcu 104 and phone mcu 110 is provided by a full - duplex client channel 108 . full - duplex client channel 108 enables a service provider to send and receive audio packets from pc - based clients 102 using , for example , the sip protocol . full - duplex client channel 108 also enables a service provider to send and receive , for example , h . 323 protocol packets from telephone - based clients 112 . the client channel 108 looks like just another active speaker to both the ip mcu 104 and the phone mcu 110 . in an embodiment of the present invention , because the transport may be different ( e . g . h323 ethernet packets for the ip mcu 104 , and a pri digital phone line for the phone mcu 110 ), the client channel 108 may go through a protocol converter or gateway . the present invention is described in terms of the above example . this is for convenience only and is not intended to limit the application of the present invention . in fact , after reading the following description , it will be apparent to one skilled in the relevant art ( s ) how to implement the following invention in alternative embodiments ( e . g ., mcus 104 and 10 handling protocols other than those illustrated herein ). the terms “ client ,” “ subscriber ,” “ party ,” “ participant ,” and the plural form of these terms may be used interchangeably throughout herein to refer to those who would access , use , and / or benefit from the system and method of the present invention . referring to fig2 , a flowchart representing the general operational flow , according to an embodiment of the present invention , is shown . more specifically , fig2 depicts an example control flow 200 involved in providing a linked internet protocol ( ip )- based client and phone - based client audio conference . in this embodiment , the ip multipoint control unit ( mcu ) 104 performs the initial steps necessary to establish a link to the phone mcu 110 . control flow 200 begins at step 202 with control passing immediately to step 204 . in step 204 , ip mcu 104 establishes a continuously active connection 108 to phone mcu 110 . connection 108 is established as continuously active ( i . e ., recognized as active speaker by ip mcu 104 ), thereby ensuring that the audio data of actively speaking ( e . g ., participants who are actually speaking rather than simply listening ) phone - based clients 112 is always included in the audio stream later distributed to the connected ip - based clients 102 . ip mcu 104 also keeps an active speaker list so that it can limit the number of actively speaking ip - based clients 102 recognized and added to the stream , thus ensuring that the list does not become too large . if the number of actively speaking ip - based clients 102 becomes too large , the data being sent by the ip mcu 104 to every participant in the audio conference will be unintelligible ( i . e ., too many participants speaking on top of each other ). returning to control flow 200 , in step 206 , the ip mcu 104 receives a mixed and converted phone client audio packet from the phone mcu 110 via the continuously active connection 108 . upon receipt of this audio packet , in step 208 , the ip mcu 104 sends the mixed and converted phone client audio packet to each connected pc client 102 connected to ip mcu 104 . in step 210 the ip mcu 104 receives pc client 102 audio packet ( s ) from each actively speaking pc client 102 connected to ip mcu 104 . upon receipt of pc audio packet ( s ), in step 212 , the ip mcu 104 forwards the actively speaking pc client audio packet ( s ) to the phone mcu 110 via the continuously active connection 108 . in step 214 , the process begins again if the continuously active connection 108 is still active . thus , control flow 200 continues until either the phone mcu 110 or the ip mcu 104 ceases hosting the audio conference ( i . e ., the conference is terminated ) as indicated by step 216 . it should be noted , as will be apparent to one skilled in the relevant art ( s ) after reading the description here . that control flow 200 as presented in fig2 assumes that there is an order to the phone mcu mixing and the ip mcu forwarding packets . this is done for ease of explanation herein , whereas , in actuality , these events are asynchronous and simultaneous as suggested above . further , as will also be apparent to one skilled in the relevant art ( s ), there may some delay between an active speaker becoming active on one mcu , and before that active speaker is heard on the other mcu , but it is symmetric . referring to fig3 , a flowchart representing the general operational flow , according to an embodiment of the present invention , is shown . more specifically , fig3 depicts an example control flow 300 involved in providing a linked ip - based client and phone - based client audio conference . in this embodiment , the phone multipoint control unit ( mcu ) 110 performs the initial steps necessary to establish a link to the ip mcu 104 . control flow 300 begins at step 302 with control passing immediately to step 304 . in step 304 , the phone mcu 110 establishes a continuously active connection 108 to ip mcu 104 . connection 108 is established as continuously active ( i . e ., recognized as active speaker by phone mcu 110 ). thereby ensuring that the audio data of actively speaking ( e . g ., participants who are actually speaking rather than simply listening ) ip - based clients 102 is always included in the audio mix later distributed to the connected phone - based clients 112 . phone mcu 110 also keeps an active speaker list so that it can limit the number of actively speaking phone - based clients 112 recognized and added to the mix , thus ensuring that the list does not become too large . if the number of actively speaking phone - based clients 112 becomes too large , the data being sent by the phone mcu 110 to every participant in the audio conference will be unintelligible ( i . e ., too many participants speaking on top of each other ). returning to control flow 300 , in step 306 , the phone mcu 110 receives a mixed pc client audio packet from the ip mcu 104 via the continuously active connection 108 . in step 308 , the phone mcu 110 receives an audio packet from each actively speaking phone client 112 connected to phone mcu 110 . upon receipt of the actively speaking phone client audio packet , in step 310 , the phone mcu mixes the mixed pc client audio packet , received in step 306 , with the actively speaking phone client audio packet , received in step 308 , into a combined audio packet . in step 312 , the phone mcu 110 forwards the combined audio packet to phone clients 112 connected to phone mcu 110 . in step 314 the phone mcu forwards the audio packet , received in step 308 , to the ip mcu 104 via the continuously active connection 108 . in step 316 , the process begins again if the continuously active connection 108 is still active . thus , control flow 300 continues until either the phone mcu 110 or the ip mcu 104 ceases hosting the audio conference ( i . e ., the conference is terminated ) as indicated by step 318 . it should be noted , as will be apparent to one skilled in the relevant art ( s ) after reading the description here , that control flow 300 as presented in fig3 assumes that there is an order to the phone mcu mixing and the ip mcu forwarding packets . this is done for ease of explanation herein , whereas , in actuality , these events are asynchronous and simultaneous as suggested above . further , as will also be apparent to one skilled in the relevant art ( s ), there may some delay between an active speaker becoming active on one mcu , and before that active speaker is heard on the other mcu , but it is symmetric . the present invention ( i . e ., architecture 100 , control flow 200 , control flow 300 , or any part thereof ) may be implemented using hardware , software or a combination thereof and may be implemented in one or more computer systems or other processing systems . in fact , in one embodiment , the invention is directed toward one or more computer systems capable of carrying out the functionality described herein . an example of a computer system . the computer system represents any single or multi - processor computer . the computer system includes one or more processors , such as processor . the processor is connected to a communication infrastructure ( e . g ., a communications bus , cross - over bar , or network ). various software embodiments are described in terms of this exemplary computer system . after reading this description , it will become apparent to a person skilled in the relevant art how to implement the invention using other computer systems and / or computer architectures . the computer system may include a display interface that forwards graphics , text , and other data from the communication infrastructure ( or from a frame buffer not shown ) for display on the display unit . the computer system also includes a main memory , preferably random access memory ( ram ), and may also include a secondary memory . the secondary memory may include , for example , a hard disk drive and / or a removable storage drive , representing a floppy disk drive , a magnetic tape drive , an optical disk drive , etc . the removable storage drive reads from and / or writes to a removable storage unit in a well - known manner . removable storage unit , represents a floppy disk , magnetic tape , optical disk , etc . which is read by and written to by removable storage drive . as will be appreciated , the removable storage unit includes a computer usable storage medium having stored therein computer software and / or data . in alternative embodiments , secondary memory may include other similar means for allowing computer programs or other instructions to be loaded into computer system . such means may include , for example , a removable storage unit and an interface . examples of such may include a program cartridge and cartridge interface ( such as that found in video game devices ), a removable memory chip ( such as an eprom , or prom ) and associated socket , and other removable storage units and interfaces , which allow software and data to be transferred from the removable storage unit to computer system . the computer system may also include a communications interface . the communications interface allows software and data to be transferred between computer system and external devices . examples of communications interface may include a modem , a network interface ( such as an ethernet card ), a communications port , a pcmcia slot and card , etc . software and data transferred via communications interface are in the form of signals , which may be electronic , electromagnetic , optical or other signals capable of being received by communications interface . these signals are provided to communications interface via a communications path ( i . e ., channel ). this channel carries signals and may be implemented using wire or cable , fiber optics , a phone line , a cellular phone link , an rf link and other communications channels . in this document , the terms “ computer program medium ” and “ computer usable medium ” are used to generally refer to media such as removable storage drive , a hard disk installed in hard disk drive , and signals . these computer program products are means for providing software to computer system . the invention is directed to such computer program products . computer programs ( also called computer control logic ) are stored in main memory and / or secondary memory . computer programs may also be received via communications interface . such computer programs , when executed , enable the computer system to perform the features of the present invention as discussed herein . in particular , the computer programs , when executed , enable the processor to perform the features of the present invention . accordingly , such computer programs represent controllers of the computer system . in an embodiment where the invention is implemented using software , the software may be stored in a computer program product and loaded into computer system using removable storage drive , hard drive or communications interface . the control logic ( software ), when executed by the processor , causes the processor to perform the functions of the invention as described herein . in another embodiment , the invention is implemented primarily in hardware using , for example , hardware components such as application specific integrated circuits ( asics ). implementation of the hardware state machine so as to perform the functions described herein will be apparent to persons skilled in the relevant art ( s ). in yet another embodiment , the invention is implemented using a combination of both hardware and software . while various embodiments of the present invention have been described above , it should be understood that they have been presented by way of example , and not limitation . for example , the operational flows presented in fig2 and 3 , are for example purposes only and the present invention is sufficiently flexible and configurable such that it may flow in ways other than that shown . further , it will be apparent to persons skilled in the relevant art that various changes in form and detail can be made therein without departing from the spirit and scope of the invention . thus the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	7
further advantages and characteristics of the invention will arise more clearly from reading the detailed description of exemplary embodiments of the invention , given for illustration and without limitation , with reference to the attached figures in which : fig1 is a diagrammatic view in longitudinal section of a so - called boiler steam generator for a pressurized water reactor ( pwr ) according to the prior art ; fig2 is a diagrammatic view in longitudinal section of a so - called boiler steam generator for a boiling water reactor ( bwr ) according to the prior art ; fig3 is a diagrammatic view of a pressurized water nuclear reactor ( pwr ) according to the prior art , the secondary circuit of which uses a rankine cycle ; fig4 is a diagrammatic view of a pressurized water nuclear reactor ( pwr ) according to the invention , the secondary circuit of which uses a rankine cycle ; fig5 is a diagrammatic view of a boiling water nuclear reactor ( bwr ) according to the invention , the secondary circuit of which uses a rankine cycle ; fig6 is a diagrammatic view of a pressurized water nuclear reactor ( pwr ) according to the prior art , the secondary circuit of which uses a rankine cycle with a single - body turbine ; fig7 is a diagrammatic view of a pressurized water nuclear reactor ( pwr ) according to the prior art , the secondary circuit of which uses a rankine cycle with a single - body turbine . throughout the present application , the terms “ vertical ”, “ lower ”, “ upper ”, “ bottom ”, “ top ”, “ below ” and “ above ” should be understood with reference to a steam generator , a vessel of a reactor , a set of dryers according to the invention as they are in the vertical operating configuration . thus in an operating configuration , the upper part of the reactor vessel is that situated above the core . similarly , throughout the present application , the terms “ inlet ”, “ outlet ”, “ downstream ” and “ upstream ” should be understood with reference to the direction of circulation of the saturated steam in a rankine cycle , both in the steam production device and from this to the steam turbine . for the sake of clarity , the same references , designating the same elements of the reactor and the nuclear installation according to the prior art and according to the invention , are used for fig2 to 7 . for the description of figures representing pwr nuclear reactors , the working fluid is designated the secondary fluid or water . the intermediate fluid is designated the primary fluid or water . for the descriptions of figures representing bwr nuclear reactors , only the working fluid is described . there is no intermediate fluid . it is specified that in all figures , the actual vessel part of the pwr or bwr reactor has been simplified and we distinguish only the core of the reactor and the main hydraulic routes for the primary steam in the case of a bwr reactor . evidently , the reactor vessel also comprises the pumps , the pressurizer in the case of a bwr reactor , and other components not shown which are not relevant to the description of the invention . it is also specified here that , for the sake of clarity on fig3 to 5 , all extraction points on the hp high - pressure body 20 and bp low - pressure body 21 of the steam turbine 2 , i . e . the parts of the secondary water ( working fluid ) circuit suitable for extracting secondary hot water to the feed water pipe for reheating thereof , have not been shown . fig1 shows in detail a so - called boiler steam generator 1 which produces steam up to saturation for pwr reactors . such a boiler steam generator 1 is housed in an enclosure 10 . firstly it comprises a tube bundle 11 suitable for exchanging heat between a primary fluid and the secondary fluid to be vaporized . when such a generator 1 is used to generate steam from the heat produced by a pwr - type nuclear reactor , the two fluids , i . e . primary and secondary , consist of water . the tube bundle 11 itself is housed in a shell 12 inside the enclosure 10 . in general , the core c of the pwr ( integrated ) reactor is situated just below the enclosure 10 , such that the enclosure 10 constitutes the cover of the vessel 15 of the nuclear reactor 16 . it is specified that for loop - type pwr reactors , pipes for the inlet and outlet of primary water are arranged below the steam generator . at least one impeller 13 is arranged above the tube bundle 11 and also inside the shell 12 , which is fixedly mounted and forms part of a cyclone separator , the other part being the tubular envelope part consisting of the shell 12 . above the set of cyclone separators 13 is a set of dryers 14 , generally comprising chicane walls . the function of such a steam generator 1 will now be explained in relation to the arrows indicating the water circulation direction of the primary circuit and secondary circuit . the primary circuit consists of the so - called primary water heated by the core of the nuclear reactor , which is delivered via the inlet opening 17 and circulates in the tube bundle 11 , then leaves via the outlet opening 18 , in order to return to the core of the nuclear reactor . in the first part of the steam generator 1 , the water from the secondary circuit , known as secondary water , is vaporized by contact with the tube bundle 11 inside the shell 12 . at the outlet of the contact zone with the tube bundle 11 , the secondary water is only partially vaporized ( state v 1 ) and cannot therefore be used as such to supply a steam turbine . the second part of the steam generation allows complete drying of the steam before it is used to actuate the turbine . this second part comprises the set of separators 13 and the set of dryers 14 . when passing through a fixed impeller 13 of a cyclone separator , the moving secondary water is set in rotation . the liquid phase is projected towards the outside while the steam phase remains in the center and passes into a state v 2 . the liquid phase returns under gravity with the feed water , i . e . the secondary water which enters the steam generator 1 , into the annular space delimited between the outer wall 10 and the inner shell 12 . at the outlet from the cyclone separators 13 , the water in state v 2 is practically entirely separated from the liquid phase but may still contain droplets of liquid water , which does not allow the secondary steam to be supplied as such to the steam turbine because of the risk of erosion which it could cause to the turbine vanes . thus in order to obtain dry steam at outlet 19 , the secondary steam leaving the cyclone separators 13 passes at low speed through the set of dryers 14 at which the droplets are deposited and returned under gravity with the feed water , as illustrated by the curved arrows at the bottom close to the dryers 14 . the steam has now reached its state v 3 of dry steam . thus in natural convection , the secondary water passes repeatedly ( three , four or more times ) through a loop inside the enclosure of the steam generator , this loop being formed by the annular space between the outer wall 10 and the inner shell 12 , the tube bundle 11 , the cyclone separators 13 and the dryers 14 . fig2 shows in detail another boiler type steam generator 1 which produces steam up to saturation for a bwr reactor . such a boiler steam generator 1 is housed in an enclosure 10 . the difference from fig1 lies in the fact that there is no tube bundle 11 suitable for exchanging heat between a primary fluid and the secondary fluid to be vaporized . the working fluid is heated by passing through the core c of the nuclear reactor and is this directly transformed into steam . the set of separators 13 and the set of dryers 14 allow dry steam v 3 to be obtained at the reactor outlet . typically , half the total height h of such a boiler steam generator 1 according to the prior art corresponds substantially to the height h 1 of the tube bundle 11 , a quarter of the height h corresponds substantially to the height h 2 necessary for arrangement of the cyclone separators 13 , and the final quarter of the height h corresponds substantially to the height h 3 necessary for the arrangement of the dryers 14 . such a boiler steam generator 1 according to the prior art is satisfactory from the point of view of its operation , but has the major drawback of taking up a large geometric space because of its substantial total height h . this substantial height h of the steam generator 1 may be disadvantageous in reactors which are desirably as compact as possible , in particular those which have already been designed with a boiler - type steam generator as the cover of the vessel of the pressurized water reactor ( pwr ), as described in patent ep1464058b1 . in fact this substantial height h may be disadvantageous for a stationary , land - based nuclear facility for which a minimum height is desired , or for a nuclear facility which is able to be transported by ship . thus in order to reduce the total height h of such a steam generator 1 , the inventor of the present invention considered physically separating the essential components of the working fluid circuit into two separate parts while retaining the natural circulation between the steam heating elements and the working fluid . according to the invention , as illustrated in fig4 and 5 , it is proposed to arrange the set of dryers 14 outside the enclosure 10 of the steam generator 1 , with its inlet 14 a connected upstream to the set of separators 13 , a first outlet 14 b connected downstream to the inlet of the high - pressure body 20 of a steam turbine 2 , and a second outlet 14 c connected downstream to the set of superheaters 23 . in other words , the set of cyclone separators 13 remains above the tube bundle 11 inside the enclosure 10 of the steam generator 1 as in the prior art , but in accordance with the invention the set of dryers 14 is placed outside the enclosure 10 of the generator 1 . since the liquid phase of the secondary water collected by the set of dryers 14 can no longer return under gravity towards the feed water as in the prior art , according to the invention it is sent directly to the set of superheaters 23 of the turbine . in yet other words , thanks to the invention , not only is the total height of the steam generator according to the invention reduced compared with a boiler - type steam generator according to the prior art , but also the advantage is retained of having a natural circulation of the working fluid inside the enclosure 10 of the generator 1 , in contrast to the pwr reactor of the prior art as described in publication [ 1 ]. fig3 shows a simplified diagram of a rankine cycle as normally found in a secondary circuit of a pwr reactor according to the prior art , in which a steam generator 1 as described in fig1 is contained inside an enclosure 10 , the secondary water circuit comprising a steam turbine 2 with two expansion bodies 20 , 21 . from upstream to downstream of the steam generator 1 , the secondary circuit comprises the steam turbine 2 which itself comprises an hp high - pressure body 20 and a low - pressure body 21 . a set of dryers 22 in series with a set of superheaters 23 is connected firstly to the outlet of the hp body 20 and secondly to the inlet of the bp body 21 . the set of superheaters 23 is preferably situated at the outlet from the set of dryers 22 . the sets of dryers 22 and superheaters 23 have the function of improving the efficiency of the steam turbine 2 and preventing erosion of the vanes of the bp body 21 . in fact at the outlet from the hp body 20 , the secondary steam is very wet with a thermodynamic titer of the order of 10 %. thus the set of dryers 22 allows the thermodynamic titer to be returned to a value equal to the unit to prevent erosion of the vanes of the bp body 21 of the turbine 2 . the set of superheaters 23 allows reheating of the secondary steam leaving the hp body 20 before it enters the bp body 21 , which improves the efficiency of the turbine . typically , in a secondary circuit of a pwr reactor , the steam pressure at the outlet from the hp body 20 is of the order of around ten bar . the steam is superheated by extraction thereof just at the inlet to the hp body 20 by the secondary circuit part which conducts it directly to the set of superheaters 23 . typically , before entering the hp body , around 10 % of the steam is diverted for steam superheating . this steam , which leaves the steam generator and bypasses the hp body 20 , then transfers its heat by condensation to the main part of the secondary circuit which connects the dryers 22 to the bp body 21 . in the return part of the secondary circuit , i . e . that which returns the feed water to the inlet of the steam generator 1 , at the outlet of the bp 21 of the turbine 2 , the steam is then completely condensed by means of a condenser 3 which is of the very low pressure type , then returned by means of a first pump called a lift pump 40 to a water collector 5 , normally called the feed tank . a second pump 41 , called the feed water pump , allows the supply of the steam generator 1 with high - pressure feed water . part of the steam leaving the hp body 20 of the turbine 2 allows the preheating of the feed water by means of a set of reheaters 6 downstream of the feed pump 41 . the steam used to preheat the feed water via the reheaters 6 may return upstream to the feed tank 5 . the steam which serves to reheat the feed water by extraction of steam between two expansion stages in the hp body 20 may also return to the feed tank 5 . the same applies to the condensate from the dryer 22 . fig4 shows the same simplified diagram of the rankine cycle of a pwr reactor according to fig1 , but with an arrangement of the set of dryers 14 according to the invention . here the set of dryers 14 is placed outside the enclosure 10 of the generator 1 , with its inlet 14 a connected upstream to the set of separators 13 , a first outlet 14 b connected downstream to the inlet of the high - pressure body 20 of the turbine 2 , and a second outlet 14 c connected downstream to the set of superheaters 23 . the set of dryers 14 is housed in an enclosure 140 in the form of a funnel 141 , the opening 14 c of which is connected upstream to the second outlet of the set of dryers 14 and downstream to the set of superheaters 23 . thus according to the invention , the circulation of working fluid in the steam generator 1 is ensured naturally by natural convection inside the enclosure 10 , i . e . without forced convection , in a hydraulic loop comprising the annular space , the tube bundle 11 and the cyclone separators 13 . in fact the condensate collected by the set of dryers 14 , with the steam flow necessary for superheating , is sent via the funnel 141 to the set of superheaters 23 between the hp body 20 and the bp body 21 of the turbine 2 . as illustrated , all other parts of the secondary circuit of fig4 according to the invention remain unchanged in relation to those of the secondary circuit of fig3 according to the prior art . the steam leaving the enclosure 10 of the steam generator is of poor quality and cannot be introduced in the turbine 2 since it contains water droplets , but the quantity of liquid water is low and the flow of this mixture does not risk causing the slug - type flow harmful to stability . under these conditions , the enclosure 140 containing the dryers 14 may be placed next to the enclosure 10 of steam generator 1 with no height constraint . a suitable position is to place this enclosure 140 slightly below the upper part of the enclosure 10 of the steam generator 1 with the aim of reducing the total height of the reactor , i . e . of the vessel and the assembly of the steam production device comprising the steam generator enclosure 10 and the drying enclosure 140 . fig5 shows the same simplified diagram of the rankine cycle of a bwr reactor according to fig2 , but with an arrangement of the set of dryers 14 according to the invention as shown and described for fig4 . thanks to the invention , for a pwr reactor with a power of 150 mwe , in combination with an increase in the exchange length of the tube bundle 11 and by relocating the dryer part according to the present invention , a total height h ′ of the steam generator enclosure 10 of around 5 m can be achieved . without relocating the part of the dryers 14 according to the invention , the total height h of the steam generator enclosure 10 according to the prior art would be around one meter more . other applications than that just described with reference to a pwr reactor may be considered within the context of the invention . thus as described with reference to fig2 and 5 , it is quite possible to relocate the set of dryers 14 outside the reactor vessel of a boiling water type reactor already known , such as an esbwr reactor (“ economic simplified boiling water reactor ”) in which until now a set of separators and a set of dryers have necessarily been integrated in the upper part of the reactor vessel ( fig2 ). the invention could also be applied to an electrical energy generation facility with a nuclear reactor and a single - body turbine 2 , i . e . a turbine which comprises a single steam expansion body 20 . such an application is illustrated with reference to fig6 according to the prior art and fig7 according to the invention . fig6 shows a simplified diagram of the rankine cycle normally found in a secondary circuit of a pwr reactor according to the prior art , in which a steam generator 1 as described in fig1 is contained inside an enclosure 10 , but in contrast to fig3 and 4 , the secondary circuit comprises a single - body steam turbine 2 with a single expansion body 20 . in contrast to a secondary circuit with a double - body turbine illustrated in fig3 according to the prior art and fig5 according to the invention , the single - body steam turbine 2 does not comprise the set of dryers 22 and the set of superheaters 23 . thus in the return part of the secondary circuit with a single - body turbine 2 , i . e . that which returns the feed water to the inlet of the steam generator 1 : a part of the steam leaving the single body 20 of the turbine 2 is fully condensed by means of the condenser 3 ; another part of the steam leaving the single body 20 of the turbine 2 allows preheating of the feed water by means of the set of reheaters 6 downstream of the feed water pump 41 . the steam used for preheating of the feed water by the reheaters 6 may return upstream to the feed tank 5 . as illustrated in fig7 according to the invention , in a secondary circuit with a single - body turbine 2 , it is proposed , at the outlet 14 c of the set of dryers 14 , to send the condensate to a set of reheaters 7 for reheating the feed water already preheated in advance by the other set of reheaters 6 . at the outlet from the reheaters 7 , the condensate may be sent to the reheaters 6 for preheating the feed water . similarly , the steam 8 extracted from the body 20 may be sent to the reheater 6 for the same purpose . it is also possible to apply the installation to an electrical energy generation facility in which steam is produced not with a nuclear reactor but with a boiler releasing heat by combustion of one or more fuels , such as coal , fuel oil , gas , wood or waste . the invention is not limited to the examples which have just been described ; in particular the characteristics of the examples illustrated may be combined within variants not illustrated . : “ westinghouse small modular reactor nuclear steam supply system design ”— proceedings of icapp &# 39 ; 12 chicago , usa , jun . 24 - 28 , 2012 — paper 12248	5
the present invention more particularly relates to an improved apparatus of the yarn splicing apparatus as mentioned above . it is a primary object of the present invention to provide a splicing apparatus in which deterioration of the appearance of the spliced portion formed by the splicing operation , which is due to decrease of the size or strength in the spliced portion or to formation of pills , is effectively prevented . the present invention is characterized in that in each of control nozzle holes sucking and holding yarn ends before the splicing operation , the position for jetting fluid stream to the yarn end for untwisting the yarn end portion can be changed so that the length of the untwisted portion of the yarn ends may be determined appropriately . the apparatus of the present invention will now be described in detail with reference to the accompanying drawings . substantially at the center of the splicing apparatus 1 of the present invention , a splicing member 2 is secured to a bracket 3 through a screw 4 , and a cylindrical splicing hole 5 is formed at the center of the splicing member 2 . a slit 6 suitable for inserting a yarn y from the outside is formed on the splicing hole 5 along the entire tangential direction thereof , and a jet nozzle 7 opened tangentially to the splicing hole 5 is formed on the splicing member 2 . the splicing member 2 further includes control plates 12 and 13 secured through spacers 10 and 11 to wall faces 8 and 9 on the both open sides of the splicing hole 5 , and one side edges 14 and 15 of the control plates 12 and 13 are located so that they intersect a part of the opening of the splicing hole 5 . the control plates 12 and 13 , together with yarn pressing levers 16 described hereinafter , exert a function of positioning a yarn end yp on the package side and a yarn end yb on the bobbin side , inserted in the splicing hole 5 , so that first entanglement of the two yarn ends is guaranteed , and the control plates 12 and 13 control the quantity of air flowing out from both the end openings of the splicing hole 5 to prevent flying - out of the yarn ends yp and yb . moreover , the control plates 12 and 13 exert a function of forming a joint having a good appearance by an appropriate turning stream . the spacers 10 and 11 prevent flying - out of the yarn ends yp and yb from the slit 6 , which is caused by increase of the quantity of compressed fluid flowing out in the direction of the slit 6 after impingement against the walls of the control plates 12 and 13 . namely , the spacers 10 and 11 forms spaces between the wall faces 8 and 9 of the splicing member 2 and the control plate 12 and 13 to control the quantity of the fluid flowing out from the slit 6 . incidentally , the fluid is supplied to the jet nozzle hole 7 through a conduit 17 connected to a pressure source not shown in the drawings . a pair of above - mentioned upper and lower yarn pressing levers 16 are pivoted on the bracket 3 through a supporting shaft 18 . in the vicinity of the control plates 12 and 13 of the splicing member 2 , there are arranged in sequence yarn guide pins 20 and 21 , yarn pressing levers 16 , control nozzles 24 and 25 , yarn guides 26 and 27 , cutters 28 and 29 and fork guides 30 and 31 on both sides of the openings of the splicing hole 5 of the splicing member 2 so that the openings of the splicing hole 5 are interposed between the respective paired members . a pair of yarn gathering levers 33 are turnably secured to the upper and lower portions of a supporting shaft 32 on the side portion of the splicing member 2 . reference numeral 34 represents a stopper of the yarn gathering lever 33 and reference numeral 35 represents a clamping device for the yarn end yb on the bobbin side , which comprises a turning lever 36 and a stopper 37 . reference numeral 36 represents a clamping device for the yarn end yp on the package side , which comprises a turning lever 39 and a stopper 40 . the control nozzles 24 and 25 have the same shape . accordingly , one of them , that is , the control nozzle 25 , will now be described . a nozzle hole 45 is formed to pierce through the bracket 3 and a block 46 integrated therewith , and a tubular sleeve 47 is fitted in the nozzle hole 45 slidably in the axial direction of the nozzle hole 45 . the sleeve 47 is connected to a flexible pipe 48 connected to a suction pipe not shown in the drawings . a jet hole 49 is slantly formed in the vicinity of the open end of the tubular sleeve 47 to extend to the interior of the sleeve 47 . the jet hole 49 is communicated with a pressure conduit not shown in the drawings through an air introducing hole 50 formed on the block 46 . below the clamping device 35 , a detecting device 55 is arranged , and a pair of turning guide plates 57 supported on a turning shaft 56 are arranged so that the detecting device 55 is interposed between the paired guide plates 57 . a stationary guide plate 58 is arranged between the turning guide plate 57 and the detecting device 55 . on each of said paired turning guide plates 57 is formed an escape groove 60 communicated with a guide groove 59 . the guide groove 59 is located at such a position that the yarn contained in the guide groove 59 is allowed to pass through the detecting device 55 . the operations of the apparatus of the present invention will now be described . when the detecting device 55 for detecting yarn breakage or running out of the yarn or the bobbin during the rewinding operation detects stopping of running of the yarn , the winding drum comes to stop and the splicing operation is performed . a pair of a suction arm , a suction arm 66 on the package side and a suction arm 65 on the bobbin side , suck the yarn end yp on the package side and the yarn end yb on the bobbin side , respectively , and turn to introduce the yarn ends into the splicing apparatus 1 . the paired suction arms 66 and 65 are not simultaneously turned , but the yarn end yp on the package side is first sucked by the suction arm 66 on the package side and the arm 66 is turned and shifted to the one outside position of the splicing apparatus 1 and stopped there . after the passage of a predetermined time , the yarn end yb on the bobbin side is sucked by the suction arm 65 on the bobbin side , and the suction arm 65 is turned and shifted to the another outside position of the splicing apparatus 1 and stopped there . during the predetermined period of from the point of initiation of the operation of the suction arm 66 on the package side to the point of initiation of the operation of the suction arm 65 on the bobbin side , as shown in fig3 and 4 , the turning lever 39 of the clamping device 38 on the package side is actuated to hold the yarn yp between the turning lever 39 and the stopper 40 and to introduce the yarn yp into the guide grooves 59 of the turning guide plate 57 and stationary guide plate 58 arranged in the vicinity of the detecting device 55 . after checking is performed by the detecting device , the turning guide plate 57 is turned to a position indicated by a chain line in fig4 with the turning shaft 56 being as the fulcrum to separate the yarn yp from the splicing apparatus 1 and insert the yarn yp into the escape groove 60 . then , the suction arm 65 on the bobbin side sucks the yarn yb on the bobbin side , and the suction arm 65 is turned and shifted to the outside position of the splicing apparatus 1 and stopped there . at this time , the yarn yb is passed through a hook portion 61 of the turning guide plate 57 and as shown in fig2 the yarn yb is held between the stopper 37 of the clamping device 35 on the bobbin side and the turning lever 36 . when the above - mentioned operations of the suction arms 65 and 66 on both the bobbin and package sides are completed , the yarn gathering levers 33 are turned with the supporting shaft 32 being as the fulcrum , and both the yarns yb and yp are guided to the guide grooves 41 and 42 of the fork guides 30 and 31 , respectively , and inserted into the splicing hole 5 of the splicing member 2 through the slit 6 . then , the yarn cutting operation is performed by the cutters 28 and 29 at positions apart by predetermined distances from the clamping device 35 on the bobbin side and the clamping device 38 on the package side , as shown in fig2 . the yarn cutting positions have a relation to the length of the joint formed by splicing and have influences on the appearance , touch and binding strength of the joint formed by splicing . the yarn cutting positions are changed according to the count number of the yarn . referring to fig1 , both the yarns yb and yp are held by the clamping devices 35 and 38 , and the yarn gathering lever 33 is actuated to move a rod 62 shown in fig4 in a direction of arrow a by a control cam not shown in the drawings and the yarn gathering lever 33 is turned in the clockwise direction with the shaft 32 being as the fulcrum . in this state , the yarn cutting operation is performed . incidentally , when the yarn gathering lever 33 and the cutters 28 and 29 are operated , the yarn pressing lever 16 is disposed in the state where the yarn pressing lever 16 is turned in the clockwise direction with the shaft 18 being as the fulcrum by the operation ( in a direction of arrow b ) of a rod 63 as shown in fig4 . then , as shown in fig1 , the yarn ends yb and yp are sucked by the control nozzles 24 and 25 , and simultaneously or before or after this sucking operation , the yarn gathering lever 33 is turned in a direction separating from the yarn , that is , in the counterclockwise direction with the shaft 32 being as the fulcrum by the operation ( in a direction of arrow c ) of the rod 62 , as shown in fig4 and the lever 33 separates from the yarn y . at this time , the yarn ends yb and yp are sucked in the control nozzle 25 by the suction force of the sleeve 47 connected through the flexible pipe 48 , and simultaneously , the yarn ends yb and yp are untwisted in a state suitable for splicing by compressed fluid jetted from the jet hole 49 of the sleeve 47 through the air introducing hole 50 . since the sleeve 47 having the jet hole 49 formed thereon is inserted in the nozzle hole 45 so that it can advance and retreat in the nozzle hole 45 as shown in fig9 - a , 9 - b and 9 - c , the untwisting length and untwisting degree in the yarn ends are changed according to the advance or retreat position of the sleeve 47 . supposing that the normal untwisting state is illustrated in fig9 - b , if the sleeve 47 is inserted in a rather drawn - out state as shown in fig9 - a , the jet hole 49 and nozzle hole 45 are brought to closer to each other and the jetted fluid impinges against the relatively upper portions of the yarn ends yp and yb , with the result that the untwisting length is increased and the size of the top portion is decreased by detachment of fibers . if splicing is carried out in this state , the appearance of the joint is degraded and pilling is readily caused . if the sleeve is advanced into the deep interior of the nozzle hole 45 as shown in fig9 - c , the position of the jet hole 49 is greatly deviated from the position of the nozzle hole 45 and the jetted fluid impinges against the tops of the yarn ends yp and yb , with the result that the untwisting length is shortened and the size or strength of the formed joint is reduced . therefore , the insertion depth of the sleeve 47 is adjusted according to the kind and count number of the yarn so that an appropriate untwisting state is produced . the top portions of the top - free yarns yb and yp inserted in the sleeve 47 are untwisted by the compressed fluid jetted from the jet hole 49 , but since there are two kinds of twists z and s on the yarn ends yb and yp and the twisting directions of these twists are opposite to each other , the jetting direction of the jet hole 49 should be adjusted according to the twisting direction of the yarn y . more specifically , in case of an s - twist yarn , the fluid jetted from the jet hole 49 should be turned in the clockwise direction and in case of a z - twist yarn , the fluid jetted from the jet hole 49 should be turned in the counterclockwise direction . it is preferred that the suction operation by the control nozzles 24 and 25 be started just before the yarn is cut by the cutters 28 and 29 . more specifically , when the yarns yb and yp are cut , a tension is sometimes given to the yarns yb and yp by the sucking action of the suction arms 65 and 66 on both the bobbin and package sides , and therefore , it sometimes happens that the yarn ends yb and yp are scattered on cutting and they separate from the control nozzles 24 and 25 and are not sucked by the control nozzles 24 and 25 . accordingly , it is preferred that the sucking operation by the control nozzles 24 and 25 be started just before the yarn is cut , although it is permissible in principle that the sucking operation is started simultaneously with or subsequently to the yarn cutting operation . incidentally , the fluid is supplied to the control nozzles 24 and 25 by changing over valves by a solenoid not shown in the drawings . when the yarn ends yb and yp are untwisted in a state suitable for splicing by the control nozzles 24 and 25 and the sucking operation by the control nozzles 24 and 25 is stopped , simultaneously or subsequently , as shown in fig1 , the yarn gathering levers 33 are operated to guide the yarn ends yb and yp , respectively , and one lever 33 is turned to the position impinging against the stopper 34 . simultaneously , the yarn pressing levers 16 are operated to similarly guide the yarn ends yb and yp , and the yarn ends yb and yp are held by one lever 16 , that is , the lever 16 on the side where the yarn y is untwisted by the compressed fluid jetted from the jet nozzle 7 of the splicing member 2 , to such an extent that untwisting of the yarn ends yb and yp is inhibited . on the other fork side , the compressed fluid exerts a function of twisting the yarn ends yb and yp , and therefore , the other lever on the fork side need not particularly hold the yarn ends yb and yp but it is sufficient if this lever 16 presses the yarn ends yb and yp to such an extent that the positions of the yarn ends yb and yp are regulated . by the actions of the yarn gathering levers 33 and yarn pressing levers 16 , the yarn ends yb and yp sucked in the sleeves 47 of the control nozzles 24 and 25 are attracted into the splicing hole 5 of the splicing member 2 and positioned therein , and both the yarn ends yb and yp are set in the state where the yarn ends to be spliced are overlapped to each other as shown in fig1 . at this time , the length of the joint to be formed by splicing is determined by the turning distances of the yarn gathering levers 33 and yarn pressing levers 16 . therefore , the turning distances of the yarn gathering levers 33 and yarn pressing levers 16 are adjusted according to the count number of the yarn . by the turning operations of the yarn gathering levers 33 , the yarn ends yb and yp drawn out by the sleeves of the control nozzles 24 and 25 are taken out while being controlled by the control plates 12 and 13 arranged on both the sides of the splicing hole 5 , and positioning of the yarn ends yb and yp on the inner circumferential face of the splicing hole 5 is performed by the side edges of the control plates 12 and 13 and the side edges of the yarn pressing levers 16 and the yarn ends yb and yp to be spliced are set in the contacted and overlapped state in the splicing hole 5 . in the state where the yarn ends yb and yp are thus set in the splicing hole 5 , splicing is accomplished by the action of the compressed fluid jetted from the jet nozzle 7 . at this time , fibers of both the overlapped yarn ends are entangled and integrated by air jetted from the jet nozzle 7 and the entangled fibers are then turned , and both the yarn ends are integrated and twisted and entanglements are given on both the sides of the twists . since the control nozzles do not perform the sucking action any longer , no restriction is given to the untwisted and disentangled top portions of the yarn ends and splicing is accomplished without formation of a horny portion . when the above - mentioned splicing operation is completed , the yarn gathering levers 33 and yarn pressing levers 16 separate from the yarns yb and yp , and the yarns yb and yp pass through the slit 6 of the splicing member 2 and the normal rewinding state is restored . as will be apparent from the foregoing description , in the apparatus of the present invention , a cylindrical sleeve is arranged in a control nozzle for sucking the yarn ends and untwisting the yarn ends by jetting a compressed fluid to the yarn ends at the splicing operation , so that the sleeve can slide in the axial direction of the control nozzle , and a jet nozzle is arranged on the sleeve to extend to the interior of the sleeve . therefore , by appropriately sliding the sleeve in the control nozzle according to the length of yarn ends and the kind of fibers , the position of impingement of the jet stream against the yarn can properly be changed and a knob - free smooth joint can be formed .	1
referring now to the drawing figures , in which like references numerals identify identical or corresponding elements , a system and method for cutting tissue by using torsional mode excitation in accordance with the present disclosure will now be described in detail . while embodiments of the present disclosure are susceptible to various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the embodiments of the present disclosure to the specific form disclosed , but , on the contrary , the embodiments are intended to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the present disclosure as defined in the claims . the present disclosure may be understood more readily by reference to the following detailed description of the disclosure taken in connection with the accompanying drawing figures , which form a part of this disclosure . it is to be understood that the disclosure herein is not limited to the specific devices , methods , conditions or parameters described and / or shown herein , and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed subject matter . the present disclosure proposes utilizing torsional ultrasound for efficiently transferring vibrational energy into soft tissue . unlike any other ultrasonic tools , the surgical tool of the exemplary embodiments directs powerful compression energy into the target tissue , resulting in secure coagulation and fast cutting . away from these compression grooves , only relatively less efficient frictional energy is present . this is minimized further through a fine polishing process that reduces the risk of transferring unwanted energy into vital structures and significantly reduces the likelihood of fatigue failure with low gain . the surgical tools of the exemplary embodiments direct compression energy into the target tissue . energy is transferred quickly , denaturing the tissue protein and rapidly forming a coagulum . at the same time the central blade cuts through the tissue as the jaw of the surgical tool is closed . the result is fast and efficient haemostatic cutting . the present disclosure further proposes emphasizing the fundamental advantages of torsional mode systems over conventional longitudinal extensional devices . the present disclosure further addresses the characteristics of torsional dissector systems that introduce particular opening issues . for instance , torsional mode transmission has several advantages over longitudinal mode transmission . these include , but are not limited to the following : the motional gain associated with cross sectional changes is greater in shear wave transmission than in equivalent compression wave transmission . analysis of torsional mode concentrators reveals a gain dependence on moments of inertia associated with section changes along the transforming element . in contrast , compression wave transmission is related to linear force variation which changes with sectional area . this consideration leads to the motional gain expression for a longitudinal mode stepped transformer , defined as the square of the diameter ratio between input and output sections , and for the shear wave equivalent , the third power of the diameter ratio . this characteristic is consistent with increased q and impedance transformation ratio for shear wave systems relative to compression wave equivalents . thus , tuning to resonance requires more critically refined generator circuitry and tuning algorithms capable of differentiating between sharply defined resonance features . another distinguishing feature between longitudinal and torsional mode systems relates to transducer design . transducer designs are specific to particular modes . the classic langevin sandwich transducer is conventionally used to generate and sustain compression waves in a longitudinal mode system . in contrast , a mode converting horn with tangentially attached transducer stack is configured to generate a torsional output from the narrow end of the horn . the transducer stack is driven in a selected flexural mode to generate a torsional mode in the horn . alternative flexural stack modes result in a substantially longitudinal output from the mode converter . as a result , in each case pure torsional or longitudinal modes depend on the design of the waveguide attached at the output of the horn . operating frequencies generally result in overtone modes with waveguides spanning several wavelengths . the relationship between the horn and transducer stack renders the oscillatory system susceptible to complex transverse modes occurring in the horn and waveguide assembly . careful and accurate control of the drive frequency is required to excite the correct mode and lock the correct mode by the generator frequency / mode control circuitry . the exemplary embodiments described below illustrate how to control a drive frequency to fine - tune resonance features and excite a desired mode for a surgical tool . embodiments will be described below while referencing the accompanying figures . the accompanying figures are merely examples and are not intended to limit the scope of the present disclosure . referring to fig1 a , a schematic diagram of a torsional mode transducer having an extended stack to facilitate frequency matching to a horn , in accordance with the present disclosure is presented . the torsional mode transducer 10 of fig1 a includes a horn 12 , a threaded element or spacer element 14 , ceramic rings 16 , electrodes 18 , a back plate 20 , a first sensor 22 , and a second sensor 24 . the length , x , of the back plate 20 is designated as 26 and the length , y , of the threaded element 14 is designated as 28 . in an exemplary embodiment of the present disclosure , the transducer 10 permits the generation of either longitudinal vibrations or pure torsional waves . transducer 10 includes a transducer stack , comprising a number of axially polarized pzt ceramic rings 16 , separated by silver or gold plated brass electrodes 18 and is compressively attached to a tangential face of the transducer 10 via spigoted back plate 20 , with threaded spigot 32 located in tapped hole 34 ( as shown in fig1 b ). moreover , fig1 a shows at least two piezo - electric sensors , a first sensor 22 and a second sensor 24 located on the horn 12 . the sensors 22 and 24 are located so that they respond selectively to torsional and longitudinal horn modes . in the former , the waveform from each piezo - electric sensor 22 , 24 will be phase shifted according to the change in torsional displacement from the sensors of the horn where it is at a minimum , to the periphery where it is at a maximum . in the presence of a longitudinal mode , both sensors 22 , 24 would experience the same extensional displacement of the horn proximal end face , producing in phase outputs from the piezo - electric sensors 22 , 24 . the specific operation of sensors 22 , 24 will be further described below with reference to fig1 . furthermore , threaded element 14 may be designed to be any length 28 . the length 28 of the threaded element 14 may be varied based on a plurality of factors , such as , but not limited to , the material of the horn 12 and the natural resonant frequencies of one or more components of the transducer 10 ( e . g ., horn 12 , stack assembly , and / or waveguide 56 ). the threaded element 14 may be varied between a few millimeters up to 20 mm depending on the desired application . the length 28 of the threaded element 14 affects the output of the horn 12 . in other words , by varying the length 28 of the threaded element 14 one skilled in the art may produce a desired vibration or wave ( e . g ., a torsional wave , a pure torsional wave , a longitudinal wave , a flexural mode wave or a combination of these waves ). additionally , the length 26 of the back plate 20 may be varied between a few millimeters up to 20 mm depending on the desired application and may also affect the type of wave produced by the horn 12 . preferably , the smaller the length 28 of the threaded element 14 , the better the achievement of the desired excitation or mode . for example , the length 28 of the threaded element 14 may be in the range of 2 - 10 mm . once again , the insertion of the threaded element 14 enables an optimization of the realization of pure torsional mode as the output of the horn 12 and enables an accurate method of fine - tuning a surgical tool / device to a user &# 39 ; s desired specifications . also , threaded element 14 may be adjusted prior to assembly or after ( subsequently ) assembly of the transducer 10 to an external device ( e . g ., such as a waveguide 56 described below with reference to fig4 and 5 ). also , threaded element 14 may have a variety of different uniform or non - uniform shapes . the substantially cylindrical shape in the figures is merely illustrative . thus , in accordance to fig1 a , a drive frequency may be controlled to fine - tune resonance features and excite a desired mode for a surgical tool by adding a threaded element 14 between the horn 12 and the transducer stack of the transducer 10 . additionally , fig1 a defines means for varying the stack assembly properties , which in turn define the modal characteristics of the horn 12 . the ability to optimize the torsional output from the transducer 10 is enhanced by providing or enabling this tuning facility at each end of the stack assembly . referring to fig1 b , a schematic diagram of a torsional mode transducer having an extended stack with a threaded spigot located in a tapered hole , in accordance with the present disclosure is presented . torsional mode transducer 11 is substantially similar to torsional mode transducer 10 and thus will only be discussed further herein to the extent necessary to identify differences in construction and / or use . the torsional mode transducer 11 of fig1 b includes a horn 12 , a threaded element 14 , ceramic rings 16 , electrodes 18 , a back plate 20 , a first sensor 22 , and a second sensor 24 . additionally , the transducer 11 includes a threaded spigot 32 located in a tapered hole 34 . as shown in fig1 a , the transducer stack / assembly includes a threaded element 14 inserted between the transducer stack and the horn 12 . as shown in fig1 b , to facilitate attachment of the threaded element 14 to the horn 12 , spigot 32 is extended to accommodate attachment of threaded element 14 . this feature allows the resonant characteristics of the complete stack incorporating threaded element 14 to be tuned by adjusting the overall length of the transducer stack prior to attachment to the horn 12 . threaded element 14 may be either parallel - sided or tapered in section towards its distal end . preferably horn 12 is a tapered horn . referring to fig1 c , a schematic diagram of a torsional mode transducer illustrating critical dimensions of the transducer with a circumscribed cylinder from which a major component is machined is presented . the torsional mode transducer 13 includes a stack assembly 21 disposed between the back plate 20 and a cylindrical surface 31 . the stack assembly 21 abuts the cylindrical surface 31 via abutment member 37 mounted on one tangential face created by machining the shaded region of the circumscribing cylindrical surface 31 of fig1 c . fig1 c and fig2 ( described below ) illustrate dimensional definitions transducers 13 , 15 . fig1 c defines circumscribing surface 31 which sets a tangential mounting plane of the stack assembly 21 . a flexural rotation of the stack assembly 21 through angle , θ , ( designated as element 44 in fig3 ), generates a torque about the horn axis o , thus driving the horn 12 into a torsional mode . referring to fig2 , a schematic diagram of an axial view of a torsional mode transducer is presented . the torsional mode transducer 15 includes a threaded hole 34 for waveguide attachment . additionally , the transducer 15 includes exponential tapering surfaces 36 , cylindrical extremity 38 , cylindrical isolating flange 33 located adjacent to the horn 12 , shaded area 35 , and the abutment member 37 . horn 12 is machined with exponential tapering surfaces 36 and interrupted by cylindrical isolating flange 33 , where the exponential tapering surfaces 36 are cut tangentially to circumscribing cylindrical surface 31 ( see fig1 c ). moreover , stack assembly 21 ( see fig1 c ) is disposed adjacent to horn 12 so that &# 39 ; s its cylindrical extremity 38 coincides with an outer extremity of a tangential face of the horn 12 and overlaps an inner extremity as indicated by the shaded area 35 . referring to fig3 , a schematic diagram of a geometric relationship between flexural stack displacement and torsional horn displacement , in accordance with the present disclosure is presented . the geometric relationship 40 of fig3 illustrates stack displacement 42 and an angle , θ , designated as 44 . transducer 10 having the stack assembly is located on horn 12 so that its cylindrical extremity coincides with the outer extremity of a tangential face of the horn 12 . the relationship between the stack diameter , d ′, the proximal horn effective diameter d , and the circumscribed diameter d are chosen critically in order to generate the required vibrational mode and resonant frequency . rotational movement of the proximal horn mass is initiated by a flexural mode displacement within the stack assembly as illustrated in fig3 . this mode is possible when d ′& gt ; d / 2 , allowing for a more compact transducer design than employing a conventional axial mode stack where d ′& lt ;& lt ; d / 2 . fig3 illustrates the geometry which controls the transfer of stack displacement 42 to the horn 12 . the equation defining the resolved component of flexural displacement f t , at angle θ , 44 , to mounting plane , is given as : t = f t cos θ · l = ½f t cos ( arctan (( d − d ′)/ d ))·( d 2 +( d − d ′) 2 ) 1 / 2 . critical selection of d ′/ d ratio for optimum compact transducer operation is defined as 0 . 45 & lt ; d ′/ d & lt ; 0 . 55 ; preferably , 0 . 482 ; and for normal ( axial mode stack ) operation , 0 . 3 & lt ; d ′/ d & lt ; 0 . 4 ; preferably 0 . 333 . torsional resonance is established in either case by critical selection of a length of the horn 12 , a diameter of connecting member 52 ( shown in fig4 and 5 ) and the dimensions of the waveguide 56 ( shown in fig4 and 5 ). referring to fig4 , a schematic diagram of a torsional mode transducer connected to a waveguide with an illustration of the displacement amplitude distribution , in accordance with the present disclosure is presented . the transducer / waveguide configuration 50 includes torsional mode transducer 10 described above with reference to fig1 a . the transducer / waveguide configuration 50 further includes connecting member 52 , a first nodal plane 54 , waveguide 56 , a second nodal plane 58 , shroud tube 60 , a third nodal plane 62 , a fourth nodal plane 64 , and an end effector 66 . the end effector 66 depicts a portion of the waveguide 68 and a distal tip 70 . arrow 80 illustrates the torsional movement of the waveguide 56 . fig4 further depicts a graph 71 illustrating a transmission wave that is generated when the transducer / waveguide configuration 50 is activated . a half wavelength 72 is generated between the horn 12 and the connecting member 52 . a half wavelength 74 is generated between the first nodal plane 54 and the second nodal plane 58 . a half wavelength 74 is also generated between the last two distal nodes 64 and 62 . a quarter of a wavelength 76 is generated between the fourth nodal plane 64 and the distal tip 70 of the end effector 66 . note that the mid - section of the waveguide is omitted to save repetition , but may be typically 7 or 8 wavelengths long . fig4 further depicts a graph 51 illustrating the effect of stack flexing ( as described below ). additionally , the waveguide 56 consists of an integral number of half wavelengths for shear wave propagation at the resonant frequency . waveguide isolation is achieved by local increase in diameter coincident with nodal planes 54 , 58 , 62 , 64 , which create space between the plastic lined shroud tube 60 and active regions of the waveguide 56 . moreover , the waveguide may be referred to as an elongated shaft having a proximal end and a distal end . in addition , the distal end may be separated into one or more sections . for example , with respect to fig6 - 8b , the distal end may be separated into three sections . the first section may have a first width and a first length , the second section may have a second width and a second length , and the third section may have a third width and a third length , where the first , second , and third widths are the same or different from each other . the first section may refer to an end effector , the second section may refer to a connecting section , and the third section may refer to a tip portion / blade portion of the distal end of the elongated shaft . the end effector may be a curved blade having twin grooves as illustrated in fig4 , element 70 . referring to fig4 a , a schematic diagram illustrating a detail of the end effector of the torsional mode transducer of fig4 , in accordance with the present disclosure is presented . the detailed view illustrates the shape of the distal tip 70 , which depicts a twin groove configuration . of course , one skilled in the art could contemplate a plurality of different distal tip configurations to achieve either longitudinal and / or torsional excitation . referring to fig5 , a schematic diagram of a longitudinal mode transducer connected to a waveguide with an illustration of the displacement amplitude distribution , in accordance with the present disclosure is presented . transducer 90 is substantially similar to torsional mode transducer 50 and thus will only be discussed further herein to the extent necessary to identify differences in construction and / or use . transducer 90 has a similar transmission wave graph to the transmission wave graph illustrated in fig4 . graph 91 illustrates a transmission wave that is generated when the transducer / waveguide configuration 90 is activated . a half wavelength 92 is generated within the horn 12 . a half wavelength 94 is generated between the first nodal plane 54 and the second nodal plane 58 . a half wavelength 94 is also generated between the third nodal plane 62 and the fourth nodal plane 64 . a quarter of a wavelength 96 is generated between the fourth nodal plane 64 and the distal tip 70 of the end effector 66 . fig5 further depicts a graph 95 illustrating the effect of stack flexing ( as described below ). in the alternative exemplary embodiment , as illustrated in fig5 , the transducer stack assembly is activated in a variant flexural mode such that end face 82 of the back plate 20 is deflected as indicated by arrow 84 in a longitudinal direction . this stack movement generates a longitudinal mode in the horn 12 at a frequency consistent with compression wave transmission in the horn 12 and attached waveguide 56 . the frequency for longitudinal resonance is related to the designed torsional mode frequency by the expression : f tor / f long = g / e , where , g , is the shear modulus and , e , is young &# 39 ; s modulus for the horn 12 and waveguide material . these features ( i . e ., threaded element 14 incorporated in the transducer 10 and nodal planes 54 , 58 , 62 , 64 ) allow a surgical tool system to be driven alternately in either longitudinal or torsional modes with the possibility of generating an increased distal length of effective displacement , with the advantage that there is no need for an additional transducer stack attached to the horn proximal end face to create the longitudinal displacement as taught in young and young , the dual mode application , issued as gb patent no . 2 , 438 , 679 . moreover , nodal bosses or nodal planes 54 , 58 , 62 , 64 machined on the waveguide 56 provide a simple means of acoustic isolation of the waveguide 56 from the mounting tube ( s ) 160 , which allow the torsional / longitudinal resonance to be deployed with a cooperative hinged jaw 182 ( see fig9 ). in both fig4 and 5 , the transducer configurations 50 , 90 can generate either longitudinal or torsional resonance in a tuned multi half wave rod system attached to the narrow end of the horn 12 . fig4 and 5 illustrate the relative effects of two flexural stack modes in orthogonal planes , as shown in graphs 51 , 71 , 91 , 95 . specifically , graphs 51 and 95 illustrate the effect of the stack flexing in the yz plane which generates a torsional mode in the horn 12 and the waveguide 56 . when excited at a different frequency , exciting flexure in the xy plane of fig5 , the output is longitudinal . fig4 and 5 further illustrate the potential to generate two different modes alternately at different frequencies , which are selected to produce torsional and longitudinal wavelengths with a number of coincident nodal planes 54 , 58 , 62 , 64 . the ability to tune the stack assembly allows one skilled in the art to optimize either longitudinal or torsional outputs and also to combine them with an appropriate switched , dual frequency electrical generator ( as described below with reference to fig1 and 12 ). essentially , the stack assembly and the horn 12 determine the mode of vibration and the waveguide 56 is tuned to resonate in a particular mode by adjusting its length to encompass a number of half wavelengths at one or more designated frequencies . furthermore , graph 51 shows a stack mode which generates a rotational mode in the horn 12 , creating torsional resonance in the waveguide 56 , indicated by arrows 71 and 80 . the horn 12 always embodies a half wave length with antinodes at both ends . moreover , the nodal planes 54 , 58 , 62 , 64 are established as part of the resonance displacement pattern and are used to provide mechanical isolation by incorporating local bosses on the waveguide 56 . these create gaps between the waveguide 56 and the plastic shroud liner ( see fig9 ). fig4 and 5 both serve to illustrate the relationship between the stack flexural mode ( plane xy longitudinal and yz torsional ) and the waveguide mode . fig4 illustrates a torsional system , whereas fig5 illustrates a longitudinal system . the only difference in the waveguide 56 is that the compression half wave length is greater than the torsional since compression wave velocity is greater than shear velocity for a given material . the prior art of young and young , gb 2423931 , teaches the use of a torsional mode dissector with a curved distal end effector substantially tapered from the distal tip and with only relatively short focusing grooves towards the proximal blade end . this lack of distal focusing grooves reduces the coagulating efficiency of the tip of the curved blade although it permits some lateral tissue welding capability . it is one objective of the exemplary embodiments illustrated in fig6 and 7 to create a torsional mode curved end effector 100 , 130 with a full distal focusing feature . fig6 and 7 will be simultaneously described . fig6 illustrates curved end effector 100 in accordance with the present disclosure , which comprises three distal waveguide regions ; a proximal first portion 102 of section wo , which would attach to a torsional waveguide and transducer as defined in fig4 ; a half wavelength second distal section extending from nodal isolating boss 122 , through quarter wave anti - nodal step 124 to first distal nodal step 126 of section ws ; and a third distal quarter wavelength region extending from distal step 126 to torsional blade tip 128 of section wl . the third section embodies a double grooved focusing region 114 , similar to that illustrated in fig4 a and defining the extent of the distal blade . the end effector waveform is shown schematically as 101 in fig6 , where the second effector region of length z , 120 , is shown to be a half wavelength , with initial length x , 116 , terminating in anti - nodal step 124 . the anti - nodal step has a zero amplitude gain characteristic , which in conjunction with nodal gain step 126 , permits control of the critical torsional displacement amplitude within curved blade region 114 . it is another objective of the exemplary embodiments of the present disclosure , to minimize transverse modes created by the inertial effect of the axially offset mass associated with the curved effector blade , which in fig6 is offset from the waveguide axis by a distance 112 . clearly , by reducing the diameter of the distal blade section 114 , relative to the input section wo , 102 , the inertial moment which generates unwanted transverse modes , is reduced . the limits satisfying this criterion are expressed by the inequality : 1 . 5 & lt ; wo / wl & lt ; 3 . 0 . inclusion of the zero gain anti - nodal step 124 allows one skilled in the art to limit the peak distal blade amplitude to 200 microns by relying on the amplitude gain at 126 . the nodal torsional gain is found from the expression : gain , k =( ws / wl ) 3 . the above consideration permits blade curvature and peak displacement amplitude to meet operating criteria for acceptable haemostatic tissue dissection . blade curvature is controlled so that the distal tip is constrained to lie within the cylindrical envelope defined by section wo at 106 . the magnitude of the waveguide section steps at 124 , 126 and any non - linear variation in the section along y , 118 , in fig6 , can clearly be varied independently to control the output characteristics of the waveguide , thus allowing high rotational amplitudes with minimum harmful transverse modes . it is noted that the above expressions serve as an exemplary definition only and do not limit scope for wider application of the present disclosure . fig8 a and 8b are schematic illustrations of a further aspect of the present disclosure intended to optimize the use and effectiveness of the torsional mode transducer , waveguide , and end effector system referred to throughout the present disclosure , in a particular surgical process which involves tissue welding as an end point objective . in this function , the elements of the end effector structure , which focus energy into the target tissue , for example , a specific large blood vessel , are emphasized whilst at the same time changing the detail of features which encourage tissue separation in order to delay or prevent that process . fig8 a shows a welder end effector 140 attached to waveguide 142 at nodal step plane 134 . the section change at the nodal step creates sufficient torsional amplitude gain , according to the principles described earlier , to enable the tissue contacting face 136 to direct energy into the target vascular tissue . fig8 b shows profile of end effector blade 136 which is essentially flat but may be raised centrally as shown , creating angled faces 148 a and 148 b which meet at ridge feature 145 . surface 36 may be close to the diametral plane of the end effector , defined by waveguide axis 146 in fig8 b . the displacement amplitude of the torsional mode activation in faces 148 a and 148 b is maximum at the periphery and small along the central ridge 145 . this characteristic generates focused ultrasound transmission into contacting tissue on either side of the ridge , thus creating a strong weld . the low energy associated with ridge 145 produces only a slow tissue separation effect delaying cutting and ensuring a fully haemostatic tissue bond in the target vessel adjacent to facets 148 a and 148 b . cutting is further slowed by employing a pulse mode electrical drive to the torsional transducers . additionally , according to the present disclosure , and especially when using an end effector having a flat operative face , or one with a very shallow longitudinal ridge , which acts to delay or de - emphasize cutting in favor of welding or coagulating the tissue ( s ) with which the end effector is in contact with , the end effector can be activated with pulsed ultrasonic vibrations . therefore , this results in pulsing the ultrasonic activation of the tool or end effector driven by the transducer . the generator is described with reference to fig1 and 12 below . the operation of ultrasonically activated dissectors and welders such as described above is greatly enhanced by the provision of a hinged cooperative jaw attached to a protective shroud which also houses a jaw articulation system . this is more fully illustrated by reference to fig9 and 10 below . referring to fig9 , a schematic diagram of a waveguide , shroud , and hinged jaw of a torsional mode waveguide configuration , in accordance with the present disclosure is presented . the torsional mode waveguide configuration 150 includes one or more liners 152 , a separating member 154 , a waveguide axis 156 , a waveguide 158 , a concentric tube 160 , a locking member 162 , an axial view of spigot ( s ) 164 , a socket balls 166 , an outer surface 168 , a tube edge 170 , a gap 172 , a top portion 174 of jaw 182 , a clamping feature 176 , a first inner portion 178 of jaw 182 , and a second inner portion 180 of jaw 182 . in another exemplary embodiment of the present disclosure , shown in fig9 , 10 a , 10 b , and 10 c , a torsional mode dissector head incorporating a waveguide , a co - operative jaw , a protective outer casing and an acoustic isolation system is described . fig9 depicts a distal portion of an ultrasonic tissue dissector . jaw 182 is attached permanently to the socket balls 166 and the clamping feature 176 , thus allowing the jaw 182 to rotate in a plane which is parallel to the waveguide axis 156 . the present disclosure permits jaw 182 to be removably mounted to the socket balls 166 , being supported on spigots 164 , which engage in the locking member 162 . attachment of the jaw 182 is achieved by expanding gap 172 until the separation of the spigots 164 is sufficient to allow them to engage in the locking member 162 having socket balls 166 . thus , a further advantage of the torsional mode waveguide configuration 150 over traditional art is the method of acoustic isolation of the waveguide 158 from the passive elements of the system , represented by concentric tube 160 and one or more liners 152 . referring to fig1 a , 10 b , and 10 c , schematic diagrams of the jaw configuration , in accordance with the present disclosure are presented . jaw configuration 200 is substantially similar to the jaw portion 184 of fig9 and thus will only be discussed further herein to the extent necessary to identify differences in construction and / or use . jaw configuration 200 further includes a pair of pivot members 202 and a pair of receiving members 204 . fig1 a merely illustrate how the pivot members 202 fasten to the receiving members 204 of fig1 b . fig1 c merely illustrates how the gap 172 separates the ends of the jaw configuration 200 in order to provide a linking mechanism between the spigot 164 , the socket balls 166 and the locking member 162 . referring to fig1 , a block diagram of a first embodiment of control and power circuits for a torsional mode ultrasonic generator , in accordance with the present disclosure is presented . the block diagram 220 includes first isolation blocks module 222 , signal conditioning module 224 , digitization module 226 , software algorithms module 228 , dds signal generator module 230 , power amplifier module 232 , second isolation blocks module 234 , current sensor module 250 , power sensor module 260 , and amplitude sensor module 270 . the current sensor module 250 , the power sensor module 260 , and the amplitude sensor module 270 may be collectively referred to as an output transducer 240 . in general , an electrical generator has the capability of driving torsional mode systems , such as the ones described in fig1 - 8 . for example , a processor controlled dds ( direct digital synthesis ) chip 230 may drive a switch mode power amplifier 232 coupled to a torsional mode transducer 240 through transformer and impedance matching inductors 250 , 260 , 270 . the matching circuit , incorporating current and voltage monitoring components and including appropriate isolating circuitry 222 , 234 , is shown in fig1 . to ensure correct mode selection , the output signals from the current and displacement monitoring circuits 250 , 260 , 270 are compared during a broad frequency scan . transducer displacement amplitude 270 is monitored using piezo ceramic sensors 5 and 6 mounted on the horn 12 , as shown in fig1 and 2 . the signal from sensor 22 , positioned on the horn axis , uniquely gives a minimum output when the transducer is a torsional resonance . the output from sensor 24 is a maximum at torsional resonance . by contrast the outputs from each sensor 22 , 24 would be at a maximum when the horn 12 is at a longitudinal resonance . referring to fig1 , a block diagram of a second embodiment of control and power circuits for a torsional mode ultrasonic generator , in accordance with the present disclosure is presented . the block diagram 300 includes an output transducer 302 , a sensor 304 , a current sensor 310 , a power sensor 320 , an amplitude sensor 330 , algorithms 340 , a first output 342 , a second output 344 , and a drive power signal 346 . the main significance of this second embodiment of the control and power circuits for the torsional mode ultrasonic generator 300 is that it mirrors the transducer current variation as the generator frequency passes through torsional resonance . by comparing these traces it is therefore possible to detect torsional resonance with absolute certainty . clearly , either current amplitude signals can be used as a means of effecting resonance control . however , a more useful result is obtained by using instantaneous load current and voltage to compute instantaneous power . additionally , a tuning algorithm may then be written to select resonance coincident with maximum power and control loop algorithms may be written for coarse and fine tuning characteristics . referring to fig1 , a schematic diagram of an alternative embodiment of a torsional mode transducer having an extended stack with two threaded spigots , one located at a proximal end and one located at a distal end of a threaded shaft , in accordance with the present disclosure is presented . torsional mode transducer 400 is substantially similar to torsional mode transducer 11 of fig2 and thus will only be discussed further herein to the extent necessary to identify differences in construction and / or use . the torsional mode transducer 400 of fig1 includes a horn 12 , a threaded element 14 , ceramic rings 16 , electrodes 18 , a back plate 20 , a first sensor 22 , and a second sensor 24 . the transducer 400 further includes a threaded spigot 32 located in a tapered hole 34 . additionally , and in contrast to fig2 , the transducer 400 includes a second threaded spigot 410 on the distal end of the threaded shaft 420 . in this exemplary alternative embodiment , the threaded shaft 420 is provided with tightenable spigots 32 , 410 ( or nuts ) at both its proximal and its distal end . this allows the stack assembly to be compressed further while still mounted to the horn 12 . also , one may use exchangeable spigots / nuts 32 , 410 at the free end of the stack assembly , having different sizes and masses , the variation in mass allowing one to tune the resonant frequency produced by the stack assembly . in existing stacks , one merely builds a stack , and then checks what frequency it happens to produce and tuning can be carried out by exchanging the spigot / nut 32 , but this is less convenient because one needs to separate the stack assembly from the horn 12 to access the nut 32 . in contrast , having a threaded shaft 420 with opposing spigots 32 , 410 allows for more versatility in assembly and manufacturing . in conclusion , fine - tuning resonance requires more critically refined generator circuitry and tuning algorithms capable of differentiating between sharply defined resonance features . the exemplary embodiments provide for efficient fine - tuning of resonance characteristics of one or more components of a surgical tool in order to selectively provide for pure torsional vibrations / waves and / or longitudinal vibrations / waves and / or flexural vibrations / waves . it is to be understood that the illustrated embodiments are for the purpose of example , and that numerous other configurations of transducer / waveguide assemblies exist . accordingly , the illustrated and described embodiments are not intended to limit the scope of the inventive subject matter only to those embodiments . it should also be understood that the transducer / waveguide arrangements described herein can be used in connection in a wide variety of applications outside the implementations described herein . for example the transducer / waveguide arrangements described herein can be used in cooperation with other known transducer / waveguide arrangements . the transducer / waveguide arrangements described herein can also be useful for non - human applications . the present disclosure also includes as an additional embodiment a computer - readable medium which stores programmable instructions configured for being executed by at least one processor for performing the methods described herein according to the present disclosure . the computer - readable medium can include flash memory , cd - rom , a hard drive , etc . it will be appreciated that variations of the above - disclosed and other features and functions , or alternatives thereof , may be desirably combined into many other different systems or applications . various presently unforeseen or unanticipated alternatives , modifications , variations , or improvements therein may be subsequently made by those skilled in the art which are also intended to be encompassed by the following claims . the claims can encompass embodiments in hardware , software , or a combination thereof . although the illustrative embodiments of the present disclosure have been described herein with reference to the accompanying drawings , it is to be understood that the disclosure is not limited to those precise embodiments , and that various other changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the disclosure . those skilled in the art , having the benefit of the teachings of the present disclosure as herein and above set forth , may effect modifications thereto . such modifications are to be construed as lying within the scope of the present disclosure , as defined by the appended claims .	0
an elevated side - view of an imaging - based reader 10 is depicted in fig1 . a typical profile of the portable bar code reader 10 is physically shown that uses an internal power source such as a battery , but could be a reader having a wire connection from which power is supplied , or remotely powered through an induction system without departing from the spirit and scope of the claimed invention . in addition to imaging and decoding 1d and 2d bar codes , including postal codes , and code 39 bar codes , the reader 10 is also capable of capturing images and signatures . in one example embodiment , the bar code reader 10 is a hand held portable reader that can be carried and used by a user walking or riding through a store , warehouse , or plant , while reading bar codes for stocking and inventory control purposes . however , it should be recognized that the imaging - based bar code reader 10 of the present invention , to be explained below , may be advantageously used in connection with any type of imaging - based automatic identification system including , but not limited to , bar code scanners , signature imaging acquisition and identification systems , optical character recognition systems , fingerprint identification systems and the like . it is the intent of the present invention to encompass all such imaging - based automatic identification systems . returning to fig1 , the imaging - based bar code reader 10 includes a handle 12 , which is located between an upper end 14 and lower end 16 of the reader 10 . the reader further includes a reading portion or head 18 situated between a first and second ends 20 and 22 , respectively . typically located about the upper end 14 of the handle 12 is a trigger 24 that when engaged by an operator initiates the reading of a target object or in this example embodiment , a bar code 26 . the trigger 24 is coupled to the reader &# 39 ; s circuitry for initiating the reading of the target bar code 26 , which is often positioned on an article such as a package , or at times on a pick list 28 , as shown in fig1 . the pick list 28 includes an array of bar codes with spaces or voids therebetween . if the reading process is to be manually performed by an operator , the process is typically activated by engaging the trigger 24 . however , other reading systems may be automated reading system initiated by an instruction internal to the reading system &# 39 ; s software or circuitry . alternatively , the initiation of the automatic reading system may be continuous once power is supplied to the reader . for either the manual or automatic reading system , an illumination source is energized projecting a first illumination pattern 30 from the first end 20 of the reader 10 through a window 32 , as depicted in fig1 . referring now to fig2 is a functional block diagram of an imaging reader system 34 capturing a target object , this example being a two - dimensional image 36 . the system 34 includes several components typically located within the reader 10 , but could be remotely located without departing from the spirit and scope of the claimed invention . functioning as a part of the system 34 is a scan engine 38 that is connected to reading components that perform functions such as imaging , control , and decoding . in this example embodiment , the system 34 , including the scan engine 38 is positioned within the head 18 and handle 12 of the reader 10 . the engagement of the trigger 14 initiates an illumination source 40 that results in the emission of a light beam 42 . in an automatic reader , the trigger 14 could be omitted since the light beam is typically enabled once power is supplied to an imaging - based reader 10 . the illumination source 40 may be any device capable of producing a light beam 42 , for example an led or cold cathode lamp ( cfl ) would be suitable devices . the light beam 42 is scattered by an illumination guide 44 that projects the illumination pattern 30 through the window 32 toward the barcode . it is desirable to have the illumination pattern 30 match or fill the field of view ( fov ) of an imaging camera 43 located within the reader 10 . the illumination pattern 30 , illuminates the target object 26 . the target object 26 scatters the light forming an image 46 that is captured by the imaging camera 43 . the scattered light from the target object 26 is redirected back toward the reader 10 through the window 32 and illumination guide 44 , and is altered by a lens 48 connected to the imaging camera 43 . the image 46 is then formed or focused by the lens 48 and is directed onto a multi - dimensional pixel array 50 , filling the pixel array sensors with data . the lens 48 focuses or forms the image 46 onto the pixel array 50 , which is tied and captured to an imager 52 . the pixel array 50 and imager 52 are additional components that construct the imaging camera 43 that is located inside the reader 10 . the multi - dimensional pixel array 50 produces a data grid corresponding to the image 46 from the target object 36 . it should be appreciated by those skilled in the art that the pixel array 50 and imager 52 could be either a charged coupled device ( ccd ) or complementary metal oxide semiconductor ( cmos ) based imaging type both having multi - dimensional array of sensors that sense the image 46 and form pixel data corresponding to the image of the target object 36 . an analog to digital (“ a / d ”) converter 54 located in the scan engine 30 , receives the stored analog image from the imager 52 . the a / d converter 54 then sends a digital signal to a decoder 56 where the signal becomes synthesized by the decoder &# 39 ; s internal circuitry . an example of such a sensor is micron technology inc . cmos image sensor part number mt9m001 . however , the a / d converter 54 and decoder 56 do not have to be incorporated into the scan engine , and may be housed in separate scanner components . the scan engine 30 is associated to a microprocessor 60 that is connected to the imaging reader 10 . the microprocessor 60 assists in processing and decoding the image into a data stream through firmware 62 . the firmware 62 is embedded within the microprocessor 60 or scan engine 30 onto for example , flash read only memory ( roms ) or as a binary image file that can be programmed by a user . alternatively , the scan engine could employ an application specific integrated circuit ( asic ). if the decode process executed within the decoder 56 is successful , the decode session may be terminated with the decoded information being transmitted to an output 64 , which could be tied to a number of reader peripherals . these could include for example , visual display devices such as a monitor or led , a speaker , or the like . fig3 a illustrates a perspective view of an imaging - based bar code reader 10 constructed in accordance with one embodiment of the claimed invention . the first end 20 of the head 18 is in view showing a circular - shaped window 32 . located internally and behind the window 32 is a circular - shaped illumination guide 44 having a textured or crenulated surface 70 . while a circular shaped window 32 and illumination guide 44 are shown , the structures could be any geometrical shape without departing from the spirit and scope of the claimed invention . for example , the illumination guide could be circular , elliptical , or square . in addition , the scattering of the light by the illumination guide 44 could also be achieved by the geometrical shape of the guide . for example , a prism or wedge shaped illumination guide 44 could also be used to produce the scattered light effect . fig3 b illustrates a perspective view of an imaging - based bar code reader 10 constructed in accordance with one embodiment of the claimed invention . similarly oriented with the reader of fig3 a , the reader 10 of fig3 b provides a view of the window 32 . however , the example embodiment of fig3 b further provides an area of discontinuity 72 located substantially about the center of the circular - shaped illumination guide 44 . the area of discontinuity 72 could however be positioned and assume any geometrical shape within the illumination guide 44 without departing from the spirit and scope of the claimed invention . the area of discontinuity 72 could be a through aperture in the illumination guide 44 or a section of material ( optical transmission material ) differing in composition from the type of material used for the illumination guide that would allow for uninhibited transmission of the image 46 . alternately , the area of discontinuity could be from the same material as the illumination guide 44 , but the surface would lack texturing . an example of a suitable transmission material includes clear glass , plastic , or any optically translucent / transparent media . the illumination guide 44 further provides a dust seal , protecting the scan engine components from debris typically produced from external environments . referring now to fig4 is a section view of the illumination guide 44 along line 4 - 4 as shown in fig3 a . a single illumination source 40 is shown as being coupled to the illumination guide 44 . more specifically , the illumination source can be attached to , or in close proximity to the illumination guide 44 such that light passes through the guide and exiting through the textured , rough , or crenulating surface 70 in a scattered and predetermined direction toward the target object 26 . the illumination guide 44 is a plate - like structure , typically having a thickness or width that is much smaller relative to its height . the illumination guide 44 is made from optically translucent material and the typical thickness or width is very small ranging up to a few millimeters . the illumination guide &# 39 ; s width is defined by two sides , where the sides could be parallel to each other or one side could include a small wedge . the textured surface 70 is a microstructure that enhances the illumination pattern 30 by scattering the light toward the target object 26 . such configuration eliminates the need for led banks and clusters that are both costly and power consuming . in addition , the illumination guide 44 provides uniform illumination background and scatters the light over a larger area . in applications where the target object 26 is located on a shiny reflective surface such as surgical instruments or displays of cell phones , it is constructive to have a large illumination system , which the illumination guide 44 provides . the imaging camera 43 of the reader 10 captures the image of the target object 26 with the illumination system reflected on the background from the shiny surface of the object on which the target object appears . the light from the target object itself is scattered or absorbed and appears as dark features in the image 46 . the image 46 is further enhanced due to the reflection of the target object &# 39 ; s supporting surface . the textured surface 70 includes a plurality of ridges 76 each having a microstructure height x and a pitch distance y . the illumination guide 44 is made from any material capable of scattering the light beam 42 into the desired illumination pattern 30 . examples of suitable materials include any optically translucent materials , isotropic materials , translucent plastic , and etched glass . the textured surface 70 is a microstructure surface providing a desirable degree of light scattering at the target object 26 . the textured surface could be integrated into the illumination guide 44 or added to the surface of the guide as a separate substrate . an example of a suitable microstructure surface would include a surface having a pitch distance and microstructure height ranging from a few microns up to a half of a millimeter . the illumination guide 44 material and construction can be such that allows the reflected image 46 ( the image of the target or scattered light from the target 26 ) 46 to pass unaffected through the guide into the lens 48 without degradation to the reflected image as shown in fig2 . alternatively , the example embodiment depicted in fig3 b and 5 include an area of discontinuity 72 for receiving the reflected image 46 . fig5 shows the alternative embodiment of the imaging - based bar code reader 10 such that objects previously discussed operating in a similar fashion are denoted with the addition of a prime next to the reference character . the illumination guide 44 ′ includes a first and a second section 44 a and 44 b , respectively . the sections 44 a , 44 b may be continuous , if for example the illumination guide 44 ′ is circular - shaped as shown in fig3 b . alternatively , depending on the illumination guide 44 ′ geometry , the sections 44 a , 44 b , may be separate , as the case for a rectangular shaped guide . in the illustrated embodiment the area of discontinuity 72 is centrally located about the illumination guide 44 ′, but could be located at any location along the illumination guide . the area of discontinuity 72 could be any material differing from the illumination guide 44 ′ that provides enhanced transmission of the reflected image 46 through the illumination guide , for example clear glass . alternatively , the area of discontinuity could be an aperture or void in the illumination guide 44 ′ creating a passage for the reflected image 46 or be made from the same material as the illumination guide but without a textured surface . when a material is used in the area of discontinuity 72 it provides a secondary function , acting as a protective shield by preventing debris and other foreign objects from entering the imaging - based reader 10 that pass beyond the window 32 . both the first and second sections 44 a , 44 b may have a respective illumination source 40 a , 40 b , or be illuminated by a single illumination source similarly attached to , or in close proximity to one of the first or second sections . alternatively , any number of illumination sources could be used around the perimeter of the illumination guide depending on the amount of illumination required for the desired application . fig6 illustrates an example embodiment constructed in accordance with the claimed invention in which the illumination guide 44 includes a diffused screen 78 in contact or connected to the illumination guide along the interior side of the reader 10 . the diffuse screen 78 enhances the light uniformity and efficiency of the guide 44 . the diffuse screen may further enhance the scattering of light achieved by the illumination guide 44 by making the diffuse screen 78 from optically non - transparent material accomplished by the addition of color , such as white or a color consentient with the color of the led ( s ) for producing the light . for example , if a red led is used , the diffuse screen 78 may be similarly colored red . while the present invention has been described with a degree of particularity , it is the intent that the invention includes all modifications and alterations from the disclosed design falling with the spirit or scope of the appended claims .	6
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . a diagram of a braking system according to a first embodiment of the present invention is shown in fig1 , generally at 10 . the system 10 includes a first vehicle controller 12 , and a second , or redundant , vehicle controller 14 . the first vehicle controller 12 controls a primary brake system , shown generally at 16 , and the second vehicle controller 14 is used to control a secondary brake system , generally at 18 . the primary brake system 16 includes a battery 20 which is used to supply power to an actuator , shown generally at 22 . the actuator 22 in this embodiment is a ball - screw - type of actuator 22 , which includes a motor 24 , which rotates a shaft 26 to move a piston 28 in a cylinder 30 . the actuator 22 is used to circulate fluid in a plurality of conduits . the system 10 also includes a reservoir 32 which includes two connectors 34 a , 34 b . the reservoir 32 is divided into different sections , which are separated by partitions ( not shown ), where each connector 34 a , 34 b provides fluid communication between each section of the reservoir 32 and a corresponding fluid conduit connected to each connector 34 a , 34 b . the first connector 34 a is connected to a return conduit 36 , which is in fluid communication with cylinder 30 . disposed in the return conduit 36 is a check valve 38 which allows for fluid in the conduit 36 to transfer to the cylinder 30 as the piston 28 is moved in a first direction towards the motor 24 . also connected to the cylinder 30 is a main feed conduit 40 , and the main feed conduit 40 is connected to and in fluid communication with several other feed conduits 42 a , 42 b , 42 c , 42 d which are connected to and in fluid communication with several anti - lock braking system ( abs ) valves 44 a , 44 b , 44 c , 44 d , 44 e , 44 f , 44 g , 44 h . four of the abs valves 44 a , 44 c , 44 e , 44 g also have pressure relief conduits 46 a , 46 b , 46 c , 46 d , and a check valve 48 a , 48 b , 48 c , 48 d located in a corresponding conduit 46 a , 46 b , 46 c , 46 d . the system 10 also includes four braking units 50 a , 50 b , 50 c , 50 d , and there are two abs valves 44 a , 44 b , 44 c , 44 d , 44 e , 44 f , 44 g , 44 h responsible for providing an anti - lock braking function for each braking unit 50 a , 50 b , 50 c , 50 d . more specifically , the first two abs valves 44 a , 44 b provide the anti - lock braking function for the first braking unit 50 a , the third and fourth abs valves 44 c , 44 d provide the anti - lock braking function for the second braking unit 50 b , the fifth and sixth abs valves 44 e , 44 f provide the anti - lock braking function for the third braking unit 50 c , and the seventh and eighth abs valves 44 g , 44 h provide the anti - lock braking function for the fourth braking unit 50 d . the first two abs valves 44 a , 44 b are connected to and in fluid communication with the first braking unit through a first final conduit 52 a , and the fifth and sixth abs valves 44 e , 44 f are connected to and in fluid communication with the third braking unit 50 c through a second final conduit 52 b , as shown in fig1 . the third and fourth abs valves 44 c , 44 d and the seventh and eighth abs valve 44 g , 44 h are connected to and in fluid communication with the secondary brake system 10 through corresponding transition conduits 54 a , 54 b . more specifically , the first transition conduit 54 a is connected to and in fluid communication with a first master cylinder cut valve 56 a , and the second transition conduit 54 b is connected to and in fluid communication with a second master cylinder cut valve 56 b . each of the master cylinder cut valves 56 a , 56 b have corresponding pressure relief conduits 56 c , 56 d , and corresponding check valves 60 a , 60 b . the master cylinder cut valves 56 a , 56 b are part of the secondary brake system 18 . in addition to the return conduit 36 , also connected to and in fluid communication with the reservoir 32 is an upstream feed conduit 58 , the upstream feed conduit 58 branches into two separate secondary feed conduits 58 a , 58 b . one of the secondary feed conduits 58 a is connected to and in fluid communication with several sub - conduits 64 a , 64 b , 64 c , 64 d , where the first sub - conduit 64 a is in fluid communication with the second abs valve 44 b , the second sub - conduit 64 b is in fluid communication with the fourth abs valve 44 d , the third sub - conduit 64 c is in fluid communication with the sixth abs valve 44 f , and the fourth sub - conduit 64 d is in fluid communication with the eighth abs valve 44 h . the other secondary feed conduit 58 b is in fluid communication with the secondary brake system 18 , and more specifically splits into two additional conduits 62 a , 62 b , which are connected to and in fluid communication with corresponding reservoirs 66 a , 66 b . the secondary brake system 18 also includes two low - pressure feed valves 68 a , 68 b , which are in fluid communication with the corresponding reservoirs 66 a , 66 b through conduits 70 a , 70 b as shown in fig1 . each of the low - pressure feed valves 68 a , 68 b is connected to and in fluid communication with a pump 72 a , 72 b , and both pumps 72 a , 72 b are driven by a motor 74 . the secondary brake system 18 also includes excess pressure relief valves 76 a , 76 b which are in fluid communication with the reservoirs 66 a , 66 b through pressure relief conduits 78 a , 78 b as shown in fig1 . there are also two corresponding downstream pressure relief conduits 80 a , 80 b which are connected to the excess pressure relief valves 76 a , 76 b as shown in fig1 , and the conduits 80 a , 80 b are also connected to and in fluid communication with corresponding cut - valve downstream conduits 82 a , 82 b . each of the cut - valve downstream conduits 82 a , 82 b splits , such that the first cut - valve downstream conduit 82 a is in fluid communication with the second braking unit 50 b and the first pump 72 a , and the second cut - valve downstream conduit 82 b is in fluid communication with the fourth braking unit 50 d and the second pump 72 b . there are also several sensors used to monitor various operating parameters at different locations in each system 16 , 18 . in this embodiment shown in fig1 , there is a position sensor 84 and a temperature sensor 86 for monitoring the position and the temperature of the motor 24 . there are also several pressure sensors , one pressure sensor 88 connected to one of the feed conduits 42 a , another pressure sensor 90 connected to one of the transition conduits 54 b , and two pressure sensors 92 , 94 connected to each corresponding pump 72 a , 72 b . there is also a brake fluid level sensor 96 which is connected to the reservoir 32 , which is used to detecting the level of fluid in the reservoir 32 . additionally , there is also a first parking brake unit 98 a which is attached to the first , or rear left braking unit 50 a , and a second parking brake unit 98 b which is attached to the third , or rear right braking unit 50 c . the parking brake units 98 a , 98 b are controlled by a secondary controller 100 , which is part of the secondary brake system 18 . the secondary controller 100 is in electrical communication with the second vehicle controller 14 , and both the secondary controller 100 and the second vehicle controller 14 are powered by a battery 102 . the primary braking system 16 also includes a primary controller 104 which is in electrical communication with the first vehicle controller 12 , and both the primary controller 104 and first vehicle controller 12 are powered by the battery 20 . in operation , the first vehicle controller 12 receives input to determine when and how the primary brake system 16 should be operated . this input may be received from various devices , such as sensors , a lidar system , gps , or other devices which may be used alone or in combination to determine the environment around the vehicle . these devices may function as a virtual driver 108 , which , based on the surrounding environment ( such as the location and speed of nearby vehicles , local traffic ordinances , speed limits , nearby pedestrians , and nearby signs and traffic signals , and weather conditions ) send signals providing input the vehicle in a similar manner to a human driver , to command the controllers 12 , 14 to operate the primary brake system 16 , or the secondary brake system 18 , respectively . if it is determined one or more of the braking units 50 a , 50 b , 50 c , 50 d needs to be activated , the first vehicle controller 12 sends signals to the primary controller 104 to activate the motor 24 . the motor 24 rotates the shaft 26 to move the piston 28 in the first direction , towards the motor 24 , or a second direction , away from the motor 24 . when the piston 28 is moved in the first direction , fluid is drawn into the cylinder 30 from the return conduit 36 and through the check valve 38 . when the piston 28 is moved in the second direction , fluid is forced into the main feed conduit 40 , and is then distributed throughout the other various conduits 42 a , 42 b , 42 c , 42 d mentioned above , depending on the configuration of the abs valves 44 a , 44 b , 44 c , 44 d , 44 e , 44 f , 44 g , 44 h of the primary brake system 16 . a portion of the fluid flows through the final conduits 52 a , 52 b such that the rear brake units 50 a , 50 c are actuated , and another portion of the fluid flows through the transition conduits 54 a , 54 b into the secondary brake system 18 . when the primary brake system 16 is operating , the secondary brake system 18 is inactive . when the secondary brake system 18 is inactive , the fluid flowing through the transition conduits 54 a , 54 b passes through the master cylinder cut valves 56 a , 56 b , and flows through the cut - valve downstream conduits 82 a , 82 b and to the front right brake unit 50 b and the front left brake unit 50 d to generate a braking force . the piston 28 is moved in either the first direction to decrease braking force or the second direction to increase braking force . if there is a failure anywhere in the primary brake system 16 , the secondary brake system 18 is activated . the failure in the primary brake system 16 may be a result of failure of the actuator 22 , a failure in the first vehicle controller 12 , the primary controller 104 , or some other component in the primary brake system 16 . the second vehicle controller 14 receives the input , and responds by sending commands to the secondary controller 100 . when the secondary brake system 18 is activated , the secondary controller 100 configures the master cylinder cut valves 56 a , 56 b to be in a closed position , preventing fluid from passing back into the transition conduits 54 a , 54 b . each of the reservoirs 66 a , 66 b receive fluid from the reservoir 32 , and the secondary controller 100 controls the motor 74 , to thereby control each of the pumps 72 a , 72 b . each of the low - pressure feed valves 68 a , 68 b controls the flow of fluid from the corresponding reservoirs 66 a , 66 b to each pump 72 a , 72 b , and the excess pressure relief valves 76 a , 76 b relieve pressure in the cut - valve downstream conduits 82 a , 82 b to keep the pressure in the cut - valve downstream conduits 82 a , 82 b below a desired level . another embodiment of the invention is shown in fig2 , with like numbers referring to like elements . in this embodiment , the upstream feed conduit 58 is only in fluid communication with the secondary feed conduit 58 b , and the other secondary feed conduit 58 a is connected to and in fluid communication with the return conduit 36 . another embodiment of the invention is shown in fig3 , with like numbers referring to like elements . in this embodiment , the upstream feed conduit 58 is still connected both the secondary feed conduits 58 a , 58 b , but the upstream feed conduit 58 is connected to the first connector 34 a , and the return conduit 36 is connected to the second connector 34 b . yet another embodiment is shown in fig4 , with like numbers referring to like elements . in this embodiment , the upstream feed conduit 58 is connected to the first connector 34 b , and the upstream feed conduit 58 is connected to and in fluid communication with the secondary feed conduit 58 a and the return conduit 36 . the other secondary feed conduit 58 b is connected to the first connector 34 a . the embodiments shown in fig2 - 4 provide the same functionality as the system 10 shown in fig1 , but demonstrate there are other possible configurations for the upstream feed conduit 58 , secondary feed conduits 58 a , 58 b , and return conduit 36 . although the variations in fig2 - 4 are shown , it is within the scope of the invention that other configurations may be used . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .	1
referring to the various drawing figs ., apparatus for playing the game according to the invention includes one or more game boards 10 , a plurality of game cards 62 , and a plurality of calling cards 74 . the board 10 has a rear face 12 and a front face 14 . the front face 14 has a plurality of openings 16 arranged in a rectangular array in the manner of a bingo game . the board 10 can be placed on any surface for purposes of playing the game , but it preferably will be placed atop a flat playing surface such as a tabletop ( not shown ). the front face 14 is secured to the rear face 12 , typically by fasteners such as screws . the front face 14 and the rear face 12 are spaced from each other so as to define a cavity 18 therebetween . the game board 10 further includes a slot 20 disposed along one edge of the connected front face 14 and rear face 12 . in the preferred embodiment , the game board 10 is rectangular , but it may be shaped differently , if desired . the rear face 12 is generally planar and includes a peripheral lip 22 . the lip 22 extends toward the front face 14 . a pair of movable legs 24 are disposed adjacent the upper corners of the rear face 12 . the rear face 12 includes a pair of compartments 26 to house the legs 24 . the legs 24 may be placed in a first position where the legs 24 are completely disposed within the compartments 26 or in a second position where the legs 24 extend outside the compartments 26 . the first position permits the rear face 12 to lie flat upon the playing surface or for storage , and the second position permits the board 10 to be positioned at an angle to the playing surface for improved viewing by players . in the second position , the legs 24 extend from the rear face 12 generally perpendicularly to the rear face 12 . the front face 14 comprises a frame 28 and a front cover 30 . the front cover 30 has an exterior face 32 as illustrated in fig2 , and an interior face 34 that is illustrated in fig7 . the openings 16 are formed in the front cover 30 . the frame 28 has a first side , shown in fig8 , and a second side shown in fig9 . the frame 28 includes two or more beams 36 that are disposed along opposed edges of the frame 28 . the beams 36 are parallel to each other . the frame 28 further includes one or more interior cross - supports 38 and a pair of peripheral cross - supports 40 . the cross - supports 38 , 40 are parallel to each other and perpendicular to the beams 36 . the cross - supports 38 , 40 are connected at their ends to the beams 36 . the peripheral cross - supports 40 cooperate with the beams 36 to form an outer periphery of the frame 28 . a pair of tracks 42 are disposed along the opposed edges of each interior cross - support 38 . the peripheral cross - supports 40 have an outer edge 44 along the outer periphery of the game board 10 , and an inner edge 46 . a track 42 is disposed along each inner edge 46 . as shown in fig2 , the beams 36 are thicker than the interior cross - supports 38 and peripheral cross - supports 40 . this permits the beams 36 to assist in holding the front cover 30 in place because the front cover 30 is disposed between the beams 36 . the game board 10 includes a plurality of covers 48 that can be positioned to cover or uncover the openings 16 . each cover 48 includes a panel 50 that is substantially planar and generally rectangular . a tab 52 extends outwardly from one edge of the panel 50 . a pair of flanges 54 extend outwardly of the panel 50 on opposed sides of the panel 50 . the flanges 54 generally define an extension of the panel 50 . when viewed from above , the flanges 54 are perpendicular to the tab 52 . an enlarged formation 56 is disposed along the outer edge of each flange 54 . it is expected that the panels 50 will be opaque , and will have dimensions that approximate that of the openings 16 , for example , about 1 . 3 inches by about 3 . 4 inches . preferably , the covers 48 are formed in a molding operation from a colored or dyed plastics material such as clarified polypropylene . the front cover 30 is substantially planar and fits on top of the interior cross - supports 38 and peripheral cross - supports 40 between the beams 36 on the first side of the frame 28 . the front cover 30 includes side edges 58 that extend over the outer edge 44 of the peripheral cross - supports 40 . the side edges 58 extend to meet the lip 22 of the rear face 12 , thereby defining the outer boundaries of the cavity 18 . the interior face 34 of the front cover 30 further includes raised edges 60 ( fig7 ) that border each opening 16 . the raised edges 60 are disposed adjacent the tracks 42 . during assembly of the game board 10 , the front cover 30 is installed so that it rests upon the first side of the frame 28 . the tabs 52 of the covers 48 extend outwardly through the openings 16 . the tracks 42 and the raised edges 60 engage the flanges 54 so as to compress the flanges 54 therebetween . the tracks 42 and the raised edges 60 fit together in a manner that is tight enough to prevent the covers 48 from moving unless force is applied to the tabs 52 by a player . referring to fig4 a and 4b , game cards 62 according to the invention are illustrated . each game card 62 has front and rear sides 64 , 66 and a pair of opposed side edges 68 , each of which includes a pair of notches 70 . each game card 62 has indicia 72 thereon . as will be described in more detail below , the indicia 72 represent answers to pre - determined questions . preferably , each side 64 , 66 includes answers 72 for two games . in use , one or more game cards 62 are inserted through the slot 20 into the cavity 18 . the answers 72 for a selected game are visible through the openings 16 when the covers 48 are retracted . if the game card 62 is shifted slightly within the cavity 18 , answers 72 corresponding to the other game will be visible through the openings 16 . referring to fig5 a and 5b , calling cards 74 according to the invention are illustrated . each calling card 74 has two sides 76 , 78 . indicia 80 in the form of a question is displayed on the side 76 . the question 80 preferably is a “ fill - in - the - blank ” question where a player is asked to complete a sentence . the answers 72 on each game card 62 correspond to and provide answers to the questions 80 displayed on the sides 76 . the other side of each calling card 74 displays information for an activity leader . the information for the activity leader includes the question 80 , the answer 72 to the question 80 , the game number and description of the category ( indicated by the reference numeral 82 ), a clue 84 that rhymes with the answer 72 to the question 80 , and one or more talking points 86 . the talking points 86 are intended to facilitate discussion among the players . the talking points 86 relate to facts about the question 80 and the answer 72 . the game board 10 is provided with a release 90 that locates the game cards 62 in a desired position within the cavity 18 . as illustrated in fig2 and 6 a – 6 c , the release 90 includes a button 92 that extends through an aperture 94 in the rear face 12 . the release 90 additionally includes a holder 96 disposed adjacent the button 92 , and a pair of deformable wings 98 . each wing 98 terminates in a cylindrical end 100 . the ends 100 contact the lip 22 of the rear face 12 , and provide support for the wings 98 to position the holder 96 in a position that engages the game cards 62 . one of the peripheral cross - supports 40 is provided with a pair of notches 104 . the ends 100 move along the lip 22 when the button 92 is pressed . the ends 100 extend through the frame 28 , and the notches 104 provide room for unrestricted movement of the ends 100 . the holder 96 fits into one of the notches 70 and prevents the game card ( s ) 62 from sliding within the cavity 18 . to operate the release 90 and remove a game card 62 ( or move it to another position ), pressure is applied to the button 92 . movement of the button 92 causes the wings 98 to bend , thereby moving the holder 96 in a direction away from the game card 62 and disengaging the notch 70 . after the holder 96 has been disengaged from the notch 70 , the card 62 can be moved . the use of slidable covers 48 is an example of one technique for selectively covering and uncovering the openings 16 . other techniques also may be employed . for example , the cover 48 could be hinged such that the cover 48 could be lifted to uncover the associated opening 16 , or lowered to cover the opening 16 . the cover 48 could be removable . such a removable cover 48 would be sized to fit the opening 16 , and would have a slight interference fit with the openings 16 to hold the cover 48 in place . the removable cover 48 would include a handle or other gripping means for a player to maneuver the cover 48 . magnets also may be used to secure the covers 48 in place . the above - described alternate techniques for covering and uncovering the openings 16 are examples only , and other suitable techniques for selectively covering and uncovering the openings 16 will be apparent to those skilled in the art . it is preferred that the openings 16 will be large enough to print the answers 72 in large font . a font size of 36 or larger is preferred , and a plain font such as a sans - serif style also is preferred . additionally , the tabs 52 are sized so that they may be gripped by persons with difficulties resulting from diminished motor skills or arthritis . the game board 10 typically could have dimensions of approximately 11 . 4 inches by 13 . 2 inches . the answers 72 are arranged on the game card 62 so that when the game board 10 is inclined at an angle of approximately 15 degrees above the playing surface , the answers 72 appear to be centered in the openings 16 . the game board 10 preferably is formed from a sturdy , lightweight plastics material . the front face 14 and the rear face 12 preferably are opaque and may be colored in a neutral color . the covers 48 may be translucent or opaque and preferably will have a color that contrasts with the color of the front face 14 and rear face 12 to aid players in locating the covers 48 . most color schemes are suitable for the front face 14 , the rear face 12 , and the covers 48 ; however , it is preferred that the color scheme does not include fluorescent colors or colors that contrast in a vivid manner . in one preferred embodiment , the front face 14 and the rear face 12 are ivory , and the covers 48 are purple . the game cards 62 and the calling cards 74 preferably are formed from a non - glare cardstock . the memory engagement game according to the invention may be played in assisted - living adult day care , long - term care , or similar settings . for use in such settings , a game kit preferably includes 15 game boards 10 , a plurality of double - sided game cards 62 for each game board 10 , a plurality of double - sided calling cards 74 ( for example , 15 for each game ), and an instruction manual . each game board 10 has a plurality of openings 16 ( preferably nine ), and each game card 62 has a plurality of answers 72 ( preferably 15 ) on each side 64 , 66 , wherein each game card 62 may be used for a plurality of games , preferably four . the game kit thus provides game boards , game cards 62 , and calling cards 74 for 15 players . because the game boards 10 are stand - alone units , there is no limitation on the arrangement of players relative to each other . before play begins , each player is provided with a game board 10 and one or more game cards 62 . each side of each game card 62 has displayed thereon the answers 72 for a plurality of games . with reference to the game card 62 illustrated in fig4 a and 4b , each of the two sides 64 , 66 of each game card 62 has a plurality of answers 72 printed thereon . the answers 72 preferably are printed so that the printing for each game contrasts with the printing for the other game or games . for example , a game card 62 could display answers 72 for “ game 5 ” in white print on a black background , and for “ game 6 ,” the answers 72 could be displayed in contrasting black print on a white background . the answers 72 are spaced on the game card 62 so that only the answers 72 for a particular game show through the openings 16 . for example , when the game card 62 is inserted entirely into the cavity 18 , the answers 72 to “ game 6 ” may be viewed through the openings 16 . when the button 92 is pressed and the game card 62 is moved slightly outwardly from the cavity 18 , the answers 72 to “ game 5 ” may be viewed through the openings 16 . each game relates to a particular category 82 . typical game categories 82 include historical events , presidents , nursery rhymes , and so forth . each game has a set of game cards 62 and corresponding calling cards 74 . if desired , some game cards 62 can contain identical answers 72 . in that case , the game will be non - competitive because each of the players will answer the same questions at the same time . it also is possible for the game cards to have different combinations of answers 72 . in such a circumstance , the game will be somewhat competitive . for a game having nine answers 72 printed on each game card 62 , there preferably are 15 calling cards 74 associated with that game . to begin play , each player inserts the game card 62 for a selected game into the game board 10 . a game leader then reads a question 80 from one of the calling cards 74 that corresponds to that game . if a player determines the answer 72 , the player covers the opening 16 in which the answer 72 is displayed . if the players are unable to determine the answer 72 , the leader may read a clue 84 displayed on the calling card 74 to assist players in answering the question 80 . the leader also may bring up some talking points 86 listed on the calling card 74 to promote discussion among the players . the process of reading questions 80 and covering answers 72 continues until one or more of the players covers all of the openings 16 and indicates to the leader that all of the openings 16 are covered . when a player covers all of the openings 16 , it signifies the end of that particular game . the covering of all of the openings 16 thus represents an inherent object to be accomplished by the players . the game card 62 may be moved within the cavity 18 or turned over to reveal the answers 72 that correspond to another game , and the process may be recommenced with a different set of calling cards 74 . to accommodate players having different levels of cognitive functioning , or to speed up play , the play of the game may be modified . for example , play may begin with several of the openings 16 covered . it is possible to provide more difficult questions 80 for higher - functioning players , and simpler questions 80 for players with low - to - mid levels of functioning . the talking points 86 provided on each calling card 74 can be of further therapeutic benefit to players &# 39 ; memory abilities and may be used to extend the game . if it is desired to shorten the game , all or some of the talking points 86 may be omitted . as will be appreciated from the foregoing description , the game according to the invention is non - competitive or largely non - competitive , can be played by individuals or a group of players , permits players to be arranged in any desired position relative to each other , and does not involve the disclosure of personal information . the game can be played by persons of different cognitive levels or needs . the game is interesting and entertaining to play and has an inherent object to be accomplished . although the invention has been shown and described with respect to certain preferred embodiments , equivalent alterations and modifications to the embodiments may be apparent to others skilled in the art upon the reading and understanding of this specification . the present invention is limited only by the scope of the following claims , and includes all such alterations , modifications , and equivalents .	0
the use of miniature and embedded electronics has become more and more prevalent . however , in certain applications , their use is limited , or not possible . for example , any environment in which the electronics must be subjected to radiation will corrupt or destroy the physical device , or may alter the state of the device . therefore , devices that are gamma or beta irradiated , such as pharmaceutical components , or subject to x - rays , such as devices that pass through airport security systems , currently cannot easily utilize electronic circuits . thus , products used in these environments must find alternative solutions . for example , in some cases , the electronics are eliminated and a simple barcode is affixed to the device , and a database is used to store and retrieve the pertinent information associated with that barcode . in other words , the memory element of the tag is literally removed and kept elsewhere . while this allows the data associated with the device to be saved and retrieved , it requires computer access and a remote database for storage . this solution is further complicated when the device manufacturer and the device user both want to access and update the associated information . such an arrangement requires joint access to the database , which may be difficult or impossible due to the need for confidentiality and data protection . a second solution involves affixing the embedded electronics at a point in the process after the irradiation of the device . for example , pharmaceutical components are often subjected to gamma or beta radiation . application of the electronic devices after this step can bypass the memory corruption and circuit malfunction issues described above . however , data associated with that component which was created before the radiation step must be somehow saved and associated with the appropriate component , so that the later affixed electronics contains all of the required information . additionally , the electronic device must itself undergo some sterilization process before it can be affixed to the pharmaceutical device . a third solution is to prohibit the use of radiation with the device . thus , users must find an alternate approach to achieve the results sought by irradiating the device ( such as high temperature steam sterilization ). however , sterilization , such as by autoclave , requires temperatures typically in excess of 145 ° c . military grade integrated circuits , which are more costly than standard commercial grade equivalents , are typically only rated to 125 ° c . thus , steam sterilization also potentially can damage the electronics . obviously , none of these solutions is optimal . at the root of the problem is the inability for a traditional semiconductor device to withstand sterilization , such as by gamma or beta radiation or steam sterilization . this is a very well known problem , and affects all types of cmos semiconductor devices , including transistors , memory circuits , amplifiers , power conversion circuits , and analog / digital and digital / analog converters . fig1 shows the typical structure for a cmos device . the n channel mosfet 100 comprises a n - type source 101 separated from an n - type drain 102 . the gate 103 is located between these two n - type regions . the substrate 104 around the mosfet is p - type . the p channel mosfet 110 comprises a p - type source 111 separated from a p - type drain 112 . the gate 113 is located between these two p - type regions . the substrate around the mosfet is n - type moat or well 114 . when exposed to radiation , these cmos devices typically fail in such a way that both the nmos transistor 100 and its complementary pmos transistor 110 both turn on , effectively creating a scr 200 ( silicone controlled rectifier ) or thyristor . these devices are essentially n — p — n — p devices , which , once turned on , can only be turned off by the removal of power from the device . typically , the scr is created between the p - drain 112 , n - moat 114 , p - substrate 104 and n - drain 102 of the adjacent transistor , as shown in fig2 . thus , the activation of this scr creating a short circuit between the power rails of the cmos device , which persists until the power is removed from the device . although this problem most often occurs between power rails , other short circuits within the device are also possible . failure to mitigate this failure can lead to permanent damage . other semiconductor fabrication techniques are known to exist . one such technique is known as silicon - on - insulator ( or soi ). soi fabrication has been in use for about 10 years . companies , such as honeywell and cissoid , have commercialized circuit components necessary to assemble wireless communication devices as well as basic sensor circuits and amplifiers . typically , integrated circuits made using soi techniques are resistant to junction temperatures up to 225 ° c ., well in excess of current military standards available for traditional cmos devices . for example , traditional integrated circuits are typically specified for two maximum temperatures ; operational and storage . most standard integrated circuits have a maximum storage temperature of 150 ° c ., and a maximum operating temperature of 125 ° c . in contrast , soi based integrated circuits are commonly rated at 225 ° c . operating temperature . in contrast to traditional semiconductors , insulating material 300 , such as silicon dioxide ( sio 2 ), aluminum oxide ( al 2 o 3 ) or other suitable materials , separates the various transistors from one another and from the bulk substrate 330 . fig3 shows a cross - section of a typical soi device . note that the presence of the insulating material 300 between the transistors 310 , 320 prohibits the formation of the scr device described above , thereby mitigating the possibility of latch - up in these devices . in addition , the insulating material isolates the transistors 310 , 320 from the doped substrate 330 . as stated above , pharmaceutical devices need to be sterilized . the most common forms of sterilization include gamma or beta radiation , and high temperature steam sterilization , both of which are impossible with traditional semiconductor devices . currently , the pharmaceutical industry is pursuing the use of disposable components . typically , these parts are manufactured by the pharmaceutical company and then shipped to the customer . often , the customer assembles these disposable components into a complete system , which they may then sterilize before use . such disposable systems include the mobius ® line of products manufactured by millipore corporation . many of these disposable products benefit because of the advantages listed above . for example , through the addition of embedded electronics . for example , rfid tags can be read and rewritten by the manufacturer and / or customer to allow improved inventory processes . based on this , it is possible to develop a sophisticated pharmaceutical asset management system . in one embodiment , the pharmaceutical components , such as filtration devices , hoses and the like , have a remotely readable tag affixed to them , such as an rfid tag . this tag contains device specific information , such as , but not limited to device specific information ( such as serial number , date of manufacture , etc . ), device specifications ( such as upper and lower pressure limits ), and device test parameters . customers could use this information in a variety of ways . for example , an automated instrument setup and calibration procedure can be established . by using an rfid or equivalent reader , the customer could determine calibration values , upper and lower limits , units of measure and / or the data exchange protocol . this semiconductor technique can also be used to create other embedded electronic components that can withstand sterilization , such as pressure , temperature and concentration sensors . it is desirable to use sensors to measure fluid conditions , such as temperature , pressure and flow rate . it is also desirable to measure fluid components , such as by using a chemical or concentration sensor . the use of some of these types of sensors is described in u . s . patent application ser . nos . 11 / 402 , 737 , 11 / 402 , 437 , and 11 / 402 , 438 , the disclosure of each is hereby incorporated by reference . in these cases , information obtained by the sensors can be stored in embedded memory and read by the customer at a later time . alternatively , the sensor data can be transmitted wirelessly to a remote transmitter or receiver . sensors 400 are typically made up of a number of subcomponents , as shown in fig4 . there is a sensor head 410 , which is the portion of the sensor that converts the physical characteristic , such as pressure or temperature , to an electrical signal . this signal can be a voltage , a current , a resistance , or any other electrical quantity . the sensor body is typically made up of a number of subcomponents , such as a signal processing unit 420 , an analog to digital converter 430 , a transmitter 440 and a power circuit 450 . the output from the sensor head may be passed to a signal processing unit 420 . this unit 420 may perform a number of different functions . for example , this unit 420 may scale the incoming signal to change the input range into a different output range . for example , an incoming signal may be in the range of 0 - 100 mv , whereas the desired output is between 100 mv and 1v . the signal processing unit 420 would translate and scale the incoming voltage to achieve the desired output range . alternatively , the signal processing unit 420 may add compensation for thermal drift or other variables . for example , a pressure sensor may experience an offset based on the ambient temperature . the signal processing unit 420 can compensate for such an error . in addition , the signal processing unit 420 may adjust the received signal based on known process variation . for example , devices may vary for each production lot . this variation may be determined by a tester , which then records the required compensation value in the signal processing unit 420 . this value may be added to the output , or may be a scaling factor . additionally , the signal processing unit 420 may include means for calibration . in this case , the signal processing unit 420 may include means to test the process variation and thermal drift . it then performs a calibration test to determine these factors and uses them to appropriately adjust the received electrical signal . a third subcomponent of a sensor may be an analog to digital converter 430 . typically , the sensor head 410 produces an analog output , as a voltage , current or resistance . this output may need to be converted to a digital value . this is typically accomplished through the use of an analog to digital converter 430 . this analog to digital converter 430 may receive the output of the signal processing unit 420 . alternatively , it may receive the output of the sensor head 410 and supply a digital value to the signal processing unit 420 . in a third embodiment , the analog to digital converter 430 is located within the signal processing unit 420 and converts the signal after unit has been partially processing by the signal processing unit 420 . a fourth subcomponent is a transmitter 440 . in some embodiments , the transmitter 440 is simply a wire , which connects the sensor components to an external reader . in other embodiments , the transmitter 440 may be wireless . a wireless transmitter may utilize any protocol , and the disclosure is not limited to any particular embodiment . for example , protocols such as the zigbee ® protocol , 802 . 15 . 1 , 802 . 15 . 4 , rfid , the bluetooth ® protocol and others , are suitable for this application . a fifth subcomponent of a sensor 400 is the power circuit 450 . this circuit 450 provides the required power to the rest of the sensor 400 . in some embodiments , a battery is used as the energy source . in other embodiments , wireless induction is used to supply energy to the sensor . in addition to supplying energy , the power circuit 450 transforms that energy into the required voltages , typically through the use of rectifiers , zener diodes , capacitors , and other components . in some embodiments , as is described in more detail below , the above described sensor 400 is at least partially made using soi technology . for example , in some embodiments , the entire sensor is made using soi technology . in other embodiments , only certain subcomponents are made using soi technology . for example , in some embodiments , the signal processing unit 420 , which may include integrated circuits , is made using soi technology . in other embodiments , the sensor head 410 is made using soi technology . for example , isfets can be used in the creation of concentration sensors . these isfets utilize drain and source regions analogous to those found in a mosfet . fig5 shows an isfet 500 made using soi technology . like traditional mosfets , the isfet has an n - type drain region 510 and an n - type source region 520 . both regions are located within a p - type substrate 530 , such as silicon . an insulator 540 is then layered on top of the p - type silicon 530 , the source 520 and the drain 510 , leaving only a small area on the source and drain regions for connection to the metal contacts 550 . the metal gate traditionally used for a mosfet is replaced by an electrode 560 spaced apart from the device . the ions in the solution 570 provide the electrical path from the electrode 560 to the device . thus , the concentration of electrons determines the strength of that electrical path , and therefore the amount that the fet is enabled . other examples of a sensor head using soi technology are the use of leds or photodiodes . these leds can be used to detect concentration density when used with fluorescent materials , and can also be made using soi technology . additionally , soi technology is suitable for other devices , including amplifiers , analog - to - digital converters , digital - to - analog converters , digital logic , radio frequency components , power conversion circuitry and memory devices . finally , the ability to utilize a remotely readable asset management tag is beneficial for pharmaceutical consumables , such as filters , bags , tubes and process instruments . currently , the pharmaceutical industry is exploring the use of disposable technology . in this scenario , the customer could configure their required system using at least some disposable components ( such as filters , bags , hoses , etc ). this allows the customer to customize their configuration as necessary and also eliminates the costly cleaning operations that must currently be performed . to improve the efficiency and predictability of using disposable components , rfid tags can be affixed to these components . such tags allow for the wireless automated identification of components , including such information as catalog number , serial number , and date of manufacture . these tags also allow a secure automated method of transferring unit specific specification to the customer as noted above . using the information contained within these tags , a gamp compliant method of transferring unit specific test procedure information to an automated integrity tester can be created . the semiconductor devices described above are beneficial in this application , since these disposable components must be irradiated to insure sterilization . furthermore , in addition to storage and wireless communications that can be provided by rfid tags , other functions are also possible given the use of soi technology . there are various applications where this soi technology would be beneficially employed . currently , there are some disposable pharmaceutical components that employ sensors . due to the issues associated with sterilization described above , many separate the sensor into two connectable portions ; a sensor head and a sensor body , which contains the remaining subcomponents . the sensor head contains a minimal amount of complexity and is typically designed in such a way so as to be able to withstand radiation or high temperature . the sensor body includes the electronics required to control the inputs to the sensor field and to convert the output from the sensor head into a meaningful result . these two components are typically connected via leads , such as wires , and are connected after the sterilization process is completed . the use of soi technology allows for much improved and more convenient implementation of electronics in sterilized pharmaceutical components . for example , in some embodiments , the sensor head is very sensitive and requires individualized calibration to insure proper readings . for example , an analog output from a sensor head may be related to the temperature by a particular equation , wherein the coefficients of that equation are unique to the sensor head . by calibrating the sensor head and storing those values proximate to the sensor head , the sensor head can now be used with a generic sensor body without any additional calibration required . storing these calibration values proximate to the sensor head requires that the storage device be capable of withstanding some type of sterilization process . memories manufactured using the soi technologies can be integrated into the sensor head , allowing calibrated sensors to be employed . in a second embodiment , the sensor head and sensor body are incorporated into a single self - contained component . this self - contained sensor includes the previously described sensor head . as described above , it also includes a power conversion / generation circuit , which generates power for the device , preferably from radiated electromagnetic fields . the sensor also includes the circuitry necessary to convert the analog output from the sensor head into a digital value , the logic required to convert that value to an appropriate computer usable result , and a transmitter to deliver that result , preferably wirelessly to an external device . if all of these components are manufactured using soi , the entire sensor can be sterilized without fear of damage or degradation . as mentioned above , electronic devices using soi technology can withstand gamma or beta radiation . to increase the amount of radiation that the electronic device can withstand , it may be possible to change the orientation of the device during the sterilization process . typically , gamma rays are directed predominantly along one axis . for example , assume that the gamma rays are moving in the z axis . typically , the item to be sterilized , such as a pharmaceutical bag , is placed such that its maximum surface area is positioned perpendicular to the flow of gamma rays . fig6 a shows gamma rays 600 flowing in the z axis . the item to be sterilized 610 and the attached semiconductor device 620 are positioned so as to maximize the surface area impacted by the gamma rays 600 . while this orientation is best for the item to be sterilized 610 , it subjects the semiconductor device 620 to high levels of radiation . to reduce these levels of radiation , the semiconductor device 620 can be oriented such that its cross - section ( as viewed in fig3 ) is perpendicular to the flow of gamma rays ( such as in the xy plane ). stated another way , the maximum surface area of the semiconductor device 620 is oriented so as to be coplanar to the direction of the gamma rays , as shown in fig6 b . in this way , a minimal surface area is susceptible to being impacted by the rays . other orientations are also possible , where the cross - sectional exposure of the electronic device is not at its maximum . however , the item to be sterilized 610 still exposes a large cross - section to the gamma rays 600 . other techniques may also be used to reduce the effect of gamma or beta radiation on these electronic devices . in some embodiments , a soi device may be temporarily disabled or affected by the exposure to radiation . reconditioning , by applying heat or simply allowing time to elapse , may be an effective method to restore the functionality of the device . in one embodiment , after the device is sterilized , it is not used for a predetermined period of time to allow it to recondition itself . in a second embodiment , after the electronic device is sterilized , it is subjected to heat to recondition it . in a further embodiment , a small heater may be installed near the semiconductor device that can be activated after exposure to radiation . fig7 shows an example of such a heater 710 . for example , the heater 710 may consist of a small coil oriented around the semiconductor device 700 . the coil can receive induced electromagnetic waves , which it then converts to current . this current is used to create heat , which is used to recondition the semiconductor device 700 . after exposure to radiation , this heater 710 can be activated , which supplies localized heat to the semiconductor device 700 , allowing it to recondition itself . in addition to the benefit of withstanding sterilization , these semiconductor devices can also operate at high temperature ranges . therefore , it is also possible to have these sensors functional during a high temperature steam sterilization procedure . thus , in situ temperature measurements can be made during sterilization or autoclaving , which allows the operator to verify that the sterilization temperature ranges and profiles conform to required values . in contrast , the actual temperature profile of a hot steam sterilization cycle currently cannot be monitored in situ . in addition to withstanding high temperatures , it is also believed that soi technology is more tolerant of extremely low temperatures , such as much less than − 55 ° c . the ability of a semiconductor material to conduct is proportional to the dopant level and the base energy level , or thermal state . typically semiconductor devices are doped to operate within the common industrial temperatures , − 55 to + 85 c . increasing the temperature of the semiconductor device will increase the ability for the device to conduct or change states . however , at lower temperatures , the energy required to excite the transistor may exceed the maximum input energy and therefore standard devices will not operate reliably below − 55 ° c . soi can more reliably operate at lower temperatures than standard semiconductor devices because less input energy is lost to parasitic leakage to adjacent devices . this feature can also be advantageous exploited by pharmaceutical components . for example , many pharmaceutical products are stored in sub - freezing environments . furthermore , the temperature profile of the drug as it is being frozen is critical to maintaining the proper molecular and crystalline structure . a temperature sensor that is able to operate at these frigid temperatures would allow the operator to monitor the temperature as the product is being frozen to verify that the proper temperature profile was followed . in one embodiment , the temperature sensor records the temperature at fixed intervals and stores these values in an internal memory . at a later time , these stored values can be retrieved by an external device that compares the stored values to acceptable temperature profiles . in another embodiment , the temperature sensor transmits these values to an external device , which monitors the temperature of the product as it is being frozen . the transmission can be by wire or wirelessly as described above . the external device can then insure that a proper temperature profile was followed . this procedure is not possible today . rather , freezers are calibrated and then products frozen in that freezer unit are assumed to have followed the profile exhibited during calibration . therefore , this new approach would allow the operator to insure that each product was subjected to a proper freezing profile , since the temperature versus time data would be attainable for each individual product . similarly , this technique can be used to monitor and verify the thawing process . as the frozen product is thawed , its temperature can be recorded by the temperature sensor , as described above . the thawing continues until the product reaches its desired use temperature . the collected temperature values can then be compared to a proper or acceptable temperature profile to insure the quality of the product . this technique can also be used to calibrate the freezing profile of the freezer itself . for example , a freezer is calibrated using thermocouple wires that are thread into the interior . due to the freezers design with insulation and sealed enclosure , routing the thermocouples to the preferred locations within the interior can be complicated and time consuming . a device that can wireless communicate through the closure or portals of the freezer may be used to allow temperature to be measured with the enclosure . silicon on insulator ( soi ) technology is also believed to be more resistant to magnetic fields , especially alternating magnetic fields . this is believed to be true for several reasons . first , soi transistors can hold their state more effectively and efficiently to reduce the effects of induced currents from the ac field . second , soi transistors have less leakage , therefore they will be less susceptible to draining the transistors in an excited state . such an environment may be encountered in various applications , for example , in the pharmaceutical industry , magnetically levitated mixer heads are often used , such as in the mobius ® mix 100 , 200 and 500 disposable mixer systems available from millipore corporation of billerica , mass . these systems use a magnetic drive on the outside of the mixing container to remotely drive a magnetic impeller within the container in order to mix its contents either as a straight industrial mixer or as a bioreactor . the use of soi technology will allow electronics to be placed in closer proximity to this magnetic field source . perhaps the most interesting application of this technology is in disposable products for the biopharmaceutical or medical industry where one or more of these conditions are used on the same product over its life time . having electronics that are capable of working in any or all of these conditions would be exceedingly useful to the operator . for example , a sample bag used on a disposable bioreactor , can have one or more electronic devices , for example a rfid or other wireless communication and memory storage device . one such system is taught by copending application wo 2009 / 017612 . having electronics of the soi type , one can form the sampler bag and attach a wireless communications and memory device and then gamma or beta sterilize it for shipping , storage and use by the customer . data relating to the lot number , date of manufacture , use restrictions and the like can be safely added before gamma or beta sterilization and read after gamma or beta sterilization . one or more trackable events such as the date of use , the location of use , operator , sample taken etc can be added to the memory by the user as a paperless record keeping system and may interface with its good manufacturing or good laboratory practices systems such as a lims systems . the sample may then be frozen as a retain and the soi based electronics will allow it to be safely stored at those temperatures and thawed at a later date with its memory and stored data intact . similar applications apply to the medical field where blood or other components can be added to gamma or beta sterilized containers and stored at low temperatures until needed . likewise , retains or medical samples such as biopsies could be handled in the same manner and yield the same satisfactory results .	0
hereinafter , one or more embodiments of the present invention will be explained in detail for better understanding . however , the following embodiments are provided herein for illustrative purpose only , and do not limit the scope of the present invention . embodiments of the present invention are provided to one of ordinary skill in the art for the complete understanding of the present invention . reference examples are presented herein to provide a reference example to a corresponding example of the present invention . respective analyses were performed at least 3 times . results obtained therefrom were analyzed by using spss version 18 . 0 manufactured by windows ( spss , chicago , ill .) and expressed as the ± standard deviation . the statistical significance was determined as p & lt ; 0 . 05 . hpecs were isolated from specimens during surgical removal and the cells were cultured . this study was performed after the approval of the institutional review board ( irb ) of busan paik hospital , inje university college of medicine , busan , korea , according to a protocol ( irb no . ; 12128 ) also approved by irb . all participants provided written informed consent after having received a comprehensive explanation of study procedures . fresh pterygium specimens were place in six - well culture plates containing 500 μl dulbecco &# 39 ; s phosphate buffered saline ( dpbs ; gibco , carlsbad , calif . ), and then , the epithelium was separated from the underlying stroma and subsequently cut into several 1 to 2 mm 2 pieces . the cut epithelial tissue was cultured on surfaces of a culture plate coated with collagen ( rat tail collagen type i ; sigma , st . louis , mo .) for three days in dulbecco &# 39 ; s modified eagle &# 39 ; s medium / f12 ( dmem / f12 ; gibco ) medium supplemented with 10 % bovine calf serum ( bcs ; gibco ), 0 . 5 % dimethyl sulfoxide ( dmso ; sigma ), and 1 % antibiotic / antimycotic ( gibco ), and during the culturing time , the cells migrated from the explant to the culture plate . then , the explant was removed , and the medium was exchanged with keratinocyte - serum free medium with 5 % bcs and 1 % antibiotic / antimycotic to further promote epithelial cell growth . when the cells were 60 - 80 % confluent , they were passaged several times with 0 . 25 % trypsin - edta ( gibco ). the cells were then placed in dmem / f12 medium supplemented with 5 % fetal bovine serum ( fbs ; hyclone , logan , utah ), 0 . 5 % dmso , and 1 % antibiotic / antimycotic . the medium was renewed every two to three days . during the passages , the cells were incubated at a temperature of 37 ° c . in an atmosphere of 5 % co 2 . cell outgrowth from the explants was observed within two to three days in the collagen type 1 - coated culture dish . by day 7 , the explants exhibited a morphology typical of epithelial cells . after two weeks in primary culture , trypsin digestion was used for subculture . these subcultured hpecs grew rapidly and were subsequently passaged once weekly , and characteristics of cells were observed by using cells from passages 1 to 4 , as a result , as shown in fig1 , the passaged hpecs were morphologically distinct from passage 3 compared to cells in the primary explants culture . cultured hpecs were stained with pan - ck , ck3 / 2p , vimentin , and ck13 antibodies and then , immunofluorescence microscopy was performed thereon to confirm whether the cultured cells are pterygial epithelial cells . for the identification of the hpecs , the cells were fixed with 3 . 5 % paraformaldehyde , permeabilized with 0 . 1 % triton x - 100 , blocked with 2 % bovine serum albumin ( bsa ; all from sigma ), and incubated for 24 hours at 4 ° c . with the following primary antibodies ; anti - pan - cytokeratin ( pan - ck , 1 : 100 ; santa cruz , calif . ), anti - cytokeratin3 / 2p ( ck3 / 2p ; 1 : 100 ; santa cruz ), anti - vimentin ( 1 : 200 ; santa cruz ), and anti - cytokeratin 13 ( ck13 , 1 : 100 ; santa cruz ). after the incubation , the cells were washed with phosphate buffered saline ( pbs ; gibco ) and then , incubated for 1 hour with fitc - conjugated mouse immunoglobulin g secondary antibody ( 1 : 200 ; santa cruz ). the stained cells were counterstained with 4 ′, 6 - diamidino - 2 - phenylindole ( dapi ; invitrogen , carlsbad , calif .) and then , pterygial epithelial cells were confirmed by using an automatic fish imager ( bx51 , olympus , tokyo , japan ). as a result , as shown in fig2 a , it was confirmed that in all cells from passages , the pan - ck staining of the corneal epithelium was weakly positive , and as shown in fig2 b , ck3 / 2p was also weakly expressed . in particular , in cells from passage 3 , ck3 / 2p decreased . however , as shown in fig2 c , cytoplasmic immunostaining with vimentin was intensely present in all hpecs , but as shown in fig2 d , ck13 , a marker of the conjunctiva epithelium , was negative in all passaged cells . from these results , it was confirmed that passage 2 hpecs were appropriate for injection to nude mice . 6 - week old male athymic nude mice were obtained from taconic farms , inc . ( germantown , n . y . ), and this experiment was conducted in accordance with guidelines for animal experiments approved by inje university college of medicine and the arvo statement for the use of animals in ophthalmic and vision research . to develop pterygial epithelial cells , 1 × 10 4 passage 2 hpecs which were cultured according to example 1 and confirmed according to example 2 were injected into the nasal subconjunctival space in athymic nude mice . the mice were euthanized by injection of zoletil 50 ( 10 mg / kg ; virbac laboratories , carros , france ), and an eye drop of alcaine ( alcon inc ., seoul , korea ) for subconjunctival injection . ecm scaffold was prepared from portcine chondrocytes according to a known method ( jin cz , park sr , choi bh , park kd , min bh ( 2007 ) in vivo cartilage tissue engineering using a cell - derived extracellular matrix ( ecm ) scaffold . artif organs 31 : 183 - 92 ). in detail , first , primary chondrocytes from porcine knee joints were first expanded in a monolayer culture for three weeks and further cultured in a three dimensional ( 3 - d ) pellet for another three weeks . the 3 - d cartilage - like tissue was freeze - dried for 48 hours at − 56 ° c . under 5 mtorr to remove cellular components of , for example , a 3 - d cartilage , thereby producing a porous , sponge type scaffold . confirmation of cdecm effects by comparing lesion sizes of pterygium animal model cornea cdecm dissolved in pbs ( 25 mg / ml , 10 μl ) was injected to the nasal subconjunctival space in the right eye 7 , 10 and 14 days after the injection of pterygial epithelial cells ( hpecs ), and as a control , pbs ( 10 μl ) was injected to the same area of the opposite eye on the same schedule as the left eye . image analysis of the photograph was performed using imagej ® to compare the lesion size , and the results were calculated as the ratio of pterygium to the entire cornea . pterygial lesion in mouse model was confirmed seven days after subconjunctival injection of the hpecs . however , there was no significant difference in the lesion size : as shown in fig3 , the ratio of the lesion area to the entire cornea in the ecm group was 25 . 5 % and that in the control group was 24 . 9 %. on day 10 after hpecs injection , the lesion size was also not significantly different between both groups . however , the lesion area relative to the entire cornea was significantly different between the control group ( 34 . 3 %) and the ecm group ( 26 . 7 %) at day 10 after hpecs injection . on day 17 after epithelial cell injection , the lesion size compared to the entire cornea was increased to 37 . 1 % in the control group , while in the ecm group , the lesion size corresponded to 26 . 3 % of the area of the cornea ( an increase of 11 . 6 % and 1 . 4 % from the baseline , respectively , p & lt ; 0 . 01 ). for histologic examination , the eyes were fixed in 3 . 5 % paraformaldehyde , and embedded in an optimal cutting temperature compound ( oct ; tissue - tek , sakura fine technical co ., ltd ., tokyo , japan ) 17 days after hpec injection , and then , the tissues were frozen with liquid nitrogen . confirmation of cdecm effects by analyzing histological change and immunohistochemistry results of pterygium animal model cornea serial sections ( 8 μm ) were deparaffinized with xylene and stained with hematoxylin and eosin , and tissue sections cut at 6 μm were used for immunohistochemistry analysis . first , the sections were fixed with pre - cooled acetone for 5 minutes , and incubated for 1 hour with the primary antibody solution shown in table 1 . then , the sections were incubated with the secondary antibody ( dako corp , glostrup , denmark ) for 45 minutes . the immunoreactions were visualized with diaminobenzidine ( dab ) chromogen , and the sections were counterstained with mayer &# 39 ; s hematoxylin ( sigma ) for 30 seconds at room temperature . images of the sections were photographed with a virtual microscope ( nanozoomer 2 . 0 rs , hamamatsu , japan ). from the histological examination results , it was confirmed that as shown in fig4 , the pterygium mice control showed a thin overlying epithelium compared with a normal group , epithelial cells extending into the superficial stroma , neo - vessels , and extracellular matrix breakdown . however , in the cdecm group , but these alterations of the histology after hpecs injection were suppressed by cdecm . also , when as shown in fig5 , the corena area was immunostained with antibodies against cluster of differentiation 31 ( cd31 ), pan - ck , ck3 / 2p , and vimentin . the neovascularization marker , cd31 , was overexpressed in the overlying epithelium and subepithelial stromal cells of the pterygium mice control group . however , in the cdecm group , as shown in fig5 a , the expression level of cd31 declined in the subepithelial stromal cells . also , referring to fig5 b and 5c showing immunostaining results of pan - ck and ck3 / 2p , in the subepithelial stromal cells of the cornea of the pterygium control group , immunostaining of pan - ck and ck3 / 2p was intensely present , but in the cdecm group , they were significantly decreased . also , even in fig5 d and 5e showing staining results of vimentin and mucin - 1 , it was confirmed that compared to the control , in the cdecm group , vimentin and mucin - 1 were intensely suppressed in the subepithelial stromal cells of the cornea . according to one or more embodiments of the present invention , human - derived pterygial epithelial cells obtained by culturing human pterygium corneal tissue sections are injected into the nasal subconjunctival space of an animal to easily induce pterygium , which occurs only in humans , in animals , thereby providing an animal model showing characteristics similar to those of human pterygium . by doing so , the animal model can be useful for research on pterygium and screening of pterygium therapeutic agent . in detail , referring to fig5 showing immunochemical staining results of the cornea of a pterygium mouse model into which human - derived pterygial epithelial cells are injected , as shown in fig2 , as in immunofluorescence staining results of cultured hpecs , the cells in the mouse model were positive for pan - ck , ck3 / 2p , and vimentin and negative for ck13 . also , as shown in fig3 to 5 , when one eye of an animal model according to the present invention is treated with cdecm , which is a candidate for a pterygium therapeutic agent , and the other eye is treated with pbs as a control , it was confirmed that the use of the animal model has lead to significant effects in screening of a pterygium therapeutic agent . from these results , it was confirmed that a mouse model having pterygium induced by using hpecs has characteristics similar to those of human pterygium and accordingly , the mouse model is suitable for use in research into pterygium and development of a pterygium therapeutic agent by therapeutic agent screening . it should be understood that the exemplary embodiments described therein should be considered in a descriptive sense only and not for purposes of limitation . descriptions of features or aspects within each embodiment should typically be considered as available for other similar features or aspects in other embodiments . while one or more embodiments of the present invention have been described with reference to the figures , it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims .	0
a number of anti - viral drugs exhibit marked accumulation in hsv infected cells in vitro . the virus induced enzyme thymidine kinase ( tk ) phosphorylates these drugs to the monophosphate , which is converted to the di and the triphosphate by cellular enzymes . this mechanism has been shown to lead to the intracellular accumulation of acyclovir [ furman et al , antimicro . agents chemother ., vol . 20 , pp . 518 - 524 ( 1981 )], 9 -( 2 - hydroxyethyoxymethyl ) guanine ( dhpg ) [ smee et al , biochem . pharmacol ., vol . 34 , pp . 1049 - 1056 ( 1985 )], trifluorothymidine ( tft ) [ fischer et al , mol . pharmacol ., vol . 24 , pp . 90 - 96 ( 1983 ), and others [ price et al , human herpesvirus infections : pathogenesis , diagnosis and treatment , in : lopez et al ( eds .) raven press , new york , n . y ., pp . 227 - 233 ( 1986 )]. the literature contains contradictory data regarding hsv specific concentration of antiviral drugs in hsv infected tissues . price et al human herpesvirus infections : pathogenesis , diagnosis and treatment . in : lopez et al ( eds .) raven press , new york , n . y ., pp . 227 - 233 ( 1986 ); biochem . pharmacol ., vol . 32 , pp . 2455 - 61 ( 1983 )] and saito et al [ science , vol . 217 , pp . 1151 - 1153 ( 1982 ); ann . neurol . vol . 15 , pp , 548 - 558 ( 1984 )] using 14 c labeled 2 &# 39 ; fluoro - 5 - methyl - 1 - β - d - arabinosyluracil ( fmau ) were able to show specific concentration of the drug in the optic nerve and chiasm of rats after intraocular inoculation of hsv - 1 . however , there is also non - specific accumulation of fmau in the choroid plexus and the cells lining the ventricular walls . biron et al [ antimicrob . agents chemother ., vol . 21 , pp . 44 - 50 ( 1982 )] studied 14 c labeled acyclovir , which has been shown to accumulate intracellularly in hsv infected cells in vitro [ furman et al , supra ]. following s . c . injection , acyclovir levels were similar in all hsv infected and uninfected tissues studied , i . e ., liver , kidney , spleen , lung , blood and brain . price et al were also unable to demonstrate any selective accumulation of acyclovir in hsv infected tissues in vivo [ price et al , supra ]. it is difficult to reconcile the lack of accumulation of acyclovir in hsv infected tissues , with the observation herein of high levels of tft in livers from hsv - 2 infected mice , since both compounds are phosphorylated by the hsv tk and do accumulate in tissue culture . recently , smee et al showed that while acyclovir accumulated in the form of phosphorylated intermediates in hsv infected cells , in vitro , it was also rapidly degraded back to acyclovir , and diffused out of the cell smee et al , supra ]. in contrast , dhpg also accumulated in a similar manner , but did not hydrolyze back to the parent compound as readily . thus , even related drugs which utilize the some basic steps in their mechanism of action can behave quite differently biologically . furthermore , i . v . injection of tft via the jugular vein is used herein , which would result in extremely high blood levels initially , with a rapid fall off , as was observed , i . e ., no detectable drug at 2 hours in the blood . when tft was given by i . p . injection , it was impossible to demonstrate accumulation of tft in the liver of hsv infected mice . since biron et al used s . c . injection , and since plasma levels remained reasonably elevated for 2 hours or more after injection , it is possible that the &# 34 ; depot &# 34 ; effect of s . c . injection , together with the propensity of phosphorylated acyclovir to be rapidly hydrolyzed back to the parent compound , was responsible for the lack of accumulation . another difference between the present invention and the system of biron et al is that herein drug levels were measured on day 2 or 3 after infection while their drug studies were carried out on days 4 - 5 after infection . it is very possible that the relationship between drug accumulation and level of infection changes during the course of the infection , and some preliminary observations in this regard are discussed below . the present invention is predicated on the discovery that this phenomenon of accumulation of anti - viral drug metabolites in hsv - infected cells may be utilized to effectively and non - invasively diagnose hsv infections in humans and non - humans . according to the present invention , a non - invasively or externally assayable ligand labelled derivative of the drug is intravenously administered to the patient and , following diffusion into and phosphorylation into non - diffusible derivatives and accumulation thereof in any hsv infected cells and then externally assayed to detect the presence or absence of the accumulation . the ligand may be any conventional assayable ligand which does not render the drug or metabolite thereof toxic or unable to accumulate . for example , tft contains 3 fluorine atoms which comprise approximately 19 % of its molecular weight . since the naturally occurring isotope , 19 f has a nuclear spin of 1 / 2 , sufficient concentrations of tft can be detected by nuclear magnetic resonance spectroscopy . tft concentrates in the tissues of hsv - 2 infected animals thereby rendering the excess accumulation detectable , non - invasively , by 19 f nmr spectroscopy . the method and composition of the invention are suitable for the diagnosis of hsv infection in human or non - human animals . the drug may be admixed with any suitable intravenously administrable carrier . suitable carriers include physiologic saline , isotonic dextrose , isotonic buffers such as sodium hydrogen phosphate ( nah 2 po 4 , na 2 hpo 4 ) with ethyl alcohol , propylene glycol , benzyl alcohol , etc . the drug is compounded with the carrier in unit dosage , i . v ., administrable form in non - toxic amounts which will vary , depending upon the compound employed . it is only necessary to include an amount of compound in the composition which will accumulate in its metabolized form in the hsv - infected cells of the patient in amounts detectable by the assay procedure chosen . again , the amounts will vary , depending upon the assayable ligand utilized and the particular assay method chosen . because tft crosses the blood brain barrier poorly , tft concentrations were measured in the livers of mice with hepatitis due to hsv - 2 infection . for comparison , tft levels were measured in the livers of uninfected mice and mice with carbon tetrachloride ( ccl 4 ) induced hepatitis . hsv - 2 ( 333 strain ) was grown and titered in vero cells as previously described [ rand - t al , j . med . virol ., vol . 20 , pp . 1 - 8 ( 1986 ). the following strains of mice were obtained from the national cancer institute : balb / c , cba / j , a / hen , a / j , p / n , and dba / 2n . preliminary studies showed that the dba / j strain consistently yielded the highest titers in the liver following intraperitoneal injection of the 333 strain of hsv - 2 . all further studies were therefore done with cba / j mice , aged 4 - 6 weeks , weighing 18 - 23 g . carbon tetrachloride was dissolved in olive oil for injection . trifluorothymidine was assayed by high pressure liquid chromatography ( hplc ). 4 - 6 week old , 18 - 23 gm , cba / j mice were injected intraperitoneally ( i . p .) with 1 . 5 ml of hsv - 2 ( 2 - 4 × 10 6 pfu / ml ). in this model , maximal viral titers are present in the liver between days 3 and 5 , and mice generally died from day 4 to 6 from this high inoculum . three days after infection , mice were anesthetized with a 3 : 1 mixture of 100 mg / ml ketamine hcl : 20 mg / ml xylazine at a dose of 0 . 2 ml / kg . the jugular vein was surgically exposed , and mice were injected intravenously with 100 or 160 mg / kg of tft in the appropriate volume of a 20 mg / ml solution in phosphate buffered saline ( pbs ) ph 7 . 4 . mice were sacrificed at 45 minutes , 2 hours , 2 . 5 and 3 . 5 hours after i . v . injection of tft . the livers were immediately excised and frozen at - 70 ° c . until they could be studied . for viral titration and measurement of tft , 1 . 5 ml of phosphate buffered saline ph 7 . 4 was mixed with 1 g of liver and the mixture homogenized ( 10 strokes using a pyrex ten broeck tissue grinder ), followed by sonication × 4 for 30 sec . in a fisher 300 sonic dismembrator at a relative output of 0 55 ; 0 . 8 ml of the liver homogenate was mixed with an equal volume of methanol , vortexed extensively and then centrifuged at 15 , 000 × g for 15 minutes . the supernatant was analyzed by hplc for tft and the results expressed per gram of liver after correction for dilution . prior to sonication , 0 . 5 ml of the liver homogenate was serially diluted in serum free tissue culture media and titrated in triplicate in vero cells as previously described [ rand et al , supra ]. in some experiments the clarified supernatant that had been mixed with methanol as described above was placed in a 5 mm nmr tube and 19 f content measured by nmr spectroscopy . in other experiments the entire liver was excised , and placed in a 12 mm nmr tube and the 19 f directly analyzed by nmr spectroscopy . carbon tetrachloride was selected as a control for hepatitis because previous work suggested that the dose related hepatic toxicity was limited to the liver and did not involve the kidney which might conceivably alter the pharmacokinetics of tft . ccl 4 induces a dose dependent patchy , centrilobular necrosis which is analogous to that induced by hsv infection of the liver . prior to i . p . injection of ccl 4 in olive oil , 0 . 2 ml of blood was collected from each of a group of 5 mice . twenty - four hours after i . p . injection of 0 . 1 ml / kg ccl 4 in olive oil , blood was collected again , and both sets were analyzed for alanine amino transferase ( alt ) and blood urea nitrogen ( bun ). for alt , 2 μl serum was analyzed in duplicate with a technicon ra 1000 and for bun 10 μl duplicate samples were analyzed with a beckman astra 8 . mice were sacrificed by cervical dislocation and the liver and kidney fixed in 10 % formalin , stained with hematoxylin and eosin and examined histologically . 19 f assay was carried out in a nicolet - ge nt - 300 nmr spectrometer , using standard techniques with a simple one - pulse sequence . the field was 7 . 05 tesla ( t ) and the frequency was 282 megahertz . depending upon the volume of the sample available , it was placed : n either a 5 mm or 12 mm diameter tube , which was usually not spun . both whole liver and liver homogenates were placed in 2 ml of a 2 : 1 v / v mixture of d 2 o : methanol which inactivated hsv , permitted field homogeneity to be optimized and provided field - frequency lock for time averaging . a five - second cycle time was used with a tip angle of 60 °. sweep width was 5000 hz and 64k data points were collected . concentration of 19 f in a sample was evaluated by comparing the electronically integrated area of the resonance peak , after application of 10 hz line broadening and fourier transformation of the free induction delays using a 1280 computer , to that of standards containing 10 , 50 , or 100 μg / ml tft instrumental reproducibility of the calculated areas was checked by comparing the integral for the 40 μg / ml standard to that calculated from a scale setting obtained with a 100 μg / ml standard . in the calculation of tft concentration , appropriate allowances were made for the dilution of the sample or for the size of the organ in the sample tube , as well as for the tft extracted from the organ by the surrounding medium . because of the very wide variation in tft levels and their relationship with viral titers above 10 6 pfu / g liver , it could not be assumed that tft levels were normally distributed among hsv infected mice . therefore , data were analyzed by the non - parametric mann - whitney u test . table 1 shows the results of a representative experiment in which tft levels and viral titers were measured in the livers of hsv - 2 infected and uninfected 4 - 6 week old cba / j mice . infected mice had a tft mean ± se of 110 . 1 + 52 . 7 μg / g liver , compared with 14 . 7 + 7 . 7 μg / g liver for uninfected mice , p = 0 . 014 , mann - whitney u . ccl 4 was selected as a control for the effect of non - specific hepatic damage , because data in the literature suggested that it was essentially a pure hepatotoxin , with no effect on renal function . at a dose of 0 . 2 ml / kg in olive oil injected i . p ., overwhelming hepatic necrosis results a day later , with alt levels in blood typically in the range of 20 , 000 - 30 , 000 iu / ml ( see table 2 ). as shown by the bun , there is no significant alternation in renal function . histologically , there is a dose related centrilobular necrosis , which at 0 . 2 ml / kg is massive , but at 0 . 0 ml / kg is more localized and less extensive . preliminary experiments were then carried out to determine the average alt levels of hsv - 2 infected mice on day 3 at the time higher levels of tft were found in the liver . on day 3 following i . p . injection with 4 - 6 × 10 6 pfu hsv - 2 , 4 mice had an alt mean ± sd of 3554 ± 781 iu / ml blood . a dose response curve of ccl 4 hepatitis had shown that between 0 . 015 - 0 . 02 ml / kg ccl 4 would lead to alt levels of 500 - 5000 iu / ml blood . therefore , ccl 4 was used at a dose of 0 . 02 ml / kg . fig1 shows that there was essentially no difference in blood levels of tft at 45 minutes after i . v . injection , and no measurable blood levels of tft at 2 hours among any of the groups . hsv - 2 infected mice had significantly higher levels of tft in their livers at both 2 and 3 . 5 hours after i . v . injection of tft , whether compared with uninfected or ccl 4 treated mice . if tft levels in liver were due to accumulation in hsv infected liver cells , then the higher the hsv titer / g liver , the higher the tft level should be . the relationship between hsv - 2 pfu / g liver and tft concentration / g liver among infected mice is illustrated in 2 separate experiments in fig2 . linear regression showed a correlation coefficient of r = 0 . 72 , p & lt ; 0 . 05 in one experiment ( o &# 39 ; s ) and r = 0 . 99 , p & lt ; 0 . 05 in the second ( &# 39 ; s ). a similar relationship was also observed among infected mice studied at 3 . 5 h after receiving tft as well as those receiving the higher dose of 160 mg / kg tft shown in table 1 . sufficient material was available from 4 mice / group to measure 19 f levels by nmr spectroscopy of the whole liver under conditions as described . the results are shown in table 3 compared with the hsv pfu / g liver where applicable and the tft levels as measured on a small portion of same samples by hplc . by linear regression , the correlation between hplc and nmr was r = 0 . 91 , p & lt ; 0 . 0005 . fig3 shows actual 19 f nmr tracings of a ) the 40 μg / ml standard , b ) liver homogenate from an hsv - 2 infected mouse 3 . 5 hours after i . v . injection of 100 mg / kg tft ; the area under the peak corresponds to 11 μg / g liver c ) liver homogenate from a ccl 4 treated mouse 3 . 5 hours after i . v . injection of 100 mg / kg tft and d ) liver homogenate from an uninfected mouse 3 . 5 hours after i . v . injection of 100 mg / kg tft . as a further specificity control 10 cba mice were infected with murine hepatitis virus ( mhv - a59 ), a coronavirus which does not contain thymidine kinase . as shown in fig4 there was no increased concentration of tft in livers of 10 mhv infected mice 2 h after i . v . injection of tft , compared with the levels found in uninfected mice in the same experiment . in contrast , the 2 hsv - 2 infected mice with titers of 10 6 pfu hsv / g liver , had strikingly elevated levels . significantly higher levels of tft were observed in the livers of hsv - 2 infected mice , as compared with those of either uninfected mice or mice treated with ccl 4 . the effect was repeatedly demonstrated , and correlated with the level of hsv - 2 infection . since blood levels among hsv - 2 infected mice were similar to or even lower than those of uninfected mice or ccl 4 treated mice , it seems unlikely that delayed excretion or otherwise altered pharmacokinetics could account for the higher levels of tft observed in the hsv - 2 infected livers . non - specific accumulation due to hepatic damage seems unlikely as well in view of the results in ccl 4 hepatitis . nuclear magnetic resonance spectroscopy was used herein to measure levels of 19 f . since there is essentially no tissue background level of fluorine , the area under the curve is directly related to a standard and is used to estimate tissue levels of tft . tft levels in the range of 50 - 100 μg / g tissue were readily detected , and even at the 1 : 6 dilution used , required only 10 min acquisition time , albeit at a high field strength of 7 . 05 t . although the highest field strengths used diagnostically in humans are about 2 t , 19 f nmr surface coil technology has sufficient sensitivity in this range of field strength . for example , a biospec system operating at 94 mhz was used to investigate metabolites of 5 - fluorouracil ( 5 fu ), and had a detection limit of 0 . 1 μmol / g in a mouse liver and a mouse tumor with 10 - 20 min acquisition times ( manufacturer &# 39 ; s technical information ). wolf et al reported similar studies of the behavior of 5 fu in human liver , obtaining suitable spectra in 8 min in a field of 1 . 5 t [ wolf et al , in : abstracts of the society of magnetic resonance in medicine , 5th annual meeting , montreal , 1986 .]. one interesting finding was that the higher levels of tft could be found in the livers of hsv - 2 infected mice on day 2 as well as day 3 following hsv - 2 infection . here , the viral titers were quite low ( 10 3 / g liver ) compared with those in mice demonstrating the tft accumulation on day 3 , (≧ 10 6 pfu / g liver ). alt levels in blood in mice 2 days after hsv infection were also much lower , compared with day 3 , and were in the range of 500 iu / ml blood ; but data was only available from a small number of animals . since the hsv induced tk is maximally produced approximately between 7 - 15 hours after infection [ kit et al , symp . quant . biol ., vol . 39 , pp . 703 - 715 ( 1975 ); fong et al , j . virol . vol . 34 , pp . 644 - 649 ( 1980 )] which is before release of infectious virus , it is possible that early in the course of infection in vivo , as virus is spreading rapidly and infecting ever increasing numbers of new cells , higher levels of tk are present relative to the number of infectious virions , resulting in greater uptake of tft per infectious unit . in summary , highly elevated levels of tft were observed in livers of hsv - 2 infected mice compared with either uninfected or ccl 4 treated mice . there was good correlation between tft levels in liver tissue and hsv - 2 titers in the same tissues . neither altered pharmacokinetics , nor non - specific liver damage could account for the observed drug accumulation . nmr spectroscopy has the sensitivity to detect high levels of tft readily , and thus offers a potentially non - invasive method for the diagnosis of visceral hsv infection . table 1______________________________________tft concentration in livers of mice infected with160 mg / kg tft i . v . and sacrificed at 2 hours . infected uninfectedviral titer conc . of tft conc . of tft ( pfu / g liver ) ( μg / g liver ) ( μg / g liver ) ______________________________________1 . 1 × 10 . sup . 7 266 . 6 36 . 52 . 4 × 10 . sup . 6 60 . 2 2 . 51 . 1 × 10 . sup . 6 74 . 6 14 . 33 . 4 × 10 . sup . 3 38 . 9 5 . 6mean * 110 . 1 14 . 7______________________________________ * p = 0 . 014 infected vs . uninfected , mann whitney u , see methods for explanation . table 2______________________________________blood levels of blood urea nitrogen and serumalanine aminotransferase levels in carbontetrachloride and herpes simplex virus - 2treated cba / mice mean ± sd bun * alt . sup .+ treatment mg / dl iu / l______________________________________ccl . sub . 4pre treatment ( n = 5 ). sup . 10 . 4 + 2 . 7 28 . 2 ± 13 . 824 h post treatment 6 . 4 ± 2 . 3 28112 ± 6086 ( n = 5 ). sup . 24 h post treatment . sup . nd . sup . 11 18950 ± 7526 ( n = 12 ). sup .§ 7526hsv - 248 h post infection nd 50072 h post infection nd 3554 ± 781 ( n = 4 ) ______________________________________ * 10 μl serum , bun measured with the beckman astra 8 . sup .+ 2 μl serum , alt measured with the technicon ra 1000 . sup . mean ± sd of the bun and alt prior to ccl . sub . 4 treatment and from the same mice 24 hours later , ccl . sub . 4 used at 0 . 2 ml / kg i . p . . sup .§ mean ± sd of the 12 ccl . sub . 4 treated mice shown in fig1 minutes ( n = 4 ) 2 h ( n = 4 ) and 31 / 2 h ( n = 4 ) after receiving 100 mg / kg tft , ccl . sub . 4 used at 0 . 02 ml / kg . . sup . 11 nd = not done table 3______________________________________tft concentration ( μg / g liver ) measured by hplcand . sup . 19 f nmr 2 hours after intrajugular injectionof 100 mg / kg tft in cba / j micetft μg / g liver viral titer * hplc . sup .+ nmr . sup . ______________________________________hsv - 2 infected # 1 7 . 5 × 10 . sup . 6 152 . 1 90 # 2 6 . 6 × 10 . sup . 6 149 . 1 182 . 5 # 3 6 . 1 × 10 . sup . 6 38 . 9 25 # 4 3 . 6 × 10 . sup . 6 63 . 6 55uninfected # 1 n / a 16 . 0 45 # 2 n / a 3 . 5 0 # 3 n / a 13 . 8 20 # 4 n / a 9 . 9 tr § ccl . sub . 4 hepatitis # 1 n / a & lt ; 1 . 0 tr # 2 n / a & lt ; 1 . 0 tr # 3 n / a & lt ; 1 . 0 0 # 4 n / a & lt ; 1 . 0 0______________________________________ * pfu / g liver . sup .+ correlation coefficient , hplc vs . nmr r = 0 . 91 , p & lt ; 0 . 0005 . . sup . calculated from the area under peak at - 63 ppm ( relative to cfcl . sub . 3 ) § = trace . in fig1 hsv - 2 infected , uninfected and ccl 4 treated 4 - 6 week old cba / j mice were injected via the jugular vein with 100 mg / kg tft , and sacrificed at 45 minutes , 2 hours or 3 . 5 hours later . the figure shows the mean ± se of the tft concentration in blood or liver measured by hplc as described in the methods . most of the experiments were done on day 3 after hsv infection ; day 2 after infection was not systematically studied , and is presented only for comparison . in fig2 the relationship between hsv - 2 titer / g liver and tft concentration / g liver measured by hplc on day 3 after hsv - 2 infection , 2 h ( o &# 39 ; s ) and 2 . 5 h ( &# 39 ; s ) following i . v . administration of tft . two separate experiments are shown . data were analyzed by linear regression . for comparison , tft levels in the livers of the 9 uninfected mice used in these two experiments were pooled and the mean ± sd shown . in fig3 representative 19 f nmr spectra was measured with the nicolet ge nt - 300 nmr spectrometer at a field strength of 7 . 05 t , using a 2 : 1 v / v d 2 o / methanol mixture as a field - frequency lock . a ) 40 μg / ml tft standard , acquisition time ≈ 7 min . b ) hsv - 2 infected mouse , day , 3 3 . 5 h after i . v . administration of 100 mg / kg . liver homogenate prepared as described in the methods . acquisition time was ≈ 28 min , and tft concentration was 11 μg / g liver by nmr c ) ccl 4 treated mouse , 3 . 5 h after i . v . administration of 100 mg / kg tft , liver homogenate , prepared as described in the methods . acquisition time was 1 . 9 hours , which accounts for the low noise level . d ) uninfected mouse 3 . 5 h after i . v . administration of 100 mg / kg tft , liver homogenate prepared as in the methods . acquisition time ≈ 28 min . horizontal line in b represents the cumulative area under the curve . according to the results depicted in fig4 infection of cba / j mice with mhv - a 59 showing levels of tft in the same range as that of uninfected mice . no relationship between mhv titer and tft level was observed . as a positive control , other cba / j mice were infected with hsv - 2 at the same time as those infected with mhv - a 59 and those infected with hsv - 2 in the range of 10 6 pfu / g liver again showed high levels of tft in liver . symbols used : = hsv - 2 ; o = mhv - a 59 ; δ = uninfected .	8
first , deionized water ( 586 . 77 g ) and sodium lauryl sulfate ( 2 . 02 g , from showa co .) are first added into a reaction bottle ( 2000 ml ) and nitrogen gas is inputted therein . additionally , in a plastic beaker ( 1000 ml ), sodium lauryl sulfate ( 1 . 435 g ), deionized water ( 399 . 23 g ), styrene ( 441 . 21 g , from echo co . ), butyl acrylate ( 121 . 04 g , from acros ), methacrylic acid ( 13 . 89 g , from showa ) and dodecyl mercaptan ( 15 . 30 g , from acros ) are admixed to form a monomers - containing solution , and then to be adequately stirred for 10 minutes by a high - speed mixer . subsequently , the monomers - containing solution is taken as 99 . 21 g and added into the aforementioned reaction bottle , followed by the rise in temperature from room temperature to 70 ° c ., and then an initiator ( ammonium sulfate of 8 . 05 g , from showa co .) pre - dissolved in deionized water ( 40 g ) is added therein . meanwhile , the addition of the remaining monomers - containing solution is accomplished at 80 ° c . after 2 hours , and then the reaction is continuously performed for additional 4 hours . after the reaction is accomplished , the reaction solution is cooled to room temperature . finally , the obtained particles are measured to get the following data : 84 nm of size , 14010 g of mw ( molecular weight ), 1987 g of mn ( number - average molecular weight ), 36 . 96 % of solid content , and 55 . 8 ° c . of tg ( glass transition temperature ). the process for preparing a high molecular weight resin emulsion ( surfactant type ) is the same as that described in preparation example 1 - 1 , except that in the preparation example dodecyl mercaptan ( 1 . 5 g , from acros ) and ammonium persulfate ( 1 . 0 g , from showa co .) are used as a chain transfer agent and an initiator , respectively . after the reaction is accomplished , the obtained particles are measured to get the following data : 94 nm of size , 53649 g of mw ( molecular weight ), 14132 g of mn ( number - average molecular weight ), 38 . 96 % of solid content , and 57 . 8 ° c . of tg ( glass transition temperature ). styrene ( 55 . 4 g , from acros co . ), butylacrylate ( 14 . 2 g , from acros co . ), 1 - dodecanethiol ( 1 . 2 g , from aldrich ) and a resin aqueous solution ( 10 %, 160 g , form eastman chemical aq 55s ) are added into a beaker ( 500 ml ) to form a solution , and then to be adequately stirred for 10 minutes by a high - speed mixer . additionally , deionized water ( 141 . 8 g ) and the aforementioned solution ( taken as 23 g ) are added into a four - necked bottle ( 500 ml ) equipped with a refluxing condenser under nitrogen and heated up to 70 ° c . subsequently , an aqueous solution of ammonium persulfate ( 1 . 23 g ) dissolved in deionized water ( 40 g ) is added therein to perform reaction for 30 minutes . subsequently , the temperature is raised to 80 ° c ., and the addition of the remaining aforementioned solution is performed at 80 ° c . by a dosing bump and accomplished after 2 hours , followed by the continuous performance of the reaction for additional 4 hours at 80 ° c . after the reaction is accomplished , the reaction solution is cooled . finally , the obtained particles are measured to get the following data : 98 nm of size , 20 % of solid content , 19000 g of mn ( number - average molecular weight ) and 58 ° c . of tg ( glass transition temperature ). the process for preparing a high molecular weight resin emulsion ( non - surfactant type ) is the same as that described in preparation example 1 - 3 , except that in the preparation example 1 - dodecyl mercaptan ( 0 . 12 g ) and ammonium persulfate ( 0 . 15 g .) are used as a chain transfer agent and an initiator , respectively . after the reaction is accomplished , the obtained particles are measured to get the following data : 110 nm of size , 19 . 8 % of solid content , 55752 g of mw ( molecular weight ), 15112 g of mn ( number - average molecular weight ) and 57 . 8 ° c . of tg ( glass transition temperature ). a pe milling jar ( 250 ml ) is provided and zirconium particles of 1 mm diameter is added therein by an amount equivalent to a half volume of the pe milling jar , followed by the addition of a pigment ( 5 g ), deionized water ( 100 g ), an assistant ( deuchen ® dp - 16 , 0 . 5 g ) and a surfactant ( sanizol b50 , 1 g , from kao co . ), as shown in table 1 . subsequently , a red devil mixer is used for performing dispersion for 4 hours . mill pearls are filtrated out to collect dispersion , and then the obtained particles are measured by a particle size analyzer ( els - 800 , from otsuka ). the results are given in table 1 . a pe milling jar ( 250 ml ) is provided and zirconium particles of 1 mm diameter is added therein by an amount equivalent to a half volume of the pe milling jar , followed by the addition of a pigment ( 5 g ), deionized water ( 100 g ), an assistant ( deuchen ® dp - 16 , 0 . 5 g ) and a resin ( eastman chemical aq 55s , 1 . 5 g ), as shown in table 2 . subsequently , a red devil mixer is used for performing dispersion for 4 hours . mill pearls are filtrated out to collect dispersion , and then the obtained particles are measured by a particle size analyzer ( els - 800 , from otsuka ). the results are given in table 2 . deionized water ( 170 . 5 g ) and ammonium persulfate ( 0 . 83 g ) are added into a four - necked bottle ( 500 ml ) equipped with a refluxing condenser under nitrogen and stirred for 1 minute . subsequently , 2 -( dimethylethylamino ) ethylmethacrylate monomers ( 15 . 9 g , from acros co .) and nitric acid ( 6 . 25 g ) are added into the four - necked bottle and stirred for 3 minutes , followed by the addition of 1 - dodecyl mercaptan ( 1 . 0 g , form aldrich ). the temperature is raised to 90 ° c . and then maintained to perform the reaction for 4 hours at stirring speed of 300 rpm . the resultant solid content is 11 . 7 % and the yield is 95 . 1 %. deionized water ( 170 . 5 g ) and ammonium persulfate ( 0 . 83 g ) are added into a four - necked bottle ( 500 ml ) equipped with a refluxing condenser under nitrogen and stirred for 1 minute . subsequently , 2 -( dimethylethylamino ) ethylmethacrylate monomers ( 15 . 9 g , from acros co .) and nitric acid ( 6 . 25 g ) are added into the four - necked bottle and stirred for 3 minutes , followed by the addition of 1 - dodecyl mercaptan ( 1 . 0 g , form aldrich ). the temperature is raised to 90 ° c . and then maintained to perform the reaction for 1 hour at stirring speed of 300 rpm , followed by the addition of methyl methacrylate ( 40 g , from aldrich ) to perform the reaction for 4 hours . the resultant solid content is 24 . 7 % and the yield is 91 . 5 %. the low molecular weight resin emulsion obtained from preparation example 1 - 3 and the high molecular weight resin emulsion obtained from preparation example 1 - 4 are mixed in a weight ratio of 4 / 1 , and the ph value is adjusted to 8 . the mixed resin emulsion is taken as 26 g and added into a beaker ( 250 ml ), followed by the addition of deionized water ( 50 g ) and then stirring at 800 rpm for 5 minutes at room temperature . subsequently , a wax dispersion ( baker petrolite ® 1417 , 4 . 5 g ) is added therein and stirred for 5 minutes at room temperature , followed by the addition of a black pigment dispersion ( sfbk - 1 , 22 g ) and stirring for 10 minutes at room temperature . next , nitric acid ( 10 %, 2 . 8 g ) and a dispersible coagulant ( 3 g ) are added therein in sequence , and then stirred for 5 minutes . the temperature is raised to a range of 92 ° c . to 95 ° c . to perform the reaction for 5 hours . black toner is obtained by filtration and drying . the results are given in table 3 . the process in the present example is the same as that described in example 1 , except that a blue pigment dispersion ( sfc - 1 ) is used in place of the black pigment dispersion ( sfbk - 1 , 22 g ). the results are given in table 3 . the process in the present example is the same as that described in example 1 , except that a red pigment dispersion ( sfm - 1 ) is used in place of the black pigment dispersion ( sfbk - 1 , 22 g ). the results are given in table 3 . the process in the present example is the same as that described in example 1 , except that a yellow pigment dispersion ( sfy - 1 ), the low molecular weight resin emulsion obtained from preparation example 1 - 1 and the high molecular weight resin emulsion obtained from preparation example 1 - 2 are used in place of the black pigment dispersion ( sfbk - 1 , 22 g ), the low molecular weight resin emulsion obtained from preparation example 1 - 3 and the high molecular weight resin emulsion obtained from preparation example 1 - 4 , respectively . the low molecular weight resin emulsion obtained from preparation example 1 - 3 and the high molecular weight resin emulsion obtained from preparation example 1 - 4 are mixed in a weight ratio of 4 / 1 , and the ph value is adjusted to 8 . the mixed resin emulsion is taken as 26 g and added into a beaker ( 250 ml ), followed by the addition of deionized water ( 50 g ) and then stirring at 800 rpm for 5 minutes at room temperature . subsequently , a wax dispersion ( baker petrolite ® 1417 , 4 . 5 g ) is added therein and stirred for 5 minutes at room temperature , followed by the addition of a black pigment dispersion ( sfbk - 1 , 22 g ) and stirring for 10 minutes at room temperature . next , nitric acid ( 10 %, 2 . 8 g ) and a dissoluble coagulant ( 3 g ) are added therein in sequence , and then stirred for 5 minutes . the temperature is raised to a range of 92 ° c . to 95 ° c . to perform the reaction for 5 hours . black toner is obtained by filtration and drying . the results are given in table 3 . the process in the present example is the same as that described in comparison example 1 , except that a blue pigment dispersion ( sfc - 1 ) is used in place of the black pigment dispersion ( sfbk - 1 , 22 g ). the results are given in table 3 . the low molecular weight resin emulsion obtained from preparation example 1 - 1 and the high molecular weight resin emulsion obtained from preparation example 1 - 2 are mixed in a weight ratio of 4 / 1 , and the ph value is adjusted to 8 . the mixed resin emulsion is taken as 26 g and added into a beaker ( 250 ml ), followed by the addition of deionized water ( 50 g ) and then stirring at 800 rpm for 5 minutes at room temperature . subsequently , a wax dispersion ( baker petrolite ® 1417 , 4 . 5 g ) is added therein and stirred for 5 minutes at room temperature , followed by the addition of a black pigment dispersion ( sbk - 1 , 22 g ) and stirring for 10 minutes at room temperature . next , nitric acid ( 10 %, 2 . 8 g ) and polyaluminum chloride aqueous solution ( 10 %, 15 g ) are added therein in sequence , and then stirred for 5 minutes . the temperature is raised to a range of 92 ° c . to 95 ° c . to perform the reaction for 5 hours . black toner is obtained by filtration and drying . the results are given in table 3 . the process in the present example is the same as that described in comparison example 3 , except that a blue pigment dispersion ( sc - 1 ) is used in place of the black pigment dispersion ( sfbk - 1 , 22 g ). the results are given in table 3 . from the above results , it can be found that the dispersible polymer coagulant can effectively control the size of toner particles to obtain toner particles with improved roughness . although the present invention has been explained in relation to its preferred embodiment , it is to be understood that many other possible modifications and variations can be made without departing from the scope of the invention as hereinafter claimed .	6
as required , a detailed illustrative embodiment of the present invention is disclosed herein . however , techniques , systems and operating structures in accordance with the present invention may be embodied in a wide variety of forms and modes , some of which may be quite different from those in the disclosed embodiment . consequently , the specific structural and functional details disclosed herein are merely representative , yet in that regard , they are deemed to afford the best embodiment for purposes of disclosure and to provide a basis for the claims herein , which define the scope of the present invention . the following presents a detailed description of the preferred embodiment ( as well as some alternative embodiments ) of the present invention . referring to fig1 , there is shown a diagram illustrating the rack structure of a multi - computer management device having a dual - screen user interface according to one embodiment of the present invention . as shown in fig1 , the multi - computer management system 10 includes a rack 11 , an extension mechanism 12 , a user interface operation module 13 , and a multi - computer management device 14 . by way of present embodiment , the multi - computer management device 14 may be a kvm switch . the multi - computer management device 14 is electrically coupled to a plurality of computers and the user interface operation module 13 , such that any one of the plurality of computers can be controlled by the user interface operation module 13 through the multi - computer management device 14 , just as the user interface operation module 13 is directly electrically coupled to and controls any one of the plurality of computers . also as shown in fig1 , the extension mechanism 12 is mounted on rack 11 which has a front end and a back end . the user interface operation module 13 is positioned at the front end and the multi - computer management device 14 is positioned at the back end . the extension mechanism 12 is connected with the user interface operation module 13 and the multi - computer management device 14 to move the user interface operation module 13 and the multi - computer management device 14 back and forth , whereby the user interface operation module 13 and the multi - computer management device 14 can be in and out of the rack 11 . in addition , depending on the need , the extension mechanism 12 may utilize slide rails , telescopic rods and / or other extendable mechanisms , where the sliding members of the slide rails may be arranged horizontally or vertically depending on the needs . the slide rails may also be a two - segment or triple - segment design . referring to fig2 , there is shown a diagram illustrating the extension mechanism of the rack structure shown in fig1 . in fig2 , it is clearly shown that the user interface operation module 13 and the multi - computer management device 14 are laterally moved by the extension mechanism 12 along a direction of movement to the outside of the rack 11 , such that the user interface operation module 13 and the multi - computer management device 14 located at an extended position . nonetheless , depending on the user &# 39 ; s needs , the multi - computer management device 14 of the present invention may also be fixed at the back end of the rack 11 and not connected with the extension mechanism 12 , such that when the user interface operation module 13 is laterally moved by the extension mechanism 12 to the outside of the rack 11 , the multi - computer management device 14 is still fixed on the rack 11 at the back - end without being moved at the same time to outside of the rack 11 , where the user interface operation module 13 can be electrically coupled to the multi - computer management device 14 by flexible wires or cables . referring to fig3 , there is shown a diagram illustrating one position of the user interface operation module 13 at its extended position as shown in fig2 . in fig3 , the user interface operation module 13 is in a flipped open position . more particularly , the user interface operation module 13 includes a display module 131 and a touch control display module 132 . in fig1 , when the user interface operation module 13 is located inside the rack 11 , the display module 131 is flipped down / closed on top of the touch control display module 132 , while in fig3 , the display module 131 is flipped up / open from the touch control display module 132 with an angle of display , which can be adjusted depending on the user &# 39 ; s needs , but normally is not less than 90 degrees and not more than 180 degrees . in addition , display module 131 may be replaced by another touch control display module based on the user &# 39 ; s needs . in the embodiment of the present invention , the rotational axis of the display module 131 and touch control display module 132 are parallel or aligned to each other . the rotation axis is perpendicular to the laterally moving direction and parallel to the front end or back end of the rack . referring to fig4 , there is shown a diagram illustrating another position of the user interface operation module 13 at its extended position as shown in fig2 . in fig4 , there is shown a positioning where the display module 131 is flipped up / open from the touch control display module 132 with an angle of 180 degrees . in particular , after the display module 131 is flipped up / open from the touch control display module 132 with an angle as shown in fig3 , the touch control display module 132 can be further flipped down in an opposite direction away from the display module 131 , such that the display module 131 and the touch control display module 132 are positioned as shown in fig4 . therefore , from fig3 and 4 , it is shown that the angle between the present invention display module 131 and touch control display module 132 can be freely adjusted depending on the user &# 39 ; s needs to accommodate different situations . referring to fig5 a , there is shown a diagram illustrating another embodiment of the present invention user interface operation module 13 . in fig5 a , the multi - computer management system 10 includes rack 11 , a first extension mechanism 121 , a second extension mechanism 122 , multi - computer management device 14 , display module 131 and touch control display module 132 , where the first and second extension mechanisms 121 and 122 are respectively connected to display module 131 and touch control display module 132 separately to move display module 131 and the touch control display module 132 independently back and forth in and out of rack 11 . in addition , the first extension mechanism 121 and the second extension mechanism 122 may be arranged in parallel or perpendicular to each other . referring to fig5 b , 5 c and 5 d , there are illustrated the various positions of the user interface operation module 13 as shown in fig5 a . as shown in fig5 b and 5c , display module 131 can be moved by the first extension mechanism 121 to the outside of the rack 11 , independent of the touch control display module 132 , and then flipped up / open into a working position , whereas shown in fig5 d , the touch control display module 132 may then be moved by the second extension mechanism 122 to the outside of the rack 11 so that it can be used by a user to input instructions , where the touch control display module 132 can also be further flipped down into a position shown in fig4 . referring to fig6 a , there is shown a diagram illustrating one operation mode of the display module 131 and the touch control display module 132 of the user interface operation module 13 . in fig6 a , the user interface operation module 13 is electrically coupled to the multi - computer management device 14 ( not shown ) and the plurality of computers ( not shown ), where the display module 131 receives a first image a of a first computer of the plurality of computers through the multi - computer management device 14 and displays the first image a on its display screen . the display screen of the touch control display module 132 is divided into a first display area 133 and a second display area 134 . the touch control display module 132 is capable of displaying image representing at least one of the plurality computers . it is noted that the image displayed on the touch control display module 132 can be the outputted image such as desktop image of the corresponding computer , or simply a represented icon image . in the present embodiment , the touch control display module 132 receives the first image a of the first computer and a second image b of a second computer of the multiple of computers through the multi - computer management device 14 , and displays the first image a and the second image b in the first display area 133 . the touch control display module 132 also displays a graphical keyboard 611 and a graphical touch panel 612 in the second display area 134 . in addition to the graphical keyboard 611 and graphical touch panels 612 , the touch control display module 132 may also display a graphical touch pad , a graphical control bar , a simulated hand - writing input pad , or any combination thereof . in fig6 a , through the graphical keyboard 611 and / or the graphical touch panel 612 , a user can enter a first external instruction to control the first computer , where the actual operation image of the first computer ( i . e ., the first image a ) is displayed in the first display area 131 . moreover , since the touch control display module 132 simultaneously displays both the first image a and second image b , the user can monitor the second computer while control the first computer , such that the user may switch to the second computer as the operation computer at any time through the multi - computer management device 14 . for example , switching the operation computer to the second computer may be accomplished by inputting a second external instruction , which may be inputted through the graphical keyboard 611 such as defined hot key , and / or the graphical touch panel 612 , or simply by touching the second image b displayed . depending on the user &# 39 ; s needs , the touch control display module 132 may simultaneously display the second image b and a third image c of a third computer of the multiple of computers , a fourth image d of a fourth computer of the multiple of computers , a fifth image e of a fifth computer of the multiple of computers , . . . , or through the switching instruction switch the second image b displayed on the touch control display module 132 to any one of the third image c , the fourth image d , the fifth image e . . . or any combination thereof . referring to fig6 b , there is shown a flow chart illustrating the process of the control operation shown in fig6 a . as shown in fig6 b , when the touch control display module 132 receives an external instruction , first the input position of the external instruction is determined and confirmed ( step 62 ). when the external instruction is recognized to be input from the graphical keyboard 611 ( result 63 ), the external instruction will be converted into the corresponding key codes ( step 631 ). the corresponding key codes are input to the first computer of the plurality of computers through the multi - computer management device 14 , in order to control / operate the first computer ( step 632 ). if the external instruction is recognized to be input from the graphical mouse ( result 64 ), the external instruction will be converted to simulate the corresponding movement of a mouse ( step 641 ). the corresponding movements of the mouse are input to the first computer of the plurality of computers through the multi - computer management device 14 , in order to control / operate the first computer ( step 632 ). in addition , as shown in fig6 b , if the external instruction is recognized as to be input at an image of a computer displayed on the touch control display module 132 ( not the image of the computer currently being controlled displayed on the display module 131 ) ( result 65 ), the multi - computer management device 14 will switch the computer currently being controlled to the computer corresponding to the computer image displayed at the input position , and then display the image of the switched - to computer on the display module 131 . for example , when the input position of an external instruction is recognized and confirmed to be at the second image b , the multi - computer management device 14 will switch the operation computer from the first computer to the second computer , and cause the second image b to be displayed on the display module 131 , to complete the switching action ( step 652 ). still referring to fig6 b , in another practical embodiment , when a user wants to switch operation computer , the user may also input an external instruction through the graphical keyboard 611 or graphical mouse 612 , such that after steps 631 or 641 the external instruction is executed by the multi - computer management device 14 to switch the current operation computer from the first computer to the second computer and cause the second image b to be displayed on the display module 131 , to complete the switching action ( i . e ., to perform the actions of step 652 ). referring to fig7 , there is shown a diagram illustrating another operation mode of the display module 131 and the touch control display module 132 of the user interface operation module 13 . in fig7 , user interface operation module 13 is still electrically coupled to the multi - computer management device 14 ( not shown ) and the plurality of computers ( not shown ). through the multi - computer management device 14 , the display module 131 receives and displays a first image a of a first computer of the plurality of computers , and touch control display module 132 and displays a second icon image b , a third icon image c , a fourth icon image d , a fifth icon image e , and sixth icon image f and a seventh icon image e of the corresponding second , third , fourth , fifth , sixth and seventh computers of the plurality of computers , and the touch control display module 132 further displays a graphical control bar 613 , to control the multi - computer management device 14 . it is noted that the icon image displayed on the touch control display module can be the outputted image such as desktop image from the corresponding computer , or simply a represented pattern or picture image representing the corresponding computer . through the operation mode shown in fig7 , a user can simultaneously monitor the second through the seventh computers , and can touch - select any one of the icon images b , c , d , e , f and g to switch the operation computer to the computer corresponding to the selected icon image and cause the display module 131 to display the image output from the switched - to computer . alternatively , the user may use the graphical control bar 613 to input a switching instruction to switch the operation computer , or replace the second through the seventh images b , c , d , e , f and g to the eighth through the thirteen images h , i , j , k , l and m , in order to monitor the status of the eighth through the thirteen computers , or perform further switching actions . in addition , the graphical control bar 613 may be replaced by a control window if needed . referring to fig6 a and 7 together , the respective operation modes shown in fig6 a and 7 can be freely switched therebetween . for example , a user may first monitor the plurality of computers through the operation mode shown on fig7 , and then switches the operation mode to the one shown in fig6 a , to operate the computer whose corresponding image is shown in the display module 131 . referring to fig8 , there is shown a block diagram illustrating the control module of the present invention multi - computer management device . as shown in fig8 , the control module 80 is electrically coupled with the plurality of computers 81 respectively . the control module 80 includes a microprocessor 801 and multiplexer 802 , 803 and 804 . the multiplexers 802 , 803 and 804 are electrically coupled with microprocessor 801 and the plurality of computers 81 respectively , where multiplexer 802 is used to receive data 805 of the plurality of computers 81 and transmit the data to microprocessor 801 . the multiplexer 802 is also used to receive commands from the microprocessor 801 and transmit the commands to the plurality of computers 81 . in addition , the multiplexers 803 and 804 are electrically coupled to display module 131 and touch control display module 132 respectively , and are used to receive image output 806 and 807 from the plurality of computers 81 and transmit image output 806 and 807 to display module 131 and touch control display module 132 respectively for displaying the images on display module 131 and touch control display module 132 respectively . when a user inputs an external instruction through touch control display module 132 , the external instruction is converted into an input signal 808 and transmitted to the microprocessor 801 to be processed by the microprocessor 801 , such that the microprocessor 801 may execute corresponding actions in accordance with the external instruction represented by the input signal 808 , such as the actions described herein , for example switching the operation computer between the plurality of computers 81 , operating on any one of the plurality of computers 81 , or changing the operation mode , etc . referring to fig9 , there is shown a block diagram illustrating the connection relationship of the present invention multi - computer management device . as shown in fig9 , the multi - computer management device 90 has interfaces 901 and 902 , a processing unit 903 , and display interfaces 904 and 905 , where processing unit 903 is electrically coupled to interfaces 901 and 902 , and display interfaces 904 and 905 respectively . the interfaces 901 and 902 may be ps / 2 , usb , hdmi , hdb , sphd , hpdb , d - sub , dvi , network socket ( e . g . rj - 45 ), or wireless interface , etc . moreover , the interfaces 901 and 902 are electrically coupled to computers 91 and 92 respectively , such that interfaces 901 and 902 can receive images from computers 91 and 92 respectively , and allows the processing unit 903 to control computer 91 and 92 respectively , or any one of them . display interface 904 is electrically coupled to display module 93 to display the image of computer 91 or 92 . touch control display interface 905 is electrically coupled to touch control display module 94 , where the touch control display module 94 displays simulated input interface 941 for receiving external instructions . when a user inputs a first instruction through simulated input interface 941 , the processing unit 903 will receive the first instruction and control computer 91 through the interface 901 , while the user can monitor the execution of the first instruction through the image of the computer 91 displayed on the display module 93 . in addition , a user can input a second instruction through simulated input interface 941 , to cause the multi - computer management device 90 to switch the operation computer from computer 91 to computer 92 . after the switching , display module 93 will be switched to display the image of computer 92 , such that the user may input a third instruction through simulated input interface 941 , to control the computer 92 through the processing unit 903 and interface 902 and further monitor the execution of the third instruction through the image of the computer 92 displayed on the display module 93 . from the above description it can be seen that the prevent invention replaces the conventional fixed keyboard with a simulated input interface displayed on the touch control display module , thereby not only reduces the trouble of stocking fixed keyboards and spaces occupied by the hardware of the multi - computer management equipment , but also increases the displaying area of the user interface operation module so that more computers may be monitored without interfering with the main display ( i . e ., the image displayed by the display module ) and system operation . in addition , the simulated input interface may be switched as needed between multiple display interface modes or simultaneously displayed to provide more suitable or intuitive input methods and present a more user - friendly operation interface . furthermore , new display interface or graphical keys can be freely added to the touch control display module , which makes it easily expandable to perform more advanced functions of multi - computer management devices and reduces complexity in system design . moreover , when the simulated input interface includes a graphical keyboard , the graphical keyboard can be switched between input methods for languages of different countries , so that when the manufacturer ships its products to a different country , it only needs to switch the input method of the graphical keyboard for the languages of that country through software , thereby completely solving the problems of having to stock or assemble keyboards for different languages . although examples of the preferred embodiments of the present invention system and method are shown and described in detail above , the present invention is not limited to the specifics described herein . it will be apparent to those skilled in the art that various modification and variations can be made in the system and method of the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover modifications and variations that come within the scope of the appended claims and their equivalents .	6
a panel of antibodies against cd22 were selected from hybridomas using the following selection criteria : binding to daudi cells , internalisation on daudi cells , binding to peripheral blood mononuclear cells ( pbmc ), internalisation on pbmc , affinity ( greater than 10 − 9 m ), mouse γ1 and production rate . 5 / 44 was selected as the preferred antibody . hybridoma 5 / 44 was generated by conventional hybridoma technology following immunisation of mice with human cd22 protein . rna was prepared from 5 / 44 hybridoma cells using a rneasy kit ( qiagen , crawley , uk ; catalogue no . 74106 ). the rna obtained was reverse transcribed to cdna , as described below . an immunohistochemistry study was undertaken to examine the incidence and distribution of staining using the 5 / 44 anti - cd22 monoclonal antibodies . control anti - cd20 and anti - cd79a antibodies were included in the study to confirm b cell areas of tumours . a total of 50 tumours were studied and these were categorised as follows by using the working formulation and real classification systems : 40 b cell lymphomas were positive for cd22 antigen with the 5 / 44 antibody at 0 . 1 μg / ml and a further 6 became positive when the concentration was increased to 0 . 5 μg / ml . for the remaining 2 b cell tumours that were negative at 0 . 1 μg / ml , there was insufficient tissue remaining to test at the higher concentration . however , parallel testing with another celltech anti - cd22 antibody 6 / 13 , which gave stronger staining than 5 / 44 , resulted in all 48 b cell lymphomas staining positive for cd22 . thus , it is possible to conclude that the cd22 antigen is widely expressed on b cell lymphomas and thus provides a suitable target for immunotherapy in nhl . cdna sequences coding for the variable domains of 5 / 44 heavy and light chains were synthesised using reverse transcriptase to produce single stranded cdna copies of the mrna present in the total rna . this was then used as the template for amplification of the murine v - region sequences using specific oligonucleotide primers by the polymerase chain reaction ( pcr ). cdna was synthesised in a 20 μl reaction volume containing the following reagents : 50 mm tris - hcl ph 8 . 3 , 75 mm kcl , 10 mm dithiothreitol , 3 mm mgcl 2 , 0 . 5 mm each deoxyribonucleoside triphosphate , 20 units rnasin , 75 ng random hexanucleotide primer , 2 μg 5 / 44 rna and 200 units moloney murine leukemia virus reverse transcriptase . after incubation at 42 ° c . for 60 minutes , the reaction was terminated by heating at 95 ° c . for 5 minutes . aliquots of the cdna were subjected to pcr using combinations of primers specific for the heavy and light chains . degenerate primer pools designed to anneal with the conserved sequences of the signal peptide were used as forward primers . these sequences all contain , in order , a restriction site ( v l sfui ; v h hindiii ) starting 7 nucleotides from their 5 ′ ends , the sequence gccgccacc ( seq id no : 50 ), to allow optimal translation of the resulting mrnas , an initiation codon and 20 - 30 nucleotides based on the leader peptide sequences of known mouse antibodies ( kabat et al ., sequences of proteins of immunological interest , 5 th edition , 1991 , u . s . department of health and human services , public health service , national institutes of health ). the 3 ′ primers are designed to span the framework 4 j - c junction of the antibody and contain a restriction site for the enzyme bsiwi to facilitate cloning of the v l pcr fragment . the heavy chain 3 ′ primers are a mixture designed to span the j - c junction of the antibody . the 3 ′ primer includes an apai restriction site to facilitate cloning . the 3 ′ region of the primers contains a mixed sequence based on those found in known mouse antibodies ( kabat et al ., 1991 , supra ). the combinations of primers described above enable the pcr products for v h and v1 to be cloned directly into an appropriate expression vector ( see below ) to produce chimeric ( mouse - human ) heavy and light chains and for these genes to be expressed in mammalian cells to produce chimeric antibodies of the desired isotype . incubations ( 100 μl ) for the pcr were set up as follows . each reaction contained 10 mm tris - hcl ph 8 . 3 , 1 . 5 mm mgcl2 , 50 mm kcl , 0 . 01 % w / v gelatin , 0 . 25 mm each deoxyribonucleoside triphosphate , 10 pmoles 5 ′ primer mix , 10 pmoles 3 ′ primer , 1 μl cdna and 1 unit taq polymerase . reactions were incubated at 95 ° c . for 5 minutes and then cycled through 94 ° c . for 1 minute , 55 ° c . for 1 minute and 72 ° c . for 1 minute . after 30 cycles , aliquots of each reaction were analysed by electrophoresis on an agarose gel . for the heavy chain v - region , an amplified dna product was only obtained when a primer pool annealing within the start of framework i replaced the signal peptide primer pool . the fragments were cloned into dna sequencing vectors . the dna sequence was determined and translated to give a deduced amino acid sequence . this deduced sequence was verified by reference to the n - terminal protein sequence determined experimentally . fig2 and 3 shows the dna / protein sequence of the mature light and heavy chain v - regions of mouse monoclonal 5 / 44 respectively . the murine v - region sequences were then cloned into the expression vectors pmrr10 . 1 and pmrr14 ( fig7 ). these are vectors for the expression of light and heavy chain respectively containing dna encoding constant regions of human kappa light chain and human gamma - 4 heavy chain . the v l region was sub - cloned into the expression vector by restriction digest and ligation from the sequencing vector , using sfui and bsiwi restriction sites , creating plasmid pmrr10 ( 544cl ). the heavy chain dna was amplified by pcr using a 5 ′ primer to introduce a signal peptide , since this was not obtained in the cloning strategy — a mouse heavy chain antibody leader from a different in - house hybridoma ( termed 162 ) was employed . the 5 ′ primer had the following sequence : the reverse primer was identical to that used in the original v h gene cloning . the resultant pcr product was digested with enzymes hindiii and apai , was sub - cloned , and its dna sequence was confirmed , creating plasmid pmrr14 ( 544ch ). transient co - transfection of both expression vectors into cho cells generated chimeric c5 / 44 antibody . this was achieved using the lipofectamine reagent according to the manufacturer &# 39 ; s protocols ( invitrogen : life technology , groningen , the netherlands . catalogue no . 11668 - 027 ). a potential n - linked glycosylation site sequence was observed in cdr - h2 , having the amino acid sequence n - y - t ( fig3 ). sds - page , western blotting and carbohydrate staining of gels of 5 / 44 and its fragments ( including fab ) indicated that this site was indeed glycosylated ( not shown ). in addition , a lysine residue was observed at an exposed position within cdr - h2 , which had the potential to reduce the binding affinity of the antibody by providing an additional site for conjugation with an agent with which the antibody may be conjugated . a pcr strategy was used to introduce amino acid substitutions into the cdr - h2 sequence in an attempt to remove the glycosylation site and / or the reactive lysine , as shown in fig4 . forward primers encoding the mutations n55q , t57a or t57v were used to remove the glycosylation site ( fig4 ) and a fourth forward primer containing the substitution k60r , was generated to remove the reactive lysine residue ( fig4 ). a framework 4 reverse primer was used in each of these pcr amplifications . the pcr products were digested with the enzymes xbai and apai and were inserted into pmrr14 ( 544ch ) ( also cleaved with xbai and apai ) to generate expression plasmids encoding these mutants . the n55q , t57a and t57v mutations ablate the glycosylation site by changing the amino acid sequence away from the consensus n - x - t / s whilst the k60r mutation replaces the potentially reactive lysine with the similarly positively charged residue arginine . the resultant ch variant plasmids were co - transfected with the cl plasmid to generate expressed chimeric antibody variants . the activities of the chimeric genes were evaluated following transient transfection into cho cells . the affinities of chimeric 5 / 44 or its variants , which have had their glycosylation site or their reactive lysine removed , were investigated using bia technology for binding to cd22 - mfc constructs . the results are shown in fig8 . all binding measurements were performed in the biacore ™ 2000 instrument ( pharmacia biosensor ab , uppsala , sweden ). the assay was performed by capture of cd22mfc via the immobilised anti - mouse fc . the antibody was in the soluble phase . samples , standard , and controls ( 50 ul ) were injected over immobilised anti - mouse fc followed by antibody in the soluble phase . after each cycle the surface was regenerated with 50 ul of 40 mm hcl at 30 ul / min . the kinetic analysis was performed using the biaevaluation 3 . 1 software ( pharmacia ). removal of the glycosylation site in construct t57a resulted in a slightly faster on - rate and a significantly slower off - rate compared to the chimeric 5 / 44 , giving an affinity improvement of approximately 5 - fold . the n55q mutation had no effect on affinity . this result was unexpected as it suggests that the removal of the carbohydrate itself apparently has no effect on binding ( as with the n55q change ). the improved affinity was observed only with the t57a change . one possible explanation is that , regardless of the presence of carbohydrate , the threonine at position 57 exerts a negative effect on binding that is removed on conversion of threonine to alanine . the hypothesis that the small size of alanine is important , and that the negative effect of threonine is related to its size , is supported from the result obtained using the t57v mutation : that replacement with valine at position 57 is not beneficial ( results not shown ). removal of the lysine by the k60r mutation had a neutral effect on affinity , i . e . the introduction of arginine removes a potential reactive site without compromising affinity . the mutations for removal of the glycosylation site and for removal of the reactive lysine were therefore both included in the humanisation design . the molecular cloning of genes for the variable regions of the heavy and light chains of the 5 / 44 antibody and their use to produce chimeric ( mouse / human ) 5 / 44 antibodies has been described above . the nucleotide and amino acid sequences of the mouse 5 / 44 v l and v h domains are shown in fig2 and 3 ( seq id nos : 7 and 8 ), respectively . this example describes the cdr - grafting of the 5 / 44 antibody onto human frameworks to reduce potential immunogenicity in humans , according to the method of adair et al ., ( wo91 / 09967 ). protein sequence alignment with consensus sequences from human sub - group i kappa light chain v region indicated 64 % sequence identity . consequently , for constructing the cdr - grafted light chain , the acceptor framework regions chosen corresponded to those of the human vk sub - group i germline o12 , dpk9 sequence . the framework 4 acceptor sequence was derived from the human j - region germline sequence jk1 . a comparison of the amino acid sequences of the framework regions of murine 5 / 44 and the acceptor sequence is given in fig5 and shows that there are 27 differences between the donor and acceptor chains . at each position , an analysis was made of the potential of the murine residue to contribute to antigen binding , either directly or indirectly , through effects on packing or at the v h / v l interface . if a murine residue was considered important and sufficiently different from the human residue in terms of size , polarity or charge , then that murine residue was retained . based on this analysis , two versions of the cdr - grafted light chain , having the sequences given in seq id no : 19 and seq id no : 20 ( fig5 ), were constructed . cdr - grafting of 5 / 44 heavy chain was accomplished using the same strategy as described for the light chain . the v - domain of 5 / 44 heavy chain was found to be homologous to human heavy chains belonging to sub - group i ( 70 % sequence identity ) and therefore the sequence of the human sub - group i germline framework vh1 - 3 , dp7 was used as an acceptor framework . the framework 4 acceptor sequences were derived from human j - region germline sequence jh4 . a comparison of 5 / 44 heavy chain with the framework regions is shown in fig6 where it can be seen that the 5 / 44 heavy chain differs from the acceptor sequence at 22 positions . analysis of the contribution that any of these might make to antigen binding led to 5 versions of the cdr - grafted heavy chains being constructed , having the sequences given in seq id no : 23 , seq id no : 24 , seq id no : 25 , seq id no : 26 and seq id no : 27 ( fig6 ). genes were designed to encode the grafted sequences gh1 and gl1 , and a series of overlapping oligonucleotides were designed and constructed ( fig9 ). a pcr assembly technique was employed to construct the cdr - grafted v - region genes . reaction volumes of 100 ul were set up containing 10 mm tris - hcl ph8 . 3 , 1 . 5 mm mgcl2 , 50 mm kcl , 0 . 001 % gelatin , 0 . 25 mm each deoxyribonucleoside triphosphate , 1 pmole each of the ‘ internal ’ primers ( t1 , t2 , t3 , b1 , b2 , b3 ), 10 pmole each of the ‘ external ’ primers ( f1 , r1 ), and 1 unit of taq polymerase ( amplitaq , applied biosystems , catalogue no . n808 - 0171 ). pcr cycle parameters were 94 ° c . for 1 minute , 55 ° c . for 1 minute and 72 ° c . for 1 minute , for 30 cycles . the reaction products were then run on a 1 . 5 % agarose gel , excised and recovered using qiagen ® spin columns ( qiaquick ® gel extraction kit , cat no . 28706 ). the dna was eluted in a volume of 30 aliquots ( 1 μl ) of the gh1 and gl1 dna were then cloned into the invitrogen topo ® ta cloning vector pcr2 . 1 topo ® ( catalogue no . k4500 - 01 ) according to the manufacturer &# 39 ; s instructions . this non - expression vector served as a cloning intermediate to facilitate sequencing of a large number of clones . dna sequencing using vector - specific primers was used to identify correct clones containing gh1 and gl1 , creating plasmids pcr2 . 1 ( 544gh1 ) and pcr2 . 1 ( 544gl1 ) ( fig1 ). an oligonucleotide cassette replacement method was used to create the humanised grafts gh4 , 5 , 6 and 7 , and gl2 . fig1 shows the design of the oligonucleotide cassettes . to construct each variant , the vector ( pcr2 . 1 ( 544gh1 ) or pcr2 . 1 ( 544gl1 )) was cut with the restriction enzymes shown ( xmai / sacii for the heavy chain , xmai / bsteii for the light chain ). the large vector fragment was gel purified from agarose and was used in ligation with the oligonucleotide cassette . these cassettes are composed of 2 complementary oligonucleotides ( shown in fig1 ), mixed at a concentration of 0 . 5 pmoles / μl in a volume of 200 μl 12 . 5 mm tris - hcl ph 7 . 5 , 2 . 5 mm mgcl 2 , 25 mm nacl , 0 . 25 mm dithioerythritol . annealing was achieved by heating to 95 ° c . for 3 minutes in a waterbath ( volume 500 ml ) then allowing the reaction to slow - cool to room temperature . the annealed oligonucleotide cassette was then diluted ten - fold in water before ligation into the appropriately cut vector . dna sequencing was used to confirm the correct sequence , creating plasmids pcr2 . 1 ( 5 / 44 - gh4 - 7 ) and pcr2 . 1 ( 5 / 44 - gl2 ). the verified grafted sequences were then sub - cloned into the expression vectors pmrr14 ( heavy chain ) and pmr10 . 1 ( light chain ). the vectors encoding grafted variants were co - transfected into cho cells in a variety of combinations , together with the original chimeric antibody chains . binding activity was compared in a competition assay , competing the binding of the original mouse 5 / 44 antibody for binding to ramos cells ( obtained from atcc , a burkitt &# 39 ; s lymphoma lymphoblast human cell line expressing surface cd22 ). this assay was considered the best way to compare grafts in their ability to bind to cell surface cd22 . the results are shown in fig8 . as can be seen , there is very little difference between any of the grafts , all performing more effectively than the chimeric at competing against the murine parent . the introduction of the 3 additional human residues at the end of cdr h2 ( gh6 and gh7 ) does not appear to have affected binding . the graft combination with the least number of murine residues was selected , gl1gh7 . the light chain graft gl1 has 6 donor residues . residues v2 , v4 , l37 and q45 are potentially important packing residues . residue h38 is at the v h / v l interface . residue d60 is a surface residue close to the cdr - l2 and may directly contribute to antigen binding . of these residues , v2 , l37 , q45 and d60 are found in germline sequences of human kappa genes from other sub - groups . the heavy chain graft gh7 has 4 donor framework residues ( residue r28 is considered to be part of cdr - h1 under the structural definition used in cdr - grafting ( se adair et al ( 1991 wo91 / 09967 )). residues e1 and a71 are surface residues close to the cdr &# 39 ; s . residue 148 is a potential packing residue . residue t93 is present at the v h / v l interface . of these residues , e1 and a71 are found in other germline genes of human sub - group i . residue 148 is found in human germline sub - group 4 , and t73 is found in human germline sub - group 3 . the full dna and protein sequence of both the light chain and heavy chain , including approximate position of introns within the constant region genes provided by the vectors , are shown in fig1 and are given in seq id no : 29 and seq id no : 28 respectively for the light chain and seq id no : 31 and seq id no : 30 respectively for the heavy chain . dna encoding these light and heavy chain genes was excised from these vectors . heavy chain dna was digested at the 5 ′ hindiii site , then was treated with the klenow fragment of e . coli dna polymerase i to create a 5 ′ blunt end . cleavage at the 3 ′ ecori site resulted in the heavy chain fragment which was purified from agarose gels . in the same way , a light chain fragment was produced , blunted at the 5 ′ sfui site and with a 3 ′ ecori site . both fragments were cloned into dhfr based expression vectors and used to generate stable cell lines in cho cells . all references and patents cited herein are hereby incorporated by reference in their entireties .	0
one embodiment of a method for controlling an air - fuel ratio for use in an internal combustion engine according to the present invention will be explained with reference to the drawings . the model calculation formulas described in the aforementioned u . s . pat . no . 4 , 388 , 906 are the model calculation formulas ( 1 ) and ( 2 ) mentioned above . by dividing both sides of the model calculation formulas ( 1 ) and ( 2 ) by the supply fuel amount ( gf ) o = q a /( a / f ) o used during the normal operation of the internal combustion engine , the numerical calculation formula ( 3 ), which is related to the fuel adhesion time β f ( n ), indicated by a control step 1 of a flow - chart shown in fig1 is obtained . further , the numerical calculation formula ( 4 ) related to the transitional correction coefficient k f is indicated by a control step 4 of a flow - chart shown in fig1 . going into more detail with respect to the manner of obtaining the above mentioned numerical calculation formulas ( 3 ) and ( 4 ), the fuel supply amount q a /( a / f ) during the normal or steady state operation of the internal combustion engine is expressed as ( g f ) o . by dividing both sides of the above mentioned model calculation formulas ( 1 ) and ( 2 ) by the fuel supply amount ( g f ) o , the model calculation formula ( 1 ) is converted , so that g f /( g f ) o is expressed as k f ( transitional correction coefficient ) and the fuel adhesion amount m f /( g f ) o is expressed as β f , and thereby the above mentioned numerical calculation formulas ( 3 ) and ( 4 ) are obtained , respectively . the rate x of adhesion of fuel to the inner wall surface portion of the intake air flow passage is determined mainly in accordance with the opening degree θ th of the throttle valve and the engine temperature t w . the fuel adhesion rate x has a characteristic as shown in fig3 . the evaporation time constant τ of the fuel which adheres to the inner wall surface portion of the intake air flow passage is determined mainly in accordance with the opening degree θ th of the throttle valve and the engine temperature t w . the evaporation time constant τ has a characteristic as shown in fig4 . namely , from the consideration of the qualitative values , the larger the engine temperature t w is low , the greater will be both the value of the adhesion rate x and the value of the evaporation time constant τ . also , the larger the value of the opening degree ι th of the throttle valve is , the greater will be the value of the adhesion rate x and the value of the evaporation time constant τ . in place of the above stated opening degree ι th of the throttle valve , the fuel adhesion rate x and the evaporation time constant τ may be determined by using an intake air flow amount q a , an intake pipe pressure , or a basic fuel injection pulse width t p . namely , a physical amount corresponding to the load on the internal combustion engine may be used therefor . the calculations shown in fig1 performed repeatedly at every predetermined calculation cycle δt . in a control step 1 shown in fig1 using the opening degree θ th of the throttle valve and the engine temperature t w , the fuel adhesion rate x and the evaporation time constant τ are determined in accordance with the characteristic shown in fig3 and the characteristic shown in fig4 respectively , and the fuel adhesion time β f is calculated therefrom . in a control step 2 shown in fig1 it is judged whether or not there is a fuel cut period . in case of a yes result , since the fuel supply is stopped , then in a control step 3 shown in fig1 the transitional correction coefficient k f is made at zero ( k f = 0 ) and the control step 3 is returned to the control step 1 . the stopping of the fuel supply i . e . a fuel cut is carried out in such a case where an automobile vehicle is operated under a deceleration operation , the vehicle speed of the automobile becomes abnormally high , or the engine speed n of the automobile vehicle becomes abnormally high etc . in case of during a non - fuel cut period or in case of a no result the control step 2 , since the fuel is supplied normally into the combustion chamber of the internal combustion engine , in a control step 4 shown in fig1 the transitional correction coefficient k f is calculated in accordance with the above stated calculation formula ( 4 ); and after the control step 4 the operation is returned to the control step 1 . fig2 is a flow - chart showing the calculation processing for calculating the fuel injection pulse width t i . the fuel injection pulse width t i is set at every predetermined cycle . in a control step 10 shown in fig2 each of the intake air flow amount q a , the opening degree θ th of the throttle valve , the engine speed n , and the engine temperature t w is detected . in a control step 11 shown in fig2 the engine temperature correction coefficient k w is read out of memory in accordance with a map shown in the control step 11 . in a control step 12 shown in fig2 the basic fuel injection pulse width t p is calculated in accordance with the calculation formula t p = k f · q a / n . in a control step 13 shown in fig2 the calculation processing shown in fig1 is carried out repeatedly , and the fuel injection pulse width t i is determined by using the transitional correction coefficient k f which is renewed or updated successively . in the control step 13 , t b is an electric power source voltage correction coefficient . fig6 is an explanatory diagram showing changes in the value of the above stated transitional correction coefficient k f . the transitional correction coefficient k f changes in accordance with the opening degree θ th of the throttle valve shown in fig5 . during the normal ( stead state ) operation period of the internal combustion engine , the calculation processing using the above stated calculation formula ( 3 ), converges to the following calculation formula ( 5 ). ## equ3 ## therefore , the transitional correction coefficient k f converges to a value of 1 . 0 in accordance with the above stated calculation formula ( 4 ). in case of rapid acceleration from the normal operation period , the rate x of fuel adhesion to the inner surface portion of the intake air flow passage increases rapidly . on the other hand , in case of rapid deceleration from the normal operation period , the rate x of fuel adhesion to the inner surface portion of the intake air flow passage decreases rapidly . accordingly , since the fuel adhesion amount β f converges gradually in accordance with the above stated calculation formula ( 5 ), the value of the transitional correction coefficient k f becomes larger than 1 . 0 during the acceleration operation of the internal combustion engine . on the other hand , the value of the transitional correction coefficient k f becomes smaller than 1 . 0 during the deceleration operation of the internal combustion engine . accordingly , the fluctuation of the air - fuel ratio during the transitional period of the internal combustion engine can be controlled or corrected satisfactorily . also , the fluctuation of the air - fuel ratio during the transitional period of the internal combustion engine can be compensated and a predetermined air - fuel ratio can be maintained . one embodiment of an apparatus for controlling air - fuel ratio for use in an internal combustion engine according to the present invention will be explained in detail as follows with reference to fig8 and fig9 . in fig8 air from an inlet portion 2 of an air cleaner 1 enters into a collector 6 via the hot wire type air flow meter 3 for detecting an intake air flow amount q a , a duct 4 , and a throttle valve body 5 having a throttle valve for controlling the intake air flow amount q a . in the collector 6 , the air is distributed into each intake pipe 8 which communicates directly with the gasoline internal combustion engine 7 and sucked into cylinders of the internal combustion engine 7 . besides , fuel from a fuel tank 9 is pumped and pressurized by a fuel pump 10 , and the fuel is supplied into a fuel supply system which comprises a fuel damper 11 , a fuel filter 12 , the fuel injector 13 , and a fuel pressure control regulator 14 . the fuel is controlled at a predetermined pressure value by the fuel pressure control regulator 14 and is injected into the respective intake pipe 8 through the fuel injector 13 disposed in the intake pipe 8 . further , a signal for detecting the intake air flow amount q a is outputted from the air flow meter 3 . this output signal from the air flow meter 3 is supplied to the electronic control unit 15 . a throttle valve sensor 18 for detecting an opening degree ι th of the throttle valve is installed on the throttle valve body 5 . the throttle valve sensor 18 works as a throttle valve opening degree detecting sensor and also as an idle switch . an output signal from the throttle valve sensor 18 is supplied to the electronic control unit 15 . a cooling water temperature detecting sensor 20 for detecting cooling water temperature of the internal combustion engine 7 is installed on a main body of the internal combustion engine 7 . an output signal from the cooling water temperature detecting sensor 20 is supplied to the electronic control unit 15 . in a distributor 16 , a crank angle detecting sensor is installed therein . the crank angle detecting sensor outputs a signal for use in detecting a fuel injection time , an ignition time , a standard signal , and the engine speed n . an output signal from the crank angle detecting sensor is inputted into the electronic control unit 15 . an ignition coil 17 is connected to the distributor 16 . the electronic control unit 15 comprises an execution apparatus including an mpu , ep - rom , ram , a / d convertor and input circuits as shown in fig9 . in the electronic control unit 15 , a predetermined execution is carried out on the basis of through the output signal from the air flow meter 3 , the output signal from the distributor 16 etc .. the fuel injector 13 is operated by the various output signals obtained by the execution results produced in the electronic control unit 15 , and then the necessary amount fuel is injected into respective intake pipe 8 .	5
efforts have been made throughout the drawings to use the same or similar reference numerals for the same or like components . fig1 is a schematic diagram that shows a conventional cable connection between a pick - and - place machine and an fes . an i / o converter 110 of a pick - and - place machine control system 102 is physically connected by a number of instrument leads 111 to solenoid valves 112 of first stick feeder controls 113 . other leads are connected in the same way to second , third and fourth stick feeder controls 114 , 115 and 116 . the fes has an fes control system 107 , which has an fes feeder stick control asic 117 . the fes is specific to each type of feeder . the fes control system 107 controls the operation of the feeder of the pick - and - place machine and pulls data from the feeder . the amount of data exchanged between the units shown in fig1 is relatively small . the present invention is not , however , so limited and can accommodate the increasing demands for exchange of data between and among parts of smt systems . in the present invention , the flow of data is as follows : from a mounter of the pick - and - place machine the signal is sent to operate an auxiliary , for example , a feeder cart . a multiplexer on the mounter side of a non - physical contact interface encodes the signal and sends it to a transmitter using a non - physical contact means for transmission such as rf or infrared or visible light . the signal is transmitted to the cart via the non - physical contact means . the receiver on the cart sends the signal to a demultiplexer . the demultiplexer decodes the signal and , based on the type of feeder , operates the required valves or solenoids on the feeder to advance the part . the only part of the system that changes with a change in the feeder type is the section after the demultiplexer on the feeder cart . an exemplary embodiment of the present invention using an optical non - physical contact interface is illustrated in fig2 . a pick - and - place machine 201 has a pick - and - place machine control system 202 that is optically coupled with an fes 208 that has an fes control system 207 . the pick - and - place machine control system 202 is typically a complex system using pneumatics , hydraulics , air or electric driven motors , solenoids and similar devices under the control of one or more microprocessors . communication is between a pick - and - place machine optical transmit - receive module 204 and an fes optical transmit - receive module 205 through an optical ( i . e ., non - physical ) contact interface 209 , i . e ., without instrument cable , waveguide or other physical link between the fes 208 and pick - and - place machine 201 . each optical transmit - receive module 204 , 205 has one or more optical sources that function as optical transmitters and one or more optical detectors that function as optical receivers to form an optical ( i . e ., non - physical contact ) coupler with a corresponding optical detector or optical source of the other optical transmit receive module 205 , 204 . an optical source , which may be a light emitting diode (“ led ”) or a laser , is modulated by a stream of digital data to transmit pulses of radiant energy , typically visible or infrared light . the detectors may be any kind of photodetector that is capable of receiving and converting the radiant energy pulses into a stream of digital data . the pick - and - place machine control system 202 and fes control system 207 are connected , respectively , to a pick - and - place machine interface unit 203 and an fes interface unit 206 . a multiplexer in the pick - and - place machine interface unit 203 combines various signals from the pick - and - place machine control system 202 for transmission over a single medium to the optical transmit / receive module 204 . a demultiplexer in the pick - and - place machine interface unit 203 separates multiplexed signals received from the pick - and - place machine optical transmit / receive module 204 to a set of discrete data points that are transmitted to the pick - and - place machine control system 202 . similarly , the fes interface unit 206 has a multiplexer / demultiplexer that combines various signals from the fes control system 207 for transmission over a single medium to the optical transmit / receive module 205 . a demultiplexer in the fes interface unit 206 separates multiplexed signals received from the fes optical transmit / receive module 205 to a set of discrete data points that are transmitted to a processor or directly to relays , solenoid valves or other components of the fes control system 207 . alternatively , a multiplexer / demultiplexer may be a part of the optical transmit / receive module 204 or the transmit / receive module 205 . the fes control system 207 may have a programmable logic controller (“ plc ”), sensors and systems for releasing components to the pick - and - place machine . the fes control system 207 can , however , be much simpler , comprising , for example , only electrical and electromechanical sensors and interlocks , without a plc or other microprocessor based controller . the fes control system 207 may , for example , have a controller to control solenoid valves to allow pulsed air blasts through an air outlet to agitate components in a hopper , thereby allowing one or more components to drop into position for mounting on a pcb . in a second embodiment the pick - and - place machine 201 is interfaced directly with a feeder . a feeder is typically a self - contained electropneumatic mechanical apparatus . the feeder operating cycle may be adjusted by a plc to be compatible with pick - and - place machines supplied by different manufacturers . the timing of the sequence of steps executed by the feeder device , as well as the positioning of the feeder to align the pick - up point with the pick - up arm of the pick - and - place machine , is determined by the plc from data detecting sensors of the feeder control system . the sensed data may , for example , be from optical sensors that detect the arrival of the pick - up arm . the present invention allows the mounting machine side of an interface to transmit and receive a standard set of signals . for example , when a feeder in a given location needs to be advanced , the mounter would simply toggle on the bit for that feeder . if the feeder is a electro - pneumatic type , such as those manufactured and sold by assembléon and yamaha im company , the signal would be received by the cart and a 12v dc signal would be sent to the feeder to activate the air valve . if the feeder were a uic feeder , then the cart would receive the same signal from the mounter and then supply a 24v dc signal to the feeder . finally , the aforementioned discussion is intended to be merely illustrative of the present invention and should not be construed as limiting the appended claims to any particular embodiment or group of embodiments . each of the systems utilized may also be utilized in conjunction with further systems . thus , while the present invention has been described in particular detail with reference to specific exemplary embodiments thereof , it should also be appreciated that numerous modifications and changes may be made thereto without departing from the broader and intended spirit and scope of the invention as set forth in the claims that follow . for example , in addition to feeders , the present invention may be practiced with many other auxiliaries for pick - and - place machines such as devices for bar code verification of part numbers , monitoring equipment and automatic nozzle changing devices . the specification and drawings are accordingly to be regarded in an illustrative manner and are not intended to limit the scope of the appended claims . in light of the foregoing , the disclosure of the present invention , one versed in the art would appreciate that there may be other embodiments and modifications within the scope and spirit of the invention . accordingly , all modifications attainable by one versed in the art from the present disclosure within the scope and spirit of the present invention are to be included as further embodiments of the present invention . the scope of the present invention is to be defined as set forth in the following claims .	8
although specific embodiments of the present invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and merely illustrative of but a small number of the many possible specific embodiments which can represent applications of the principles of the present invention . various changes and modifications obvious to one skilled in the art to which the present invention pertains are deemed to be within the spirit , scope and contemplation of the present invention as further defined in the appended claims . referring to fig1 and 3 , there is shown at 10 the present invention hands - free activated valve apparatus . the apparatus includes a lower sidewall 12 which surrounds an interior hollow chamber 16 into which a liquid 100 can flow . the first embodiment of the present invention apparatus 10 illustrated in fig1 through 3 is a press fit embodiment wherein sidewall 12 can be press fitted onto the opening of a container ( not shown ) by having the interior surface 14 of sidewall 12 press fit onto the exterior opening of a container for housing liquids . alternatively , the interior surface of the sidewall 12 can be press fitted into the opening of the liquid container . by virtue of this press fit onto ( or into ) the container , the liquid 100 which by way of example can be water , juice , protein drink , etc . automatically flows from the container into the hollow chamber 16 . the apparatus 10 further comprises an upper neck portion 20 which comprises a top surface 30 and a neck sidewall 40 . the neck sidewall 40 includes a first upper extension 42 and a spaced apart parallel second upper extension 44 with a space 50 between them . the opposite portion of the neck sidewall 40 includes a first lower extension 46 which is aligned with first upper extension 42 and a spaced apart parallel second lower extension 48 which is aligned with second upper extension 44 . first lower extension 46 and second lower extension 48 are parallel to each other and spaced apart by a space 52 which is the same height and width as space 50 . spaces 50 and 52 are aligned with each other . the neck sidewall 40 surrounds an interior hollow chamber 60 which is longitudinally divided by longitudinal dividing wall 62 which divides interior hollow chamber 60 into a first longitudinal interior chamber 64 and a second longitudinal interior chamber 66 , both of which extend for most of the length of neck portion 20 and both of which are in fluid engagement with hollow chamber 16 . upper neck portion 20 and lower sidewall 12 join at a throat area 70 . the interior sidewall 22 of upper neck portion 20 forms a valve seat 72 at the throat area 70 . top surface 30 of upper neck portion 20 comprises a solid surface 32 through which a first opening 34 extends and is in fluid communication with first longitudinal interior chamber 64 . the top surface 30 also comprises an interior ledge 36 which extends slightly below the surface level so as to create a gap 38 in top surface 30 . longitudinal dividing wall 62 is attached and in the preferred embodiment integrally formed with the interior of top surface 30 , and extends the length of the interior portion of upper neck portion 20 and ends slightly above the valve seat 72 . a key point of novelty of the present invention is an arch shaped resilient member 80 . at its top end , arch shaped resilient portion 80 has a hook member 82 by which it is snap fitted into he gap 38 and held in place against ledge 36 , to thereby retain the arch shaped resilient member 80 within second interior longitudinal chamber 66 . the arch shaped resilient member 80 is prestressed so that its arch portion 84 nearly abuts the interior wall 22 of upper neck portion 20 at the location of the space 50 . sidewall 40 contains a gap 41 at the location of space 50 so that arch shaped portion 84 fills the gap 41 and is accessible from space 50 . arch shaped resilient member 80 terminates in a transverse valve member 86 which is caused to abut against the valve seat 72 to thereby seal off interior hollow chamber 60 from interior hollow chamber 16 . therefore , in its prestressed memory condition , arch shaped resilient member 80 is affixed at one end adjacent top surface 30 and extends the length of upper neck portion 20 so that its transverse valve member 86 abuts against the valve seat 72 and its arch portion 84 is aligned with and abuts against gap 41 in sidewall 40 and is in contact with space 50 . in this initial condition , the liquid 100 in the liquid container and which extends into interior chamber 16 is sealed off from neck interior chamber 60 of neck portion 20 and the assembly is in the closed condition . when a transverse force t is applied to the arch portion 84 in the direction of the arrow shown in fig3 the arch portion 84 is caused to move away from the gap 41 in upper neck sidewall 40 and this in turn causes transverse valve member 86 to move away from the valve seat 72 as illustrated in fig3 thereby opening a passageway 90 between transverse valve member 86 and valve seat 72 so that liquid can flow from chamber 16 through first longitudinal interior chamber 64 and out opening 34 in top surface 30 . for use by a person , space 50 is sized to accommodate the width of at least one human tooth ( preferably a front upper tooth ) and space 52 is sized to accommodate the width of at least one human tooth ( preferably a front lower tooth ). therefore , when a biting action occurs such that opposite upper and lower teeth of a user are inserted into spaces 50 and 52 respectively , the transverse biting action causes arch portion 84 to move away from gap 41 and causes transverse valve member 86 to move away from the valve seat 72 so that liquid can flow from chamber 16 through passageway 90 through first longitudinal interior chamber 64 and out opening 34 so that the liquid can be ingested by the user . the transverse valve member 86 is configured such that when the valve member 86 is caused to move away from the valve seat 72 , no gap is created on the area of the second longitudinal interior chamber 66 so that no liquid can flow in the second longitudinal interior chamber 66 . the arch shaped resilient member 80 has sufficient memory such that when the transverse force “ t ” is removed , the arch portion 84 returns to its location adjacent gap 41 and the transverse valve 86 returns to its initial position against the valve seat 72 to shut off the flow of liquid . therefore , when the bite is completed and the teeth removed from spaces 50 and 52 , the arch shaped resilient member 80 causes the valve to close . illustrated in fig4 and 5 is an alternative embodiment of the present invention . the only difference in this alternative embodiment 110 is the method of attachment to a liquid container . the apparatus 110 includes a lower sidewall 112 which surrounds an interior hollow chamber 116 into which a liquid 100 can flow . the alternative embodiment of the present invention apparatus 110 illustrated in fig4 and 5 is a threaded fit embodiment wherein sidewall 112 contains internal threads 118 so that apparatus 110 can be threaded onto the exterior threads of the liquid container . by way of example , the apparatus 110 can be sized so that the threads 118 fit conventional threads of a soda bottle or water bottle . by virtue of this threaded fit embodiment wherein interior threads 118 of sidewall 12 can be threaded onto container , the liquid 100 which by way of example can be water , juice , protein drink , etc . automatically flows from the container into the hollow chamber 116 . the apparatus further comprises an upper neck portion 120 which comprises a top surface 130 and a neck sidewall 140 . the neck sidewall 140 includes a first upper extension 142 and a spaced apart parallel second upper extension 144 with a space 150 between them . the opposite portion of the neck sidewall 140 includes a first lower extension 146 which is aligned with first upper extension 142 and a spaced apart parallel second lower extension 148 which is aligned with second upper extension 144 . first lower extension 146 and second lower extension 148 are parallel to each other and spaced apart by a space 152 which is the same height and width as space 150 . spaces 150 and 152 are aligned with each other . the neck sidewall 140 surrounds an interior hollow chamber 160 which is longitudinally divided by longitudinal dividing wall 162 which divides interior hollow chamber 160 into a first longitudinal interior chamber 164 and a second longitudinal interior chamber 166 , both of which extend for most of the length of neck portion 120 and both of which are in fluid engagement with hollow chamber 116 . upper neck portion 120 and lower sidewall 112 join at a throat area 170 . the interior sidewall 122 of upper neck portion 120 forms a valve seat 172 at the throat area 170 . top surface 130 of upper neck portion 120 comprises a solid surface 132 through which a first opening 134 extends and is in fluid communication with first longitudinal interior chamber 164 . the top surface 130 also comprises an interior ledge 136 which extends slightly below the surface level so as to create a gap 138 in top surface 130 . longitudinal dividing wall 162 is attached and in the preferred embodiment integrally formed with the interior of top surface 130 , and extends the length of the interior portion of upper neck portion 120 and ends slightly above the valve seat 172 . a key point of novelty of the present invention is an arch shaped resilient member 180 . at its top end , arch shaped resilient member 180 has a hook member 182 by which it is snap fitted into the gap 138 and held in place against ledge 136 , to thereby retain the arch shaped resilient member 180 within second interior longitudinal chamber 166 . the arch shaped resilient member 180 is prestressed so that its arch portion 184 is located adjacent to the interior wall 122 of upper neck portion 120 at the location of the space 150 . sidewall 140 contains a gap 141 at the location of space 150 so that arch shaped portion 184 fills the gap 141 and is accessible from space 150 . arch shaped resilient member 180 terminates in a transverse valve member 186 which is caused to abut against the value seat 172 to thereby seal off interior hollow chamber 160 from interior hollow chamber 116 . therefore , in its prestressed memory condition , arch shaped resilient member 180 is affixed at one end adjacent top surface 130 and extends the length of upper neck portion 120 so that its transverse valve member 186 abuts against the valve seat 172 and its arch portion 184 is aligned with and abuts against gap 141 in sidewall 140 and is in contact with space 150 . in this initial condition , the liquid 100 in the liquid container and which extends into hollow chamber 116 is sealed off from hollow chamber 160 of neck portion 120 and the assembly is in the closed condition . when a transverse force “ t ” is applied to the arch portion 184 in the direction of the arrow shown in fig5 the arch portion 184 is caused to move away from the gap 141 in upper neck sidewall 140 and this in turn causes transverse valve member 186 to move away from the valve seat 172 as illustrated in fig5 thereby opening a passageway 190 between transverse valve member 186 and valve seat 172 so that liquid can flow from chamber 116 through first longitudinal interior chamber 164 and out opening 134 in top surface 130 . the present invention conforms to conventional forms of manufacture or any other conventional way known to one skilled in the art . the apparatus can be made from several materials . by way of example , the apparatus can be made of polypropylene material while the arch shaped resilient member can be made of nylon material . defined in detail , the present invention is a valve apparatus , comprising : ( a ) a lower sidewall which surrounds an interior hollow chamber into which a liquid can flow ; ( b ) means for attaching the lower sidewall to an opening of a liquid container such that liquid can flow from the container into the interior hollow chamber ; ( c ) an upper neck portion having a top surface and a neck sidewall ; ( d ) the neck sidewall including a first upper extension and a spaced apart parallel second upper extension extending parallel to the first upper extension and separated therefrom by a first space ; ( e ) the neck sidewall further including a gap at the location of the first space ; ( f ) the neck sidewall further including a first lower extension opposite the location of the first upper extension , the first lower extension aligned with the first upper extension ; ( g ) the neck sidewall further including a second lower extension opposite the location of the second upper extension , the second lower extension aligned with the second upper extension ; ( h ) the first lower extension and the second lower extension being parallel to each other and separated by a second space ; ( i ) the neck sidewall surrounding an interior hollow chamber which is longitudinally divided by a longitudinal dividing wall extending from the top surface and dividing the interior hollow chamber into a first longitudinal interior chamber and a second longitudinal interior chamber , both chambers being in fluid engagement with the interior hollow chamber surrounded by the lower sidewall ; ( j ) the upper neck portion and the lower sidewall portion joined at a throat area having an interior sidewall which forms a valve seat ; ( k ) the top surface including a solid surface through which a first opening extends and which is in fluid communication with the first longitudinal interior chamber , the top surface also including an interior ledge which extends slightly below the top surface level so as to create a gap in the top surface which is aligned with the second longitudinal interior chamber ; ( l ) the longitudinal dividing wall extending from the top surface through most of the length of the upper neck portion to a location adjacent the valve seat ; ( m ) an arch shaped resilient member having a hook at one end which is snap fitted into the gap in the top surface and held in place against the ledge to thereby retain the arch shaped resilient member within the second longitudinal interior chamber ; ( n ) the arch shaped resilient member prestressed so that its arch portion is located adjacent to the interior wall of the upper neck portion at the location of the gap in the neck sidewall such that the arch portion is accessible from the first space ; ( o ) the arch shaped resilient member terminating in a transverse valve member which is caused to abut against the valve seat to thereby seal off the first and second interior longitudinal chambers from the interior hollow chamber in the lower sidewall ; and ( p ) the arch shaped resilient member having a sufficient memory so that when a transverse force is applied at the location of the arch portion , the arch shaped resilient member is caused to move away from the gap in the neck sidewall and move toward the dividing wall which in turn causes the transverse valve to move away from the valve seat to thereby permit liquid to pass from the hollow chamber in the lower sidewall through the first longitudinal interior chamber and through the opening in the top surface , and when the transverse force is removed , the arch portion returns to the gap in the neck sidewall and the transverse valve returns to abut against the valve seat to seal off the first and second interior longitudinal chambers . defined broadly , the present invention is a valve apparatus , comprising : ( a ) a lower sidewall which surrounds an interior hollow chamber into which a liquid can flow ; ( b ) means for attaching the lower sidewall to an opening of a liquid container such that liquid can flow from the container into the interior hollow chamber ; ( c ) an upper neck portion having a top surface and a neck sidewall , the neck sidewall having a gap located adjacent to means on the neck sidewall to receive at least one tooth ; ( d ) the neck sidewall surrounding an interior hollow chamber which is longitudinally divided by a longitudinal dividing wall attached to the top surface and extending from the top surface and dividing the interior hollow chamber into a first longitudinal interior chamber and a second longitudinal interior chamber , both chambers being in fluid engagement with the interior hollow chamber surrounded by the lower sidewall ; ( e ) the upper neck portion and the lower sidewall joined at a throat area having an interior sidewall which forms a valve seat ; ( f ) the top surface including a solid surface through which a first opening extends and which is in fluid communication with the first longitudinal interior chamber ; ( g ) the dividing wall extending from the top surface through most of the length of the upper neck portion to a location adjacent the valve seat ; ( h ) an arch shaped resilient member having means at one end to attach it to a location on the top surface so that it is retained within the interior chamber of the upper neck portion ; ( i ) the arch shaped resilient member prestressed so that its arch portion is adjacent to the interior wall of the upper neck portion at the location of the gap in the upper neck sidewall such that the arch portion is accessible when a tooth is pressed against the gap in the neck sidewall ; ( j ) the arch shaped resilient member terminating in a transverse valve member which is caused to abut against the valve seat to thereby seal off the first and second longitudinal interior chambers from the interior hollow chamber in the lower sidewall ; and ( k ) the arch shaped resilient member having a sufficient memory so that when a transverse force from a tooth is applied at the location of the arch portion , the arch shaped resilient member is caused to move away from the gap in the neck sidewall and move toward the dividing wall which in turn causes the transverse valve member to move away from the valve seat to thereby permit liquid to pass from the hollow chamber in the lower sidewall through the first longitudinal interior chamber and through the opening in the top surface , and when the transverse force is removed , the arch portion returns to the gap in the neck sidewall and the transverse valve member returns to abut against the valve seat to seal off the first and second longitudinal chambers . defined more broadly , the present invention is a valve apparatus , comprising : ( a ) a lower sidewall which surrounds an interior hollow chamber into which a liquid can flow ; ( b ) means for attaching the lower sidewall to an opening of a liquid container such that liquid can flow from the container into the interior hollow chamber ; ( c ) an upper neck portion having a top surface and a neck sidewall , the neck sidewall having a gap located adjacent to means on the neck sidewall to receive at least one tooth ; ( d ) the neck sidewall surrounding at least one interior longitudinal chamber which is in fluid engagement with the interior hollow chamber surrounded by the lower sidewall ; ( e ) the upper neck portion and the lower sidewall joined at a throat area having an interior sidewall which forms a valve seat ; ( f ) the top surface including a solid surface through which a first opening extends and which is in fluid communication with the at least one interior longitudinal chamber ; ( g ) an arch shaped resilient member having means at one end to attach it to a location on the top surface so that it is retained within the at least one interior longitudinal chamber ; ( h ) the arch shaped resilient member prestressed so that its arch portion is adjacent to the interior wall of the upper neck portion at the location of the gap in the neck sidewall such that the arch portion is accessible when the at least one tooth is pressed against the gap in the neck sidewall ; ( i ) the arch shaped resilient member terminating in a transverse valve member which is caused to abut against the valve seat to thereby seal off the at least one interior longitudinal chamber from the interior hollow chamber in the lower sidewall ; and ( j ) the arch shaped resilient member having a sufficient memory so that when a transverse force from the at last one tooth is applied at the location of the arch portion , the arch shaped resilient member is caused to move away from the gap in the neck sidewall which in turn causes the transverse valve member to move away from the valve seat to thereby permit liquid to pass from the hollow chamber in the lower sidewall through the at least one interior longitudinal chamber and through the opening in the top surface , and when the transverse force is removed , the arch portion returns to the gap in the neck sidewall and the transverse valve member returns to abut against the valve seat to seal off the at least one interior longitudinal chamber . defined even more broadly , the present invention is a valve apparatus comprising : ( a ) a container having a hollow elongated neck portion with a top having an opening leading to an interior chamber of the elongated neck portion , and which the elongated neck portion includes an interior wall and an exterior sidewall having a gap therein located adjacent to means on the sidewall to receive at least one tooth ; ( b ) the container further including a lower portion having means by which the container is attached to a source of liquid ; ( c ) the container having a hollow interior further including a valve seat ; ( d ) an arch shaped resilient member having means at one end by which it is retained in the elongated neck portion of the container , the arch shaped resilient member prestressed so that its arch portion is adjacent to the interior wall of the elongated neck portion at the location of the gap such that the arch portion is accessible when the at least one tooth is pressed against the gap ; ( e ) the arch shaped resilient member terminating in a transverse valve member which is caused to abut against the valve seat to thereby seal off the interior chamber in the elongated neck portion from the portion of the container by which it is attached to the source of liquid ; and ( f ) the arch shaped resilient member having a sufficient memory so that when a transverse force from the at least one tooth is applied at the location of the arch portion , the arch shaped resilient member is caused to move away from the gap which in turn causes the transverse valve member to move away from the valve seat to thereby permit liquid to pass from the source of liquid through the interior chamber in the elongated neck portion and through the opening in the top surface , and when the transverse force is removed , the arch portion returns to the gap and the transverse valve member returns to abut against the valve seat to seal off the interior chamber in the elongated neck portion . of course the present invention is not intended to be restricted to any particular form or arrangement , or any specific embodiment , or any specific use , disclosed herein , since the same may be modified in various particulars or relations without departing from the spirit or scope of the claimed invention hereinabove shown and described of which the apparatus or method shown is intended only for illustration and disclosure of an operative embodiment and not to show all of the various forms or modifications in which this invention might be embodied or operated . the present invention has been described in considerable detail in order to comply with the patent laws by providing full public disclosure of at least one of its forms . however , such detailed description is not intended in any way to limit the broad features or principles of the present invention , or the scope of the patent to be granted . therefore , the invention is to be limited only by the scope of the appended claims .	1
referring now to the figure it may be seen that the contemplated cw radar ( using , for example , a pseudo - random phase modulation technique for ranging ) is made up of four interconnected major subassemblies : a transmitter 10 ; an antenna section 12 ; a receiver 14 ; and a control unit 16 . the transmitter 10 is made up of a cw source 17 ( of conventional construction ) which produces a cw carrier with sufficient power to allow targets ( not shown ) to be detected . the cw carrier is passed , through an appropriate transmission path ( not numbered ) to a phase shifter 19 . a directional coupler 21 is disposed , as shown , to allow a small portion of the cw carrier to be fed to a phase shifter 23 . phase shifters 19 , 23 here are digital phase shifters adapted to pass the cw carrier without change in phase or to pass the cw carrier with a 180 ° shift in phase . the output of the phase shifter 19 is connected , through an appropriate transmission line ( not numbered )) to a transmitting antenna 25 . a directional coupler 27 is disposed , as indicated , to tap off a small portion of the output signal of the phase shifter 19 . control signals for the phase shifter 19 are derived directly as shown from a code generator 29 . similar control signals for the phase shifter 23 are derived through a register 31 . the code generator 29 here may be a simple switching arrangement for producing bipolar dc signals in accordance with control signals ( repetitive pseudo - random trains of pulses ) from the control unit 16 . it will be appreciated , therefore , that the output signal from the phase shifter 19 is the continuous wave carrier phase modulated in accordance with a pseudo - random code . the antenna section 12 includes , in addition to the transmitting antenna 25 , a receiving antenna 33 and an antenna drive 35 . the latter , of course , is arranged to rotate the transmitting antenna 25 and the receiving antenna 31 in unison . the receiving antenna 33 is connected to a first input port ( not numbered ) of a hybrid junction 37 and a feedthrough nulling bridge 39 is connected to a second input port ( not shown ) of the hybrid junction 37 . the first and second input ports are those ports which cause the difference between signals to be produced . the output of the hybrid junction 37 is fed to a first input port of a hybrid junction 41 . the output of a feedthrough nulling bridge 43 is connected to a second input port of the hybrid junction 41 . as with the hybrid junction 37 , the difference between the input signals to the hybrid junction 41 is produced at the output port . such difference is connected to a mixer 45 along with a signal from local oscillator 47 . the resulting intermediate frequency signal is passed through an amplifier ( i . f . amplifier 49 ) and then divided , with a first part being fed back to the feedthrough nulling bridges 39 , 43 and a second port being connected to a signal processor 51 in the control unit 16 . finally , a computer 53 is responsive , as shown , to the output of the signal processor 51 and to azimuth position data from the antenna drive 35 to produce the control signals for the code generator 29 and control signals for the register 31 . the feedthrough nulling bridges 39 , 43 may be similar to those shown on pages 16 - 19 of the radar handbook by merrill i . skolnik , copyright 1970 by mcgraw - hill , inc .. the signal processor 51 may be of the type shown in u . s . pat . no . 3 , 875 , 391 to shapiro which is assigned to the same assignee as the present invention . in operation , the antenna drive 35 is actuated in any convenient manner to step the transmitting antenna 25 and the receiving antenna 33 through its complete azimuth scan . each step may be in order of a beamwidth to permit nulling to be accomplished as much as possible . spillover and close - in clutter returns ( which are practically contemporaneous and are referred to hereinafter as &# 34 ; near - field signals &# 34 ;) are automatically nulled by reason of the operation of the feedthrough nulling bridge . high clutter returns from objects at a distance ( referred to hereinafter as &# 34 ; far - field signals &# 34 ;), for example returns from man - made objects such as standpipes or natural objects such as mountains , are not nulled by operation of the feedthrough nulling bridge 39 because correlation between the inputs to the hybrid junction 37 is not achieved . with the control signal from the computer 53 to the register 31 first being set to be contemporaneous with the control signal to the code generator 29 , the feedthrough nulling bridge 43 and then delayed ( without changing the azimuth of the antenna section 12 ) to correspond with ranges up to the ambiguous range , correlation between the output of the feedthrough nulling bridge 43 and return signals from clutter at different ranges will occur . each time correlation occurs , the hybrid junction 41 is effective to null the return from clutter at a given range . the output of the signal processor 51 then reflects each such nulling . the range from which the largest clutter signal is received is then stored in the computer 53 , along with the azimuth of the antenna section 12 . thus , after completion of the observations throughout all of the azimuth steps , the computer 53 is programmed automatically to delay the control signal to the register 31 so that when the antenna section 12 is continuously rotated , nulling of the highest clutter signal at any azimuth is effected . having described a preferred embodiment of this invention , it will now be apparent to one of skill in the art that changes may be made without departing from our inventive concepts . for example , the number of nulling loops may be increased so that clutter returns from clutter at different ranges at the same azimuth may be nulled . additionally , the type of modulation of the carrier may be changed . it is felt , therefore , that this invention should not be restricted to its disclosed embodiment , but rather should be limited only by the spirit and scope of the appended claims .	6
referring to fig1 there is shown a cross sectional view of an electrocapillary display sheet 10 of this invention . the electrocapillary display sheet 10 comprises three transparent and insulating sheets 12 , 14 and 16 such as glass or mylar . sheets 12 , 14 and 16 are substantially parallel to each other and they are spaced from each other . the distance d 1 between sheet 12 and 14 and the distance d 2 between the sheets 14 and 16 both are in the range between 0 . 0001 and 0 . 05 inches . hereinafter , for the purpose of simplicity , &# 34 ; electrocapillary display sheet &# 34 ; will also be referred to as &# 34 ; display sheet &# 34 ;. referring to fig2 there is shown an example of a method of bonding sheet 12 , 14 and 16 together . the sheets 12 , 14 and 16 are suitably spaced from each other and bonded to a frame 17 that runs around the periphery of the display sheet 10 . if the frame 17 and the sheets 12 , 14 and 16 are glass , bonding might be done by means of a glass frit painted onto joining surfaces and subsequently heated to its melting temperature . the bonding might also be done with epoxy or some other bonding resin . if the sheets 12 , 14 and 16 are all made of a plastic material , such as teflon or mylar , the bonding might be a heat weld , accomplished by means well known in the art . since the frame 17 runs around the periphery of the display sheet 10 , it seals the spaces 13 and 15 which are located between sheets 12 and 14 and sheets 14 and 16 respectively . referring back to fig1 a plurality of electrodes 18 are placed on sheet 12 where it faces sheet 14 and a plurality of electrodes 20 are placed on sheet 14 where it faces sheet 12 . electrodes 18 and 20 generally must be made from a transparent material such as indium / tin oxide ( ito ) or tin oxide . electrodes 18 and 20 can be selected to have different shapes such as square or circular . however , the shape of both electrodes 18 and 20 have to be selected to be identical . in the preferred embodiment of this invention , both electrodes 18 and 20 are selected to be square with rounded corners . each one of the electrodes 18 of sheet 12 is aligned with a corresponding electrode 20 from sheet 14 . referring to fig3 there is shown a portion of the top view of the electrodes 18 of sheet 12 . the electrodes 18 of sheet 12 are placed next to each other in such a manner that they form parallel lines both along the width w and the length l of the surface of sheet 12 . the electrodes 18 , of dimension n by n , are placed at a distance d 3 away from each other . since each electrode has the same size as the size of a pixel , the dimension n is defined by the size of the pixels . distance d 3 is in the range between 0 . 001n and 0 . 05n . it should be noted that electrodes 20 of the sheet 14 have the same shape , size and arrangement as the electrodes 18 of sheet 12 . referring back to fig1 sheet 14 has a plurality of reservoirs ( storage to hold liquid ) 22 . the reservoirs 22 are created by forming a hole , preferably at the center c of each electrode 20 , which extends through the thickness w 1 of the sheet 14 . in addition , sheet 14 has a plurality of holes 23 which are formed to extend through the thickness w 1 preferably where there is a space between four adjacent electrodes 20 of sheet 14 . however , holes 23 can be placed between two adjacent electrodes 20 of sheet 14 . holes 23 provide a communicating path between the sealed spaces 13 and 15 . sheet 12 , where faces sheet 14 , has a layer 24 of low surface energy insulator . the low surface energy insulator layer 24 , which is placed over the electrodes 18 of the sheet 12 , covers the entire surface of the sheet 12 . in the same manner , a low surface energy insulator layer 26 , which is placed over the electrodes 20 of the sheet 14 , covers the entire surface of the transparent sheet 14 while leaving the reservoirs 22 and the holes 23 open . the low surface energy insulator layers 24 and 26 may be a layer of teflon ( dupont co .) or other perfluorinated polymer , bonded to the sheets 12 and 14 as a sheet or deposited by a sputtering or chemical vapor deposition process . they can also be a silicone elastomer such as sylgard 184 manufactured by the dow corning co . furthermore , they may be a two or more layer structure such as parylene ( a product of the union carbide co .) overcoated with a perfluorinated polymer such as fluorad fc725 manufactured by the 3m co . in addition , a plurality of high surface energy plates 28 made from a material such as evaporated or sputtered gold , platinum , indium / tin oxide , or nickel are placed over the low surface energy insulator layer 24 of the sheet 12 only on the areas which are aligned to be above the reservoirs 22 of the sheet 14 . in the preferred embodiment of this invention , the shape of the high surface energy plates 28 is the same as the shape of the cross section of the reservoirs which is a circle . it should be noted that the electrodes 18 and 20 , and the low surface energy insulators 24 and 26 are all transparent . the high surface energy plates 28 may also be transparent . the reservoirs 22 are filled with dyed polar liquid l 1 such as water , alcohol , acetone , formamide , ethylene glycoy and mixtures of these and other suitable liquids . the space ( passage ) 13 between the sheets 14 and 16 , the space ( passage ) 15 between the sheets 12 and 14 and the holes 23 are filled with a low surface energy liquid l 2 such as dow coming 200 series silicone oil , exxon isopar or 3m fluorinert . the two liquids l 1 and l 2 are immiscible . the liquid l 2 may be clear , dyed or pigmented with a contrasting color to liquid l 1 . the spaces 13 , 15 and holes 23 may also be filled with a gas such as air . conductive liquids are polar and are generally miscible with one another . however , there are classes of non - conducting liquids that are not miscible with one another . examples of these are the fluorocarbons , such as the 3m fluorinerts , that are not miscible with most of the hydrocarbons , dow coming fs - 1265 oil is also not soluble in hydrocarbons or the 3m fluorinerts . the dyed polar liquid l 1 , in each reservoir adheres to the high surface energy plates 28 above the reservoir . the high surface energy plate 28 not only serves the purpose of maintaining the placement of the conductive liquid adjacent to the addressing electrodes 18 and 20 , but also serves as a means of making electrical connection to the conductive liquid l 1 . since the high surface energy plates 28 provide electrical connection to liquid l 1 , hereinafter , &# 34 ; the high surface energy plate &# 34 ; will be referred to as &# 34 ; connection plate &# 34 ;. this invention is based on a concept called &# 34 ; electrocapillarity &# 34 ;. the electrocapillarity relates to changes in surface tension as a function of an applied electric field which is discussed in ` surface chemistry `, by lloyd i . osipow , 1962 , reinhold publishing co ., new york &# 34 ;. the structure shown in fig1 is designed to move the dyed polar liquid l 1 from one area into another by using effects related to the electrocapillary concept . in order to comprehend the disclosed embodiment of this invention , it is necessary to study the electrocapillary concept . referring to fig4 there are shown two same size droplets a and b of two different kinds of liquid on a surface 32 . as it can be observed , droplet b is spread out and droplet a is beaded up . as a result , droplet b occupies a larger surface area s 1 than the surface area s 2 which the droplet a occupies . the reason for the different surface areas of the two liquids is that each liquid has a certain energy relationship with the surface which results in a specific contact angle with respect to a given surface . the lower the interaction energy between the liquid and the surface , the larger the contact angle and the less the shared area . referring to fig5 a contact angle α is an angle between the plane 34 of a surface and the tangent line 36 of a droplet 38 of a liquid . the contact angle of each liquid with respect to a given surface depends on the properties of that liquid for example , surface tension and the properties of the surface for example , surface energy . referring to fig6 there is shown the two droplets a and b of fig4 with their contact angles α 1 and α 2 . some liquids such as the liquid of droplet b have an acute contact angle α 2 which causes the droplet of that liquid to occupy a large surface s 1 . however , some liquids such as the liquid of droplet a have an obtuse contact angle α 1 which causes a same size droplet of one of these liquids to occupy a much smaller surface s 2 than the surface area s 1 occupied by liquids with acute contact angles . referring to fig7 there is shown two plates 40 and 42 which are placed parallel and spaced from each other in such a manner as to create a step . through extensive experiments , it has been determined that if a droplet of a liquid which has a contact angle less than about 95 degrees is placed in the corner 44 created by the step , the droplet will spread into the space 46 between the two parallel plates 40 and 42 . however , referring to fig8 if the droplet of a liquid which has a contact angle above about 95 degrees is placed at corner 44 , the droplet will not spread . furthermore , referring to fig9 through extensive experiments it has been determined that by applying a voltage v between a droplet c located on a thin insulative surface 48 and an electrode 49 ( directly under the surface 48 ) an electric field is created which causes , the contact angle to be changed and , depending on the voltage applied to the liquid , the contact angle can be modified to a desired angle . in fig9 from left to right , droplet c is shown prior to applying a voltage v , during application of a voltage v and after removal of the voltage v . as can be observed , prior to applying a voltage v the droplet c is beaded up and has an obtuse angle α3 . during the application of the voltage v , the contact angle of droplet c changes to an acute angle α 4 and as a result , the droplet expands . after removal of the voltage v , the contact angle of the droplet changes to its original obtuse angle α 3 and as a result the droplet beads up again . it should be noted that if the voltage is turned off , the charges remain in the droplet and the electrodes , as a result , the droplet will remain spread . however , if the droplet and the electrodes are discharged , then the liquid will bead up . in this specification the term &# 34 ; electric field is removed &# 34 ; shall mean &# 34 ; the liquid , its corresponding electrodes and electrical connection means to the liquid are discharged &# 34 ;. modifying a contact angle from an obtuse angle α 3 to an acute angle α 4 causes the droplet c to occupy a larger surface area s 3 than its original surface area s 4 ( the surface that a droplet occupies prior to the application of an electric field ). once the voltage is removed , the droplet c will contract back to its original shape and surface area s 4 . the experiments have shown that by applying a voltage v to liquids such as water and mercury on a surface such as silicone elastomer that overcoat a conductor , their surface areas can increase by a factor of 10 . furthermore , by utilizing surfaces such as teflon coated parylene , the surface areas of water or mercury can increase by a factor in the range between 20 and 30 . the concept of increasing the surface area of a liquid by applying a voltage has been used in this invention to expand the surface area of a dyed liquid in order to fill a surface area on demand . in the preferred embodiment of this invention , the contact angle of the dyed polar liquid 11 with respect to the low surface energy insulator is selected to be more than 90 degrees . it is well known that the contact angle of a first liquid with respect to a surface is greatly enhanced if a second liquid , with a lower surface tension and immiscbile with the first liquid , is present . this phenomenon is shown in fig1 and 11 . in fig1 , a droplet d of a liquid is placed on surface 50 . the droplet d which is surrounded by air 52 has an acute contact angle α 5 . however , in fig1 , droplet d &# 39 ; which is the same as the droplet d of fig1 is surrounded by a different liquid 54 and placed on the surface 50 &# 39 ; which is the same as surface 50 of fig1 . in fig1 , as can be observed , liquid 54 has caused the droplet d &# 39 ; to have an obtuse angle α 6 . this effect can be utilized to greatly increase the number of polar liquid / low energy surface combinations which is very useful in the practice of this invention . referring back to fig1 in operation , an individual voltage source which generates a voltage v is applied to each pair of electrodes 18 and 20 and to their corresponding liquid l 1 through the connection plate 28 . it should be noted that for the purpose of simplicity , only the connection of one pair of electrodes 18 and 20 and their corresponding connection plate 28 to a voltage v is shown . however , it should be noted that an individually addressable electric field is applied to each pair of electrodes 18 and 20 and their corresponding connection plate 28 . when an individual voltage v is applied to electrodes 18 and 20 and their corresponding connection plate 28 an electric field is being generated between the electrodes 18 and 20 ( electrodes 18 and 20 are activated ) and their corresponding connection plate 28 . the voltage v can be either dc or ac . in the case of a dc voltage v , electrodes 18 and 20 are connected to the same polarity of the voltage v and the connection plate 28 is connected to the opposite polarity of the voltage v . therefore , liquid 11 , which receives its electrical connection through the connection plate 28 , has the opposite polarity compared to the polarity of the electrodes 18 and 20 . in operation , once the voltage v is activated , the contact angle of the polar liquid l 1 with respect to the surfaces of the low surface energy insulators 24 and 26 decreases . it should be noted that low surface energy insulators 24 and 26 are over the electrodes 18 and 20 respectively . therefore , the opposite polarity of liquid l 1 with respect to the polarity of the electrodes 18 and 20 directly under the low surface energy insulators 24 and 26 causes the contact angle of polar liquid l 1 to decrease . the decrease in the contact angle causes the polar liquid l 1 to be pumped into the space 13 between sheets 12 and 14 . the dyed polar liquid l 1 occupies the space 15 only within the perimeters of the electrodes 18 and 20 . as the expanding liquid l 1 approaches the perimeters of the electrodes 18 and 20 , the strength of the electric field between this liquid l 1 and the electrodes 18 and 20 falls off , causing the contact angle of liquid l 1 with respect to the surfaces of the low surface energy insulators 24 and 26 to increase . this increase in contact angle will cause the further expansion of the liquid to cease . when the liquid l 1 moves into the space 13 , it causes the liquid l 2 in the space 13 , holes 23 and the space 15 to move and flow into the reservoirs 22 from the opening of the reservoir into the space 15 in order to equilibrate the liquid l 1 and the liquid l 2 . once a voltage v is activated , the dyed polar liquid l 1 occupies the area between electrodes 18 and 20 and therefore the area between electrodes 18 and 20 will be seen as a colored pixel or subpixel . by removing the electric field created by the voltage v , the contact angle of the liquid l 1 with respect to the surfaces of the low surface energy insulators 24 and 26 increases , causing the dyed polar liquid l 1 to retreat back to the reservoir where it adheres only to the connection plate 28 which it wets . once an electric field is removed , since the dyed polar liquid retreats back to the reservoir , the area under that electrode will be seen as a clear area . the diameter of the reservoir and therefore , the diameter of the high energy connection plate 28 is small enough to make the dyed polar liquid l 1 within the reservoirs 22 invisible . therefore , by activating and removing the proper electric fields , an image can be displayed on the electrocapillary display sheet 10 . the voltage required to create an electric field adequate to move the liquid from the reservoirs is in the range between 5 volts and 300 volts . the electrocapillary display sheet 10 requires a constant application of a pattern of addressing voltages v in order to continuously display an image . an active matrix addressing circuit can provide such a retained voltage pattern . in order to utilize the electrocapillary display sheet 10 of this invention as a paper surrogate , the bottom surface 60 of sheet 10 has to be either coated with a material of a contrasting color compared to the color of the polar liquid l 1 or brought into contact with such a surface . if a light color is selected for the bottom surface 60 and the dyed polar liquid is selected to be dark , the electrodes 18 and 20 with an activated field will appear as dark pixels or subpixels depending on the size of the electrodes 18 and 20 . however , the electrodes 18 and 20 with a removed electric field will appear as clear pixels . for example , if the dyed polar liquid l 1 is dyed black and the surface 60 is coated white , then the electrodes 18 and 20 with an activated electric field will appear as black on a white background . the electrodes 18 and 20 with a removed electric field will appear as white since the white background can be seen through the clear electrodes 18 and 20 . this will have the physical appearance of black ink on white paper . it should be noted that since the size of the reservoirs is very small in the range between 0 . 1 % and 10 % of the area of the pixel , the ink in the reservoirs is substantially invisible . furthermore , the electrocapillary display sheet 10 of this invention can be utilized as a transparent display to be placed on a projector to project the image of the electrocapillary display sheet 10 onto a screen . therefore , on the screen only the projected image of the electrodes 18 and 20 with an active electric field will be seen as dark pixels or subpixels depending on the size of the electrodes . the electrodes with a removed electric field appear clear and the light passing through these electrodes forms a bright image on the screen . referring to fig1 , there is shown yet another alternative electrocapillary display sheet 80 of this invention . in fig1 , the elements 82 , 83 , 84 , 85 , 86 , 88 , 80 , 92 , 93 , 94 , 96 , 98 , l 3 and l 4 are the same and serve the same purpose as the elements 12 , 13 , 14 , 15 , 16 , 18 , 20 , 22 , 23 , 24 , 26 , 28 , l 1 and l 2 of fig1 respectively . in fig1 , the connection plates 98 are no longer used to provide electrical connection to liquid l 3 . however , they are placed above the reservoirs in order to cause the liquid l 3 to rise and adhere to the plates 98 . instead of the connection plates 98 , a conductive coating 72 is placed on the walls of the reservoirs 22 via plating or any other well known methods which will be used to provide electrical connection to liquid l 3 . in fig1 , the voltage v 1 is applied to electrodes 88 and 90 and their corresponding liquid l 3 through the conductive coating 99 . the electrodes 88 and 90 are connected to the same polarity of the voltage v 1 and the conductive coating 99 which provides the electrical connection to liquid l 3 is connected to the opposite polarity of the voltage v 1 . referring to fig1 , there is shown yet another alternative electrocapillary display sheet 100 of this invention . in fig1 , the elements 102 , 103 , 104 , 105 , 106 , 108 , 100 , 112 , 113 , 114 , 116 , 118 and l 5 are the same and serve the same purpose as the elements 12 , 13 , 14 , 15 , 16 , 18 , 20 , 22 , 23 , 24 , 26 , 28 and l 1 of fig1 respectively . in the electrocapillary display sheet 100 , liquid l 1 of fig1 is replaced by two liquids l a and l b . liquid l a is a clear conductive liquid . however , liquid l b is a dyed or pigmented non - conductive liquid . furthermore , liquids l 5 , l a and l b are all immiscible liquids . liquid l b is placed under liquid l a in such a manner that once liquid l a flows into the space 103 only in the area directly between the electrodes 108 and 110 and a portion of the reservoir 112 liquid l b is fully retreated into the reservoir 92 . in operation , once a voltage v 2 is applied to electrodes 108 and 110 and the connection plate 118 , the conductive liquid l a which is in contact with connection plate 118 spreads into space 103 and fills the space between the electrodes 108 and 110 . once the liquid l a flows out of reservoir 112 , liquid 1 b moves into reservoirs 112 . in the mean time , the liquid l 5 will fill in the space 120 ( within the space 105 directly under electrodes 108 and 110 ). upon removal of the voltage v 2 , liquid l a retreats back into reservoir 112 and therefore liquid l b flows out to fill the space 120 while pushing out the liquid l 5 . a viewer looking at the electrocapillary display sheet from the bottom surface 122 , will see the dyed or pigmented liquid l b within the space 120 when the voltage v 2 is removed . accordingly , the space 120 will be seen as a pixel in the color of liquid l b . however , when the voltage v 2 is activated , liquid l b retreats back into the reservoir 112 and clear liquid l 5 flows into the space 120 . as a result , space 120 will be seen as a clear pixel . therefore , the electrocapillary display sheet 100 generates a pixel when an electric field created by an applied voltage v 2 is removed and it clears a pixel when an electric field is created by the applied voltage v 2 . in contrast , the electrocapillary display sheet 10 of fig1 generates a pixel when an electric filed is created by an applied voltage v and clears a pixel when the electric field created by an applied voltage v is removed . the electrocapillary display sheet 100 of fig1 can be modified to display full color images . referring to fig1 , there is shown a portion of the top view of the electrocapillary color display sheet 180 of this invention . in this approach , the sizes of the electrodes 188 are the same as the size of a pixel . referring to fig1 , there is shown a magnified cross sectional view of the disclosed embodiment of fig1 along line a -- a . in fig1 , elements 182 , 183 , 185 , 186 , 188 , 194 and l 6 are the same and serve the same purpose as the elements 102 , 103 , 105 , 106 , 108 , 114 and l 5 of fig1 . layer 184 , electrodes 190 and the layer 196 are the same as layer 104 , electrodes 110 and the layers 116 of fig1 , except for each electrode 190 there are three reservoirs 200 , 202 and 204 within layer 184 , electrode 190 and layer 196 . since in the cross sectional view of fig1 the reservoir 202 is not visible , it is shown by dashed lines . the color display sheet 180 uses the approach used in the display sheet 100 of fig1 . in fig1 , each reservoir contains two liquids , one clear conductive and one pigmented non - conductive . in fig1 , reservoir 200 contains a clear conductive liquid l c and a pigmented conductive liquid l r which is partially in reservoir 200 and partially in the space 220 ( the space within space 185 within the perimeters of electrodes 188 and 190 ). in the same manner reservoirs 202 and 204 each have a clear conductive liquid l c and a pigmented non - conductive liquid l b and l g respectively . the inks l r , l b and l g are immiscible . it should be noted that the r , b and g in l r , l b and l g represent red , blue and green . it should also be noted that any reservoir in each pixel can hold any of these three liquids and the order in which different color inks are placed in the reservoirs is immaterial . each reservoir 200 , 202 and 204 has an individual connection plate 206 , 208 and 210 respectively . the clear liquid l c in each reservoir is in contact with the connection plate of that reservoir . for example , the clear liquid l c in the reservoir 200 is in contact with the connection plate 206 . in order to activate the clear liquid in each reservoir , electrodes 188 and 190 are connected to one polarity of a power supply and each one of the connection plates 206 , 208 and 210 is connected to the opposite polarity of the power supply through individually addressable switches s 1 , s 2 and s 3 . once a switch is closed , the electric field is being applied to electrode 188 , electrode 190 , a corresponding connection plate and the clear liquid in the corresponding reservoir . in fig1 , each time one of the connection plates 206 , 208 and 210 is activated , the clear liquid l c flows into the space 222 ( the space within space 183 between electrodes 188 and 190 ). as a result , the respective pigmented liquid , for example l r , moves into its respective reservoir 200 . therefore , in the color display sheet 180 of fig1 , when the connection plates are not active , the major portion of all three pigmented inks l r , l b an l g are in the space 220 resulting in a color pixel which is visible from the bottom of the sheet 180 . each time one of the connection plates 206 , 208 and 210 is activated , the respective pigmented liquid will move into its respective reservoir and therefore the respective pigmented liquid is removed from the space 220 . in fig1 when all the connection plates are activated , all pigmented liquids l r , l b and l g will be removed form space 220 and clear liquid l 6 will move into space 220 resulting in clear pixel . in fig1 , since the inks l r , l b and l g are non - conductive and immiscible , they do not mix with each other . it should be noted that in this specification a colored liquid is referred to as &# 34 ; pigmented liquid &# 34 ;. however , dyed liquids can replace the pigmented liquids disclosed in this invention . it should also be noted that in the electrocapillary color display sheet of this invention , the red , blue and green liquids can be replaced by any three complementary colors which can create the spectrum of colors . it should further be noted that numerous changes in details of construction and the combination and arrangement of elements and materials may be resorted to without departing from the true spirit and scope of the invention as hereinafter claimed .	6
hereinafter , exemplary embodiments will be described in greater detail with reference to the accompanying drawings . exemplary embodiments are described herein with reference to cross - sectional illustrations that are schematic illustrations of exemplary embodiments ( and intermediate structures ). as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances , are to be expected . thus , exemplary embodiments should not be construed as limited to the particular shapes of regions illustrated herein but may be to include deviations in shapes that result , for example , from manufacturing . in the drawings , lengths and sizes of layers and regions may be exaggerated for clarity . like reference numerals in the drawings denote like elements . it is also understood that when a layer is referred to as being “ on ” another layer or substrate , it can be directly on the other or substrate , or intervening layers may also be present . referring to fig1 , a pcram device includes a heating electrode 100 . the heating electrode 100 includes a body portion 100 a and a stepped protrusion 100 b formed on the body 100 a . since the stepped protrusion 100 b is formed in a phase - change space ps , the phase - change space ps has partially different heights . a phase - change material layer 120 is formed within the phase - change space ps having the partially different heights . the phase - change material layer 120 may include a single material and be formed through a single deposition process . the phase - change material layer 120 has partially different thicknesses by a structure of the heating electrode 100 . at this time , a portion { circle around ( a )}, having a relatively small thickness , of the phase - change material layer 120 is first phase changed and portions { circle around ( b )} and { circle around ( c )} having a relatively small thickness are sequentially phase changed . therefore , the phase - change material layer 120 is phase changed in a step - by - step manner , so that multi - levels are realized . to produce a more precise phase change of the phase - change material layer , the phase - change material layer 120 may be formed of partially different materials , as shown in fig2 . the phase - change material layer 120 may be formed of a first phase - change material layer 120 a in edge portions , that is , the { circle around ( c )} portions of the phase - change space ps . the phase - change material layer 120 may also be formed of a second phase - change material layer 120 b in the { circle around ( b )} portions of the phase - change space ps . the phase - change material layer 120 also may be formed of a third phase - change material layer 120 c in the { circle around ( a )} portion of the phase - change space ps . at this time , the multi - levels may be precisely defined by setting the first phase - change material layer 120 a to have the highest phase - change temperature and setting the third phase - change material layer 120 c to have the lowest phase - change temperature . fig3 a to 3c are perspective views illustrating a method of forming a heating electrode according to an exemplary embodiment of the inventive concept . referring to fig3 a , a disc - shaped first heating electrode 100 a is formed within a phase - change space ps . a diameter of the first heating electrode 100 a is substantially the same as that of the phase - change space ps . referring to fig3 b , a second heating electrode 100 b - 1 is formed on the first heating electrode 100 a . the second heating electrode 100 b - 1 may have a disc shape and may have a smaller diameter than the first heating electrode 100 a . the second heating electrode 100 b - 1 may be arranged on a central portion of the first heating electrode 100 a . referring to fig3 c , a third heating electrode 100 b - 2 is formed on the second heating electrode 100 b - 1 . the third heating electrode 100 b - 2 may have a smaller diameter than the second heating electrode 100 b - 1 and may be arranged on a central portion of the second heating electrode 100 b - 1 . therefore , the stepped heating electrode may be formed . fig4 is a cross - sectional view of a pcram device according to an exemplary embodiment . referring to fig4 , a word line 210 is formed on a semiconductor substrate 200 . the word line 210 is electrically insulated from the semiconductor substrate 200 and includes a polysilicon layer including impurities or a metal layer . a first interlayer insulating layer 220 is formed on the semiconductor substrate 200 , in which the word line 210 is formed , and a diode d is formed in a predetermined portion of the interlayer insulating layer 220 . the diode d may be formed to be in contact with the word line 210 . the diode d may include a pn diode or a schottky diode according to a material of the word line 210 . a second interlayer insulating layer 230 is formed on the first interlayer insulating layer 220 . a predetermined portion of the second interlayer insulating layer 230 is etched to form a phase - change space ps . a heating electrode 240 is formed on a bottom of the phase - change space ps through the above - described method . the heating electrode 240 may be formed through a stepped type etching method other than the above - described etching method . although not shown , an ohmic contact layer may be interposed between the diode d and the heating electrode 240 . a phase - change material layer 250 is buried within the phase - change space ps on the heating electrode 240 . the phase - change material layer 250 may be formed of a single phase - change material . alternatively , the phase - change material layer 250 may be formed of different materials for steps of the heating electrode 240 . a bit line 260 is formed on the phase - change material layer 250 . the bit line 260 may extend in a direction substantially perpendicular to the word line 210 and an upper electrode ( not shown ) may be interposed between the bit line 260 and the phase - change material layer 250 . when a predetermined current is applied to the pcram device , a plurality of temperature - induced phase - changes are caused based on a thickness , or composition , of the phase - change material layer 250 , as shown in fig5 . in fig5 , an x - axis indicates current and a y - axis indicates resistance . a symbol “ x ” denotes a phase - change period . accordingly , the pcram may be precisely verified by supplying a constant write voltage , which is difficult to control in a conventional pcram . the inventive concept is not limited to the above - described exemplary embodiment . the exemplary embodiment has described that the phase - change space ps , in which the heating electrode and the phase - change material layer are formed , is configured in a cylindrical shape , but the structure of the phase - change space ps is not limited thereto . the phase - change space ps may be formed in various shapes , such as a square pillar or a trigonal prism . while certain embodiments have been described above , it will be understood that the embodiments described are by way of example only . accordingly , the devices and methods described herein should not be limited based on the described embodiments . rather , the systems and methods described herein should only be limited in light of the claims that follow when taken in conjunction with the above description and accompanying drawings .	6
multiple televisions on a wall or over a bar are becoming popular attractions for the venues that provide retail services . the large display screens are decorative and deliver multiple channels / stations covering a wide range of entertainment . a challenge to the multiple televisions setup is the audio distribution . for the video , the customers can focus on any particular television to watch with their eyes without much interference from other nearby televisions . to hear a particular television , however , the audio from any one particular television would get mixed with other nearby televisions and become difficult to understand . a simple solution of the past has been to have no audio from any television or have one audio from one main television . another more sophisticated way is to collect the audio from each television and distribute them through wi - fi digital transmission to individual smartphones . the customers with smartphones can then listen to the particular televisions using apps . the advantage of using smartphones is that the customers can watch and listen to their own selection of televisions independently and individually . in designing the wi - fi digital transmission of the television audios , different types of transmission , such as tcp / ip , rtp / ip or udp / ip , have been used . each has its own advantage over the others in the goals of achieving a stable and speedy transmission which translates to a good sound quality and a low latency . the good sound quality and the low latency however are the two ends of a tradeoff . different type of the transmission offers a better achievement in one at the expense of the other . this invention relates to the transmission of the multiple channels in general . it includes the cases in which a transmission of a single channel using the tcp / ip or rtp / ip connection is used as a prelude to the multiple channel transmission . an example of the prelude would be the connection to inquire and / or share the transmission configuration information between the transmitter and the receiver before the multiple channel transmission begins . given a multiple channel transmission , the existing method of sharing the transmission configuration information , such as which channel and what data are being transmitted , has been to establish a single channel connection between the transmitter and the receiver . the connection may be of tcp / ip or rtp / ip type . through the connection , the transmission configuration information is sent from the transmitter to the receiver . the transmission configuration information may be generated in the transmitter upon receiving an inquiry or pre - generated and stored in the transmitter . the transmission configuration information would contain among others the basic configuration information such as which port is being used to transmit which channel and what station is in each channel . this invention proposes an alternative method that the transmission configuration information is transmitted in an additional channel along with the main body of the multiple channel transmission . the port for the transmission of the additional channel and the format of the data packet would be preset in a mutual agreement between the transmitter and the receiver . thus the transmitter will transmit and the receiver will receive through the preset port . it is unlike the existing methods of the transmitter waiting for an inquiry in a connection from the receiver . the transmitter transmits the transmission configuration information into the air using wi - fi signal . the receiver then using the preset port and format catches the information from the wi - fi signal in the air and processes it for the purpose of receiving the multiple channel transmission . the method of this invention to transmit the transmission configuration information along with the multiple channel data has the following advantages over the existing methods . first , it separates the transmitter from the unnecessary connections with the receiver , which may be of tcp / ip or rtp / ip format . the receiver searches and obtains the transmission configuration information from the broadcast / multicast , i . e . from the transmitted wi - fi signals in the air using a preset port . second , this method of sending the transmission configuration information does not change whether there are one or many receivers at the receiving end . both cases of a single or multiple receivers result in no change of load or burden to the transmitter . third , when the receiver changes its selection of the channel , that is , changes from receiving the data of one channel to another , it does not need to engage the transmitter . the receiver can simply follow the transmission configuration information and change the channel on its own . fourth , when the transmission configuration is changed , such as when the data in a channel is changed from one source to another or additional channels are added due to increased number of inputs , the new transmission configuration information will become available immediately to the receiver in the broadcast / multicast . the new transmission configuration information does not require another connection of inquiry from the receiver to be transmitted . fig1 is an example layout of the transmission configuration information being sent from the transmitter to the receiver . from the transmitter ( 101 ) to the receiver ( 102 ), the multiple channel transmission sends the data packets ( 104 - 107 ) through their channels noted port 1 - 48 . this invention proposed that the transmitter ( 101 ) also transmits the transmission configuration information in the packet ( 103 ) in an additional channel noted by the port xxxx . the packet ( 103 ) will carry the information of the packets ( 104 - 107 ) and the channel information of the port 1 - 48 . the port 1 - 48 can be relative addresses from the port xxxx . the port xxxx would be preset in a mutual agreement between the transmitter and the receiver . the receiver when activated will search for the packet ( 103 ) in the port xxxx , and when the packet is received , will use the information within to select any channel in the multiple channel transmission . note that other connections ( 108 ) can be made between the transmitter and the receiver as needed . they may be of any ip connection type including the tcp / ip or rtp / ip for their purpose of application . fig2 is an example of the transmission configuration information packet ( 103 ) of fig1 . the packet identifier ( 201 ), the multicast group address ( 202 ), and the multicast port ( 203 ) are the parts that would be embedded into the transmission protocol guiding the packet into the preset port that is mutually agreed on between the transmitter and the receiver . the data packets ( 204 - 206 ) are the transmission configuration information of the data packets ( 104 - 107 ). they include the port numbers in which the transmissions are being made , the call sign that would indicate the data description , and the option that specify other relevant variables in the data . they describe each and all of the channels in the multiple channel transmissions . in this example , up to 48 channels are noted . fig3 is an example of data packet being transmitted in a single channel ( 104 ). it consists of transmission protocol in the packet identifier ( 301 ) and the channel index ( 302 ). the protocols will guide the packet into the port noted in the transmission configuration information . the packet would also contain the brief description of the data content such as its length , name , and sequence number as shown in ( 303 ), ( 304 ), and ( 305 ). the data itself is ( 306 ) which is being transmitted to the receiver for the application . a concrete example of the invention can be found in the transmission of the audio outputs of the multiple televisions located in a sports bar . the audio outputs of the multiple televisions are first collected into the transmitter . the original forms of the audio outputs can be analog or digital , coming into the transmitter using rca , usb , hdmi or any other connector . the server would then convert the audio data into the digital signal that can be replayed by the receiver , such as a smartphones and tablets , and transmits the digital signal as wi - fi signals . in the example , for the speedy transmission which means the low latency , the user datagram protocol ( udp / ip ), also known as the multicast , is selected for the transmission . fig4 describes the internet protocol architecture for the udp / ip transmission . the application data ( 401 ) would be the data packet of fig2 or the data packet of fig3 . the udp header ( 402 ), ip header ( 403 ), and the frame header ( 404 ) and footer ( 405 ) are the transmission protocols that would be used for transmitting the application data ( 401 ). the protocols ( 402 ), ( 403 ), ( 404 ), and ( 405 ) would reflect the values in ( 201 ), ( 202 ), ( 203 ), ( 301 ), and ( 302 ) inserted by the transmitter , thus able to be found and read by the receiver . fig5 is a detail description of the udp header ( 402 ). notably , it spends 32 bits for the transmission protocol , half of which , the source port ( 503 ) and the checksum ( 506 ), can be ignored as option in the commonly found ipv4 transmission . the small number of the protocol bits can indicate the fast speed transmission by sheer space allotted for the application data relative to the protocol . more importantly however is that the small number of protocol means less or no safety measures for the integrity of the delivered datagram , thus resulting in a faster transmission . the sole mission of the udp / ip transmission is to send out with speed the data packet in multicast regardless of the integrity of the delivered data to the receiver . it requires only the destination port and the length of the data in the protocol . other protocols , such as transmission control protocol ( tcp ) or the real - time transmission protocol ( rtp ) has been considered for the transmission . fig6 is a detail description of the transmission control protocol ( tcp ) header , which for the tcp / ip transmission can replace the udp header ( 402 ). the tcp / ip is the most commonly used ip transmission in our daily internet surfing . it has over 128 bit of header protocol ( 603 - 620 ) per data packet designed heavily with the safety measures for the integrity of the received data . it incorporates the data offset , the reserved , and the control bits ( 607 - 617 ) as well as the window size ( 618 ) for bi - directional communication . a major delay in the tcp / ip transmission comes from this bi - directional protocol to re - transmit the data in case of data loss . the tcp / ip transmission is thus strong on the integrity of the received transmission at the cost of the transmission speed . fig7 is a detail description of the real - time transmission protocol ( rtp ) header , which is another alternative to the udp header ( 402 ). using the rtp header , the rtp / ip transmission is most commonly found in the voice over ip ( voip ) transmission used in the digital telephony such as skype and vonage . the protocol consists of minimum 96 bit protocol ( 702 - 704 ) which includes control bits and the sequence number ( 702 ) which would notify the receiver of lost data packets . although the protocol does not attempt to recover the lost data packet through re - transmission , the control bits and the sequence number alerts the receiver of the lost data and in response , the receiver takes the actions to patch up the loss data . the appropriate actions by the receiver however can be another major cause of delay in the transmission . in the example of audio transmission of the multiple televisions , the udp / ip transmission is thus selected for its speed of transmission . its weakness in preserving the integrity of the delivered data can be improved by the data format in the transmission rather than using the protocols . the research on how to improve the integrity of the delivered data in the udp / ip transmission is a topic of future research . using the udp / ip transmission then , the method of this invention is to deliver the transmission configuration information using an additional preset channel as shown in ( 103 ) of fig1 . this additional channel would be transmitted in a preset port xxxx . the receiver , which would be a device such as iphone , ipad , or androids , can then search for the port xxxx using an application program ( also known as app ), and upon finding the port and its transmission , will display the received information in a customer interface showing all selectable channels and their respective station descriptions , for example , channel 1 : espn , channel 2 : fox news , channel 3 : cnn , etc . different from this invention , the existing methods of first establishing an ip connection between the transmitter and the receiver for the transmission configuration information are discussed in the u . s . pat . no . 8 , 495 , 236 b1 by glasser and u . s . pat . no . 8 , 852 , 565 b1 by morsy et al . the advantage of this invention is clear that : first , the new invention separates the transmitter from the unnecessary connections with the receiver , which may be of tcp / ip or rtp / ip format . second , the number of receiver ( s ) does not matter to the transmitter in terms of load or burden . third , the receiver is free to change its selection of the channel without any response from the transmitter . fourth , any change in the transmission configuration is immediately transmitted in the port xxxx , and be received by the receiver without any connections between the transmitter and the receiver .	7
the common forms of elemental phosphorous include the clear or whitish - yellow waxy solid melting at 44 ° known as white phosphorus , and a red , high melting , less reactive substance known as red phosphorus . for the purposes of the process of this invention , only the white phosphorus is useful . the elemental phosphorus may be employed as a finely divided solid or as a melt , or it may be dissolved or dispersed in an inert organic solvent . elemental phosphorus is substantially insoluble in water and does not react with water at any appreciable rate . in the presence of an acid and in particular in the presence of aqueous hydroiodic acid , elemental phosphorus appears to undergo disproportionation to form phosphine and orthophosphorus acid . the reaction proceeds best at elevated temperatures in the range of 100 ° to 130 ° c ., and appears to require that hydroiodic acid be present in a ratio greater than 6 moles of hydrogen iodide ( hi ) for each phosphorus molecule ( p 4 ). at ratios below about 6 : 1 , some of the white elemental phosphorus is converted to insoluble and inert red phosphorus , lowering the overall yield and contaminating the final product . hydroiodic acid forms a constant boiling azeotrope with water containing 57 % hi which boils at 127 ° c . the process of this invention may thus be conveniently carried out by adding elemental phosphorus , in a continuous stream or incrementally , to a pot containing refluxing 57 % aqueous hydroiodic acid and replenishing the water as it is consumed or lost through evaporation to maintain the boiling temperature at or below 127 ° c . the reaction may be carried out in more dilute hydroiodic acid solutions if desired , and at any convenient temperature in the range of 100 ° to 130 ° c ., however , at temperatures above about 127 ° c ., phosphonium iodide , ph 4 i , sublimes from the reaction mixture , leading to a substantial reduction in the concentration of hydroiodic acid . it is absolutely essential that the reaction be carried out in an inert gas atmosphere . elemental phosphorus is spontaneously flammable in moist air , and the phosphine produced is flammable and forms potentially explosive mixtures with air or oxygen . for reasons of safety , the reaction vessel will thus be purged with an inert gas such as nitrogen or argon and a slight positive pressure of inert gas will preferably be maintained throughout the reaction period to prevent air from entering the vessel . an inert organic solvent for the elemental phosphorus may optionally be included to aid in dispersing the phosphorus . the solvents useful for the purposes of this invention will be inert organic liquids which boil at a temperature within or slightly above the preferred temperature range and which may be readily distilled from the pot mixture at the end of the reaction period , including , for example , anhydrous , c 1 to c 6 aliphatic carboxylic acids . the solvent may be employed directly in the reaction mixture with the aqueous hydroiodic acid , or alternatively the elemental phosphorus may be dispersed in the solvent and added therewith in a steady stream . because of its stability , convenient boiling temperature of 118 ° c . and ready availability , acetic acid will be preferred for these purposes . the proportion of solvent employed is not critical ; when added directly to the reaction mixture , approximately equal volumes of the solvent and aqueous hydroiodic acid may be conveniently employed . the products of the reaction are orthophosphorous acid , which remains in the reaction mass , and gaseous phosphine which is evolved and may be conducted out of the reaction vessel , optionally water - scrubbed to remove hi , then collected by any convenient method such as cold trapping and gas - liquid displacement . phosphine is both flammable and highly - toxic , and precautions must be taken to prevent its escape into the air and to ensure that no exposure to phosphine can occur . phosphine is commercially useful as a synthesis intermediate . alternatively , phosphine may be readily oxidized to form phosphoric acid . prior art methods for the preparation of phosphine generally produce phosphine contaminated with significant amounts of diphosphine , p 2 h 4 which is considerably more flammable and potentially more of an explosion hazard than phosphine . surprisingly , the instant process results in very pure phosphine containing no detectable amounts of diphosphine . the process of this invention thus also provides a very practical and convenient method for the production of very pure phosphine . the reaction vessel , after the addition of phosphorus is complete and the evolution of phosphine has ceased , contains orthophosphorous acid and aqueous hydroiodic acid , together with the solvent , if employed . the mixture is then distilled to strip off the hydroiodic acid as the azeotrope which may be re - used directly . the pot mixture after distillation contains only clear viscous orthophosphorus acid with no other acids of phosphorus such as orthophosphoric acid . the mass is readily crystallized if desired . the process of this invention may be carried out either as a batch or continuous flow process . in a continuous process , molten phosphorous would be continuously added under an inert atmosphere to the pot mixture of 57 % aqueous hydroiodic acid and solvent heated to a temperature of 127 ° c . phosphine would be collected as it evolved , and pot mixture would be continuously removed to a second heated vessel and stripped of solvent and hydroiodic acid azeotrope . the azeotrope would be returned to the reaction vessel . the process of this invention will be better understood by consideration of the following example : to a 0 . 5 l round bottom flask fitted with a stirrer , a reflux condenser and a thermometer were added 0 . 15 l of glacial acetic acid and 0 . 118 l of 57 % aqueous hydroiodic acid . the mixture was slowly stirred , purged with nitrogen , and heated to 125 °- 129 ° c . elemental phosphorus ( 105 g .) was added incrementally over a period of 30 days , and water was periodically added to maintain the boiling temperature of the reaction mass below 127 ° c . as phosphine evolved , it was passed through a water - filled gas scrubber , then collected by trapping in a sodium hypochlorite solution . the total phosphine generated amounted to 51 g ( 89 % yield ). the gas stream was completely free of diphosphine ( p 2 h 4 ). the pot mixture was fractionally distilled to remove the acetic acid and hydroiodic acid azeotrope . the pot residue , amounting to 105 g ( 76 . 6 % yield ) was a clear viscous liquid . chromatographic analysis showed this product to be h 3 po 3 , with no detectable trace of h 3 po 4 or other phosphorus acids . the invention will thus be seen to be a method for the preparation of orthophophorus acid and phosphine comprising the steps of adding elemental white phosphorus to aqueous hydroiodic acid , optimally in the presence of a solvent , at a reaction temperature of about 100 ° to 130 ° c ., collecting phosphine as it is evolved , stripping hydroiodic acid , water and any solvent from the reaction mixture , thereby providing orthophosphorous acid .	2
a dispensing unit ( 10 ) and a remote control unit ( 40 ) are described herein . in some embodiments , the dispensing unit ( 10 ) may include a single part ( as shown in fig1 b ) or two parts ( as shown in fig1 c ). the two - part dispensing unit includes a reusable part ( 100 ) and a disposable part ( 200 ). the dispensing unit ( 10 ) may employ different dispensing mechanisms , including without limitation a syringe - type reservoir with a propelling plunger , peristaltic positive displacement pump in some embodiments , the dispensing unit ( 10 ) can be adhered to the patient &# 39 ; s body by a skin adherable cradle unit . an example of such a cradle unit is disclosed in the co - owned , co - pending u . s . patent application ser . no . 12 / 004 , 837 and international patent application no . pct / il2007 / 001578 , the disclosures of which are incorporated herein by reference in their entireties . the term “ dispensing unit ” is not limited to fluid delivery . in some embodiments , the dispensing unit ( 10 ) may be capable of dispensing fluid ( e . g ., insulin ) to a patient &# 39 ; s body or sensing analyte ( e . g ., glucose ) in the body . infusion programming , data transferring and control of the dispensing unit ( 10 ) can be carried out by a remote control unit ( 40 ), which may be configured as a personal digital assistant (“ pda ”), a hand watch , a cellular phone , or any other means . the remote control unit ( 40 ) is capable of establishing a unidirectional communication with the dispensing unit ( 10 ), i . e ., the remote control unit ( 40 ) only transmits data to the dispensing unit ( 10 ) or only receives data from the dispensing unit ( 10 ). the communication link between remote control unit ( 40 ) and dispensing unit ( 10 ) can be also bidirectional , i . e ., the remote control unit ( 40 ) is capable of transmitting and receiving data to and from the dispensing unit ( 10 ). fig2 a - b show exemplary embodiments of the dispensing unit ( 10 ) employing a peristaltic pumping mechanism for dispensing fluid to a user &# 39 ; s body . fig2 a shows a single - part dispensing unit ( 10 ). the fluid is delivered from a reservoir ( 220 ) provided in the dispensing unit ( 10 ) through a delivery tube ( 230 ) to an exit port ( 213 ). the peristaltic pump includes a rotary wheel ( 110 ) provided with rollers ( not shown ) and a stator ( 190 ). rotation of the rotary wheel ( 110 ) and periodic squeezing of the delivery tube ( 230 ) against the stator ( 190 ) positively displaces fluid from the reservoir ( 220 ) to the exit port ( 213 ). an example of such a positive displacement pump is disclosed in the co - owned , co - pending u . s . patent application ser . no . 11 / 397 , 115 , filed on apr . 3 , 2006 , the disclosure of which is incorporated herein by reference in its entirety . a driving mechanism ( 120 ) for rotating the rotary wheel ( 110 ) can be provided . the driving mechanism ( 120 ) includes a gear and a motor . the motor can be a stepper motor , a dc motor , sma actuator or any other motor . the driving mechanism ( 120 ) is controlled by electronic components ( 130 ) residing in the dispensing unit ( 10 ). the electronic components ( 130 ) may include a controller ( not shown ), a processor ( 132 ), a transceiver ( 131 ) and / or a transmitter ( 133 ). an appropriate power source ( 240 ) and an energy storage device ( 252 ) ( e . g ., a capacitor ) are also provided . the power source ( 240 ) may include without limitation one or more batteries , such as a button - sized zinc - air battery . in some embodiments , the power source ( 240 ) may be a button battery and the energy storage device ( 252 ) may be a high capacity ( e . g ., about 0 . 2 f ) capacitor . using a button battery usually requires the supply of pulsed power in order to increase the current output by the battery . the pulsed power mode is established by periodically charging and discharging the high capacity capacitor . infusion programming of the dispensing unit ( 10 ) can be carried out either by remote control unit ( 40 ) and / or by manual buttons ( 15 ) provided on the dispensing unit ( 10 ). fig2 b shows a two - part dispensing unit ( 10 ) that includes a reusable part ( 100 ) and a disposable part ( 200 ). the reusable part ( 100 ) includes a positive displacement pump provided with rotary wheel ( 110 ), driving mechanism ( 120 ), and electronic components ( 130 ). the disposable part ( 200 ) includes reservoir ( 220 ), delivery tube ( 230 ), power source ( e . g ., button battery ) ( 240 ), energy storage device ( 252 ), exit port ( 213 ), and stator ( 190 ). pumping is enabled upon attachment of the two parts to each other . this arrangement is discussed in the co - owned , co - pending u . s . patent application ser . no . 11 / 397 , 115 , filed on apr . 3 , 2006 , the disclosure of which is incorporated herein by reference in its entirety . the power source ( 240 ) may also be located in the reusable part ( 100 ) and can be rechargeable . fig3 a and 3 b show respectively an embodiment of the two - part dispensing unit ( 10 ) prior to ( as shown in fig3 a ) and subsequent to ( as shown in fig3 b ) connection of the two parts . the reusable part ( 100 ) contains a peristaltic pumping mechanism provided with rotary wheel ( 110 ) and a driving mechanism ( 120 ) having a motor ( 121 ), a worm ( 126 ), a shaft ( 128 ) and gears ( 124 ). the reusable part ( 100 ) also contains electronic components ( 130 ). the disposable part ( 200 ) includes reservoir ( 220 ), delivery tube ( 230 ), power source ( 240 ), exit port ( 213 ), and stator ( 190 ). the power source ( 240 ) may be a zinc - air battery or button battery . fig4 a - b show embodiments of the dispensing unit ( 10 ) employing a piston - plunger pumping mechanism for dispensing fluid to a user &# 39 ; s body . fig4 a shows a two - part dispensing unit ( 10 ) having a reusable part ( 100 ) and a disposable part ( 200 ). the disposable part ( 200 ) includes reservoir ( 220 ) provided with plunger assembly ( 110 ), power source ( e . g ., battery ) ( 240 ), energy storage device ( 252 ), and exit port ( 213 ). in alternative embodiments , the plunger assembly ( 110 ) may be located in the reusable part ( 100 ) or be shared by both parts . the reusable part ( 100 ) includes a driving mechanism ( 120 ), which has a motor ( 121 ) ( e . g ., stepper motor , dc motor , or sma actuator ) and a driving gear ( not shown ) for displacing the plunger assembly ( 110 ). the driving mechanism ( 120 ) is controlled by electronic components ( 130 ), which has a controller ( not shown ), a processor ( 132 ), a transceiver ( 131 ), and / or a transmitter ( 133 ). infusion programming can be carried out by a remote control unit ( not shown ) and / or by one or more buttons ( 15 ) provided on the dispensing unit ( 10 ). the power source ( 240 ) may be located in the reusable part ( 100 ) and may be rechargeable . an example of such a dispensing unit is disclosed in the co - owned , co - pending u . s . provisional patent application no . 61 / 123 , 509 , filed on apr . 9 , 2008 , the disclosure of which is incorporated herein by reference in its entirety . fig4 b shows a single - part dispensing unit ( 10 ), which includes substantially similar components as the two - part dispensing unit ( 10 ). the components of the single - part dispensing unit ( 10 ) are deployed within a common housing ( 11 ). the embodiments shown in fig4 a - b are disclosed in the co - owned , co - pending international patent application no . pct / il2008 / 000641 , the disclosure of which is incorporated herein by reference in its entirety . any of the above - mentioned embodiments may be provided with a sensing and monitoring device for controlling operation of the driving mechanism ( 120 ). fig5 shows this device employing a photo interrupter ( 113 ) as disclosed in the co - owned , co - pending international patent application no . pct / il2008 / 000642 , the disclosure of which is incorporated herein by reference in its entirety . the sensing and monitoring device is provided with an encoder vane ( 116 ) configured as a 180 degree sector , which is affixed to a shaft ( 128 ) such that the encoder vane ( 116 ) rotates with the shaft ( 128 ) at the same rotational velocity . photo - interrupter ( 113 ) is positioned such that as encoder vane ( 116 ) rotates it passes through space ( s ) between led ( 112 ) and light detector ( 114 ). the motor &# 39 ; s ( 121 ) rotational velocity can be derived from the shaft &# 39 ; s ( 128 ) rotational velocity by taking into consideration the gear ( 124 ) reduction ratio . for example , when the shaft ( 128 ) rotates at 1 rotation per minute ( rpm ) and the gear ( 124 ) ratio is 3 : 1 ; the motor &# 39 ; s ( 121 ) speed is 3 rpm . other sensing and monitoring devices may also be employed to measure the motor &# 39 ; s ( 121 ) rotational velocity . fig6 shows schematically the power source ( 240 ) and energy consuming components of the dispensing unit ( 10 ) controlled by controller ( 132 ). the energy consuming components include : a communication device ( 134 ), which may include without limitation rf , ir and other communication types ( e . g ., magnetic relay , manual buttons , audible commands ). a pumping mechanism ( 136 ) actuated by a driving mechanism having a motor and motor driver . a sensing and monitoring device ( 138 ), which may include without limitation an occlusion sensor or motion sensor . an indication device ( 140 ), ( also referred to as “ notification device ”), which may include without limitation a buzzer or vibration alarm . fig7 shows a flow chart depicting an energy supply and control of the motor ( 121 ). in practice , a low price , small - sized power source ( 240 ) ( e . g ., button battery ) may be used , particularly a small quantity thereof , to provide a dispensing unit ( 10 ) that is of miniature size and lightweight . due to the small size of a button battery , the electrical power output produced thereby , i . e ., current (“ i ”) and voltage (“ v ”), is substantially lower than the electrical power required for motor operation , i . e ., a condition is satisfied whereby for example , a zinc - air battery has a maximum power output of about 0 . 03 watts ( e . g ., current of about 25 ma and voltage of about 1 . 2 volts ), while the motor ( 121 ) requires electrical power of 1 . 5 watts ( e . g ., current of about 500 ma and voltage of about 3 volts ). it can be seen in this example that the electrical power ( w motor ) required the motor is times larger than what battery ( w battery ) is able to supply . the electric power required by the motor is not limited to the particular electrical power indicated above . thus , in order to enable operation of the motor ( 121 ), the voltage and current supplied thereto are increased . voltage increase can be carried out by virtue of a dc - dc converter ( 254 ) which can for example convert the 1 . 2 volts supplied by the battery , i . e ., power source ( 240 ), to the voltage required by the motor ( 121 ), i . e ., 3 volts . increasing the current can be carried out by a pulsed power method , i . e ., by charging the energy storage device ( 252 ) ( e . g ., a 0 . 2 f capacitor ) for approximately 1 second and then discharging it for about 20 milliseconds . this enables multiplication of the current by 50 times . the 3v voltage is also supplied to the controller ( 132 ) and to the sensing and monitoring device ( 138 ) ( e . g ., revolution counters ). such a sensing and monitoring device ( 138 ) is disclosed in the co - owned , co - pending international patent application no . pct / il2008 / 000642 , as noted above . the motor driver ( 255 ), which is controlled by the controller ( 132 ), operates the motor ( 121 ) by providing it with a pulsed power , as shown by line ( 109 ). the pulsed power is supplied by the energy storage device ( 252 ). in some embodiments , the motor &# 39 ; s ( 121 ) operation is controlled by the principle of a closed - loop feedback , according to which the amount of power supplied to the motor ( 121 ) is adjusted based on the motor &# 39 ; s ( 121 ) rotational velocity ( 38 ). sensing and monitoring device ( 138 ) ( e . g ., revolution counter or rotation sensor ) measures the motor &# 39 ; s ( 121 ) output as shown by dashed line ( 22 ) and provides the controller ( 132 ) with the required data , including without limitation , the motor &# 39 ; s ( 121 ) instant rotational velocity , as shown by dashed line ( 38 ). in some embodiments , the sensing and monitoring device ( 138 ) merely provides a number of revolutions of the motor ( 121 ), while the velocity is calculated by the controller ( 132 ). in some embodiments , the motor &# 39 ; s ( 121 ) mechanical energy may be converted into electrical energy , as shown by line ( 108 ). this energy can be stored in the energy storage device ( 252 ) for later use . fig8 a - b show the main components depicted in fig7 : the motor ( 121 ), the energy storage device ( 252 ), and the power source ( 240 ) connected by flat strip connectors ( 241 ) to other electrical components ( 130 ). the energy storage device ( 252 ) can be a high capacity capacitor having a capacity of 180 mf to 200 mf . it is advantageous if the capacitor has a flat configuration and reduced dimensions ( e . g ., 29 mm × 17 mm × 0 . 9 mm ). consequently , the capacitor may be placed parallel to the electronic components ( 130 ) ( e . g ., a printed circuit board ), which allows the dispensing unit ( 10 ) to be kept as small and thin as possible . in practice , the capacitor having the above - mentioned configuration and dimensions provides a dispensing unit having thickness less than 15 mm . fig9 a - b are power - time plots illustrating a pulsed power produced by a capacitor and supplied to the motor . in some embodiments , the supply of pulsed power includes two modes : accumulation mode ( 400 ) and release mode ( 500 ). during the accumulation mode ( 400 ), a battery charges the capacitor . during the release mode ( 500 ), the capacitor is being discharged and supplies current to power consuming components of the dispensing unit , including without limitation , the motor and electronic elements . the ratio between the accumulation time t (“ t accumulaton ”) and release time (“ t release ”) “ t release ”) is proportional to the ratio between the power required for operation of power consuming components , such as a motor (“ w motor ”) and the electrical power outputted by a battery (“ w battery ”), i . e ., fig9 a shows a graph of a typical charging / discharging cycle of the capacitor having the two modes . it is clear that the duration of the accumulation mode ( 400 ) is substantially longer than the release mode ( 500 ). in practice , this duration may be 50 times longer . therefore , the maximal pulse train duration applied for activating the motor is less than the release mode ( 500 ) duration . in alternative embodiments , the charge stored in the capacitor may be monitored ( e . g ., by an a / d converter ), thereby allowing a dynamic control over the discharging and recharging of the capacitor to be achieved . fig9 b shows schematic graphs of the power (“ power ”) and current (“ i ”) of a charging / discharging cycle of the capacitor . during accumulation mode ( 400 ), the energy that is supplied by the battery is accumulated and stored in the capacitor . in practice , when applying a 0 . 2 f capacitor and a zinc - air battery , it may take 980 milliseconds . the energy ( p 1 ) that is stored in the capacitor gradually increases while the supplied current ( i 1 ) remains constant . during the release mode ( 500 ), the capacitor discharges and , supplies the required amount of power to the power consuming components . when the capacitor has 0 . 1 f capacity and the battery is a silver - oxide button - sized battery with 0 . 186 watt output , the release mode can take 10 milliseconds , while the accumulation time is about 8 times higher . discharged power and current are designated as p2 and i2 , respectively . in some embodiments , there may be continued charging of the capacitor , even during the discharge phase , which shortens the time interval between two consecutive pulses . if the capacitor is fully loaded , the charging process may not continue . fig1 a shows the angular velocity ( ω m ) of the motor versus time ( t ) and fig1 b shows the corresponding power ( p ) discharged from the capacitor and supplied to the motor . during this period , the motor operates the pump to deliver fluid ( e . g ., insulin ) via the dispensing unit . when the motor is rotated based on energy from the capacitor only a limited amount of fluid can be delivered during a single charging / discharging cycle and , therefore , more than one cycle may be required to deliver the appropriate amount of fluid required for therapeutic treatment . in some embodiments , a variant pulse train can be supplied to the motor each time the capacitor is being discharged . the amount of power supplied during the discharge of the capacitor depends upon whether the motor rotates with constant or variable rotational velocity . at t = t 0 , the motor begins to rotate and its rotational velocity should be gradually increased up to a certain velocity . the increasing velocity is designated as a 1 . the velocity increases due to supplying a certain amount of electrical power delivered by the capacitor to the motor ( p & gt ; 0 ). this power is designated as b 1 . at t = t 1 , the motor &# 39 ; s angular velocity is constant , as represented on the graph in fig1 a as a plateau . the achieved velocity is designated as a 2 . the amount of power required to keep the motor rotating at constant velocity a 2 can be b 2 , which is less than b1 since constant angular velocity ( ω m ) is maintained due to inertia . thus , the required power ( b 2 ) is less than b 1 . during the time interval from t = t 2 to t = t 3 , the velocity of the motor is decreased until full stop ( the decreasing velocity is designated as a 3 ). the velocity can be reduced by supplying power b3 , as may be required to overcome inertia until stopping the motor . in some embodiments , the time interval from t = t 1 to t = t 3 is about 20 milliseconds . the pattern of the pulses is typically predetermined when the pulse trains are tailored . that is , the dispensing pump is initially configured with at least one pulse train . in some embodiments , the dispensing pump controller can adjust and combine various pulses and pulse trains as needed . in other embodiments , the controller can adjust and schedule the pulse train ( e . g ., energy , number of pulses , width of pulses , or frequency ) based on the energy stored in the energy storage device or power source . fig1 a - b refer to another embodiment and show graphs of the angular velocity ( ω m ) of the motor versus time ( t ) and the corresponding power ( p ) required by the motor versus time ( t ). the graphs depict variations in velocity and power during drug delivery , while an alternative operational mode of the motor is employed for saving energy . the two first phases designated by a 1 , a 2 and b 1 , b 2 are identical to those referred to in fig1 a - b . during the time interval starting at t = t 2 and ending at t = t 3 , the velocity of the motor is decreased merely due to friction forces until a full stop ( the reducing velocity is designated in fig1 a as a 4 ). fig1 b shows that in this time interval ( t = t 2 to t = t 3 ), the motor continues to rotate and no energy is required . therefore , energy associated with the rotation of the motor is available for use by the energy consuming components while the motor itself does not require supply of energy , i . e ., during this phase the motor may operate like a dynamo . fig1 shows current ( i ) supplied to the motor versus time ( t ), during a pulse train employing the operation mode described in fig1 a - b . the current ( i ) is supplied by pulses while each pulse is characterized by a time interval (“ t ”) ( i . e ., a period ). the initial pulse ( e . g ., between t 1 and t 2 ) has long period t 1 , typically lasting for 1 to 1 . 5 millisecond , for setting the driving mechanism into motion and for accelerating the motor . the duration of each consecutive pulse is either equal or shorter than the former . in some embodiments , the second phase has a minimal pulse period t 2 of about 0 . 5 milliseconds . this trend is turned over when the motor speed is decreased , i . e ., in this phase the motor is decelerating and each period t 3 of each pulse is either equal or longer than the former . for example , the duration of the n pulses of an exemplary pulse train can be written as shown in the following equation : since a pulse duration ( t ) is inversely proportional to the angular velocity of the motor ( ω ), ( t α 1 / ω ), the above equation can be accordingly rewritten as follows : according to some embodiments , every pulse is tailored to rotate the motor &# 39 ; s axis through an identical angle ( known as a ‘ step ’). enabling a constant angular rotation resulting from each discrete pulse and providing the same amount of fluid is highly advantageous in that it simplifies the dispensing pump control and calibration , for example , when calculating the number of pulses needed to deliver a required amount of therapeutic fluid . this is achieved by maintaining constant the multiple of pulse duration by the rotational velocity it causes : t 1 · ω 1 = t 2 · ω 2 = t 3 · ω 3 = . . . t n − 1 · ω n − 1 = t n · ω n = 18 ° fig1 - 14 shows current ( i ) supplied to the motor versus time ( t ), according to some embodiments . conventional methods for supplying energy to motors of infusion devices employ pulses in which a constant level of power is provided to the motor during each pulse period ( i . e ., a 100 % duty cycle ). this method can be employed to the device disclosed herein as well , i . e ., power pulse trains may be supplied to the motor while each pulse train includes pulses of power during which power would be supplied non - invariantly at three various levels b 1 , b 2 and b 3 lasting during respective periods t 1 , t 2 and t 3 following without interruption . in some embodiments , supply of power may be organized during each pulse with interruptions . as shown schematically in fig1 there could be provided three different operational phases and each pulse of the pulse train includes : a discharge phase ( 510 )— pulsed power is provided to the motor by discharging a capacitor . a null phase ( 520 )— power supply is interrupted and power is not supplied to and neither generated by the motor . a charge phase ( 530 )— energy is generated by the motor and this energy can be supplied to power consuming components . the pulses typically include discharge ( 510 ) and null ( 520 ) phases or null ( 520 ) and charge ( 530 ) phases but may include only discharge ( 510 ) or charge ( 530 ) phases . fig1 shows a graph of the current ( i ) supplied to the motor versus time ( t ), for generating the angular velocity according to principles described in connection with fig1 a - b . the graph shows a single pulse train , which includes three initial pulses . each one of initial pulses ( e . g ., the pulses designated as p 1 , p 2 and p 3 ) have two phases : a discharge phase ( 510 ) ( designated as w 1 , w 2 and w 3 ), followed by a null phase ( 520 ). in some embodiments , the null phase ( 520 ) is 10 % to 30 % of the pulse period , i . e ., the width of these pulses is of 70 % to 90 %. in some embodiments , the dispensing pump controller applies pulse width modulation ( pwm ) for changing the width of the pulses to generate the determined pulse train . it should be appreciated that other methods for exploiting the motor &# 39 ; s inertia for reducing the energy supply may be implemented , such as by changing the pulse period , amplitude , or shape ( e . g ., triangle , square , sine wave ). halting motor operation is carried out by the last pulses of the pulse train ( e . g ., p n − 1 and p n ). the discharge phase ( 510 ) of these pulses equals the duty cycle ; p n − 1 = ω n − 1 and p n = ω n . this causes the motor to stop almost immediately , so that no excess fluid is delivered by the dispensing unit . fig1 shows a graph of current ( i ) supplied to the motor versus time ( t ), for implementing the principle described above in connection with fig1 a - b . the graph shows a pulse train . the last pulses of the pulse train ( e . g ., p n − 1 and p n ) include a single phase , i . e ., the charge phase ( 530 ). this mode of operation enables the motor to generate energy due to its rotation and to transfer it to an energy storage device . the halting method is shown in fig1 a - b and may require the use of a sensing and monitoring device ( e . g ., a sensor ) to detect the relative position ( i . e ., angle ) of the rotary wheel . the sensing and monitoring device may be required to achieve an accurate fluid delivery employing a flow correction mechanism . although particular embodiments have been disclosed herein in detail , this has been done by way of example for purposes of illustration only , and is not intended to be limiting with respect to the scope of the claims . in particular , it is contemplated by the inventors that various substitutions , alterations , and modifications may be made without departing from the spirit and scope of the devices and methods defined by the claims . other aspects , advantages , and modifications are considered to be within the scope of the claims . the claims presented are representative of the devices and methods disclosed herein . other , presently unclaimed devices and methods , are also contemplated . the inventors reserve the right to pursue such devices and methods in later claims . the following examples serve to illustrate embodiments of the disclosed devices and methods and are given for illustrative purposes only and are not intended to limit the present disclosure . fig1 , 16 and 17 show examples of pulse train supplied to the motor according to some embodiments . these figures show the discharge phase ( 510 ), in which power is supplied to the motor , the null phase ( 520 ) in which no power is supplied to the motor and the charge phase ( 530 ) when power is generated by the motor . the pulse trains were tailored to reduce the power provided to the motor while each pulse rotates the motor by 20 degrees . the power source in these examples is a zinc - air button battery , a 0 . 2 f capacitor and two phase motor commercially provided by nidec copal corporation ( u . s . a .). the pulses are provided by pwm and / or by changing the pulse period . fig1 shows a pulse train for rotating the motor by 160 degrees composed of three sets of pulses : the first set of pulses is applied for accelerating the motor and includes three pulses lasting for 2 . 3 milliseconds . the second set of pulses is designed for maintaining the motor speed and includes four pulses , each having a 1 . 15 millisecond period . this set of pulses rotates the motor by the same angle as the first set but requires 50 % less power . to increase the energy efficiency , the last two pulses may have 80 % width of the duty cycle . the third set of pulses is for stopping the motor and is identical to the first set but in reversed phase . in this example all the pulses have 100 % pulse width ( i . e ., the pulse width equals the pulse duration ). fig1 shows a pulse train designed to rotate the motor by 520 degrees at a lower rotation velocity than that disclosed in example 1 . this pulse train is composed of three sets of pulses : the first set of pulses is applied for accelerating the motor and includes four pulses lasting for 1 . 0 millisecond . the second set of pulses is designed for maintaining the motor speed and includes 22 pulses , each having a 0 . 7 millisecond period . if the pulses in this set were tailored as the first set ( as described in the prior art ), the energy consumption of this set would be 40 % higher . the third set of pulses includes two stop pulses lasting for 1 . 0 millisecond , wherein a 90 % duty cycle is applied to stop the motor rotation . fig1 shows a pulse train that does not apply power to stop the motor . the pulse train includes two sets of pulses : the first set of pulses is applied for accelerating the motor and includes four pulses lasting for 1 . 0 millisecond . the second set of pulses is designed for maintaining the motor speed and includes 22 pulses , each having a 0 . 7 millisecond period . also shown are two pulses ( 530 ) supplied by the motor for recharging the capacitor , i . e ., the motor functions as a dynamo by transferring kinetic energy to electrical power . example 3 requires less energy than the pulse train described in example 2 and provides two more steps to the motor ( which are applied to stop the motor in example 2 ). the inertia of the motor at the end of this pulse train can be converted by the motor to electrical power , which can be provided to other electrical components of the dispensing unit . this pulse train requires 29 . 1 j , provides 26 steps of rotation and can also retrieve part of the excess power provided to the motor . a standard method of motor activation would be composed of 20 pulses lasting 1 . 0 millisecond each , whereby at least two of them are applied for stopping the motor . thus , less than 20 steps can be provided in this method .	0
there were dropped into a solution of 20 grams of nh 4 cl in 400 ml of water ( 5 weight % nh 4 cl ) in a round - bottomed flask with stirring within 10 minutes at 40 ° c . 296 grams of bleaching liquor ( corresponding to 41 . 79 grams naocl + 3 grams of naoh ), whereupon to begin the reaction the ph was adjusted to 9 by adding caustic soda solution ( a total of 12 grams of naoh ). after a short time , the ph increased to 13 . 8 and only dropped within the addition of the last third of the bleaching liquor with strong development of gas . within 7 minutes 1 . 25 liters of nitrogen and within a further 3 minutes 3 . 5 liters of n 2 were set free . the solution then showed a ph of 7 . 5 ; it contained only 1 ppm nh 4 + (= 0 . 0001 weight %) and 0 . 09 grams of naocl which can be converted by addition of equivalent amounts of na 2 so 3 solution into nacl . in the samples which were removed after 5 - 7 minutes reaction time , after acidification and decomposition of the naocl , hydrazine could be detected with salicylaldehyde . in example 1 the weight ratio of chlorine from the hypochlorite to the nh 3 -- n is about 3 . 6 : 1 . there were added to 400 ml of a 5 weight % nh 4 cl solution at 20 ° c . with stirring in a round - bottomed flask within 10 minutes 296 grams of bleaching liquor ( corresponding to 41 . 79 grams naocl + 3 grams naoh ), whereupon the ph was held at the beginning to 9 by dropping in some caustic soda solution ( 12 grams naoh ). after a short time , the ph increased to 13 . 0 and only dropped upon the addition of the last third of the bleaching liquor . the solution warmed up to 50 ° c . the development of gas , the ph and the residual content of nh 4 + and naocl had the same values as given in example 1 . the gas formed in the reaction was led through a 20 % solution of na 2 so 3 . by kjeldahl analysis , there could not be detected nh 3 , consequently the nitrogen set free was free of ncl 3 . in a manner similar to example 1 at 40 ° c . 6 ml of bleaching liquor ( corresponding to 0 . 846 grams naocl ) were dropped into 500 ml of an aqueous solution of 0 . 5 grams ( nh 4 ) 2 so 4 ( 0 . 1 weight % ( nh 4 ) 2 so 4 ) within 10 minutes . after a short time the ph of 10 . 2 dropped and then there had to be added a total of 7 . 5 ml of 1n naoh ( 0 . 303 grams naoh ) to hold the ph between 9 and 8 . after 5 minutes further reaction the ph of the solution stood at 7 . it still contained 2 ppm nh 4 + and 55 ppm naocl . in the manner of example 3 there were dropped into 500 ml of a 0 . 05 weight % ( nh 4 ) 2 so 4 containing aqueous solution at 40 ° c . 3 ml of bleaching liquor ( 0 . 423 grams naocl ) within 10 minutes . after the start of the reaction the ph dropped from 10 . 0 and then there had to be added a total of 37 . 5 ml of 0 . 1n naoh to hold the ph between 9 and 8 . after 5 minutes of post reaction time the ph fell to 7 . 2 . there were found in the solution 1 . 5 ppm nh 4 + and 56 ppm naocl . in the manner of example 3 there were added to 500 ml of an aqueous solution of 0 . 005 weight % ( nh 4 ) 2 so 4 at 40 ° c . 0 . 3 ml of bleaching liquor ( corresponding to 0 . 0423 grams naocl ) and then 3 . 75 ml of 0 . 1 n naoh to hold the ph between 9 and 8 . the solution still contained 2 ppm nh 4 + and 18 . 6 ppm naocl . 500 ml of an aqueous solution of 0 . 25 grams nh 4 cl ( 0 . 05 weight %) were adjusted to a ph of 8 with 12 ml of 1 n naoh . to this solution there were then added with stirring within 10 minutes 30 ml of bleaching liquor (= 0 . 52 gram naocl + 0 . 026 gram naoh ). thereby at first there was established a ph of 10 . 5 without the setting free of n 2 and then the ph decreased slowly to 9 with development of n 2 , then the ph fell further very quickly . to keep a ph of 7 it was necessary to add caustic soda solution , e . g ., 1 n sodium hydroxide . 500 ml of an aqueous solution of 5 grams of nh 4 cl ( 1 weight %) was adjusted to a ph of 8 at 40 ° c . with a solution of 3 . 22 grams of naoh in 50 ml of water . there were then added to this solution with stirring within 10 minutes 66 ml of bleaching liquor (= 10 . 45 grams naocl + 0 . 53 gram naoh ). thereby a ph of 9 . 5 was established . after a short time ( 5 minutes ) there took place the release of n 2 and under the development of heat the ph fell to 6 . 5 . the solution was adjusted to a ph of 7 with 10 ml of 1 n naoh . it no longer contained nh 4 cl . 500 ml of an aqueous solution of 20 grams nh 4 cl ( 4 weight %) was treated at 20 ° c . with 14 . 9 grams of naoh and in all in 30 minutes there were blown in 39 . 8 grams of chlorine gas and simultaneously the ph was held at 11 to 11 . 5 by dropping in a solution of 44 . 8 grams of naoh in 100 ml of water . at a temperature increase to 60 ° c . there was a strong release of n 2 and thereupon the ph fell to 6 . 8 . to 700 ml of an aqueous solution of 8 . 54 grams of nh 4 oh ( 1 . 22 weight %) which had a ph of 10 . 4 there were dropped in with stirring at 40 ° c . within 10 minutes 187 ml of bleaching liquor (= 27 . 3 grams naocl + 1 . 38 grams naoh ) whereupon the ph increased to 12 . 6 . after 5 - 7 minutes there began the development of n 2 and the giving off of heat of reaction , whereupon the ph fell to 9 . 2 . within 7 - 10 minutes after the beginning of the addition of the bleaching liquor the temperature increased to 56 ° c . with strong release of n 2 . the solution was adjusted to neutral and was free of nh 4 + . 700 grams of an aqueous 12 weight % hydrochloric acid (= 84 grams hcl ) which contained 10 . 5 grams nh 4 cl (= 1 . 5 weight %) were neutralized with caco 3 and adjusted to ph * with milk of lime . to the solution obtained there were added 7 . 3 grams of ca ( oh ) 2 in the form of milk of lime ( equivalent to the nh 4 cl content ) whereupon the ph increased to 9 . 4 . there were then added at 40 ° c . with stirring within 10 minutes 150 ml of bleaching liquor (= 21 . 9 grams naocl + 1 . 57 grams naoh ) whereupon the ph increased to 10 . 5 . up to 7 minutes of addition time there arose almost no nitrogen , however , after then with an increase in temperature to 57 ° c . there was observed a strong n 2 development . at the end of the reaction the ph of the solution which was 9 . 2 was adjusted to 7 . it contained no nh 4 + ion . to an aqueous solution of 127 . 4 grams of cacl 2 ( 18 . 2 weight %) and 6 . 86 grams of nh 4 oh ( 0 . 98 weight %) which had a ph of 10 . 2 there were added at 40 ° c . within 10 minutes with stirring 150 ml of bleaching liquor (= 21 . 9 grams naocl + 1 . 57 grams naoh ), whereupon the ph increased to 10 . 6 . after 7 minutes of addition time the temperature increased to 57 ° c . and the ph dropped to 9 . 4 with strong n 2 development . the solution adjusted to neutral was free of nh 4 + ions . 700 ml of 14 weight % hydrochloric acid solution containing 4 . 49 grams of nh 4 cl neutralized with dolomite to ph 3 . 4 had the ph adjusted to 8 with milk of lime and treated with an additional 6 . 3 grams of ca ( oh ) 2 ( equivalent amount to the nh 4 cl content ) to give a ph of 8 . 3 and heated to 50 ° c . then there were added within 1 minute 110 ml of chloride of lime solution (= 11 . 2 grams ca ( ocl ) cl = theory + 5 % excess ), whereupon a strong development of nitrogen was released . a sample which was withdrawn after 45 seconds still contained 0 . 78 % of the original nh 4 cl content , i . e ., already 99 . 2 % of the nh 4 cl was destroyed . after 5 minutes the solution was free from nh 4 cl and the ph was 6 . 0 . by addition of a little na 2 so 3 solution or h 2 o 2 the residual content of active chlorine was destroyed . 700 grams ml of a 12 weight % of hcl solution containing 10 . 5 grams of nh 4 cl ( 1 . 5 weight % nh 4 cl ) were employed . it was neutralized with dolomite ( final ph = 3 . 4 ). by addition of milk of lime there was established a ph of 8 and with a further 7 . 3 grams of ca ( oh ) 2 ( an amount equivalent to the nh 4 cl content ) a ph of 8 . 3 . to the solution heated to 50 ° c . there was then added within 1 minute 250 ml of chloride of lime solution (= 26 . 2 grams ca ( ocl ) cl = theory + 5 % excess ) whereby there was released a strong development of nitrogen . after 5 minutes the solution was free of nh 4 cl . the final ph was 8 . 0 . residual active chlorine was removed with na 2 so 3 solution . there was employed 700 ml of a 14 weight % of hcl solution containing 4 . 49 grams of nh 4 cl neutralized with dolomite . this solution was brought to a ph of 8 with milk of lime and adjusted to ph 8 - 9 with a further 6 . 2 grams of ca ( oh ) 2 ( an amount equivalent to the nh 4 cl content ). there were then led into this solution at 50 ° c . for 15 minutes cl 2 in such manner that only a little chlorine got through with the nitrogen developed ( altogether 1 . 5 grams of chlorine got through ). the solution was free of nh 4 cl and still contained 0 . 05 grams of active chlorine that was removed by addition of na 2 so 3 . final ph 8 . 0 . 2 . 8 liters of 14 weight % hydrochloric acid neutralized with dolomite to ph 3 . 4 was adjusted to ph 8 . 0 with milk of lime . the solution contained 15 . 7 grams of nh 4 cl which was converted into n 2 in a continuously operating cascade consisting of 2 × 100 ml round - bottomed flasks . the nh 4 cl containing solution was so added to the first flask together with 253 ml / hour of bleaching liquor (= 32 . 8 grams naocl , i . e ., without excess ) and 150 ml / h naoh (= 11 . 8 grams naoh ) that the feeding of the nh 4 cl containing solution was 46 ml / min , the bleaching liquor 4 . 2 ml / min and the naoh 2 . 5 ml / min . the ph in this way could be held between 6 and 7 ( neutralization delay by slow reaction of precipitated mg ( oh ) 2 with the hydrochloric acid set free ). the main reaction took place in flask 1 , the second flask served merely for post reaction so that the average residence time was about 2 . 5 minutes . with theoretical consumption of bleaching liquor the solution flowing out of the apparatus was free from nh 4 cl .	2
referring to fig1 , an automotive power system 10 for a vehicle 12 may include a high voltage power source 14 ( e . g ., + 300 v battery , ultra capacitor , etc . ), high voltage bus 16 , precharge circuit 18 and contactors 20 , 22 , 24 ( e . g ., switches ). as known in the art , the high voltage bus 16 may supply power from the high voltage battery 14 to various loads , such as an electric machine , etc . the contactor 20 is electrically connected with the battery &# 39 ; s low ( negative ) side and the high voltage bus 16 . the contactor 22 is electrically connected with the battery &# 39 ; s high ( positive ) side and the high voltage bus 16 . the contactor 24 is electrically connected with the high voltage bus 16 and the precharge circuit 18 . the contractors 20 , 22 , 24 may be selectively opened or closed under the control of one or more controllers ( not shown ) in a known fashion . to precharge the system 10 , the contactor 20 is closed and the contactor 24 is subsequently closed as known in the art . precharge of the system 10 is complete when , for example , the voltage across the contactor 24 falls within some acceptable limit ( e . g ., 20 v ), and a predetermined period of time ( e . g ., 150 msec ) has passed . the period of time may be determined based on vehicle test data , etc . once the system 10 has been precharged , the high side contactor 22 is closed and the contactor 24 is subsequently opened . electrical power may then flow from the high voltage battery 14 to loads electrically connected with the high voltage bus 16 . each of the contactors 20 , 22 , 24 may be relatively expensive and add considerable material cost to the vehicle 12 . a reduction in the number of contactors may , therefore , result in a reduction of material cost to the vehicle 12 . referring now to fig2 , numerals of fig2 that differ by 100 relative to the numerals of fig1 are used to designate similar elements in fig2 . unlike the system 10 of fig1 , a single contactor 126 has been electrically connected between the high voltage battery 114 and the high voltage bus 116 . the system 110 thus has only two contactors as opposed to three . referring now to fig3 a and 3b , a double - pole single - throw contactor may include contacts 128 , 130 , 132 , 134 , poles 129 , 133 , a spring - loaded plunger 136 and a coil 138 . the plunger 136 is mechanically connected with the poles 129 , 133 . as known in the art , passing a current through the coil 138 will generate an electromagnetic field that causes the plunger 136 to move such that the pole 129 touches the contacts 128 , 130 , and the pole 133 touches the contacts 132 , 134 respectively . referring now to fig2 , 3 a and 3 b , if the contactor of fig3 a and 3b were to be used as the contactor 126 of fig2 ( the contacts 128 , 130 may be electrically connected with the low side of the power source 114 and the low side of the high voltage bus 116 respectively ; the contacts 132 , 134 may be electrically connected with the high side of the power source 114 and the high side of the high voltage bus 116 respectively ), the system 110 could not be properly precharged as the high side and low side of the power source 114 would be simultaneously connected with the high voltage bus 116 upon activation of the plunger 136 . referring now to fig2 , 4 a and 4 b , the double - pole single - throw contactor 126 may include contacts 140 , 142 , 144 , 146 , poles 141 , 145 , a split ( or dual ) plunger 148 ( of any shape / configuration ), coils 150 , 152 , and a moveable spring - loaded pin 153 . the coil 150 is wound around the split plunger 148 . the coil 152 is wound around the moveable spring - loaded pin 153 . the contact 140 may be electrically connected with the battery &# 39 ; s low side ( as designated by “ a ”). the contact 142 may be electrically connected with the low side of the high voltage bus 116 ( as designated by “ c ”). the contact 144 may be electrically connected with the battery &# 39 ; s high side ( as designated by “ b ”). the contact 146 may be electrically connected with the high side of the high voltage bus 116 ( as designated by “ d ”). the coils 150 , 152 may each be electrically connected with a low voltage source such as a + 12 v battery , etc . ( as designated by “ e ,” “ f ,” “ g ” and “ h ”). in the embodiment of fig4 a and 4b , the split plunger 148 may be spring biased in the open position and include leg portions 154 , 156 . the leg portion 154 is mechanically connected with the pole 141 . the leg portion 156 is mechanically connected with the pole 145 . passing a current through the coil 150 will generate an electromagnetic field that causes the leg portion 154 to move such that the pole 141 touches the contacts 140 , 142 . the same , however , is not necessarily true for the leg portion 156 . the moveable spring - loaded pin 153 , if engaged , may block the leg portion 156 from moving . as such , the poles 141 , 145 may be sequentially closed via control of the moveable spring - loaded pin 153 . referring now to fig5 , the moveable spring - loaded pin 153 may be spring biased such that if no current is passing through the coil 152 , the pin 153 blocks movement of the leg portion 156 . if , however , current is passing through the coil 152 ( and the coil 150 ), the pin 153 may move such that it no longer blocks the path of the leg portion 156 , and the leg portion may move such that the pole 145 touches the contacts 144 , 146 illustrated in fig4 b . in other embodiments , any suitable mechanical or electrical mechanism may be used to block / interfere with the movement of the leg portion 156 . as an example , a mechanical lever may engage / disengage the leg portion 156 . as another example , an electromagnet , a motor and gear arrangement , etc . may be used to move the mechanical mechanism . other arrangements are , of course , also possible . referring again to fig2 , 4 a and 4 b , the coil 150 may be energized ( while the pin 153 is engaged with the leg portion 156 ) to cause the leg portion 154 to move such that the pole 141 touches the contacts 140 , 142 , and the contactor 124 may be closed to precharge the system 110 . once precharge of the system 110 is complete ( e . g ., when the voltage across the contactor 124 falls within an acceptable range and / or a predetermined period of time has based ), the coil 152 may be energized to cause the spring - loaded pin 153 to disengage from the leg portion 156 and to allow the leg portion 156 to move such that the pole 145 touches the contacts 144 , 146 . the contactor 124 may then be opened . electrical power may thus flow from the power source 114 to loads electrically connected with the high voltage bus 116 . those of ordinary skill will recognize that any suitable and / or known controller ( s ) may be arranged with the system 110 in order to control the contactors 124 , 126 . for example , one or more controllers may control the activation of the coils 150 , 152 to achieve the sequential closing of the poles 141 , 145 as described above . while embodiments of the invention have been illustrated and described , it is not intended that these embodiments illustrate and describe all possible forms of the invention . the words used in the specification are words of description rather than limitation , and it is understood that various changes may be made without departing from the spirit and scope of the invention .	8
in otn transmission , oh information in a client signal may not be transmitted transparently in a given transmission section . fig1 and fig2 illustrate an example of otn transmission . in transmission systems 200 and 300 illustrated in fig1 and fig2 , a client signal d 1 is input from network equipment a , passed through network equipment b , and then output from network equipment c . as illustrated in fig1 , the client signal d 1 in the transmission system 200 may be a synchronous digital hierarchy ( sdh )/ ethernet ( registered trademark ) signal or an otuk signal in a low - level ( lower ) layer . in an otuk section of the pieces of network equipment a and b and an otuk section of the pieces of network equipment b and c in an oduk path between the pieces of network equipment a and c , otuk oh information is terminated . the client signal d 1 input to a transmission device 210 a of the network equipment a is mapped into a payload of an otuk signal in a high - level ( upper ) layer , and is then transmitted to a transmission device 210 b of the network equipment b . the client signal d 1 is transmitted through the transmission device 210 b to a transmission device 210 c of the network equipment c , extracted by the transmission device 210 c from the payload of the otuk signal in the high - level ( upper ) layer , and then output . the client signal d 1 input to the network equipment a and output from the network equipment c is mapped into the payload of the otuk signal in the high - level ( upper ) layer , and then transmitted . therefore , the oh information in the client signal d 1 is transparently transmitted without being terminated . as illustrated in fig2 , in the transmission system 300 , a multiplex ( otuk ) layer on the side of a client signal input to network equipment a and a multiplex ( otuk ) layer on the side of a transmission line ( between the pieces of network equipment a , b , and c ) are substantially identical with each other , and , for example , an otu4 is used on both of the client signal side and the transmission line side . in this case , in the standard , otuk oh information is terminated on the input side , and the values are rewritten on the output side . for example , a transmission device 310 a of the network equipment a terminates and rewrites the otuk oh information of the client signal d 1 , and transmits the otuk oh information to a transmission device 310 b of the network equipment b . the transmission device 310 b terminates and rewrites the otuk oh information transmitted from the transmission device 310 a , and transmits the otuk oh information to a transmission device 310 c of the network equipment c . the transmission device 310 c terminates and rewrites the otuk oh information transmitted from the transmission device 310 b , and outputs the otuk oh information . the oh information in the client signal d 1 input to the network equipment a and output from the network equipment c is rewritten to different values , and therefore may not be transmitted transparently . constitutions having substantially the same or similar functions may be identified by the same reference symbols , and repeated description thereof may be omitted or reduced . fig3 illustrates an example of a transmission system . in a transmission system 1 of fig3 , a client signal may be input from network equipment a , passed through network equipment b , and then output from network equipment c . a similar description may be applied to a client signal in an opposite direction from that of fig3 . as illustrated in fig3 , in the transmission system 1 , a multiplex ( otuk ) layer on the side of the client signal input to the network equipment a and a multiplex ( otuk ) layer on the side of a transmission line ( between the pieces of network equipment a , b , and c ) may be substantially identical with each other . for example , an otu4 may be used on both of the client signal side and the transmission line side . otuk oh information is terminated in an otuk section ( between a and b ) and an otuk section ( between b and c ) in an oduk path between the pieces of network equipment a and c . transmission devices 10 a , 10 b , and 10 c that transmit the client signal by an otn transmission system are provided to the pieces of network equipment a , b , and c , respectively . fig4 illustrates an example of hardware configuration of a transmission system . the transmission system illustrated in fig4 may be the transmission system 1 illustrated in fig3 . as illustrated in fig4 , the transmission device 10 a includes an optical / electricity ( o / e ) converting unit 11 a , a frame processing unit 12 a , and an electricity / optical ( e / o ) converting unit 13 a . the frame processing unit 12 a includes a forward error correction ( fec ) processing unit 121 a , an otuk oh processing unit 122 a , an oduk frame generating unit 123 a , and an fec inserting unit 124 a . similarly , the transmission device 10 b includes an o / e converting unit 11 b , a frame processing unit 12 b , and an e / o converting unit 13 b . the frame processing unit 12 b includes an fec processing unit 121 b , an otuk oh processing unit 122 b , an oduk frame generating unit 123 b , and an fec inserting unit 124 b . similarly , the transmission device 10 c includes an o / e converting unit 11 c , a frame processing unit 12 c , and an e / o converting unit 13 c . the frame processing unit 12 c includes an fec processing unit 121 c , an otuk oh processing unit 122 c , an oduk frame generating unit 123 c , and an fec inserting unit 124 c . for convenience , the configuration and functions of the transmission device 10 a will be described in the following . however , the configuration and functions of the other transmission devices may be substantially the same or similar . the o / e converting unit 11 a converts the client signal , for example , an optical signal into an electric signal , and then outputs the electric signal after the conversion to the frame processing unit 12 a . the frame processing unit 12 a subjects an otn frame included in the electric signal to given frame processing , and outputs the electric signal after the processing to the e / o converting unit 13 a . the e / o converting unit 13 a converts the electric signal processed by the frame processing unit 12 a into an optical signal , and then transmits the optical signal . the optical signal converted by the e / o converting unit 13 a is transmitted to the transmission device 10 b via the otuk section ( between a and b ). the fec processing unit 121 a subjects payload data of the otn frame to error correction code processing , and then outputs the frame after the processing to the otuk oh processing unit 122 a and the oduk frame generating unit 123 a . the otuk oh processing unit 122 a stores various kinds of operation information in an otuk overhead region within the frame to be processed by the oduk frame generating unit 123 a . the oduk frame generating unit 123 a subjects the frame ( oduk frame ) to given processing . the fec inserting unit 124 a inserts an fec code into the frame generated by the oduk frame generating unit 123 a , and then outputs the frame to the e / o converting unit 13 a . the frame processing unit 12 a saves overhead information ( otuk oh information ) that is included in the input signal and is an object of termination in the oduk path , to a given unused region within the frame based on a user setting . for example , when a setting for saving the otuk oh information is made by a user , the otuk oh processing unit 122 a saves the otuk oh information of the input client signal to the given unused region within the frame to be processed by the oduk frame generating unit 123 a . the frame processing unit 12 a writes back and restores the overhead information ( otuk oh information ) included in the input signal and saved to the unused region of the frame to the original position within the frame based on a user setting . for example , when a setting for restoring the otuk oh information is made by the user , the otuk oh processing unit 122 a writes back and restores , to the original oh region , the otuk oh information saved to the unused region within the frame to be processed by the oduk frame generating unit 123 a . the user setting for saving or restoring the otuk oh information may be made by console operation on the transmission device itself , or may be made via an external device such as a network monitoring device that monitors the pieces of network equipment a , b , and c or the like . for example , the transmission device 10 a of the network equipment a may be set to save the otuk oh information , and the transmission device 10 c of the network equipment c may be set to restore the otuk oh information . as illustrated in fig3 , a client signal is input to the transmission device 10 a ( s 1 ). oh information 20 of the client signal includes a frame alignment signal ( fas ) 21 , otuk oh information 22 , and oduk oh information 23 . the transmission device 10 a is set to save the otuk oh information 22 as an object of termination . therefore , the frame processing unit 12 a of the transmission device 10 a saves the otuk oh information 22 stored in a region r 1 to a region r 2 storing an unused res ( reserved byte ) in the oduk oh information 23 within the frame ( s 2 ). the frame in which the otuk oh information 22 included in the client signal is saved to the unused region r 2 is thus transmitted in the oduk path . in the otuk section ( between a and b ), the otuk oh information in the region r 1 is overwritten and terminated ( s 3 ). in the otuk section ( between b and c ), the otuk oh information in the region r 1 is overwritten and terminated ( s 4 ). the transmission device 10 c is set to restore the otuk oh information 22 as an object of termination . therefore , the frame processing unit 12 c of the transmission device 10 c checks for the presence or absence of a transmission line alarm and / or the normality of the otuk oh information 22 saved in the unused region r 2 within the frame ( s 5 ). when there is no transmission line alarm , and the normality of the otuk oh information 22 is confirmed , the frame processing unit 12 c writes back and restores , to the original region r 1 , the otuk oh information 22 saved in the unused region r 2 within the frame ( s 6 ). the otuk oh information 22 of the client signal input to the transmission device 10 a is restored , and then output from the transmission device 10 c ( s 7 ). fig5 a illustrates an example of processing on a transmitting side . fig5 b illustrates an example of processing on a receiving side . as illustrated in fig5 a , the frame processing units 12 a , 12 b , and 12 c determine whether or not to save the otuk oh information 22 based on a user setting ( s 10 ). the transmission device 10 a is set to save the otuk oh information 22 . thus , the frame processing unit 12 a determines that the frame processing unit 12 a is to perform saving ( s 10 : yes ). the frame processing units 12 b and 12 c are not set to save the otuk oh information 22 . thus , the frame processing units 12 b and 12 c determine that the frame processing units 12 b and 12 c are not to perform saving ( s 10 : no ). because the frame processing unit 12 a is to perform saving , the frame processing unit 12 a performs saving processing that saves the otuk oh information 22 stored in the region r 1 to the unused region r 2 within the frame ( s 11 ). fig6 and fig7 illustrate an example of overhead information . fig6 illustrates the position of the region r 1 . fig7 illustrates the position of the region r 2 . as illustrated in fig6 , information such as a section monitoring ( sm ), a general communication channel 0 ( gcc0 ), and an res or the like stored in the region r 1 is saved . information to be saved among the sm , the gcc0 , and the res may be arbitrarily selected by a user setting , for example . as illustrated in fig7 , the unused region r 2 in the oh information 20 includes an res ( row 2 , 3 bytes ), an exp ( row 3 , 2 bytes ), and an res ( row 4 , 6 bytes ), or the like . a region as a saving destination in the region r 2 may be a single region or an arbitrary combination of a plurality of regions based on a user setting . the region as a saving destination in the otuk oh information 22 is not limited to a region within the oh information 20 , but may be within a payload as long as the region is an unused region within the frame . fig8 illustrates an example of an otu4 frame . as illustrated in fig8 , the otuk oh information 22 may be saved to arbitrary bytes in a region r 3 of fixed stuff bytes ( columns 3817 to 3824 , 32 bytes ) within the payload . the region as a saving destination in the otuk oh information 22 may not be only within the identical frame that includes the otuk oh information 22 , but may be an unused region in one of a previous frame and a subsequent frame based on a user setting . fig9 illustrates an example of frames as saving destinations . as illustrated in a case c 1 of fig9 , the frame processing unit 12 a may save the otuk oh information 22 stored in the region r 1 of a frame ( n ) to the region r 2 of the identical frame . as illustrated in a case c 2 , the frame processing unit 12 a may save the otuk oh information 22 stored in the region r 1 of the frame ( n ) to the region r 2 of a previous frame ( n − 1 ). as illustrated in a case c 3 , the frame processing unit 12 a may save the otuk oh information 22 stored in the region r 1 of the frame ( n ) to the region r 2 of a subsequent frame ( n + 1 ). in saving and restoring the otuk oh information 22 to and from the unused region of one of the previous frame and the subsequent frame , data for restoration , for example , frame information , and / or the otuk oh information 22 to be saved and restored are / is temporarily stored in a memory . the temporarily stored data may be processed in accordance with frames processed sequentially . as illustrated in fig5 b , the frame processing units 12 a , 12 b , and 12 c determine whether or not to write back the otuk oh information 22 saved to the region r 2 or r 3 based on a user setting ( s 20 ). the transmission device 10 c is set to restore the otuk oh information 22 , for example , and therefore the frame processing unit 12 c determines that the frame processing unit 12 c is to perform writing back ( s 20 : yes ). the frame processing units 12 a and 12 b are not set to restore the otuk oh information 22 , and therefore determine that the frame processing units 12 a and 12 b are not to perform writing back ( s 20 : no ). when writing back is not to be performed , the processing is ended . because the frame processing unit 12 c is to perform writing back , the frame processing unit 12 c determines whether or not a transmission line alarm is absent and whether or not the otuk oh information 22 is normal ( s 21 ). for example , the frame processing unit 12 c determines whether or not the input signal includes signal disappearance ( loss of signal )/ frame synchronization loss ( loss of frame ) information ( los / lof information ), a transmission line alarm such as an alarm indication signal ( ais ) alarm or the like . the frame processing unit 12 c may determine the normality of the saved otuk oh information 22 by checking the saved otuk oh information 22 . for example , in the sm in the otuk oh information 22 , the normality may be determined based on source access point identifier / destination access point identifier information ( sapi / dapi information ) and / or bit interleaved parity ( bip ) 8 information . when the transmission line alarm is absent , and the normality of the otuk oh information 22 is confirmed ( s 21 : yes ), the frame processing unit 12 c performs writing - back processing that writes back and restores the otuk oh information 22 saved in the unused region r 2 or r 3 within the frame to the original region r 1 ( s 22 ). the writing - back processing is performed after it is confirmed that there is no transmission line alarm and the normality of the otuk oh information 22 is confirmed . therefore , even when the saved otuk oh information 22 is lost due to an abnormality in the oduk path , the restoration using wrong information , for example , the fixed pattern of the ais signal may be reduced . in the above - described writing - back processing , based on a user setting , the frame processing unit 12 c reads the otuk oh information 22 saved to the arbitrarily selected region r 2 or r 3 , and restores the otuk oh information 22 to the original region r 1 . also in the case where the otuk oh information 22 is saved to the unused region of one of the previous frame and the subsequent frame , the frame processing unit 12 c similarly restores the otuk oh information 22 by temporarily storing appropriate data in a memory in advance and processing the temporarily stored data in accordance with frames processed sequentially . in the transmission system 1 , the transmission device 10 a saves the otuk oh information 22 , which is included in a frame of the client signal and is an object of termination in the oduk path , to the unused region r 2 within the frame , and transmits an optical signal including the frame in which the otuk oh information 22 is saved to the unused region r 2 . after the transmission device 10 c restores the saved otuk oh information 22 by writing back the otuk oh information 22 saved to the region r 2 in the frame included in the received optical signal to the original position , the transmission device 10 c outputs the signal including the restored frame . therefore , in the transmission system 1 , the otuk oh information 22 of the input signal is transmitted transparently in the transmission section in which the otuk oh information 22 is terminated . transparently transmitting the otuk oh information 22 in the section from the network equipment a to the network equipment c , for example , the sections of the network equipment b provides a great advantage also in network management . for example , when the service area of the transmission system 1 becomes larger , realizing service in the entire area with only the network equipment of one communication carrier may result in poor cost effectiveness . as a measure , operation may be performed in which the network equipment of another communication carrier is rented . however , in the case of the operation in which the network equipment of another communication carrier is rented , the monitoring of the entire network may be affected . for example , when the network equipment b illustrated in fig3 is equipment rented from another communication carrier , the monitoring of the sections of the network equipment b may be difficult due to differences in specifications related to network management or the like . for example , when the otuk oh information 22 is transmitted transparently in the sections of the network equipment b , the sections of the network equipment b may be treated as equivalent to a simple light transmission line . the network management may therefore be performed without awareness of the sections of the network equipment b . fig1 illustrates an example of a transmission system . as illustrated in fig1 , in a transmission system 1 a , when a frame processing unit 12 a of a transmission device 10 a saves otuk oh information 22 , the frame processing unit 12 a inserts ( stores ), into a region r 2 , saving information indicating that the otuk oh information 22 is saved ( s 2 a ). a frame processing unit 12 c of a transmission device 10 c detects the saving information stored in the region r 2 ( s 5 a ). when the saving information is stored , the frame processing unit 12 c writes back the otuk oh information 22 saved to the region r 2 . fig1 a illustrates an example of processing on a transmitting side . the processing illustrated in fig1 a may be performed in the transmission system la illustrated in fig1 . as illustrated in fig1 a , frame processing units 12 a , 12 b , and 12 c determine whether or not to save the otuk oh information 22 based on a user setting ( s 10 ). the transmission device 10 a is set to save the otuk oh information 22 , for example . thus , the frame processing unit 12 a determines that the frame processing unit 12 a is to perform saving ( s 10 : yes ). the frame processing units 12 b and 12 c are not set to save the otuk oh information 22 . the frame processing units 12 b and 12 c therefore determine that the frame processing units 12 b and 12 c are not to perform saving ( s 10 : no ). the frame processing unit 12 a is to perform saving . the frame processing unit 12 a therefore performs saving processing that sets ( stores ) saving information indicating saving in the unused region r 2 within the frame ( s 10 a ) and that saves the otuk oh information 22 in the region r 2 ( s 11 ). as illustrated in fig1 b , the frame processing units 12 a , 12 b , and 12 c determine whether or not to write back the otuk oh information 22 saved to the region r 2 or a region r 3 based on a user setting ( s 20 ). the transmission device 10 c is set to restore the otuk oh information 22 , for example . thus , the frame processing unit 12 c determines that the frame processing unit 12 c is to perform writing back ( s 20 : yes ). the frame processing units 12 a and 12 b are not set to restore the otuk oh information 22 . the frame processing units 12 a and 12 b therefore determine that the frame processing units 12 a and 12 b are not to perform writing back ( s 20 : no ). when writing back is not to be performed , the processing is ended . the frame processing unit 12 c is to perform writing back . thus , the frame processing unit 12 c refers to the region r 2 , and determines whether or not the saving information is detected ( s 21 a ). when the saving information is not detected ( s 21 a : no ), the otuk oh information 22 is not saved in the region r 2 , and therefore the frame processing unit 12 c ends the processing without performing the writing - back processing . when the saving information is detected ( s 21 a : yes ), the otuk oh information 22 is saved to the region r 2 , and therefore the frame processing unit 12 c performs the writing - back processing ( s 22 ). when whether or not to perform the writing - back processing is determined based on a transmission line alarm and the like , a plurality of alarms may be integrated . when the saving information is used , for example , only the monitoring of the region r 2 is performed , so that a processing configuration may be simplified . in a case where normality is determined based on sapi / dapi information in an sm and the writing - back processing is performed , the sapi / dapi information is transferred in multiple frames . therefore the determination may be made after reception of a plurality of frames . when the saving information is used , for example , only the monitoring of the region r 2 within one frame is performed , so that an instant determination may be made . even when the monitoring of the region r 2 is performed , another method such as the transmission line alarm and the like may be used for the determination , for example . when normality is determined based on bip8 information in the sm , and the writing - back processing is performed , an instant determination may be made because the bip8 information is information that precedes by two frames . for example , error information of the bip8 information does not include the oh region . thus , when saving is performed to an oh region , the determination of exact normality may be difficult . when the saving information is used , the saving information is stored in the same region as the saved otuk oh information 22 . therefore a more accurate determination may be made . when normality is determined based on gcc0 information , and the writing - back processing is performed , there is a possibility of the gcc0 information being a random signal , so that the determination of normality may be difficult . in the case where the saving information is used , for example , even when a signal in a format that makes the determination of normality difficult such as the gcc0 information or the like is saved , the determination of normality may be made . fig1 illustrates an example of processing of a transmission system . fig1 represents a ladder chart of operation of a transmission system 1 b . a configuration of the transmission system 1 b may be substantially the same as or similar to those of the transmission systems 1 and 1 a , and therefore description thereof may be omitted and reduced . as illustrated in fig1 , in the transmission system 1 b , a master side that saves otuk oh information 22 and transmits the otuk oh information 22 ( transmission device 10 a ) makes a test transmission for all of unused regions r 2 within a frame to a slave side that restores the otuk oh information 22 ( transmission device 10 c ). the transmission device 10 a determines a region r 2 in which there is a response to the test transmission from the transmission device 10 c as a candidate destination to which the otuk oh information 22 is saved . for example , the transmission device 10 a adds a given test flag to all of unused regions r 2 ( all of saving candidate destinations ) within a frame , and makes a transmission ( s 30 ). when a usually unused region r 2 is used between the transmission devices 10 a and 10 c , the added test flag is rewritten into other data . therefore , when the transmission device 10 c confirms the given test flag , it may be confirmed that the region r 2 is unused between the transmission devices 10 a and 10 c . the transmission device 10 c receives the frame in which the test flags are added ( s 31 ), adds a response flag to the regions r 2 as candidate destinations in which the given test flags are received , and then returns the frame ( s 32 ). the transmission device 10 a receives the frame in which the response flags are added ( s 33 ), and determines the regions r 2 to which the response flags are added as candidate destinations to which the otuk oh information 22 is saved ( s 34 ). therefore , in the transmission system 1 b , the otuk oh information 22 is saved to the regions r 2 not used between the transmission devices 10 a and 10 c , for example , by the network equipment b . fig1 a illustrates an example of processing on a master ( transmitting ) side . as illustrated in fig1 a , the frame processing unit 12 a determines whether or not to save the otuk oh information 22 based on a user setting ( s 40 ). when the frame processing unit 12 a is not to perform saving ( s 40 : no ), the frame processing unit 12 a ends the processing . when the frame processing unit 12 a is to perform saving ( s 40 : yes ), the frame processing unit 12 a sets a given test flag in a plurality of regions r 2 unused within a frame ( s 41 ). an res ( row 2 , 3 bytes ), an exp ( row 3 , 2 bytes ), an res ( row 4 , 6 bytes ), fixed stuff bytes within a payload , and the like may be used as the regions r 2 in which the test flags are set . the frame processing unit 12 a transmits the frame in which the test flags are set to the slave side via an e / o converting unit 13 a ( s 42 ). the frame processing unit 12 a determines whether or not there is a response flag from the slave side ( s 43 ). when there is no response flag from the slave side ( s 43 : no ), the frame processing unit 12 a determines whether or not a time - out has occurred ( s 44 ). when the time - out has not occurred ( s 44 : no ), the frame processing unit 12 a sets the processing in a waiting state . when the time - out has occurred ( s 44 : yes ), the frame processing unit 12 a makes an abnormal end because there is no region r 2 as a candidate for a saving destination and thus saving is difficult ( s 45 ). in the case of the abnormal end , the user may be notified by outputting an alert , for example , that it is difficult to save the otuk oh information 22 . when there is a response flag from the slave side ( s 43 : yes ), the frame processing unit 12 a determines whether or not there is otuk oh information 22 that can be used in ( that can be saved to ) the region r 2 to which the response flag is added ( s 46 ). for example , when various kinds of information of the otuk oh information 22 can be stored in the region r 2 to which the response flag is added , it may be determined that the information can be saved . the frame processing unit 12 a sets a saving location of the otuk oh information 22 , which is determined to be able to be saved , in the region r 2 to which the response flag is added ( s 47 ). fig1 b illustrates an example of processing on the slave ( receiving ) side . as illustrated in fig1 b , the frame processing unit 12 c determines whether or not to save the otuk oh information 22 based on a user setting ( s 50 ). when the frame processing unit 12 c is not to perform saving ( s 50 : no ), the frame processing unit 12 c ends the processing . when the frame processing unit 12 c is to perform saving ( s 50 : yes ), the frame processing unit 12 c extracts information from the plurality of regions r 2 unused within the frame ( s 51 ), and determines whether or not there is a test flag from the master side ( s 52 ). when there is no test flag ( s 52 : no ), the frame processing unit 12 c determines whether or not a time - out has occurred ( s 53 ). when the time - out has not occurred ( s 53 : no ), the frame processing unit 12 c sets the processing in a waiting state . when the time - out has occurred ( s 53 : yes ), the frame processing unit 12 c ends the processing . when there is a test flag ( s 52 : yes ), the frame processing unit 12 c sets a response flag in the region r 2 in which the test flag is detected ( s 54 ), and transmits the frame in which the response flag is set to the master side via an e / o converting unit 13 c in an opposite direction from fig4 ( s 55 ). all examples and conditional language recited herein are intended for pedagogical purposes to aid the reader in understanding the invention and the concepts contributed by the inventor to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions , nor does the organization of such examples in the specification relate to a showing of the superiority and inferiority of the invention . although the embodiments of the present invention have been described in detail , it should be understood that the various changes , substitutions , and alterations could be made hereto without departing from the spirit and scope of the invention .	7
fig2 is a plan view showing the construction of the surface of one of the glass substrates constituting the liquid crystal display device of the present invention on the liquid crystal side . this glass substrate is in a state wherein a disconnection or short - circuit condition of each signal line can be inspected . in the drawing , a glass substrate 1 has a size somewhat greater than the glass substrate that actually constitutes the liquid crystal display device . in other words , this glass substrate 1 is cut along dotted line q in the drawing in a subsequent process and its peripheral regions are removed . gate signal lines 2 extending in an x - direction and juxtaposed in a y - direction in the drawing are formed on the surface of the glass substrate 1 on the liquid crystal side , and drain signal lines 3 extending in the y - direction and juxtaposed in the x - direction are so formed as to be insulated from these gate signal lines 2 . a rectangular area encompassed by each gate signal line 2 and each drain signal line 3 ( for example , the area encompassed by dotted line a ) becomes a pixel area . as shown in fig3 which is an enlarged view of a part ( upper left - hand portion ) of fig2 this area includes a thin film transistor tft , which is turned on by a gate signal from the gate signal line 2 , and a transparent pixel electrode ito to which a drain signal from the drain signal line 3 is applied through the thin film transistor tft when it is turned on . the pixel area further includes an additional capacitor cadd so as to accumulate the drain signal for a long time when the thin film transistor tft is turned off . therefore , in the pixel area on the line of the gate signal line 2 to which the gate signal is applied , the drain signal ( pixel signal ) is supplied to the pixel electrode ito from each signal line 3 , and a potential difference is generated between this pixel electrode ito and a common electrode formed on the other glass substrate on the liquid crystal side , not shown , so as to modulate the light transmission factor of the liquid crystal in that region . one of the ends ( left - hand end portion in the drawing ) of each gate signal line 2 extends to the position on the surface of the glass substrate which is later cut off in the subsequent process , and is connected in common to a common terminal 2a for inspection . each gate signal line 2 has a relatively large width in the proximity of the portion which later will become an actual glass substrate la after separation and forms an external terminal 2t . further , a terminal 2t for individual inspection is formed at the other end ( right - hand end portion in the drawing ) of each gate signal line . similarly , each of the drain signal lines 3 extends at one of the end portions thereof to a position on the surface of the glass substrate which is later cut off in a subsequent process , and is connected in common to a common terminal 3a for inspection , which is formed at this portion . each drain signal line 3 has a relatively large width in the proximity of the portion which will become an actual glass substrate la after cut - off and forms an external terminal 3t . further , a terminal 3t for individual inspection is formed at the other end of each drain signal line 3 . in this case , the drain signal lines 3 have a construction such that the drain signals are supplied to them by image driving circuits disposed on the upper and lower sides in the drawing . therefore , every other one of the drain signal lines 3 will include an external terminal 3t on the upper side in the drawing which are connected in common to the common terminal 3a for inspection . the other drain signal lines 3 include the external terminal 3t on the lower side in the drawing and are connected in common to the common terminal 3a for inspection . a common wiring 10 for so - called electrostatic protection is formed between a sealing material 5 encompassing the area into which the liquid crystal is sealed and a display area comprising the group of the pixel areas . this common wiring 10 for electrostatic protection comprises a common wiring 10g for first electrostatic protection which extends in an orthogonal direction while being insulated from each gate signal line 3 and is connected to each gate signal line 3 through a diode for electrostatic protection ( not shown in fig2 ) and a common wiring 10d for second electrostatic protection which extends in an orthogonal direction while being insulated from each drain signal line 2 and is connected to the drain signal line through a diode for electrostatic protection ( not shown in fig2 ). in this case , the common wirings 10g for first electrostatic protection are formed on both sides ( right and left sides in the drawing ) of the gate signal lines 3 and the common wirings 10d for second electrostatic protection are formed on both sides ( upper and lower sides in the drawing ) of the drain signal lines 3 . as shown in detail in fig3 ( corresponding to the upper left - hand portion of fig2 ) but not shown in fig2 the diode for electrostatic protection comprises a diode dg1 connected in the forward direction between each gate signal line 2 on the external terminal 2t ( terminal 2t for inspection on the other - side ) side , and the common wiring 10g for first electrostatic protection and a diode dg2 connected in the forward direction between the common wiring 10g and the gate signal line 2 on the display area side , in connection with each of the gate signal line 2 . as to each of the drain signal lines 3 , the diode for electrostatic protection comprises a diode dd1 connected in the forward direction between the drain signal line 3 on the external terminal 3t ( terminal 3t for inspection on the other hand ) side and the common wiring 10d for second electrostatic protection and a diode dd2 connected in the forward direction between the common wiring 10d and the drain signal line 3 on the display area side . incidentally , each of these diodes is of a mis type fabricated in substantially the same production process as the thin film transistor tft inside the display area , and is formed in a state that its gate electrode and its drain electrode are connected . as can be seen from fig4 showing in detail the lower left - hand portion of the glass substrate 1 shown in fig2 one diode for electrostatic protection , which is formed between the drain signal line 3 and the common wiring 10d for second electrostatic protection , is disposed on one of the sides of the display area and on the opposite side to the diode for electrostatic protection disposed on the adjacent drain signal line 3 . in other words , the electrostatic protection diodes on the gate signal lines 2 are disposed at the same positions ( portions on one of the sides of the display area ) in the same way as the adjacent gate signal lines 2 , whereas the electrostatic protection diodes on the drain signal lines 3 are disposed at every other position on one of the sides of the display area , in order to carry out an inspection of the disconnection or short - circuit condition of each signal line 2 , 3 as will be later described in detail . in this embodiment , the common wiring 10g for first electrostatic protection and the common wiring 10d for second electrostatic protection are formed in such a way as to be electrically insulated from each other through an insulation portion x . as can be seen from fig2 for example , the isolation portion x is positioned at each corner of the display area and moreover , the end portion of each common wiring 10g , 10d at the isolation portion x has a relatively large area . the glass substrate 1 formed at this stage is fundamentally completed as the transparent substrate of one of the substrates of the liquid crystal display device and at this point , the disconnection or short - circuit condition of each signal line 2 , 3 is inspected . ( 1 ) inspection between the gate signal line 2 and the drain signal line 3 : an inspection probe is brought into contact between the common terminal 2a on the gate signal lines 2 side and the common terminal 3a on the drain signal lines 3 side , and a current flowing between them is measured . any short - circuit between the gate signal line 2 and the drain signal line 3 can be detected by the measured value . in this case , the common wiring 10g for electrostatic protection on the gate signal lines 2 side and the common wiring 10d for electrostatic protection on the drain signal lines 3 side are electrically isolated from each other as already described . therefore , the inspection of a short - circuit condition between the gate signal lines 2 and the drain signal lines 3 can be effected without being affected at all by these common wirings . the inspection probe is brought into contact between the common terminal 3a on one of the sides ( upper side in the drawing ) of the drain signal lines 3 and the common terminal 3a on the other side ( lower side in the drawing ), and a current flowing between them is measured . a short - circuit between the drain signal lines 3 can be detected by the measured value . in this case , when the diode for electrostatic protection is formed on each drain signal line 3 on one of the sides thereof ( upper side in the drawing ), the diode for electrostatic protection is not formed on the other side in the construction of the invention . in other words , the adjacent drain signal lines 3 are completely insulated electrically from one another . therefore , the inspection can be carried out with high reliability . the inspection probe is brought into contact between the common terminal ( 2a or 3a ) of the signal line to be inspected and the independent terminal ( 2t or 3t ) of the signal line , and the current flowing between them is measured . because the common wirings , etc , of the diodes for electrostatic protection employ the construction described above , the inspection of a disconnection or short - circuit condition of each signal line can be carried out efficiently and with high reliability . the glass substrate 1 in which a disconnection or short - circuit is not found in this way is used to constitute the liquid crystal display device with the other glass substrate different from this glass substrate 1 . here , the other glass substrate has the common transparent electrodes which have been already formed on the face thereof on the liquid crystal side and which are common to each pixel area , and with color filters if this liquid crystal display device is a color display device . fig1 is a partial exploded perspective view showing the state wherein the other glass substrate 12 is assembled with the glass substrate 1 described above on the liquid crystal side of the latter . though the portion of the glass substrate 1 where its inspection terminals 2a and 3a are formed are cut and separated in this drawing , this cut and separation may be naturally carried out before or after this assembly . in this drawing , the other glass substrate 12 is disposed on the glass substrate 1 on the liquid crystal side through the sealing material so that the peripheral portion of the other glass substrate 12 can be positioned to the portion of the sealing material 5 . in this case , the other glass substrate 12 is disposed while the conductor 13 is disposed at the isolation portion x of the common wiring layers 10g and 10d of the diodes for first and second electrostatic protection of the glass substrate 1 in this embodiment . because the end portion of each common wiring layer 10g , 10d at this isolation portion x has a relatively large area as already described , the conductor 13 can be disposed in such a way as to sufficiently extend over them . moreover , since the conductor 13 is sandwiched between the glass substrates 1 and 12 , it can maintain its position as it is . this conductor 13 is disposed in order to electrically connect the common wiring layers 10g and 10d for first and second electrostatic protection , which are so formed as to be mutually isolated on the glass substrate 1 , at the time of the assembly of the liquid crystal display device . therefore , the material of the conductor 13 is not particularly limited so long as this purpose can be achieved . however , the conductor for leading out the common electrodes , formed on the surface of the other glass substrate 12 on the liquid crystal side , to the external terminal side formed on one of the glass substrates 1 is ordinarily made of a conductive paste , such as a silver paste or a conductive bead having a conductor film formed on the surface of a plastic bead . therefore , when these conductors are used as they are , the trouble of separately forming the conductor 13 can be eliminated . when the common wirings 10g and 10d for first and second electrostatic protection are mutually connected at the time of assembly of the liquid crystal display device as described above , the inspection of a disconnection or short - circuit condition of each signal line to be carried out prior to the assembly can be made without being affected by the common wirings 10g and 10d , and subsequent countermeasures for preventing static electricity can be effected with high reliability . because the common wirings 10g and 10d for first and second electrostatic protection are mutually connected , static electricity can be quickly dissipated even when a charging of static electricity occurs . the liquid crystal cell of the liquid crystal display device is constituted in this way , and the liquid crystal is sealed in between the glass substrate 1 and the glass substrate 12 through a feed port disposed in advance in a part ( not shown ) of the sealing member 5 . after the liquid crystal is sealed in , the feed port formed in the sealing member 5 is naturally closed completely . as is obvious from the foregoing explanation , the liquid crystal display panel according to the present invention can form the common wirings for electrostatic protection to be formed during its production process , with the necessary portions in a disconnected state . when the common wirings for electrostatic protection can be formed in this manner , even when the inspection terminal to which the gate signal lines are connected in common and the inspection terminal to which the drain signal lines are connected in common are formed on the surfaces of the transparent substrates that are later cut off , each of these signal lines can be constituted without being effected at all electrically by the common wirings for electrostatic protection . accordingly , the inspection of a disconnection or short - circuit condition of each signal line and the measures for preventing static electricity for the thin film transistors can be sufficiently achieved . in the embodiment described above , the common terminals for inspecting each signal line , etc , are formed as shown in the drawings , but they are not particularly limited to the arrangement shown in the drawing . when the common wirings 10g and 10d for electrostatic protection are formed to be freely isolated , the possibility that the common terminals for inspection can be formed more effectively than in this embodiment can be obtained . the embodiment described above employs the construction wherein the drain signal lines 3 are fed with a drain signal by the image driving circuits disposed on the upper and lower sides of the glass substrate 1 , respectively . therefore , the drain signal lines 3 that are alternately disposed are equipped with the external terminal 3t on the upper side and the drain signal lines 3 are equipped with the external terminals 3t on the lower side . however , the present invention is not particularly limited to this construction . in other words , a similar effect can be naturally obtained by disposing all the external terminals 3t on one of the sides of the glass substrate 1 , which are connected in common to the common terminal 3a for inspection . as is obvious from the foregoing description , a liquid crystal display device according to the present invention can sufficiently carry out the inspection of a disconnection or short - circuit condition of the signal lines and can take sufficient countermeasures against static electricity affecting the thin film transistors .	6
referring now to fig2 the watch guard of the present invention is shown generally at 10 worn by a user 12 , to protect the watch 13 , especially the crystal 14 . as shown in fig3 and 6 , the watch guard of the preferred embodiment of the present invention is shown at 10 . the watch guard of the preferred embodiment of the present invention 10 consists of a wide body central portion 16 , a longitudinal axis 18 , and a pair of extensions 20 , 22 also having a longitudinal axis 24 and 26 , respectively . additionally each of the extensions 20 and 22 include fasteners 28 which in the preferred embodiment are hooks 30 and loops 32 . as shown in fig4 and 7 , the watch guard of a first alternate embodiment of the present invention shown at 10 &# 39 ; and consists of a wide body central portion 16 &# 39 ;, a longitudinal axis 18 &# 39 ; and a pair of extensions 20 &# 39 ;, 22 &# 39 ; also having a longitudinal axis 24 &# 39 ; and 26 &# 39 ;, respectively . additionally , each of the extensions 20 &# 39 ; and 22 &# 39 ; include fasteners 28 &# 39 ; which in the first alternate embodiment consists of a male portion 29 &# 39 ; and a female portion 31 &# 39 ; of a snap 32 &# 39 ;. as shown in fig5 and 8 , the watch guard of the second alternate embodiment of the present invention is 10 &# 34 ;. the watch guard of the second embodiment of the present invention 10 &# 34 ; consists of a wide body central portion 16 &# 34 ;, a longitudinal axis 18 &# 34 ;, and a pair of extensions 20 &# 34 ; and 22 &# 34 ; also having a longitudinal axis 24 &# 34 ; and 26 &# 34 ;, respectively . the longitudinal axis 18 &# 34 ;, the longitudinal axis 24 &# 34 ;, and the longitudinal axis 25 &# 34 ; are all colinear . additionally each of the extensions 20 &# 34 ; and 22 &# 34 ; include fasteners 28 &# 34 ; which in the second alternate embodiment consists of a buckle 29 &# 34 ; and strap 33 &# 34 ;, respectively . as shown in fig9 central portion 16 conforms to the curved surfaces of watch 13 and crystal 14 by being bendable in a three dimensional spatial relationship against the curved , irregular surfaces of watch 13 and crystal 14 . in order to fully protect the watch 13 and crystal 14 , the central portion 16 forms a tight fit , but is removably adjacent to said watch 13 and crystal 14 . the central portion 16 acts as a sealing means . while it is substantially planar in its unflexed state , the circular portion 16 is capable of conforming to the curved , irregular surfaces of the watch 13 and crystal 14 , as shown in fig9 and is bendable in a three dimensional spatial relationship against the curved , irregular surfaces of said watch 13 and crystal 14 . the central portion 16 , which acts as a sealing means , is substantially flat in its unflexed state . the bottom edge of the circular portion 16 is bendable in a three dimensional spatial relationship , against the curved , irregular surface of the watch crystal and completely covers the watch 13 and crystal 14 forming a seal capable of overlapping any spatial gaps between the skin of the wearer and the watch 13 itself . the outer bottom surface of the circular portion 16 is compressed downward against the skin of the wearer of the watch 13 to form a tight seal against environmental hazards and contaminants . removably adjacent to the face of the crystal 14 and the watch 13 , as well as the surface of the skin of the wearer , the central portion 16 has an upper exterior flexible portion 16a and a lower flexible exterior portion 16b , each flexible portion having outer edges 16c and 16d respectively , either of which said flexible portions 16a or 16b can be lifted up in order to view the time on the watch face in use . in a preferred embodiment as shown in fig3 in order to permit the wearer to conveniently and quickly view the watch 13 while the watch guard 10 is worn , there is alternatively provided within central body portion 16 a slit 34 extending along a portion of longitudinal axis 18 of watch guard 10 . slit 34 separates and bisects wide body central portion 16 into the aforementioned two flexible exterior portions 16a and 16b , each flexible portion having respective rounded edges 16c and 16d respectively , said rounded edges 16c and 16d each extending in opposite directions perpendicular to the longitudinal axis 18 of said watch protector 10 . slit 34 has - corresponding end parts 34a and 34b , which limit the length of slit 34 . when a wearer wishes to observe the watch 13 , the wearer places one finger upon flexible portion 16a of central portion 16 and another finger , or thumb , upon flexible portion 16b of central portion 16 and applies manual force to dislodge said flexible portions apart from each other along a line formed by slit 34 . by dislodging flexible portions 16a and 16b away from each other in a movement perpendicular to the longitudinal axis 18 of watch guard 10 , the resilient materials of wide body central portions 16a and 16b are caused to separate openly , thereby revealing the visible portion of the face of watch 13 . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the type described above . while the invention has been illustrated and described as embodied in a - watch guard device , it is not intended to be limited to - the details shown , since it will be understood that various omissions , modifications , substitutions and changes in the forms and details of the device illustrated and in its operation can be made by those skilled in the art without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention .	6
a specific embodiment of the charge monitoring apparatus of the invention will be described with reference to fig1 to 6 . fig1 is a block diagram showing a configuration example of a plug - in hybrid vehicle and a power supply equipment which is used in a charging operation in the embodiment , fig2 is a block diagram showing the configuration of a plc unit shown in fig1 , fig3 is a flowchart showing the contents of the control of the plc unit disposed on the side of the plug - in hybrid vehicle shown in fig1 , fig4 is a flowchart showing the contents of the control of a power - supply side charge monitoring apparatus disposed on the side of the power supply equipment shown in fig1 , fig5 is a flowchart showing a modification of the contents of the control of the plc unit shown in fig3 , and fig6 is a flowchart showing a modification of the contents of the control of the power - supply side charge monitoring apparatus shown in fig4 . in the embodiment , the case will be considered where , as shown in fig1 , the plug - in hybrid vehicle ( hv ) 10 is connected to the power supply equipment 20 through a charging electrical cable 15 , and a battery 13 is charged by using electrical power which is supplied from the side of the power supply equipment 20 to the plug - in hybrid vehicle 10 . the plug - in hybrid vehicle 10 has a function of charging the battery 13 by using commercial ac power ( for example , ac 100 v ) which can be taken out from a usual domestic power supply socket . therefore , the power supply equipment 20 may be an equipment which is disposed in a public place , or an equipment for the usual household as far as it can supply necessary commercial ac power . a predetermined electrical power supply installation 30 supplies electrical power to the power supply equipment 20 . usually , the electrical power supply installation 30 is an equipment of an electrical power company , and corresponds to a power substation , a pole transformer , or the like . in the case of a power supply equipment in the usual household , a special apparatus for supplying electrical power to the plug - in hybrid vehicle 10 , such as a fee charging apparatus is not disposed , and hence as in the power supply equipment 20 shown in fig1 , when a power supply plug 15 a of the charging electrical cable 15 is connected to a power supply socket 21 a , electrical power is always supplied from the power supply equipment 20 to the side of the plug - in hybrid vehicle 10 . therefore , the owner of the plug - in hybrid vehicle 10 or the like can perform a charging operation without obtaining permission from the owner of the power supply equipment 20 , or without paying the electric power fee , and there is a possibility that the owner of the plug - in hybrid vehicle 10 or the like may perform an unauthorized charging operation ( stealing of electricity ). as a countermeasure against stealing of electricity and the like on the side of the power supply equipment 20 , therefore , the power - supply side charge monitoring apparatus 22 is disposed . the power - supply side charge monitoring apparatus 22 has also functions of obtaining and managing various kinds of information stored in the side of the plug - in hybrid vehicle 10 , and providing necessary information to the plug - in hybrid vehicle 10 . as shown in fig1 , the power - supply side charge monitoring apparatus 22 includes a plc ( power lice communications ) modem 25 , a personal computer 26 , a charging history holding portion 27 , a tachograph db ( database , the same shall apply hereinafter ) 41 , and a navigation db 42 . a power supply plug 28 disposed in a power supply cord of the plc modem 25 is connected to one power supply socket 21 c ( or 21 a or 21 b ). the tachograph db 41 is a storage region for obtaining information ( the vehicle speed , the number of revolutions of an engine , and the like ) from digital tachographs mounted on vehicles such as the plug - in hybrid vehicle 10 , and managing the information in the personal computer 26 . the navigation db 42 is a storage region for providing information ( for example , latest map information ) which is required by vehicle navigation apparatuses mounted on the vehicles such as the plug - in hybrid vehicle 10 , to the vehicle side , and obtaining information produced in the vehicle navigation apparatuses from the vehicle side to manage the information in the personal computer 26 . the information held by the navigation db 42 is successively updated to latest information . programs for realizing the functions of the power - supply side charge monitoring apparatus 22 are incorporated into the personal computer 26 . when the personal computer 26 executes the programs , therefore , it is possible to perform a monitor control shown in fig4 . unique identification information ( power supply - side id ) for identifying the power supply equipment 20 is previously registered in the personal computer 26 . under the control of the personal computer 26 , history information related to the charging operation of the plug - in hybrid vehicle 10 is produced , and then stored in the charging history holding portion 27 . fig7 shows a specific example of the history information stored in the charging history holding portion 27 . in place of the personal computer 26 , a single - chip microcomputer into which programs are previously incorporated may be used , or the functions may be incorporated into the plc modem 25 . in the side of the plug - in hybrid vehicle 10 , a charging circuit 12 for charging the battery 13 , a plc unit ( vehicle - side charge monitoring apparatus ) 14 , a digital tachograph 16 , a tachograph db 17 , a navigation apparatus 18 , and a navigation db 19 are disposed . the plc unit 14 is connected to a power supply line of a vehicle - side socket 11 . as described later , the plc unit 14 has functions of dealing with an unauthorized charging operation such as stealing of electricity , and transferring information with respect to the side of the power supply equipment 20 . the digital tachograph 16 obtains various kinds of information indicating the driving situation of the plug - in hybrid vehicle 10 on which the tachograph is mounted , from sensors ( not shown ) mounted on the vehicle in , for example , a periodical manner , and accumulates the obtained information in the tachograph db 17 as time series information . the tachograph db 17 is a storage device from and into which information can be read and written . for example , the information to be stored in the tachograph db 17 includes the vehicle speed , the number of revolutions of the engine , the driving time , the travel distance , the maximum speed , the average speed ; and the time when the speed exceeds a predetermined speed . similarly with a usual vehicle navigation apparatus , the navigation apparatus 18 has functions of : receiving radio waves from a plurality of gps ( global positioning system ) satellites to measure the current position of the own vehicle ; displaying a map containing the current position on a screen as an image ; searching a route from the current position to a designated destination ; and receiving a signal transmitted from a beacon transmitter disposed on a road to obtain traffic information relating traffic jam information , accident information , and the like . the navigation db 19 is a storage device from and into which information can be read and written , and holds map information and the like to be used by the navigation apparatus 18 . as shown in fig1 , the digital tachograph 16 and the navigation apparatus 18 are connected to the plc unit 14 . the plc unit 14 performs the control described later , whereby information stored in the tachograph db 17 is transferred toward the personal computer 26 on the side of the power supply equipment 20 , that stored in the navigation db 19 is transferred toward the personal computer 26 , and the contents of the navigation db 19 is updated to latest information by using information transmitted from the side of the personal computer 26 . in the configuration example shown in fig1 , the plc unit 14 , the digital tachograph 16 , and the navigation apparatus 18 are configured as independent apparatuses . alternatively , a part or the whole of these apparatuses may be integrally configured as a single apparatus . a power supply line on the input side of the charging circuit 12 is connected to the vehicle - side socket 11 via a charge switch sw . when the power supply socket 21 a on the side of the power supply equipment 20 is electrically connected to the vehicle - side socket 11 through the charging electrical cable 15 , therefore , the commercial ac power which is supplied from the power supply equipment 20 is applied to the charging circuit 12 via the charge switch sw . the charging circuit 12 produces predetermined dc power which is required in the charging operation , from the supplied commercial ac power , and supplies the dc power to the battery 13 to charge the battery . the charge switch sw is a switch which can electrically control the connection state , such as a relay . as shown in fig2 , the plc unit 14 which is mounted on the side of the plug - in hybrid vehicle 10 includes a plc modem 141 , a controlling portion 142 , a vehicle id holding portion 143 , a charging history holding portion 144 , a driver circuit 145 , and an id database 146 . in the same manner as a usual plc modem which is commercially available , the plc modem 141 can transmit information with another station ( another plc modem ) connected to the same power line , through the power line . in the information transmission , a carrier wave having a high frequency is used , and hence information can be transmitted without affecting the power supply . the vehicle id holding portion 143 is a nonvolatile memory , and holds information of unique identification information ( vehicle - side ids ) which is predetermined for each vehicle . the ids held by the vehicle id holding portion 143 cannot be rewritten . the charging history holding portion 144 is a nonvolatile memory . the contents of charging history information held by the charging history holding portion 144 are successively added or updated by history information which is produced under the control of the controlling portion 142 when the charging operation is performed . the id database 146 is a nonvolatile memory for holding the identification information ( power supply - side ids ) which is uniquely allocated to each of the various power supply facilities 20 , and used for , with respect only to a specific power supply equipment 20 in which security of information transfer has been confirmed by , for example , the user of the vehicle or a special administrator , registering and holding a power supply - side id that is allocated to the power supply equipment . for example , there is a possibility that , when information of the vehicle side is transferred to the power supply equipment 20 which is disposed in a public place , the transferred information may leak to a third party . therefore , the power supply - side id of the equipment is not registered in the id database 146 . by contrast , with respect to the power supply equipment 20 which is disposed in the home of the owner of the vehicle , and that , in a company of a specific business managing the vehicle , the possibility of leakage of transferred information may be low . therefore , the power supply - side ids of the facilities are registered in the id database 146 as an equipment in which security has been confirmed . the controlling portion 142 is a microcomputer for controlling the operation of the plc unit 14 , and performs the control shown in fig3 by using the plc modem 141 , vehicle id holding portion 143 , charging history holding portion 144 , driver circuit 145 , and id database 146 which are connected to the controlling portion 142 . as a result of the control , history information related to a charging operation is produced , and the history information is stored in the charging history holding portion 144 . by the control of the controlling portion 142 , when a charging operation is performed , information is transferred between the side of the plug - in hybrid vehicle 10 and that of the power supply equipment 20 through the power supply line ( charging electrical cable 15 ). fig8 shows a specific example of the history information stored in the charging history holding portion 144 . fig3 schematically shows the operation of the plc unit 14 mounted on the plug - in hybrid vehicle 10 . referring to fig3 , the operation of the plc unit 14 will be described . in step s 11 , the controlling portion 142 activates the plc modem 141 . in step s 12 , the controlling portion 142 checks whether the plug - in hybrid vehicle 10 ″ and the power supply equipment 20 are connected to each other through the charging electrical cable 15 or not . namely , the controlling portion checks whether or not the power supply plug 15 a of the charging electrical cable 15 is connected to the power supply socket 21 a , and a power supply socket 15 b is connected to the vehicle - side socket 11 to set a chargeable state . actually , detection of whether the power supply socket 15 b is inserted or not may be performed in the vicinity of the vehicle - side socket 11 by a switch , a sensor , or the like , it may be checked whether a predetermined power supply voltage appears in an electrode of the vehicle - side socket 11 or not , or it may be checked whether there is the carrier wave transmitted from the plc modem on the side of the power supply equipment 20 or not . in step s 13 , the controlling portion 142 checks whether the plc modem 141 is set to a state where it can communicate with the plc modem on the side of the power supply equipment 20 or not . in the case where the power - supply side charge monitoring apparatus 22 is connected to the power supply socket 21 c on the side of the power supply equipment 20 as shown fig1 , the plc modem 25 in the power - supply side charge monitoring apparatus 22 operates as described later , and hence the plc modem 141 in the plug - in hybrid vehicle 10 is set to the state where it is communicable with the side of the power supply equipment 20 ( the state where a communication path is established ). when the communicable state is set , the process proceeds to next step s 14 . in step s 14 , the controlling portion 142 reads the identification information held by the vehicle id holding portion 143 , and transmits the id as the vehicle - side id by plc communication . namely , the vehicle - side id is sent from the plc modem 141 to the plc modem 25 through a power line route of the power supply line — the vehicle - side socket 11 — the charging electrical cable 15 — the power supply socket 21 a . after the plc unit 14 in the plug - in hybrid vehicle 10 sends the vehicle - side id , as described later , the power supply - side id is transmitted from the power - supply side charge monitoring apparatus 22 connected to the side of the power supply equipment 20 , by plc communication . in next step s 15 , therefore , the controlling portion 142 waits for transmission of the power supply - side id from the plc unit 14 . when the power supply - side id is received , the process proceeds to next step s 16 , and the received power supply - side id is recorded into the charging history holding portion 144 . in next step s 17 , the plc unit 14 transmits a predetermined authentication request signal to the power - supply side charge monitoring apparatus 22 . in response to the authentication request , the power - supply side charge monitoring apparatus 22 replies a result of authentication . therefore , the plc unit 14 checks the authentication result in step s 18 . if the authentication is ok , the process proceeds to step s 19 , and , if the authentication is ng , the process proceeds to step s 25 . in step s 19 , the controlling portion 142 controls the charge switch sw via the driver circuit 145 so as to be switched to the on state where charging is enabled , or namely drives the charge switch sw so as to connect the power supply line , whereby the power supplied from the side of the power supply equipment 20 to the vehicle - side socket 11 through the charging electrical cable 15 is given to the charging circuit 12 . at this timing , therefore , the charging circuit 12 starts the operation of charging the battery 13 . in step s 20 , the controlling portion 142 checks whether the charging operation is ended or not . for example , the charging operation can be deemed to be ended , in the case such as that where the user operates an end button which is not shown , that where sufficient power is stored in the battery 13 and the current flowing from the charging circuit 12 to the battery 13 becomes less than a predetermined level , that where the charging electrical cable 15 is removed , or that where the carrier wave transmitted from the partner plc modem is not detected . during the charging operation , the processes of steps s 20 to s 24 and s 26 to s 28 are repeatedly performed . during the charging operation , i . e ., during a period when the plug - in hybrid vehicle 10 and the power supply equipment 20 are connected to each other and power is supplied from the power supply equipment 20 toward the plug - in hybrid vehicle 10 , the power supply - side id is repeatedly transmitted from the power - supply side charge monitoring apparatus 22 as described later . on the power line such as the charging electrical cable 15 , as in the signal shown in fig9 , for example , information of the power supply - side id which is transmitted as a plc signal by the power - supply side charge monitoring apparatus 22 repeatedly appears for a predetermined time period ( x1 seconds ), the information of the power supply - side id then again repeatedly appears for the predetermined time period ( x2 seconds ) after a separation of a predetermined time period , and , after another separation of a predetermined time period , the information of the power supply - side id then again repeatedly appears for the predetermined time period ( x3 seconds ). in the example , x1 , x2 , and x3 are equal to one another . in step s 21 , the controlling portion 142 checks whether the plc modem 141 continues the reception of the power supply - side id transmitted by the power - supply side charge monitoring apparatus 22 or detects interruption of the reception corresponding to the separation . if the reception is continued , the process proceeds to step s 22 , and , if the separation is detected , the process proceeds to step s 23 . in step s 22 , the controlling portion 142 controls so that the identification information read from the vehicle id holding portion 143 is again transmitted as the vehicle - side id from the plc modem 141 . during the charging operation , namely , the vehicle - side id is repeatedly transmitted from the power - supply side charge monitoring apparatus 22 to the power supply equipment 20 , and the power supply - side id is repeatedly transmitted from the power supply equipment 20 to the plug - in hybrid vehicle 10 . in step s 23 , the controlling portion 142 counts the number of receptions in which the power supply - side id is received , and records the reception number into the charging history holding portion 144 . specifically , the detection number of separations indicating that the reception of the power supply - side id is temporarily interrupted is counted , and the separation number is recorded into the charging history holding portion 144 . in the case where the plc modem 141 receives the signal shown in fig9 , for example , the separation between the periods of x1 and x2 is detected as a first separation , that between the periods of x2 and x3 is detected as a second separation , and , after the period of x3 is ended , a third separation is detected . every time a separation is detected , the separation detection number which is recorded as the history in the charging history holding portion 144 is updated . in step s 24 , the controlling portion 142 records the power supply - side id which is finally detected by the plc modem 141 , as the history into the charging history holding portion 144 . furthermore , the finally detected power supply - side id is compared with that recorded in the charging history holding portion 144 , and it is checked whether the ids are coincident with each other or not . if coincident , it is not necessary to update the record , but , if not coincident , the finally detected power supply - side id is additionally recorded into the charging history holding portion 144 as a new history . in step s 26 , the controlling portion 142 compares the power supply - side id which is finally detected in step s 21 , with the ids registered in the id database 146 , and checks whether coincidence is attained or not . namely , it is checked whether the power supply - side id of the power supply equipment 20 which is connected for the purpose of charging of the plug - in hybrid vehicle 10 is identical with one of the ids in which security is previously confirmed ( one of the ids registered in the id database 146 ). if coincidence is attained , the process proceeds to step s 27 , and , if coincidence is not attained , the process returns to step s 20 . in step s 27 , the controlling portion 142 checks whether the plc modem 141 receives a transmission stop command from the side of the power supply equipment 20 or not . if not received , the process proceeds to step s 28 , and , if received , the process returns to step s 20 . in step s 28 , the controlling portion 142 obtains information which is accumulated by the digital tachograph 16 in the tachograph db 17 , and sequentially transmits the information toward the power supply equipment 20 via the plc modem 141 . when the charging operation is to be ended , the process proceeds from step s 20 to step s 25 . in step s 25 , the controlling portion 142 controls the charge switch sw via the driver circuit 145 so as to disconnect the input of the charging circuit 12 from the power line such as the vehicle - side socket 11 , thereby ending the charging operation . when the plc unit 14 performs the control shown in fig3 , during the charging operation , various kinds of information stored in the tachograph db 17 are automatically transferred to the personal computer 26 on the side of the power supply equipment 20 through the charging electrical cable 15 . in the transferring of the information of the tachograph to the personal computer 26 , therefore , it is not required to use a wireless communication network ; a memory card , or the like , and hence the problem of the communication cost , that of security related to information to be transferred , and the like can be solved . when the charging operation is performed , for example , history information shown in fig8 is recorded and stored in the charging history holding portion 144 . in the example shown in fig8 , information of the history indicating each charging operation includes “ history number ”, “ power supply - side id ”, and “ connection time ”. in the above , “ history number ” is a number indicating the order of performing the charging operation , “ power supply - side id ” is identification information which is received from the side of the power supply equipment 20 by the plc modem 141 , and “ connection time ” means the separation detection number which is recorded in step s 23 . since the separation appears at constant time intervals ; the separation detection number corresponds to the length of the connection time or the time during which the charging operation is performed . in this way , “ connection time ” is recorded for each “ power supply - side id ”. therefore , it is possible to know the amount of the electrical power that is supplied from “ power supply - side id ” to the vehicle in which these information is recorded . fig4 schematically shows the operation of the personal computer 26 in the power - supply side charge monitoring apparatus 22 connected to the power supply equipment 20 . the operation shown in fig4 will be described . in step s 31 , the personal computer 26 activates the plc modem 25 . in step s 32 , the personal computer 26 checks whether the plc modem 25 is communicable with the plc modem 141 on the side of the plug - in hybrid vehicle 10 or not . when the plug - in hybrid vehicle 10 is connected to the power supply equipment 20 through the charging electrical cable 15 and the plc unit 14 in the plug - in hybrid vehicle 10 operates , the plc modem 25 is communicable with the plc modem 141 in the plc unit 14 . in this case , therefore , the process proceeds to next step s 33 . in step s 33 , the personal computer 26 checks whether the plc modem 25 receives the vehicle - side id transmitted from the side of the plug - in hybrid vehicle 10 or not . if the vehicle - side id is received , the process proceeds to next step s 34 . in step s 34 , the personal computer 26 records the vehicle - side id received in step s 33 , into the charging history holding portion 27 . in step s 35 , the personal computer 26 reads the power supply - side id which is previously registered therein , and sends the power supply - side id to the side of the plug - in hybrid vehicle 10 via the plc modem 25 by plc communication . therefore , the plc unit 14 on the side of the plug - in hybrid vehicle 10 can know the power supply - side id . in step s 36 , the personal computer 26 checks whether the plc modem 25 receives the authentication request signal from the side of the plug - in hybrid vehicle 10 or not . if the signal is received , the process proceeds to step s 37 . in step s 37 , the personal computer 26 compares vehicle - side id received in step s 33 with ids registered in an id database 29 , and checks whether there is a coincident id or not . in the id database 29 , information of vehicle - side ids respectively allocated to vehicles which can use the electrical power supply installation 30 are registered and held . in the case where the power supply equipment 20 is a fee charging public equipment , for example , it may be contemplated to perform a control in which , when payment of a fee is confirmed on the side of the power supply equipment 20 , the vehicle - side id of the corresponding vehicle is registered into the id database 29 . in step s 38 , the personal computer 26 transmits a result of the authentication in step s 37 to the side of the plug - in hybrid vehicle 10 via the plc modem 25 . in step s 39 , the personal computer 26 checks whether the connection state between the power supply equipment 20 and the plug - in hybrid vehicle 10 is continued or not . specifically , detection of whether the power supply plug 15 a of the charging electrical cable 15 is connected to the power supply socket 21 a or not is performed by a switch or the like ( not shown ) in the vicinity of the power supply socket 21 a , or it is checked whether there is the carrier wave sent onto the charging electrical cable 15 by the plc modem 141 on the side of the plug - in hybrid vehicle 10 or not . in step s 40 , the personal computer 26 again transmits the power supply - side id to the side of the plug - in hybrid vehicle 10 via the plc modem 25 by plc communication . since step s 40 is repeatedly performed , the power supply - side id is repeatedly transmitted in a short period from the plc modem 25 during when the plug - in hybrid vehicle 10 is connected to the power supply equipment 20 . as described above , also the plc modem 141 on the side of the plug - in hybrid vehicle 10 repeatedly transmits the vehicle - side id . therefore , the personal computer 26 successively fetches the received vehicle - side id which is received by the plc modem 25 , and checks whether the id coincides with one of the ids registered in the id database 29 or not . in step s 51 , the personal computer 26 checks whether the stored information ( in this example , the stored information of the tachograph ) sent out from the plug - in hybrid vehicle 10 is received by the plc modem 25 or not . if received , the process proceeds to step s 52 , and , if not received , the process proceeds to step s 41 . in step s 52 , the personal computer 26 controls the plc modem 25 so as to perform the process of receiving stored information , and sequentially stores the received stored information into the tachograph db 41 . in step s 53 , the personal computer 26 checks whether the reception of all stored information is completed or not . if the reception is completed , the process proceeds to step s 54 , and , if not completed , the process proceeds to step s 41 . in step s 54 , the personal computer 26 transmits a predetermined transmission stop command by using the plc modem 25 in order to notify the side of the plug - in hybrid vehicle 10 that the reception of stored information is completed . in step s 41 , the personal computer 26 checks whether a constant time period ( x seconds ) which is preset has elapsed or not . if not elapsed , the process proceeds to step s 39 , and , if elapsed , the process proceeds to step s 42 after elapse of the time period . namely , the process subsequent to step s 42 is performed at intervals of the constant time period ( x seconds ). in step s 42 , the personal computer 26 produces a separation time period for interrupting the transmission of the power supply - side id . specifically , the personal computer waits for elapse of a predetermined time period , and halts the execution of step s 40 during the tome period to stop the transmission of the power supply - side id . therefore , the signal sent from the plc modem 25 toward the charging electrical cable 15 by plc communication is set to a state such as shown in fig9 . namely , information of the power supply - side id which is transmitted by the plc modem 25 as a plc signal repeatedly appears for the predetermined time period ( x1 seconds ), the information of the power supply - side id then again repeatedly appears for the predetermined time period ( x2 seconds ) after a separation of a predetermined time period , and , after another separation of a predetermined time period , the information of the power supply - side id then again repeatedly appears for the predetermined time period ( x3 seconds ). in the example , x1 , x2 , and x3 have the same length ( x seconds ). as described above , during a period when the side of the power supply equipment 20 transmits information of the power supply - side id , also the plc unit 14 on the side of the plug - in hybrid vehicle 10 repeats transmission of the vehicle - side id . therefore , also the signal which is sent out by the plc unit 14 is identical with that of fig9 . namely , information of the vehicle - side id which is transmitted by the plc modem 141 as a plc signal repeatedly appears for the predetermined time period ( x1 seconds ), the information of the vehicle - side id then again repeatedly appears for the predetermined time period ( x2 seconds ) after a separation of a predetermined time period , and , after another separation of a predetermined time period , the information of the vehicle - side id then again repeatedly appears for the predetermined time period ( x3 seconds ). in step s 43 , the personal computer 26 counts the number of receptions in which the vehicle - side id is received , and records the reception number into the charging history holding portion 27 . specifically , the number of separations in step s 42 is counted , and the separation number is recorded as a history into the charging history holding portion 27 . in the case where the finally received vehicle - side id is different from the previously received vehicle - side ids , the separation number is cleared , and the counting process is again started from zero . in step s 44 , the personal computer 26 records the vehicle - side id which is finally received by the plc modem 25 , as a history into the charging history holding portion 27 . furthermore , the finally detected vehicle - side id is compared with that recorded in the charging history holding portion 27 , and it is checked whether the ids are coincident with each other or not . if coincident , it is not necessary to update the record , but , if not coincident , the finally detected vehicle - side id is additionally recorded into the charging history holding portion 27 as a new history . as a result of the process shown in fig4 and performed by the power - supply side charge monitoring apparatus 22 , when the plug - in hybrid vehicle 10 is connected to the power supply equipment 20 and the charging operation is performed , information accumulated by the digital tachograph 16 of the plug - in hybrid vehicle 10 can be automatically transferred to the power - supply side charge monitoring apparatus 22 by using the power supply line , and the transferred information can be stored into the tachograph db 41 . in the transferring of the information of the tachograph to the personal computer 26 , therefore , it is not required to use a wireless communication network , a memory card , or the like , and hence the problem of the communication cost , that of security related to information to be transferred , and the like can be solved . when the charging operation is performed , for example , history information shown in fig7 is recorded and stored in the charging history holding portion 27 . in the example shown in fig7 , information of the history indicating each charging operation ( power supplying operation ) includes “ history number ”, “ vehicle - side id ”, and “ connection time ”. in the above , “ history number ” is a number indicating the order of performing the charging operation , “ vehicle - side id ” is identification information which is received from the side of the plug - in hybrid vehicle 10 by the plc modem 25 , and “ connection time ” means the separation detection number which is recorded in step s 43 . since the separation appears at intervals of the constant time ( x seconds ), the separation detection number corresponds to the length of the connection time or the time during which the charging operation is performed . in this way , “ connection time ” is recorded for each “ vehicle - side id ”. therefore , it is possible to know the amount of the electrical power that is supplied to each vehicle . the timing of transmitting the vehicle - side id as a plc signal by the plc unit 14 on the side of the plug - in hybrid vehicle 10 , that of transmitting the power supply - side id as a plc signal by the power - supply side charge monitoring apparatus 22 on the side of the power supply equipment 20 , and the like can be changed as required . however , it is preferred that the transmissions of the vehicle - side id and the power supply - side id are repeated at a relatively short period . as described above , the operation shown in fig3 is performed by the plc unit 14 , and that shown in fig4 is performed by the power - supply side charge monitoring apparatus 22 , whereby the charging operation can be controlled , and information of the tachograph stored in the side of the plug - in hybrid vehicle 10 can be automatically transferred to the side the power - supply side charge monitoring apparatus 22 . fig5 shows a modification of the operation shown in fig3 , and fig6 shows a modification of the operation shown in fig4 . the operation shown in fig5 is performed by the plc unit 14 , and that shown in fig6 is performed by the power - supply side charge monitoring apparatus 22 , whereby the charging operation can be controlled , information held by the navigation db 19 on the side of the vehicle can be transferred to the side of the power - supply side charge monitoring apparatus 22 , and conversely information held in the side of the power - supply side charge monitoring apparatus 22 can be transferred to the side of the vehicle . in fig5 and 6 , the steps corresponding to those in fig3 and 4 are denoted by the same step numbers . in fig5 , namely , step s 28 in fig3 is changed to steps s 61 to s 64 , and , in fig6 , steps s 71 and s 72 are added between steps s 54 and s 41 . the operation of the changed places will be described below . in step s 60 shown in fig5 , the plc unit 14 in the plug - in hybrid vehicle 10 obtains information to be transferred , via the navigation apparatus 18 among the information stored in the navigation db 19 , and transmits the information to the side of the power - supply side charge monitoring apparatus 22 by plc communication . as a specific example of the information which is transmitted in step s 60 by the plc unit 14 , traffic information ( traffic jam information , accident information , and the like ) which is obtained by the navigation apparatus 18 from a beacon transmitter disposed on a road , coordinate information of a position which is designated as a hazardous location by the user ( driver ), version information of the map data existing in the navigation db 19 , and the like are assumed . in step s 61 , the plc unit 14 in the plug - in hybrid vehicle 10 checks whether information transmitted from the power - supply side charge monitoring apparatus 22 is received from the power supply line or not . if received , the process proceeds to step s 62 , and , if not received , the process returns to step s 20 . in step s 62 , the plc unit 14 controls the plc modem 141 so as to perform the receiving process , and temporarily stores the received information into a predetermined storage device . in step s 63 , the plc unit 14 checks whether reception of all information to be transferred is completed or not . if reception is completed , the process proceeds to step s 64 , if not completed , the process returns to step s 20 . in step s 64 , the plc unit 14 updates information in the navigation db 19 to latest information by using the information which is received in step s 62 . in a database such as a map which can be used by the navigation apparatus 18 , for example , latest information can be periodically obtained , and such information is usually provided in the form of an information recording medium such as a dvd , or from a server which is on the internet , and to which the apparatus can be on - line connected . in the case where an information recording medium such as a dvd is used , however , a dvd driver for reading the medium is required , and in the case where the navigation apparatus 18 mounted on a vehicle is connected to the internet or the like and data are downloaded , there is a possibility that the communication cost may be expensive . in the system shown in fig1 , therefore , latest information such as a map is registered in the navigation db 42 on the side of the power - supply side charge monitoring apparatus 22 , data of the navigation db 42 are transferred toward the plug - in hybrid vehicle 10 through the power supply line during a period when a charging operation is performed on the plug - in hybrid vehicle 10 , and , by using the data , the map and the like in the navigation db 19 are automatically updated to data of the latest version . as information to be transferred from the side of the power - supply side charge monitoring apparatus 22 to the plug - in hybrid vehicle 10 , for example , travel plan information ( information related to the destination , information related to the possible travelling route , the schedule , and the like ) which is previously produced by the user may be used in addition to map data . in step s 71 shown in fig6 , by contrast , the personal computer 26 checks whether latest information to be transferred is registered in the navigation db 42 or not . specifically , registration dates and times of respective information are compared with each other , or the version of the map data on the side of the vehicle is compared with that of the map data in the navigation db 42 . if latest information is registered , the process proceeds to step s 72 , and , if not registered , the process proceeds to step s 41 . in step s 72 , the personal computer 26 obtains the latest information from the navigation db 42 , and transmits the information to the side of the plug - in hybrid vehicle 10 via the plc modem 25 . alternatively , both the operation shown in fig3 and that shown in fig5 may be performed in the side of the plc unit 14 , and both the operation shown in fig4 and that shown in fig6 may be performed in the side of the power - supply side charge monitoring apparatus 22 . according to the configuration , both the transfer of information related to the tachograph function , and that of information related to the navigation function can be performed during the charging operation . as described above , the charge monitoring apparatus of the invention can be used for monitoring an operation of charging a battery mounted on a vehicle such as an electric vehicle or a hybrid vehicle , and particularly also for performing transfer of information between the vehicle side and an apparatus outside the vehicle while using a power supply line connecting the vehicle side and the power supply side during a charging operation , as a transmission line . in information transfer , therefore , it is not required to use a wireless communication network , and to use a detachable information recording medium such as a memory card or a dvd , and the apparatus is useful for reducing the communication cost , and ensuring security related to information to be transferred . although the invention has been illustrated and described for the particular preferred embodiments , it is apparent to a person skilled in the art that various changes and modifications can be made on the basis of the teachings of the invention . it is apparent that such changes and modifications are within the spirit , scope , and intention of the invention as defined by the appended claims . the present application is based on japanese patent application no . 2008 - 314815 filed on dec . 10 , 2008 , the contents of which are incorporated herein for reference .	8
in order that the invention may be more fully understood , adjustable heimlich maneuver device 12 will now be described by way of example with reference to the accompanying drawings . fig1 - 6 illustrate adjustable heimlich maneuver device 12 . it is comprised of body 14 and strap 16 . body 14 has front surface 18 that has a concave shape , narrower at the front and top and wider at the back and bottom as illustrated in fig1 - 5 . body 14 &# 39 ; s back surface 20 has desk side support notch 22 embedded at approximately a 45 degree angle as shown in fig2 - 5 . it also has hand rest 28 across the bottom of back surface 20 for manually applying force to body 14 when victim is in prone position as in fig1 . strap 16 is a flexible strap that is either connected on each side of body 14 or body 14 has a slip fit slot through body 14 on which body 14 slides on strap 16 as shown in fig6 and is of sufficient length to allow even a small caregiver to reach around a very large adult . fig7 illustrates a standard use of adjustable heimlich maneuver device 12 as body 14 is shown placed between the navel and sternum and strap 16 is wrapped around the hands of a caregiver and utilized to pull body 14 rapidly upward in a jerking motion to expel a large burst of air by applying force to the stomach , diaphragm and lungs . the shape of body 14 &# 39 ; s front surface 18 is critical to the improved function relative to standard spherical shapes and is designed to fit between the navel and the sternum . the narrowing at the interface front edge allows for the force to be concentrated in a smaller area increasing the local pressure at point of attack . the top to bottom taper allows body 14 to be nestled close to the sternum directly over the diaphragm without putting pressure on the victim &# 39 ; s ribs which suffer the most damage from improperly applied heimlich maneuvers . the fact that strap 16 is quite long allows a similar application even though the victim remains seated , perhaps even slumped over as shown in fig8 . fig9 shows an application of adjustable heimlich maneuver device by a solitary victim . in this case the victim places back surface 20 of body 14 at desk side support notch 22 on any square cornered solid piece of furniture , places his abdomen against front surface 18 of body 14 and leans sharply in a rearward and down motion forcing a burst of air , clearing the breathing channel . fig1 shows yet another method of use of adjustable heimlich maneuver device 12 where the victim has already fallen to the floor . in this case the victim is rolled onto his back and body 14 is placed in the same position as before and the heel of the care giver &# 39 ; s hand is placed on hand rest 28 and a sharp downward and forward force is applied again forcing a burst of air through the larynx and clearing the air way .	0
the packaging of the present invention consists of ( a ) polymer film or sheet either in the form of preformed bag sealed on three sides or a tube sealed at the bottom ( pouch ), ( b ) filling of hot paving grade bitumen binder having softening point of about 30 - 65 ° c . and pen ( penetration at 25 ° c .) of about 20 - 250 into the polymer bag / pouch , ( c ) sealing and cooling the bag with its contents which can then be stacked , shipped and used at the user site without removing the packing . the package of the invention can be manufactured by any suitable method . the polymer bag / pouch or tube is made of polymer film which is made from any polymeric material having sufficient heat resistance i . e . does not melt at least up to 90 ° c ., preferably up to 120 ° c ., has enough mechanical strength ( dart impact strength & gt ; 900 gm as measured by test method is : 2508 ) and melts in the temperature range of 140 ° c . to 280 ° c ., preferably in the temperature range of 150 - 200 ° c . the preferred multilayer film is made , preferably two or three layers . the film thickness can range from 50 to 500 μm , preferred range between 90 to 450 μm . the preferred polymeric materials are polypropylene , polyethylene and copolymers of ethylene , propylene , nylons , etc . the polymeric materials , which can be made into film form and having the desired properties as described earlier can also be used . different layers can be made from different polymeric materials . for example in a three layered film the outer layers can be made from polyethylene and the inner core can be made from polypropylene . the preferred film for packaging bitumen binders should have the following properties : temperature susceptibility impact performance flexibility and softness compatibility with bitumen binder rigidity and creep resistance sealing through contaminant capability tear resistance melts at the temperature at which bitumen is converted to molten state at end user application monolayer polymer films lack some of the above - mentioned properties . it is now invented that a multilayered film , preferably three layered film with suitable polymeric material for each layer provides desired properties for the film . for example , when a three layered film is made from polypropylene , polyethylene , nylon etc . polypropylene and nylon provides rigidity , temperature performance , mechanical strength , puncture and impact resistance , while polyethylene gives excellent sealing capability and softness . some of the compositions of three layered film using polyethylene and polypropylene which give desired properties are polyethylene in the outer layers and propylene in the inner core . the weight ratios could be 1 : m : n where in l , m , n vary from 0 to 100 %. bulk bitumen was first melted and maintained at a temperature range of about below 140 ° c ., preferably below 120 ° c ., in a suitable container . metallic mold in rectangular box shape having three walls made of perforated sheets for fast heat transfer was designed and fabricated . the three rigid rectangular walls ( 1 , 2 , 8 ) which form a mold are placed in such a way that one is at the bottom ( 8 ) and two are vertical ( 1 , 2 ) and parallel to each other . in the preferred embodiment shown , one of the vertical walls ( 1 ) is welded to the horizontal bottom wall ( 8 ) and the other vertical wall ( 2 ) is fixed to the bottom wall ( 8 ) with hinges ( 5 , 6 , 7 ) for flexibility . the hinges ( 5 , 6 , 7 ) allow the flexible wall ( 2 ) to freely rotate along the axis of the hinges ( fig1 and 2 ). the two vertical walls ( 1 , 2 ) can be held together in parallel with the help of hook and eye mechanism ( 3 , 4 ). the surfaces and corners , which get in contact with film encasement are made smooth ( devoid of pointed and sharp edges ). prefabricated empty polymer bags as shown in fig3 can be placed in the mold and firmly held in the mold the help of suitable fixture such as clamp . the mold is then placed in a coolant tank , which is maintained at a temperature below 30 ° c ., preferably below 10 ° c . required quantity of molten bitumen heated earlier is then poured into the bag from the top opening with the help of a funnel . the filled bag along with mold is left in the water tank for more than 2 minutes so as to cool it below 70 ° c ., preferably below 50 ° c . the sealed bag is then placed on pallet which can be further moved for the stacking and storage . in an automatic machine , polymer film in the form of either sheet or cylinder is continuously fed to the machine where the film is sealed in such a way that a bag is formed having opening at the top . desired quantity of hot bitumen binder in molten state maintained at a temperature in the range of 40 to 140 ° c ., preferably , in the range of 70 to 120 ° c . is filled into the polymer bag . the desired quantity of bitumen filling can be achieved either by measurement and control of volume or mass . the filled bag is then sealed at the top and separated from the rest of the film by cutting above the seal . when hot bitumen binder is filled in the polymer bag , the bag may get damaged / punctured / deformed due to high temperature . to avoid such damage to the film the bag is cooled from outside either by immersing the bag in a cold fluid such as water or by spraying cold fluid such as water or vapor or gas . the temperature of the fluid used for cooling is maintained below 30 ° c ., preferably below 10 ° c . the sealed bag containing bitumen then carried in a conveyer that is submerged in a cold fluid maintained at temperature below 30 ° c ., preferably below 10 ° c . the bag remains in the conveyer for a period of more than 2 minutes so as to cool the hot bitumen binder contained in the polymer bag to below 70 ° c ., preferably to below 50 ° c . alternatively , during filling and sealing damage to the film / bag can also be prevent by supporting the bag using a specially designed mold / case and cooling it . the mold was designed so as to provide enough exposure to bag for fast heat transfer . the mold is so designed that it automatically opens from the front after filling , sealing and cutting is complete . right mold dimensions are selected so as to fit the bag / pouch / tube well . the mold is fixed below the bitumen filling point . after filling the bag with bitumen and sealing front side of the mold is automatically opened so as to allow the bag to fall out of the mold . further , during bitumen filling and sealing the bag can be cooled as explained above either by immersing in cold fluid or by spraying cold fluid , on the mold / bag . the bitumen binder bag can now be handled for secondary packaging , stacking or for shipping . a semi automatic filling machine with the features described is designed and fabricated for filling bitumen binder in polymer bags . the machine consists of bitumen storage tank having capacity 50 kg ( can also have other capacities either lower or higher ), a temperature control and measurement facility , pneumatically controlled bitumen inlet valve , a non contact bitumen level sensor , bag holding fixtures and an injection nozzle having adjustable timer control . sensing the level of the bitumen in the tank the inlet valve allows / stops the flow of bitumen in to the tank . a over flow line is also provided to remove excess bitumen from the tank in the eventuality of non - operation of the inlet valve such as non - closure when the tank is filled to the desired level . sufficient heat insulation was provided to bitumen contact parts to reduce heat loss and smooth opening and closing of valves . the open / shut of the injection nozzle was based on timer controlled , which can be adjusted according to the quantity of the bitumen to be filled . the injection nozzle was designed to avoid spraying of bitumen and total cut of mechanism to stop the dripping of bitumen . an additional mechanism for operating the injection valve through remote foot pedal switch was provided to increase the personal safety during operations . the bitumen storage tank is connected to the bitumen inlet line , and bitumen at 40 - 140 ° c ., preferably at 70 - 140 ° c . is filled in the filling machine tank of 50 - 250 kg capacity , as the level in the tank reached desired height , the inlet valve get closed with the help of a level sensor . the filling machine tank temperature is maintained the desired level . below the injection valve a water tank of filled with water maintained below 30 ° c . is placed . the polymer bags were fixed in the molds as explained in manual method . the timer for injection valve is set at desired quantity . the mold was placed in cold water below the injection valve and foot pedal was operated . preset quantity of hot molten bitumen is filled in bag and the valve got closed . the filled bag along with mold was shifted ahead inside the same water tank and kept for more than 2 minutes for cooling the bitumen to the desired temperature . in similar way filling of other bags were continued . the other operations such as removing the mold / bag , sealing etc ., were carried out sequentially as explained for manual filling operations . the weight of each packed bitumen bag / pouch can be in the range of 0 . 1 kg to 100 kg , preferably in the range of 1 kg to 50 kg in weight . when the pack size is small ( less than 25 kg ), two or more bags can be packed / wrapped together ( called secondary package ) to produce a final pack of 50 kg or more for easy handling , stacking , loading , shipping and usage . the secondary packaging is done for ease of handling and transportation . secondary packaging provides additional strength . in the present invention , two types of secondary packaging material are used viz ., ( 1 ) removable packaging in which single layer of high density polyethylene film having thickness in the range of 150 - 500 μm preferably in the range of 200 - 300 μm or any other suitable material is used . this material does not dissolve completely in molten bitumen at the end use application and hence , this secondary package has to be removed prior to the use of bitumen for pavement or any other application . any other suitable material can also be used for secondary packaging . ( 2 ) non removable packaging in which a suitable single , double or multilayer layered polymer film comprising of thickness of about 150 - 500 μm preferably 200 - 300 μm is used . in this case film material gets completely dissolved in hot molten bitumen during its end use and hence , there is no need for the removal of secondary packaging . in one of the inventions , a secondary packing is done using prefabricated polymer bag in a box shape of desired size by stitching , keeping a flip type opening at top . desired number of individual primary bitumen bags is placed in the secondary bag and stitched the open end using portable stitching machine . the secondary packaging can also be done is an automatic machine . the secondary packing material is removed at the time of end use at the user site as the material does not melt or mix with bitumen at the temperature at which bitumen concrete is prepared . however , if the secondary bag made with polymeric material such as low density polyethylene or any other polymeric material which dissolves and mixes with bitumen binder at the temperature at which bitumen concrete is prepared , the bitumen binder packed in secondary package can be directly used without removing material to the hot mixer to produce bitumen concrete at user site . the temperature at which bitumen is converted to molten state if the polymer used for package fully melts and gets incorporated , and the polymer used in the packaging is sufficiently high i . e . more than 2 wt % by weight , the bitumen obtained on melting along with the packaging material at the user site is polymer modified bitumen ( pmb ). the polymer modified bitumen thus obtained possesses superior properties . the pmb thus obtained by the method of present invention is from drawbacks such as degradation / decomposition of polymers as the material is not subjected to prolonged heating . the packaging of the present invention is suitable both for unmodified and modified bitumen binders . the various grades of bitumen binders having softening point in the range of 30 - 65 ° c . can be packed using the present invention . present invention is not restricted to any particular bitumen grade but suitable for packaging any material in molten or liquid state . the invention will now be further illustrated by the following examples . each one of the experiment described in the examples was carried out under conditions of strict confidentiality . particularly , the trials mentioned in above examples , including manufacturing , transport worthiness , melting , hot mix preparation , road laying and other related experiments were conducted in a closed area and by maintaining confidentiality and secrecy . bitumen products are characterized for various properties like penetration , softening point , elastic recovery etc . following the standard tests by bureau of indian standard ( bis ) designated is 1203 : 1978 , is 1205 : 1978 and is 15462 : 2004 respectively . the drop test data given in examples for the packed bitumen bag is measured by the bis method is - 12724 . dissolution of packed bitumen bag data given in the examples is measured as described below : base bitumen sufficient to immerse the packed bitumen bag is melted in a suitable container by heating and maintaining at a temperature in the range of 140 to 280 ° c . the bag is then immersed in the above molten bitumen and the dissolution / melting of the polymeric bag in the base bitumen is observed with occasional mixing and by recording the time required for dissolution / melting of the entire polymeric material to form a homogeneous mixture . all of the given examples are merely for the purpose of illustration and are not to be regarded as limiting the scope of the invention or the manner in which it can be practiced . mold of dimensions 22 ″× 18 ″× 4 ″ in a box shape made up of light weight perforated aluminum sheet walls was fabricated . the design of the mold was made in such a way that it has smooth surfaces and corners . the empty bag can be easily fixed in the mold , filled with hot bitumen and cooled bags are removed easily . the empty bag can be fixed in the mold with the help of clamps at top and bottom . a preformed polymer bag of dimensions 23 ″× 18 ″ formed from a three layered film of thickness 150 μm , melting at 160 ° c . and having polyethylene in the outer layers and polypropylene in the inner core in the weight ratio 1 : 1 : 1 is fixed in the mold fabricated as per described in example 1 . the mold along with the bag is immersed in a water tank maintained at 5 ° c . temperature in such a way that about 19 inches of the bag is immersed in water . about 10 kg of accurately weighed hot molten bitumen having penetration and softening point of 66 and 50 ° c . respectively , maintained at a temperature of 110 ° c . is poured in the bag with the help of a funnel . bitumen is filled in the bag up to a mark of about 19 ″. the cooling of the bitumen inside the bag was continued in the water tank for additional 12 minutes during which the bitumen temperature is reduced to 50 ° c . the mold along with bag is then removed from the tank . the bitumen containing bag is removed from the mold and sealed using hot seal . the bag thus prepared is dropped from a height of 4 ″ and examined for any damage . the bag remained intact and no rupture / damage was observed . the bag is then immersed in molten bitumen in a drum maintained at 190 ± 10 ° c . the polymer bag with bitumen fully melted in 20 min . time . the bitumen product thus obtained showed penetration and softening point 64 and 51 ° c . respectively . a multi layered polymer film of polyethylene in outer layers and polypropylene in inner core having a melting point of 160 ° c ., and film thickness of 100 μm is taken and a bag of dimensions 9 ″× 12 ″ is formed by sealing three sides of the film . the bag thus formed is fixed in a mold of suitable size fabricated as described in example 1 . the mold with empty bag is immersed in cold water maintained at temperature of 7 ° c . and a pre - weighed ( 500 gms ) hot molten bitumen having softening point of 50 ° c ., at a temperature of about 115 ° c . is poured into the above bag . the filled bag is left inside the cold water for about 5 minutes and then removed , sealed and stacked . a polymer bag of 28 ″× 22 ″ dimensions is formed from a three layered polymer film of polypropylene in outer layers and polyethylene in inner core in the weight ratio 1 : 2 : 1 and having a melting point of 175 ° c . the bag thus formed is fixed in the mold of suitable size fabricated as described in example 1 and immersed in cold water maintained at temperature of 5 ° c . pre - weighed hot molten bitumen of 30 kg at a temperature of 110 ° c . having softening point of 48 ° c . and penetration of 68 is poured into the above bag . the filled bag is left inside the cold water for about 15 minutes and then removed and sealed . the bag thus formed could be fully melted . polymeric material used for packaging the bitumen is fully dissolved in molten bitumen at 200 ° c . a multi layered polymer film of polyethylene and polypropylene having characteristics as mentioned in example 2 and having film thickness of 250 μm is used to form a bag . the bag is then fixed in the a mold of suitable size fabricated as described in example 1 and immersed in cold water maintained at temperature of 3 ° c . pre - weighed ( 10 kg ) quantity of hot molten bitumen having penetration of 65 , at a temperature of about 110 ° c . is poured into the above bag . the filled bag is left inside the cold water for about 10 minutes and then removed , sealed and stacked . the bag thus formed was dropped from a height of 6 feet . no damage to the bag was observed . the bag with bitumen could be fully melted at 190 ° c . and brought to molten state . a pillow shaped bag is formed by cutting and sealing a three layered polymer film having melting point of 145 ° c . in dimensions of 18 ″× 23 ″. the bag thus formed is fixed in a mold and immersed in a water tank maintained at a temperature of about 5 ° c . pre - weighed ( 10 kg ) of hot molten bitumen was poured into the bag from the top opening with the help of a funnel . the bag filled with bitumen is continued in cold water till the temperature of bitumen in the bag dropped to less than 50 ° c . the mold is then removed from the water bath and the bag is sealed from top . a three layered polymer film of polyethylene in outer layers and polypropylene in inner core in the weight ratio 1 : 1 : 1 having a melting point of 210 ° c ., and having film thickness of about 90 μm is taken and a bag is formed as per the procedure mentioned in example 2 . filling of hot molten bitumen of a quantity of 10 kg having softening point of 50 ° c . and penetration of 60 / 70 is performed as per the procedure mentioned in example 2 . the filled bag is left inside the cold water for about 15 minutes cooling and then removed and sealed . a two - layered polymer film of thickness 150 μm made from polyethylene and polypropylene in weight ratio of 1 : 1 and melting point of 130 ° c . is used to make a bag . about 1 kg of accurately weighed bitumen having penetration and softening point of 100 and 45 ° c . respectively and maintained at a temperature of 85 ° c . is poured in the bag with the help of a funnel . the bag along with bitumen was cooled for another 5 minutes to reduce the bitumen temperature to 50 ° c . the mold along with bag was then removed from the tank and sealed . the bag thus formed could be fully melted . polymeric material used for packaging the bitumen is fully dissolved in molten bitumen at 200 ° c . a bag is formed using a single layered polymer film made from polyethylene having film thickness of 90 μm . hot bitumen at 120 ° c . could not be filled in the bag thus formed as the bag got punctured during filling . a polymer bag is prepared from a nylon film 100 μm of thick . hot molten bitumen of quantity 10 kg is filled and sealed as described in example 2 . the bag when heated at 180 ° c . did not fully melt . however , on further heating it was found that the bag along with bitumen could be fully melted at 265 ° c . a preformed polymer bag of dimensions 23 ″× 18 ″ formed from a three layered film of thickness 150 μm , melting at 160 ° c . and having polyethylene in the outer layers and polypropylene in the inner core is fixed in the mold fabricated as described in example 1 . the mold along with the empty bag is immersed in a water tank maintained at a temperature of about 5 ° c . polymer modified bitumen ( pmb ) ( 10 kg ), having a softening point of 60 ° c . and elastic recovery of 70 percent , maintained at 120 ° c . is poured in the bag with the help of a funnel . the cooling of the bitumen inside the bag was continued in the water tank for 10 minutes to reduce the bag temperature to 50 ° c . the mold along with bag is then removed from the tank and sealed . the bag thus prepared is dropped from a height of 4 ″ and examined for any damage . the bag remained intact and no rupture / damage was observed . the bag is then immersed in molten pmb in a drum maintained at 190 ± 10 ° c . the polymer bag with bitumen fully melted in 20 min . time . the product thus obtained did not show any change in the softening point and elastic recovery . a bag is formed from a multi layered polymer film of polyethylene and polypropylene having characteristics and dimensions as mentioned in example 2 . this bag is then fixed in the mold fabricated as described in example 1 . the mold along with the bag is immersed in a water tank maintained at 5 ° c . temperature in such a way that about 19 inches of the bag is immersed in water . about 10 kg of accurately weighed hot molten pmb having softening point of 55 ° c . and elastic recovery of 40 percent is filled , cooled and sealed . polymeric material used for packaging the bitumen is fully dissolved in molten bitumen at 200 ° c . the product thus obtained did not show any change in the softening point and elastic recovery . for easily handling of bitumen packed polymer bags , a secondary packaging is provided as described below : a two layer polymer film made from low density polyethylene and high density polyethylene melting above 250 ° c . and having thickness of 400 μm is used to fabricated bags in box shape having dimensions 22 ″× 18 ″× 12 ″ closed on all sides keeping flip type opening at top . for easy handling of the bags handles are also provided on either side along the length of the bag . the bag thus formed is hereinafter called a secondary bag . five numbers of individual bitumen packed bags of 10 kg capacity prepared as described in example 2 are placed in the secondary bag and the open end is closed by using a stitching . 500 numbers of such secondary bags are packed and subjected to the loading and unloading operations . the polymeric material , design and dimensions of secondary bags are convenient to handle and also sturdy enough to take the load of 50 kg . further these secondary bags are stacked up to a height of 8 ″ one above other for 24 hrs to observe any damage of outer secondary bag and inside individual bags . no damage on the sealing area , bursting of bags is observed during handling , stacking and storage . as the polymeric material used for making secondary bags does not dissolve completely at the end use application temperature , it is to be removed prior to the use of bitumen . a multilayer layered polymer film described in example 2 having film thickness of 250 μm is used for making secondary bags as described below . a prefabricated bag is formed in a box shape of dimensions 20 ″× 15 ″× 4 ″ closed on all sides , keeping a flip type opening at the top . three numbers of individual bitumen bags of 10 kg capacity each prepared as described in example 2 are placed in the secondary bag and sealed . 100 numbers of secondary bags thus prepared are heated in a container maintained at a temperature of 180 ± 10 ° c . bag along with bitumen melted and the polymer bag material completely dissolved . the molten bitumen thus obtained contained 5 wt % of polymeric material . the resultant bitumen product showed significant improvement in softening point , penetration and elastic recovery . the penetration reduced from 64 to 35 , softening point increased from 50 ° c . to 78 ° c . and elastic recovery increased to 38 %. four individual bitumen bags of 10 kg capacity each prepared as described in example 2 are wrapped together with the help of a three layered polymer film of thickness 50 μm . the effect of polymeric content on bitumen quality is studied by adjusting the weight content of the entire polymeric packaging material to 3 % of the packed bitumen quantity . the bag thus formed could be fully melted . polymeric material used for both primary and secondary packaging is fully dissolved in molten bitumen at 200 ° c . the resultant bitumen showed an improvement in penetration and softening point to 64 . 2 and 51 . 5 ° c . as against 65 and 50 ° c . respectively . packaging of 11 mt bitumen in primary polymeric bags of capacity 10 kg each ( total 1100 nos .) is done as described in example 2 however the filling activity is carried out using a semi - automatic filling machine and the system as described in the present invention . the primary bags thus formed are packed in secondary bags of capacity 50 kg each ( total 220 nos .) as described in example 13 . transport worthiness study of bitumen bags is completed by transporting the entire 11 mt poly packed bitumen by road over more than 600 kms , it is observed that there is no damage , spillage of bitumen from the bags . the packaging material ( individual and secondary as well ) is strong enough to undertake the road transportation conditions such as weather , handling , loading and unloading , etc . further it is observed that the stacking of the bitumen secondary bags required less space as compared to conventionally packed bitumen . an increased quantity of bitumen bags can be transported at one time compared to drum packed bitumen . bitumen bag is also fully resistant to extreme humid environmental condition vis - à - vis commonly faced problem of rusting of metallic drum packed bitumen . melting / dissolution of 11 mt packed bitumen bags is conducted in a commercial scale hot mix plant ( bitumen tank having about 50 % of molten bulk bitumen , maintained at a temperature range of about 180 - 200 ° c .). it is observed that the polymer film material got dissolved / mixed with the bitumen completely and easily in the existing set - up without any modifications and damage . the molten bitumen behaved exactly in similar way as of bulk bitumen and no operational difficulties could be encountered as against the use of bulk bitumen in hot mix plant . the hot molten bitumen obtained from the example described above is then spray mixed with aggregate to form bitumen concrete as per the required ratio . this bitumen concrete is then tested for marshall stability ( as per astm d1559 ). a higher marshall strength of 15 nm 2 is observed for polymer bag packed bitumen as compared to bulk bitumen of 12 nm 2 and during this no operational differences encountered as compared with the road lying using bitumen concrete prepared from bulk / drum packed bitumen .	1
referring now specifically to the drawings , an orthopedic padding , for example for use as an undercast liner according to the present invention is illustrated in fig1 and shown generally at reference numeral 10 . while the undercast liner 10 can be formed in any desired width or length , the undercast liner 10 shown in fig1 , 2 , and 3 is about 7 . 5 cm ( about 3 in .) wide and is formed into a roll during manufacture for shipping and storage until use . the undercast liner 10 is easily applied from the roll , as shown in fig2 . the liner 10 includes two opposing faces 11 , 12 and an intermediate spacer area 13 that both separate and interconnect the faces 11 , 12 , as described in further detail below . the undercast liner 10 can be formed in a tubular form or in an elongate padding form in a roll . the liner 10 can be constructed using any suitable organic or inorganic monofilament yarn , preferably a hydrophobic / water resistant monofilament yarn such as polypropylene , polyester , polyethylene and nylon . the monofilament yarn used for constructing the liner 10 preferably has a diameter of at least 0 . 03 mm . the liner 10 is constructed in a spacer fabric construction to provide sufficient cushioning and breathability , and it has been found that the use of a monofilament hydrophobic yarn on both faces 11 , 12 and in the spacer area 13 provides enhanced water resistance , light weight , breathability and resistance to collapse and degradation due to moisture and bacteria during extended use . the liner 10 is formed using any suitable fabric forming technology such as weaving , various knitting techniques such as , for example , weft knitting and warp knitting , non - woven , stitching , or a combination of these techniques . preferably , the structure should provide some stretch in both the length - wise and width - wise directions , and facilitate conforming the undercast liner 10 around an anatomical shape during application . the liner 10 can be treated with one or more finishes to provide additional water resistance , anti - bacterial and / or anti - odor characteristics , or aromatherapy to improve the functionality or enhance the cast - wearing experience for the patient . alternatively , the liner 10 can be fabricated from modified / treated monofilament yarns incorporating suitable fillers or finishes to improve the performance of the liner 10 . the liner 10 may also be provided with an adhesive coating on one or both faces 11 , 12 to aid in application to the patient . the adhesive is preferably any suitable low tack , pressure sensitive adhesive , such as an acrylic or silicone adhesive . the adhesive aids in application by adhering to itself and thus maintaining the exact placement of the layers relative to each other as the liner 10 is applied by the cast technician . in one preferred embodiment , the liner 10 is constructed as a spacer fabric using polypropylene monofilament and a low tack , pressure sensitive adhesive on one surface . the monofilament yarn has a diameter of at least 0 . 03 mm , and preferably between 0 . 05 - 0 . 25 mm . preferably , the liner 10 requires no additional finish or water repellency treatment . more specifically , the preferred embodiment of the liner 10 is constructed of a polypropylene monofilament yarn on a double needle bed knitting machine , and can be knitted on either a warp knitting raschel machine or a crochet knitting machine . the liner 10 is preferably constructed using a pillar and inlay stitch on the surfaces 11 , 12 and a 3 or 5 needle v in the spacer area 13 . the yarn has a diameter of 0 . 03 - 0 . 25 mm . the fabric for the liner 10 is formed with at least 50 courses per meter preferably 200 - 850 courses per meter . the liner 50 weighs between 50 - 400 grams per square meter , and more preferably between 100 - 250 grams per square meter . the liner 10 has a nominal thickness when not compressed or under tension of approximately 1 . 5 - 3 . 5 mm . alternatively , an undercast liner may be constructed as a spacer fabric with at least one of the yarns being a multifilament or spun yarn in order to provide even more patient comfort . the liner may be treated with suitable fluorochemical , silicone or other water repellant finish to improve drainage and provide faster drying . referring now to fig2 , the undercast liner 10 is applied to the injured limb in a conventional manner . as noted above , the stretch provided by the undercast liner 10 permits a fast , accurate , closely - conforming application without wrinkles or creases . as is shown in fig3 - 7 , after application of the undercast liner 10 , a conventional cast tape 20 is wetted , fig3 , excess water removed by wringing , fig4 , and applied to the injured limb , fig5 - 7 , taking care in the usual manner to avoid overlapping the undercast liner 10 on opposite ends , leaving a short width of exposed undercast liner 10 . referring now to fig8 , a circular knit liner 30 is shown , preferably with the same preferred constructions described above . the liner 30 includes an outer face 31 , an inner face 32 and a spacer area 33 that both separates and interconnects the two faces 31 , 32 , as shown in fig1 . instead of wrapping , the liner 30 is pulled onto the limb as shown in fig9 , in the same manner as a conventional stockinette . thereafter , a cast tape 20 is applied in a conventional manner . a further embodiment includes a knitted spacer fabric constructed from monofilament yarns . the monofilament yarns may be of the type selected from nylon , polypropylene or polyester yarns or a mixture thereof . the monofilament yarns may be between 0 . 03 mm and 1 . 5 mm in diameter . the substrate may have a thickness of between 0 . 5 and 10 mm . the substrate weight may be between 40 and 160 grams per square meter . the substrate may have between 4 and 20 courses per inch . the substrate may be used in a bandaging product or in a compression bandage , and may incorporate elastic yarns . an orthopedic padding for example for use as an undercast liner is described above . various details of the invention may be changed without departing from its scope . furthermore , the foregoing description of the preferred embodiment of the invention and the best mode for practicing the invention are provided for the purpose of illustration only and not for the purpose of limitation — the invention being defined by the claims .	8
several embodiments of the present invention provide for a single crystal pull apparatus using an improved crucible . one embodiment of the improved crucible in the form of a multilayer crucible 21 is shown in fig2 - 4 . as illustrated in fig2 , an outer crucible 22 is shown and is preferably made from nickel or a nickel alloy . in the preferred embodiment , the outer crucible 22 will have a parabolic shape in that the sides will curve smoothly down from the edge of the top portion and flatten toward the base of the crucible near its center . furthermore , the outer crucible 22 can be circular in shape . other shapes can be used ; however , they should be such that the thermal field within the apparatus remains stable . in other embodiments , the outer crucible 22 is shaped like a bowl , with the middle of the bowl forming a substantially flat bottom and the sides curving upwards to form an upper edge . in some embodiments , on the upper portion of the outer crucible 22 , a flange 23 can extend outward from the edge of the outer crucible 22 . as further shown in fig2 , an insertable layer 24 can be placed inside the outer crucible 22 . the insertable layer 24 preferably is made of platinum with a wall thickness of from about 0 . 2 mm to about 1 . 0 mm , and preferably , from about 0 . 3 mm to about 0 . 8 mm , more preferably from about 0 . 4 to about 0 . 7 mm , and still more preferably , from about 0 . 4 mm to 0 . 6 mm , and most preferably the wall thickness is about 0 . 5 mm . alternatively , the thickness of the insertable layer 24 can be 1 mm or less , more preferably 0 . 7 mm or less , still more preferably 0 . 5 mm or less . however , in some embodiments , the insertable layer 24 can be a disposable insert made of quartz as an inexpensive alternative to platinum , as the quartz material will be destroyed by the crystal growth process . the insertable layer 24 should be shaped to have a tight and intimate fit with outer crucible 1 . in particular , the insertable layer 24 preferably conforms to the shape of the inner surface of the outer crucible 22 . accordingly , the insertable layer 24 should have a parabolic shape with the lowest portion being at the center and sides curving upwards to a top edge of the upper portion . furthermore , the insertable layer 24 preferably covers the whole surface of the outer crucible 22 , including the flange 23 . optionally , the insertable layer 24 covers the outer crucible up to and above the height of any melt contained therein . as further shown in fig2 , a wire frame 25 can be placed in the insertable layer 24 . the wire frame 25 can be made of platinum wire having a diameter of from about 0 . 2 mm to about 1 . 0 mm , preferably , from about 0 . 3 mm to about 0 . 8 mm , more preferably from about 0 . 4 to about 0 . 7 mm , still more preferably , from about 0 . 4 mm to 0 . 6 mm , and most preferably the diameter is about 0 . 5 mm . alternatively , the diameter of the wire frame 25 can be 1 mm or less , more preferably 0 . 7 mm or less , still more preferably 0 . 5 mm or less . additionally , an inner crucible 26 is also shown in fig2 and can be placed in wire frame 25 . wire frame 25 will rest between insertable layer 24 and inner crucible 26 . preferably , the wire frame 25 should be designed and arranged so that there is a space between the insertable layer 24 and the inner crucible 26 . as a result , there will always be a space between them equivalent to the diameter of the wire frame . accordingly , if the diameter of the wire frame 25 is 5 mm , the space between the insertable layer 24 and the inner crucible 26 would also be 5 mm . this allows a melt to pass between the insertable layer 24 and inner crucible 26 and enter the interior of the inner crucible 26 through one or more holes 29 . alternatively , the wire can be bent and configured to a position where it holds the inner crucible 26 further from the insertable layer 24 than just the diameter of the wire frame 25 . for example , if the wire is looped over itself or bent inwards , it will create additional space between the inner crucible 26 and insertable layer 24 than just the diameter of the wire itself . one design embodiment for the wire frame is shown in fig2 . the wire frame 25 can be designed such that there is wire around the circumference of the top thereby forming an upper ring . the wire can then extend downward and curve inward , reaching a lower wire portion forming an inner ring having a smaller diameter than the upper ring . extending between the upper and lower ring can be at least one wire portion . when more than one wire portion extends between the upper and lower ring the portions can be spaced in equal distance from one another , or alternatively unequal distances . the lower ring can also formed into arch extending upward and inward for example following the shape of a hole in the lower portion of the inner crucible 26 . the wire frame can be one continuous wire length or can be several wire pieces assembled together . the inner crucible 26 conforms to the shape of the outer crucible 22 in its lower part . therefore , the inner crucible 26 will have a bowl like shape with a lower portion which is substantially flat , similar to the outer crucible and then curve upwards to the outer edge . the upper portion of the inner crucible 26 will be spaced apart from the outer crucible 22 and the insertable layer 24 covering the inner part of the outer crucible . thus , the walls of the inner crucible 26 as they curve upwards toward the outer edge will curve further inward than the outer crucible 22 . as a result , there will be a larger space between the inner crucible 26 and the outer crucible 22 toward the upper portions of each thereby forming an annular well 27 between the two , as shown in fig3 . a feed tube 28 as shown in fig3 will charge raw material to this annular well 27 to be melted by heat generated by side heaters . after melting , the raw material will pass into the space formed by the diameter of the wire frame 25 between the inner crucible 26 and insertable layer 24 . the melt can then pass through the one or more holes in the inner crucible 26 into its interior . as shown in fig2 , there can be one large hole 29 in the center bottom portion of the inner crucible 26 , however , this hole can also be placed off center or along the side , or alternatively there can be more than one hole placed in the center , off - center , and through the sides of the inner crucible 26 to allow the melt to pass therethrough . also , a hole in the lower portion of the inner crucible can arch curve inward toward the interior of the crucible . the inner crucible 26 can be made of platinum and have a wall thickness of from about 0 . 2 mm to about 1 . 0 mm , preferably , from about 0 . 3 mm to about 0 . 8 mm , more preferably from about 0 . 4 to about 0 . 7 mm , still more preferably , from about 0 . 4 mm to 0 . 6 mm , and most preferably the wall thickness is about 0 . 5 mm . alternatively , the thickness of the inner crucible 26 can be 1 mm or less , more preferably 0 . 7 mm or less , still more preferably 0 . 5 mm or less . an embodiment showing the multilayer crucible 21 fully assembled is illustrated in fig3 also showing a single crystal 30 contacting a melt 31 contained within the multilayer crucible . it is preferable that all parts of the multilayer crucible are joined tightly together , except for the upper portion of the inner crucible 26 and outer crucible 22 , allowing room for the annular well 27 . as can be seen , the insertable layer 24 fits intimately with the outer crucible 22 . the wire frame 25 is placed between the inner crucible 26 and outer crucible 22 ( including insertable layer 24 ). furthermore , as shown in fig4 , the wire frame 25 will be preferably positioned so that at least one portion of the wire frame is located at the point where the inner crucible 22 meets insertable layer 24 . moreover , in the preferred embodiment , the level of the melt 31 is set at the point where the inner crucible 26 and the insertable layer 24 meet . the three parts of the multilayer crucible : insertable layer 24 , the wire frame 25 , and the inner crucible 26 , will all deform as a result of the changing temperatures required by the growth process . as discussed above this deformation is a result of the heating of the raw material to form the melt , and the freezing of the melt to form the single crystal as the seed crystal is pulled . however , as a result of the smooth shape and thin walls and diameter of the component parts of the multilayer crucible , reshaping these parts using simple tools will be easy for an operator of the single crystal pull apparatus . while the present invention may be embodied in many different forms , a number of illustrative embodiments are described herein with the understanding that the present disclosure is to be considered as providing examples of the principles of the invention and such examples are not intended to limit the invention to preferred embodiments described herein and / or illustrated herein .	8
the following detailed description is of the best currently contemplated modes of carrying out exemplary embodiments of the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention , since the scope of the invention is best defined by the appended claims . various inventive features are described below that can each be used independently of one another or in combination with other features . broadly , an embodiment of the present invention generally provides a one - piece football uniform . an embodiment of the present invention is a sports garment with no shirttail . finally , equipment managers ( or mothers ) would only have one piece to keep track of and put in the washing machine and dryer . in an embodiment , with the elimination of the need for a belt ( and draw string ), a one piece uniform may cost roughly $ 5 . 50 less per uniform . this could be a savings of $ 70 to $ 90 a year for a rural eight man high school team or a youth league team , up to $ 1 , 900 to $ 2 , 000 a year for major colleges and pros . an embodiment may prevent a defender from grabbing the ball carrier by the bottom of an untucked jersey . equipment managers would not need to pile pants and jerseys separately in preparation for washing . a one piece uniform may also be faster to put on . to use an embodiment of the present invention , the collar has a zipper that goes down to the sternum . to start , the zipper may be fully unzipped , and the opening at the collar may be as wide as possible . the player steps through the opened collar . s / he then puts his or her feet and legs completely through each pant leg . once the pants are securely on , the player will reach down and pull up the attached garment by the collar , and then place the arm through the sleeve . s / he will repeat the process with the other arm . each arm sleeve will have to be manipulated over the shoulder pads . once the uniform is completely on , the player will zip up the collar . there will be an attached piece of cloth that runs the length of the zipper . once the zipper is up , this strip of cloth is folded over the zipper and held in place by velcro ® or other hooks - and - loops . an embodiment may include polyester and mesh materials blended uniquely for the game of american football , and the zipper from the front of the collar down to the sternum . the collar opening is wide enough for the player to slip it on and pull the collar and sleeves over the shoulder pads . an optional embodiment may include velcro ® or other hooks - and - loops reinforcement that cover the zipper ; and inserts on the inside of the pants for hip , knee , and thigh pads . fig1 depicts an embodiment of a one - piece football uniform 10 with a combined top and bottom 12 . it includes shoulder pad supports 14 , knee pad supports 16 , and thigh pad supports 18 , each of which allows the appropriate pad to be inserted and retained by the uniform 10 . it also includes a heavy - duty zipper 20 , that allows the collar to open wide enough for the player to step through the uniform and stretch over the shoulder pads . an embodiment of a heavy - duty zipper 20 is depicted in fig2 . also included is a velcro ® or other hooks - and - loops flap 22 to cover the zipper 20 . in an embodiment , first , the player steps into the pant legs , similar to the way a person steps into a pair of one piece coveralls , long underwear , or one piece racing suit . second , once the pants are in place , the player would grab the collar of the uniform , keeping in mind that the top and bottoms are connected . this is the same concept and mechanics as putting on a one - piece pair of work coveralls , long underwear , or full body scuba diving suit . the one piece football uniform also accommodates football pads , and is made of a stretch material for football . third , an arm is inserted into the sleeve . the player stretches and manipulates the collar over the shoulder pad . s / he would then repeat the process for the other arm . fourth , once the uniform is completely on , securely fasten it . this may be done via the six inch , heavy duty plastic zipper . the zipper runs from the front of the collar down to the sternum . once the zipper is zipped up , a three inch strip of cloth that is attached parallel to the zipper is folded over the zipper and secured down over it by velcro ® or other hooks and loops . in an embodiment , the collar is totally unzipped and open . the player steps through the opening at the top . the player pulls the pants part fully up . the arms are put through the sleeves . the collar is pulled up and stretched over the shoulder pads . the zipper is zipped up . the attached cloth covering is pulled over the zipper . the cloth zipper cover is pressed down to secure it with the hooks - and - loops . to don an embodiment , the player would have the collar as wide open as possible . this is accomplished by unzipping the six inch heavy duty plastic zipper that runs from the front of the collar down to the sternum . the player would step through each pant leg and pull the pants up securely in place . then , much like a scuba diver pulling up a wet suit , the player is preparing to put his or her arms through the sleeves . the player inserts one arm at a time , and then stretches the collar and upper part of the sleeve over the shoulder pads . once the top is completely on , meaning the arms are in the sleeves and the collar is fully over the shoulder pads , the player zips up and folds the parallel three inch strip of cloth over the zipper , presses it down against the chest in order to secure it to the awaiting hooks - and - loops . it should be understood , of course , that the foregoing relates to exemplary embodiments of the invention and that modifications may be made without departing from the spirit and scope of the invention as set forth in the following claims .	0
next , an embodiment of this invention will be explained in detail , referring to the figures . as shown in fig1 a reference voltage from a capacitance c1 for reference voltage is inputted to a buffer 12 , which outputs a reference voltage of the same voltage as the input voltage . the reference voltage from the buffer 12 is applied as an input voltage to a first buffer 13 and a second buffer 14 . an output of a first operational amplifier 4 and an output of the first buffer 13 are connected together to a terminal 9 . an output of a second operational amplifier 7 and an output of the second buffer 14 are connected together to a terminal 10 . resistances r6 , r7 and r8 divide a power supply voltage vcc according to ratios of the resistances to generate reference voltages at a node a and at a node b . a first level comparator 15 consists of transistors q 4 and q 5 and a resistance r4 , compares the reference voltage from the capacitance c1 for reference voltage with the reference voltage at the node b , and applies the results to bases of transistors q 3 and q 6 . a second level comparator 16 consists of transistors q 9 and q 10 and a resistance r5 , compares the reference voltage from the capacitance c1 for reference voltage with the reference voltage at the node a , and applies the result to a base of a transistor q 8 . a current mirror circuit 17 charges the capacitance c1 for reference voltage with a current equal to a collector current of the transistor q 3 , which is limited by a resistance r3 . a control circuit 19 generates a control signal corresponding to turning - on of a transistor q 7 or a transistor q 8 . a switch 20 selects between a terminal a and a terminal b according to a control signal from the control circuit 19 . an operating current source 21 provides either of the first operational amplifier 4 and the second operational amplifier 7 or the first buffer 13 and the second buffer 14 with an operating current through the switch 20 . note that a common element is given the same symbol in fig1 as in fig2 . in the circuit shown in fig1 the reference voltage from the buffer 12 is applied not only to the first operational amplifier 4 and the second operational amplifier 7 , but also to the first buffer 13 and the second buffer 14 . and the first buffer 13 and the second buffer 14 are enabled while the first operational amplifier 4 and the second operational amplifier 7 are disabled immediately after turning - on of the power supply . output voltages of the first buffer 13 and the second buffer 14 are exactly the same as an output voltage of the buffer 12 . hence , exactly the same dc voltages are generated at the terminal 9 and at the terminal 10 , thus no current flows through the speaker 11 and no sound is made . because the output terminals of the first buffer 13 and the second buffer 14 have low impedances , and because both of the first operational amplifier 4 and the second operational amplifier 7 are disabled , they are not affected by the signal from the terminal 3 or noise due to rising power supply voltage . this status is kept for duration of time that a shock sound occurs , during which the output voltage of the buffer 12 rises to a bias level vref1 which the first operational amplifier 4 and the second operational amplifier 7 need . until then , the switch 20 is turned to the terminal a . meantime , the first buffer 13 and the second buffer 14 charge the blocking capacitor c 2 to vref1 through the resistances r9 and r10 . because the operation described above makes dc voltages at the terminal 3 , at the terminal 9 and at the terminal 10 equal , no current flows through the speaker 11 when the switch 20 turns to the terminal b and the first operational amplifier 4 and the second operational amplifier 7 begin their operation . since the dc voltages at the terminal 3 , at the terminal 9 and at the terminal 10 are equal , an ac ( alternating current ) audio signal from the terminal 2 is applied to the first operational amplifier 4 through the blocking capacitor c 2 and the resistance r9 . an output signal of the first operational amplifier 4 is applied to the second operational amplifier 7 through the resistance r11 , since the first buffer 13 is disabled . therefore , a normal audio signal is obtained at the terminal 10 while the reverse audio signal is obtained at the terminal 9 . a speaker 11 is driven by the two audio signals to make a sound such as the beep sound . next , how the reference voltage of the buffer 12 rises and how the switch 20 alternates between the terminal a and the terminal b will be explained . now a voltage at a power supply line 25 in fig1 is assumed to be switched from a ground to vcc . then , reference voltages are immediately generated at the node a and at the node b . the reference voltage at the node a is applied to a base of the transistor q 10 and the reference voltage at the node b is applied to a base of the transistor q 5 . resistances r1 and r2 are set to have high value of resistance of about 50 kω . this is to remove ripples on the power supply line 25 . the reference voltage of the capacitance c1 for reference voltage needs to be stable , because it is used as a bias voltage for the operational amplifiers . consequently , a voltage at a terminal 26 is low at first . therefore , the transistor q 4 is turned on while the transistor q 5 is turned off . when the transistor q 4 is tuned on , the transistor q 7 is turned on . a voltage at a base of the transistor q 9 is low because the voltage at the terminal 26 is low . therefore , the transistor q 9 is turned on while the transistor q 10 is turned off . with the transistor q 7 turned on , the control circuit 19 turns the switch 20 to the terminal a . as a result , the first buffer 13 and the second buffer 14 are enabled while the first operational amplifier 4 and the second operational amplifier 7 are disabled immediately after turning - on of the power supply . how long this status should last is determined according to timings of generation of the shock sound and the beep sound . duration of this status is determined by a charging rate of the capacitance c1 for reference voltage . that is , the status changes when the voltage charged to the capacitance c1 for reference voltage exceeds the reference voltage at the node b . since the resistance r1 has the high value of resistance , charging only through the resistance r1 takes a long time . thus , the charging rate to the capacitance c1 for reference voltage is adjusted by the current mirror circuit 17 in the circuit shown in fig1 . the transistor q 3 is turned on at the same time the transistor q 7 is turned on . when the transistor q 3 is turned on , the current mirror circuit 17 is put in operation , and a current equal to a current flowing through the resistance r3 flows into the capacitance c1 for reference voltage . a conversion timing of the first level comparator 15 can be chosen freely , since the current flowing through the current mirror circuit 17 is determined by the resistance r3 . as described above , charging to the capacitance c1 for reference voltage is made through the resistance r1 and the current mirror circuit 17 to raise the voltage at the terminal 26 . when the voltage charged to the capacitance c1 for reference voltage exceeds the reference voltage at the node b , the transistor q 4 is turned off and the transistor q 5 is turned on . when the transistor q 5 is turned on , the transistor q 6 is turned on and the reference voltage at the node b is turned to a low level . this is made to reduce an inversion time of the first level comparator 15 . when the transistor q 4 is turned off , the transistors q 3 and q 7 are turned off . when the transistor q 3 is turned off , the charging made through the current mirror circuit 17 comes to a halt . with the transistor q 7 turned off , the control circuit 19 turns the switch 20 to the terminal b . as a result , the first buffer 13 and the second buffer 14 are disabled while the first operational amplifier 4 and the second operational amplifier 7 are enabled . at that time , the transistor q 9 remains on and the transistor q 10 remains off , since the reference voltage at the node a is set at high enough voltage compared with the voltage charged to the capacitance c1 for reference voltage . the capacitance c1 for reference voltage is disposed primarily to apply the bias voltage to the first operational amplifier 4 and the second operational amplifier 7 . in the circuit shown in fig1 the capacitance c1 for reference voltage is also used to generate a predetermined duration ( to keep the operational amplifiers disabled and the buffers enabled ). the dual - purpose use of the capacitance c1 eliminates the need for an additional capacitance for setting the duration , and reduces the number of elements , benefiting implementation of the circuit in an ic . when the power supply is turned on , the shock sound does not occur because the first buffer 13 and second buffer 14 are enabled and the first operational amplifier 4 and the second operational amplifier 7 are disabled , as described above . next , turning off of the power supply is explained . when the power supply voltage falls to 0v , an abnormal waveform is applied to the terminal 2 . the abnormal waveform goes through the first operational amplifier 4 and the second operational amplifier 7 to the speaker where a shock sound occurs according to the abnormal waveform . thus in the circuit shown in fig1 utilizing the system to prevent the shock sound at the turning - on of the power supply , the first buffer 13 and the second buffer 14 are used to prevent the shock sound also when the power supply is turned off . now the voltage at the power supply line 25 in fig1 is assumed to be switched from vcc to the ground . then the voltages at the node a and at the node b fall immediately to the ground . when the voltage at the node a falls to the ground , the transistor q 9 is turned off and the transistor q 10 is turned on . the voltage at the terminal 26 is lowered gradually at low rate , since the capacitance c1 for reference voltage is discharged through the resistance r2 . when the transistor q 10 is turned on , the transistor q 8 is turned on and the control circuit 19 turns the switch 20 to the terminal a . voltages at the terminal 9 and at the terminal 10 are determined by a dc voltage of the buffer 12 . therefore , the voltages at the terminal 9 and at the terminal 10 are not affected even the abnormal waveform is applied from the terminal 2 . when the voltage at the node b falls to the ground , the transistor q 4 is turned off and the transistor q 5 is turned on . when the transistor q 4 is turned off , the transistor q 3 is turned off and the current mirror circuit 17 stops charging . as a result , the shock sound at turning - off of the power supply also can be prevented according to the circuit shown in fig1 . an example of a concrete circuit for a case in which the first buffer 13 , the second buffer 14 , the first operational amplifier 4 and the second operational amplifier 7 in fig1 are driven by the control circuit 19 is shown in fig3 . the control circuit 109 in fig3 includes a voltage source 30 and a switch 31 , which flips to a - side when the buffer 32 is to be enabled and flips to b - side when the operational amplifier 33 is to be enabled . when the switch 31 flips to a - side , a voltage from the voltage source 30 is applied to transistors 34 and 35 to turn them on . when the transistors 34 and 35 are turned on , transistors 36 and 37 are turned on to put a differential amplifier 38 in operation . the reference voltage vrefin from the buffer 12 in fig1 is applied to an input terminal 39 of the differential amplifier 38 . since the differential amplifier 38 makes 100 % negative feedback operation , the same voltage as the voltage at the input terminal 39 is obtained at an output terminal 40 . meantime , the operational amplifier 33 halts its operation since transistors 41 and 42 to supply an operating current are turned off . when the switch 31 flips to b - side , the voltage from the voltage source 30 is applied to transistors 41 and 42 to turn them on . when the transistors 41 and 42 are turned on , a transistor 43 is turned on to put a differential amplifier 44 in operation . the reference voltage vrefin from the buffer 12 in fig1 is applied to an input terminal 45 of the differential amplifier 44 . the differential amplifier 44 makes amplification with a gain defined by a ratio between resistances 46 and 47 . a signal from an input terminal 48 is amplified and led out to an output terminal 49 . as described above , the buffer and the operational amplifier can be alternatively put in operation , according to the circuit in fig3 . according to this invention , the capacitance for reference voltage can also be used for setting the bias voltage for the first and the second buffers and the first and the second operational amplifiers , benefiting the integration of the circuit in an ic by reducing the number of capacitances . and according to this invention , there arises no shock sound , since the first and the second buffers are turned on and the first and the second operational amplifiers are turned off immediately after turning - on of the power supply and the voltage charged to the capacitance for reference voltage is applied to the first and the second buffers to make the voltages at both ends of the speaker equal . also according to this invention , only with addition of a level comparator , the same function used at the turning - on of the power supply is used to turn on the first and the second buffers and turn off the first and the second operational amplifiers to make the changes in the voltages at the both ends of the speaker exactly the same so that the speaker makes no shock sound at the turning - off of the power supply . furthermore , according to this invention , the duration of switchover from the buffers to the operational amplifiers can be adjusted , since there is a charge - boosting circuit to boost charging to the blocking capacitor according to the output signal of the level comparator .	7
[ 0025 ] fig1 shows a planar inverted - f antenna element , or “ pifa ”, 10 , which is utilized in the present invention . this antenna element 10 includes a planar first conductive plate 12 with preselected length and widths l 1 , w 2 and a second conductive plate 14 that are interconnected together and spaced apart from each other by a third conductive plate 16 that provides a short circuit between the two plates 12 , 14 . as shown best in fig1 the radiating plate 12 has a t - shaped configuration with the wider , top portion 13 of the “ tee ”. the second plate 14 has predetermined length and width dimensions l 2 , w 2 that define a preselected surface area of the plate . in the embodiment shown , the second plate 14 has a greater surface area than the first plate 12 , and the two plates 12 , 14 are preferrable arranged generally parallel to each as is typical to pifas . in the embodiment illustrated , the second plate 14 is generally longer than the first plate and the interconnecting third plate generally has a width less than the widths w 1 , w 2 of the first and second plates 12 , 14 . it will be understood that this parallel arrangement is only preferred and that the two plates , at a minimum maybe disposed in two different planes . the second plate 14 is further connected to the short circuit plate 16 by folding stamping and forming the entire antenna from a single sheet of conductive material and folding it along the edges , or folding 18 a , 18 b which may be partially slotted as at 19 to facilitate the bending of these plates . each inverted - f antenna 10 of the antenna system of the invention is substantially identical to each other . the radiating plate 12 of each antenna 10 is preferably provided with a slot 20 which opens along a front edge 20 a of the radiating plate 12 at a location opposite the short circuit plate 16 , or what will be described herein as the “ front end ” of the antenna element 10 . this slot 20 extends lengthwise within the leg portion 15 of the radiating element , and preferably down the center thereof . the ground plate 14 has a similar slot 22 , which is larger than slot 20 , that begins at a corresponding edge 22 a of the plate 14 and also extends lengthwise inwardly of the ground plate 14 . the slots are generally aligned with each other vertically and facilitate the terminating of the coaxil feed line 56 to the antenna elements 10 as described hereafter . although the modular antenna system of the invention is described herein with the antenna modules of the system incorporating pifa - style antennas 10 , it should be understood that the system of the invention may be applicable for use with other types of antennas . [ 0028 ] fig2 and 3 illustrate an antenna “ system ”, or assembly , of the invention that joins together two individual antenna modules 24 , which are interengageble as described below . each antenna module 24 includes a dielectric housing or frame 26 , that supports a single antenna 10 element therein . the dielectric housing 26 may be provided as a one - piece structure that is molded of a suitable dielectric material , such as plastic or the like . as illustrated , each antenna module 24 has a square or rectangular configuration that is slightly larger than the antenna elements 10 , so as to easily accommodate the antenna elements therein . in this regard , each module 24 may be considered as having a housing or frame - like structure as is shown in the drawings that utilizes various sidewalls 32 , 34 , 36 that cooperatively define a housing with a central or interior cavity for the antenna element 10 . the housing has two side walls 34 that are disposed adjacent to each other , and a third side wall 36 that includes an engagement means for attaching and joining two corresponding antenna modules together . interconnecting these three sidewalls 34 , 36 is a wall 32 having an opening 33 through which the antenna elements 10 may be inserted into the central cavities 29 of the modules 24 . each housing 26 has an open top 28 ( fig2 ) and a closed bottom 30 ( fig3 ) and further may include a plurality of mounting pads , or blocks , 38 molded integrally therewith , that are used to facilitate mounting the modules to or within an appropriate structure , such as a laptop computer or desktop computer . the bottom surfaces or mounting blocks 38 may have adhesive layers 39 applied thereto for securing the modules to the structure . as mentioned above , the two antenna modules 24 are preferably provided with a means for engaging or interlocking with each other . as best shown in fig3 and 4 , this engagement means 40 may include a dovetail - type engagement means , such as a mortise , or channel , 44 into which a tenon , tongue , or other similar projection 42 fits . this configuration of these two modules is preferably of the mortise - tenon configuration so that the two antenna modules 24 may be interengaged together and reliably retained together once assembled , but other types of engagement are also contemplated such as plugs and receptacles , and any other similar post and recess arrangement . the engagement means assists in orienting the antenna modules 24 in a preferred orientation at approximate right angles to each other , with respect to the polarization of each antenna element 10 . the attachment means 40 may take the general form of a tongue - and - groove or mortise and tenon interengaging structure between the exterior portions of the frame attachment walls 36 . as seen in fig2 and 3 , an elongated tongue 42 projects from attachment wall 36 of the left - hand module and groove 44 is formed in the corresponding opposing attachment wall 36 of the right - hand antenna module 24 . the groove is sized and shaped for receiving the tongue 42 . the dovetail tongue 42 is slid into groove 44 in the direction of arrows “ a ” to join the two antenna modules 24 together as shown in fig4 and 5 . in the preferred embodiment , the tongue 42 and groove 44 have interengaging dovetail configurations in cross - section so that when the modules are interengaged , the modules cannot be pulled apart in a direction transversely of the tongue - and - groove interengaging structure . as shown in fig2 one end of dovetail groove 44 is open and the opposite end 44 a of the groove is closed . as illustrated in fig2 and 4 , the top and leg portions 13 , 15 of the tee , are oriented in an offset manner with respect to each other . the radiation pattern of each of these antennas may be considered as being at least partially centered around the slots 20 of each antenna and this combined field pattern is shown diagrammatically in fig8 . the orientation of each of the t - shaped radiating elements and the feed slots serve to influence the polarization of the radiating elements of each antenna . the direction of polarization occurs lengthwise along the leg portion 15 of each radiating plate 12 , i . e ., from the slot 20 to the top portion 13 of the t - shape . the length d controls the operational frequencies of the antenna elements , while the width , w , controls the isolation of the antenna elements . the greater the length d , the lower the frequency and the lesser the width w , the more the isolation will approach a minimum . in the preferred embodiment shown , the length d is greater than the width w . as such , the radiating patterns will intersect and provide an overall expanded radiation pattern that is larger than that pattern obtained with a single antenna . this is supplemented by the different widths of the top and leg portions 13 , 15 of each antenna , which cooperatively produce a band width that is greater than of a single , or constant , width section . this t - shape of the antenna elements approximate a bowtie antenna . the openings of the modules permit the antennas to be easily slid , or otherwise introduced into their respective modules 24 . fig6 and 7 best show the antenna elements 10 being supported within the module housings 26 primarily by way of a series of support walls 50 , 52 . two of these support walls 50 are spaced apart from each other and extend lengthwise of the antennas from the “ front ” to the “ rear ” of the antenna element 10 . these walls 50 extend alongside the antenna feed slots 20 , 22 and are closed off by wall 52 to define a passage 66 between the two plates 12 , 14 and which can be considered as enclosing the slots 20 , 22 . this location is shown at “ rm ” in fig6 and for purposes of explanation , the “ rear ” of the antenna element 10 or “ rm ” in fig6 is considered as that portion where the short circuit plate interconnects the first and second plates together , while the “ front ” or “ f ” in fig6 of the antenna is considered to be disposed at the free ends of the first and second plates . the feed slots 22 of the antenna elements are preferably aligned with this passage 53 so that they extend lengthwise of the passage 53 and so that the antenna element portions surrounding the slots 22 form in effect , top and bottom walls of the passage 66 . this passage 66 facilitates the installation and termination of a feedline 56 . these support walls 50 , 52 not only serve to support the radiating plates 12 , but also maintain the first and second plates 12 , 14 apart from each other in a particular spacing . one or more retainers shown as tabs 55 in fig2 and 4 may be provided which are spaced apart from and extend over the support walls 50 , and which serve to retain the front , or free edges , of the first conductive plate in place within the module housing and prevent it from vertical movement in cooperation with the upper foldline 18 a thereof . these retainers 55 may be oriented in locations where they face the open end ( as shown in the left module of fig2 and 4 ) or where they lie along the wall adjacent the open end ( as shown in the right module of fig2 and 4 ). in the assembly of the antenna modules , the antenna elements may be inserted into the open end of each module housing so that antenna element slots 22 are aligned with the housing interior passages 66 and so the antenna element free ends are held in place by the retainers . in this position , a coaxial feed line 56 may be introduced into the housing passage 66 . the feedline 56 first has its outer insulation layer 62 stripped to expose its shielding braid 63 . the center conductor 58 of the feedline 56 is also exposed but its insulating layer 60 is left intact in a distance about equal to or slightly less than the distance d ( fig1 ) that separates the two conductive plates 14 , 14 . the center conductor 58 may then be terminated to the first conductive plate 12 and the shielding braid 63 may be terminated to the second conductive plate 14 as illustrated in fig7 . this type of structure provides a connectorless junction between the antenna and the feedline . in another important aspect of the present invention , each of the antennas not only has an independent ground plane that is isolated from each other , but also has an “ inherent ” rear shield formed by the shorting plate 16 of each antenna element . this rear shield provides electrical isolation from the other antenna and any surrounding elements in the envirornent in which the antenna is used which assists in providing the desired performance independent of the placement of the antennas within the system . the points at which the antenna elements 10 are fed are aligned with each other and occur near the end 80 of the two slots 20 , 22 . ( fig1 ). the feed and ground for each antenna are thus integrated within the separate antenna elements 10 , thereby eliminating the need to space them apart from each other in order to obtain a desired frequency for the antenna element . [ 0039 ] fig8 illustrates the effect of the placement of the two antenna elements 10 using the housings 26 of the present invention . the two housings are joined together so that their respective slots 20 of the upper radiating plates 12 are offset from each other , and if imaginary lines were drawn lengthwise along the slots , the imaginary lines would intersect . the two radiation patterns of each antenna are shown r 1 and r 2 and they may be considered emanating from the entire body of each antenna element radiating plate 12 . in fig8 two antenna elements 10 are mounted in an offset orientation in an electronic component , such as the laptop computer 100 illustrated . the antenna elements 10 are located in the base portion 101 of the computer 100 . the antenna elements 10 are positioned so that the radiating plates 12 thereof are oriented at right angles to lock other with this arrangement , each antenna element is separately polarized in different directions . as shown in fig8 this results in a significant overlap of the two radiation patterns r 1 , r 2 of the antenna elements ( that extend in the direction of the arrows of fig8 on opposite sides thereof ) so that if the electronic component is located near a wall or in another “ dead ” spot , or “ deep fade ” that compresses the radiation pattern of one antenna element , the radiation pattern of the other antenna element will not be so detrimentally affected . it will be understood that the invention may be embodied in other specific forms without departing from the spirit or central characteristics thereof . for example , the modules , or housings , may take different shapes than the square or rectangular structures shown . additionally , the antenna elements may be joined together in their specific orientation by an intervening dielectric member . the present examples and embodiments , therefore , are to be considered in all respects as illustrative and not restrictive , and the invention is not to be limited to the details given herein .	7
tissue specific adenovirus vectors target breast cancer cells with genes that encode products that kill the cells . viral vectors are deleted in both the e1 and e3 regions to maximize the foreign dna cloning capacity in this type of vector . these vectors facilitate gene therapy of breast cancer . one aspect of the vectors of the present invention that makes them unique is the use of the following tissue specific promoters to drive suicide genes : the α - lactalbumin promoter , ( human ), ( harris et al ., 1991 ) the β - lactoglobulin promoter ( ovine ) ( ali et al ., 1990 ), and the prolactin - inducible protein - 15 ( pip - 15 ) promoter ( human ). vectors using each of these promoters separately in combination with suicide genes such as the herpes virus thymidine kinase gene or the cytosine deaminase gene are aspects of the present invention . for purposes of comparison , the cmv promoter / enhancer is used . this is a strong constitutive promoter , directing genes it controls to synthesize abundant quantities of proteins . six virus vectors are aspects of the present invention . the activity of 3 thymidine kinase expressing vectors ( ala . tk , blg . tk , and cmv . tk ) were confirmed . the cytosine deaminase vectors were constructed . a variety of routes for delivery of the vector to the target mammalian tissue includes intravenous injection for systemic therapy of metastatic cancer ; intracavitary , intra - arterial , and intralesional routes . the herpes virus thymidine kinase gene kills cells when it is expressed in the presence of the drug gancyclovir , and the cytosine deaminase gene kills cells when it is expressed in the presence of 5 - fluorocytosine . therefore , an aspect of the invention is to administer an effective dose of these drugs in conjunction with the vectors . both gancyclovir and 5 - fluorocytosine are drugs already approved for humans and are in clinical trials involving gene therapy ( marcel et al ., 1997 ; alvarez et al ., 1997 ) the clinical regimen for prospective patients includes delivery of the adenoviral vector ( tk or cd ) by various routes ( i . e . intravenous , intratumoral ). the specific viral concentrations will have to be determined during the course of therapy . the prodrug ( gcv or 5 - fc ) will then be administered systemically at concentrations that are being used and will be established in current clinical trials . the origins of adenoviruses suitable for the invention are described in swaminathan and thimmapaya ( 1996 ). in an embodiment , the recombinant adenovirus ad5 ( 309 / 356 ) contains specific deletions in the early region 1 ( e1 ), and early region 3 ( e3 ). it is important to use a control virus with this genetic background ( that is , including the same mutations ) because a different viral genome could introduce unwanted variables that make results of tests difficult to interpret . for example , a recombinant adenovirus with a deletion in the early region 2 ( e2 ) gene is non - viable . expression cassettes were initially constructed in a puc18 derived plasmid backbone flanked by nhei and xbai restriction enzyme sites . these cassettes contained the following sequences ; adenoviral inverted terminal repeat and packaging sequences ( ad5 bp 1 - 375 ), promoter ( cmv , ala , blg , pip - 15 ) and gene ( β - galactosidase , hsv - thymidine kinase , cytosine deaminase ) sequences followed by sv - 40 polyadenylation sequences . the promoters were isolated from human genomic dna using the polymerase chain reaction ( pcr ). the genes were isolated or subcloned from other plasmid constructs . the β - galactosidase gene was amplified via pcr from the plasmid pnassβ ( clontech ). the hsv - tk gene ( bp 301 - 1448 ) was amplified from the plasmid pmc1 - tk ( marini et al . 1995 ). the plasmid used in the construction of the cytosine deaminase ( cd ) viruses was obtained from dr . ronald crystal ( ohwada et al ., 1996 ). the sv - 40 polyadenylation sequences were subcloned from the plasmid pnassβ via noti and hindiii restriction sites ( alam , 1990 ). promoter sequences were isolated from mcf - 10a cells ( atcc # crl 10317 ). the expression cassettes were released from the plasmid background via digestion with nhei and xbai restriction enzymes and ligated to an xbai digested adenoviral genomic dna fragment ( ad 309 / 356 ) containing sequences from 4 - 100 map units . the ligation mixture was then transfected into subconfluent ( 75 %) cell line 293 cells via the calcium phosphate co - precipitation method . these cells were then harvested in growth media ( dmem + 2 % dcs ) after showing evidence of 80 % cytopathic effect ( cpe ). the cytopathic effect ( cpe ) is defined as a dramatic change in morphology and detachment from the growing surface ( i . e . tissue culture plate ) subsequent to viral infection . after harvesting , the cells were then subjected to 3 cycles of rapid freeze / thawing . the cellular debris was cleared by centrifugation at 2500 rpm for 10 min . and the lysate containing the recombinant adenovirus was stored at - 20 ° c . for future use . fig1 shows maps of reporter vectors with the β - galactosidase gene ; fig2 shows maps of therapeutic vectors with suicide genes . plaque assays were performed on the cell lysates in order to isolate an individual viral clone . the adenoviral containing lysates were serially diluted in dmem containing 2 % dcs and added to subconfluent ( 80 %) cell line 293 ( ad 5 transformed human kidney cells , graham et al ., 1977 ) cells in 60 mm plates . after 1 hr . of incubation at 37 ° c ., the medium was removed and replaced by f - 15 minimal essential medium ( mem ) containing 0 . 85 % agar , 0 . 1 % pen / strep , and 4 % fetal calf serum ( fcs ). single plaques indicative of a single viral infection were isolated and used to reinfect another plate of 293 cells for plaque isolation . after 3 rounds of plaque assays individual plaques were amplified in 293 cells in 10 cm plates for dna analysis . for viral dna analysis the cell line 293 cell lysates containing virus from plaque infections were harvested . the supernatants were layered onto cscl cushions , 2 . 5 ml of heavy ( 1 . 45 g / cm 3 cscl / 10 mm tris ph 8 . 0 , 1 mm edta ; refractive index ( ri ), 1 . 375 ) and 2 . 5 ml of light ( 1 . 20 g / cm 3 cscl / 10 mm tris ph8 . 0 , 1 mm edta ; ri 1 . 356 ) and centrifuged in an sw - 41 rotor at 30000 rpm for 90 min . at 15 ° c . to remove the cscl , the collected virion bands were mixed with 0 . 1m tris - hcl ph 8 . 0 and dialyzed against tris / edta buffer ( tris ph8 . 0 / 1 mm edta ) for 8 - 10 hours . the virions were then collected and subjected to deproteinization in a solution containing ; 1 % sds , 0 . 1 % 0 . 5m edta ph8 . 0 , 2 . 5 μg pronase , and incubated at 37 ° c . for 60 min . the solution was then subjected to 2 rounds of phenol / chloroform extractions and the viral dna was precipitated in 95 % and then 70 % ethanol . the dna was then dried in a speedvac apparatus and resuspended in 40 μl of te buffer . restriction digestions were performed as follows ; approximately 2 μl of viral dna was added to a solution containing the restriction enzyme of interest ( xbai or hindiii at a concentration of 2 units / μg dna ), 0 . 1 volumes restriction enzyme buffer , and sterile water to 20 μl . these reactions were allowed to incubate for 2 hrs . at 37 ° c . after which the digestion was loaded on a 0 . 6 % agarose gel and run at 34 volts for approximately 12 hours . the gel was then stained with ethidium bromide ( etbr ) and viewed under uv light for analysis . fig3 a shows the predicted digestion pattern of the recombinant viral vectors . fig3 b shows that the dna fragment containing the e1a gene ( arrow ) is not present in the recombinant viruses when compared to the control ( 309 / 356 ). the following examples provide illustrations of the present invention , not limitations . example 1 : effects of adenovirus vectors on breast cancer cell lines fig4 shows the cell killing effects of the thymidine kinase ( tk ) viruses in the breast cancer cell line t47d [ human breast pleural effusion carcinoma cells ( atcc # htb 133 )] as measured by lactase dehydrogenase ( ldh ) release from the cells . the y - axis of this graph shows absorbance at 420 nanometers . this is a standard means to measure the cytoxic effects of an exogenous agent added to the cells . the kit for these experiments was obtained from promega ( cytotox 96 ) as shown in the graph , a moderate proportion of cells are killed due to conversion of the prodrug gancyclovir ( gcv ) to the toxic analog by thymidine kinase . this experiment was done using various concentrations of gancyclovir ranging from 0 . 01 to 10 , 000 μg / ml media . the highest concentration was toxic to all cells while the lowest showed no toxicity . a concentration of 1 mg / ml , ( fig4 ) in conjunction with the tissue - specific viruses that are an aspect of the invention was the most effective at cell killing . t47d cells were grown to sub - confluency in rpmi = 5 % fbs in 60 mm culture dishes . these cells were then infected with recombinant adenoviruses at 5 pfu / cell . one hour post - infection , fresh media with gancyclovir ( 0 . 1 - 10000 μg / ml ) was added ). ldh release was measured every 24 hours for a total of 48 hours . each sample is a mean value of triplicate measurements from two experiments . ldh release values obtained from ad . cmv . b - gal infections were subtracted from all other infections as shown by the table below . ______________________________________ absolute - expression cassette absolute value control values______________________________________ad . cmv . b .- gal 1 . 2 0ad . ala . tk 1 . 89 0 . 69ad . blg . tk 1 . 78 0 . 58ad . cmv . tk 2 . 05 0 . 85______________________________________ nude mice are an accepted model for effects of therapies on human cancers ( gould , 1995 ). fig5 shows the effects of the tk viruses constructed according to the present invention on actual human breast cancer tumors grown in nude mice . t47d cells were injected and allowed to grow as tumors in balb / c nude mice . tk expressing adenoviruses were injected directly into the tumor and the virus was allowed to express the tk protein for 5 days . gancyclovir or a suitable vehicle ( e . g ., pbs ) was then injected systemically and the tumor sizes were measured every day for a total period of 8 days . linear regression analysis of this data shows that the ad . ala . tk vector is effective at regressing breast tumors in these mice as compared to ad . ala . tk and gcv treated or those treated with vehicle alone or ad . cmv . tk treated with gcv . ( the cmv promoter has been well characterized and only serves as a positive control in our experiments .) nude mice were injected subcutaneously with 10 7 t47d cells in the upper flank region and allowed to establish as growing breast tumors . after 2 weeks tumors were injected with 2 × 10 8 of recombinant tk expressing adenoviruses . gancyclovir was administered at a dosage of 50 mg / kg / day via intra - peritoneal ( ip ) injection for a period of 5 days . tumor areas were measured using the formula l × w 2 / 2 each day for a total of 8 days . l × w 2 / 2 is a formula used to measure tumor area where l is the length of the tumor in millimeters and w is the width in millimeters . the area , expressed in millimeters squared ( mm 2 ), of a given tumor can be calculated when numerical values are substituted for the variables in this formula . this graph shows a linear regression of the calculated tumor sizes . the initial measurement taken at day 0 before gcv treatment was given a value of 1 . all subsequent measurements are a percentage of this value . the y - axis of this graph is denoted as follows : all mouse tumors were of various sizes before treatment . to normalize for this variability in tumor size , mouse tumors were given a value of 1 . 0 regardless of tumor volume . all subsequent measurements are a percentage of the starting value . fig5 demonstrates the strong expression of the vector as measured by tumor regression . the magnitude of the regression is obvious compared to regression caused by other treatment strategies .	2
in the particular embodiment illustrated in fig2 , the device 100 is composed of two bases 110 , two slideable parts 120 , six gyrate brackets 130 , two shelf frames 140 , and three shelves 150 . each base 110 is composed of metal , wood , or another strong material , depending on weight , strength , and cost considerations . each base 110 is mounted on one side of a cabinet compartment where the device will be installed . the bases 110 are mounted on the cabinet compartment using traditional means , such as mounting brackets , bolts , screws , nails , or other appropriate means . the pair of bases 110 is intended to act as the main support for the device . as illustrated in fig4 , each base 110 has two sets of rails 112 , one near the top and one near the bottom . rails 112 connect slideable parts 120 . rails 112 allow slideable parts 120 to slide in and out of the cabinet space via wheels , ball bearings , or other appropriate means . each base 110 has a slot 116 located below top rail 112 . slot 116 is a shallow , horizontal groove that provides a guide for the sliding action of slideable part 120 . slot 116 prevents slideable part 120 from sliding all the way out of the cabinet . bases 110 may optionally have grooves 118 . grooves 118 are areas of thinner material or no material at all that reduce the weight of bases 110 . grooves 118 may be necessary depending on the material that bases 110 are constructed from , in order to provide sufficient strength without being too heavy . between the bottom of the cabinet and each base 110 are wedges 114 . wedges 114 are composed of plastic or other lightweight , strong material . wedges 114 are square shaped , or can be another shape if the space requires it . wedges 114 lift bases 110 off the bottom of the cabinet so that slideable parts 120 will clear any lip on the bottom of the cabinet . wedges 114 are sized appropriately to provide enough space as is needed . wedges 114 may optionally be placed between the sides of bases 110 and the cabinet walls in order to provide enough space for slideable parts 120 to clear any lip on the sides of the cabinet . slideable parts 120 are composed of similar material to the rest of the device , such as wood or metal , depending on strength , weight , and cost considerations . as illustrated in fig7 , each slideable part 120 has rails 122 . rails 122 are sized to fit inside of rails 112 . rails 122 allow slideable part 120 to slide partially out of the cabinet space . guide 124 is a short protrusion intended to fit in slot 116 . guide 124 prevents slideable part 120 from sliding all the way out of the cabinet space . each slideable part 120 has at least 3 pins 126 . pins 126 are short , cylindrical protrusions intended to attach gyrate brackets 130 . pins 126 are located near the bottom of slideable part 120 , nearly evenly distributed horizontally . one of the pins 126 , typically the pin closest to the rear wall of the cabinet , is located higher than the others . each slideable part 120 has a groove 128 . groove 128 is a shallow curved groove intended to provide stability to the operation of gyrate brackets 130 . groove 128 is located and shaped such that it forms an arc with center pin 126 as the anchor . each slideable part has a spring hole 127 . spring hole 127 is a small hole which allows a spring to be mounted . slideable parts 120 may optionally have grooves 129 . grooves 129 are areas of thinner material or no material at all that reduce the weight of slideable parts 120 . grooves 129 may be necessary depending on the material that slideable parts 120 are constructed from , in order to provide sufficient strength without being too heavy . the particular embodiment described uses three gyrate brackets 130 for each side , as shown in fig8 . each gyrate bracket 130 is composed of a strong material such as metal . each gyrate bracket 130 is shaped as a long , thin rectangle with rounded corners . each gyrate bracket 130 has two pinholes 138 , located near either end of gyrate bracket 130 . pinholes 138 are sized and shaped such that pins 126 will fit inside . center gyrate bracket 134 has an additional protrusion which contains spring hole 137 . center gyrate bracket 134 also has pin 139 . pin 139 is a protruding pin sized to fit in groove 128 . center gyrate bracket 134 has a thinner top section with less material , which corresponds to a similar bottom section of bottom gyrate bracket 136 . when assembled , top gyrate bracket 132 connects to slideable part 120 via rear pin 126 , as shown in fig3 . top gyrate bracket 132 also connects to shelf frame 140 via pin 142 . center gyrate bracket 134 connects to slideable part 120 via center pin 126 , while pin 139 fits into groove 128 to provide additional stability when opening and closing the device . center gyrate bracket 134 connects to spring 135 via spring hole 137 . the other end of spring 135 connects to slideable part 120 via spring hole 127 . spring 135 assists in closing operations by providing additional force from the tension in the spring 135 . center gyrate bracket 134 also connects to shelf frame 140 via pin 142 . bottom gyrate bracket 136 connects to slideable part 120 via bottom pin 126 . bottom gyrate bracket 136 also connects to shelf frame 140 via pin 142 . though not pictured , a washer is typically placed between gyrate brackets 132 , 134 , and 136 , and slideable part 120 to prevent friction damage . shelf frames 140 are composed of similar material to the rest of the device , such as wood or metal , depending on strength , weight , and cost considerations . as shown in fig9 , each shelf frame 140 has pins 142 , grooves 144 , and slideable wedges 148 . pins 142 are sized to fit gyrate brackets 130 . pins 142 are positioned such that when gyrate brackets 130 are connected , each shelf frame 140 is in a level position . slideable wedges 148 are composed of plastic or similar material that allow sliding with little friction . slideable wedges 148 are attached to each shelf frame 140 by glue or other appropriate means . slideable wedges 148 allow for easier opening and closing and prevent the shelf frames 140 from contacting the surface of bases 110 . shelf frames 140 may optionally have grooves 146 . grooves 146 are areas of thinner material or no material at all that reduce the weight of shelf frames 140 . grooves 146 may be necessary depending on the material that shelf frames 140 are constructed from , in order to provide sufficient strength without being too heavy . shelves 150 are composed of wood , plastic , metal , or other material appropriate for shelves . as shown in fig1 , each shelf 150 has a basic shelf 152 , and optionally side holders 156 , and optionally mounting brackets 154 . basic shelf 152 is a rectangular piece of material that functions as a typical shelf . optional side holders 156 are lips placed at the front and back of shelves 150 in order to prevent items from falling off during opening and closing operations . optional side holders 156 are attached to each basic shelf 152 by appropriate means such as brackets , bolts , screws , nails , pins , or glue . optional mounting brackets 154 are attached to each basic shelf 152 using bolts , screws , or other typical means . optional mounting brackets 154 are then placed into grooves 144 at whatever location is appropriate to achieve the desired shelf height . other means of mounting the shelves 150 to the shelf frames 140 may also be used , such as bolts , screws , nails , pins , or glue . while various aspects and embodiments have been disclosed herein , other aspects and embodiments will be apparent to those skilled in the art . the various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting , with the true scope and spirit being indicated by the following claims . other embodiments may be utilized , and other changes may be made , without departing from the spirit or scope of the subject matter presented herein . it will be readily understood that the aspects of the present disclosure , as generally described herein and illustrated in the figures , can be arranged , substituted , combined , separated , and designed in a wide variety of different configurations , all of which are contemplated herein .	0
the invention will now be described in detail with reference to the drawings . fig3 and 4 show a vane compressor according to an embodiment of the invention . as shown in fig3 and 4 , the vane compressor is composed mainly of a cylinder formed by a cam ring 1 having an inner peripheral surface 1a with a generally elliptical cross section , and a front side block 3 and a rear side block 4 closing open opposite ends of the cam ring 1 , a cylindrical rotor 2 rotatably received within the cylinder , a front head 5 and a rear head 6 secured to outer ends of the respective front and rear side blocks 3 and 4 , and a driving shaft 7 on which is secured the rotor 2 . the driving shaft 7 is rotatably supported by a pair of radial bearings 8 and 9 provided in the respective side blocks 3 and 4 . a discharge port 5a is formed in an upper wall of the front head 5 , through which a refrigerant gas is to be discharged as a thermal medium , while a suction port 6a is formed in an upper wall of the rear head 6 , through which the refrigerant gas is to be drawn into the compressor . the discharge port 5a and the suction port 6a communicate , respectively , with a discharge pressure chamber 10 defined by the front head 5 and the front side block 3 , and a suction chamber 11 defined by the rear head 6 and the rear side block 4 . a pair of compression spaces 12 , 12 are defined at diametrically opposite locations between the inner peripheral surface 1a of the cam ring 1 , the outer peripheral surface of the rotor 2 , and end faces of the respective front and rear side blocks 3 and 4 on the cam ring 1 side . the rotor 2 has its outer peripheral surface formed therein with a plurality of axial vane slits 13 at circumferentially equal intervals , in each of which a vane is radially slidably fitted . refrigerant inlet ports 15 , 15 are formed in the rear side block 4 at diametrically opposite locations , as shown in fig3 ( since fig3 shows a cross - section taken at an angle of 90 ° formed about the longitudinal axis of the compressor , only one refrigerant inlet port is shown in the fig .) these refrigerant inlet ports 15 axially extend through the rear side block 4 , and through which the suction chamber 11 and the compression spaces 12 are communicated with each other . two paris of refrigerant outlet ports 16 , 16 are formed through respective opposite lateral side walls of the cam ring 1 at diametrically opposite locations . ( in fig4 for the same reason as in the case of the refrigerant inlet ports , only one pair of refrigerant outlet ports is shown .) to each of the opposite lateral side walls of the cam ring 1 is secured by a volt 18 a discharge valve cover 17 having a valve stopper 17a . interposed between the lateral side wall and the valve stopper 17a is a discharge valve 19 retained by the discharge valve cover 17 . each discharge valve 19 opens in response to discharge pressure to thereby open the corresponding refrigerant outlet port 16 . defined by the cam ring 1 and the respective discharge valve covers 17 are a pair of communication chambers 20 which each communicate with a corresponding pair of the refrigerant outlet ports 16 when the corresponding discharge valve 19 opens . further , a projection 3b is integrally formed on the end face 3a on the front head 5 side of the front side block 3 , and a pair of communication passages 21 , each formed of a single opening 21a , are axially formed through the projection 3b and the front side block 3 at diametrically opposite locations . these communication passages 21 communicate with the communication chambers 20 , respectively . next , the operation of the present embodiment constructed as above will be described below . as the rotor 1 rotates , the volume defined by two adjacent vanes is reduced to compress refrigerant gas in the compression space 12 . when the pressure of the refrigerant gas in the compression space 12 reaches a predetermined value , the refrigerant outlet ports 16 open to discharge the refrigerant gas into the communication chamber 20 . the refrigerant gas discharged into the communication chamber 20 is under pulsation , and the pulsating refrigerant gas causes vibrations in the communication chamber 20 in the longitudinal directions of the compressor . the pulsating refrigerant gas flows into the discharge pressure chamber via the communication passage 21 . when the refrigerant gas flows through the communication passage 21 , the vibration frequency is lowered and the pressure of a pulsation having a particular frequency of the refrigerant gas is damped . as a result , when the refrigerant gas flows into the discharge pressure chamber 10 , a vibration may be prevented which may induce resonance of component parts of the automotive vehicle in which the compressor is installed . thus , the noise in the compartment of the vehicle can be greatly reduced . the ground for the above result of the invention will be explained below : the communication passage 21 can be regarded as an air column . in general , the frequency fs - 1 of an air column within a conduit ( i . e . the communication passage 21 ) having a uniform cross - section over its length can be obtained by the following equation : where l is the length of the conduit , k the bulk modulus of elasticity ( kg / cm 3 ), γ the weight of fluid per unit volume ( kg / cm 3 ), g the acceleration of gravity ( g = 981 cm / sec 2 ), and λ a dimensionless number determined by the boundary condition and the vibration waveform , the value of which is , in the case where one end of the conduit is fixed and the other end if free as in the fig3 embodiment , as follows : λ = 1 / 2π , 3 / 2 π , 5 / 2 π , . . . . therefore , the columnar frequency f is inversely proportional to the length l of the conduit ( communication passage 21 ). fig5 a to 5c show curves representing waveforms of vibrations with the length l of a conduit c set to respective different values . as can be understood from the figures , the change rate of pressure is the maximum at nodes n of displacement or speed , and the minimum at antinodes a of same . further , if the length l of the conduit is increased ( fig5 c ), the frequency f is decreased in accordance with the above equation , i . e . the pitch of the vibration waveform becomes longer as compared with the case of fig5 a in which the length l is shorter . accordingly , the slope of the curve representing the vibration waveform becomes gentler to reduce the maximum change rate of pressure at anodes n , whereby the pulsation is damped . further , if a node n of the vibration waveform is located at the outlet end of the conduit , a great vibration corresponding to the maximum change rate of pressure is outputted from the conduit . therefore , the resonance of component parts of the vehicle can be avoided by setting the length l to such a value that no mode n is located at the outlet end of the communication passage 21 ( fig5 b or 5cl ). experiments have revealed that when it is set that = 14 mm , the plate thickness t of the side block 3 = 12 mm , and the diameter of the conduit ( the diameter of the communication passage 21 )= 10 mm , a pulsation having a certain frequency can be greatly reduced , as shown in fig6 . particularly , in a medium speed region , the reduction of the pulsation is remarkably large , as distinct from a curve in fig2 which is obtained by the conventional compressor . further , the vibrations having a frequency range of 300 to 800 hz which is produced when the conventional compressor is installed int eh automotive vehicle can be attenuated by setting of 6 ≧ l / d ≧ 1 . 2l . the valve l / d should be set to this range for the reason that if the value l / d is smaller than 1 . 2 , the pulsation attenuating effect cannot be attained to a sufficient degree , while if it is larger than 6 , the arrangement becomes impractical because the value d cannot be too small since the communication passage , if it has too small a diameter , will have a restricting effect . preferably , the range is 3 . 0 ≧ l / d ≧ 2 . 5 . in the above described embodiment , the communication passage 21 has a single opening 21a . however , the communication passage 21 may be divided into e . g . 2 to 4 openings 21a as shown in fig8 a to 8c . these arrangements can attenuate vibrations without increasing the length of the passage 21 , i . e . the thickness of the side block 3 . normally , the fluid discussed in the field of engineering is in the form of a turbulent flow . however , the closer to a laminar flow the form of a fluid , the pulsation of the fluid can be more suppressed . if the distance between an inlet end of a conduit and a point in the conduit at which the fluid starts to form a laminar flow is x , and the diameter of the conduit is d , the following equation can be established according to boussinesq : in other words , the suppressibility of the pulsation of the fluid depends on the ratio of x to d which is required from the above equation . where μ is the average speed of the fluid over the whole cross - sectional area of the conduit , ρ the density of the fluid , and μ the viscosity coefficient of the fluid . therefore , by axially dividing the interior of the conduit ( or the communication passage 21 ) into two or more openings 21a having reduced diameters d , the re number can be decreased , which enables the distance x to be shortened . thus , the pulsation of the refrigerant gas can be attenuated by dividing the passage 21 into two or more openings 21a . further , in the embodiment of fig3 the both open ends of the passage 21 are opposed to each other . alternatively , as shown in fig7 a through hole 23 as an outlet opening may be formed in the peripheral wall of the passage 21 and one end thereof closer to the through hole 23 may be closed to allow the refrigerant gas to be discharged in a vertical direction relative to the axis of the driving shaft 7 , whereby the same results as obtained by the fig3 embodiment can be obtained . although in the above described embodiments , the invention is applied to a vane compressor , this is not limitative , but the invention may be applied to other types of compressors , such as a wobble - plate type compressor and a swash - plate type compressor .	8
the above - described process is very useful in producing particularly the hfpo trimer which is a perfluorocarboxylic acid fluoride represented by the above general formula ( 1 ) wherein n is 3 . for example , since in the resultant product the hfpo trimer is contained in an amount of not less than 60 %, it is very advantageous as a process to obtain the trimer selectively . in the present invention , it is very important that oligomerization is effected using as the aprotic polar solvent a sulfone or a mixed solvent of a sulfone with an ether expressed by the general formula ( 2 ). thereby , it has been achieved that the hfpo trimer is particularly obtained in a selectivity of not less than 60 % in the product . the sulfone used as the solvent is a known compound expressed by the following general formula : ## str3 ## wherein r are each a monovalent organic group and the two r may together form a ring containing a sulfur atom . in the present invention any sulfone may be used , and preferably sulfolane ( tetramethylene sulfone ) is used . further , the ether is expressed by the general formula ( 2 ) wherein m is preferably 2 to 5 , and most preferably the ether is tetraglyme . the solvent is preferably used in an amount of 0 . 1 to 30 % by weight , particularly 5 to 12 % by weight , based on the hexafluoropropylene oxide as the starting material . when a mixed solvent of a sulfone with an ether is used , the sulfone content is preferably not less than 50 % by weight , more preferably 80 to 95 % by weight , in the mixed solvent . in the present invention , as the catalyst an alkali metal fluoride is used , which is preferably potassium fluoride . further , the amount of the catalyst is preferably in a range of 0 . 01 to 8 % by weight , particularly 0 . 1 to 1 % by weight , based on the hexafluoropropylene oxide . the reaction temperature for oligomerization is preferably in a range of - 30 ° to 110 ° c . it is important that the use of the aprotic polar solvent as specified above makes it possible to set a higher reaction temperature than conventional processes as well as to improve the selectivity of the hfpo trimer . therefore , according to the present invention , since the oligomerization can be carried out at a higher reaction temperature , reaction time therefor is remarkably shortened , for example , in half or less of that required in conventional processes . this is a big advantage of the present invention . in this reaction , an agitation state and reaction temperature have influence on the yield of the hfpo trimer and the degree of polymerization of the hfpo oligomer obtained . where agitation is vigorous , that is , the catalyst and the solvent are in a high dispersion state , or where reaction temperature is high , the degree of polymerization of hfpo oligomers will be lowered . on the contrary , where agitation is mild , that is , the catalyst and the solvent are in a low dispersion state , or where reaction temperature is low , the degree of polymerization of hfpo oligomers will be increased . on the basis of the above - described fact , it is possible to adjust an yield of the hfpo trimer by controlling the agitation state and the reaction temperature . the oligomerization is readily carried out by supplying hexafluoropropylene oxide in a state wherein the catalyst is dissolved or dispersed in the aprotic polar solvent , and by setting temperature to a prescribed reaction temperature . preferably , hexafluoropropylene oxide begins to be supplied into the reaction vessel under reduced pressure . the reaction product thus obtained contains the hfpo trimer in an amount of not less than 60 %, and the selectivity of the hfpo trimer is very high . since no isomer of hexafluoropropylene oxide is produced , it is very easy to separate the catalyst and the solvent from the resultant product . by applying a known refining method such as distillation , it is possible to refine the product without difficulty in a short period of time . into a 300 ml autoclave made of sus 316 stainless steel and equipped with an agitator , 1 . 8 g of potassium fluoride and 30 g of sulfolane were charged , and stirred at 40 ° c . for 30 min . after evacuation of the inside of the autoclave by a vacuum pump , it was initiated to supply hexafluoropropylene oxide ( hfpo ) therein . since an exothermic reaction started , by external cooling the autoclave was kept so as to have an internal temperature of 39 ° c . to 40 ° c . in addition , the internal pressure of the autoclave was adjusted to 4 kg / cm 2 by controlling the feed rate of the hfpo . thus , 298 . 6 g of the hfpo was fed over 6 hours . after the hfpo was fed , agitation was further continued until the internal pressure of the autoclave reached about 1 mmhg . soon after the agitation was stopped , the reaction mixture was separated into two layers , of which the lower layer only was taken out , amounting to 280 . 4 g . after the reaction product was esterified with methanol , the composition was analyzed by gas chromatography . the results are given in table 1 . in table 1 , n denotes the degree of polymerization of the resultant hfpo polymers represented by the general formula ( 1 ). table 1______________________________________ n composition (%) ______________________________________ 2 26 . 2 3 63 . 7 4 9 . 7 5 0 . 4______________________________________ average degree of polymerization : 2 . 84 into the same autoclave as used in example 1 , 1 . 8 g of potassium fluoride , 30 g of sulfolane and 6 g of tetraglyme were charged , and stirred at 40 ° c . for 30 min . after evacuation of the inside of the autoclave by a vacuum pump , it was initiated to supply hfpo therein . since reaction is accompanied by heat generation , by external cooling the autoclave was kept so as to have an internal temperature between 39 ° c . and 41 ° c . in addition , the internal pressure of the autoclave was adjusted to 4 kg / cm 2 by controlling the feed rate of the hfpo . thus , 300 . 2 g of the hfpo was fed over 3 hours . after the hfpo was fed , agitation was further continued until the internal pressure of the autoclave reached about 1 mmhg . soon after agitation was stopped , the reaction mixture was separated into two layers , of which the lower layer only was taken out , amounting to 299 . 4 g . after esterification of the reaction product with methanol , the composition was analyzed by gas chromatography in the same manner as in example 1 . the results are given in table 2 . table 2______________________________________ n composition (%) ______________________________________ 2 11 . 2 3 61 . 8 4 25 . 4 5 1 . 7______________________________________ average degree of polymerization : 3 . 18	2
referring now to the example given for the detailed description of the invention , fig2 ( a ) shows a circular , film frame counter 6 and a microswitch s f associated with the film frame counter , in accordance with the invention , so as to be turned off at each of the cam notches formed in the circumference of film frame counter 6 . the cam notches are arranged in two or three positions of the frame counter so as to correspond to the last frame numbers of conventionally available rolls of film , for example , the 12th , 24th and 36th frames . in this way the film frame counter and microswitch s f are capable of indicating the last frame of a film having a specific length . switch s f is turned off when the frame counter indicates 12 , 24 , 36 or the vicinity thereof , as shown in fig2 ( b ). otherwise switch s f is turned on . in the case of a camera loaded with a film cartridge of 24 frames , there may be instances in which only 24 frames of pictures can be photographed . however , depending upon how the roll of film is loaded into the cartridge , there may also be other instances in which 25 frames can be photographed . thus , switch s f is so arranged as to be turned off when the frame counter indicates approximately 24 frames , so that photographing a 25th exposure is not precluded using applicant &# 39 ; s method , as will be understood more fully from the description below . fig3 shows a sprocket 3 &# 39 ; and a microswitch s sp arranged near the circumference of sprocket 3 &# 39 ;. a cam 31 is provided on the axis of sprocket 3 &# 39 ;, and sprocket 3 &# 39 ; makes one complete revolution for each frame advanced . thus , as each film frame is wound up , sprocket 3 &# 39 ; and switch s sp operate to generate a signal corresponding to the advancing of each frame . fig4 is a block diagram showing a control circuit controlled in accordance with the method of the present invention by a built - in microcomputer of a motor - driven , automatic film winding camera . fig5 shows the time - charts of a film winding operation controlled in accordance with the method of the present invention for one frame . fig5 ( 1 ) shows a state in which a battery operates normally . fig5 ( 2 ) shows a state of camera winding operation in which the voltage has dropped due to the deterioration of a battery . fig5 ( 3 ) shows a state in which winding of the film is stopped before the last film frame has been advanced , and further winding has become impossible due to the tension of the film . fig6 shows an operation program of the control circuit . as the shutter of a motor - driven automatic film winding camera , such as shown in fig1 is released and an exposure is completed , the control circuit transmits a start signal to the timer and a motor - drive signal for regular rotation ( fm +) is transmitted from the control circuit to the motor . then , take - up spool 4 is rotated by the motor in accordance with the motor - drive signal for regular rotation ( fm +) and film f begins to advance in the direction in which film f is taken up by take - up spool 4 . in accordance with the present invention , when sprocket 3 &# 39 ; starts to rotate , then microswitch s sp of sprocket 3 &# 39 ; is in the off position . the timer is activated by the control circuit start signal and signals have transmitted to the control circuit from the timer when prescribed periods t 1 , t 2 , described below , have elapsed . prescribed period t 1 is set a little longer than a period t 0 , which is the period required for winding a frame of film when the battery voltage is normal . period t 1 is used to detect the deterioration of a battery . whenever the control circuit determines that the period required for winding a single frame becomes longer than prescribed period t 1 , the control circuit sounds a warning buzzer to indicate battery deterioration . preferably t 1 should be calibrated to be longer than t 0 by 30 % of t 0 . prescribed period t 2 is set to detect the completion of photographing the last frame of a film roll and thus is several times longer than period t 0 . whenever the control circuit determines that the period required for winding one frame becomes longer than prescribed period t 2 , the control circuit stops the motor . this occurs when the control circuit receives a t 2 signal from the timer without receiving a film frame advance signal from switch s sp . in effect , the control circuit judges that the film is being stretched because the film is not being wound and thus the control circuit signals the motor to stop winding the film . if the film winding has been stopped because t 2 has been received by the control circuit without a signal from switch s sp and an off signal also is transmitted from microswitch s f to the control circuit , then a motor driving signal for a reverse motor rotation is transmitted to the motor by the control circuit . however , if a t 2 signal is transmitted to the control circuit from the timer before the control circuit receives a signal from switch s sp and an on signal is being transmitted from switch s f to the control circuit , then the control circuit stops the motor and sounds a warning buzzer to indicate the occurrence of a malfunction . in the example , periods , t 1 , t 2 were prescribed as 1 . 5 sec ., 3 sec ., respectively , and the one frame winding period t 0 was 1 . 1 sec . when sprocket 3 &# 39 ; is rotated forward one revolution in accordance with a motor - drive signal fm + received by the motor and one frame of a film roll is wound up by sprocket 3 &# 39 ;, microswitch s sp transmits a single - frame transporting signal to the control circuit which responds by stopping the motor . when the period between the moment of start signal transmission and the moment of single - frame transporting signal transmission is shorter than prescribed period t 1 for giving a warning of battery deterioration , the control circuit judges that the battery and the film winding are operating properly , and thus no battery deterioration warning is given . the timer is then reset and the control circuit will check the elapsed time again when the next frame of film is advanced . [ refer to fig5 ( 1 ).] when the period from the moment of a start signal transmission to the moment of a single frame transport signal transmission is longer than prescribed period t 1 for giving a warning of battery deterioration and is shorter than prescribed period t 2 , the control circuit judges that a battery is deteriorated and gives a warning of battery deterioration ; for example , a buzzer is sounded . [ refer to fig5 ( 2 ).] when a motor driving signal fm + for forward rotation is transmitted from the control circuit to the motor after the control circuit receives a start signal , the motor rotates and a single frame of film is wound up . when prescribed period t 2 elapses before the one frame is wound up completely , the control circuit judges that the film winding is stopped and the motor is unable to wind up the film and that further operation of the motor during this condition will cause the film to become stretched . if this condition occurs when an off signal is transmitted from microswitch s f to the control circuit , the control circuit judges that all the film frames of a film roll loaded in a cartridge were photographed , and thus transmits a reverse motor - drive signal fm - to cause the motor to reverse its regular rotation , disconnects the motor from take - up spool 4 and also rotates cartridge spool 5 clockwise to rewind the film into the cartridge . [ refer to fig5 ( 3 ).] however , if prescribed period t 2 elapses before switch s sp indicates that another frame of film is wound up and an on signal is transmitted from microswitch s f to the control circuit , the control circuit judges that a malfunction has occurred , stops the motor and gives a warning ( by a buzzer ) at the same time . the operations described above are performed in accordance with the program exhibited in a flow chart shown in fig6 . as is understood from the flow chart , the film wind - rewind device performs the following four operations : ( 1 ) the motor starts to rotate until the sprocket is rotated once within a period t 1 , and then the motor stops rotating . ( 2 ) the motor starts rotating until the sprocket rotates once within a period longer than the period t 1 , but shorter than a period t 2 , and a buzzer sounds to warn of the deterioration of the battery . in this case , the camera remains operative to take photographs notwithstanding the battery deterioration warning , because the sprocket rotates to advance one frame of film in the film roll . ( 3 ) the sprocket fails to rotate once within period t 2 in spite of the rotation of the motor . the motor is stopped and an abnormality in the winding of the film is indicated . ( 4 ) the motor is rotated in reverse and the roll of film is rewound when the conditions described above in ( 3 ) occur in the vicinity of the last frame of the film roll , such as the 12th , 24th or 36th frame . heretofore , the method for automatically rewinding a roll of film upon detecting an abnormality in the film advance has resulted in such malfunctions as the film being rewound from the middle of a film roll and the like . the present invention accomplishes an automatic rewinding of a roll of film by making judgments based on information obtained through a switch arranged so as to be turned on and off in the vicinity of the position of the last frame number of a roll of film loaded in a camera . in the present invention , when a film winding abnormality is detected , the reading of the film frame counter switch is checked to determine if the last frame has been advanced , before rewinding is initiated . in this way , the present invention prevents the film from being automatically rewound from the middle of the roll of film and improves the reliability of the results obtained using an automatic rewinding mechanism . the film roll &# 39 ; s last frame number , such as 12 , 24 , or 36 , can be set by using a switch and a frame counter , as in the above example , or by storing the frame number in a memory device of the camera . the last frame number also may be set by hand when film is loaded into the camera by a user . moreover it is also possible to detect the last frame number when a film cartridge is loaded into a camera , provided that the film cartridge is notched in advance to correspond to the last frame number , such as 12 , 24 or 36 , of the film loaded therein . in the particular example described above , the necessary information for determining whether to initiate rewinding of the film is taken from a film winding period . in this way it is possible to differentiate abnormalities occurring during winding of the film . moreover , as stated above , the present invention may also be practiced using other detecting means or other necessary information combined therewith .	6
turning now to the drawings and , more particularly to fig1 , a home appliance in the form of a range having a griddle and an improved griddle cover is illustrated generally at 10 and includes a floor - standing range body 12 with two cavities formed in a lower portion 14 of the range body 12 . as is generally known , many ranges provide a single oven cavity while others , such as the one pictured , define two cavities , both of which way may be an oven . alternately , the configuration may be , for example , a single oven with a steamer or a warming drawer in the same range body 12 . a cooktop 16 is disposed on a top portion of the range body 12 . the cooktop 16 includes a plurality of aligned burner pans . a generally planar upstanding backsplash 18 is provided at a rearward portion of the cooktop 16 protect the wall behind the range 10 . a control panel is disposed in the lower portion 14 of the range adjacent the cooktop 16 , allowing a user to control cooking throughout the range 10 . on certain ranges , like the one illustrated in fig1 , a griddle 102 may be provided on the cooktop 16 in a griddle space intermediate two burner pans . a griddle cover 20 according to a preferred embodiment of the present invention is fitted to the griddle 102 . the griddle 20 includes a generally planar cover body 22 having a handle 50 mounted at one end thereof for access by the user maneuvering the griddle cover 20 in and out of a covering relationship with the griddle 102 . turning now to fig2 , the griddle cover 20 will be described in greater detail . the griddle cover 20 is made from a stainless steel sheet defining a planar cover body 22 that is sized to cover the griddle 102 seen in fig1 . with continued reference to fig2 , the rectangular griddle cover 20 includes four corners 32 , 34 , 36 , 38 and four downturned walls including a front wall 24 , two side walls 26 , 28 and a rear wall 30 extending between the corners 32 , 34 , 36 , 38 . the griddle cover 20 includes a handle 50 mounted at one end thereof . the handle 50 includes two upstanding cylindrical support members 54 , 56 and a generally cylindrical handle body 52 extending therebetween . while the handle 50 is configured as three cylinders , it should be noted that the handle 50 can be formed in any particular configuration to compliment the overall configuration and appearance of the range . with reference to fig2 and 3 , a plurality of support feet 58 are mounted to support elements 40 , 42 , 44 , 46 formed integrally with the side walls 26 , 28 adjacent respective corners 32 , 34 , 36 , 38 . a fifth foot 68 is mounted to a fifth support element 48 which is formed integrally with the rear wall 30 . the fifth foot 68 is positioned at approximately the center of the rear wall 30 intermediate two other side wall mounted feet 64 , 66 . as will be seen in greater detail hereinafter , the fifth foot 68 helps to position and stabilize the griddle cover 20 when the griddle cover 20 is mounted on a griddle 102 . as seen in fig4 , and 5 , the griddle cover 20 has feet positioned adjacent the corners and along the rear center portion of the back wall 30 . turning now to fig6 , one of the plurality of feet 58 is illustrated . although the foot illustrated in fig6 is identified by the numeral 60 , it should be understood that each of the plurality of feet 58 is either identical or substantially similar , and the description of a first foot 60 applies to all remaining feet 62 , 64 , 66 , 68 . the use of identical feet helps further lower the cost of the present griddle cover . for durability and high temperature resistance as well as ease of manufacture , each of the plurality of feet 58 is made from polyphenylene sulfide resin , known to those skilled in the plastic arts as pps . pps provides a durable , heat resistant material that is effectively moldable to the present foot configuration and is effective in providing a durable , non - damaging interface with the griddle . as seen in fig6 , a foot 60 includes a foot body 70 having a generally planar top surface 72 extending thereacross . the foot 60 is formed as a generally elongate rectangular volume having a central projection 74 rising from the foot body 70 and defining a first plateau 76 and a second plateau 78 on either side of the projection 74 . each plateau 76 , 78 includes a fastener throughbore 86 , 92 respectively extending therethrough . it should be understood that the foot 60 illustrated in fig6 is inverted from its use position with the projection 74 extending upwardly and , in use , the projection 74 extends downwardly . the projection 74 enhances the contact surface of the vertical wall 80 for better and more stable engagement of the griddle cover 20 with the griddle 102 . the foot body 70 includes a generally vertical wall 80 for contact with a griddle wall as will be seen in greater detail hereinafter . a flange 82 extends from one side of the foot body 70 and extends the full length thereof . the flange 82 defines a horizontal surface 84 which is also configured for griddle contact as will also be described in greater detail hereinafter . the vertical wall 80 and the horizontal wall 84 define a substantially right angle α therebetween . turning now to fig7 , the foot 60 is shown inverted from the view in fig6 and illustrates the fastener throughbores 86 , 92 passing through the foot body 70 . the projection 74 is revealed in fig7 to be hollow and is indicative of the conservation of material available when molding the foot 60 from a polymer such as ppe . fig8 shows a bottom view of the foot 60 wherein line 9 - 9 defines cutaway view illustrated in fig9 . the cutaway view of fig9 illustrates the hollow nature of the projection 74 and the fastener throughbores 86 , 92 extending through each plateau 76 , 78 respectively . since the intended fasteners of the present invention are screws , the throughbores 86 , 92 each include a head well 88 , 94 and a shaft passage 90 , 96 open to the respective head wells 88 , 94 . accordingly , any screw used to mount the foot 60 will be contained fully within the through bores 86 , 92 insofar as the foot 60 is concerned . as may be surmised , the shaft of each screw will extend beyond the through bores 86 , 92 for engagement with the respective support flange associated with each foot 60 . fig1 and 11 further illustrate the configuration of the outer portion of the foot 60 . the relationship between the horizontal wall 84 and the vertical wall 80 is more fully illustrated and , with particular reference to fig1 , the substantially right angle α includes a slightly curved vertex for ease of both manufacture and cleaning . in order to make the griddle cover 20 of the present invention , a generally planar sheet ss of material , preferably metal and , more specifically , stainless steel is provided as seen in fig1 . the metal is stamped , cut or otherwise manipulated to form a generally rectangular cover body 22 having a front wall 24 , two side walls 26 , 28 and rear wall 30 defined therein . respective corners 32 , 34 , 36 and 38 are open such that the two end walls 24 , 30 are independent of the two side walls 26 , 28 thereby defining four individual walls . support flanges 40 , 42 , 44 , 46 for supporting feet are formed adjacent each corner 32 , 34 , 36 , 38 of the cover body 22 . for example , adjacent the first corner 32 , a support flange 40 projects outwardly from the side wall 26 and is formed as a generally rectangular member coplanar with the griddle cover body 22 and including two screw openings 98 that are punched , drilled or otherwise formed adjacent each end of the support flange 40 . the support flange 40 is sized in accordance with the overall perimeter of the foot 60 . support flanges 40 , 42 , 44 , 46 are formed at or adjacent all four corners 32 , 34 , 36 , 38 of the cover body 22 . a fifth support flange 48 is formed integrally with the rear wall 30 at approximately the center thereof intermediate two other feet 44 , 46 which acts to enhance the stability of the present griddle cover and enhances the ease of installation . as seen in fig1 , dotted lines are provided to show the boundaries between the cover body 22 , the front wall 24 , the side walls 26 , 28 , the end wall 30 , and the support flanges 40 , 42 , 44 , 46 , 48 . it will be understood that such dotted lines are typically not applied to any actual griddle cover but are presented herein for clarity . turning now to fig1 , an intermediate manufacturing step is illustrated wherein the walls 24 , 26 , 28 , 30 are folded away from the cover body 22 to project away therefrom at approximately a 90 ° angle . during this intermediate step , the support flanges 40 , 42 , 44 , 46 remain coplanar with the side walls 26 , 28 and the end support flange 48 remains coplanar with the end wall 30 . with reference to fig1 , the support flanges 40 , 42 , 44 , 46 , 48 are then folded , bent or otherwise directed inwardly toward a common center of the cover body 22 such that the planar support flanges 40 , 42 , 44 , 46 , 48 extend parallel to and are spaced a predetermined distance from the cover body 22 . the plurality of support feet 58 are then attached to their respective support flanges 40 , 42 , 44 , 46 , 48 using screws 100 extending through the throughbores 86 , 92 . in fig1 , a single foot 66 is shown for clarity , the single foot 66 being shown exploded from its respective support flange 46 . turning now to fig1 and 16 interaction of the griddle cover 22 and the griddle 102 may be seen . the griddle 102 is illustrated open from the rear for clarity . there , the griddle cover 22 is fitted to the griddle 102 with the cover body 22 in an overlying relationship with the griddle surface 104 so as to prevent contaminants from reaching the griddle surface 104 . the plurality of feet 58 engage the walls of the griddle wherein a vertical wall 80 of each respective foot 60 , 62 , 64 , 66 , 68 engages a vertical wall 108 of the griddle 102 . further , a horizontal wall 84 of each respective foot 60 , 62 , 64 , 66 , 68 engages a horizontal wall 106 of the griddle 102 . by including one foot at each of five positions on the griddle cover 20 including the four corners 32 , 34 , 36 , 38 and center of the rear wall 30 , the present griddle cover 20 provides a stable and easy - to - install griddle cover that can be removed from the front using the handle 50 . by the above , the present griddle cover provides an attractive , easy - to - use cover that protects the griddle of a home appliance such as a range from contaminants as well as from abrasions and other damage from utensils , while maintaining an attractive stainless steel appearance and mounting to the griddle in a user - friendly , non - destructive manner . it will therefore be readily understood by those persons skilled in the art that the present invention is susceptible of a broad utility and application . while the present invention is described in all currently foreseeable embodiments , there may be other , unforeseeable embodiments and adaptations of the present invention , as well as variations , modifications and equivalent arrangements , that do not depart from the substance or scope of the present invention . the foregoing disclosure is not intended or to be construed to limit the present invention or otherwise to exclude such other embodiments , adaptations , variations , modifications and equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof .	0
the present invention is specially adapted for use in , although not limited in application to , a brewing system 10 illustrated in fig1 . here , the dispensed liquid is water that is heated to a predetermined elevated temperature to brew beverages from extracts ( e . g ., coffee , tea , powders and concentrates ) contained in disposable hermetically sealed cartridges . with reference initially to fig1 a single serve brewer 10 includes a housing 12 containing a liquid storage tank 14 . the tank has a lower metering chamber 16 formed by a reduced diameter cup - shaped bottom 18 integrally joined to the larger diameter tank side wall at a circular sealing surface defining a seat 20 . water can be poured into the storage tank 14 via an inlet 17 . a fixed internal structure includes a horizontal platform 22 and struts 24 supporting a vertically disposed sleeve bearing 26 aligned centrally with respect to the tank 14 and its cup - shaped bottom 18 . a vertically reciprocal shaft 28 extends through the sleeve bearing 26 . the shaft carries a generally conically shaped baffle 70 at its lower end , and a circular plate 32 disposed beneath the platform 22 . a resilient and compressible circular gasket 33 on the lower surface of the baffle overlies the seat 20 . an arm 34 is pivotally mounted on a bracket 36 carried by the platform 22 . the arm 34 is connected to the shaft 28 by a pin 38 . a coiled spring 40 surrounds the pin 38 between the arm 34 and the upper surface of platform 22 , and an inflatable bladder 42 is positioned between the bottom surface of the platform 22 and the plate 32 . the distal end of the arm 34 extends into a brewing chamber 44 designed to accept a single serve beverage filter cartridge 46 of the type for example described in co - pending patent application ser . no . 09 / 782 , 622 filed feb . 13 , 2001 , the description of which is herein incorporated by reference in its entirety . an air pump 48 on the platform 22 is pneumatically connected to the bladder 42 , and is also connected via a flexible hose 50 to a port 52 in the baffle 70 . a metering tube 54 extends through the baffle 70 into the chamber 16 . the metering tube 54 is connected via a second flexible hose 56 to a depending tubular probe 58 carried by the arm 34 . a second tubular probe 60 underlies the cartridge 46 and opens downwardly above an exterior shelf 62 configured and dimensioned to support a cup 64 or other like receptacle . the tank 14 stores a supply of liquid 66 heated by an electrical heating element 68 underlying the cup - shaped bottom 18 . a tubular transparent column 72 is connected by upper and lower branch conduits 74 and 76 to the tank 14 . as can best be seen by further reference to fig2 a - 2c , the column is illuminated from below by a blue light source 78 , such as a light emitting diode ( led ). the column 72 contains liquid at the same level as the liquid level in tank 14 . a ball 80 is buoyantly supported on the surface of the liquid contained in column 72 , and its position in the column is visually enhanced by light emitted from the underlying light source 78 . optical sensors 82 , 84 are positioned to sense the position of the ball in its uppermost and lowermost positions , as shown in fig2 b and 2c . the uppermost position provides an indication that the tank 14 is filled , and the lowermost position conversely indicates that the tank has been emptied and is in need of being refilled . with reference to fig3 it will be seen that the sensors 82 , 84 provide output signals to a controller 86 . referring again to fig1 the brew chamber 44 includes a drawer 88 that may be opened to the position indicated by the broken lines in fig1 in order to accept the filter cartridge 46 . the drawer 88 is carried on a slide bar 90 guided by rollers 92 , and a switch 94 provides a control signal to the controller 86 ( fig3 ) indicating open and closed drawer positions . a temperature sensor 96 provides a signal to the controller 86 ( fig3 ) indicative of liquid temperature in the metering chamber 16 , and a pressure sensor 98 provides a signal to the controller indicative of air pressure in the hose 50 , which is representative of the air pressure in the metering chamber 16 . referring again to fig3 a panel 100 on the brewer head includes red and green indicator lights 102 a , 102 b , connected to the controller 86 . the heater 68 and pump 48 are also connected to the controller 86 . with reference additionally to fig4 it will be seen that when the brewer is initially energized , the red light 102 a is lit continuously and the blue light 78 is in a flashing mode . the sensors 82 , 84 provide the controller 86 with an indication of the liquid level in the tank 14 , and the controller performs a test 104 to determine if an adequate liquid supply is available . a “ no ” determination recycles the sequence , and a “ yes ” determination illuminates the blue light 78 continuously . the controller 86 then performs a second test 106 using the signal from the temperature sensor 96 to determine if the liquid in the metering chamber 16 has been heated to the desired brew temperature . a “ no ” determination recycles the sequence , and a “ yes ” determination extinguishes the red light 102 a and illuminates the green light 102 b , indicating that the brewer is ready to perform a brew cycle . the user then opens the drawer 88 and inserts a filter cartridge 46 . the switch 94 provides the controller with a signal indicating that the drawer is open , in response to which the controller extinguishes the green light 102 b . the controller then performs a test 108 to determine if the drawer had been closed . a “ no ” determination recycles the sequence , and a “ yes ” determination causes the controller to intermittently illuminate the green light 102 b , and to commence the brew cycle by energizing pump 48 and deenergizing the heater 68 . the air pump 48 then pneumatically effects the following sequence of system operation . the bladder 42 is inflated , the pushing shaft 28 and the baffle 70 downwardly , until the gasket 33 is pressed against the seat 20 to seal off the liquid in the metering chamber 16 from the remainder of the tank 14 . the downward movement of the shaft 28 also produces downward pivotal movement of the arm 34 against the resistance of the spring 40 , which in turn results in the lid and bottom of the cartridge 46 in the brewing chamber 44 being pierced respectively by probes 58 , 60 . compressed air is then fed into the metering chamber 16 via the hose 50 , causing a metered mount of liquid to be expelled and fed to the cartridge 46 via the hose 56 and the tubular probe 58 . the resulting brewed beverage exits the cartridge probe 60 and is received in the underlying cup 64 . at the conclusion of the brew cycle , compressed air purges the metering chamber 16 , and the resulting pressure drop is sensed by the pressure sensor 98 . the controller then responds by deactivating the pump 46 and the system is vented . the bladder 42 then collapses , allowing an upward displacement of the shaft 28 under the return force of the spring 40 . the baffle 70 is thus raised above the seat 20 , allowing air in the chamber 16 to be displaced by liquid in the tank 14 . the return force of the spring 40 also pivots arm 34 upwardly , which in turn removes the probe 58 from the cartridge 46 . the drawer 88 may then be opened and the spent cartridge 46 removed from the brewing chamber , readying the system for the next cycle . the heater 68 is reenergized to heat the liquid that has refilled the metering chamber 16 . various modifications may be made to the embodiment herein disclosed . for example , the shaft 28 may be vertically reciprocated by other means such as for example a motor - driven gear drive , or manual operation of the arm 34 . the metering chamber 16 and the seat 20 may be formed on a separate cup - shaped insert received in the tank , rather than being formed integrally with the tank . the operation of pump 48 may be controlled by a timed sequence rather than in response to pressure in the metering chamber . different visual indicators may be employed , and audible warning devices may be included to indicate various conditions , e . g ., if the tank is either empty or in danger of being overfilled . an immersion heater may be employed in place of the external heating element 68 . fig5 is a vertical sectional view taken through an alternative embodiment single serve beverage brewer 200 . this brewer 200 is substantially similar to the brewer 10 illustrated in fig1 with the principal exception that the brewer 200 includes several pneumatic pumps to control the brewing process . specifically , the brewer 200 includes an air pump 202 that inflates the air bladder 42 . a first pneumatic brew pump 204 provides compressed air into conduit 206 , which routes the compressed air through a check valve 208 , and into the pneumatic port 52 . a pressure sensor 212 is connected to the conduit 206 . the pressure sensor 212 is preferably a dual threshold pressure sensor that provides a first signal on a line 214 indicative of when the pressure is above or below and first pressure threshold value ( e . g ., 1 . 5 psi ), and a second signal on a line 215 indicative of when the pressure is above or below a second pressure threshold value ( e . g ., 7 psi ). such pressure sensors are available for example from world magnetics ( www . worldmagnetics . com ) and from micropneumatics logic . the brewer 200 also includes an interrupt brew pump 214 that provides compressed air into conduit 216 , which routes the compressed air through a check valve 218 , and into conduit 220 . the conduit 220 routes the compressed air from the interrupt brew pump to a flow line 222 , which routes compressed air through a check valve 224 to the tubular probe 58 . fig6 is a block diagram illustration of the control system associated with the brewer illustrated in fig5 . a controller 230 ( e . g ., a microcontroller ) receives boolean signals from the pressure sensor 212 , the drawer switch 94 and the optical sensors 82 , 84 . the controller also receives temperature threshold signals from a comparator circuit 241 . the comparator circuit 241 receives a temperature signal on a line 239 from the temperature sensor 96 . the circuit 241 includes a first comparator ( not shown ) that provides a boolean signal on the line 240 indicative of whether or not the temperature is above or below a first temperature threshold value ( e . g ., 186 ° f .). the circuit 241 also includes a second comparator ( not shown ) that provides a boolean signal on a line 244 indicative of whether or not the temperature is above or below a second temperature threshold value ( e . g ., 193 ° f .). the first and second temperature threshold values are used as set points for a heater control routine to be discussed hereinafter . the controller 230 also receives an input signal on a line 234 from a brew button 232 located on the brewer control panel . we shall now discuss the operation of the pumps 202 , 204 , 214 and a purge value 361 . fig7 a and 7b ( collectively fig7 ) together are a flow chart illustration of a brew cycle routine 700 performed by the controller 230 . the controller 230 is preferably a microcontroller such as a model pic16c57 manufactured by microchip ( www . microchip . com ). this microcontroller includes on chip program memory , ram and a cpu . in this embodiment , the steps illustrated in fig7 represent executable program instructions that are stored in the microcontroller program memory and periodically executed by the cpu . the routine 700 includes a test 702 that determines if the brewing process should begin . this test checks the state of the brew signal on the line 234 ( fig6 ) that is generated by a brew button located on the brewer , and depressed when the user wishes to brew a beverage . if the signal on line 234 indicates that a user has not depressed the brew button , then the remaining steps of the routine 700 are not executed . however , if the brew signal indicates that the user has depressed the brew button , test 703 checks the liquid level sensors 82 , 84 ( fig6 ) to ensure that there is water in the brewer . if there is not , step 705 is performed to flash the water column light 78 ( fig6 ) to call attention to the tubular transparent column that indicates the water level . if there is enough water in the brewer , test 706 is performed to determine if the water temperature is hot enough for brewing . the test 706 checks the status of the boolean signal on line 240 ( fig6 ) to determine if the water temperature is above the first threshold value . if the temperature is not above the first threshold value ( e . g ., the signal on the line 240 is a logical zero ) then step 708 is executed to illuminate a status light ( e . g ., a yellow light ) to indicate the water temperature is not hot enough for brewing . if the water temperature is hot enough for brewing , a test 710 is performed to check that the cartridge drawer 88 ( fig5 ) has been closed in the last thirty ( 30 ) seconds . this test helps to ensure that the user has placed an unused cartridge into the brewer . specifically , the test 710 checks the status of the signal from the drawer switch sensor 94 ( fig5 and 6 ). if the drawer 88 has not been closed in the last thirty seconds , step 712 is performed to illuminate a status light . if the drawer is closed , then the system is ready for brewing and step 714 is performed to turn the heater off , close the purge valve 361 ( fig6 ) and turn the bladder pump 202 ( fig6 ) on . referring to fig5 turning the bladder pump 202 on causes the air bladder 42 to inflate , which moves the shaft 28 downward sealing the gasket 33 against the seat 20 to establish the metering chamber area 16 . this also causes the arm 34 to pivot , causing the probe 58 to puncture the cartridge 46 to establish a flow path inlet to the cartridge . the downward force from the arm 34 also forces the cartridge against and to be pierced by the flow outlet needle 60 , thus establishing a flow exit path from the cartridge . referring to fig5 and 7 , following the step 714 where the bladder pump is turned on , step 716 is performed to delay for several seconds ( e . g ., five seconds ), before commanding the brew pump 204 ( fig5 ) on in step 718 . the delay accounts for the time is takes for the shaft 28 to drive the gasket 33 into position to seal the metering chamber , and for the arm 34 to move into the brewing position . while the brew pump 204 is on and the bladder 42 is inflated to seal the gasket 33 against the seat 20 , compressed air enters the metering chamber 16 through port 223 driving water in the metering chamber into the metering tube 54 . the water then passes through the brew valve check valve 224 into the cartridge 46 . the water enters the cartridge through the downwardly projecting apertured probe 58 , passes through beverage extract and a filter within the cartridge , and exits the cartridge through the hollow piercing member 60 to a cup below . referring again to fig5 and 7 , once the brew pump 204 is turned on in the step 718 , the controller performs a safety test 722 . the test 722 monitors the sensed pressure signal value on the line 215 ( fig6 ), which is indicative of whether or not pressure in the metering chamber exceeds a maximum pressure threshold value ( e . g ., 7 psi ). if the pressure the pressure exceeds the maximum pressure threshold value , then step 724 commands the pumps off . step 724 also commands a purge valve 361 ( fig5 ) to the open , in order to deflate the air bladder 42 causing the shaft 28 to move vertically upward and the probe 58 to disengage from the cartridge 46 . the test 722 also checks if the brew pump 204 has been on for an excessive amount of time and executes the step 724 if it has . following step 724 , step 725 is performed to determine if an over pressure has been detected for two consecutive brewing cycles . that is , test 725 determines if during the brewing of the last two cups , was an over pressure detected during each brew . if it was detected during two consecutive brews , then the flow path between the metering tube 54 and the probe 60 may be at least partially blocked . therefore , step 727 is performed to illuminate a status light ( s ) indicative of a detected condition where the user should clean the flow path between and including the metering tube 54 and the probe 60 . if the test 724 determines an over pressure or a time - out situation does not exist , an interrupt brew routine illustrated in fig8 is performed . fig8 is a flow chart illustration of a interrupt brew logic routine 800 . this routine controls the operation of the interrupt brew pump 214 ( fig5 ), which provides a user the ability of customize the amount of water in their brewed beverage , and hence the taste . the routine includes a test 802 to check if the brew pump 204 ( fig5 ) is on . if the brew pump 204 is not on , then the routine exits . however , if the brew pump 204 is on , then a test 804 is performed to determine if the user has depressed the brew button 232 ( fig5 ). if the brew button is not depressed , the routine exits . if the user has depressed the brew button , then in step 806 the brew interrupt pump 214 ( fig5 ) is turned on , and the brew pump 204 ( fig5 ) is turned off . as a result , compressed air flows through the flow line 220 ( fig5 ), into the flow line 222 ( fig5 ) and through the tubular probe 58 ( fig5 ) into the cartridge . the brew interrupt pump remains on for about six seconds , to drive the water in the flow line 222 through the tubular probe 58 to the cartridge . significantly , once the brew interrupt pump 214 is turned on , water no longer flows from the metering chamber 14 ( fig5 ) to the metering probe 54 ( fig5 ). execution then returns to test 726 illustrated in fig7 . test 726 is performed to determine if the air pressure in the metering chamber 16 ( fig5 ) has dropped below a threshold value indicating that a desired amount of liquid has been output from the brewer . the threshold value is preferably a fraction of the nominal maximum sensed pressure during the brewing cycle . for example , the threshold may be 75 % of the maximum sensed pressure during the brewing cycle . alternatively , the threshold may be a constant value . if the user has not depressed the brew button while the brew pump is on in order to terminate the brew cycle , then the pressure will nominally drop below the threshold value when a predetermined amount of liquid has been delivered from the metering chamber . the predetermined amount ( e . g ., eight fluid ounces ) is set based upon the size of the metering chamber . however , the user can control the amount of liquid in the brewed beverage by depressing the brew button while the brew pump is on . this causes the brew pump to turn off , and the brew interrupt pump to turn on in order to blow out the water in the line flow line 222 . significantly , depressing the brew button 232 ( fig5 ) while the brew pump is on , terminates the brew cycle causing an amount of liquid less than the predetermined amount to be delivered during the brew cycle . the test 726 monitors the sensed pressure value on the line 214 from the pressure sensor 212 ( fig5 ). if the pressure has not dropped ( i . e ., the signal on the line 214 indicates the pressure is above the threshold ), execution returns to test 322 . once the test 726 determines that the pressure has dropped ( caused by either delivering the predetermined amount of liquid or a brew interrupt ), step 728 is performed to delay several seconds in order to blow residual liquid from the liquid flow path leading to the probe 58 ( fig5 ). during this delay the brew pump 204 or the interrupt brew pump 214 ( fig5 ) remains on , depending of course which one is on prior to the delay 228 . significantly , blowing out the flow path leading to the cartridge ensures that only hot water is used to brew , which is especially important if there is a substantial period between uses . in addition , blowing out the flow path removes liquid from the used cartridge for cleaner disposal . one of ordinary skill will recognize that during the delays the controller performs other tasks such as input signal processing , output signal processing , storage tank temperature control , and background and foreground built - in - tests , and / or other control and monitoring routines . the delays may be implemented by hardware or software counters . once the delay time of step 728 has elapsed , step 730 is executed to command the pumps 202 , 204 , 214 off . step 732 is then performed to open the purge valve 361 ( fig5 ) to deflate the air bladder 42 . deflating the air bladder 42 causes the shaft 28 to move vertically upward , which allows water to enter ( i . e ., refill ) the metering chamber 16 ( fig5 ) from the tank 14 ( fig5 ). referring again to fig5 to brew another beverage , the drawer 44 is opened , the used cartridge is removed , a new cartridge is inserted and the drawer 44 is returned to the closed position , and the start brew button is depressed again . fig9 is a flow chart of a built - in - test routine 900 periodically performed by the controller . the routine 900 includes a test 902 to determine if the heater has been on for an excessive amount of time ( e . g ., twelve minutes ), or it has been off for too long . if either of these conditions is true , step 904 commands the heater off . step 904 may also command the pumps off , and the purge valve open . step 906 then annunciates the fault / alarm condition and the system is placed into an “ off / safety state ” to prevent further brewing . otherwise , test 908 is performed to determine if the metering chamber 14 ( fig5 ) is over pressurized . the test 908 reads the status of the signal on the line 215 ( fig5 ) from the pressure sensor ( fig5 ), and if the status of the signal indicates the pressure exceeds the second pressure threshold value associated with an over pressure , step 910 is performed to turn the pumps off and open the purge value . step 912 is then performed to annunciate the fault / alarm condition and the system is placed into the “ off / safety state ” to prevent further brewing . fig1 is a flow chart illustration of a routine 1000 for controlling the liquid heater . the routine 1000 includes test 1002 that checks if the brew pump 204 ( fig5 ) is on . if it is , then the heater has already been commanded off ( step 714 in fig7 ), and heater remains off while the brew pump is on . however , if the brew pump is not on , then test 1003 checks to see if the water level in the brew is above the minimum threshold . this test is performed by checking the status of the signal from optical sensor # 1 82 ( fig2 a and 5 ). if there is not enough water in the brewer the heater is turned off in step 1006 . otherwise , test 1004 is performed to determine if the water temperature is above a maximum water temperature threshold value . this test checks the status of the signal on the line 244 ( fig5 ). if the boolean signal on the line 244 ( fig5 ) indicates that the temperature is greater than this threshold value , then the water is hot enough and the heater is commanded off in step 1006 . test 1008 is then performed to determine if the water temperature is below a minimum water temperature value . this test checks the status of the boolean signal on the line 240 ( fig5 ). if the signal on the line 240 ( fig5 ) indicates that the temperature is less than the minimum water threshold value , then the heater is commanded on in step 1010 . if the test 1008 determines the water temperature is not below the minimum water threshold value , then the temperature is between the minimum and maximum threshold temperature values ( i . e ., the threshold values set in the comparator circuit 241 of fig5 ). therefore , step 1012 is performed to turn the heater on and off with a 50 % duty cycle . fig1 is a flow chart illustration of a routine 1100 for checking the liquid level within the storage tank 14 ( fig5 ). the routine 1100 includes test 1102 to check if the water level in the tank 14 ( fig5 ) is too high . the test checks the status of the optical sensor # 1 ( fig2 a and 5 ). if the optical sensor # 1 82 indicates the tank is full , then step 1104 is performed to provide an audio indication to the user to stop filling the unit via inlet 17 ( fig5 ). for example , several beeps may be output from speaker 266 ( fig5 ). if the tank is not full , then test 1106 is performed to determine if the water level is too low . if it is , then step 1108 is performed the flash the water column light 78 ( fig2 a and 5 ). while the present invention has been described in the context of a preferred embodiment that senses air pressure to determine when the desired amount of liquid has been delivered from the metering chamber , the present invention is not so limited . for example , a level sensor ( e . g ., a float switch ) may be located in the metering chamber to determine when the liquid in the chamber is below a certain level . in addition , the brew pump may be simply commanded on for a set period of time sufficient to ensure that the predetermined amount of liquid has been delivered from the metering chamber . notably , it suffices that in all these embodiments of the present invention compressed air is used to drive liquid from the metering chamber . in addition , although the brewer is discussed in the context of manually adding water to the system , one of ordinary skill will recognize that the system may include automatic refill if connected for such operation to the plumbing . although the present invention has been discussed in the context of an automated brewing system that includes a microcontroller , one of ordinary skill will recognize that there a number of different techniques for controlling the delivery of the compressed air to the metering chamber . for example , a state machine may be used rather than a cpu . in addition , the controller may be an analog system rather than a digital controller . furthermore , a pneumatic controller rather than an electronic controller may be used to control delivery and venting of the compressed air . while obvious , it should also be noted the present invention is certainly not limited to the delay values , threshold values or brewing sizes discussed herein . in addition , it is contemplated that rather than an electrically controllable valve , the purge valve may be mechanically linked to the arm so the valve opens as the arm moves from the beverage brewing position . in addition , the controller may also include an analog - to - digital converter ( adc ), which allows analog temperature and pressure signal values to be input to the controller and digitized for use in the control and monitoring routines . the present invention may also operate in a “ vending ” environment . that is , as a vending machining , the system would not start brewing until money has been deposited or an account debited . for example , test may check to ensure the required fee has been paid before brewing is allowed to start . although the present invention has been shown and described with respect to several preferred embodiments thereof , various changes , omissions and additions to the form and detail thereof , may be made therein , without departing from the spirit and scope of the invention .	0
fig1 is a schematic of a device 13 for identifying parameters . a field device 1 incorporated into an automation process is connected to a monitoring unit 2 . said field device has been calibrated with a vendor - specific parameter set in keeping with the process requirements . the monitoring unit 2 is embodied as what is termed an autonomic manager that checks the field device &# 39 ; s behavior during ongoing operation . for this purpose the autonomic manager 2 measures the signals being applied to the external interfaces of the field device 1 and records them . the signals are , for example , telegrams sent over a network such as , for instance , a wlan or field bus , or are , for example , sensor values . the recorded signals are stored in a first memory area 3 . stored in a second memory area 4 is a field device model that describes the operational behavior of the field device 1 in a cross - vendor manner . different field devices of the same type ( pid controllers , for example ) can be described by means of the field device model . the field device model has model parameters 6 that determine the field device model &# 39 ; s system behavior . a processing unit 5 has access to the operating information , stored in the first memory area , that describes the operational behavior of the real field device 2 , and to the field device model stored in the second memory area 4 . based on the operating information of the real field device 1 , the processing unit 5 determines the field device model &# 39 ; s model parameters 6 in such a way that the vendor - neutral field device model to which parameters are assigned will exhibit the same system behavior as the real field device 1 . the identified model parameters are , for example : vendor specifications , such as device type , that can be read from , for example , an electronic type plate operating conditions , such as temperature range controller parameters registering rate scaling factors for temperature , pressure . . . ( additional information is required for this concerning the automation system in which the field device is being used ) monitoring , thresholds characteristic curves the vendor - neutral model parameters can be used in the following as a basis for assigning parameters to further field devices which , in particular , may also be from another vendor . that can be advantageous if , for example , the field device fails and has to be replaced by a replacement field device and the replacement field device is not identical in design to the original field device . what is special about the parameter identification is that the model parameters are determined from the field device &# 39 ; s runtime characteristics and no accessing of engineering information is necessary . no parameters have to be read either from the device of from any other storage media . the processing unit does not require a direct coupling to the autonomic manager 2 but uses only the operating information stored in the first memory area 3 , which information can also be designated as a history . parameter identifying can therefore also work offline on a copy of the history . in the first memory area 3 is a mechanism that can analyze standardized telegrams and data in order to read out a drive &# 39 ; s target / actual value from , for example , a profibus telegram . fig2 shows an exemplary realization of a method for identifying parameters . the example uses what is termed an fir ( finite impulse response ) filter 11 for identifying model parameters describing the operational behavior of a field device 1 . the time - dependent input signals u ( t ) and the output signals y ( t ) of the field device 1 are evaluated by the fir filter 11 at discrete sampling instants n . the fir filter 11 is characterized by an equation linking the output signals y ( n ) to the input signals of the last n sampled values u ( n − n ) . . . u ( n ) via the filter coefficients g i . equations with the aid of which the filter coefficients g 0 . . . g n can be determined will accordingly be available after n sampling instants . the filter coefficients g 0 . . . g n correspond to the vendor - neutral model parameters by means of which the field device behavior can be described . based on the filter coefficients , new vendor - specific device parameters for a further field device from another vendor can be determined in an ensuing step of the method . fig3 is a schematic of a method for generating vendor - specific device parameters 9 on the basis of target values 7 for model parameters . the target values 7 of the model parameters can be determined for the field device 1 for example at a previous step of the method with the aid of the fir filter 11 shown in fig2 . let it be assumed below that the field device 1 must , owing to a technical defect , be replaced by a further field device 10 that is not identical in design , referred to below also as a replacement device . to insure the same operational behavior from the replacement device 10 within an automation process , the model parameters 6 previously determined for the original field device are defined as the target values 7 for the replacement field device 10 . the vendor - specific device parameters 9 of the replacement field device 10 are determined from the target values 7 of the model parameters with the aid of a vendor - specific target compiler 12 . a cross - vendor method for assigning parameters that is known from de 101 32 036 c2 can alternatively also be used for generating the vendor - specific device parameters 9 from the target values 7 of the model parameters . a further possibility is to systematically vary the vendor - specific device parameters with the aim , for example , of simulating a desired transfer function . fig4 is a schematic of a further method for generating vendor - specific device parameters 9 on the basis of target values 7 for model parameters for a further field device 10 serving in particular as a replacement device for an original field device . the target values 7 have been determined according to , for example , the method , described in fig2 , for the original field device . the idea underlying the method shown for identifying the suitable device - specific parameters 9 is based on a closed control loop . parameters are assigned to the replacement field device 10 using vendor - specific device parameters 9 . the replacement field device 10 is coupled to a monitoring unit 2 that monitors the field device behavior of the replacement field device 10 and stores relevant operating information in a first memory area 3 . for monitoring the field device behavior the monitoring unit 2 taps the signals being applied to the external interfaces of the replacement field device 10 . stored in a second memory area 4 is a vendor - neutral field device model corresponding to the common type of the field device and replacement field device 10 . current model parameters 6 of the replacement field device 10 are determined from the replacement field device &# 39 ; s operating information and from the vendor - neutral field device model with the aid of a processing unit 5 . the current model parameters 6 are fed back and compared with the target values 7 of the model parameters . the system deviation resulting from the difference between the target values 7 and the current model parameters 6 is lastly sent to a further processing unit 8 embodied as a controller , for example . the corrected vendor - specific device parameters 9 of the replacement field device 10 will finally be available at the controller &# 39 ; s output . with the method described in fig4 an inventive embodiment for identifying parameters is thus used not only for determining the original field device &# 39 ; s model parameters but also for automatically assigning parameters to the replacement field device . the inventive method or , as the case may be , inventive apparatus can further be used for applications other than changing over devices . examples include : determining a relationship / correlation between vendor - specific field device parameters and values observed at the external interfaces , with the aim of achieving automated setting of a standardized behavior for all field devices of one type regardless of the respective vendor or version status of a vendor &# 39 ; s field device type . simulating a field device behavior in the case , for example , of process simulating during a planning phase or as part of a virtual system power - on . monitoring a plurality of devices of the same kind . the inventive apparatus can herein compare a plurality of field devices of the same kind and transfer the parameters of the best device to the other devices . additionally registering the operational characteristics for statistics and verifications . comparing devices . obtaining optimized parameters .	6
referring to fig1 and 2 , the aerosol medicament delivery apparatus 10 of the present invention is composed of a holding chamber 200 with first and second ends . at the first end of the holding chamber is a receptacle 300 for connection to a source of aerosol medication . for the purposes of the present invention , aerosol medicament or aerosol medication is intended to include finely divided solid or liquid materials that are carried by a gas for delivery to a subject &# 39 ; s respiratory tract , especially to the lungs . this includes nebulized materials . the medicament and carrier gas aerosol composition can be prepared prior to use if it exhibits sufficient physical and chemical stability , or it can be prepared in situ from sources of solid or liquid medicament materials ( either in pure form or combined with a suitable solid or liquid solvent , excipient or diluent ) and pressurized gas . at the second end is a mouthpiece member 100 for delivering aerosol medicament to a subject through a valve 150 . the mouthpiece member includes a housing 101 that defines a passage 102 through which aerosol medicament can be supplied to a subject and has an opening 103 that opens to the outside of the housing . the valve , discussed below , is of one - piece construction . during inhalation the valve permits the flow of aerosol medicament from the holding chamber to the subject , while blocking the inflow of outside air to the passage 102 through the sidewall of the housing of the mouthpiece member . during exhalation , the valve blocks the flow of exhaled air upstream in the direction of the holding chamber , and permits the exhaled air to be exhausted through the sidewall of the housing . in an exemplary embodiment , the housing 101 is composed of a delivery member 110 and an adaptor member 170 . the opening 103 may be defined , as it is in part in the exemplary embodiment , by a notch 186 in the adaptor member . the delivery member and adaptor member may be releasably connected by a quick release mechanism 182 . in the exemplary embodiment , the quick release mechanism is a flexible wall , upon which a positioning element 175 may be located . also , in the exemplary embodiment , the housing is transparent . this has the advantage that it allows for the subject to visually verify the operation of the valve , to ensure opening and closing during treatment . referring to fig3 , the delivery member 110 may include a subject side section 120 , a connecting ring 130 , and an adaptor side section 140 . in the exemplary embodiment , the subject side section of the delivery member of the mouthpiece is sized and shaped to fit a human mouth , e . g . having an oval shape . the subject end section is defined by a housing composed of a sidewall having a height 124 , and upon which may be provided at least one ridge 125 . positioning pins 141 may be provided on the adaptor side section of the delivery member . referring to fig4 , the adaptor side section 140 of the delivery member 110 in this exemplary embodiment has walls 142 arranged around an opening 145 . one or more openings , for example the illustrated notches 147 , is formed in the wall 142 and can define an exhaust opening from the delivery member for exhaled air . this opening is closed by the valve during inhalation , and the opening may be provided with an element to assist in seating a valve member , for example protrusion 146 . the end face 144 of the wall can be used as a surface for holding the valve in place when the apparatus is assembled , in cooperation with an opposed surface on the adaptor member . also , in this embodiment , the four positioning pins 141 extend from the end face of the wall 142 . referring to fig5 a and 5 b , the one - piece two - way valve system 150 allows for inhalation and exhalation with a single valve . the valve has a base 151 , a first valve element 152 , which has a duck - bill shape in this embodiment , and a second valve element 153 , which is shaped like a hinged flap 153 in this embodiment . in the exemplary embodiment , the valve is composed of a flexible material and there are two hinged flaps 153 . the two valve elements may be joined at or carried on a common base 151 . the base has a thickness 154 that is less than the height of the positioning pins of the mouthpiece , so that the pins may pass therethrough . there is an opening 155 in the base , which may be defined as the perimeter of contact between the duck - bill and the base . the exemplary embodiment has four positioning holes 156 placed near the perimeter of the base , each being sized to admit the matching positioning pins . thus , when the apparatus is assembled , the positioning pins of the mouthpiece penetrate the positioning holes of the valve base and the valve base forms a substantially airtight seal between the delivery member and the adaptor member . the duck - bill is a shape predominantly that of a wedge with a very narrow split across the apex of the wedge . the split is narrow enough that the two edges forming the ends of the duck - bill are substantially in contact when there is no external pressure on the duck - bill . the duck - bill has a span , a height , and a thickness . the height of the duck - bill is the vertical distance between the apex of the wedge where the split is located and the base . the span is the distance of the split across the thin edge of the wedge and the height . the span is sufficiently narrow that the apex of the duck bill will fit within the delivery member without contacting it . thus , the dead zone within the delivery member is minimized by the valve extending therein . the valve may be as wide as possible to provide for easier inhalation , but just narrower than the passage so that the duck - bill sides do not receive pressure and the lips of the duck - bill are not parted except by inhalation . dead space refers to the volume of the apparatus containing air which is rebreathed . dead space is inherent in any valve - based system enclosed within a mouthpiece or mask ; it is the space between the mouth of a subject and the valve . any subject has a limited volume of air that may be inhaled , and which then is exhaled . this is the subject &# 39 ; s tidal volume . the inhalation air will contain both oxygen and medicament . the exhalation air will contain carbon dioxide . in a sealed system , all inhalation air will come through the valve and will contain a preferable mixture of medicament laden air . however , this inhalation air will be combined with whatever gases remain sealed within the dead space on their way to being actually inhaled into the subject &# 39 ; s respiratory tract . similarly , when the subject exhales , all air must pass through this dead zone on the way out the exhaust portion of the valve system . because the subject will be incapable of forcing a complete vacuum within this sealed system , the dead space will contain gases that then will be re - inhaled during the next breathing cycle . given that the volume of the subject &# 39 ; s lungs is fixed , the larger the volume of the system &# 39 ; s dead space , the smaller the volume of medicament laden air the subject will receive with each breathing cycle . thus , the larger the volume of dead space , the less efficient the system because increasing dead space causes a buildup of carbon dioxide and rebreathing . rebreathing carbon dioxide can have an adverse effect on breathing rates and patterns , especially for small children who have very small tidal volumes . duck - bill valves are more efficient than diaphragm valves because the volume encompassed by the duck - bill is subtracted from space that otherwise would be dead space in a diaphragm - based system . the duck - bill is thin enough that the sides of the wedge will flex when the atmospheric pressure on the opposite side of the base from the duck - bill is greater than that above the duck - bill . this causes the edges of the duck - bill to part , letting air flow through the duck - bill in the direction from the base to mouthpiece . thus , in the present embodiment , air is permitted to flow through the mouthpiece to a subject during inhalation . the duck - bill closes automatically at the end of inhalation when the atmospheric pressure differential is removed . thus , the flow of exhaled air upstream of the valve to the holding chamber is prevented during exhalation . the exemplary embodiment of the present invention provides two hinged flaps 153 extending from on or near the perimeter of the base . each hinged flap 153 is sized so as to be able to cover a corresponding notch 147 when assembled . each flap is placed on the base at such a position and at such an angle that when the base is placed onto the positioning pins of the mouthpiece , the flap covers one of the notches 147 . the flap is hinged onto the base so that it may cover the notch 147 during inhalation , thereby preventing the flow of outside air into the interior of the housing through the opening in the sidewall of the housing . when the mouthpiece of the apparatus of the exemplary embodiment is assembled , the notch of the delivery member 147 and the aforementioned notch of the adaptor member 186 may be aligned radially , and the hinged outgas flap 153 is disposed between these notches . the flexible material forming each of the outgas flaps is sufficiently thin to allow an outgas flap to flex through at least a few degrees of flexibility when differences in relative atmospheric pressure caused by human breathing exert flexing pressure on said flap , thereby moving the flap away from the notch 147 during exhalation and allowing exhaled air to pass out of the mouthpiece through the notch 186 . referring to fig6 , the subject side section 120 of the delivery member may be formed by a sidewall 128 that is generally cylindrical in shape with an oval cross section . the exemplary embodiment has two side points 122 , opposite each other on the sidewall , and two lip points 123 , opposite each other on the sidewall . each lip point is equidistant between the two side points . there is a contact end 126 where the sidewall is joined to the connecting ring and a lip end 127 opposite the contact end . the upper opening of the sidewall 121 at the lip end is oval . there is a lower opening of the sidewall at the contact end , through which the tip of the duck - bill valve passes . ridges 125 may be provided for placement of the subject &# 39 ; s lips , or to aid in the placement of an adaptor mask on the outside of the delivery member . shaped correctly , a ridge 125 may be used to seal and mount such a mask with a tight pressure fit . these ridges are placed approximately halfway down the upper section , and are wedge shaped in the exemplary embodiment . specifically , they are formed by the upper and lower thickness measurements being equal at the side points and the lower thickness being greater than the upper thickness at the lip points . referring to fig4 and 6 , the connecting ring 130 between the adaptor side and subject side sections of the delivery member has an interior opening 135 , which may be equal in size to and substantially continuous with the opening of the sidewall of the subject side section . it has an exterior limit 131 that is greater than the interior opening , and a surface 132 where the connecting ring is joined to the subject side section . the surface 132 extends from the sidewall 128 outwards toward the exterior limit 131 where it joins with an exterior wall 133 . the exterior wall 133 may be substantially parallel to the sidewall 128 and extends from the top surface in a direction away from the lip end of the subject side section . the exterior wall has an interior surface and an exterior surface , the interior surface being closer to the interior opening of the connecting ring . in the exemplary embodiment , there are two contact openings 134 in the top surface , which are disposed approximately equidistantly around the circumference of the top surface . each contact hole is adapted to accept a portion of the adaptor member , to help hold the two members of the mouthpiece securely together . on the interior surface of the exterior wall , there may be provided two engaging members 136 , or catches , each being below a contact hole . they are wedge shaped and oriented with the thin end of the wedge towards the adaptor side for ease in connecting and resistance to disconnecting . in the exemplary embodiment , each has a width less than that of the corresponding contact opening above the catch , a length less than that of the distance between the top and bottom of the exterior wall of the connecting ring , and a height less than the length . referring back to fig3 and 4 , the width 143 of each section that makes up the wall 142 is approximately as wide as a contact opening in the top surface of the connecting ring . each wall section is disposed along the interior opening substantially adjacent to a contact opening , thus providing a limit to the flexing of the walls of the adaptor member , which is discussed below . in the exemplary embodiment , each wall section has two positioning pins 141 placed along the end face of the wall , extending in the same direction . they are placed near the edge of the wall sections , and can be placed as far apart from each other as the width of a contact opening in the surface of the connecting ring . due to their height , the sections of the wall 142 extend into the space of the adaptor member when the apparatus is assembled . protrusions 146 may be disposed on the perimeter of the opening forming the passage for exhalation air flow ( notches 147 ). these protrusions act as stop elements for the exhaust flap portions of the one - piece valve , limiting their travel in an inward direction . as will be seen in more detail below , when the subject inhales , these exhaust flaps are pressed by suction against the stop elements and form a seal so that the pressure of inhalation is fully directed towards drawing the medicament laden air from the holding chamber . referring to fig7 , the adaptor member 170 may be generally frustoconical in shape , thereby providing for the smooth change in diameter from the holding chamber to the delivery member . in the exemplary embodiment , it is both frustoconical and transparent . a transparent embodiment of the present invention has the additional advantage of allowing the subject to visually verify the presence of the medicament during delivery to the patient . the adaptor member may have a base end 171 , a conical midsection 172 , four wall sections , and a delivery side end 173 . the base end is adapted to cooperate with the edge of the holding chamber , for example forming an exterior wall extending from the end of the cone . the base end of the adaptor member also may have an inner wall 174 extending from the end of the cone . in the exemplary embodiment , each of these two walls having a height of at least 0 . 5 mm to define a groove for accepting the edge of the holding chamber . in this case , the walls are shaped and positioned such that , when the chamber is positioned between the inner and outer walls and a thin layer of adhesive is applied between the walls , a substantially airtight seal may be formed between the holder and the chamber . other systems for joining the adaptor member and holding chamber may be used , including permanent bonding or releasable connections . the releasable connection may not be needed when the delivery member is made of two readily - separated components that allow for easy cleaning and for replacement of the valve when necessary , as in the illustrated embodiment . referring to fig7 and 8 , the wall arising from the frustoconical midsection 172 of the adaptor member 170 may be divided into four sections , including two catch walls 176 and two vent walls 177 in the exemplary embodiment . these may be placed alternately around the delivery side end of the adaptor member . each catch wall 176 may have a catch opening 178 sized to admit one of the catches 136 of the connecting ring 130 of the delivery member 110 . a catch wall 176 is positioned on the adaptor member such that its opening 178 is adapted to fit a catch 136 when the two adaptor and delivery members are joined . the end 179 of the catch wall 176 may fit a contact opening 134 of the connecting ring 130 of the delivery member 110 . the catch walls 176 may be flexible , so that they may be bent by the subject applying pressure at the positioning points 175 to release the catch 136 from the opening 178 . this allows the two members of the exemplary housing 101 to be joined and separated in a quick - release fashion . each valve wall 177 in the exemplary embodiment is u shaped . that is , it is a wall on the long side of the oval opening with a notch 186 in it . other systems for connecting the adaptor member and delivery member can be used . in addition , the catch and opening could be reversed , i . e . the opening provided on the connecting ring and the catch provided on wall section of the adaptor member . the delivery side end of the conical adaptor member may have an opening 185 of substantially the same size as the opening 155 . an airtight seal may be formed between the opposing surfaces of the adaptor member and the delivery member by the valve . that is , the valve base 151 may have opposing surfaces arranged to meet those of the adaptor member and the delivery member and form an airtight seal when the apparatus is assembled . the exemplary embodiment &# 39 ; s adaptor member 170 has a rim 180 around the opening 185 with four positioning openings 181 in the rim , one for each pin 141 . thus , when the two members are joined , the four pins of the delivery member drop into these openings in the exemplary embodiment . referring to back fig1 , 2 and 7 , the cylindrical holding chamber 200 may be defined by a length of cylindrical tube that extends between the mouthpiece 100 and a source of aerosol medicament and includes the receptacle 300 accepting an outlet from a source of aerosol medicament such as a metered dose inhaler or the like . the tube wall 201 may be sized to fit between the inner wall 174 and the outer wall 171 of the base of the mouthpiece . in the exemplary embodiment , the holding chamber is made of a lightweight metal or alloy , such as aluminum or an alloy thereof . the use of such material reduces the risk of resistance to medicament flow by static attraction between the particles of medicament and the holding chamber wall . alternatively , the surface of a holding chamber of any material may be treated with an anti - electrostatic coating or process to achieve this advantage . in the exemplary embodiment using a metal tube , the tube is anodized which provides the advantage of sealing the micro - porosity of such a tube &# 39 ; s surface and stabilizing it against oxidation . referring to fig9 a and 9 b , the receptacle 300 may include a base with a lip 310 , an opening 350 for accepting a source of aerosol medicament in the base with a collar 370 extending into the chamber 200 , an air vent 320 , and a supporting wall 340 that surrounds the opening arising from the base into the chamber . the exemplary embodiment has four vents . the receptacle base is sized to fit within the tube of the holding chamber . it may be formed of a resilient and flexible material such that it may be removed from the chamber tube ( e . g ., for cleaning ) and replaced many times without loss of functionality , such as maintenance of structural integrity or the ability of the receptacle to form a substantially airtight seal with the tube , throughout the life of the apparatus . in the exemplary embodiment , the receptacle may be removed and replaced hundreds of times without ripping , tearing or otherwise harming the functionality of the apparatus . this removal resilience also applies to the removal and replacement of the source of aerosol medicament from the apparatus . the lip 310 of the receptacle fits around the perimeter of the base of the member so that the lip extends beyond the edge of the tube . the lip may be sized such that it forms a substantially airtight seal with the tube . other systems can be used to join the receptacle to the tube if desired . the opening 350 of the receptacle of the exemplary embodiment may be sized to accept several different types of aerosol medicament sources such as mdis . the collar 370 is sufficiently long and flexible to form a seal with the aerosol medicament source when one is admitted into the receptacle . the supporting wall 340 of the exemplary embodiment is provided with cyclone baffles 330 placed upon the outside of the wall ( relative to the opening ) and support ribs 360 radially placed upon the inside of the wall . the support ribs 360 extend from the wall towards the collar 370 . they are sized so that there is space for the collar to be pressed up against the ribs when a typical mdi is inserted into the opening . thus , an airtight seal may be formed around the source of the aerosol medicament . the support ribs of the exemplary embodiment provide support to the source of aerosol medicament by holding that source against the structure of the collar . the vents 320 allow outside air to be drawn into the holding chamber during inhalation . this helps to push the aerosol medicament to the subject during inhalation . each cyclone baffle 330 extends towards the base and is aligned with a vent 320 so that the point where the baffle reaches the base is just beyond the vent . the baffle thus covers the vent . the baffle may have a width sufficient to form a seal between the supporting wall and the tube wall of the chamber . by using the baffle to direct airflow coming through the vents , a rotational flow is imparted to the air entering the chamber through the vents . in the exemplary embodiment , the placement of the cyclone baffles above the vents and next to the wall of the holding chamber wall directs outside air to and along the wall of the holding chamber . this reduces the tendency for medicament to adhere to the wall of the holding chamber . although each of the four vents have been provided with a cyclone baffle in the present embodiment , this may not be necessary in all cases . the exemplary embodiment of the present invention is steam autoclavable either assembled or disassembled . this advantage arises from both the choice of materials used , as herein discussed , and the materials and methods of assembling the components of the invention , such as the quick release mechanism 182 and the use of high - temperature adhesive at the junction of adaptor member 170 and holding chamber 200 . further , the present invention is easily disassembled for cleaning and parts replacement by a non - technical person . while a detailed description of the present invention has been provided above , the invention is not limited thereto . modifications that do not depart from the scope and spirit of the invention will be apparent to those skilled in the art . the invention is defined by the claims that follow .	0
methods and systems that implement the embodiments of the various features of the invention will now be described with reference to the drawings . the drawings and the associated descriptions are provided to illustrate embodiments of the invention and not to limit the scope of the invention . reference in the specification to “ one embodiment ” or “ an embodiment ” is intended to indicate that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least an embodiment of the invention . the appearances of the phrase “ one embodiment ” or “ an embodiment ” in various places in the specification are not necessarily all referring to the same embodiment . throughout the drawings , reference numbers are re - used to indicate correspondence between referenced elements . in broadest terms , the invention involves the determination of a cardiac value , such as a stroke volume ( sv ), and / or a value derived from the sv such as cardiac output ( co ), using the arterial pulse pressure propagation time . the arterial pulse pressure propagation time may be measured by using arterial pressure waveforms or waveforms that are proportional to or derived from the arterial pulse pressure , electrocardiogram measurements , bioimpedance measurements , other cardiovascular parameters , etc . these measurements may be made with an invasive , non - invasive or minimally invasive instrument or a combination of instruments . the invention may be used with any type of subject , whether human or animal . because it is anticipated that the most common use of the invention will be on humans in a diagnostic setting , the invention is described below primarily in use with a “ patient .” this is by way of example only ; however , it is intended that the term “ patient ” should encompass all subjects , both human and animal , regardless of setting . fig1 illustrates an example of two blood pressure curves representing two different arterial pressure measurements received from a subject . the top curve represents a central arterial pressure measurement detected from the subject &# 39 ; s aorta and the bottom curve represents a measurement detected from the subject &# 39 ; s radial artery . the pulse pressure propagation time ( t prop ) can be measured as the transit time between the two arterial pressure measurements . the rationale of using the pulse pressure propagation time for hemodynamic measurements is based on a basic principle of cardiovascular biomechanics . that is , if the subject &# 39 ; s heart pumped blood through a completely rigid vessel , upon contraction of the heart , the pressure waveform would instantaneously be present at any distal arterial location in the subject &# 39 ; s body . however , if the subject &# 39 ; s heart pumped blood through a compliant vessel , upon contraction of the heart , the pressure waveform would be present some amount of time after the heart contracted at a distal arterial location in the subject &# 39 ; s body . the pulse pressure propagation time can be measured invasively or non - invasively at several different locations on the pressure waveform ( or any other waveform related to the pressure waveform ). in the example shown on fig1 , the pulse pressure propagation time may be measured by using two different arterial pressure measurements , for example , one reference measurement from the aorta and one peripheral measurement from the radial artery . fig2 illustrates an example of using an electrocardiogram signal as a reference signal for the propagation time measurement . the top curve represents an electrocardiogram ( ecg ) signal detected with electrodes placed near the subject &# 39 ; s heart and the bottom curve represents an arterial pressure measurement detected from the subject &# 39 ; s peripheral artery . in this example , the arterial pulse pressure propagation time ( t prop ) may be measured by using the transit time between the ecg signal and the peripheral arterial pressure . similarly , a transthoracic bioimpedance measurement could be used as a reference site , and the propagation time could be measured as a transit time versus a peripheral measurement derived from or proportional to the arterial blood pressure . the arterial pulse pressure propagation time provides an indirect measure of the physical ( i . e ., mechanical ) properties of a vessel segment between the two recording sites . these properties include primarily the elastic and geometric properties of the arterial walls . the properties of the arterial walls , for example their thicknesses and lumen diameters , are some of the major determinants of the arterial pulse pressure propagation time . as a result , the pulse pressure propagation time depends mainly on the arterial compliance . fig3 illustrates an example where the pulse pressure propagation time increases with increasing arterial compliance ( c ). hence , the pulse pressure propagation time ( t prop ) can be represented as a function of arterial compliance ( c ), i . e ., the arterial pulse pressure propagation time can therefore be used as a simple measure to estimate the arterial compliance . the propagation time can be used as a separate measure to assess a patient &# 39 ; s vascular status or can be used in a pulse contour cardiac output algorithm along with other parameters to account for the effects of vascular compliance , vascular resistance and vascular torie . in one embodiment , the arterial pulse pressure propagation time is measured using an arterial pulse pressure signal from relatively large arteries ( e . g ., radial , femoral , etc .) and therefore the influence of the peripheral resistance is minimal . also , this measurement may include the average arterial compliance between the measurement sites and may not reflect the pressure dependence of the arterial compliance . the basic relationship could be derived from the well known bramwell - hill equation used to calculate the pulse wave velocity ( pwv ): pwv 2 = ⅆ p ⅆ v · 1 ρ · v ( equation ⁢ ⁢ 10 ) the arterial compliance ( c ) may be defined as the ratio of the incremental change in volume ( dv ) resulting from an incremental change in pressure ( dp ), i . e ., where l is the vascular length between the two recording sites and t prop is the arterial pulse pressure propagation time . if equation 13 is substituted into equation 12 , the arterial compliance can be given by : where the scaling factor γ is a function , which depends on the blood density , the effective vascular distance between the two recording sites and the basic volume , i . e ., γ depends on the physical vascular volume between the two recording site and the blood viscosity ( i . e ., hematocrit . . . etc ). based on the above equations , the arterial pulse pressure propagation time can be used in a number of different ways . 1 . the use of the arterial pulse pressure propagation time to estimate arterial compliance . the pulse pressure propagation time may be used as an input to a hemodynamic model based on the standard deviation of the arterial pulse pressure to evaluate the dynamic changes in the arterial pressure created by the systolic ejection . the co can be represented as a function of the standard deviation of the arterial pulse pressure as follow : where k , as we have shown above , is a scaling factor proportional to the arterial compliance , std ( p ) is the standard deviation of the arterial pulse pressure , and hr is the heart rate . where map is the mean arterial pressure , τ is an exponential pressure decay constant , and c , like k , is a scaling factor related to arterial compliance . from equations 17 and 18 , the scaling factor k is a measure equal to vascular compliance . if we substitute the scaling factor k in equation 17 for the compliance as given in equation 16 , co can be computed using the standard deviation of the arterial pulse pressure waveform and the arterial pulse pressure propagation time : co = γ · t prop 2 · std ( p )· hr ( equation 19 ) where standard deviation of the arterial pulse pressure can be calculated using the equation : where n is the total number of samples , p ( k ) is the instantaneous pulse pressure , and p avg is the mean arterial pressure . the mean arterial pressure can be defined as : fig4 is a graph illustrating the relationship between the square of the arterial pulse pressure propagation time and the scaling factor k of patients during recovery from cardiac bypass surgery . fig4 plots ten ( 10 ) averaged data points from ten ( 10 ) different patients . in the example of fig4 , the arterial pulse pressure propagation time has been calculated as a transit time between the ecg signal and the radial arterial pressure . the data shown in fig4 illustrates that the k scaling factors of equation 17 can be effectively estimated using the arterial pulse pressure propagation time as given by equation 16 . fig5 and 6 are graphs illustrating the correlation between the arterial pulse pressure propagation time and the k scaling factor of equation 17 for different hemodynamic states of two subjects . both trends correspond to animal data taken from experiments using porcine animal models . these figures show identical trends of the scaling factor k and the square of the pulse pressure propagation time . the data on fig5 and 6 illustrate that the k or the c scaling factors of equations 17 and 18 can be effectively estimated using the arterial pulse pressure propagation time . the scaling factor γ of equation 19 can be determined using any pre - determined function of the propagation time and the pressure p ( t ); thus , where γ is a pre - determined function of the propagation time and pressure , used to develop computational methods to estimate γ . any known , independent co technique may be used to determine this relationship , whether invasive , for example , thermodilution , or non - invasive , for example , trans - esophageal echocardiography ( tee ) or bio - impedance measurement . the invention provides continuous trending of co between intermittent measurements such as td or tee . even if an invasive technique such as catheterization is used to determine γ , it will usually not be necessary to leave the catheter in the patient during the subsequent co - monitoring session . moreover , even when using a catheter - based calibration technique to determine γ , it is not necessary for the measurement to be taken in or near the heart ; rather , the calibration measurement can be made in the femoral artery . as such , even where an invasive technique is used to determine γ , the invention as a whole is still minimally invasive in that any catheterization may be peripheral and temporary . as discussed above , rather than measure arterial blood pressure directly , any other input signal may be used that is proportional to blood pressure . this means that calibration may be done at any or all of several points in the calculations . for example , if some signal other than arterial blood pressure itself is used as an input signal , then it may be calibrated to blood pressure before its values are used to calculate standard deviation , or afterwards , in which case either the resulting standard deviation value can be scaled , or the resulting sv value can be calibrated ( for example , by setting γ properly ), or some final function of sv ( such as co ) can be scaled . in short , the fact that the invention may in some cases use a different input signal than a direct measurement of arterial blood pressure does not limit its ability to generate an accurate sv estimate . in addition to the blood viscosity , γ depends mainly of the physical vascular volume between the two recording sites . of course , the effective length ( l ) and the effective volume ( v ) between the two recording sites can not be known . vascular branching and the patient to patient differences are two main reasons why the effective physical vascular volume between the two recording sites can not be known . however , it is obvious that this physical volume is proportional to the patient &# 39 ; s anthropometric parameters and therefore it can be estimated indirectly using the patient &# 39 ; s anthropometric parameters . the anthropometric parameters may be derived from various parameters such as the measured distance ( l ) between the two recording sites , patient &# 39 ; s weight , patient &# 39 ; s height , patient &# 39 ; s gender , patient &# 39 ; s age , patient &# 39 ; s bsa , etc ., or any combination of these factors . in one embodiment , all the anthropometric parameters , for example , the distance ( l ) between the two recording sites , patient &# 39 ; s weight , patient &# 39 ; s height , patient &# 39 ; s gender , patient &# 39 ; s age and patient &# 39 ; s bsa , may be used to compute γ . additional values are preferably also included in the computation to take other characteristics into account . in one embodiment , the heart rate hr ( or period of r - waves ) may be used . thus , the predictor variables set for computing γ , using the multivariate model γ , are related to the “ true ” vascular compliance measurement , determined as a function of co measured through thermo - dilution and the arterial pulse pressure , for a population of test or reference subjects . this creates a suite of compliance measurements , each of which is a function of the component parameters of γ m . the multivariate approximating function is then computed using numerical methods that best relates the parameters of γ m to a given suite of co measurements in a predefined manner . a polynomial multivariate fitting function is used to generate the coefficients of the polynomial that give a value of γ m for each set of the predictor variables . thus , the multivariate model has the following general equation : where a 1 . . . a n are the coefficients of the polynomial multiregression model , and y are the model &# 39 ; s predictor variables : the use of the arterial pulse pressure propagation time to estimate vascular tone . vascular tone is a hemodynamic parameter used to describe the combined effect of vascular compliance and peripheral resistance . in the prior art , the shape characteristics of the arterial pressure waveform in combination with patients anthropometric data and other cardiovascular parameters were used to estimate vascular tone ( see roteliuk , 2005 , “ arterial pressure - based automatic determination of a cardiovascular parameter ”). the arterial pulse pressure propagation time can also be used to estimate vascular tone . in one embodiment , the arterial pulse pressure propagation time can be used as an independent term to a multivariate regression model to continuously estimate vascular tone . in one embodiment , the arterial pulse pressure propagation time can be used in combination with the shape information of the arterial pulse pressure waveform to estimate the vascular tone . the higher order shape sensitive arterial pressure statistical moments and the pressure - weighted time moments may be used as predictor variables in the multivariate model along with the arterial pulse pressure propagation time . additional values are preferably also included in the computation to take other characteristics into account . for example , the heart rate hr ( or period of r - waves ), the body surface area bsa , as well as a pressure dependent non - linear compliance value c ( p ) may be calculated using a known method such as described by langwouters , which computes compliance as a polynomial function of the pressure waveform and the patient &# 39 ; s age and sex . thus , k = χ ( t prop , μ t1 , μ t2 , . . . μ tk , μ p1 , μ p2 , . . . μ pk , c ( p ), bsa , age , g . . . ) ( equation 26 ) μ 1t . . . μ kt are the 1 - st to k - th order time domain statistical moments of the arterial pulse pressure waveform ; μ 1p . . . μ kp are the lest to k - th order pressure weighted statistical moments of the arterial pulse pressure waveform ; c ( p ) is the pressure dependent vascular compliance as defined by langwouters et al . (“ the static elastic properties of 45 human thoracic and 20 abdominal aortas in vitro and the parameters of a new model ,” j . biomechanics , vol . 17 , no . 6 , pp . 425 - 435 , 1984 ); bsa is the patient &# 39 ; s body surface area ( function of height and weight ); depending on the needs of a given implementation of the invention , one may choose not to include either skewness or kurtosis , or one may include even higher order moments . the use of the first four statistical moments has proven successful in contributing to an accurate and robust estimate of compliance . moreover , anthropometric parameters other than the hr and bsa may be used in addition , or instead , and other methods may be used to determine c ( p ), which may even be completely omitted . the exemplary method described below for computing a current vascular tone value may be adjusted in a known manner to reflect the increased , decreased , or altered parameter set . once the parameter set for computing k has been assembled , it may be related to a known variable . existing devices and methods , including invasive techniques , such as thermo - dilution , may be used to determine co , hr and sv est for a population of test or reference subjects . for each subject , anthropometric data such as age , weight , bsa , height , etc . can also be recorded . this creates a suite of co measurements , each of which is a function ( initially unknown ) of the component parameters of k . an approximating function can therefore be computed , using known numerical methods , that best relates the parameters to k given the suite of co measurements in some predefined sense . one well understood and easily computed approximating function is a polynomial . in one embodiment , a standard multivariate fitting routine is used to generate the coefficients of a polynomial that gave a value of k for each set of parameters t prop , hr , c ( p ), bsa , μ 1p , σ p , μ 3p , μ 4p μ 1t , σ t , μ 3t , μ 4t . 3 . the use of the arterial pulse pressure propagation to directly estimate co is discussed below . the pulse pressure propagation time may be used as an independent method to estimate co . that is , the arterial pulse pressure propagation time is independently proportional to sv , as shown below : co can be estimated if we multiply equation 29 by hr : the scaling factor k p can be estimated using a direct calibration , for example , using a known co value from a bolus thermo - dilution measurement or other gold standard co measurement . fig7 - 9 are graphs illustrating the correlation between the co computed using the pulse pressure propagation time as shown in equation 30 ( coprop ), continuous cardiac output ( cco ) and co values measured by intermittent thermodilution bolus measurements ( ico ). cco and ico are measured using the vigilance monitor manufactured by edwards lifesciences of irvine , calif . the measurements have been performed on animal porcine models in different hemodynamic states of the animals . these graphs show experimentally that changes in co are related to changes in the pulse pressure propagation time and that the pulse pressure propagation time can be used as an independent method to estimate co . the scaling factor k p of equation 30 can be determined using any pre - determined function of the propagation time and co or sv . any independent co technique may be used to determine this relationship , whether invasive , for example , thermo - dilution , or non - invasive , for example , trans - esophageal echocardiography ( tee ) or bio - impedance measurement . the invention provides continuous trending of co between intermittent measurements such as td or tee . even if an invasive technique such as catheterization is used to determine k p , it may not be necessary to leave the catheter in the patient during the subsequent co - monitoring session . moreover , even when using catheter - based calibration technique to determine k p , it may not be necessary for the measurement to be taken in or near the heart ; rather , the calibration measurement can be made in the femoral artery . as such , even where an invasive technique is used to determine k p , the method is still minimally invasive in that any catheterization may be peripheral and temporary . the approach shown in equation 30 allows measuring co to be performed completely non - invasively if non - invasive techniques are used to measure the propagation time and if a predefined function or relationship is used to measure k p . the non - invasive techniques to measure the propagation time can include , but are not limited to : ecg , non - invasive arterial blood pressure measurements , bio - impedance measurements , optical pulse oximetry measurements , doppler ultrasound measurements , or any other measurements derived from or proportional to them or any combination of them ( for example : using doppler ultrasound pulse velocity measurement to measure the reference signal near the heart and using a bio - impedance measurement to measure the peripheral signal . . . etc ). the scaling factor k p , depends mainly on blood viscosity and the physical vascular distance and volume between the two recording sites . of course , the effective length ( l ) and the effective volume ( v ) between the two recording sites can not be known . vascular branching and the patient to patient differences are two main reasons why the effective physical vascular volume between the two recording sites can not be known . however , the physical volume may be proportional to the patient &# 39 ; s anthropometric parameters and therefore it can be estimated indirectly using the patient &# 39 ; s anthropometric parameters . the anthropometric parameters may be derived from various parameters such as the measured distance ( l ) between the two recording sites , patient &# 39 ; s weight , patient &# 39 ; s height , patient &# 39 ; s gender , patient &# 39 ; s age , patient &# 39 ; s bsa etc ., or any combination of these parameters . in one embodiment , all the anthropometric parameters : the distance ( l ) between the two recording sites , patient &# 39 ; s weight , patient &# 39 ; s height , patient &# 39 ; s gender , patient &# 39 ; s age and patient &# 39 ; s bsa are used to compute k p . thus , the predictor variables set for computing k p , using the multivariate model m , are related to the “ true ” co measurement , determined as a function of the propagation time , where co is measured through thermo - dilution , for a population of test or reference subjects . this creates a suite of measurements , each of which is a function of the component parameters of m . the multivariate approximating function is then computed using numerical methods that best relates the parameters of m to a given suite of co measurements in some predefined sense . a polynomial multivariate fitting function is used to generate the coefficients of the polynomial that give a value of m for each set of the predictor variables . thus , the multivariate model has the following equation : where a 1 . . . a n are the coefficients of the polynomial multiregression model , and y are the model &# 39 ; s predictor variables : fig1 is a graph showing the relationship between the co estimated using equation 17 ( co std on the x - axis ) and co estimated using equation 30 ( co prop on the y - axis ) from a series of animal experiments . the data shows co measurements from a total of ten ( 10 ) pigs . three ( 3 ) selected data points from each pig are used for the graph . in order to cover a wide co range , each selected data point corresponds to a different hemodynamic state of the pig : vasodilated , vasoconstricted and hypovolemic states , respectively . the proportionality shown in fig1 is experimental proof of the effectiveness and the reliability of using the propagation time to estimate co . fig1 is a block diagram showing an exemplary system used to execute the various methods described herein . the system may include a patient 100 , a pressure transducer 201 , a catheter 202 , ecg electrodes 301 and 302 , signal conditioning units 401 and 402 , a multiplexer 403 , an analog - to - digital converter 405 and a computing unit 500 . the computing unit 500 may include a patient specific data module 501 , a scaling factor module 502 , a moment module 503 , a standard deviation module 504 , a propagation time module 505 , a stroke volume module 506 , a cardiac output module 507 , a heart rate module 508 , an input device 600 , an output device 700 , and a heart rate monitor 800 . each unit and module may be implemented in hardware , software , or a combination of hardware and software . the patient specific data module 501 is a memory module that stores patient data such as a patient &# 39 ; s age , height , weight , gender , bsa , etc . this data may be entered using the input device 600 . the scaling factor module 502 receives the patient data and performs calculations to compute the scaling compliance factor . for example , the scaling factor module 502 puts the parameters into the expression given above or into some other expression derived by creating an approximating function that best fits a set of test data . the scaling factor module 502 may also determine the time window [ t 0 , tf ] over which each vascular compliance , vascular tone , sv and / or co estimate is generated . this may be done as simply as choosing which and how many of the stored , consecutive , discretized values are used in each calculation . the moment module 503 determines or estimates the arterial pulse pressure higher order statistical time domain and weighted moments . the standard deviation module 504 determines or estimates the standard deviation of the arterial pulse pressure waveform . the propagation time module 505 determines or estimates the propagation time of the arterial pulse pressure waveform . the scaling factor , the higher order statistical moments , the standard deviation and the propagation time are input into the stroke volume module 506 to produce a sv value or estimate . a heart rate monitor 800 or software routine 508 ( for example , using fourier or derivative analysis ) can be used to measure the patient &# 39 ; s heart rate . the sv value or estimate and the patient &# 39 ; s heart rate are input into the cardiac output module 507 to produce an estimate of co using , for example , the equation co = sv * hr . as mentioned above , it may not be necessary for the system to compute sv or co if these values are not of interest . the same is true for the vascular compliance , vascular tone and peripheral resistance . in such cases , the corresponding modules may not be necessary and may be omitted . for example , the invention may be used to determined arterial compliance . nonetheless , as fig1 illustrates , any or all of the results , sv , co , vascular compliance , vascular tone and peripheral resistance may be displayed on the output device 700 ( e . g ., a monitor ) for presentation to and interpretation by a user . as with the input device 600 , the output device 700 may typically be the same as is used by the system for other purposes . the invention further relates to a computer program loadable in a computer unit or the computing unit 500 in order to execute the method of the invention . moreover , the various modules 501 - 507 may be used to perform the various calculations and perform related method steps according to the invention and may also be stored as computer - executable instructions on a computer - readable medium in order to allow the invention to be loaded into and executed by different processing systems . while certain exemplary embodiments have been described and shown in the accompanying drawings , it is to be understood that such embodiments are merely illustrative of and not restrictive on the broad invention , and that this invention not be limited to the specific constructions and arrangements shown and described , since various other changes , combinations , omissions , modifications and substitutions , in addition to those set forth in the above paragraphs , are possible . those skilled in the art will appreciate that various adaptations and modifications of the just described preferred embodiment can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein .	0
while fig1 , 2 , and 6 show the most preferred embodiment 2 of the strong and rugged present invention fluid collection pan ( sometimes hereinafter also referred to as pan 2 ), fig3 , 4 , and 5 shows one example of a vibration isolator 30 that can be used in the top indentation 10 of each egg - shaped support 6 in most preferred embodiment 2 for vibration reduction , to prevent movement of a supported fluid - causing unit ( not shown ) from its originally installed position collectively upon multiple egg - shaped supports 6 during routine use , and for enhanced heat dissipation around the associated furnace , air - conditioning system , or other fluid - causing unit while it is being supported upon the egg - shaped supports 6 . although not shown , pan 2 is typically used ( but not limited thereto ) for horizontal support of a fluid - causing unit upon the ground , a floor , floor joists , or attic beams . it is to be understood that many variations in the present invention , including variations in the configurations of vibration isolators 30 , are also considered to be a part of the invention disclosed herein even though such variations are not specifically mentioned or shown . as a result , a reader should determine the scope of the present invention by the appended claims and not make any limiting assumptions based upon the examples given below . fig1 , 2 , and 6 show the most preferred embodiment 2 of the present invention pan having a substantially rectangular interior bottom surface 48 defined by a substantially rectangular perimeter wall 4 , and ten spaced - apart egg - shaped supports 6 upwardly depending from interior bottom surface 48 . the rectangular configuration of interior bottom surface 48 and perimeter wall 4 are preferred , but not critical . the size of pan 2 is also not critical . between perimeter wall 4 and egg - shaped supports 6 , interior bottom surface 48 is substantially planar to prevent pooling of collected fluid thereon in any localized area and thereby potentially causing premature pan 2 failure . fig1 and 6 also show each egg - shaped support 6 having an upwardly - tapering configuration and a circular top surface 10 that widens into an elliptical base 46 . the important goals in the structural design of most preferred embodiment 2 relating to the reduction of stress points and the even pulling of plastic during manufacture to reduce thin areas prone to cracking and sagging , dictate an arcuate configuration for the top surface 10 of each egg - shaped support 6 , circular or other , with the same goals also being achieved by the arcuate configuration of the elliptical base 46 of each egg - shaped support 6 . the size of perimeter wall 4 ( and thus interior bottom surface 48 ) is not fixed and may be determined by several factors , including but not limited to , the size of the fluid - causing unit ( not shown ) to be supported by egg - shaped supports 6 in an intended application , the space available for pan 2 at an installation site , the amount of fluid generation anticipated during routine cycles of collection and evaporation from the supported fluid - causing unit ( not shown ), and manufacturing cost . the relative height of perimeter wall 4 as compared with that of egg - shaped supports 6 is also not fixed , and may be different from that shown in fig1 and 2 . however , it is contemplated for egg - shaped supports 6 to generally be large and always extend above perimeter wall 4 so that all structural support for a fluid - causing unit ( not shown ) is provided by egg - shaped supports 6 . further , although ten egg - shaped supports 6 are shown in fig1 and 6 , the number used may be different from that shown . strengthening features for pan 2 may also be provided in the structure of the perimeter wall 4 , and may include any of the following , alone or in combination , perimeter gussets 14 with staggered front edges , at least one horizontally - extending perimeter rib 28 between gussets 14 , angled corners 16 , an up - turned perimeter lip 16 , a mounting shelf 42 configured for quick attachment of a shut - off switch 22 , and an arcuate ribbed area 44 configured for protecting an associated float switch 22 from side impact directed toward the perimeter wall . their configurations also help to reduce the number of pressure points in pan 2 that could lead to its premature cracking and / or failure . when a quick - mounting shelf 42 is used in the present invention pan 2 for attaching a float switch 22 in fixed association with a drain line connection 24 having a configuration complementary to the mounting shelf 42 , rapid float switch installation is achieved and automatic leveling of the float body within switch 22 occurs when the pan 2 is placed into a level orientation . only a simple height adjustment of the deployable body of float switch 22 may additionally be required during installation , according to the quantities of fluid collection anticipated in an application and the depth of fluid considered safe in the particular application / location . although the use of a quick - mounting shelf 42 is not critical to pan 2 , it is preferred for the many advantages it provides during float switch installation and use . since the use of mounting shelf 42 and arcuate ribbed area 44 are optional features of pan 2 and the combined float switch 22 and drain line connection 24 assembly to be used with them forms no part of the present invention structure , and further since the structure of the combined float switch 22 and drain line connection 24 assembly ( also created by the inventor herein ) to be used with mounting shelf 42 and arcuate ribbed area 44 is revealed in other u . s . patent disclosures , detailed information about the structure of the combined float switch 22 and drain line connection 24 assembly has not been made a part of this invention disclosure . fig1 , 2 , and 6 also show a protrusion 8 depending radially from each egg - shaped support 6 and extending upwardly from the elliptical base 46 of the associated egg - shaped support 6 almost to its circular top surface 10 . although only one protrusion 8 is shown with each egg - shaped support 6 , it is considered to be within the scope of the present invention for at least one egg - shaped support to have more than one protrusion 8 . in addition , fig1 and 2 show protrusions 8 having a convexly - shaped top edge 50 , which contributes to the even pulling of plastic and reduction of stress points in most preferred embodiment 2 would otherwise result from the use of angular interfaces . the central orientation of protrusions 8 and their alignment with the protrusion 8 of an opposed egg - shaped support 6 in an opposed row , as shown in fig1 and 6 , is not critical but preferred , as it also strengthens most preferred embodiment 2 by contributing to the even distribution of material during manufacture that reduces weak spots . further , although not critical , a nesting configuration is desired in most preferred embodiment pans 2 so that they can be compactly storage in stacked array for efficient and cost - saving transport and storage . although not shown in fig1 , 2 , and 6 , stacking of most preferred embodiment 2 pans is facilitated by the hollow interior of its egg - shaped supports 6 and their open bottom surface . however , even though it is contemplated for egg - shaped supports 6 to be hollow , their strength is not compromised as the even distribution of plastic during manufacture and the upwardly - tapering of egg - shaped supports 6 prevent them from collapsing during routine support of a heavy fluid - causing unit . other strengthening features of most preferred embodiment 2 that also help to distribute the weight of a supported fluid - causing unit across a broader portion of interior bottom surface 48 include the strength - enhancing triangular configuration formed by upwardly - tapering protrusion 8 and elliptical base 46 , the optional arcuate annular ridge 18 around the elliptical base 46 of each egg - shaped support 6 and associated protrusion 8 , and the optional stress - transmitting ribs 20 connected between the annular ridges 18 on some of the egg - shaped supports 6 that are in close proximity with one another . it is important that stress - transmitting ribs 20 are positioned to allow the free - flow of collected fluid throughout the non - raised areas of interior bottom surface 48 and prevent pooling of fluid in a single area that could lead to premature pan 2 failure due to sagging or buckling , malfunction of an associated float switch 22 caused by lean - in of perimeter wall 4 and / or twisting of pan 2 , premature shut - off of a supported fluid - causing unit caused by pooling of fluid around an associated float switch 22 , and / or malfunction of an associated float switch 22 caused by pooling of fluid around the switch &# 39 ; s float body that contains debris and / or promote algae growth on it . for this same purpose , it is contemplated for the non - raised areas in interior bottom surface 48 between the perimeter wall 4 and the egg - shaped supports 6 to be made substantially level with one another . for even pull of plastic during manufacture , in most preferred embodiment 2 it is contemplated for all annular ridges 18 and all stress - transmitting ribs to be approximately the same height dimension above the pan &# 39 ; s interior bottom surface 48 . however , in other patentably non - distinct embodiments of the present invention , the height dimensions of the annular ridges 18 and stress - transmitting ribs used may be different . as previously mentioned , the height of egg - shaped supports 6 above perimeter wall 4 is not fixed and may be different from that shown in fig1 and 2 . thus , in furnace applications requiring a minimum non - combustible clearance , the height egg - shaped supports 6 relative to perimeter wall 4 may be greater than in a non - furnace application . however , it is contemplated for egg - shaped supports 6 to always extend above perimeter wall 4 so that all structural support for an associated fluid - causing unit ( not shown ) is provided via egg - shaped supports 6 . fig6 is a top view of most preferred embodiment 2 showing many of the same features of most preferred embodiment 2 shown in fig1 , except the convexly - contoured top edges 50 of protrusions 8 and the associated float switch 22 and drain line connection 24 . instead , fig6 shows most preferred embodiment 2 without an associated float switch 22 or drain line connection 24 , thereby revealing the mounting shelf 42 for drain line connection 24 and the arcuate ribbed area 44 ( having an array of vertically - stacked and horizontally - extending ribs ) that protects an associated float switch 22 from most side impact directed toward perimeter wall 4 during pre - installation handling and use after installation . attachment of the drain line connection 24 to mounting shelf 42 automatically places float switch 22 in level orientation relative to pan 2 . thus , when pan 2 is placed into a level orientation during its installation , the deployable float body within float switch 22 attached to pan 2 ( attached either during its manufacture , pre - installation , installation ) instantly becomes poised for proper , reliable , and repeat deployment to shut off the associated fluid - causing unit supported by pan 2 when excess fluid from the fluid - causing unit collects in pan 2 beyond a pre - determined threshold amount considered safe to prevent damage to surroundings . after the drain line connection 24 is aligned with quick - mounting shelf 42 , the float switch 22 in fixed association with drain line connection 24 is automatically placed adjacent to the arcuate ribbed area 44 . further , all that is needed to secure drain line connection 24 to pan 2 and place float switch 22 in level orientation relative to pan 2 , is the insertion of the threaded tailpiece ( shown in fig2 where the line associated with the numeral 24 ends ) of drain line connection 24 through the opening ( shown in fig6 immediately to the right of the line associated with the numeral 42 ends ) in mounting shelf 42 and the tightening of a nut ( not shown ) on the tailpiece from the outside of pan 2 . depending upon the application of pan 2 , although not marked with numerical identification , a plug ( shown at the end of the tailpiece in fig2 ) where the line associated with the numeral 24 ends ) may be used to block fluid discharge from the tailpiece of drain line connection 24 , or the tailpiece of drain line connection 24 can be connected to a drain pipe ( not shown ) that is configured to transport excess fluid away from pan 2 . fig1 and 6 show multiple egg - shaped supports 6 spaced apart substantially across its length and width , each egg - shaped support having a circular top surface 10 and an elliptical base 46 , and each egg - shaped support 6 also having an indentation 12 in its top surface 10 configured for securely holding a vibration isolator ( such as the vibration isolator 30 in fig3 ). although also shown in fig1 , fig6 more clearly shows the off - center positioning of the connected egg - shaped supports 6 and stress - transmitting ridges 20 between them that may be optionally used . this can be important when the weight of the supported fluid - causing unit ( not shown ) intended for positioning upon egg - shaped supports 6 is not balanced to locate egg - shaped supports 6 under the heaviest portions of the fluid - causing unit and help maintain the fluid - causing unit in its originally installed position during routine use . fig6 also more clearly shows the substantially triangular configuration created by each protrusion 8 and the elliptical base 46 of its associated egg - shaped support 6 that provides strength - enhancing benefit to pan 2 . in addition , fig6 also provides a complete view of the arcuate annular ridge 18 extending around the arcuate outline of the elliptical base 46 of each egg - shaped support 6 and its associated protrusion 8 , and further shows the softened transitions between the angular perimeters of the stress - transferring ribs 20 and the arcuate perimeters of the annular ridges 18 that are intended to reduce pressure points in most preferred embodiment 2 . also , since stress - transmitting ribs 20 are an optional feature of the present invention , the number and positioning of stress - transmitting ribs 20 between egg - shaped supports 6 is not limited to that shown in fig1 and 6 . additionally , the varying configurations of the gussets 14 integrated into perimeter wall 4 are also more clearly shown in fig6 , which are desired to reduce stress points and thereby add strengthening benefit to pan 2 . thus , as shown in fig1 and 6 , it is contemplated for some gussets 14 to have their interior - projecting front edges in staggered array relative to that of adjacent gussets 14 , adjacent gussets 14 with differing width dimensions , and varying spaced - apart distances between adjacent gussets 14 . the egg - shaped supports 6 in pan 2 are purposefully dimensioned and configured to widen the portion of the interior bottom surface 48 directly bearing the weight load of an associated fluid - causing unit ( not shown ) to further reduce tendencies of most preferred embodiment pan 2 toward bending , bowing , warping , cracking , and / or other distortion that have been found to occur in prior art pans during the extended time periods contemplated for use . although the length , width , and height dimensions of perimeter wall 4 are not critical , they must be appropriate to the intended application and not so overly large relative to the associated fluid - causing unit to cause material waste or be too large for easy installation in a location with limited space . also , the height dimensions of egg - shaped supports 6 must all be similar to one another to provide balanced support for an associated unit ( not shown ). further , egg - shaped supports 6 generally are configured to substantially fill the interior bottom surface 48 to diminish the amount of fluid collected in the interior bottom surface of pan 2 prior to unit shut - off by an associated float switch , such as the switch shown by the number 22 in fig1 and 2 . egg - shaped supports 6 are also configured and positioned to promote the free flow of collected fluid across interior bottom surface 48 for balanced weight distribution of collected fluid during routine cycles of accumulation and evaporation without bowing , buckling , or other distortion of interior bottom surface 48 and / or perimeter wall 4 . further , the materials used for the present invention pan 2 are strong , impact resistant , heat resistant , impervious to corrosion , non - flammable , unaffected by large ambient temperature fluctuations , and resistant to buckling , bowing , warping , distortion , and collapse during extended use . resistance to uv radiation is not necessarily a contemplated feature of the present invention , unless dictated by the application . polycarbonate , polycarbonate alloys , and polycarbonate blends are preferred for pan 2 , including but not limited to polycarbonate alloys and blends using abs , pbt , pet , and pp . manufacture of the present invention could be accomplished by blow molding , injection molding , assembly of pre - formed individual components , or a combination thereof , with the choice of manufacturing being determined by the anticipated purchase cost to consumers and the expected duration of use without maintenance , parts replacement , or repair . thus , the structure design of the present invention that includes egg - shaped supports 6 upwardly - extending from interior bottom surface 48 provides many improvements over prior art pans used for fluid collection , including but not limited to enhanced material strength , a reduced incidence of cracking during installation and use that reduces the need for inspection and maintenance after installation , a greater duration of use , and improved safety during pan installation and use . these same benefits apply in overflow prevention applications , wherein if the usual discharge pathway for produced fluid becomes blocked and causes fluid to accumulate in the pan and thereafter rise above a pre - determined level considered safe , a float switch ( such as that identified by the number 22 in fig1 and 2 ) associated with the pan &# 39 ; s perimeter wall 4 will deploy and promptly shut - off the supported unit &# 39 ; s operation to prevent damage to the unit and / or its surroundings , as well as in applications involving the management of routine cycles of fluid accumulation and evaporation expected during the support of a system or unit that at least periodically produces condensate as a by - product of its operation , perhaps as a result of inadequate insulation . fig3 - 5 respectively show vibrations isolators 30 contemplated for use as a part of the present invention to enhance safe and stable support of a fluid - causing unit collectively by egg - shaped supports 6 . fig3 shows a preferred configuration of a vibrations isolator 30 , while fig2 shows stacked positioning of two vibration isolators 30 and fig3 shows one possible furnace adaptation of a vibration isolator 30 . in addition to their vibration reducing function , vibration isolators 30 also provide the additional advantage of enhanced heat deflection around a fluid - causing unit while it is supported by egg - shaped supports 6 . fig3 shows a vibration isolator 30 having ring - shaped configuration with a large diameter shoulder 52 , a reduced diameter lower portion 54 , a sealing rib 34 , and a central bore 32 . in the alternative , although not shown , lower portion 54 may have a slight downward taper , more than one sealing rib 34 , or no sealing ribs 34 . using two or more ring - shaped vibration isolators 30 in stacked array , as shown in fig4 , is an easy way to raise an associated unit ( not shown ) to optimal operating height , if needed . although the vibration isolator 30 in fig3 is shown to be ring - shaped , it is not contemplated for the vibration isolators 30 used with the present invention egg - shaped supports 6 to be limited to a ring - shaped configuration in applications where vertical stacking is not needed or preferred . thus , although not shown , alternative configurations for the vibration isolators 30 that can be used with the present invention may also include a convex upper surface , a flat top surface without a central bore 32 , or any other configuration that is able to achieve the important goal of minimizing operational vibration or other vibration that might otherwise move a supported fluid - causing unit from its originally installed position relative to egg - shaped supports 6 and avoid unexpected weight transfer and possible pan collapse during unit operation . for its vibration - dampening use , it is contemplated for vibrations isolators 30 to be made from resilient material , such as but not limited to rubber . when vibration isolators 30 are made from ( or adapted with ) non - combustible materials ( such as metal or ceramic , but not limited thereto ), vibration isolators 30 can be used to meet non - combustible clearance requirements in furnace applications . one example of this is shown in fig5 where an inverted cup 38 made from non - combustible material ( such as but not limited to metal or ceramic ) covers the top and side surfaces of a vibration isolator 30 , with inverted cup 38 supported in its usable position via an upright post 36 having a cross piece 40 that engages the top surface of shoulder 52 and a bottom end ( not separately numbered ) that is secured within the lower end 54 of a vibration isolator 30 . upright post 36 ( and preferably cross piece 40 ) would also be made from non - combustible materials ( such as but not limited to metal or ceramic ) and may have a slight downward taper to assist the providing of a secure and easy fit of the lower portion 54 of its associated vibration isolator 30 within an indentation 12 in the arcuate top surface 10 of an egg - shaped support 6 . although not shown , the configuration of cross piece 40 may be that of a horizontally - extending disk ( with or without holes or other openings therethrough ) having a diameter dimension similar to the top surface of the vibration isolator 30 intended for association with it , or cross piece 40 may be formed from one or more horizontally - extending braces that span bore 32 but do not extend much beyond the outer surface of shoulder 52 to prevent wobble of inverted cup 38 relative to the vibration isolator 30 beneath it . thus , when the configuration in fig5 is used , the top end ( made from non - combustible material ) of the upright post 36 is in contact with the bottom surface of a fluid - causing unit , with the rib 34 and much of the lower portion 54 of the vibration isolator 30 that surrounds the bottom end of upright post 36 being secured within the indentation 12 in the arcuate top surface 10 of one of the egg - shaped supports 6 in most preferred embodiment 2 . when upright post 36 and inverted cup 38 are both be made from non - combustible materials , the non - combustible clearance needed in furnace applications is provided simply by their presence , while their close association with a vibration isolator 30 made from resilient material still provides needed vibration dampening for the supported fluid - causing unit to maintain the fluid - causing unit substantially in its originally installed position and avoid unexpected weight transfer that could lead to possible pan collapse during unit operation and positioning upon egg - shaped supports 6 . although fig1 and 6 show the top surface 10 of each egg - shaped support 6 having a circular indentation 10 and fig3 shows vibration isolator 30 also having a circular cross - section , it is also contemplated ( but not shown ) for indentations 10 and vibration isolators 30 to have other arcuate configurations , including but not limited to an elliptical configuration , as long as the indentation 10 receiving a vibration isolator 30 is able to hold it securely in place to allow minimal opportunity for movement of a supported fluid - causing unit relative to perimeter wall 4 during routine use that could otherwise potentially lead to unexpected weight transfer and possible pan collapse , and potential fluid damage to surroundings .	8
referring in detail in the drawings and , in particular , in fig1 the molding device 2 comprises a cup - like mold 4 contoured to the shape desired to be formed in the distal end 6 of the catheter 8 . the contour of the mold 4 includes the tube tip shaping bottom 10 , sidewall 12 and entrance lip 14 . the mold 4 further comprises a raised central portion 16 designed to project into the central lumen 18 of the catheter 8 when it is inserted into the mold 4 . the portion 16 in the embodiment of fig1 is in the form of a solid pin , but it may instead be in the form of a hollow tube closed at the top . the clearances between the catheter walls 20 and 22 and the surfaces of the mold sidewalls 12 and the central portion 16 , respectively , are designed close enough so that the catheter 8 can be inserted without interference , but not with clearance to the extent that molten plastic can flow back up the inside of wall 12 or the outside of central portion 16 . the molding device 2 includes suction tube 24 provided with a cap 26 to fit over the proximal end 28 of the catheter lumen 18 . a typical cycle for finishing the catheter 8 in the molding device 2 is as follows : the catheter distal end 6 is inserted into the entering portion of the mold cavity . the suction tube 24 is connected to a vacuum source ( not shown ) and the finishing cycle is initiated by applying a suction to the tube 24 from the vacuum source , e . g ., with a vacuum potential of 22 &# 34 ; to 29 &# 34 ; hg . this produces a suction on the inside of the catheter 6 . such applied suction draws the catheter toward the bottom 10 of the mold 4 . the cycle is programmed so that the mold bottom 10 will be heated when the suction is applied , or heating of the mold may be delayed a predetermined amount . downward pressure on the catheter is applied by hand or this may be done by electrical , mechanical or fluid pressure devices ( not shown ). the combination of downward pressure on the catheter forcing it toward the bottom 10 of the mold 4 plus the application of the heat bringing the plastic to a flowing ( molten ) condition and evacuation of any air that may , in the absence of the suctioning , become entrapped between the catheter and the mold , permits the flowing plastic to fully fill the mold bottom 10 to form the desired shape on the catheter tip without sprue projections , flash or the like . suction need only be applied during the part of the finishing cycle when the catheter is advancing downward to the mold bottom 10 with the plastic of the catheter heated to flowable condition . during the period of cooling , heat and vacuum are removed , but the downward pressure on the catheter is advantageously continued through the cooling stage of the finishing cycle . the molding device 2a of fig2 is essentially like that of fig1 . except for the central portion 16a which is of tubular form that includes an integral outlet tube 30 . in the finishing cycle using the device 2a , the tube 30 is connected via hose 32 to the vacuum source ( not shown ) and the proximal end 20 of catheter 8 is closed with a cap 32 . suction is applied via the tube 30 in the initial stage of the finishing cycle as contrasted to its application via tube 24 in the molding device 2 . otherwise the finishing operation parallels that described for device 2 . in the foregoing description , only one catheter tip configuration is illustrated , but it should be understood that a variety of different tip shapes may be made by the new finishing methods .	8
when the anti - diffusion layer formed with cu is thick , the number of processes may increase and a cost may increase . further , variability of in - plane evenness may increase . when the anti - diffusion layer is thin , it is difficult to sufficiently restrain the diffusion of the solder . a description will be given of a best mode for carrying the present invention . fig1 a illustrates a cross sectional view of a semiconductor device in accordance with a first embodiment . fig1 b illustrates an enlarged view around an electrode . a thickness of layers in the cross sectional view is schematically illustrated . in fig1 a , a wafer - shaped semiconductor device before dividing is illustrated . as illustrated in fig1 a , the semiconductor device of the first embodiment has a substrate 10 and an electrode 11 . an insulating layer may be provided between the electrodes 11 adjacent to each other . the substrate 10 is a semiconductor substrate having an insulating substrate such as silicon ( si ), silicon carbide ( sic ) or a sapphire and nitride semiconductor that is epitaxially grown on the insulating substrate . fig1 b illustrates an enlarged view of a region surrounded by a broken line of fig1 a . the electrode 11 includes a foundation layer 12 , a nickel ( ni ) layer 16 , a cover layer 18 and a solder ball 20 . the foundation layer 12 is , for example , formed with gold ( au ) having a thickness of 5 μm to 10 μm and is provided on the substrate 10 . an insulating layer 14 is , for example , a lamination layer in which a silicon nitride ( sin ) layer , a silicon oxide ( sio 2 ) layer , or a polyimide layer is laminated , and is provided on the substrate 10 and the foundation layer 12 . the foundation layer 12 is exposed through an opening formed in the insulating layer 14 . the ni layer 16 is provided on the exposed region of the foundation layer 12 and on the insulating layer 14 . as sectioned by a broken line in fig1 b , one region of the ni layer 16 on the side of the foundation layer 12 is referred to as a first region 16 a , and the other region of the ni layer 16 on the side of the solder ball 20 is referred to as a second region 16 b . a thickness of the first region 16 a and the second region 16 b is , for example , 0 . 1 μm or more to 5 μm or less . the cover layer 18 is , for example , formed with a metal such as au having a thickness of 30 nm , is provided between the ni layer 16 and the solder ball 20 , and covers an upper face and a side face of the ni layer 16 . the solder ball 20 is , for example , formed with a solder ( sn — ag — cu based solder ) mainly including tin , silver and copper , and is provided on the cover layer 18 . the foundation layer 12 is contacting with the upper face of a substrate layer of the substrate 10 . the ni layer 16 is contacting with the upper face of the foundation layer 12 . the cover layer 18 is contacting with the upper face and the side face of the ni layer 16 . the solder ball 20 is contacting with the upper face of the cover layer 18 . the ni layer 16 acts as an ubm ( under bump metal ) restraining diffusion of the solder from the solder ball 20 . the foundation layer 12 acts as a foundation of the electrode 11 and an interconnection layer . the cover layer 18 acts as a protection layer restraining oxidation of the ni layer 16 . the solder ball 20 acts as an outer connection terminal coupling the semiconductor device with an outer mount substrate . a description will be given of details of a structure of the ni layer 16 . fig2 a illustrates a schematic view of the electrode of the first embodiment . fig2 b is a graph illustrating hardness of the ni layer 16 . a horizontal axis of fig2 b indicates the hardness . a vertical axis of fig2 b indicates a depth from the upper face of the cover layer 18 . as illustrated in fig2 a and fig2 b , the ni layer 16 is formed by an electroless plating method and includes the first region 16 a and the second region 16 b having different hardness . the second region 16 b is harder than the first region 16 a . the hardness is changed in stages between the soft first region 16 a and the hard second region 16 b . the hardness x 1 of the first region 16 a is , for example , 150 hv or more and less than 500 hv . the hardness x 2 of the second region 16 b is , for example , 500 hv or more to 1000 hv or less . the hardness of pure ni is approximately 150 hv . generally , the hardness of the ni formed by the electroless plating method is approximately 500 hv . the second region 16 b is hardened in order to restrain the diffusion reaction of the solder from the solder ball 20 to the foundation layer 12 . however , when a layer gets harder , stress gets larger . when the first region 16 a is softer than the second region 16 b , the stress of the second region 16 b is suppressed . in the first embodiment , the second region 16 b restrains the open or the short caused by the diffusion of the solder , and the first region 16 a restrains a crack of the electrode 11 and the semiconductor substrate 10 caused by the stress of the second region 16 b . and , in the first embodiment , the ni layer 16 restrains the crack of the solder ball 20 caused by thermal expansion coefficients of a chip and a mount substrate , compared to a case where a single layer having the same thickness as the ni layer 16 and formed with hard ni is provided . this is because it is difficult for the single hard ni layer to suppress the stress of the solder ball 20 . on the other hand , the stress of the solder ball 20 is suppressed when the single ni layer is soft . however , in this case , it is difficult to restrain the diffusion of the solder . the upper limit of the hardness of the first region 16 a may be 450 hv , 400 hv , 300 hv or the like . the hardness of the second region 16 b may be 550 hv to 950 hv , 600 hv to 900 hv or the like . preferably , difference of the hardness between the first region 16 a and the second region 16 b may be 100 hv or more . in the first embodiment , the ni layer 16 is denser than another ni layer formed by an electrolytic plating method , a vapor deposition method or the like , because the ni layer 16 is formed by the electroless plating method . therefore , the diffusion of the solder is effectively restrained . generally , when the thickness of the ubm gets larger , the stress gets larger . the ni layer 16 is , for example , a thin layer having a thickness of 0 . 2 μm to 10 μm . therefore , the stress of the ni layer 16 may be reduced . and , the cost gets lower . the thickness of the first region 16 a and the second region 16 b may be 0 . 2 μm or more to 4 . 8 μm or less , and may be more than 0 . 1 μm and less than 5 μm . the thickness of the first region 16 a may be the same as that of the second region 16 b , and may be different from that of the second region 16 b . next , a description will be given of a method for manufacturing the semiconductor device of the first embodiment . fig3 a through fig3 c illustrate a cross sectional view illustrating the method for manufacturing the semiconductor device in accordance with the first embodiment . as illustrated in fig3 a , the foundation layer 12 is formed on the substrate 10 by the electroless plating method or the like . then , the insulating layer 14 is formed , and the opening is formed in the insulating layer 14 . as illustrated in fig3 b , the ni layer 16 is formed on the foundation layer 12 by the electroless plating method . nickel electroless plating solution ( hereinafter referred to as plating solution ) includes a ni ion and hypophosphorous or hypophosphite . two types of plating equipment having different types of the plating solution are used , and the first region 16 a and the second region 16 b are formed . the details are described later . as illustrated in fig3 c , the cover layer 18 is formed by the electroless plating method or the like . the solder ball 20 is formed on the cover layer 18 by a printing method or a reflow method . with the processes , the semiconductor device illustrated in fig1 a is manufactured . further , the substrate 10 is cut off and is divided into chips . next , a description will be given of the composition of the plating solution . fig4 illustrates a graph of a relation between a p concentration and the hardness . a horizontal axis indicates the p ( phosphorous ) concentration of the plating solution used in the electroless plating method . a vertical axis indicates the hardness of the ni layer 16 . as illustrated in fig4 , when the p concentration is 0 wt %, the hardness is approximately 200 hv . when the p concentration is 2 wt %, the hardness is approximately 700 hv . when the p concentration is 12 wt %, the hardness is approximately 500 hv . in order to form the first region 16 a and the second region 16 b in the ni layer , the p concentration has only to be changed in a range of 0 wt % to 15 wt %. in order to form the first region 16 a having the hardness of 150 hv or more and less than 500 hv , the p concentration of the plating solution has only to be 0 wt % or more to 1 wt % or less , or more than 12 wt %. the p concentration may be less than 1 wt % or more than 12 wt %. in order to form the second region 16 b having the hardness of 500 hv or more , the p concentration of the plating solution has only to be 1 wt % or more to 12 wt % or less . in order to enhance the hardness of the second region 16 b , the p concentration may be 1 . 5 wt % or more to 10 wt % or less . the solder of the solder ball 20 may be sn — cu based solder , sn — ag based solder , tin silver bismuth ( sn — ag — bi ) based solder , or tin zinc ( sn — zn ) based solder or the like . it is preferable that the solder does not include lead ( pb ) in view of environmental protection . the foundation layer 12 may be formed with a metal such as cu or aluminum ( al ) other than au . the foundation layer 12 may be formed with an alloy including at least one of au , cu and al . a material of the cover layer 18 may be a metal such as ag other than au . the nitride semiconductor of the semiconductor layer is semiconductor including nitrogen such as gallium nitride ( gan ), aluminum nitride ( aln ), aluminum gallium nitride ( algan ), indium aluminum nitride ( inaln ), indium gallium nitride ( ingan ), indium nitride ( inn ), or aluminum indium gallium nitride ( alingan ). the material of the semiconductor layer may be gallium arsenic ( gaas ) or the like other than the nitride semiconductor . the substrate 10 may be a si substrate , a substrate in which silicon germanium ( sige ) substrate is laminated on a si substrate , a substrate in which a gaas - based semiconductor is laminated on a gaas substrate , a substrate in which an inp - based semiconductor is laminated on an indium phosphide ( inp ) substrate , or the like . the semiconductor device may be a csp acting as a fet ( field effect transistor ), a hbt ( hetero junction bipolar transistor ), a mmic ( monolithic microwave integrated circuit ), a led ( light emitting diode ), a ld ( laser diode ), a tft ( thin film transistor ) used for a liquid crystal or the like . a second embodiment is an embodiment in which the hardness of the ni layer 16 changes continuously . fig5 a illustrates a schematic view of an electrode of the second embodiment . fig5 b illustrates a graph of the hardness of the ni layer . in fig5 a , hatchings of the ni layer 16 are omitted , and the first region 16 a and the second region 16 b are schematically illustrated by dotted ellipses . as illustrated in fig5 a and fig5 b , the hardness of the ni layer 16 continuously gets higher from the foundation layer 12 side to the solder ball 20 side . the hardness x 1 of the lower face of the ni layer 16 is , for example , 150 hv and less than 500 hv . the hardness x 2 of the upper face of the ni layer 16 is , for example , 500 hv or more to 1000 hv or less . in accordance with the second embodiment , the low cost is achieved , the diffusion of the solder is restrained , and the stress is restrained , as well as the first embodiment . there is no region of which hardness drastically changes in the ni layer 16 . therefore , the peeling of the ni layer 16 at an interface between regions having different hardness is restrained . next , a description will be given of a method for manufacturing the semiconductor device in accordance with the second embodiment . fig3 a through fig3 c are also in common with the second embodiment . the plating solution is the same as the first embodiment . the p concentration is constant . the temperature of the plating solution is continuously changed from 30 degrees c . to 80 degrees c . in the electroless plating method for forming the ni layer 16 . at the starting point of the electroless plating method , the temperature of the plating solution is low about 30 degrees c . thus , the soft first region 16 a is formed . after that , the temperature is gradually increased . the temperature of the plating solution is high about 80 degrees c . in the latter half of the electroless plating method . thus , doping of p into the ni layer 16 is promoted . thus , the hard second region 16 b is formed . the rest processes are the same as the first embodiment . the temperature of the plating solution may be 20 to 70 degrees c ., 40 to 90 degrees c . or the like other than 30 to 80 degrees c . a third embodiment is an embodiment in which a heat treatment is performed in the process for forming the ni layer . fig6 a through fig6 c illustrate a cross sectional view of a method for manufacturing a semiconductor device in accordance with the third embodiment . as illustrated in fig6 a , the ni layer 16 is formed on the foundation layer 12 . the plating solution of the third embodiment is the same as the first embodiment . the p concentration is constant . therefore , the hardness of the ni layer 16 after the electroless plating is even regardless of regions of the ni layer 16 , and is , for example , approximately 100 hv to 500 hv . as illustrated in fig6 b , the cover layer 18 is formed on the ni layer 16 . an upper face of a wafer is subjected to a laser light scanning , or the laser light is radiated to the upper face of the wafer as a whole . thus , as illustrated with meshed lines in fig6 c , a region of the ni layer 16 near the upper face thereof and the cover layer 18 are heated to 350 degrees c . an excimer laser , a yag ( yttrium aluminum garnet ) laser or the like is used as the laser light source . a laser annealing is performed in an atmosphere including an inert gas such as a hydrogen ( h 2 ) gas , a nitrogen ( n 2 ) gas or an argon ( ar ) gas and air . the hard second region 16 b is formed in the ni layer 16 through the laser annealing . the heat is continuously conducted from the upper face to the lower face of the ni layer 16 . and , the hardness of the ni layer 16 continuously changes as illustrated in fig5 b . the processes after the laser annealing are the same as the first embodiment . when the heat treatment temperature is 300 degrees c . to 500 degrees c ., the hardness of the second region 16 b is over 800 hv . when the heat treatment temperature is around 400 degrees c ., the hardness increases to 900 hv to 1000 hv . in order to achieve preferable hardness , the heat treatment temperature is adjusted between 100 degrees c . to 600 degrees c . in order to harden the second region 16 b more , it is preferable that the heat treatment temperature is 200 degrees c . to 500 degrees c ., 300 degrees c . to 450 degrees c ., or the like . in order to keep the hardness of the first region 16 a low and harden the second region 16 b more , it is preferable that the region of the ni layer 16 near the upper face thereof is intensively subjected to the heat treatment for a short time such as one second . the laser annealing is preferable as the heat treatment method . and the degradation of the semiconductor is restrained and the efficiency of the manufacturing processes is improved , because the treatment time is short . in the case of the laser annealing , the heat treatment temperature and the radiation time may be changed when the output of the laser , the beam scanning speed , and the pulse width are adjusted . the changing of the p concentration of the first embodiment , the changing of the plating temperature of the second embodiment , and the heat treatment of the third embodiment may be combined . for example , the p concentration of the plating solution may be changed , and the temperature may be changed continuously . for example , the second region 16 b is hardened more , when the ni layer 16 is formed by changing the p concentration continuously , and the ni layer 16 is subjected to the laser annealing . in particular , it is preferable that the heat treatment is performed , in order to achieve the hardness of 1000 hv . the plating solution may include a ni ion , dimethylamine - borane and gluconic acid , or dimethylamine - borate and gluconate . in this case , it is possible to adjust the hardness of the ni layer 16 by adjusting the concentration of boron ( b ), changing the temperature of the plating solution , or the heat treatment . a fourth embodiment is an embodiment in which concavity and convexity is formed on the upper face of the ni layer 16 . fig7 a illustrates an enlarged view around the electrode of the fourth embodiment , and illustrates a cross sectional view taken along a line a - a of fig7 b . fig7 b illustrates a plane view of the electrode . in fig7 b , the solder ball 20 is seen through . a region surrounded by a broken line circle is a region where the solder ball 20 is jointed . as illustrated in fig7 a , the concavity and convexity is formed on the upper face of the foundation layer 12 . and concavity and convexity is formed on a surface of the ni layer 16 according to the concavity and convexity of the foundation layer 12 . the cover layer 18 is formed along the concavity and convexity of the ni layer 16 . concavity and convexity is formed on a surface of the cover layer 18 according to the concavity and convexity of the ni layer 16 . the solder ball 20 is provided so as to contact with the concavity and convexity of the cover layer 18 . the depth of a concave portion 22 of the ni layer 16 is , for example , 0 . 5 μm to 10 μm . as illustrated in fig7 b , the surface of the ni layer 16 has a waffle structure in which a plurality of the concave portions 22 are distributed . a surface area of the foundation layer 12 and a surface area of the ni layer 16 are enlarged because of the concavity and convexity . thus , stress concentration to a small region is restrained . therefore , even if a diameter of the electrode 11 is reduced , the stress can be restrained . further , anchor effect enhances jointing strength between the foundation layer 12 and the ni layer 16 , between the ni layer 16 and the cover layer 18 , and between the cover layer 18 and the solder ball 20 . thus , reliability of mounting is improved . next , a description will be given of a method for manufacturing a semiconductor device in accordance with the fourth embodiment . fig8 a through fig8 c illustrate a cross sectional view of the method for manufacturing the semiconductor device of the fourth embodiment . an explanation of the same processes as the first embodiment is omitted . as illustrated in fig8 a , after forming the foundation layer 12 , the concavity and convexity are formed on the upper face of the foundation layer 12 by an etching method or the like . the concavity and convexity may be formed before or after forming the insulating layer 14 . as illustrated in fig8 b , the ni layer 16 is formed by the electroless plating method . thus , the concavity and convexity are formed on the surface of the ni layer 16 according to the concavity and convexity of the foundation layer 12 . here , the hardness of the first region 16 a and the second region 16 b is adjusted by changing the p concentration as well as the first embodiment . as illustrated in fig8 c , the cover layer 18 is formed along the concavity and convexity of the ni layer 16 by a vapor deposition method or a sputtering method . the concavity and convexity are filled with molten solder through a reflow process , and the solder ball 20 is formed . the concavity and convexity may be directly formed on the surface of the ni layer 16 and the surface of the cover layer 18 other than the upper face of the foundation layer 12 . next , a description will be given of a modified embodiment of the fourth embodiment . fig9 illustrates a plane view of an electrode of the modified embodiment . as illustrated in fig9 , the surface of the ni layer 16 may have a structure in which the concave portions 22 are arrayed in a cross shape . the number and the alignment of the concave portions 22 may be changed . in the fourth embodiment , one of the changing of the p concentration , the changing of the temperature of the plating solution , and the heat treatment may be applied . and , two or more of the changing of the p concentration , the changing of the temperature of the plating solution , and the heat treatment may be combined . the present invention is not limited to the specifically disclosed embodiments and variations but may include other embodiments and variations without departing from the scope of the present invention .	7
the preferred embodiment of a manual and automatic flusher in the present invention , as shown in fig1 , 2 and 3 , includes a cup member 10 , a base tube 20 , a film 30 , a pressure cap 40 , a valve body 50 , a hand rod 60 , an upper cap 70 , a communicating tube 80 and an infrared sensor 90 as main components combined together . the cup member 10 is provided with an inlet 11 , a combine hole 12 , an outlet 13 , and a chamber 14 . a tubular base 15 extends upright on the bottom of the chamber 14 , the base tube 20 is firmly fixed inside the tubular base 15 , having a close groove 21 formed in the upper portion for an upper disc member 51 of the valve body 50 to press thereon . the film 30 with , a through hole 31 is fixed on the upper end of the base tube 20 , having its circumference pressed by the lower annular edge of the pressure cap 40 . thus the upper cap 40 , the film 30 , the base tube 20 and the upper disc member 51 define a pressure - adding room ( a ), which communicates with the inlet 11 via the through hole 31 of the film 30 , the space between the circumference of the base tube 20 and the cup member 10 . the valve body 50 has a pillar member 52 and an upper disc member 51 fixed with the pillar member 52 , and an insert head 53 is inserted in the center of the disc member 51 , and a flow passageway 54 formed in the center of the pillar member 52 under the insert head 53 to communicate with the outlet 13 of the cup member 10 . the hand rod 60 is fixed with the opening outlet 12 of the cup member 10 , possible to be pressed down to force its end push against the end of the pillar member 52 so that a gap may formed between the close groove 21 of he base tube 20 and the disc member 51 of the valve body 50 , permitting the pressure - adding room ( a ) communicate with the outlet 13 of the cup member 10 via the interior of the base tube 20 . the upper cap 70 is closed on the cup member 10 . therefore , when the hand rod 60 is pressed down , the water normally stored in the pressure - adding room ( a ) can flow through the gap formed in the valve body 50 and the close groove 21 and then through the base tube 20 . then the water pressure in the pressure - adding room 9 ( a ) may decrease , and the pressure under the film 30 will increase more than that in the pressure - adding room ( a ), forcing the film 30 move upward to form a flowing gap ( b ) between the film 30 and the tubular base 15 and the space between the base tube 20 and the annular base 15 , permitting a large quantity of water flow in through the inlet 11 and then out of the outlet 13 for flushing a toilet . the flushing action may continue until the film 30 moves down to the original position , with the pressure - adding room 9 ( a ) filled with water . however , this kind of operational function is the same as the conventional flusher . the special feature of the invention is to be described below . the valve body 50 has an insert head 53 inserted in the center of the upper disc member 51 and a flow passageway 54 formed in the pillar member 51 to communicate with the outlet 13 of the cup member 13 . the pressure cap 40 has an annular wall 41 of a small diameter formed in an upper portion , and a position groove 42 inside the annular wall 41 , a block 43 contained in the position groove 42 , a sealing gasket 44 closing the opening of the position groove 42 to seal the , block 43 therein . further , the pressure cap 40 has a through hole 431 to correspond to a through hole 54 formed in the pressure cap 40 to communicate with the pressure - adding room ( a ), and a flowing hole 432 in the center to communicate indirectly with the through hole 431 via the sealed space of the position groove 42 . the communicating tube 80 is a bellows - shaped flexible tube , having one end connected to the bottom of the flowing hole 432 and the other end fitting firmly around the upper end of the flow passageway 50 of the insert head 53 , letting the pressure - adding room ( a ) indirectly connected with the outlet 13 via the communicating tube 80 . the infrared sensor 90 consists of a fixing frame 91 fixed between the upper cap 70 and the pressure cap 40 , an electronic eye 92 fixed on the fixing frame 91 , an electro - magnetic valve 93 fixed in the center of the fixing frame 91 , and a power device 94 fixed on the opposite side of the electronic eye 92 . the iron core of the electro - magnetic valve 93 penetrates through the seal gasket 44 downward , possible to be moved up and down by sensing of the electronic eye 92 to press in due time the block 43 on the flow hole 432 to control the pressure - releasing passageway of the pressure - adding room ( a ) so as to control flushing action next , it is to be specially mentioned that the communicating tube 80 can be a bellows - shaped flexible tube , but also can be a helical flexible tube as shown in fig6 , or a straight flexible tube as shown in fig7 . and if the straight flexible tube is used , it is necessary to leave a spare space 433 to correspond to the block 43 for the communicating tube 80 to move up . the communicating tube 80 can also be a rigid tube as shown in fig8 , having a spherical member 81 formed in the lower end to fit in a spherical groove 531 formed in an upper portion of the insert head 53 , and a threaded cap 53 to engage with the insert head 53 to keep the spherical member 81 connected with the insert head 53 . then in conjunction with the spare space 433 of the block 43 , the valve body 50 can incline with the lower end of the rigid communicating tube 80 . next , the manual function and the automatic function of flushing with the invention will be described below . as for the manual function , when a user presses down the hand rod 60 , the hand rod 60 will touch and move the pillar member 52 of the valve body 50 to incline for a preset angle to just form a gap between the disc member 51 of the valve body 50 and the close groove 21 at the upper end of the base tube 20 to produce pressure releasing effect , with the film 30 moving to cause a gap for a large quantity of water flowing through the inlet 11 in the interior of the cup member 10 and out of the outlet 13 into a toilet . so far the flushing action just mentioned is the same as the conventional flusher , and it has to be noticed that the communicating tube 80 has a flexible specialty , not affecting the inclining action and up - and - down movement of the valve body 50 , ensuring manual operation of flushing smoothly carried out . as for the automatic function , when a user comes near to the flusher to trigger the infrared sensor 90 , the electro - magnetic valve 93 is started to generate magnetism , with the iron core 931 attracted to move inward . at this moment , the flow hole 432 of the block 43 in the pressure cap 40 becomes open to force the water in the pressure - adding room ( a ) flow through the through hole 45 of the pressure cap 40 , the through hole 431 of the block 43 , the flow hole 432 of the block 43 , the communicating tube 80 and the passageway 54 of the valve body 50 , producing pressure releasing action , just as the action of the conventional flusher , that is , with the film 30 moved to form a flowing gap ( b ) for a large quantity of water coming from the inlet 11 flowing out of the outlet 13 for flushing a toilet , as described above . further , it is worthy to say that if the hand rod 60 is released or the source of sense disappears out of the sensing scope of the electric eye 92 of the infra red sensor 90 , the leaking passageway between the valve body 50 and the base tube 20 or that between the iron core 931 and the block 43 will recover at once closing condition , forcing water to flow into the pressure - adding room ( a ) to be gradually filled with water , with the film 30 moved down to stop flushing immediately , keeping correct function of flushing without fail . the invention has the following advantages , as can be seen from the foresaid description . 1 . the manual mode of flushing can be used , in case the automatic mode cannot function owing to the infrared sensor getting out of order , not necessary to wait until the infrared sensor is repaired . 2 . the hand rod can be kept under pressed condition to let water continue to flush out into a toilet to use as much water as wanted , for convenience of washing the toilet , removing the inconvenience of impossibility of controlling the conventional flusher . 3 . it can use many components of the conventional manual flusher and the conventional automatic flusher , with appliance of the communication tube used in the invention , and very profitable in manufacturing . while the preferred embodiment of the invention has been described above , it will be recognized and understood that various modifications may be made therein and the appended claims are intended to cover all modifications that may fall within the spirit and scope of the invention .	8
referring to fig1 through 4 , a bidirectional snare device 10 is shown . fig1 is a distally oriented perspective view of the bidirectional snare device 10 . the bidirectional snare device 10 consists of a curved handle 50 which fixedly holds a short wire snare 60 and a long wire snare 70 within a receiving bore 51 . the curved handle 50 is typically comprised of a medical - grade stainless steel and formed in such a manner to allow for manipulation by the user . the short wire snare 60 and long wire snare 70 are also made from medical - grade stainless steel , but in small diameter wire form . the short wire snare 60 and long wire snare 70 pass through a wire bore 81 of a malleable sleeve 80 . the sleeve is typically manufactured form a nonreactive , biocompatible material such as titanium and is fashioned that the distal end has an enlarged flange 82 connected to a body 83 of a slightly smaller diameter . the long wire snare 70 is formed by bending a length of wire 72 into a loop 71 with a twisted end 73 . the short wire snare 60 is formed by bending a substantially shorter length of wire 62 into a loop 61 with a twisted end 63 . the twisted end 73 of the long wire snare 70 is passed directly through the wire bore 81 of the sleeve 80 positioning the loop 71 distally from the flange 82 . the twisted end 63 of the short wire loop 60 is passed through the wire bore 81 of the sleeve 80 from the opposite direction than the long wire snare 70 . the twisted end 63 enters the sleeve 80 from the body 83 side , passes through the wire bore 81 , exits the flange 82 and is looped around the sleeve 80 such that part of the loop 61 is flattened and forms an untwisted pair 64 that wrap around the flange 82 and body 83 of the sleeve 80 and the twisted end 63 is positioned next to the twisted end 73 of the long wire snare 70 . twisted end 63 and twisted end 73 are inserted into the receiving bore 51 and fixedly attached via mechanical means such as welding or crimping . fig2 is an enlarged partial cross - sectional perspective view of the bidirectional snare device 10 of fig1 showing the twisted end 73 of the long wire snare 70 , clearly shown in fig1 , adjacent to the untwisted pair 64 of the short wire snare 60 passing through the wire bore 81 of sleeve 80 . fig3 is a proximally oriented perspective view of the bidirectional snare device 10 shown in fig1 . again , the twisted end 73 of the long wire snare 70 passes through the wire bore 81 of the sleeve 80 with the loop 71 positioned distal to the flange 82 . the short wire snare 60 is passed through the sleeve 80 such that the loop 61 is proximal to the flange 82 and the untwisted pair 64 pass through the wire bore 81 of the sleeve 80 and wraps around the body 83 and the twisted end 63 is positioned parallel to and coincident with the twisted end 73 of the long wire snare 70 . twisted end 73 and twisted end 63 are fixedly attached to curved handle 50 . fig4 is an enlarged partial cross - sectional perspective view of the bidirectional snare device 10 of fig3 showing the twisted end 73 of the long wire snare 70 , clearly shown in fig3 , adjacent to the untwisted pair 64 of the short wire snare 60 passing through the wire bore 81 of sleeve 80 . fig5 is a distally oriented perspective view of the bidirectional snare device 10 and a deployment device 20 . the curved handle 50 of the bidirectional snare device 10 is inserted through a distal opening 91 and exits an exit port 92 ( best illustrated in fig5 b ) in a distal tip 90 until the flange 82 of the sleeve 80 rests firmly against a frontal face 111 of a hammer anvil 110 within the distal tip 90 . fig5 a is an enlarged perspective view of the distal end of the deployment device 20 of fig5 with the installed bidirectional snare device 10 of fig1 . the twisted end 73 and twisted end 63 of the long wire snare 70 and the short wire snare 60 , respectively exit the distal tip 90 through the exit port 92 ( best shown in fig5 b ). the remaining twisted end 73 exits the distal opening 91 , positioning loop 71 distal to the distal tip 90 . the loop 61 of the short wire snare 60 and the untwisted pair 64 exit the distal tip 90 through a loop channel 94 . the sleeve 80 is shown with the flange 82 seated against the frontal face 111 of the hammer anvil 110 within the distal tip 90 . fig5 b is an enlarged perspective view of the deployment device 20 along lines 5 b - 5 b of fig5 with the installed bidirectional snare device 10 of fig1 . the twisted end 73 and twisted end 63 of the long wire snare 70 and the short wire snare 60 , respectively exit the distal tip 90 through the exit port 92 . the loop 71 of the long wire snare 70 is positioned distal to the tip 90 . the loop 61 of the short wire snare 60 and the untwisted pair 64 ( not shown ) exit the distal tip 90 through a loop channel 94 . fig5 c is a distally oriented perspective view of the bidirectional snare device 10 and a deployment device 20 in an alternate assembly configuration . the small loop 61 of the short wire snare 60 is first routed in direction 65 through the exit port 92 over a projecting suture elevator 120 , out of the entry port 96 , through the trough 95 ( all part of the distal tip 90 and best shown in fig7 ). the small loop 61 of the short wire snare is then inserted into the flange 82 and through the wire bore 81 of the sleeve 80 and finally out through the loop channel 94 of the distal tip 90 . the curved handle 50 of the bidirectional snare device 10 is inserted through a distal opening 91 and exits the exit port 92 ( best illustrated in fig7 ) in the distal tip 90 until the flange 82 of the sleeve 80 rests firmly against a frontal face 111 of a hammer anvil 110 within the distal tip 90 . fig6 is an enlarged perspective view of the distal end of the deployment device 20 of fig5 c with the installed bidirectional snare device 10 of fig1 . the twisted end 73 and twisted end 63 of the long wire snare 70 and the short wire snare 60 , respectively exit the distal tip 90 through the exit port 92 ( also best shown in fig7 ). the remaining twisted end 73 exits the distal opening 91 , positioning loop 71 distal to the tip 90 . the loop 61 of the short wire snare 60 exits the distal tip 90 through a loop channel 94 and the untwisted pair 64 lay within a trough 95 ( also better shown in fig7 ) in the distal tip 90 . the sleeve 80 is shown with the flange 82 seated against the frontal face 111 of the hammer anvil 110 within the distal tip 90 . fig7 is an enlarged perspective view of the deployment device 20 along lines 7 - 7 of fig5 c with the installed bidirectional snare device 10 of fig1 . the twisted end 73 and twisted end 63 of the long wire snare 70 and the short wire snare 60 , respectively , exit the distal tip 90 through the exit port 92 . the loop 71 of the long wire snare 70 is positioned distal to the tip 90 . the loop 61 of the short wire snare 60 exits the distal tip 90 through a loop channel 94 and the untwisted pair 64 lay within a trough 95 in the distal tip 90 . fig8 is a proximally oriented perspective view of the bidirectional snare device 10 and a deployment device 20 . the curved handle 50 of the bidirectional snare device 10 exits the distal tip 90 and remains in line with a shaft tube 230 of deployment device 20 . fig9 is an enlarged perspective view of the distal end of the deployment device 20 of fig8 showing the curved handle 50 and twisted end 73 and twisted end 63 of long wire snare 70 and short wire snare 60 , respectively , running parallel to the axis of the shaft tube 230 of the deployment device 20 . the loop 71 of the long wire snare 70 is shown positioned distal to the distal tip 90 while the loop 61 of the short wire snare 60 is shown exiting the loop channel 94 of the distal tip 90 . fig1 is a partial orthogonal section view of the deployment device 20 and bidirectional snare device 10 along lines 10 - 10 of fig8 . the loop 61 of the short wire snare 60 exits the loop channel 94 of the distal tip 90 while the twisted end 73 of the long wire snare 70 and twisted end 63 of the short wire snare 60 , respectively , exit the exit port 92 of the distal tip 90 . the flange 82 of the sleeve 80 rests flush with the frontal face 111 of the hammer anvil 110 . fig1 is a partial orthogonal section view of the deployment device 20 and bidirectional snare device 10 along lines 11 - 11 of fig9 wherein the flange 82 of the sleeve 80 rests against the frontal face 111 of the hammer anvil 110 , the untwisted pair 64 of the short wire snare 60 rests within the trough 95 of the distal tip 90 and reenters the distal tip 90 through an entry port 96 , routed over a suture elevator 120 and through the exit port 92 parallel to and coincident with the twisted end 73 of the long snare wire 70 . referring to fig1 through 19 , the method of loading suture tails 130 of suture 133 from a leaflet 150 ( shown in fig3 ) and suture tails 140 of suture 146 from a papillary muscle 160 ( also shown in fig3 ) into the bidirectional snare device 10 and the deployment device 20 . fig1 is a partial distally oriented rear perspective view of the deployment device 20 with installed bidirectional snare device of fig8 showing suture tails 130 of suture 133 placed into the loop 61 of the short wire snare 60 of the bidirectional snare device 10 . fig1 is a progression of fig1 where the curved handle 50 of the bidirectional snare device 10 is pulled in the direction 52 relative to the deployment device 20 . the loop 61 from fig1 has retracted into the distal tip 90 pulling the suture tails 130 of suture 133 in direction 131 and further into the distal tip 90 while the loop 71 of the long wire snare 70 of the bidirectional snare device 10 progresses in direction 74 towards the distal tip 90 . fig1 is a progression of fig1 where the curved handle 50 of the bidirectional snare device 10 is pulled further in the direction 52 relative to the deployment device 20 . the loop 61 has collapsed and fully withdrawn from the distal tip 90 , pulling the suture tails 130 of suture 133 in direction 132 fully through and exiting the distal tip 90 . the loop 71 of the long wire snare 70 of the bidirectional snare device 10 progresses further in the direction 74 towards the distal tip 90 . fig1 is a partial distally oriented rear perspective view of the deployment device with installed bidirectional snare device of fig8 showing suture tails 140 of suture 146 placed into the loop 71 of the long wire snare 70 of the bidirectional snare device 10 . fig1 is a progression of fig1 where the curved handle 50 of the bidirectional snare device 10 is pulled in the direction 52 relative to the deployment device 20 . the loop 71 of the long wire snare 70 of the bidirectional snare device 10 further retracts in the direction 74 into the distal tip 90 pulling the suture tails 140 of suture 146 toward the distal tip 90 . fig1 is a progression of fig1 where the curved handle 50 of the bidirectional snare device 10 is pulled further in the direction 52 relative to the deployment device 20 . the loop 71 of the long wire snare 70 of the bidirectional snare device 10 has progressed further in the direction 74 and has collapsed and withdrawn from the distal tip 90 , pulling the suture tails 140 of suture 146 in direction 141 fully through and exiting the distal tip 90 . fig1 is a final progression of fig1 where the suture tails 140 of suture 146 have been pulled in direction 142 and completely through the distal tip 90 . the bidirectional snare device 10 ( last shown in fig1 ) is disposed . fig1 is a partial distally oriented rear perspective view of the deployment device 20 in fig8 showing suture tails 130 of suture 133 and suture tails 140 of suture 146 being tensioned in direction 143 as the deployment device 20 is extended in direction 145 to place the distal tip 90 on the desired deployment site . fig2 is a perspective view of a coaxial mechanical fastener 30 with suture 133 attached to a leaflet 150 and the suture 146 attached to a papillary muscle 160 a now crimped sleeve 80 retains both suture 133 and suture 146 such that the suture tails 130 exit from the flange 82 of the sleeve 80 and the suture tails 140 exit from the body 83 of the sleeve 80 . fig2 is an exploded perspective view of the deployment device 20 . the deployment device 20 comprises a left handle 170 , right handle 180 , and a lever 190 all of which are suitably manufactured from a medical grade plastic via an injection molding process . the lever 190 is constrained by and pivots about posts 191 that are circumferentially disposed within pivot bore 171 of the left handle 170 and a similarly defined pivot bore 181 ( not shown ) within the right handle 180 . an extension spring 200 , typically made from a biocompatible material such as stainless steel , provides preload to the lever 190 by attaching to a spring tab 192 on the lever 190 via a hook 201 and attaching to a post 172 in the left handle 170 via a loop 202 . a wedge tip 210 is retained in a pocket 193 of the lever 190 by rotational posts 211 . the wedge tip is made , preferably , from a medical grade plastic via the injection molding process . a cutter blade 220 , made from a medical grade metal such as stainless steel is attached to the wedge tip 210 and retained and constrained by the geometry of the wedge tip 210 and an internal bore 231 of a shaft tube 230 . the shaft tube 230 , preferably made from stainless steel , is constrained by mating slots 232 in the shaft tube 230 and fingers 173 and fingers 182 ( not shown ) within the left handle 170 and right handle 180 , respectively . a fluid - tight seal is maintained at the proximal end of the shaft tube 230 and wedge tip 210 by the installation of an o - ring 240 over a groove 212 of the wedge tip 210 . a fluid housing 250 , made from plastic , is slid over the shaft tube 230 through a shaft bore 251 such that a communication bore 252 aligns with fluid channels 233 in the shaft tube 230 . the hammer anvil 110 , also manufactured from a medical grade metal such as stainless steel or the like , is secured within the distal end of the shaft tube 230 by press fitting a pin 260 through pin hole 97 in the distal tip 90 and pin hole 234 in the shaft tube 230 and through a pin channel 112 in the hammer anvil 110 . the suture elevator 120 , comprised of a medical grade stainless steel , is installed within the shaft tube 230 by press fitting into an elevator slot 235 . fig2 is a distally oriented , partially sectioned perspective view of the deployment device 20 of fig5 showing the introduction of fluid 270 through the communication bore 252 of the fluid housing 250 and subsequently through the fluid channels 233 in the shaft tube 230 . fluid 270 flows through the shaft tube 230 and out of the distal tip 90 to provide infusion . fig2 is a distally oriented , partial section view of the deployment device 20 along lines 23 - 23 in fig2 wherein the lever 190 is fully extended in its natural position , the wedge tip 210 and attached cutter blade 220 are retracted with the o - ring 240 providing a seal during fluid communication through the fluid housing 250 . the bidirectional snare device 10 is not shown for clarity . fig2 is an enlarged partial view of fig2 illustrating the position of the o - ring 240 on the groove 212 of the wedge tip 210 within the shaft tube 230 . the fluid housing 250 provides a fluid tight seal via the compression fit of shaft bore 251 on the shaft tube 230 . fluid passes through the fluid housing 250 into the shaft tube 230 by way of fluid channels 233 and through the shaft tube 230 over the wedge tip 210 by way of fluid troughs 213 . fig2 is an enlarged partial view of fig2 illustrating the position of the wedge tip 210 in relation to the hammer anvil 110 . the fluid troughs 213 of the wedge tip 210 communicate fluid to the distal tip 90 . an arm 214 of wedge tip 210 is proximal to and not engaging a ramp 113 of the hammer anvil 110 . the sleeve 80 is shown with the flange 82 resting against the frontal face 111 of the hammer anvil 110 . fig2 is a distally oriented , partial section view of the deployment device 20 along lines 23 - 23 in fig2 wherein the lever 190 is fully retracted in direction 194 , extending the extension spring 200 and driving the wedge tip 210 and cutter blade 220 in direction 215 . the bidirectional snare device 10 is not shown for clarity . fig2 is an enlarged partial view of fig2 illustrating the position of the o - ring 240 on the now advanced groove 212 of the wedge tip 210 within the shaft tube 230 . fluid is allowed to communicate through the shaft tube 230 by way of the fluid housing 250 and coinciding fluid channels 233 of the shaft tube 230 and over the fluid troughs 213 of wedge tip 210 . fig2 is an enlarged partial view of fig2 illustrating the position of the wedge tip 210 in relation to the hammer anvil 110 . the fluid troughs 213 of the wedge tip 210 communicate fluid to the distal tip 90 . the arm 214 of wedge tip 210 is now engaging the ramp 113 of the hammer anvil 110 and causing the hammer anvil 110 to compress the sleeve 80 . fig2 a is an orthogonal section view along view lines 28 - 28 of fig2 illustrating the advanced wedge tip 210 compressing the hammer anvil 110 and sleeve 80 and the also advanced cutter blade 220 impacting the suture elevator 120 and trimming suture tails 130 and suture tails 140 . fig2 b is an alternate enlarged partial section view of fig2 again illustrating the advanced wedge tip 210 compressing the hammer anvil 110 and sleeve 80 and the also advanced cutter blade 220 impacting the suture elevator 120 and trimming suture tails 130 and suture tails 140 . fig2 is an enlarged perspective view of the sleeve 80 compressed by the actions detailed in fig2 . the body 83 of sleeve 80 is compressed , but the flange 82 is intact . fig3 shows a schematic illustration of the human heart 40 sectioned to remove the front from the left side of the heart . this heart 40 is shown during diastole which is the filling phase during the cardiac cycle . the right side is not highlighted in this illustration . the left atrium 300 receives blood returning from the lungs through the pulmonary veins 301 and 302 . two pulmonary veins generally enter to the left atrium 300 on the patient &# 39 ; s right side 300 a and two more on the patient &# 39 ; s left atrial side 3008 . note the four open arrows 303 coming from the pulmonary veins 301 and 302 illustrating the return of blood flow to the left atrium 300 . during this phase of the cardiac cycle , the anterior leaflet 304 of the mitral valve 305 and the posterior leaflet 306 of the mitral valve 305 are open to permit the blood returning into the atrium 300 to pass into the left ventricle 307 . note that the chordae tendineae 308 is shown passing from the anterior leaflet 304 of the mitral valve 305 to a papillary muscle 309 in the left ventricle 307 . note that a second chordae tendineae 310 is shown here passing from the posterior leaflet 306 to another papillary muscle 311 . the thin black arrows 312 indicate the opening of the anterior and posterior mitral valve leaflets , 304 and 306 . the aortic valve 314 is shown in the closed position as it is during diastole due to back pressure from blood in the ascending aorta 315 . for purposes of clarity , this illustration does not show the right atrium or the right ventricle . fig3 illustrates the heart 40 now in the contraction phase , systole , of the cardiac cycle . the cardiac walls 316 and septum 317 thicken as the ventricular chamber 318 contracts . the thin black arrows 312 and 313 illustrate that the pressure built up in the left ventricle 307 causes both the anterior mitral leaflet 304 and posterior mitral leaflet 306 to come together and seal at what is called the coaptation zone 319 . the four open arrows illustrate blood leaving the left ventricle and passing through the now open aortic valve 314 . fig3 is similar to fig3 with the schematic heart 40 in systole . however , here the chordae tendineae 308 in fig3 which should be in continuity between the papillary muscle 309 and anterior leaflet 304 of the mitral valve 305 has been disrupted . this disrupted chordae tendineae 320 is shown partially attached to the papillary muscle 309 and partially attached 320 to the anterior leaflet 304 . the coaptation zone 319 between the anterior leaflet 304 and the posterior leaflet 306 is disrupted allowing blood to pass back into the left atrium 300 instead of being blocked by the coapted mitral valve 305 . this passing of blood back into the right atrium is called regurgitation , and the movement of the anterior leaflet into the left atrium is called prolapse . fig3 shows a proper length suture hand - tied replacement 321 for a disrupted chordae tendineae , which is not shown here due to its surgical removal . the open arrows 303 indicating blood show that the blood again passes only towards the now open aortic valve 314 . fig3 is similar to the illustration of fig3 however in fig3 the hand - tied suture replacement 321 of suture 321 a ( for the anterior leaflet 304 disrupted chordae tendineae 308 as shown in fig3 ) is tied too long so that the anterior leaflet 304 can prolapse into the left atrium 300 thereby rendering the coaptation zone 319 dysfunctional . one open arrow illustrates the passage of blood regurgitating back into the left atrium 300 due to inaccurate knotting of the chordae tendineae replacement suture 321 . fig3 is like fig3 and 34 however now the chordae tendineae replacement suture 321 is too short . by tying the replacement suture 321 of suture 321 a too short , the coaptation zone 319 of the mitral valve 305 is rendered open . the inappropriate coaptation of the anterior leaflet 304 leaves a space between the anterior leaflet 304 and the posterior leaflet 306 through which blood can pass as illustrated with the open arrow 323 . fig3 shows the tip of the deployment device 20 of the present invention passing into the schematic left atrium 300 of the human heart 40 . note there are two different loops of suture , 324 and 325 , one coming from the papillary muscle 309 and another coming from the anterior leaflet 304 whose chordae tendineae has been removed . fig3 shows similar illustration as fig3 except now the deployment device 20 has passed completely down onto the papillary muscle 309 in the left ventricle 307 . the suture 324 going from the papillary muscle 309 and through the coaxial mechanical fastener 30 is drawn tight . however the suture 325 going to the anterior leaflet 304 has yet to be drawn down into the proper coaptation alignment . fig3 shows the schematic heart 40 with the deployment device 20 in place on the papillary muscle 309 and now also infusing pressurized saline 326 into the left ventricle 307 to push upon the inside surfaces of both of the mitral leaflets 304 and 306 , as indicated by the thin black arrows 313 . by drawing the suture 325 from the anterior leaflet 304 in , the anterior leaflet 304 is pulled down into position in the appropriate zone for coaptation . when the suture length is properly set , the lever 190 ( not shown ) of the deployment device 20 is squeezed , crimping the coaxial fastener 30 and simultaneously cutting away all redundant suture 324 and 325 through the suture hole ( not shown ). fig3 shows the coaxial fastener 30 in place anchoring the suture 325 coming from the anterior leaflet 304 to the papillary muscle 309 . the double headed arrow 327 indicates the direction of the tension from the papillary muscle 309 up to the anterior leaflet 304 . note that the coaptation zones 319 are completely in contact and the inner surfaces of both the anterior and posterior mitral leaflets 304 and 306 are parallel and aligned . fig4 is a distally oriented perspective view of an additional embodiment of a bidirectional snare device 280 . the bidirectional snare device 280 is formed by first forming a small loop 284 and routing the wire pair 288 through the body 83 of the sleeve 80 . looping the wire pair 288 around the flange 82 of the sleeve 80 . while maintaining a small loop 284 , arrange the wire pair 288 so that one end is substantially longer than the other and create a twisted portion 285 of about ½ inch in length approximately 2 inches from the small loop 284 . route the remaining long end of wire 283 through the body 83 of the sleeve 80 and form a large loop 282 again feeding the end of the wire 283 back through the flange 82 of the sleeve 80 . twist a portion 286 of about 3 - 4 inches in length until it meets the twisted portion 285 . finally taking the remaining free ends of wire 283 , create a twisted pair end 287 and secure within the receiving bore 51 of the curved handle 50 . fig4 is an enlarged partial cross - sectional perspective view of the bidirectional snare device 280 of fig4 showing the twisted portion 286 and the wire pair 288 adjacent to each other inside of the wire bore 81 of sleeve 80 . fig4 is a proximally oriented perspective view of the bidirectional snare device 280 shown in fig4 . the large loop 282 is distal from the flange 82 of the sleeve 80 and the small loop 284 is proximal to the body 83 of the sleeve 80 . fig4 is an enlarged partial cross - sectional perspective view of the bidirectional snare device 280 of fig4 again showing the twisted portion 286 and the wire pair 288 adjacent to each other inside of the wire bore 81 of sleeve 80 . referring to fig4 through 46 , a variety of therapeutic configurations is detailed in conjunction with the bidirectional snare device 10 . fig4 is a perspective view of a bidirectional snare device 10 being loaded with a single suture 290 with a suture tail 290 a placed though a papillary muscle 160 and fed through the loop 71 of the long wire snare 70 of the bidirectional snare device 10 and the other suture tail 2908 placed through a leaflet 150 and fed through the loop 61 of the short wire snare 60 of the bidirectional snare device 10 . fig4 is a perspective view of a bidirectional snare device 10 being loaded with a suture 291 placed though a papillary muscle 160 and the suture tails 291 a fed through the loop 71 of the long wire snare 70 of the bidirectional snare device 10 and a suture 292 placed through a leaflet 150 and the suture tails 292 a fed through the loop 61 of the short wire snare 60 of the bidirectional snare device 10 . fig4 is a perspective view of a bidirectional snare device 10 being loaded with a suture 291 placed though a papillary muscle 160 and the suture tails 291 a fed through the loop 71 of the long wire snare 70 of the bidirectional snare device 10 and sutures 292 and suture 293 placed through a leaflet 150 and the suture tails 292 a and suture tails 293 a , respectively , fed through the loop 61 of the short wire snare 60 of the bidirectional snare device 10 . fig4 a through 49b are perspective views illustrating a variety of configurations of coaxial mechanical fasteners 30 . fig4 a illustrates the use of the single suture 290 forming a loop 290 c proximal to the body 83 of the sleeve 80 and a loop 290 d distal to the flange 82 of the sleeve 80 . suture tail 290 a and suture tail 290 b exit the sleeve 80 opposite each other . fig4 b illustrates the routing of the suture 290 with the sleeve 80 removed for clarity . fig4 a illustrates the use of the suture 292 forming a loop 2928 proximal to the body 83 of the sleeve 80 and the single suture 291 forming a loop 2918 distal to the flange 82 of the sleeve 80 . suture tails 291 a and suture tails 292 a exit the sleeve 80 opposite each other . fig4 illustrates the routing of the suture 291 and suture 292 with the sleeve 80 removed for clarity . fig4 a illustrates the use of the suture 292 and suture 293 both forming separate loops 292 b and 293 b , respectively , proximal to the body 83 of the sleeve 80 along with suture 291 forming a loop 291 b distal to the flange 82 of the sleeve 80 . suture tails 292 a and suture tails 293 a exit the sleeve 80 together at the flange 82 opposite from suture tails 291 a exiting from the body 83 . fig4 b illustrates the routing of the suture 291 , suture 292 , and suture 293 with the sleeve 80 removed for clarity . fig5 is a perspective view of the deployment device 20 with an attached slotted suture securing reel 330 which is used to maintain coaxial alignment of the papillary suture 324 and leaflet suture 325 with the shaft tube 230 of the deployment device 20 while also aiding in suture management . a yard arm 340 of the slotted suture securing reel 330 is positioned on the shaft tube 230 and secured with a screw 380 through a second bore 343 . the yard arm 340 is typically of a machined stainless steel or the like and has the ability to flex slightly about a flexure groove 342 . the leaflet suture 325 is placed within a slot 341 and is free to slide coaxial to the shaft tube 230 . the papillary suture 324 is placed between compression rings 360 , which are customarily made of a rubber material , and secured via a knurled knob 370 that is comprised of a machined metal or molded plastic and whose threaded bore 371 ( best shown in fig5 ) is threaded onto a threaded shaft 381 ( also best shown in fig5 ) of the screw 380 , which is also typically stainless steel , and applies compressional force onto reel plates 350 , which can be manufactured as machined metal or molded plastic , and subsequently the compression rings 360 . fig5 is an exploded perspective view of the slotted suture securing reel 330 of fig5 . the yard arm 340 is attached to the shaft tube 230 of the deployment device 20 by the compressional force applied by the knurled knob 370 whose threaded bore 371 is threaded onto the threaded shaft 381 of the screw 380 and subsequently compresses the reel plates 350 whose bores 351 fit over the threaded shaft 381 of screw 380 and compression rings 360 whose internal diameters 361 also fit over the threaded shaft 381 of screw 380 . while the invention has been described in connection with a number of presently preferred embodiments thereof , those skilled in the art will recognize that a number of modifications and changes may be made therein without departing from the true spirit and scope of the invention which accordingly is intended to be defined solely by the appended claims .	0
in the following discussion , numerous specific details are set forth to provide a thorough understanding of the present invention . however , those skilled in the art will appreciate that the present invention may be practiced without such specific details . in other instances , well - known elements have been illustrated in schematic or block diagram form in order not to obscure the present invention in unnecessary detail . additionally , for the most part , details concerning network communications , electro - magnetic signaling techniques , and the like , have been omitted inasmuch as such details are not considered necessary to obtain a complete understanding of the present invention , and are considered to be within the understanding of persons of ordinary skill in the relevant art . it is further noted that , unless indicated otherwise , all functions described herein may be performed in either hardware or software , or some combinations thereof . in a preferred embodiment , however , the functions are performed by a processor such as a computer or an electronic data processor in accordance with code such as computer program code , software , and / or integrated circuits that are coded to perform such functions , unless indicated otherwise . referring to fig3 of the drawings , the reference numeral 300 generally designates a rfid system . the system 300 comprises a unified rfid base unit 304 , an rfid tag 302 , a computer network 314 , automated devices 330 , alternate security device 334 , and an input / output ( i / o ) device 338 . in operation , there a number of configurations that can be employed . in all of the systems , the rfid tag 302 communicates with the rfid base unit 304 through an rf link 332 . depending on the type of rfid tag 302 desired , the rfid base unit 304 is equipped to communicate with any type of rfid tag . at the center of the system 300 is the rfid base unit 304 . the rfid base unit 304 further comprises a field generator 306 , rf circuitry 308 , an antenna 309 , a microcontroller 310 , and an rf integrated circuit ( rfic ) 312 . the rfic 312 is coupled to the rf circuitry 308 and the microcontroller 310 through the communication channels 346 and 344 , respectively . the rf circuitry 308 communicates information to and from the rfid tag 302 by utilizing the antenna 309 and the rf link 332 . additionally , the rf link 332 can be of multiple frequencies to communicate with standard low frequency rfid tags ( between 125 khz to 134 khz ), standard high frequency rfid tags ( 13 . 56 mhz ), standard ultra high frequency ( uhf ) rfid tags ( 868 mhz to 956 mhz ), and standard microwave rfid tags ( 2 . 45 ghz ). the rfid base unit 304 can also be designed to be robust and powered by a variety of power sources . for example , the rfid base unit 304 can be powered by standard 110 vac , batteries , rechargeable batteries , power over ethernet , power over usb , etc . additionally , the rfid base unit 304 can be constructed using various housings for harsh environments . for example , a basic version , a shockproof version , a high / low temp environment version , a highly acidic / basic environment version , and so forth could be developed . depending on the type of rfid tag 302 , the field generator 306 can be engaged by the rfic 312 . control information is provided to the field generator 306 from the rfic 312 through the communication channel 342 , and , when desired , the field generator 306 may not be utilized . such case where the field generator 306 may not be utilized is when the rfid tag is a passive rfid that utilize a reflected wave , such as the tag 100 . the field generator 306 is coupled to an inductor 307 for generating a magnetic field , when indicated , to provide power to a passive or semi - passive rfid tag . however , it is possible to have the field generator 306 deliver control information to a much larger generator with a large power source to generate a magnetic field . then , based on the configuration desired , the rfid base unit 304 can be coupled to a variety of other devices . to be able to interact with multiple devices , the microcontroller 310 can be flexible . the microcontroller 310 of the rfid base unit 304 can have memory which would include expandable volatile memory , such as dynamic random access memory ( dram ) or static random access memory ( sram ) and non - volatile memory , such as hard disk drives and flash memory sticks . additionally , standard operating systems , such as windows ce ® ( microsoft corp , one microsoft way redmond , wash . 98052 - 6399 ) and vx works , can be readily usable with the microcontroller 310 . the microcontroller 310 can also be equipped to communicate with either a computer network 314 , automated devices 330 , and other devices through bluetooth , rs232 , universal serial bus ( usb ), ethernet , wireless , t - carrier connections , firewire ® ( apple computer , inc ., 1 infinite loop , cupertino , calif . 95014 ), optical fiber , zigbee ® ( philips electronics north american corp ., avenue of the americas new york , n . y . 100201 - 104 ), etc . examples of interconnection of the rfid base unit 304 with a variety of other devices can be seen with the communication channels 316 , 318 , 320 , 322 , 324 , and 326 . the rfid base unit 304 , though , does not necessarily need to be connected to a network . rather than using the network 314 to store information related to authorization , internal memory or other devices storing , accessing or otherwise obtaining the information may be used additionally or as another option . by equipping the rfid base unit 304 to communicate with external devices , there are a variety of configurations . the rfid base unit 304 can be connected to a remote monitoring system or can be monitored over a computer network , such as the internet . for example , a user can be notified of operation of a through voice over internet protocol ( voip ) on a cell phone . additionally , several rfid base units 304 could be interconnected or connected with a server . hence , by having the ability to dynamically interconnect rfid base units 304 with one another and computer networks 314 , the functionality of the rfid base unit 304 and rfid tags 302 can be dynamically changed for changing conditions . for example , rifd tags 302 can have id numbers dynamically updated , or the software of the microcontroller 310 can be updated . the rfid base unit 304 , though , has significant potential in controlling the operation of other external devices . for example , the rfid base unit 304 could be coupled to an automated device 330 by a communication channel 328 . automation equipment 330 can also be connected directly to the i / o module . the rfid base unit 304 can then enable or disable access to the automated device 330 . the rfid base unit 304 can also be coupled to an i / o device 338 through the communication channel 340 , where the rfid base unit 304 can be configured to receive and / or transmit digital and / or relay signals . for example , the rfid base unit 304 can be configured to communicate with programmable ladder logic controllers ( plcs ) that are common in industrial applications or with other i / o modules . the rfid base unit 304 can also be used to discontinue the operation of other external devices . for example , a power source disconnect module ( psdm ) can be used in conjunction with the rfid base unit 304 . the rfid base unit 304 could be helpful as a last line of safety type of device where one might want to turn a piece of equipment completely off if an operator gets too close . for example , an industrial laser can be extremely hazardous and would need to be off if an operator is too close . additionally , the rfid base unit 304 can be used as a fail safe in case the operator can bypass the other safety devices . alternatively or additionally , the rfid base unit 304 could be employed to signal a controller if the proper operator is not present and / or in an acceptable location to operate a device , such as a laser or other potentially harmful or otherwise important equipment . in high security situations , additional security devices can be employed in conjunction with the rfid base unit 304 . in fig3 , an alternative security device 334 can communicate with the rfid base unit 304 through the communication channel 336 . until conditions of both the rfid tag 302 and the alternative security device 334 are satisfied , access to an automated device or to an area is denied . for example , a fingerprint reader , an iris scanner , a retinal scanner , a facial recognition scanner , and so forth can be used as an alternative security device . specifically , the rfid base unit 304 is designed to have a great deal of flexibility . there are a large number of combinations of devices , rfid tags , and communication techniques that can be employed to yield that flexibility . moreover , the rfid base unit 304 is designed to be a lower cost unit so that usage of rfid tags , particularly in commercial and industrial applications , can become more common . an example of the usage of the rfid system 300 in an industrial application is with safety or security . referring to fig4 of the drawings , the reference numeral 400 generally designates a flow chart depicting the usage of an rfid system in a safety or security application . in step 410 , an rfid tag interfaces the rfid base unit . the rfid tag can be any type of rfid tag . during the interface , the rfid tag can be energized , and the identification information ( id ) is transmitted to the rfid base unit . once received , the id is analyzed . a determination is made in step 412 of whether the id is correct or sufficient to gain access . if the id is not correct , access to a device or area is denied in step 414 . for example , if an employee attempts to operate a milling machine and if the employee &# 39 ; s id is not cleared to operate the milling machine , then the mill will not function . if the id is determined to be sufficient to gain access to a device or area , a further determination is made as to if a second tag is necessary in step 416 . in some industrial and commercial applications , it is necessary to have multiple parties present during the performance of an industrial function . for example the operators of an industrial press : at least two operators need to be present at all times when the equipment is in operation in case someone gets injured such that they cannot get or seek medical attention on their own . the second tag can then be analyzed to determine if the second id is correct . if the second id is not correct , then access is again denied in step 414 . once the rfid tags have proven sufficient to gain access to a device or area , a determination is made in step 420 to determine if a secondary id is needed . if needed , then a determination is made in step 422 if the secondary id is correct . if the secondary id is not correct , then access is again denied in step 414 . however , if the secondary id is correct , then access is allowed in step 424 . for example , a plasma etching machine may require both an rfid and a thumbprint scan to operate the machine . it is understood that the present invention can take many forms and embodiments . accordingly , several variations may be made in the foregoing without departing from the spirit or the scope of the invention . the capabilities outlined herein allow for the possibility of a variety of programming models . this disclosure should not be read as preferring any particular programming model , but is instead directed to the underlying mechanisms on which these programming models can be built . having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . many such variations and modifications may be considered desirable by those skilled in the art based upon a review of the foregoing description of preferred embodiments . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention .	6
the presently described embodiments provide network support for voice - activated web browsing for audio data streams . the system allows wireless customers or subscribers to make verbal web requests for audio streams . an advantage of this system is that it does not require the use of hands , making it possible to request web audio programs while , for example , safely driving a vehicle . wireless service providers may wish to offer such value added services to utilize existing wireless voice and internet browsing capabilities . as an example of an implementation of the present invention , presume a subscriber is a chicago bears fan , and is out of town during one of the bears &# 39 ; football games . a service in accord with the present invention allows the subscriber to call a service provider voice and internet browsing request point ( e . g ., via an 800 - number ). then , the subscriber states , “ audio for today &# 39 ; s chicago bears football game .” the wireless network service subsequently performs a number of functions including translating the statement ( i . e ., “ audio for today &# 39 ; s chicago bears football game ”) to a search request , searching the internet for a match based on the request , and connecting the mobile subscriber to an audio feed for the bears football game , if a match is found . other similar examples of implementation may involve a request for a “ chicago traffic report ” or a “ chicago weather report ” while driving . another feature that may be realized by implementation of this invention is the option of pre - designating a web site for a particular query request . for example , if the subscriber states “ st . charles swim team ,” the network will search a subscriber database to find a match and connect the subscriber to the audio streams available on , for example , www . stcswim . com . another feature that may be realized by implementation of this invention is the use of a reminder list to allow for the provision of audio data streams to a subscriber based upon predetermined criteria , in the absence of the audio request . in this regard , a reminder list may be stored and acted upon in such a way so as to allow a subscriber web alert manager to initiate a data session based on information stored in the reminder list . referring now to the drawings wherein the showings are for purposes of illustrating the preferred embodiments of the invention only and not for purposes of limiting same , fig1 provides a view of an exemplary system according to the present invention . as shown , a network 10 is accessed by a mobile subscriber using a mobile device 12 through a base station 14 . the base station 14 is in communication with a switching center 16 , which may take the form of a mobile switching center ( msc ) or other primary switching element of the network into which the invention is incorporated . the switching center 16 includes a switching module 16 a , as well as an internet gateway 18 which has access to a speech recognition unit 20 . the internet gateway 18 is also connected to a subscriber web database 22 which connects to a subscriber web interface 24 . of course , the subscriber web interface 24 provides access to the internet 26 . a subscriber web alert manager 28 is also connected to the subscriber web database 22 and the internet gateway 18 . also shown in fig1 is an audio web search engine 30 . it should be appreciated that — while the switching module 16 a , internet gateway 18 , speech recognition unit 20 , subscriber web database 22 , subscriber web interface 24 , subscriber web alert manager 28 , and audio web search engine 30 are shown as being part of the switching center 16 — these elements may also be configured as separate network elements , or be housed on separate network elements , in communication with one another . these elements may take a variety of forms as a consequence . appropriate software techniques and hardware implementations may be used . the software may be housed on a single element or distributed among all or some of those elements . the switching center 16 may take the form of a mobile switching center ( msc ). however , it will be understood that the embodiments described herein are not so limited . as noted above , the switching center 16 may take the form of any primary switching module available in a network — which , of course , may vary from network to network in a number of ways including the generation of technology that is implemented . the same is true for the base station 14 — its form may vary and may be replaced with an alternative structure . it should be further understood that the switching module 16 a includes the functionality necessary for suitable switching to take place within the switching center 16 . this functionality is well known in the art and is thus not described herein . however , it should be appreciated that the switching center 16 preferably includes the additional functionality of having the ability to identify a request for voice - activated browsing according to the present invention and pass that request on to the internet gateway 18 . this could be accomplished through the use of a specific phone number to which a call is made from the mobile device 12 and / or a specific command that can be spoken , or a keystroke that can be entered , by the mobile subscriber into the mobile device 12 . the internet gateway 18 provides an interface from the switching module 16 a to all of the various components that are required to provide the subject voice - activated web browsing functionality . for example , if a request for a certain audio program is received , the internet gateway 18 will send the input voice data to the speech recognition unit 20 to translate the input voice data to text data . the internet gateway 18 then sends the text data to audio search web engine 30 to find a desired web link or conducts a search of the subscriber web database 22 , as described below . in either case , the speech recognition unit 20 converts the speech web requests that are spoken by the mobile customer to text data . speech to text conversion may be implemented in a variety of well known manners . the subscriber web database 22 stores customer requests and preferences for keyword translation that can be correlated to a specific web site . an example of this functionality resides in a customer preference to equate a web site to find out about school closings with the keyword “ school closings .” so , the database may be configured in such a manner to have keywords act as indices and the corresponding web site data serve as an associative data field . another type of request or preference that can be stored in this database relates to scheduling future programs to be provided to the subscriber . for example , a customer may set a program reminder for a football game that will be played tomorrow . the subscriber alert manager 28 will use this data to provide the appropriate audio stream at the appropriate time . the subscriber web interface 24 provides a secure interface for mobile customers , for example , to input customer specific data , such as that described in subscriber web database 22 . this interface also acts to receive audio streams that are captured in response to a user request . the subscriber alert manager 28 provides alerts to mobile customers about scheduled future audio programs when the time of the program happens . as noted above , the subscriber alert manager 28 accesses the subscriber web database to do so . the audio search web engine 30 is customized to find audio files on the internet ( e . g ., real player , windows media , etc .). searching for audio data streams on the internet is a well known process . for example , it can be accomplished by simply limiting the search to results that have particular file extensions that are unique to audio data . with respect to operation of the system , an exemplary method according to the presently described embodiments is shown in fig2 . as illustrated , the method 100 is initiated upon the receipt of a call at the switching module 16 a ( at 102 ). the switching module 16 a then determines if the call is an audio request according to the present invention ( at 104 ). this can be accomplished by implementing a particular access number for the service . if not , of course , the call is processed in the normal course . if so , however , the audio request ( or the subscriber who is operating the mobile device 12 ) is validated by the system ( at 106 ). this is accomplished by accessing a subscriber database housed within , or simply in communication with , the switching center 16 , as is well known in the art . the subscriber web database 22 may also serve this function , depending on the design of the network . if the audio request is verified and the subscriber is validated , the audio request ( e . g ., the voice data ) is forwarded to the internet gateway 18 ( at 108 ). the voice data , or web query , is then received by the internet gateway ( at 110 ). this received speech is converted to text data ( at 112 ). the internet gateway 18 then determines if the converted speech ( e . g ., text data ) corresponds to an entry in the subscriber web database 22 ( at 114 ). a simple database search can be conducted by comparing the converted data to the database entries . if not , the text data is input to the audio web search engine ( at 116 ). the audio web search engine 30 formulates a search query based on the text data and conducts an audio search on the internet ( at 118 ). as noted above , searching for audio streams is a known process . results of the search are returned to the mobile subscriber through the audio web search engine 30 ( at 120 ). it should be appreciated that the search results may be provided in a variety of forms , such as an audio menu or the like , to the user . in some situations , the system may simply provide an audio stream directly to the mobile subscriber . if it is determined that the text data corresponds to an entry stored in the subscriber web database 22 ( at 114 ), then the appropriate data in the subscriber database 22 is retrieved and correlated to an appropriate , pre - defined web site ( at 122 ). the determined web site is then accessed through the subscriber web interface 24 ( at 124 ). the results are ultimately returned to the mobile user ( at 126 ). it should be understood that returning the results to the user in this context could simply mean providing the requested audio data streams to the mobile subscriber . this process may also include , or be accompanied by , an audio menu to allow the mobile subscriber to exercise options regarding the audio data stream . as noted above , the presently described embodiments also provide for the use of a technique for reminding and / or scheduling the mobile subscriber in connection with audio streams to which the mobile subscriber requests access . for example , the mobile subscriber may set a reminder and / or schedule a football broadcast to be played to the mobile subscriber on a particular day and time . referring now to fig3 , a method 200 describing the process for doing so is illustrated . as shown , the method 200 includes the function of checking the reminder list periodically to determine if a connection should be made ( at 202 and 204 ). if there is no connection that should be made , the reminder list is simply checked again after a predetermined time expires . if , however , the system determines that a connection should be made , the data relating to the desired web site is retrieved and / or correlated using the subscriber web database 22 ( at 206 ). the desired web site is then accessed through the subscriber web interface 24 ( at 208 ). once the connection is completed , the audio is simply sent to the subscriber ( at 210 ). as with the other embodiments , it should understood that the audio results returned to the subscriber may simply be a connection to the audio stream , or it may also be accompanied by a menu such as an audio menu to provide the mobile subscriber with alternatives regarding listening to the audio , storing the audio , . . . etc . the above description merely provides a disclosure of particular embodiments of the invention and is not intended for the purposes of limiting the same thereto . as such , the invention is not limited to only the above - described embodiments . rather , it is recognized that one skilled in the art could conceive alternative embodiments that fall within the scope of the invention .	7
the present invention provides for methods of non - invasively diagnosing abnormal joint conditions by the auditory display of a vag signal . in particular , the methods described herein are useful for diagnosing the quality of articular cartilage in a knee joint . however , it is not intended to limit the claimed invention to one specific application . the claimed invention may be applicable to the diagnosis of a wide variety of conditions where auscultation is a diagnostic tool . when describing the present invention , the following terms have the following meanings , unless indicated otherwise . all terms not defined herein have their common art - recognized meanings . the term “ vibroarthrographic signal ” refers to an electronically recorded signal that represents the sound or noise or vibration generated in or by a joint of a body . the signal may be sensed using a microphone , accelerometer or a vibration sensor , which are all well known in the art . auditory display may be defined as an aural representation of a stream of data . in general terms , the invention comprises the audification or sonification of a vag signal obtained from a knee joint . audification is the direct transformation of a data stream to the audible domain for purposes of monitoring and analysis . filters and signal processing techniques may be used to assist the user of the display in isolating certain events , but there are no sound - synthesizing elements involved . the audification of vag signals may be performed in two ways : 1 ) direct playback , 2 ) audification via a time - frequency scaling method based on a signal decomposition technique such as matching pursuit ( mp ) [ 11 , 21 ]. in direct playback , the digitized vag signals may be converted to an audio file and replayed using audio software tools which are well known . in one embodiment , the audio file (. au ) format is that played using the “ audiotool ” program in an ultraspare ( sun microsystems ) station . direct playback of vag signals may provide more information than the sounds heard using a stethoscope due to better noise immunity , sensitivity , and low - frequency response of an accelerometer than a stethoscope . vag signals lie at the lower end of the frequency spectrum , and audible sound is only a part of their total spectral content . the presence of background noise , muscle vibration artifacts , and the complex nature of the vag signal make auscultation difficult . a technique that shifts the frequency spectrum of components of diagnostic relevance to a higher and more easily perceptible range may be useful . on the other hand , clicks of clinical interest are of very short duration , and direct auscultation or direct audification may not facilitate auditory analysis of the subtle characteristics of such transients . a method that scales transients to a longer duration may facilitate improved auscultation . in one embodiment , time - frequency ( tf ) scaling is performed using the method proposed by zhang et al . [ 13 ] for heart sounds . the method is based on mp decomposition , and the atoms generated as a result of the decomposition procedure are suitably time - scaled and frequency - scaled . the scaled atoms are used in the synthesis stage to construct a tf - scaled signal . fig1 shows the block diagram of the mp - based audification method . the original vag signal is decomposed into tf atoms by using the mp method described below . the mp decomposition process is stopped once the coherent structures of the signal are extracted . at the decomposition stage , the mp algorithm provides the parameters α n , s n , p n , ƒ n and φ n in eq . 7 below . by scaling t , s n , and p n a time - scaled version of the signal can be obtained . scaling ƒ n gives a frequency - scaled version of the signal . the scaling parameters can be varied suitably to obtain the desired perceptual , frequency , and temporal characteristics . in joint tf scaling , the time ( t ) and the frequency ( ƒ n ) variables are transformed to new variables t ′ and ƒ ′ n , respectively , by the scalar transformations where α and β are positive numbers . α & gt ; 1 expands the signal in time , and α & lt ; 1 compresses the signal in time without any change in the spectral characteristics . β & gt ; 1 shifts the spectral bandwidth to a higher frequency range and β & lt ; 1 shifts the spectral bandwidth to a lower frequency range ; the frequency transformation does not affect the temporal properties . in case of critically - sampled signals , the following condition should be met : where ƒ n is the maximum frequency component present in the signal , and ƒ s is the sampling rate . the condition in eq . 3 avoids frequency aliasing in frequency - scaled versions of the signals . in the present application , we are interested in playing vag signals for a longer duration with frequency mapping to an audible band in a comfortable frequency range for human perception . the temporal properties of the signal are related to the time - position p n , and the scale factor s n . therefore , in the time - scaling procedure , the temporal placement and the scale factors are transformed to p ′ n , and s ′ n , where p ′ n = αp n and s ′ n = αs n ′ . in case of frequency scaling , the frequency variable ƒ n is transformed to ƒ ′ n = βƒ n . the tf - scaled atom is given by g γ n ′  ( t ) = 1 s n ′  g  ( t - p n ′ s n )  exp [ j ( 2  π   f n ′  α   t + φ n ] = 1 ω n  g  ( t ′ - αφ n αγ n )  exp [ j ( 2  πβ   f n  α   t + φ n ] ( 4 ) from eq . 4 it is evident that in time - scaling , the spectral characteristics remain unchanged . normally , a time - scale expansion by a factor of α decreases the rate ( frequency ) by 1 / α . by introducing α in the phasor part of the expression in eq . 4 , the original rate of the signal is maintained ; in other words , the frequency characteristics remain unchanged with time - scale expansion ( or contraction ). mp reconstruction using the tf - scaled atoms provides the desired tf - scaled signal x ( t ′), which may be expressed as x  ( t ′ ) = ∑ n = 0 m - 1  a n  g γ ′  n  ( t ′ ) , ( 5 ) where m is the total number of coherent tf structures provided by mp decomposition . the inverse tf scaling part shown in fig1 is preferred , but not essential , in order to verify the scaling procedures . after tf scaling , the temporal and / or spectral properties of the signals are changed , and verification of the scaling process becomes difficult . therefore , for quantitative evaluation of the scaling process , an inverse scaling procedure was also implemented , where the variable t ′ and ƒ ′ are transformed back to t and ƒ , by using the scale parameters 1 / α and 1 / β , respectively . if there is no distortion caused by the scaling transformations and the mp decomposition procedures , the denoised signal x ( t ) and the inverse - scaled signal x ″( t ) should be identical . we have observed that because of certain characteristics of vag signals , they cannot be easily analyzed by common signal processing techniques such as the fourier transform . techniques such as autoregressive modeling cannot accurately characterize a nonstationary signal like a vag signal . we have found that a nonstationary signal analysis tool such as a joint time - frequency distribution ( tfd ) may be used . a preferred tfd for vag signals may be one that can give an accurate display of vag characteristics with reasonable tf resolution and cross - term suppression , and can emphasize in the tf plane the expected characteristics of vag signals . a preferred tfd may be utilized in feature extraction and identification methods . if x ( t ) is a signal and tfd ( t , ω ) is its joint tfd , then the following are criteria that the tfd preferably , but not necessarily , should satisfy [ 23 ]: total energy : ∫∫ tfd ( t , ω ) dtdω =∫\| x ( t )\| 2 dt =∫\| x ( ω )\| 2 dw where x ( ω ) is the fourier transform of ( x ) t . this criterion indicates that at a particular t and ω , tfd ( t , ω ) gives the fractional energy of the signal . further , tfd ( t , ω ) may be viewed as a two - dimensional probability density function ( pdf ), with t and ω considered to be random variables . invariance : the tfd should be invariant to linear shifts in time and frequency . in most cases it is also expected that the tfd is scale - invariant . the invariance criterion helps in understanding the tf localization , and helps in extracting meaningful features . positivity : for a tfd to be positive , it is required that tfd ( t , ω )& gt ; 0 for all t and ω . the positivity criterion helps in treating the tfd as a pdf . if a tfd possesses negative values , it could pose severe interpretation problems and may not be suitable for objective feature extraction and identification purposes . marginals : the interpretation of tfds as pdfs help in extracting the marginal distributions by integrating either in the time or frequency direction . integration along frequency gives the instantaneous energy of the signal : ∫ tfd ( t , ω ) dw =\| x ( t )\| 2 . integration along time gives the power spectral density of the signal : ∫ tfd ( t , ω ) dt =\| x ( ω )\| 2 . global expectation values : global expectation values may give an idea about signal behaviour at a particular time and frequency . e { g ( t , ω )}=∫∫ g ( t , ω ) tfd ( t , ω ) dtdω . e { g ( t , ω )} expresses a generalized moment of a tfd . the function g ( t , ω ) is chosen according to the desired moment . local expectation values ; local expectation values may be obtained by applying the expectation operator with respect to time or frequency , and help in tracking non - stationary features such as instantaneous frequency and group delay of a signal . the instantaneous mean frequency is given by the time - varying first moment of the tfd along frequency . e l  { ω } = 1  x  ( l )  2  ∫ ω   t   f   d  ( t , ω )   ω . the group delay is given as the frequency varying first moment of the tfd along time e ω  { t } = 1  x  ( ω )  2  ∫ l   tfd  ( t , ω )   t . the group delay yields the mean time of arrival for a given frequency . finite support : if x ( t ) is zero at t 1 , then tfd ( f 1 , ω ) should be zero . also if x ( ω ) is zero at ω 1 , then tfd ( t , ω 1 ) should be zero . the simplest of all tfds is the spectrogram . the spectrogram of a signal is computed as the squared modulus of its short - time fourier transform ( stft ). spectrograms have inherent trade - off between time and frequency resolution , and do not satisfy the marginal and finite - support criteria . these shortcomings restrict application of the spectrogram as a tfd tool for vag signal analysis . among the other types of tfds available , the cohen &# 39 ; s class of bilinear tfds have received significant attention in signal analysis [ 23 ]. cohen &# 39 ; s class distributions are quadratic in nature . quadratic distributions have to perform a trade - off between joint tf resolution and the level of cross - terms . objective and subjective analysis of tfds indicate that cohen &# 39 ; s class of bilinear tfds are not preferred for vag signal extraction [ 22 ]. it is widely accepted that , in the case of complex signals where objective feature extraction is desired , there is no definite tfd that will satisfy all the criteria and still give optimal performance . the purpose of the methods described in this section is to construct tfds according to the properties of the signal being analyzed . such tfds may be referred to as adaptive tfds and may provide preferred tfds for the sonification method referred to herein . in one embodiment , the concept of adaptive tfds is based on signal decomposition . a block diagram of a method for adaptive tfd construction is shown in fig3 . it is assumed that the given signal is somehow decomposed into components of a specified mathematical representation . by knowing the components of the signal , the interation between them can be established and used to remove or prevent cross - terms . this avoids the main drawback associated with cohen &# 39 ; s class tfds for which numerous efforts have been directed to develop kernels to overcome the cross - term problem . the components obtained from a decomposition algorithm depend largely on the type of basis functions used . in one example , the basis function of the fourier transform decomposes the signal into tonal ( sinusoidal ) components , and the basis function of the wavelet transform decomposes the signal into components with good time and scale properties . for tf representation , it preferred if the signal is decomposed using basis functions with good tf properties . the mp algorithm described below can suitably decompose a signal into tf atoms . matching pursuit ( mp ) is a signal decomposition algorithm that decomposes a given signal using basis functions that have excellent tf properties . the mp algorithm selects the decomposition vectors depending upon the signal &# 39 ; s properties . the vectors are selected from a family of waveforms called a dictionary . the signal x ( t ) is projected onto a dictionary of tf atoms obtained by scaling , translating and modulating a window function g ( t ): x  ( t ) = ∑ n - 0 ∞  a n  g γ   n  ( t ) , ( 6 ) where g γ   n  ( t ) = 1 s n  g  ( t - p n s n )  exp [ j ( 2  π   f n  t + φ n ] ( 7 ) and α n are the expansion coefficients . the scale factor s n is used to control the width of the window function , and the parameter p n controls temporal placement . 1 s n is a normalizing factor that restricts the norm of g γn ( t ) to 1 . γ n represents the set of parameters ( s n , p n , ƒ n , φ n ). in the present invention , the window is a gaussian function , i . e . g ( t )= 2 ¼ exp (− πt 2 ); the tf atoms are then gabor atoms . in practice , the algorithm works as follows . the signal is iteratively projected onto a gabor function dictionary . the first projection decomposes the signal into two parts : x ( t )=( x , g γ0 ) g γ0 ( t )+ r 1 x ( t ) ( 8 ) where ( x , g γ0 ) denotes the inner product ( projection ) of x ( t ) with the first tf atom g γ0 ( t ). the term r 1 x ( t ) is the residue after approximating x ( t ) in the direction of g γ0 ( t ). this process is continued by projecting the residue onto the subsequent functions in the dictionary , and after m iterations x  ( t ) = ∑ n = 0 m - 1  〈 r n  x , g γ   n 〉  g γ   n  ( t ) + r m  x  ( t ) , ( 9 ) where r 0 x ( t )= x ( t ). there are two ways of stopping the iterative process : one is to use a prespecified limiting number m of the tf atoms , and the other is to check the energy of the residue r m x ( t ). a very high value of m and a zero value for the residual energy will decompose the signal completely at the expense of increased computational complexity . in one embodiment , decomposition is stopped after extracting the first m coherent structures of the signal , determined using a decay parameter [ 21 ]. λ  ( m ) = 1 -  r m  x  2  r m - 1  x  2 ( 10 ) in eq . 10 , \|\| r m x \|\| 2 denotes the residual energy at the mth iteration . the decomposition is continued until the decay parameter does not reduce any further . at this stage , the selected components represent the coherent structures and the residue represents the incoherent structures in the signal with respect to the dictionary . the residue may be assumed to be due to random noise , since it does not show any tf localization . the signal reconstructed using the m coherent structures extracted , i . e ., x  ( t ) = ∑ n - 0 m - 1  〈 r n  x , g γ   n 〉  g γ   n  ( t ) , ( 11 ) a signal - decomposition based tfd may be obtained by taking the wigner - ville distribution ( wvd ) of the tf atoms obtained from the mp algorithm ( 11 ) and is given as w  ( t , ω ) = ∑ n - 0 m - 1   〈 r n  x , g γ   n 〉  2  wg γ   n  ( t , ω ) + ∑ n - 0 m - 1  ∑ m = 11 n ≠ 11 m - 1  〈 r n  x , g γn 〉  〈 r m  x , g γ   m 〉 * × w [ g γ   n , g γ   m ]  ( t , ω ) ( 25 ) where wg γn ( t , ω ) is the wvd of the gaussian window function . the double sum corresponds to the cross - terms of the wvd indicated by w [ gγn , gγn ] ( t , ω ) and should be rejected in order to obtain a cross - term free energy distribution of x ( t ) in the tf plane . thus , only the first term is retained , and the resulting tfd is given by w ′  ( t , ω ) = ∑ n = 0 m - 1   〈 r n  x , g γ   n 〉  2  wg γ   n  ( t , ω ) ( 26 ) this cross - term free tfd , referred to herein as the matching pursuit tfd ( mptfd ), has very good readability and is preferred for analysis of nonstationary , multicomponent signals such as vag signals from knee joints . the extraction of coherent structures makes mp a preferred tool for tf representation of signals with unknown snr . one of the drawbacks of the mptfd is that it does not satisfy the marginal properties . the mptfd may be modified to satisfy the marginal requirements , and still preserve its other important characteristics . one way to optimize the mptfd is by using the cross - entropy minimization method [ 23 , 24 ]. cross - entropy minimization is a general method of inference about an unknown probability density function ( pdf ) when there exists a prior estimate of the function and new information in the form of constraints on expected values is available . if the optimized mptfd or omp tfd ( an unknown pdf ) is denoted by m ( t ,), then it should satisfy the marginals . ∫ m ( t , 107 ) dω =\| x ( t )\| 2 = m ( t ) ( 12 ) ∫ m ( t , ω ) dt =\| x ( ω )\| 2 = m ( ω ) ( 13 ) equations ( 12 ) and ( 13 ) may be treated as constraint equations ( new information ) for optimization . now , m ( t ,) may be obtained from w ′( t ,) ( a prior estimate of the function ) by minimizing the cross - entropy between them , given by ii  ( m , w ′ ) = ∫ ∫ m  ( t , ω )  log  ( m  ( t , ω ) w ′  ( t , ω ) )   t   ω . ( 14 ) as we are interested only in the marginals , the omp tfd may be written as [ 24 ] m ( t , ω )= w ′( t , ω ) exp {−[ α 0 ( t )+ β 0 ( ω )]} ( 15 ) where the α &# 39 ; s and β &# 39 ; s are lagrange multipliers which may be determined using the constraint equations . an iterative algorithm to obtain the lagrange multipliers and solve for m ( t , ω ) is presented next . m 1 ( t , ω )= w ′( t , ω ) exp [− α 0 ( t )] ( 16 ) as the marginals are to be satisfied , the time marginal constraint has to be imposed in order to solve for α n ( t ). by imposing the time marginal constraint given by ( 12 ) on ( 16 ), we obtain α 0  ( t ) = ln  ( m ′  ( t ) m  ( t ) ) ( 17 ) where m ( t ) is the desired time marginal and m ′( t ) is the time marginal estimated from w ′( t , ω ). now , eq . ( 16 ) can be written as m 1  ( t , ω ) = w ′  ( t , ω )   m  ( t ) m ′  ( t ) ( 18 ) at this point , m 1 ( t , ω ) is a modified mptfd with the desired time marginal ; however , it may not necessarily have the desired frequency marginal m ( ω ). in order to obtain the desired frequency marginal , the following equation has to be solved : m 2 ( t , ω )= m 1 ( t , ω ) exp [− β 0 ( ω )] ( 19 ) note that the tfd obtained after the first iteration m 1 ( t , ω ) is used as the incoming estimate in ( 19 ). by imposing the frequency marginal constraint given by ( 13 ) on ( 19 ), we obtain β 0  ( ω ) = ln  ( m ′  ( ω ) m  ( ω ) ) ( 20 ) where m ( ω ) is the desired frequency marginal , and m ′( ω ) is the frequency marginal estimated from w ′( t , ω ). now , ( 20 ) can be rewritten as m 2  ( t , ω ) = m 1  ( t , ω )   m  ( ω ) m ′  ( ω ) ( 21 ) by incorporating the desired marginal constraint , the m 2 ( t , ω ) tfd may be altered and may not necessarily give the desired time marginal . successive iteration could overcome this problem and modify the desired tfd to get closer to m ( t , ω ). this follows from the fact that the cross - entropy between the desired tfd and the estimated tfd decreases with the number of iterations [ 24 ]. as the iterative procedure is started with a positive distribution w ′ ( t , ω ), the tfd at the nth iteration m n ( t , ω ) is guaranteed to be a positive distribution . such a class of distributions belongs to the cohen - posch class of positive distributions [ 22 ]. the omp tfds are adaptive tfds because they are constructed on the basis of the properties of the signal being analyzed . a method for constructing a positive distribution using a spectrogram as a priori knowledge was developed by loughlin et al . [ 30 ]. the major drawback of using the spectrogram as a priori knowledge is the loss of tf resolution : this effect may be minimized by taking multiple spectrograms with analysis windows of different sizes as initial estimates of the desired distribution . the method proposed herein starts with the mptfd , overcomes the problem of using multiple spectrograms as initial estimates , and produces a high - resolution tfd tailored to the characteristics of the signal at hand . it is known that vag signals are multicomponent signals [ 11 ]. hence , in tf scaling , shifting all the components of a vag signal to a different frequency band may not bring out the event of interest , and may obscure the features of diagnostic value . in an effort to facilitate ad of only the important characteristics of vag signals , a sonification algorithm is proposed . a block diagram of the proposed sonification method is shown in fig2 . in sonification , features extracted from the data are used to control a sound synthesizer . the sound signal generated does not bear a direct relationship to the original data . a simple example of a sonification technique is mapping of parameters derived from a data stream to ad parameters such as pitch and loudness . the sonification algorithm involves amplitude modulation ( am ) and frequency modulation ( fm ). the instantaneous mean frequency ( imf ) of a signal is an important parameter in characterizing multicomponent , nonstationary signals such as a vag signal [ 22 ]. the fm part of the sonified signal is obtained by frequency - modulating a sinusoidal waveform with the imf of the signal . the auditory characteristics of the fm part alone will be tonal , which could quickly cause boredom and fatigue . to obviate this problem , an am part is obtained as the absolute value of the analytic version of the vag signal . the am part provides an envelope to the signal and frequency deviation ( bandwidth ) about the imf . the imf - based sonification algorithm is summarized as follows : 1 . construct a positive tfd [ 23 , 11 ], preferably an mptfd or an opm tfd , of the signal . 2 . extract the imf ( frequency parameter fp ( t )) as the first central moment of the tfd along the frequency axis . 3 . lowpass - interpolate the fp ( t ) waveform by the required time - scale factor ; that is , obtain fp ( t ′), where t ′= αt . 4 . take the hilbert transform of the denoised vag signal and form its analytic representation as \| α ( t )\|={ square root over ( x 2 ( t )+( h { x ( t )}) 2 )} ( 23 ) 6 . lowpass - interpolate the envelope by the required time - scale factor ; that is , obtain α ( t ′). 7 . construct the sonified signal x s ( t ′) by combining the envelope and the imf components , i . e ., x s ( t ′)=\| α ( t ′)\| cos ( ƒ t ′ − ω 2 πfp ( τ ′) dτ ′+ φ 0 ), ( 24 ) where φ 0 is an arbitrary phase constant . the derivative of the phase of α ( t ) may be used to extract the imf of the signal . extensive research has been conducted on the extraction of the imf of a signal via the phase of its analytic form [ 24 , 25 , 23 , 26 ]. however , it has been observed that the imf extracted via the phase of the analytic signal often leads to paradoxical results such as the imf taking negative and non - interpretable values [ 25 , 26 , 27 ]. the approach of using tfds to extract the imf provides an interpretable value that is always positive [ 23 , 11 ]. it helps in auditory analysis of a multicomponent nonstationary signal in terms of its main features such as fp ( t ) and α ( t ). fp ( t ) takes high values for transients and noise . however , by making use of the envelope ( intensity ) information , noise can be made less audible as compared to transients . if fp ( t ) is in the subaudible range , it can be shifted to the audible band by frequency scaling . frequency scaling can be easily achieved by just multiplying fp ( t ) by the required frequency scale factor β ; that is , fp ′( t )= βfp ( t ). integration of fp ( t ) ensures a continuous phase , and the method does not require any phase unwrapping . in the case of a noisy signal , fp ( t ) will have an almost uniform waveform , and does not provide much information unless the envelope can contribute some information . in the present study , this problem is overcome by processing denoised versions of the vag signals . it is obvious that the sonification method of the present invention may not be applicable to information - rich signals such as speech : the formant structure of voiced speech cannot be represented by the relatively simple imf . for ad of signals with rich spectral information , audification might be the better choice . test subjects sat on a rigid table in a relaxed position with the leg being tested freely suspended in air . the vag signal was detected on the skin surface at the mid - patella position of the knee by using vibration sensors ( dytran 3115a accelerometers ) as the subject swung the leg over an approximate angle range of 135 °→ 0 °→ 135 ° in 4s . the vag signal was prefiltered by a bandpass filter of bandwidth 10 hz to 1 khz and amplified using isolation pre - amplifiers ( gould , cleveland , ohio , model 11 - 5407 - 58 ) and universal amplifiers ( gould , model 13 - 4615 - 18 ) before digitizing . a data acquisition board ( national instruments , austin , tex ., at - mio - 16l ) and lab windows software ( national instruments ) were used to digitize the signals at a sampling rate of 2 khz and 12 bits per sample . details of data acquisition may be found in krishnan et al . [ 9 ]. for the sake of illustration , plots of an abnormal vag signal of a patient with chondromalacia patella grade ii and iii , and the processed versions of the signal are presented . fig4 shows the original vag signal and the spectrogram of the signal is shown in fig5 . the spectrograms and related entities of the audified and the sonified versions of the signal are shown in fig6 to 9 . the spectrogram of the processed versions clearly indicate the effects of time - scaling when compared to the original spectrogram shown in fig6 . the envelope and the imf of the signal are shown in fig7 and 8 , respectively . the spectrogram shown in fig9 clearly illustrates the envelope - imf behavior of the sonified signal . as will be apparent to those skilled in the art , various modifications , adaptations and variations of the foregoing specific disclosure can be made without departing from the scope of the invention claimed herein . the following references are referred to above as a numeral within square brackets ([ x ]). the contents of each such reference is incorporated herein as if reproduced herein in their entirety . r . a . b . mollan , g . c . mccullagh , and r . i . wilson . a critical appraisal of auscultation of human joints . clinical orthopaedics and related research , 170 : 231 - 237 , 1982 . c . f . walters . the value of joint auscultation . lancet , 1 : 920 - 921 , 1929 . m . l . chu , l . a . gradisar , and r . mostardi . a noninvasive electroacoustical evalution technique of cartilage damage in pathological knee joints . medical and biological engineering and computing , 16 : 437 - 442 , 1978 . g . f . mccoy , j . d . mccrea , d . e . beverland , w . g . kernohan , and r . a . b . mollan . vibration arthrography as a diagnostic aid in disease of the knee . journal of bone and joint surgery , 69 - b ( 2 ): 288 - 2931 1987 . y . nagata , joint - sounds in gonoarthrosis — clinical application of phonoarthrography for the knees . journal of uoeh , 10 ( 1 ): 47 - 58 , 1988 . s . tavathia , r . m . rangayyan , c . b . frank , g . d . bell , k . o . ladly , and y . t . zhang . analysis of knee vibration signals using linear prediction . ieee trans . biomedical engineering , 39 ( 9 ): 959 - 970 , 1992 . n . p . reddy , b . m . rothschild , m . mandal , v . gupta , and s . suryanarayanan . noninvasive acceleration measurements to characterize knee arthritis and chondromalacia . annals of biomedical engineering , 23 : 78 - 84 , 1995 . z . m . k . moussavi , r . m . rangayyan , g . d . bell , c . b . frank , k . o . ladly , and y . t . zhang . screening of vibroarthrographic signals via adaptive segmentation and linear prediction modeling , ieee trans . biomedical engineerings , 43 ( 1 ): 15 - 23 , 1996 . s . krishnan , r . m . rangayyan , g . d . bell , c . b . frank , and k . o . ladly . adaptive filtering , modelling , and classification of knee joint vibroarthrographic signals for non - invasive diagnosis of articular cartilage pathology . medical and biological engineering and computing , 35 : 677 - 684 , november 1997 . r . m . rangayyan , s . krishnan , g . d . bell , c . b . frank , and k . o . ladly , parametric representation and screening of knee joint vibroarthrographic signals . ieee trans . biomedical engineering , 44 ( 11 ): 1068 - 1074 , november 1997 . s . krishnan , r . m . rangayyan , g . d . bell , and c . b . frank . adaptive time - frequency analysis of knee joint vibroarthrographic signals for non - invasive screening of articular cartilage pathology . ieee transactions on biomedical engineering , 47 ( 6 ): 773 , june , 2000 . c . hayward , listening to the earth sing . in g . kramer , editor , auditory display : sonification , audification , and auditory interfaces , pages 369 - 404 . addison wesley , reading , mass ., 1994 . x . zhang , l .- g . durand , l . senhadji , h . c . lee , and j .- l . coatrieux . analysis - synthesis of the phonocardiogram based on the matching pursuit method . ieee trans . biomedical engineering , 45 ( 8 ): 962 - 971 , august 1998 . v . t . fitch and g . kramer . sonifying the body electric : superiority of an auditory over a visual display in a complex , multivariate system . in g . kramer , editor , auditory display : sonification , audification , and auditory interfaces , pages 369 - 404 . addison wesley , reading , mass ., 1994 . t . f . quatieri , r . b . dunn , and t . e . hanna . a subband approach to time - scale expansion of complex acoustic signal . ieee trans . speech and audio processing , 3 : 515 - 519 , 1995 . r . m . rangayyan , a . c . g . martins , and r . a . ruschioni , aural analysis of image texture via cepstral filtering and sonification . in proc . spie vol . 2656 on visual data exploration and analysis iii , pages 283 - 294 , san jose , calif ., january 1996 . a . c . g . martins , r . m . rangayyan , l . a . portela , e . amaro jr ., and r . a . ruschioni . auditory display and sonification of textured images . in proc . third international conference of auditory display , pages 9 - 11 , palo alto , calif ., november 1996 . p . meijer . an experimental system for auditory image representation . ieee trans . biomedical engineering , 39 ( 2 ): 112 - 121 , 1992 . d . l . mansur , m . m . blattner , and k . l . joy . sound graphs : a numerical data analysis method for the blind . journal of medical systems , 9 ( 3 ): 163 - 174 , 1985 . d . malah . time - domain algorithm for harmonic bandwidth reduction and time scaling of speech signals . ieee trans . acoustics , speech , and signal processing , 27 ( 2 ): 121 - 133 , april 1979 . s . g . mallat and z . zhang . matching pursuit with time - frequency dictionaries . ieee trans . signal processing , 41 ( 12 ): 3397 - 3415 , 1993 . s . krishnan . adaptive signal processing techniques for analysis of knee joint vibroarthrographic signals . ph . d . disertation , university of calgary , calgary , ab , canada , june 1999 . l . cohen . time - frequency distributions - a review . proc . ieee , 77 : 941 - 981 , 1989 . d . gabor . theory of communication . proc . ieee , 93 : 429 - 457 , 1946 . b . boashash . estimating and interpreting the instantaneous frequency of a signal - part 1 : fundamentals . proc . ieee , 80 ( 4 ): 519 - 538 , april 1992 . p . j . loughlin and b . tracer . on the amplitude - and frequency - modulation decomposition of signals . journal of the acoustical society of america , 100 ( 3 ): 1594 - 1601 , september 1996 . p . j . loughlin . comments on the interpretation of instantaneous frequency . ieee signal processing letters , 4 ( 5 ): 123 - 125 , may 1997 . l . r . rabiner and r . w . schafer . digital processing of speech signals . prentice - hall , englewood cliffs , n . j ., 1978 . s . krishnan and r . m . rangayyan . automatic denoising of knee joint vibration signals using adaptive time - frequency representations . medical and biological engineering and computing , page in press , 2000 . p . loughlin , j . pitton , and l . atlas , construction of positive time - frequency distributions . ieee trans . signal processing , 42 , 2697 - 2705 , october 1994 .	0
preferred embodiments of the present invention will hereinafter be described in detail with reference to the accompanying drawings . fig1 shows a speed reduction motor according to an embodiment of the present invention . the speed reduction motor comprises a motor mechanism 31 and a speed reduction mechanism 41 . the motor mechanism 31 is arranged as follows : a stator coil 3 is fitted around a stator iron core 2 . a rotor iron core 4 is securely fixed to a rotary shaft 5 . the stator iron core 2 is secured to a stator frame part 42b integrally formed in a gear casing 42 . that is , the stator frame part 42b is a part of the gear casing in this embodiment . a rear bracket 32 is attached to the stator frame part 42b at a rear end portion thereof , and the rear bracket 32 supports a rear end portion of the shaft 5 through a bearing 8 . a fan 33 is securely fixed to a rear end of the shaft 5 . a fan cover 34 is attached to the rear bracket 32 . the speed reduction mechanism 41 is arranged as follows : the gear casing 42 for hermetically housing gear members is formed integrally with a rear gear bracket part 42a , the stator frame part 42b and a main body part 40 , and is provided with a mounting leg 42c at the lower part of the main body part 40 . the gear casing is further provided with an opening portion 42d at the lower part of the main body part 40 . the opening portion 42d has a size large enough to allow each gear member ( described later ) to pass therethrough . the rear gear bracket part 42a supports a front end portion of the shaft 5 through a ball bearing 15 . the shaft 5 has a first gear 16 at its front end portion . the first gear 16 is meshed with a second gear 43 which constitutes an intermediate gear member and has a relatively large diameter . the second gear 43 is fixedly secured to an intermediate gear shaft 44 supported at both ends by the gear casing 42 through ball bearings 46 and 47 . a stop ring 48 retains the ball bearing 47 so as to prevent an axial displacement of the ball bearing 47 . the intermediate gear shaft 44 is formed with a third gear 45 which is a pinion and is relatively small in diameter . the third gear 45 is meshed with a fourth gear 49 which constitutes an output gear and has a relatively large diameter . the fourth gear 49 is coupled through splines with an output power shaft 50 supported at its rear end by the rear gear bracket part 42a of the gear casing 42 through a sleeve bearing 51 and at its front portion to the main body part 40 of the gear casing 42 through a ball bearing 52 . an axial movement of the fourth gear 49 is prevented by an abutment piece 53 . a stop ring 54 retains the ball bearing 52 so as to prevent an axial movement of the ball bearing 52 . reference numerals 28 and 29 designate oil seal members . the gear casing 42 is formed with a hole through which the ball bearing 47 is inserted so that a boss portion 42e supports the bearing 47 . a cap 55 is provided for covering the hole . as shown in fig2 ( a ) and 2 ( b ), the boss portion 42e is provided with a notch 42f on the opening portion 42d side so that an inside of the boss portion 42e communicates with an outside thereof through the notch 42f . the notch 42f has a width so as to allow the front end of the intermediate shaft 44 to pass radially therethrough . turning to fig1 the opening portion 42d has such a size that the length of the opening portion 42d in the outer circumferential direction of the gear casing 42 is determined so as to allow the fourth gear 49 to pass therethrough , whereas the width of the opening portion 42d in the axial direction is determined so as to allow the intermediate gear shaft 44 , to which the second gear 43 and the ball bearing 46 are secured , to pass therethrough . the opening portion 42d is oil - sealed by a cover 56 . the cover 56 is provided with a packing plate which is made of nitrile rubber or the like and which is heat - stuck to the cover 56 . the opening portion 42d is provided at the lower part of the gear casing 42 , so that the opening portion cannot be seen when the speed reduction motor is installed in place by the mounting leg 42c , thus enhancing the aesthetic outer appearance . a manner for assembling the gear members within the gear casing 42 will now be described . the gear casing 42 is placed in a state that the front side thereof is directed upwardly , the sleeve bearing 51 is inserted into a boss portion provided in the rear gear bracket part 42a , and the abutment piece 53 is put on the boss portion . the fourth gear 49 is put on the abutment piece 53 . the output shaft 50 , onto which the ball bearing 52 is fitted , is inserted into the fourth gear 49 , the abutment piece 53 and the sleeve bearing 51 in this order from above , and then the stop ring 54 is fitted onto the gear casing 42 . the intermediate gear shaft 44 , onto which the ball bearing 46 is fitted and the second gear 43 is securely fixed , is inserted through the opening portion 42d in such a position that an axis of the shaft 44 is kept substantially parallel to that of the shaft 50 which has been installed in the casing 42 . in this insertion of the shaft 44 , the front end portion of the intermediate gear shaft 44 passes through the notch 42f , so that the front end portion of the intermediate gear shaft 44 is inserted in the inside of the boss portion 42e . then the intermediate shaft 44 with the ball bearing 46 and the second gear 43 is moved downwardly i . e ., toward a boss portion for the ball bearing 46 so that the ball bearing 46 is inserted in the boss portion . after that , the ball bearing 47 is fitted to the front end portion of the intermediate gear shaft 44 from above , and then , the stop ring 48 is fitted onto the inside of the boss portion . as described above , the intermediate gear shaft 44 can be inserted into the gear casing 42 in such a position that the ball bearing 46 and the second gear 43 are assembled on the shaft 44 outside of the casing 42 in advance , so that the gear members which are installed in the gear casing 42 are assembled with high machining efficiency even if the gear casing 42 is made of one piece . additionally , in the above - described embodiment , the notch 42f is provided in the boss portion 42e at the side of the opening portion 42d , but the present invention should not be restricted thereto . for example , without the notch 42f , the intermediate gear shaft 44 , onto which the ball bearing 46 and the second gear 43 are secured , may be inserted through the opening portion in an oblique state , thereby accommodating the shaft 44 within the gear casing 42 . further , in the above - described embodiment , the gear casing 42 is provided with the mounting leg 42 and the opening portion 42d at the lower portion of the gear casing 42 , but the present invention should not be restricted thereto . for example , the mounting leg may be provided on the front end portion of the gear casing and , on the other hand , the opening portion may be provided in any portion of the outer circumference of the gear casing , which the intermediate gear shaft or the intermediate gear faces . further , in the above described embodiment , the gear casing 42 is formed such that the main body part of the gear casing 42 is formed integrally and simultaneously with the rear gear bracket part 42a and the stator frame part 42b as a single construction , but the present invention should not be restricted thereto . for example , the gear casing may be formed by separated members , one of which is a main body part formed integrally with a rear gear bracket part , and the other of which is a stator frame . according to the present invention , in a speed reduction motor in which intermediate gear members are interposed between a first gear formed on the front end portion of a rotary shaft of a motor and a forth gear provided on an output shaft , so as to reduce and transmit the rotation of the motor in a two - stage manner , a gear casing is arranged in such a manner that a main body part is formed integrally with a rear gear bracket ( or may be formed with both a stator frame and a rear gear bracket ), an opening portion is provided on the outer circumference of the gear casing so as to accommodate the fourth gear and the intermediate gear shaft therethrough within the gear casing in a state that a bearing is fitted to an end portion of the intermediate gear shaft and an intermediate gear is secured to or formed integrally with the intermediate gear shaft . as a result , the gear casing is worked or machined in the reduced number of the working steps , assembling of the gear members is performed with a high accuracy and the noise generated by the gear members is reduced . further , the intermediate gear members may be assembled in advance outside of the gear casing , and then , the assembled intermediate gear members are accommodated within the gear casing , so that the work efficiency is improved . although the gear casing has an integral structure for entirely encasing the gear members , due to the provision of the opening portion of an appropriately large size , in the case where the gear casing is produced especially by the die casting , a core of molds can be drawn through the opening portion , so that it is not necessary to form the gear casing having an excessive thickness . as a result , a thickness of the gear casing can be reduced . further , a mounting leg is provided on a lower portion of the gear casing and the opening portion is formed on the lower portion , so that the outer appearance of the gear casing is enhanced . further , a notch or slit is formed on a boss portion , which is for supporting the front end of the intermediate gear shaft through a bearing , at a side of the opening portion , and the notch or slit is communicated with the inside of the boss portion , so that the front end of the intermediate gear shaft passes through the notch or slit from the outside of the boss portion to the inside thereof . therefore , when the intermediate gear shaft is accommodated within the gear casing through the opening portion , the intermediate gear , to which the bearing is fitted at its rear end , and the intermediate gear is securely fixed in advance outside of the casing can be inserted in place within the casing in such a position that the axis of the intermediate gear is kept substantially parallel to that of the output shaft . as a result , assembling becomes easy , and further , automatic assembling can be performed .	5
in the following detailed description , reference is made to the accompanying drawings , which form a part hereof , and in which is shown by way of illustration specific embodiments in which the invention may be practiced . in this regard , directional terminology , such as “ top ,” “ bottom ,” “ front ,” “ back ,” “ leading ,” “ trailing ,” etc ., is used with reference to the orientation of the figure ( s ) being described . because components of embodiments of the present invention can be positioned in a number of different orientations , the directional terminology is used for purposes of illustration and is in no way limiting . it is to be understood that other embodiments may be utilized and structural or logical changes may be made without departing from the scope of the present invention . the following detailed description , therefore , is not to be taken in a limiting sense , and the scope of the present invention is defined by the appended claims . fig1 illustrates transceiver module 10 , face plate 11 , cage 12 , and printed circuit board ( pcb ) 14 in accordance with the present invention . cage 12 is shown mounted to pcb 14 . cage 12 can be secured to pcb 14 in various ways consistent with present invention . face plate 11 is fixed the pcb 14 and typically includes a plurality of openings . cage 12 is illustrated extending through one of the openings in face plate 11 . cage 12 may be further secured to faceplate 11 with outwardly - extending prongs or springs or the like . only a single cage 12 is illustrated extending through faceplate 11 for ease of illustration , but one skilled in the art will recognize that a multiplicity of cages can be mounted to pcb 14 and extend through faceplate 11 to receive a multiplicity of transceivers in accordance with the present invention . cage 12 includes cage latch 16 . in fig1 , transceiver module 10 is shown inserted into cage 12 and secured by cage latch 16 . cage latch 16 is resiliently biased to move toward transceiver module 10 thereby securing transceiver module 10 within cage 12 . cage latch 16 can also be moved away from transceiver module 10 so that transceiver module 10 can be extracted from cage 12 , as will be described in more detail below . transceiver module 10 includes input / output receptacles 20 in its front face 21 . input / output receptacles 20 may be used to provide both input and output for optical and electrical signals to and from transceiver module 10 . in other embodiments , one or more input / output receptacle 20 may be used . front face 21 of transceiver module 10 is referred to as being at the front of transceiver module 10 . however , in this regard , such directional terminology is used with reference to the orientation of the figures being described and is in no way meant to be limiting . one skilled in the art will recognize that components of embodiments of the present invention can be positioned in a number of different orientations . in operation , optical and electrical signals can be transmitted to and from a destination or source that is plugged into input / output receptacles 20 to transceiver module 10 . when transceiver module 10 is plugged into cage 12 , it is in electrical communication with pcb 14 via the connections therebetween . thus , signals can be sent to and from the pcb via transceiver module 10 . transceiver module 10 is hot pluggable and may be removed from cage 12 and replaced . fig2 illustrates an exploded isometric view of the top - front side of a first configuration of transceiver module 10 . transceiver module 10 includes housing 22 which receives transceiver opto - electronic components 24 and electromagnetic interference ( emi ) shield 26 . in the first configuration of transceiver module 10 , release handle 27 and actuator wedge 28 are attached to housing 22 in manners described in greater detail below . a mode indicator button 30 is attached to housing 22 to indicate the particular mode of transceiver module 10 . module cover 32 is configured to fit over housing 22 of transceiver module 10 and protects opto - electronic components 24 . module cover 32 also helps secure module 10 in cage 12 when it is inserted therein , and also helps secure release handle 27 and actuator wedge 28 to housing 22 . in one embodiment , housing 22 is formed of a die cast or molded conductor , such as metal or conductive plastic , while module cover 32 is formed from stamped and shaped sheet metal . release handle 27 is formed of shaped wire , while wedge 28 and mode indicator button 30 are formed of a plastic material . in a second configuration of transceiver module 10 , the same housing 22 , opto - electronic components 24 , emi shield 26 , mode indicator button 30 and module cover 32 are utilized , but release handle 27 and actuator wedge 28 are omitted from transceiver module 10 . in this manner , different end - user configuration requirements for the transceiver module 10 can be satisfied with common components . in particular , housing 22 can be used for at least two different transceiver module configurations . as best seen in fig3 , the bottom side of housing 22 provides a surface 33 . a latch boss 34 extends away from surface 33 such that the top of latch boss 34 is raised relative to surface 33 . latch boss 34 extends away from surface 33 and is configured to engage cage latch 16 of cage 12 ( best seen in fig4 ). specifically , when transceiver module 10 is inserted into cage 12 , latch boss 34 deflects latch 16 slightly away from transceiver module 10 such that latch boss 34 travels past the front edge 36 of latch 16 and toward latch slot 40 in latch 16 . when transceiver module 10 is fully inserted into cage 12 , latch boss 34 is aligned with latch slot 40 such that latch boss 34 extends through latch slot 40 . latch 16 is configured with a bias such that when latch boss 34 is fully aligned with latch slot 40 , latch 16 transitions toward transceiver module 10 . in this way , transceiver module 10 will be locked into cage 12 . in one embodiment , latch boss 34 and latch slot 40 are configured to be triangular in shape and complement each other such that latch boss 34 fits through latch slot 40 . although latch slot 40 is specified as triangular in shape in the above - referenced small form - factor pluggable transceiver multi - source agreement , latch boss 34 and latch slot 40 may have shapes other than the triangular shape illustrated in the figures . the shapes of latch boss 34 and latch slot 40 may be the same ( i . e ., both triangular , rectangular , circular , etc . ), or may be different , so long as latch slot 40 is capable of securely engaging latch boss 34 . in the first configuration of transceiver module 10 , release handle 27 is mounted in trough 37 or similar openings on housing 22 . handle 27 is mounted in trough 37 such that it can be rotated relative to transceiver module 10 . release handle 27 includes cam portion 39 . as described in greater detail below , when handle 27 is rotated , cam portion 39 engages actuator wedge 28 and causes wedge 28 to move away from front face 21 of transceiver module 10 . in one embodiment ( best seen in fig5 ), tab portions 43 of module cover 32 trap handle 27 within trough 37 when module cover 32 is installed on housing 22 . in the first configuration of transceiver module 10 , actuator wedge 28 ( seen in fig2 and 6 ) is slidably retained in a slot ( shown as t - slot 42 ) that is provided on surface 33 . slot 42 is configured to retain actuator wedge 28 such that wedge 28 can move toward and away from the front side 21 of transceiver module 10 , but so that it cannot move laterally . the engaging shapes of actuator wedge 28 and slot 42 may differ from the t - shape illustrated , so long as slot 42 retains actuator wedge 28 adjacent surface 33 and permits wedge 28 to move toward and away from the front side 21 of transceiver module 10 , but constrains lateral movement of actuator wedge 28 . actuator wedge 28 includes tines 44 spaced to accommodate latch boss 34 therebetween , such that when latch boss 34 is placed between tines 44 , as illustrated in the figures and described in greater detail below , linear movement of wedge 28 ( in the direction of arrow 45 in fig6 ) will not be impeded by latch boss 34 as wedge 28 moves away from the front face 21 of transceiver module 10 . tines 44 of wedge 28 are configured with ramp portions 52 . as wedge 28 moves away from the front face 21 of transceiver module 10 , ramp portions 52 of tines 44 engage latch 16 of cage 12 and deflect latch 16 away from surface 33 of module 10 . ramp portions 52 are illustrated as having a generally linear slope , but can also be designed with non - linear slopes . to extract transceiver module 10 from cage 12 , cage latch 16 must be moved away from surface 33 of transceiver module 10 a sufficient distance so that that latch slot 40 is removed from engagement with latch boss 34 and latch boss 34 clears the front edge 36 of latch slot 40 , as will be described more fully below . in the configuration of transceiver module 10 having release handle 27 and actuator wedge 28 , the release handle 27 can be used to release transceiver module 10 from cage 12 so that it can be extracted therefrom . in fig1 and 6 , release handle 27 is shown in a closed or 0 ° position , such that it is generally parallel with the front face 21 of transceiver module 10 . in one embodiment , cam portion 39 of release handle 27 does not engage wedge 28 when release handle 27 is in the closed postion . as release handle 27 is rotated from the initial closed position toward a second open position ( best seen in fig7 ), cam portion 39 moves away from the front of transceiver module 10 with the rotation , thereby engaging actuator wedge 28 and causing actuator wedge 28 to move in an approximately linear direction within slot 42 away from the front face 21 of transceiver module 10 with the rotation of release handle 27 . as wedge 28 moves away from front surface 21 , ramp portions 52 of wedge 28 engage cage latch 16 and deflect latch 16 away from surface 33 of transceiver module 10 and consequently away from latch boss 34 . in this way , the movement of wedge 28 against latch 16 pushes latch 16 off latch boss 34 and provides clearance for latch boss 34 to pass out of latch slot 40 . once adequate clearance is provided , transceiver module 10 can be removed from cage 12 , such as by pulling on handle 27 . in the configuration of transceiver module 10 in which release handle 27 and wedge 28 are not present , release tool 60 ( illustrated in fig8 a and 8b ) can be used to release transceiver module 10 from cage 12 so that it can be extracted therefrom . release tool 60 includes a handle portion 61 having connector engagement elements 62 at one end thereof . engagement elements 62 are configured to engage receptacles 20 of transceiver module 10 . actuator arm 64 extends past connector engagement elements 62 and is shaped to approximately resemble wedge 28 at its distal end 66 . accordingly , similar reference numbers are used herein to designate similar parts . as described above with respect to wedge 28 , when actuator arm 64 is actuated , such as by inserting the tool , ramp portion ( s ) 52 engages latch 16 of cage 12 and deflect latch 16 away from surface 33 of module 10 . to remove transceiver module 10 using release tool 20 , actuator arm 64 is inserted through gap or opening 70 in front face 21 of housing 22 . opening 70 is sized to receive actuator arm 64 and permit actuator arm 64 to pass unimpeded through slot 42 . from this first position , as removal tool 60 is advanced toward transceiver module 10 , connector engagement elements 62 engage receptacles 20 , and ramp portions 52 of actuator arm 64 engage cage latch 16 . ramp portion ( s ) 52 deflect latch 16 away from surface 33 of transceiver module 10 and consequently away from latch boss 34 to provide clearance for latch boss 34 to pass out of latch slot 40 . once actuator arm 64 of removal tool 60 is fully inserted and adequate clearance is provided , transceiver module 10 can be removed from cage 12 , such as by pulling on handle portion 61 of removal tool 60 . actuator arm 64 of removal tool 60 is illustrated as spatially fixed with respect to handle portion 61 and connector engagement elements 62 , such that connector engagement elements 62 engage receptacles 20 of transceiver module 10 concurrent with the engagement of actuator arm 64 and latch 16 . in other embodiments , actuator arm 64 may be movable with respect to handle portion 61 and connector engagement elements 62 , such that connector engagement elements 62 engage receptacles 20 of transceiver module 10 prior to the engagement of actuator arm 64 and latch 16 . typically , fiber optic components use color to designate mode ( e . g ., wavelength , contact type , product type , etc .). transceiver module 10 is generally small and only a small portion of transceiver module 10 is visible when installed in cage 12 . mode indicator button 30 ( fig2 a and 9 b ) provides a highly visible color signal adjacent the front face 21 of transceiver module 10 , and is visible from the front and top of transceiver module 10 . mode indicator button 30 is a molded plastic button ( in any desired color ) that is integral to the fiber optic input / output receptacles 20 of transceiver module 10 , thereby clearly providing mode information to a user and adding no size to transceiver module 10 . in one embodiment , mode indicator button 30 includes a recessed portion 80 in its back surface that is shaped to receive protrusion 81 of housing 22 . mode indicator button 30 may be secured to protrusion 81 by means including press fit and adhesive . in another embodiment , the positions of recessed portion 80 and protrusion 81 may be switched such that mode indicator button 30 has a protrusion receivable in a recessed portion of housing 22 . mode indicator button 30 can be used to designate transceiver module 10 optical mode information , or in specific applications can be used by the end - user to designate user specific information . mode indicator button 30 provides several advantages over previous color marking features , such as color coded molded handles . for example , mode indicator button is easily assembled for different mode configurations , adds no size to the transceiver module , and allows the use of either a handle 27 or a removal tool 60 to release the transceiver module 10 from cage 12 . previous color marking features , such as color coded molded handles , are obviously of no advantage in a transceiver module with no handle . although specific embodiments have been illustrated and described herein for purposes of description of the preferred embodiment , it will be appreciated by those of ordinary skill in the art that a wide variety of alternate and / or equivalent implementations calculated to achieve the same purposes may be substituted for the specific embodiments shown and described without departing from the scope of the present invention . those with skill in the mechanical , electromechanical , and electrical arts will readily appreciate that the present invention may be implemented in a very wide variety of embodiments . this application is intended to cover any adaptations or variations of the preferred embodiments discussed herein . therefore , it is manifestly intended that this invention be limited only by the claims and the equivalents thereof .	6
in the following embodiments , experimental methods in which specific conditions are unspecified are typically carried out under general conditions , e . g . the method described in short protocols in molecular biology ( edited by ausubel f . m ., kingston r . e ., seidman j . g . et al ., translated by ma , xuejun , shu , yuelong . beijing : science press , 2004 ) in the present invention , in order to establish the antibody detection method against dtmuv , the balb / c mice are immunized by a dtmuv strain ( fx 2010 ), after screened through monoclonal antibody preparation technology , to obtain the hybridoma cell lines that can secrete a monoclonal antibody against duck tembusu virus stably . in a preferred embodiment of the present invention , the monoclonal antibody secreted by one hybridoma cell line can specifically bind with e protein of dtmuv , having the activity of neutralizing dtmuv . the monoclonal antibody is named 1f5 . then , coating a elisa plate using purified duck tembusu virus ; adding the monoclonal antibody 1f5 , enzyme - labeled anti - mouse secondary antibody , color developing agent in sequence when the test serum reacts with coated antigen ; reading the absorbance value od 450nm using a microplate reader , calculating the inhibition rate of test serum , and establishing a block elisa method ( b - elisa ) for detecting dtmuv antibody . the further preferable conditions show that the optimal concentration of coated antigen is 3 μg / hole , the optimal dilution factor of the test serum is 1 : 10 , the optimal dilution factor of the monoclonal antibody 1f5 is 1 : 20 , the optimal dilution factor of the enzyme - labeled anti - mouse secondary antibody is 1 : 5000 . with higher sensitivity and specificity , the b - elisa method for detecting dtmuv antibody will present a promising prospect in the diagnosis of dtmuv disease . preparation and identification of a monoclonal antibody against duck tembusu virus duck tembusu virus ( dtmuv ) fengxian strain ( fx2010 strain ) was isolated and preserved by the laboratory ; the duck embryo fibroblasts ( def cells ) and sp2 / 0 cells were provided by the laboratory ; the clean grade balb / c mice were purchased from shanghai laccas experimental animals co ., ltd . the pcaggs - dtmuv - e recombinant eukaryotic expression plasmids were constructed and preserved by our laboratory . dmem was purchased from gbico ; 8 - azaguanine , peg1450 , hat , ht , freund &# 39 ; s complete adjuvant , freund &# 39 ; s incomplete adjuvant and hrp labeled goat - anti - mouse igg were purchased from sigma . dtmuv positive and negative sera , positive sera of avian influenza virus ( aiv ), newcastle disease virus ( ndv ), reticuloendotheliosis virus ( rev ), type - i duck hepatitis virus ( dhv - 1 ), reovirus ( rv ) and avian leukemia virus ( alv ) were preserved in our laboratory . the def cells were infected by virus seed fx2010 at a dose of 10 4 . 5 tcid50 ; in 72 hours , cells having over 70 % cpe were collected , after freeze - thaw for three times , inactivated for 24 h by 3 % formaldehyde . after high - speed centrifuge 7500 rpm for 2 hours , the supernatant was fetched , and then centrifuged by ultracentrifugation 30000 rpm 5 , to obtain the precipitation , to get the purified dtmuv . the protein concentration was determined and sub - packaged at − 70 ° c ., which were used as immunogen and coating antigen . after the purified dtmuv antigen was added with equal amount of freund &# 39 ; s complete adjuvant for emulsification , the 6 - 8 week female bab / c mice were injected with it subcutaneously from abdomen and back , 100 μg each mouse ; after the purified dtmuv antigen was added with equal amount of freund &# 39 ; s incomplete adjuvant for emulsification , immunization was performed for the second time and third time every two weeks , with the dose same as the first time of immunization ; two weeks after the third immunization , booster immunization was performed , and three days later , cells fusion started . the mouse peritoneal macrophages were prepared according to the conventional procedures , which were used as feeder cells . the spleen cells and myeloma cells ( sp2 / 0 ) were fused under the reaction of fusion agent peg1450 according to the ratio of 10 : 1 . after screening of the positive myeloma cells by indirect elisa , cloning was carried out according to limiting dilution analysis . results : through lymphocyte hybridoma technique and indirect elisa , the hybridoma supernatants were detected , to obtain three hybridoma cell lines that can stably secrete anti - dtmuv monoclonal antibody , which were named 1f5 , 7b5 , 1e5 respectively . 0 . 5 ml sterile paraffin oil was injected to abdominal cavity of mice , one week later , injected with 10 6 hybridoma cells , 7 - 10 days later , when distension of the abdomen caused by ascitic fluid of mice , the ascitic fluid was drawn , and subpackaged for standby . the duck embryo fibroblasts ( def cells ) were prepared and cultured in 6 - well plates . when the cell monolayers grown , def cells were infected by dtmuv , meanwhile , negative control holes were set . 24 hours after infection , the supernatant was discarded , and the cells were fixed with 4 % paraformaldehyde . after washed three times by pbst , hybridoma cultural supernatant was added , and incubated for 1 h at 37 ° c ., washed three times using pbst , added with fitc - goat anti - mouse igg antibody , continued to incubate for 1 hour at 37 ° c ., washed three times using pbst , and finally observed under a fluorescence microscope . those with green fluorescence were judged as positive , and those without fluorescence were judged as negative . results : def cells were infected by dtmuv . ifa was performed using three strains of monoclonal antibodies and the uninfected def cells were set as blank control ( mock ). the test results showed that , three strains of monoclonal antibodies 1f5 , 7b5 , 1e5 all could produce specific green fluorescence ( as shown in fig1 ), indicating that all three strains can specifically bind with dtmuv protein . in fig1 , ( a ): mab 1f5 ; ( b ): mock - 1f5 ; ( c ): mab 7b5 ; ( d ): mock - 7b5 ; ( e ): mab 1e5 ; ( f ): mock - 1e5 . identification of a monoclonal antibody against duck tembusu virus e protein 1 . identification of a monoclonal antibody again duck tembusu virus e protein 293 cells were cultured in 6 - well plates , when the cell monolayers grown , 293 cells were transfected by eukaryotic expression recombinant plasmid pcaggs - dtmuv - e , meanwhile , negative control holes were set . 24 hours after transfection , the supernatant was discarded , and the cells were fixed with 4 % paraformaldehyde . after washed once by pbst , hybridoma cultural supernatant was added , and incubated for 1 h at 37 ° c ., washed three times using pbst , added with fitc - goat anti - mouse igg antibody , continued to incubate for 1 hour at 37 ° c ., washed three times using pbst , and finally observed under a fluorescence microscope . those with green fluorescence were judged as positive , and those without fluorescence were judged as negative . results : through ifa detection of 293 t cells transfected by pcaggs - dtmuv - e eukaryotic plasmids , the controlled empty plasmid pcaggs - transfected 293t cells had no specific fluorescence ; while specific green fluorescence appeared in 1f5 ( as shown in fig2 ), but no green fluorescence in another two strains of monoclonal antibodies , which further confirmed that mab 1f5 was the monoclonal antibody of anti - dtmuv e protein . in fig2 , ( a ): pcaggs - dtmuv - e - transfected 293t cells ; ( b ): pcaggs - transfected 293t cells . the stain of hybridoma cell line that secreted monoclonal antibody against duck tembusu virus e protein , i . e . mouse hybridoma cell line 1f5 of anti - dtmuv e protein , was preserved in china center for type culture collection ( cctcc ) on jan . 17 , 2012 , with accession no . cctcc no : c201220 . the virus neutralization test was performed using fixed virus antibody dilution method , to detect the neutralizing activity of monoclonal antibodies . the hybridoma cell culture supernatant and ascites were diluted by two - fold series after inactivated 30 min at 56 ° c ., and mixed with equal volume of dtmuv ( fxv2010 strain ) containing 100eld 50 at 37 ° c . for 1 h , and then inoculated to 7 - day - old spf chicken embryo ; meanwhile , the dtmuv positive serum , sp2 / 0 cell culture supernatant were set as the positive control and negative control . the highest dilution factor of antibody that can inhibit the virus replication by 50 % was determined as the neutralizing antibody titer . the neutralization test showed that , 1f5 monoclonal antibody had the dtmuv neutralizing activity . the neutralizing antibody titer of 1f5 monoclonal antibody cell culture supernatant was 1 : 64 and the neutralizing antibody titer of ascites was 1 : 512 . establishment of block elisa method ( blockinge elisa , b - elisa ) for detecting dtmuv antibody 6 - week - old spf ducks were used , to collect blood from heart , and then the serum was separated , and dispensed in 0 . 2 mlep tubes , kept at − 20 ° c . for future use . 6 - week - old spf ducks were infected nasally by 10 3 . 5 eld 50 dtmuv fx2010 isolates . 3 weeks later , blood was collected from heart , and then the serum was separated , and dispensed in 0 . 2 mlep tubes , kept at − 20 ° c . for future use . the purified dtmuv was diluted to 0 . 03 mg / ml using 0 . 05 mol / l carbonate buffer solution ( ph 9 . 6 ), coated 96 - well microtiter plate , 100 μl each well , overnight at 4 ° c ., and closed for 1 h at 37 ° c . using pbs ( 0 . 01 mol / l , ph 7 . 4 ) solution containing 5 % skim milk powder , and then washed three times with pbs ( pbst ) containing 0 . 5 ml / l tween 20 . the dtmuv - positive and negative sera diluted by pbs were added to closed microtiter plates separately , sealed with parafilm , mixed for 1 h at 37 ° c ., and then washed 3 times using pbst . 1f5 monoclonal antibody was diluted 1 : 20 , added with 100 μl each well , mixed for 1 h at 37 ° c . ; added with the 5000 - fold diluted hrp - anti - mouse igg 100 μl ; and then added with 100 μl of tmb color developing agent , developing for 10 min at darkness , and finally added with 50 μl of stop solution ( 2 mol / l of h 2 so4 ) to stop the reaction , and measure the od450 nm values . b - elisa detection was performed for 350 portions of duck negative sera , and the detection results were statistically analyzed , to calculate the average inhibition rate of negative samples and the standard deviation ( sd ). the critical values were calculated separately according to the formula : critical value = average inhibition rate of negative samples + 3 × standard deviation ( sd ). results : the average inhibition rate of 350 portions of duck negative sera was 0 . 95 % and the standard deviation was 5 . 79 %. calculated according to the formula : critical value = average inhibition rate of negative samples + 3 × standard deviation ( sd ), the critical value was 18 %. when the inhibition rate ≧ 18 %, the dtmuv antibody was positive for the serum samples ; when 13 %& lt ; inhibition rate & lt ; 18 %, the serum was suspicious ; when inhibition rate ≦ 13 %, the dtmuv antibody was negative . the positive sera of h5n1 and h9n2 subtype avian influenza virus ( aiv ), newcastle disease virus ( ndv ), reticuloendotheliosis virus ( rev ), type - i duck hepatitis virus ( dhv - 1 ), reovirus ( rv ) and avian leukosis virus ( alv ) were detected by the established b - elisa , to validate cross - reactivity of the kit in the invention on positive sera of other viruses . results showed that , after detection by b - elisa , only dtmuv positive serum presented positive , with the inhibition rate of 69 . 13 %, higher than 18 %; the positive serum of other viruses presented negative ( as shown in table 1 ), indicating that the method and kits herein have good specificity . the known dtmuv positive serum was detected by the established b - elisa , agar diffusion test ( agp ), and serum neutralization test ( snt ) respectively , to compare the sensitivity difference between them . results showed that , the sensitivity of b - elisa was significantly higher than that of agp and snt ( as shown in table 2 ). ( 1 ) within - run repeatability test : different samples were detected using the same batch of coated microtiter plates . one positive sample , one negative sample , 6 holes repeated for each sample , and b - elisa test was performed , to calculate the coefficient of variation of inhibition rate for the same sample , to test the within - run repeatability ; ( 2 ) between - run repeatability test : one positive sample and one negative sample were tested repeatedly using different batches of coated microtiter plates . b - elisa test was performed , to calculate the coefficient of variation of inhibition rate for the same sample , to test the between - run repeatability . results : the statistical analysis of the inhibition rates of the within - run repeatability test and between - run repeatability test of the same batch and different batches of b - elisa showed that , the coefficient of variation was less than 10 %, indicating that the kits had good repeatability ( as shown in table 3 and table 4 ). a . coating : the removable elisa plates were coated with coating antigen one day before the detection . the coating antigen of the above reagent was mixed in the coating buffer evenly , 100 μl / well , 4 ° c . overnight , on the next day , taken out and washed three times using 1 × pbs - t scrubbing solution , 3 min each time ; b . block : 20 μl / well of blocking buffer , 1 h at 37 ° c ., washed three times using 1 × scrubbing solution , 3 min each time ; c . the test serum , positive and negative control sera were diluted 10 - fold with an antibody diluent for standby , and added to elisa plates , 100 μl per well , incubated for 1 hour at 37 ° c . ; washed three times using 1 × scrubbing solution , 3 min each time , procedures same as above ; d . dilute monoclonal antibody using 20 × antibody diluent , 100 μl monoclonal antibody per well , incubated for 1 hour at 37 ° c . ; washed three times ; e . add 100 μl of hrp - anti - mouse igg diluted to 1 × by antibody diluent to each well , 37 ° c . for 1 h , and washed three times ; f . add tmb chromogenic substrate solution 100 μl to each well , developing 10 min in the darkness at room temperature ; g . add 50 ul of stop solution to each well , read the absorbance value od 450nm from microplate reader , calculate the inhibition rate . the inhibition rate (%)=( absorbance of negative control − absorbance of test serum )/ absorbance of negative control × 100 %. when the inhibition rate of positive serum was greater than 50 %, the experimental results were reliable , judge them according to the following criteria : when the inhibition rate of serum samples was greater than or equal to 18 %, the sample can be judged positive dtmuv antibody ; when the inhibition rate of serum samples was less than or equal to 13 %, the sample can be judged negative dtmuv antibody ; when 13 %& lt ; inhibition rate of serum samples & lt ; 18 %, the sample can be judged suspicious , and still suspicious after repeated test , it can be judged negative . 130 duck serum samples from different places were determined using the established b - elisa . results showed that , among the 130 duck serum samples , 32 samples were positive , 98 samples were negative , with the positive rate of 24 . 62 %. while various aspects and embodiments have been disclosed herein , other aspects and embodiments will be apparent to those skilled in the art . the various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting , with the true scope and spirit being indicated by the following claims .	2
fig1 shows a sling carrier for skies with attached boots . in this figure the back of the user 39 is shown with the ski equipment slung over the back of the user in a diagonal orientation . in this orientation the user can bend forward and can walk with the weight of the equipment fairly evenly distributed on the user 39 . the ski boots 48 and 49 are secured in the ski bindings 47 , thereby no additional securing mechanism is required to retain the ski boots 48 and 49 . while the ski boots 48 and 49 are shown secured into the ski bindings , the user can wear the ski boots 48 and 49 as they transport the skies and ski poles slung over the back of the user . the curved end of the skies 42 and 43 are secured together with a upper ski strap 60 that both secures the skies 42 and 43 together and provides an upper connection for a front sling ( not shown in this figure ). the upper end of the poles 46 and 47 ( obscured in this figure ) are connected together with an upper pole strap 70 that is secured to a “ d ” ring ( obscured in this figure ) that is secured around the skis , in this case , skis 42 and 43 . the upper pole strap 70 is retained on the poles because the top of the ski poles include an enlarged top 44 to the hand grip portion of the pole ( s ). the flat under sides of the skies rest together and the bottom end of the ski poles are secured to the lower end of the skies 42 and 43 with a lower ski and pole strap 90 / 100 . the flat end of the skies 42 and 43 and secured into a pouch 80 . fig2 shows a view of the components used in the sling carrier for skies . these are the components that are used to transport the skies , boots and pole . the lower ski and pole straps 90 and 100 and the pole strap 70 can be placed within the ski pouch 80 and all the components can be carried by the user as a complete unit . this will be shown and described in other figures herein . the sling strap 50 has a separable buckle 53 with a male and a female clasp that allows a user to separate the two parts , 51 and 52 , of the sling strap 50 . the separable buckle 53 further includes an adjustment mechanism to alter the overall length of the sling strap to fit the geometry of a user to adjust the location of the equipment on the back of a user . on the opposing sides of the buckle 53 there are separate lengths of straps 51 and 52 . each of these lengths of straps terminate with operable clasps 54 and 55 . the clasps 54 and 55 , along with the buckle 53 are designed to allow an operator to connect and disconnect the components in freezing condition and with limited dexterity caused by gloves and or cold conditions . the upper ski strap 60 has a central male clasp 63 that mates or connects into a complimentary female clasp 65 . an “ o ” or “ d ” ring 64 is positioned between the male 63 and the female 65 clasps . the ring 64 allows for connection of one of the operable clasps 54 or 55 on the sling strap 50 . a free end 62 of the strap 61 allows for a user to grasp to tighten a grip on skies placed in the strap between the male 63 and the female 65 clasps . the pole strap 70 has two lengths of strap material 72 and 74 with an operable clasp 73 located at an equal distance between two separate rings 71 and 75 . in operation , a portion of the strap material , 72 or 74 is looped and passed through the respective ring 71 or 75 and the hand grip of the ski pole is passed through the loop . the loop is then tightened to secure the hand grip of the ski pole . the ski pouch 80 is essentially a pouch with an opening where the flat portion of the skies are placed to secure the flat end of the skies . the ski pouch 80 has a top flap that wraps around the opening to secure any contents within the pouch . the ski pouch 80 is shown with the lower ski strap components 90 and 100 secured to the ski pouch 80 . the lower pole strap components 90 and 100 are snapped 93 and 103 onto the ski pouch 80 . lower pole strap component 90 has a snap 93 at a first end with a male clasp 94 and a free length of strap material 91 with a buckle 92 . a “ d ” ring 95 is secured to the front flap of the ski pouch 80 . the lower pole strap component 100 also snaps to the ski pouch 80 and has a female buckle 101 . fig3 shows a view of the attachment of the ski poles 46 and 47 . the ski poles 46 and 47 are secured by using the pole strap 70 that has two lengths of strap material 72 and 74 with an operable clasp 73 located at an equal distance between two separate “ d ” ring 71 and 75 . to install the ski poles 46 and 47 onto the pole strap 70 a portion of the strap material , 72 or 74 is looped 76 and passed through the respective “ d ” ring 71 or 75 and the hand grip 44 or 45 of the ski pole is passed through the loop . the loop is then tightened to secure the hand grip 45 of the ski pole . fig4 shows the top of the skies being secured . because current skies 42 & amp ; 43 are parabolic in shape , the upper ski strap 60 can be secured at a narrow portion of the skies 42 & amp ; 43 . the free end 62 of the strap 60 can be pulled to tighten the strap 60 in the buckle 63 and then moved 86 up to the wider portion of the skies 42 & amp ; 43 to increase the binding of the strap 60 on the skies 42 & amp ; 43 . fig5 shows the bottom of the skies 42 & amp ; 43 entering 87 into the open 88 end of the pouch 80 . a backing lip 85 extends around the back of the pocket to provide a flat surface that sits on the flat surface of the ski . the end of the skies 42 & amp ; 43 are then seated into the pocket 80 . the flap portion 85 of the pocket 80 is brought along the back side of the skies 42 & amp ; 43 . the ski pouch 80 has a number of snaps 82 , 83 and 84 for securing some of the straps , in particular the lower pole strap 90 / 100 that wraps around the pouch 80 and previously shown . fig6 shows the top of the poles 46 and 47 being secured to the skies 42 . the ski poles 46 and 47 have hand grips 44 and 45 respectively where the upper pole strap 72 is secured . the clasp 73 in the center of the pole strap 72 is secured to the ring 64 on the upper ski strap 60 and then the upper pole strap 72 is brought between the curved tips of the skies for stability . the clasp 54 on the lower sling strap 52 is also connected to the ring 64 on the upper strap 60 . it is important for the ring 64 to be positioned at the side of the skies to allow the apparatus to be slung diagonally across the back of a user . fig7 shows the bottom of the poles being secured to the skies . at this location the end of the ski poles 46 and 47 are shown secured to the bottom straight end of the skies 42 . the lower straps 90 / 100 secure all the skies and poles together to prevent undesirable movement while they are being transported . fig8 shows pouch being secured to the opposing side of the sling strap 51 . the lower end 51 of the sling strap has a clasp 55 that connects to the “ d ” ring 87 on the flap 85 of the pouch 80 . the flat end of the skies 42 and 43 are shown in the pouch 80 . the snap 86 can be secured to one of the snaps 86 on the front of the pouch 80 . the ski poles 46 and 47 are shown secured to the skies 42 and 43 with the lower ski and pole strap 90 / 100 is wrapped around both the skies and both of the poles . once both ends of the sling strap 50 have been secured with the clasp 54 in the “ d ” ring 64 ( at the other end of strap 51 ) and the “ d ” ring 87 with clasp 55 of the ski pouch 80 , the user can place the sling 50 over their head and shoulder . once the user is wearing the sling , the user can adjust the length of the sling 50 to set the preferred location of the sling on the user . to quickly remove the sling , a user can unbuckle the clasp or buckle 53 in the sling 50 . fig9 shows the pouch 80 secured over a shoulder of a user 39 . when the pouch 80 is not being used to transport ski equipment , the remaining straps are placed into the pouch 80 . this view shows the clasp 53 of the sling 51 and 52 . the clasps 54 and 55 are secured to “ d ” ring on the back of the pouch 80 . the front flap 85 of the pouch 80 is brought over the pouch 80 where the “ d ” ring 87 is held by the straps . fig1 shows a sling carrier with a snowboard 110 and snowboard boots 111 and 112 . the snowboard 110 , boots or boot bindings 111 and 112 are all carried on the back of the user 39 in a sling arrangement that allows the person 39 to easily walk and bend over because the equipment is distributed and balanced on the back of the user 39 . this further frees the hands of the user to pay for lift tickets or carry other items . the bottom of the snowboard 110 is held in a pocket 133 within a pouch 130 . the pouch 130 has a surrounding lip 134 with a raised front surface where the snowboard 110 fits inside of the pouch 130 . the front of the pouch 130 has some pockets with mechanical or magnetic snaps 135 and 136 for securing the pockets . a sling strap ( not visible in this figure ) connects from the pouch 130 to an upper strap 120 . the upper strap 120 wraps around the upper portion of the snowboard 110 to secure the snowboard 110 . the upper strap has a male 121 and a female 122 buckle portion secured on the strap 120 . the “ o ” ring 122 is placed in the center of the width of the snowboard . an end 123 of the strap 120 allows for tightening or loosening of the strap 120 on the snowboard 110 . fig1 shows the components used in the sling carrier for a snowboard . the sling strap 50 has a separable buckle 53 with a male and a female clasp that allows a user to separate the two parts , 51 and 52 , of the sling strap 50 . the separable buckle 53 further includes an adjustment mechanism to alter the overall length of the sling strap to fit the geometry of a user to adjust the location of the equipment on the back of a user . an adjustable pad 56 is present on the strap 52 to provide a cushion and to distribute loads on the strap 50 . on the opposing sides of the buckle 53 there are separate lengths of straps 51 and 52 . each of these lengths of straps terminate with operable clasps 54 and 55 . the clasps 54 and 55 , along with the buckle 53 are designed to allow an operator to connect and disconnect the components in freezing condition and with limited dexterity caused by gloves and or cold conditions . the pouch 130 is configured with a square or rounded bottom to accept either end of a snowboard . the pouch 130 has a front flap 132 that closes over a pocket opening 133 where an end of a snowboard is secured therein . the flap has a “ d ” ring at the front of the flap for securing one end 55 of the sling strap 50 . mechanical or magnetic snaps 137 and 138 secure the flap 132 to the front of the pouch 130 . a plurality of “ d ” rings and clasps 127 , 128 and 129 are located on the front and back of the pouch 130 for converting the pouch into a backpack for storage of the straps and or other personal items . an upper snowboard strap 120 is configured to wrap around the snowboard . the inside of the upper snowboard strap 120 is reinforced or backed with leather or other equivalent material to protect the strap material from being damaged from the hard sharp edges of the snowboard . this strap 120 has a male connector 121 and a female connector 125 at opposing ends . the tail 123 can be pulled to tighten the strap 120 on the snowboard . between the male 121 and the female 125 connectors an “ o ” ring is located between the strap portions 122 and 124 . the “ o ” ring is used to connect to the other clasp 55 on the opposing end of the sling strap 50 . two additional strap members 140 are used to transport the pouch 130 as a backpack . the strap members 140 are essentially the same . the straps 140 include clasps 141 and 147 on each end of the strap . the strap 140 has three section 142 , 144 and 146 . between section 144 and 146 a “ d ” ring 145 is located for securing the end of the strap 144 . an adjustable buckle 143 is located to adjust the overall length of the strap 140 . fig1 shows a snowboard being secured into the pouch and the sling . first the upper strap is secured around the snowboard 110 and then buckle at the end of strap portions 122 and 124 is connected . the strap is tightened onto the snowboard 110 at a position above the top boot binding . when the top strap is attached , the “ o ” ring 123 is centered in the middle of the base width wise . snowboards also have a parabolic shape . the method for attaching the top strap 122 is to clip it around the board just above the leading ( top ) binding , pull the adjuster strap down nice and snug making sure the “ o ” 123 is centered on the base , the strap is moved up until the strap reaches the widest part of the parabolic shape making a nice and tight strap on the snowboard . the bottom of the snowboard is slid into the pouch opening 139 to a position below the lower binding 111 . the top flap 132 is lifted to allow the clip 55 of the sling strap to connect to the “ d ” loop 126 . the other end of the sling strap 52 is then hooked 54 into the “ o ” ring 123 of the upper strap . the user can then enter into the sling strap and tighten the sling strap for the desired fit . when the board is being transported , the top strap will come into contact with the edges as it is positioned on the base . those edges can be extremely sharp and would probably cut right through a standard nylon strap . as with the ski sling , the central buckle on the sling strap is disconnected to quickly exit from the snowboard sling carrier . fig1 shows the snowboard pouch being carried on the back of a user . when the snowboard carrier is not being used to transport the snowboard the pouch 130 can be used as a backpack . the strap members 142 are connected to the “ d ” ring 129 at the top of the carrier and also connected to “ d ” rings 158 ( obscured in this view ) on the back of the carrier 130 . the straps 140 can then be adjusted to the desired fit based upon the desires of the user or the physical features of the user 39 . fig1 shows a sling carrier for skis , snowboard and boots . in this embodiment a user 39 is able to carry all of the ski and snowboard equipment with a single sling carrier . the hands of the user remain free . the majority of the components have been shown and described in previous embodiments shown and described herein with the exception of the pouch 150 . the pouch has two pockets , a first pocket 151 where the snowboard 110 is inserted and a second pouch 153 where the flat ends of the skies are inserted , and the ends of the ski poles 46 and 47 are retained . the pocket 153 for the skies 42 & amp ; 43 essentially folds out perpendicular to the pocket 51 that retains the snowboard 110 . a flap 152 covers the ski retaining pocket 153 when the pocket is not being used . fig1 shows the carrier without the ski and snowboard equipment being carried as a backpack . this figure shows the other side of the flap 152 with storage pockets 154 and 155 for storage of the securing straps . the back of the flap 152 further includes a transparent window 156 for storage of a license , lift ticket etc . when the carrier 150 is not being used to transport the skies and or snowboard the pouch 150 can be used as a backpack . the strap members 142 are connected to the “ d ” ring 157 at the top of the carrier and also connected to “ d ” rings ( obscured in this view ) on the back of the carrier 150 . the straps can then be adjusted to the desired fit based upon the desires of the user or the physical features of the user 39 . fig1 shows the components used to carry skies and a snowboard . the straps 50 , 70 , 120 , 140 and 190 are essentially the same as previously described . strap 50 includes a protective sleeve 57 to reduce abrasion of the clasp 54 . strap 190 is essentially the same as strap 120 with a slight difference in the length of the strap and strap 120 further has an additional clip that is adjacent to the female part of the buckle . the clip is secured to the upper ski strap 190 . to assemble the skis within this storage version the curved ends of the skies are bound as previously described and the grip ends of the ski poles are bound as previously identified . fig1 shows the snowboard in the pouch with the skies being inserted . the strap 120 is secured to the snowboard 110 as previously described . the snowboard 110 is inserted into the pocket 151 of the pouch 150 . an inner pocket 153 is exposed from the pouch 150 and the flat end of the skies are inserted into the inner pocket 153 . the skies 42 and 43 are elevated , essentially parallel to the snowboard 110 . fig1 shows the top end of the poles being secured to the skies 42 & amp ; 43 and snowboard 110 . in this figure the strap 70 that retains the ski poles 46 & amp ; 47 are secured to the “ d ” ring of strap 190 . the “ d ” ring of strap 190 is connected to clip that is adjacent to the female buckle . the free end of the ski poles are the tucked into the pocket 153 . the sling strap 50 is secured to strap 120 and to the pouch 150 to allow a user to lift all the equipment onto their back for transportation . while specific materials of leather , nylon and “ o ” rings and buckles have been identified in the application , it should be obvious to one skilled in the art that future progression of the carriers can include alternative materials and construction that provide the same or superior functionality . thus , specific embodiments of a sling carrier for skis , snowboard and boots has been disclosed . it should be apparent , however , to those skilled in the art that many more modifications besides those described are possible without departing from the inventive concepts herein . the inventive subject matter , therefore , is not to be restricted except in the spirit of the appended claims .	0
for a better understanding of the invention , reference may be had to the following description of exemplary embodiments . the present invention includes nucleic acid compositions in which the nucleic acid serves as an antioxidant . although dna may be best suited for most embodiments of the invention because of its durability , rna or other nucleic acids may also be used , especially in applications where more rapid degradation of the nucleic acid is desirable . dna and rna may include all forms of dna and rna , natural and synthetic , specifically including cdna , mrna , rrna and trna . the nucleic acid compositions may be part of a material , such as a food , vitamin , cosmetic , or pharmaceutical . the nucleic acid compositions may also be formulated for later addition to such a material . such compositions are biologically safe . oxidized nucleic acid breaks down into readily degradable and non - toxic by - products . additionally , dna is heat - tolerant ; the base pairs do not normally separate in an aqueous solution until approximately 94 – 96 ° c . and may remain bonded at higher temperatures in non - aqueous solutions . nucleic acid antioxidants of the present invention may be provided and / or dispensed in powder liquid , gel , spray or aerosol forms , inter alia , or as a misting agent . the nucleic acid used in the present invention may be from any source . harvesting techniques for recovery of nucleic acid from biological sources , including techniques capable of producing commercial volumes of nucleic acids are readily known in the art . nucleic acids may be extracted from almost any biological source . two common sources of non - specific nucleic acid are fish sperm and calf thymus . almost any source , animal or plant - based , yeast or bacterial may be used . these sources may be specifically developed for nucleic acid harvest or may be waste products of other commercial processes , as in the case of calf thymus . because the present invention employs nucleic acids for their antioxidant properties alone , and not for their information coding properties , the sequences of the nucleic acid may be irrelevant . dna , in certain examples , may be produced by solubilization of cellular material with a detergent , followed by extraction of nucleic acid from the aqueous layer with an alcohol . various additional steps and additives may assist in the removal of protein to obtain purer nucleic acid . various nucleases and extraction techniques may be employed to destroy unwanted forms of nucleic acids , such as rna . such techniques are well known in the art . nucleic acids may also be synthesized artificially from nucleotides . for instance , surface catalysis techniques or oligonucleotide synthesizers may be used . the purity of nucleic acid from biological sources used in compositions of the present invention may vary by application . in most applications , the nucleic acid will contain no more than 50 % by weight residual matter from the biological source such as proteins , lipids and carbohydrates . in certain embodiments , it will contain no more than 25 %, 10 %, 5 % or 1 % by weight residual matter . such residual matter will likely include proteins which may cause unwanted effects such as bad taste in food or spoilage . for pharmaceutical compositions , the nucleic acid may contain less than 5 % by weight residual matter . residual protein may need to be substantially removed from pharmaceutical compositions , especially injectable compositions , in order to avoid an immune response . nucleic acid is biodegradable and may also degrade due to oxidative damage , which is known to cause breaks in nucleic acid molecules . in many applications the rate of degradation of nucleic acid will not be significant . however , the rate may be influenced by the length of the nucleic acid molecule used and type of nucleic acid as well as by treatment of the nucleic acid . the nucleic acid may also be crosslinked , although such crosslinking may reduce the antioxidant properties of the nucleic acid . additionally , if the nucleic acid composition will eventually be used in a biological system , such as a human body , crosslinking agents that are toxic in such a biological system may be avoided . crosslinking may be between chains of a single dna molecule or between chains of two different nucleic acid molecules or in any other possible permutation . crosslinking may be accomplished in a variety of ways , including hydrogen bonds , ionic and covalent bonds , ππ bonds , van der wals forces . more specifically , crosslinking may be accomplished by uv radiation , esterification , hydrolysis , or silica compounds if biological toxicity is at issue . one specific example includes the use of siloxane bridges as described in u . s . pat . no . 5 , 214 , 134 . intercalating agents , neoplastic agents , formaldehyde and formalin may also be used . more than one type of crosslinking may be used in a given composition . furthermore , crosslinking may occur between two strands of a nucleic acid molecule or between two separate nucleic acid molecules . increased levels of crosslinking will generally slow degradation of nucleic acid , but may result in lower antioxidant activity . however , in some applications any reduced antioxidant effect may be worth the increased stability . for example , although dna is heat - resistant , base pair - crosslinked dna will not be as able to separate along base pairs at higher temperatures and thus will exhibit at greater degradation resistance at higher temperatures . an optimal balance between degradation and antioxidant activity for a given composition should be readily determinable to one skilled in the art . additionally , the nucleic acid may be methylated , ethylated , alkylated , or otherwise modified along the backbone to influence degradation rates . generally , methylated , hemi - methylated , ethylated , or alkylated nucleic acids will degrade more slowly . other backbone modifications affecting degradation rates include the use of heteroatomic oligonucleoside linkages as described in u . s . pat . no . 5 , 677 , 437 . such backbone modifications may also affect the solubility of nucleic acid , for instance rendering it more lipid soluble . backbone modifications may also increase the antioxidant capacity of nucleic acid . nucleic acids may also be capped to prevent degradation , influence solubility , or influence antioxidant effects . such caps are generally located at or near the termini of the nucleic acid chains . examples of capping procedures are included in u . s . pat . nos . 5 , 245 , 022 and 5 , 567 , 810 . the size of the nucleic acid molecules used in compositions of the present invention may vary from as small as 2 bases to as long as 10 , 000 bases or more . in general , most compositions will contain nucleic acid molecules with a variety of lengths . in exemplary embodiments , the average nucleic acid molecule length may be between 50 and 500 bases . however , smaller nucleic acid molecules may be used in certain embodiments , particularly those where the nucleic acid is used as an antioxidant for an oil or other lipid - rich material in which it is not readily soluble . alternatively , larger nucleic acid molecules may be used in such materials to form small nucleic acid particles which may be dispersed throughout the material . the compositions of the present invention may include nucleic acid as the sole antioxidant , or they may also include other antioxidants , including both natural and synthetic antioxidants . the following examples are provided only to illustrate certain aspects of the invention and are not intended to embody the total scope of the invention or the totality of any aspect thereof . variations of the exemplary embodiments of the invention below will be apparent to one skilled in the art and are intended to be included within the scope of the invention . although vitamin c is commonly sold as a nutrient supplement , because it is a potent antioxidant it has a very limited shelf - life . furthermore , vitamin c becomes a mild pro - oxidant after an oxidative reaction . therefore , vitamin c supplements that have been substantially oxidized may actually be harmful . nucleic acid may be added to a solution of vitamin c in an alcohol . the solution may be dried to produce vitamin c powder or tablets . the optimal proportion of nucleic acid to vitamin c may be determined by mixing various proportions in alcohol solutions , drying the solutions , and storing the dried powders for approximately 6 months ( the normal shelf - life of vitamin c ). vitamin c levels or antioxidant activity may then be measured , for instance by measuring reactivity with diphenyl picryl hydrazine . in certain embodiments , the optimal proportion of nucleic acid to vitamin c by weight will fall between 60 % and 80 %. examples of antioxidant formulations and methods for testing these formulations are provided in u . s . pat . no . 6 , 235 , 721 of ghosal ( the “&# 39 ; 721 patent ”). although the &# 39 ; 721 patent addresses stabilization of vitamin c and other compounds using a fruit extract , the methodologies should be applicable to nucleic acid as well . nucleic acid may also be used as an antioxidant for vitamin e . methods such as those described in example 5 may be used to increase solubility of nucleic acid in vitamin e . alternatively , the nucleic acid may be allowed to from small aggregates in a mixture with the vitamin e , or the vitamin e may be allowed to form small aggregates in a mixture with the nucleic acid . proportions of nucleic acid used in vitamin e formulations may be similar to those used in vitamin c formulations , although more nucleic acid by weight may be recommended . nucleic acid may similarly be added to other vitamin compositions , which may or may not contain vitamins c or e . in particular , vitamin a supplements may be prepared using methodologies similar to those used for vitamin e . lotions , creams and other similar preparations , whether used for cosmetic , topical pharmaceutical , or other purposes , are often formed by mixing component lipids and other chemicals at approximately 80 – 85 ° c . lipids may oxidize during this heating process , so the addition of an antioxidant capable of enduring heating is desirable . nucleic acid may be added to such a mixture prior to or during heating to help prevent oxidation of lipid or other lotion components . the amount of nucleic acid in such lotions may be varied depending upon the oxidative reactivity of the lotion components . for many lotions , between 0 . 1 and 5 % nucleic acid by weight may be sufficient . appropriate nucleic acid proportions may be tested by allowing samples to sit for acceptable shelf - life time intervals , for example one year , and then measuring the amount of oxidative damage to one or more indicator compounds . the above method may also be used to prepare lotions containing antioxidants , such as vitamins c and e , or topical ointments which will contain pharmaceuticals susceptible to oxidative damage . lotion , cream and topical antioxidant formulations may further be prepared as described in u . s . pat . no . 6 , 124 , 268 ( the “&# 39 ; 268 patent ”). although the &# 39 ; 268 patent relates to the use of a fruit extract as an antioxidant , its methodologies should be applicable to nucleic acids as well . methods for increasing solubility of nucleic acids in hydrophobic substances are described in example 5 . alternatively , nucleic acids may be allowed to form small aggregates within the lotion . synthetic estrogens are used for a variety of medical reasons , ranging from birth control to treatment of hormone deficiencies . however , synthetic estrogens tend to be unstable , especially in damp environments . one source of instability , hydrolysis of the synthetic molecules , may be combated using a buffer . however , use of the buffer only produces a shelf - life of around 6 months . addition of 0 . 25 to 6 moles of an antioxidant has been shown to increase shelf - life up to two years without significant degradation of alkali metal synthetic estrogen sulfates . ( see u . s . pat . no . 4 , 154 , 820 of simoons , the “&# 39 ; 820 patent ”.) nucleic acid may be used in as an antioxidant in synthetic estrogen compositions and tested for efficiency as described in the &# 39 ; 820 patent . because both nucleic acid and most synthetic estrogens may be solubilized in water , aqueous solutions may be easily prepared and used or further processed to gelcap or dry formulations . like lotions , gum base must often be heated during preparation . this allows significant oxidation of fats and oils in the gum base . although gum base processing temperatures are often higher than the denaturation temperature of dna , they are not so high as to cause breakdown of the nucleic acid backbone . many of dna &# 39 ; s antioxidant properties do not depend upon a helical structure , therefore dna should continue to function as an antioxidant even in denatured form . additionally , the dna molecule may be modified by crosslinking to prevent denaturation at higher temperatures . addition of between 7 – 2000 parts per million of antioxidant has been shown to significantly reduce oxidative damage to gum base , particularly during heat processing steps . ( see u . s . pat . no . 5 , 545 , 416 to broderick et al ., the “&# 39 ; 416 patent ”.) although the &# 39 ; 416 patent uses a synthetic antioxidant , its techniques should be applicable to the preparation of a gum base with nucleic acid antioxidant . additionally , as described in the &# 39 ; 416 patent , larger amounts of nucleic acid may be added in initial processing stages to ensure that sufficient amounts remain after heat processing . this technique of adding larger amounts of nucleic acid prior to heat processing may also be used the processing of other materials . this methodology may also be useful for the addition of nucleic acid as an antioxidant to oils used for frying , which may also involve the use of temperatures above the denaturation point of dna . another methodology for maintaining a constant nucleic acid concentration in cooking oils that may be used with nucleic acid as an antioxidant is described in u . s . pat . no . 4 , 115 , 597 of pellar . nucleic acid is relatively insoluble in hydrophobic compositions , such as fats , vitamin e and other lipids . in order to increase its solubility , it may be added to the hydrophobic composition in a manner similar to that described in u . s . pat . no . 5 , 084 , 293 of todd , jr . ( the “&# 39 ; 293 patent ”) for ascorbic acid . generally , the process in the &# 39 ; 293 patent involves forming an anhydrous paste of the nucleic acid in a substance that has both hydrophobic and hydrophilic properties . nucleic acid may also be added to lipids by the incorporation of small nucleic acid aggregates into the lipids . these aggregates are preferably less than 50 microns in size . u . s . pat . no . 5 , 296 , 249 of todd , jr . ( the “&# 39 ; 249 patent ”) discloses a method of producing and using vitamin c microparticles of approximately less than 38 microns . the &# 39 ; 249 patent shows that antioxidants do not have to be solubilized in a lipid to reduce oxidative damage . small particles dispersed in the lipid are also functional for this purpose . the wet milling techniques of the &# 39 ; 249 patent may be used for nucleic acid in solution in which it is insoluble or only slightly soluble , such as a solution with high alcohol content . alternatively , small nucleic acid particles may be produced by dropping aqueous nucleic acid solution into a condensing solution , such as a high alcohol content solution . other methods of producing very small particles of nucleic acid are also possible . the size and type of the nucleic acid molecule may affect the size of the aggregate formed . micro or nanoparticles of nucleic acid may be preferred for many uses . harvested fruits and vegetables deteriorate rapidly for a variety of reasons , one of which is the oxidation of molecules in their surface layers . in order to prevent this oxidation , u . s . pat . no . 6 , 403 , 139 to sardo et al . ( the “&# 39 ; 139 patent ”) discloses a method for applying antioxidants to harvested fruits and vegetables . similar application techniques may be used to apply nucleic acid as an antioxidant . the nucleic acid may be applied at a lower temperature than in the &# 39 ; 139 patent if it is in an aqueous solution . alternatively , if the nucleic acid is first mixed in a hydrophobic compound as described in examples 5 and 6 , if the hydrophobic compound is solid at room temperature it may remain on the fruit or vegetable more readily than nucleic acid alone , but will likely benefit from elevated application temperatures as described in the &# 39 ; 139 patent . u . s . pat . no . 5 , 498 , 434 ( the “&# 39 ; 434 patent ”) and u . s . pat . no . 5 , 427 , 814 ( the “&# 39 ; 814 patent ”) describe beneficial effects of providing more than one antioxidant in a given formulation . specifically , both observe a beneficial effect when vitamin e and lecithin are used together with either vitamin c or oil of rosemary . nucleic acid may also be used in such a mixture , with expected beneficial effects . such formulation may be prepared as described in the &# 39 ; 814 and &# 39 ; 434 patents . because nucleic acid is hydrophilic , the process described in the &# 39 ; 814 patent may be preferred , with nucleic acid used in a manner similar to or in place of vitamin c . u . s . pat . no . 6 , 093 , 436 describes an antioxidant system in which an enzyme , glucose oxidase , serves as the primary antioxidant and an inorganic oxygen scavenger serves as a repository . the system is tailored for a beverage system . nucleic acid may be in place of an inorganic oxygen scavenger in systems such as these . u . s . pat . no . 5 , 919 , 483 of takaichi et al . ( the “&# 39 ; 483 patent ”) describes an effervescent composition containing an antioxidant . the composition is water soluble and may be used to store antioxidant then allows its ready use in an aqueous solution . compositions similar to those described in the &# 39 ; 483 patent may be prepared using nucleic acid as the antioxidant . in certain applications long - lasting antioxidants are not required or desirable . for example , short - lived antioxidants may be useful in neutralizing the effects of chemical weapons such as mustard gas . when such short - lived antioxidants are desirable then rna or shorter nucleic acid molecules may be used . nucleic acid antioxidants of the present invention may be used to neutralize any oxide , including peroxides , carbonyl radicals , carboxy radicals and ozones . they may also be used to mitigate effects of biological materials that directly or indirectly produce oxides such as prostaglandins and interleukins or other inflammatory mediators or by - products . finally , oxidative products of any source such as uv radiation , mustard gas and alkylating agents may be neutralized or their effects mitigated using antioxidants of the present invention . for example , nucleic acid antioxidants may mitigate effects of blistering agents by neutralizing oxidative products and reducing inflammation . all of the compositions and / or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure . while the compositions and methods of this invention have been described in terms of specific embodiments , it will be apparent to those of skill in the art that variations may be applied to the compositions and / or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept , spirit and scope of the invention . all such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit , scope and concept of the invention .	0
in an embodiment , the present invention provides novel pyridone disulfide derivatives of formula ( i ), a process for their preparation and isolation of stable compounds of formula ( i ) in the ph range of 4 . 5 to 8 . 5 . the invention also includes the preparation of stereoisomeric isomers of stable pyridone disulfide derivatives . the meaning of term ‘ stable ’ used herein indicates that the compound of formula ( i ) is obtained in a stable form , crystalline or amorphous , not easily prone to degradation . in yet another embodiment , the present invention provides a process for preparation and isolation of novel pyridone disulfide derivatives of formula ( i ), comprising of the following steps . step 1 involves reaction of substituted benzimidazo - 2 - thiol or substituted imidazo - pyridine - 2 - thiol ( compound ii ) with substituted - 2 - chloromethyl - 4 - methoxy - pyridine derivative ( compound iii ) in presence of a base and solvent to give substituted methoxy - 2 - pyridinyl - methylsulfidyl benzimidazole or the corresponding imidazo - pyridine derivative ( compound iv ). the base was selected from the group comprising of sodium hydroxide , potassium hydroxide , calcium hydroxide , barium hydroxide etc . the solvent was selected from the group comprising of water , methanol , ethanol , isopropanol , butanol etc . and mixtures thereof . the reaction was carried out at 20 - 40 ° c . after completion of the reaction as monitored by tlc , the mixture was filtered to give the respective substituted methoxy - 2 - pyridinyl - methylsulfidyl benzimidazole derivative or imidazo - pyridine derivative ( compound iv ) having desired purity . step 2 involved regioselective dealkylation of substituted methoxy - 2 - pyridinyl - methylsulfidyl benzimidazole or imidazo - pyridine derivative ( compound iv ) in presence of a dealkylating agent and a solvent to give compound of formula ( v ). various dealkylating agents such as sodium sulfide , hydrobromic acid , aluminium chloride etc . were used . in case of sodium sulfide , the reaction was carried out in the temperature range of 80 to 110 ° c ., in presence of a solvent . the solvent was selected from the group comprising of nitriles , alcohols , polar aprotic solvents such as n - methyl pyrrolidone , dimethyl formamide , dimethyl acetamide water or mixtures thereof . after completion of the reaction based on tlc , the reaction mass was cooled and neutralized with an acid such as acetic acid . filtration of the obtained solid and drying gave the respective substituted hydroxy - 2 - pyridinyl - methylsulfidyl - benzimidazole or imidazo - pyridine derivative ( compound v ) having desired purity . alternatively , the dealkylation was also carried out by employing aqueous hydrobromic acid or using lewis acid halides such as aluminium chloride , zinc chloride , optionally in presence of decanethiol . the reaction was carried out at a temperature ranging from 50 - 110 ° c ., depending upon the type of the dealkylating reagent used . after completion of the reaction as monitored by tlc , the product was isolated by concentrating the mixture and adding water followed by addition of an organic solvent like methanol to the aqueous layer at around neutral ph to obtain the desired product of formula ( v ). step 3 comprised treatment of substituted hydroxy - 2 - pyridinyl - methylsulfidyl - benzimidazole or imidazo - pyridine derivative ( compound v ) with an oxidizing agent to give compound of formula ( vi ). this step involved treatment of compound of formula ( v ) with an oxidizing agent such as ( 10 )- camphorsulfonyl oxaziridine ( cso ) and its stereoisomers or an alkali metal hypochlorite to provide the sulfoxide derivative of formula ( vi ). the sulfide derivative ( v ) was treated with the oxidizing agent at 20 - 35 ° c . in presence of a base and organic solvent like isopropanol . the base was selected from inorganic or organic bases . the inorganic base was selected from the group comprising of alkali metal hydroxides , carbonate and bicarbonates etc . while the organic base was selected from dbu , triethyl amine , diisopropyl ethyl amine etc . the solvent was selected from the group comprising of alcohols such as methyl alcohol , ethyl alcohol , isopropyl alcohol etc . or mixtures thereof . after completion of reaction , as monitored by tlc , the reaction mass was filtered and the filtrate concentrated to get the desired compound ( vi ) which was optionally treated with organic solvents such as methanol , methyl tertiary butyl ether , toluene etc . or used as such for further reaction . when oxidation was carried out using hypochlorite , compound ( v ) was added to a mixture of sodium hydroxide , water and methanol , followed by addition of sodium hypochlorite solution and the reaction was carried out at 20 - 35 ° c . the reaction was monitored by tlc and after completion , the reaction mass was extracted with an organic solvent and the organic layer was then concentrated to give the desired compound ( vi ). alternatively , after completion of oxidation reaction , the mass was carried forward for the next reaction . the ph of the reaction mass was adjusted in range of 4 . 5 to 8 . 5 using acid and the mass was stirred at 20 - 35 ° c . optionally , an organic solvent such as methanol or ethyl acetate or solvent mixture was added during stirring and resulting solid was filtered after completion of the reaction as monitored by tlc , to give compound of formula ( i ). step 4 comprised treatment of compound ( vi ) with an acid in a solvent to obtain ph between 4 . 5 and 8 . 5 , preferably 6 . 5 to 8 , which was then stirred and filtered to obtain the desired compound ( i ). the solvent was selected from the group comprising of water and organic solvents or mixtures thereof . the organic solvent was selected from the group comprising of ethers , esters , alcohols , ketones , hydrocarbons and halogenated hydrocarbons . the ethers were selected from the group comprising of dimethyl ether , dimethoxyethane , methyl - tertiary butyl ether etc . the solvents were selected from the group comprising of ethyl acetate , acetone , methanol , toluene , xylene , dichloromethane etc . the acid employed was selected from an organic or mineral acid or a mixture thereof . the mineral acid was selected from the group comprising of hydrochloric acid , sulfuric acid and nitric acid . the organic acid was selected from the group comprising of acetic acid , citric acid , propionic acid , lactic acid etc ., but preferably acetic acid . in this step , the acid was slowly added with stirring to the mixture of compound ( vi ) and solvent ( s ) at 20 - 35 ° c ., till the desired ph was obtained . the desired ph range varied for different substrates in the class of compound ( vi ) and ranged from 4 . 5 to 8 . 5 but preferably between 6 . 5 and 8 . 0 . after completion of the reaction , the desired compound of formula ( i ) separated out from the reaction mixture , filtered and dried . optionally , the compound of formula ( i ) was subjected to purification procedures such as crystallization , solvent treatment , treatment with acid , column chromatography etc . to obtain the desired purity . the desired compounds were obtained as stable , crystalline or amorphous solids and were characterized by 1 h nmr , 13 c nmr and ms . the different compounds obtained by varying the substituent in the general formula ( i ) are provided in tables 1a and 1b . for clinical use , the compounds of the invention were utilized for pharmaceutical formulations for oral , rectal , parenteral or other modes of administration . the pharmaceutical formulation contains a compound of the invention in combination with a pharmaceutically acceptable carrier . the carrier may be in the form of a solid , semisolid or liquid diluent , or a capsule . usually the amount of active compound is between 0 . 1 and 95 . 0 % by weight of the preparation . when the compound of the present invention is to be administered as a therapeutic or preventive agent for peptic ulcer , it may be orally administered as powder , granule , capsule or syrup . alternately , it may be parenterally administered in the form of suppositories , injections , external preparations or intravenous drips . the dose may vary depending on the condition , age and ulcer type of the patient . it may be administered in a dose of approximately 0 . 01 to 200 mg / kg / day , preferably 0 . 05 to 50 mg / kg / day and still preferably 0 . 1 to 10 mg / kg / day in one to several portions . it may be formulated in a conventional manner by using conventional pharmacological carriers . when a solid preparation for oral administration is to be produced , for example , the active component is mixed with filler as well as a binder , a disintegrating agent , a lubricant , a colorant and / or a corrigent , if required . the obtained mixture is then formulated into tablets , coated tablets , granules , powders or capsules in a conventional manner . examples of fillers include lactose , corn starch , white sugar , glucose , sorbitol , crystalline cellulose and silicon dioxide . examples of binder include polyvinyl alcohol , polyvinyl ether , methylcellulose , gum arabic , tragacanth , gelatin , shellac , hydroxypropyl - cellulose , hydroxypropyl starch and polyvinylpyrrolidone . example of disintegrating agent includes starch , agar , gelatin powder , crystalline cellulose , calcium carbonate , sodium hydrogen carbonate , calcium citrate , dextrin and pectin . examples of the lubricant include magnesium stearate , talc , polyethylene glycol , silica and hardened vegetable oils . as the colorant , pharmacologically acceptable ones may be employed . examples of the corrigent include cocoa powder , mentha herb , aromatic powder , mentha oil , borneol and cinnamon powder . needless to say , these tablets or granules may be coated with , for example , sugar or gelatin . when an injection is to be produced , the active component is mixed with various additives such as a ph modifier , a buffer , a stabilizer or a solubilizing agent , if required . thus a subcutaneous , intramuscular or intravenous injection is obtained . the principles , preferred embodiments and modes of operation of the present invention have been described in the foregoing examples . the invention which is intended to be protected herein , however , is not to be construed limited to the particular forms disclosed , since these are to be regarded as illustrative rather than restrictive . variations and changes may be made by those skilled in the art , without departing from the spirit of the invention . general procedures for preparation of compound iv , compound v and compound vi are given below . a . preparation of compound iv ( scheme - 3 ): the reaction of substituted benzimidazothiol derivatives or substituted imidazopyridine - thiol derivatives ( compound ii ) with substituted methoxypyridinium hydrochloride derivatives ( compound iii ) was carried out at 25 - 30 ° c ., in presence of aqueous solution of base such as sodium hydroxide and an organic solvent like methanol . the reaction was monitored by tlc and after completion of the reaction , the mixture was filtered , the solid was separated and dried to give the respective substituted methoxy - pyridinylmethylsulfidyl imidazole or imidazopyridine derivatives ( compound iv ). b . 1 —( using sodium sulfide ): the solution of compound iv in n - methyl pyrrolidone was treated with sodium sulfide at 80 - 110 ° c . the reaction was continued till completion of the reaction , as monitored by tlc . the reaction mass was cooled and ph was adjusted in the range of 6 to 7 using aqueous solution of acetic acid . filtration of the obtained solid and drying gave compound v having desired purity . b . 2 —( using hbr / acetic acid ): a stirred mixture of compound iv , acetic acid and aqueous hbr was heated to 100 - 110 ° c . till the reaction was complete , as monitored by tlc . after completion , the reaction mass was cooled and concentrated under reduced pressure . the residue was diluted with water and washed with dichloromethane . the aqueous layer was neutralized by addition of sodium carbonate solution , which was followed by addition of methanol and filtered . the residue thus obtained was optionally washed with aqueous methanol and dried to give compound v . b . 3 —( using alcl 3 ): a mixture of compound iv , aluminium chloride were stirred in a solvent like chloroform and heated to 50 - 70 ° c . till the reaction was complete , as monitored by tlc . the reaction mass was cooled , quenched with water and concentrated . hydrochloric acid was added to the residue and the aqueous layer was neutralized using aqueous sodium carbonate solution . the precipitated solid was filtered , dried , and optionally purified to give compound v . c . 1 : oxidation with camphorsulfonyl oxaziridine : ( 10 - camphorsulfonyl ) oxaziridine was gradually added to a solution of compound v and sodium hydroxide in isopropyl alcohol at 25 to 30 ° c . and stirred at same temperature . after completion of the reaction , as monitored by tlc , the reaction mass was filtered , and the filtrate was concentrated under vacuum to obtain compound vi , which was directly used for further reaction . in some cases , the residue obtained after concentration was dissolved in methanol , concentrated and further treated with toluene and dried to obtain compound vi c . 2 : oxidation with sodium hypochlorite : compound v was added to a stirred mixture of aqueous sodium hydroxide and methanol , followed by gradual addition of sodium hypochlorite solution at 25 - 30 ° c . the reaction mixture was stirred at the same temperature till completion of the reaction and then extracted with an organic solvent . the organic layer was concentrated to give the desired product . alternatively , the reaction mass containing compound vi was carried forward for the next reaction , without isolating the product . d — preparation of compound i : a solution of compound vi dissolved in water or an organic solvent or mixtures thereof was treated with acid , which was gradually added to it at 25 - 30 ° c ., till the ph of the reaction mixture was in the range of 4 . 5 to 8 . 5 , preferably 6 . 5 to 8 . the mass was stirred till completion of the reaction as monitored by tlc . the suspension thus obtained was filtered and solid was dried to get compound i , which was optionally purified using suitable methods . methanol ( 270 ml ) was added to a solution of naoh ( 41 . 5 gms ) in water ( 180 ml ), followed by addition of 5 - difluoromethoxy - 2 - mercapto - 1h - benzimidazole ( 105 . 2 gms ). a solution of 2 - chloromethyl - 3 , 4 - dimethoxy - pyridine . hydrochloride ( 100 . 3 gm in water ( 150 ml )) was gradually added to the reaction mixture and stirred at 25 - 30 ° c . till completion of the reaction . after completion , as monitored by tlc , the reaction mixture was filtered and the obtained solid was dried to give compound iv - a - 11 . 1h nmr ( 400 mhz , cdcl3 ): δ 8 . 27 ( d , j = 5 . 6 hz , 1h ), 7 . 48 ( d , j = 8 . 8 hz , 1h ), 7 . 32 ( d , j = 2 hz , 1h ), 6 . 99 ( dd , j = 2 . 4 , 8 . 8 hz , 1h ), 6 . 87 ( d , j = 5 . 6 hz , 1h ), 6 . 50 ( t , j = 74 . 8 hz , 1h ), 4 . 39 ( s , 2h ), 3 . 95 ( s , 3h ), 3 . 93 ( s , 3h ). the solution of compound iv - a - 11 ( 50 . 7 gms ) and sodium sulfide ( 38 . 6 gm , assay 55 %) in n - methyl pyrrolidone ( 700 ml ) were heated to 90 to 100 ° c . and stirred at the same temperature . after completion of the reaction , as monitored by tlc , the reaction mass was quenched with water and ph was adjusted to 6 . 7 using aqueous acetic acid ( 50 %). the obtained suspension was filtered and solid dried to get compound v - a - 11 . 1 h nmr ( 400 mhz , dmso d 6 ): δ 7 . 66 ( br . s , 1h ), 7 . 48 ( br . s , 1h ), 7 . 30 ( br . s , 1h ), 7 . 16 ( t , j = 74 . 4 hz , 1h ), 6 . 98 ( dd , j = 2 . 0 , 8 . 0 hz , 1h ), 6 . 25 ( br . s , 1h ), 4 . 54 ( s , 2h ), 3 . 76 ( s , 3h ), esi - ms : 353 . 7 ( m + 1 ). ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 33 . 7 gm ) was gradually added to a solution of v - a - 11 ( 50 . 1 gm ), and sodium hydroxide ( 12 . 4 gm ) in isopropyl alcohol ( 350 ml ) at 25 to 30 ° c . the reaction mixture was stirred at 25 to 30 ° c . the reaction mass was filtered and the filtrate was concentrated under vacuum to obtain vi - a - 11 ( 60 . 1 gm ) and carried forward for next reaction . aqueous acetic acid ( 50 %) was gradually added to a solution of vi - a - 11 ( 190 . 5 gm ) in ethyl acetate ( 1900 ml ) and water ( 1140 ml ) at 25 to 30 ° c . till the reaction mass attained ph 7 . 3 . the mass was stirred till completion of the reaction as monitored by tlc . the suspension thus obtained was filtered and solid was dried to give compound i - a - 11 . 1 h nmr ( 400 mhz , dmso d 6 ): δ 13 . 35 ( br . s , 2h ), 7 . 94 ( d , j = 7 . 6 hz , 2h ), 7 . 59 ( br . s , 2h ), 7 . 40 (( s , 6h br . s , 2h ), 7 . 22 ( t , j = 74 hz , 2h ), 7 . 11 ( d , j = 8 . 4 hz , 2h ), 6 . 33 ( d , j = 7 . 6 hz , 2h ), 4 . 17 ( s , 4h ), 3 . 76 ( s , 6h ). 13 c nmr ( 100 mhz , dmso d 6 ): δ 173 . 0 , 147 . 9 , 146 . 9 , 146 . 3 , 139 . 4 , 137 . 5 , 119 . 4 , 116 . 8 , 116 . 6 , 115 . 7 , 114 . 2 , 59 . 6 , 32 . 7 . the experimental procedure that was followed was same as that described for synthesis of ( vi - a - 11 ) wherein compound ( v - a - 1 , 72 . 8 g ), sodium hydroxide ( 22 . 4 g ), isopropyl alcohol ( 500 ml ) and ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 67 . 9 g ) were used to obtain compound ( vi - a - 1 ) which was used for further reactions . the experimental procedure that was followed was same as that described for synthesis of ( i - a - 11 ) wherein compound ( 110 . 4 g ), ethyl acetate ( 1100 ml ), water ( 660 ml ) and aqueous acetic acid ( 50 %) were used to obtain ( i - a - 1 ). 1 h nmr ( 400 mhz , dmso - d6 ): δ 13 . 25 ( br . s , 2h , d 2 o exchangable ), 7 . 98 ( d , j = 8 . 0 hz , 2h ), 7 . 57 ( s , 4h ), 7 . 29 - 7 . 25 ( m , 4h ), 6 . 30 ( d , j = 2 . 4 hz , 2h ), 6 . 21 ( dd , j = 2 . 8 , 8 . 0 hz , 2h ), 4 . 06 ( s , 4h ). 13 c nmr ( 100 mhz , dmso ): δ 177 . 7 , 145 . 7 , 145 . 3 , 141 . 7 , 122 . 9 , 120 . 4 , 116 . 7 , 38 . 3 . esi - ms : 612 . 9 ( m + 1 ). ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 167 . 5 g ) was gradually added to a mixture of ( v - a - 2 ) ( 200 . 7 g ), and sodium hydroxide ( 57 . 2 g ), in isopropyl alcohol ( 1400 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 2 ), which was used for further reactions . yield : 235 . 6 g aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of compound ( vi - a - 2 ), ( 130 . 4 g ), in ethyl acetate ( 1300 ml ) and water ( 780 ml ) till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 2 ). 1 h nmr ( 400 mhz , cd3od ): δ 7 . 84 ( s , 2h ), 7 . 58 - 7 . 56 ( m , 4h ), 7 . 36 - 7 . 33 ( m , 4h ), 3 . 99 ( s , 4h ), 2 . 01 ( s , 6h ), 2 . 00 ( s , 6h ). 13 c nmr ( 100 mhz , dmso d 6 ): δ 177 . 3 , 146 . 0 , 141 . 6 , 137 . 5 , 124 . 2 , 122 . 9 , 122 . 3 , 115 . 5 , 36 . 7 , 13 . 3 , 11 . 4 . ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 83 . 2 gms ) was gradually added to a mixture of ( v - a - 3 ); ( 100 . 4 g ) and sodium hydroxide ( 29 . 6 gms ) in isopropyl alcohol ( 700 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 3 ), which was used for further reactions . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of compound ( vi - a - 3 ); ( 120 . 3 g ), in ethyl acetate ( 1200 ml ) and water ( 720 ml ), till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 3 ). 1 h nmr ( 400 mhz , dmso d 6 ): δ 13 . 15 ( br . s , 2h , d 2 o exchangable ), 7 . 94 ( d , j = 7 . 6 hz , 2h ), 7 . 56 ( br . s , 4h ), 7 . 28 - 7 . 26 ( m , 4h ), 6 . 32 ( d , j = 7 . 6 hz , 2h ), 4 . 17 ( s , 4h ), 3 . 75 ( s , 6h ). 13 c nmr ( 100 mhz , dmso d 6 ): δ 172 . 9 , 147 . 9 , 145 . 3 , 139 . 5 , 137 . 7 , 122 . 9 , 116 . 5 , 59 . 6 , 32 . 7 . the experimental procedure that was followed was same as that described for synthesis of ( vi - a - 3 ) wherein compound ( v - a - 4 , ( 150 . 6 g ), sodium hydroxide ( 41 . 9 g ) isopropyl alcohol ( 1050 ml ) and ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 119 . 3 g ) were used to obtain compound ( vi - a - 4 ) which was used for further reactions . the experimental procedure that was followed was same as that described for synthesis of ( i - a - 3 ) wherein compound ( vi - a - 4 ), ( 200 . 3 g ), ethyl acetate ( 2000 ml ), water ( 1200 ml ) and aqueous acetic acid ( 50 %) were used to obtain ( i - a - 4 ). 1 h nmr ( 400 mhz , dmso - d6 ): δ 13 . 05 ( br . s , 2h , d 2 o exchangable ), 7 . 89 ( s , 2h ), 7 . 6 - 7 . 2 ( br . m , 4h ), 7 . 09 ( d , j = 7 . 6 hz , 2h ), 4 . 10 ( s , 4h ), 2 . 42 ( s , 6h ), 1 . 90 ( s , 6h ), 1 . 88 ( s , 6h ) 13 c nmr ( 100 mhz , dmso ): δ 177 . 2 , 145 . 4 , 141 . 6 , 137 . 4 , 133 . 4 , 133 . 0 , 131 . 4 , 124 . 1 , 122 . 2 , 118 . 8 , 111 . 4 , 36 . 7 , 21 . 3 , 13 . 3 , 11 . 4 . ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 87 . 2 gms ) was gradually added to a mixture of ( v - a - 5 ) ( 110 . 5 gms ), and sodium hydroxide ( 30 . 3 gms ), in isopropyl alcohol ( 770 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 5 ), which was used for further reactions . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of compound ( vi - a - 5 ), ( 150 . 8 g ), in ethyl acetate ( 1200 ml ) and water ( 720 ml ), till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 5 ). 1 h nmr ( 400 mhz , dmso d 6 ): δ 12 . 99 ( br . s , 2h ), 7 . 92 ( d , j = 7 . 6 hz , 2h ), 7 . 45 ( d , j = 7 . 6 hz , 2h ), 7 . 33 ( s , 2h ), 7 . 08 ( d , j = 8 . 0 hz , 2h ), 6 . 32 ( d , j = 7 . 6 hz , 2h ), 4 . 16 ( s , 4h ), 3 . 75 ( s , 6h ), 2 . 41 ( s , 6h ). 13 c nmr ( 100 mhz , dmso ): δ 172 . 8 , 147 . 8 , 144 . 9 , 139 . 4 , 137 . 7 , 132 . 3 , 124 . 3 , 116 . 5 , 59 . 6 , 32 . 8 , 21 . 2 . ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 74 . 4 g ) was gradually added to a mixture of ( v - a - 6 , 100 . 1 gms ) and sodium hydroxide ( 25 . 4 g ) in isopropyl alcohol ( 700 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 6 ) as pale yellow powder . 1 h nmr ( 400 mhz , dmso d 6 ): δ 7 . 54 ( s , 1h ), 7 . 32 ( d , j = 8 . 8 hz , 1h ), 6 . 98 ( d , j = 2 . 4 hz 1h ), 6 . 53 ( dd , j = 2 . 4 , 8 . 8 hz 1h ), 4 . 23 - 4 . 12 ( abq , j = 12 . 8 hz , 2h ), 3 . 71 ( s , 3h ), 1 . 96 ( s , 3h ), 1 . 84 ( s , 3h ). 13 c nmr ( 100 mhz , dmso d 6 ): δ 174 . 1 , 161 . 9 , 154 . 2 , 146 . 9 , 145 . 9 , 141 . 4 , 121 . 8 , 121 . 3 , 117 . 7 , 109 . 7 , 99 . 8 , 61 . 9 , 55 . 7 , 15 . 2 , 12 . 3 . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of compound ( vi - a - 6 ; 15 . 3 gms ) in ethyl acetate ( 150 ml ) and water ( 90 ml ) till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 6 ). 1 h nmr ( 400 mhz , dmso d 6 ): δ 13 . 0 ( s , 2h , d 2 o exchangable ), 7 . 88 ( s , 2h ), 7 . 47 ( br . s , 2h ), 7 . 03 ( br . s , 2h ), 6 . 88 ( dd , j = 2 . 0 , 8 . 8 hz , 2h ), 4 . 09 ( s , 4h ), 3 . 79 ( s , 6h ), 1 . 90 ( s , 6h ), 1 . 88 ( s , 6h ). 13 c nmr ( 100 mhz , dmso d 6 ): δ 177 . 2 , 156 . 3 , 145 . 2 , 141 . 7 , 137 . 5 , 124 . 0 , 122 . 2 , 112 . 6 , 56 . 5 , 36 . 8 , 13 . 3 , 11 . 4 . ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 150 . 3 g ) was gradually added to a mixture of ( v - a - 7 ) ( 200 . 2 g ), and sodium hydroxide ( 52 . 1 g ) in isopropyl alcohol ( 1400 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 7 ), which was used for further reaction . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of compound ( vi - a - 7 ), ( 280 . 2 g ) in ethyl acetate ( 2800 ml ) and water ( 1680 ml ) till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 7 ). 1 h nmr ( 400 mhz , dmso d 6 ): δ 12 . 99 ( br . s , 2h , d 2 o exchangable ), 7 . 91 ( d , j = 7 . 6 hz , 2h ), 7 . 51 - 6 . 87 ( m , 6h ), 6 . 32 ( d , j = 7 . 6 hz , 2h ), 4 . 13 ( s , 4h ), 3 . 79 ( s , 6h ), 3 . 76 ( s , 6h ). ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 157 . 1 gms ) was gradually added to a mixture of ( v - a - 8 ), ( 200 . 5 g ) and sodium hydroxide ( 54 . 3 g ) in isopropyl alcohol ( 1400 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 8 ), which was used for further reaction . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of ( vi - a - 8 ) ( 200 . 2 g ) in ethyl acetate ( 2000 ml ) and water ( 1200 ml ) till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 8 ). 1 h nmr ( 400 mhz , dmso d 6 ): δ 13 . 36 ( br . s , 2h , d 2 o exchangable ), 7 . 92 ( s , 2h ), 7 . 63 - 7 . 51 ( br . m , 2h ), 7 . 45 - 7 . 33 ( br . m , 2h ), 7 . 16 - 7 . 12 ( m , 2h ), 4 . 10 ( s , 4h ), 1 . 90 ( s , 6h ), 1 . 88 ( s , 6h ). 13 c nmr ( 100 mhz , dmso d 6 ): δ 177 . 2 , 160 . 0 , 157 . 7 , 146 . 9 , 141 . 4 , 137 . 3 , 124 . 1 , 122 . 3 , 111 . 3 , 36 . 7 , 13 . 2 , 11 . 4 . ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 52 . 5 g ) was gradually added to a mixture of ( v - a - 9 ), ( 77 . 6 g ) and sodium hydroxide ( 18 . 0 g ) in isopropyl alcohol ( 540 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 9 ), which was used for further reaction . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of ( vi - a - 9 ), ( 100 . 6 g ) in ethyl acetate ( 1000 ml ) and water ( 600 ml ) till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 9 ). 1 h nmr ( 400 mhz , dmso d 6 ): δ 7 . 98 ( d , j = 7 . 6 hz , 2h ), 7 . 92 ( s , 2h ), 7 . 75 ( d , j = 8 . 4 hz , 2h ), 7 . 58 ( d , j = 8 . 4 hz , 2h ), 6 . 35 ( d , j = 7 . 6 hz , 2h ), 4 . 20 ( s , 4h ), 3 . 77 ( s , 6h ). 13 c nmr ( 100 mhz , dmso ): δ 172 . 9 , 147 . 9 , 147 . 8 , 139 . 3 , 137 . 4 , 124 . 8 ( q , j = 270 hz , cf 3 ), 123 . 5 ( q , j = 31 hz ), 119 . 5 , 116 . 6 , 115 . 8 , 113 . 6 , 59 . 6 , 32 . 8 . ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 123 . 4 gms ) was gradually added to a mixture of ( v - a - 10 ), ( 182 . 3 gms ), and sodium hydroxide ( 42 . 2 gms ) in isopropyl alcohol ( 1270 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc and filtered . the filtrate was concentrated under reduced pressure to provide a residue , which was dissolved in methanol , concentrated and further treated with toluene and dried to obtain ( vi - a - 10 ), which was used for further reaction . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of ( vi - a - 10 ) ( 220 . 1 g ) in ethyl acetate ( 2200 ml ) and water ( 1320 ml ) till the ph of the reaction mass was between 6 . 5 and 7 . 5 . reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . the reaction mass was filtered and the obtained solid was dried to give compound ( i - a - 10 ). 1 h nmr ( 400 mhz , cd 3 od ): δ 7 . 85 ( s , 2h ), 7 . 59 ( d , j = 8 . 8 hz , 2h ), 7 . 37 ( s , 2h ), 7 . 17 ( d , j = 8 . 8 hz , 2h ), 6 . 83 ( t , j = 74 . 4 hz , 2h ), 4 . 04 ( s , 4h ), 2 . 03 ( s , 6h ), 2 . 01 ( s , 6h ). 13 c nmr ( 100 mhz , cd 3 od ): δ 180 . 5 , 149 . 5 , 147 . 8 , 144 . 5 , 139 . 2 , 138 . 6 , 126 . 6 , 125 . 2 , 120 . 7 , 118 . 1 , 118 . 0 , 115 . 6 , 107 . 6 , 38 . 4 , 13 . 7 , 12 . 1 . the experimental procedure followed was same as that described for synthesis of ( vi - a - 11 ) wherein compound ( v - b - i ; ( 120 . 5 g ), sodium hydroxide ( 34 . 6 g ), isopropyl alcohol ( 840 ml ) and ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 99 . 8 g ) were used to obtain crude ( vi - b - 1 ) which was used for further reactions . the experimental procedure followed was same as that described for synthesis of ( i - a - 11 ) wherein compound ( vi - b - 1 ); ( 200 . 6 g ), ethyl acetate ( 2000 ml ), water ( 1200 ml ) and aqueous acetic acid ( 50 %) were used to obtain ( i - b - 1 ). 1 h nmr ( 400 mhz , dmso - d6 ): δ 8 . 25 ( d , j = 4 . 8 hz , 2h ), 8 . 03 ( s , 2h ), 7 . 92 ( d , j = 7 . 6 hz , 2h ), 7 . 14 ( dd , j = 4 . 8 , 8 . 0 hz , 2h ), 4 . 32 ( s , 4h ), 1 . 90 ( s , 6h ), 1 . 86 ( s , 6h ) 13 c nmr ( 100 mhz , dmso ): δ 177 . 2 , 153 . 2 , 152 . 8 , 142 . 0 , 141 . 3 , 137 . 6 , 133 . 9 , 124 . 2 , 123 . 8 , 121 . 9 , 116 . 7 , 37 . 4 , 13 . 4 , 11 . 5 . the experimental procedure that was followed was same as that described for synthesis of ( vi - b - 1 ), wherein compound ( v - b - 2 ) ( 77 . 7 g ), sodium hydroxide ( 19 . 1 g ), isopropyl alcohol ( 540 ml ) and ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 58 . 7 g ) were used to obtain compound ( vi - b - 2 ) which was used for further reactions . the experimental procedure that was followed was same as that described for synthesis of ( i - b - 1 ) wherein compound ( vi - b - 2 ), ( 140 . 3 g ), ethyl acetate ( 1400 ml ), water ( 840 ml ) and aqueous acetic acid ( 50 %) were used to obtain ( i - b - 2 ). 1 h nmr ( 400 mhz , dmso - d6 ): δ 13 . 58 ( br . s , 2h . d 2 o exchangable ), 7 . 93 - 7 . 90 ( m , 4h ), 6 . 74 ( d , j = 8 . 8 hz , 2h ), 6 . 31 ( d , j = 8 . 0 hz , 2h ), 4 . 16 ( s , 4h ), 3 . 88 ( s , 6h ), 3 . 77 ( s , 6h ). 13 c nmr ( 100 mhz , dmso ): δ 172 . 8 , 161 . 1 , 147 . 9 , 144 . 3 , 139 . 4 , 137 . 5 , 126 . 2 , 116 . 5 , 106 . 9 , 59 . 6 , 53 . 4 , 32 . 7 . ( 1r )-(−)-( 10 - camphorsulfonyl ) oxaziridine ( 88 . 4 g ) was gradually added to a mixture of ( v - b - 3 ; 80 . 2 gms ) and sodium hydroxide ( 23 . 3 gms ) in isopropyl alcohol ( 700 ml ) under stirring at room temperature . the reaction mixture was stirred at the same temperature till completion of the reaction as monitored by tlc . when the reaction was complete , the solid was filtered off and the filtrate was concentrated under reduced pressure to obtain compound ( vi - b - 3 ) as a solid , which was used for further reaction . aqueous acetic acid ( 50 %) was gradually added to the stirred mixture of compound ( vi - b - 3 ; 180 . 1 gms ), dissolved in a mixture of ethyl acetate ( 1050 ml ) and water ( 1500 ml ) till the ph of reaction mass was 7 . 3 . the reaction mass was stirred at room temperature till completion of the reaction as monitored by tlc . after completion , the reaction mass was filtered and the obtained solid was stirred in hydrochloric acid , filtered , washed with water and dried to give compound ( i - b - 3 ). 1 h nmr ( 400 mhz , dmso d 6 ): δ 7 . 94 - 7 . 91 ( m , 4h ), 6 . 76 ( d , j = 8 . 8 hz , 2h ), 4 . 12 ( s , 4h ), 3 . 89 ( s , 6h ), 1 . 91 ( s , 6h ), 1 . 88 ( s , 6h ). 13 c nmr ( 100 mhz , dmso d 6 ): δ 177 . 4 , 161 . 4 , 144 . 8 , 142 . 0 , 137 . 8 , 124 . 5 , 122 . 6 , 107 . 2 , 53 . 5 , 37 . 0 , 13 . 4 , 11 . 5 . spectral characterization of the aforementioned compounds was carried out as given below . the magnetic resonance spectra ( 1 h nmr and 13 c nmr ) were recorded on varian 400 - mr , while mass spectra were recorded on applied biosystems api2000 lc / ms / ms and shimadzu lc / ms 8030 . solid oral formulation ( tablets ) containing the active ingredient . a tablet containing compound ( i ) was prepared from the following ingredients : the active ingredient was mixed with lactose , and granulated with a water solution of methyl cellulose . the wet mass was forced through a sieve and the granulate was dried in an oven . after drying , the granulate was mixed with polyvinylpyrrolidone and magnesium stearate . the dry mixture was pressed into tablet cores ( 10 000 tablets ), each tablet containing 20 % by weight of the active substance in a tableting machine using 6 mm diameter punches . evaluation of the effects of compounds on the activity of the h + / k + atpase activity was quantified by measuring the formation of para - nitrophenol ( p - np ) from para - nitrophenol phosphate ( p - npp ) using an enzyme isolated from the rabbit or porcine ( pig ) fundus . the test compound , reference compound or water ( control ) are pre - incubated for 30 min at 37 ° c . with the enzyme ( 5 μg ) in a buffer containing 40 mm hepes / tris ( ph 6 . 0 ), 20 mm kcl , 5 mm mgcl 2 and 1 mm ouabain . the enzymatic reaction was then initiated by the addition of 2 mm p - npp . the absorbance was measured immediately at λ = 405 nm using a microplate reader ( envision , perkin elmer ). this measurement at t = 0 was also used to verify any compound interference with the spectrophotometric detection at the selected wavelength . thereafter , the mixture was incubated for 15 min at 37 ° c ., after which time the reaction is stopped by addition of 0 . 5 m naoh and a second measurement is made at the same wavelength ( t = 15 ). the enzyme activity is determined by subtracting the signal measured at t = 0 from that measured at t = 15 . the results are expressed as a percent inhibition of the control enzyme activity . bibliographic reference : dantzig , h ., minor , p . l . garrigus , j . l ., fukuda , d . s . and mynderse , j . s ., studies of the mechanism of action of a80915a , a semi - naphtolquinone natural product , as an inhibitor of gastric ( h +/ k +)- atpase , biochem . pharmacol . ( 1991 ), 42 : 2019 . * literature reference : c . k scott and e . sundell , inhibition of h + k + atpase activity by sch 28080 and sch 32651 , eur . j pharmacol , jun . 7 , ( 1985 ); 112 ( 2 ): 268 - 70 . ** literature reference - d . j . keeling , c fallowfield , k . j . milliner , s . k . tingley , r . j . ife , and a . h . underwood , “ studies on the mechanism of action of omeprazole ”, biochem pharmacol , aug . 15 , ( 1985 ); 34 ( 16 ): 2967 - 73 . the anti - ulcer efficacy of various test compounds ( i - a - 1 to i - a - 11 , i - b - 1 to i - b - 3 ) was assessed in indomethacin — induced gastric ulceration model in female albino wistar rats ( bhattacharya s ., banerjee d ., bauri a . k ., chattopadhyay s ., bandyopadhyay s . k . healing property of the piper betelphenol , allylpyrocatechol against indomethacin - induced stomach ulceration and mechanism of action . world j gastroenterol ., 13 ( 27 ): 3705 - 13 , 2007 ; lee a . animal models of gastroduodenal ulcer disease . bailliere &# 39 ; s best pract . res . clinic gastroenterol ., 14 ( 1 ): 75 - 96 , 2000 ). the test compounds were administered orally at various doses ( 0 . 2 , 0 . 4 , 0 . 8 and 1 . 6 mg / kg ) in comparison to omeprazole ( 10 mg / kg ) as standard comparator . experiments were conducted in overnight fasted healthy female albino wistar rats maintained at controlled environmental conditions of temperature and humidity with water given ad libitum . non - steroidal anti - inflammatory drug ( nsaid ), indomethacin ( 30 mg / kg , p . o .) was used to induce gastric ulcer ( treatment groups ) with a comparative group without indomethacin treatment ( negative group ). indomethacin was administered to treatment groups 1 hour after oral treatment with vehicle ( 1 % cmc ), various doses of test compounds ( eppis ) and omeprazole ( 10 mg / kg ). after 4 - 6 hours after indomethacin administration , the animals were sacrificed by cervical dislocation and their stomach was dissected out . various parameters like macroscopic ulcer index , gastric mucus content and gastric acid ph measurements were undertaken . the rat stomachs were cut opened along the greater curvature for macroscopic determination of ulcer index . all the tested compounds at higher doses ( 1 . 6 / 0 . 8 mg / kg ) produced very significant and equivalent anti - ulcerogenic effect in comparison to omeprazole ( 10 mg / kg ) in this indomethacin — induced ulcer model in rats ( table d ).	2
although certain preferred embodiments and examples are disclosed below , inventive subject matter extends beyond the specifically disclosed embodiments to other alternative embodiments and / or uses , and to modifications and equivalents thereof . thus , the scope of the claims appended hereto is not limited by any of the particular embodiments described below . for example , in any method or process disclosed herein , the acts or operations of the method or process may be performed in any suitable sequence and are not necessarily limited to any particular disclosed sequence . various operations may be described as multiple discrete operations in turn , in a manner that may be helpful in understanding certain embodiments ; however , the order of description should not be construed to imply that these operations are order dependent . additionally , the structures , systems , and / or devices described herein may be embodied as integrated components or as separate components . to guarantee control fidelity , it may be important to monitor the tendon tension when robotically - controlling endoscopic and laparoscopic tools that use tendon - like members , such as a catheter , endoscope , laparoscopic grasper , or forceps . while there are a number of approaches to monitoring tendon tension , direct measurement in the instrument provides a number of practical advantages , including simplifying the instrument - driver interface , and reduce friction and inefficiencies in transmission through the interface . accordingly , the present invention provides a sensing apparatus that may be mounted within the instrument . fig1 a illustrates a tension sensing mechanism located within the robotically - controlled instrument , in accordance with an embodiment of the present invention . in transparent isometric view 100 , the instrument 101 provides for a series of actuating bodies , such as rotatable bodies for low friction , such as spools or pulleys 102 , 103 , that are coupled to tendons 106 and 107 that are designed to actuate the distal end of an elongated instrument ( not shown ), such as a flexible catheter or rigid laparoscopic tool , in response to tension . instrument 101 also provides for cavities 104 , 105 for additional rotatable bodies to actuate additional tendons ( now shown ). rotatable bodies 102 , 103 , and those potentially used in cavities 104 , 105 may be driven by a robotically - controlled instrument device manipulator as part of a larger robotic system , such as those disclosed in the aforementioned patents . while the instrument 101 is shown to be circular , other embodiments may take other shapes , such as oblong , rectangular , or square - shaped . in addition to the actuating rotatable bodies , and related cavities for additional rotatable bodies , the present embodiment contemplates redirecting surfaces , represented as rotatable ( body ) pulleys 108 and 109 in instrument 101 , to measure tension in tendons 106 and 107 respectively . to measure tension , tendons 106 and 107 may be wound around rotatable bodies 108 and 109 in addition to rotatable bodies 102 and 103 . fig1 b illustrates a top schematic view of the instrument 101 , in accordance with an embodiment of the present invention . as shown in view 110 , tendon 106 may be wound around pulley 102 and pulley 108 . similarly , tendon 107 may be wound around pulley 103 and pulley 109 . even though pulleys 102 , 103 , 108 , 109 are shown to have parallel axes in instrument 101 , they may not be parallel in other embodiments . pulley 108 is coupled to a lever element 111 , which is configured to exert a reactive force in response to tension in tendon 106 . the resulting reactive force from tension in tendon 106 may be resolved through contact between lever 111 , constrained by a pivot point such as pivot axis 112 , and sensor 113 . while the instrument 101 contemplates the pivot axis 112 and sensor 113 positioned at opposite ends of the level element 111 , they may be positioned at a number of positions along the lever element in other embodiments . the relative position of the sensor and pivot point may provide for a known , fixed ratio between the tension and the reactive force on the sensor . identical structural relationships exist with respect to pulley 109 , lever element 114 , pivot axis 115 , and sensor 116 . in some embodiments , the sensors 113 and 116 may be force sensors , piezoelectric sensors , piezoresistive sensors , or load cells to measure the reactive force exerted by levers 111 and 114 respectively . in some embodiments , it may be desirable for the sensors to be low cost , particularly if the instrument is intended to be recyclable or disposable . in some embodiments , such as instrument 101 , the pivot point may be offset from the axis of the corresponding rotatable body , e . g ., the axis of pulley 108 relative to the pivot axis 112 in instrument 101 . as shown in instrument 101 , while the pivot point may be a pivot axis 112 , which reduces friction resulting from any bending moments , the pivot point may be non - axial element in other embodiments , such as a flexure . tension on tendon 106 may be the consequence of a number factors , including rotation of pulley 108 or external pressure on the elongated member in which tendon 106 resides . regardless of its source , when wound around pulley 108 , tension on tendon 106 may be imparted equally around pulley 108 . as the pulley 108 is operatively coupled to lever 111 , the resulting reactive force may be transmitted through the lever 111 and measured based on the force exerted on sensor 113 . the positioning of the lever 111 , in contact with sensor 113 , allows measurement of the reactive force from the tension in tendon 106 . offsetting the axis of the pivot point such as pivot axis 112 at fixed distance from the axis of pulley 108 allows the force from lever 111 to be smaller or larger in magnitude based on the length of the lever and the fixed offset . using these measurements , combined with the measured force at the sensor 113 , the tension in tendon 106 may be calculated . allowing for differences in the magnitude of the lever force based on the length of the lever may be useful to bring the measured force within the range and tolerances of the sensor . this may be particularly useful for inexpensive sensors designed for a specific range of forces . identical operational relationships exist with respect to pulley 109 , lever element 114 , pivot axis 115 , and sensor 116 . among other advantages , this method of direct measurement of the tendon tension bypasses the complexity and efficiency losses that may be associated with measuring force further down the drivetrain . fig1 c , 1d , 1e , 1f , 1g illustrate additional views of instrument 101 from fig1 a , 1b , in accordance with an embodiment of the present invention . side view 117 from fig1 c illustrates a side perspective of instrument 101 and the alignment of the tendons , spools , levers , and sensors within instrument 101 , according to one embodiment . front view 118 from fig1 d illustrates a frontal perspective of instrument 101 and the alignment of the spools and sensors within instrument 101 , according to one embodiment . partial cutaway view 119 from fig1 e illustrates a rear perspective of instrument 101 and the alignment of the spools and levers within instrument 101 , according to one embodiment . rear view 120 from fig1 f illustrates a rear perspective of instrument 101 and the alignment of the spools and levers , and their respective axes , without the exterior shell of instrument 101 , according to one embodiment . bottom cutaway view 121 from fig1 g illustrates a bottom - up perspective of instrument 101 and the alignment of the spools , levers , sensors within instrument 101 , according to one embodiment . in addition , view 121 illustrates placement of magnets 122 that may be configured to couple instrument 101 to an interface or an instrument driving mechanism / instrument device manipulator . fig2 a illustrates an instrument that incorporates a tension sensing mechanism and is designed to actuate an elongated instrument , in accordance with an embodiment of the present invention . in isometric view 200 , instrument 201 receives rotational motion from an instrument device manipulator via coaxial drive shafts 202 to actuate tendons that are wound around redirect surfaces ( i . e ., idlers ) that are located on an idler carriage 203 , consistent with u . s . provisional patent application no . 62 / 134 , 366 , the entire contents of which are incorporated by reference . fig2 b illustrates the idler carriage 203 from instrument 201 that incorporates a tension sensing mechanism , in accordance with an embodiment of the present invention . as shown in view 204 , the idler carriage 203 generally comprises four rotatable bodies for redirecting tendons , i . e ., pulleys 205 , 206 , 207 , 208 , where each of the pulleys is coupled to an individual lever element , such as levers 209 , 210 , 211 , 212 respectively . each lever 209 , 210 , 211 , 212 includes a pivot axis , such as 213 , 214 , 215 , 216 respectively , which is offset from the axes of pulleys 205 , 206 , 207 , 208 respectively . in some embodiments , the axial offsets may be consistent and common to all the pulleys and levers in the idler carriage . in other embodiments , the axial offset between the levers and pulleys may vary within the idler carriage . consistent with previously disclosed embodiments , each lever in instrument 201 may be configured to provide reactive force to a corresponding sensor , such as sensor 217 , which is configured to detect force exerted by lever 209 in response to tension on pulley 205 . similarly , sensor 218 is configured to detect force exerted by lever 211 in response to tension on pulley 207 . additional sensors are similarly situated relative to levers 210 and 212 . fig2 c illustrates the idler carriage 203 from instrument 201 that incorporates a tension sensing mechanism , in accordance with an embodiment of the present invention . in contrast to view 204 from fig2 b , frontal view 219 from fig2 c provides a different perspective of the orientation of pulleys 205 , 206 , 207 , 208 , levers 209 , 210 , 211 , 212 and pivot axes 213 , 214 , 215 , 216 relative to each other . consistent with previously disclosed embodiments , each lever in instrument 201 may be configured to provide reactive force to a corresponding sensor , such as sensor 217 , which is configured to detect force exerted by lever 209 in response to tension on pulley 205 . similarly , sensor 218 is configured to detect force exerted by lever 211 in response to tension on pulley 207 . fig2 d illustrates a vertical cross - sectional view of idler carriage 203 from instrument 201 that incorporates a tension sensing mechanism , in accordance with an embodiment of the present invention . as shown in cross - sectional view 220 , pulleys 205 , 206 , 207 , 208 may wrap around levers 209 , 210 , 211 , 212 respectively to capture tension in the tendons that may be redirected around them . additionally , the distal ends of the lever elements may be directed towards the center of the carriage where the sensors ( not shown ) are located . fig2 e illustrates an overhead view of idler carriage 203 from instrument 201 that incorporates a tension sensing mechanism , in accordance with an embodiment of the present invention . as shown in top view 221 , lever elements 209 , 211 may be directed towards sensors 217 , 218 respectively , located towards the center of the idler carriage 203 , from opposite sides of idler carriage 203 . sensors 217 , 218 may be configured to detect any force generated by levers 209 , 211 respectively based on tension around pulleys 205 , 207 respectively . fig3 illustrates a free body diagram representing the mechanical operation of a tension sensing apparatus , in accordance with an embodiment of the present invention . as shown in view 300 , the embodiment may generally comprise a tendon 301 , a pulley 302 with a pulley axis 303 , a lever element 304 with a pivot axis 305 , and a sensor 306 . tension forces ( represented as arrows 307 and 308 ) in tendon 301 exert equal and opposite forces along tendon 301 as it winds around pulley 302 . given the known relationships between the location of the pulley 302 , lever 304 , and sensor 306 , the tension in tendon 301 may be determined based on the measurement of force at sensor 306 . mathematically , the statistics equilibrium may be expressed as : σ m pivot = 0 =( l 1 + r ) f tension +( l 1 − r ) f tension − l 2 f sense ( equation 1 ) where σm pivot represents the sum of moments of lever 304 about the pivot axis 305 , f tension represents the tension force on the tendon 301 , l 1 represents the distance from the pulley axis 303 pivot axis 305 , l 2 represents the distance from pivot axis 305 to the point where the lever element 304 contacts the force sensor 306 , r represents the radius of the pulley 302 , and f sense represents the force on the sensor 306 . with some algebraic manipulation , the expression may be reduced to determine the specific relationship between f tension and f sense : where l 1 and l 2 are fixed constants based on the physical arrangement of the pulley 302 , lever 304 , and sensor 306 . this mathematical relationship may also be applied with respect to the previously disclosed embodiments . the takeoff angle of the tendons is the angle at which the tendon comes off the pulley relative to the lever . the takeoff angle of the tendons in the example of fig3 is 90 degrees . where the takeoff angle of the tendons differs , the algebraic relationship described above may differ , but it still follows the same general principles . fig4 illustrates a free body diagram representing the mechanical operation of a tension sensing apparatus , in accordance with an embodiment of the present invention . as shown in view 400 , the embodiment may generally comprise a tendon 401 , a pulley 402 with a pulley axis 403 , a lever element 404 with a pivot axis 405 , and a sensor 406 . in view 400 , tension forces f tension ( represented as arrows 407 and 408 ) in tendon 401 exert equal and opposite forces along tendon 401 as it winds around pulley 402 . unlike fig3 , however , the direction of the tendon 401 off of the pulley 402 is not orthogonal to the lever 404 . as a result , the vector component of f tension that runs parallel to f sense , represented as arrow 409 is calculated . algebraic manipulation could then be used to derive the precise relationship between f tension and f sense . the present invention also contemplates other embodiments where the takeoff angle differs for different tendons . fig5 illustrates a free body diagram representing the mechanical operation of a tension sensing apparatus , in accordance with an embodiment of the present invention . as shown in fig5 , tension sensing may make use of an alternative arrangement of a tendon 501 , a pulley 502 with a pulley axis 503 , a lever element 504 with a pivot axis 505 , and a sensor 506 . for the embodiment of fig5 , where the tendon 501 “ takes off ” from the pulley 502 at different angles relative to the lever element 504 , the vector components , if any , of f tension that runs parallel to f sense is evaluated to determine the relationship between those forces . the aforementioned embodiments of the present invention may be designed to interface with an instrument drive mechanism and robotics platform such as those disclosed in the aforementioned patent applications that are incorporated by reference . for example , the embodiments in fig1 a and 1b may be configured to be driven by an instrument drive mechanism or an instrument device manipulator that is attached to the distal end of a robotic arm through a sterile interface such as a drape . the driving elements may be shafts ( male ) or shaft receptacles ( female ) with spline interfaces to transfer rotational motion from the instrument drive mechanism to the instrument . as part of a larger robotics system , robotic control signals may be communicated from a remotely - located user interface , down the robotic arm , and to the instrument device manipulator to control the embodiment ( instrument ) of the present invention . for purposes of comparing various embodiments , certain aspects and advantages of these embodiments are described . not necessarily all such aspects or advantages are achieved by any particular embodiment . thus , for example , various embodiments may be carried out in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other aspects or advantages as may also be taught or suggested herein . elements or components shown with any embodiment herein are exemplary for the specific embodiment and may be used on or in combination with other embodiments disclosed herein . while the invention is susceptible to various modifications and alternative forms , specific examples thereof have been shown in the drawings and are herein described in detail . the invention is not limited , however , to the particular forms or methods disclosed , but to the contrary , covers all modifications , equivalents and alternatives thereof .	0
the present invention involves one or more vents passing through a surfboard from top to bottom . the vents are used to create an air film beneath the trailing portion of the board as it moves through the water . a broad air film is preferably created . in order to create such a film , an array of two or more vents are included in a suitable pattern . the top view of fig1 shows such an array . six vents 26 are provided in this embodiment . fig2 depicts a sectional elevation view of one of the vents 26 shown in fig1 . vent 26 passes vertically through the surfboard . the board in this example includes a typical construction used for modern surfboards . core 30 defines the overall shape of the board . deck skin 32 is made by laying one or more layers of woven cloth ( fiberglass , kevlar , or other more exotic materials such as carbon fiber ) over the upper surface of the core and bonding it using a liquid resin material that transitions to a strong solid . examples of the resin include polyester and epoxy . the reinforcing cloth and bonding resin surround and bond to core 30 on all sides . bottom skin 34 is the portion of the bonded reinforcing cloth that lies over the bottom of the board . in this example , vent 26 is simply an inclined cylindrical cavity having central axis 28 . the cylindrical cavity intersects the deck at top exit 56 . it intersects the bottom at bottom exit 54 . it is undesirable to expose any portion of the core material since it has little toughness or abrasion resistance . thus , it is preferable to provide wall skin 36 around the perimeter of vent 26 . wall skin 36 may be formed using a variety of techniques . it is preferable for wall skin 36 to be bonded to deck skin 32 and bottom skin 34 . the reader will observe that the nose of the surfboard lies off to the right of the cross section , and the tail lies off to the left . vent 26 is therefore inclined so that its upper portion lies close to the nose and its lower portion lies closer to the tail . this geometry is significant to the operation of the vent . fig3 shows the same geometry as the surfboard is moved rapidly through the water . the bottom exit region of vent 26 includes leading boundary 58 and trailing boundary 60 . water flow 44 slides rapidly along bottom 24 in the direction indicated by the arrow . as the water moves aft past leading boundary 58 , air / water boundary 38 moves up into vent 26 . this phenomenon is well known in the field of fluid mechanics and is commonly referrer to as “ hydraulic jump .” as the moving water approaches trailing boundary 60 , however , a different phenomenon occurs . the inclined surface of trailing boundary 60 causes some air to be entrained and pulled beneath the board ( entrained air 40 ). once this entrained air is aft of the vent , it cannot easily escape to the surface and must instead travel along the bottom of the board . air film 42 is thereby created . as is well known to those skilled in the art , the creation of such an air film substantially reduces the sliding friction between the bottom of the surfboard and the water . the vent shown in fig3 is a simple cylindrical bore drilled through the surfboard ( having a diameter “ d ”). this simple shape produces the desired effect . it is readily apparent that other shapes could produce the desired effect as well . the important element is the inclination of trailing boundary 60 . the inclination of leading boundary 58 is relatively unimportant . this portion may simply be vertical , or may even be inclined in the opposite direction as trailing boundary 60 . fig4 provides air extreme illustration of the importance of properly inclining trailing boundary 60 . in the example of fig4 , trailing boundary 60 is inclined so that its lower portion is closest to the nose and its upper portion is closest to the tail . water flow 44 slides along the bottom of the board as for the example of fig3 , but no air is entrained . instead , lifted flow 46 is “ scooped ” up through vent 26 and propelled onto deck 12 . this configuration obviously does not produce the desired effect . it is important to realize that the example of fig4 is not an embodiment of the present invention . it is not really prior art , however , since the inventor is not aware of a board having this precise configuration ( though some prior art boards have incorporated scoops intended to spray water upwards ). fig4 merely serves to illustrate — by way of an extreme example — how the inclination of trailing boundary 60 is important to the operation of the present invention . fig5 shows several examples of vents formed by creating a simple cylindrical cavity having a central axis 28 . in fig5 ( a ) , central axis 28 is perfectly perpendicular to deck 12 . in fig5 ( b ) , central axis 28 is tilted forward with respect to deck 12 . the angle between the central axis and the deck in this example is 60 degrees . fig5 ( c ) shows an example where the angle is 45 degrees , and fig5 ( d ) shows an example where the angle of tilt is 30 degrees . the example of fig5 ( a ) entrains some air but is not very effective . the other examples work better , with the preferred embodiment being about 45 to 60 degrees . although the invention is not limited to any particular construction technique , the reader may wish to know some information regarding the construction of suitable vents in a typical surfboard . fig6 - 8 provide illustrations of one suitable process . fig6 shows a small section of core 30 used to create a surfboard . only the section immediately surrounding the location of a vent is shown . cavity 48 is made through core 30 . the cavity may be drilled by passing a drill bit along central axis 28 . alternatively , the cavity may be cast into the core material at the time the core material itself is cast . as stated previously , it is preferable to provide a wall skin in the cavity . in fig7 , pipe 50 has been added to the cavity by gluing it in position . the pipe may be a pvc extrusion , a fiberglass composite , or even a piece of metal tube . once the pipe is in position , deck skin 32 and bottom skin 34 are added . the deck and bottom skins are preferably bonded to the pipe . resin fillet 52 may be formed when the resin is used to soak and bond the woven reinforcing cloth used to make the deck and bottom skins . in the assembly as shown , a portion of pipe 50 sticks up beyond the deck and a second portion ( not shown ) protrudes down below the bottom . the protruding portions are cut off and the boundaries are sanded smooth . fig8 shows the result . pipe 50 is sanded smooth with deck skin 32 and bottom skin 34 . the resulting vent 26 is thereby bounded within a “ wall skin ” ( the pipe ). additional adhesive and / or filler material may be used to dress the joints . in order to create the desired air film beneath the aft portion of the surfboard , it may be necessary to provide two or more vents in a pattern . fig9 provides a plan view for three different embodiments . the upper surfboard 10 has a single large vent 26 . the middle board has an array of three staggered vents 26 . the bottom board has a linear array of four vents 26 . the invention is by no means limited to any particular number or configuration of vents . some embodiments may have ten or more vents in various locations . in the preceding examples a simple cylindrical cavity is used for the vent . this is a very easy shape to create , since it involves simply drilling a hole through the board at a desired angle . it may be desirable in some instances , however , to employ a more complex shape for the vent . fig1 shows an additional embodiment in which vent 26 has a non - uniform cross section as it proceeds from top to bottom . the reader will observe that leading boundary 58 is simply a vertical wall . trailing boundary 60 is suitably inclined , but only in proximity to the portion of the vent that actually contacts the water . this embodiment pulls in the entrained air and creates air film 42 . however , it uses a complex blended shape for the vent . in studying this shape , the reader will note that the inclination of the trailing boundary is the feature that makes the device produce the desired result . the shape of the other portions of the vent are not critical , as long as they permit enough air to pass . the preceding description contains significant detail regarding the novel aspects of the present invention . it is should not be construed , however , as limiting the scope of the invention but rather as providing illustrations of the preferred embodiments of the invention . thus , the scope of the invention should be fixed by the claims presented , rather than by the examples given .	8
nid ( 0 , σ )-- normally and independently distributed with mean of zero and standard deviation of σ , i . e ., random θ y , θ x , θ z -- boresight state variables , viz ., boresight pitch , roll , and yaw θ y , θ x , θ z -- boresight state velocity variables representing , respectively , ## equ1 ## ( see augmented boresight state matrix .) rrf -- representative return formation i , j , k -- unit vectors along the x -, y -, z - axes , respectively , of a right - handed three - dimensional vector coordinate system v -- general notation denoting a vector where the components are normally expressed as a sum of scalar values times each of the unit vectors !-- encloses a matrix when it is not expressed in full matrix form nor identified as a matrix ## equ2 ## e { m }-- expected value of m , usually the mean the following description discloses a calibration filter for an infrared ( ir ) sensor array aboard a surveillance satellite . the calibration output from the filter is termed a boresight and comprises three euler angle rotations that are applied to three - dimensional line - of - sight ( los ) vectors . the boresight calibration filter calculations involve four coordinate frames of reference , each of which is based on a system of three mutually perpendicular dextral axes , x , y , and z . unit vectors along the x -, y -, and z - axes are designated i , j , and k , respectively . one coordinate frame of reference is the ir ( sensor ) reference frame ( irf ). the irf is referenced to the focal plane in which the sensors are arranged and upon which a surveillance telescope is focussed . a second frame of reference is the satellite frame of reference ( srf ). the sensor array focal plane is in the x - y plane of the srf and the z - axis of the srf is parallel to the line - of - sight ( los ) of the satellite &# 39 ; s telescope , usually directed toward the earth &# 39 ; s center . a third frame of reference is the satellite attitude frame of reference ( arf ) and the fourth is the earth - centered frame of reference ( ecf ) which is considered fixed . each of these frames of reference will now be discussed in more detail . the irf is referenced to the satellite &# 39 ; s center of mass ( scm ) 103 as illustrated in fig1 . the t - shaped element 101 represents the sensor focal plane which contains a plurality of sensors , infrared sensors in this description . this description contemplates that the sensors provide a scan of the earth once per rotation of the satellite . the orientation of this focal plane with respect to the satellite is the subject of the calibration filter . the x - axis 105 is parallel to the center line of the focal plane 101 and the z - axis 107 intersects the bottom center point 109 of the focal plane 101 . the focal plane 101 rotates about the point 109 while the irf rotates about the z - axis . the y - axis 109 is perpendicular to the x - and z - axes . the nominal location of each of the sensing elements is specified by azimuth , angle α , and elevation , angle ε . in the irf , the azimuth is designated α irf and the elevation , ε irf . each sensor in the focal plane 101 is uniquely identified by a los such as the vector 111 to one of the sensors 102 as shown . the srf is illustrated in fig2 . it is also centered at the scm 103 . the satellite 201 rotates right - handedly about the z - axis 203 . the x - axis 205 is perpendicular to the los of the scanning telescope . the y - axis 207 is mutually perpendicular to the x - and z - axes . the azimuth and elevation angles are shown but not used in the srf which is an intermediate ( mesne ) frame of reference for converting between the irf and the arf . the focal plane 101 is shown as it nominally relates to the z - axis 203 of the satellite . the arf and ecf are illustrated in fig3 to show their relationship to one another . that is , the arf orientation is derived from the ecf . the arf z - axis 301 points to the center of the earth 303 , i . e ., to the origin of the ecf . the arf x - axis 305 is directed parallel to the earth &# 39 ; s easterly direction . the y - axis 307 is mutually perpendicular to the x - and z - axes . a unit vector 310 to a known target , e . g ., a star 309 , within the field of view of the satellite having an azimuth aarf and an elevation earf is given as z . sub . arf = cos ( ε . sub . arf ) ( 2c ) ## equ5 ## with ## equ6 ## and ε . sub . arf = cos . sup .- 1 ( z . sub . arf ). the ecf is considered the fixed frame of reference in this description and is the base reference frame for all the calibration measurement sources . the measurement sources include earth sources and celestial sources . the earth sources are known locations on or near the surface of the earth expressed in geodetic latitude , longitude , and altitude . the celestial sources are typically stars located by geocentric latitude , longitude , and time . ephemerides are a tabulation of star locations relative to time . the ephemerides take into account the earth &# 39 ; s rotation and orbit , proper motion , precession , nutation , and diurnal aberration . the ecf x - axis 311 is oriented from the ecf origin at the center of the earth through the crossing of the greenwich meridian at the equator , i . e ., latitude 0 ° and longitude 0 °. the z - axis 315 is oriented through the north pole , i . e ., latitude 90 ° and longitude indeterminate . the y - axis 317 is mutually perpendicular to the x - and z - axes , i . e ., latitude 0 ° and longitude 90 ° east . the ecf axes therefore rotate with the earth . unit vectors to all ground sources are computed from geodetic latitude and longitude . the filter calculations depend on the capability to express vectors in each of the frames of reference transforming between frames of reference for rotation purposes only . fig4 is a block diagram of an implementation of the invention . the right ascension ( ra ) and declination ( dec ) of one or more stars in an ephemeris 401 are converted by a cce ( conversion from celestial parameters to ecf ) process . the ecf coordinates 403 are transformed to arf coordinates 405 by a transformation process tea , described below as a transformation matrix t erf → arf . the arf coordinates 405 are transformed to srf coordinates 407 by a transformation process tas , described below as a transformation matrix t arf → srf . the srf coordinates 407 are transformed to irf coordinates 409 by a transformation process tsi , described below as a transformation matrix t srf → irf . data returns 411 of a known object from a geodetic survey satellite are processed to generate boresight data in the irf which are applied to one input of a difference ( comparator ) unit 417 , the other input signals being the irf coordinates 409 of the predicted location of the image . the output signals from the difference unit 417 are errors which are supplied as input data to a kalman filter 421 . the kalman filter updates the boresight &# 39 ; s state vector with terms θ y , θ x , and θ z ( pitch , roll , and yaw , respectively ). the boresight state vector and the attitude state vector , p a , r a , and y a , are applied as input signals to a processor 415 . the raw data returns representing mission data are processed by the processor 415 to supply mission data corrected for boresight errors . in fig5 the position coordinates of a known object to be observed , e . g ., a star within the observation field of the satellite telescope , are supplied . the coordinates can be computed or can be taken from stored catalog of coordinates as represented by a process block 501 . the coordinates are typically updated every 30 seconds from a list of candidates for the observation . the star returns are collected , block 503 , but the image of the target is not necessarily confined to a single sensor . the sensor image overlaps several of the sensor elements , producing a blurred image . that is , the star return data forms a cluster of images on the sensor array . to obtain an accurate position of the image of the known object , the returns are averaged to determine a centroid of measurement , block 505 . the representative return formation determines a centroid of measurement of the image , effectively cleaning up the input data and providing performance measure . the kalman filter optimizes the measurement by predicting the centroid of the image based on present measurements and the current state . the representative returns are in terms of an augmented averaged azimuth and elevation . for greater accuracy averaging , the ε values are weighted as explained below according to intensity . the returns are used for performance measure and to collect raw data for an optimal estimator . the output values ( raw returns ) from the process block 505 are supplied one at a time to a residual computation 507 that compares and supplies the error between the measured data and the known data of the known object prediction . the known data , supplied by the ephemeris 501 is converted from a celestial or earth coordinate frame of reference to the sensor frame of reference by mesne conversions 511 . the other input information to the conversion process 511 include the satellite attitude state , i . e ., the pitch , roll , and yaw terms of the satellite attitude , and the boresight state , i . e ., the boresight pitch , roll , and yaw from an optimal estimator 509 . the optimal estimator 509 is preferably implemented as a kalman filter because the latter accepts multiple input data and supplies multiple output state data . the input to the optimal estimator 509 are the error data from the residual ( error ) computations 507 . an optimal multivariable estimator , such as a kalman filter , basically employs iterative process for optimizing linear measurement estimates . the discrete process equation for a kalman is usually portrayed as the basic ideas of a kalman filter are that it combines previous estimates with the current measurement , and it uses the history of data as in the present application , the output from the kalman filter , i . e ., the x state vector , is the boresight state , θ y , θ x , and θ z . the significance of the states are explained in more detail below . the refined boresight state data is then used to correct mission returns , i . e ., the observation data which the satellite was intended to collect . the corrected mission returns are computed from the raw data returns , the boresight state vector from the optimal estimator 509 , and the converted satellite attitude vector . the corrected mission returns are converted from the sensor frame of reference to the attitude frame of reference in the correction process 515 . the details of the conversions ( or transformations ) among the different frames of reference are described next . the ecf to arf transformation is accomplished by defining a set of unit vectors in the ecf that are parallel to the corresponding arf axes . the vector r s ( with magnitude r s ) is an ecf radius vector to the scm with coefficients a , b , and c . these are known values since they represent the position of the satellite with respect to the ecf coordinates . the value of r s is √ a 2 + b 2 + c 2 . a magnitude r xy is \| r s , xy \| and equal to √ a 2 + b 2 , that is , the magnitude of the x and y ecf components of the r s vector . the quantities r s and r xy are scalars . the ecf coordinates in the arf are the vector dot products of each of the basis unit vectors . to convert a vector in the ecf to a vector in the arf , the unit vector v erf is found as illustrated in equation ( 2 ). the transform matrix is denoted t ecf → arf . ## equ8 ## to transform a vector from the ecf to the arf , the inverse of t ecf → tarf can be used . ( t ecf → arf is orthogonal so its inverse is equal to its transpose .) therefore , t arf → ecf = t t ecf → arf . successive rotations about the pitch ( arf y ), the roll ( arf x ), and the yaw ( arf z ) axes are used to transform from the arf to the srf . these rotational transforms are denoted as ψ y , ψ x , and ψ z , respectively , and use the pitch angle ψ y , the roll angle ψ x , and the yaw angle ψ z : ## equ9 ## the transform matrix is given by t arf → srf = ψ z ψ x ψ y . transformation of a vector from the arf to the srf is , therefore , the inverse matrix transforms srf coordinates to arf coordinates . the - transformation matrix t srf → arf is given by ψ t y ψ t x ψ t z since each of the ψ matrices are orthogonal and the order of multiplication is reversed . approximations for arf to srf transformations can be made for ψ y and ψ x when the angles are small , which is usually the case . the value of ψ z takes on angular measurements from 0 to 2π radians as the satellite rotates about the z - axis . the small angle transformation are simplified by taking a first order approximations of the sine and cosine functions ( a value of 1 for the cosine function ). the simplified result is ## equ10 ## transformation from the satellite frame of reference to the sensor ir frame is accomplished by successive rotations about the yaw ( srf z ), roll ( srf x ), and pitch ( srf y ) axes . these rotations are denoted by , θ z , θ x , and θ y , respectively , using the yaw angle θ z , the roll angle θ x , and the pitch angle θ z , ## equ12 ## the matrix product of the θ transform matrices gives the srf to irf transformation matrix , t srf → irf = θ y θ x θ z so that a vector in the srf is transformed to a vector in the irf by the inverse transformation matrix is t irf → srf = θ t z θ t x θ t y since each rotation matrix θ is orthogonal and the order of matrix multiplication is reversed . as in the arf to srf transformation , the θ y and θ x angles are usually small while θ z takes on a constant value between 0 and 2π with small variations around the constant value . using a first order approximation for the sine and cosine functions , the small angle transform becomes ## equ13 ## multiplying the matrices , ## equ14 ## for faster and more efficient computation , a composite transformation matrix for small angles from the arf directly to the irf can be derived as ## equ15 ## performing the matrix multiplication and using angle sum and difference formulae , the transformation matrix ## equ16 ## where γ z = θ z + ψ z . the application of the details to the embodiment of the invention are now described . to accomplish the boresight calibration , the boresight pitch angle θ y , the boresight roll angle θ x , and the boresight yaw angle θ z are determined . that is , the orientation of the irf to the srf is ascertained . these angles change on a diurnal basis and an annual basis , primarily due to thermal effects from the position of the sun on the satellite . variance measurements using known diurnal boresight curves show that the variance increases according to the square of time up to several hours . based on several measurements every ten seconds , the model chosen for the system is a double integrator for each state driven by gaussian white noise nid ( 0 , σ ). only the output from the second integrator is filtered . the state definition is , therefore , ## equ17 ## the system model is then x ( t )= w ( t )! with x ( t ) t = 0 = 0 . the state transition matrix φ ( t ) is found by solving the state equation and φ ( t )= i where i is the identity matrix , i . e ., all matrix elements are zero except for the main diagonal which is all ones . the second order statistic ( covariance equation ) matrix is p xx ( t )= q ! so the mean squared value grows according to the time . squared , i . e ., ## equ18 ## the measurement model is a function of the state variables plus a random component of measurement noise or disturbance which is assumed to be gaussian white noise with zero mean and covariance r !. that is , z k != h k ( x ( t k ))!+ v k !. the measurement is z k ! at time t k , and h k ! is a nonlinear function . v k ! is the measurement noise . the measurements are provided by discrete sensor elements in the focal plane illuminated by stars and ground sources on earth . each sensor element is identified by azimuth and elevation coordinates in the irf . the nonlinear measurement function is obtained in the process of transforming star data from the arf to the irf . the measurement equations are ## equ19 ## since t arf → irf contains the state variables , the given measurement equations is the nonlinear measurement function h k ( x ( t k ))!. the kalman filter requires a linear form of h k ( x ( t k ))! to compute the kalman gain equation and the covariance matrix update . linearization is accomplished by taking the partial derivative of each of the measurement variables with respect to each of the state variables : ## equ20 ## the steps for taking the partial derivatives of α ( omitting the subscripts ) with respect to θ ( also omitting the subscripts ) are as follows : ## equ21 ## by eliminating common terms . substituting the terms in the irf for x , y , and z as given in equations ( 1a - 1c ), ## equ22 ## eliminating common terms , using the pythagorean identity , and restoring the subscripts , ## equ23 ## therefore , ( 5 ) ## equ24 ## the above equations provide expressions for the irf azimuth and elevation changes for small changes in each of the three state variables , viz ., boresight pitch θ y , boresight roll θ x , and boresight yaw θ z . they are , however , functions of the partial derivatives of the x , y , and z components in the irf and are therefore functions of the same state variables . expressions for these partial derivatives can . be obtained by differentiating . the following set of equations expressed in matrix form : ## equ25 ## t arf → irf is derived above and the arf x , y , and z components are not functions of the state variables . the partial derivative of the above equations with respect to the generalized variable θ is ## equ26 ## the following three matrices are the partial derivatives with respect to each of the state variables and the following are used with the above equation to produce nine equations : ## equ27 ## using the above equations , the h matrix can be derived as follows . for each measurement , the nine partial derivatives for x irf , y irf , and z irf with respect to the boresight state variables using the above three equations are substituted into equation ( 6 ). those results are substituted into the six equations represented by equations ( 4 ) and ( 5 ). the implementation details are now set forth to summarize the complete implementation . the boresight filter uses a standard modified kalman filter with a nonlinear measurement model . the filter algorithm is set forth below to facilitate a practical implementation and to illustrate the entire process of producing a boresight state vector . fixed ir sources ( targets ) are used to determine the boresight state vector and can be stars primarily but also stable ground earth sources with a known location . the ephemeris for star sources are stored in ecf fixed coordinates for every thirty - second interval , for example . every thirty seconds the ecf star coordinates and ground coordinates are transformed to arf coordinates using the above transformation equations . these require knowledge of the satellite location , i . e ., the ecf radius vector , also stored in an ephemeris . only those stars and ground sources that would be in the sensor field of view every thirty seconds need be stored . sensor observations are made in the vicinity (± 500 μrad ) of the predicted arf location of the source . the collected observations are processed by a representative return formation ( rrf ) procedure once per scan time of the sensor , i . e ., one complete rotation of the satellite . the rrf eliminates noisy returns and measures filter performance . the representative return is not filtered itself . instead , each raw return comprising the representative return is processed through the filter with measurement noise based on each return &# 39 ; s intensity as compared to the brightest ( primary ) return . the following steps are followed to process data from each scan : 1 . sort by source collection identifier ( id ) for each collection id for each star or ground source in decreasing arf elevation order ; 2 . beginning with the brightest intensity return for an id , accumulate all returns until a specified gap between adjacent returns is exceeded or there is an increase in intensity ; 3 ( a ). if at least one adjacent return for the primary return is found , then the process is finished . 3 ( b ). otherwise , tag the primary return as unavailable and repeat step 2 using the next brightest intensity return available . 4 . if a representative return is found , compute the representative weighted average of azimuth and elevation as follows : ## equ28 ## where n = total number of raw returns used in the rrf , and m i = intensity of the i - th raw return ; and 5 . apply the error ( difference ) data to the boresight kalman filter in the time order received . the location of each representative return α irf , rep ( the average of the returns ) and ε irf , rep ( a weighted average ) is compared to a predicted source ( target ) location to determine the error statistics in step 5 above . the kalman filter processes the error statistics ( in irf coordinates ) according to the following steps : 1 . compute δt k = t k - t k - 1 , the elapsed time since the previous filter update in seconds ( the initial interval is δt = 0 ); 2 . propagate the state vector from the last update to the present time as x k = φx k - 1 which , since φ ( t )= i , leaves the state vector unchanged after propagation , i . e ., the state vector is propagated from its value at time t n to time t n + 1 by multiplying it by the transition matrix ; ( this step is trivial but included for completeness since it is necessary when estimation is improved by including velocity states as described below where φ ( t )≠ i .) 3 . transform the arf location to a unit vector using equations ( 2a - c ); 4 . compute the measurement residual as the difference between the measured and predicted location in the irf as where h k ( x k )! is found from equations ( 3a - c ). these equations must use the propagated boresight state vector and the current best estimate of the attitude state vector in t arf → irf and the full form should be used instead of the small angle approximation ; 5 . compute the observation matrix h k using equations ( 4 ), ( 5 ), ( 6 ), and ( 7 ). these equations must use the propagated boresight state vector and the current best estimate of the attitude state vector ; 6 . propagate the covariance matrix using ( all uppercase letters are matrices ) p k = φp k - 1 φ t + q k - 1 and since q ( t ) t = 0 grows with the square of time , ## equ29 ## 7 . compute the kalman gain k k using k k = p k h k t h k p k h k t + r k ! - 1 where all upper case letters represent matrices ; 8 . update the estimate of the boresight state using the kalman gain and residual as x k = x k + k k r k , i . e ., updating is performed by applying the probability measures to correct the state using the residuals ; 9 . update the covariance matrix using the kalman gain and the observation matrix using p k = i - k k h k ! p k . the state vector output from step 7 is the filtered boresight state vector and is used to correct the mission - related returns from the sensors which are transformed to the arf for mission data correction and then to the ecf for earth location and direction . the filter optimizes the accuracy of the result . the block diagram of fig6 show a system embodying the invention . a data processor 607 includes a computer section 637 , a data storage 627 , an input section 647 , and an output section 657 . the processing is executed by a computer 637 controlled by a stored program 617 . a sensor array 601 is located in a survey satellite with a transmitter 603 . the scanner data is downloaded from the transmitter 603 to a receiver 605 which couples the scanning data signals to the input section 647 and the data is stored in the data storage section 627 from where it is retrieved for processing . the raw data from the survey satellite is processed for corrections as described in the preceding explanations and , via the output section 657 , is supplied to a utilization device , shown in fig6 as a mapper . other utilization devices are available but are not material to the present invention and will not be discussed further . a flow chart for the program 617 is shown in fig7 . in the following description , references are made to the flowcharts depicting the sequence of operations performed by the program . the symbols used are standard flowchart symbols accepted by the american national standards institute and the international standards organization . in the explanation , an operation may be described as being performed by a particular block in the flowchart . this is to be interpreted as meaning that the operations referred to are performed by programming and executing a sequence of instructions that produces the result said to be performed by the described block . the actual instructions used depend on the particular hardware used to implement the invention . different processors have different instruction sets but persons of ordinary skill in the art are familiar with the instruction sets with which they work and can implement the operations set forth in the blocks of the flowchart . in fig7 the boresight filter program that controls the data processor 607 of fig6 is detailed in a flowchart . it is depicted as a subroutine that is typically called at 30 - second intervals and is invoked by a hardware or software timer 701 via the enter terminal 703 . the raw data from the scanner or sensor array 601 of fig6 is stored via the transmitter 603 and receiver 605 and the input section 647 of the data processor of fig6 as shown in an input block 705 of fig7 . next , the coordinates of the known image , i . e ., the target , candidates ( those targets within the sensible area of the sensor array ) are retrieved in ecf according to a process block 707 . the ecf coordinates are transformed in a process block 709 to irf coordinates as explained in detail above . the raw data returns are processed in a process block 711 in the order received from the sensor array one at a time . a database gap or an increase in intensity is detected in a decision block 713 . if either condition is sensed , then the primary return is tagged as being unavailable as shown in a process block 714 . if , according to a decision block 717 , the raw data return is the last , then the program execution returns to read in more raw data returns from the scanner at the input block 705 . otherwise , the execution returns to process the next return at process block 711 . if the decision block 713 finds neither a database gap nor an intensity increase , the centroid of the raw return is computed in a process block 719 by averaging as described above . a process block 721 computes the difference between the irf coordinates of the target and centroid of measurement . these differences are processed by a subroutine 723 in the time order received to supply an optimal estimation of the differences . the optimal estimator is embodied as a kalman filter . the subroutine 723 is shown in detail in fig8 . at the end , the procedure is exited via a terminal block 725 . the flowchart of an optimal estimator embodied as a kalman filter illustrates the sequence of program instructions employed to implement the kalman filter . it is shown as a subroutine that is entered at a terminal block 801 . the methods of calculation of the various expressions are explained in detail above . in most cases , programs to make the individual process computations are commercially available . many are readily implemented by computer programmers of ordinary skill in the art . first , the time interval at from the last update of the boresight state vector is calculated by a process block 803 . the state vector is propagated to the present time from its prior update in a process block 805 . next , the arf coordinates of the unit earth vector are computed in a process block 807 . in a process block 809 , the measurement residual is computed . the h k matrix is computed in a process block 811 and used to propagate the previous covariance matrix according to a process block 813 . these computations permit the kalman gain to be computed by a process block 815 and to update the boresight state vector by a process block 817 . the covariance matrix is updated in a process block 819 . then the subroutine is exited via a terminal block 821 . the program flowchart of fig9 illustrates the steps for applying the boresight corrections to the mission data . it is depicted as a subroutine entered at a terminal block 901 . the raw mission data is read by an input block 903 similar to the way the target data is read from the scanner ( sensor array ) as described for the input block 705 in fig7 . the boresight state vector , updated by the process block 817 of the flowchart of fig8 is applied to the raw mission data according to a process block 905 . the corrected mission data is supplied via an output block 907 and the subroutine is exited via a terminal block 909 . the correction technique is explained in connection with fig1 . the equations with their derivation have been set forth above but will be repeated for each step in the following explanation for convenience of reference . the routine is entered via a terminal block 1001 and begins with reading in the index ( id ) numbers of each sensor in an input / output block 1003 . in a process block 1005 , the azimuth and elevation of the particular sensor is obtained using , for example , a look - up table technique . the focal plane table is accessed with the individual sensor ( cell ) index number and the result is a and e of the sensor . a process block 1007 is supplied with a and e which are converted to irf coordinates with the equations noted above , viz ., the irf coordinates are then converted to corrected srf coordinates in a process block 1009 . the inverse transform , t irf → srf ( the boresight state vector ), is multiplied times the irf coordinates . next , in a process block 1011 , the attitude state vector , t srf → arf , is applied to compute the arf corrected coordinates by ## equ31 ## for those uses of the corrected mission data that need polar coordinates , i . e ., corrected α and ε , a process block 1015 converts the cartesian coordinates to polar . as explained above , ## equ32 ## the ecf coordinates of the earth frame unit vector are computed in a process block 1017 using the satellite unit vector and t arf → ecf (= t ecf → arf t ) viz ., ## equ33 ## the ecf coordinates can be converted to geodetic latitude and longitude if necessary or desired . the accuracy of the conversion from the input cell index to the earth centered frame of reference , i . e ., the sensor data corrected for boresight errors , is directly related to the accuracy of the focal plane vector ( look - up ) table , the satellite attitude state vector , and the satellite ephemeris . the invention improves the accuracy of the computed earth frame location corresponding to a given sensor cell index by improving the accuracy of the boresight state vector estimate . to improve accuracy at the expense of longer computing time , the boresight state vector can be augmented to a six - state version vice the three - state version described above . in addition to the pitch , roll , and yaw state variables , their derivatives ( representing velocity in the three directions ) can be included . the augmented state vector is ## equ34 ## the covariance matrix of the kalman filter is modified to comport with the six - state boresight state vector . that is , ## equ35 ## the transition matrix for the augmented boresight state vector is no longer a unit ( or identity ) matrix . instead , it is ## equ36 ## where u is replaced by y , x , or z for each of the coordinate axes . finally , the h k matrix must be augmented for compatibility . zeroes are simply added so that ## equ37 ## the improvement using the augmented matrices in the kalman filter is illustrated in fig1 for a sample case over a twenty - four hour period . fig . ll ( a ) shows the boresight pitch , roll , and yaw for the three state boresight state vector . fig . o 11 ( b ) illustrates the same values for the six - state result . the graph line 1101 is the boresight yaw for the three - state implementation and 1102 is the boresight yaw for the six - state implementation . similarly , the lines 1103 and 1105 are the boresight roll and pitch values , respectively , for the three - state implementation and the lines 1104 and 1106 are the same values , respectively , for the six - state implementation . the boresight state vector values are smoother using the augmented matrices and more accurate but at the expense of more computation time . fig1 is a graph of sample data over a twenty - four hour period showing the boresight pitch , roll , and yaw for a three - state implementation of the invention . the boresight yaw is shown as line 1101 , the boresight roll as line 1103 , and the boresight pitch as line 1105 . fig1 is a graph of the same sample data over a twenty - four hour period showing the boresight pitch , roll , and yaw for a sixstate augmented implementation of the invention . the boresight yaw is shown as line 1201 , the boresight roll as line 1203 , and the boresight pitch as line 1205 . the smoothing due to inclusion of the velocity vector states is readily discernible . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes and modifications in form and details may be made therein without departing from the spirit and scope of the invention according to the following claims .	1
an embodiment of the present invention within a voltage regulator will now be described by reference to fig2 through 5 . a step - type voltage regulator transformer assembly 102 and its associated controller 206 according to an embodiment of the present invention are shown in fig2 . the transformer assembly 102 is identical to the prior art step - type voltage regulator of fig1 however , the associated voltage regulator controller 206 differs from the controller 106 of fig1 in that has a slot for receiving a standard pcmcia &# 34 ; plug - in &# 34 ; memory card and associated internal logic ( as shown in more detail in fig3 through 5 ). the slot 218 provides a user with access to an internal memory card connector 220 which is electrically connected to a pcmcia memory card interface 310 ( fig3 & amp ; 4 ) disposed internally in the controller housing . the transformer assembly 102 and voltage regulator controller 206 are illustrated in more detail in fig3 . the transformer assembly 102 includes a multi - tap transformer 302 and an associated tap changer 304 . the tap changer 304 is controlled by the voltage regulator controller 206 based on the controller &# 39 ; s program code and programmed configuration parameters . the voltage regulator controller 206 includes a processor section 306 , a high voltage interface 308 and a memory card interface 310 . the processor section 306 , the high voltage interface 308 and the memory card interface 310 can be embodied on separate circuit boards . the processor section 306 generates digital control signals based on internal program code and user selected parameters entered ( by a user ) via the controllers front panel . in operation , high voltage signals are generated by the transformer 302 . these signals are scaled down via internal transformers ( not shown ) and provided to the high voltage interface 308 . the high voltage interface 308 , in turn , further scales the transformed down signals for reading by an analog to digital converter ( shown in fig4 ) within the processor section 306 . the data fed back from the transformer 302 is used by the processor section 306 to make tap change control decisions and to generate indicators of various conditions to a user . the memory card interface 310 provides data exchange between the processor and a removable , field programmable data memory storage module ( memory card ) 312 . the memory card 312 has read / write capability and is used , for example , to store controller data for later retrieval , to revise the configuration parameters of the controller , or to provide additional program code so that the processor section 306 can run non - resident algorithms or perform updates or revisions to the processor &# 39 ; s resident control program . the memory card interface 310 is preferably embodied as a personal computer memory card international association ( pcmcia ) interface . the interface 310 is electrically connected to a pcmcia connector 220 ( fig2 ), externally accessible through the slot 218 in the controller housing . a pcmcia standard memory card 312 can be plugged into the connecter 220 via the slot 218 . field changes to the controllers configuration information or the processor &# 39 ; s resident program , or uploading of data stored in controllers internal memory is accomplished by a user plugging the memory card 312 into the memory card interface 310 and invoking a command from the regulator controller &# 39 ; s keypad 412 ( fig4 ). the memory card 312 can be left plugged in to collect data or it can be inserted briefly to transfer data to or from the controller 206 . advantageously , the memory card 312 can be easily unplugged from the external connector 220 and carried by a field engineer to another site for reprogramming or analysis of it &# 39 ; s stored data . a more detailed block diagram of the processor section 306 and its interconnection with the memory card interface 310 and memory card 312 is illustrated in fig4 . the processor section 206 includes a microprocessor 402 ( for example , a motorola 68hc16 ) which is coupled to the other processor elements by way of a common bus 404 . an electrically erasable programmable read only memory ( eeprom ) 406 includes the microprocessor &# 39 ; s program instructions and default configuration data . a static random access memory ( sram ) 408 stores user programmed configuration data and includes an area for the microprocessor 402 to store working data . the microprocessor 402 also communicates with an alphanumeric character display 410 , a keypad and indicators ( front panel ) 412 and the memory card interface 310 of the type described with respect to fig3 . the keypad / indicators 412 are coupled to the bus 404 via a connector 414 and a bus interface 416 . as previously described , the memory card 312 can be coupled to the bus 404 by way of a conventional pcmcia standard interface 310 and connector 220 which is externally mounted on the controller cabinet as illustrated in fig2 . operational parameters , setpoints and special functions including metering parameters and local operator interfacing are accessed via the keypad 412 . the keypad is preferably of the membrane type however any suitable switching device can be used . the keypad provides single keystroke access to regularly used functions , plus quick access ( via a menu arrangement ) to all of the remaining functions . the microprocessor 402 includes an sci port 402a which is connected to a communication port interface 422 . the communication port interface provides 422 the sci signals to an external local port 424 and a system port 425 ( both accessible on the controller &# 39 ; s front panel ). an isolated power supply for the communication port interface 422 is provided by the high voltage interface 408 via high voltage signal interface connecter 426 . the communication port interface 422 supports transfer of data in both directions , allowing the controller to be configured via a serial link , and also provides meter and status information to a connected device . in addition to supporting the configuration and data retrieval functions required for remote access , the communication port interface 422 supports uploading and / or downloading the program code for the microprocessor 402 . the communication port interface 422 can be , for example , an rs232 - compatible port . the local and system port connectors 424 , 425 can be used for serial communication with other apparatus , for example a palmtop or other computer . the physical interface of the local and system port connectors 424 , 425 can be a 9 - pin d - type connector whose pin - out meets any suitable industry standard , for example , matching the pc - at rs232 port connector . the microprocessor 402 also includes a spi port 402b which is connected to an expansion connector 428 by way of an spi interface 430 other devices that reside on the spi bus include a real time clock ( rtc ) 432 and a serial eeprom 434 . the serial eeprom 434 stores user programmed configuration data . the user programmed configuration data is downloaded to the sram 432 by the microprocessor 502 when the processor section 406 is initialized . the sram copy is used , by the microprocessor , as the working copy of the configuration data . the real time clock 432 is programmed and read by the microprocessor 402 . the high voltage signal interface connector 426 provides a mating connection with a connector on the high voltage interface 308 . scaled analog signals from the high voltage interface 308 are provided to an a / d converter port 402c by way of an analog sense signal interface 436 . the analog sense signal interface 436 low pass filters the scaled analog input signals prior to their provision to the a / d converter port 402c . digital signals from the high voltage interface 308 are provided to the bus 544 via a digital sense signal interface 438 . the digital sense signal interface 438 provides the proper timing , control and electrical signal levels for the data . control signals from the microprocessors general i / o port 402d are provided to the high voltage signal interface connector 426 by way of a relay control signal interface 440 . the relay control signal interface converts the voltage levels of the i / o control signals to those used by the high voltage interface 408 . a speaker driver 442 is connected to the gpt port 402e of the microprocessor 402 . the processor section 306 also includes a power supply 444 which provides regulated power to each of the circuit elements of fig4 as needed . the high voltage interface 308 provides an unregulated power supply and the main 5 volt power supply for the processor board 306 . the operation of the processor section and memory card interface is illustrated in fig5 . the program code for detecting and handling the memory card 312 is stored in the program memory portion of the eeprom 406 . in step 502 , the microprocessor detects that a memory card 312 is plugged into the memory card interface 310 . this can be accomplished in a number of ways . in one embodiment , the microprocessor 402 recognizes that a memory card 310 has been plugged into the memory card interface 312 by monitoring the bus 404 for a signal so indicating . as an alternative or additional embodiment , the microprocessor 402 can be programmed to monitor the keypad 412 for entry ( by a user ) of a given key sequence indicating that a memory card 310 is present . in any event , once the presence of a memory card 312 in the connector 220 is detected , in step 504 the processor 402 displays a menu of options on the character display 410 . these options include : in step 506 , the microprocessor 402 monitors the keypad 412 for entry of the users selection . when a selection has been entered , in step 508 the microprocessor 402 executes the selection as follows : options 1 through 3 are upload options . if option 1 ( upload controller data ) has been selected , the processor reads information from the eeprom 406 and the sram 408 and writes it to the memory card 312 . this information includes configuration parameters such as regulator voltage and current ratings , set - points and thresholds and a program code revision identifier ; statistical data such as temperature extremes and total number of tap changes ; and log data including time stamped , metered parameters ( e . g . tap extremes and voltage levels ) monitored by the controller . if option 2 ( upload diagnostic results ) is selected , the processor executes a regulator diagnostic program ( stored in the eeprom 406 ) and writes the results to the memory card 312 . if option 3 ( upload from communication port ) is selected , the processor monitors the system port 425 for incoming data and writes the data to the memory card 312 until a predetermined number of bytes have been written ( e . g . the amount of memory available in the memory card 312 ), until a timeout occurs , or until interrupted by the user , whichever comes first . options 4 through 6 are download options . if option 4 ( download program code revs .) is selected , the microprocessor 406 updates the program memory in the eeprom 406 by overwriting appropriate memory locations with control program revisions stored in the memory card 312 . if option 5 ( download configuration data ) is selected the microprocessor reads the data from the memory card 312 and writes it to the processor &# 39 ; s non - volatile user configuration memory in the spi bus eeprom 434 . it is noted here that the default configuration data in the main eeprom 406 can be updated as part of option 4 . if option 6 ( download to communication port ) is selected , the processor reads the data stored in the memory card 312 and writes the data to the system port 424 via the sci bus 402a and the communications port interface 422 . if option 7 ( execute program from memory card ) is selected , the processor executes the data stored in the memory card 312 as program code . if option 8 ( return to main menu ) is selected , the processor displays a main menu on the character display 410 . once the selected option has been executed , in step 510 the microprocessor displays a completion message on the character display 410 and returns to a main menu . as an alternative embodiment , the processor section 306 can be programmed to default to the memory card whenever its presence is detected . in this case , upon detection of a memory card 312 in the connector 220 , the processor reads a data header ( which is stored in a predetermined location in the memory card 312 ) to determine whether it contains program code , configuration data or both . if the memory card contains configuration data , it is downloaded to the spi bus eeprom 434 . if the header indicates that program code is stored in the memory card 312 the program code from the memory card 312 is downloaded to the sram 408 and executed by the microprocessor from there . now that the invention has been described by way of the preferred embodiment , various modifications , enhancements and improvements which do not depart from the scope and spirit of the invention will become apparent to those of skill in the art . thus , it should be understood that the preferred embodiment has been provided by way of example and not by way of limitation . the scope of the invention is defined by the appended claims .	6
the ferric fluoride used as an additive to the conventional cmdb propellants which contain aluminum causes the aluminum to burn more completely and thereby increasing the specific impulse efficiency . the exhaust from the combustion of a cmdb propellant with ferric fluoride contains fluorine . it has been discovered that the presence of fluorine in the exhaust plume attenuates the radar interference . thus for a given aluminum content , the radar interference is decreased thereby allowing more freedom in the design of the missile and making feasible higher concentrations of aluminum in cmdb propellants . larger amounts of aluminum increases the theoretical specific impulse . thus the delivered specific impulse can be increased by the use of ferric fluoride because of a greater combustion efficiency and a possibility of a greater theoretical specific impulse . the addition of ferric fluoride decreases the amount of nitroglycerin or fluorine - nitrogen compounds needed in the propellant . since the density of ferric fluoride is much greater than nitroglycerin , the density of cmdb is correspondingly greater . the thermal stability is also increased by the use of ferric fluoride for a similar reason , i . e ., ferric fluoride is more stable than nitroglycerin or fluorine - nitrogen compounds . it should be noted that within the meaning of this invention the term , composite - modified double base propellant ( cmdb ) shall cover propellants which contain an oxidizer , fuel , binder , and plasticizer . naturally , as will be recognized by those skilled in the art those propellants may also contain various additives . the practice of this invention does not limit the choice of material which can be used to formulate the cmdb propellant . examples and weight percentage ranges of the materials which can be used in the practice of this invention are as follows : the plasticizers which constitute about 15 - 30 percent of the compositions can be any of the art recognized plasticizers such as , for example nitroglycerin or triacetin or mixture thereof . nitroglycerin would be the most preferred . the binders may constitute about 7 - 15 percent of the cmdb propellant and may be any of the art recognized binders such as , for example nitrocellulose or plastisol nitrocellulose . oxidizers constitute about 25 - 50 percent of the composition and can be any of the art recognized oxidizers such as , for example ammonium perchlorate , sodium perchlorate , or cyclotetramethylene tetranitramine ( hmx ) and mixtures thereof . an excellent mixture would be ammonium perchlorate constituting 9 - 25 percent of the propellant and hmx constituting 9 - 30 percent of the propellant . the metal fuel is aluminum or a mixture of aluminum with other metals and constitute 10 - 25 percent of the cmdb propellant . it should be noted that the present invention deals only with cmdb propellants which contain some aluminum . the amount of ferric fluoride may vary from about 1 - 3 percent , with about 1 . 5 percent being the most preferred quantity . for the purpose of illustration the following two formulations which were prepared are set forth : formulation ( weight percent ) propellant composition 1 2______________________________________adiponitrile 3 . 4 3 . 3aluminum 12 . 0 22 . 0ammonium perchlorate 11 . 2 19 . 6ferric fluoride 1 . 5 1 . 5hmx 27 . 1 10 . 6nitrocellulose 13 . 0 12 . 42 - nitrodiphenylamine 1 . 0 1 . 0nitroglycerin 29 . 8 28 . 6resorcinol 1 . 0 1 . 0______________________________________ there is no limitation on the method of preparation of any propellant within the scope of this invention . any standard solvent or solventless method may be used and followed by a normal cure cycle . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings it is therefore understood that within the scope of the appended claims the invention may be practice otherwise than as specifically described herein .	2
referring more particularly to the drawings there is shown the instant apparatus 10 , horizontally mounted to a vertical support 12 such as a wall or the like . the apparatus 10 comprises an elongated shaft 14 having at least a recess 16 at one end thereof . if desired the shaft 14 may be hollow . the recess 16 will accommodate a further shaft 18 that terminates in means 20 for removably affixing the apparatus to the wall 12 such as a suction cup or the like . of course , the shaft 14 can communicate directly with means 20 , however , for purposes of stability and balance , it is preferable that the means 20 and shaft 14 be separated . the opposite end of shaft 14 will terminate in a shield 22 such as disk or plate or the like that is eccentrically mounted on said shaft 14 . the function of the shield 22 being to obstruct the view of the apparatus 10 . the shield 22 will include a knurled knob 24 or the like affixed to a rotatable shaft 26 ; the shaft 26 being in disposed substantially in the center of said shield 22 . the shaft 26 will communicate with said knob 24 on one side of said shield 22 and a threaded column 28 , i . e ., screw threaded on the opposite side of said shield 22 by being disposed for journal through a substantially centrally located aperture in said shield 22 . it is preferable that the screw 28 at its point of communication with the shaft 26 be obscured by a flange 30 disposed around the circumference of said shield 22 . the shaft 26 and screw 28 are journalled for rotation by hand 31 movement of the knurled knob 24 . a weighted object 32 such as a ball or the like is disposed frictionally along the length of a flexible tether cord 34 . preferably the cord 34 passes through the body of the object 32 thereby providing for an interrupted length of cord 34 . one end of the cord 34 preferably is looped 36 or contains a nylon sleeve around the loop 36 to facilitate the movement of the same . the looped end 36 is placed on the far end , nearest the shield 22 , and the knob 24 rotated until such time that the looped end 36 moves along the threads of the screw 28 and disengages therefrom such that the weighted object 32 and cord 34 are frictionally released and gravitationally brought down towards the ground , whereupon they are meant to be caught , prior to the object 32 touching the ground ; that is caught by the same hard 31 that rotated the shaft 26 and caused the object 32 to be released . an example of setting up the apparatus 10 and playing the game is as follows . the means 20 such as a suction cup is attached to any smoothe non - porous surface such as glass , metal , tile or enamel at approximately the player &# 39 ; s height above the floor . the screw 28 must be below the shaft 14 . the loop 36 is placed anywhere on the screw 28 and the object 32 is positioned as desired by sliding it up or down on the cord 34 which runs through it ; the lower the object 32 on the card 34 the greater the challenge . the player takes a position directly in front of the knurled knob 24 with knees slightly bent and eyes level with and approximately one foot from the object 32 . with the same hand 31 the player wishes to use for catching the object 32 the knurled knob 24 is gently rotated in a clockwise direction . as the knob 24 is turned the loop 36 will &# 34 ; walk the threads &# 34 ; slowly towards the end of the screw 28 . the player must focus full attention and concentration on the object 32 . no attempt should be made to peek at the screw 28 or loop 36 in order to cheat . as the eye detects the object 32 starting to fall the hand 31 must leave the knob 24 and grab the object 32 before it hits the floor . since it is obvious that numerous changes and modifications can be made in the above - described details without departing from the spirit and nature of the invention , it is to be understood that all such changes and modifications are included within the scope of the invention .	0
in order to give a help of understanding the present invention , before describing the embodiments , a general operation of a digital circuit will be described . fig1 shows a circuit diagram illustrating a typical inverter composed of a digital circuit of a cmos arrangement , and fig2 shows a timing chart of an example of an input signal . the current consumed in the digital circuit of a cmos arrangement is , in large , divided into a through current and a charge and discharge current . in the inverter as shown in fig1 for example , the through current means a current flowing between a power supply and a grounding terminal gnd when the two mos transistors pch and nch are switched on at the same time for quite a short time as a result of reversing the input signal (&# 34 ; l ( low )&# 34 ; to &# 34 ; h ( high )&# 34 ; or &# 34 ; h &# 34 ; to &# 34 ; l &# 34 ;) as shown in fig2 . the charge and discharge current means a current flowing when a parasitic capacitance is charged or discharged between a gate electrode of the mos transistor and the other electrode . it is also generated depending on the change of the electric potential of the input signal . fig3 shows an example of a flip - flop circuit of a cmos arrangement . as shown in fig3 in this circuit , when an input clock signal clock is reversed as shown in fig2 and the two mos transistors 11 and 12 are switched on at the same time for quite a short time , a through current ia which flows between a power supply and a grounding terminal gnd is generated . also , when the two mos transistors 13 and 14 are switched on at the same time for quite a short time , a through current ib which flows between a power supply and a grounding terminal gnd is generated . even if an input data signal data does not change , since the signal clock is reversed , charge and discharge currents flow for charging or discharging the parasitic capacitance of each of mos transistors 21 to 28 . in this arrangement , even if the input data signal data does not change or it is not necessary to apply the signal clock to the flip - flop , when the signal clock is reversed , the through current or the charge and discharge current flows as a result , thereby consumes large currents . the embodiments of the present invention are arranged to remove unnecessary reversing of the signal clock , and the through current and the charge and discharge current are suppressed to a minimum as a result . an embodiment of the present invention will be described in detail with reference to fig4 and 5 . fig4 shows a four - bit shift register of a cmos arrangement according to an embodiment of the invention . this shift register is configured to have four synchronous flip - flops 31 , 32 , 33 , 34 which are synchronized with clock signals , nand gates 51 , 52 , 53 , 54 and exclusive or gates 61 , 62 , 63 , 64 . each flip flop provides a combination circuit including one exclusive or gate and one nand circuit . the two inputs of the exclusive or gate 61 are respectively connected to a data signal terminal and an output terminal . the output of the exclusive or gate 61 is connected to one of the input terminals of the nand gate 51 . the other input terminal of the nand gate 51 is connected to an output terminal of an inverter 35 for supplying a clock signal . the output terminal of the nand gate 51 is connected to a clock - signal input terminal ckt of the flip - flop 31 . the other combination circuits employ the same arrangement . that is to say , each one input of the exclusive or gates 62 , 63 , 64 is connected to each data - signal input terminal d of the flip - flops 32 , 33 , 34 . each of the other inputs of the exclusive or gates 62 , 63 , 64 is connected to each of the output terminals q of the flip - flops 32 , 33 , 34 . each of the outputs of the exclusive or gates 62 , 63 , 64 is connected to each one input of the nand gates 52 , 53 , 54 . each of the other inputs of the nand gates 52 , 53 , 54 is connected together to the output of the inverter 35 . the outputs of the nand gates 52 , 53 , 54 are respectively connected to the clock - signal input terminals ckt of the flip - flops 32 , 33 , 34 . in turn , the description will be directed to the operation of the logic circuit with reference to a timing chart of fig5 . as shown in fig5 in the timing chart , it is assumed that the output signals q1 , q2 , q3 , q4 of the flip - flops 31 , 32 , 33 , 34 stay at a low level . when a high - level data signal is input to the flip - flop 31 , the exclusive or gate 61 serves to supply a high - level output signal n1 to the nand gate 51 , because the two signals input to the exclusive or gate 61 stay at different logic levels . hence , the clock signal , which has been reversed by the inverter 35 is , again , reversed as a clock signal ck1 by the nand gate 51 and then is input to the flip - flop 31 . as a result , the flip - flop 31 latches the high - level data signal as being synchronized with a timing t1 corresponding to the first leading edge of the clock signal and then outputs the high - level output signal q1 . at the next timing t2 of the clock signal , the high - level data signal continues to be input to the flip - flop 31 . in this case , since the output signal q1 is at a high level , the exclusive or gate 61 outputs a low - level output signal n1 . hence , the clock signal is blocked by the nand gate 51 , so that the clock signal is not supplied to the flip - flop 31 . that is , in the case that the output signal q1 is at the same logic level as the new input data signal , the clock signal is blocked by the nand gate 51 , so that the clock signal is not allowed to be supplied to the flip - flop 31 . hence , the flow of an idle charge and discharge current through an internal circuit of the flip - flop 31 is prevented as a result . the flip - flops 32 to 34 operate in the same manner . that is , each of the flip - flops 32 to 34 receives a data signal at the data - signal input terminal d and outputs the corresponding signal of q2 to q4 having the same logic level as the input data signal . however , in case that the newly input data signal has the same logic level as the output signal of the flip - flop , the exclusive or gates 62 , 63 , 64 serve to respectively output the corresponding low - level output signals n2 , n3 , n4 . hence , the clock signal is blocked by the nand gates 52 , 53 , 54 . as a result , the flow of an idle charge and discharge current through the internal circuit of each flip - flop is prevented . the shaft register has another advantage of reducing the current consumption . in this shift register , clock signals ck1 to ck4 are respectively supplied from the nand gates 51 , 52 , 53 , 54 to the flip - flops 31 to 34 . unlike the typical shift register described above , no inverter is required for supplying clock signals to a lot of flip - flops . as a result , the through current in the cmos transistor composing the inverter is eliminated when the clock signal is reversed . the foregoing embodiment has been described with respect to the logic circuit including four synchronous flip - flops , four nand gates and four exclusive or gates , however , the number of the flip - flops ; the nand gates and the exclusive or gates is not limited by four . as the number of the flip - flops , the nand gates and the exclusive or gates , one , two , three or n , which is a number larger than four , can be taken . many widely different embodiments of the present invention may be constructed without departing from the spirit and scope of the present invention . it should be understood that the present invention is not limited to the specific embodiments described in the specification , except as defined in the appended claims .	7
in accordance with the present invention , a mobile telecommunications device , such as mobile phone 108 ( fig2 ), presents the user with a prompt 204 indicating the availability of information associated with currently playing multimedia content , such as video 202 . for example , the associated information can be made available through a telephone call that can be placed at the pressing of a soft button 208 . such makes video 202 truly interactive , allowing the user to actively seek out additional information related to the content of video 202 , pausing or stopping playback of the multimedia content , in response to a single , easy , user input gesture . from the user &# 39 ; s perspective , the multimedia experience is very interactive — additional related information is available at the push of a single button . from the content provider &# 39 ; s perspective , content can be made much more appealing and much more likely to draw a response by embedding a link to the content within an entertaining and eye - catching video or other multimedia content . as shown in fig1 , mobile phone 108 is in communication with a wireless communications network 106 , such as a conventional data - capable cellular telephone network for example . wireless communications network 106 is in communication with the internet 104 and the public switched telephone network ( pstn ) 110 . as a result , mobile phone 108 is capable of browsing information available through internet 104 , e . g ., from server 102 , and of voice communication through pstn 110 , e . g ., with telephone 112 . mobile phone 108 is a shown in diagrammatic form in fig3 . it should be appreciated that other devices can be used in place of mobile telephone 108 , such as a smartphone , personal digital assistant ( pda ), or a pda with voice capability , for example . mobile telephone 108 includes a microprocessor 302 that retrieves data and / or instructions from memory 304 and executes retrieved instructions in a conventional manner . microprocessor 302 and memory 304 are connected to one another through an interconnect 306 which is a bus in this illustrative embodiment . interconnect 306 is also connected to one or more input devices 308 , one or more output devices 310 , and network access circuitry 312 . input devices 308 include a typical wireless telephone keypad in this illustrative embodiment and a microphone . output devices 310 include a liquid crystal display ( lcd ) in this illustrative embodiment in addition to a speaker for playing audio received by mobile telephone 108 and a second speaker for playing ring signals . input devices 308 and output devices 310 can also collectively include a conventional headset jack for supporting voice communication through a convention headset . network access circuitry 312 includes a transceiver and an antenna for conducting data and / or voice communication through a network . browser logic 314 is a collection of instructions or data that define the behavior of mobile telephone 108 in browsing information available through internet 104 . except as described herein , browser logic 314 is conventional . multimedia playback logic 316 is a collection of instructions or data that define the behavior of mobile telephone 108 in playing multimedia content , such as video 202 , to the user . multimedia playback logic 316 is responsive to commands from browser logic 314 , such as to start , stop , pause , and resume playback of multimedia content for example . telephony api ( applications programming interface ) 318 is a collection of instructions and data that define the behavior of mobile telephone 108 in establishing and carrying out communication through network access circuitry 312 in a conventional manner . telephony api 318 accepts commands from other logic , such as browser logic 314 , to effect telephone communications . such commands can include dialing a specified telephone number , going off - hook , and going on - hook ( i . e ., hanging up ), for example . history data 320 stores data representing previous activity of browser logic 314 , such as sites previously visited through internet 104 , for example . for presentation to the user during playback of multimedia content , prompt 204 ( fig2 ) and label 206 for soft button 208 are described in metadata associated with the multimedia content , such as multimedia metadata 402 ( fig4 ). in this illustrative example , video 202 ( fig2 ) is served through internet 104 ( fig1 ) by server 102 for presentation by mobile phone 108 . in addition , server 102 associates multimedia metadata 402 ( fig4 ) with video 202 ( fig2 ). when a request is received from mobile phone 108 ( fig1 ) for video 202 ( fig2 ) from server 102 , server 102 sends data representing video 202 and multimedia metadata 402 ( fig4 ) in response . multimedia metadata 402 includes one or more contemporaneous links such as contemporaneous link 404 . contemporaneous link 404 includes data representing a contact type 406 , a contact address 408 , a contact description 410 , and an offset range 412 . contact type 406 specifies the type of contact associated with contemporaneous link 404 . for example , the contact type can be a voice telephone call , an sms / mms / xms message ( referred to herein as simply an sms message ), an e - mail message , a wap link , or an http link . contact address 408 specifies an address to which the user is to be directed upon actuation of contemporaneous link 404 . if contact type 406 specifies a voice telephone call or an sms message , contact address 408 specifies a telephone number to dial to establish a voice telephone call or to which to send the sms message , respectively . if contact type 406 specifies an e - mail message , contact address 408 specifies an e - mail address to which to send the e - mail message . if contact type 406 specifies a wap or http link , contact address 408 specifies a url to which to direct browsing logic 314 upon actuation of contemporaneous link 404 . contact description 410 specifies the appearance of a prompt , such as prompt 204 and label 206 , by which the user is informed of the nature of contemporaneous link 404 and / or how to actuate contemporaneous link 404 . in the illustrative example of fig2 , prompt 204 prompts the user by presenting the text , “ for a test drive near you , press dial .” in addition , label 206 identifies soft button as “ dial .” thus , the user is informed that , by pressing soft button 208 while prompt 204 is displayed , information about how to arrange a test drive of a new automobile will be presented . offset range 412 specifies a beginning offset and an ending offset within video 202 between which contemporaneous link 404 is active . logic flow diagram 500 ( fig5 ) illustrates the behavior of mobile telephone 108 ( fig2 ) in playing video 202 and processing associated multimedia metadata 402 . in step 502 ( fig5 ), browsing logic 314 initiates playback of video 202 ( fig2 ) by multimedia playback logic 316 . during playback in step 502 , multimedia playback logic 316 causes information of contemporaneous links , such as prompt 202 , to be displayed over video 202 at times within playback of video 202 specified by offset range 412 ( fig4 ). in this illustrative embodiment , contact description 410 ( fig4 ) specifies the content of prompt 204 ( fig2 ) and label 206 to be associated with soft button 208 . in an alternative embodiment , prompt 204 is added to the substantive content of video 202 using conventional video editing techniques prior to delivery of video 202 through internet 104 . in this alternative embodiment , contact description 410 ( fig4 ) specifies label 206 to be associated with soft button 208 . in either case , multimedia playback logic 316 ( fig3 ) causes label 206 to be associated with soft button 208 during playback of the portion of video 202 represented by offset range 412 . in step 504 ( fig5 ), multimedia playback logic 316 ( fig3 ) asynchronously detects actuation of soft button 208 during playback of the portion of video 202 represented by offset range 412 . in doing so , multimedia playback logic 316 identifies a particular contemporary link within multimedia metadata 402 by identifying the offset range within which actuation of soft button 208 is detected . in this illustrative example , the particular contemporary link is contemporary link 404 . in step 506 ( fig5 ), multimedia playback logic 316 ( fig3 ) causes multimedia playback logic 316 to pause or , alternatively , stop playback of video 202 . in some mobile devices , only one process is able to execute an any given time , typically as a limitation of either the device itself or the operating system of the device . in these cases , multimedia playback logic 316 stops playback of video 202 . in step 508 ( fig5 ), multimedia playback logic 316 ( fig3 ) initiates contact according to the contemporaneous link actuated by the user . in this illustrative example , the user actuated contemporaneous link 404 and browsing logic 314 initiates contact according to contact type 406 and contact address 408 . if contact type 406 and contact address 408 collectively specify a telephone call to a specified telephone number , multimedia playback logic 316 ( fig3 ) initiates a telephone call to the specified telephone number through telephony api 318 . if contact type 406 and contact address 408 collectively specify an sms message to a specified telephone number , multimedia playback logic 316 ( fig3 ) initiates sending of an sms message to the specified telephone number through telephony api 318 . if contact type 406 and contact address 408 collectively specify an e - mail message to a specified e - mail address , multimedia playback logic 316 ( fig3 ) initiates sending of an e - mail message to the specified e - mail address . if contact type 406 and contact address 408 collectively specify a wap or http url , multimedia playback logic 316 ( fig3 ) retrieves and displays content from the specified url . if contact type 406 and contact address 408 collectively specify a telephone call or an sms message to a specified telephone number and if supported by mobile telephone 108 and its operating system , processing by multimedia playback logic 316 transfers to step 510 upon termination of the specified connection . in the case of a telephone call , telephony api 318 informs multimedia playback logic 316 upon termination of the telephone call initiated in step 508 . in the case of an sms message , telephone api 314 informs multimedia playback logic 316 upon completion of sending the message . in step 510 ( fig5 ), multimedia playback logic 316 causes browsing logic 314 to resume browsing behavior in a conventional manner and responsive to interaction with the user through input device ( s ) 308 . in one embodiment , browser logic 314 returns to browsing at a location immediately preceding display of video 202 . that location , and perhaps other locations , are stored in history data 320 ( fig3 ) to allow backtracking in a conventional manner . in another embodiment , browsing logic 314 resumes browsing at a predetermined subsequent location . for example , multimedia metadata 402 can include data specifying a url for subsequent browsing after completion of display of video 202 , e . g ., as a contemporaneous link whose offset range includes the end of video 202 . upon completion of playback of video 202 or upon termination of the contact initiated in step 508 , browser logic 314 can resume browsing at the location specified by the url . after step 510 , processing according to logic flow diagram 500 completes . it should be appreciated that , while video 202 is described above as the multimedia content with which a telephone number or other contact information is associated , other forms of multimedia can be associated with contact information the an analogous manner . for example , an audio signal can be played back to the user while a textual and / or graphical prompt informs the user to “ press dial to order this song ” or “ press download to download this ring tone .” the above description is illustrative only and is not limiting . instead , the present invention is defined solely by the claims which follow and their full range of equivalents .	7
in fig1 an euv - illumination system comprising an inventive imaging system 1 comprising an object plane 3 , a first mirror 5 , a second mirror 7 and an image plane 9 is shown . in the object plane 3 the field stop of the system is located . furthermore the field in the object plane 3 is already arc - shaped . the imaging system 1 images the arc - shaped field from the object plane 3 into the image plane 9 . in the image plane 9 the reticle or mask of the euv - illumination system is located . also shown is the exit pupil 10 of the imaging system 1 , which is identical with the exit pupil of the total euv - illumination system . the exit pupil 10 falls together with the entrance pupil of the projection optical system . furthermore the euv - illumination system shown in fig1 comprises a light source 12 , a collector 14 , means 16 for enhancing the étendue of the light source 12 and field forming mirrors 18 , 20 for forming the arc - shaped field in the object plane 3 of the imaging system 1 . also shown are a first plane 40 conjugate to the exit pupil 10 and a second plane 42 conjugate to the exit pupil 10 . furthermore the distance ep 0 between first field forming mirror 18 and the first plane 40 conjugated to the exit pupil 10 , the distance e 01 between the first 18 and the second 20 field forming mirror , the distance se 1 ′ between the second field forming mirror 20 and the second plane 42 conjugate to the exit pupil 10 , the distance sr 1 ′ between the second field forming mirror 20 and the object plane 3 and the distance se 2 between the second plane 42 conjugate to the exit pupil 10 and the first imaging mirror 5 is depicted . throughout the system examples shown hereinafter some parameters remain constant the design principles as shown below however , can also be applied to other sets of parameters . in all embodiments shown in this application the incidence angle at the image plane 9 of the imaging system is 6 ° and the numerical aperture at the image plane 9 is na = 0 . 05 . it corresponds for example to a na = 0 . 0625 of the projection lens and a σ = 0 . 8 . the projection lens arranged in the light path after the euv - illumination system has typically a 4 ×- magnification and thus na = 0 . 25 at the light sensitive object e . g . the wafer of the euv - projection exposure unit . fig2 shows the euv - illumination system depicted schematic in fig1 in greater detail . same components as in fig1 are designated with the same reference numbers . the system according to fig2 comprises a light source 12 and a collector - mirror 14 . regarding the possible euv - light sources reference is made to de 199 038 07 a1 and wo 99 / 57732 , the content of said documents is incorporated herein by reference . the collector mirror 14 of the system according to fig2 is of elliptical shape . the means 16 for enhancing the étendue comprises two mirrors with raster elements 30 , 32 so called fly - eyes integrators . the first mirror with raster elements 30 comprises an array of 4 × 64 field facets ; each field facet being of plane or elliptical , toroidal or spherical shape ( r ≈− 850 mm ). the second mirror with raster elements 32 comprises an array of 16 × 16 pupil facets or a spherical or hexagonal grid with pupil facets , each pupil facet being of hyperbolic , toroidal or spherical shape ( r ≈− 960 mm ). the second mirror 32 is located in a plane conjugate to the exit pupil 10 of the illumination system . an illumination system with a first and a second mirror comprising raster elements as described before is known from de 199 038 07 a1 and wo 99 / 57732 ; the content of said applications is incorporated herein by reference . for forming the arc shaped field in the object plane of the imaging system comprises two field forming mirrors 18 , 20 . the second field forming mirror 20 is a grazing incidence mirror . in principle one mirror , here the mirror 20 , would be sufficient for field forming . but mirror 18 is required to control the length of the system and the size of the pupil facets . in order to achieve a large field radius of ≈ 100 mm mirror 20 must have low optical power . the size of the field and the pupil facets are related to the étendue of the system . the product of the size of the field facets and the size of the pupil plane is determined by the étendue . the pupil plane is a first plane 40 conjugate to the exit pupil 10 of the illumination system . in said plane the second mirror with raster elements 32 is located . due to the aforementioned relation restrictions to the size of the field facets and the pupil facets are given . if the magnification for the pupil facets is very large , i . e . the pupil facet is very small , field facets become very large . to avoid large magnification of the imaging of the pupil facets into a second plane 42 conjugate to the exit pupil 10 of the system either the distance between mirror 20 and the second mirror with raster elements 32 increases or an additional mirror 18 has to be introduced . the first field forming mirror 18 has almost all power of the imaging system consisting of a first field forming mirror 18 and a second mirror 20 for imaging the pupil facets of the second field forming mirror with raster elements 32 into the second plane 42 conjugate to the exit pupil 10 of the system . the data for the first field mirror 18 and the second field mirror 20 are given in table 1 : the magnification between the first plane 40 conjugate to the exit pupil 10 and the second plane 42 conjugate to exit pupil 10 is β 40 → 42 ≈− 0 . 4 . the field radius of the arc - shaped field in the object plane 3 is controlled by the second field mirror 20 . if the magnification β image =− 1 of the imaging system and r field = 100 mm the field radius to be formed by the second field forming mirror 20 is r obj =− 100 mm . there are three means to control the radius r obj : the optical power , see table 1 , f ≈ 605 mm , the chief ray distance between the second field forming mirror 20 and the object plane 3 : in the second plane 42 conjugate to the exit pupil 10 an accessible aperture stop for the illumination system could be located . also shown in fig2 is the inventive multi - mirror - system comprising an imaging system 1 with a first 5 and a second 7 imaging mirror for imaging the arc - shaped field from the object plane 3 , which is conjugate to the field plane , into the image plane 9 , which corresponds to the field plane of the illumination system and in which the reticle or mask of the illumination system is located . the conjugate field plane 3 could be used as a plane for reticle masking . said plane is located near to the second field forming mirror 20 at the limit for construction , e . g . sr ′≈ 250 mm chief ray distance for ≈ 15 ° grazing incidence reflection on the mirror . the field in the conjugate field plane which is the object plane 3 is arc - shaped by field forming mirror 20 , thus rema blades need to be almost rectangular . small distortions of a following rema system can be compensated for . since all mirrors of the illumination system have positive optical power , the field orientation in the conjugate field plane 3 after positive mirror 20 is mirrored by negative magnification of the inventive imaging system 1 . the field orientation in the field plane 9 is then correct . since the second field forming mirror 20 is off - axis in order to compensate the distortion due to this off - axis arrangement , the pupil facets have to be arranged on the second mirror with raster elements 32 on a distorted grid . with pupil facets arranged on a pre - distorted grid optimized pupils with respect to telecentricity and ellipticity can be achieved . the derivation of a multi - mirror - system comprising an imaging system for imaging a rema - blade situated in the object - plane or rema - plane 3 of the inventive multi - mirror - system into the image plane or field plane 9 , wherein the reticle is situated will be described in detail hereinbelow . fig3 shows in a schematic refractive view the elements of the inventive imaging system and abbreviations used in table 1 . furthermore components with reference numbers used in fig1 and 2 are designated with the same reference numbers . furthermore in fig3 is shown the virtual image 3 ′ of the field plane and the virtual image 10 ′ of the exit pupil . the imaging system according to fig3 and table 2 is a hyperbolic - ellipsoid combination as a first order starting system . the data of the first order system are given in table 2 . in the next step designing an imaging system according to the invention the first order system shown in table 2 is optimized and coma corrected . the first mirror 5 of the imaging system is a hyperbolic mirror , optimized for field imaging , which means imaging of the field in the rema plane 3 into the field plane 9 . the second mirror 7 of the imaging systems is an elliptical mirror optimized for pupil imaging , which means imaging of the second plane 42 conjugate to the exit pupil into the exit pupil 10 . the overall system comprising the first 5 and the second 7 imaging mirror with abbreviations used in table 3 for the coma corrected system is shown in fig3 to 5 . identical components as in fig1 , fig2 and fig3 are designated with the same reference numbers . apart from the elements already shown in fig1 and 2 in fig3 ; fig4 shows : the axis of rotation 50 of the first imaging mirror 5 the axis of rotation 52 of the second imaging mirror 7 the centre 54 of the first imaging mirror the vertex of the first imaging mirror 56 the virtual image 3 ′ of the field plane 3 the centre 58 of the second imaging mirror the vertex of the second imaging mirror 60 the virtual image 10 ′ of the exit pupil 10 of the illumination system the chief ray 62 as is apparent from fig4 the axis 50 of the hyperbolic mirror 5 and the axis of the elliptic mirror 7 subtend an angle γ . fig5 shows in detail the first imaging mirror 5 , which is in this embodiment a hyperboloid , of the inventive imaging system according to fig4 and fig6 the second imaging mirror 7 of the imaging system according to fig4 , which in this embodiment is a ellipse . the same elements as in fig4 are designated in fig5 and fig6 with the same reference numbers . in fig5 depicting the first hyperbolic mirror 5 the abbreviation used for the following equations calculating the parameters of the hyperbola are known : then the angle between incident chief ray and hyperbola axis is : z 2 a 2 - d 2 b 2 = 1 ; a = e 2 - b 2 ( 9 ) b 4 +( z 2 + d 2 − e 2 ) b 2 − d 2 = 0 ( 10 ) ⇒ b 2 = - ( z 2 + d 2 - e 2 ) + ( z 2 + d 2 - e 2 ) 2 - 4 ⁢ d 2 ⁢ e 2 2 ( 11 ) e = ( - sr2 · cos ⁢ ⁢ ( ω 2 ) - sr2 ′ · cos ⁢ ⁢ ( δ 2 ) ) 2 ( 12 ⁢ b ) in fig6 depicting the second elliptic mirror 7 the abbreviations used for the following equations calculating the parameters of the ellipse are shown : the angle between incident chief ray and the hyperbola axis is defined by equation ( 14 ). z 2 a 2 + d 2 b 2 = 1 ; a = e 2 + b 2 ( 17 ) ⇒ b 2 = - ( e 2 - z 2 - d 2 ) + ( e 2 - z 2 - d 2 ) 2 - 4 ⁢ d 2 ⁢ e 2 2 ( 19 ) e = ( se3 · cos ⁢ ⁢ ( ω 3 ) + se3 ′ · cos ⁡ ( δ 3 ) ) 2 ( 20 ⁢ b ) p = b 2 a ⁢ ⁢ curvature ⁢ ⁢ at ⁢ ⁢ node ⁢ ⁢ r = - p ( 21 ) ɛ = e a ⁢ ⁢ eccentricity ( 22 ) k =− ε 2 conic constant ( 23 ) by coma - correcting the first order system according to table 2 with an analytical calculation angle γ is determined . the coma - correction uses for calculating γ the magnification of the imaging for the chief ray 62 and the coma - rays not shown in fig4 . the differences in magnifications can be reduced by minimization of the angle of incidence α 3 ( 7 °) and corresponding selection of α 2 . in this example the equations are minimized by the gradient method , which means choose a start system e . g . according to table 2 , calculate the magnifications , change the angle α 2 and calculate a new magnifications . from the difference in magnifications the next α 2 can be calculated . repeat this algorithm until difference in magnification for the chief ray and the upper and lower coma - ray is less than e . g . 0 . 5 %. the coma - correction will be described hereinbelow in detail with reference to fig7 . identical elements as in fig1 to 6 are designated with the same reference numbers . furthermore in fig7 is shown the lower coma ray 70 . the calculation of the magnifications along the chief ray 62 is clear from the first order derivation . the calculation for the coma or rim rays is shown with regard to the lower coma ray 70 . the coma rays 70 for the imaging 3 → 3 ′ at the hyperbola is straight forward . the coma or rim rays in the object plane 3 can be defined by the angles between rays and hyperbola axis : ω 2 ⁢ c = ω 2 ∓ arscin ⁢ ⁢ (  na reticle · β rema , field  ) ( 24 ) the distances between the image points 3 and 3 ′ and the intersection point i 2c of the mirror with the coma or rim rays are given by hyperbola formulas in polar co - coordinates : s c = ri 2 ⁢ c _ = p 1 + ɛ ⁢ ⁢ cos ⁡ ( ω 2 ⁢ c ) ( 25 ) s ′ c = i 2c r ′ = s c + 2 a ( 26 ) to calculate the lengths at the ellipse is more complicated , because the coma or rim rays will not intersect in the plane 9 any more . however the magnification can be calculated approximately after calculating the intersection point i 3c . with for given γ , ω 3c and thus the intersection point i 3c can be calculated . with the magnification of the rema - imaging system for the rim or coma rays follows as shown in fig7 this derivation is not exact , because the rim rays will not intersect in the image plane 9 exactly . however , magnification can be calculated with reasonable accuracy , sufficient for a minimisation of the coma error . an optimisation with the gradient method described before leads to the solution given in table 3 . for a coma - corrected system according to table 3 the magnification difference due to coma is approx . 0 . 1 % and is identical for the upper and the lower coma - ray . the data for the magnification β of the inventive two mirror imaging system for the chief ray , the upper and lower coma - ray after coma correction is shown in table 4 . in fig8 . 1 the arc - shaped field in the field or reticle plane with carthesian coordinates x and y is shown . reference number 100 designates a field point in the centre of the arc - shaped field and 102 , a field point at the edge of the arc - shaped field . the y - axis denotes the scanning direction and the x - axis the direction perpendicular to the scanning direction . in fig8 . 2 the spot diagram for a field point 100 and in fig8 . 3 the spot diagram for a field point 102 of a coma - corrected multi - mirror - system according to fig4 to 8 is depicted . the spot diagram is the diagram resulting from a multiplicity of rays travelling through the system with the aperture na object and impinging the field or reticle plane in a predetermined field point , e . g . the centre of the field 100 . the aperture is na object = 0 . 05 in the system described in fig4 to 8 . as is apparent from the spot - diagrams 8 . 2 and 8 . 3 the edge sharpness eds in scanning direction , corresponding to the y - axis of the arc shaped field , in coma corrected system is smaller than 2 mm . the edge sharpness eds of a system in scanning direction is defined as the difference of the points with the greatest value and the smallest value in y - direction for an edge field point , e . g . edge field point 102 as shown in fig8 . 3 . for further optimizing the inventive imaging system astigmatism and spherical aberration has to be considered . nevertheless a balanced system can be found with only hyperbolic and elliptical mirrors . fig9 and table 5 shows a system which is corrected for spot aberrations & lt ; 1 mm in scanning direction . because the rema blades are essentially required to avoid the overscan in scanning direction , it is sufficient to achieve the required performance in scanning direction ; here in y - direction . in fig9 the same elements as in fig1 to 8 are designated with the same reference numbers . in fig9 . 1 and 9 . 2 the spot - diagrams for a point in the centre of the field 100 and for an edge point 102 is depicted . the optical data of the system according to fig9 are shown in table 5 . the embodiment according to fig9 is again a 1 : 1 imaging system and is derived from the embodiment according to fig8 . the image plane 9 comprising the reticle is tilted with respect to the chief ray by 6 °- angle of incidence . for a minimized spot aberration also the object plane 3 has to be tilted . in the example the optimized tilt angle of the object plane 3 , where the field stop or rema has to be placed , is approximately 0 . 9768 °. also shown in fig8 and 9 are the complete first hyperbolic imaging 5 and the complete second elliptic imaging mirror 7 of the imaging system with the first axis of rotation 50 and the second axis of rotation 52 . as is apparent from fig9 the rays impinging the mirrors of the imaging system off - axis ; this means that the used area of the two mirrors are situated off - axis with regard to the axis of rotation of the two mirrors . also clearly shown the angle γ between the two axis of rotation . in fig1 an even better performing imaging system than the system according to fig8 is shown . the same reference numbers as for the system according to fig9 are used . the system according to fig1 is derived from a more balanced optimization . this time the magnification is β ≈− 0 . 85 . the limiting aberrations in the imaging system according to the invention is coma and astigmatism . for field imaging a mirror 5 near to conjugate pupil plane 42 is used . this mirror 5 is aimed not to affect pupil imaging . if one looks at the aberrations in a plane which contains the focus , for field points different from the focus there are field aberrations . that is the case of the hyperbola , which is actually limited by astigmatism . for a given field of view size the smaller the tilt angle of the hyperbola , the smaller the angle of the field objects and , therefore , the smaller the astigmatism . an elliptical mirror 7 is chosen for pupil imaging . the ellipse case is more complicated because the parameters are found to give stigmatic imaging at the centre of the exit pupil , not in the field plane 7 . when used off axis for other conjugates different than the two geometrical foci , the ellipse introduces coma , and this is what can be seen in the field plane 7 . once more , the way of reducing this coma is minimising the tilt and balancing coma between the first mirror 5 and the second mirror 7 of the imaging system . the spot diagrams for the centre field point 100 and an edge field point 102 for a system according to fig1 are depicted in fig1 . 1 and 10 . 2 . as is apparent from fig1 . 2 the edge sharpness eds for an edge field point is better than 1 mm in the scanning direction as well as in the direction perpendicular to the scanning direction . said embodiment is a preferred embodiment since the required imaging performance of the imaging system is also achieved in the direction perpendicular to the scanning direction ; here in the x - direction . the data of the system according to fig1 are given in code - v - format in table 6 . in fig1 a euv - illumination system with a ripple - plate 200 as field - forming component and an multi - mirror - system comprising an imaging system 1 according to the invention is shown . the system comprising a light source 12 , a collector unit 14 , a ripple - plate 200 as a field - forming component for the arc - shaped field and a field mirror ( 202 ) is known from henry n . chapman et al . aa . o ; the content of said article is incorporated herein by reference . the imaging system shown in fig1 is identical to the imaging systems according to fig1 to 10 . the same elements as in fig1 to 10 are designated with the same reference numbers . other setups then those of fig1 are possible , in which the light is not collimated before the ripple plate 200 , but converging to a focal point . in this case the grooves of the ripple plate are not parallel , but conically , i . e . the prolongation of the grooves meet in one point corresponding to the focal point of the incident wave . the shape of the ripple plate 200 can be derived theoretically , but has to be optimized . the pupil formation with the ripple design leads to an elliptical illumination of the exit pupil after the illumination system corresponding to the entrance pupil of the lens system . therefore an aperture stop is required in a conjugate pupil plane . this aperture stop will also lead to light less . the ellipticity of the pupil increases with the lateral coordinate , along the arc field perpendicular to scanning direction . the light loss has to be compensated for by shaping the ripple plate aspherically . next , two examples of hyperbola - ellipsoid - combinations for the imaging mirrors 5 , 7 are shown with β =− 1 . 5 . the first order system is analytically derived , as described before . the second system is optimized for a better performance in scanning direction . the parameters are given in tables 7 to 9 : if one corrects the coma of the system of table 7 according to analytic solution of ellipsoid and hyperboloid , as shown before , a system as shown in table 8 and fig1 results . the spot aberrations are shown in fig1 . 1 and fig1 . 2 for a centre field point 100 and an edge field point 102 . in the following section an illumination system with an arbitrary field , e . g . a rectangular field in the object plane 3 is discussed . the schematic set - up for such systems are shown in fig1 and 15 . in both examples the imaging system images a rectangular field 300 into an arc - shaped field 302 . consequently arc - shaped rema blades or field stop 304 have to be applied to compensate for the deformation induced by the imaging with grazing incidence field mirror 306 as shown in fig1 . furthermore in fig1 the clipping 308 in the image or rema - plane 9 is shown . the system according to fig1 and 15 comprises : an object plane 3 at least , a first imaging normal incidence mirror 5 and at least one grazing incidence mirror 306 for forming the arc - shaped field in the image plane 9 . a realisation of a system with one grazing incidence mirror 306 is given in fig1 . to achieve the desired orientation for the ring field , a field lens with negative optical power is required . the radius of the arc - shaped field is approximately 138 mm , however , by the angle of incidence and the optical power of the first imaging mirror 5 almost any desired field radius is achievable . table 10 gives the data for such a system , where for the magnification β image =− 1 . 2 was chosen . the arcuate field is demonstrated in fig1 . 1 . a rectangular aperture was ray - traced through the system until the reticle plane . here the arc - shaped field arises due to the grazing incidence reflection at the grazing incidence mirror 306 . however , the spot diameter is in this un - optimized example about 10 mm . due to the imaging with one normal incidence and one grazing incidence mirror , a large amount of coma is introduced , which can not be reduced effectively . a reduction of coma is possible by insertion of a second normal incidence mirror 7 . an example is shown in fig1 , the corresponding data are given in table 11 ( with β image =− 1 . 272 ). the illumination at reticle field is shown in fig1 . 1 . the system has capability to be optimized further to similar performance as system examples given before by similar straight forward optimization , which means proper selection of reflection and folding angles .	8
referring to fig1 - 1 , 1 - 2 and 1 - 3 , the upper assembly 10 of the present invention is shown with a perspective view , a top view , and a front view respectively ; the upper assembly 10 includes : an electric connector 102 includes several spring contact probes 1021 and a d - type connector 1022 to be connected with a robot ; two positioning pins 103 ; an engaging mechanism 104 ; a robot adapted plate 105 to be connected with the wrist of a robot ; an upper part 101 for fixedly mounting the aforesaid parts . the upper part 101 is provided with a pneumatic passage 1011 , whereby a compressed air is conveyed into the lower assembly 20 . referring to fig2 - 1 , 2 - 2 , and 2 - 3 , the lower assembly 20 of the present invention is illustrated with a perspective view , a top view , and a front view ; the lower assembly includes : an electric connector 202 which further includes a several receptacles 2021 and a d - type connector 2022 ; a rotary shaft pin 203 to be engaged with an engaging mechanism 104 ; a tool adapted plate 205 for connecting with a tool ; a lower part 201 for fixedly mounting the aforesaid parts . the lower part 201 has a pneumatic passage 2011 for conveying a compressed air into a tool , and two positioning holes 2012 for assembling the upper and lower assemblies together . an o - ring 204 is mounted on the pneumatic passage 2011 to prevent from air leakage . fig3 illustrates a front view of the engaging mechanism according to the present invention ; the engaging mechanism 104 in the upper assembly 10 includes a double - acting pneumatic cylinder 1041 , two sliding yokes 1042 , a supporting pin 1043 , a cam 1044 and a cam shaft pin 1045 . the double - acting pneumatic cylinder 1041 is used to pull ( or push ) the sliding yokes 1042 so as to actuate the cam 1044 to turn around the cam shaft pin 1045 for engaging or disengaging from the rotating shaft pin 203 in order to have the upper assembly 10 and the lower assembly 20 connected together or dis - connected from each other . the operation of the present invention upon being mounted on a robot is described as follows : at first , the upper assembly 10 is fixedly attached , by means of the robot adapted plate 105 , to the wrist of a robot ( not shown ). by the robot adopted plate 205 , differont tools are fixedly attached to the lower assemblies 20 , individually , and the lower assemblies 20 are put on a tool rack ( not shown ); then , a robot is moved to a position as shown in fig3 to pick up the lower assembly 20 on the tool rack . ( fig4 shows the location of the engaging mechanism 104 when the two positioning pins 103 have been plugged into two positioning holes 2012 respectively ); in that case , a space &# 34 ; a &# 34 ; ranging from 0 - 3 mm is left between the upper assembly 10 and the lower assembly 20 . referring to fig5 the engaging mechanism connect the upper and lower assemblies 10 and 20 together , i . e ., the rotary shaft pin 203 of the lower assembly 20 is located right on a curved edge of the cam 1044 upon the same moving to its upper dead point . after the sliding yokes 1042 move to their limit point , the engaging mechanism 104 will stay in a still and locked condition . if the compressed air which enter into the cyinder is lost , the weight of lower assembly 20 and the tool mounted ( not shown ) can only provide a radial compression force to the rotary shoft pin 203 , then the cam would not turn , and the engaging mechanism 104 is kept in locked condition . when the tool - exchanging device want to disengaged from each other , the device is moved to the tool rack , and the double - acting pneumatic cylinder 1041 is actuated to drive the sliding yokes 1042 to cause the cam 1044 to turn to disengage from the rotary shaft pin . then the two accemblies 10 and 20 are completely disengaged from each other . the design and operation theory of the engaging mechanism are further described as follows : fig6 - 1 and 6 - 2 illustrate the operation of the engaging mechanism , in which &# 34 ; w &# 34 ; stands for the weight of the lower assembly 20 and the tool mounted ; &# 34 ; f &# 34 ; stands for a pulling or pushing force of the double - acting pneumatic cylinder 1041 (&# 34 ; f &# 34 ; stands for a pulling force upon the double - acting pneumatic cylinder moving upwords ). the engaging part of the engaging mechanism is on the curved edge abc of the cam 1044 . the curve ab of the cam 1044 provides a upward movement . the curve bc is a circular arc which center is the same by means of the cam shaft pin 1045 . the curve bc of the cam 1044 provides no upward movement . when the engaging mechanism start to make engagement as shown in fig6 - 2 , &# 34 ; f &# 34 ; is considered as a pulling force to cause the cam 1044 to turn so as to have the curve ab and the rotary shaft pin 203 contacted together ; in that case , the lower assembly 20 will be pulled upwards to be engaged together with the upper assembly 10 upon the rotary shaft pin 203 moving along the curve ab ; when the sliding yokes 1042 continue to move upwards , the rotavy shaft pin 203 moves along the curve bc , and stops as shown in fig6 - 2 , and the cam 1044 will stop to turn ; the whole engaging mechanism 104 will stop to move completely . in this time the two assemblies 10 and 20 have finished engagement . whenever the intake of double - acting pneumatic cylinder is discontinued , i . e ., f = 0 , we take free body diagram of the engaging mechanism ( as shown in fig7 - 1 and 7 - 2 ). the weight &# 34 ; w &# 34 ; is a downward force . due to the positioning pins 103 , a reaction force &# 34 ; h &# 34 ; is generated ; at the same time , a reaction force &# 34 ; n &# 34 ; normal to the curve bc will be applied to the rotary shaft pin 203 . the three forces &# 34 ; w &# 34 ;, &# 34 ; h &# 34 ; and &# 34 ; n &# 34 ; will be in a balance condition , and the reaction force &# 34 ; n &# 34 ; provides only pressure onto the cam shaft pin 1045 without causing the cam to rotite ; therefore , the engaging mechanism 104 remains in still condition so as to have the device remained in engaged state ( i . e ., the locked condition ), and the whole machine operation is maintained in safety condition . when the engaging mechanism 104 is disengaged , the force &# 34 ; f &# 34 ; becomes a pushing force ( as shown in fig6 - 1 ) to compel the cam 1044 to turn , and the rotary shaft pin 203 of the lower assembly 20 will roll down along the curved edge cba of the cam 1044 , and then the rotary shaft pin 203 will separate from the cam . during ba section of engagement , the weight &# 34 ; w &# 34 ; becomes a part of the disengaging force to facilitate the disengagement . in order to minimize the wear - and - tear condition of the cam , the rotary shaft pin 203 is sleeved with oiless bearing ( not shown ), and the engagement is rolling contact for minimizing the friction and increasing the disengagement speed as well .	8
according to the present invention , leachable lead in treated materials is decreased to levels well below 5 . 0 mg / l , measured by tclp test criteria . waste and process materials having tclp lead level in excess of 5 mg / l are considered hazardous and must be treated to be brought into compliance with regulatory requirements . other metal - bearing materials having leachable metals may also be treated according to the present invention to achieve acceptable metal levels . the treatment technology according to another embodiment of the present invention consists of a two step process for treating contaminated soils and / or solid waste materials with chemical treating agents that convert leachable lead to synthetic ( man - made ) substantially insoluble lead mineral crystals . as used here , “ substantially insoluble ” means the leachable lead content in the treated waste sample is less than 5 . 0 mg / l in the extract by the tclp test . another preferred embodiment of the present invention consists of applying technical grade phosphoric acid ( tgpa ) that contains sulfate as an impurity to leachable and soluble radionuclides and other radioactive substances often found in debris , soils and solid materials . the addition of water aids in the dispersion and percolation of tgpa throughout the contaminated host matrix . water can be added at any point of the process , either before or after the tgpa addition , or by diluting the tgpa and applying the dilute tgpa to the target matrix . mixing of the tgpa with the host matrix is optional , dependent upon the permeability and porosity of the host material . when employed , mixing enhances the uniformity of reagent dispersion through the host material . the treatment chemicals useful in the present invention may be divided into two groups . the addition of water with the additives may facilitate the ultimate mixing and reaction . a first group , “ group one ”, comprises a source of sulfate , hydroxide , chloride , fluoride and / or silicates . these sources are gypsum , lime , sodium silicate , cement , calcium fluoride , alum and / or like similar products . the second group , “ group two ”, comprises a source of phosphate anion . this group consists of products like phosphoric acid ( phosphoric ), pyrophosphates , triple super phosphate , trisodium phosphates , potassium phosphates , ammonium phosphates and / or similar compounds capable of supplying a phosphate anion . the first step of this novel process comprises the reaction of leachable lead in contaminated soils or solid waste materials with a gypsum powder , calcium sulfate dihydrate ( caso 4 . 2h 2 o ). calcium sulfate dihydrate powder reacts with leachable and mobile lead species in wastes to form hard sulfates , which are relatively insoluble in water . in the invention , the powder form of dry calcium sulfate dihydrate , or gypsum , is preferred for blending with lead contaminated materials because it provides a uniform cover or dry coating over the surfaces of the waste particles and aggregates under low moisture conditions . the greatest benefit and fastest reaction is achieved under conditions wherein 95 % of the powder is passable through a 100 mesh sieve , and the remaining 5 % is passable through a 20 mesh sieve . the amount of gypsum powder employed is typically from 0 - 30 percent of the weight of solid waste material being treated . the actual amount employed will vary with the degree and type of lead contamination in the waste material or soil , and with the initial composition as well as the condition of the waste material , among other factors , alternatively , sulfuric acid , or alum in liquid or powder form can also be used as sources of sulfate ion in certain solid wastes that contain sufficient calcium prior to treatment . in a preferred embodiment of the present invention , the radionuclides and other radioactive substances as well as any metal - hazardous waste materials to be treated are contacted with a treatment reagent in the form of a suspension . the suspension is formed from a first component selected from the first group of treatment chemicals and a second component selected from the second group of treatment chemicals . in a preferred embodiment , a third component is included in the suspension , selected from the second group of treatment chemicals . the first component of the suspension can be either a liquid or a solid . the second component of the suspension can also be either a liquid or a solid . in some embodiments , the first and second components are both solids ; while in other embodiments , the first and second components are both liquids . it is also within the scope of the present invention for one of the two components to be a solid , while the other component is a liquid . in a preferred embodiment , the second component is an aqueous phosphate reagent . the first component of the suspension supplies a source of sulfate , hydroxide , chloride , fluoride , magnesium , and / or silicates and can be selected from suflfric acid , sodium sulphide , sodium sulphite , sodium peroxide , sodium hydroxide , sodium carbonate , sodium chlorate , sodium nitrate , sodium silicate , magnesium hydroxide , magnesium oxide , magnesium hydrogencarbonate , magnesium sulfate , magnesium carbonate , magnesium chloride , magnesium aluminum silicate , calcium magnesium carbonate , lime , cement , calcium fluoride , calcium chloride , calcium nitrate , calcium sulphate ( or gypsum ), potassium sulphate , potassium hydroxide , aluminum potassium sulphate ( or alum ) and / or similar compounds . the second component of the suspension supplies a phosphate source and can be selected from the group consisting of phosphoric acid , super phosphoric acid , phosphinic acid , phosphonic acid , pyrophosphates , superphosphate , triple superphosphate ( tsp ), trisodium phosphate , potassium phosphates , ammonium phosphates , diammonium phosphates , monocalcium phosphate , calcium triple superphosphate , calcium superphosphate , tricalcium phosphate , tetrasodium pyrophosphate and / or similar compounds which are capable of supplying a phosphate anion . in a preferred embodiment , the suspension includes a third component which supplies at least one phosphate anion . the third component can be a solid or a liquid and can be an aqueous phosphate reagent . the third component of the suspension is selected from the group consisting of phosphoric acid , super phosphoric acid , phosphinic acid , phosphonic acid , pyrophosphates , superphosphate , triple superphosphate ( tsp ), trisodium phosphate , potassium phosphates , ammonium phosphates , diammonium phosphates , monocalcium phosphate , calcium triple superphosphate , calcium superphosphate , tricalcium phosphate , tetrasodium pyrophosphate and / or similar compounds which are capable of supplying a phosphate anion . in another preferred embodiment , the suspension includes monocalcium phosphate , tetrasodium pyrophosphate and a magnesium aluminum silicate . a similar suspension called “ emy &# 39 ; s waste removal environmental formula ” is commercially available from emy &# 39 ; s of walton , indiana and it has been found to be useful in practicing the present invention . the suspension can include solid particles , liquids or a combination of solid particles and liquids suspended in a solution . the solid particles and liquids can be selected from the first component and the second component , and can include more than one member of the group from which the first and second components are selected . the solution can include a liquid selected from the first component , such as sulfuric acid , or the second component , such as phosphoric acid . the solution can also include combinations of the first and second components . the first and second components in the suspensions of the present invention can be in either the solid or liquid form and can be either the solvent ( the liquid ) or the solute ( the substance dissolved in the liquid ). when two liquids are mixed to form the solution , the solvent is the major component and the solute is the minor component . the suspensions of the present invention can also be diluted to facilitate application of the suspensions to the materials being treated . the diluent can be water or a liquid containing the first component or the second component , such as sulfuric acid or phosphoric acid . the diluent can also include a surfactant , such as a detergent , to increase its spreading or wetting properties by reducing the surface tension . at lease one component from group one is added to the mixing vessel or reactor , preferably as a dry powder , although slurries could be pumped under certain circumstances . at least one component from group two is added to the mixing vessel or reactor as either liquid reagent or as granular solid materials . the group one and group two components can also be combined to form a reagent before the reagent is mixed with the hazardous waste materials . in a preferred embodiment , the group one and group two components are combined to form a suspension . the suspension is then contacted with the hazardous waste materials . the ingredients of group one and group two can be added to the hazardous waste materials simultaneously , and they are pre - mixed and added in a single step . alternatively , the components of group one and two can be added sequentially in a two - step process with either component added first . that is , the two steps may occur in any order . at least one ingredient of group one can be added in step i or step ii . likewise , at least one ingredient of group two can be added in either step i or step ii . enough water may be added to allow good mixing to prevent dust formation , and to permit good chemical reaction . not too much water is added to solid materials if the treated waste is to pass the paint filter test . in the first step of the instant process , a thorough and uniform mixing of gypsum powder with the solid waste is accomplished by mixing shredded and screened waste particles with small gypsum particles in , for example , a grizzly or other mixing device . the calcium ions from the gypsum powder displace lead from soil complexes and organic micelles present in the contaminated soil and solid waste material the following equations ( 1 ) and ( 2 ) describe the reaction of leachable lead with gypsum , pb  -  micelle + caso 4 · 2  h 2  o -& gt ; pbso 4 anglesite + ca  -  micelle + 2  h 2  o ( 1 ) pb  ( hco 3 ) 2 + caso 4 · 2  h 2  o -& gt ; pbso 4 anglesite + caco 3 + 3  h 2  o + co 2 ( 2 ) the reaction of lead with gypsum forms a “ hard sulfate ” which crystallizes into mineral species of the barite family — anglesites and calcium - substituted anglesites — which are insoluble in water . the solubility product of lead sulfate is 1 . 8 × 10 − 8 , indicating that anglesite crystals would continue to develop over the geologic periods . in the second step of the process , the solid waste material as amended with gypsum powder is treated with a phosphate - supplying reagent , such as ( for example ), phosphoric acid . upon contact with the soil or solid waste , the phosphate - supplying reagent reacts chemically to immobilize the remaining leachable lead . the phosphate - supplying reagent includes phosphate ion sources having one or more reactive phosphate ions , such as phosphoric acid , trisodium phosphate , a potassium phosphate and monobasic or dibasic calcium phosphates . the quantity of phosphate - supplying reagent employed will vary with the characteristics of the solid waste being treated , including particularly such factors as leachable lead content , total lead , and buffering capacity , among other factors . it has been determined that in most instances a quantity of phosphoric acid up to 30 percent of the weight of the waste material is sufficient . the concentration of phosphoric acid in solution will typically range from about 2 to 75 percent by weight . the solution and treatment process are maintained above 30 ° f . to permit the handling of the phosphoric acid as a liquid reagent . below 30 ° f ., the phosphoric acid tends to gel while water freezes to form ice , thus creating material handling problems . free lead , along with calcium ions found in the solid waste ( including those imparted through the first step of the process ), reacts with the phosphate to form insoluble superhard rock phosphates or calcium substituted hydroxy lead apatites as shown in equations ( 3a ) and ( 3b ): 4  pbco 3 + caco 3 + 3  h 3  po 4 -& gt ; pb 4  ca  ( oh )  ( po 4 ) 3 hydroxy   lead apatites + 5  co 2 + 4  h 2  o ( 3  a ) 4  pbco 3 + caso 4 · 2  h 2  o + 3  h 3  po 4 -& gt ; pb 4  ca  ( oh )  ( po 4 ) 3 hydroxy   lead apatites + h 2  so 4 + 4  co 2 + 5  h 2  o ( 3  b ) the phosphate ions are added to the contaminated soils in solution form ; for example , phosphoric acid may be added to water in amounts ranging from about 2 percent to about 75 percent by weight . phosphoric acid decomposes carbonates and bicarbonates in wastes leading to the synthesis of apatites and evolution of carbon dioxide gas . destruction of carbonates and bicarbonates contributes to desirable volume reductions . although water molecules are generated during the carbonate and bicarbonate decomposition process , it is preferred to have soil moisture at about 10 percent to about 40 percent by weight of the soil in order to accelerate the fixation of the leachable lead with the phosphate ions . at this moisture range , material handling is also easy and efficient . it is apparent from equations ( 2 ), ( 3a ) and ( 3b ) that gypsum and phosphoric acid decompose carbonates and bicarbonates during synthesis of new stable minerals of the barite , apatite , and pyromorphite families in soils ( as shown in table i ). decomposition of carbonates and bicarbonates is usually associated with the evolution of carbon dioxide , formation of hydroxyl group , ( oh —), and the release of water molecules . as the water evaporates and carbon dioxide molecules are lost to the atmosphere , the treated waste mass and volume are decreased significantly . the solid sulfate powder and the phosphate - supplying reagent are added to contaminated soil and solid waste material having a typical moisture content ranging from about 10 percent to about 40 percent by weight . at a moisture level within the foregoing range , the curing time of the treated materials is approximately 4 hours , which provides adequate time for chemical reactions to occur and immobilize the leachable lead species . crystals of various lead mineral species begin to form immediately , but will continue over long time periods with an excess of treatment chemicals present . this contributes to “ self - healing ,” as noted during treatability studies as well as fall scale treatment operations . under the foregoing conditions , the immobilization of leachable lead occurs in a relatively dry environment because no wet byproducts , slurries or wastewater are produced by the process of the present invention . operation of the process under relatively dry conditions beneficially allows cost - efficient handling of the contaminated soils and the waste materials . this allows compliance with paint filter test for solid wastes required by usepa and rcra approved solid waste landfill facilities . effective mechanical mixing , as by a pug mill or other such mixing device , eliminates the need for diffusion in the nonaqueous solid waste matrix . the water resistant and insoluble lead minerals synthesized in soils and solid wastes according to this process are stable , and would behave like naturally occurring rock phosphates and hard sulfates . a list of these synthetic lead mineral species and complexes is presented in table i below , in order of the relative abundance found during characterization of treated soil by x - ray florescence spectrometry , polarized light microscopy ( plm ) and scanning electron microscopy ( sem ). table i synthetic mineral species of lead detected in a treated sample ( listed in decreasing order of abundance ) 31 - 41 % calcium substituted hydroxy lead apatites , ca 0 . 5 - 1 . 5 pb 3 . 5 - 4 . 5 ( oh )( po 4 ) 3 28 - 29 % mixed calcium lead phosphate sulfates , ca 0 . 05 - 0 . 2 pb 0 . 8 - 0 . 95 ( po 4 ) 0 . 15 - 0 . 5 ( so 4 ) 0 . 25 - 0 . 75 20 - 22 % mixed calcium anglesites , ca 0 . 05 - 0 . 3 pb 0 . 7 - 0 . 95 ( so 4 ) 3 - 6 % anglesites , pbso 4 2 - 7 % lead hydroxy / chlor apatite , pb 5 ( po 4 ) 3 ( oh ) 0 . 5 cl 0 . 5 1 - 3 % pyromorphite , pb 3 ( po 4 ) 2 1 - 2 % organo - lead phosphate sulfate , humus - o - pb 3 ( po 4 )( so 4 ) some of the chemical reactions that occur during the curing stage , and lead to the development of mixed minerals containing both sulfates and phosphates , are illustrated in equations ( 4 ) and ( 5 ). 18  pbco 3 + 5  caso 4 · 2  h 2  o + 12  h 3  po 4  → cure   time  =  4   hrs .  under   ambient temperature   ( & gt ; 30 °   f . ) & amp ;   pressure   20  ca 0 . 1  pb 0 . 9  ( po 4 ) 0 . 5  ( so 4 ) 0 . 25 mixed   calcium   lead phosphate   sulfate + ca 3  ( po 4 ) 2 + 18  co 2 + 28  h 2  o ( 4 ) 6  pb  [ humus ] + 2  caso 4  2  h 2  o + 3  h 3  po 4   → cure   time  =  4   hrs .  under   ambient temperature   ( & gt ; 30 °   f . ) & amp ;   pressure   ca  ( 9  h )  [ humus ] · pb 3  ( po 4 )  so 4 organo  -  lead   phosphate   sulfate + 2  h 2  o + ca 0 . 3  pb 0 . 7  so 4 anglesite + ca 0 . 7  pb 2 . 3  ( po 4 ) 2 pyromorphite ( ca   substituted ) ( 5 ) the process of the present invention beneficially decreases the volume of the waste materials through : ( i ) the evolution of carbon dioxide during the chemical decomposition of carbonates and bicarbonates , upon reaction with the acidic components in gypsum and phosphoric acid , and ( ii ) hardening and chemical compaction as a result of the synthesis of new minerals which result in changes in interstitial spaces and interlattice structures . applications of the process on a lead contaminated soil was associated with pore space decrease from 38 . 8 % to 34 . 3 % by volume . a decrease in pore space was associated with increased compaction of the treated soils and a decrease in overall waste volume ranging from 21 . 4 % to 23 . 0 %. for different waste types , the volume decrease varies with the amount of treatment chemicals used in the process . in another lead toxic solid waste , application of this process resulted in a volume decrease of the order of 36 . 4 % while decreasing the leachable lead to levels below the regulatory threshold . this reduction in volume of the contaminated soil and the solid waste material makes the process of the present invention particularly beneficial for off - site disposal in a secured landfill by cutting down the costs of transportation and storage space . the process can be accomplished at a cost - efficient engineering scale on - site or off - site for ex - situ treatment of lead - toxic solid wastes . this innovative treatment technology also offers a great potential for in - situ application to immobilize lead most economically without generation of any wastewater or byproducts . [ 0093 ] fig3 illustrates schematically the process of the present invention . the lead - contaminated uncontrolled hazardous waste site 10 with lead - toxic wastes is subject to excavation and segregation 20 of waste piles based on their total lead and tclp lead contents into ( a ) heavily contaminated pile 30 a , ( b ) moderately contaminated waste pile 30 b and ( c ) least contaminated waste pile 30 c . the staged soil and solid waste material in piles 30 a , 30 b and 30 c is subjected to grinding , shredding , mixing 40 and screening 50 through an appropriately sized mesh sieve . the screening yields particles that are usually less than 5 inches in diameter for mixing with gypsum powder 60 in a grizzly that allows a uniform coating of gypsum over the soil particles and waste aggregates during the grinding , shredding and / or mixing step . alternatively , as shown by the dashed line , gypsum powder 10 may be added continuously to the screened solid waste material in prescribed amounts as determined during treatability trials . most of the leachable lead binds chemically with gypsum at molecular level to form lead sulfate , which crystallizes into a synthetic nucleus of mixed calcium anglesite and pure anglesite minerals identified in the treated material by chemical microscopy techniques . the gypsum - coated waste particles and aggregates are then transported on a belt conveyor 70 or other conveying means to an area where an effective amount of phosphoric acid solution 80 of specified strengths in water 90 is added or sprayed just prior to thorough mixing in a pug mill 100 ( or other mixing means ). the temperature of the phosphoric solution is preferably maintained above 30 ° f . to prevent it from gelling . the treated soil and wastes are subject to curing 110 and drying 120 on a curing / drying pad , or may less preferably be cured and dried using thermal or mechanical techniques . the end product of the process passes the paint filter test . during the curing time of about four hours , various “ super - hard phosphate ” mineral species , such as calcium - substituted hydroxy lead - apatites and mixed calcium - lead phosphate - sulfate mineral species , are formed in treated waste media 130 . crystals of these mineral species ( in early stages of development ) have been identified in the treated soil materials and solid wastes by geo - chemical and microscopy techniques like plm and sem . the proportions of waste materials and reagents used in the process may be varied within relatively wide limits . for example , the amount of gypsum powder should be sufficient to produce lead sulfate in contaminated solid or solid waste material . in addition , the amount of phosphate - supplying reagent is prescribed in an amount sufficient to produce mineral species such as hydroxy - lead apatite in contaminated soil or solid waste material during a relatively short curing time of 4 hours , usually ranging from about 3 to about 5 hours . further drying of the treated material may take 24 to 96 hours , but has not been required in any application to date . table ii documents the optimum curing time of 4 hours for the process . in all instances , the leachable lead as measured by the ep toxicity test procedure was found below 0 . 6 mg / l and the differences between analytical values below this level and statistically insignificant . table ii documentation of optimum curing time using ep toxicity test criteria for lead fixation ep toxic pb ep toxic pb concentration in mg / l found waste ( untreated in processed sample at a curing time of matrix sample ) 4 hrs . 48 hrs . 96 hrs . category mg / l mg / l mg / l mg / l pb toxic 495 0 . 4 0 . 4 0 . 6 soil a pb toxic 46 0 . 3 0 . 2 0 . 2 soil b pb toxic 520 0 . 3 0 . 5 0 . 5 soil c the amount of the gypsum powder and the phosphoric acid employed will be dependent on the amount of contaminant present in the soil , initial characteristics of the solid waste material , whether the material is in - situ or is excavated and brought to an off - site facility for treatment ; the same is true for other sulfate compounds and phosphate reagents . the following example i describes various ratios of the chemical reagents for application to the excavated lead - contaminated solid wastes in order to render the leachable lead substantially insoluble ; i . e ., to reduce the leachable lead to levels below 5 . 0 mg / l by ep toxicity test lead and tclp test criteria now in force under current land - ban regulations , when the present invention is used to treat radionuclides and other radioactive materials , the amounts of treatment chemicals added are a function of the contaminated host matrix geochemistry , the concentration of radionuclides in the host matrix , and the presence of potential interferences that could inhibit the reactions , and the geotechnical properties of the host material . a preferred rate of tgpa addition is in the range of 0 . 1 to 20 % by weight of the matrix to be treated . preferred water content will also vary with the characteristics of the host material to be treated , but should be in the range of 5 % to 50 % by weight . water content may affect the rate of reaction with lower water content requiring longer reaction periods and increased need for supplemental mixing . higher water content , on the other hand , may adversely impact subsequent material handling , and volume reduction results . water supplied to an excess will yield a material that will contain free liquids , in these cases , the treated material should be allowed to react for a longer period of time to permit a decrease in moisture content by capillary drying and / or evaporation . in some instances , dewatering or other drying techniques may be used to form a material that contains no free liquids . when tgpa is not utilized as the group two treatment chemical reagent , other compounds that provide soluble phosphates , or phosphates that can be solubilized may be substituted . the phosphates may be applied in a liquid form or as a solid . prior to employing the process of the present invention at a site , laboratory tests should be conducted to determine the amounts of group one and group two treatment chemicals that will be needed for the contaminated matrix that is to be treated . identification of carbonates , borates , sulfates , silicates and / or phosphates in the host material will facilitate the selection of the optimum quantities of treatment chemicals . ambient temperature and pressure may be used for the disclosed treatment process , permitted the operations of the feeding and mixing equipment allow such . under sub - freezing conditions , phosphoric acid may be heated to 50 ° f . to prevent it from gelling and in order to keep it in a pumpable viscosity range . the treatment may be performed under a batch or continuous system of using , for example , a weight - feed belt or platform scale for the metal - hazardous waste materials and a proportionate weight - belt feed system for the dry ingredient or ingredients and powders of at least one of the groups . a metering device , e . g ., pump or auger feed system , may instead , or additionally , be used to feed the ingredients of at least one of the groups . the same equipment used for treating metal - hazardous waste material is used for treating soils and waste materials contaminated with radionuclides and other radioactive substances . single step mixing of treatment chemicals a lead contaminated soil from a battery cracking , burning , and recycling abandoned site was obtained and treated with group one and group two chemicals in one single step at bench - scale . the contaminated soil contained total lead in the range of 11 . 44 % to 25 . 6 % and tclp lead in the ranged of 1781 . 3 mg / l to 3440 mg / l . the bulk density of contaminated soil was nearly 1 . 7 g / ml at moisture content of 10 . 3 %. the contaminated soil ph was 5 . 1 with an oxidation reduction potential value of 89 . 8 mv . to each 100 g lot of lead hazardous waste soil , sufficient amounts of group one and group two treatment chemicals and reagents were added as illustrated in table iii , in order to render it nonhazardous by rcra ( resource conservation and recovery act ) definition . table iii tclp test run treatment additive ( s ) lead ( mg / l ) i 5 % lime , 5 % gypsum , 10 . 2 % phosphoric 0 . 5 ii 12 % phosphoric , 10 % potassium sulfate 2 . 2 iii 12 % phosphoric , 10 % sodium sulfate 3 . 5 iv 15 % tsp 3 . 7 v 12 % phosphoric , 10 % portland cement i 0 . 2 vi 12 % phosphoric , 10 % portland cement ii 0 . 9 vii 12 % phosphoric , 10 % portland cement iii 0 . 3 viii 12 % phosphoric , 10 % gypsum 4 . 6 ix 15 % tsp , 10 % portland cement 0 . 1 x 15 % tsp , 10 % portland cement ii 0 . 2 xi 15 % tsp , 10 % portland cement iii 0 . 2 xii 15 . 1 % phosphoric 3 . 6 xiii 10 % trisodium phosphate , 10 % tsp 1 . 2 xiv 6 . 8 % phosphoric , 4 % tsp 4 . 5 xv 10 % gypsum 340 xvi 12 % phosphoric , 5 % lime 0 . 9 control untreated check 3 , 236 . 0 it is obvious from tclp lead analyses of fifteen test runs that the single step mixing of at least one component of either or both group one and group two treatment chemicals is very effective in diminishing the tclp lead values . in test run i , mixing of lime and gypsum from group one additives and phosphoric from group two decreased the tclp lead to levels below 1 mg / l from 3440 mg / l with a curing time of less than 5 hours . although the treatment chemicals of group two are more effective in decreasing the tclp lead than the treatment chemicals of group one , as illustrated by the comparison of test runs xii and xv for this waste soil , but the combined effect of both groups is even more pronounced in decreasing the leachable lead . results of these bench - scale studies were confirmed during engineering - scale tests . single step mixing of 5 % lime , 11 . 76 % phosphoric acid and 15 % water in a 2000 g hazardous soil diminished the tclp lead values form 3440 mg / a to 0 . 77 mg / l in less than 5 hours . likewise , single step mixing of 300 g triple super phosphate ( tsp ), 200 g portland cement ( pc ) and 300 ml water in 200 g hazardous soil decreased the tclp lead to levels below 0 . 3 mg / l within a relatively short curing time . single step nag of both groups of treatment chemicals can dramatically reduce treatment costs making this invention highly attractive and efficient for commercial use . the first advantage of using lime and phosphoric acid combination over the use of tsp and pc is that in the former a volume decrease of 6 % was realized when compared to the original volume of untreated material . in the later case , a volume increase of 37 % was measured due to hydration of cement . the second advantage of using phosphoric and lime combination is that the mass increase is less than the mass increase when tsp and pc are added . quantitatively , the mass increase in this hazardous waste soil treatment was approximately 16 . 7 % due to combination of lime and phosphoric whereas the mass increase was about 40 % due addition of tsp and pc . and therefore , those skilled scientists and engineers learning this art from this patent , must make an economic judgment for each lead contaminated process material and waste stream which chemical quantity from each group would be most effective in rendering the treated material non - hazardous . the third advantage in using lime and phosphoric over the use of tsp and pc is that the former does not change in physical and mechanical properties of original material and if a batch fails for shortage of treatment chemicals , it can be retreated rather easily by adding more of the treatment reagent . the material treated with pc hardens and may form a monolith which is difficult to retreat in case of a batch failure . in the lead contaminated soil from the abandoned battery recycling operations , the treatment chemicals of either group can be added first and mixed thoroughly in an amount sufficient to decrease the tclp lead below the regulatory threshold . two step mixing method of the group one and group two treatment additives is as effective as single step mixing of same quantity of treatment chemicals selected from group one and group two . table iv illustrates data that confirm that the application of group one treatment chemicals in step i is about as effective as application in step ii . the same is true for group two treatment chemicals . thus , the two steps are essentially interchangeable . the reversibility of the steps according to the present invention make it very flexible for optimization during commercial use , scaling up and retreatment of any batches that fail to pass the regulatory threshold criteria . table iv treatment additives two step mixing methods test total tclp lead run step i step ii lead mg / l i 10 % gypsum & amp ; 12 % phosphoric 20 . 8 1 . 8 2 % lime acid ( group ii ) ( group i ) ii 12 % phosphoric 10 % gypsum & amp ; 24 . 4 1 . 9 ( group ii ) 2 % lime ( group i ) iii 10 % gypsum 10 . 6 % phosphoric 24 . 4 3 . 4 ( group i ) ( group ii ) iv 10 . 6 % phosphoric 10 % gypsum 22 . 4 3 . 5 ( group ii ) ( group i ) single step mixing method v 10 % gypsum and 12 % phosphoric 23 . 6 3 . 5 untreated control / check 23 . 1 3440 a sample of hazardous cracked battery casings of ½ ″- 1 ″ size containing 14 % to 25 . 2 % total lead and about 3298 mg / l of tclp was obtained for several test runs of the invention to verify the retreatability of batches that fail because of the insufficient dose of treatment chemical added . the results of initial treatment and retreatment are presented in table v and compared with single step mixing treatment additives from both groups . about 200 g of hazardous material was treated with 10 . 5 % phosphoric acid , 2 . 5 % gypsum and 1 . 25 % lime , all mixed in one single step . the tclp lead was decreased from 3298 mg / l to 2 , 5 mg / l as a result of single step mixing in test run v ( table v ). when the amount of additive from group two was less than the optimum dose needed , the tclp lead decreased from 3298 mg / l to : ( i ) 1717 mg / l when 4 . 2 % phosphoric and 1 % lime were added during step i and ii respectively , and ( ii ) 2763 mg / l when 4 . 2 % phosphoric and 5 % gypsum were added , compared to untreated control . since the tclp lead did not pass the regulatory criteria of 5 mg / l , treated material from test runs i and ii were retreated during test runs iii and iv , respectively , using sufficient amounts to phosphoric acid ( an additive from group two ) in sufficient amount to lower the tclp lead to 2 . 4 mg / l and 2 . 5 mg / l , respectively . furthermore , this example confirms that lime is more effective in decreasing tclp lead than gypsum among different additives of group one . and as a result , the requirement of group two treatment reagent is lessened by use of lime over gypsum . the example also illustrates that one or more compounds of the same group can be used together to meet the regulatory threshold limit . table v treatment additives two step mixing methods tclp lead test run step i step ii mg / l i 4 . 2 % phosphoric 1 % lime 1717 ii 4 . 2 % phosphoric 5 % gypsum 2763 untreated 3296 control retreatment ( single step mixing ) method iii - i 6 . 8 % phosphoric 2 . 4 iv - ii 8 . 5 % phosphoric 3 . 5 single step mixing v 10 . 5 % phosphoric , 2 . 5 % gypsum , 1 . 25 % lime 2 . 5 wide range of applications and process flexibility in curing time , moisture content and treatment operations table vi illustrates different types of waste matrix that have been successfully treated employing the one step and two step mixing treatment additives from group one and group two . for these diverse waste types and process materials , total lead ranged form 0 . 3 % to 23 . 5 %. this example discloses the flexibility and dynamics of the treatment process of the invention in rendering non - hazardous , by rcra definition , a wide range of lead - hazardous and other metal - hazardous materials within a relatively short period of time , usually in less than 5 hours . it is expected that this process will also render bismuth , cadmium , zinc , chromium ( iii ), arsenic ( iii ), aluminum , copper , iron , nickel , selenium , silver and other metals also less leachable in these different types of wastes . the moisture content of the waste matrix is not critical and the invented process works on different process materials and waste types independent of the moisture content . the treatment operations can be carried out at any level — bench , engineering , pilot and full - scale — on relatively small amounts of hazardous waste material in laboratory to large amounts of contaminated process materials , soils , solid wastes , waste waters , sludges , slurries and sediments outdoor on - site . the process is applicable in - situ as well as ex - situ . table vi universe of application for the invention mactite treatment process lead leachable lead ( mg / l ) contaminated treatment total before after volume waste type additive lead % treatment treatment decrease old dirt 3 . 4 % phosphoric 2 . 2 164 . 4 1 . 5 16 . 7 waste with broken 8 . 1 % lime 2 . 7 197 . 5 nd (& lt ;. 5 ) battery casing 1 % gypsum and 3 . 4 % phosphoric slag - lead shelter 10 . 2 % phosphoric 6 . 6 21 . 3 2 . 0 lead - bird shot 16 % phosphoric 16 . 1 3720 nd (& lt ;. 5 ) 14 % lime and 30 % gypsum lead - buck shot 16 % phosphoric 11 . 4 1705 nd (& lt ;. 5 ) 14 % lime and 28 % gypsum battery casings 5 % gypsum 12 288 0 . 6 0 organic humus soil 0 . 5 % lime 1 . 9 23 . 2 nd (& lt ;. 5 ) 29 2 . 0 % phosphoric 50 : 5o mixture of 4 % gypsum 0 . 5 687 0 . 7 3 . 3 casings and sand 4 % phosphoric 422 . 2 0 . 95 23 . 6 solid waste soil 3 % lime 23 . 5 12 . 0 6 . 0 contaminated with 12 % phosphoric tetraethyl lead soil contaminated 10 % gypsum 4 . 74 590 13 . 7 with leaded 6 % phosphoric gasoline 3 % lime 3 . 2 213 1 . 6 5 . 1 % phosphoric carbon with 4 . 7 % phosphoric 12 . 6 105 . 6 0 . 5 lead dross wire fluff 1 . 7 % phosphoric 0 . 3 19 0 . 7 wire chip 0 . 75 % phosphoric 0 . 4 28 nd (& lt ;. 2 ) lagoon sediment 0 . 6 % tsp 0 . 3 3 . 9 0 . 23 0 . 5 % phosphoric 5 . 6 0 . 3 rcra organic sludge 0 . 6 % phosphoric 9 . 4 580 nd (& lt ;. 5 ) 10 % gypsum filter cake 8 . 5 % phosphoric 2 . 9 245 . 3 1 . 1 gravel 5 % gypsum 0 . 16 7 . 5 0 . 5 2 . 2 % phosphoric road gravel 10 % gypsum 0 . 34 46 nd (& lt ;. 5 ) 8 . 4 % phosphoric mixture of battery 2 . 5 % gypsum 1 . 3 75 0 . 6 19 . 6 casings ( sold waste ) 3 . 4 % phosphoric and soil industrial waste 1 g lime 2 . 75 91 0 . 7 ( b ) 3 . 4 % phosphoric industrial process 3 . 4 % phosphoric 1 . 3 61 nd (& lt ;. 5 ) mat . ( g ) soil ( b ) 3 . 4 % phosphoric 4 . 1 129 . 5 0 . 6 25 . 6 soil ( s ) 50 % gypsum 11 & lt ; 0 . 01 soil ( o ) 1 . 3 % phosphoric 0 . 38 34 . 6 nd (& lt ;. 5 ) soil ( c ) 5 % lime 11 . 78 130 . 6 0 . 33 8 . 5 % phosphoric battery casings 5 % gypsum 2 . 5 110 . 1 1 . 9 3 . 4 % phosphoric gray clay soil 5 % trisodium 2 . 2 46 . 6 0 . 2 phosphate nearly twenty ( 20 ) different chemicals and products from various vendors and supply houses were screened for chemical fixation of leachable lead in hazardous solid waste samples . only six ( 6 ) of these treatments chemicals were found effective in decreasing the leachable lead as measured by : ( 1 ) the ep toxicity test and ( 2 ) the tclp test . table vii presents a summary of if leachable lead found in untreated and treated waste samples allowed to cure for a minimum of 4 hours after treatment with at least one of the effective chemicals . treatment chemicals found relatively ineffective for lead fixation included a variety of proprietary products from american colloid company and oil dri , different sesquioxides like alumina and silica , calcium silicate , sodium silicate , portland cement , lime , and alum from different vendors . results for these ineffective chemicals are not shown in table vii . table vii relative effectiveness of various treatment chemicals screened to decharacterize the lead - toxic solid wastes leachable lead in mg / l treatment chemical ( step ) toxicity test ep tclp test i . untreated control 221 . 4 704 . 5 ii . single treatment chemical ( one step treatment ) a . sulfuric acid ( i ) 11 . 7 39 . 8 b . phosphoric acid ( i ) 1 . 0 5 . 9 c . superphosphate granular ( i ) 2 . 7 11 . 4 d . liquid phosphate fertilizer ( i ) 19 . 4 64 . 3 e . gypsum powder ( i ) 24 . 9 81 . 8 f . sodium phosphate ( i ) 28 . 7 93 . 9 iii . two step treatment g . sulfuric ( i ) & amp ; lime ( ii ) 20 . 6 68 . 1 h . gypsum powder ( i ) & amp ; alum ( ii ) 3 . 9 15 . 3 i . sodium phosphate ( i ) & amp ; 3 . 1 12 . 6 phosphoric ( ii ) j . gypsum ( i ) & amp ; phosphoric ( ii ) n . d . * 1 . 6 iv . three step treatment k . gypsum ( i ), alum ( ii ) & amp ; 12 . 8 43 . 3 sodium phosphate ( iii ) l . gypsum ( i ), phosphoric ( ii ) & amp ; n . d . * 1 . 4 sodium phosphate ( iii ) evaluation of a single treatment chemical in one step reveals that phosphoric acid was most effective in fixation of leachable lead followed by granular super - phosphate , a fertilizer grade product available in nurseries and farm supply houses . however , neither treatment effectively treated leachable lead to the usepa treatment standard of 5 . 0 mg / l by tclp methodology . although both phosphoric acid and granular superphosphate were effective in meeting the now obsolete ep toxicity test criteria at 5 . 0 mg / l , this test has been replaced by tclp test criteria for lead of 5 . 0 mg / l . single application of the phosphoric acid , granular superphosphate or any other chemical was short of meeting the regulatory threshold of 5 . 0 mg / l by tclp test criteria for lead . in a two - step treatment process , application of gypsum during step i and treatment with phosphoric acid in step ii resulted in decrease of tclp - lead consistently and repeatedly below the regulatory threshold of 5 . 0 mg / l . the results of this two - step treatment process utilizing gypsum in step i and phosphoric acid in step ii are most reliable and hence , the two - step process may be applied to a wide variety of lead contaminated wastes as exhibited in example ii . a three - step process , as set forth in table vii , was not perceived to be as economically viable as a two - step treatment process , despite its ability to reduce lead levels in satisfaction of the tclp test criteria . a process that employees the beneficial combination of treatment first with a sulfate compound and then with a phosphate reagent in accord with the present invention , in combination with one or more additional treatment steps , may nevertheless be within the scope of the invention . in order to illustrate the relative proportions of two chemicals , e . g ., gypsum and phosphoric acid , needed for treatment of lead - toxic wastes , three soil samples from a lead contaminated test site were processed using the present invention , in which gypsum powder was used in the first step , and phosphoric acid solution in water at concentrations of about 7 , 15 and 22 percent by weight in the second step . the soil was measured for lead content in accordance with the ep toxicity test before and after treatment . a level of leachable lead below 5 mg / l was considered non - hazardous according to this procedure . during these test runs , the ep toxicity test criteria were in force for treated waste material . the results of these tests are set forth in table viii : table viii effectiveness in fixation and stabilization of leachable lead in lead toxic soils ep toxic lead process steps test results soil sample gypsum phosphoric before after ( lead - toxic step i step ii treatment treatment waste ) ( g / kg soil ) ( g / kg soil ) mg / l mg / l 1 . low lead 20 10 8 & lt ; 0 . 1 contamination 2 . moderate 30 20 61 & lt ; 0 . 1 contamination 3 . high lead 40 30 3 , 659 1 . 7 contamination the foregoing results demonstrate that the process of the present invention was effective in all three samples , representing 3 different levels of lead contamination . the process is flexible and is usually optimized during bench scale treatability studies for each waste type to immobilize the leachable lead and to decharacterize or transform the lead - toxic waste into non - toxic solid waste acceptable to tsd facilities under current land ban regulations . a net reduction of 36 . 4 % in waste volume through use of the instant process has been observed . typical volume reductions are set forth in table ix . table ix changes in solid waste volume as a result of treatment with the two - step process solid waste volume final ( after decrease in initial ( before application of waste solid waste application of process and volume material process ) curing ) (%) ( treatment scale ) 1 . low toxic soil 3 , 850 cu . yd . 2 , 450 cu . yd . 36 . 4 ( full scale ) 2 . lead - toxic solid waste ( bench scale ) test run i 106 . 1 cu . in . 81 . 51 cu . in . 23 . 0 test run ii 22 . 0 cu . in . 17 . 3 cu . in . 21 . 4 the most profound effect of the process of the present invention is at a structural level , where the break - down of granular aggregates is associated with a loss of fluffiness and a decrease in pore space and increased compaction due to physical , mechanical and chemical forces at different levels . at a molecular level , phosphoric acid breaks down the minerals containing carbonates and bicarbonates , including cerussites , in stoichiometric proportions . soon after the addition of phosphoric acid to a solid waste containing cerussites , extensive effervescence and frothing becomes evident for several minutes and sometimes for a few hours . the phosphoric acid breaks down the acid sensitive carbonates and bicarbonates leading to the formation of carbon dioxide , water and highly stable and insoluble sulfate and phosphate mineral compounds . thus , structural changes due to interlattice reorganization as well as interstitial rearrangement in waste during processing are associated with an overall decrease in waste volume . depending on the extent of carbon dioxide loss from the breakdown of carbonates and bicarbonates present in the lead - toxic solid waste , the process may lead to a slight loss of waste mass as well . water generated during the chemical reactions is lost by evaporation , which further decreases the mass and volume of the treated solid wastes and soils . the cost of the process of the present invention is moderate to low , depending upon ( i ) waste characteristics , ( ii ) treatment system sizing , ( iii ) site access , ( iv ) internment of final disposition of treated material and ( v ) site support requirements . the costs of treatment and disposal are presently on the order of $ 115 per ton of lead - toxic waste , as compared to off - site conventional treatment and disposal costs of over $ 250 per ton if no treatment in accord with the invention had been performed . moreover , recent land ban regulations would prohibit the disposal of all lead - toxic wastes in landfills . the foregoing example makes clear that the process of the present invention provides an efficient technology that is economically attractive and commercially viable in meeting regulatory criteria for landfills . the process of the present invention was applied on bench scale to five different lead - toxic waste materials that were characterized for total lead , tclp - lead , moisture content and ph before and after treatment . a curing time of 5 hours was allowed for completion of the treatment process . the results compiled in table x exhibit the profound effects of the process in decreasing the tclp lead in a wide range of lead - toxic soils and solid wastes containing total lead as high as 39 , 680 mg / kg and tclp lead as high as 542 mg / l . in each of the five cases , the instant process immobilizes the leachable lead to levels below the regulatory threshold of 5 mg / l set by the tclp test criteria for lead currently in force under the land ban regulations of the united states environmental protection agency . table x typical changes in solid waste characteristics due to process effects measured values solid waste before after treatment & amp ; characteristics treatment curing i . lead - toxic sw - a total lead , % 1 . 442 1 . 314 tclp - lead , mg / l 542 . 0 2 . 0 moisture , % 23 . 0 33 . 0 ph , s . u . 8 . 1 4 . 8 ii . lead - toxic sw - b total lead , % 0 . 847 0 . 838 tlcp - lead , mg / l 192 . 0 2 . 4 moisture , % 27 36 ph , s . u . 8 . 0 5 . 3 iii . lead - toxic sw - c total lead , % 3 . 968 3 . 066 tlcp - lead , mg / l 257 . 6 1 . 0 moisture , % 10 . 0 18 . 1 ph , s . u . 7 . 2 4 . 5 iv . lead - toxic sw - d total lead , % 2 . 862 2 . 862 tlcp - lead , mg / l 245 . 3 0 . 38 moisture , % 71 . 6 84 . 1 ph , s . u . 8 . 1 6 . 3 v . lead - toxic sw - e total lead , % 0 . 16 0 . 12 tlcp - lead , mg / l 7 . 5 1 . 87 moisture , % 12 . 3 23 . 0 ph , s . u . 7 . 0 5 . 4 it is obvious from table x that the instant process operates over a wide range of moisture and ph conditions . it is associated with 8 to 11 % rise in moisture content . the end product of the treatment process may contain moisture in a typical range of 18 % to 36 % on a dry weight basis . the end product passes the paint filter test for solids and there are not other byproducts or side streams generated during the process . the treated solid waste is cured in 4 to 5 hours and may be allowed to dry for 2 to 3 days after treatment for loss of unwanted moisture prior to final internment and disposition . this time is sufficient for the tclp tests to be completed as part of the disposal analysis under land ban regulations enforced by the usepa . it is necessary to establish the quantities of gypsum and phosphate reagent on a case - by - case basis , because the consumption of these materials will depend not only upon the initial lead level in the waste or soil , but also upon other waste characteristics such as cation exchange capacity , total buffering capacity , and the amounts of carbonates and bicarbonates present , among others . bench scale treatability studies for each solid waste considered will be necessary to determine the optimum levels of the materials that are employed . the treatability studies are designed to optimize the amount and grade of gypsum powder ( or other sulfate compound ) needed during step i , and the amount and concentration of phosphoric acid ( or other phosphate compound ) needed in step ii for cost - effective operation of the treatment system . those skilled in the art are knowledgeable of such bench studies , which are usually carried out as precursors to full scale treatment . several series of studies were performed on host matrices containing leachable and soluble radionuclides and other radioactive substances using the present invention . sample material from a site in the eastern united states was homogeneously mixed in a container . the material consisted of silts , clays , sand and gravel mixed with glass , nails , rocks and debris . the material was collected from an environmental restoration project where site efforts focused on excavation , packaging , transportation and disposal of thorium contaminated soil and materials from beneath residential homes . three 300 g sub - samples of untreated material were prepared from the sample material with the materials in each of the sub - samples sized to less than ⅜ inch and suitable for usepa sw - 846 method 1311 ( tclp ) extraction . sample 1 ( us - 1 ) was extracted using tclp fluid no . 1 , sample 2 ( us - 2 ) was extracted using tclp fluid no . 2 , and sample 3 ( us - 3 ) was extracted using laboratory grade deionized (“ di ”) water as the only modification to the epa method . this soil characterization step was conducted for purposes of determining the most harsh extraction conditions for the untreated material . tclp fluid no . 1 was prepared with glacial acetic acid and 1n naoh with an end ph of 4 . 93 +/− 0 . 05 s . u . tclp fluid no . 2 was prepared with glacial acetic acid and deionized water with an end ph of 2 . 88 +/− 0 . 05 s . u . the laboratory grade di water had a ph of 6 . 82 +/− 0 . 05 s . u . after tumbling 100 g of the 300 g sub - sample in 200 ml of extraction fluid for eighteen ( 18 ) hours at 30 +/− 2 rpm in a longitudinal rotary tclp agitator , the extracts were decanted from the settled solids , filtered as per the method , and then placed in marinelli containers . radionuclide leachability was determined by conducting total gamma spectroscopy analysis on each extract in accordance with accepted quantification methods using a nuclear data genie model nd9900 gamma spectrometer integrated with a dec micro vax ii computer . each extract was counted for sixteen ( 16 ) hours . all results presented below are in the units of picocuries per liter ( pci / l ). table xi eastern united states untreated sample material characterization us - 1 us - 2 us - 3 untreated untreated untreated radionuclide tclp fluid 1 tclp fluid 2 deionized water pb - 210 329 +/− 30 173 +/− 45 175 +/− 37 bi - 211 2 , 751 +/− 736 3 , 360 +/− 797 3 , 451 +/− 560 bi - 214 772 +/− 93 1 , 002 +/− 120 1 , 017 +/− 106 pb - 214 810 +/− 350 910 +/− 242 966 +/− 202 fr - 223 2 , 183 +/− 660 3 , 768 +/− 73 3 , 228 +/− 531 ra - 223 939 +/− 404 1 , 514 +/− 383 714 +/− 148 ra - 224 1 , 551 +/− 503 1 , 772 +/− 358 1 , 868 +/− 321 ra - 226 1 , 090 +/− 167 1 , 294 +/− 162 1 , 352 +/− 156 ac - 227 213 +/− 20 243 +/− 54 173 +/− 31 th - 227 533 +/− 163 921 +/− 179 788 +/− 131 th - 228 8 , 335 +/− 1014 16 , 490 +/− 12 13 , 170 +/− 1 , 371 pa - 231 1 , 136 +/− 476 1 , 764 +/− 467 1 , 490 +/− 307 th - 234 22 +/− 6 19 +/− 13 10 +/− 9 u - 235 190 +/− 22 313 +/− 38 281 +/− 29 as shown by the gamma spectral analysis of each extract , tclp fluid no . 2 was identified as the most rigorous extraction fluid for the soil material , primarily because of leachable thorium and uranium levels . this fluid was then selected to be used for extraction of the treated samples for the remainder of the studies . in the second portion of the study , two ( 2 ) 300 g samples were prepared from the eastern u . s . sample material and labeled as ts - 1 and ts - 2 . each sample was placed in a laboratory beaker and 35 ml of deionized water and 5 % ( ts - 1 ) and 10 % ( ts - 2 ) by weight tgpa were added . the contents in each of the beakers were then mixed by folding with a laboratory spatula in order to simulate blending achievable using full - scale methods in the field . the samples were then allowed to react overnight . each beaker was then sub - sampled , material particles sized to less than ⅜ inch , and prepared for usepa sw - 846 method 1311 ( tclp ) extraction using 100 g of treated sub - sample material and 2000 ml tclp fluid no . 2 . table xii presents the data from the gamma spectral analysis with all units reported as pci / l . the results from table xi for untreated materials extracted using tclp fluid no . 2 were used as a control and are shown in the fourth column . table xii eastern united states sample material treated with di water and tgpa tclp extraction fluid no . 2 results radio - ts - 1 ts - 2 us - 2 nuclide 5 % tgpa 10 % tgpa tclp fluid no . 2 pb - 210 & lt ; mda * & lt ; mda 173 +/− 45 bi - 211 & lt ; mda & lt ; mda 3 , 360 +/− 797 bi - 214 & lt ; mda & lt ; mda 1 , 002 +/− 120 pb - 214 & lt ; mda & lt ; mda 910 +/− 242 fr - 223 & lt ; mda & lt ; mda 3 , 768 +/− 73 ra - 223 & lt ; mda & lt ; mda 1 , 514 +/− 383 ra - 224 & lt ; mda & lt ; mda 1 , 772 +/− 358 ra - 226 & lt ; mda & lt ; mda 1 , 294 +/− 162 ac - 227 & lt ; mda & lt ; mda 243 +/− 54 th - 227 & lt ; mda & lt ; mda 921 +/− 179 th - 228 & lt ; mda & lt ; mda 16 , 490 +/− 12 pa - 231 & lt ; mda & lt ; mda 1 , 764 +/− 467 th - 234 & lt ; mda & lt ; mda 19 +/− 13 u - 235 & lt ; mda & lt ; mda 313 +/− 38 as indicated by the data from tables xi and xii , tgpa substantially reduces the leachability of radionuclides in soil as determined by usepa sw - 846 method 1311 ( tclp ) extraction with fluid no . 2 and gamma - spectral analysis of resultant extract . it should be noted that the soil sample materials were not sized to less than ⅜ inch until after the tgpa and deionized water were mixed and allowed to cure overnight . the leaching of thorium , its decay - daughters , and other radionuclides from untreated material was effectively reduced by the addition of tgpa to the material . the treated material was moist after curing overnight , but contained no free liquids . after exposure to the air for forty - eight ( 48 ) hours , the treated material was dry and crumbly with nonuniform cohesivity . volume reduction was observed , but not quantified . in another study , samples of the untreated material used in example 7 were mixed with tgpa and other compounds . for this study , gypsum , calcium oxide , triple superphosphate ( tsp ), and tgpa were selected based upon a generally desired ph range of the end product . four 300 g samples were prepared : ts - 3 = 35 ml di water + 8 % gypsum + 5 % tgpa ; ts - 4 = 35 ml di water + 9 % calcium oxide + 8 % tgpa ; ts - 5 = 35 ml di water + 3 % calcium oxide + 5 % tgpa ; and ts - 6 = 45 ml di water + 10 % tsp + 1 . 6 % calcium oxide . treatment samples received variable amounts of water so that after mixing , the consistency of the mixtures was uniform for all of the samples and there were no free liquids . the water assisted in the dispersement of the reagent and calcium oxide hydration ; and hence , the disassociation of the phosphate to a soluble form . additional water was required in ts - 6 because of the solid reagent forms and the hydration demand of cao in the presence of dry tsp . table xiii presents the data from usepa sw - 846 method 1311 ( tclp ) extracts of ts - 3 , ts - 4 , ts - 5 , and ts - 6 analyzed by total gamma - spectroscopy in accordance with procedures outlined in example 7 . all samples were analyzed with tclp fluid no . 2 ( acetic acid + water with a ph of 2 . 88 +/− 0 . 05 s . u .). table xiii eastern united states sample material treated with other embodiments tclp extraction fluid no . 2 results radionuclide ts - 3 ts - 4 ts - 5 ts - 6 pb - 210 & lt ; mda * & lt ; mda & lt ; mda & lt ; mda bi - 211 & lt ; mda 180 +/− 69 296 +/− 106 & lt ; mda bi - 214 & lt ; mda 55 +/− 23 75 +/− 29 & lt ; mda pb 214 & lt ; mda & lt ; mda 50 +/− 50 & lt ; mda fr - 223 & lt ; mda & lt ; mda & lt ; mda & lt ; mda ra - 223 & lt ; mda 245 +/− 97 84 +/− 34 & lt ; mda ra - 224 & lt ; mda & lt ; mda & lt ; mda & lt ; mda ra - 226 & lt ; mda & lt ; mda 122 +/− 114 & lt ; mda ac - 227 & lt ; mda & lt ; mda 286 +/− 47 & lt ; mda th - 227 & lt ; mda & lt ; mda 552 +/− 131 & lt ; mda th - 228 & lt ; mda & lt ; mda & lt ; mda & lt ; mda pa - 231 & lt ; mda & lt ; mda & lt ; mda & lt ; mda th - 234 & lt ; mda & lt ; mda 139 +/− 53 & lt ; mda u - 235 & lt ; mda & lt ; mda 79 +/− 35 & lt ; mda as evidenced by the data , the treatment regimes utilizing gypsum + tgpa , calcium oxide + tgpa , and triple superphosphate ( tsp )+ calcium oxide resulted in the reduction of nuclide leachability . each of the treatment regimes provided soluble phosphates , or phosphates that were solubilized by ph manipulation in the presence of a fluid . each of the treatments resulted in the formation of apatites within the host material , with mineral crystal nucleation chemically incorporating the radionuclides . the tests in example 9 were performed to study the volume change of materials treated by the process of the present invention . in example 9 , soil volume was examined prior to and after the addition of tgpa . because of the difficulty in examining volume changes due to varied conditions , geometric configuration , and chemical properties of material differing between pre - and post - treatment , a special device was constructed to account for changes in density , moisture content , and geotechnical properties . the test apparatus used for measuring the volume consisted of a removable stainless steel cylindrical cup with a flat bottom (“ the cup ”). the cup had a 10 . 3 cm inside diameter and a 29 . 6 inside height and mounted vertically to the base of the test apparatus . mounted above the cup on the apparatus frame was a pneumatic piston with a 1 . 4 cm thick plate fixed to the piston shaft . when activated with compressed air , a 10 . 2 cm diameter close - tolerance plate fixed to the piston shaft extended downward and into the open end of the cup . compressed air operated the piston and was adjusted with a valve so that from 1 to 100 psi could be exerted on soil placed within the cup . the untreated material from example 7 was used to prepare ten aliquots ( of approximately 100 g ) which were individually weighed using a top - loading electronic balance (+/− 0 . 01 g ). the ten aliquots were then sequentially emptied into the cup . after the addition of each 100 g aliquot , the cylindrical cup was placed in the apparatus and the piston activated to exert a pressure of 10 psi on the soil column . this procedure was repeated until all ten long aliquots had been added and compacted . the height of the soil column was then determined by measuring from the top of the cup to the top of the plate , correcting for the plate thickness , and subtracting the total from the inside height of the cup . the untreated material was then removed from the cup and placed in a laboratory beaker . care was taken to ensure all visible material was removed and transferred . water was added to the beaker on a weight basis equal to 12 % of the untreated material . tgpa was then added at a dose of 5 %, also by weight , of the untreated material . the untreated material and amendments were mixed with a laboratory spatula by folding and allowed to sit overnight . the treated material was then removed from the beaker and placed in the cylindrical cup in ten stages of approximately 100 g each . the pneumatic piston was activated at the same 10 psi pressure each time treated material was added to the cup . after all of the treated material was transferred and compacted with the apparatus , the resultant column height was calculated as previously described , after the material had been allowed to sit for approximately seven ( 7 ) days , the volume test was performed again in the same manner . the results of the study are presented in table xiv . table xiv volume change of eastern united states sample material treated with 5 % ( wt .) tgpa mass height mass height mass height treated treated treated treated untreated untreated & lt ; 24 hours & lt ; 24 hours 7 days 7 days ( grams ) ( cm ) ( grams ) ( cm ) ( grams ) ( cm ) 1003 . 09 8 . 2 1074 . 77 7 . 4 942 . 51 6 . 7 these test results show a total volume reduction of 9 . 75 % after 24 hours and 22 . 4 % after 7 days , relative to the initial untreated material . in the next series of studies , sample material from a site in the midwestern united states was utilized in treatability studies . the material contained small soil grains ( with 100 % passing through a 9 . 5 mm sieve ) and was comprised of 30 % sand , 47 % silt , and 23 % clay as determined by astm d - 422 ( particle - size distribution ). the average density of the material was 1 . 43 g / cc and the material had a moisture content of 16 percent by weight and a ph of 6 . 0 s . u . as in the previous examples , the sample material was characterized for radionuclides and other radioactive substances . nuclide leachability was examined utilizing the toxic characteristic leaching procedure ( tclp ) extraction procedure ( usepa sw - 846 , method 1311 ). material was also subjected to other leaching tests including the synthetic precipitation leaching procedure ( splp ) extraction procedure ( usepa sw 846 , method 1312 ), and a modified version of the tclp extraction method , where deionized water was substituted for the extraction fluid ( di / tclp ). results of the gamma - spectral , uranium , and technetium - 99 characterization analyses on extraction fluids are presented in table xv . table xv untreated midwestern united states sample material radionuclide leachability characteristics us - 4 us - 5 us - 6 radionuclide / method 1311 method 1312 modified - 1311 isotope / item tclp splp di / tclp ra - 226 3 , 644 +/− 895 3 , 120 +/− 494 556 +/− 219 u - 235 266 +/− 66 190 +/− 43 39 +/− 25 u - 238 * 12 , 308 +/− 969 11 , 210 +/− 92 2 , 590 +/− 45 pb - 212 16 +/− 4 & lt ; mda & lt ; mda th - 234 485 +/− 138 355 +/− 90 228 +/− 73 tc - 99 238 +/− 11 152 +/− 10 235 +/− 11 u 8 , 698 +/− 68 7 , 922 +/− 65 1 , 830 +/− 32 u , total ( ug / l ) 17 , 979 16 , 375 3 , 783 in this example , four 400 g samples of soil material ( ts - 7 , ts - 8 , ts - 9 and ts - 10 ) were prepared from the untreated midwestern u . s . sample material and placed in separate laboratory beakers . sample ts - 7 was used as a control and mixed only with 120 ml of deionized water . for each of the three other samples , 120 ml of deionized water and varying amounts of tgpa were added to each beaker and mixed until a uniform consistency was achieved : ts - 8 = 120 ml di water + 3 % ( wt .) tgpa ; ts - 9 = 120 ml di water + 5 % ( wt .) tgpa ; and ts - 10 = 120 ml di water + 10 % ( wt .) tgpa . when the mixing was completed , no free liquids were present . after sitting overnight , a 100 g sample of treated material was removed from each beaker and extracted by usepa sw - 846 , method 1311 ( tclp ), using fluid no . 2 , to simulate exposure to acidic landfill leachate . the radionuclide leachability for each extract was then quantified by gamma spectroscopy . total uranium and technetium - 99 tests were also conducted . uranium - 238 was calculated , assuming the total uranium present was 100 % depleted . the levels of leachable radionuclides and other radioactive substances in the sample material after treatment are presented below in table xvi . the results in table xvi can be compared to the results for sample us - 4 in table xv for reference . table xvi radionuclide leachability of midwestern united states sample material in usepa sw - 846 , method 1311 ( tclp ) fluid no . 2 extract after treatment with tgpa radio - nuclide / isotope / ts - 7 ts - 8 ts - 9 ts - 10 item di water 3 % tgpa 5 % tgpa 10 % tgpa ra - 226 3 , 114 +/− 568 & lt ; mda & lt ; mda & lt ; mda u - 235 231 +/− 55 & lt ; mda & lt ; mda & lt ; mda u - 238 * 5 , 847 +/− 184 54 . 5 +/− 1 . 7 51 . 7 +/− 1 . 7 53 . 5 +/− 1 . 7 ( ug / l ) th - 234 230 +/− 97 & lt ; mda & lt ; mda & lt ; mda tc - 99 213 +/− 14 . 3 67 . 6 +/− 8 . 5 55 . 6 +/− 10 . 4 3 . 7 +/− 4 . 8 u 4 , 132 +/− 130 38 . 5 +/− 1 . 2 36 . 5 +/− 1 . 2 37 . 8 +/− 1 . 2 u , total 8 , 541 80 75 78 ( ug / l ) 100 g samples of material treated in example 10 ( ts - 7 , ts - 8 , ts - 9 and ts - 10 ) were sub - sampled , extracted and analyzed by usepa sw - 846 , method 1312 ( splp ), where the extraction fluid utilized simulated acid rain . each extract was then quantified for radionuclides by gamma - spectroscopy , and total uranium and technetium - 99 tests were conducted . uranium - 238 was calculated , assuming the total uranium present was 100 % depleted . the results of the leachable radionuclides and other radioactive substances in the soil after treatment are presented below in table xvii . the results in table xvii can be compared to the results for sample us - 5 in table xv for reference . table xvii radionuclide leachability in epa sw - 846 , method 1312 ( splp ) extract after treatment with tgpa radio - nuclide / isotope / ts - 7 ts - 8 ts - 9 ts - 10 item control 3 % tgpa 5 % tgpa 10 % tgpa ra - 226 2 , 622 +/− 233 +/− 136 & lt ; mda & lt ; mda 443 u - 235 153 +/− & lt ; mda & lt ; mda & lt ; mda 37 u - 238 * 6 , 065 +/− 30 . 1 +/− 1 . 0 8 . 8 +/− 0 . 1 7 . 3 +/− 0 . 1 192 th - 234 170 +/− & lt ; mda & lt ; mda & lt ; mda 81 tc - 99 210 +/− 55 . 6 +/− 7 . 8 23 . 2 +/− 6 . 5 69 . 8 +/− 7 . 6 15 u 4 , 286 +/− 21 . 3 +/− 0 . 7 6 . 3 +/− 0 . 1 5 . 2 +/− 0 . 1 136 u , total 8 , 859 44 13 . 9 10 . 7 ( ug / l ) 100 g samples of treated soil material in example 10 ( ts - 7 , ts - 8 , ts - 9 and ts - 10 ) were subsampled and extracted by usepa sw - 846 , method 1311 with laboratory grade deionized water substituted for the extraction fluid . although material treated by the invention would never likely be exposed to similar fluid except in the laboratory settings , deionized water is considered by many to be a harsh extraction test as leachable ionic species will tend to diffuse from zones of high concentration to zones of low concentration . each di water extract was then quantified for radionuclides by gamma - spectroscopy , and total uranium and technetium - 99 tests were conducted . uranium - 238 was calculated , assuming the total uranium present was 100 % depleted . the results showing the level of leachable radionuclides and other radioactive substances in the soil after treatment are presented below in table xviii for ts - 7 , ts - 8 , ts - 9 and ts - 10 . the results in table xviii can be compared to the results for sample us - 6 in table xv for reference . table xviii radionuclide leachability in epa sw - 846 , modified method 1311 with di extraction water after treatment with tgpa radio - nuclide / isotope / ts - 7 ts - 8 ts - 9 ts - 10 item control 3 % tgpa 5 % tgpa 10 % tgpa ra - 226 940 +/− 278 & lt ; mda & lt ; mda & lt ; mda u - 235 55 +/− 40 & lt ; mda & lt ; mda & lt ; mda u - 238 * 1 , 807 +/− 57 30 . 1 +/− 1 . 0 8 . 8 +/− 0 . 1 7 . 3 +/− 0 . 1 th - 234 103 +/− 89 & lt ; mda & lt ; mda & lt ; mda tc - 99 207 +/− 15 55 . 6 +/− 7 . 8 23 . 2 +/− 6 . 5 — u 1 , 277 +/− 40 4 . 4 +/− 0 . 1 5 . 2 +/− 0 . 1 5 . 9 +/− 0 . 1 u , total 2 , 640 9 . 1 10 . 6 12 . 1 ( ug / l ) examples 13 and 14 demonstrate additional uses for the present invention . sample material and rgw for examples 13 and 14 were obtained from the midwestern united states site . to establish baseline untreated characterization data , rgw and soil + rgw samples were tested for radionuclides and other radioactive substances using splp and rgw / tclp extraction methods , prior to adding tgpa to the sample material . the following tests were performed : 1 ) rgw was tested for total radionuclides and other radioactive substances ( us - 7 ); 2 ) rgw was mixed into the sample material at 30 % ( wt .). radionuclides and other radioactive substances were examined in the amended sample material &# 39 ; s splp extract ( us - 8 ); and ( 3 ) di water was mixed into the sample material at 30 % ( wt .). radionuclides and other radioactive substances were examined in the amended sample material &# 39 ; s modified tclp extract where rgw was utilized as the substitute tclp extraction fluid ( us - 9 ). table xix presents the baseline data . previous splp extraction test results from the same sample material amended only with di water ( us - 5 ) are presented for comparison . table xix baseline radionuclide leachability for untreated sample material using radioactive groundwater ( rgw ) as a dispersing agent and extraction fluid us - 8 us - 9 us - 5 us - 7 30 % rgw 30 % di h 2 o 30 % di water radionuclide / rgw splp rgw as splp isotope / item totals extract tclp fluid extract bi - 211 234 +/− 18 & lt ; mda & lt ; mda & lt ; mda ra - 224 & lt ; mda & lt ; mda 254 +/− 131 & lt ; mda pb - 212 & lt ; mda & lt ; mda 27 . 8 +/− 11 . 7 & lt ; mda ra - 226 6 +/− 7 & lt ; mda & lt ; mda & lt ; mda u - 235 9 , 251 +/− 1 , 341 261 +/− 49 8 , 353 +/− 115 9 , 190 +/− 43 th - 234 35 , 940 +/− 5 , 027 560 +/− 113 26 , 220 +/− 462 3 , 355 +/− 90 u , total ( mg / l ) 97 , 431 7 , 813 66 , 471 16 , 375 u - 238 ( ug / l ) 45 , 793 3 , 696 31 , 441 11 , 210 tc - 99 126 , 790 580 +/− 30 63 , 241 +/− 589 152 +/− 10 ph ( s . u .) 7 . 5 tss ( mg / l ) 1 , 320 tds ( mg / l ) 4 , 400 hardness [ caco 3 ( mg / l )] 1 , 734 in example 13 , the effects of extracting tgpa treated radioactive sample material containing rgw with usepa &# 39 ; s simulated acid rain leaching method ( splp ) are presented . in this example , rgw was used as a dispersion agent in place of deionized water . contaminated sample material ( characterized in table xix ) was mixed with rgw at 30 % ( wt .). three ( 3 ) equivalent aliquots of the sample material mixed with rgw were placed in separate beakers . in the first beaker , tgpa was added at a dose of 2 % ( wt .) and mixed ( ts - 11 ). in the second beaker , tgpa was added at a dose of 5 % ( wt .) and mixed ( ts - 12 ). in the third beaker , tgpa was added at a dose of 10 % ( wt .) and mixed ( ts - 13 ). the amount of tgpa added was calculated from the base mass of the untreated sample material exclusive of the rgw mass added . table xx presents the data from the analysis of splp extract for each of the treated samples ( ts - 11 , 12 , and 13 ). the untreated characterization data from samples ( us - 7 , and us - 8 ) are presented in table xix for comparison . the splp extraction ( sw - 846 , method 1312 ) is usepa &# 39 ; s procedure for simulating soil exposure to acid rain . the splp method calls for the extraction of 100 g of material with 2000 ml of simulated acid rain fluid . table xx tgpa soil treatment results : radionuclides in splp extract of sample material mixed with 30 % ( wt .) radioactive groundwater radionuclide / ts - 11 ts - 12 ts - 13 isotope / treated treated treated item 2 % tgpa 5 % tgpa 10 % tgpa bi - 211 & lt ; mda & lt ; mda & lt ; mda ra - 226 & lt ; mda & lt ; mda & lt ; mda u - 235 & lt ; mda & lt ; mda & lt ; mda th - 234 & lt ; mda & lt ; mda & lt ; mda u , total , ( mg / l ) 30 19 38 u - 238 ( ug / l )* 14 9 18 tc - 99 292 +/− 21 322 +/− 23 280 +/− 21 in example 14 , sample materials containing radionuclides and other radioactive substances was treated with varying doses of tgpa and di water was utilized as a dispersing agent . these treated samples were then extracted using the modified tclp method ( rgw / tclp ) where rgw was substituted for the specified extraction fluid ( tclp fluid no . 2 ). the sample material was mixed with di water and three ( 3 ) equivalent aliquots of the material were placed in separate beakers . in the first beaker , tgpa was added at a dose of 2 % ( wt .) and mixed ( ts - 14 ). in the second beaker , tgpa was added at a dose of 5 % ( wt .) and mixed ( ts - 15 ). in the third beaker , tgpa was added at a dose of 10 % ( wt .) and mixed ( ts - 16 ). the percent weight of tgpa added was calculated from the initial base mass of the untreated sample material exclusive of the rgw mass added . each of the treated samples were then extracted using the rgw / tclp method with rgw fluid added at the method specified volume and ratio ( 100 g soil : 2000 ml fluid ). table xxi presents the data from the analysis of the modified rgw / tclp extract for each of the treated samples ( ts - 14 , 15 , and 16 ). the untreated characterization data from rgw ( us - 7 ) and untreated soil extract by rgw / tclp ( us - 9 ) are presented in table xix for comparison . table xxi tgpa treatment results : radionuclides in modified rgw / tclp extract of sample material mixed with 30 % ( wt .) di water ts - 14 ts - 15 ts - 16 radionuclide / 2 % tgpa 5 % tgpa 10 % tgpa isotope rgw / tclp rgw / tclp rgw / tclp bi - 211 & lt ; mda & lt ; mda & lt ; mda ra - 226 & lt ; mda & lt ; mda & lt ; mda u - 235 2 , 513 +/− 461 1 , 919 +/− 267 & lt ; mda th - 234 & lt ; mda 5 , 656 +/− 790 200 +/− 170 u , total ( mg / l ) 18 , 191 11 , 880 18 u - 238 ( ug / l )* 8 , 604 5 , 619 9 tc - 99 45 , 738 +/− 222 60 , 398 +/− 255 35 , 176 +/− 195 examples 13 and 14 show that the present invention can use radioactive groundwater as a dispersing agent and that materials treated by the present invention can be used to treat rgw . these examples also demonstrate that acid rain will not affect treated material . example 15 examines the leachability of constituents from a host material based on a calculation of the distribution coefficient ( k d ) for a given analyte ( e . g ., a specific constituent measured by the analyses ). the distribution coefficient is expressed in ml / g and calculated as the quotient of the activity of nuclide sorbed per unit mass of host material ( expressed in pci / g ), and the activity of the nuclide in extract solution per unit volume of extract ( expressed in pci / ml ). k d is an equilibrium value often calculated to determine the sorption affinity of waste analytes ( e . g ., nuclides ) by host matrix ( e . g ., contaminated material ) in aqueous or other fluid suspensions . in this example , the distribution coefficients are calculated for the untreated ( table xxii ) and tgpa treated material ( table xxiii ). the same calculations can be made for similar extractions using other extraction fluids such as , deionized water , splp or rgw . table xxii calculated distribution coefficient ( kd ) of untreated sample material modified using sw - 846 , method 1311 extraction method us - 10 us - 1 us - 1 modified total tclp tclp distribution activity fluid 2 fluid 2 coefficient ( k d ) analyte ( pci / g ) ( pci / l ) ( pci / ml ) ( ml / g ) pb - 210 179 173 0 . 173 1 , 034 . 7 bi - 211 4 , 212 3 , 360 3 . 360 1 , 253 . 6 bi - 214 1 , 321 910 0 . 910 1 , 373 . 6 fr - 223 3 , 919 3 , 768 3 . 768 1 , 040 . 1 ra - 223 1 , 574 1 , 514 1 . 514 1 , 039 . 6 ra - 224 2 , 463 1 , 772 1 . 772 1 , 390 . 0 ra - 226 1 , 800 1 , 294 1 . 294 1 , 391 . 0 ac - 227 188 243 0 . 243 773 . 7 th - 227 960 921 0 . 921 1 , 042 . 3 th - 228 17 , 110 16 , 490 16 . 490 1 , 037 . 6 pa - 231 1 , 857 1 , 764 1 . 764 1 , 052 . 7 u - 235 326 313 0 . 313 1 , 041 . 5 th - 234 nt 19 0 . 019 — [ 0159 ] table xxiii calculated distribution coefficient ( kd ) of tgpa treated sample material modified using sw - 846 , method 1311 extraction method us - 10 ts - 1 ts - 1 untreated 5 % tgpa 5 % tgpa modified material tclp tclp distribution total activity extract extract coefficient ( k d ) analyte ( pci / g ) ( pci / l ) ( pci / ml ) ( ml / g ) pb - 210 179 & lt ; 82 & lt ; 0 . 082 & gt ; 2 , 183 bi - 211 4 , 212 & lt ; 21 & lt ; 0 . 021 & gt ; 200 , 571 bi - 214 1 , 321 & lt ; 21 & lt ; 0 . 021 & gt ; 62 , 905 pb - 214 1 , 250 & lt ; 20 & lt ; 0 . 020 & gt ; 62 , 500 fr - 223 3 , 919 & lt ; 226 & lt ; 0 . 226 & gt ; 17 , 341 ra - 223 1 , 574 & lt ; 37 & lt ; 0 . 037 & gt ; 42 , 541 ra - 224 2 , 463 & lt ; 50 & lt ; 0 . 050 & gt ; 49 , 260 ra - 226 1 , 800 & lt ; 190 & lt ; 0 . 190 & gt ; 9 , 474 ac - 227 188 & lt ; 44 & lt ; 0 . 044 & gt ; 4 , 273 th - 227 960 & lt ; 56 & lt ; 0 . 056 & gt ; 17 , 143 th - 228 17 , 110 & lt ; 588 & lt ; 0 . 588 & gt ; 29 , 099 pa - 231 1 , 857 & lt ; 272 & lt ; 0 . 272 & gt ; 6 , 827 u - 235 326 & lt ; 104 & lt ; 0 . 104 & gt ; 3 , 135 th - 234 nt & lt ; 12 & lt ; 0 . 012 na tables xxii and xxiii show an increase of the sorption affinity of the radionuclides by the host material as a result of treatment with tgpa . further , the calculations in tables xxii and xxiii utilize the mda values for the equation denominator . the mda is based on numerous factors , including count times , background , detector efficiency , recovery , decay , and other variables . therefore , the k values for radionuclides in materials treated with tgpa are actually higher than what can be empirically determined when the nuclide presence in extract is & lt ; mda . although the present invention has been described in connection with preferred embodiments , it will be appreciated by those skilled in the art that additions , modifications , substitutions and deletions not specifically described may be made without departing from the spirit and scope of the invention defined in the appended claims .	2
while this invention is susceptible of embodiments in many different forms , there is shown in the drawings and will herein be described in detail preferred embodiments of the invention with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the broad aspects of the invention to the embodiments illustrated . the present invention is a stationary container system in which the material being contained is fluid . the fluid may be , for example , soil , dirt , gravel or other materials for growing and irrigating vegetation . referring to fig1 a cross - sectional side diagrammatic view of the container 1 on an unlevel load - bearing surface 2 according to the present invention is shown . the base of the container 1 is formed by an array of closely - packed columnar support cells 3 that are able to move freely vertically through guide holes 4 in a horizontal base frame 5 . each support cell 3 has a lower segment 6 of uniform cross - sectional area slightly less than the area of the guide hole and an upper segment 7 with a uniform cross - sectional area greater than that of the guide hole . the guide holes are spaced sufficiently apart so that the upper segment of one cell does not interfere with the upper segment of an adjacent cell . the base frame 5 is attached to a plurality of container walls 8 through the use of fasteners , clamps , or by means of a tapered tab captured in a groove with stops and possibly filled with spacers 9 . each container wall 8 has vertical sides and is attached to and supported by a vertical corner post 10 ( shown in fig3 ) through the use of fasteners , clamps , or by means of a tapered tab captured in a groove with stops . each corner post 10 is positioned vertically by means of a container leveling foot 11 that supports the corner post 10 as an unattached block of selected height or as a column partly contained within and attached to the corner post 10 through the use of set screws or a clamp . the container 1 might also have an auxiliary frame 12 positioned above the support cells 3 and attached to each wall 8 in a fashion similar to that of the base frame 5 . if the auxiliary frame 12 is attached to one of the walls 8 through a dovetail groove , it may be held in position by auxiliary frame stops 13 that are attached to each wall by fasteners , set screws or spacers 9 stacked between the frames . the auxiliary frame 12 can be , for example , a solid or perforated plate , a grid , a network of channels 14 , or a combination of any of these design characteristics . referring to fig2 a partial perspective view of the base frame 5 in another aspect of the present invention in which the container 1 is suspended so that no force is applied to the bottom of the support cells 3 is shown . specifically , the base frame 5 is shown with five inserted support cells 3 and four additional guide holes 4 without support cells present . the five support cells 3 are shown to be supported by the bottom of the wider upper segment 7 . referring to fig3 a top plan view of a form of the present invention in which the basic shape is square 15 and an auxiliary frame 12 is not present is shown . all of the support cells 3 are shown to be closely packed within the confines of the container walls 8 . the base frame is attached to each container wall 8 by tapered tabs 16 captured in dovetail grooves 17 within each container wall 8 and each wall similarly captured within each container corner post 10 . a container wall 8 can be provided with dovetail grooves 18 on both of the long sides so that base frames can be attached to either side of it and thus perform as a common container wall 8 for two containers 1 . likewise , a container corner post 10 might have attachment points 19 on all four vertical sides in order to perform as a common container corner post 10 for four containers . referring to fig4 a top plan view of another form of the present invention in which the basic shape is hexagonal 20 and an auxiliary frame is not present is shown . all of the hexagonal support cells 21 are shown to be closely packed within the confines of the container walls 22 . in the form of the invention shown in fig4 the base frame is attached to each container wall 22 by tabs 50 captured within grooves 23 located at different angles along the container wall 22 . each wall 22 is attached to each container corner post 52 by tapered tabs 54 captured in dovetail grooves within each container corner post 52 . a container wall 22 might have grooves 24 on both of the long sides so that base frames can be attached to either side of it and thus perform as a common container wall for two containers . likewise , a container corner post might have attachment points 25 on all six vertical sides in order to perform as a common container corner post for six containers . while the square and hexagonal top - view shapes represent the best mode geometries , other top - view shapes for the present invention may also include but are not limited to rectangular , triangular , octagonal , and circular shapes . referring to fig5 a and 5b , yet another form of the present invention in which a cross - sectional isometric view of an open support cell 26 is shown . the open support cell 26 maintains the same outside geometry as the support cell 3 shown in fig1 through 3 . the open support cell 26 lacks an enclosing top so that the top surface is defined by the edges of the support cell walls 27 . the open support cell 26 might also have small openings 28 through the bottom wall . the open support cell might also have small openings through one or more of the side walls . another form of the open support cell ( not shown ) is a solid cell with holes running through the cell . yet another form of the open support cell is similar to the support cell 3 shown in fig1 - 3 but constructed of a porous medium . the dimensions of the open support cell 26 are dictated by the structural and fluid control requirements of the application of the present invention . referring to fig6 yet another form of the present invention in which a cross - sectioned side diagrammatic view of an open support cell 29 with a rotating foot 31 is shown . the support cell 29 shown in fig6 is similar to the open support cell with the exception of the support cell bottom wall having a spherical concave contour 30 in order to fit closely over the spherical upper portion of the support cell foot 31 . the contour of the bottom wall of the support cell 30 might have spherical dimensions such that the spherical upper portion of the support cell foot 31 is captured within the socket . the support cell foot 31 has a circular bottom surface that is in contact with the unlevel load - bearing surface 2 and has a diameter slightly smaller than the width of the support cell . below the spherical section , the support cell foot 31 has conical or beveled sides that provide sufficient clearance below the support cell to allow a specified rotation angle ∝ around any horizontal axis . typically , the rotation angle ∝ is less than 45 degrees . another form of the rotating - foot support cell might be solid rather than of an open form . yet , another form of the rotating - foot support cell might have a bottom wall with a convex spherical contour that fits closely into a concave socket at the top of the support cell foot . yet another form of the rotating - foot support cell might have a foot that rotates about or within a cylinder rather than a sphere , limiting the freedom of rotation to a single horizontal axis . a foot with a cylindrical upper section might have a rectangular - shaped bottom surface . referring to fig7 yet another form of the present invention is shown in which a cross - sectional side diagrammatic view along a portion of a row of support cells of the present invention includes a support sleeve 32 positioned around a single support cell 26 . the support sleeve 32 fits closely around a support cell and is in contact with the base frame 5 while having no contact with the bottom of the support cell . as shown in fig7 the support sleeve 32 might also have openings 33 near or at the bottom to allow flow between the inside and the outside of the support sleeve 32 . the overall dimensions of the container 1 in all its forms are generally unlimited , however , those practiced in the art will appreciate that specific dimensions are dictated by a particular application . likewise , the maximum number of support cells 3 is generally unlimited but specifically limited by a particular application . the minimum number of support cells 3 is generally equal to the number of container walls 8 but , again , specifically limited by a particular application . the maximum total height of a support cell 3 is less than the container wall 8 height . the minimum height of the lower cell segment 6 is greater than the thickness of the base frame 5 while the minimum height of the upper cell segment 7 is sufficiently great enough to prevent the possibility of a vertical gap existing between two adjacent support cells 3 as dictated by a particular application , e . g . a surface with large protrusions . the dimensions of the base frame 5 are limited by the container 1 interior cross - section horizontally and the height of the container walls 8 vertically . the width of a corner post is generally equal to the thickness of a container wall in order to accommodate the creation of multiple containers with a common corner post . the dimensions of the auxiliary frame 12 are generally limited to the interior dimensions of the container 1 but are specifically dictated by the particular application . each of the components of the present invention can be constructed of a wide range of solid materials including but not limited to high density thermoplastics , thermoset composites , various metals , rigid porous media , or wood . those practiced in the art will appreciate that each of the components described can be formed through a variety of techniques including but not limited to injection molding , casting , or milling as dictated by the specific application . since the material within the container 1 is typically a static fluid , the loads applied to the interior surfaces of the container 1 are force vectors normal to the interior surfaces of the container walls 8 and support cells 3 . each force vector has a vertical component and a horizontal component but only the vertical component is equally opposed by the solid load - bearing surface 2 . referring to fig1 a force vector 34 applied to the vertical interior surface of a container wall 8 has a vertical force component equal to zero , thus the entire weight , or vertical force due to gravity 35 , of the fluid is applied to the support cells 3 . the advantages of the present invention are maximized when each of the support cells 3 in the container 1 has equal and opposite net vertical forces applied to it by the fluid and the solid load - bearing surface 2 exclusively . in this state , the weight of the fluid is transferred through the bottom of the container 1 at as many points as there are support cells 3 . it should be appreciated that applications might exist in which extreme unevenness of the load - bearing surface 2 prohibits one or more support cells 3 from being in contact with the load surface 2 , therefore , the system is considered optimized when the distances between the base frame 5 and the load - bearing surface 2 is such that a minimum number of support cells 3 have contact with the top horizontal surface of the base frame 5 and the base frame 5 has minimal or no contact with the load - bearing surface 2 . the distances between the base frame 5 and the load bearing surface 2 are established by the vertical adjustment of the container leveling feet . typically , the container is applied to load - bearing surfaces with a slope of less than 45 degrees . depending on the form that it takes and the manner in which it is applied , the auxiliary frame serves many functions . for example , one form of the auxiliary frame is a dense grid - like network of conduits 14 that provides horizontal support to the container walls 8 in addition to the base frame 5 , controls the displacement of material in the container 1 by limiting the flow or movement of material vertically at the surface , provides a solid surface for any additional loads applied to the top of the container 1 , and serves as a means to flow water or other liquids or gases into or out of the container 1 . another possible form of the auxiliary frame is a solid , rigid load - bearing plate that is allowed to float on the contained fluid and is of sufficient thickness at the tapered frame tab 16 to be held horizontal by the container walls 8 . referring to fig3 and 4 , a container wall might have grooves on both of the long sides so that base frames can be attached to either side of it and thus perform as a common container wall for two containers . likewise , a container corner post might have attachment points on all vertical sides in order to perform as a common container corner post for multiple containers . in this way , multiple containers might be assembled adjacently so that a large surface could be covered by an array of interconnected containers with less weight and cost than an array of individually constructed and installed containers . referring to fig5 a and 5b , the open support cell 26 lacks an enclosing top so that the top surface is defined by the edges of the support cell walls 27 , thus providing greater volume for the container 1 than the form of the present invention using a fully enclosed or solid support cell 3 . the open support cell 26 might also have small openings 28 in the bottom ( or sides ) to allow for drainage or other flow between the inside and outside of the container 1 . another form of the open support cell is a solid cell with holes running through the cell to allow flow between the inside and outside of the container 1 . referring to fig6 the rotating - foot support cell 29 typically allows three primary contact points between a single support cell and the load - bearing surface 2 . a support cell without a foot typically has only one or two primary contact points with the load - bearing surface 2 . referring to fig7 all of the load - bearing force 36 applied to the bottom of the support sleeve transfers directly to the base frame 5 . typically , the support cells in the vicinity of a support sleeve will rest on the base frame 5 so that the container load forces due to gravity in the vicinity of the sleeve - supported cell will translate to the load - bearing surface through the support sleeve 32 . support sleeves might be positioned over various support cells in order to allow the container load to be concentrated at specified points on the load - bearing surface for special applications such as when a container must be positioned over an especially large depression or a particularly weak area of a roof or balcony . while the present invention could be used as a container on any surface , the advantages of the invention are realized where the surface is uneven , sloped , or has limited load pressure capabilities . such surfaces on which the present invention might be beneficially applied include , but are not limited to building rooftops , balconies , terraces , sloped floors , unstable ground , or extremely uneven ground or rock . specific examples of applications of the present invention include vegetation containers located on building rooftops or balconies , storage containers for fluid material located on rooftops or sloped floors , containers filled with very low density granular fluid material and covered with a solid auxiliary frames to serve as platforms or walkways on rooftops or unstable ground , or containers for loose construction foundation material located on extremely uneven or unstable ground . it should be emphasized that the above - described embodiments of the present invention , particularly , any “ preferred ” embodiments , are merely possible examples of implementations , merely setting forth for a clear understanding of the principles of the invention . many variations and modifications may be made to the above - described embodiment ( s ) of the invention without substantially departing from the spirit and principles of the invention . all such modifications are intended to be included herein within the scope of this disclosure and the present invention and protected by the following claims .	4
fig1 illustrates a steering column arrangement 1 . the steering column arrangement 1 has a bracket 2 . the bracket 2 has a substantially rectangular cross - section . it has receptacles 3 for fastening devices . the bracket 2 is mounted via the fastening devices on a vehicle . furthermore , receptacles 4 are provided ( cf ., fig2 ) which serve to accommodate a further fastening element . the fastening element which is arranged in the receptacle 4 serves to fasten a sleeve 5 . furthermore , the bracket 2 has a slot 6 which extends over a large part of the length of the bracket 2 . the function of the slot 6 will be explained in greater detail in the following text . furthermore , the steering column arrangement 1 has a steering column 7 with a casing tube 8 and a steering column 9 which is mounted rotatably in the casing tube 8 . the steering column 9 serves for holding a steering wheel and for transmitting a rotational movement which is imparted to the steering wheel by a driver to a steering gear mechanism . in addition , lamella assemblies 11 are illustrated in fig1 which are arranged on both sides of the casing tube 8 and via which it is possible to fix the steering column in a defined position . the lamella assemblies 11 interact with a clamping apparatus 12 . fixing and releasing may be carried out by increasing and reducing the pressure which prevails between the lamellae 11 , and displacement or fixing of the steering column may thus be brought about . a bracket slide 13 is arranged below the bracket 2 . the bracket slide 13 is connected to the bracket 2 via fastening elements 14 and a sliding block 15 . the dimensions of the sliding block 15 are adapted to the dimensions of the slot 6 , and the sliding block 15 is arranged in the slot 6 . the sliding block 15 is connected to the bracket slide 13 via suitable fastening elements , such as screws 16 . as illustrated in fig2 , the clamping apparatus 12 is arranged on the bracket slide 13 . for this purpose , the bracket slide 13 has limbs 17 which are arranged at an angle to it . the limbs 17 have receptacles 18 , via which a connection may be produced between the bracket slide 13 and the clamping apparatus 12 . in the following text , a method of operation of the steering column arrangement 1 is explained in greater detail in conjunction with fig3 and 4 . if , in the case of a crash , a force a acts on the steering column arrangement 1 according to the arrow a , and the force a exceeds a predefined magnitude , the force a is transmitted into the bracket slide 13 via the steering spindle 9 , the casing tube 8 and the clamping apparatus 12 . the clamping apparatus 12 is designed such that it withstands a predefined magnitude of force , that is to say it holds the steering column 7 in its position despite this force . if the force a then exceeds a predefined magnitude , the fastening elements 14 are released between the bracket slide 13 and the bracket 2 , which results in a movement of the bracket slide 13 then becoming possible relative to the bracket 2 . the fastening elements 14 between the bracket slide 13 and the bracket 2 are explained in greater detail with reference to fig5 and 6 . the bracket slide 13 performs a defined , linear movement which is determined by the slot 6 , as a result of the interaction of the sliding block 15 which is connected to the bracket slide 13 and the slot 6 of the bracket 3 . accordingly , the steering column arrangement 1 provides two possibilities for displacing the steering column 7 in the vehicle . there is one possibility after release of the clamping apparatus 12 for the purpose of adjusting the steering column 7 for comfort . there is a further possibility after release of the fastening elements 14 in the case of a crash . as a result of two separate displacement or adjustment possibilities being provided , it is possible to set the resistances differently which have to be overcome during displacement of the steering column arrangement 1 . fig3 illustrates a bracket 2 with a bracket slide 13 , to be precise before the action of the force a on the steering column arrangement 1 . for clarity , an illustration of the steering column 7 which is connected to the bracket slide 13 and of the clamping apparatus 12 is omitted . however , both the fastening elements 14 between the bracket slide 13 and the bracket 2 and also the fastening elements 16 for the sliding block 15 are illustrated in fig3 . furthermore , the slot 6 in the bracket 2 is illustrated , the sliding block 15 being guided by the slot 6 . if , in the case of a crash , a force a acts on the steering column arrangement 1 and the latter acts on the bracket slide 13 via the steering spindle 9 , the casing tube 8 and the clamping apparatus 12 , the fastening elements 14 are released and allow a movement of the bracket slide 13 with respect to the bracket 2 . fig4 illustrates a bracket slide 13 after a movement of this type . the bracket slide 13 is displaced along the slot 6 in the direction of the introduction of force . fig5 diagrammatically illustrates a section through a bracket 2 and a bracket slide 13 at the level of a locking device . the locking device has the form of a sleeve 14 . the sleeve 14 is connected fixedly to the bracket 2 via a rivet 21 . a tear - off pin 22 is provided between the bracket slide 13 and the sleeve 14 . the tear - off pin is formed of plastic and , if a force which exceeds a predefined magnitude is applied to the bracket slide 13 , tears at the level of the dividing line 23 . fig6 is a cross - sectional view through the bracket slide 13 and the sleeve 14 at the level of a tear - off pin 22 . the tear - off pin 22 has a constriction 27 which extends radially around the circumference of the tear - off pin 22 . the constriction 27 has the effect that the tear - off pin 22 has a defined diameter d . the diameter d is independent of whether the diameter in the remaining region of the tear - off pin 22 changes during assembly . the constriction 27 is arranged at the level of the dividing plane 28 between the bracket slide 13 and the sleeve 14 . if the extent of the constriction 27 exceeds a certain amount , a further aspect results during the assembly of the tear - off pin 22 . the position of the tear - off pin 22 and its constriction 27 does not have to be set so precisely relative to the dividing plane 28 , as there are a plurality of possibilities to assume the position . it is also possible to provide the tear - off pin 22 with a longitudinal groove which may ensure that the air in the hole of the sleeve 14 may escape in a simple manner during assembly . fig7 illustrates a further exemplary embodiment of a sleeve 14 . a detail from a bracket slide 13 is illustrated . the bracket slide 13 has a receptacle 24 . the contour of the receptacle 24 is adapted to the contours of the sleeve 14 . the sleeve 14 has holding chambers 25 along its circumference . as illustrated in fig6 , the holding chambers 25 have a semicircular shape . the receptacle 24 has holding chambers 26 along its edge which faces the sleeve 14 . the holding chambers 25 of the sleeve and the holding chambers 26 of the receptacle are selected in terms of their size and their position such that they enclose a space which has a substantially round cross - section . furthermore , the dimensions of the sleeve and the receptacle are selected such that a gap 27 is produced between them . the gap 27 with the holding chambers 25 , 26 is filled with plastic . in the case of a collision and a force which acts on the bracket slide , the plastic tears in accordance with the tear - off pin 22 which is described with reference to fig5 , and releases the bracket slide 13 with respect to the bracket 2 .	1
in the following detailed description , reference is made to the accompanying drawings that show , by way of illustration , specific embodiments in which the invention may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention . it is to be understood that the various embodiments of the invention , although different , are not necessarily mutually exclusive . furthermore , a particular feature , structure , or characteristic described herein in connection with one embodiment may be implemented within other embodiments without departing from the scope of the invention . in addition , it is to be understood that the location or arrangement of individual elements within each disclosed embodiment may be modified without departing from the scope of the invention . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims , appropriately interpreted , along with the full range of equivalents to which the claims are entitled . in the drawings , like numerals refer to the same or similar functionality throughout the several views . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . likewise , the terms “ embodiment ( s ) of the invention ”, “ alternative embodiment ( s )”, and “ exemplary embodiment ( s )” do not require that all embodiments of the method , system , and apparatus include the discussed feature , advantage or mode of operation . the following description of the preferred embodiment is merely exemplary in nature and is in no way intended to limit the invention , its application , or use . the terms “ vacuum attachment system ”, “ vacuum attachment ”, and “ attachment ” may be used interchangeably herein to refer to the present invention . although the following description and claims may refer to components of the system in the singular , such as a vacuum attachment , it is understood that the references may also include components of the system in the multiple . several preferred embodiments of the vacuum attachment system are discussed in this section . however , the invention is not limited to these embodiments . a vacuum attachment system is any combination of vacuum attachments that are used to remove debris . the system is not limited in method of removal , dimensions of attachments , types of vacuums that may be used with the attachments , or size of suction tubes to which the attachments are attached . referring now to fig1 , there is shown a block diagram of an exemplary method for using a vacuum attachment system as according to one embodiment of the present invention . a user of the system may evaluate ( 101 ) the cleanup job by assessing the location and nature of the debris to be removed . after evaluating ( 101 ) the cleanup job , the user may select an appropriate attachment ( 102 ) from the available attachments to use for removing the debris . the user may then secure the vacuum attachment ( 103 ) to a vacuum tube or hose that is , in turn , attached to a vacuum device . after securing the attachment ( 103 ), the user may activate the vacuum device ( 104 ) in order to create a suction force through the vacuum attachment . with the vacuum activated ( 104 ), the user may begin removing debris ( 105 ) by placing the vacuum attachment in sufficiently close proximity as to allow the suction force to transport the debris through the vacuum attachment into the vacuum device . once the cleanup job is done , the user may de - activate the vacuum device ( 106 ) by turning off or unplugging the device . after the device de - activated ( 106 ), the user may remove the attachment ( 107 ) from the suction tube or hose , or may re - evaluate ( 101 ) the same or another area that needs to be cleaned . if the same or another area requires cleaning , the user may repeat steps 101 - 107 for as many times as necessary . once there are no more areas requiring cleaning , the cleanup procedure ends ( 108 ). referring now to fig2 , there is shown a side view of the tip of an exemplary vacuum attachment ( 200 ) as according to one embodiment of the present invention . the vacuum attachment ( 200 ) has an open receptacle area for receiving a vacuum tube or hose ( 201 ). the attachment may be tapered ( 203 ) so as to increase the force of suction created by a vacuum device . the vacuum attachment ( 200 ) may have a release mechanism ( 206 ) that can be lifted to disengage a removable scraping blade ( 202 ). the removable scraping blade ( 202 ) can be used to scrape stuck - on debris off of a surface that requires cleaning . the removable scraping blade ( 202 ) may be made of metal or plastic . a plastic removable scraping blade ( 202 ) may be used to avoid scratching floors , countertops , or other soft materials from which debris must be removed . debris may be sucked into the vacuum attachment ( 200 ) through a suction opening ( 204 ) and transported to the vacuum device . referring now to fig3 a and 3b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 300 ) with an integrated scraping blade ( 303 ) as according to one embodiment of the present invention . the integrated scraping blade ( 303 ) may be made of metal or plastic . a plastic integrated scraping blade ( 303 ) may be used to avoid scratching floors , countertops , or other soft materials from which debris must be removed . the vacuum attachment tip ( 300 ) may have a release mechanism ( 302 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades ( 303 ). the attachment ( 300 ) may have an opening ( 304 ) through which debris are removed by suction force . a user may hold the attachment ( 300 ) by gripping the attachment body ( 301 ). referring now to fig4 a and 4b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 400 ) with a separable scraping blade ( 405 ) as according to one embodiment of the present invention . the separable scraping blade ( 405 ) may have a sharpened edge ( 403 ) for cutting through stuck - on debris . the separable scraping blade ( 405 ) may be made of metal or plastic . a plastic separable scraping blade ( 405 ) may be used to avoid scratching floors , countertops , or other soft materials from which debris must be removed . the tip of the vacuum attachment ( 400 ) may have an opening ( 401 ) through which debris are removed by suction force . a release mechanism ( 404 ) may be used to release the separable scraping blade ( 405 ). referring now to fig5 a and 5b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 500 ) with a serrated scraping edge ( 503 ) as according to one embodiment of the present invention . the tip of the vacuum attachment ( 600 ) may have an integrated or removable serrated scraping edge ( 503 ) for loosening stuck - on debris . the serrated scraping blade ( 503 ) may be made of metal or plastic . a plastic serrated scraping blade ( 503 ) may be used to avoid scratching floors , countertops , or other soft materials from which debris must be removed . the tip of the vacuum attachment ( 500 ) may have a release mechanism ( 502 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades . the attachment tip ( 500 ) may have an opening ( 504 ) through which debris are removed by suction force . a user may hold the attachment tip ( 500 ) by gripping the attachment body ( 501 ). referring now to fig6 a and 6b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 600 ) with corner scraping edges ( 605 ) as according to one embodiment of the present invention . the tip of the vacuum attachment ( 600 ) may have an integrated or removable scraping blade ( 602 ) for loosening stuck - on debris . the tip of the vacuum attachment ( 600 ) may have a release mechanism ( 604 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades ( 602 ). the attachment tip ( 600 ) may have an opening ( 603 ) through which debris are removed by suction force . a user may hold the attachment tip ( 600 ) by gripping the attachment body ( 606 ). referring now to fig7 a and 7b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 700 ) with a curved suction nozzle ( 701 ) as according to one embodiment of the present invention . the tip of the vacuum attachment ( 700 ) may have an integrated or removable scraping blade ( 702 ) for loosening stuck - on debris . the tip of the vacuum attachment ( 700 ) may have a release mechanism ( 704 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades . the attachment tip ( 700 ) may have an opening ( 705 ) through which debris are removed by suction force . a user may hold the attachment tip ( 700 ) by gripping the attachment body ( 703 ). referring now to fig8 a and 8b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 800 ) with a right - angle suction nozzle as according to one embodiment of the present invention . the tip of the vacuum attachment ( 800 ) may have an integrated or removable scraping blade ( 801 ) for loosening stuck - on debris . the tip of the vacuum attachment ( 800 ) may have a release mechanism ( 804 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades . the attachment tip ( 800 ) may have an opening ( 803 ) through which debris are removed by suction force . a user may hold the attachment tip ( 800 ) by gripping the attachment body ( 802 ). referring now to fig9 a and 9b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 900 ) with a fanned suction nozzle as according to one embodiment of the present invention . the tip of the vacuum attachment ( 900 ) may have an integrated or removable scraping blade ( 901 ) for loosening stuck - on debris . the tip of the vacuum attachment ( 900 ) may have a release mechanism ( 904 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades . the attachment tip ( 900 ) may have an opening ( 903 ) through which debris are removed by suction force . the tip of the vacuum attachment ( 900 ) may have side walls ( 905 ) for guiding debris into the opening ( 903 ) through which debris are removed . a user may hold the attachment tip ( 900 ) by gripping the attachment body ( 902 ). referring now to fig1 a and 10b that will be discussed together , there is shown the tip of an exemplary vacuum attachment ( 1000 ) with scraping holes ( 1002 ) as according to one embodiment of the present invention . the scraping holes ( 1002 ) may be used by rubbing the tip of the vacuum attachment ( 1000 ) against stuck - on debris in a grating manner to loosen and remove the debris . the tip of the vacuum attachment ( 1000 ) may have an integrated or removable scraping blade ( 1001 ) for loosening stuck - on debris . the tip of the vacuum attachment ( 1000 ) may have a release mechanism ( 1004 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades . the attachment tip ( 1000 ) may have an opening ( 1005 ) through which debris are removed by suction force . a user may hold the attachment tip ( 1000 ) by gripping the attachment body ( 1003 ). referring now to fig1 a and 1 lb that will be discussed together , there is shown the tip of an exemplary corner vacuum attachment ( 1100 ) with scraping holes ( 1102 ) as according to one embodiment of the present invention . the scraping holes ( 1102 ) may be used by rubbing the tip of the vacuum attachment ( 1100 ) against stuck - on debris in a grating manner to loosen and remove the debris . the tip of the vacuum attachment ( 1100 ) may have a housing ( 1101 ) angled in such a way as to allow for easy cleaning of corners or areas where building surfaces meet . the tip of the vacuum attachment ( 1100 ) may have a release mechanism ( 1104 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades . a user may hold the attachment tip ( 1100 ) by gripping the attachment body ( 1103 ). referring now to fig1 , there is shown an exemplary vacuum attachment ( 1200 ) with a widened suction nozzle as according to one embodiment of the present invention . the vacuum attachment ( 1200 ) may have an integrated or removable scraping blade ( 1201 ) for loosening stuck - on debris . the vacuum attachment ( 1200 ) may have a collar ( 1204 ) for attaching the vacuum attachment ( 1200 ) to a suction tube or hose . the vacuum attachment ( 1200 ) may have an opening ( 1203 ) through which debris are removed by suction force . a user may hold the attachment ( 1200 ) by gripping the attachment body ( 1202 ). referring now to fig1 , there is shown a side view of the tip of an exemplary vacuum attachment ( 1300 ) with a permanent scraping blade ( 1302 ) as according to one embodiment of the present invention . the tip of the vacuum attachment ( 1300 ) may have an open receptacle area for receiving a vacuum tube or hose ( 1301 ). the attachment may be tapered ( 1303 ) so as to increase the force of suction created by a vacuum device . the permanent scraping blade ( 1302 ) can be used to scrape stuck - on debris off of a surface that requires cleaning debris may be sucked into the vacuum attachment ( 1300 ) through a suction opening ( 1304 ) and transported to the vacuum device . referring now to fig1 , there is shown a side view of an exemplary vacuum attachment ( 1400 ) with curved sections ( 1403 ) as according to one embodiment of the present invention . the vacuum attachment ( 1400 ) may have curved sections ( 1403 ) so that the vacuum attachment may access difficult - to - reach debris . debris may be sucked into the vacuum attachment ( 1400 ) through a suction opening ( 1401 ) and transported to the vacuum device . a user may hold the attachment ( 1400 ) by gripping the body of the attachment ( 1402 ). the vacuum attachment ( 1400 ) may have an integrated or removable scraping blade ( 1405 ) for loosening stuck - on debris . the vacuum attachment ( 1400 ) may have a collar ( 1404 ) for attaching the vacuum attachment ( 1400 ) to a suction tube or hose . the exact size , shape , and dimensions of the vacuum attachment ( 1400 ) may be variable in order to meet the requirements of different cleaning applications . furthermore , the curved sections ( 1403 ) of the vacuum attachment ( 1400 ) may be curved to variable degrees of curvature in order to meet the requirements of different cleaning applications . referring now to fig1 a and 15b that will be discussed together , there is shown the tip of an exemplary corner vacuum attachment ( 1500 ) with a scraping blade ( 1501 ) as according to one embodiment of the present invention . the scraping blade ( 1501 ) may be used by rubbing the scraping blade ( 1501 ) against stuck - on debris to loosen and remove the debris . debris may be transported to a suction device by suction force through an opening ( 1504 ) in the tip of the vacuum attachment ( 1500 ). the tip of the vacuum attachment ( 1500 ) may have a housing ( 1502 ) angled in such a way as to allow for easy cleaning of corners or areas where building surfaces meet . the tip of the vacuum attachment ( 1500 ) may have a release mechanism ( 1503 ) for releasing detachable blades , even though detachable blades may not be used with attachments possessing integrated blades . a user may hold the attachment tip ( 1500 ) by gripping the attachment body ( 1502 ). referring now to fig1 there is a cross - sectional view of a vacuum attachment ( 1600 ) with a tapered section as according to one embodiment of the present invention . the vacuum attachment ( 1600 ) may have tube section ( 1601 ) with an outer wall ( 1602 ) that tapers down to accommodate vacuum tubes or hoses with a smaller diameter . debris may be transported through the vacuum attachment ( 1600 ) by travelling in a reduced - diameter opening ( 1603 ) within the vacuum attachment ( 1600 ). referring now to fig1 there is a cross - sectional view of a vacuum attachment ( 1700 ) with a tapered section as according to one embodiment of the present invention . the vacuum attachment ( 1700 ) may have tube section ( 1701 ) with an outer wall ( 1702 ) that tapers down to accommodate vacuum tubes or hoses with a smaller diameter . debris may be transported through the vacuum attachment ( 1700 ) by travelling in a reduced - diameter opening ( 1703 ) within the vacuum attachment ( 1700 ). referring now to fig1 , there is shown an exemplary vacuum attachment ( 1800 ) with a narrowed suction nozzle ( 1802 ) as according to one embodiment of the present invention . the narrowed suction nozzle ( 1802 ) may allow the user to reach debris that are in confined spaces otherwise not accessible with wider or larger vacuum attachments . the vacuum attachment ( 1800 ) may have an integrated or removable scraping blade ( 1805 ) for loosening stuck - on debris . the vacuum attachment ( 1800 ) may have a collar ( 1804 ) for attaching the vacuum attachment ( 1800 ) to a suction tube or hose . the vacuum attachment ( 1800 ) may have an opening ( 1801 ) through which debris are removed by suction force . a user may hold the vacuum attachment ( 1800 ) by gripping the attachment body ( 1802 ). some of the attached figures depict either a vacuum system attachment , or the tip of the vacuum system attachment . for those figures that depict only the tip of the vacuum system attachment , the figures are not intended to limit the scope of the invention to the depicted tip . it is implied that the figures depicting a tip of a vacuum attachment are merely showing a portion of a complete vacuum system attachment in an effort to clarify the nature of the invention . it is assumed that the tips of the vacuum attachments are integral parts of an entire vacuum system attachment and are operable to be used with the present invention . the vacuum system attachments of the present invention may have features that , while depicted in only some of the attached images , may be found in some or all of the vacuum system attachments . these features may include a collar for attaching a vacuum system attachment to a suction tube or hose . a suction tube or hose may be physically mated to the vacuum system attachment by inserting the tube or hose into the collar section of the attachment . the features may further include a taper for accommodating smaller vacuum tubes or hoses . the taper portion of a vacuum attachment may provide an airway for transporting debris to a suction device that has a reduced internal diameter . the smaller vacuum tubes or hoses may attach to the vacuum system attachment by mating directly to the reduced diameter tapered portion . however , the present invention may be implemented without the use of the aforementioned collar or taper sections . certain configurations of vacuum system attachments have been shown with specific types of blades or tips . by way of example , fig7 a and 7b show a curved vacuum system attachment with an integrated or removable blade while fig5 a and 5b show a vacuum attachment tip with a serrated scraping blade . the figures are not intended to limit the types of blades used on each attachment . namely , each vacuum system attachment may use any of the blades described herein or shown in the accompanying images . each vacuum system attachment may use a scraping blade , a serrated blade , a thick blade , a thin blade , a razor blade , a corner - scraping blade , an inverted blade , a blade that is fanned , a narrowed blade , a flat blade with scraping holes , a corner - scraping blade with holes , or any other blade mentioned herein . furthermore , each blade used by the vacuum system attachment may be removable or permanently attached . the blades may also be made of plastic , metal , or any other material as is appropriate . although certain example methods , apparatus and articles of manufacture have been described herein , the scope of coverage of this patent is not limited thereto . on the contrary , this patent covers all methods , apparatus and articles of manufacture fairly falling within the scope of the appended claims either literally or under the doctrine of equivalents .	1
the active ingredient used in the present invention is erythropoietin and its derivatives having the biological properties of causing bone marrow cells to increase production of reticulocytes and red blood cells . the epo formulations of the present invention are useful as a parenteral formulation in treating blood disorders characterized by low or defective red blood cell production such as various forms of anemia , including anemia associated with chronic renal failure , zidovidine treated hiv infected patients , and cancer patients on chemotherapy . it may also have application in the treatment of a variety of disease states , disorders and states of hematologic irregularity such as sickle cell disease , beta - thalassemia , cystic fibrosis , pregnancy and menstrual disorders , early anemia of prematurity , spinal cord injury , space flight , acute blood loss , aging and the like . it may also have application in situations where an increase in red blood cells is desired such as in pre - surgery patients . preferably , the epo composition of the present invention is administered parenterally ( e . g . iv , im , sc or ip ). effective dosages are expected to vary considerably depending on the condition being treated and the route of administration but are expected to be in the range of 0 . 1 (˜ 7 u ) to 100 (˜ 7000 u ) μg / kg body weight of the active material . preferable doses for treatment of anemic conditions are about 50 to about 300 units / kg three times a week . the non - antigenic water - soluble polymers in the conjugates include polyalkylene oxides , polyvinyl pyrrolidone , homo - polyamino acids , hetero - polyamino acids , polyamides and carbohydrates . within this group of substances are alpha - substituted polyalkylene oxide derivatives such as polypropylene glycol or other suitable alkyl - substituted derivatives such as c 1 - c 6 groups . non - antigenic polymer peg homopolymer are suitable . alternative polyalkylene oxides such as other polyethylene glycol homopolymers , polypropylene glycol homopolymers , other alkyl - polyethylene oxides , bis - polyethylene oxides and co - polymers or blocked co - polymers of polyalkylene oxides are also useful . the polymers may be either linear or branched . the polymers must contain a functionality that can be covalently attached to epo , a chemically enzymatically modified epo or similar erythropoietic moiety . they must contain additional functionality that can be used to attach one or more organic moieties having properties that increase the in vivo half - life of the resulting construct . attachment of the functionalized , water - soluble polymer can be by non - site specific means , under conditions that do not adversely affect the activity of epo , although site - specific attachment is preferred . examples of methods of attachment include , but are not limited to : 1 . glyoxyl modification of the n - terminal amino group followed by reductive alkylation with an amine , hydrazine , oxime , semicarbazide or other appropriate nucleophile . 2 . periodic acid oxidation of one or more carbohydrates on epo followed by reductive alkylation with an amine , hydrazine , oxime , semicarbazide or other appropriate nucleophile . 3 . reverse proteolysis to attach an organic moiety containing a nucleophile to the c - or n - terminal of epo , followed by reductive alkylation or reaction with a suitable electrophile . 4 . production of epo containing one or more additional cysteines , followed by its reaction with a suitable maleimide to form a thioether or activated thiol to form a disulfide , or halo compound to form a thioether . 5 . reaction of an active ester with amino groups on epo either nonspecifically or site - specifically using ph , steric , stochiometric or kinetic control . further examples of the types of chemistry that may be employed are found in techniques in protein modification by roger l . lundblad , crc press , 1995 . a specific example of n - terminal derivatization of epo with an unfunctionalized peg is taught by wei , et al ., u . s . pat . no . 6 , 077 , 939 , jun . 20 , 2000 . in those aspects of the invention in which peg - based polymers are used , it is preferred that they have average molecular weights between about 200 and about 100 , 000 daltons , and preferably between about 2 , 000 and about 20 , 000 daltons . a molecular weight of 2 , 000 to 5 , 000 daltons is most preferred . alternative non - antigenic polymeric substances include materials such as dextrans , polyvinyl pyrrolidones , polysaccaharides , starches , polyvinyl alcohols , polyacrylamides or other similar non - immunogenic polymers . those of ordinary skill in the art realize that the foregoing is merely illustrative and unintended to restrict the type of non - antigenic polymers suitable for use herein . the functionalized polymers can be homo or heterobifunctional . thus , the artisan can prepare cross - linked epo conjugates or three - part conjugates containing epo , a functionalized polymer and an additional substance that enhances bioactivity . such substances include interleukins such as il - 3 or il - 6 , growth factors , stimulating factors such as csf , gm - csf , and the like , or peptides or other moieties known in the art to enhance the activity of glycopolypeptides in vivo . the organic moieties that can be attached to the hydrophilic polymer to increase the half - life include fatty acids , dicarboxylic acids , monoesters or monoamides of dicarboxylic acids , lipids containing saturated fatty acids , lipids containing unsaturated fatty acids , lipids containing mixtures of saturated and unsaturated fatty acids , simple carbohydrates , complex carbohydrates , carbocycles ( such as steroids ), heterocycles ( such as alkaloids ), amino acid chains , proteins , enzymes , enzyme cofactors , or vitamins . in one embodiment , the hydrophilic polymeric group is substituted with one to about six alkyl , fatty acid , fatty acid ester , lipid or phospholipid groups ( as described herein , e . g ., formulas i and ii ). preferably , the substituted hydrophilic polymeric group is a linear or branched peg . preferably , the substituted hydrophilic polymeric group is a linear peg ( e . g ., peg diamine ) that is terminally substituted with a fatty acid , fatty acid ester , lipid or phospholipid group . hydrophilic polymers that are substituted with an alkyl , fatty acid , fatty acid ester , lipid or phospholipid groups group can be prepared using suitable methods . for example , a modifying agent can be prepared by reacting monoprotected peg diamine with an activated fatty acid ( e . g ., palmitoyl chloride ). the resulting product can be deprotected , a suitable activating group can be introduced ( e . g . maleimido ), and the resulting modifying agent can be used to produce a modified epo that comprises a peg that is terminally substituted with a fatty acid group . a variety of other suitable synthetic schemes can be used . for example , a polymer comprising an amine group can be coupled to a carboxylate of the fatty acid or fatty acid ester as described herein , and an activated carboxylate ( e . g . activated with n , n ′- carbonyl diimidazole ) on a fatty acid or fatty acid ester can be coupled to an hydroxyl group on a polymer . fatty acids and fatty acid esters suitable for modifying epo of the invention can be saturated or can contain one or more units of unsaturation . in a preferred embodiment , the fatty acids and fatty acid esters comprise from about six to about forty carbon atoms or about eight to about forty carbon atoms . fatty acids which are suitable for modifying antibodies of the invention includes , for example , n - dodecanoate ( c 12 , laurate ), n - tetradecanoate ( c 14 , myristate ), n - hexadecanoate ( c 16 , palmitate ), n - octadecanoate ( c 18 , stearate ), n - eicosanoate ( c 20 , arachidate ), n - docosanoate ( c 22 , behenate ), n - triacontanoate ( c 30 ), n - tetracontanoate ( c 40 ), cis - δ 9 - octadecanoate ( c 18 , oleate ), all cis δ 5 . 8 , 11 , 14 - eicosatetraenoate ( c 20 , arachidonate ), octanedioic acid , tetradecanedioic acid , octadecandeioic acid , docosanedioic acid , and the like . suitable fatty acid esters include monoesters of dicarboxylic acids which comprise a linear or branched lower alkyl group . the lower alkyl group can comprise from one to above twelve , preferably one to about six , carbon atoms . suitable fatty acid esters for modifying antibodies of the invention include , for example , methyl octadecanoate , ethyl octadecanoate , propyl octadecanoate , butyl dodecanoate , sec - butyl dodecanoate , tert - butyl dodecanoate , neopentyl tetradecanoate , hexyl tetradecanoate , methyl cis - δ 9 - octadecanoate , and the like . the modification of epo as described herein below is preferably performed using one or more modifying agents . a “ modifying agent ” as the term is used herein , refers to the hydrophilic polymer , and organic molecule conjugate complex which comprises an activating group . an “ activating group ” is a chemical moiety or functional group that can , under appropriate conditions , react with a second chemical group thereby forming a covalent bond between the modifying agent and a chemical group on the epo molecule . for example , amine - reactive activating groups include electrophilic groups such as tosylate , mesylate , halo ( chloro , bromo , iodo ), n - hydroxysuccinimidyl esters ( nhs ), substituted phenyl esters , acyl halides and the like . activating groups which can react with thiols include , for example , maleimide , iodoacetyl , acrylolyl , pyridyl disulfides , 5 - thiol - 2 - nitrobenzoic acid thiol ( tnb - thiol ), and the like . an aldehyde or ketone functional group can be coupled to amine - or hydrazide containing molecules and an azide group can react with a trivalent phosphorous group to form phosphoramidate or phosphorimide linkages . suitable methods to introduce activating groups into molecules are known in the art ( see for example , hermanson , g . t ., bioconjugate techniques , academic press : san diego , calif . ( 1996 ). an activating group can be bonded directly to the hydrophilic polymer , conjugate complex or through a linker moiety , for example a c 1 - c 12 hydrocarbyl group . as used herein , “ hydrocarbyl group ” refers to a hydrocarbon chain wherein one or more carbon atoms are optionally replaced by a heteroatom such as oxygen , nitrogen or sulfur . suitable linker moieties include , for example , tetraethylene glycol , —( ch 2 ) 3 —, — nh —( ch 2 ) 6 — nh —, —( ch 2 ) 2 — nh — and — ch 2 — o — ch 2 — ch 2 — o — ch 2 — ch 2 o — ch — nh —. modifying agents which comprise a linker moiety can be produced , for example , by reacting a mono - boc - alkyldiamine ( e . g . mono - boc - ethylenediamine , mono - boc - diaminohexane ) with a fatty acid in the presence of 1 - ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide ( edc ) to form an amide bond between the free amine and the fatty acid carboxylate . the boc protecting group can be removed from the product by treatment with trifluoracetic acid ( tfa ) to expose a primary amine which can be coupled to another carboxylate as described , or can be reacted with maleic anhydride and the resulting product cyclized to produce an activated maleimido derivative of the fatty acid . ( see , for example , thompson , et al ., wo 92 / 16221 the entire teachings of which are incorporated herein by reference ). the modified epo of the invention can be produced by reacting the epo or epo derivation molecule with a modifying agent , as described herein . in one embodiment , the modified epo can be bound in a non - site specific manner by employing an amine - reactive modifying agent , for example , an nhs ester of a modified peg . in another embodiment , the modified epo can be bound in a site - specific manner by employing ph control to limit reactivity with an nhs ester of a modified peg to the alpha amino group of the first amino acid . thus , in one embodiment , the modified epo can be produced by reacting epo with one or more modifying agents to produce a modified epo comprising one to about 8 organic moieties which are bonded to specific sites on the epo molecule , for example a synthetically introduced ( i . e ., one more ) cysteinyl residue . in particularly preferred embodiments , the modified epo can comprise one or two linear peg moieties of greater than 2 , 000 daltons which are bonded to specific sites ( e . g ., one or more synthetically introduced cysteinyl residue ) followed by reaction with a suitable maleimide to form a thioether or activated thiol to form a disulfide or a halo compound to form a thioether . for example , the modified epo can be reacted with a thiol - reactive modifying agent , for example , o -( 2 - maleimidoethyl )- o ′- steroyl - polyethylene glycol 5 , 000 to produce the modified epo of the invention . in another example , the modified epo is produced by reverse proteolysis to attach an organic moiety containing a nucleophile to the carboxyl or amino terminal epo followed by reductive alkylation or reaction with a suitable electrophile . one method for preparing a modified erythropoietin is to introduce a unique functionality at the carboxyl or amino terminus of the epo molecule through reverse proteolysis . “ reverse proteolysis ” is a term of the art which refers to the fact that under particular conditions certain proteases can catalyze the formation of amide or ester bonds . for example , a purified epo can be mixed with a protease and carbohydrazide under conditions suitable for reverse proteolysis ( e . g ., 250 - fold molar excess of the carbohydrazide relative to the epo ), to produce an epo molecule comprising a unique hydrazide function at the carboxyl terminus . the hydrazide - containing epo can be modified by reaction with a suitable modifying agent . for example , the epo derivative can be reacted with a modifying agent comprising a carbonyl functional group to produce a modified epo comprising an organic moiety that is specifically attached to the carboxyl terminus through a hydrazone - linkage . the hydrazone can be further stabilized by reaction with a suitable reducing agent ( e . g . sodium cyanoborohydride ). various enzymes can be used to introduce a hydrazide function by reverse proteolysis . the conditions for reverse proteolysis are known to those skilled in the art and include a large ( e . g ., 250 - fold ) molar excess of carbohydrazide and an extended reaction time . additionally , the reverse proteolysis reaction may preferentially occur at a ph different from the optimal ph for proteolysis ( fisch et al ., bioconjugate chem ., 3 : 147 - 153 ( 1992 ); werlen et al ., bioconjugate chem ., 5 : 411 - 417 ( 1994 ); kumaran et al ., protein sci . 6 ( 10 ): 2233 - 2241 ( 1997 ); itoh et al ., bioorg . chem ., 24 ( 1 ): 59 - 68 ( 1996 ); capellas et al ., biotechnol . bioeng ., 56 ( 4 ): 456 - 463 ( 1997 ). the optimal ph for reverse proteolysis can be determined empirically using standard methods . a preferred enzyme for carboxyl terminus modification is achromopeptidase . some examples of compounds are shown below . although dspe is used as the lipid in some of these examples , other lipids and phospholipids are included by analogy . molecular weights of peg are generally less than 30 , 000 and include linear , branched and star pegs . peg can also be replaced by other water - soluble polymers . examples of epo derivatives include dspe - peg - epo where the peg - dspe is joined to the n - terminus of epo and epo -( peg - dspe ) 2 where two peg - dspe groups are joined with a valency - enhancing construct to the derivatized n - termini of epo . higher multiples are included as well . valency enhancing construct are defined as a moiety containing at least three functional groups such that one functional group is used for attachment to an erythropoietic compound and the remaining functional groups are used for the attachment of two or more derivatized hydrophilic polymer constructs . the n terminal may be derivatized by glyoxyl modification . the glyoxyl group can be reacted with a hydrazine - derivatized hydrophilic polymer construct such as hydrazine - peg - dspe . m - peg - epo where the m - peg is attached non - specifically to lysine amino groups using a variety of different chemistries where m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . ( m - peg ) 2 - epo where the m - peg is attached to two amino groups using a variety of different chemistries where m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . higher multiples are included as well . ( m - peg ) 2 - epo where the ( m - peg ) 2 - r is attached to an amino group using a variety of different chemistries where m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein and r is a valency enhancing construct . higher multiples are included as well . m - peg - epo where the m - peg is attached to a cysteine in epo created by the addition of an amino acid , the mutation of an existing amino acid or the addition of a thiol to epo using a bifunctional agent and where m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . ( m - peg ) 2 - epo where the m - peg is attached to two cysteines in epo created by the addition of one or more amino acids , the mutation of existing amino acids , the addition of a thiol to epo using a bifunctional agent or a combination of these and m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . higher multiples are included as well . ( m - peg ) 2 - epo where the ( m - peg ) 2 - r is attached to a cysteine in epo created by the addition of an amino acid , the mutation of an existing amino acid or the addition of a thiol to epo using a bifunctional agent and m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein and r is a valency enhancing construct . higher multiples are included as well . m - peg - epo where the m - peg is attached by reductive alkylation to a carbonyl generated by the partial oxidation of a carbohydrate on epo or by the addition of a carbonyl function by derivatization and m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . ( m - peg ) 2 - epo where the m - peg is attached by reductive alkylation to two carbonyls generated by the partial oxidation of carbohydrates on epo or by the addition of carbonyl functions by derivatization or a combination of these . higher multiples are included as well . ( m - peg ) 2 - epo where the ( m - peg ) 2 - r is attached by reductive alkylation to two carbonyls generated by the partial oxidation of carbohydrates on epo or by the addition of carbonyl functions by derivatizion or a combination of these and m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein and r is a valency enhancing construct . higher multiples are included as well . m - peg - epo where the m - peg is attached to an arginine guanidino group using a variety of different chemistries . ( m - peg ) 2 - epo where the m - peg is attached to two arginine guanidino groups using a variety of different chemistries and m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . higher multiples are included as well . ( m - peg ) 2 - epo where the ( m - peg ) 2 - r is attached to an arginine guanidino group using a variety of different chemistries where m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein and r is a valency enhancing construct . higher multiples are included as well . m - peg - epo where the m - peg is attached by reductive alkylation to a hydrazine (— nh — nh 2 ) generated by reverse proteolysis on the n - or c - terminal amino acids of epo or by derivatization and m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . ( m - peg ) 2 - epo where the ( m - peg ) 2 - r is attached by reductive alkylation to two hydrazines (— nh — nh 2 ) generated by reverse proteolysis on the n - or c - terminal amino acids of epo or by derivatization where m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein . higher multiples are included as well . ( m - peg ) 2 - epo where the ( m - peg ) 2 - r is attached by reductive alkylation to a hydrazine (— nh — nh 2 ) generated by reverse proteolysis on the n - or c - terminal amino acids of epo or by derivatization where m is a lipid , carbohydrate , polysaccharide , fatty acid , fatty acid derivative , fatty alcohol or protein and r is a valency enhancing construct . higher multiples are included as well . the erythropoietin glycoprotein products prepared in accordance with this invention may be prepared in pharmaceutical compositions suitable for injection with a pharmaceutically acceptable carrier or vehicle by methods known in the art . for example , appropriate compositions have been described in wo97 / 09996 , wo97 / 40850 , wo98 / 58660 , and wo99 / 07401 . among the preferred pharmaceutically acceptable carriers for formulating the products of the invention are human serum albumin , human plasma proteins , etc . the compounds of the present invention may be formulated in 10 mm sodium / potassium phosphate buffer at ph 7 containing a tonicity agent , e . g . 132 mm sodium chloride . optionally the pharmaceutical composition may contain a preservative . the pharmaceutical composition may contain different amounts of erythropoietin products , e . g . 10 - 2000 μg / ml , e . g . 50 μg or 400 μg . the stability of the composition can be further enhanced by the addition of antioxidants such as tocopherol , butylated hydroxytoluene , butylated hydroxyanisole , ascorbyl palmitate , or edetates such as e . g . disodium edetate , with the edetates additionally binding possibly present heavy metals . the stability can furthermore be enhanced by the addition of preserving agents such as benzoic acid and parabens , e . g . methylparaben , and / or propylparabene . treating blood disorders characterized by low or defective red blood cell production administration of the erythropoietin glycoprotein products of the present invention results in red blood cell formation in humans . therefore , administration of the erythropoietin glycoprotein products replenishes this epo protein which is important in the production of red blood cells . the pharmaceutical compositions containing the erythropoietin glycoprotein products may be formulated at a strength effective for administration by various means to a human patient experiencing blood disorders characterized by low or defective red blood cell production , either alone or as part condition or disease . the pharmaceutical compositions may be administered by injection such as by subcutaneous , intravenous or intramuscular injection . average quantities of the erythropoietin glycoprotein product may vary and in particular should be based upon the recommendations and prescription of a qualified physician . the exact amount of conjugate is a matter of preference subject to such factors as the exact type of condition being treated , the condition of the patient being treated , as well as the other ingredients in the composition . for example , 0 . 01 to 10 g per kg body weight , preferably 0 . 1 to 10 μg per kg body weight , may be administered e . g . once weekly . throughout this application , various publications have been referenced . the disclosures in these publications are incorporated herein by reference in order to describe more fully the state of the art . the present invention is further illustrated by the following examples that are presented for purposes of demonstrating , but not limiting , the preparation of the compounds and compositions of this invention . 420 μg erythropoietin in 300 μl pbs ( ph 7 . 4 ) is diluted to 900 μl with pbs buffer ( ph 6 . 8 ). 25 μl of this solution is removed for later analysis by sds - page . 2 . 0 mg of ( peg - dspe ) 3 . 4k - nhs is dissolved in 2 ml of absolute ethanol and stirred for 30 minutes . 93 μl of the peg - dspe 3 . 4k - nhs solution is added to 875 μl of the epo solution . similar aliquots are added at 40 and 60 minutes into the reaction . the reaction is stirred at ambient temperature for 3 hours . a solution of tris is added to quench any unreacted reagent . the reaction mixture is loaded onto a zorbax gf - 250 semi - prep column and eluted with pbs and peaks are collected to give 120 μg of epo . mass spectral analysis indicated the molecular weight of the product to be 31 , 654 . 44 ( calcd . 31 , 501 ). sds page indicated that the major band was ≧ 99 %. tryptic mapping indicated that the dspe - peg was attached to the alpha amino group of amino acid 1 . erythropoietin is dissolved in pbs ( ph 7 . 4 ). to this solution is added a 50 % molar excess of ( dspe - linoleate ) 3 . 4k - nhs dissolved in absolute ethanol . the reaction is stirred at ambient temperature for 3 hours . an aqueous solution of tris ( ph 9 . 5 ) is added and the resulting solution stirred for 30 minutes at ambient temperature to quench any unreacted reagent . the reaction mixture is concentrated using a centrifugal concentrator with a membrane cutoff of 5 kd . the concentrated solution is loaded onto a zorbax gf - 250 semi - prep column and eluted with pbs . peaks are collected and analyzed by sds page and mass spectrometry . the peak corresponding to epo -( peg - linoleate ) 3 . 4k is collected and concentrated using a centrifugal concentrator with a membrane cutoff of 5 kd . lysyl glycine t - butyl - ester is dissolved in dmf . to this is added a 3 equivalents of peg - dspe3 . 4k - nhs dissolved in dmf . a drop of the reaction mixture is checked with moist indicator paper and diisopropylethylamine added to the reaction mixture to maintain the ph between 7 . 5 - 8 . 5 . the reaction mixture is stirred overnight at ambient temperature . the dmf is removed under reduced pressure and the residue chromatographed to give ( dspe - peg 3 . 4k ) 2 - lysyl glycine t - butyl ester . this material is dissolved in 50 % trifluoroacetic acid in methylene chloride and the reaction mixture stirred for one hour at ambient temperature . the solvent is removed under reduced pressure and the residue triturated with diethylether to give ( dspe - peg 3 . 4k ) 2 - lysyl glycine that is used without further purification . ( dspe - peg 3 . 4k ) 2 - lysyl glycine is dissolved in a minimum amount of dmf along with a 10 % molar excess . an equimolar ration of diisopropylcarbodiimide based on ( dspe - peg 3 . 4k ) 2 - lysylglycine is added and the reaction mixture stirred for 45 minutes . this solution is added dropwise to a solution of erythropoietin in pbs ( ph 7 . 4 ). the reaction is stirred at ambient temperature for 3 hours . an aqueous solution of tris ( ph 9 . 5 ) is added and the resulting solution stirred for 30 minutes at ambient temperature to quench any unreacted reagent . the reaction mixture is concentrated using a centrifugal concentrator with a membrane cutoff of 5 kd . the concentrated solution is loaded onto a zorbax gf - 250 semi - prep column and eluted with pbs . peaks are collected and analyzed by sds page and mass spectrometry . the peak corresponding to ( dspe - peg 3 . 4k ) 2 - lysyl glycine - epo is collected and concentrated using a centrifugal concentrator with a membrane cutoff of 5 kd . to a solution of mono - boc - diamino - peg 3 . 4k in thf is added one equivalent of 1 , 1 ′- carbonyldiimidazole . the reaction mixture is stirred for one hour at ambient temperature . to this is added a solution of nona - o - acetyl - β - d - galactopyranosyl )-( 1 → 4 )-[ α - l - fucopyranosyl ]-( 1 → 3 )-( 2 - amino - 2 - deoxy - β - d - glucopyranoside in thf . the reaction mixture is stirred for 4 hours at ambient temperature . the solvent is removed under reduced pressure and the residue dissolved in 50 % trifluoroacetic acid in methylene chloride and stirred for 30 minute at ambient temperature . the solvent is removed under reduced pressure and the residue chromatographed to give nh 2 — peg 3 . 4k — nh — co —( n -( nona - o - acetyl -( β - d - galactopyranosyl )-( 1 → 4 )-[ α - l - fucopyranosyl ]-( 1 → 3 )-( 2 - amino - 2 - deoxy - β - d - glucopyranoside ))). this compound is dissolved in thf and one equivalent of bromoacetyl bromide and one equivalent of diisopropylethylamine is added . the reaction mixture is stirred at ambient temperature for one hour . the resulting solution is added dropwise to a solution of cys - epo ( erythropoietin to which an n - terminal cysteine has been added by recombinant technology ). after 4 hours the solution is concentrated and the product purified on a size exclusion column , eluting with pbs . the material corresponding to epo - peg 3 . 4k — nh — co —( n -( nona - o - acetyl -( β - d - galactopyranosyl )-( 1 → 4 )-[ α - l - fucopyranosyl ]-( 1 → 3 )-( 2 - amino - 2 - deoxy - β - d - glucopyranoside ))) is collected and aqueous ammonia added to remove the acetyl groups . further chromatography gives the desired product , epo - peg 3 . 4k — nh — co —( n -( β - d - galactopyranosyl )-( 1 → 4 )-[ α - l - fucopyranosyl ]-( 1 → 3 )-( 2 - amino - 2 - deoxy - β - d - glucopyranoside )). cells were washed three times in pbs and starved for 24 hours prior to assay . ut - 7 cells were starved in imdm with added l - glutamine and fbs at 5 % ( i5q ). cells were washed once in 50 ml dpbs and counted while suspended in dpbs and suspended in the appropriate media to a final concentration of 6 × 10 5 cells / ml ( yields a final concentration of 30 , 000 cells per well ). an epo standard was prepared by diluting epo stock ( 1 . 7 mg / ml ) to 0 . 85 μg / ml ( 2 μl in 4 ml media ) this solution was diluted 2 : 340 to 5 ng / ml followed by 1 : 2 serial dilutions down to a concentration of 0 . 0098 ng / ml in i5q media . this yields standard concentrations of 2 . 5 ng / ml to 0 . 0024 ng / ml . epo - peg - dspe was diluted in a similar manner . 50 μl of the ut - 7 cell suspension was transferred to the corresponding wells and the plates were incubated at 37 ° c . for 48 hours . cell proliferation was assessed using promega &# 39 ; s mts solution , adding 20 μl per well . readings were begun 1 hour after mts addition . the ec50 for epo was 1 . 03 × 10 − 11 m and for epo - peg - dspe was 2 . 22 × 10 − 11 m . bdf1 female mice obtained from charles rivers laboratories ( raleigh , n . c . ), weighing approximately 18 - 20 grams were group housed ( 10 per cage ) in filtered - top plastic cages . the animals were identified with ear tags , placed at least i week prior to the start of the study . cage cards labeled with animal number , test article , treatment , and study number were affixed to the cages . on day − 5 of the study , the animals were assigned to 1 of 3 treatment groups ( pbs control , epo and epo -( peg - dspe ) 3 . 4k ) with 15 animals in each group . the animals were anesthetized ( co 2 ) and blood samples were taken in edta coated glass tube via retro - orbital sinus with a target blood volume of 0 . 05 ml / sample to establish baseline levels . blood was placed into commercially available edta prepared microcentrifuge tubes . aliquots were placed into hematocrit tubes and the tubes were sealed with clay and centrifuged for 5 minutes . the packed cell volume ( pcv / hematocrit ) was obtained from reading the hematocrit tubes on a commercially available hematocrit determinator card . using 10 μg of blood , hemoglobin levels were determined using a coulter ™ counter . on days 0 and 2 , the animals received an intraperitoneal injection of 0 . 94 ml ( 112 . 8 ml / kg ) of either pbs ( ph 7 . 4 ), epo ( 0 . 333 μg / ml in pbs ), or epo -( peg - dspe ) 3 . 4k ( 0 . 383 μg / ml in pbs ). on days 4 , 7 and 10 blood samples taken . aliquots were placed into hematocrit tubes and the were sealed with clay and centrifuged for 5 minutes . the packed cell volume ( pcv / hematocrit ) was obtained from reading the hematocrit tubes on a commercially available hematocrit determinator card . using 10 μl , hemoglobin levels were determined using a coulter ™ counter . day 0 day 4 day 7 day 10 hematocrit epo 44 . 8 48 . 6 50 . 6 45 . 8 epo - dspe 44 . 0 50 . 4 52 . 8 54 . 0 pbs 44 . 8 42 . 0 44 . 8 43 . 6 hemoglobin epo 12 . 3 13 . 2 13 . 3 12 . 5 epo - dspe 12 . 2 13 . 5 14 . 2 15 . 0 pbs 13 . 0 11 . 9 12 . 4 12 . 7	0
the coating composition includes , in an organic phase , a polymer , preferably an acrylic polymer , having functionality selected from hydroxyl groups , primary carbamate groups , and combinations of these ; a water - miscible organic solvent ; an oxygenated solvent that is not strongly hydrogen bonding ; and water . the water is emulsified in the coating . the coating thus has a solventborne continuous phase . the polymer includes hydroxyl groups , primary carbamate groups , or both hydroxyl groups and primary carbamate groups . suitable polymers for the coating composition include , without limitation , acrylic polymers , polyurethane polymers , and polyester polymers . preferred among these are acrylic polymers . synthesis of such polymers for coatings are well - known in the art . a typical synthesis of the preferred acrylic polymer will be described , but the person skilled in the art should understand that the principles apply likewise to other suitable coatings resins . with particular reference to the preferred acrylic polymer , then , the hydroxyl and / or carbamate functionality may be conveniently introduced by polymerizing a monomer having an hydroxyl group and / or polymerizing a monomer having a primary carbamate group , although it is also possible to polymerize with a monomer having functionality that may be reacted to supply an hydroxyl and / or carbamate group after polymerization . examples of addition polymerizable monomers having hydroxyl or primary carbamate functionality include , without limitation , hydroxyethyl acrylate , hydroxyethyl methacrylate , hydroxypropyl acrylate , hydroxypropyl methacrylate , hydroxybutyl acrylate , and hydroxybutyl methacrylate ; polyalkylene glycol acrylates and methacrylates ; and the reaction product of a glycidyl - group containing monomer , such as glycidyl acrylate , glycidyl methacrylate , and allyl glycidyl ether , with a carboxylic acid . hydroxyl and / or primary carbamate functionality can be introduced to an acrylic polymer by a number of reactions , including , without limitation , reacting glycidyl functionality with a carboxylic acid ; reacting a carboxylic acid group with a glycidyl compound ; and by other methods , such as those set out in ohrbom et al , u . s . pat . no . 6 , 160 , 058 and mcgee et al ., u . s . pat . no . 5 , 726 , 244 , both of which are incorporated herein by reference . the acrylic polymer of the organic phase includes a sufficient amount of the hydroxyl and / or carbamate functionality so that the acrylic polymer , in conjunction with the water miscible solvent ( s ) and the oxygenated solvent that has hydrogen bonding , stabilizes the emulsion of the water . in one preferred embodiment , the acrylic polymer has an equivalent weight ( with respect to the hydroxyl and / or carbamate functionality ) of up to about 650 grams / equivalent , more preferably up to about 520 grams / equivalent , still more preferably up to about 435 grams / equivalent , even , more preferably up to about 370 grams / equivalent , and most preferably up to about 350 grams / equivalent . the acrylic polymer preferably has an equivalent weight ( with respect to the hydroxyl and / or carbamate functionality ) of at least about 260 grams / equivalent , more preferably at least about 290 grams / equivalent , and still more preferably at least about 310 grams / equivalent . the acrylic polymer preferably has equivalent weight in the range of 260 to 650 grams / equivalent , more preferably 290 to 520 grams / equivalent , still more preferably 290 to 435 grams / equivalent , even more preferably 290 to 370 grams / equivalent , and most preferably 310 to 350 grams / equivalent . in another preferred embodiment , the hydroxyl functionality is partially or completely replaced with carbamate functionality , for example through transcarbamation . the acrylic polymer may be polymerized using one or more comonomers . examples of such comonomers include , without limitation , α , β - ethylenically unsaturated monocarboxylic acids containing 3 to 5 carbon atoms such as acrylic , methacrylic , and crotonic acids and the esters of those acids ; α , β - ethylenically unsaturated dicarboxylic acids containing 4 to 6 carbon atoms and the anhydrides , monoesters , and diesters of those acids ; vinyl esters , vinyl ethers , vinyl ketones , and aromatic or heterocyclic aliphatic vinyl compounds . representative examples of suitable esters of acrylic , methacrylic , and crotonic acids include , without limitation , those esters from reaction with saturated aliphatic and cycloaliphatic alcohols containing 1 to 20 carbon atoms , such as methyl , ethyl , propyl , isopropyl , n - butyl , isobutyl , tert - butyl , 2 - ethylhexyl , lauryl , stearyl , cyclohexyl , trimethylcyclohexyl , tetrahydrofurfuryl , stearyl , sulfoethyl , and isobornyl acrylates , methacrylates , and crotonates . representative examples of other ethylenically unsaturated polymerizable monomers include , without limitation , such compounds as fumaric , maleic , and itaconic anhydrides , monoesters , and diesters with alcohols such as methanol , ethanol , propanol , isopropanol , butanol , isobutanol , and tert - butanol . representative examples of polymerization vinyl monomers include , without limitation , such compounds as vinyl acetate , vinyl propionate , vinyl ethers such as vinyl ethyl ether , vinyl and vinylidene halides , and vinyl ethyl ketone . representative examples of aromatic or heterocyclic aliphatic vinyl compounds include , without limitation , such compounds as styrene , α - methyl styrene , vinyl toluene , tert - butyl styrene , and 2 - vinyl pyrrolidone . the comonomers may be used in any combination . the acrylic polymer may have a small amount of acid functionality . it is not preferred for the acid group to be salted , as it is believed that salted groups would interfere with the desired emulsification of the water in the organic solvent - acrylic polymer system , because the polymer must remain in the organic continuous phase . if an acid monomer is included as a comonomer , it typically may be up to about 5 % by weight of the monomers being polymerized , preferably up to about 1 % by weight of the monomers being polymerized . the acrylic polymer may be prepared using conventional techniques , such as by heating the monomers in the presence of a polymerization initiating agent and optionally chain transfer agents . the polymerization is preferably carried out in solution , although it is also possible to polymerize the acrylic polymer in bulk . it is particularly preferred to employ one or both of the water - miscible organic solvent and the low hydrogen bonding oxygenated solvent as part or all of the polymerization solvent . suitable polymerization solvents include , without limitation , ethyl acetate , acetone , methyl ethyl ketone , methyl propyl ketone , ethylene glycol monoalkyl ethers and propylene glycol monoalkyl ethers , including propylene glycol monomethyl ether , propylene glycol monoethyl ether , ethylene glycol monopropyl ether , and propylene glycol monopropyl ether , monoalkyl ethers of dipropylene glycol such as the monomethyl ether of dipropylene glycol , and alcohols such as methanol , ethanol n - propanol , isopropanol , and tert - butyl alcohol . typical initiators are organic peroxides such as dialkyl peroxides such as di - t - butyl peroxide , peroxyesters such as t - butyl perooctoate and t - butyl peracetate , peroxydicarbonates , diacyl peroxides , hydroperoxides such as t - butyl hydroperoxide , and peroxyketals ; azo compounds such as 2 , 2 ′ azobis ( 2 - methylbutanenitrile ) and 1 , 1 ′- azobis ( cyclohexanecarbonitrile ); and combinations of these . typical chain transfer agents are mercaptans such as octyl mercaptan , n - or tert - dodecyl mercaptan ; halogenated compounds , thiosalicylic acid , mercaptoacetic acid , mercaptoethanol , and dimeric alpha - methyl styrene . the reaction is usually carried out at temperatures from about 20 ° c . to about 200 ° c . the reaction may conveniently be done at the temperature at which the solvent or solvent mixture refluxes , although with proper control a temperature below the reflux may be maintained . the initiator should be chosen to match the temperature at which the reaction is carried out , so that the half - life of the initiator at that temperature should preferably be no more than about thirty minutes , more preferably no more than about five minutes . the acrylic polymer should have a weight average molecular weight of at least about 2400 , preferably at least about 3000 , more preferably at least about 3500 , and particularly preferably at least about 4000 . weight average molecular weight may be determined by gel permeation chromatography using polystyrene standard . in addition , the weight average molecular weight is preferably up to about 5000 , more preferably up to about 4750 , and still more preferably up to about 4500 , the solvent or solvent mixture is generally heated to the reaction temperature and the monomers and initiator ( s ) and optionally chain transfer agent ( s ) are added at a controlled rate over a period of time , typically from about two to about six hours . additional solvent may be added concurrently . the mixture is usually held at the reaction temperature after the additions are completed for a period of time to complete the polymerization . optionally , additional initiator may be added to ensure complete conversion of monomers to polymer . although the specific details and optimum equivalent weight and weight average molecular weights may be different for other polymers from those just described for an acrylic polymer , the polymers should have low equivalent weight and a weight average molecular weight that produces a similar viscosity . polyurethane polymers are prepared by reaction of a compounds or macromonomers having two hydroxyl groups , for example compounds such as 1 , 4 - butanediol , a di - beta - hydroxy carbamate compound , and neopentyl glycol and macromonomers such as polyester diols , with a diisocyanate materials . when the coating composition is a topcoat ( including basecoat and clearcoat ) composition , the diisocyanate is aliphatic , for example isophorone diisocyanate , hexamethylene diisocyanate or cyclohexamethylene diisocyanate . in a preferred embodiment , the polyurethane is prepared in two stages , with an isocyanate - functional prepolymer prepared in the first stage and capped with a polyhydroxyl compound , such a trimethylolpropane , pentaerythritol , diethanolamine , and so on . polyester polymers are prepared by reaction of dihydroxy compounds , such as those already mentioned , and dicarboxylic acids . a monomer having carbamate functionality in addition to the hydroxyl functionality may be reacted , in which case carbamate functionality is introduced along the backbone of the polymer . hydroxy end groups may be converted to carbamate functionality by any of the methods mentioned in conjunction with the acrylic polymer . see also ohrbom et al ., u . s . pat . no . 6 , 084 , 038 and the references cited therein ; menovcik et al . u . s . pat . no . 5 , 532 , 061 ; menovcik et al ., u . s . pat . no . 5 , 508 , 379 ; and menovcik et al ., u . s . pat . no . 5 , 451 , 656 , the disclosures of which are incorporated herein by reference . the coating composition preferably contains one or more crosslinking agents that react with the acrylic polymer after the coating composition is applied to form a cured coating . the crosslinking agents have two or more groups reactive with the polymer , and the crosslinker advantageously have affinity for water . that is , the crosslinking agents preferably have a polar group or groups . a certain amount of crosslinking agents without affinity for water may also be included . the crosslinker may be monomeric , oligomeric , or polymeric . examples of suitable crosslinking agents include , without limitation , aminoplast crosslinkers and polyisocyanates , especially blocked aliphatic polyisocyanates , particularly those blocked with polar blocking groups . suitable blocking agents are those compounds that will unblock under the curing conditions to regenerate the isocyanate group for reaction as a crosslinking site . blocking agents suitable for crosslinkers are known in the art and include , without limitation , oximes , lower alcohols , lactams , and phenol . specific examples of such materials include , without limitation , methyl ethyl ketoxime , acetaldehyde oxime , ε - caprolactam , and pyrazole compounds such as 2 , 5 - dimethyl pyrazole . the aminoplast crosslinker is advantageously a monomeric , preferably partially alkylated , particularly preferably partially methylated , melamine formaldehyde resin . melamine formaldehyde resins having imino content are also useful . the coating composition may include a resinous material , for example one or more of the carbamate - functional materials described in ohrbom et al ., u . s . pat . no . 6 , 165 , 618 , green et al ., u . s . pat . no . 5 , 872 , 195 , mcgee et al ., u . s . pat . no . 5 , 854 , 385 , green et al ., u . s . pat . no . 5 , 852 , 136 , ohrbom et al ., u . s . pat . no . 5 , 827 , 930 , menovcik et al ., u . s . pat . no . 5 , 792 , 810 , mcgee et al ., u . s . pat . no . 5 , 770 , 650 , ohrbom et al ., u . s . pat . no . 5 , 766 , 769 , bammel et al ., u . s . pat . no . 5 , 760 , 127 , menovcik et al ., u . s . pat . no . 5 , 744 , 550 , rehfuss et al ., u . s . pat . no . 5 , 719 , 237 , green , u . s . pat . no . 5 , 693 , 724 , green , u . s . pat . no . 5 , 693 , 723 , menovcik , u . s . pat . no . 5 , 659 , 003 , briggs , u . s . pat . no . 5 , 639 , 828 , rehfuss et al ., u . s . pat . no . 5 , 336 , 566 , ohrbom et al ., u . s . patent application ser . no . 09 / 741 , 511 , filed dec . 19 , 2000 , and ohrbom et al ., u . s . patent application ser . no . 09 / 464 , 309 , filed dec . 15 , 1999 , each of which is incorporated herein by reference . the carbamate - functional material can be a compound or an oligomer ( that is , with up to ten or so repeating monomer units ). preferably the carbamate - functional material has a molecular weight ( for a compound ), or number average molecular weight ( for an oligomer ) of up to about 2000 , preferably up to about 1800 . water soluble carbamate - functional materials are preferably avoided , as they might interfere with emulsification of the water in the organic phase . the coating composition includes a water - miscible organic solvent and a low hydrogen bonding oxygenated solvent . standard references , such as the crc handbook , may be consulted to determine whether a particular solvent is water - miscible . suitable examples of water - miscible solvents include , without limitation , acetone , diacetone alcohol , ethylene glycol monomethyl , monoethyl , monopropyl , and monobutyl ethers ( including all of the propyl and butyl isomers ), the acetate of the monomethyl ether of ethylene glycol , diethylene glycol monomethyl , monoethyl , monopropyl , and monobutyl ethers , triethylene glycol monomethyl , monoethyl , monopropyl , and monobutyl ethers , propylene glycol monomethyl , monoethyl , and monopropyl ethers ( including the n - propyl and isopropyl ethers ), dipropylene glycol monomethyl and monoethyl ethers , tripropylene glycol monomethyl and monoethyl ethers , butyl ethoxy propylene glycol , methanol , ethanol , n - propanol , isopropanol , and 1 - methyl - 2 - pyrrolidinone . low hydrogen bonding oxygenated solvents include water - immiscible alcohols , ester solvents , and acetate solvents . the low hydrogen bonding oxygenated solvent should have a hanson solubility parameter for hydrogen bonding of no more than about 6 . 0 . particular examples of low hydrogen bonding oxygenated solvents include , without limitation , ketones such as methyl ethyl ketone , methyl propyl ketone , diethylene ketone , cyclohexanone , methyl butyl ketone , methyl isobutyl ketone , methyl n - amyl ketone , and methyl isoamyl ketone ; non - water miscible alcohols such as hexanol and 2 - ethylhexanol ; esters such as ethoxy ethyl propionate , ethyl acetate , n - propyl acetate , isopropyl acetate , n - butyl acetate , isobutyl acetate , sec - butyl acetate , tert - butyl acetate , ethyl propionate , n - propyl propionate , isopropyl propionate , n - butyl propionate , isobutyl propionate , sec - butyl propionate , tert - butyl propionate , and ethylene glycol monoalkyl ether acetates ( other than ethylene glycol monomethyl ether acetate ) and propionates , and monobutyl ether of diethylene glycol . a minor amount of non - oxygenated , non - water miscible solvents may also be included in the coating composition , so long as those solvents do not interfere with the interaction between the water , the polymer , and the water miscible solvent . preferably , no more than about 10 %, more preferably no more than about 5 %, by weight of the total solvent weight is non - oxygenated , non - water miscible solvent . the coating composition further includes water . the water is absorbed into the coating composition as an emulsion . it is desirable for the water to form a colloidal emulsion . unexpectedly , the water reduces the viscosity of the solvent - borne coating composition . the water emulsion also provides a surprising improvement in the leveling of the coating formed from the coating composition . for a given polymer , the amounts of water - miscible organic solvent , low hydrogen bonding oxygenated solvent , and water are selected so that the water is emulsified in the organic phase . preferably , the water forms a colloidal emulsion ( that is , an emulsion of very small droplet size ). for a given amount of water - miscible organic solvent and a given amount of low hydrogen bonding oxygenated organic solvent , an optimum amount of water can be determined in a straightforward manner by adding water incrementally and measuring the viscosity of the resulting coating composition to determine at what point the viscosity exceed the desired coating composition viscosity with additional water . the viscosity of the coating compositions initially decreases with added water , goes through a minimum viscosity , and then begins to increase . the water may continue to be added until the desired viscosity would be exceeded if any more water were added . in general , the water can be up to about 50 % by weight , based on the total amount of volatile materials ( i . e ., water plus organic solvents ). in a preferred embodiment , the water is at least about 10 %, more preferably at least about 15 %, still more preferably at least about 20 %, and even more preferably at least about 25 % by weight of the total amount of volatile material . in general , the water - miscible organic solvent can be up to about 50 % by weight , based on the total amount of volatile materials ( i . e ., water plus organic solvents ). in a preferred embodiment , the water - miscible organic solvent is at least about 10 %, more preferably at least about 15 %, still more preferably at least about 20 %, and even more preferably at least about 25 % by weight of the total amount of volatile material . in general , the low hydrogen bonding oxygenated solvent can be up to about 50 % by weight , based on the total amount of volatile materials ( i . e ., water plus organic solvents ). in a preferred embodiment , the low hydrogen bonding oxygenated solvent is at least about 10 %, more preferably at least about 15 %, still more preferably at least about 20 %, and even more preferably at least about 25 % by weight of the total amount of volatile material . the organic phase of the coating composition includes the polymer having a sufficient amount of the hydroxyl functionality and / or primary carbamate functionality and a sufficient amount of the water - miscible organic solvent to form a colloidal emulsion of the water . the organic phase further includes a low hydrogen bonding oxygenated solvent , which advantageously reduces the viscosity of the coating composition . the weight ratio of water - miscible organic solvent , low hydrogen bonding oxygenated solvent , and water in the coating composition is preferably from about 0 . 4 to about 3 . 0 parts by weight water - miscible organic solvent to from about 0 . 4 to about 3 . 0 parts by weight low hydrogen bonding oxygenated solvent for each part by weight of water ; more preferably from about 0 . 5 to about 2 . 5 parts by weight water - miscible organic solvent to from about 0 . 5 to about 2 . 5 parts by weight low hydrogen bonding oxygenated solvent for each part by weight of water ; and even more preferably from about 0 . 75 to about 2 . 0 parts by weight water - miscible organic solvent to from about 0 . 75 to about 2 . 0 parts by weight low hydrogen bonding oxygenated solvent for each part by weight of water . the volatile organic content of the coating composition , as measured according to epa method 24 , is preferably about 3 . 5 lbs ./ gal . or less , more preferably about 3 . 2 lbs ./ gal . or less , and even more preferably about 3 . 0 lbs ./ gal . or less ( without water ). ( voc values used herein are those calculated without water .) the voc is minimized as much as possible by using the minimum amount of organic solvent along with the maximum amount of water to obtain the desired viscosity . in relation to the polymer , more water may be emulsified with increasing amounts of hydroxyl and / or primary carbamate groups on the polymer ( i . e ., with decreasing equivalent weight ), with the caveat that the polymer must remain in the continuous organic phase . in a preferred embodiment , the coating composition has a viscosity is 200 centipoise or less . coating compositions at this viscosity can be applied using the same application equipment as is used with traditional high solids coating technology . accordingly , the monomers used to prepare the acrylic or other polymer are selected and apportioned to achieve the desired viscosity , and in conjunction therewith the molecular weight of the polymer and the water miscible solvent or solvent blend are likewise selected to achieve the desired viscosity . in a preferred embodiment , the coating composition of the invention is a coating composition for an automotive vehicle . among the kinds of automotive coating compositions are primers and primer surfacers , topcoats , basecoats , and clearcoats . clearcoats are particularly preferred . primer and primer surfacer compositions may further include one or more pigments and typically include one or more fillers . basecoat and one layer topcoat compositions further include one or more color pigments and / or one or more special effect pigments , including metallic flake pigments and pearlescent pigments . clearcoat compositions may be tinted . the coating composition may experience some stratification over a period of time , but the composition is easily re - homogenized with gentle stirring . the invention is further described in the following examples . the examples are merely illustrative and do not in any way limit the scope of the invention as described and claimed . the following table shows the compositions of clearcoat coating compositions of comparative example a that contains no emulsified water and examples 1 - 3 of the invention . resin a is an acrylic polymer polymerized from a monomer mixture containing 39 % by weight hydroxyethyl methacrylate . resin a is about 66 % nonvolatile in aromatic solvent . resin a has a viscosity of about 18 , 500 cps and a weight average molecular weight of 4600 daltons . resin b is an acrylic polymer polymerized from a monomer mixture containing 39 % by weight hydroxyethyl methacrylate . resin b is about 66 % nonvolatile in a combination of propylene glycol monopropyl ether and methyl propyl ketone . resin b has a viscosity of about 500 cps and a weight average molecular weight of 3500 daltons . resin c is an acrylic polymer polymerized from a monomer mixture containing 39 % by weight hydroxyethyl methacrylate . resin c is about 66 % nonvolatile in propylene glycol monopropyl ether . resin c has a viscosity of about 4500 cps and a weight average molecular weight of about 5000 daltons . resin d is an acrylic polymer polymerized from a monomer mixture containing 39 % by weight hydroxyethyl methacrylate . resin d is about 66 % nonvolatile in methyl propyl ketone . resin d has a viscosity of about 600 cps and a weight average molecular weight of 3800 daltons . resin e is a carbamate functional resin prepared according to rehfuss , u . s . pat . no . 5 , 336 , 566 , having a nonvolatile content of 30 . 8 % by weight and containing 25 . 3 % by weight amyl acetate , 22 . 5 % by weight isomers of butanol , and 21 . 4 % by weight methyl isoamyl ketone . blocked isocyanate “ a ” is 2 , 5 - dimethyl pyrazole blocked hexamethylene diisocyante , 75 % in a blend of aromatic solvent and propylene glycol monomethyl ether acetate . blocked isocyanate “ b ” is 2 , 5 - dimethyl pyrazole blocked hexamethylene diisocyante , 80 % in methyl ethyl ketone . in the total solvent composition breakdown given for comparative example a and example 1 , propyl propasol and isopropanol are water miscible solvents ; mpk , mak , amyl acetate , pm acetate , mek , butyl acetate and exxate 600 are oxygenated solvents having a hanson solubility parameter hydrogen bonding value of up to about 6 . 0 the invention has been described in detail with reference to preferred embodiments thereof . it should be understood , however , that variations and modifications can be made within the spirit and scope of the invention .	2
in the present invention , after the formation of a barrier film ( there is also a case where a thin insulating film as a protection layer of the barrier film is formed on the barrier film ), portions other than a part where a contact hole is formed at a subsequent step are covered with a photoresist ( resist pattern ), and the barrier film of only the part where the contact hole is formed is removed by etching using the photoresist as a mask . as a method of removing the barrier film , dry etching + deposited material removing method can be used . an area where the barrier film is removed is also referred to as a first opening portion below . as the dry etching , plasma etching under general contact hole etching conditions of an interlayer insulating film , for example , by an etching gas including a fluorine based gas ( cf 4 , chf 3 , c 2 f 6 , c 3 f 8 , c 4 f 8 , sf 6 , etc . ), or plasma etching under metal wiring etching conditions , for example , by an etching gas including a chlorine based gas ( cl 2 , bcl 3 , etc .) can be applied . although the deposited material is produced in the above dry etching as described above , like the data of table 2 , under barrier film etching conditions ( etchant : cf 4 + chf 3 + ar ), if etching rates of the barrier film ( in this case , an alumina film ) and the first insulating film ( under layer insulating film , in this case , a silicon oxide film ) are stable , it is easy to suppress a film decrease in the first insulating film by controlling an overetching amount at the etching of the barrier film . in this way , if the first insulating film of a sufficient thickness remains up to the conductive region formed in the substrate or the like , even if a chemical treatment or sputter etching is carried out as a deposited material removing treatment , since the chemicals or elements do not come in direct contact with the conductive region , there does not occur such a problem that damage or the like is caused in the conductive region . it is preferable that the removing area diameter ( diameter of the first opening portion ) of the barrier film is larger than a design value of the diameter of the second opening portion by fluctuations in the process , such as an alignment shift ( phenomenon where superposition with an under layer is off ) at the time of photolithography step of the first opening portion ( at the time of formation of a resist mask by a photolithography method ), an alignment shift at the time of photolithography step of the second opening portion , a fluctuation in a diameter after the photolithography step of the second opening portion , and a shift of the diameter of the opening portion by etching . specific examples are shown in table 3 . by removing the barrier film of the area exceeding the barrier film removal area in table 3 , it is possible to prevent the barrier film from being exposed in the contact hole at the time of contact hole etching with respect to any process fluctuation . in order to remove the barrier film in a large area , generally , it is necessary to prepare a new photomask ( mask for resist pattern formation ) of a wide opening area . however , as a method of removing a barrier film in a wide area without preparing a new mask , there is a following method . first , after the barrier film is formed , a third insulating film is formed thereon . contact photolithography step is carried out by using a photomask for contact hole formation thereon to form a resist pattern , and next , the third insulating film on the barrier film is wet etched by chemicals using the resist pattern . for example , if the third insulating film is a si oxide film , it is suitable to use a hf solution ( diluted hf solution , diluted bhf solution , etc .). an opening of a desired size is formed in the third insulating film by the wet etching , and then , the photoresist mask is removed , and when the barrier film is dry etched by using the third insulating film as a mask , the barrier film can be removed at a desired diameter . according to the method of the present invention , at the contact hole etching step , the aspect ratio of the contact hole formed in the first insulating film can be decreased by the barrier film thickness + the film decrease of the first insulating film by over etching at the removal of the barrier film . as a result , a process margin can be increased . after the barrier film is partially removed by the foregoing method , the deposited material is removed by a chemical treatment or inverse sputtering , and further , the second insulating film is deposited , and contact photolithography step and dry etching are carried out , so that the contact hole is formed . according to the method of the present invention , since the barrier film is not exposed during the dry etching , the deposited material by the barrier film is not produced , and the contact hole with an excellent shape can be formed . incidentally , as respective structural elements of the semiconductor device , material and film thickness well known in the field can be adopted . further , the formation method and processing method of those can be suitably selected from well - known methods in accordance with the material and film thickness constituting the respective structural elements . specifically , as the first insulating film , the second insulating film , and the third insulating film , a silicon oxide film , a silicon nitride film , an nsg film , a bsg film , a psg film , a bpsg film , and the like can be enumerated . further , these insulating films may be composed of a plurality of layers . besides , it is preferable that the thicknesses of the first insulating film , the second insulating film , and the third insulating film are 200 to 1500 nm , 100 to 1000 nm , and 50 to 1000 nm , respectively . further , as the barrier film , films made of al 2 o 3 , tio 2 , tin , tion , ta 2 o 5 , tasin , sin , and the like can be enumerated . it is preferable that the thickness of the barrier film is 10 to 300 nm . the conductive region means a region where electrical conduction is desired , such as a source , a drain , and a gate of a transistor . besides , the conductive region means not only a region formed on the substrate , but also a conductive region formed in an interlayer insulating film . hereinafter , the present invention will be described in detail on examples . fig1 a to 1 h are schematic views showing manufacturing steps of a semiconductor device according to example 1 . first , after a semiconductor component ( not shown ) is formed on a si substrate 11 , an nsg film 12 having a thickness of 100 nm and a bpsg film 13 having a thickness of 700 nm are deposited by an atmospheric pressure cvd method , respectively . a functional component ( not shown ) is formed on the bpsg film 13 , an alumina film ( barrier film ) 14 having a thickness of 30 nm is formed thereon by a sputtering method , and an nsg film 19 having a thickness of 50 nm is deposited by the atmospheric pressure cvd method ( fig1 a ). the nsg film 12 and the bpsg film 13 correspond to the first insulating film . next , a photoresist film having a thickness of 1 μm is coated on the nsg film 19 by spin coating , and is baked to form a film . next , the photoresist film is exposed by using a new photomask 20 capable of forming an opening in an area with a diameter larger than a diameter of a subsequent contact hole by all fluctuations caused in the process ( for example , when the contact hole diameter is 0 . 6 μm , the opening diameter of the new photomask is 1 . 01 μm or more ) and is developed , so that a resist pattern 15 is obtained ( fig1 b ). subsequently , the nsg film 19 , the alumina film 14 , and a part ( 30 nm thickness ) of the bpsg film 13 are dry etched under contact hole etching conditions by using the resist pattern 15 as a mask . for example , in the case where the etching is carried out by an rie apparatus under conditions of rf power = 780 w , pressure = 225 mtorr , etching gases and their flow rates of cf 4 / chf 3 / ar = 27 / 27 / 400 sccm , when the etching rate of the nsg film is 5200 å / min , the etching rate of the alumina film is 1034 å / min , and the etching rate of the bpsg film is 7200 å / min , it becomes necessary that the etching time is about 26 seconds . by this etching , a first opening portion is formed . next , a deposited material produced from alumina is removed by chemicals ( fig1 c ). as a removing method , for example , a method can be cited in which ekc270 is heated to 70 ° c ., a sample is immersed therein for 5 minutes , and then , it is washed by pure water for 30 minutes , and is dried by a spin dryer . subsequently , the resist pattern 15 remaining after dry etching is removed ( fig1 d ). as a removing method , for example , ashing by o 2 , washing by organic solvent , sulfuric acid boil , or combination thereof can be cited . thereafter , an nsg film 17 having a thickness of 450 nm is deposited by the atmospheric pressure cvd method ( fig1 e ). the nsg films 19 and 17 corresponding to the second insulating film . then , a photoresist film having a thickness of 1 μm is coated on the laminated nsg film 17 by the spin coating to form a film . next , exposure and development are carried out by using a contact hole formation photomask , so that a resist pattern 18 for contact hole etching is formed ( fig1 f ). subsequently , the nsg film 17 , the bpsg film 13 , and the nsg film 12 are etched by using the formed resist pattern 18 as a mask , so that a contact hole ( second opening portion ) is formed ( fig1 g ). for example , in the case where the etching is carried out by an rie apparatus under conditions of rf power = 780 w , pressure = 225 mtorr , etching gases and their flow rates of cf 4 / chf 3 / ar = 27 / 27 / 400 sccm , it becomes necessary that the etching time is about 200 seconds . in this case , the opening area of the previously removed alumina film is larger than the actual contact hole diameter and includes the area for the case where the alignment at the time of photolithography is shifted or the contact hole diameter becomes large by the etching , so that the alumina film is not exposed during the contact hole etching . finally , the resist pattern 18 after the etching is removed ( fig1 h ). as a removing method , for example , ashing by o 2 , washing by organic solvent , sulfuric acid boil , or combination of those can be cited . fig2 a to 2 h are schematic views showing manufacturing steps of a semiconductor device according to example 2 . first , after a semiconductor component is formed on a si substrate 11 , an nsg film 12 having a thickness of 100 nm and a bpsg film 13 having a thickness of 700 nm are deposited by an atmospheric pressure cvd method , respectively , and a functional component ( not shown ) is formed thereon . then , an alumina film 14 having a thickness of 30 nm is formed on the functional component by a sputtering method , and an nsg film ( third insulating film ) 19 having a thickness of 200 nm is deposited by the atmospheric pressure cvd method ( fig2 a ). next , a photoresist film having a thickness of 1 μm is coated on the nsg film 19 by a spin coating method to form a film . the photoresist film is exposed by using a contact hole formation photomask 16 and is developed , so that a resist pattern 15 is obtained . next , the nsg film 19 is wet etched by 10 : 1 bhf solution . here , when the nsg wet etching rate of 10 : 1 bhf is 200 nm / min , and when etching is carried out for 75 seconds , an opening of a diameter larger than the opening diameter of the photoresist pattern 15 by 0 . 5 μm is formed in the nsg film ( fig2 b ). subsequently , the resist pattern 15 is removed ( for example , ashing by o 2 , washing by organic solvent , sulfuric acid boil , or combination of those ) ( fig2 c ). subsequently , the alumina film 14 and a part ( 30 nm thickness ) of the bpsg film 13 are dry etched under contact hole etching conditions by using the nsg film 19 as a mask . for example , in the case where the etching is carried out by an rie apparatus under conditions of rf power = 780 w , pressure = 225 mtorr , etching gases and their flow rates of cf 4 / chf 3 / ar = 27 / 27 / 400 sccm , when the etching rate of the nsg film is 5200 å / min , is 5200 the etching rate of the alumina film is 1034 å / min , and the etching rate of the bpsg film is 7200 å / min , it becomes necessary that the etching time is about 20 seconds . in this case , there remains the nsg film 19 , which became the mask , of a thickness of 27 nm . next , a deposited material produced from alumina is removed by chemicals ( fig2 d ). as a removing method , a method can be cited in which for example , ekc 270 is heated to 70 ° c ., and a sample is immersed therein for 5 minutes , and thereafter , it is washed by pure water for 30 minutes , and is dried by a spin drier . an nsg film ( second insulating film ) 17 having a thickness of 500 nm is deposited on the whole surface by the atmospheric pressure cvd method ( fig2 e ). thereafter , a photoresist film having a thickness of 1 μm is coated on the nsg film 17 by the spin coating to form a film . next , the photoresist film is exposed by using the contact hole formation photomask 16 and developed , so that a resist pattern 18 for contact hole etching is formed ( fig2 f ). subsequently , contact hole etching is carried out by using the formed resist pattern 18 as a mask ( fig2 g ). for example , in the case where the etching is carried out by an rie apparatus under conditions of rf power = 780 w , pressure = 225 mtorr , etching gases and their flow rates of cf 4 / chf 3 / ar = 27 / 27 / 400 sccm , it becomes necessary that the etching time is about 200 seconds . in this case , the opening area of the previously removed alumina film is larger than the actual contact hole diameter and includes the area for all fluctuations caused in the process , such as the case where the alignment at the time of photolithography is shifted or the contact hole diameter becomes large by the etching , so that the alumina film is not exposed during the contact hole etching . finally , the resist pattern 18 after the etching is removed ( fig2 h ). as a removing method , for example , ashing by o 2 , washing by organic solvent , sulfuric acid boil , or combination of those can be cited . in the example 1 , although two photomasks become necessary for the formation of the resist patterns 15 and 18 , since the alumina film 14 and the nsg film 19 can be simultaneously etched using the resist pattern 15 , the steps can be decreased . besides , in the example 2 , although the alumina film 14 and the nsg film 19 are etched by the separate steps , the resist patterns 15 and 18 can be formed by one photomask . in accordance with a semiconductor device to be manufactured and for the purpose of reducing the cost , the methods of the examples 1 and 2 can be suitably selected . besides , in any method of the examples 1 and 2 , it is possible to prevent the deposited material from adhering to the si substrate at the time of subsequent contact hole formation by removing the deposited material produced from alumina after etching of the alumina film . as a result , it is possible to prevent the phenomenon in which the contact resistance becomes unstable by adhesion of the deposited material to the si substrate . as described above , since a part of the barrier film , which has such a diameter that the alumina film is not exposed at the time of contact etching , is removed by dry etching in advance , an excellent contact hole without poorness and defects caused by the deposited material from the barrier film can be formed .	7
a number of runs were carried out wherein indene was nitrated with concentrated nitric acid and isolated nitroindenes were subsequently oxidized with dilute nitric acid . the indene employed was composed of a mixture of 91 weight per cent indene , six weight per cent indane and three weight per cent other unidentified hydrocarbons of similar volatility . indene was added slowly , with stirring , to concentrated nitric acid at a selected temperature level . upon completion of the addition , stirring was continued for 0 . 5 hour . the product mixture was poured onto ice and the resulting mixture was diluted further with water . the nitroindenes , which precipitated as tan granular solids , were separated by vacuum filtration , washed with water and air dried . nitric acid consumed was determined by titration of aliquots of the filtrate and washings with a standard base . in the oxidation step , the nitroindenes so obtained were combined with dilute nitric acid in a one - liter , stainless steel autoclave , the autoclave pressured with about 50 pounds per square inch gauge ( 3 . 5 kilograms per square centimeter ) of nitrogen and the mixture heated , with stirring , to the desired temperature over a period of about one hour . heating and stirring at a selected temperature level was continued for a selected period of time . maximum pressure during oxidation was controlled by an automatic relief device . after cooling the system to ambient temperature over a period of 0 . 5 hour , pressure was released , the system flushed with nitrogen and the product mixture , an aqueous solution containing a very small amount of suspended insoluble material , was siphoned from the autoclave . the insolubles were separated by vacuum filtration and the product isolated from the clarified product solution as a non - volatile residue by vacuum rotary evaporation . the original residue was thrice combined with water ( 200 milliliters ) and reevaporated to complete removal of excess nitric acid . nitric acid consumed in the oxidation step was determined by titration of aliquots of the evaporation liquids with standard base . the composition of the product was determined by gas chromatographic analysis of an acetone solution of a sample of the product using a 6 - feet by 1 / 8 - inch stainless steel column packed with 10 per cent ov - 1 on 80 / 100 mesh gas chrom q and operated isothermally at 175 ° c . a standard solution of a mixture of 4 - nitro - o - phthalic acid and 3 - nitro - o - phthalic acid in acetone was used as a reference . under conditions of analysis , nitrophthalic acids and phthalic acids dehydrate . peaks produced by the corresponding anhydrides appeared on the chromatograms . the data obtained are summarized below in table i . table i__________________________________________________________________________run no . 1 2 3 4__________________________________________________________________________nitration . sup . ( a ) hno . sub . 3 concentration , weight per cent 90 90 90 70hno . sub . 3 . sup . ( b ) : grams ( mols ) 162 . 5 ( 2 . 579 ) 162 . 5 ( 2 . 579 ) 162 . 5 ( 2 . 579 ) 164 . 0 ( 2 . 603 ) indene : grams ( mols . sup . ( c )) 30 ( 0 . 258 ) 30 ( 0 . 258 ) 30 ( 0 . 258 ) 30 ( 0 . 258 ) time , hours . sup . ( d ) 4 . 5 3 . 3 3 . 5 3 . 5temperature , ° c . - 6 ± 2 10 ± 2 25 ± 3 25 ± 3hno . sub . 3 consumed , mols 0 . 39 0 . 384 0 . 433 0 . 425hno . sub . 3 consumed , mol per mol of indene 1 . 51 1 . 488 1 . 678 1 . 65product : grams ( per cent . sup . ( e )) 44 . 8 ( 94 . 1 ) 47 . 1 ( 99 . 8 ) 46 . 8 ( 94 . 7 ) 34 . 6 ( 70 . 5 ) oxidationnitroindenes ( ni ): grams ( mols . sup . ( e )) 30 ( 0 . 154 ) 45 ( 0 . 246 ) 45 ( 0 . 235 ) 34 . 2 ( 0 . 180 ) hno . sub . 3 concentration , weight per cent 25 25 25 25hno . sub . 3 . sup . ( b ) : grams ( mols ) 94 . 8 ( 1 . 50 ) 125 . 2 ( 1 . 988 ) 125 . 2 ( 1 . 988 ) 113 . 5 ( 1 . 80 ) mols hno . sub . 3 per mols ni 9 . 7 8 . 1 8 . 5 10time , hours 1 . 0 1 . 0 1 . 0 1 . 5temperature , ° c . 180 ± 1 183 ± 1 186 ± 1 184 ± 1pressure , pounds per square inch gauge 250 ( 17 . 6 ) 275 ( 19 . 3 ) 275 ( 19 . 3 ) 250 ( 17 . 6 )( kilograms per square centimeter ) hno . sub . 3 consumed , mols 0 . 82 1 . 114 1 . 013 0 . 562hno . sub . 3 consumed per mol ni 5 . 32 4 . 53 4 . 31 3 . 13product : grams ( per cent . sup . ( e ) ( f )) 33 . 1 ( 101 . 8 ) 48 . 2 ( 92 . 9 ) 46 . 5 ( 93 . 8 ) 32 . 7 ( 86 . 1 ) analysis . sup . ( g ), per cent 4 / 3 / p / o 93 . 0 / 2 . 8 / 0 . 7 / 3 . 5 91 . 1 / 2 . 9 / 0 . 9 / 7 . 1 86 . 9 / 3 . 0 / 0 . 9 / 9 . 2 32 . 5 / 2 . 8 / 58 . 6 / 6 . 1__________________________________________________________________________ . sup . ( a ) at atmospheric pressure . sup . ( b ) as 100 per cent hno . sub . 3 . sup . ( c ) assuming 100 per cent . sup . ( d ) includes 0 . 5 hour post addition stirring period . sup . ( e ) calculated assuming all hno . sub . 3 consumed goes to form mono - or dinitroindenes . sup . ( f ) weight per cent , calculated versus maximum mols of 4 - nitro - o - phthalic acid possible using assumed molecular weight of nitroindenes charged . sup . ( g ) mol per cent 4 - nitro - o - phthalic acid / 3 - nitro - o - phthalic acid / phthalic acid / other ( unknowns ) by glc . a number of runs were carried out using indene of the same composition as above wherein indene was nitrated with concentrated nitric acid and the nitroindenes produced were subsequently oxidized without isolation . the total nitrated product was diluted with water to obtain a desired nitric acid concentration therein and this mixture was subjected to oxidation under selected conditions . thus , excess nitric acid present in the nitration was used as oxidant in the second stage . more specifically , indene was added slowly , with stirring , to concentrated nitric acid while maintaining a selected temperature level . stirring was continued for 0 . 5 hour after completion of the addition . the product mixture was poured onto a weighted amount of ice and the resulting mixture further diluted with a measured amount of water . this mixture was charged to the autoclave for oxidation along with enough water to achieve the desired nitric acid concentration . the amount of dilution water added to the nitration product was calculated knowing how much nitric acid was consumed in the nitration step from earlier , parallel runs wherein nitroindenes were isolated . oxidation , oxidation product recovery and product isolation proceeded as in runs nos . 1 to 4 . the total amount of nitric acid consumed in the nitration and oxidation steps was determined by titration of aliquots of evaporation liquids with standard base . nitric acid consumed in the nitration step was assumed to be equal to that consumed in earlier , parallel runs wherein nitroindenes were isolated . nitric acid consumed in the oxidation stage was determined by difference . the data obtained are summarized below in table ii . table ii__________________________________________________________________________run no . 5 6 7 8 9 10__________________________________________________________________________nitration . sup . ( a , b ) indene , grams ( mols . sup . ( c )) 30 ( 0 . 258 ) 30 ( 0 . 258 ) 30 ( 0 . 258 ) 30 ( 0 . 258 ) 30 ( 0 . 258 ) 30 ( 0 . 258 ) mols hno . sub . 3 per mol of indene 10 10 10 10 10 10 time , hours . sup . ( d ) 3 . 2 3 . 3 3 . 2 3 . 5 3 . 4 3 . 3 temperature , ° c . - 10 ± 2 - 10 ± 2 - 10 ± 2 10 ± 2 10 ± 2 10 ± 2 hno . sub . 3 consumed , mols 0 . 387 0 . 387 0 . 387 0 . 400 0 . 400 0 . 400 hno . sub . 3 consumed , mol per mol of indene 1 . 5 1 . 5 1 . 5 1 . 55 1 . 55 1 . 55 product : grams ( per cent . sup . ( e )) 47 . 4 ( 100 ) 47 . 4 ( 100 ) 47 . 4 ( 100 ) 48 . 0 ( 100 ) 48 . 0 ( 100 ) 48 . 0 ( 100 ) oxidation nitroindenes ( ni ) grams ( mols ) 47 . 4 ( 0 . 258 ) 47 . 4 ( 0 . 258 ) 47 . 4 ( 0 . 258 ) 48 . 0 ( 0 . 258 ) 48 . 0 ( 0 . 258 ) 48 . 0 ( 0 . 258 ) hno . sub . 3 concentration , weight per cent 25 25 25 25 25 25 hno . sub . 3 . sup . ( f ) : grams ( mols ) 138 . 1 ( 2 . 192 ) 138 . 1 ( 2 . 192 ) 138 . 1 ( 2 . 192 ) 137 . 3 ( 2 . 179 ) 137 . 3 ( 2 . 179 ) 137 . 3 ( 2 . 179 ) mol hno . sub . 3 per mol ni 8 . 5 8 . 5 8 . 5 8 . 4 8 . 4 8 . 4 time , hours ; temperature , ° c . 2 . 0 ; 166 ± 1 1 . 0 ; 175 ± 1 1 . 0 ; 185 ± 1 1 . 0 ; 165 ± 1 2 . 0 ; 166 ± 1 1 . 0 ; 175 ± 1 pressure , pounds per sqaure inch gauge 255 ( 17 . 9 ) 265 ( 18 . 6 ) 260 ( 18 . 3 ) 250 ( 17 . 6 ) 250 ( 17 . 6 ) 250 ( 17 . 6 ) ( kilograms per square centimeter ) hno . sub . 3 consumed , mols 1 . 155 1 . 116 1 . 340 1 . 044 1 . 172 1 . 122 hno . sub . 3 consumed , mols per mol ni 4 . 48 4 . 43 5 . 19 4 . 05 4 . 54 4 . 35 aqueous acid insolubles , grams 0 . 6 0 . 9 0 . 5 2 . 8 0 . 5 0 . 6 product , grams , ( per cent . sup . ( g )) 52 . 8 ( 96 . 9 ) 51 . 1 ( 93 . 8 ) 55 . 9 ( 102 . 5 ) 49 . 2 ( 90 . 3 ) 51 . 8 ( 95 . 0 ) 52 . 5 ( 96 . 3 ) analysis . sup . ( h ) : per cent 4 / 3 / p / o 82 . 9 / 2 . 1 / 84 . 6 / 2 . 5 / 86 . 0 / 2 . 3 / 84 . 9 / 2 . 0 / 89 . 2 / 2 . 8 / 85 . 2 / 2 . 3 / 0 . 5 / 14 . 5 0 . 5 / 12 . 4 1 . 2 / 10 . 5 0 . 7 / 12 . 4 0 . 6 / 7 . 4 0 . 6 / 11 . 9nitration and oxidation hno . sub . 3 consumed , mols 1 . 542 1 . 503 1 . 727 1 . 444 1 . 572 1 . 522 hno . sub . 3 consumed , mols per mol of indene 5 . 98 5 . 83 6 . 69 5 . 60 6 . 09 5 . 90__________________________________________________________________________run no . 11 12 13 14 15 16__________________________________________________________________________nitration . sup . ( a , b ) indene , grams ( mols . sup . ( c )) 30 ( 0 . 258 ) 37 . 5 ( 0 . 323 ) 30 ( 0 . 258 ) 25 ( 0 . 215 ) 37 . 5 ( 0 . 323 ) 30 ( 0 . 258 ) mols hno . sub . 3 per mol of indene 10 8 10 12 8 10 time , hours . sup . ( d ) 3 . 5 3 . 0 3 . 2 3 . 4 3 . 4 3 . 2 temperature , ° c . 10 ± 2 25 ± 4 25 ± 5 25 ± 5 26 ± 3 26 ± 3 hno . sub . 3 consumed , mols 0 . 400 0 . 533 0 . 426 0 . 355 0 . 533 0 . 426 hno . sub . 3 consumed , mol per mol of indene 1 . 55 1 . 65 1 . 65 1 . 65 1 . 65 1 . 65 product : grams ( per cent . sup . ( e )) 48 . 0 ( 100 ) 61 . 5 ( 100 ) 49 . 1 ( 100 ) 40 . 9 ( 100 ) 61 . 5 ( 100 ) 49 . 1 ( 100 ) oxidation nitroindenes ( ni ) grams ( mols ) 48 . 0 ( 0 . 258 ) 61 . 5 ( 0 . 323 ) 49 . 1 ( 0 . 258 ) 49 . 9 ( 0 . 215 ) 61 . 5 ( 0 . 323 ) 49 . 1 ( 0 . 258 ) hno . sub . 3 concentration , weight per cent 25 25 25 25 25 25 hno . sub . 3 . sup . ( f ) : grams ( mols ) 137 . 3 ( 2 . 179 ) 128 . 9 ( 2 . 046 ) 135 . 6 ( 2 . 153 ) 140 . 1 ( 2 . 224 ) 128 . 9 ( 2 . 046 ) 135 . 6 ( 2 . 153 ) mol hno . sub . 3 per mol ni 8 . 4 6 . 3 8 . 3 10 . 3 6 . 3 8 . 3 time , hours ; temperature , ° c . 1 . 0 ; 185 ± 1 1 . 0 ; 185 ± 1 1 . 0 ; 185 ± 1 1 . 0 ; 184 ± 1 2 . 0 ; 184 ± 1 2 . 0 ; 184 ± 1 pressure , pounds per square inch gauge 255 ( 17 . 9 ) 250 ( 17 . 6 ) 250 ( 17 . 6 ) 250 ( 17 . 6 ) 255 ( 17 . 9 ) 250 ( 17 . 6 ) ( kilograms per square centimeter ) hno . sub . 3 consumed , mols 1 . 295 1 . 524 1 . 308 1 . 181 1 . 502 1 . 246 hno . sub . 3 consumed , mols per mol ni 5 . 02 4 . 72 5 . 07 5 . 49 4 . 65 4 . 83 aqueous acid insolubles , grams 0 . 3 n . d .. sup . ( i ) n . d . n . d . n . d . n . d . product , grams , ( per cent . sup . ( g )) 51 . 1 ( 93 . 8 ) 62 . 7 ( 92 . 1 ) 50 . 3 ( 92 . 3 ) 43 . 4 ( 95 . 6 ) 68 . 1 ( 89 . 0 ) 54 . 5 ( 92 . 5 ) analysis . sup . ( h ) : per cent 4 / 3 / p / o 82 . 9 / 2 . 5 / 83 . 2 / 2 . 9 / 84 . 0 / 2 . 6 / 80 . 9 / 2 . 7 / 81 . 7 / 3 . 0 / 76 . 8 / 3 . 6 / 0 . 5 / 14 . 1 1 . 8 / 12 . 1 0 . 9 / 12 . 5 0 . 6 / 15 . 8 1 . 7 / 13 . 6 1 . 6 / 18 . 0nitration and oxidation hno . sub . 3 consumed , mols 1 . 695 2 . 057 1 . 734 1 . 536 2 . 035 1 . 671 hno . sub . 3 consumed , mols per mol of indene 6 . 57 6 . 37 6 . 72 7 . 14 6 . 30 6 . 48__________________________________________________________________________ underlined numbers are estimated values . sup . ( a ) at atmospheric pressure . sup . ( b ) each run used 180 . 6 grams of 90 per cent aqueous nitric acid . sup . ( c ) as 100 per cent . sup . ( d ) includes 0 . 5 hour post addition stirring period . sup . ( e ) calculated weight assuming all hno . sub . 3 consumed goes to mono - or dinitroindenes . sup . ( f ) as 100 per cent hno . sub . 3 . sup . ( g ) weight per cent , relative to mols indene charged . sup . ( h ) mol per cent 4 - nitro - o - phthalic acid / 3 - nitro - o - phthalic acid / phthalic acid / other ( unknowns ) by glc . . sup . ( i ) not determined . an additional run was completed wherein nitration was carried out with a mixture of nitric acid and sulfuric acid . the same indene used above was added slowly , with stirring , to a mixture of concentrated nitric and sulfuric acids maintained at a selected temperature level . stirring was continued for 0 . 5 hour after completion of the addition . the product mixture was poured onto ice . the nitroindenes were isolated from the mixture and subsequently oxidized as described above under selected conditions . still an additional run was carried out wherein polyindene was nitrated with concentrated nitric acid and the nitropolyindenes produced subsequently oxidized without isolation . polyindene used was prepared by the acid - catalyzed polymerization of indene . indene in the amount of 50 grams was added slowly , with stirring , to 85 per cent aqueous sulfuric acid ( 422 grams as 100 per cent sulfuric acid ) over a two - hour period while maintaining a temperature of 10 ± 2 ° c . and the resulting mixture was stirred at 10 ° c . for 0 . 3 hour . polyindene developed as a granular precipitate during the addition period . the product mixture was poured onto ice , and the resulting mixture was further diluted with water and the insoluble polyindenes were separated by vacuum filtration , washed with water until the washings were neutral to litmus and air dried . the dried product , amounting to 49 . 5 grams , was washed with hexane to remove occluded monomer , resulting in the production of 43 . 4 grams of purified polyindenes . the polyindenes were characterized by elemental analysis and gel permeation chromatograhy . gel permeation chromatography revealed the polymer to contain a molecular weight distribution from about 230 ( dimer ) to about 10 , 000 ( about 86 indene units ). about 50 weight per cent of the sample contained from two to six indene units and the remainder from six to 86 units polyindene was nitrated by adding the polymer slowly , while stirring , to concentrated nitric acid while maintaining a selected temperature level . after stirring for 0 . 5 hours , the product mixture was poured onto a weighed amount of ice and the resulting mixture was further diluted with a measured volume of water . this mixture was charged to the autoclave for oxidation along with enough water to achieve the desired nitric acid concentration . oxidation , oxidation product recovery and product isolation proceeded as indicated above . the results obtained from the latter two runs are summarized below in table iii . table iii__________________________________________________________________________run no . 17 18 . sup . ( a ) __________________________________________________________________________nitration . sup . ( b , c ) 96 . 5 weight per cent aqueous h . sub . 2 s . sub . 4 o , grams 184 -- indene : grams ( mols ) 30 . sup . ( d ) ( 0 . 258 ). sup . ( e ) -- polyindene : grams ( mols ) -- 30 ( 0 . 258 . sup . ( f )) time , hours 3 . 2 3 . 5 temperature , ° c . 10 ± 3 10 ± 2 hno . sub . 3 consumed , mols 0 . 457 0 . 400 hno . sub . 3 consumed , mol per mol of indene 1 . 77 1 . 55 product : grams ( per cent . sup . ( g )) 50 . 6 ( 100 ) 48 . 0 ( 100 ) oxidation nitroindenes ( ni ): grams ( mols ) 48 ( 0 . 245 ) 48 ( 0 . 258 ) hno . sub . 3 concentration , weight per cent 25 25 hno . sub . 3 . sup . ( h ) : grams ( mols ) 125 . 2 ( 1 . 987 ) 137 . 3 ( 2 . 179 ) mol hno . sub . 3 per mol ni 8 . 1 8 . 4 time , hours 1 . 0 1 . 0 temperature , ° c . 175 ± 1 175 ± 1 pressure , pounds per square inch gauge 260 ( 18 . 3 ) 260 ( 18 . 3 ) ( kilograms per square centimeter ) hno . sub . 3 consumed , mols 1 . 231 1 . 169 hno . sub . 3 consumed mol per mol of ni 5 . 03 4 . 53 aqueous acid insolubles , grams 0 . 4 1 . 0 product : grams ( per cent . sup . ( i )) 50 . 8 ( 98 . 2 ) 50 . 4 ( 92 . 5 ) analysis . sup . ( j ) : per cent 4 / 3 / p / o 36 . 5 / 0 . 7 / 80 . 2 / 1 . 6 / 1 . 1 / 61 . 7 0 . 5 / 17 . 7nitration and oxidation hno . sub . 3 consumed mols -- 1 . 569 hno . sub . 3 consumed , mols per mol of indene 6 . 80 6 . 08__________________________________________________________________________ figures underlined are estimated values . sup . ( a ) tandem nitration / oxidation - no nitroindenes isolation . sup . ( b ) at ambient pressure . sup . ( c ) each run consumed 180 . 6 grams of 90 per aqueous hno . sub . 2 = 162 . grams , 2 . 579 mols hno . sub . 3 . sup . ( d ) 91 per cent . sup . ( e ) assuming 100 per cent . sup . ( f ) indene equivalents . sup . ( g ) calculated assuming all hno . sub . 3 goes to mono - or dinitroindene . sup . ( h ) as 100 per cent . sup . ( i ) weight per cent , relative to mols of indene in system . sup . ( j ) mol per cent 4 - nitro - o - phthalic acid / 3 - nitro - o - phthalic acid / phthalic and / other ( unknown ) by glc . an additional run was carried out wherein 1 , 2 - dihydronaphthalene was nitrated with concentrated nitric acid and the nitrodihydronaphthalenes produced subsequently oxidized without isolation . the 1 , 2 - dihydronaphthalene employed was composed of a mixture of 97 weight per cent 1 , 2 - dihydronaphthalene , about one weight per cent each of tetrahydronaphthalene , 1 , 4 - dihydronaphthalene and naphthalene , and traces of other unidentified hydrocarbons of similar volatility . nitration , oxidation , oxidation product recovery and product isolation wre carried out substantially the same as in run no . 10 described above . the results obtained are summarized below in table iv . table iv______________________________________run no . 19 . sup . ( a ) ______________________________________nitration . sup . ( b ) dihydronaphthalene , grams ( mols . sup . ( c )) 30 ( 0 . 230 ) mols hno . sub . 3 per mol of dihydronaphthalene 11 . 2 time , hours . sup . ( d ) 3 . 3 temperature , ° c . 10 ± 3 hno . sub . 3 consumed , mols 0 . 3565 hno . sub . 3 consumed , mol per mol of dihydronaphthalene 1 . 55 product : grams ( per cent . sup . ( e )) 46 . 0 ( 100 ) oxidation nitrodihydronaphthalenes ( ndn ), grams ( mols ) 46 . 0 ( 0 . 230 ) hno . sub . 3 concentration , weight per cent 25 . 7 hno . sub . 3 . sup . ( f ) : grams ( mols ) 140 . 0 ( 2 . 222 ) mol hno . sub . 3 per mol ndn 9 . 7 time , hours 1 . 0 temperature , ° c . 175 ± 1 pressure , pounds per square inch gauge 265 ( 18 . 6 ) ( kilograms per square centimeter ) hno . sub . 3 consumed , mols 1 . 192 hno . sub . 3 consumed , mols per mol ndn 5 . 18 aqueous acid insolubles , grams 0 . 7 product , grams ( per cent . sup . ( g ) 41 . 7 ( 86 . 0 ) analysis . sup . ( h ) : per cent 4 / 3 / p / o 68 . 4 / 6 . 0 / 3 . 5 / 22 . 1nitration and oxidation hno . sub . 3 consumed , mols 1 . 548 hno . sub . 3 consumed , mols per mol of dihydronaphthalene 6 . 73______________________________________ underlined numbers are estimated values . sup . ( a ) tandem nitration / oxidation - no dihydronaphthalenes isolation . sup . ( b ) used 180 . 6 grams of 90 per cent nitric acid = 162 . 5 grams , 0 . 257 mols hno . sub . 3 . sup . ( c ) as 100 per cent . sup . ( d ) includes 0 . 5 hour post addition stirring period . sup . ( e ) calculated weight assuming all hno . sub . 3 consumed goes to mono - or dinitrodihydronaphthalenes . sup . ( f ) as 100 per cent hno . sub . 3 . sup . ( g ) weight per cent , relative to mols dihydronaphthalene charged . sup . ( h ) mol per cent 4 - nitro - o - phthalic acid / 3 - nitro - o - phthalic acid / phthalic acid / other ( unknowns ) by glc . obviously , many modifications and varitions of the invention , as hereinabove set forth , can be made without departing from the spirit and scope thereof , and therefore only such limitations should be imposed as are indicated in the appended claims .	2
referring to fig1 , an example gauge assembly 10 includes a dial face 12 and a pointer assembly 14 . the pointer assembly 14 includes an outer pointer portion 16 and an inner portion 18 . the pointer assembly 14 rotates about an axis 20 and is driven by a motor 22 . the example pointer assembly 14 is only one configuration possible . although the illustrated example pointer assembly includes an inner and outer portion , other separately lightable pointer configurations are possible within the scope of this disclosure . referring to fig2 , the outer portion 16 is illuminated by a first light emitting diode ( led ) 38 and the inner portion 18 is illuminated by a second led 40 . the first led 38 is mounted on a main circuit board 24 . the main circuit board 24 is disposed below the dial face 12 and provides a mounting location for the motor 22 . the motor 22 includes a shaft 25 to which a mount 15 for the pointer assembly 14 is mounted . the main circuit board 24 includes a connector socket 28 into which a connector pin 30 is received . the connector pin 30 extends downward from an auxiliary circuit board 26 . the auxiliary circuit board 26 is mounted above the pointer assembly 14 and held in place by a light support 36 . the light support 36 supports the auxiliary circuit board 26 that includes the second led 40 . the second led 40 is disposed substantially along the central axis 20 . the light mount 36 includes a light housing that directs light from the led 40 downwardly onto the pointer assembly 14 and dial face 12 . the inner portion 18 includes a reflective surface 21 that directs light from the second led 40 through the inner portion 18 . because the second led 40 is disposed along the central axis 40 light is directed into the central portion 18 of the pointer assembly 14 . the first led 38 mounted on the main circuit board is mounted a distance from the axis 25 to illuminate the outer portion 16 of the pointer 14 . the outer portion 16 includes a second reflective surface 23 that directs light from the first led through the outer portion 16 . the inner and outer portions 18 , 16 of the pointer assembly 14 can be illuminated independently with the separate leds 38 , 40 . the first led 38 may be of a different color or intensity than the second led 40 to provide a desired color and illumination scheme . alternatively , different colors for the inner and outer portions 18 , 16 of the pointer assembly 14 can be provided with coatings of different colors . further , a worker with the benefit of this disclosure would understand how to sequentially or preferentially illuminate specific portions of the pointer assembly to provide the desired aesthetic appearance . referring to fig3 , an exploded view of the dial gauge assembly 10 is illustrated . the exploded view shows the cap 42 that is placed over the auxiliary circuit board 26 . the auxiliary circuit board 26 in turn provides a mounting location for the led 40 . the led 40 is disposed along the central axis 20 . the auxiliary circuit board 26 includes connector pins 30 that extend through the light support 36 and engage connectors 28 on the main circuit board 24 . the main circuit board 24 provides a mounting location for the first led 38 . in this example , three leds 38 are illustrated , however any number of leds as are required to provide the desired uniform illumination and brightness of the outer pointer portion 16 may be utilized . the dial face 12 is mounted within a housing 32 that is also mounted adjacent the main circuit board 24 . the pointer assembly 14 is mounted on the pointer mount 15 which is in turn mounted to the shaft 25 of the motor 22 . rotation of the shaft 25 rotates the pointer assembly 14 about the axis 20 to indicate a desired perimeter on the dial face 12 . referring to fig4 , an instrument cluster assembly 50 includes several gauge assemblies including the dial face 12 . the outer portion 16 points to an outer scale 19 and the inner portion 18 points to an inner scale 17 . the example gauge assembly 10 is utilized as a speedometer that includes the outer scale 19 in miles per hour ( mph ) and the inner scale 17 in kilometers per hour ( kph ). the space between the inner portion 18 and the outer portion 16 provides for a clear view of the inner scale 17 which is in this example is the kph scale . the instrument cluster illustrated in fig4 is in a non - illuminated condition . in this condition neither of the pointer portions 16 , 18 are illuminated . the instrument cluster 50 also includes auxiliary gauges with auxiliary dial faces 14 ′, 14 ″. these dial faces also includes pointer assemblies 14 ′, 14 ″. the dial face 46 includes two pointer assemblies 14 ′ that each have inner and outer portions 16 ′ and 18 ′. another dial gauge assembly 44 includes a single pointer assembly 14 ″. the dial face 44 provides an indication of engine speed ( rpm ). the dial gauge 46 provides an indication of fuel level and also of coolant temperature . as appreciated , the example cluster assembly 50 includes several gauges that communicate information to a vehicle operator . a worker with the benefit of this disclosure would understand that other gauges and information that are commonly equipped in vehicles to provide the communicating information to an operator could also utilize the pointer assemblies of this invention . referring to fig5 , the pointer assemblies 14 , 14 ′, 14 ″ are illustrated in an illuminated condition . in the example illuminated condition the inner pointer portions 18 ′ and 18 ″ are illuminated in a first color 52 ( indicated by the dark shading ) and the outer portions 16 , 16 ′, 16 ″ are illuminated in a second color 54 ( indicated by the lighter shading ). the independent illumination of different portions of the pointer assemblies 14 , 14 ′, 14 ″ provide for different lighting schemes as may be desired . although a preferred embodiment of this invention has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this invention . for that reason , the following claims should be studied to determine the true scope and content of this invention .	6
the present invention will now be fully explained in connection with embodiments thereof with reference to the accompanying drawings . incidentally , in the drawings , the same elements are designated by the same reference numerals . [ 0025 ] fig1 and 2 show a wet multi - plate clutch according to an embodiment of the present invention . fig1 is a sectional view taken along the line 1 - 1 in fig2 and fig2 is a front view of the clutch . in a wet multi - plate clutch 1 , a clutch case 2 and a hub ( not shown ) are disposed on a same axis . splines 6 are formed on an inner periphery of an outer cylinder 21 of the clutch case 2 , and separator plates 4 are provided on the splines 4 and friction plates 5 are provided on splines formed on an outer periphery of the hub ( not shown ), and the separator plate and the friction plates are arranged alternately . a backing plate 8 having an axial thickness greater than those of the separator plates 4 is disposed in an axial open end of the clutch case 2 . these friction engagement elements are prevented from being dislodging and are restricted for axial movement by means of a stop ring 18 . on the other hand , a piston 30 is disposed adjacent to an axial closed end of the clutch case 2 . the piston 30 is provided with a wave spring 40 disposed in a surface ( of the piston ) contacting with the separator plate ( friction engagement element ) 4 . the piston is shifted to the left ( fig1 ) by supplying pressurized oil to an oil chamber 13 defined between the piston and an inner wall of the clutch case 2 . the pressurized oil is supplied through an oil hole 17 . incidentally , in order to prevent leak of the operating pressurized oil , a seal ring 33 is provided on the piston 30 and a seal 16 is provided on an inner cylinder 22 of the clutch case 2 . further , when the pressurized oil is released from the oil chamber 13 , the piston 30 is returned by a repelling force of a return spring 14 , thereby releasing the friction engagement elements . the return spring 14 is supported by a snap ring 19 through a canceller 11 . [ 0028 ] fig3 and 4 show a first embodiment of the present invention . fig3 is a front view of the piston 30 and fig4 is an axial partial sectional view of the piston 30 . as mentioned above , the piston is provided at its outer periphery with the seal ring 33 . further , the piston is also provided at its outer periphery with a substantially annular urging surface 31 opposing to the friction engagement element such as the separator plate 4 in an axial direction and adapted to apply an axial urging force . further , at an inner periphery side of the piston , there is provided a substantially annular surface 34 having an axial length smaller than that of the urging surface 31 ( i . e ., height smaller than that of the urging surface ). a substantially annular recessed groove 32 opened in a confronting relationship to the separator plate 4 is provided between the urging surface 31 and the surface 34 . a substantially annular wave spring 40 is disposed in the recessed groove 32 . as apparent from fig4 the wave spring 40 and the urging surface 31 can contact with the separator plate 4 , but the surface 34 does not contact with the separator plate 4 . with this arrangement , surface pressure distribution of a lockup load is limited to a small area , with the result that resonance is hard to occur . [ 0031 ] fig5 shows a second embodiment of the present invention . fig5 is an enlarged view showing a part of the urging surface and the wave spring 40 . in this second embodiment , contrary to the first embodiment , the urging surface 31 is provided at an inner periphery side of the recessed groove 32 , and a surface 35 at an outer periphery side does not contact with the separator plate 4 . also in this second embodiment , similar to the first embodiment , the surface pressure distribution of the lockup load is limited to the small area , with the result that the resonance is hard to occur . [ 0032 ] fig6 and 7 show third and fourth embodiments of the present invention , respectively . in the third embodiment shown in fig6 an urging surface 36 is provided at an outer diameter side of the recessed groove 32 and an axial sectional configuration of the urging surface is semi - circular . with this configuration , the urging surface is line - contacted with the friction engagement element to greatly reduce a contact area , thereby limiting the surface pressure distribution of the lockup load to a smaller area , with the result that the resonance is hard to occur . on the other hand , in the fourth embodiment shown in fig7 an urging surface 37 is provided at an inner diameter side of the recessed groove 32 and an axial sectional configuration of the urging surface is substantially triangular , and a tip end is chamfered . also in this embodiment , a contact area to the friction engagement element can be reduced , thereby limiting the surface pressure distribution of the lockup load to a small area , with the result that the resonance is hard to occur . [ 0034 ] fig8 and 9 show the wave spring used in the various embodiments in detail . fig8 is a front view and fig9 is an axial sectional view . the substantially annular wave spring 40 has mountain portions 41 and valley portions 42 alternately along a circumferential direction , so that , when these mountain portions 41 and valley portions 42 are urged to be flattened , an elastic force is generated . a comparison test regarding the conventional wet multi - plate clutch and the wet multi - plate clutch according to the present invention was carried out . the test was performed in such a manner that , after the friction plates and inertia ( inertia member ) are rotated at a predetermined number of revolutions by means of an electric motor , a predetermined lockup load is applied to the friction engagement elements immediately after the driving from the electric motor is interrupted . it was examined how the transmitting torque is changed during a time period from when the lockup load is inputted to when the number of revolutions becomes zero . atf ( automatic transmission fluid ) is used as lubricating oil . test conditions are as follows : [ 0044 ] fig1 shows the test result of the conventional wet multi - plate clutch , fig1 shows the test result of the wet multi - plate cultch according to the first embodiment of the present invention , and fig1 shows the test result of the wet multi - plate clutch according to the second embodiment of the present invention . graphs indicate the lockup load and the transmission torque . here , observing waveforms of the transmitting torques , it can be ascertained that , in the conventional case , amplitude of the torque , i . e ., shudder is generated during a time period from when the lockup load is inputted to when the number of revolutions become zero . however , in the first and second embodiments of the present invention , it can clearly be recognized that there is substantially no shudder . the present invention is carried out as the above - mentioned embodiments and achieves the effect that a wet multi - plate clutch which has a small axial dimension and in which a shudder phenomenon can be suppressed .	5
the present application provides a new approach to the preparation of strips that are part of identifiable groups . these groups may be based on different geographical regions , they may be used to differentiate manufacturers ( for example where one brand uses multiple manufacturing sources ) or they may be used to differentiate the time of manufacture , thus becoming a type of hard - coded expiration date . in addition , the approach of the invention can be used to distinguish a strip designed for one type of analyte ( such as glucose ) from another type of analyte ( such as cholesterol ) such that a multi - function meter will perform the correct analysis with information provided from the strip , not the user . a further benefit of the present invention is that the encoding for identification of the strips can be applied after a quality control check has been run such that strips can be directed into groups as a final step in manufacturing , rather than requiring a separate manufacturing process for each group of strips . thus , in one example , strips that meet very high quality control standards can be identified in the method of the invention for use with a meter that does not require a calibration code ( a no - code meter ), while strips manufactured in the same initial process that do not meet the rigid standards for uniformity but are otherwise acceptable can be identified for use in meters that require a calibration code for the particular lot of the test strips . this eliminates wastage , thus controlling the costs of the strips . uniformity of test strips within a lot is an example of a “ specification ” on which assignment to groups can be based . once the strips have been assigned to a group , the strips are packaged and may be labeled to indicate the characteristics of the group . for example , the group may be labeled to indicate type of analyte , type of meter , whether a calibration code is necessary , and / or geographic region . the invention operates by using notches or holes cut into defined locations in a test strip to interrupt initially formed electrical connections . fig1 shows a connection end of a test strip prior to the formation of notches . in the illustrated embodiment , there are 5 points on the strip ( labeled 1 - 5 ) where electrical contact can be made via 5 pins from the strip port connector ( spc , not shown ). in actual practice there can be more contact points , or fewer contact points than the five shown here . in preferred embodiments , the contact points are arranged in two or more groups , each at a different depth from the end of the test strip . the exact alignment of these rows as a single line is not required , although it may make it easier to design the contacts in the spc . in common usage , the contact points 1 , 2 and 3 also serve as the electrical connectors to for example to working and counter electrodes and a fill detection electrode . the numerals 6 , 7 and 8 in the figure refer to the leads from such structures which may or may not be electrically isolated from one another . for example , leads 6 and 8 can both be in contact with a common electrode or one leg can be in contact with the sample space and an active measurement electrode ( working or counter ) and the other may simply be a conductive region that is not involved in measurement . lead 7 is then in contact with the other of the measurement electrodes . the specific arrangement of the leads is not critical to the present invention . in the figures of this application , the contact points are shown as white squares for clarity . the contact points do not have to be separate structures , however , and are generally just locations on the conductive surface of the test strip that are accessible to probes on the spc . the strip as depicted in fig1 also includes a region of insulating material 10 which separates leads 6 , 7 and 8 from each other , and which partially separate the two rows of contact points . this region is suitably an underlying insulating substrate where the conductive material is not disposed . the presence and / or absence of electrical continuity between electrical contact points on the strip is be probed by the meter to ensure uniqueness of the strip . pairs of points and / or combinations of pairs of points can be used to arrive at strip designs that are unique with respect to the electrical features . fig2 - 9 show different notching patterns that can be used to define different strip identification groups . in fig2 , the notch extends into the insulating region 10 , eliminates contact point 5 and disconnects 3 from every other point on the test strip . thus , measurement of the connection ( for example as a resistance measurement ) between points 1 and 4 would show connection ( low resistance ) while that between 3 and 4 would show no connection ( high / infinite resistance ) comparable to that observed between point 2 and point 4 . point 2 in this figure is always electrically isolated , and therefore measurements using point 2 can , if desired be used as a kind of control indicator of the no connection . tests with a connector where point 3 was eliminated would show comparable yet distinguishable results . in fig3 , the notch eliminates contact point 4 and disconnects 1 from every other point . thus , this test strip would produce results parallel to but different from the results of the strip of fig2 . the notch can be long enough to extend into the insulating region 10 as shown in fig2 and 3 or it can extend only partially into the end of the strip as show in fig4 and 5 . in fig4 , the notch eliminates contact point 5 but does not disconnect 3 from every other contact point . rather , the resistance between 4 and 3 is dependent on the width of the conductive portion , and thus can be used as an indicator of the place and extent of notching . similarly , in fig5 , the notch eliminates contact point 4 but does not disconnect 1 from every other contact point . the resistance between 1 and 5 is dependent on the width of the conductive portion . in fig6 , the notch breaks the continuity between 1 and 5 . in fig7 , the notch breaks the continuity between 4 and 5 . in fig8 , the notch breaks the continuity between 3 and 5 . in fig9 , the notch eliminates points 4 and 5 . in this configuration , one of the leads , for example lead 6 , does not make contact with the sample chamber , it just serves the back of the strip . thus , electrical continuity is maintained between points 1 and 3 . as noted above , alteration in the width of the conductive path is achieved by notching out portions of the strip as a physical removal of the entire thickness of the strip . alternatively , this can be achieved by laser ablation to remove the conductive material between the contact points . thus in a general sense the invention provides a postprocessing step in which conductive material is removed to modify the electrical continuity between selected ones of a plurality of contact points in order to provide for a multiplicity of possible group identifications . the notching can be complete ( 100 %) so as to completely sever the electrical connection such that no current can flow across ( as shown in fig2 ), or it may be incomplete . the lower the width of the conductive path , the greater the resistance . the variable extent of notching ( eg : 25 %, 50 %, 75 %) will alter the resistance correspondingly . one example is shown in ( fig4 ). isolation of one conductive point can be achieved by ablating a ring around that contact point . in the case of an ablated ring around a contact point , the diameter of the ring can be used define the extent of notching so that a large diameter ring ( overlapping both the insulating region and the end of the strip ) will result in complete notching while smaller diameter rings can be used to produce different levels of resistance . similar results can be achieved by cutting holes ( rather than end notches ) that surround one of the contact points . indeed , a hole may be preferred to an end notch in cases of an incomplete cut where variable resistance is utilized , since alignment is not critical as long as the hole does not overlap with either the end of the strip or the insulating region 10 . these techniques provide examples of removal of electrically conductive material . the use of variable resistance adds great versatility to the identification capabilities of the invention because the same structure , with a limited number of contact points , can produce many different and distinguishable configurations each of which can be assessed without any change in the design of the spc . the strips of the invention with conductive material removed to define identifiable groups can be used in combination with mechanical features on the strip and meter to prevent improper insertion ( i . e . upside down ) of the test strip . features of this type are known in the art , for example from u . s . pat . no . 5 , 526 , 120 , which is incorporated herein by reference . in addition , the spc can have a post in a position corresponding to a notch which will be received in the notch when an appropriate strip is inserted in the spc and which will prevent insertion of a strip with a notch in an inappropriate position for the particular meter . where a notch is used that extends to the end of the strip , the presence or absence of a notch in a particular position can also be used to interact with a switch mechanism , which can be used to activate the meter if a correctly coded strip is inserted , or to set the operation of the meter depending on the type of strip ( as indicated by the position of the notch ) inserted . as depicted in fig1 a , the strip port connector may contain a deflectable switch part 100 and a fixed switch contact 101 . when a strip 102 is inserted that is not notched in alignment with this switch , the deflectable switch portion 100 is deflected to make contact with the fixed switch contact 101 as show in fig1 b . when the strip is notched in alignment with the switch , however , no deflection occurs .	6
in carrying out my invention , i provide a main body a for the converter plug , see the exploded view of fig3 as well as fig1 and 2 . this main body is cylindrical in shape and it has a hollow cylindrical interior 1 and a closed end 2 . the hollow interior of the main body has three compartments formed therein by three partitions , 3 , 4 and 5 that extend substantially in a radial direction from a central longitudinally extending portion that has an axially aligned center bore 6 therein , see fig4 . the closed end 2 of the main body has three arcuate - shaped ribs 7 , 8 and 9 on its inner surface that cooperate respectively with the three partitions 3 , 4 and 5 , for holding the three electrodes in the compartments from angular displacement when the standard plug has its three electrodes inserted into the converter plug and the two plugs angularly rotated with respect to each other for interlocking the standard plug electrodes with the three electrodes in the converter plug . this feature will be more fully described hereinafter . a terminal carrier b , is shown in isometric in fig3 and an end view is shown in fig5 . the terminal carrier has a base 10 with an integral axially aligned cylindrical rod 11 projecting therefrom and adapted to be received in the bore 6 in the main body , see fig2 . the base 10 also has three integral projections 12 , 13 and 14 which surround the central rod 11 and are spaced therefrom as shown in fig3 and by dotted lines in fig5 . these three projections are angularly spaced from each other by 120 ° and each has a central wire receiving bore 12a , 13a , and 14a . the wire receiving bores extend through the carrier base 10 and radial grooves 15 , 16 and 17 in the base , see fig5 also receive the wires . a finger gripping central handle 18 is integral with the base 10 of the terminal carrier and is axially aligned with the rod 11 and projects from the opposite face of the base from that of the rod , see fig3 and 5 . this axial handle 18 has three longitudinally extending grooves in its periphery and these grooves extend to the radial grooves 15 , 16 and 17 in the base 10 and receive the wires therefrom as will be described later . fig3 shows the projection 12 with a groove 12b for receiving the bare metal strands of the end of the wire portion that extends from the bore 12a and fig2 illustrates how the bare metal strands of a wire 19 extend from the bore 13a in the projection 13 and are bent back on themselves and are received in a groove 13b with the ends of the strands being soldered together and received in recess 10a in the base . when a large diameter cable c , is connected to the converter plug , see fig1 and 3 , the cable is received in the bore 20 of a sleeve d . the sleeve has an annular rim 21 that in turn has an annular recess 22 therein . the annular shoulder 23 provided between the recess 22 and the bore 20 in the sleeve d , has notches 24 therein as clearly shown in fig3 . the annular recess 22 receives an insert e which is shown in fig3 and 6 . this insert has an annular rim 25 that is received in the recess 22 and it has a cylindrical portion 26 received in the bore 20 in the sleeve d . the portion 26 has a longitudinally extending key 27 , see fig6 that is received in a keyway groove 28 in the inner cylindrical surface of the sleeve d . in addition , the rim 25 of the insert has diametrically opposed projections 29 , see fig3 and 6 , on its underside and these projections are received in the notches 24 in the sleeve d . the bore 30 in the insert e , receives the handle 18 of the terminal carrier b . the three wires in the large diameter cable c have their bare wire strands anchored to the projections 12 , 13 and 14 in the same manner as already described for the wire 19 . the three compartments in the main body a receive two electrodes f and g , and a &# 34 ; ground &# 34 ; terminal h , see fig3 . in fig4 the three compartments are designated at a1 , a2 and a3 . the electrode f , is received in the compartment a3 while the electrode g , is positioned in the compartment a1 . the compartment a2 receives the &# 34 ; ground &# 34 ; terminal h , and it is shown in fig2 . the &# 34 ; ground &# 34 ; terminal has a tongue 31 , as shown in fig3 and this tongue is held in electrical contact with the bare wire strands of the wire 19 which extend along the outer wall of the projection 13 on the terminal contact with that portion of the bare wire strands 19 which extend from the bore 13a in the projection 13 to the outer edge of the projection . what i have described for the &# 34 ; ground &# 34 ; terminal h , holds true for the other two electrodes f and g , and therefore these need no further detailed description . the sleeve d and insert e , as well as the terminal carrier b , are mounted in the main body a , and are held in place by an end cap j that has an internally threaded skirt 33 which is screwed onto the externally threaded portion 34 of the main body a , see fig1 and 3 . the outer surfaces of the main body a and end cap j , are provided with knurled areas 35 and 36 , respectively , see fig1 and 3 , and with smooth areas 37 and 38 on which printed matter may be displayed . the terminal carrier b , is properly aligned in the interior of the main body a because the body has a longitudinally extending key 39 on its inner surface that is received in a keyway groove 40 in the periphery of the carrier , see fig2 - 5 . the closed end 2 of the main body a has two arcuate slots 41 and 42 and these slots removably receive the two electrodes 43 and 44 of a standard electric plug k , shown in fig1 . the closed end 2 of the main body a also has an l - shaped slot 45 therein and the standard plug has a &# 34 ; ground &# 34 ; terminal 46 with an end portion that is l - shaped in cross section and this l - shaped portion is removably received in the l - shaped slot 45 so as to make an electrical connection with the &# 34 ; ground &# 34 ; terminal h , in the main body a . in fig7 and 9 there is illustrated on an enlarged scale how the &# 34 ; ground &# 34 ; terminal 46 of the standard electric plug k is moved into locking engagement with the &# 34 ; ground &# 34 ; terminal h , in the main body a . the arrow 47 in fig7 indicates the line of movement of the &# 34 ; ground &# 34 ; terminal 46 as it is moved into electrical contact with the terminal h . fig8 illustrates the completion of the coupling movement while fig9 shows the &# 34 ; ground &# 34 ; terminal 46 being rotated angularly as indicated by the arrow 47 with respect to the &# 34 ; ground &# 34 ; terminal h for moving the shoulder 48 of the terminal 46 under a tongue 49 on the terminal h . this tongue 49 will prevent the accidental direct withdrawal of the standard plug k from the electrodes in the main body a . the standard plug k must be rotated in a reverse direction to the arrow 47 in fig9 before the standard plug may be disconnected from the electrodes in the main body a . it is important that the three electrodes in the main body a be not displaced laterally in the compartments a1 , a2 and a3 in the main body when there is a relative rotative movement of the standard plug k with respect to the main body a when locking the two together or when unlocking one from the other . reference to fig2 will show how i accomplish this . the arcuate shaped rib 8 on the inner surface of the closed end 2 of the main body a cooperates with the radial partition 4 to hold the electrode g , in the compartment a1 from any lateral displacement in the compartment . also , the compartment a1 has an inwardly extending rib 50 which cooperates with the arcuate rib 8 for holding the electrode g against lateral movement . what i have just set forth in structure for preventing any lateral displacement of the electrode g , in the compartment a1 , of the main body a will hold true for the &# 34 ; ground &# 34 ; terminal h , in the compartment a2 and the electrode f , in the compartment a3 . the compartment a2 has the arcuate rib 9 , see fig4 and the inwardly extending rib 51 . the compartment a3 has the arcuate rib 7 and the longitudinal and inwardly extending rib 52 . in fig1 i show a slight modification of my invention where a smaller diameter cable l is used . instead of using the insert e and mounting it in the sleeve d , i use a smaller diameter sleeve m that receives the cable and the sleeve has an annular flange 53 with a projection 54 on its undersurface . the sleeve m is received in the bore 20 of the larger diameter sleeve d , see fig3 and the projection 54 is received in the notch 24 . in addition the sleeve m has a longitudinally extending key 55 that is received in the keyway 28 of the sleeve d . the three wires in the smaller diameter cable l , are connected to the terminal carrier b , in exactly the same manner as already described for connecting the three wires in the large diameter cable c to the terminal carrier . the parts are then mounted within the main body a and are secured in place and are electrically connected to the electrodes f , g and h , by the connecting of the end cap j to the main body . no further detailed description need be given of the modified form shown in fig1 .	7
according to a first embodiment of the present invention , the dielectric ceramic composition is represented by the general formula : when the contents of cao , sro , bi 2 o 3 and tio 2 are not in the above composition ranges , the q 0 becomes less than 100 , so that the dielectric ceramic composition is unsuitable for practical applications . the preferred contents of cao , sro , bi 2 o 3 and tio 2 are 0 ≦ a ≦ 10 , 5 ≦ b ≦ 15 , 25 ≦ c ≦ 30 , 50 ≦ d ≦ 60 and 5 ≦ a + b ≦ 20 by mol %. the dielectric ceramic composition according to a second embodiment of the present invention has a main composition represented by the general formula : wherein 0 ≦ a & lt ; 30 , 0 & lt ; b ≦ 20 , 10 ≦ c ≦ 50 , 40 ≦ d ≦ 80 , and 0 & lt ; a + b ≦ 30 by mol %, and further contains at least one of the following components : 5 weight % or less of thallium oxide ( tl 2 o 3 ), 5 weight % or less of yttrium oxide ( y 2 o 3 ), and when tl 2 o 3 exceeds 5 weight %, the q 0 becomes less than 100 , and the τf becomes largely negative . and when y 2 o 3 exceeds 5 weight %, or when mno exceeds 0 . 6 weight %, similar problems take place , providing ceramic materials unsuitable for practical applications . the preferred contents of cao , sro , bi 2 o 3 and tio 2 are 0 ≦ a ≦ 10 , 5 ≦ b ≦ 15 , 25 ≦ c ≦ 30 , 50 ≦ d ≦ 60 and 5 ≦ a + b ≦ 20 by mol %, and the total amount of tl 2 o 3 , y 2 o 3 and mno is preferably 2 weight % or less . the dielectric ceramic composition according to a third embodiment of the present invention has a composition represented by the general formula : wherein r represents at least one of ge , zr , sn , ce and hf , and a , b , c , d and e satisfy 0 ≦ a & lt ; 30 , 0 & lt ; b ≦ 20 , 10 ≦ c ≦ 50 , 40 ≦ d ≦ 80 , 0 & lt ; e & lt ; 5 , and 0 & lt ; a + b ≦ 30 by mol %. when geo 2 , zro 2 , sno 2 , ceo 2 and hfo 2 reach 5 mol %, the q 0 becomes less than 100 , and the τf cannot be detected at high temperatures because measured peaks are concealed by noises or become increasingly negative , making the dielectric ceramic composition unsuitable for practical applications . the preferred contents of cao , sro , bi 2 o 3 and tio 2 are 0 ≦ a ≦ 10 , 5 ≦ b ≦ 15 , 25 ≦ c ≦ 30 , 50 ≦ d ≦ 60 and 5 ≦ a + b ≦ 20 by mol %, and ro 2 is preferably 2 mol % or less . the dielectric ceramic composition of the present invention can be prepared by mixing and sintering starting material powders in the predetermined proportions . the starting materials may be carbonates , nitrates , organic acid salts , etc . because they are thermally decomposed to form the corresponding oxides . caco 3 powder , srco 3 powder , bi 2 o 3 powder and tio 2 powder were introduced into a polyethylene pot in the proportions as shown in table 1 together with agate balls and acetone , and mixed for 16 hours . the resulting slurry was dried by heating and classified with a 5 - mesh sieve , and then burned at 1000 ° c . for 2 hours in the air . the burned product was again introduced into the polyethylene pot containing agate balls together with acetone and pulverized for 16 hours . the resulting slurry was dried by heating , mixed with a polyvinyl alcohol aqueous solution , and then granulated with a 32 - mesh sieve . the granulated powder was pressed at 1 ton / cm 2 , and sintered in the atmosphere at 1200 °- 1400 ° c . for 4 hours . the resulting sintered product was worked to have a diameter of about 30 mm and a height of about 15 mm . this sample was measured at about 1 ghz to obtain a peak in a te 011 mode , and the sample &# 39 ; s εr and q 0 were calculated from the above peak . next , the τf was determined from the variation or resonance frequency between - 20 ° c . and + 60 ° c . the results are shown in table 1 . table 1______________________________________sample composition ( mol %) τfno . cao sro bi . sub . 2 o . sub . 3 tio . sub . 2 εr q . sub . 0 ( ppm /° c . ) ______________________________________1 0 14 . 29 28 . 57 57 . 14 198 168 - 302 1 13 . 29 28 . 57 57 . 14 196 182 - 103 2 12 . 29 28 . 57 57 . 14 192 188 + 14 2 . 86 11 . 43 28 . 57 57 . 14 188 196 + 185 4 10 . 29 28 . 57 57 . 14 184 200 + 406 5 9 . 29 28 . 57 57 . 14 180 210 + 627 5 . 71 8 . 57 28 . 57 57 . 14 176 230 + 758 6 8 . 29 28 . 57 57 . 14 177 220 + 809 6 . 5 7 . 79 28 . 57 57 . 14 176 220 + 8410 20 10 40 30 169 53 + 3011 5 25 20 50 150 90 + 4212 10 10 5 75 120 95 + 320______________________________________ note : sample nos . 1 - 9 : examples of the present invention sample nos . 10 - 12 : comparative examples caco 3 powder , srco 3 powder , bi 2 o 3 powder , tio 2 powder , tl 2 o 3 powder , y 2 o 3 powder and mnco 3 powder were introduced into a polyethylene pot in the proportions as shown in table 2 together with agate balls and acetone , and mixed for 16 hours . the resulting slurry was dried by heating and classified with a 5 - mesh sieve , and then burned at 1000 ° c . for 2 hours in the air . the burned product was again introduced into the polyethylene pot containing agate balls together with acetone and pulverized for 16 hours . the resulting slurry was dried by heating , mixed with a polyvinyl alcohol aqueous solution , and then granulated with a 32 - mesh sieve . the granulated powder was pressed at 1 ton / cm 2 , and sintered in the atmosphere at 1200 °- 1400 ° c . for 4 hours . the resulting sintered product was worked to have a diameter of about 30 mm and a height of about 15 mm . this sample was measured at about 1 ghz to obtain a peak in a te 011 mode , and the sample &# 39 ; s εr and q 0 were calculated from the above peak . next , the τf was determined from the variation of resonance frequency between - 20 ° c . and + 60 ° c . the results are shown in table 2 . table 2__________________________________________________________________________samplecomposition ( mol %) additives τfno . cao sro bi . sub . 2 o . sub . 3 tio . sub . 2 ( weight %) εr q . sub . 0 ( ppm /° c . ) __________________________________________________________________________1 2 . 86 11 . 43 28 . 57 57 . 14 tl . sub . 2 o . sub . 3 0 . 1 187 174 - 62 2 . 86 11 . 43 28 . 57 57 . 14 tl . sub . 52 o . sub . 3 1 . 0 188 179 - 93 4 . 0 10 . 29 28 . 57 57 . 14 tl . sub . 2 o . sub . 3 3 . 0 184 200 + 54 2 . 86 11 . 43 28 . 57 57 . 14 y . sub . 2 o . sub . 3 0 . 5 179 163 + 75 2 . 86 11 . 43 28 . 57 57 . 14 mno 0 . 006 188 203 + 16 4 . 0 10 . 29 28 . 57 57 . 14 mno 0 . 003 184 220 + 57 2 . 86 11 . 43 28 . 57 57 . 14 y . sub . 2 o . sub . 3 3 . 0 169 138 + 28 4 . 0 10 . 29 28 . 57 57 . 14 tl . sub . 2 o . sub . 3 1 . 0 185 170 + 3 mno 0 . 0069 2 . 86 11 . 43 28 . 57 57 . 14 y . sub . 2 o . sub . 3 0 . 5 180 199 + 2 mno 0 . 00610 2 . 86 11 . 43 28 . 57 57 . 14 tl . sub . 2 o . sub . 3 1 . 0 182 179 - 1 y . sub . 2 o . sub . 3 0 . 111 2 . 86 11 . 43 28 . 57 57 . 14 tl . sub . 2 o . sub . 3 0 . 05 185 186 - 2 y . sub . 2 o . sub . 3 0 . 112 2 . 86 11 . 43 28 . 57 57 . 14 tl . sub . 2 o . sub . 3 6 . 0 179 90 - 2213 2 . 86 11 . 43 28 . 57 57 . 14 y . sub . 2 o . sub . 3 6 . 0 142 89 - 4814 2 . 86 11 . 43 28 . 57 57 . 14 mno 0 . 9 186 85 - 52__________________________________________________________________________ note : sample nos . 1 - 11 : examples of the present invention sample nos . 12 - 14 : comparative examples caco 3 powder , srco 3 powder , bi 2 o 3 powder , tio 2 powder , geo 2 powder , zro 2 powder , sno 2 powder , ceo 2 powder and hfo 2 powder were introduced into a polyethylene pot in the proportions as shown in table 3 together with agate balls and acetone , and mixed for 16 hours . the resulting slurry was dried by heating and classified with a 5 - mesh sieve , and then burned at 1000 ° c . for 2 hours in the air . the burned product was again introduced into the polyethylene pot containing agate balls together with acetone and pulverized for 16 hours . the resulting slurry was dried by heating , mixed with a polyvinyl alcohol aqueous solution , and then granulated with a 32 - mesh sieve . the granulated powder was pressed at 1 ton / cm 2 , and sintered in the atmosphere at 1200 °- 1400 ° c . for 4 hours . the resulting sintered product was worked to have a diameter of about 30 mm and a height of about 15 mm . this sample was measured at about 1 ghz to obtain a peak in a te 011 mode , and the sample &# 39 ; s εr and q 0 were calculated from the above peak . next , the τf was determined from the variation of resonance frequency between - 20 ° c . and + 60 ° c . the results are shown in table 3 . table 3__________________________________________________________________________sample composition ( mol %) τfno . cao sro bi . sub . 2 o . sub . 3 tio . sub . 2 ro . sub . 2 εr q . sub . 0 ( ppm /° c . ) __________________________________________________________________________1 2 . 86 11 . 43 28 . 57 57 . 04 geo . sub . 2 0 . 1 186 179 - 52 2 . 86 11 . 43 28 . 57 56 . 14 geo . sub . 2 1 . 0 181 166 - 153 2 . 86 11 . 43 28 . 57 56 . 64 zro . sub . 2 0 . 5 185 170 + 24 2 . 86 11 . 43 28 . 57 56 . 14 zro . sub . 2 1 . 0 181 140 - 125 2 . 86 11 . 43 28 . 57 57 . 06 sno . sub . 2 0 . 08 188 175 + 86 2 . 86 11 . 43 28 . 57 56 . 14 sno . sub . 2 1 . 0 175 133 - 607 2 . 86 11 . 43 28 . 57 56 . 54 ceo . sub . 2 0 . 6 186 192 - 18 2 . 86 11 . 43 28 . 57 56 . 14 ceo . sub . 2 1 . 0 182 191 - 169 2 . 86 11 . 43 28 . 57 56 . 64 hfo . sub . 2 0 . 5 182 165 + 210 2 . 86 11 . 43 28 . 57 56 . 14 hfo . sub . 2 1 . 0 178 138 - 5411 5 . 0 9 . 29 28 . 57 56 . 14 geo . sub . 2 1 . 0 179 205 + 412 2 . 86 11 . 43 28 . 57 52 . 14 geo . sub . 2 5 159 90 - 8913 2 . 86 11 . 43 28 . 57 52 . 14 zro . sub . 2 5 171 50 --* 14 2 . 86 11 . 43 28 . 57 52 . 14 sno . sub . 2 5 170 75 --* 15 2 . 86 11 . 43 28 . 57 52 . 14 ceo . sub . 2 5 148 58 - 19016 2 . 86 11 . 43 28 . 57 52 . 14 hfo . sub . 2 5 172 26 --* __________________________________________________________________________ note : sample nos . 1 - 11 : examples of the present invention sample nos . 12 - 16 : comparative examples * unmeasurable as described above in detail , the dielectric ceramic composition of the present invention shows high εr and q 0 , and its τf can be widely controlled by adjusting the ratio of cao / sro , the amounts of tl 2 o 3 , y 2 o 3 and mno , and the amounts of geo 2 , zro 2 , sno 2 , ceo 2 and hfo 2 . it is highly suitable for microwave dielectric elements and temperature compensating capacitors , etc .	2
the present invention will now be described with some preferred embodiments thereof . for the purpose of easy to understand , elements that are the same in the preferred embodiments are denoted by the same reference numerals . please refer to fig3 that illustrates a charge pump according to a first embodiment of the present invention . as shown , the charge pump includes a first clock output clk , a second clock output clkb , a first cascode section 31 , a second cascode section 32 , a third cascode section 33 , a fourth cascode section 34 , a first source / drain coupling transistor mc 1 , a second source / drain coupling transistor mc 2 , a third source / drain coupling transistor mc 3 , a fourth source / drain coupling transistor mc 4 , a first diode - connected transistor md 1 , a second diode - connected transistor md 2 , a first output transistor mo 1 , a second output transistor mo 2 , and a load capacitor cl . the first clock output clk provides a first clock signal φ 1 , and the second clock output clkb provides a second clock signal φ 2 . the first clock signal φ 1 and the second clock signal φ 2 have reversed polarities , as shown in fig4 . and , the voltage values of the first clock signal φ 1 and the second clock signal φ 2 are switched between zero and vdd . the first cascode section 31 includes cascode - connected first transistor m 1 and second transistor m 2 , and is connected to between an input end and a first point s 1 while the gates of the first and the second transistor m 1 , m 2 are connected to each other at a first node n 1 . the second cascode section 32 includes cascode - connected third transistor m 3 and fourth transistor m 4 , and is connected to between the input end and a second point s 2 while the gates of the third and the fourth transistor m 3 , m 4 are connected to each other at a second node n 2 . the third cascode section 33 includes cascode - connected fifth transistor m 5 and sixth transistor m 6 , and is connected to between the first point s 1 and an output end while the gates of the fifth and the sixth transistor m 5 , m 6 are connected to each other at a third node n 3 . the fourth cascode section 34 includes cascode - connected seventh transistor m 7 and eighth transistor m 8 , and is connected to between the second point s 2 and the output end while the gates of the seventh and the eighth transistor m 7 , m 8 are connected to each other at a fourth node n 4 . further , as can be seen from the connection shown in fig3 , the first node n 1 is the connecting point of the cascode - connected first transistor m 1 and second transistor m 2 , the second node n 2 is the connecting point of the cascode - connected third transistor m 3 and fourth transistor m 4 , the third node n 3 is the connecting point of the cascode - connected fifth transistor m 5 and sixth transistor m 6 , and the fourth node n 4 is the connecting point of the seventh transistor m 7 and eighth transistor m 8 . preferably , the first transistor m 1 , the third transistor m 3 , the fifth transistor m 5 and the seventh transistor m 7 are n - type metal - oxide - semiconductor field - effect ( mos ) transistors , while the second transistor m 2 , the fourth transistor m 4 , the sixth transistor m 6 and the eighth transistor m 8 are p - type mos transistors . the first source / drain coupling transistor mc 1 , the second source / drain coupling transistor mc 2 , the third source / drain coupling transistor mc 3 , and the fourth source / drain coupling transistor mc 4 respectively utilize the parasitic capacitance between source / drain and gate to replace the charging capacitors shown in fig2 to thereby enable the integration of the charge pump of the present invention on a chip via a standard mos process . the connection of the source / drain coupling transistors mc 1 ˜ mc 4 to one another has been shown in fig3 and is therefore not further described . in fig4 , there are defined three phases i , ii and iii . in the first phase i and the third phase iii , the first clock signal φ 1 and the second clock signal φ 2 provide a voltage value of zero and vdd , respectively . therefore , the first transistor m 1 , the fourth transistor m 4 , the sixth transistor m 6 and the seventh transistor m 7 are on while the second transistor m 2 , the third transistor m 3 , the fifth transistor m 5 and the eighth transistor m 8 are off . in the second phase ii , the transistors m 1 ˜ m 8 respectively have an on / off state reverse to that in the first phase i or the third phase iii . in the first phase i or the third phase iii , in which first clock signal φ 1 is low ( 0v ), the voltage values of the first node n 1 and the second node n 2 are increased to 2vdd and vdd , respectively ; and the voltage values of the third node n 3 and the fourth node n 4 are increased to 3vdd and 2vdd , respectively . in the second phase ii , in which the first clock signal φ 1 is high ( vdd ), the voltage values of the first node n 1 and the second node n 2 are vdd and 2vdd , respectively ; and the voltage values of the third node n 3 and the fourth node n 4 are 2vdd and 3vdd , respectively . thus , the third source / drain coupling transistor mc 3 and the fourth source / drain coupling transistor mc 4 would break down because a voltage difference between the gate and the source / drain exceeds 2vdd . for the purpose of integrating the charge pump of the present invention on a chip without causing breakdown of the source / drain coupling transistors , the first diode - connected transistor md 1 is additionally provided between the second node n 2 and the third node n 3 , the second diode - connected transistor md 2 is additionally provided between the first node n 1 and the fourth node n 4 , the first output transistor mo 1 is provided between the fourth node n 4 and the output end by way of diode , and the second output transistor mo 2 is provided between the third node n 3 and the output end by way of diode . after the above - mentioned transistors are provided , in the phases with the first clock signal φ 1 being low ( 0v ), the charge transfer operation is executed along a path from the first transistor m 1 via the first diode - connected transistor md 1 and the first output transistor mo 1 to the load capacitor cl at the output end ; and in the phase with the first clock signal φ 1 being high ( vdd ), the charge transfer path is from the fourth transistor m 4 via the seventh transistor m 7 and the sixth transistor m 6 to the load capacitor cl at the output end . during the course of charge transfer by controlling the charge pump via the clock signals φ 1 and φ 2 , it is able to avoid the source / drain coupling transistors from breakdown due to an exceeded voltage difference of 2vdd between the gate and the source / drain of the coupling transistors . in addition , it is also able to speed up the charge transfer process to obtain upgraded transfer efficiency . please refer to fig5 that is a schematic view of a charge pump according to a second embodiment of the present invention . the second embodiment is different from the first embodiment in that a fifth cascode section 35 , a sixth cascode section 36 , a fifth source / drain coupling transistor mc 5 , a sixth source / drain coupling transistor mc 6 , a third diode - connected transistor md 3 , and a fourth diode - connected transistor md 4 are further provided in the charge pump . since all other electronic elements in the second embodiment are connected in manners similar to those in the first embodiment and are illustrated in fig5 , they are not further described herein . after the above - mentioned additional transistors are added , it is able to generate at the output end an output voltage having a voltage value of 5vdd . please refer to fig6 , which shows the output voltage transient responses of the charge pump according to the second embodiment of the present invention and a prior art charge pump . as shown , after the above - mentioned additional transistors are added , the charge pump of the present invention has a response time from 0v to 5v faster than that of the prior art charge pump . fig7 a illustrates the output voltage - output current relationship of the charge pump according to the second embodiment of the present invention and of different prior art charge pumps , and 7 b illustrates the conversion efficiency of the charge pump according to the second embodiment of the present invention and of different prior art charge pumps . please refer to fig7 a and 7b the same time . as shown , under the same operating conditions , the charge pump of the present invention can generate an output voltage at the output end and provide conversion efficiency higher than those of the prior art charge pumps . in the following table 1 , a comparison of the charge pump of the present invention with other prior art charge pumps is shown . as can be seen from table 1 , under the same operating conditions , the charge pump of the present invention provides higher output voltage and conversion efficiency than the prior art charge pumps . the present invention has been described with some preferred embodiments thereof and it is understood that many changes and modifications in the described embodiments can be carried out without departing from the scope and the spirit of the invention that is intended to be limited only by the appended claims .	7
fig1 shows a therapeutic device 1 for improving the respiration of a patient which , in accordance with fig2 a and 2 b , can be used simultaneously for inhalation and exhalation , and thus for a combined airway therapy . fig1 , 3 a , 3 b and 3 c are intended to explain the design and structure of the therapeutic device 1 , and fig2 a and 2 b to explain the mode of function of the therapeutic device 1 . the therapeutic device 1 initially comprises a first pipe section 2 which is curved or kinked . a second pipe section 22 is provided in parallel to the first pipe section 2 . a first end 3 of the first pipe section 2 is provided with a mouthpiece 6 inserted in it or placed on it , by means of which the two pipe section 2 and 22 are connected together . this is because the mouthpiece 6 has a channel branch 21 provided in it , by means of which two air channels 7 or 7 ′ of the mouthpiece 6 which communicate with the two pipe sections 2 and 22 are combined into one output or input channel 21 ′. the first pipe section 2 is provided with an inlet opening 10 provided in its second end 4 facing away from the mouthpiece 6 , and a holding peg 11 can be attached to the inlet opening 10 in such a way that the holding peg 11 can be positioned in various positions in relation to the second end 4 of the first pipe section 2 . this is because the holding peg 11 is provided with a first hose 13 attached to it which is firmly attached to the holding peg 11 . the holding peg 11 is provided with a passage channel 12 disposed therein which is in a communicating active connection with the first hose 13 in such a way that the air flowing in through the inlet opening 10 enters the first hose 13 , causing it to expand and , given an adequate air flow , leading to oscillating vibrations of the hose 13 , with the effect that the hose 13 positioned inside the first pipe section 2 , and in this case in particular its free end 24 facing towards the mouthpiece 6 , is moved back and forth in between an inner wall 5 of the first pipe section 2 . furthermore , it is disclosed in fig1 and 3 a that a ring element 17 is inserted in the first pipe section 2 , between the free end 24 of the first hose 13 and the mouthpiece 6 , in which case this ring element 17 has , on the one hand , four passage openings 18 , or slots , disposed therein in the peripheral direction and , on the other hand , a baffle plate 20 aligned at right angles to the axis of symmetry of the pipe , by means of which baffle plate 20 the air flow inside the first pipe section 2 is deflected in the direction of the inner wall 5 of the first pipe section 2 , and thus in the direction of the passage openings 18 . moreover , an adjustable sleeve 19 is provided which has a mesh 30 in its inside on which a filter 28 is placed . as a result , the filter 28 is held by the adjustable sleeve 19 . the adjustable sleeve 19 faces towards the mouthpiece 6 and is held and supported within it in a friction - locking arrangement . the mesh 30 can also be provided in the mouthpiece 6 for holding the filter 28 . the adjustable sleeve 19 allows the passage openings 18 to be fully or partially closed or fully opened , because the adjustable sleeve 19 has a circumferential collar 19 ′ formed onto it which is provided with one or more openings 35 disposed therein with diameters of different sizes , and the inside contours of which can be configured in different ways in relation to one another . the passage openings 18 of the ring element 17 can be closed or partially opened by the collar 19 ′, or else it is possible to provide a setting in which the passage openings 18 are fully opened when the openings 35 in the collar 19 ′ are flush with the adjustable sleeve 19 and aligned with one or more of the passage openings 18 of the ring element 17 . the filter 28 serves to clean the air which flows through it , and to capture and hold back suspended matter or microparticles . furthermore , the therapeutic device 1 consists of an air distribution element 23 arranged in the second pipe section 22 , the air distribution element 23 being positioned in the area of the mouthpiece 6 . the air distribution element 23 is shown in particular in fig3 c and is provided with a ring - shaped configuration , with the effect that it corresponds to the inside contour of the mouthpiece 6 and the second pipe section 22 , and can be inserted into them . the air distribution element 23 has passage openings disposed therein with differently sized diameters , as is shown in fig3 b in cross section . starting from the smallest size d 1 , the geometrical relationships increase to the largest diameter d 4 . it is possible for a plurality of differently sized passage openings 26 to be provided in the air distribution element 23 . the air distribution element 23 also has the baffle plate 20 located at right angles to the axis of symmetry of the second pipe section 22 . the opposite side of the baffle plate 20 has the mesh 30 provided on it on the air distribution element , and a second filter 29 is held on the mesh 30 . the mesh 30 and the filter 29 can be installed optionally for exhalation . in accordance with fig3 c , the second pipe section 22 is provided with a second hose 14 inserted in it by means of a holding ring 15 . the holding ring 15 is arranged at a distance from the air distribution element 23 , with the effect that a sufficiently large intermediate space is provided between these two components inside the second pipe section 22 . the air distribution element 23 has a setting ring 27 allocated to it which is held on it in a rotating arrangement , and into which the openings 35 are disposed with differently sized diameters or opening widths . as a result , when the setting ring 27 is turned , it is possible for the openings 35 in the setting ring 27 to be set to different flow cross sections with the passage openings 18 provided in the air distribution element 23 , with the effect that the air flowing through is partially obstructed . this is because the air flowing in should flow through them out of the air distribution element 23 into an intermediate space 36 located between an inner wall 16 of the second pipe section 22 and the air distribution element 23 or the outer circumference of the setting ring 27 . fig1 shows that the second pipe section 22 has a second end 33 which can be sealed using a stopper 37 in which an opening 37 ′ is disposed . fig2 a firstly shows the inhalation procedure schematically . the flow direction established for the drawn - in air is indicated by the reference number 8 . as a result , the patient uses his or her respiratory musculature to breathe in air through the first pipe section 2 which flows into the pipe section 2 in the area of the second end 4 through the inlet opening 10 , and enters the first hose 13 through the passage channel 12 of the holding peg 11 . as shown by the schematic vibration arrows 8 ′, the free end 24 of the first hose 13 is moved back and forth between the inner wall 5 of the first pipe section 2 . the vibratory behaviour of the first hose 13 can be variably adjusted as a result of the different curvature of the pipe section 2 and the adjustable position of the first hose 13 relative to it . the holding peg 11 is held in a moveable arrangement in the second end 4 of the first pipe section 2 , which means the length of the first hose 13 which protrudes into the first pipe section 2 can have different lengths , as a result of which the hose 13 can be kinked or bend at different points . the air flowing in , or drawn in , causes the flexible hose 13 to expand , with the effect that the air passes through it and enters the inside of the first pipe section 2 . the baffle plate 20 of the ring element 17 redirects the air outwards , i . e . in the direction of the inner wall 5 , and from the baffle plate 20 the air is guided sideways in the direction of the passage opening 18 or openings 35 in the ring element 17 or the adjustable sleeve 19 . the cross sectional area set between the passage openings 18 and the openings 35 means the air resistance prevailing there is increased or reduced according to the cross sectional area through which the air flow can pass . as soon as the air flow leaves the ring element 17 in the direction of the mouthpiece 6 , it flows through the first passage channel 7 in the direction of the shared channel 21 ′ of the channel branch 21 into the patient &# 39 ; s mouth cavity . as a result of the air pressure situation prevailing inside the two pipe sections 2 and 22 , a negative pressure is formed in the second pipe section 22 , because air is drawn out of this in accordance with the air flow direction 8 . this negative pressure is communicated to the second hose 14 due to the air pressure situation prevailing between the air distribution element 23 and the inside of the second pipe section 22 , as a result of which a negative pressure results inside the second hose 14 , causing the flexible side wall of the hose 14 to enter into contact , thereby preventing air flow through the second hose 14 . as a result , the second hose 14 acts in this operating status as a kind of valve preventing air from entering through the second pipe section 22 in the direction of the mouthpiece 6 . as a result of the vibratory behaviour of the first hose 13 , the patient can hear and detect that the necessary negative pressure preset by the opening width has been achieved . fig2 b shows the operating status during exhalation . the flow direction of the exhaled air out of the patient &# 39 ; s pulmonary space is identified by the reference number 9 . the air flow is initially forced into the mouthpiece 6 and , there , it is distributed in the area of the air channel branch 21 . the air flow which enters the second pipe section 22 is forced through the passage openings 26 into the intermediate space 36 and , from there , it enters the inside of the second pipe section 22 , and thus into the second hose 14 which is now expanded by the air flow and is , in its turn , induced to adopt an oscillating vibratory behaviour if a sufficiently high air pressure is generated by the air that is forced in . the air flowing out through the second hose 14 is evacuated into the atmosphere through the second end 33 and the opening 37 ′ in the stopper 37 . the other portion of the exhaled air flow enters the first pipe section 2 and , there , it initially exits the ring element 17 through the passage openings 18 and enters the inside of the first pipe section 2 . there is a positive pressure in this pipe section 2 due to the air flowing in , as a result of which the first hose 13 is compressed and thereby closes like a kind of valve , with the effect that no air can escape from the inside of the first pipe section 2 . the positive pressure prevailing in the first pipe section 2 therefore leads to the situation that a correspondingly formed cushion of air prevails immediately after exhalation , by means of which the exhaled air is directed into the second pipe section 22 after a certain period of time , at least in its entirety . the first and second pipe sections 2 and 22 can be provided with separate mouthpieces 6 and consequently can be used independently of one another .	0
fig1 illustrates in a simplified block diagram , a computer system 100 suitable for implementing embodiments of the present invention . the computer system 100 has a central processing unit ( cpu ) 110 , which is a programmable processor for executing programmed instructions , such as instructions contained in memory 108 . memory 108 can also include hard disk , tape or other storage media . while a single cpu is depicted in fig1 , it is understood that other forms of computer systems can be used to implement the invention , including multiple cpus . it is also appreciated that the present invention can be implemented in a distributed computing environment having a plurality of computers communicating via a suitable network 119 , such as the internet . the cpu 110 is connected to memory 108 either through a dedicated system bus 105 and / or a general system bus 106 . memory 108 can be a random access semiconductor . memory 108 is depicted conceptually as a single monolithic entity , but it is well known that memory 108 can be arranged in a hierarchy of caches and other memory devices . fig1 illustrates that an operating system 120 may reside in memory 108 . components of an embodiment of the present invention may also reside in memory 108 . the operating system 120 provides functions such as device interfaces , memory management , multiple task management , and the like as known in the art . the cpu 110 can be suitably programmed to read , load , and execute instructions of the operating system 120 . the computer system 100 has the necessary subsystems and functional components to implement embodiments of the present invention as will be discussed later . other programs ( not shown ) include server software applications in which a network adapter 118 interacts with the server software application to enable the computer system 100 to function as a network server via the network 119 as well as to provide data from remote instances supporting embodiments of the present invention . a general system bus 106 supports transfer of data , commands , and other information between various subsystems of the computer system 100 . while shown in simplified form as a single bus , the bus 106 can be structured as multiple buses arranged in hierarchical form . a display adapter 114 supports a video display device 115 , which is a cathode - ray tube display or a display based upon other suitable display technology that may be used to depict data . the input / output adapter 112 supports devices suited for input and output , such as a keyboard or mouse device 113 , and a disk drive unit ( not shown ). a storage adapter 142 supports one or more data storage devices 144 , which could include a magnetic hard disk drive or cd - rom drive although other types of data storage devices can be used , including removable media for storing data . an adapter 117 is used for operationally connecting many types of peripheral computing devices to the computer system 100 via the bus 106 , such as printers , bus adapters , and other computers using one or more protocols including token ring , lan connections , as known in the art . the network adapter provides a physical interface to a suitable network 119 , such as the internet . the network adapter 118 includes a modem that can be connected to a telephone line for accessing the network 119 . the computer system 100 can be connected to another network server via a local area network using an appropriate network protocol and the network server can in turn be connected to the internet . fig1 is intended as an exemplary representation of the computer system 100 by which embodiments of the present invention can be implemented . it is understood that in other computer systems , many variations in system configuration are possible in addition to those mentioned here . our framework involves three main components as depicted in the class structure of fig2 . these include an interface referred to as listdatabeaninterface 200 , an abstract class referred to as abstractsmarttlistbean 205 , and a concrete class extended from abstractsmarttlistbean by the user , referred to as conretelistdatabean 210 . the purpose of listdatabeaninterface 200 is to define a protocol of behavior to be implemented . methods defined in the class include : // paging methods public void setpagesize ( int size ); // number of records to be returned in a page public void setstartindex ( int index ); // start index of the records to be returned public void setfullresultset ( boolean truefalse ); // if it is set to true , result set size and start index will not be used . defaults to false . public int gettotallistsize ( ); // returns the total number of records public boolean is empty ( ); // returns true if empty // returns results public collection getnextsetofdataobjects ( ); // returns a list of data objects ( i . e . databeans in the websphere commerce architecture ) public collection getdataobjects ( ); // returns all data objects // sorting methods public com . ibm . commerce . base . util . sortingattribute getsortatt ( ); // returns the sorting attribute public void setsortattribute ( com . ibm . commerce . base . util . sortingattribute newsortatt ); // sets the sorting attribute abstractsmartlistbean 205 implements listdatabeaninterface 200 just defined . the purpose of abstractsmartlistbean 205 is to provide the actual implementations for the methods defined in listdatabeaninterface 200 . in addition to providing implementations for those common methods , a number of callback methods are also defined in abstractsmartlistbean 205 . the callback methods may be invoked by the framework and thus their implementations must be provided in the concrete class created by the user . the concrete class extends from abstractsmartlistbean 205 and therefore automatically inherits the methods implemented in abstractsmartlistbean 205 . listdatabeaninterface and abstractsmartlistdatabean will be provided by the framework whereas concretelistdatabean represents a class that will be created by a user . however , before the concrete class can be put into use , a number of callback methods as defined in abstractsmartlistbean 205 will have to be implemented . examples of such callback methods include : abstract void dopopulate ( ) throws exception ; // initialization work is done here abstract collection dogetprimarykeys ( ) throws exception ; // returns a list of primary keys for pagination operations abstract object dogetejbhome ( ) throws exception ; // returns an ejbhome for the data object of interest abstract object createdatabean ( object accessbean ) throws exception ; // creates a databean from an accessbean the callback methods provide a means for the framework to inquire about the concrete class . the framework is a generic implementation and it requires two important pieces of information to be provided by the callback methods to operate . the two pieces of information required are the actual database objects being processed and the identity of each of those objects . the method dogetejbhome ( ) returns an instance of ejb home interface to the framework . for example , if customer order is of interest here , an order ejb home interface will be returned . having just an ejb home is not sufficient as what is required is a list of records . for example of the customer order is used as an example here , the order ids that can uniquely identify each of the database objects are missing . the other method dogetprimarykeys ( ) provides that information as it returns a list of primary keys to the framework . having a framework in place minimizes the coding needed and at the same time provides an efficient solution for accessing and manipulating the data . it may be possible to provide functions such as pagination of data , navigating from a page to the next or previous page , jumping from a page to another page , displaying the total number of records , and sorting by different attributes with little coding . the following is a high level description of how data is accessed and pagination done within the framework . first retrieve only the primary keys of the database record , and then retrieve the data of interest later using a subset of primary keys . for example , if there are one million customer orders and there is interest in displaying 40 records starting from the 151 st record , first get all the required primary keys ( first 190 of them , and the records should already be sorted appropriately , support for other than primary key based sorting is also provided and not just limited to the example sort given ), then do a subset operation to get the 151 st to the 190 th , and then get the real data from the database using the extracted primary keys . the technique typically poses less stress on the database as what was retrieved in the first pass was only the primary keys , and in most cases only a portion of the primary keys . the actual data is retrieved in the second pass using only the primary keys of interest . the technique can be further enhanced by caching all of the primary keys after they have been retrieved in the first pass from the database . subsequent access to the database will then be reduced to just the records of interest as the required primary keys can always be subset from the keys in the cache . the following is a flow of the database access using a proposed embodiment of the present invention . first , fetch all the primary keys . for example , in a customer ordered database , select orderid from custorders order by memberid . second , subset the primary keys of interest . for example , if there is only interest in looking at 40 records at a time , extract the first 40 primary keys and use those keys in the next step . the location of the subset is determined by the page size and start index . third , fetch the real data using primary keys just obtained . for example , select currency , totalvalue , totaltax , lastupdate , description from custorders where orderid in ( the 40 primary keys subset in step 2 ) order by memberid . the “ order by ” clause is determined from the sorting attribute specified . the steps are repeated when another set of results need to be displayed . step 1 may be eliminated if the primary keys are cached after the first retrieval . a method of caching the primary keys is to store them within the session object , thus eliminating the need to re - execute the first “ select ” statement when the next set of results is needed . if caching is not available , then step 1 can be made more efficient by limiting the number of primary keys returned . for example , do a “ select orderid from custorders order by memberid fetch first 190 only ” if there is interest in looking at only 40 records starting from the 151 st record . typically the logic described above cannot be performed in a single database query such as that in structured query language ( sql ). one reason may be that there is always a need to have access to the total number of records that match the search criteria ( different from the number of records returned per page ). this value is also important when it is required to show the total number of pages as calculated by the total number of records divided by the page size . another reason may be that the value of the total number of records with the actual data we need in one sql query cannot be aggregated because there is an expectation of receiving a data object representing the database table . the data object has already been defined and has fields that map directly to database table columns . it may be further speculated if a technique involving use of the primary key as an index , and fetching the next 50 records where the primary key is greater than the base index key would be possible . typically this is not feasible because in most of the cases , the sorting attribute is used to define how the data is to be sorted . the “ order - by ” clause of the sql query is generated from the sorting attribute a user provides . consider a scenario where it is required to fetch a range of the 51 st record to the 100th record of customer orders sorted by order values . the primary keys ( i . e . orders_id ) in this case will be out of order , and thus cannot be used to compare with the base index in a “ fetch the next 50 records where the primary key is greater than the base index key ” technique . fig3 is a block diagram of a high level view showing where a user created concretelistdatabean would reside in a system implementing an embodiment of the present invention . a flow initiates from client 300 and is received by servlet 305 . servlet 305 in turn passes the request along to business logic 310 . business logic has access to ejb container 315 which in turn has database connections for data 320 from which to receive requested data . the requested data will be returned to client 300 by way of business logic 310 formatting the information though jsp 325 . jsp 325 contains concretelistdatabean 210 to manage presenting the requested data to user client 300 . further in fig4 is shown in a block diagram the simplified flow involved in operation of an embodiment of the present invention . beginning in operation 400 is performed the necessary initialization steps . block 405 shows the typical methods that may be used during operation 400 . moving to operation 410 , there is performed the querying of the concretelistdatabean 210 to activate the bean and to invoke the callback methods . as seen in block 415 various methods described earlier will be invoked by operation of the framework to establish which database object is being processed and the identity of the object as well . in phase three , the data is actually retrieved from the database during the operation 420 . this is accomplished using methods provided in block 425 . it may also be known that connection pooling is used within the embodiments of the present invention a means of operating in a somewhat “ disconnected ” mode . the connection pooling afforded by the database allows for quick connections to retrieve data when needed without the burden of cursor management using a session object . connection pooling offers the benefit of fast connection acquisition without the overhead of establishing new connections or maintaining connections or session management . although the invention has been described with reference to illustrative embodiments , it is to be understood that the invention is not limited to these precise embodiments . the described embodiments of carrying out the invention are susceptible to many changes and modifications that may be effected therein by one skilled in the art . the invention , rather , is intended to encompass all such change and modification within its scope , as defined by the claims .	8
a heat sink must be capable of exchanging heat with or to the environment , the ultimate cooling medium , i . e . air , water or earth . the controlling rule in determining secondary ornamentation , such as heat sink modules , is that such ornamentation should never , throughout its modes of operation , become hot . since most electronic devices are mounted with standard 60 / 40 solder , &# 34 ; hot &# 34 ; would be properly defined as being at or near the 60 / 40 solder melting point of 180 ° c . in the instant invention , the ultimate sink comprises a common base plate or element that is integrated with fluid conduit means . more specifically , the conduit means is a closed fluid channel which has a fluid source input at one end and a fluid source output at the other . although modules employing the novel integrated heat sink may be cascaded , that is , connected in series so that the fluid from one heat sink module passes through another and / or succeeding modules , such connection would defeat the concept of exchanging heat with or to the environment , at least to a consistent and stable environment . therefore , in the instant invention , where several of the heat sink modules of the instant invention are to be &# 34 ; ganged &# 34 ;, i . e ., used together , it is preferred that they be operated in parallel , as from a manifolded fluid source which delivers a cooling fluid at the same ( and consistent ) temperature to all heat sink modules . the actual choice will remain , of course , with the operator who has final responsibility for determining and specifying electronic heat sink as well as other circuit requirements . in fig1 a fluid - conducting element 10 is illustrated in a top plan view . this element is preferably comprised of a copper block 12 approximately 2 . 5 inches long by 1 . 5 inches wide , and with a nominal thickness of 0 . 25 inch . in diametrically opposed corners , a hole 14 / 14 &# 39 ; ( diameter preferably being approximately 0 . 125 inch ) is bored completely through block 12 . thereafter , a channel 16 is cut generally inward of the block from one hole 14 to the other 14 &# 39 ; using a suitable cutting technique such as electric discharge machining ( edm ). the channel is cut in a sinuous path 17 and results in fluid - conducting element 10 having a solid continuous periphery 20 and a generally interdigitated interior configuration . although in some embodiments holes 14 / 14 &# 39 ; may serve as cooling fluid inlet and outlet ports , inlet and outlet ports 18 / 18 &# 39 ; may be formed since they are far more expedient in most operational circumstances , such as where several modules are employed , each having a separate block 12 , and cooling fluid is circulated in series from one block to the next . when outlet ports 18 / 18 &# 39 ; are used , holes 14 / 14 &# 39 ; are sealed by plates joined to the upper and lower surfaces of block 12 , as shown , for example , in fig4 and 6 . the end elevation of fig2 which is an orthographic illustration of fig1 supplements the foregoing description relative to the inlet placement . in this embodiment , the inlet and outlet bores 18 / 18 &# 39 ; are nominally 0 . 125 inches in diameter . the partial isometric drawing of fig3 further elaborates on the illustration of fig1 . in this view , it is readily seen that fluid - conducting element 10 has a definite , designed thickness . in the previously stated nominal dimensions for fluid - conducting element 10 , the number of channels would be eleven , with a spacing of 0 . 125 inches between each adjacent pair of the parallel portions of channel 16 and between each outermost parallel portion of channel 16 and the nearest outer periphery 20 ( and as represented , for example , by the separation 19 / 19 &# 39 ;). the resulting tce of fluid - conducting element 10 is approximately 5 . 0 - 6 . 5 ppm /° c ., considerably smaller than the approximately 17 . 0 ppm /° c . tce of unchanneled block 12 . a concomitant benefit in the form of a significant reduction in the amount of copper mass employed , compared to that of the unchanneled block , is also realized . the final step in the assembly of the integrated heat sink of the instant invention is the application of top and bottom covers to fluid - conducting element 10 . having constructed the basic heat sink module with a known tce of approximately 5 . 0 - 6 . 5 ppm /° c ., a conductive top cover or plate 22 and a metal clad bottom cover or plate 24 are applied to fluid - conducting element 10 , as shown in fig4 and are either eutectically bonded thereto or , more expediently , soldered thereto . in fig4 fluid - conducting element 10 , illustrated in phantom , is sandwiched between top plate 22 and bottom plate 24 . the top plate is a laminate of at least two strata , the upper stratum 26 comprising a conducting element , preferably copper , and the lower stratum 27 comprising a ceramic , preferably beryllia . an understanding of previous direct bonded copper ( dbc ) techniques would lead one to assume that top plate 22 can be manufactured most economically by simply laminating the beryllia stratum 27 between copper stratum 26 and a bottom stratum 28 and this is precisely what is done in the preferred embodiment . economy alone , however , is not the driving factor and , in employing the dbc technique , great care must be taken to ensure that uppermost stratum 26 is electrically isolated by the middle stratum 27 from the lowermost stratum 28 . as may be readily discerned from the phantom depiction in fig4 uppermost stratum 26 constitutes the common electrode of the heat sink module to which various semiconductor devices are to be soldered . it is desirable to effect electrical isolation at this point , because it prevents the cooling fluid from being electrically active . one of the primary objectives of the invention can be realized by bringing the electrode into direct contact with the environmental sink , in this case the cooling fluid previously mentioned . furthermore , the constrained copper technique ( cct ) is effectively realized by bonding copper atop ceramic substrate 27 and by bonding the substrate directly to block 10 . the disadvantage of this approach is that productionwise it lacks the enhancements of the previously - discussed full top plate 22 laminate depicted in fig4 . in accordance with the invention , top and bottom plates 22 and 24 may be manufactured or supplied independently of fluid - conducting element 10 and only a final assembly process may be required by the prime manufacturer . if all external surfaces of the aforementioned units 10 , 22 and 24 are pretinned ( i . e ., afforded thin layers of a soldering substance ), they may be assembled in a singular step by a one - time solder reflowing process . therefore , it is more expedient , although not absolutely necessary , to fabricate the invention as herein disclosed . assembly of bottom plate 24 , which comprises a plate 23 of molybdenum or similar conductive material having a tce approximately equal to that of fluid - conducting element 10 and that of top plate 22 , is effected during the final solder reflow , discussed above . thus , plate 23 is either copper plated or totally clad with copper , the tce of molybdenum constraining the copper in accordance with the earlier described cct . in fig4 bottom plate 24 is depicted as a conductive stratum 23 clad by , or sandwiched between , copper platings 26 , and may be manufactured by either direct bonding techniques or conventional metal - to - metal cladding techniques . use of copper throughout , of course , lends the various parts to the vastly simplified and expedient solder reflowing process which facilitates single step assembly . fig5 and 6 depict operational employment of the heat sink module of the instant invention . the top plan schematic drawing of fig5 illustrates common conductor plate 26 with extension tabs 30 which are prepared for connection at holes 31 to receive other electrical connection means . semiconductor devices 50 are illustrated in phantom at the positions at which they would be soldered to the common cathode , plate 26 . finally , connecting hoses or conduits 33 are connected to module input lines 32 ( which are inserted in inlet / outlet ports 18 / 18 &# 39 ;) by insulating sleeves 32 &# 39 ;. use of insulation for sleeves 32 &# 39 ; provides double insulation for greater safety , if required . in the fig6 end elevation view of an operational employment of the invention , semiconductor devices 50 are shown attached to cathode 26 which comprises the previously described uppermost stratum of top plate 22 . all previously mentioned elements such as top plate 22 and bottom plate 24 are depicted in proper relationship with channeled plate 10 , while inlet / outlet ports 18 / 18 &# 39 ; are depicted in phantom . secured immediately above devices 50 , by conventional means 65 , are a gate plate 60 and an anode plate 62 . connectors 64 and 66 connect the aforementioned electrode plates with their respective components to devices 50 . digression into such matters as electrode plate suspension and connection , as well as mounting such to the heat sink module , is not discussed herein , being that such matters have been previously disclosed in the prior art or are long since established by common practice . while only certain preferred features of the invention have been illustrated and described herein , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention .	7
while the making and using of various embodiments of the present invention are discussed in detail below , it should be appreciated that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts . the specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention . to facilitate the understanding of this invention , a number of terms are defined below . terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention . terms such as “ a ”, “ an ” and “ the ” are not intended to refer to only a singular entity , but include the general class of which a specific example may be used for illustration . the terminology herein is used to describe specific embodiments of the invention , but their usage does not delimit the invention , except as outlined in the claims . the inventors have discovered a novel cancer testis antigen ( cta ), sp17 , in breast cancer that is both a biomarker and an immunotherapy target . it is shown herein that targeting sp17 is effective for the treatment of primary , metastatic and triple negative breast cancer cells , sp17 expression is completely absent in normal breast tissue and a wide panel of normal tissues . the highly restricted expression pattern makes sp17 an excellent candidate for a cancer vaccine target . the inventors have further shown the efficacy of immunotherapeutic approaches by generating autologous sp17 - specific t cells in vitro and demonstrate that they efficiently and specifically kill the sp17 expressing breast cancer cells . it is further shown herein that sp17 is a biomarker of breast cancer progression , prognosis , resistance and treatment . in summary , the invention represents a novel breast cancer immunotherapy that is useful in the treatment of normal , metastatic , and triple negative breast cancers . the invention is an improvement over current therapies that are largely ineffective against metastatic and triple negative breast cancers . additionally , cancer vaccines work through naturally exploiting the human body &# 39 ; s immune system and raising specific cytotoxic t lymphocyte anti - tumor responses which may avoid some of the health risks associated with traditional chemotherapeutics . the cancer / testis antigen sperm protein 17 ( sp17 ) is a highly conserved mammalian protein , normally found in spermatozoa , where it contributes to sperm maturation , capacitation and acrosomal reaction [ 22 ], ( genbank accession no . af334735 ( nucleic acid ), aak20878 . 1 ( amino acid ), which sequences are incorporated herein by reference ). aberrant sp17 expression has been shown in ovarian and esophageal cancers [ 23 , 24 ], nervous system tumors [ 25 ] and in multiple myeloma [ 26 ]. sp17 mechanisms of action in cancer cells are still poorly understood . nonetheless , it has been shown that sp17 mediates cell - cell adhesion in malignant b - lymphocytes through heparan - sulfate [ 27 ], and enhances cell motility and drug resistance in ovarian cancer [ 28 ]. thus , sp17 - targeted immunotherapy is likely to prove effective in various solid and hematological tumors . to date , sp17 expression in bc has never been identified or investigated . surprisingly , it was found herein that sp17 is expressed at the mrna and protein levels in human breast cancer cell lines , primary idbc and normal breast tissue . the present inventors demonstrate herein the use of sp17 immunogenicity for the development of breast cancer immunotherapy . breast carcinoma is a major health issue for millions of women . current therapies display serious side effects , and are hardly effective in patients with metastatic and / or poorly - differentiated tumors . thus , the need for novel therapies is urgent . vaccinations exploiting tumor - associated antigens able to raise specific cytotoxic t lymphocyte - mediated antitumor responses are likely to become the therapy of choice in the future . cancer / testis antigens are a group of tumor - associated antigens displaying ideal features as vaccine targets . the cancer / testis antigen sp17 has been found aberrantly expressed in different neoplasia , such as ovarian and esophageal cancers , nervous system tumors and multiple myeloma . thus , sp17 - targeted immunotherapy is expected to prove effective in various solid and hematological tumors . here sp17 expression and immunogenicity in breast cancer is evaluated for the first time . the inventors evaluated sp17 expression at the transcriptional and translational levels in breast cancer cell lines , normal tissues and biopsies of invasive ductal breast carcinoma and normal mammary ducts . then , the inventors generated in vitro sp17 - specific cytotoxic t lymphocytes and evaluated their capacity of lysing breast tumor cells . the inventors show for the first time sp17 to be expressed in breast cancer cell lines and primary tumor samples . sp17 was absent in all normal breast samples analyzed and in normal tissues derived from different organs . finally , the inventors demonstrate that sp17 is a suitable target for bc immunotherapy , as specific anti - sp17 antibodies was detected in patients &# 39 ; sera and the induction and / or activation of sp17 - specific hla class i - restricted cytotoxic t lymphocytes efficiently killing tumor cells in vitro . these data demonstrate that sp17 is a novel cancer / testis antigen in breast cancer , prompting further analysis of sp17 expression as a biomarker for tumor progression and prognosis . further , it is shown that sp17 - targeted immunotherapy for breast cancer leads to subject vaccination . according to the latest data available from the united states cancer statistics ( uscs , apps . nccd . cdc . gov / uscs ) 186 , 467 women were diagnosed with breast carcinoma ( bc ) and 41 , 116 died from the disease in 2005 . the most common breast cancers are invasive ductal breast carcinoma ( idbc ) and invasive lobular carcinoma ( ilc ) [ 1 , 2 ]. however , idbc accounts for 80 % of all cases , while ilc affects only about 5 % to 10 % of all patients [ 2 ]. further , the risk of mortality of women with ilc is 26 % lower than women with idbc [ 3 ]. among bc treatment options , anti - estrogen drugs ( tamoxifen or aromatase inhibitors ), and epidermal growth factor - targeted therapies ( trastuzumab ) have largely proven effective [ 4 - 6 ]. but even if these therapies are still the mainstay of breast cancer treatment , they display important disadvantages . firstly , tamoxifen and aromatase inhibitors increase the risk of endometrial cancer and osteoporosis , respectively [ 7 ], while anti - epidermal growth factor agents cause severe cardiac toxicity [ 8 ]. secondly , the efficacy of endocrine - active drugs is limited by intrinsic and acquired resistance [ 9 ]. finally , these approaches are useless in triple - negative breast cancers ( tnbc ) that do not express estrogen , progesterone or human epidermal growth factor receptors and are characterized by an extremely poor prognosis [ 10 ]. these factors underline the urgent need for novel clinical strategies . the most promising approach is based on cancer vaccines . such vaccinations exploit tumor - associated antigens able to raise specific cytotoxic t lymphocyte ( ctl ) antitumor responses both in animal models and in clinical settings [ 11 - 14 ]. targets for ideal immunotherapy should have an expression pattern highly restricted to tumor cells to prevent autoimmunity . the main categories of antigens that meet these requirements are mutated , viral and differentiation antigens . numerous clinical trials are currently ongoing for breast cancer vaccines based , for instance , on muc - 1 or estrogen receptors ( clinical trial identifiers nct00986609 and 6 nct00343109 ). more recently , a novel and expanding group of tumor - associated antigens has been discovered : since their expression is testis - restricted , but strongly associated with many tumors , they are called cancer / testis antigens ( cta ). their marked immunogenicity and restricted expression make them ideal targets for immunotherapies : cta vaccinations have been successfully performed in patients with solid cancers of different origins such as lung , ovary and melanoma [ 15 - 17 ]. cta expression in bc has been found to affect cell proliferation [ 18 , 19 ] and to be correlated with a lack of estrogen receptor expression and poor prognosis [ 20 , 21 ]. the cancer / testis antigen sperm protein 17 ( sp17 ) is a highly conserved mammalian protein , normally found in spermatozoa , where it contributes to sperm maturation , capacitation and acrosomal reaction [ 22 ]. aberrant sp17 expression has been shown in ovarian and esophageal cancers [ 23 , 24 ], nervous system tumors [ 25 ] and in multiple myeloma [ 26 ]. sp17 mechanisms of action in cancer cells are still poorly understood . nonetheless , it has been shown that sp17 mediates cell - cell adhesion in malignant b - lymphocytes through heparan - sulfate [ 27 ], and enhances cell motility and drug resistance in ovarian cancer [ 28 ]. thus , sp17 - targeted immunotherapy is likely to prove effective in various solid and hematological tumors . sp17 expression in bc has not been investigated . in the present study , the inventor evaluated sp17 expression at the mrna and protein levels in human breast cancer cell lines , primary idbc and normal breast tissue . then , sp17 immunogenicity was assessed for the development of breast cancer immunotherapy . materials and methods . cell lines and primary samples . a normal breast epithelial cell line and bc cell lines were purchased from the american type culture collection ( atcc , www . atcc . org ): 184b5 cells ( atcc no . crl - 8799 ) are benzo ( a ) pyrene - transformed cells originated from a normal mammary epithelium , mda - mb - 361 cells ( atcc no . htb - 27 ) were originated from a brain metastasis of breast adenocarcinoma , while hcc70 cells ( atcc no . crl - 2315 ) were derived from a primary ductal carcinoma and these cells are negative for the expression of epidermal growth factor receptor - 2 . cell lines were analyzed in 2 passages after purchasing , to rule out possible alterations due to in vitro propagation . primary samples were obtained after informed consent at texas tech university health sciences center , usa and irccs istituto clinico humanitas , italy , according to the declaration of helsinki , and consisted of needle biopsies taken from milk ducts . rna isolation and reveres - transcriptase - polymerase chain reaction ( rt - pcr ). total rna was isolated from bc cell lines or biopsy materials through the aurum total rna mini kit ( bio - rad , hercules , calif .) and 1 μg was retro - transcribed using the iscript cdna synthesis kit ( bio - rad ). rnas from normal human tissues were obtained from firstchoice ® total rna ( ambion , austin , tex .). 1 / 20 of retro - transcription reaction volume was pcr - amplified in 20 μl reaction with itaq hot - start dna polymerase ( bio - rad ). primers sequences were : sp17 left 5 ′- tctccaacacccactaccga - 3 ′ ( seq id no . : 1 ), sp17 right 5 ′- agcggtcttctaccttactcccc - 3 ′ ( seq id no . : 2 ), β - actin left 5 ′- caaggccaaccgcgagaaga - 3 ′ ( seq id no . : 3 ), β - actin right 5 ′- ccagaggcgtacagggatagca - 3 ′ ( seq id no . : 4 ). all reactions were performed at 57 ° c . annealing temperature for 38 cycles with 1 . 5 mm mgcl 2 . 10 μl pcr reaction were run in 2 % w / v agarose gel stained with ethidium bromide . pictures were taken after 30 minutes run using the molecular imager chemidoc xrs + system ( bio - rad ) equipped with a quantity one 1 - d analysis software ( bio - rad ). protein analysis . total proteins were isolated through the readyprep protein extraction kit ( bio - rad ) and quantified using the bradford colorimetric method ( bio - rad ). 80 μg total protein extracts were subjected to electrophoresis in a mini - gel system ( bio - rad ), with a 6 % stacking - and 12 % resolving - polyacrylamide gel . resolved proteins were electro - transferred overnight at 4 ° c . on an immun - blot pvdf membrane ( bio - rad ). membranes were probed with the mouse anti - human - sp17 antibody produced by the present inventor , then with hrp - linked bovine anti - mouse igg ( santa cruz biotechnology ). after antibody hybridization , chemiluminescent signals were detected on a photographic sheet ( sigma - aldrich , st . louis , mo .) using the immun - star westernc chemiluminescent kit ( bio - rad ). pictures of the developed photographic sheets were taken through the molecular imager chemidoc xrs + system ( bio - rad ). immunohistochemistry . biopsy material was embedded in paraffin and 3 μm thick - sections were prepared . slices were exposed to the anti - sp17 primary antibody ( santa cruz biotechnology , 1 : 100 dilution in pbs / bsa 0 . 1 %), and then incubated for 30 minutes with the hrp - linked secondary antibody ( santa cruz biotechnology , 1 : 500 dilution in pbs / bsa 0 . 1 %) and 5 minutes with dab ( 3 , 3 ′- diaminobenzidine , dako , glostrup , denmark ). pictures were taken at 10 ×, 20 ×, 40 × and 63 × objective magnifications using a dmi3000 b inverted microscope ( leica microsystems gmbh , wetzlar , germany ) and analyzed by the leica application suite ( las ) software ( leica microsystems gmbh ). enzyme - linked immunosorbent assay . an enzyme - linked immunosorbent assay ( elisa ) was performed on the sera of 22 bc and on 7 pooled healthy patients . polystyrene 96 - well flat - bottom plates were coated with 5 μg / μl sp17 recombinant protein ( generated by the present inventors ) and incubated overnight at 4 ° c . after washing and blocking with superblock ® buffer ( pierce , rockford , ill ., usa ), plates were placed at 37 ° c . for 2 hours . each sample , as well as the negative controls ( pbs supplemented with 10 % fbs ), were diluted 1 : 1000 in superblock ® buffer and incubated for 4 hours at rt . after washing with pbs / 0 . 05 % tween - 20 , horseradish peroxidase - conjugated goat anti - human igg ( pierce ), diluted 1 : 5000 in superblock ®, was added and allowed to incubate at rt for 2 hours . next , the 1 - step ultra tmb - elisa chromogenic substrate ( pierce ) was added to each well for color development for 10 minutes . after blocking the reaction with sulfuric acid , the intensity was measured by the victor2 micro plate multilabel counter ( perkinelmer , waltham , mass ., usa ) at 450 nm wavelength excitation . all samples were run in triplicate . isolation of peripheral blood mononuclear cells and generation of dendritic cells . peripheral blood mononuclear cells ( pbmcs ) from 22 bc patients were prepared by separation of heparinized blood with density gradient centrifugation performed with ficoll - hypaque . pbmcs were seeded into 6 - well culture plates with 3 ml rpmi 1640 supplemented with 10 % fetal bovine serum ( fbs ) at the density of 8 - 10 × 10 6 cells / well . after 2 hours incubation at 37 ° c . and 5 % co 2 , non - adherent cells were removed ; adherent cells were maintained in rpmi 1640 supplemented with 10 % fbs , 103 iu / ml interleukin 4 ( il - 4 ) and 800 iu / ml granulocyte - macrophage colony - stimulating factor ( gm - csf ). after 1 - week culture , dendritic cells ( dcs ) were harvested and pulsed with sp17 protein [ 26 ]. dendritic cell ( dc ) pulsing . dcs were washed twice with pbs and transferred in a 50 ml polypropylene tube . the recombinant protein ( developed in the inventor &# 39 ; s laboratory ) sp17 ( rsp17 ) was mixed with the cationic lipid dotap ( roche , mannheim , germany ) at room temperature for 20 minutes , then added to the dcs for 3 hours at 37 ° c . generation of sp17 - specific cytotoxic t - lymphocytes ( ctls ) in vitro . antigen pulsed dcs were co - cultured with fresh autologous pbmcs at a ratio of 1 : 10 in rpmi 1640 with 10 % autologous serum , 10 iu / ml il - 2 and 5 ng / ml il - 7 . irradiated autologous pbmcs feeder cells and sp17 protein ( 50 μg / ml ) were added every 7 days , while il - 2 was added every 3 days [ 26 ]. cytotoxicity assay . a standard 4 - hour europium - release assay was performed to evaluate the cytotoxic activity of the sp17 - stimulated t cells [ 26 ]. cytotoxicity against autologous breast cancer primary cells was determined at various effector : target cell ratios in the range of 60 : 1 to 1 : 1 . for the measurement of ctl - mediated lysis of normal breast duct cells ( 184b5 ), breast tumor cell lines ( hcc770 and md - mb - 361 ) or autologous lymphoblastoid cells ( lcl ) alone or pulsed with hpv16 - e6 antigen or with rsp1 , cytotoxicity assay was performed with 20 : 1 effector : target ratio . to determine hla restricted response a cytotoxicity assay was performed with or without 25 μg / ml hla - i or hla - ii ( w6 / 32 or l243 monoclonal antibody , respectively , biolegend 11080 roselle street , san diego , calif .) blocking antibodies ( effector : target ratio 20 : 1 ). standard deviations were determined on the results of the experiments run in triplicates . the inventors first analyzed sp17 mrna expression in bc cell lines . as shown in fig1 , sp17 mrna was detected in metastatic ( mda - mb - 361 ) and primary ( hcc70 ) breast cancer cell lines , but not in the normal mammary epithelium cell line 184b5 . further , it was shown that sp17 mrna expression was absent in a panel of human normal tissues , namely brain , breast , colon , heart , kidney , liver , lung , ovary , pancreas , skeletal muscle , spleen , stomach and bone marrow ( fig2 ). the inventors further validated the data by analyzing sp17 expression at the protein level in 184b5 , hcc70 and mda - mb - 361 cell lines by western blot : fig3 shows that sp17 protein is expressed in bc cell lines but not in 184b5 non - tumor cells . next , the inventors analyzed sp17 expression by rt - pcr in primary cells . samples consisted of 7 normal breast tissues and 22 primary invasive ductal bc ( fig4 ). no sp17 expression was detected in normal mammary ducts , but it was present in 10 bc samples . results and subjects &# 39 ; characteristics are summarized in table 1 . sp17 expression data obtained by rt - pcr in primary samples were confirmed by immunohistochemistry : fig5 a to 5l shows representative pictures taken from immunohistochemical analysis for sp17 protein in normal and tumor mammary duct cells . positive staining was detectable in tumor samples only . fig5 m is a graph that shows the presence of circulating sp17 - specific auto - antibodies . fig5 a to 5l shows the expression and immunogenicity of sp17 in breast cancer ( bc ) population including triple - negative breast cancers . fig5 a control . fig5 b , c , d , e , f , g , h , i are representative ihc pictures of bc and tnbc samples stained with anti - sp17 antibody ( brown signal indicates sp17 - positive cells ). fig5 l - 1 to 5 l - 4 show tissue microarrays ihc for sp17 : 5 l - 1 and 5 l - 3 and breast cancer : 5 l - 2 and 5 l - 4 . fig5 m is a graph that shows circulating anti - sp17 igg were detected in the serum of the majority of bc patients , were not present in the serum of age - matched healthy women ( healthy controls ), and were elevated in triple negative ( tn ) bc patients . in order to evaluate the suitability of sp17 as a target for bc immunotherapy , the presence of anti - sp17 antibodies in the serum of patients &# 39 ; and healthy controls by elisa technique ( fig6 ) was assayed . a positive signal was detected in 10 patients ( 45 %). the cut - off point ( mean + 3 sd ), determined by the healthy controls , was significantly low ( 0 . 04875od ), while negative controls had an od425 nm = 0 . 03235 . finally , the inventors successfully generated anti - sp17 lymphocytes from pbmcs of bc patients . autologous sp17 - stimulated t cells were able to specifically kill bc cells derived from patients &# 39 ; primary samples ( fig7 ). to determine the sp17 - specificity of cell lysis , t cell - mediated killing of normal breast duct cells , 184b5 , hcc770 , md - mb - 361 cell lines or of autologous lymphoblastoid cells ( lcl ) alone or pulsed with hpv - e6 antigen or with rsp17 was measured . results ( fig8 ) show that significant lysis is detectable only in sp17 expressing target cells , namely lcl - sp17 , hcc70 and md - mb - 361 . it is further demonstrated herein that sp17 - stimulated t cells were unable to kill sp17 - expressing target cells when hla - i molecules were blocked through a specific antibody , while killing activity was not affected by hla - ii blocking ( fig8 ). the present inventors demonstrate for the first time that sp17 is a novel cancer / testis antigen in breast cancer . it is shown herein that sp17 is expressed at both mrna and protein levels in breast cancer cell lines , but not in normal breast - derived cells ( 184b5 ). importantly , sp17 is present in both bc primary ( hcc70 ) and metastatic ( mda - mb - 361 ) cells , indicating that its expression is conserved during the metastatic spread of primary tumors . the specificity of this analysis was confirmed by the lack of sp17 detection in high - grade total rna isolated from a wide panel of human normal tissues of different subjects , and by the positive signal displayed in testis - derived rna . finally , the present inventors describe for the first time the presence of sp17 mrna protein in primary invasive ductal bc through rt - pcr and immunohistochemistry ; the same analyses failed to reveal sp17 expression in all normal breast tissues analyzed , indicating the robust specificity of sp17 expression . these data demonstrate that sp17 is a novel target for bc , as it has been successfully proven in animal models of ovarian cancer [ 29 ]. further , sp17 expression has recently been shown to predict cisplatin resistance in esophageal squamous cancer cell lines [ 30 ]. it is shown herein that sp17 is an indicator of bc progression , prognosis and risk of drug resistance . the current need and challenge in the therapy of bc is the discovery of novel tumor - associated antigens for the development of anti - tumor vaccines [ 31 ]. it was found that sp17 - restricted expression in tumor cells is a powerful target for immunotherapy , as shown in ovarian cancer [ 32 ] and multiple myeloma [ 33 ]. the present inventors detected significant levels of anti - sp17 antibodies in the serum of 45 % patients with bc , proving its immunogenicity in vivo . as shown herein , the inventors were able to generate autologous sp17 - specific t cells in vitro , efficiently killing sp17 - expressing primary tumor cells and sp17 - positive bc cell lines , but not sp17 - negative control cells . further , it is shown that cytotoxic activity of autologous sp17 - activated t cells was hla - i restricted , indicating that the anti - tumor response was mediated by cd8 + cytotoxic lymphocytes ( ctl ). remarkably , these results show for the first time that targeting sp17 is an innovative immunotherapeutic approach in the cure of bc , which overcomes the limitations of current therapies . it is contemplated that any embodiment discussed in this specification can be implemented with respect to any method , kit , reagent , or composition of the invention , and vice versa . furthermore , compositions of the invention can be used to achieve methods of the invention . it will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention . the principal features of this invention can be employed in various embodiments without departing from the scope of the invention . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , numerous equivalents to the specific procedures described herein . such equivalents are considered to be within the scope of this invention and are covered by the claims . all publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains . all publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference . the use of the word “ a ” or “ an ” when used in conjunction with the term “ comprising ” in the claims and / or the specification may mean “ one ,” but it is also consistent with the meaning of “ one or more ,” “ at least one ,” and “ one or more than one .” the use of the term “ or ” in the claims is used to mean “ and / or ” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive , although the disclosure supports a definition that refers to only alternatives and “ and / or .” throughout this application , the term “ about ” is used to indicate that a value includes the inherent variation of error for the device , the method being employed to determine the value , or the variation that exists among the study subjects . as used in this specification and claim ( s ), the words “ comprising ” ( and any form of comprising , such as “ comprise ” and “ comprises ”), “ having ” ( and any form of having , such as “ have ” and “ has ”), “ including ” ( and any form of including , such as “ includes ” and “ include ”) or “ containing ” ( and any form of containing , such as “ contains ” and “ contain ”) are inclusive or open - ended and do not exclude additional , unrecited elements or method steps . in embodiments of any of the compositions and methods provided herein , “ comprising ” may be replaced with “ consisting essentially of ” or “ consisting of ”. as used herein , the phrase “ consisting essentially of ” requires the specified integer ( s ) or steps as well as those that do not materially affect the character or function of the claimed invention . as used herein , the term “ consisting ” is used to indicate the presence of the recited integer ( e . g ., a feature , an element , a characteristic , a property , a method / process step or a limitation ) or group of integers ( e . g ., feature ( s ), element ( s ), characteristic ( s ), propertie ( s ), method / process steps or limitation ( s )) only . the term “ or combinations thereof ” as used herein refers to all permutations and combinations of the listed items preceding the term . for example , “ a , b , c , or combinations thereof ” is intended to include at least one of : a , b , c , ab , ac , bc , or abc , and if order is important in a particular context , also ba , ca , cb , cba , bca , acb , bac , or cab . continuing with this example , expressly included are combinations that contain repeats of one or more item or term , such as bb , aaa , ab , bbc , aaabcccc , cbbaaa , cababb , and so forth . the skilled artisan will understand that typically there is no limit on the number of items or terms in any combination , unless otherwise apparent from the context . as used herein , words of approximation such as , without limitation , “ about ”, “ substantial ” or “ substantially ” refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present . the extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature . in general , but subject to the preceding discussion , a numerical value herein that is modified by a word of approximation such as “ about ” may vary from the stated value by at least ± 1 , 2 , 3 , 4 , 5 , 6 , 7 , 10 , 12 or 15 %. all of the compositions and / or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure . while the compositions and methods of this invention have been described in terms of preferred embodiments , it will be apparent to those of skill in the art that variations may be applied to the compositions and / or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept , spirit and scope of the invention . all such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit , scope and concept of the invention as defined by the appended claims . 1 . margolese r g , hortobagyi g n , buchholz t a . histologic types . in : kufe d w , pollock r e , weichselbaum r r , bast , r c jr , gansler , t s , holland , j f , frei iii e , editors . neoplasms of the breast . hamilton ( canada ): bc decker inc . ; 2003 . p . 121 . 2 . dian d , herold h , mylonas i , scholz c , janni w , sommer h , et al . survival analysis between patients with invasive ductal and invasive lobular breast cancer . arch gynecol obstet 2009 ; 279 ( 1 ): 23 - 8 . 3 . li c i , moe r e , daling j r . survival analysis between patients with invasive ductal and invasive lobular breast cancer . arch gynecol obstet 2009 ; 279 ( 1 ): 23 - 8 . 4 . hughes - davies l , caldas c , wishart g c . tamoxifen : the drug that came in from the cold . br j cancer 2009 ; 101 ( 6 ): 875 - 8 . 5 . cleator s j , ahamed e , coombes r c , palmieri c , cleator s j , ahamed e , et al . a 2009 update on the treatment of patients with hormone receptor - positive breast cancer . clin breast cancer 2009 ; 9 suppl 1 : s6 - s17 . 6 . spector n l , blackwell k l . understanding the mechanisms behind trastuzumab therapy for human epidermal growth factor receptor 2 - positive breast cancer . j clin oncol 2009 nov . 2 . 7 . lin m l , fukukawa c , park j h , naito k , kijima k , shimo a , et al . involvement of g - patch domain containing 2 overexpression in breast carcinogenesis . cancer sci 2009 ; 100 ( 8 ): 1443 - 50 . 8 . de azambuja e , bedard p l , suter t , piccart - gebhart m . cardiac toxicity with anti - her - 2 therapies : what have we learned so far ? target oncol 2009 ; 4 ( 2 ): 77 - 88 . 9 . musgrove e a , sutherland r l . biological determinants of endocrine resistance in breast cancer . nat rev cancer 2009 ; 9 ( 9 ): 631 - 43 . 10 . arslan c , dizdar o , altundag k . pharmacotherapy of triple - negative breast cancer . expert opin pharmacother 2009 ; 10 ( 13 ): 2081 - 93 . 11 . inoda s , hirohashi y , torigoe t , nakatsugawa m , kiriyama k , nakazawa e , et al . cep55 / c10orf3 , a tumor antigen derived from a centrosome residing protein in breast carcinoma . j immunother 2009 ; 32 ( 5 ): 474 - 85 . 12 . sørensen r b , svane i m , staten p t , andersen m h . a surviving specific t - cell clone from a breast cancer patient display universal tumor cell lysis . cancer biol ther 2008 ; 7 ( 12 ): 1885 - 7 . 13 . tsuruma t , iwayama y , ohmura t , katsuramaki t , hata f , furuhata t , et al . clinical and immunological evaluation of anti - apoptosis protein , survivin - derived peptide vaccine in phase i clinical study for patients with advanced or recurrent breast cancer . j transl med 2008 10 ; 6 : 24 . 14 . stauss h j , thomas s , cesco - gaspere m , hart d p , xue s a , holler a , king j , et al . wt1 - specific t cell receptor gene therapy : improving tcr function in transduced t cells . blood cells mol dis 2008 ; 40 ( 1 ): 113 - 6 . 15 . atanackovic d , altorki n k , cao y , ritter e , ferrara c a , ritter g , et al . booster vaccination of cancer patients with mage - a3 protein reveals long - term immunological memory or tolerance depending on priming . proc natl acad sci usa 2008 ; 105 ( 5 ): 1650 - 5 . 16 . odunsi k , qian f , matsuzaki j , mhawech - fauceglia p , andrews c , hoffman e w , et al . vaccination with an ny - eso - 1 peptide of hla class i / ii specificities induces integrated humoral and t cell responses in ovarian cancer . proc natl acad sci usa 2007 ; 104 ( 31 ): 12837 - 42 . 17 . van baren n , bonnet m c , dréno b , khammari a , dorval t , piperno - neumann s , et al . tumoral and immunologic response after vaccination of melanoma patients with an alvac virus encoding mage antigens recognized by t cells . j clin oncol 2005 ; 23 ( 35 ): 9008 - 21 . 18 . ajiro m , katagiri t , ueda k , nakagawa h , fukukawa c , lin m l , et al . involvement of rqcd1 overexpression , a novel cancer - testis antigen , in the akt pathway in breast cancer cells . j oncol 2009 ; 35 ( 4 ): 673 - 81 . 19 . lin m l , fukukawa c , park j h , naito k , kijima k , shimo a , et al . involvement of g - patch domain containing 2 overexpression in breast carcinogenesis . cancer sci 2009 ; 100 ( 8 ): 1443 - 50 . 20 . grigoriadis a , caballero o l , hoek k s , da silva l , chen y t , shin s j , et al . ct - x antigen expression in human breast cancer . proc natl acad sci usa 2009 ; 106 ( 32 ): 13493 - 8 . 21 . frank b , wiestler m , kropp s , hemminki k , spurdle a b , sutter c , et al . association of a common akap9 variant with breast cancer risk : a collaborative analysis . j natl cancer inst 2008 ; 100 ( 6 ): 437 - 42 . 22 . lea i a , richardson r t , widgren e e , o &# 39 ; rand m g : cloning and sequencing of cdnas encoding the human sperm protein , sp17 ; biochim biophys acta 1996 , 1307 : 263 - 266 . see also chiriva - internati m , gagliano n , donetti e , costa f , grizzi f , franceschini b , et al . sperm protein 17 is expressed in the sperm fibrous sheath . j transl med 2009 15 ; 7 : 61 . 23 . nakazato t , kanuma t , tamura t , faried l s , aoki h , minegishi t . sperm protein 17 influences the tissue - specific malignancy of clear cell adenocarcinoma in human epithelial ovarian cancer . int j gynecol cancer 2007 ; 17 ( 2 ): 426 - 32 . 24 . gupta g , sharma r , chattopadhyay t k , gupta s d , ralhan r . clinical significance of sperm protein 17 expression and immunogenicity in esophageal cancer . int j cancer 2007 ; 120 ( 8 ): 1739 - 47 . 25 . grizzi f , gaetani p , franceschini b , di ieva a , colombo p , ceva - grimaldi g , et al . sperm protein 17 is expressed in human nervous system tumors . bmc cancer 2006 ; 6 : 23 . 26 . murakami , y . et al . toso , a functional igm receptor , is regulated by il - 2 in t and nk cells . j . immunol . 2012 ; 189 , 587 - 597 . 27 . lacy h m , sanderson r d . sperm protein 17 is expressed on normal and malignant lymphocytes and promotes heparan sulfate - mediated cell - cell adhesion . blood 2001 ; 98 ( 7 ): 2160 - 5 . 28 . li f q , han y l , liu q , wu b , huang w b , zeng s y . overexpression of human sperm protein 17 increases migration and decreases the chemosensitivity of human epithelial ovarian cancer cells . bmc cancer 2009 ; 9 : 323 . 29 . chiriva - internati m , grizzi f , weidanz j a , ferrari r , yuefei y , velez b , et al . nod / scid tumor model for human ovarian cancer that allows tracking of tumor progression through the biomarker sp17 . j immunol methods 2007 ; 321 ( 1 - 2 ): 86 - 93 . 30 . anderson k s . tumor vaccines for breast cancer . cancer invest 2009 ; 27 ( 4 ): 361 - 8 . 31 . kausar t , ahsan a , hasan m r , lin l , beer d g , ralhan r . sperm protein 17 is a novel marker for predicting cisplatin response in esophageal squamous cancer cell lines . int j cancer 2009 aug . 14 . [ epub ahead of print ]. 32 . chiriva - internati m , weidanz j a , yu y , frezza e e , jenkins m r , kennedy r c , cobos e , et al . sperm protein 17 is a suitable target for adoptive t - cell - based immunotherapy in human ovarian cancer . j immunother 2008 ; 31 ( 8 ): 693 - 703 . 33 . chiriva - internati m , wang z , salati e , wroblewski d , lim s h . successful generation of sperm protein 17 ( sp17 )- specific cytotoxic t lymphocytes from normal donors : implication for tumour - specific adoptive immunotherapy following allogeneic stem cell transplantation for sp17 - positive multiple myeloma . scand j immunol 2002 ; 56 ( 4 ): 429 - 33 . 34 . arora s , matta a , shukla n k , deo s v , ralhan r . identification of differentially expressed genes in oral squamous cell carcinoma . mol carcinog 2005 ; 42 ( 2 ): 97 - 108 .	0
as shown in fig1 a and 1 b a patient 1 is connected to a number of items of intensive care equipment typically employed in an intensive care unit of a hospital . the patient 1 is for instance connected to an ecg apparatus 2 which , via electrodes 3 connected at different positions on the patient 1 , records and analyzes the patient &# 39 ; s heart signals . further a ventilator 4 is connected to the patient 1 via gas lines 5 for supporting or controlling the patient &# 39 ; s respiration . an infusion system 6 is connected to the patient 1 via an infusion line 7 for providing the patient with nutrient solution , plasma or other substances which can be infused during intensive care . a monitor 8 according to the invention includes a catheter 9 for communication with the system of the patient 1 and a housing 10 in which is placed a sensor unit ( not shown ). for clarity , the catheter 9 is shown with a disproportional length . in reality , the catheter 9 should be as short as possible to reduce the total liquid volume in the catheter and to accelerate that volume reaching equilibrium with the blood . the arrangement 8 will therefore normally be located very close to , if not in direct contact with , the patient 1 as illustrated in fig1 b . a central control unit 11 is connected to all apparatus units 2 , 4 , 6 , 8 involved in the intensive care treatment of the patient 1 for recording , analyzing and controlling ( automatically or by prompting changes ) the treatment given to the patient 1 . a display 12 can display different curves or measurement results relating to the patient 1 , such as ecgs , respiration curves , blood gas content , etc . fig2 shows an embodiment of the monitor 8 according to the present invention useable in the intensive care situation depicted in fig1 . the catheter probe 9 is shown as having a concentric arrangement of inner and outer lumens 13 , 14 respectively . the outer lumen 14 is made of a fluid tight material except for a region 15 which in use is intended to contact the patient &# 39 ; s blood and which is made of a permeable material selected to permit the chemicals of interest to migrate through it . the inner lumen 13 is impermeable to these chemicals and ends just short of the catheter tip 16 . both lumens 13 , 14 are connected to a housing 10 within which the lumens 13 and 14 are separated . the inner lumen 13 is passed through the wall of the outer lumen 14 , to a peristaltic pump 17 and back into the outer lumen 14 which terminates in the housing 10 . in this manner a closed flow path ( shown by the arrows within the catheter 9 ) is formed for a probe fluid , such as a saline solution . within the housing 10 the inner lumen 13 is connected a sensor unit 19 in a manner which enables the unit 19 to be isolated from the flowing probe liquid . referring to fig3 two valves 20 and 21 are disposed on opposite sides of a sample chamber 23 of the sensor unit 19 and synchronously open and close to periodically exchange liquid samples with the inner lumen 13 . that is , with both valves 20 , 21 open the pump 17 acts to drive liquid from the lumen 13 , along the flow path 22 , through the valve 20 and into the sample chamber 23 . the same amount of liquid is displaced from the sensor unit 19 , through the valve 21 , to return to the inner lumen 13 . when the new sample has replaced the old in the sensor unit 19 the valves 20 , 21 are closed and a new analysis is made by sensors 18a . . . c . as the sample volume in this system is much less than the total volume of the probe liquid , the valves 20 , 21 are closed for much longer than they are open so that the probe liquid is cycled past the permeable region 15 of the catheter 9 several times before a new sample is taken . thus a large , substantially the entire , volume of the liquid reaches equilibrium with the blood . it should be noted that a change in the treatment ( by means of a ventilator or other equipment ) of a patient will normally not have an instantaneous effect on the measured level of diffusable blood chemicals since a systemic exchange between the treatment and the body ( such as the gas exchange between gases in the lungs and in the blood system ) first must occur before the parameter of interest is affected . this could in some circumstances take up to a couple of minutes , depending on the individual case and the parameter to be measured . it may therefore be sufficient to periodically open the valves 20 , 21 at this related rate , which in most , cases will ensure that the entire liquid volume is in equilibrium between sample extractions . one or more of any known optical , electrochemical or similar sensors 18a . . . c are disposed within the chamber 23 to analyze any fluid within it and can be arranged to communicate with devices external to the monitor 8 using any known telemetric techniques , for example electrically conducting cables 24 , or optical or radio frequency transmitter / receiver arrangements ( not shown ). in the present case , where it desired to analyze blood gasses , suitable sensors may be an oxygen electrode 18a , such as a clark type electrode , a carbon dioxide electrode 18b , such as commonly available glass electrodes or an ion selective field effect transistor ( isfet ) and an electrode , such as an isfet , with a suitable chemically sensitive covering 18c , to selectively sense the presence of electrolytes . these are all well known in the art so that it is not necessary to describe the sensors 18a . . . c in further detail . furthermore , as such electrodes are well known in the art and may be chosen dependent on the parameters to be measured , the above selection is not intended to be a limitation to the scope of the present invention . a second flow path 25 is provided within the unit 19 which also provides a fluid communication with the sample chamber 23 via control valves 26 , 27 and is used to introduce calibration fluid to the sensors , for example from a source external to the housing 10 , typically when valves 20 , 21 are closed . this second flow path 25 also may used to introduce a flushing fluid into the chamber 23 when it is desirable not to contaminate the probe liquid with calibration fluid , or may be used to introduce new probe liquid into the monitor 8 . the valves 20 , 21 , 26 , 27 may all be fabricated using standard micromechanical techniques or may be standard magnetic or pressure controlled valves . a further embodiment of a sensor unit 19 , usable in the monitor according to the present invention , having an alternative extraction instrument 28 is shown in fig4 . components that are common to fig4 and fig2 and 3 are given the same reference numerals . here a miniature syringe 28 is used to extract a sample of probe liquid for analysis by the sensors 18a . . . c . the syringe 28 is connected to a fluid conduit 29 , which is disposed between the inner lumen 13 and the sensors 18a . . . c , by means of a variable flow path , such as a shunt valve 30 . the shunt valve 30 is moveable between a position in which liquid can be drawn into the syringe 28 from the inner lumen 13 and a position in which liquid may be expelled from the syringe 28 to provide a sample at the sensors 18 . . . c . although the embodiments contained herein are described in connection with the monitoring of blood gasses this is not intended to be a limitation on the scope of the invention . it will be understood that the monitor of the above embodiments could be readily adapted to measure other diffusable chemical substances such as glucose or h + ions ; that the double lumen catheter could be replaced with any dialysis type catheter ; and that the body fluid need not be inside the body during analysis without falling outside the scope of the invention . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art .	0
referring to fig1 , a communication system 10 includes a pair of correspondents 12 , 14 connected by a communication link 16 . each correspondent 12 , 14 includes a respective cryptographic unit 18 , 20 . each correspondent 12 , 14 can include a processor 22 , 24 . each processor may be coupled to a display and to user input devices , such as a keyboard , mouse , or other suitable devices . if the display is touch sensitive , then the display itself can be employed as the user input device . a computer readable storage medium is coupled to each processor 22 , 24 for providing instructions to the processor 22 , 24 to instruct and / or configure processor 22 , 24 to perform steps or algorithms related to the operation of each correspondent 12 , 14 , as further explained below . the computer readable medium can include hardware and / or software such as , by way of example only , magnetic disks , magnetic tape , optically readable medium such as cd rom &# 39 ; s , and semi - conductor memory such as pcmcia cards . in each case , the medium may take the form of a portable item such as a small disk , floppy diskette , cassette , or it may take the form of a relatively large or immobile item such as hard disk drive , solid state memory card , or ram provided in a support system . it should be noted that the above listed example mediums can be used either alone or in combination . in order to transfer data between the correspondents 12 , 14 , a packet stream 30 is assembled at one of the correspondents in accordance with a defined protocol . the packet stream 30 is shown schematically in fig2 and is composed of one or more frames 31 , each of which has a header 32 and data 34 . in some protocols , the packet may itself be organised as a frame with a header 32 a and the data 34 a consisting of a collection of individual frames . the header 32 is made up of a string of bits and contains control information at specified locations within the bit stream . included in each of the headers 34 are security control bits 33 , that includes a security mode bit 35 and integrity level bits 36 , 37 . in this embodiment , security mode bit 35 is used to indicate whether encryption is on or off . security bits 36 and 37 together are used to indicate which of four integrity levels , such as 0 , 32 , 64 , or 128 bit key size is utilised . the security mode bit may be used to indicate alternative modes of operation such as authentication , and the number of bits may be increased to accommodate different combinations . it will be recognized that providing security bits in each frame 31 of the stream 30 allows the security level to be on a frame - by - frame basis rather than on the basis of a pair of correspondents , therefore providing greater flexibility in organizing communications . in order to provide security , certain minimum security levels may be used . these levels should be decided upon among all of the correspondents through an agreed - upon rule . this rule may be either static or dynamic . in operation , the correspondent 12 performs the steps shown in fig4 by the numeral 100 to send information to the correspondent 14 . first , the correspondent 12 prepares data and a header at step 102 . then it selects the security level at step 104 . the security level is determined by considering the minimum security level required by the recipient , the nature of the recipient , and the kind of data being transmitted . if the security level includes encryption , then the correspondent 12 encrypts the data at step 106 . if the security level includes authentication , then the correspondent 12 signs the data at step 108 . then the correspondent 12 includes bits indicating the security mode and security level in the frame control at step 110 . the correspondent 12 then sends the frame to the correspondent 14 . upon receiving the frame , the correspondent 14 performs the steps shown in fig5 by the numeral 120 . the correspondent 14 first receives the frame at step 122 . it then extracts the security bits at step 124 . if the security mode bits 35 _indicate encryption , then the correspondent 14 decrypts the data at step 126 . if the security bits indicate authentication , then the correspondent 14 verifies the signature at step 126 . finally , the correspondent 14 checks the security level to ensure it meets predetermined minimum requirements . if either the encryption or authentication fails , or if the security level does not meet the minimum requirements , then the correspondent 14 rejects the message . it will be recognized that providing security bits and an adjustable security level provides flexibility in protecting each frame of the communication . it is therefore possible for the sender to decide which frames should be encrypted but not authenticated . since authentication typically increases the length of a message , this provides a savings in constrained environments when bandwidth is at a premium . in a further embodiment , the correspondent 12 wishes to send the same message to multiple recipients 14 with varying minimum security requirements . in this case , the correspondent 12 chooses a security level high enough to meet all of the requirements . the correspondent 12 then proceeds as in fig4 to assemble and send a message with the security level . the message will be accepted by each recipient since it meets each of their minimum requirements . it will be recognized that this embodiment provides greater efficiency than separately dealing with each recipient &# 39 ; s requirements . in another embodiment , a different number of security bits are used . the actual number of bits is not limited to any one value , but rather may be predetermined for any given application . the security bits should indicate the algorithm parameters . they may be used to determine the length of a key as 40 bits or 128 bits , the version of a key to be used or any other parameters of the encryption system . although the invention has been described with reference to certain specific embodiments , various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined in the claims appended hereto .	7
referring initially to fig1 - 3 of the drawings , an embodiment of the scented trail apparatus of this invention is generally illustrated by reference numeral 1 . in this embodiment the scented trail apparatus 1 is characterized by a scent canister 6 , typically having a generally cylindrical canister housing 7 defining a canister housing interior 10 and having a housing mount end 8 , with a canister retainer 9 extending therefrom . the opposite end of the scent canister 6 is open at an interior lip 10 a ( fig2 and 3 ) to removably receive a cap 11 , typically fitted with a cap tether 12 for retaining the cap 11 on the open end of the canister housing 7 of the scent canister 6 . the cap 11 is typically designed to fit on the interior lip 10 a of the canister housing 7 in a friction - fit , as hereinafter further described . a cap band 13 may be typically be used to attach the cap tether 12 to the canister housing 7 of the scent canister 6 . as illustrated in fig1 and 4 of the drawings the reel 17 has a rotatable spool 18 fitted with one or more spool grips 19 and journalled for rotation on a frame 20 by means of a shaft or spindle 21 . a line 15 , which may be of any size and character , but is typically characterized by monofilament fishing line , is wound on the spool 18 , as illustrated in fig4 of the drawings . the opposite end of the line 15 is typically secured to a mount eye 4 , provided in an eye bracket 5 attached to a scent strip mount 3 of a scent carrier 1 a . referring again to fig2 and 3 , it will be appreciated that the scent carrier 1 a , including a pair of typically flexible , liquid - absorbent scent strips 2 , attached to the scent strip mount 3 , can be inserted in the open end of the canister housing 7 of the scent canister 6 . in one embodiment an animal lure scent ( not illustrated ) can be poured or otherwise placed in the canister housing interior 10 of the canister housing 7 , to coat or saturate the scent strips 2 with an animal scent lure of choice . alternatively , the scent strips 2 can be coated or saturated with an animal scent lure and the scent strips 2 then placed in the canister housing interior 10 . under circumstances where the scent carrier 1 a is inserted in the canister housing 7 as illustrated in fig2 , the typically plastic cap 11 can be closed over the interior lip 10 a of the canister housing 7 , with a portion or segment of the line 15 depressed between the cap 11 and the canister housing 7 , as illustrated in fig1 . referring now to fig4 of the drawings , under circumstances where it is desired to use the scented trail apparatus 1 to create a scented trail through brush 24 , typically between a tree 23 and the reel 17 , the latter of which is spaced - apart from the scent canister 6 , the scent canister 6 is initially secured or tethered to the tree 23 , typically using a retainer strap , rope or chain 14 and clip 14 a . the retainer chain 14 may be typically secured to the canister retainer 9 at the housing mount end 8 of the canister housing 7 . the scent carrier 1 a is attached to the line 15 and wound to the reel 17 and a quantity of the animal scent lure ( not illustrated ) is either placed inside the canister housing 7 of the scent canister 6 or applied directly to the scent strips 2 . the reel 17 is then attached to brush 24 or to a tree or stake at a blind or observation area ( not illustrated ) and the scent carrier 1 a is grasped and the line 15 manually carried and unwound from the spool 18 along a predetermined trail , until the scent carrier 1 a is located at the tree 23 , where it is inserted in the scent canister 6 . the cap 11 is then closed over a segment of the line 15 near the eye bracket 5 of the scent strip mount 3 , as illustrated in fig1 and 2 of the drawings . the reel 17 is then activated , either manually by grasping the spool grip or grips 19 and rotating the spool 18 , or automatically , using an electric reel of suitable design , according to the knowledge of those skilled in the art . rotation of the spool 18 applies tension to the line 15 and causes the cap 11 to be removed from the friction - fit on the interior lip 10 a of the canister housing 7 . additional tension applied to the line 15 by continued rotation of the spool 18 causes the scent carrier 1 a to exit the now - open canister housing interior 10 as illustrated in fig3 and 4 of the drawings , and traverse the brush 24 along the terrain of the predetermined trail between the scent canister 6 and the reel 17 . during the initial transportation by hand of the scent carrier 1 a through the brush 24 from the reel 17 to the scent canister 6 , a line depressor 16 , having a depressor fork 16 a , may be typically manually applied to the line 15 at the depressor fork 16 a , to force the line 15 downwardly against or near the ground or terrain as the scent carrier 1 a is carried through the brush 24 . reverse movement of the scent carrier 1 a along the trail by operation of the reel 17 then operates to leave a residue of animal lure scent from the scent strips 2 along the trail between the scent canister 6 and the reel 17 . when the scent carrier 1 a reaches the reel 17 the desired scent trail has been established between the scent canister 6 and the reel 17 and the scent carrier 1 a and reel 17 are put aside , while the scent canister 6 typically remains in position at the tree 23 . it will be appreciated by those skilled in the art that use of the line depressor 16 is optional for adjusting the height of the line 15 from the ground and depending upon the nature of the terrain and the plant , grass and tree growth or rocky ground between the scent canister 6 and the reel 17 , the line dispenser 16 may not be needed . however , under circumstances where fairly thick grass or brush 24 is located between the scent canister 6 and the reel 17 , the line depressor 16 may be utilized to manually engage the depressor forks 16 a with the line 15 rearwardly of the scent carrier 1 a as the scent carrier 1 a is carried along the terrain to the scent canister 6 , into a desired position between the ground and the grass or brush 24 , to leave the residue of animal scent lure at a selected level along the scent trail . it is understood that a selected length of line 15 can be located in the scent canister 6 and saturated or coated with scent in lieu of the scent carrier 1 a . this segment or length of the line 15 remains in place along the trail after deployment . it will be further appreciated by those skilled in the art that the scent canister 6 may be of any shape , size and design which is characterized by a container having a closed or sealed canister housing suitable for application of a typically liquid animal scent lure for enclosing animal scent and a scent carrier of selected design . alternatively , saturation or coating of the absorbent scent strips on the scent carrier or on the segment of line 15 can be effected for leaving the desired scent residue along the trail . furthermore , any number of scent strips 2 can be utilized with the scent strip mount 3 on the scent carrier 1 a and the scent strip or strips 2 are typically constructed of flexible felt , sponge or an alternative liquid - absorbent material , to facilitate easy insertion in and removal from the canister housing interior 10 of the canister housing 7 . it will be further appreciated that the canister housing 6 and the reel 17 can be attached or tethered to substantially any spaced - apart objects , such as stumps , rocks or stakes , as well as a tree 23 or even some brush 24 , to relatively immobilize , tether or secure the reel 17 and scent canister 6 in place and facilitate placement of the scent carrier 1 a or the scent - impregnated segment of the line 15 in the scent canister 6 and later retrieval of the scent canister 1 a or segment of the line 15 from the scent canister 6 , by tension in the line 15 responsive to operation of the reel 17 . moreover , the scent canister 6 may be designed such that the scent strip or strips 2 or the scented segment of the line 15 are encapsulated inside . this design allows the scent strip or strips 2 or the segment of the line 15 to be pulled through the encapsulated seal and deployed as described above . this allows use of a non - capped canister 6 with the animal scent lure and scent carrier 1 a or the scented segment of the line 15 placed in the canister housing interior 10 without using the cap 11 . it will also be appreciated by those skilled in the art that the reel 17 may be of any desired design , including the design illustrated in the drawings , or a fishing reel of any character , as well as a more simple device , such as a stick or board for receiving the monofilament line 15 wound thereon . moreover , when a reel 17 of selected design is utilized , it may be manual and provided with one or both of the indicated reel spool grips 19 as illustrated in fig1 and 4 , or it may be automated by an electric motor ( not illustrated ), according to the knowledge of those skilled in the art . when automated , the reel 17 may be secured to the stand or blind ( not illustrated ) at one end of the trail and activated , and the user may first carry the scent carrier 1 a to the scent canister 6 and optionally utilize the line depressor 16 by placing the depressor forks 16 a on the line 15 rearwardly of the scent carrier 1 a , to effect the desired later application of animal scent residue on , or at a selected height above , the ground and through the brush 24 by operation of the reel 17 . while the preferred embodiments of the invention have been described above , it will be recognized and understood that various modifications may be made in the invention and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention .	0
the specifications of u . s . application ser . nos . 09 / 434 , 376 ; 09 / 634 , 707 ; and 09 / 702 , 861 of which the present application is a c - i - p , are being hereby incorporated by reference . [ 0074 ] fig1 shows a side view of a 3 - cavity gt etalon tuned to provide dispersion compensation for an output signal from an interleaver circuit . the cavities are made of three blocks of silica providing a predetermined gap of 0 . 52 mm between reflective end faces . the device has a front input / output face having a reflectivity of 0 . 088 %, a second face with a reflectivity of 3 . 6 %, a third face with reflectivity of 42 % and an outward ( back ) face that is substantially totally reflective having a reflectivity of practically 100 %. the periodic nature of time delay versus wavelength is shown in fig2 . [ 0075 ] fig3 illustrates dispersion vs . wavelength for a 3 - cavity gt etalon dispersion compensator , wherein the periodic nature of the dispersion is evident from the plot . [ 0076 ] fig4 is a plot of dispersion resulting from utilizing two different multi - cavity systems to correct for dispersion . as a result , one can obtain a constant dispersion over a wide spectral region . by changing the relative phase of the two systems , one can obtain different dispersion . the solid line in fig4 is the dispersion from a first multi - cavity etalon , disp i n a while the dotted line is the dispersion from a second multi - cavity etalon that does not necessarily have the same number of cavities as in the first multi - cavity etalon . the resulting dispersion after passing through both etalons with a flat line result for λ i 1 . 5499 to 1 . 5501 nm is a dashed line . this is an illustration of how the invention allows for the correction of dispersion in an optical fiber . note that if the second multi - cavity etalon &# 39 ; s dispersion characteristic is tuned to a slightly longer wavelength , the resulting dispersion for λ 1 1 . 5499 to 1 . 5501 nm would be a flat line but with a dispersion value below zero . similarly , if the second multi - cavity etalon &# 39 ; s dispersion characteristic is tuned to a slightly shorter wavelength , the resulting dispersion would be a flat line but with a dispersion value above zero . the use of a multipass system allows for a greater range of change in each multi - cavity etalon since a multipass multi - cavity is a way of amplifying the effect of a single pass through the multi - cavity system . in fact , several multiple pass multi - cavity etalon systems can be cascaded to achieve a still greater range of dispersion effects . in order to obtain a zero - dispersion ( fig4 ), the channels &# 39 ; central wavelength should correspond . notwithstanding , this feature can be used as an advantage of the invention . for example , by varying the optical path length between the etalon end faces of the gt dispersion compensator , the etalon &# 39 ; s dispersion characteristics can be varied to a slightly higher or lower wavelength . this tuning can be effected by providing a change in temperature to the gt device , for example by providing a heating element adjacent the etalon to heat the block , or conversely by providing cooling to reduce the optical path length . in addition , both can be done simultaneously in the case of a system with two multiple pass multi - cavity etalons where one multiple pass multi - cavity etalon would be heated and the second multiple pass multi - cavity would be cooled . further to this would be a solution where one multiple pass multi - cavity etalon would be heated or cooled by a greater amount than the second multiple pass multi - cavity etalon . thus the flat but present dispersion present in the optical fiber within the system can be compensated for by providing a required flat dispersion compensation that is afforded by fine tuning the gt cavity optical path length . [ 0079 ] fig5 a illustrates the functioning of an x - beam displacer 101 to separate the two orthogonally polarized beams vertically and rotate the polarization of one beam using a half waveplate hwp 121 so both beams 111 have the same o polarization . as shown in fig5 the beams 111 then travel straight through a y - beam displacer 102 . the beams 111 then pass through a quarter waveplate qwp 103 resulting in a change in polarization to circular . the circular polarized light 111 c passes into the multi - cavity etalon 109 and is reflected back and passes through qwp 103 that changes the polarization to extraordinary , e . the e - beams 112 are displaced by y - beam displacer 102 and reflect off of the qwp mirror assembly 107 that changes the polarization of the beams to ordinary , o 113 . the o - beams 113 travel straight through y - beam displacer 102 , impinge on qwp 103 , become circularly polarized 113 c and travel into multi - cavity etalon 109 and are reflected back and impinge on qwp 103 . the beams undergo a polarization change to become e polarized beams 114 . as e - beams 114 pass through element 102 they are displaced by y - beam displacer 102 until the beams impinge qwp mirror assembly 107 that changes the polarization of the beams 115 to o and o - beams 115 travel straight through beam displacer 102 and through qwp 103 changing to circularly polarized light 115 c . as before , the beams 115 c are reflected by multi - cavity etalon 109 and impinge on qwp 103 . qwp 103 changes the polarization of the beams to e 116 which are displaced by y - beam displacer 102 and exit the optical element . one of the e beams is passed through hwp 122 causing a change in polarization to an o beam and then beams 116 are recombined to a single beam by x - beam displacer 108 to form beam 117 . these embodiments allow reflecting from the multi - cavity etalon at near - normal incidence reducing degradation of the signal due to insertion loss and the dispersion properties of the etalon . now referring to fig6 in the qwp mirror assembly the mirror has been replaced with an additional multi - cavity etalon 1110 . beams 112 have the same polarization and conditions as in fig5 until after these beams travel through the qwp 1071 becoming circularly polarized , impinge on multi - cavity etalon 1110 , are reflected back to qwp 1071 which changes the polarization to o , and then travel straight through y - beam displacer 102 . each time the beams are redirected by the multi - cavity etalon 109 and pass through qwp 103 for the second time , the beams undergo a polarization change to e and y - beam displacer 102 displaces them . each time the beams are redirected by multi - cavity etalon 1110 and pass through qwp 1071 for the second time the beams undergo a polarization change to o polarization which allows them to travel straight through the y - beam displacer 102 . thus are the beams redirected until they are recombined to a single beam by x - beam recombiner 108 to form beam 117 . referring to fig7 the beam displacer 102 in fig6 is replaced with a block of polarizing beam splitters pbss 302 . these beam splitters allow o polarized beam to pass straight through and deflect e polarized beams 90 degrees . the “ ordinary ” beams 311 , 313 , 315 , and 317 , travel through the beam splitters to impinge first on the qwp 103 becoming circularly polarized and then on the multi - cavity etalon 109 . the beams that return from the multi - cavity etalon 109 again pass through the qwp 103 to become e polarized beams 312 , 314 , 316 , and 318 , and then impinge on the qwp mirror assembly 107 . the qwp mirror assembly 107 reflects the beams and changes the polarization to “ o ” which allows the beams to pass through the pbs . the result is eight reflections from the etalon as each beam 311 , 313 , 315 , 317 is directed twice at the etalon . this process of reflection and transmission occurs until the final stage where the beams of 318 are recombined in x - beam combiner 308 . note that the mirror of the qwp mirror assembly 107 can be replaced with a multi - cavity etalon which may have the same number of cavities as the first multi - cavity etalon , as illustrated in fig6 but does not have to and the invention herein disclosed is not so restricted . these systems of multiple pass tunable dispersion compensators can be used in combinations to set different dispersion corrections and result in an overall dispersion correction for a set of international telecommunication union ( itu ) channels . each separate multipass tunable dispersion compensator etalon system would solve a different dispersion problem . as shown in the illustrations in fig5 , and 7 , there is no angle tuning of the individual systems . rather , each multiple pass tunable compensator allows for the optical beam to enter and leave the etalon normal to the front surface , r 4 . this reduces ripple loss that is caused by the interaction of beams from the different surfaces when the incident beam is not normal to the front surface . of course by having multiple passes this ripple loss would be increased on each pass . therefore , for the multiple pass multi - cavity etalons , having the optical beam at a normal incidence is a requirement to keep losses low . the use of multiple passes through the same multi - cavity etalon allows the dispersion to be corrected without attaining losses due to fiber coupling the etalon at each surface and at each multi - cavity interface . thus the multiple pass system takes the advantages of the multi - cavity etalon and improves the optical properties further . these systems are still temperature tunable as discussed earlier in this document . in the embodiment of fig8 the input and output port 330 of the device is the same and is coupled with a garnet / hwp block 332 , a ybd beam displacer 334 , a wollaston prism 336 , a beam displacer 338 and a dual - fiber collimator 340 which has a grin lens 342 and a two - fiber tube 344 . the arrangement 332 - 344 functions as an isolator so that the single input / output port is sufficient . it will be noted that the mirror 107 extends to reflect the beam 116 , but the quarter waveplate 346 does not extend to the same degree . as a result , the beam 116 undergoes a reflection and goes back over the same path to the output port 330 . in the embodiment of fig9 the device has a circulator that employs , instead of a wollaston prism as in fig8 a pbs block coupled to collimators and beam displacers on one side and a garnet - hwp unit 332 on the other side . the collimator is coupled to the input / output port 330 as in the embodiment of fig8 . the arrangement of fig1 has a similar circulator design as the embodiment of fig8 . it will be seen , however , that the birefringent routing block 102 of fig5 and 8 is replaced by a polarizing beam splitter block 302 as in fig7 . because of the need to reroute the input beam from the input / output port 330 through the pbs and back to the input / output port , an additional mirror 352 is disposed in the path of the optical beam 354 exiting the pbs in order to reflect the beam 354 back into the pbs to follow a reverse route with multiple reflections from the etalon . it will be understood that the input beam in the embodiment of fig1 will undergo eight passes through the etalon 109 ( four on its way “ forward ” from the input to the mirror 352 and four on its way “ back ”). the elements analogous to elements in other embodiments are not mentioned in detail . of course numerous other embodiments may be envisaged , without departing from the spirit and scope of the invention herein disclosed .	6
the present invention relates to a hybrid polymer electrolyte comprising a porous polymer matrix consisting of superfine polymer fibers having a diameter of 1 nm ˜ 3000 nm and a polymer electrolyte incorporated into the porous polymer matrix . in particular , the present invention relates to a hybrid polymer electrolyte obtained by dissolving a polymer in an organic solvent , generating a porous polymer matrix in the form of superfine fibers having a diameter of 1 nm ˜ 3000 nm from the polymeric solution by electrospinning , and injecting a polymer electrolyte solution , in which a polymer , a plasticizer and an organic electrolyte solution are mixed and dissolved together , into the pores of the porous polymer matrix . hereinafter , “ hybrid polymer electrolyte ” means a polymer electrolyte in which a polymer electrolyte is incorporated into a porous polymer matrix ; “ polymer electrolyte solution ” means a solution in which the polymer incorporated into the porous polymer matrix is dissolved in an organic electrolyte solution , and it may further comprise a plasticizer . and , “ polymer electrolyte ” refers totally to an organic electrolyte solution and a polymer incorporated into a porous polymer matrix . as depicted in fig1 , a porous polymer matrix consisting of superfine polymer fibers has a structure in which superfine fibers having a diameter of 1 ˜ 3000 nm are grouped disorderly and three - dimensionally . due to the small diameter of the fibers , the ratio of surface area to volume and the void ratio are very , high compared to those of a conventional matrix . accordingly , due to the high void ratio , the amount of electrolyte impregnated is large and the ionic conductivity is increased , and due to the large surface area , the contact area with the electrolyte can be increased and therefore the leakage of electrolyte can be minimized , in spite of the high void ratio . furthermore , if a porous polymer matrix is fabricated by electrospinning , it has an advantage in that it can be prepared in the form of a film directly . the polymers for forming the porous polymer matrix are not particularly limited , on condition that they can be formed into fibers ; in particular , that they can be formed into superfine fibers by electrospinning . examples include polyethylene , polypropylene , cellulose , cellulose acetate , cellulose acetate butylate , cellulose acetate propionate , polyvinylpyrrolidone - vinylacetate , poly [ bis ( 2 -( 2 - methoxyethoxyethoxy )) phosphagene ], polyethyleneimide , poly - ethyleneoxide , polyethylenesuccinate , polyethylenesulfide , poly ( oxy - methylene - oligo - oxyethylene ), polypropyleneoxide , polyvinylacetate , polyacrylonitrile , poly ( acrylonitrile - co - methylacrylate ), polymethyl methacrylate , poly ( methylmethacrylate - co - ethylacrylate ), polyvinylchloride , poly ( vinylidene - chloride - co - acrylonitrile ), polyvinylidenedifluoride , poly ( vinylidenefluoride - co - hexafluoropropylene ) or mixtures thereof . although there is no specific limitation on the thickness of the porous polymer matrix , it is preferable to have a thickness of 1 μm - 100 μm . it is more preferable to have a thickness of 5 μm - 70 μm and most preferable to have a thickness of 10 μm - 50 μm . furthermore , the diameter of the fibrous polymer in the polymer matrix is preferable to be adjusted to a range of 1 ˜ 3000 nm , more preferable to a range of 10 nm ˜ 1000 nm , and most preferable to a range of 50 nm ˜ 500 nm . the polymers incorporated into the porous polymer matrix function as a polymer electrolyte , and examples include polyethylene , polypropylene , cellulose , cellulose acetate , cellulose acetate butylate , cellulose acetate propionate , polyvinylpyrrolidone - vinylacetate , poly [ bis ( 2 -( 2 - methoxyethoxy - ethoxy )) phosphagene ], polyethyleneimide , polyethyleneoxide , polyethylene - succinate , polyethylenesulfide , poly ( oxymethylene - oligo - oxyethylene ), polypropyleneoxide , polyvinylacetate , polyacrylonitrile , poly ( acrylonitrile - co - methylacrylate ), polymethylmethacrylate , poly ( methylmethacrylate - co - ethylacrylate ), polyvinylchloride , poly ( vinylidenechloride - co - acrylonitrile ), polyvinylidenedifluoride ; poly ( vinylidenefluoride - co - hexafluoropropylene ), polyetylene glycol diacrylate , polyethylene glycol dimetha acrylate or mixtures thereof . although there is no specific limitation on the lithium salt incorporated into the porous polymer matrix , preferable example includes lipf 6 , lico 41 , liasf 6 , libf 4 and licf 3 so 3 . it is more preferable to use lipf 6 . examples of the organic solvent used in the organic electrolyte solution can include ethylene carbonate , propylene carbonate , diethyl carbonate , dimethyl carbonate , ethylmethyl carbonate or mixtures thereof . in order to improve the low - temperature characteristic of the battery , methyl acetate , methyl propionate , ethyl acetate , ethyl propionate , butylene carbonate , γ - butyrolactone , 1 , 2 - dimethoxyethane , 1 , 2 - dimethoxyethane , dimethyl - acetamide , tetrahydrofuran or mixtures thereof can be further added to the organic solvent . the hybrid polymer electrolyte of the present invention can further comprise a filling agent in order to improve porosity and mechanical strength . examples of a filling agent include substances such as tio 2 , batio 3 , li 2 o , lif , lioh , li 3 n , bao , na 2 o , mgo , li 2 co 3 , lialo 2 , sio 2 , al 2 o 3 , ptfe and mixtures thereof . generally , the content of the filling agent is not greater than 20 wt % of the total hybrid polymer electrolyte . the present invention also relates to a fabrication method for the hybrid polymer electrolyte . the method of the present invention comprises a step of obtaining a polymeric melt or solution , for forming a porous polymer matrix , by melting a polymer or dissolving a polymer in an organic solvent , a step of generating a porous polymer matrix with the obtained melt or solution and a step of injecting a polymer electrolyte solution into the obtained porous polymer matrix . the step of obtaining a polymeric melt or solution is achieved by melting the polymer by heating or mixing the polymer with an appropriate organic solvent and then raising the temperature of the mixture to obtain a clear polymeric solution . if the polymer is dissolved in an organic solvent , the organic solvent which may be used is not particularly limited , on condition that it can dissolve polymers substantially and be applied to electrospinning . solvents which might influence on the characteristics of battery can even be used , because the organic solvents are removed while fabricating the porous polymer matrix by electrospinning . the fabrication of the porous polymer matrix of the present invention is generally achieved by electrospinning . in more detail , a porous polymer matrix can be fabricated by filling a polymeric melt or polymeric solution dissolved in an organic solvent , for forming the polymer matrix , into the barrel of an electrospinning apparatus , applying a high voltage to the nozzle , and discharging the polymeric melt or polymeric solution through the nozzle onto a metal substrate or a mylar film at a constant rate . the thickness of the porous polymer matrix can be optionally adjusted by varying the discharging rate and time . as mentioned before , the preferable thickness range is within 1 - 100 μm . if the above - described method is used , a polymer matrix built up three - dimensionally with fibers having a diameter of 1 ˜ 3000 nm , not just the polymer fibers for forming a matrix , can be fabricated directly . in order to simplify the fabrication process , a porous polymer matrix can be generated onto electrodes directly . accordingly , although the above - mentioned method is a fabrication in fibrous form , no additional apparatus is required and therefore an economical efficiency can be achieved by simplifying the fabrication process because the final product can be fabricated not just as fibers but as a film directly . a porous polymer matrix using two or more polymers can be obtained by the following two methods : 1 ) after two or more polymers are melted or dissolved in one or more organic solvents , the obtained polymeric melts or solutions are filled into the barrel of an electrospinning apparatus , and then discharged using a nozzle to fabricate a porous polymer matrix in a state that polymer fibers are entangled with each other ; and 2 ) after two or more polymers are melted separately or dissolved in organic solvents respectively in separate bowls , the obtained polymeric melts or solutions are filled into the different barrels of an electrospinning apparatus respectively , and then discharged using different nozzles to fabricate a porous polymer matrix in a state that the respective polymer fibers are entangled with each other respectively . the hybrid polymer electrolyte can be obtained by injecting a polymer electrolyte solution into a porous polymer matrix fabricated by electrospinning . in more detail , it is obtained by dissolving a polymer in an organic electrolyte solution and / or a plasticizer to obtain a polymer electrolyte solution , and injecting the obtained polymer electrolyte solution into the porous polymer matrix by a die - casting . it is preferable to use a plasticizer in the fabrication of the polymer electrolyte solution in order to improve properties of the polymer electrolyte solution . examples of the plasticizer which may be used include propylene carbonate , butylene carbonate , 1 , 4 - butyrolactone , diethyl carbonate , dimethyl carbonate , 1 , 2 - dimethoxyethane , 1 , 3 - dimethyl - 2 - imidazolidinone , dimethyl - sulfoxide , ethylene carbonate , ethylmethyl carbonate , n , n - dimethylformamide , n , n - dimethylacetamide , n - methyl - 2 - pyrrolidone , polyethylenesulforane , tetraethylene glycol dimethyl ether , acetone , alcohol and mixtures thereof . because the plasticizers can be removed while fabricating the porous polymer matrix , there is no specific limitation on the kinds of plasticizer . the preferable weight ratio of the polymer to the organic solvent is within a range of 1 : 1 - 1 : 20 . the preferable weight ratio of the polymer to the plasticizer is within a range of 1 : 1 - 1 : 20 . the present invention also relates to a lithium secondary battery comprising the above - described hybrid polymer electrolyte , and fig2 a to 2 c illustrate the fabrication processes of lithium secondary batteries of the present invention in detail . fig2 a illustrates a fabrication process of a battery , comprising inserting a hybrid polymer electrolyte , fabricated by incorporating a polymer electrolyte solution into a porous polymer matrix fabricated by electrospinning , between a cathode and an anode , making the electrolyte and electrodes into one body by a certain heat lamination process , inserting the resulting plate into a battery casing after laminating or rolling it , injecting an organic electrolyte solution into the battery casing , and then finally sealing the casing . fig2 b illustrates a fabrication process of a battery , comprising coating a hybrid polymer electrolyte onto both sides of a cathode or an anode , adhering an electrode having opposite polarity to the coated electrode onto the hybrid polymer electrolyte , making the electrolyte and electrodes into one body by a heat lamination process , inserting the resulting plate into a battery casing after laminating or rolling it , injecting an organic electrolyte solution into the battery casing , and then finally sealing the battery casing . fig2 c illustrates a fabrication process of a battery , comprising coating a hybrid polymer electrolyte onto both sides of one of two electrodes and onto one side of the other electrode , adhering the electrodes closely so as to face the hybrid polymer electrolytes to each other , making the electrolytes and electrodes into one body by a certain heat lamination process , inserting the resulting plate into a battery casing after laminating or rolling it , injecting an organic electrolyte solution into the battery casing , and sealing the battery casing . as in a conventional lithium secondary battery , the anode and cathode of the present invention are prepared by mixing a certain amount of active materials , a conducting material , a bonding agent and organic solvents , casting the resulting mixture onto both sides of a copper or aluminum foil plate grid , and then dry - compressing the plate . the anode active material comprises one or more materials selected from the group consisting of graphite , cokes , hard carbon , tin oxide and lithiated compounds thereof . the cathode active material comprises one or more materials selected from the group consisting of liclo 2 , linio 2 , linicoo 2 , limn 2 o 4 , v 2 o 5 , and v 6 o 13 . and , metallic lithium or lithium alloys can be used as an anode of the present invention . the present invention will be described in more detail by way of the following examples , but those examples are given for the purpose to illustrate the present invention , not to limit the scope of it . 20 g of polyvinylidenefluoride ( kynar 761 ) was added to 100 g of dimethylacetamide , and the resulting mixture was stirred at room temperature for 24 hours to give a clear polymeric solution . the resulting polymeric solution was filled into the barrel of an electrospinning apparatus and discharged onto a metal plate at a constant rate using a nozzle charged with 9 kv , to fabricate a porous polymer matrix film having a thickness of 50 μm . 0 . 5 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ), 2 g of pvdf ( atochem kynar 761 ) and 0 . 5 g of pmma ( prepared by polyscience company ) were added to a mixture of 15 g of 1m lipf 6 solution in ec - dmc and 1 g of dma solution ( as a plasticizer ), and the resulting mixture was blended for 12 hours . after blending , the resulting mixture was heated at 130 ° c . for one hour to give a clear polymer electrolyte solution . when a viscosity of several thousands cps suitable for casting was obtained , the resulting polymer electrolyte solution was cast into the porous polymer matrix fabricated in example 1 - 1 by die - casting , to fabricate a hybrid polymer electrolyte in which the polymer electrolyte solution was incorporated into the porous polymer matrix . the hybrid polymer electrolyte fabricated in example 1 - 2 was inserted between a graphite anode and a licoo 2 cathode . the resulting plates were cut so as to be 3 cm × 4 cm in size and laminated . terminals were welded on to the electrodes and the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the vacuum casing , and then finally the vacuum casing was vacuum - sealed to fabricate a lithium secondary battery . 2 - 1 ) 20 g of polyvinylidenefluoride ( kynar 761 ) was added to 100 g of dimethylacetamide , and the resulting mixture was stirred at room temperature for 24 hours to give a clear polymeric solution . the resulting polymeric solution was filled into the barrel of an electrospinning apparatus and discharged onto both sides of a graphite anode at a constant rate using a nozzle charged with 9 kv , to fabricate a graphite anode coated with a porous polymer matrix film having a thickness of 50 μm . 2 - 2 ) 0 . 5 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ), 2 g of pvdf ( atochem kynar 761 ) and 0 . 5 g of pmma ( prepared by polyscience company ) were added to a mixture of 15 g of 1m lipf 6 solution in ec - dmc and 1 g of dma solution ( as a plasticizer ). the resulting mixture was blended for 12 hours and then heated at 130 ° c . for one hour to give a clear polymer electrolyte solution . when a viscosity of several thousands cps suitable for casting was obtained , the resulting polymer electrolyte solution was cast into the porous polymer matrix obtained in example 2 - 1 by die - casting , to generate a hybrid polymer electrolyte on both sides of the graphite anode . 2 - 3 ) a licoo 2 cathode was adhered onto the hybrid polymer electrolyte obtained in example 2 - 2 . the resulting plate was cut so as to be 3 cm × 4 cm in size and laminated . terminals were welded , on to the electrodes and the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the vacuum casing , and the casing was then finally vacuum - sealed to fabricate a lithium secondary battery . 3 - 1 ) 20 g of polyvinylidenefluoride ( kynar 761 ) was added to 100 g of dimethylacetamide , and the mixture was stirred at room temperature for 24 hours to give a clear polymeric solution . the resulting polymeric solution was filled into the barrel of an electrospinning apparatus and discharged onto one side of a licoo 2 cathode at a constant rate using a nozzle charged with 9 kv , to fabricate a licoo 2 cathode coated with a porous polymer matrix film having a thickness of 50 μm on one side of it . 3 - 2 ) 0 . 5 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ), 2 g of pvdf ( atochem kynar 761 ) and 0 . 5 g of pmma ( prepared by polyscience company ) were added to a mixture of 15 g of 1m lipf 6 solution in ec - dmc and 1 g of dma solution ( as a plasticizer ). the resulting mixture was blended for 12 hours and then heated at 130 ° c . for one hour to give a clear polymer electrolyte solution . when a viscosity of several thousands cps suitable for casting was obtained , the resulting polymer electrolyte solution was cast into the porous polymer matrix obtained in example 3 - 1 by die - casting , to generate a hybrid polymer electrolyte on one side of the licoo 2 cathode . 3 - 3 ) the licoo 2 cathode obtained in example 3 - 2 was adhered onto both sides of the graphite anode obtained in example 2 - 2 so as to face the hybrid polymer electrolytes to each other . the resulting plate was made into one body by heat lamination at 110 ° c ., followed by cutting so as to be 3 cm × 4 cm in size and then laminated . terminals were welded on to the electrodes and then the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the casing , and the casing was then finally vacuum - sealed to fabricate a lithium secondary battery . 4 - 1 ) 10 g of polyvinylidenefluoride ( kynar 761 ) and 10 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ) were added to 100 g of dimethylacetamide , and the resulting mixture was stirred at room temperature for 24 hours to give a clear polymeric solution . the resulting polymeric solution was filled into the barrel of an electros pinning apparatus and discharged onto both sides of a graphite anode using a nozzle charged with 9 kv at a constant rate , to fabricate a graphite anode coated with a porous polymer matrix film of 50 μm thickness . 4 - 2 ) 0 . 5 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ), 2 g of pvdf ( atochem kynar 761 ) and 0 . 5 g of pmma ( prepared by polyscience company ) were added to a mixture of 15 g of 1m lipf 6 solution in ec - dmc and 1 g of dma solution ( as a plasticizer ). the resulting mixture was blended for 12 hours and then heated at 130 ° c . for one hour to give a clear polymer electrolyte solution . when a viscosity of several thousands cps suitable for casting was obtained , the resulting polymer electrolyte solution was cast into the porous polymer matrix obtained in example 4 - 1 by die - casting , to generate a hybrid polymer electrolyte on both sides of the graphite anode . 4 - 3 ) the processes in examples 4 - 1 and 4 - 2 were applied to one side of a licoo 2 cathode , instead of to both sides of a graphite anode , to fabricate a licoo 2 cathode coated with a hybrid polymer electrolyte on one side of it . 4 - 4 ) the licoo 2 cathode obtained in example 4 - 3 was adhered onto both sides of the graphite anode obtained in example 4 - 2 so as to face the hybrid polymer electrolytes to each other . the resulting plate was made into one body by heat lamination at 110 ° c ., followed by cutting so as to be 3 cm × 4 cm in size and then laminated . terminals were welded on to the electrodes and then the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the casing , and the casing was then finally vacuum - sealed to fabricate a lithium secondary battery . 5 - 1 ) two polymeric solutions of 20 g of polyvinylidenefluoride ( kynar 761 ) in 100 g of dimethylacetamide and 20 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ) in 100 g of dimethylacetamide were respectively filled into the different barrels of an electrospinning apparatus . and then , the solutions were discharged onto both sides of a graphite anode using nozzles charged with 9 kv respectively at a constant rate , to fabricate a graphite anode coated with a porous polymer matrix film having a thickness of 50 μm . 5 - 2 ) 0 . 5 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ), 2 g of pvdf ( atochem kynar 761 ) and 0 . 5 g of pmma ( prepared by polyscience company ) were added to a mixture of 15 g of 1m lipf 6 solution in ec - dmc and 1 g of dma solution ( as a plasticizer ). the resulting mixture was blended for 12 hours and then heated at 130 ° c . for one hour to give a clear polymer electrolyte solution . when a viscosity of several thousands cps suitable for casting was obtained , the resulting polymer electrolyte solution was cast into the porous polymer matrix obtained in example 5 - 1 by die - casting , to generate a hybrid polymer electrolyte on both sides of the graphite anode . 5 - 3 ) the processes in examples 5 - 1 and 5 - 2 were applied to one side of a licoo 2 cathode , instead of to both sides of a graphite anode , to fabricate a licoo 2 cathode coated with a hybrid polymer electrolyte on one side of it . 5 - 4 ) the licoo 2 cathode obtained in example 5 - 3 was adhered onto both sides of the graphite anode obtained in example 5 - 2 so as to face the hybrid polymer electrolytes to each other . the resulting plate was made into one body by heat lamination at 110 ° c ., followed by cutting so as to be 3 cm × 4 cm in size and then laminated . terminals were welded on to the electrodes and then the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the casing , and the casing was then finally vacuum - sealed to fabricate a lithium secondary battery . 6 - 1 ) 20 g of polyvinylidenefluoride ( kynar 761 ) was added to 100 g of dimethylacetamide , and the mixture was stirred at room temperature for 24 hours to give a clear polymeric solution . the resulting polymeric solution was filled into the barrel of an electrospinning apparatus and discharged onto a metal plate at a constant rate using a nozzle charged with 9 kv , to fabricate a porous polymer matrix film having a thickness of 50 μm . 6 - 2 ) 2 g of oligomer of polyethylene glycol diacrylate ( hereinafter referred to as “ pegda ”, prepared by aldrich company , molecular weight of 742 ) and 3 g of pvdf ( atochem kynar 761 ) were added to 20 g of 1m lipf 6 solution in ec - emc . the resulting mixture was blended enough to be homogeneous at room temperature for 3 hours and then coated onto the porous polymer matrix obtained in example 6 - 1 . and then , an ultraviolet lamp having a power of 100 w was irradiated onto the porous polymer matrix for about 1 . 5 hours to induce a polymerization of the oligomer , to fabricate a hybrid polymer electrolyte in which the polymer electrolyte solution was incorporated into the porous polymer matrix . the hybrid polymer electrolyte fabricated in example 6 - 2 was inserted between a graphite anode and a licoo 2 cathode , and the resulting plates were cut so as to be 3 cm × 4 cm in size and laminated . terminals were welded on to the electrodes and the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the vacuum casing , and then finally the vacuum casing was vacuum - sealed to fabricate a lithium secondary battery . 7 - 1 ) 20 g of polyvinylidenefluoride ( kynar 761 ) was added to 100 g of dimethylacetamide , and the resulting mixture was stirred at room temperature for 24 hours to give a clear polymeric solution . the resulting polymeric solution was filled into the barrel of an electrospinning apparatus and discharged onto both sides of a graphite anode at a constant rate using a nozzle charged with 9 kv , to fabricate a graphite anode coated with a porous polymer matrix film having a thickness of 50 μm . 7 - 2 ) 2 g of oligomer of pegda ( prepared by aldrich company , molecular weight of 742 ) and 3 g of pvdf ( atochem kynar 761 ) were added to 20 g of 1m lipf 6 solution in ec - emc , and the resulting mixture was blended enough to be homogenous at room temperature for 3 hours . after blending , the resulting mixture was coated onto the porous polymer matrix obtained in example 6 - 1 . and then , an ultraviolet lamp having a power of 100 w was irradiated onto the porous polymer matrix for about 1 . 5 hours to induce a polymerization of the oligomer , to generate a hybrid polymer electrolyte on to both sides of the graphite anode . 7 - 3 ) a licoo 2 cathode was adhered onto the hybrid polymer electrolyte obtained in example 7 - 2 . the resulting plate was cut so as to be 3 cm × 4 cm in size and laminated . terminals were welded on to the electrodes and the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the vacuum casing , and the casing was then finally vacuum - sealed to fabricate a lithium secondary battery . 8 - 1 ) two polymeric solutions of 20 g of polyvinylidenefluoride ( kynar 761 ) in 100 g of dimethylacetamide and 20 g of pan ( prepared by polyscience company , molecular weight of about 150 , 000 ) in 100 g of dimethylacetamide were respectively filled into the different barrels of an electrospinning apparatus . and then , the respective solutions were discharged onto both sides of a graphite anode using nozzles charged with 9 kv respectively at a constant rate , to fabricate a graphite anode coated with a porous polymer matrix film having a thickness of 50 μm . 8 - 2 ) 2 g of oligomer of pegda ( prepared by aldrich company , molecular weight of 742 ) and 3 g of pvdf ( atochem kynar 761 ) were added to 20 g of 1m lipf 6 solution in ec - emc , and the resulting mixture was blended enough to be homogenous at room temperature for 3 hours . after blending , the resulting mixture was coated onto the porous polymer matrix obtained in example 6 - 1 . and then , an ultraviolet lamp having a power of 100 w was irradiated onto the porous polymer matrix for about 1 . 5 hours to induce a polymerization of the oligomer , to fabricate a hybrid polymer electrolyte on both sides of the graphite anode . 8 - 3 ) the processes of example 8 - 1 and 8 - 2 were applied to one side of a licoo 2 cathode , instead of to both sides of a graphite anode , to fabricate a licoo 2 cathode coated with a hybrid polymer electrolyte on one side of it . 8 - 4 ) the licoo 2 cathode obtained in example 8 - 3 was adhered onto both sides of the graphite anode obtained in example 8 - 2 so as to face the hybrid polymer electrolytes to each other . the resulting plate was made into one body by heat lamination at 110 ° c ., followed by cutting so as to be 3 cm × 4 cm in size and then laminated . terminals were welded on to the electrodes and then the laminated plate was inserted into a vacuum casing . a 1m lipf 6 solution in ec - dmc was injected into the casing , and the casing was then finally vacuum - sealed to fabricate a lithium secondary battery . a lithium secondary battery was fabricated by laminating electrodes and separator films in order of an anode , a pe separator film , a cathode , a pe separator film and an anode , inserting the resulting laminated plates into a vacuum casing , injecting a 1m lipf 6 solution in ec - dmc into the casing , and then finally vacuum - sealing the casing . according to the conventional fabrication method of a gel - polymer electrolyte , 9 g of 1m lipf 6 solution in ec - pc was added to 3 g of pan . the resulting mixture was blended for 12 hours and then heated at 130 ° c . for 1 hour to give a clear polymeric solution . when a viscosity of 10 , 000 cps suitable for casting was obtained , the polymeric solution was cast by die - casting to give a polymer electrolyte film . a lithium secondary battery was fabricated by laminating , in order , a graphite anode , an electrolyte , a licoo 2 cathode , an electrolyte and a graphite anode , welding terminals on to the electrodes , inserting the resulting laminated plates into a vacuum casing , injecting a 1m lipf 6 solution in ec - dmc into the casing , and then finally vacuum - sealing the casing . charge / discharge characteristics of the lithium secondary batteries obtained in examples 1 - 8 and comparative examples 1 and 2 were tested , and fig3 shows the results . the tests for obtaining the charge / discharge characteristics were performed by a charge / discharge method of , after charging the batteries with a c / 2 constant current and 4 . 2v constant voltage , discharging with a c / 2 constant current , and the electrode - capacities and cycle life based on the cathode were tested . fig3 shows that the electrode capacities and cycle life of the lithium secondary batteries of examples 1 - 8 were improved compared to the lithium secondary batteries of comparative examples 1 and 2 . low - and high - temperature characteristics of the lithium secondary batteries of example 1 and comparative example 2 were tested , and fig4 a and 4 b illustrate the results ( wherein fig4 a is for example 1 and fig4 b is for comparative example 2 ). the tests for obtaining the low - and high - temperature characteristics of the lithium secondary batteries were performed by a charge / discharge method of charging the lithium batteries with a c / 2 constant current and 4 . 2 v constant voltage , and then discharging with a c / 5 constant current , fig4 a and 4 b show that the low - and high - temperature characteristics of the lithium secondary battery of example 1 are better than those of the battery of comparative example 2 . in particular , it shows that the battery of example 1 has an outstanding characteristic of 91 % even at − 10 ° c . high rate discharge characteristics of the lithium secondary batteries of example 1 and comparative example 2 were tested , and fig5 a and 5 b illustrate the results ( wherein fig5 a is for example 1 and fig5 b is for comparative example 2 ). the tests for obtaining the high rate discharge characteristics of the lithium secondary batteries were performed by a charge / discharge method of charging the lithium batteries with a c / 2 constant current and 4 . 2 v constant voltage and then discharging while changing the constant current into c / 5 , c / 2 , 1c and 2c . as depicted in fig5 a and 5 b , the lithium secondary battery of example 1 exhibited capacities such as 99 % at c / 2 discharge , 96 % at 1c discharge and 90 % at 2c discharge , based on the value of c / 5 discharge . however , the lithium secondary battery of comparative example 2 exhibited low capacities such as 87 % at 1c discharge and 56 % at 2c discharge , based on the value of c / 5 discharge . accordingly , it was discovered that the high rate discharge characteristic of the lithium secondary battery of example 1 was better than that of the lithium secondary battery of comparative example 2 .	7
illustrated in fig1 are the outline of overall configuration of a grinding machine and the schematic connection of associated control circuits for practicing a method of grinding crankpins cp on a crankshaft w according to the present invention . the grinding machine 20 comprises a bed 1 , a pair of guide rails 3 , 3 extending in the longitudinal direction along the z axis ( as defined in fig1 ) on the bed 1 , and a table 2 slidably supported on the guide rails 3 , 3 . at the left side area on the table 2 , a headstock 7 is arranged carrying a work spindle 17 . the work spindle 17 is coupled to an output shaft of a servomotor 9 , which in turn is coupled to a rotary encoder 18 for control in rotation . the work spindle 17 has a chuck or the like device ( not shown ) to grip a journal portion at one end of the crankshaft w . opposite to the headstock 7 , a tailstock 8 is arranged at the right side area on the table 2 . the tailstock 8 rotatably supports a journal portion at the other end of the crankshaft w by means of a center 19 . with such an arrangement , the rotational axis of the work spindle 17 and the central axis of the journal portions of the crankshaft w coincide with each other , so that the crankshaft w is rotated around the axis of the work spindle 17 to effect a planetary motion of the crankpins cp . between the pair of guide rails 3 , 3 , a ball screw 4 is arranged for moving the table 2 in the direction of z axis . the ball screw 4 is coupled , at its left end , to an output shaft of a servomotor 5 mounted at the left end of the bed 1 . the servomotor 5 is coupled to a rotary encoder 6 to detect the rotational angle of the ball screw 4 . this arrangement enables sliding movement of the table 2 as controlled in the z axis direction , so that each of the crankpins cp on the crankshaft w may be aligned with a grinding wheel 15 . an x axis defines a direction perpendicular to the z axis on the horizontal plane of the machine . a pair of guide rails 11 , 11 are provided on the bed 1 extending along the x axis direction to slidably support a wheel head 10 which carries the grinding wheel 15 . between the pair of guide rails 11 , 11 , a ball screw 12 is arranged for moving the wheel head 10 in the direction of x axis . the ball screw 12 is coupled , at its rear end , to an output shaft of a servomotor 13 mounted at the rear end ( distal end ) of the bed 1 . the servomotor 13 is coupled to a rotary encoder 14 to detect the rotational angle of the ball screw 12 . this arrangement permits a back - and - forth movement of the wheel head 10 as controlled in the x direction which is perpendicular to the central axis of the crankshaft w , so that the grinding wheel can be moved back and forth in synchronism with the planetary motion of the crankpin cp . further , the grinding wheel 15 mounted on the wheel head 10 is to be rotated as driven by a motor ( not shown ). reference numeral 16 denotes a measuring device featuring the present invention . the measuring device 16 is provided at the front end of the bed 1 of the crankpin grinding machine 20 opposite to the grinding wheel 15 . as shown in more detail in fig2 the measuring device 16 is mounted on the bed 1 by means of a connecting member 52 . a measuring head 41 is of an approximately rectangle shape having a certain thickness and mounts an upper feeler 44 and a lower feeler 45 on one side for measuring the crankpin cp which is indexed to a position opposed to the grinding wheel 15 . the measuring head 41 is supported on a head support 43 via a hinge pin 42 , as will be described hereinafter . the head support 43 is mounted on a head slide 46 which is slidably supported on the guide member 49 . fixed at the bottom of the head slide 46 is a driving nut 59 , which is engaged with a ball screw 50 . the ball screw 50 is connected to an output shaft of a servomotor 47 , so that the rotation of the ball screw 50 moves the head slide 46 in the x axis direction . a rotary encoder 48 is mounted on the servomotor 47 to control the moving position of the head slide 46 . fig3 shows the measuring head 41 in more detail , in which the upper feeler 44 is fixedly attached to the upper side of the measuring head 41 and has a contact pad 57 attached to the inside tip thereof . the contact pad 57 defines a reference point of measurement in measuring the diameter of the crankpin cp . the lower feeler 45 is movably mounted on the lower side of the measuring head 41 , and carries a contact pad 58 attached to the inside tip thereof . the lower feeler 45 is deflectable according to the diameter of the crankpin cp , while the distance between the upper feeler 44 and the lower feeler 45 at its undeflected state is made a little bit narrower than the diameter of the crankpin cp to be measured . approximately at the middle point along the length of the movable feeler 45 is attached a cross - shape spring 54 to permit the movable feeler 45 to expand outward with the cross - shaped spring 54 serving as a fulcrum of rotation during the diameter measurement . the measuring head 41 contains therein a differential transformer 55 having a movable probe 56 which is secured to the other portion ( inside the head box 41 ) of the movable feeler 45 . the differential transformer 55 detects the amount of the movement of the probe 56 electrically , and outputs an electric signal representing such an amount to a numerical control unit 30 which will be described hereinafter . the movable feeler 45 is urged by a tension spring 52 to rotate in the direction of the contact pad 58 moving toward the contact pad 57 . when the feeler 45 is in its rest position not performing the measurement as indicated by the solid line in fig3 the other portion of the feeler 45 abuts a stop member 53 which is provided opposite to the probe 56 so that a further rotation of the feeler 45 is limited . the measuring head 41 is rotatably coupled to the head support 43 by means of the hinge pin 42 and is elastically held at a neutral position where the repulsive force of the leaf spring 51 balances with the horizontally pressing force of the measuring head 41 due to its weight . as the measuring head 41 rotates in the direction away from the leaf spring 51 ( the leaf spring remains pressing the measuring head with a decreased force ) during the measurement , the feeler 44 presses the upper peripheral surface of the crankpin op with an adequate contact pressure due to the gravity exerted on the measuring head 41 ( minus the decreased repulsive force of the leaf spring ), while the movable feeler 45 contacts the lower peripheral surface of the crankpin cp due to the tension spring 52 . a numerical control unit 30 ( fig1 ) contains programs for the machining operation 31 , for the crankpin diameter measurement and the feed amount computation at the finish grinding step 71 , and so forth , and further contains data processing subunits for parameter registration 32 , for workpiece identification 33 , for parameter retrieval 34 , and so forth . the parameter registration subunit 32 is to register an eccentricity amount of the crankpins cp and phase angle of the respective crankpins cp about the central axis of the crankshaft with respect to each of plural types of crankshafts w for the operations of the crankpin grinding machine 20 , the workpiece identification subunit 33 is to identify the type ( kind ) of a crankshaft w to be ground , and the parameter retrieval subunit 34 is to retrieve parameter data representing the eccentricity amount and the phase angle of the crankpins cp with respect to each type of crankshaft w identified by the workpiece identification subunit 33 from the above - explained parameter registration subunit 32 . fig6 shows a data table included in the parameter registration subunit 32 . the table contains parameters for grinding crankshafts and more particularly , contains eccentricity amounts s 1 , s 2 , . . . , sn of the crankpins of the respective types # 1 , # 2 , . . . , # n of crankshafts w which eccentricity amounts s 1 , s 2 , . . . , sn are to be used for determining the advancing position of the measuring head . the table further contains phase angles p 1 , p 2 , . . . , pm of the existing crankpins on the respective crankshafts , wherein “ 0 degree ” means the direction of nine o &# 39 ; clock , “ 120 degrees ” the direction of five o &# 39 ; clock , “ 180 degrees ” the direction of three o &# 39 ; clock , and “ 240 degrees ” the direction of one o &# 39 ; clock . the numerical control unit 30 outputs machining instructions to a spindle servomotor control circuit 22 , a wheel head servomotor control circuit 23 and a table servomotor control circuit 21 by a cpu 35 via an interface 37 based on the parameters registered in the parameter registration subunit 32 . the rotary encoders 6 , 14 and 18 respectively attached to the servomotors 5 , 13 and 9 respectively detect movements of the table 2 , the wheel head 10 and the work spindle 17 , and feed back the respective states in controls thereof to the numerical control unit 30 via the interface 37 . the journal portion of the crankshaft w gripped by the chuck of the work spindle 17 has a keyway or the like mark defining the reference angular position of the crankshaft w . the plane encompassing the central axis of the journal portion and the center line of the keyway is defined as an angular reference plane , and the plane angle between this reference plane and another plane encompassing the central axis of the journal portion and the central axis of each crankpin cp is defined as a phase angle of each such crankpin cp with respect to the spindle axis . the chuck of the work spindle 17 is provided with a key not shown which is engageable with the keyway formed on the journal portion , so that the crankshaft w is clamped to the work spindle 17 properly in the rotational direction by holding the journal portion by the chuck with the key being engaged with the keyway . thus , as the work spindle 17 is rotated and indexed to the phase angle of a particular crankpin cp by means of the servomotor 9 , the crankpin cp is indexed and positioned at a proper angle for the diameter measurement by the measuring device 16 . the above described embodiment will work as follows . first , the numerical control unit 30 and the crankpin grinding machine 20 are started to operate . the operator then inserts a crankshaft w to be ground into the chuck of the work spindle 17 with the keyway formed at one end of the journal portion of the crankshaft w being engaged with the key formed on the chuck . the operator then inputs a command to make the journal portion to be clamped by the chuck thereby permitting the phase angles of the crankpins to be identifiable , and the shaft center axis of the other journal portion to be supported by the center 19 of the tailstock 8 . the operator next inputs the type # of the crankshaft w to be ground from an input / output device 36 such as a keyboard , and starts the program for the machining operation 31 , the flow chart of which is shown in fig4 . at a step 62 of fig4 the type of the crankshaft w so input is identified by the workpiece identification subunit 33 in the numerical control unit 30 , and accordingly the eccentricity amount and the phase angles of the crankpins cp of the crankshaft w of the type as identified by the workpiece identification subunit 33 are retrieved by the parameter retrieval subunit 34 from among the parameter data registered in the parameter registration subunit 32 . a step 63 is to index the table position as a preparation for the grinding . the cpu 35 in the numerical control unit 30 outputs move instructions to the work spindle servomotor control circuit 22 , the wheel head servomotor control circuit 23 and the table servomotor control circuit 21 . thus , the servomotor 5 rotatably drives the ball screw 4 to move the table 2 at a position to index the first crankpin cp to the position opposed to the grinding wheel 15 . the servomotor 9 rotatably drives the work spindle 17 to rotate the crankshaft w gripped by the chuck of the work spindle 17 around the spindle axis , which brings about a planetary motion of the crankpin cp . the servomotor 13 rotatably drives the ball screw 12 to move the wheel head 10 back and forth in synchronism with the planetary motion of the crankpin cp , so that the work spindle 17 and the wheel head 10 perform cooperative movements ( i . e . a generating movement ) for the grinding wheel 15 to grind the crankpin cp in a cylindrical profile . a step 64 is to feed the grinding wheel 15 toward the crankshaft w . in addition to , or in superposition to , the synchronized reciprocating movement of the wheel head 10 for an eccentric cylindrical profile , the wheel head 10 is advanced in the x axis direction in turn at a rapid advance feed rate , a rough grinding feed rate and a fine grinding feed rate as determined based on the retrieved machining parameters for the identified crankshaft w in order to perform a rough grinding process and then a fine grinding process on the crankpin cp with the grinding wheel 15 . when the fine grinding of the crankpin cp is over , the wheel head 10 carrying the grinding wheel 15 is retracted to a predetermined position ( standby position ), and the work spindle is stopped at the reference angular position ( pose ) for the diameter measurement of the crankpin as well as for the computation of a feed amount in a finish grinding . a step 65 is to measure the diameter of the crankpin in mid course of the grinding process . in the step 65 , a subroutine processing program 71 for measuring the diameter of the crankpin and for computing the feed amount in finish grinding is executed according to a flow chart shown in fig5 . upon starting of this program 71 , the type of the crankshaft w is identified at a step 73 by the workpiece identification subunit 33 based on the type # ( e . g . # 1 ) input from the keyboard 36 or the like . the parameter retrieval subunit 34 retrieves from the parameter registration subunit 32 the phase angles of the crankpins cp on the subject crankshaft w ( e . g . # 1 ) of the type so identified . at a step 74 , the work spindle 17 is indexed and rotated by the servomotor 9 based on the retrieved phase angle and is positioned to a predetermined phase angle for the first crankpin of the subject crankshaft w , i . e . to the angular direction of nine o &# 39 ; clock in this embodiment . further , the parameter retrieval subunit 34 retrieves an eccentricity amount s 1 as registered for the # 1 crankshaft w in the parameter registration subunit 32 and determines the measuring position of the crankpin cp of the # 1 crankshaft at a step 75 . at a step 76 , the servomotor 47 of the measuring device 16 is rotatably driven with a feedback of the detected signal from the rotary encoder 48 , and advances the head slide 46 to the measuring position by means of the ball screw 50 . in case the crankshaft w is of type # 1 , the head slide 46 is advanced so that the feelers 44 and 45 are located at the position corresponding to the eccentricity amount s 1 of the crankpin cp . similarly , in case the crankpin shaft w is of type # 3 , the head slide 46 is advanced so that the feelers 44 and 45 are moved to the position corresponding to the eccentricity amount s 3 . in such a manner , even in the situation where the types of crankshaft w to be ground are variously and frequently changed , the advancing position of the measuring head 41 is automatically determined and set in accordance with the eccentricity amount registered in the parameter table of the parameter registration subunit for each crankshaft w to be ground . this eliminates a manual adjustment of the advancing position of the measuring head as would be necessary in the case of using a conventional measuring device . as the head slide 46 advances toward the crankpin cp , the contact pad 57 of the feeler 44 and the contact pad 58 of the movable feeler 45 come in contact with the upper and lower peripheral surfaces of the crankpin cp , at which time the measuring head 41 rotates upward about the hinge pin 42 so that the feeler 44 and the movable feeler 45 slides on the upper and lower surfaces of the crankpin cp . according to the control by means of the rotary encoder 48 , the measuring head 41 is stopped at the position where the centers of the contact pads 57 and 58 touch the uppermost and lowermost points of the crankpin cp for the diameter measurement . at this time , the movable feeler 45 in the lower side is pushed outward with the cross - shape spring 54 as the fulcrum of rotation , which in turn moves the probe 56 of the differential transformer 55 into the differential transformer 55 . then at a step 77 , the position of the probe 56 relative to the differential transformer 55 is converted into an electric value and is transmitted to the numerical control unit 30 as an electric signal representing the diameter of the crankpin cp . the numerical control unit 30 then computes the feed amount of the wheel head 10 for the fine grinding based on the diameter of the crankpin cp thus measured . the feed amount for the fine grinding is a half of the difference between the measured diameter of the crankpin cp and a target diameter registered beforehand . after the measurement is completed , the measuring head 41 is returned to its rest position at a step 78 , whereby the program for measuring the crankpin diameter and computing the feed amount for the finish grinding comes to its end to return to the program 31 for the machining operation resuming at a step 66 of fig4 . now back to the program 31 for the machining operation , the step 66 is carried out to infeed the wheel head 10 against the crankpin cp by the amount which has been computed for the finish grinding of the crankpin cp . then , the wheel head 10 is kept at the final finish position for a predetermined short period of time to continue a zero infeed grinding , i . e . a sparkout . upon completion of the sparkout , the wheel head 10 is retracted to the grinding start position at a step 67 . next , at a step 68 , the program checks whether or not , the crankpin cp thus finished is the last crankpin on the crankshaft w under machining . if there still remains another crankpin unfinished on the crankshaft w , the program returns to the step 63 to repeat the aforementioned processing up to the step 67 , whereby the table 2 is indexed to a position to bring another crankpin cp to be ground next before the grinding wheel 15 and whereby such another crankpin cp is finished in the same manner as described above . if the judgment at the step 68 is affirmative ( yes ), the processing moves forward to a step 69 to return the table 2 to its rest position before ending the machining operation program 31 . the operator then inputs a command to disengage the crankshaft w from the chuck of the work spindle 17 , and sets another crankshaft w to be ground . while the above embodiment is described about the case where each of the crankpins cp of the crankshaft w is directed to and kept at the nine o &# 39 ; clock position in mid course of the grinding operation for the diameter measurement by the measuring device 16 , the measurements of all the crankpins cp may be performed with the crankshaft w being indexed to a fixed angular position . for example , in the case of a crankshaft for a typical in - line four - cylinder engine , the first and fourth crankpins are indexed to the nine o &# 39 ; clock ( or three o &# 39 ; clock ) position , while the second and third crankpins lying at a phase angle which is different by 180 degrees from the first and fourth crankpins are indexed to the three o &# 39 ; clock ( or nine o &# 39 ; clock ) position , so that the measuring head 41 is advanced differently between the first and fourth crankpins and the second and third crankpins . by indexing the crankshaft w to a single angular position for the measurements of all the crankpins cp , the time which would otherwise be necessary for indexing the crankshaft w to respective angular positions for the individual crankpins cp prior to the measurement can be shortened . moreover , the possibility of erroneous indexing can be minimized , thereby minimizing the possibility of causing damages to the measuring head 41 due to erroneous indexing . while in the above described embodiment , the crankshaft w is put manually by the operator on the chuck of the work spindle 17 of the crankpin grinding machine 20 , it may be set automatically by utilizing a robot arm or the like . further , in the above embodiment , the operator inputs the type # of the crankshaft w to be ground from the input / output device 36 such as a keyboard , but alternatively some imprint mark may be affixed to the crankshaft end surface and there may be provided a mark reader for reading such a mark , so that the output signal from the mark reader may be input to the numerical control unit 30 for automatically identifying the type of the crankshaft w . further , although in the above embodiment , the back and forth movement of the measuring head 41 is effected by the ball screw 50 driven by the servomotor 47 , a cylinder type driving mechanism 29 may be employed as shown in fig8 in place of the servomotor 47 in fig2 . in the case of fig8 the measuring position of the measuring head 41 is determined by an abutment piece 24 of the cylinder type driving mechanism 29 abutting on a stop member 25 . the stop member 25 may preferably provided with two levels of abutment surfaces on which the abutment piece 24 abuts and the two levels may be selectively designated by shifting the stop member 25 by a cylinder 28 . thus , the measuring head 41 can be positioned at two different positions in the x axis direction . the cylinders 29 and 28 may be of a hydraulic type or a pneumatic type . although in the above embodiment , the measuring head 41 is movable only in the direction of the x axis but not in the vertical direction , it may be equipped with a servomotor 26 and a ball screw ( not shown ) to be driven vertically , as shown in fig9 so that the feelers can be placed at an arbitrary height automatically even in the case where the crankpin cp is positioned in the direction of twelve o &# 39 ; clock . in this instance , the height of the measuring head 41 is first adjusted by the servomotor 26 , and thereafter the measuring head 41 is advanced in the x axis direction by a cylinder device 27 to measure the diameter of the crankpin cp . as the mechanism of vertically indexing the measuring head 41 , a cylinder device which selectively positions the measuring head 41 to two different heights may be employed in place of the servomotor 26 . further , the mechanism for moving the measuring head 41 horizontally in the x axis direction may employ a servomotor in place of the cylinder device 27 , so that the measuring head 41 can be moved to any positions in the x axis direction horizontally . further , although the nine o &# 39 ; clock position is preferred as an angular position to which the crankpin cp is indexed for measuring the diameter of the same , other angular positions such as the ten o &# 39 ; clock position and the like may be selected instead . in such a case , however , it is preferable to advance the measuring head 41 in a direction parallel to the line which passes across the central axis of the crankpin cp and the central axis of the work spindle ( i . e . crankshaft ). while several forms of the invention have been shown and described , other forms will be apparent to those skilled in the art without departing from the spirit of the invention . therefore , it is to be understood that the embodiments shown in the drawings and described above are merely for illustrative purposes , and are not intended to limit the scope of the invention which is defined by any of the appended claims .	6
referring to fig1 a , 1b , 1c and 3a , 3b , 3c of the drawing , the maxillary recording assembly 64 is shown comprised of a substantially u - shaped first rigid bow 5 having a straight forward bar 65 , and two extremities 66 positioned equidistantly rearwardly of said forward bar . the bow is bounded at its top , bottom , exterior edge and interior edge by substantially flat surfaces 67 , 68 , 69 and 70 , respectively . shoulders 76 protrude inwardly from interior edge 70 adjacent extremities 66 . left and right box - like receptacles 4l and 4r , respectively , are securely but removably fastened to the extremities of bow 5 . each receptacle is comprised of a flat upper surface 71 , a flat lower surface 72 surrounding a recessed molding cavity 59 , flat sidewall edges 73 , and an attachment arm 74 . the receptacles are attached to bow 5 by means of cap screws 7 which penetrate holes provided in the bow and engage threaded holes 6 in attachment arm 74 . in such position of attachment , it is to be noted that the attachment arm 74 is in abutment with the interior edge 70 and shoulder 76 of the bow . when ready for use in recording a patient &# 39 ; s condylar pathways , the cavity 59 of each receptacle is filled with a plastic non - elastic recording clay composition capable of being hardened with minimal dimensional change . suitable compositions include monomers and prepolymers capable of undergoing additional - type polymerization in the presence of catalytic species to form solid products . such compositions , generally referred to as auto - polymerizing materials , may for example contain cyanoacrylate substances polymerizable by peroxide - type free radical catalysts . such compositions may also incorporate solid powder lubricants such as teflon , graphite , talc and molybdenum disulfide . in some embodiments , thin plates 23 as shown in fig3 c , containing a circular indentation 77 , may be placed within the molding cavity , their presence being useful as positioning guides for the subsequent recording step . an orientation pointer 8 of threadably adjustable length may be removably associated with the interiorly directed portion of the sidewall edge 73 of each receptacle , said pointers being directed toward the interior of the bow , and used to position the apparatus upon the patient relative to the patients mandibular condyles . a hardened composition having a condylar tracing or pathway 60 is shown filling one cavity 59 in fig3 c . an upper bite plate 9 , also known as a maxillary clutch , is pendantly attached to forward bar 65 by a slidable fastener 11 and post 10 depending therefrom . movement of fastener 11 upon bar 65 is controlled by set screw 78 . a support bar 79 extends connectively between the lowermost extemity of post 10 and maxillary clutch 9 . such arrangement of components allows for positioning of the maxillary recording bow in horizontal alignment with the midline of the face and vertically aligned with the frankfort plane ( axis orbital plane ). said maxillary clutch is upwardly and reardwardly domed . a trough 80 extends about the front and sides of the upper surface of the clutch , said trough being adapted to receive a material such as a paste of zinc oxide and eugenol which forms maxillary tooth imprint 62 . the underside of the maxillary clutch is comprised of a forwardly disposed upwardly curved bearing surface 57 and opposed substantially flat side portion 58 . the mandibular recording assembly 81 , as shown in fig2 a , 2b , 2c and 2d , is comprised of second rigid u - shaped bow 12 having straight forward bar 82 , and rearwardly disposed extremities 83 . the bow is bounded at its top , bottom , exterior edge and interior edge by substantially flat surfaces 84 , 85 , 86 and 87 , respectively . a smooth bore circular cylindrical channel 88 is perpendicularly disposed to said top and bottom surfaces adjacent extremities 83 . a cylindrical post 13 is adapted to slidably engage channel 88 . the uppermost extremity of said post , located above top surface 84 , is provided with an attached ball 14 , preferably fabricated of teflon material . the position of the ball above said top surface is fixed by cap screw 16 which penetratively engages a threaded channel communicating horizontally between outside surface 86 and channel 88 . the balls are spaced in a manner to enter the respective receptacles of the overlying maxillary recording assembly . a lower bite plate or clutch 19 is attached by extension bar 21 and slidable fastener 22 to forward bar 82 in substantially coplanar relationship therewith and extending rearwardly therefrom to a position of vertical alignment with said upper bite plate . the underside of bite plate 19 is provided with a u - shaped trough 100 adapted to receive an imprint paste such as that used in upper bite plate 9 . a vertically adjustable bearing stud 20 , extending upwardly from the substantially flat upper surface 89 of said bite plate , is centered within the sagittal plane represented by dashed line 90 , and is adapted to engage the curved forward bearing surface 57 of said upper bite plate . an l - shaped guide pin 17 is slidably engaged by channel 91 in close parallel juxtaposition to channel 88 . a threaded lock bolt 18 penetrates an edge of the bow to fix the position of pin 17 within its channel . the function of guide pins 17 as to aid in the proper positioning of balls 14 when the receptacles are filled with the recording material . upper articulator member 92 , as shown in fig4 a , 4b and 7 , is comprised of rigid base plate 24 having flat upper and lower surfaces 93 and 94 , respectively , a boundary sidewall 95 , and a penetrating bolt 25 centered in said sagittal plane and extending beneath lower surface 94 and perpendicular thereto . opposed equal right and left side arm portions 28 and 29 , respectively , extend away from the sagittal plane in a straight line path . a forward arm portion 34 extends from said bolt in centered relationship to the sagittal plane and in perpendicular disposition to said side arm portions . a mounting ring 27 is held tightly to lower surface 94 by bolt 25 . the forwardmost or distal extremity of arm 34 holds vertically adjustable post 2 whose position is locked by constricting collars 35 or equivalent means . the distal extremities of side arms 28 and 29 are provided with penetrative threaded bolts 31 adapted to extend below lower surface 94 and into engagement with holes 22 in upper surface 71 of attachment arm 74 of the corresponding receptacles 4l and 4r . in some instances , a spacer block 32 may be inserted between the lower surface of the side arm portions and the underlying receptacle to provide adequate space for mounting the patient &# 39 ; s maxillary model . by virtue of the aforesaid arrangement of components , the receptacles are adapted to the transposed from the maxillary recording assembly into the upper articulator member ; and during said transposition the receptacles are secured to both the maxillary recording assembly and upper articulator member . base plate 24 of said upper articulator member may be further provided with a rear extension 36 , the underside of which supports paired pivot plates 37 held by bolts 40 which extend through channels 38 and into threaded recesses 39 . lower articulator member 96 , as shown in fig5 a , 5b , 5c , and 7 , is comprised of horizontally disposed floor plate 43 , the underside of which is provided with one forward and two rearward adjustable bolt footings 55 and 56 , respectively . posts 44 support main cross bar 45 above the rear of said floor plate in parallel relationship therewith and perpendicularly disposed to the sagittal plane . left and right balls 14 atop posts 13 are vertically positionable above cross bar 45 by virtue of sliding engagement of posts 13 within close - fitting channels 46 . set screws 50 lock posts 13 within channels 46 . said post and ball combinations are preferably identical to those earlier described with respect to mandibular recording assembly 81 . the lateral and vertical positioning of the balls is such as to facilitate engagement with condylar moulded pathways 60 within overlying cavities 59 . a lower mounting ring 48 is held fast upon the upper surface of floor plate 43 by centered mounting bolt 52 acting from the underside of said floor plate . said mounting ring facilitates attachment of the patient &# 39 ; s mandibular model 54 as shown in fig7 . a positioning stud 53 , rising upwardly from said floor plate , engages mounting ring 48 to ensure precise positioning of the ring and model 54 mounted thereupon . an upraised platform 3 having a flat upper surface is positioned upon floor plate 43 adjacent its forward extremity . the upper surface of said platform serves as abutment means for the lowermost extremity of adjustable post 2 of said upper articulator , as shown in fig7 . the upper surface of the platform may alternatively be contoured to have angular indentations or a custom molded configuration produced from a clay - like composition comprised of autopolymerizing resin . it is to be noted that the upper extremity of post 2 is shown to have a curvature representing an arc of a circle centered upon a line drawn between the centers of balls 14 . such configuration ensures that , despite vertical adjustments of the post , its lowermost extremity will remain in the same position upon said platform . a pivot post 1 is rotatably held by bearing block 97 slideably positioned upon cross bar 45 . the rotative position of the post is fixed by set screw 98 . movement of the bearing block along cross bar 45 is fixed by set screws 51 . the pivot post is adapted to be embraced by pivot plates 37 pendant from the upper articulator member . a channel 99 penetrates said pivot post in a horizontal direction at a height above said cross bar defined by a line drawn between the centers of the balls . a pivot pin 42 removably extends through said pivot plates and the channel in said pivot post . such assembly constitutes optional means for pivotably interengaging the upper and lower articulator members so that movement of the upper member toward or away from the lower member is restricted to motion in a vertical path . the pivotal plates 37 are secured to plate 36 in their rearmost part so that they may be loosened and turned out of functional use subsequent to removal of axis pin 42 . in the method of this invention , the maxillary and mandibular clutches 9 and 19 , respectively , are fabricated either intraorally or on a conventional hinge type articulator . the facing surfaces of the clutches are adjusted and polished so that bearing post 20 contacts the curved forward portion of the underside of the maxillary clutch , and the peripheral areas of the facing surfaces have smooth simultaneous contact , thereby preventing rocking of the clutches about the bearing post . the bows are positioned so that balls 14 are seated within the depressions 77 of plates 23 located within cavities 59 . the positions of the balls are then adjusted such that there will be no contact with the cavity walls in all possible movements . in such positioning adjustments pointers 8 may be used to secure precise orientation with the condyle axes , thereby providing greater fidelity of the molded pathways to the actual movements of the patient &# 39 ; s condyles . plates 23 and said pointers are then removed , and the cavities are filled with recording clay . the clutches are then cemented to the maxillary and mandibular teeth of the patient using a paste of zinc oxide and eugenol . the balls are manually seated into the cavities 59 filled with the aforesaid hardenable clay - like plastic composition until the original preclay position of the teflon balls is achieved . said preclay position is located using the l - shaped pins 17 located on the mandibular bow , said pins functioning as depth gauges . the balls , now in contact with the plastic composition , function as forming balls . as shown in fig3 a and 3b , the patient begins molding the condylar pathway , starting from the most retruded mandibular position . the patient is asked to protrude and retrude his lower jaw and subsequently to perform right and left lateral mandibular movements . such action produces three - dimensional impressions of said motion . the impressions may be added to and lubricated and re - inserted for achieving the most accurate result . after finely detailed , accurate condylar pathways 60 , as shown in fig3 c , have been established and hardened to constitute stable solid recordings , the maxillary and mandibular recording assemblies are removed from the patient . the aforementioned procedure allows for diagnostic visual observation of the reproduced condylar pathways which yields additional information about the synchrony or asynchrony of the condylar movements as well as the timing of the movement in each condyle for each basic movement . these observations allow the operator to simulate these movements during dental fabrication procedures . this arrangement also allows for three dimensional analysis of condylar pathways . in the mounting procedure , the patient &# 39 ; s maxillary model 61 is seated in the zinc oxide and eugenol paste imprints 62 in maxillary bite plate 9 . the base plate 24 of the upper articulator member with attached mounting ring 27 is next secured to the box like receptacles 4r and 4l of the maxillary recording apparatus . this is accomplished utilizing cap screws 31 which penetrate spacers 32 and engage holes 22 in the upper surface 71 of the receptacles . by virtue of such procedure , the maxillary bow is directly transformed into an upper articulator member . the patient &# 39 ; s maxillary model is next affixed to the mounting ring 27 of the upper base plate 24 utilizing dental mounting plaster . in such manner of association the teeth of the patient &# 39 ; s model 61 seat within the imprint 62 of the upper bite plate 9 and is secured to upper mounting ring 27 . cap screws 7 are then removed , a procedure which permits removal of first bow 5 , with attached upper bite plate which is then set aside . this procedure ensures complete fidelity in the orientation of the patient &# 39 ; s maxillary model 61 to the molded condylar pathways 60 and further ensures that the mounted models in the articulator have the same occlusal plane inclination relative to the frankfort plane as the patient &# 39 ; s jaws have in the head . if methods other than this direct one are used , serious orientation errors could result . the aforesid procedure essentially converts the maxillary recording assembly into an upper articulator member , with the patient &# 39 ; s maxillary model 61 mounted and accurately oriented to the molded condylar pathways 60 . it is to be noted that the apparatus component heretofore referred to as the upper articulator member is in actuality merely a precursor of the completed member . subsequently , the upper articulator member with the mounted maxillary model and condylar pathways is placed on the teflon balls 14 of the lower articulator member as shown in fig7 . since the medio - lateral distances of the teflon balls 14 in the mandibular recording apparatus and the teflon balls in the lower articulator member are identical , the upper condylar pathways fit accurately to the lower teflon articulator balls which now function as tracing balls . since the balls are in the most superior position in the clay paths in the centric relation jaw position , the orientation of the balls to this position is very easy and very stable . with upper and lower articulator members in proper interengagement and held in place with elastics over the receptacles containing the condylar pathways , the patient &# 39 ; s mandibular model 54 is mounted to the lower articulator member utilizing an interocclusal record 63 , as shown in fig7 . the assembled articulator by virtue of its specialized features , requires no centric lock for patients with normal condyles . said interocculusal record is composed of a stiff wax and zinc oxide and eugenol paste and taken in centric relation position . this completes the mounting of the patient &# 39 ; s models in proper relationship to the condylar pathways . the assembled articulator is capable of accurately reproducing condylar and mandibular motion in its entire merge as well as opening and closing , without deviation , on the same radius of the arc of closure as a the patient in the retruded condylar position . while particular examples of the present invention have been shown and described , it is apparent that changes and modifications may be made therein without departing from the invention in its broadest aspects . the aim of the appended claims , therefore , is to cover all such changes and modifications as fall within the true spirit and scope of the invention .	0
fig1 is a schematic perspective view of a body component for an automotive vehicle denoted as a whole by reference numeral 1 . in a possible embodiment , the body component is a reinforcing component for a radiator grille opening . body component 1 consists of a core made from a structurally rigid material , such as steel or reinforced composite material , and an outer layer made of a moldable plastic material . the outer layer may completely or partially surround the core . such a hybrid part may be formed by a process such as over - molding or co - molding , as is well know in the art . such hybrid components have the advantage of combining the structural strength of steel ( or another structurally rigid material ) with the adaptability of the plastics material , which allows the component to be adapted to requirements in an especially detailed manner . the body component 1 has a crash sensor 2 molded into its central region . a connecting cable 3 leads out from the crash sensor 2 and is provided at its end with a connector 4 for connection to the onboard electronics . in this case the connecting wires 7 of the connecting cable 3 are soldered directly to the sensor element 5 and the circuit board 6 . a seal 8 may also be molded integrally in the region of the exit of the connecting cable 3 . this construction allows the seal 8 to serve and a “ strain relief ” and / or ensures that no material fatigue occurs through movement of the connecting cable 3 , which may allow ingress of moisture , etc ., into the sensor . thus , during assembly , only the connector or the connecting cable needs to be connected to the remainder of the vehicle . the sensor 2 can therefore be installed and tested during the preproduction of the body component , which is more easily controllable and less time - critical . the crash sensor 2 is therefore molded into a protective layer 9 and only then molded into the body component 1 ; that is to say that it is provided with a surrounding plastic layer , usually an epoxy resin , prior to the installation process . the layer 9 protects the bare sensor and its ancillary connecting components ( wires , leads , etc . ), if necessary , against the conditions of the installation process , for example the injection of the plastic material which forms the coating . the protective material of layer 9 can also provide damping for the sensor with respect to vibrations and , depending on the configuration , can ensure further improved installation . the protective layer 9 may advantageously be made of a material that is fusible with the material of the under the conditions of the molding - in process . in this way an especially intimate connection is achieved . the embodiment of fig3 corresponds to the first embodiment of fig1 and 2 , apart from the omission of the additional seal 8 . the embodiments of fig3 to 5 differ from the embodiment just discussed only in that , in their case , the sensor is molded in when encapsulated by means of a polymer protective layer . the differences will therefore be discussed below . the embodiment of fig4 corresponds to the embodiment of fig1 and 2 , apart from the additional use of the protective layer 9 . the embodiment of fig5 includes , in addition to the use of the protective layer 9 , the embedding of a connector element 10 , which forms one half of a plug - in connection for connecting the sensor 2 and its electronics to the vehicle . in addition , the connector element 10 is connected to the sensor element 2 by means of connecting tags 11 , which at the same time form the contacts in the connector element 10 . the embodiments of fig6 and 7 differ from the embodiments previously discussed essentially in that , in their case , the sensor 2 is molded - in directly during the injection molding process without any protective layer . that is to say that the actual sensor element 5 , along with the interface circuit board 6 and the connecting lines 7 , is molded directly into the plastics material of the body component 1 and so is directly surrounded by the material of the body component . that is to say , the sensor 2 is embedded , for example , during the injection molding process of said body component and is then enclosed by the plastics material . the embodiment of fig6 corresponds to the embodiment of fig5 apart from the absence of the protective layer 9 . in the embodiment of fig7 , by contrast , although connecting tags 11 are used for the electrical connection , they are connected directly , for example soldered , to the connecting cable 4 inside the molded - in region , without a plug - in connection . the last embodiment , from fig8 , differs from the embodiments previously described in that the sensor 12 is not molded - in in a form - fitting manner . rather , the body component 1 includes a recess 13 within which the sensor element 14 , with circuit board 15 and connecting cable 16 , is bonded by means of the injection molding compound 17 , which may be identical to the material of the body component 1 . since the crash sensor is molded directly into a body component , without any intervening housing , a simplified installation can be combined with protection of the sensor against environmental influences . installation is simplified because only the body component needs to be incorporated in the vehicle assembly line . incorrect installation is also prevented , and the mounting location can be selected more freely , so that a more optimized position for the crash sensor can be used . in addition , the sensor is made smaller and more sensitive , because it is used without a housing . the crash sensor is advantageously molded form - fittingly , with or without a protective layer , into a corresponding “ recess ” in the body component . alternatively , depending on the configuration of the body component and of the optimum mounting location , the recess may be configured larger than the sensor and the sensor may therefore be molded - in “ only with air ”, in the manner of an integrated bond .	1
in the form of the invention illustrated in the drawings and described hereinafter , a high resolution , deep submergence , towed sonar apparatus 10 comprises a hydrodynamically streamlined and pressure resistant housing , generally indicated at 12 , that is adapted to be towed through an aqueous medium by a towing vehicle , such as a surface vessel or a helicopter , through the agency of a towing cable 15 . an electrical cable 16 provides for the conduction of electrical power and / or information bearing signals between the towing vehicle and the apparatus 10 . housing 12 is characterized by a low , substantially oval profile in side elevation , and is circular in plan , as is best illustrated in fig2 . this streamlined housing configuration incorporates what is known as a joukowski streamlined shape and is characterized by a diameter that is , or is close to , twice the thickness thereof . housing 12 , which is preferably formed principally of a rigid , solid material such as aluminum , includes a central portion 12a and top and bottom lid members or covers 12b and 12c . referring now to fig3 central portion 12a comprises a central frame 16 having a planar center wall or web 18 that is generally circular in plan . extending in opposite directions , upwardly and downwardly from web 18 , are central posts 20 and a plurality of annular , radially spaced , and coaxial ribs 22 , 24 , and 26 . the outermost ribs 26 are conveniently provided with radially extending flanges 28 . mounted on the outer surfaces of ribs 26 , between flanges 28 and an extending portion of web 18 , are a plurality of electroacoustic transducers 30 . these transducers are arranged in rows as a peripheral array and are adapted to project and / or receive acoustical energy . suitable waterproof compound , such as an epoxy resin , is advantageously used between adjacent ones of the transducers and between the transducers and the flanges 28 . openings 32 are provided through ribs 26 to pass electrical conductors to various electronic elements housed in housing 12 . disposed in overlying relation to the array of transducers 30 is a hydrodynamic fairing 34 , which in this example serves also as an acoustic window . fairing 34 is preferably formed of a suitable waterproof , and solid plastic material such as neoprene rubber , acrylic resin , polyurethane , or the like , having a desired acoustic transmission capability . the surface 36 of fairing 34 is curved to provide a more hydrodynamically efficient shape to the central portion 12a of housing 12 than would be achieved without its presence . additionally , the index of refraction of the material of fairing 34 , together with the curvature of surface 36 thereof , can in some applications be selected according to well understood principals to cause the fairing to serve also as an acoustic lens . covers 12b and 12c are identical in this example , each comprising a concavo - convex wall portion 40 having the convex surface thereof facing outwardly of the housing 12 . extending inwardly from each wall portion 38 are a central post 40 and a plurality of annular , radially spaced and coaxial ribs 42 , 44 and 46 corresponding in diameters to ribs 22 , 24 and 26 , respectively of central frame 16 . the outermost ribs 46 are of sufficient width to present an annular mating surface that is substantially congruent with the corresponding rib 26 and flange 28 thereof . a plurality of releasable fastening elements in the form of screws 50 extend through apertures in the periphery of covers 12b and 12c and are threadedly engaged in the respective flanges 28 . covers 12b and 12c are thereby readily assembled or removed . a resiliently pliable o - ring 52 is recessed into the edge of each rib 26 and cooperates with the opposing rib 46 to provide a water and pressure resistant seal between the covers and the central portion of housing 12 . it will be seen that the cooperating , radially spaced ribs of the covers and the central frame provide cover wall to cover wall load bearing support , appropriately distributed to lend great crush resistance to the housing 12 in spite of the thinness of the walls thereof . it will also be seen that the cooperating ribs define a plurality of annular , radially spaced and coaxial chambers 60 , 62 , and 64 within housing 12 and on opposite sides of web 18 . chambers 60 , 62 , and 64 accommodate electronic components or elements represented by blocks 70 of various geometrical form . these components may include , for example , amplifiers , sonar beam forming signal processors , information signal multiplexers , and other electronic devices well known in their association with sonar or other underwater instrumentations . housing 12 is adapted to be attached to cable 14 , for towing , by the provision of a pair of spaced , apertured ears 74 extending from ribs 26 to form a clevis . a clevis pin 76 extends through the ears 74 and through the eye of a cable end fitting 78 . electrical cable 15 extends through an appropriate penetration seal 80 in rib 26 to the interior of housing 12 , for connection to one or more of the electronic elements 70 therein . any well known hull penetration seal may be used , for example potting material poured around the cable at its point of emergence . the central frame 16 and the covers 12a , 12b can , because of their circular symmetry , be manufactured by turning on a lathe from a solid blank . alternatively they may be readily formed as castings , stampings , or forgings , with mere finishing machining being required . although only one o - ring is shown in the preferred embodiment , it will be recognized that o - rings may be provided between the mating surfaces of others of the ribs to isolate one or more of the chambers 60 , 62 , 64 from one another . moreover , the cooperating ribs may be increased or decreased in number and / or spacing as the use to which the housing is to be put dictates . obviously , other embodiments and modifications of the subject invention will readily come to the mind of one skilled in the art having the benefit of the teachings presented in the foregoing description and the drawing . it is , therefore , to be understood that this invention is not to be limited thereto and that said modifications and embodiments are intended to be included within the scope of the appended claims .	6
the preferred embodiment of the improved mat 30 and methods for fabricating it are shown in fig1 through 10 . preferably , the mat 30 is molded from a hard rubber . this will promote durability . the mat 30 is comprised of a mat base 32 , long legs 38 , short legs 40 , ribs 44 , channels 52 , grit trenches 64 , adhesive 72 and grit 70 . the mat base 32 has a top surface 34 and a bottom surface 36 . the long legs 38 are perpendicularly attached to the bottom surface 36 of the mat base 32 . this will provide resilient support for the mat base 32 . the short legs 40 are perpendicularly attached to the bottom surface of the mat base 32 . the long legs 38 and the short legs 40 are adapted to provide a selected mat compression when a load is applied to the top surface 34 of the mat base 32 . the combination of long legs 38 and short legs 40 causes the mat 30 which is constructed from hard rubber to feel and function as if it were constructed from a softer , more compressive rubber . this function is shown in fig5 a , 5 b and 5 c . there , a compressive force 42 is applied to the top surface 34 of the mat base 32 . before the compressive force 42 is applied the long leg 38 is in contact with the ground . the short legs 40 are raised above the ground . the compressive force 42 causes the long leg 38 to compress thereby bringing the short legs 40 closer to the ground . finally , in fig5 c , the short legs 40 contact the ground and begin to compress . the result is a mat 30 constructed from hard rubber which compresses as if it were constructed from a softer material . we have found that when using a configuration similar to that depicted in fig2 to fabricate an 18 inch by 18 inch by three - quarter inch mat , the combination of 504 long legs and 144 short legs 40 provides the preferred compression of the mat . the molded mat 30 contains a number of different rib 44 styles . shorts support ribs 45 are used to provide structural integrity , especially near the drain openings 58 described below . long ribs 48 are used to connect legs 38 , 40 . each long rib 48 is approximately the length of the legs 38 , 40 to which it is to be attached . however , the long ribs 48 do not exceed the length of the legs 38 , 40 to which they are attached . a plurality of long ribs 48 are each connected to a pair of legs 38 , 40 . the long ribs 48 will thereby prevent the mat 30 from sinking into and becoming embedded into a grating upon which it is placed . the mat 30 , may also be used on top of a solid floor . if only long ribs 48 were used to connect the legs 38 , 40 , drainage from the top of the mat 30 to the exterior of the mat 30 and air circulation within the mat 30 may be inhibited . therefore , a plurality of short ribs 46 are used , instead of long ribs 48 , to interconnect some legs 38 , 40 . this will result in expanded gapping between the floor and the short ribs 46 , thereby promoting drainage and circulation , as shown by the drain paths 60 in fig7 . the channels subdivide the mat top surface 34 into mat segments 62 , as shown in fig1 . each channel 52 has a floor 54 and a lateral wall surface 56 . most channels 52 have two lateral wall surfaces 56 . preferably , the lateral wall surfaces 56 contain drain openings 58 . such drain openings 58 are positioned upon a vertical lateral wall surface 56 rather than horizontally oriented , as in current mats . because the drain openings 58 are on vertically oriented surfaces the drain openings are less likely to become clogged by contaminants . the drain openings 58 are also much less likely to trap hard and dangerous objects resulting in safety hazards . liquids and other contaminants drain through the drain openings 58 to the bottom of the mat 30 and to the exterior of the mat 30 by way of the drain paths 60 . the grit trenches 64 are embedded within the top surface 34 of the mat base 32 . the grit trenches 64 are intended to hold grit 70 . each grit trench 64 has two ends 66 . each end 66 has a retention lip 68 forming a dam for retaining adhesive 72 and grit 70 . the retention lip 68 prevents the adhesive 72 from flowing out of the grit trench 64 , while the adhesive 72 is in a liquid form . this enhances the ability to selectively place grit 70 upon the top surface 34 of the mat 30 . grit 70 is securely bonded into the grit trenches 64 with the adhesive 72 . the preferred grit 70 is silicon carbide . the preferred adhesive 72 is cyanoacrylate . in order to minimize the likelihood of mat 30 flexure causing the grit 70 to become unbonded , the grit 70 and adhesive 72 are placed substantially below the top surface 34 of the mat 30 , as shown in fig1 . however , some of the grit 70 must protrude above the top surface 34 of the mat base 32 in order for the grit 70 to increase the coefficient of friction of the top surface 34 of the mat base 32 . to further reduce unbonding of grit 70 by flexure , long legs 38 are perpendicularly attached to the bottom surface 36 of the mat base 32 below the grit trenches 64 in order to provide support for the grit trenches 64 . because the grit 70 and adhesive 72 are substantially below the top surface 34 of the mat base 32 and because the grit trenches 64 are supported by long legs 38 grit 70 may be selectively placed upon the top surface 34 without significant unbonding being caused by flexure . lateral drain openings 58 positioned upon a lateral wall surface 56 are difficult to cost effectively fabricate by molding . another technique is needed to fabricate the drain openings 58 . first , a mat 30 is molded such that it has a top surface 34 and a bottom surface 36 . it is molded such that channels 52 subdivide the mat top surface 34 into mat segments 62 . as previously described , the channels 52 have a floor 54 and a lateral wall surface 56 . the mat 30 is fabricated such that a rib 48 is perpendicularly molded into the bottom surface 34 of the mat 30 below each channel 52 . drain openings 58 may be created within the lateral wall surfaces 56 of each channel 52 by removing material from the floor 54 , at least one lateral wall surface 56 and the underlying rib 48 , 46 of the channel . the material must be removed to a depth which is below the bottom surface 36 of the mat base 32 in order to form a drain opening 58 . the material may be removed with a grooving tool such as a tire groover . the grooving tool has a heated blade 74 for removing rubber . preferably , the material is removed from the floor 54 of each channel 52 and its underlying rib 48 , 46 by a process which uses a programmable cartesian robot . the first step of the process is to attach a grooving tool having a heated blade 74 to the robot . preferably , the grooving tool is a tire groover . the robot is programmed to remove the material from the floor 54 of each channel 56 and its underlying rib 46 , 48 . after the groover is attached to the robot and the robot is programmed , the mat 30 is secured onto the workbed of the robot . then , the material is removed from the floor 54 of at least one channel 52 , at least one of its lateral wall surfaces 56 and its underlying rib 46 , 48 with the robot and the attached groover , thereby forming a drain opening 58 . the robot may also be used to automate the bonding of grit 70 into the trenches 64 embedded within the top surface 34 of a mat 30 . first an adhesive dispenser 76 is attached to the robot . the robot is programmed to fill the trenches 64 with adhesive 72 . the mat 30 is secured onto the workbed of the robot . the robot then fills the trenches 64 with adhesive 72 . before the adhesive 72 sets grit 70 is spread over it . finally , the excess grit 70 is removed from the mat 30 . optionally , the programmable cartesian robot may be equipped with a grit dispenser 78 for selectively spreading grit 70 , as shown in fig9 . although the invention has been shown and described with reference to certain preferred embodiments , those skilled in the art undoubtedly will find alternative embodiments obvious after reading this disclosure . with this in mind , the following claims are intended to define the scope of protection to be afforded the inventor , and those claims shall be deemed to include equivalent constructions insofar as they do not depart from the spirit and scope of the present invention .	8
fig1 shows a bottom plan view relating to a second substrate 350 of a liquid crystal display panel 3 in accordance with a first preferred embodiment of the present invention . fig2 shows a cross - sectional view of the liquid crystal display panel 3 . referring to fig1 and 2 , the liquid crystal display panel 3 includes a first substrate 300 , the second substrate 350 and a liquid crystal layer ( not shown in full ) comprising a plurality of liquid crystal molecules 303 . the liquid crystal layer is sandwiched between the first and second substrates 300 , 350 . an alignment film 301 is formed on an inner side of the first substrate 300 . the first substrate 300 includes a plurality of data lines ( not shown ) and gate lines ( not shown ). the data lines are perpendicular to the gate lines . a plurality of tfts ( thin film transistors ) is formed at crossings of the data and gate lines . a plurality of pixel electrodes ( not shown ) is deposited on the first substrate 300 , the pixel electrodes being connected with drain electrodes of the tfts . an alignment film 351 is formed on an inner side of the second substrate 350 . the second substrate 350 includes a color filter ( not shown ) and a common electrode ( not shown ). the common electrode and the pixel electrode can form an electric field to drive the liquid crystal molecules 303 , so that a display of the liquid crystal display panel 3 is obtained . the second substrate 350 defines a central display area 3502 and a peripheral area 3501 . a sealant 310 in the form of a continuous line is located at the peripheral area 3501 . the sealant 310 is made of a light hardening material ; in particular , the sealant 310 is hardened by uv radiation . the first substrate 300 and the second substrate 350 are attached together by the sealant 310 . a blocker 360 in the form of a continuous line is located around a periphery of the display area 3502 . the liquid crystal molecules 303 and the sealant 310 are separated by the blocker 360 , in order to avoid reaction between the liquid crystal molecules 303 and the uncured sealant 310 . the blocker 360 is made of elastic material , such as polymethyl methacrylate ( pmma ), natural rubber ( nr ), styrene butadiene rubber ( sbr ), isobutylene - isoprene rubber ( iir ), nitrile - butadiene rubber ( nbr ), or ethylene - propylene - diene monomer ( epdm ). the blocker 360 and the sealant 310 are spaced apart by a substantially uniform gap . a black matrix 330 in the form of a continuous thick line is located on the inside of the second substrate 350 , straddling a region where the display area 3502 adjoins the peripheral area 3501 in order to avoid light shielding phenomena . the black matrix 330 is made from chromium ( cr ) and is opaque . the black matrix 330 covers the blocker 360 and is spaced a horizontal distance from the sealant 310 , so that light can pass through the second substrate 350 and harden the sealant 310 . fig3 and 4 are schematic , cross - sectional views of sequential stages in a method for manufacturing the liquid crystal display panel 3 . referring to fig3 , the first substrate 300 and the second substrate 350 are provided . the second substrate 350 includes the peripheral area 3501 and the display area 3502 . the black matrix 330 is formed on a region straddling the peripheral area 3501 and the display area 3502 . the alignment film 351 is formed on the second substrate 350 , and covers the black matrix 330 . the alignment film 301 is formed on the first substrate 300 . a plurality of spacers ( not shown ) is deposited on the alignment film 301 . referring to fig4 , liquid crystal molecules 303 are dropped on the alignment film 301 . the sealant 310 is formed on the alignment film 351 in the peripheral area 3501 . the sealant 310 and the black matrix 330 are spaced apart by a horizontal gap , so that light can pass through the second substrate 350 and harden the sealant 310 . the blocker 360 is formed on the alignment film 351 . the blocker 360 is deposited between the sealant 310 and the display area 3502 , so that it can separated the sealant 310 and the liquid crystal molecules 303 . referring to fig2 , the second substrate 350 is turned over and positioned on the first substrate 300 . assembly of the first substrate 300 and the second substrate 350 is performed in a vacuum chamber ( not shown ). after that , the combined substrates 300 , 350 are taken out from the vacuum chamber . the substrates 300 , 350 are securely held together by reason of atmospheric pressure exerting on the combination . then the sealant 310 is hardened by u radiation , so that the substrates 300 , 350 are firmly attached together . the liquid crystal display panel 3 is thus formed . fig5 shows a bottom plan view relating to a second substrate 450 of a liquid crystal display panel 4 in accordance with a second preferred embodiment of the present invention . fig6 shows a cross - sectional view of the liquid crystal display panel 4 . referring to fig5 and 6 , the liquid crystal display panel 4 includes a first substrate 400 and the second substrate 450 . the second substrate 450 defines a central display area 4502 and a peripheral area 4501 . a sealant 410 and a blocker 460 are formed on the peripheral area 4501 , and are spaced apart by a substantially uniform gap . a black matrix 430 is formed on a region straddling the display area 4502 and the peripheral area 4501 . an optical spacer 470 in the form of continuous line is formed on the peripheral area 4501 . the optical spacer 470 is spaced apart from an outside extremity of the black matrix 430 by a horizontal gap . the optical spacer 470 helps the liquid crystal display panel 4 have a uniform thickness . fig7 and 8 are schematic , cross - sectional views of sequential stages in a method for manufacturing the liquid crystal display panel 4 . referring to fig7 , the first substrate 400 and the second substrate 450 are provided . the second substrate 450 includes the peripheral area 4501 and the display area 4502 . the black matrix 430 is formed on the region straddling the peripheral area 4501 and the display area 4502 . the alignment film 451 is formed on the second substrate 450 , and covers the black matrix 430 . the alignment film 401 is formed on the first substrate 400 . referring to fig8 , liquid crystal molecules 403 are dropped onto the alignment film 401 . the sealant 410 is formed on the alignment film 451 in the peripheral area 4501 . the sealant 410 and the black matrix 430 are spaced apart by a horizontal gap , so that light can pass through the second substrate 450 and harden the sealant 410 . the blocker 460 is formed on the alignment film 451 . the blocker 460 is deposited between the sealant 410 and the display area 4502 , so that it can separate the sealant 410 and the liquid crystal molecules 403 . the optical spacer 470 is formed on the alignment film 451 in a position corresponding to beyond the outside extremity of the black matrix 430 . referring to fig6 , the second substrate 450 is turned over and positioned on the first substrate 400 . assembly of the first substrate 400 and the second substrate 450 is performed in a vacuum chamber ( not shown ). after that , the combined substrates 400 , 450 are taken out from the vacuum chamber . the substrates 400 , 450 are securely held together by reason of atmospheric pressure exerting on the combination . then the sealant 410 is hardened by uv radiation , so that the substrates 400 , 450 are firmly attached together . the liquid crystal display panel 4 is thus formed . many modifications and variations are possible within the ambit of the invention herein . for example , the blocker and the sealant may be connected together . the blocker , the sealant and the optical spacer may be formed on the first substrate instead of the second substrate . the black matrix may be made from chromium oxide ( crox ). it is believed that the present embodiments and their advantages will be understood from the foregoing description , and it will be apparent that various changes may be made thereto without departing from the spirit and scope of the invention or sacrificing all of its material advantages , the examples hereinbefore described merely being preferred or exemplary embodiments of the invention .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.