Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
fig1 shows a 14 band 32 kbit / s sub - band coder system . the input signal having a nominal bandwidth of 7 khz is sampled at 14 khz -- illustrated schematically by a switch 1 -- and the full band spectrum is divided into fourteen uniform bands by a four - stage tree - structured filter bark 2 employing quadrature mirror filters . 32 - tap finite impulse response filters are suggested though lower order filters could be employed at the higher stages of the filter bank . the filter outputs are , as is conventional , down sampled ( by means not shown ) to 1 khz . laplacian forward adaptive quantizers are employed for the quantization of the sub - band signals . essentially there are two stages here ; firstly ( normalization stages n1 . . . n14 ) the signal is normalized by dividing by a scaling factor which is defined every 16 ms from estimates of the energy of the relevant sub - band . basically this is the rms value of the signal over that period . 16 samples ( for sub - band 1 , x 1j - j = 1 , . . . 16 ) are buffered in a register 3 , and the scaling factor or step size δ 1 calculated at 4 using the relation ## equ2 ## the scaling factors are quantized to 5 - bit accuracy in a quantizer 5 and the quantized value δ transmitted as side information to the receiver . thus the side information accounts for almost 4 . 5 kbit / s and thus approximately 27 . 5 kbit / s is available for transmission of the samples themselves . these processes are carried out for each of the fourteen sub - bands . the normalized samples ( s kj = x kj / δ k ) for each sub - band are then fed to a quantizer 6 which encodes them using the desired number of bits b k prior to transmission via multiplexer 7 . bit allocation is indicated in fig1 schematically as unit 8 . in the prior proposal of tribolet and crochiere , equation ( 1 ) was used to define the bit allocation , in the present proposal , equation ( 1 ) is used to determine the bit allocation patterns for all the 16 msec frames in an input training sequence which is free of any silent intervals . γ is set to - 0 . 3 and the maximum number of bits m allowed in the allocation is set to 5 . let n i represent the total number of times in the training sequence that i bits are allocated , where i = 1 . . . , 5 . next , we define f i as : ## equ3 ## where n t is the total number of bits available for allocation throughout the training sequence . f i therefore represents the portion of n t used in allocating i bits for the coding of sub - band signals . if there are n t bits available for allocation the expected number of bands n i that receive i bits can be calculated according to : for i = 1 , . . . , m . a time - invariant bit allocation pattern is thus obtained using the n i estimates , i . e ., ( n 5 * 5 bits , n 4 * 4 bits , . . . , n 1 * 1 bit ; 0 bit for the remaining bands ), assuming m is equal to five . this means that , within a 16 msec frame , n 5 sub - bands receive 5 bits , n 4 sub - bands receive 4 bits and so on . manual adjustment is normally required to ensure that the total number of bits in the invariant allocation pattern gives the desired total transmission bit rate . for the 14 - band coder , the 27 . 5 kbit / sec capcity and 1 khz sampling rate permit 27 bits , and the bit pattern obtained was given by : though the pattern is fixed , the allocation is based on the scale factors of the sub - band signals . for each frame of 16 msec the bank with the largest scaling factor is allocated 5 bits ; the 2nd largest 4 bits and so on . the processing requirements of this algorithm are considerably reduced when compared with those of the fully adaptive scheme , since once the invariant allocation pattern has been derived , it is fixed for a given coder . also because the allocation of these bit groups to the particular sub - bands is determined by reference to the scaling factors , the transmission of further side information to the receiver is not necessary . considering now transform coding , in this example an adaptive transform coder using the discrete cosine transform employs a blocksize of 128 samples . an estimation of the 16 primary coefficients of the basic spectrum ( r zelinski and p noll , &# 34 ; adaptive transform coding of speech signals &# 34 ;, ieee trans . on assp , vol assp - 25 , no . 4 , pp 299 - 309 , aug . 1977 ) is carried out every 8 msec although the average of two set sof these coefficients , from adjacent frames , is used to define the step - sizes of the transofrm coefficient qauantizers and the bit allocation pattern . 3 bit gaussian quantizers are used to quantize the 16 primary values of the average basis spectrum . normalization of the input samples is also carried out using a normalization parameter which is evaluated every 256 samples . the normalization parameter is quantized using a 5 bit gaussian quantizer . the problem of efficiently coding the resulting 128 coefficients is similar to that of coding the sub - band samples in the previous examples . here equations 1 to 3 are applied to a training sequence to obtain a bit allocation pattern ( γ =- 0 . 2 ) of : ( 1 * 7 , 4 * 6 , 5 * 5 , 9 * 4 , 20 * 3 , 25 * 2 , 28 * 1 , 36 * 0 ), that is , out of the 128 transform coefficnets , 1 coefficient is quantized with 7 bits 4 coefficients with 6 bits etc . the advent of digital signal processing ( dsp ) devices has facilitated the real - time implementation of a number of otherwise difficult to implement speech coding algorithms . a sub - band coder for example , can be conveniently implemented using a dsp chip . the implementation complexity of a coder depends to an extent on the number of multiplications / divisions , additions / substractions and on the size of memory required for storing the intermediate variables of the coding algorithm . table 1 illustrates the computational requirements , including delays , of the coders considered . sbc and atc indicate sub - band and transform coding respectively , whilst aba indicates adaptive bit allocation according to equation ( 1 ) and sba the simplified bit allocation as described above . ______________________________________ memory system size no . of ×/÷ no of +/- delay ( words ) (/ sample ) (/ sample ) ( m sec ) ______________________________________adpcm 50 37 38 ≃ 0sbc / sba 700 62 65 45 ( can bereduced to ) 500 45 48 33atc / aba 900 9 14 25______________________________________ table 1 summary of the system complexity for the various decoders . a fast algorithm for the cosine transform was assumed in deriving the above estimates . note that the adaptive transform coders also require additional log 2 and inverse log 2 look - up tables . for the sub - band coder , the higher stages of the quadrature mirror filter analysis bank can be implemented using lower order fir filters to reduce the memory size and coder delay . excluded in the estimation is the memory required for the program instructions of the coding algorithm . currently , due to their stringent real - time and memory requirements , large blocksize transform coders can be more conveniently implemented using array processors . the performance of the coders described has been assessed by computer simulation in terms of ( 2 ) long - term average spectral density plot of the output noise and the input data used in our computer simulation experiments consisted of two sentences of male speech and two sentences of female speech . table 2 shows the average segmental snr performance ( in dbs ) of the coders . ______________________________________ male ( average female ( average totalcoder of 2 sentences ) of 2 sentences ) average______________________________________sbc / aba 19 . 26 20 . 52 19 . 88sbc / sba 18 . 79 19 . 68 19 . 24atc / aba 14 . 60 12 . 58 13 . 59atc / sba 13 . 73 11 . 50 12 . 62adpcm 13 . 55 18 . 02 15 . 79______________________________________ table 2 . average segmental snr measurements of the various coders . the two sub - band coding schemes offer the best snr measurements of 19 . 88 and 19 . 24 db . informal subjective listening tests indicate that the sbc / aba system produces an excellent quality recovered speech . this is due to the fact that the output noise level is low enough and is masked by the speech energy in each band . also , the use of the simplified bit allocation algorithm did not affect the subjective quality of the 14 - band coder though there is a drop of 0 . 6 db in snr . the next scheme , in order to merit , is adaptive transform coding employing the full algorithm . the distortion due to inter - block discontinuities can be substantially reduced by smoothing . it should be noted that subjectively the difference between sub - band and transform coding is not as significant as suggested by their large difference in snr values . the transform coder employing the simplified bit allocation algorithm was found to have an snr reduction of 1 db compared to the one with the fully adaptive algorithm . the block - end distortion becomes more pronounced and the recovered speech is also degraded by a &# 34 ; whispery &# 34 ; noise . this means that as the noise level , at this bit rate , is just at the threshold of audibility , the use of the full adaptation algorithm becomes necessary . however , if mor ebits are allowed for the transform coder , the sba algorithm might prove to be a valuable method in reducing the coder complexity . in general , some degradation in the quality of the atc speech at 32 kbits / sec is caused by interblock discontinuities . though the underlying speech can be very good , the effect of discontinuities is perceptually unaccpetable . one suggested solution to this problem is to apply 10 percent overlap between adjacent blocks . another method is to employ either median filtering or a moving average filtering process to a few samples at both ends of each block . the 10 percent overlap scheme is found to be the least effective because fewer bits are available for the quantization of the transform coefficients which in turn increases the amount of block - end distortion . the method of median filtering is found to give some subjective improvement while the best performance is obtained from the moving averaging method . in its use , 10 samples x 1 , x 2 , . . . , x 10 ( the last five samples of the previous block and the first five samples of the present block ) were replaced by y 1 , y 2 , . . . , y 10 , where y i = 1 / 3 ( x i - 1 + x i + x i - 1 ), and i = 1 , . . . , 10 . an exemplary method used for implementing the bit allocation algorithm 8 is depicted at fig2 . here , the quantized normalization factors δ , through δ 14 used for each 16 ms data block or &# 34 ; frame &# 34 ; are supplied as inputs to block 82 where they are re - arranged into descending order according to their magnitudes . this reordered sequence ( e . g ., δ 5 , δ 2 , δ 1 , . . . ) is then used at block 84 in conjunction with the previously derived magnitude ordered bit allocation pattern form the 14 sub - bands ( e . g ., 1 * 5 , 1 * 4 , 3 * 3 , 2 * 2 , 5 * 1 , 2 * 0 ) to correspondingly allocate the correct number of bits to the correct band ( e . g ., 5 bits for the 5th sub - band , 4 bits for the 2nd sub - band , 3 bits for the 1st sub - band , . . . ). the resulting allocated numbers of bits are then output at b 1 . . . b 14 to control the appropriate quantizers 6 for that particular 16 ms time block ( e . g ., 27 bits ) as depicted in fig1 .	7
the process steps and structures described below do not form a complete process flow for manufacturing integrated circuits . the present invention can be practiced in conjunction with integrated circuit fabrication techniques currently used in the art , and only so much of the commonly practiced process steps are included as are necessary for an understanding of the present invention . the figures representing cross - sections of portions of an integrated circuit during fabrication are not drawn to scale , but instead are drawn so as to illustrate the important features of the invention . referring to fig1 integrated circuit devices are formed in a substrate 10 . field oxide regions 12 , 14 separate and define active areas within the substrate 10 . polycrystalline silicon signal line 16 is used to conduct signals on the device . signal line 16 is separated from the substrate 10 by gate oxide layer 18 . sidewall oxide spacers 20 are formed on either side of the signal line 16 as known in the art . although the cross - sectional view through signal line 16 shows the same structure as a field effect transistor , signal line 16 can be a non - gate signal line which is utilized in a shared contact region . signal line 16 will be so used as will be described further below . active regions 22 , 24 function as the source / drain regions of the field effect device if polycrystalline silicon signal line 16 actually functions as a field effect gate . in a shared contact layout , the active areas 22 , 24 may actually be connected out of the plane of the drawing , so that the signal line 16 does not function as a gate . polycrystalline silicon signal line 26 rests on field oxide region 14 . oxide sidewall spacers 28 are formed thereon at the same time as sidewall spacers 20 . processing to form the elements just described is conventional as known in the art . after formation of the transistor structures , dielectric layer 30 is deposited over the surface of the integrated circuit device . this layer 30 is preferably lpcvd / apcvd / lto silicon dioxide followed by a deposited layer of lpcvd silicon nitride as known in the art . other insulating layers may be used if desired . after formation of dielectric layer 30 , insulating layer 32 is deposited over the surface of the device . layer 32 is preferably a dielectric which can be easily planarized . layer 32 may be , for example , bpsg which is deposited and heated to reflow as known in the art . if bpsg is used , the reflow is preferably performed in an ambient atmosphere including steam . the reflow cycle , or other planarization step , results in a nearly planar surface as shown in fig1 . referring to fig2 an insulating layer 34 is deposited over the surface of the device . insulating layer 34 is preferably an lpcvd silicon nitride layer deposited to a depth of approximately 2000 - 4000 angstroms . nitride layer 34 is then patterned and etched to define a region 36 in which polycrystalline silicon resistors are to be formed . another insulating layer ( not shown ) is deposited over the surface of the chip , and anisotropically etched without masking to form sidewall spacers 38 within the resistor region 36 . the insulating layer used to form the spacers 38 is preferably an lpcvd / lto silicon oxide layer . the oxide layer is deposited to a thickness which results in the width of the oxide regions 38 resulting as desired . as known in the art , the width of the spacers 38 is approximately equal to the thickness of the oxide layer from which they are formed . thus , for example , if a 0 . 2 micron opening is desired between the spacers 38 , and the region 36 is one micron wide , the oxide layer used to produce spacers 38 is deposited to a depth of approximately 4000 angstroms . after formation of the sidewall spacers 38 , contacts are opened to the substrate 10 and other underlying features through insulating layers 30 , 32 , 34 . as examples of the types of contacts which may be formed , contact opening 40 makes contact with active region 22 within a substrate 10 . contact opening 42 makes contact with both the polycrystalline silicon signal line 16 and active region 24 . the contact to be formed in opening 42 is part of a shared contact region . contact opening 44 is opened simply to allow contact to underlying polycrystalline silicon line 26 . referring to fig3 a layer of polycrystalline silicon 40 is deposited over the device . layer 40 is preferably deposited to a depth of approximately 500 to 1500 angstroms . a blanket impurity implant is then made to control the resistivity of the polycrystalline silicon resistors to be fabricated in region 36 . if n - type resistors are to be formed , an n - implant is made . referring to fig4 the polycrystalline silicon layer 46 is patterned and etched to remove it except in the desired contact regions 40 , 42 , 44 and interconnect regions as desired . this results in various polycrystalline silicon contact structures 48 as shown . the layer 40 is etched to completely clear it , which can be accomplished by etching until the end point is reached as known in the art , and continuing the etch for a period of time approximately ten percent beyond reaching the end point . such an over etch insures that undesired polycrystalline silicon regions do not remain behind . during etching of the polycrystalline silicon layer 46 , resistor region 36 is left unmasked . this causes the polycrystalline silicon overlying such region 36 to be etched away . however , due to the depth of the region 36 , some material remains in the region between the sidewall spacers 38 . this polycrystalline silicon region 50 provides the resistor desired for use in the device . as will be apparent to those skilled in the art , the cross - sectional area of resistor 50 is much smaller than a resistor which fills the resistor region 36 . a masked n + implant can then be made to reduce the resistivity of the polycrystalline silicon contacts and interconnect 48 . remaining fabrication steps for the device , such as formation of further polycrystalline silicon and metal interconnect layers , is completed in a conventional manner . to a great extent , the device is already planarized due to the planarization of insulating layer 32 , so that further planarization steps may be minimized or not required . referring to fig5 an alternative technique for fabricating small cross - section polycrystalline silicon resistor structures is shown . the technique used is very similar to that described in connection with fig1 - 4 . the difference is that the deposition of the oxide layer , and anisotropic etching thereof to form sidewall spacers 38 , is not performed . instead , when polycrystalline silicon layer 40 is deposited over the device , it extends across the entire width of resistor region 36 . when the polycrystalline silicon is anisotropically etched to form contact and interconnect regions 48 , sidewall polycrystalline silicon regions 52 are formed within the resistor region 36 . these regions 52 are separated by region 54 in much the same manner that sidewall oxide regions 38 were separated as described in connection with fig2 . the width of the polycrystalline silicon resistors 52 is controlled by the depth to which polycrystalline silicon layer 46 is deposited . the height of the resistor regions 52 is controlled by the depth to which the nitride layer 34 is deposited . decreasing the depth of nitride layer 34 , or the thickness of polycrystalline silicon layer 46 , results in resistor regions 52 having a smaller cross - sectional area . further processing of the device after the stage shown in fig5 is completed in a conventional manner as described above in connection with fig4 . fig6 illustrates a plan view of a polycrystalline silicon resistor formed according to the techniques described in connection with fig1 - 4 . polycrystalline silicon contacts 60 connect to signal lines 62 . lines 64 indicate the boundaries of the resistor region 36 . polycrystalline silicon resistor 66 connects the contacts 60 . as can be seen , the cross - sectional area of the polycrystalline silicon resistor 66 is greatly reduced from that which would normally be formed connecting contact regions 60 . this allows a much higher valued resistor to be formed , or a shorter resistor to be used . use of shorter resistor 66 allows the contacts 60 to be placed closer together , if desired , thereby reducing the overall layout area required for circuit structures such as 4 - transistor sram cells . fig7 is a plan view of a device constructed according to the method described in connection with fig5 . contact regions 70 are connected to signal lines 72 . polycrystalline silicon resistors 74 connect the contact regions 70 . since the resistors are formed on both sidewalls of the resistor region 36 , two parallel resistors 74 are formed . the twin resistor structures 74 shown in fig7 have the same advantages as the single structure 66 shown in fig6 and can be fabricated with a lesser number of process steps . the resistor structures described above provide polycrystalline silicon resistor structures which have a reduced width , and thus a reduced cross - sectional area . use of such resistor structures in circuits such as cmos sram cells allows the use of shorter resistors for a given required resistance . this can lead to smaller cell layout areas , and increased device density on an integrated circuit chip . while the invention has been particularly shown and described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention .	8
in accordance with the embodiment of the invention shown in fig1 , probe 10 includes a first gas permeable sand - resin , generally cylindrically shaped body 12 formed of a baked gas permeable sand - resin mixture . as shown the baked sand - resin body 12 has a stem portion 13 of a size adapted to fit within the interior of paperboard sleeve 18 and a radially raised or enlarged portion 11 which serves as a stop for the immersion end of paperboard sleeve 18 . the abutting surfaces of the sand body and the end surface of the paperboard sleeve 18 should be totally sealed gas tight . thus a ceramic cement 21 or the like is used between these abutting surfaces . the end surface 45 is abutted by the end of smaller tube 20 but it is not adhered thereto . any other sand body contact with the paper tubes 18 or 20 internal to the tubes should not be gas tight . tubes 18 and 20 are loosely fitted in order to allow gas flow therebetween . the embodiment of fig1 ( as well as fig6 - 7 ) is used in instances wherein only the oxygen content and temperature of the melt is to be determined . in fig1 and all figures except fig5 that show the tip portion 14 of an oxygen measuring cell , usually a stabilized zirconia oxygen cell can be seen in the drawings together with a quartz u - tube loop portion 16 of a thermocouple assembly and pt / rh wires which are welded to conductors 24 and 26 and directly encased in the sand body and connected to monitoring instrumentation . a small ceramic basket 19 also supports the quartz loop 16 . the welds are the thermocouple cold junctions 99 and 100 and are best shown in fig7 . they are not shielded , but instead enclosed in the well vented sand body in accordance with the present invention . the outer surface ( internal to the sand body ) of the zirconia oxygen cell 14 ( also see fig3 ) internal to the gas permeable sand is totally exposed in all areas to the sand - resin body 12 . the smaller diameter paper tube or sleeve 20 is adapted to be supported by the immersion end of a support pipe or lance of standard configuration . the inner , smaller tube 20 has an outer diameter about the same as that of a reduced diameter end portion 13 , 45 of probe body 12 . a slot or slots 22 , best seen in fig1 are provided in the distal end of the sleeve 20 to allow escape of gases from the interior area of sleeve 18 into the interior of the smaller diameter sleeve 20 from whence the gases can escape to the atmosphere either directly or between the loosely fitting tubes , lance or support pipes . as previously noted , sleeve 20 fits loosely within the interior of larger sleeve 18 to facilitate escape of gases . sleeves 18 and 20 can be stapled together , 23 , to stabilize the assembly . also a gas vented 360 degree interrupted circle of adhesive 31 , fig1 , may be applied around the perimeter of tubes 18 and 20 at the proximal end of tube 18 to allow venting through this area . a metallic connector tube 32 is attached to a steel ground rod or wire 34 that extends into the immersible tip portion of the device as shown . the heavy structural ground rod may be pointed in the area exposed to the molten metal to ensure a fine single point grounding and to avoid possible ground rod dilution and contamination of the sample . in order to further enable venting of gases , one or more openings 48 are provided through the connector and ground tube 32 . see fig1 . tube 32 may have a diameter of about ⅜ inch ( 1 cm ). the unvented connector system used and well vented as shown in fig1 is commonly known and defined as a ⅜ inch pipe sized connector system . the vented connector system used in fig2 , 3 , 6 , 7 , and 7 a are commonly known and defined as a ¾ inch pipe size connector system . a metal sample mold 28 , formed by halves 51 and 52 , having a immersible fused quartz sample mold filling tube 29 covered by a small metal cap 53 is included in the embodiment 40 of fig2 , 3 and 4 . as most clearly shown in fig2 , sample mold 28 is of a conventional two - part clam - shell configuration common in the art which includes halves 51 and 52 and a quartz fill tube 29 through which the molten metal can enter during immersion . a steel clamp 27 may be used , if preferred , to hold the two mold halves together . quartz tube 29 may be provided with a fusible steel cap 53 . also seen in fig2 and 3 is ground rod or wire 34 which , as in the case of probe 10 of fig1 , ensures that the electrical potential of tube 36 is grounded at single point relative to the molten metal bath when it is contacted by the rod 34 . mold 28 and ground rod 34 , swage 59 and metal ring 36 provide a prebaking structural integrity to the probe prior to the baking of the sand body . thus greater physical strength is provided to the mold combination of fig2 and 3 to better withstand the forces necessary to submerge the probe deeply into a dense metal melt . since the sensor combination with sample mold 28 displaces a greater volume of the melt , a greater immersion force is required . in order to obtain excellent metal samples a substantially instantaneous evacuation of gases from within the mold is required so that the molten metal can enter the mold in the brief time available . the single point ground rod or wire 34 may be exposed as in fig2 or may be located in any area that is preferred at the surface of the immersion sensor that will be exposed to the molten metal . also see ground wire 96 , fig7 , for another alternate example of ground point exposure . the venting of the immersion sand sensor system through the paper tubes and connector system is substantially completely gas permeable , instantaneous , with no detectable back pressure . as also best seen in fig2 & amp ; 3 , oxygen cell 14 utilizes a circuit formed by the ground rod 34 and a positive lead 24 of the thermocouple u - tube 16 , to which a positive lead 25 for the oxygen cell is swaged at junction 59 , so that only three leads are thus necessary to enable operation of the thermocouple 16 and the oxygen sensor 14 . as seen , the immersion tip is covered by a consumable slag repelling paper cover 50 which covers the fusible metal end cap 17 . cap 17 preferably has no openings in it and the measuring components , sampling tube inlet 29 and ground 34 thus can be covered and protected until immersion . cap 17 is preferably formed from non - galvanized steel so that , for example , the presence of zinc vapors in the areas of the oxygen cell are avoided . a thin metal cap with only outer surface corrosion protection can be used . metal caps 17 or 65 are preferably mounted without cement and are provided with irregular shaping such as scallops 63 , 64 at the sand - resin contact area of cap 65 as seen in fig5 or alternatively with pins 60 , 62 as shown on cap 17 in fig1 , 2 , 3 and 7 . this results in avoidance of the formation of a residual ring remaining after the molten metal exposed capping system has melted which could cause electrical interference with the sensor measurement signals when used in induction or electric melting furnaces or electric reheating ladles . metal rings are thus avoided except in the connector end or area . the connector ends are provided with mating electrical connectors of known design , except for the venting , for providing means for transmitting data from the testing devices of the probe to remote electronic monitoring equipment . the embodiments of fig2 and 3 are intended for use with a pair of paperboard tubes 18 and 20 similar to those shown in fig1 . the gas permeable body 42 , having a stem portion 43 and provided with a projecting shoulder 41 which , in similar fashion to the embodiment of fig1 , serves to limit the distal movement of tube 18 to which it is adhered forming a gas tight seal . stem 43 is adapted to closely fit within the tube 18 and the proximal end 45 of the separate permeable sand - resin body 30 may serve as a stop for the smaller tube 20 which is preferably also provided with a slot 22 ( seen in fig1 ) to provide optimal gas escape from within the probe body into a supporting lance or directly to the atmosphere . alternatively , a connector 78 supports the end of body 30 as illustrated in fig2 and 3 . connector 78 , which may be formed of a ceramic material , is provided with a shoulder 79 to which tube 20 may be abutted but preferably not adhered at the abutment . the distal end of the outermost tube 18 is adhered gas tight to its abutting surface but , to preserve venting , the inner tube 20 is not adhered gas tight to any of the sand body embodiments of the invention illustrated herein . in the embodiments of fig1 and of fig2 and 3 which utilize two supporting tubes 18 and 20 , several alternative avenues are provided for the flow of gases out of the probe body . unlike previous devices , the described devices allow the greatest amounts of gases entering the probe body to enter through the most deeply immersed distal end of the probe , adjacent to the measuring instruments , temperature and oxygen which both , of course , have components that are necessarily not gas permeable . the gases are then able to flow between the probe body and the larger tube 18 as well as between the tubes 18 and 20 into the area of slots 22 . in the embodiment of fig1 , gases can also flow through a ceramic fiber filter 84 and around the plastic electrical connector 89 . connector 89 is loosely secured by small projections , often referred to as “ nubs ” in the interior of tube 32 . in the embodiment of fig1 , gases also exit through metal tube 32 , through filter 84 and around plastic electrical connector 89 into the space between tube 20 and the supporting lance ( not shown ) and into the atmosphere . in the embodiment of fig2 and 3 a similar venting path is also available . in the embodiments , such as fig1 and fig2 and 3 , that have two paperboard tubes 18 and 20 , gases also vent from between the two tubes out through intermittent openings in adhesive of junction 31 . in the case of fig2 and 3 , the outer diameter of mold 30 is less than the inner diameter of tube 18 in order to allow free venting in the space between them as well as through the gas permeable probe bodies 12 and 30 . the probes of this invention 10 , 40 and 70 are formed by assembling all of the illustrated components in a mold together and vibrated with a baking sand - resin mixture used to form each of the gas permeable parts 12 , 30 , 42 & amp ; 72 . each such assembly is then baked at approximately 500 ° f . ( 260 ° c .) in order to form the gas permeable sand - resin body with the other components baked in situ and held together in place by the resultant strong porous body . foundry sand having a particle size of about 50 to 100 mesh , as desired may be used . sand - resin material comprises approximately 5 weight % resin and approximately 5 weight % ferric oxide has been found suitable with especially preferred uniform particle sizes of 70 to 90 mesh , but other sized particles can be substituted so long as the desired gas permeability , strength and sample release is provided . the sand - resin material may include 2 weight % or more of a resin ( approximately 5 weight % resin in a preferred embodiment ) and preferably approximately 5 weight % ferric oxide . the ferric oxide can alleviate any unwanted rf interference during use of the probe . in accordance with preferred embodiments , no coating nor metal plating is used on any metal caps used in the vicinity of or in the immersion end of the probe in order to avoid any unwanted distortion of the data provided by the probe . it is also preferred that there be no holes or openings in any metal caps used . while sand - resin mixtures are greatly preferred formation of the permeable probe bodies of the invention , it will be understood by those skilled in the art that other materials can be substituted , for example , resin blends with sized inorganic gas permeable materials or comminuted particles of inorganic materials other than sand . the sand - resin materials preferably used in forming the probes of this invention are commercially available from various foundry sand suppliers and are variously referred to as “ resin sand ” or “ binder coated sand .” due to sand being the main ingredient of the probe bodies of this invention , however , they are referred to herein as “ sand - resin ” compositions . numerous resin binders are used in the foundries . some of these are low temperature curing systems which could be utilized . however , it is greatly preferred that curing of the probe bodies of the invention be conducted at elevated temperatures of at least 350 ° f . ( 176 . 67 ° c . ), and preferably 500 ° f . ( 260 ° c .) in order that a minimum amount of volatile residues ( i . e . volatile at highly elevated temperatures of molten steel ) remain in the bodies after curing . examples of suitable resin systems are epoxide , epoxide novolac , furane , amine - hardened resins and thermosetting resins such various urea formaldehyde systems . such materials will be selected by those skilled in the art based on characteristics of gas permeable bodies produced by curing of the same . referring to fig4 , there is shown an end view ( not to scale ) of the probe of fig2 and 3 . it has been found necessary , in the case of each of the embodiments of the invention , that no part of the stabilized zirconia oxygen cell 14 be closer to the quartz thermocouple tube loop 16 than 0 . 2375 inch ( 0 . 60 cm ). referring to fig6 - 7 , there is seen another alternative probe 70 of the invention in which the gas permeable probe body 72 does not include an outwardly extending flange such as 11 of fig1 , or of 41 of fig2 and 3 , but instead has a generally smooth profile . the immersion tip profile may be varied as desired , for example , cylindrical square or oval rather than the tapered shape illustrated . gas flow into and out of the probe 70 is symbolized by arrows 80 . unlike previous probes , gases are able to flow into the distal , immersion end surfaces of the probe body as indicated by arrows 80 . thus , gases from the melt flow into , through and throughout the described probe bodies . in this modified embodiment of fig6 and 7 , a shorter and thinner ground wire 96 is provided . a ceramic connector base 78 is provided with a shoulder 79 which serves as a gas impermeable stop against which an end of a supporting paperboard tube of type 18 of appropriate length and diameter can be adhered . these parts may be supported in a plastic outer connector 82 . this connector has a plurality of openings 93 ( see fig7 a ) which allow gas flow out of the probe through the open interior 91 of connector 82 and out of slots 90 . the openings 93 and structure of connector 82 also retain a fibrous filter layer 84 that forms a filter for trapping impurities carried by the gases . as shown in fig7 and 7a , a plastic or elastomeric gasket or o - ring 86 prevents impurities from entering associated electrical components . thus moisture or other contaminants containing gases such as tars , sand particles , etc ., are prevented from moving through the venting system formed by the probe . channels 90 are in the form of two or more intermittent openings around the circumference of the proximal end of connector 82 . the plastic or elastomeric o - ring gasket 86 does not interfere with the air flow channels 90 which allow escape of gases from the probe body , but serves to seal the end of any subsequently attached connector in which electrical components are contained thereby protecting them from poor performance or damage which could be caused by entrance of contaminants . the fibrous filter layer 84 may be formed of refractory fibers , such as tightly packed high alumina fibers , and has been found to protect the connector systems and electrical components from damage caused by gas borne volatiles , contaminants and moisture . as best seen in fig7 , probe 70 incorporates a ground wire 96 . the smaller diameter wire provides added likelihood that a single point ground results upon immersion of the probe . also best seen in fig7 are additional details of probe 70 . see , for example , pins 60 and 62 of cap 17 . also shown is a temporary combustible paper cap 50 . details of thermocouple connectors 92 and 94 are also seen as are plastic clip thermocouple assembly fixture 115 which serves to secure the thermocouple quartz tube and lead wires 24 and 26 during manipulation of the probe assembly . the porous baked probe body 72 enables flow of gases into and through the probe 70 upon immersion into the melt . the proximal ends of connecting wires 24 and 26 are adapted to interconnect with connector leads of known design . internal wires in the probe may be bare if separated or selectively insulated in areas to prevent shorting . additional details of the internal configuration and wiring of the measuring devices can also be best seen in fig7 . wires 26 and 24 are formed with flattened ends 92 and 94 . welds 99 and 100 secure thermocouple lead wires 97 and 98 , respectively , at the cold junctions of thermocouple assembly . the base of quartz u - tube 16 is sealed by heat resistant sealants 101 and 103 in order to protect the interior of the u - tube from the entry of contaminants during baking of the sand - resin body 72 . it will be noted that , in a radical departure from previous devices , that the thermocouple cold junction areas and leads 97 , 98 , leads 92 , 94 and welds 99 and 100 along with the other described internal electrical parts are all not shielded , are unprotected and thus are exposed and open to changes in gas pressure and therefore to the resultant gas flows .	6
referring now to the drawings wherein thicknesses and other dimensions have been exaggerated in the various figures as deemed necessary for explanatory purposes and wherein like reference numbers designate the same or similar elements throughout the several views , an ink jet printhead 10 according to the present invention is shown in fig1 . the ink jet printhead 10 may be used in connection with the devices disclosed and claimed in u . s . pat . nos . 5 , 227 , 813 , 5 , 235 , 352 , 5 , 334 , 415 , 5 , 345 , 256 , 5 , 365 , 645 , 5 , 373 , 314 , 5 , 400 , 064 , 5 , 402 , 162 , 5 , 406 , 319 , 5 , 414 , 916 , 5 , 426 , 455 , 5 , 430 , 470 , 5 , 433 , 809 , 5 , 435 , 060 , 5 , 436 , 648 and 5 , 444 , 467 , the entire disclosures of which are hereby incorporated herein by reference . as shown in fig1 the ink jet printhead 10 includes a body portion 12 having a top side 14 , a bottom side 16 , and a front end 18 . the body portion 12 may be formed from materials well known to those of ordinary skill in the art such as piezoceramic material including an active poled piezoelectric material , such as lead zirconate titanate ( pzt ), polarized in the direction indicated by the arrows 20 in fig2 a , 2 b and 2 c . as shown in fig2 a , thin layers 22 and 24 of a metallic material are disposed on the top side 14 and bottom side 16 , respectively , of the body portion 12 , and relatively thin sheets 26 and 28 of pzt are respectively disposed on the outer side surfaces of front portions of the metallic layers 22 and 24 . the pzt sheets 26 and 28 are poled in the direction indicated by arrows 30 and 32 in fig2 a . also , as shown in fig2 a , top and bottom blocks 34 and 36 of pzt are disposed on the outer sides of the pzt sheets 26 and 28 , respectively . blocks 34 and 36 are laterally aligned with body portion 12 sandwiched therebetween , have front ends 38 and 40 , respectively , which are aligned with the front end of the body portion 12 , are poled in the direction indicated by arrows 39 and 41 in fig2 a , and have rear ends 42 and 44 , respectively , that are aligned with one another and stop short of the rear end of the body portion 12 . accordingly , as best illustrated in fig1 a portion 12 a of the body portion 12 extends rearwardly beyond the top and bottom blocks 34 and 36 . as shown in fig2 b , thin layers 22 and 24 of a metallic material are disposed on the top side 14 and bottom side 16 , respectively , of the body portion 12 . a relatively thin sheet 26 of pzt having thin layers 70 , 72 of a metallic material is mounted on the outer side surface of the metallic layer 22 . a first layer of a conductive adhesive 74 , for example , an epoxy material , is provided to conductively attach the metallic layer 70 attached to the sheet of pzt 26 and the metallic layer 22 attached to the top side 14 of the body portion 12 . a relatively thin sheet 28 of pzt having thin layers 76 , 78 of a metallic material is mounted on the outer side surface of the metallic layer 24 . a second layer of a conductive adhesive 80 , for example , an epoxy material , is provided to conductively attach the metallic layer 76 attached to the sheet of pzt 28 and the metallic layer 24 attached to the bottom side 16 of the body portion 12 . in each of the embodiments shown in fig2 a and 2b the pzt sheets 26 and 28 are poled in the direction indicated by arrows 30 and 32 . also , as shown in fig2 a , top and bottom blocks 34 and 36 of pzt are disposed on the outer sides of the pzt sheets 26 and 28 , respectively . as shown in fig2 b , top block 34 of pzt having a thin layer 82 of a metallic material is mounted on the outer side surface of the metallic layer 72 . a third layer of a conductive adhesive 84 , is provided to conductively attach the metallic layer 82 attached to the top block 34 of pzt and the metallic layer 72 attached to the sheet 26 of pzt . also , as shown in fig2 b , bottom block 36 of pzt having a thin layer 86 of a metallic material is mounted on the outer side surface of the metallic layer 78 . a fourth layer of a conductive adhesive 88 , is provided to conductively attach the metallic layer 86 attached to the bottom block 36 of pzt and the metallic layer 78 attached to the sheet 28 of pzt . as shown in fig2 c , the body portion 12 is formed of a first body section 90 and a second body section 92 . a fifth layer of an adhesive 94 , for example , an epoxy material , is provided on the first body section 90 or the second body section 92 . the fifth layer of an adhesive 94 enables the first body section 90 to be secured to the second body section 92 . in each of the embodiments shown in fig2 a , 2 b and 2 c , blocks 34 and 36 are laterally aligned with body portion 12 sandwiched therebetween , have front ends 38 and 40 , respectively , which are aligned with the front end of the body portion 12 , are poled in the direction indicated by arrows 39 and 41 , and have rear ends 42 and 44 , respectively , that are aligned with one another and stop short of the rear end of the body portion 12 . accordingly , as best illustrated in fig1 a portion 12 a of the body portion 12 extends rearwardly beyond the top and bottom blocks 34 and 36 . prior to the attachment of the top and bottom blocks 34 and 36 to the pzt sheets 26 and 28 or the metallic layers 72 and 78 , spaced series of grooves 50 and 52 are respectively formed in the top and bottom sides of the body portion 12 , through the metallic layers 22 and 24 and the pzt sheets 26 and 28 thereon , or through the metallic layers 22 and 24 , the adhesive layers 74 and 80 , through the metallic layers 70 and 76 and the pzt sheets 26 and 28 thereon , by means well known to those of ordinary skill in the art including precision dicing sawing such as disclosed in u . s . pat . no . 5 , 414 , 916 , the entire disclosure of which is hereby incorporated herein by reference . grooves 50 and 52 are laterally displaced so that the walls of the body portion 12 and the pzt sheet 26 separating the grooves 50 are vertically aligned with the grooves 52 , and the walls of the body portion 12 and the pzt sheet 28 separating the grooves 52 are vertically aligned with the grooves 50 . both sets of grooves 50 and 52 longitudinally extend from the front end of the body portion 12 to its rear end . after the formation of the grooves 50 and 52 , elongated segments 22 a of the top metal layer 22 are interdigitated with the grooves 50 , and elongated segments 24 a of the bottom metal layer 24 are interdigitated with the grooves 52 . the metal layer segments 22 a and 24 a are used as electrical leads through which control signals are transmitted by means of controller 29 in fig1 to cause the operative piezoelectric deflection of internal portions of the printhead body . similar electrical connection is made to metal layer segments 22 a and 24 a . after the top and bottom pzt blocks 34 and 36 are secured to the pzt sheets 26 and 28 they respectively cover the open sides of front portions of the grooves 50 and 52 to thereby form , within the printhead 10 a top series of interior driving channels 50 and a bottom series of interior driving channels 52 . the driving channels 50 and 52 are sealed at the rear portions of the top and bottom pzt blocks 34 and 36 , respectively . along their lengths the driving channels 50 are laterally bounded by opposing pairs of interior side walls 54 ( see fig2 a , 2 b and 2 c ) each having in a vertically intermediate portion thereof a segment of the metallic layer 22 or segments of the metallic layer 22 , the adhesive layer 74 and the metallic layer 70 . in a similar manner , along their lengths the driving channels 52 are laterally bounded by opposing pairs of interior side walls 56 each having in a vertically intermediate portion thereof a segment of the metallic layer 24 or segments of the metallic layer 24 , the adhesive layer 80 and the metallic layer 76 . a horizontally elongated orifice plate member 58 ( see fig1 ) is secured to the front ends 18 , 38 and 40 of the body portion 12 and the top and bottom blocks 34 and 36 , and has a single horizontally extending array a 1 of small diameter orifices 60 formed therethrough . each of the orifices is in fluid communication with a different one of the driving channels 50 and 52 . ink manifolds ( not shown ) are interiorly formed within rear end portions of the top and bottom pzt blocks 34 and 36 and are supplied with ink from a suitable source thereof ( not shown ) via exterior ink supply conduits 62 and 64 . the orifices 60 , preferably , are tapered and may be formed according to methods well known to those of ordinary skill in the art , such as those disclosed in u . s . pat . no . 5 , 208 , 980 , the entire disclosure of which is hereby incorporated herein by reference . as shown in fig3 the orifices 60 disposed in the horizontally elongated orifice plate member 58 ( see fig1 ) are generally cylindrical . also , each orifice 60 is in fluid communication with a fluid channel 66 ( shown in dotted lines ) disposed on the obverse of the plate member 58 . each fluid channel 66 in turn is in fluid communication with one of the driving channels 50 and 52 , thereby providing fluid ejection nozzles for the ink jet printhead 10 . the plate member 58 may be formed of any suitable material and may include one or more of the following commercially available materials : a polyimide material , polyethylene terephthalate , polybutylene terephthalate , polyesters , polyamides , cellulosic polymers , vinyl polymers , acrylic polymers , fluorinated polyethylenes , polyolefins , polyether ketones , polyoxazoles , polythiazoles , metallic films , metallized films , plates and glasses as are well known to those of ordinary skill in the art . as shown in fig4 a and 4b , the plate member 58 may be formed by applying a layer of adhesive 68 , for example , an epoxy material , to a block of material suitable for forming the plate member 58 . a layer of backing material ( not shown ) is superposed on the adhesive layer 68 to protect the adhesive layer 68 during formation of the orifices 60 and fluid channels 66 . the orifices 60 and fluid reservoirs 66 may be formed in the plate member 58 , adhesive 68 and backing material composite structure by removing portions of each of the backing material , adhesive 68 and plate member 58 according to any suitable technique well known to those of ordinary skill in the art such as by excimer laser ablation as disclosed in u . s . pat . no . 5 , 208 , 980 , the entire disclosure of which is incorporated herein by reference . according to the excimer laser ablation process , the laser energy is focused on the composite structure through a sequence of masks . fig4 a shows the plate member 58 and adhesive 68 structure after formation of the fluid channels 66 and orifices 60 . fig4 b shows a cross - section of the fluid channels 66 and orifices 60 extending within the plate member 58 . fig5 shows the ablation sequence for forming the orifices 60 and fluid reservoirs 66 in the plate member 58 , adhesive 68 and backing material 98 composite structure 100 shown in fig5 a . first , a mask 102 having openings 104 as shown in fig5 b , is superposed on the backing material 98 of the composite structure 100 . excimer laser energy is focused on the composite structure 100 through the openings 104 in the mask 102 to remove portions of the backing layer 98 , adhesive 68 and plate member 58 to result in the structure shown in fig5 c . next , a mask 106 having orifices 108 as shown in fig5 d , is superposed on the backing material 98 of the composite structure 100 . excimer laser energy is focused on the composite structure 100 through the orifices 108 to remove portions of the plate member 58 to form the orifices 60 in the plate member 58 and result in the structure shown in fig5 e . to mount the plate member 58 to the respective leading edges of the body portion 12 , the thin metallic layers 22 and 24 , the pzt sheets 26 and 28 and the top and bottom blocks 34 and 36 , as well as the metallic layers 70 , 72 , 76 , 78 , 82 and 86 and the adhesive layers 74 , 80 , 84 and 88 ( as appropriate ) the remaining portions of the backing material layer 98 may be removed to expose the layer of adhesive 68 as shown in fig5 f . the exposed portions of the layer of adhesive 68 are then aligned with and superposed on the front end 18 of the body portion 12 , the front ends of the thin metallic layers 22 and 24 , the front end of the pzt sheets 26 and 28 and the front ends 38 and 40 of the top and bottom blocks 34 and 36 , as well as the metallic layers 70 , 72 , 76 , 78 , 82 and 86 and the adhesive layers 74 , 80 , 84 and 88 ( as appropriate ). fig4 c shows an alternate embodiment of the plate member 58 which also includes a nonwetting coating 59 on the surface of the plate member 58 opposite the front ends 18 , 38 and 40 of the body portion 12 and the top and bottom blocks 34 and 36 . the nonwetting coating 59 may be formed of any suitable material and preferably may include commercially available modified polytetrafluoroethylene ( teflon ®). those of ordinary skill in the art will recognize that the nonwetting coating 59 may be selected from many other suitable nonwetting coating materials that are well known to those of ordinary skill in the art . the ablation sequence discussed above with respect to fig5 may also be used to form the cover plate 58 including the nonwetting coating 59 except that the composite structure 100 also includes the nonwetting coating 59 and the ablation step shown in fig5 d involves focusing excimer laser energy on the composite structure 100 through the orifices 108 in the mask 106 to remove portions of the plate member 58 and the nonwetting coating 59 to form the orifices 60 in the plate member 58 . during operation of the printhead 10 ink disposed within the driving channels 50 and 52 may be discharged through selected ones of the associated orifices 60 by transmitting electrical driving signals through the segments of the metallic layers 22 and 24 , as well as the segments of the metallic layers 22 and 24 , the adhesive layers 74 and 80 and the metallic layers 70 and 76 ( as appropriate ) to piezoelectrically deflect the interior side walls of the channels communicating with the selected orifices to cause the forward discharge of ink outwardly through the selected orifices . for example , if it is desired to discharge ink in droplet form from an orifice 60 associated with the top channel 50 a shown in fig2 a , appropriate electrical driving signals are transmitted through the pair of metallic lead segments 22 a within the opposing interior side walls 54 that laterally bound the channel 50 a . these driving signals are first used to piezoelectrically deflect the bounding pair of side walls 54 outwardly away from the selected channel 50 a , and then reversed to piezoelectrically deflect the bounding pair of side walls 54 into the selected channel 50 a to increase the ink pressure therein and responsively force a droplet of ink outwardly through the associated orifice 60 . in a similar manner , electrical driving signals may be transmitted through associated pairs of the bottom metallic lead segments 24 a to force ink , in droplet form , outwardly from a selected bottom channel 52 through its associated orifice 60 . those of ordinary skill in the art will recognize that while the body portion 12 is shown in fig1 a and 2 b as being formed from a unitary block of pzt material with grooves cut in the top and bottom of the block , the body portion 12 can also be formed by bonding together two blocks of pzt material each having grooves cut in one side thereof in which the grooves are misaligned such as is shown in fig2 c . those of ordinary skill in the art will recognize that compared to a conventionally configured ink jet printhead assembly having only a single driving channel array in its main piezoelectric block portion , the ink jet printhead 10 of the present invention advantageously provides a substantially higher discharge orifice density due to the fact that two laterally misaligned channel arrays are formed on opposite sides of the main printhead body portion defined by the main piezoelectric block 13 , the metallic layers 22 and 24 , and the opposite side sheets of piezoelectric material 26 and 28 . the provision of these dual channel series in this manner substantially reduces the overall size of the printhead to create this substantially increased orifice density . the lateral displacement of the driving channels makes the printhead easier to make and use since alignment tolerances between the first and second series of driving channels 50 and 52 are reduced which consequently reduces print errors . while the present invention has been described with reference to a presently preferred embodiment , it will be appreciated by those of ordinary skill in the art that various modifications , changes , alternatives and variations may be made therein without departing from the spirit and scope thereof as defined in the appended claims .	1
the copying machine of fig1 comprises a drum 10 rotatable mounted on a shaft 11 and carrying wound on its cylindrical periphery a photoconductive web 12 fed from a feed reel 8 mounted inside the drum 10 , through the slit 9 ad rewound through the slit 9 to a take up reel also mounted inside the drum 10 . positioned adjacent and distributed around the periphery of the drum 10 are the following devices : a corona charging device 15 for uniformly charging the photoconductive web 12 , an exposure window 16 receiving through an optical system 20 the image of the original to be reproduced positioned on the carriage 17 , a corona charging device 32 for the transfer of the powder image onto the copysheet fed to the transfer station from a cassette 30 by a feeding device 29 and feeding rollers 28 known per se , a sheet detaching unit 33 including an a . c . corona charging device 39 and , according to the invention , a fixed mechanical device 40 which will be better described below , the carriage 17 carrying the original to be reproduced effects a first stroke from right to left ( with reference to fig1 ) in synchronism with the drum rotation during which the original is illuminated by the lamps 19 and the light image of the original is focused onto the charged photoconductive web 12 by the optical system 20 and through the exposure window 16 , and a second return stroke from left to right during which the portion of the drum comprising the slit 9 passes in correspondance of the exposure window 16 . the copying machine 1 further comprises a fixing unit 35 having a fusing device 36 and a conveyor 37 suitable to receive the copy - sheet from the detaching unit 33 and to deliver it to the exit slit 38 of the machine after the fixing operation . the detaching device according to the invention will be now described in detail with reference to fig1 and 2 . a pair of plaques 42 is mounted on the periphery of the drum parallel along a generatrix . the plaques 42 are symmetrically positioned with respect to the center line of the drum and have a thickness of about 2 mm . the photoconductive web is wound on the periphery of the drum passing over the plaques 42 , therefore , at least in the zone comprised between the two plaques 42 and parallel to the drum axis , the photoconductive web is raised about 2 mm with respect to the cylindrical surface of the drum . substantially the raising of the web 12 forms a protuberance 44 in the surface of the drum which has a thickness of about 2 mm . the drum 10 is mounted on the shaft 11 in such a manner that , during the execution of a copying cycle , the leading edge of the copying sheet is fed into contact with the drum 10 in the transfer station 32 at the time in which the protuberance 44 passes in correspondence with the transfer station 32 , whereby the leading edge of the copy sheet contacts substantially the base of the protubernce 44 , as is clearly visible in fig1 and 2 . as already said , the detaching mechanical element 40 is fixedly mounted with respect to the machine frame and adjacent the drum 10 in a position immediately successive to the a . c . corona 39 in the direction of rotation of the drum 10 . the detaching element 40 comprises a curved metallic lamina 41 extending parallel to the drum axis for all the drum length and having in correspondence with its center line a stylus 43 which constitutes the detaching finger . the minimum distance between the lamina 41 and the periphery of the drum 10 in a portion outside of the protuberance 44 is of about 0 . 6 - 1 mm , less than the thickness of the plaques 42 . when the protuberance 44 passes in correspondence with the stylus 43 , it contacts the web 12 in the zone comprised between the two plaques 42 , while when the protuberance 44 is not in such a correspondence , the finger 43 does not interfere with the drum periphery . the curved form of the lamina 41 is determined by the two functions which it performs : the first is that of causing with the finger 43 the separation of the leading edge of the copy sheet 12 from the photoconductive web 12 , the second is that of deflecting and guiding the leading edge towards the conveyor 37 of the fixing unit 35 . the operation of the pick off device is shown by the succession of the fig3 a , 3b , 3c , 3d . fig3 a shows the relative position of the drum 10 and of the detaching device at the instant in which , during the copying cycle , the leading edge of the copying sheet already in contact with the photoconductive web 12 has passed the transfer corona device 32 and is under the effect of the a . c . corona 39 . at the instant of fig3 a the leading edge of the protuberance 44 is entering into contact with the finger 43 . fig3 b shows the relative position of the drum 10 and the pick off device at a instant immediately successive to that of fig3 a . in this figure the rotation of the drum 10 has carried the protuberance 44 in interference with the finger 43 . as a consequence the detaching finger 43 pushes against the web 12 in the zone comprised between the two plaques and reduces substantially the height of the protuberance 44 in this zone . the curved form of the lamina 41 allows the finger 43 to slide on the photoconductive web 12 without scraping the web 12 . the pressure exerted by the detaching device 40 in the zone between the two plaques 42 causes therefore a depression in the corresponding portion of the web 12 which will aid the detaching of the leading edge of the copy sheet from the drum 10 . in fact as it is clearly shown in fig3 b the copy sheet follows only partially the deformation of the web 12 under the pressure exerted by the detaching device 40 , while , owing to its own weight , begins to separate from the web 12 . fig3 c represents the relative position of the drum and of the copy sheet at instant successive to that of fig3 b , when , continuing the drum rotation , the finger 43 , pushing a sliding on the trailing edge of the protuberance 44 , causes the definitive detaching of the leading edge of the copy sheet from the web 12 . contemporaneously the leading edge of the protuberance 44 is resuming its initial form . fig3 d represents the relative positioning of the drum and of the copy sheet after a further rotation of the drum 10 with respect to fig3 c . in this situation the rotation of the drum 10 has carried the protuberance 44 out of the engagement with the detaching device 40 , while the leading edge of the copysheet lies on the conveyor 37 of the fixing unit 35 . in such a situation the lamina 41 acts as a guide for the portion of the copy sheet still in contact with the drum 10 . it is clear that the device till now described can be used also a in copying machine in which the photoconductive element is not a web 12 wound on the drum 10 , but is a photoconductive layer coated on the cylindrical surface of the drum 10 . in such a case the protuberance 44 could not be obtained by the use of the two plaques 42 but it would be necessary to form it during the construction of the drum 10 or during the coating of the photoconductive layer . moreover in such a case the timing relation between the drum rotation and the feeding of the copy sheet should be such that the leading edge of the copy sheet arrives in contact with the top of the protuberance 44 . finally , the minimum distance between the finger 43 and the photoconductive element 12 coated on the drum , outside of the protuberance 44 , should not be less than the height of the protuberance 44 , since in this last case the photoconductive element is not deformable under the pressure of the lamina 41 as in the case previously described ; on the contrary , it is only possible for the finger to slide on the top of the protuberance 44 until the leading edge of the copysheet is detached and deflected . it is preferred that the finger 43 and all the detaching device 40 have a certain elastic flexibility , which can be obtained by properly choosing the thickness of the lamina 41 , in order to avoid scraping of the photoconductive element 12 . while the present invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly it is intended to embrace all such alternatives , modifications and variations that fall within the spirit and broad scope of the appended claims .	8
referring to the drawings , an illustrative card deck which is suitable for use in implementation of the battle play card game according to the present invention is generally indicated by reference numeral 1 in fig1 . briefly , the card deck 1 includes multiple playing cards 2 , some of which represent a warrior or beast having a specified number of “ offense ” points and “ protect ” points . these playing cards 2 are sequentially played either offensively or defensively by two or more players in an effort to increase the total number of points of each player and deduct points from the total number of points of the opposing player , as well as cause the opposing player to lose the played card , according to the typical rules of play which will be hereinafter further described . others of the playing cards 2 represent a “ snare ” or a “ curse ” which may , for example , cause the opposing player to lose points and / or a card , for example , during card play , as will be hereinafter further described . each of the playing cards 2 has a front side 3 and a rear side 6 . as shown in fig2 , the front side 3 of each playing card 2 typically has a solid - colored background 4 and a splat - like insignia 5 typically in the center of the background 4 . the splat - like insignia 5 has a color which differs from that of the background 4 and may be printed with the insignia , “ battle monsters ” or the like . as shown in fig3 , the playing cards 2 typically include multiple warrior / beast cards 2 a . the rear side 6 of each warrior / beast card 2 a typically includes a power level section 7 , on which is indicated the power level of a warrior or beast presented on the playing card 2 , typically by multiple stars ( not shown ) presented on the power level section 7 . for example , the power level of the warrior / beast card 2 a may range from one star ( low power ) to four or more stars ( high power ). a name section 8 , on which is provided the name of the warrior or beast , is provided beneath the power level section 7 . an image section 9 , on which is displayed an image ( not shown ) of the warrior or beast , is provided beneath the name section 8 . an information section 10 , on which is provided information about the warrior or beast , may be provided beneath the image section 9 . an offense points section 11 and an adjacent protect points section 12 are provided beneath the information section 10 . the number of offense points of the warrior / beast card 2 a appears in the offense points section 11 , whereas the number of protect points of the warrior / beast card 2 a appears in the protect points section 12 . the various warrior / beast cards 2 a in the card deck 1 vary in the number of offense points and the number of protect points . the number of offense points and the number of protect points of the warrior / beast card 2 a are typically proportional to the power level of the warrior / beast card 2 a as presented in the power level section 7 , and may be the same number of points . as shown in fig4 , the playing cards 2 typically further include multiple special ability warrior / beast cards 2 b . the rear side 6 of each special ability warrior / beast card 2 b typically includes a power level section 7 , a name section 8 , an image section 9 , an offense points section 11 and a protect points section 12 , in addition to an information on warrior / beast and information on special ability section 10 a . the section 10 a may present a special ability , such as the ability to deduct additional points from the opposing player &# 39 ; s score total or the ability to remove one or more of the opposing player &# 39 ; s playing cards 2 , for example , when the special ability warrior / beast card 2 b is played . as shown in fig5 , the playing cards 2 may further include multiple snare cards 2 c . the rear side 6 of each snare card 2 c includes a snare card section 15 , on which is printed the insignia , “ snare card ”. a name of snare card section 16 is provided beneath the snare card section 15 . the name of the snare which is represented by the snare card 2 c is presented in the name of snare card section 16 . an image section 17 , on which is displayed a selected image which may relate to the snare , is provided beneath the name of snare card section 16 . an information section 18 is provided beneath the image section 17 . the information section 18 presents information about the snare represented by the snare card 2 c when the snare card 2 c is played by one player against another . the snare may include such playing tactics as the deduction of points from the opposing player &# 39 ; s score total or loss of a card or cards from the opposing player . the snare may additionally or alternatively include such playing tactics as the addition of points to the point total of the player who plays the snare card 2 c or the addition of a card or cards to his or her hand of playing cards 2 , for example . as shown in fig6 , the playing cards 2 further include multiple curse cards 2 d . the rear side 6 of each curse card 2 d includes a curse card section 22 , on which is printed the insignia , “ curse card ”. a name of curse card section 23 is provided beneath the curse card section 22 . the name of the curse which is represented by the curse card 2 d is presented in the name of curse card section 23 . an image section 24 , on which is displayed a selected image which may relate to the curse , is provided beneath the name of curse card section 23 . an information section 25 is provided beneath the image section 24 . the information section 25 presents information about the curse represented by the curse card 2 d when the curse card 2 d is played by one player against another . the curse may include such playing tactics as the deduction of points from the opposing player &# 39 ; s score total or loss of a card or cards from the opposing player , for example . the curse may additionally or alternatively include such playing tactics as the addition of points to the point total of the player who plays the curse card 2 d or the addition of a card or cards to his or her hand of playing cards 2 , for example . the playing tactics displayed on the curse cards 2 d may be the same as or different from those displayed on the snare cards 2 c . as shown in fig7 , the playing cards 2 may further include multiple merged warrior / beast cards 2 e . the rear side 6 of each merged warrior / beast card 2 e typically includes a power level section 28 , a name section 29 , an image section 30 , an offense points section 32 and a protect points section 33 , in addition to an information on merged warrior / beast section 31 . the power level displayed in the power level section 28 , as well as the number of offense points displayed on the offense points section 32 and the number of protect points displayed on the protect points section 33 , is typically higher than those respective values displayed on the warrior / beast card 2 a of fig3 and the special ability warrior / beast card 2 b of fig4 . as shown in fig8 , the playing cards 2 may further include multiple offense / protect splitter cards 2 f . the rear side 6 of each offense / protect splitter card 2 f includes an upper image section 36 , on which is displayed the image of a warrior / beast , and a lower image section 38 , on which is also displayed the image of the same or a different warrior / beast . an offense points section 37 may be provided as an inset on the upper image section 36 , and a protect points section 39 may be provided as an inset on the lower image section 38 . a selected number of offense points , which corresponds to the strength of the offensive power of the warrior or beast displayed on the upper image section 36 , is displayed on the offense points section 37 . in similar fashion , a selected number of protect points , which corresponds to the strength of the protection power of the warrior or beast displayed on the lower image section 38 , is displayed on the protect points section 39 . in typical play , the offense / protect splitter cards 2 f can be used either offensively or defensively by a player . as shown in fig9 , the playing cards 2 may further include multiple protect / offense splitter cards 2 g . the rear side 6 of each protect / offense splitter card 2 g includes a layout which is similar that shown with respect to the offense / protect splitter card 2 f of fig8 , except the positions of the image sections 36 , 38 and the offense points section 37 and the protect points section 39 are reversed . as shown in fig1 , the playing cards 2 may further include multiple merged splitter cards 2 h . the rear side 6 of each merged splitter card 2 h includes a merged splitter section 48 , on which is printed the insignia , “ merged splitter ”. an image section 49 is provided beneath the merged splitter section 48 . an offense point section 50 and an adjacent protect point section 51 are provided beneath the merged splitter section 48 . the number of offense points displayed in the offense point section 50 and the number of protect points displayed in the protect point section 51 of the merged splitter cards 2 h are typically greater than the number of offense points and the number of protect points displayed on the offense / protect splitter card 2 f and the protect / offense splitter card 2 g which were described hereinabove . according to typical rules of play , the battle play card game is played as follows . after shuffling of the card deck 1 , each of two players is initially dealt five cards . on each turn , each player may choose to attack the other player or defend himself from the previous play of the other player using from one up to all five of his or her cards . depending on the number of offense points and the number of protect points on each playing card 2 played in a given turn , as well as the privileges afforded to each player by the snare card 2 c and the curse card 2 d played in the turn , each player , as either the attacker or defender , may gain or lose points , gain or lose a card , or cause his or her opponent to gain or lose points and / or a card . for example , in the event that the attacker &# 39 ; s played cards in a given turn display a total number of offense points which is higher than the total number of offense points that are presented by the defender &# 39 ; s cards on his or her subsequent turn , then the defender loses the number of points and the attacker gains the number of points which corresponds to the point difference and also loses a card from among his or her dealt cards . in the event that the number of offense points on the attacker &# 39 ; s played cards and the defender &# 39 ; s played cards are the same , then neither the attacker nor the defender loses points and both the attacker and the defender loses a card . in the event that the number of offense points on the attacker &# 39 ; s played cards is less than the number of offense points on the defender &# 39 ; s cards , the attacker loses the number of points which corresponds to the point difference and also loses a card , whereas the defender gains the number of points which corresponds to the point difference . in the event that the attacker &# 39 ; s played cards in a given turn display a total number of offense points which is higher than the total number of protect points that are presented by the defender &# 39 ; s cards on his or her subsequent turn , then neither the attacker nor the defender loses any points ; however , the defender loses a card from among his or her dealt cards . in the event that the number of offense points on the attacker &# 39 ; s played cards equals the number of protect points on the defender &# 39 ; s played cards , neither the attacker nor the defender loses points and both the attacker and the defender loses a card . in the event that the number of offense points on the attacker &# 39 ; s played cards is less than the number of protect points on the defender &# 39 ; s cards , the attacker loses the number of points and the defender gains the number of points which corresponds to the point difference and also loses a card . an illustration of the scoring system which was outlined above is presented in tabular form below in table ( i ). it will be appreciated by those skilled in the art that numerous variations of the battle play card game outlined above are possible using the various playing cards 2 from the card deck 1 . for example , a “ mega battle ” can be played in which the first player to reach a predetermined number of points , such as 4 , 000 points , for example , wins the game . accordingly , each player has his or her own stack of cards and his or her own “ defeated ” pile , which consists of the cards lost during play . when a player subsequently draws a card , he or she can choose from the “ defeated ” pile or the community cards , which consists of the cards in the card deck 1 remaining after dealing . all of the remaining rules of play apply . in another variation , a “ tag team battle ” can be played according to the normal rules of play , except with two players per team . in still another variation , a “ mega tag team battle ” can be played according to the “ mega battle ”, described above , except two people are on each team . while the preferred embodiments of the invention have been described above , it will be recognized and understood that various modifications can be made in the invention and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention .	0
the subject matter disclosed herein is related to application ser . no . 876 , 970 , entitled &# 34 ; printed circuit board receptacle for sealed connector &# 34 ;; application ser . no . 876 , 525 , entitled &# 34 ; sealed plug for interconnection to a printed circuit board receptacle &# 34 ;; and application ser . no . 876 , 159 , entitled &# 34 ; sealing member for bulkhead connector &# 34 ;, all filed concurrently herewith . the above - mentioned applications are incorporated herein by reference . referring to fig1 the subject connector 2 is shown mounted to a bulkhead 300 , such as a sealed &# 34 ; black box &# 34 ; for use in automotive controls . the connector 2 can be totally enclosed within the black box except for the plug receiving cavity 18 , which is left exposed for receiving the plug 400 . the connector 2 is also shown in fig1 as having a printed circuit board 110 attached to the connector , the connector 2 for interconnecting the circuitry on the printed circuit board 110 with the plug 400 . referring more specifically to fig2 connector 2 is shown in greater detail . the connector 2 has a front mating face 4 having a plug receiving cavity 18 therein . the cavity 18 is defined by a frustoconical surface 22 , an oblong surface 20 and back surface 30 . at the intersection of the cavity 18 and the front mating surface 4 is a gasket seat , shown generally as 24 , which includes cylindrical surface 28 and back surface 26 . the front mating surface 4 further includes alignment bosses 10 and threaded inserts 8 . extending from the back wall 30 forward along the oblong surface 20 is a polarizing lug 21 . still referring to fig2 there is shown generally as 98 three rows of pin terminals . referring more specifically to fig4 the contacts 90a , 90b and 90c are shown in greater detail . it is apparent from fig4 that each terminal differs somewhat from each other , although each contact has common constituent components . when referring to the contact or contact constituent components , reference will be made to numerals 90 - 100 generally , omitting the postscripts . when referring to a specific contact , reference will be made to numerals 90 - 100 adding the postscripts . contact 90a includes a long shank portion 92a having side edges 91a . on the forward end of contact 90a is contact end 100a formed by two bent upstanding arms 99a . at the pin end , contact 90a includes an upstanding portion 94a having a front edge 96a . the pin portion 98a is formed from the flat blank , the two flat edges rolled completely around into cylindrical configuration . referring now to contact 90b , it can be seen that contact end 100b is formed like that of contact end 100a , yet contact end 100b is greater in length than that of contact end 100a . however , the shank portion 92b of contact 90b is shorter than that of contact 90a resulting in a decreased overall length with respect to contact 90a . referring now to contact 90c , contact end 100c is substantially the same length as that of the contact end 100b , although the shank portion 92c is much shorter than 92b , resulting in contact 90c having a shorter overall length than that of contact 90b . still referring to fig4 the internal structure of connector 2 is shown in greater detail . as shown in the cutaway , connector 2 has a central body portion 19 , with a plurality of t - slots therein . there are three rows of t - slots , 40a , 40b and 40c , and postscripts a , b and c corresponding to the postscripts a , b and c of the contact 90 , referring to the upper , center and lower positions of slots and contacts , respectively . when referring to the t - slots generally , the slots and constituent surfaces 40 - 48 will be referred to without using the postscripts a , b , and c . when referring to specific slots and constituent surfaces , reference will be made to numerals 40 - 48 adding the postscripts . each t - slot 40 begins at cavity back wall 30 and extends further rearwardly towards the outer surface 54 . as shown in fig4 a , each t - slot has corresponding sidewalls 44 , floor 42 and ceiling 43 . as the t - slot 40 extends rearwardly , the t - portion of the slot ends at surface 46 ; the slot thereafter having a longitudinal cross section defined by a ceiling 48 . adjacent the upper row of t - slots 40a , an upper ledge 50 extends from the back wall 54 , the floor 42a of t - slot 40a contiguous and in alignment with terminal channel 52 , and t - slot sidewalls 44b contiguous and in alignment with channel sidewalls 53 , as shown in fig4 . adjacent the middle row of t - slots 40b , an intermediate ledge 56 extends from the back wall 54 , each floor 42b of t - slot 40b contiguous and in alignment with a terminal channel 58 , and t - slot sidewalls 44b contiguous and in alignment with channel sidewalls 59 , t - slot 40c has no ledge extending from the back wall 54 , but rather terminates at the back wall 54 . as best shown in fig4 each t - slot 40a is in substantial vertical alignment with a respective lower t - slot 40c , while for every aligned pair of t - slots 40a and 40c , there is a center t - slot 40b laterally staggered from 40a and 40c . below the lower row of t - slots 40c and extending from the back wall 54 is a termination wall , shown generally as 60 . terminal wall 60 carries a plurality of laterally alternating termination slots 62 and 74 . as best shown in fig4 and 8 , each pair of aligned t - slots 40a and 40c is laterally aligned with termination slots 62 , 68 while each center t - slot 40b is laterally aligned with termination slot 74 . as best shown in fig8 each termination slot 62 is flanked by a pair of parallel opposed sidewalls 64 and extending downwardly , along each sidewall 64 , is a rib 66 . termination slot 62 is laterally aligned with and in transition with a lower termination slot 68 . the termination slot 68 , is narrower in width than the termination slot 62 , slot 68 being flanked by a pair of parallel opposed sidewalls 70 and extending downwardly along the sidewalls 70 are ribs 72 . referring now to fig7 the connector is shown having the mating face 4 on its side , with the mounting face 6 facing forward . extending from the mounting face 6 are two alignment tabs 12 . also contiguous with mounting face 6 and planar thereto are mounting feet 14 , having mounting holes 16 therein . although not part of the instant invention , fig2 shows a printed circuit board 110 having two mounting holes 116 and two alignment holes 112 extending into and through the board 110 . the printed circuit board 110 further includes three rows of circuit holes 120a , 120b and 120c , respectively . also shown in fig2 but not part of the instant invention , are a gasket 200 and a bulkhead 300 . the gasket 200 comprises a flat facial portion 204 and an o - ring portion 224 extending from the flat portion 204 . on each end of the gasket 200 is located an insert receiving hole 208 and a boss receiving hole 210 . the bulkhead 300 includes a mating face 304 , two holes 308 for receiving machine screws 560 ( fig1 ) and two holes 310 for receiving self - tapping screws 314 . the bulkhead 300 further includes a cylindrical portion 302 extending outwardly and away from face 304 , as shown in fig2 . with reference now to fig4 the three contact elements 90a , 90b and 90c are each shown poised for receipt in the respective t - slots 40a , 40b and 40c . the row of lower contact elements 90c are first installed in the t - slots 40c , the contact ends 100c fitting underneath the ceiling 48c , and the shank portion 92c lying on the floor portion 42c . the contact elements are inserted until the forward surface 96c of the upstanding portion 94c abuts the back edge 46c of slot 40c . the contact 90c is then bent downwardly , as shown in fig5 until the upstanding arms 99c of terminal end 100c are forced between the ribs 72 in the lower terminal slot 68 . when the terminal end is forced into the slot 68 , the upstanding walls 99c are deformed inwardly slightly , crimping them at 101c , as shown in fig9 assuring an adequate interference fit . as the upstanding walls 99c are normally biased against ribs 72 , and as theribs 72 are very narrow , the normal force of the upstanding walls 99c against ribs 72 causes the plastic in the ribs to flow over the top edges of the upstanding walls 99c to form portions 73 , as shown in fig8 . the contact ends 99c are thereby positively seated within the slots 68 and against the ribs 72 . the second row of contacts 90b are then installed , each contact 90b in a respective t - slot 40b until the forward surface 96b abuts the back edge 46b . the contact 90b is then bent downwardly until the terminal end 100b is forced between the ribs 78 in termination slot 76 . to assure an adequate interference fit , the upstanding arms 99b are deformed at 101b , as best shown in fig1 . the interaction of the upstanding walls 99b with the ribs 78 also forms a flowing portion of plastic 79 over the top edges of the upstanding walls 99b , as shown in fig8 . the top row of terminals 90a is next inserted , each contact 90a laterally aligned with a respective lower contact 90c , as shown in fig6 . when the contact 90a is bent downwardly , and forced into the upper terminal slot 62 , the edges 91a of the shank portion 92a shears a portion of the ribs 66 away from the sidewalls 64 , leaving a curled end 66a . as the side edges 91a only shear off a portion of the ribs 66 , a thin section of the rib 66 is first sheared on both sides , with an increasingly thicker section of sheared rib as the shank portions 92a continue downward into the slot 66 , wedging the shank portion into the ribs 66 of slot 62 . furthermore , the side edges 91a of the shank portion 92a are slightly crimped inwardly at 102 ( fig1 ) assuring an adequate interference fit between the shank portion 92a and the ribs 66 . once the contact portions 90 are fit in their respective slots , the connector 2 may be mounted to a printed circuit board . as stamped and formed , the distances between surfaces 96a , 96b and 96c , and the ends of pin portions 98a , 98b and 98c , respectively are all equal . also , in each of the t - slots 40a , 40b and 40c , the distances from the back surfaces 46a , 46b and 46c to the cavity back wall 30 , are also equal . therefore when the contacts 90a , 90b and 90c are placed in their respective slots , the lengths of the pin portions 98a , 98b and 98c which protrude through the t - slots from the cavity back wall 30 are all equal . furthermore , when shank portion 92a is bent downwardly around the mandrel 50 , the contact 90a is fixed in an axial direction , that is , the contact cannot be further pushed axially into the t - slot 40a , nor can it back out of the t - slot 40a . as the contacts 90b are staggered laterally of contacts 90a and 90c , and as the upper and lower contacts 90a and 90c are laterally aligned , the connector 2 provides for a high density connector for interconnection to a printed circuit board . as best shown in fig2 the printed circut board 110 comprises three rows of circuit holes 120a , 120b and 120c , respectively . in order to properly align the terminal ends 100 with the respective circuit holes 120 , the connector 2 includes two alignment bosses 12 extending downwardly from the mounting face 6 , the bosses extending downwardly further than the terminal ends . thus , when the connector is lowered towards the printed circuit board 110 , the alignment bosses 12 are aligned with and begin their entry into alignment holes 112 , before the terminal ends 100 reach the printed circuit board 110 . further lowering of the connector 2 onto the printed circuit board extends the terminal 100 ends into their respective circuit holes 120 , the mounting face 6 of the connector 2 lowered onto the printed circuit board 110 . as best shown in fig1 , the terminal ends 100 may then be soldered to the circuit 122 around the circuit hole 120 , interconnecting the circuit traces 124 with the contacts 90 . referring more specifically to fig1 , the subject plug includes an insert 410 , a plug housing 460 and a cover portion 540 and a plurality of socket contacts 510 . extending from the back surface 446 are a plurality of semicircular standoff feet 444 . located around the periphery of the insert 410 are two alignment channels 448 , which extend from the back surface 446 and extend towards the front wall 430 . also extending around the periphery of the insert 410 are polarizing channels 450 extending from the front surface 430 extending rearwardly towards the back wall 446 . located on the top and bottom of surface 420 are two locking lugs 452 , each lug having a ramp surface 454 and a locking surface 456 . referring more specifically to fig1 , the insert 410 is shown in greater detail . the insert 410 is oval - shaped in nature having surface 420 peripherally surrounding the insert 410 . insert 410 further comprises a front wall 430 and a back wall 446 . a contact receiving cavity 434 extends from the back face 446 through to the front face 430 . the cavity 434 is defined by a contact lead - in portion 436 , a straight portion 438 , a pin - receiving diameter 442 and a pin - receiving chamfered surface 432 . shoulder 440 is defined by the decrease in diameter between straight section 438 and the pin - receiving diameter 442 . referring now to fig1 and 14a , the plug housing 460 is shown in greater detail . the housing 460 first comprises an insert receiving cavity 470 which is defined by oval - shaped interior surface 472 and a surface 478 . two alignment lugs 498 are located on either side of the cavity 470 . the housing 460 further comprises a gasket - receiving cavity 468 defined by an oval - shaped peripheral surface 469 and a flat surface 488 . a contact receiving aperture 480 extends from the flat surface 488 through to the surface 478 , the aperture defined by contact lead - in section 481 , a straight section 482 , a lance lead - in section 484 and a bore 486 . a locking lug channel 474 extends from the flat surface 488 to the forward portion of the housing 460 , the termination of the channel being defined by a back surface 476 . the exterior of the plug housing 460 includes a peripheral surface 490 and a plug lead - in surface 496 . also located on the exterior of the housing 460 is an o - ring receiving groove 492 which extends peripherally around the housing . as shown in fig1 the preferred embodiment includes a planar mounting surface 502 . alternatively , the mounting surface of another embodiment includes mounting bosses 504a , as shown in fig1 a . extending from the lower portion of the housing 460 is a wire - receiving surface 466 having a mounting lug 464 located on either side edge . referring now to fig1 , the socket contact 510 is shown in greater detail . the socket contact 510 includes a socket end 518 having a pin - receiving opening 512 and a constricted portion 514 . the constricted portion 514 comprises individual resilient beams 515 , which are fixed at each end , by the socket end 518 at the forward end and by the contact barrel portion 532 at its rearward end . the contact 510 further includes a locking lance 516 struck from and extending upwardly from the lower portion of the contact 510 and has a lance end 520 bent upwardly which extends through an envelope defined by the barrel portion 532 of the contact 510 at lance opening 522 . the lance end 520 extends outwardly through the lance opening 522 and is adjacent to a surface 524 of the contact 510 . the socket contact 510 further comprises a wire terminating portion 526 including a conductor terminating area 528 and a strain relief section 530 . referring again to fig1 , the cover 540 is shown as including top wall 548 , sidewalls 550 and endwalls 552 . extending forwardly from the top wall 548 are latching tabs 542 and extending downwardly from the sidewalls 550 are latches 546 . a wire bundle exit area 544 ( fig1 ) is located within the endwall 552 . to assemble the plug assembly , the insert 410 is placed in the insert - receiving cavity 470 of the plug housing 460 , the alignment channels 448 mating with the respective alignment lugs 498 , as shown in fig1 . the insert 410 is slid rearwardly in the cavity 470 until the standoff feet 444 contact the wall 478 of the plug housing 460 . the insert 410 will then be locked within the cavity as an upper locking lug 452 is disposed in a upper channel 474 and a lower locking lug 452 is disposed in a lower channel 474 , locking surfaces 456 against back surfaces 476 , as shown in fig1 a . when the insert 410 is completely inserted in the cavity 470 , a forward portion of the insert 410 protrudes through the cavity 470 , as best shown in fig1 . furthermore , when the insert 410 is completely backed up against the wall 478 , a gap exists between the surface 446 and the surface 478 , the gap being the height of the standoff feet 444 . with the insert 410 in place , each contact - receiving cavity 434 in the insert 410 is axially aligned with a contact - receiving hole 480 in the plug housing . the grommet 470 is then placed in a rearward cavity 468 , each aperture 574 in the grommet 570 in axial alignment with the contact - receiving holes 434 and 480 , as shown in fig1 . the socket contacts 510 are then prepared for insertion into the respective cavities . as shown in fig1 , each individual conductor 580 is prepared by removing a portion of the insulation 582 and exposing the conductor 584 . the prepared wire 580 is then installed in the wire terminating portion 526 , the conductor lying in the conductor terminating area 528 and the insulation portion 582 lying in the strain relief section 530 . the conductor terminating section 528 is then crimped onto the conductor providing an adequate electrical connection , while the strain relief section 530 is folded around the insulation to provide a strain relief . in order to install the contact 510 through the apertures in the rubber grommet , the lance end 520 should be enclosed within the envelope defined by the contact barrel portion 532 so as not to damage the grommet . as shown in fig1 , a pin , paper clip , or the like may be inserted in the pin - receiving area 512 and pushed rearwardly until the point of the pin contacts the lance 516 urging the lance end 520 downwardly through the lance opening 522 and into the envelope defined by the barrel portion 532 . the contact 510 , with the pin inserted , may then be placed through the grommet apertures 574 and through the contact receiving holes 434 in insert 410 , as shown in fig1 . when the contact 510 is completely inserted , the socket end 518 abuts shoulder 440 in the insert 410 . the pin which has been inserted in the contact 510 protrudes through the individual holes in the insert 410 and is now removed , which allows the lances to bias upwardly , placing the lance end 520 in the gap between the surface 446 of the insert and the surface 478 of the plug housing 460 , as shown in fig1 . the contact is securely mounted within the insert and housing , as the contact end 518 abuts the respective shoulder 440 of the insert and the lance end 520 abuts the lance back stop 524 and the surface 478 of plug housing 460 . once all the contacts are in place , the cover may be installed enclosing the rearward end of the plug housing 460 , as best shown in fig1 . the latching tabs 542 may then be placed in respective slots ( not shown ) in the housing 460 and the latches 546 snapped over the mounting slots 464 . a bundle tie 562 is then placed around the multiconductor cable and around the cover 540 and plug housing 460 providing for strain relief on the individual wires 580 . although not part of the instant invention , the connector 2 and the printed circuit board 110 are mounted on a bulkhead 300 , as shown in fig1 . the bulkhead 300 , although shown as a wall , is actually one side of a box to be located locally for a system requiring the logic of circuitry . the actual method of mounting the connector 2 and the plug housing 460 on the bulkhead 300 is determined by the configuration of the mounting face . in the preferred embodiment , the front mating face 502 of the plug housing 460 is planar , as shown in fig1 , whereas , in an alternate embodiment , the front mating face 502 includes bosses 504a . when the mounting face 502 of the plug housing 460 is planar , the mounting face 502 , will of course be mounted flushly with the bulkhead 300 outer surface , as shown in fig2 . the holes 308 and 310 in the bulkhead , aligned with the insert 8 and boss 10 , respectively , are dimensioned to receive the respective screws only , that is , the holes are not dimensioned to receive the insert 8 and boss 10 . rather , the front face of the insert 8 and the boss 10 bears directly on the bulkhead 300 back surface 304 . the heights of insert 8 and boss 10 are dimensioned so as to control the amount of gasket 204 squash , that is , the height of the insert 8 and boss 10 is smaller than the undeformed thickness of the gasket 204 . when the connector 2 is mounted to the back side of the bulkhead 300 by means of the self tapping screws however , the connector 2 will pull up towards the bulkhead and the gasket 204 will deform to the extent of the interference between the insert 8 and boss 10 and the backside of the bulkhead 300 , as best shown in fig2 . when the plug housing 460 is also attached to the bulkhead 300 , the machine screws 560 are placed through the housing and threaded within the inserts 8 . as the machine screws 560 are tightened within the inserts 8 , the insert is brought up against the backside of the bulkhead 300 , and the facial friction between the insert 8 and the bulkhead 300 , prevents the insert from failing in a torsional mode , turning within the connector boss 36 . when the alternate embodiment is employed , as shown in fig2 a , the holes 308a and 310a within the bulkhead are dimensioned so as to receive the insert 8 and boss 10 therein , as shown in fig2 a . in this embodiment , the height of the insert 8a and boss 10a away from the face 4a , is greater than that in the preferred embodiment , as they extend into the respective holes 308a and 310a of the bulkhead 300 . when the plug 460a is inserted into engagement with the connector 2 , and the machine screws 540 a threaded into engagement with the inserts 8a , the bosses 504a are also brought into the hole 308a . continued tightening of the machine screws 560a brings the faces of the bosses 504a to bear on the faces of the inserts 8a , leaving a gap 501a between the face 502a and the bulkhead 300a , as shown in fig2 a . in this case , as the screws 560a are tightened , the bosses 308a against the faces of the inserts 8a causes a frictional effect preventing the inserts 8a from failing by turning within the connector bosses 36a . a gap 501a exists between the mounting face 502a of the plug housing 460a and the bulkhead 300a . to seal the connector 2 and a printed circuit board 110 from any contaminants at the local interface , a seal 200 is placed between the bulkhead mounting face 304 , the surface 204 of the seal abutting the mounting surface 304 of the bulkhead 300 , as shown in fig1 . when the gasket 200 is placed onto the mating face 4 of the connector 2 , the cylindrical portion 224 of the gasket extends into the gasket seal 24 of the connector 2 . as the connector is drawn up to the bulkhead 300 , by means of the self - tapping screws 314 , the flat portion 204 of the gasket 200 undergoes a slight amount of crush between the surfaces 304 and 4 , respectively . as best shown in fig1 , as the plug assembly 400 is brought forward into the plug cavity 18 , the contacts 98 are aligned with the socket ends 518 by means of frustoconical lead - in sections 432 . the peripheral surface 212 of the gasket 200 and the peripheral surface 490 of the plug 400 are dimensioned so as to create an interference fit between them , thus continued forward motion of the plug portion 400 results in contact between the lead - in surface 496 of the housing in the outer surface 212 of the gasket 200 , as shown in fig1 . as the plug 400 continues inward , the lead - in portion 496 sequentially forces the surface 212 of the o - ring portion 224 radially outward , as shown in fig1 , which ultimately results in the surface 212 being planar or continuous with surface 312 and with surface 490 , as shown in fig1 . when completely inserted , the front surface 430 of the insert 410 abuts back surface 30 of the cavity 18 , and lead - in section 496 of the plug 400 abuts the lead - in section 22 of the connector 2 as shown in fig1 and 19 . when the machines screws 560 ( fig1 ) are threaded into the inserts 8 , and the plug 400 is drawn up to the bulkhead 300 , the peripheral groove 492 extends over the flange 302 , the forward surface of flange 302 abutting and squashing the seal 494 as shown in fig1 , providing a seal between the local environment and the socket contacts 510 . in the preferred embodiment , when the plug 400 is drawn up to the bulkhead 300 , the mounting face 502 is mounted flush with the face of the bulkhead , as shown in fig1 . when the alternate embodiment is used , as shown in fig1 a , a gap 501a exists between the mounting face 502a of the plug housing 460a and the bulkhead 300a . when the plug portion is fully mated with the header , as shown in fig1 or 19a , the pin contacts 98 , are fully inserted in the constricted portion 514 of socket contact 510 . as assembled the unit provides an exceptional vibration resistant plug and header combination . as designed the socket contact 510 utilizes four resilient beam sections 515 inwardly biased between two band sections , the forward contact portion 518 and the contact barrel portion 532 . because the beam sections 515 are held at each end by the band portions , the beam sections cannot vibrate away from the pin causing an electrical discontinuity . also , as the straight section of 438 of the insert 410 is closely toleranced to only allow a sliding fit of the contact front portion 518 and contact barrel portion 532 , the contact 510 cannot unroll , causing a discontinuity between the pin portion 90 and the individual resilient beam sections of the constricted portion 514 . therefore , the socket contacts exhibit superior vibration resistance when utilized in a high vibration environment . vibration can be excited in any plane of the contact or pin without causing either to vibrate thereby effecting an open circuit . samples of the embodiment of fig2 a were subjected to vibrational tests which include applying a current of 100 milliamperes through each contact of the plug 400 and receptacle 2 , and then subjected to random vibrational excitations of between 0 - 2000 hertz . the test monitored the plug and receptacle current for discontinuities greater than one micro - second . during a 20 - hour test for this embodiment , the connector system was able to withstand average accelerations of 27 times the normal earth &# 39 ; s gravity through the entire frequency range from 0 to 2000 hz , and no discontinuities in current were found , nor was physical damage experienced by the monitored samples . it is believed that the embodiment of fig2 would perform with similar success when subjected to the same test . it is important that in each of the embodiments that the plug 400 and receptacle 2 vibrate as a unit . in the preferred embodiment the plug 400 and receptacle 2 vibrate as a unit solidly affixed to the bulkhead 300 , whereas in the alternate embodiment the plug 400 and receptacle 2 vibrate with the bulkhead 300 , but buffered through the seal 200 . in the preferred embodiment as shown in fig2 , the receptacle 2 is first mounted to the backside 304 of the bulkhead 300 , the front faces of the inserts 8 and bosses 10 directly abutting the bulkhead 300 . when the plug 400 is inserted and the screws 560 torqued down , surfacd 502 of the plug 400 is also directly abutting the bulkhead 300 , therefore , the plug 400 and receptacle 2 vibrate directly with the bulkhead . in the alternate embodiment , as shown in fig2 a , the insert 8a and the bosses 10a are dimensioned to be received in the bulkhead mounting holes 308a and 310a , respectively . when the self - tapping screws 314a are drawn up to hold the receptacle in place , the seal is somewhat squashed and the insert 8a and bosses 10a may travel within the respective holes 308a and 310a . when the plug 400a is mated to the receptacle 2a and the machine screws installed , the bosses 504a extending from the plug mating face 502a abut the inserts 8a prior to the mating face 502a contacting the bulkhead , leaving a gap 501a between the mating face 502a of the plug 400 and the bulkhead 300 . thus , the receptacle 2 and plug 400 are solidly affixed to one another but only contact the bulkhead 300 through the seal 200 which buffers vibration from the bulkhead to the receptacle - plug assembly . furthermore , in either the preferred or alternate embodiment , the gasket 200 between the connector 2 and the bulkhead ; the seal 474 between plug housing 460 and the bulkhead flange 302 ; the seal 570 within the plug housing 460 ; and the bundle tie 562 around the multi - conductor bundle of wires , all help to reduce the vibration from the bulkhead 300 to the socket contacts 98 . the instant invention of either embodiment relates to a plug - receptacle assembly for mounting in a high vibration environment , such as in automotive use , and each individual wire can carry up to 6 amps of current without interruption from the vibration . although the preferred embodiment of the receptacle contains 28 contacts which would allow a total current of 168 amps , it should be understood that the connector could include any number of contacts .	7
referring to fig1 - 6 , there is shown an embodiment of an external fixation system 100 having a telescoping rod 120 , a first housing 220 , a second housing 240 , a plurality of pin clamping members 260 and a plurality of locking post members 280 . fig2 a is a perspective view of an assembled telescoping rod 120 having an actuation member 140 , a first elongate tube member 160 , and a second elongate tube member 180 . as shown in fig2 b and 2c , actuation member 140 includes an actuation portion 142 , a base portion 144 , an engagement portion 146 and a shaft portion 148 . actuation portion 142 projecting outwardly in a distal direction from a distal end surface 150 of base portion 144 . engagement portion 146 projects outwardly in a proximal direction from a proximal end surface 152 of base portion 144 . shaft portion 148 projects outwardly in a proximal direction from engagement portion 146 . actuation portion 142 is preferably configured to be engaged and manipulated by hand or with a tool . in the embodiment shown , actuation portion 142 has four angled flat surfaces 154 in a square configuration with four rounded edges 156 between adjacent surfaces 154 . engagement portion 146 preferably includes first and second recesses 155 , 157 . shaft portion 148 is preferably substantially threaded 159 . first elongate tube member 160 includes a distal end surface 162 and a proximal end surface 164 . first elongate tube member has a bore 168 extending through the proximal and distal end surfaces 162 , 164 thereof and a protrusion 170 projecting outwardly from an inner surface 172 thereof . second elongate tube member 180 includes a distal end surface 182 , a proximal end portion 184 , a tube portion 186 and a shaft portion 188 . tube portion 186 includes an inner threaded surface 190 and an outer surface 192 having a longitudinal recess 194 . proximal end portion 184 is preferably threaded in order to couple second elongate tube member to other external fixation constructs , if desired . in assembling telescoping rod 120 , distal end surface 162 of first elongate tube member 160 preferably mates with proximal end surface 152 of base portion 144 of actuation member with shaft portion 148 of actuation member 140 being housed within bore 168 of first elongate member . when actuation member 140 is operatively coupled to first elongate tube member 160 , engagement portion 146 of actuation member 140 engages inner surface 172 of first elongate tube member 160 . recesses 155 , 157 of engagement portion 146 may act as relief portions for coupling purposes or may house a ring member in order to maintain the coupling of actuation member 140 and first elongate tube member 160 . once actuation member 140 and first elongate tube member 160 are coupled , protrusion 170 of first elongate tube member 160 is coupled to longitudinal recess 194 of tube portion 186 at distal end surface 182 of tube portion 186 and slid along longitudinal recess 194 until threaded portion 159 of shaft portion 148 of actuation member 140 comes in contact with inner threaded surface 190 of tube portion 186 of second elongate tube member 180 . actuation portion 142 is then rotated in a clockwise direction in order to threaded shaft portion 148 onto threaded surface 190 . as actuation portion 142 continues to be rotated in a clockwise direction , protrusion 170 continues to ride along longitudinal recess 194 of tube portion 186 in a first direction until proximal end surface 164 lies adjacent a distal end surface 196 of shaft portion 188 . because protrusion 170 rides along longitudinal recess 194 , first elongate tube member 160 does not rotate with respect to second elongate tube member 180 . instead , first elongate tube member 160 only translates with respect to second elongate tube 180 along longitudinal axis l 1 . if actuation portion 142 is rotated in a counterclockwise direction , protrusion 170 will continue to ride along longitudinal recess 194 of tube portion 186 , but in a second direction along longitudinal axis l 1 such that proximal end surface 164 will be separated from distal end surface 196 of shaft portion 188 a larger linear distance from one another . as long as actuation member 140 , first elongate tube member 160 , and second elongate tube member 180 are coupled to one another , rotation of actuation member 140 in either a clockwise or counterclockwise direction will cause proximal end surface 164 and distal end surface 196 to move closer and further away from one another in a linear direction along longitudinal axis l 1 of external fixation system 100 . in another embodiment , tube portion 186 of second elongate tube member 180 has an outer surface 192 that is square shaped and has no longitudinal recess 192 in the outer surface thereof . also , first elongate tube member 160 has a bore 168 having an inner surface 172 that is square shaped and no protrusion 170 projecting outwardly from the inner surface thereof . in this embodiment , once actuation member 140 and first elongate tube member 160 are coupled , square shaped inner surface 172 of first elongate tube member 160 is coupled to square shaped outer surface 192 of tube portion 186 of the second elongate tube member 180 at distal end surface 182 of tube portion 186 and is slid along the outer surface 192 until threaded portion 159 of shaft portion 148 of actuation member 140 comes in contact with inner threaded surface 190 of tube portion 186 of second elongate tube member 180 . actuation portion 142 is then rotated in a clockwise direction in order to threaded shaft portion 148 onto threaded surface 190 . fig3 is a perspective view of a first embodiment of a housing 300 of the external fixation system 100 . housing 300 includes side surfaces 302 , 304 having a bore 306 therethrough . bore 306 defines a longitudinal axis l 2 of housing 300 . housing 300 includes a front face 312 and a back face 314 and a plurality of apertures 322 therethrough . each of the plurality of apertures 322 has a longitudinal axis that is perpendicular and offset to longitudinal axis l 2 of housing 300 . an internal circumference of each of the plurality of apertures 322 perpendicular to the longitudinal axes of each of the plurality of apertures 322 and is open to bore 306 such that a portion of each of plurality of apertures 322 intersects bore 306 . housing 300 further includes bores 332 extending into housing 300 from bottom and top surfaces 334 , 336 thereof . bores 332 are also open to bore 306 such that a portion of bores 332 intersect bore 306 . in the embodiment shown , housing 300 includes four apertures 322 . two of the four apertures are located above longitudinal axis l 2 and two of the four apertures are located below longitudinal axis l 2 . fig4 a is a perspective view of a second embodiment of a housing 400 of the external fixation system 100 . housing 400 includes side surfaces 402 , 404 having a bore 406 therethrough . bore 406 defines a longitudinal axis l 3 of housing 400 . housing 400 includes a front face 412 and a back face 414 and a plurality of apertures 422 therethrough . each of the plurality of apertures 422 has a longitudinal axis that is perpendicular and offset to longitudinal axis l 3 of housing 400 . an internal circumference of each of the plurality of apertures 422 perpendicular to the longitudinal axes of each of the plurality of apertures 422 and is open to bore 406 such that a portion of each of plurality of apertures 422 intersects bore 406 . housing 400 further includes bore 432 extending into housing 400 from a top surface 436 thereof . bore 432 is also open to bore 406 such that a portion of bore 432 intersects bore 406 . in the embodiment shown , housing 400 includes two apertures 422 . fig5 - 6 are views of one embodiment of a pin clamp 500 that can be used with housings 300 , 400 of external fixation system 100 . pin clamp 500 includes side surfaces 502 , 504 and an outer circumference surface 506 intermediate side surfaces 502 , 504 . side surfaces 502 , 504 have an inner surface 508 . pin clamp 500 has a slot 512 that extends through side surface 502 , 504 and outer circumference surface 506 . slot 512 provides a resiliency to pin clamp 500 such that if a force is applied to outer circumference surface 506 , pin clamp 500 may flex . in flexing , a width of slot 512 is either decreased or increased depending on how the force is applied to outer circumference surface 506 . preferably , slot 512 has a neutral width when pin clamp 500 is in a relaxed state and a lesser width when a force is applied to outer circumference surface 506 . pin clamp 500 includes a bore 520 extending through side surfaces 502 , 504 , the bore 520 having a longitudinal axis l 3 . bore 520 has a diameter d 1 at side surface 502 , 504 when pin clamp 500 is in a relaxed state . upon a force being applied to outer circumference surface 506 , bore 520 preferably has a diameter d 2 at side surfaces 502 , 504 . diameter d 2 is preferably less than d 1 . fig4 b is a cross - section view of housing 400 taken along line 4 b - 4 b of fig4 a . in this figure , a clamping mechanism of housing 440 is shown . clamping mechanism includes an actuation member 600 , a wedge member 620 , and first and second pin clamps 500 each engaged to housing 400 . as shown in fig4 b , pin clamps 500 are housed with apertures 422 of housing 400 and actuation member 600 and wedge member 620 are housed within bore 432 of housing 400 . actuation member 600 may be referred to as a locking post member having an actuation portion 602 , a threaded portion 604 and a protrusion 606 . wedge member 620 includes first and second contact surfaces 622 , 624 and a recess portion 626 . protrusion 606 of actuation member 600 is configured to be received in recess portion 626 of wedge member 620 and contact on outer surface 628 of wedge member 620 . in other embodiments , actuation member 600 and wedge member 620 are integral such that the clamping mechanism does not include protrusion 606 of actuation member 600 and recess portion 626 and outer surface 628 of wedge member 620 . in another embodiment , protrusion 606 does not projecting outwardly from threaded portion 604 . instead , the base of threaded 604 is rounded . also , wedge member 620 does not include recess portion 626 . in this embodiment , rounded surface of threaded portion 604 interacts with a flat surface of wedge member 620 . in use , pin clamps 500 are received in apertures 422 of housing 400 such that outer circumference surface 506 is located substantially between front and back surfaces 412 , 414 . apertures 422 are preferably bounded by inner walls 423 of housing 400 . when clamping mechanism of housing 400 is in a neutral state , pin clamps 500 may rotate in polyaxial directions with at least a portion of outer circumference surface 506 contacting inner walls 423 . the polyaxial rotation of pin clamps 500 is bounded by the outer circumference surface 506 thereof and the structure surrounding of housing 400 . in order to restrict the polyaxial movement of pin clamps 500 with respect to housing 400 , clamping mechanism of housing 400 may be activated . in activating clamping mechanism , actuation member 600 is rotated in a clockwise direction causing the protrusion thereof to move proximally and contact outer surface 628 of wedge member 600 . the result of this contact is wedge member 600 also moving in a proximal direction such that first and second contact surfaces 622 , 624 thereof contact outer circumference surface 506 of pin clamps 500 and causes the diameter of bore 520 at side surfaces 502 , 504 of pin clamps 500 to decrease . pin clamps 500 also move in a proximal fashion when actuation member 600 is rotated in a clockwise direction . in order to bring clamping mechanism back to a neutral state , actuation member 500 is rotated in a counterclockwise direction . as shown in fig1 , housing 400 is coupled to shaft portion 188 of second elongate tube member 180 . when clamping mechanism is in a neutral state , housing 400 may rotate with respect to second elongate tube member 180 such that longitudinal axis l 3 of housing 400 may rotate with respect to longitudinal axis l 1 of external fixation system 100 even though longitudinal axis l 1 and l 3 are preferably coaxial . when clamping mechanism is activated , wedge member 620 compresses pin clamps 500 between contact surfaces 622 , 624 thereof and shaft portion 188 of second elongate tube member 180 . another result of activation of the clamping mechanism is that housing 400 preferably can no longer rotate with respect to second elongate tube member 180 . the same clamping mechanism of housing 400 that is shown in fig4 b is also included in housing 300 except that housing 300 preferably includes two separate clamping mechanisms on each side of longitudinal axis l 2 thereof . as shown in fig1 , housing 300 is coupled to an outer surface of first elongate tube member 160 . when the clamping mechanisms thereof are in a neutral state , housing 300 may rotate with respect to first elongate tube member 160 such that longitudinal axis l 2 of housing 300 may rotate with respect to longitudinal axis l 1 of external fixation system 100 even though longitudinal axis l 1 and l 2 are preferably coaxial . when either clamping mechanism of housing 300 is activated , a wedge member thereof preferably compresses pin clamps 500 between contact surfaces of the wedge member and outer surface of first elongate tube member 160 . another result of activation of either clamping mechanism 300 is that housing 300 preferably can no longer rotate with respect to first elongate tube member 160 . the present invention provides a dynamic mini - rail that allows for many degrees of freedom between components parts thereof . first and second elongate tube members 160 , 180 may translate with respect to one another . housings 300 and 400 may rotate with respect to first and second elongate tube members 160 , 180 and housings 300 and 400 may rotate about first and second elongate tube members 160 , 180 with respect to one another . pin clamps 500 may rotate at independent trajectories while housed within housings 300 . fig7 is a perspective view of a third embodiment of a housing 700 of the present invention . housing 700 includes a base member 720 , first and second plate members 740 , 760 , a plurality of pin clamps 500 , and first and second fixation post members 780 . base member 720 is coupled to a clamping mechanism that includes bottom and top plate members 740 , 760 , the plurality of pin clamps 500 and first and second fixation post members 780 . base member 720 has a bore 722 therethrough and a longitudinal axis l 4 . a longitudinal axis of first and second plate members 740 , 760 is preferably parallel with longitudinal axis l 4 of base member 720 , but may be angled with respect to longitudinal axis l 4 of base member 720 . first and second plate members 740 , 760 each have a threaded vertical bore 790 extending through outwardly and inwardly facing surfaces 750 , 770 thereof . first and second plate members 740 , 760 further have a longitudinal recess 775 in the inwardly facing surfaces 770 thereof . longitudinal recess 775 is shaped to receive a portion of outer circumference surface 506 of the plurality of pin clamps 500 in order to couple and partially house the plurality of pin clamps 500 with respect to first and second plate members 740 , 760 . fixation post members 780 have a head portion 782 and a threaded shaft portion 784 . threaded shaft portion 784 of fixation post members is received and threaded into vertical bore 790 of first and second plate member 740 , 760 . upon threading of fixation post members into vertical bores 790 of first and second plate members 740 , 760 , a bottom surface 786 of head portion 782 of fixation post members 780 presses against outwardly facing surface 750 of one of the first and second plate members 740 , 760 and cases the inwardly facing surfaces 770 of the first and second plate members 740 , 760 to move closer to one another such that the plurality of pin clamps 500 become compressed . fig8 is a perspective view of another embodiment of an external fixation system 900 of the present invention including two of the third housings 700 shown in fig7 each coupled to the telescoping rod 100 shown in fig2 a . one of the third housings 700 is coupled to a first elongate tube member 160 and the other of the third housings 700 is coupled to a second elongate tube member 180 . fig9 is a perspective view of yet another embodiment of an external fixation system 1000 of the present invention including first housing 300 coupled to second elongate tube member 180 and first housing 300 and second housing 400 coupled to first elongate tube member 160 . fig1 is a perspective view of yet another embodiment of an external fixation system 1100 of the present invention including third housing 700 coupled to second elongate tube member 180 and first housing 300 and second housing 400 coupled to first elongate tube member 160 . fig1 is a perspective view of yet another embodiment of an external fixation system 1200 of the present invention including second housing 400 coupled to second elongate tube member 180 and second housing 400 coupled to first elongate tube member 160 . a plurality of pins 480 are received and housed with pin clamps 500 of housings 400 . the plurality of pins 480 have independent pin trajectories with respect to one another . in activating clamping mechanism of housings 400 , actuation member 600 is rotated in a clockwise direction causing it to move proximally and compress outer circumference surface 506 of pin clamps 500 and causes the diameter of bore 520 at side surfaces 502 , 504 of pin clamps 500 to decrease . the result of activating the clamping mechanism of housings 400 is the pin clamps 500 cannot rotate and angulate independently of housing 400 . in order to bring clamping mechanism back to a neutral state , actuation member 500 is rotated in a counterclockwise direction , which will also pin clamps 500 housing pins 480 to rotate and angulate with respect to housings 400 once again . fig1 is a partial view showing an end of second elongate tube member 180 of a telescoping rod having a built - in thread 184 such that the telescoping rod may be coupled to other external fixation constructs . such constructs , for example , are shown in fig1 a - 13c , which are a bolt adapter 1220 , a rod clamp 1240 , and a hinge coupling 1260 , respectively . these coupling mechanism are all known in the art of external fixation systems and all the external fixation systems of the present invention to be compatible with such constructs . in a method of correcting a bone deformity of the present invention , an external fixation system having a plurality of housings ( may be housing 300 , 400 or 700 ) are coupled to a telescoping rod 100 . a plurality of pins such as those shown in fig1 are coupled to the housings . one end of the pins are received in pin clamps housed within the housings and another end of the pins are engaged to bone at or adjacent to the deformity in the bone being corrected . a first end of pins are preferably engaged to bone . a second end of pins are then received through a bore hole in a pin clamp coupled to a housing , the housing coupled to a telescoping rod . additional pins engaged at one end to bone may all be received through a bore hole in another pin clamp coupled to the housing or a different housing coupled to a telescoping rod . once the desired number of pins are engaged to bone and the other ends of the pins are coupled to pin clamps , the fixation or set screws of the housing may then be tightened to set the angle of the pins with respect to the housings each are coupled to . although the invention herein has been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims .	0
fig1 - 5 and the following description depict specific examples to teach those skilled in the art how to make and use the best mode of the invention . for the purpose of teaching inventive principles , some conventional aspects have been simplified or omitted . those skilled in the art will appreciate variations from these examples that fall within the scope of the invention . those skilled in the art will appreciate that the features described below can be combined in various ways to form multiple variations of the invention . as a result , the invention is not limited to the specific examples described below , but only by the claims and their . equivalents . fig1 - 4 illustrate a method of making sensor 100 in an example of the invention . fig1 - 4 provide a view from above sensor 100 . note that fig1 - 4 are illustrative and do not provide actual dimensions . sensor 100 is configured to measure an analyte in a solution . for example , the analyte could be chlorine or ferrocene , and the solution could be water . referring to fig1 , substrate 101 is provided first . substrate 101 could be plastic , ceramic , glass , or some other suitable material . conductive ink is then printed on substrate 101 to form electrode regions 102 - 104 and leads 105 - 107 . the conductive ink could be carbon - based such as graphite , metal - based such as silver , or some other suitable conductive material . note that the term “ printing conductive ink ” does not mean that the same conductive ink must be used — the term “ printing conductive ink ” includes the printing of different inks . electrode region 102 could be a working electrode , electrode region 103 could be a counter electrode , and electrode region 104 could be a reference electrode . referring to fig2 , dielectric 108 is then placed on substrate 101 to provide a mask . dielectric 108 typically covers leads 105 - 107 , except for portions of leads 105 - 107 that form electrical contacts near the edge of substrate 101 . dielectric 108 also typically covers substrate 101 to clearly demark and define electrode regions 102 - 104 . electrical insulation 109 is deposited to cover electrode region 102 . electrical insulation 109 could be any material that effectively blocks the flow of electric current . referring to fig3 , electrical insulation 109 is sonically ablated to form an array of pores 111 - 114 . on fig3 , the number of pores has been restricted for clarity . a square centimeter of electrical insulation 109 could have between one thousand and one hundred thousand pores . these pores could each have a diameter between 0 . 1 and 10 microns . the array could have a random placement of pores . an ultra - sonic horn or transducer that sonically induces cavitations in electrical insulation 109 is typically used to perform the sonic ablation . the pores extend through electrical insulation 109 to the conductive ink forming electrode region 102 , and thus , pores 111 - 114 expose electrode region 102 . referring to fig4 , metal 121 - 124 is deposited into pores 111 - 114 to form an array of electrodes in electrode region 102 . the metal may be deposited by placing sensor 100 in a metal - plating solution that has the desired metal dissolved therein . the metal could be gold , silver , platinum , chromium , mercury , nickel , cadmium , copper , or some other suitable metal . layers of different metals could be deposited within pores 111 - 114 . for example , a layer of chromium could be deposited in the pores first due to the adhesive properties of chromium , and a layer of gold could be deposited over the chromium . in another example , a layer of gold could be deposited in the pores first , and then a layer of mercury could be deposited over the gold . in addition , the metal may be chemically treated to modify the characteristics of the electrode array . for example , the metal in the pores could be treated with a thiol solution to improve the electrochemical characteristics on the surface of the metal . fig5 illustrates sensor 100 in an example of the invention . fig5 illustrates a side view of sensor 100 . substrate 101 forms the base of sensor 100 . electrode regions 102 - 104 are printed on substrate 101 . dielectric 108 separates and defines electrode regions 102 - 104 and covers a portion of leads 105 - 107 ( not shown ). electrical insulation 109 covers electrode region 102 . to form electrodes 123 - 124 ( electrodes 121 - 122 are not shown ), metal is deposited in pores that were sonically ablated through electrical insulation 109 . in electrode regions 103 - 104 , the conductive ink itself forms the electrodes , such as counter and reference electrodes . in electrode region 102 , an array of electrodes is formed by the metal in the pores and the underlying conductive ink . this array of electrodes may comprise a working electrode . if desired there could be many more electrode regions on substrate 101 , including additional electrode regions that form electrode arrays . to detect an analyte in a solution , sensor 100 is placed in the solution . a potential is placed across the working electrode array of region 102 and the reference electrode of region 104 . the reference electrode is used in measuring the potential of the working electrode . electrode region 103 provides the counter electrode to source / sink current . this current is measured at the working electrode , and the current measurement is processed using known techniques to determine the concentration of the analyte in the solution . the metal in the pores provides better sensitivity than a conducting organic polymer for some applications , such as chlorine detection . the metal in the pores also provides more versatility than a conducting organic polymer to support numerous different applications .	6
the essential features of a preferred embodiment of the invention are shown schematically in fig3 which represents a wick - injector according to the invention that can be substituted for the injection needle 1 of the conventional es source shown in fig1 . ( component numbers below 10 relate to fig1 ) a primary stream of sample liquid from any desired source such as a liquid chromatograph ( not shown ), enters arm 11 of tee 12 and exits through arm 13 . this primary stream bathes one end of wick 14 that extends from the interior of tee 12 through plug - seal 15 at the end of arm 16 of tee 12 for any desired distance , typically 5 to 25 mm in many experiments . plug - seal 15 prevents convective flow of sample liquid through arm 16 of tee 12 but allows a capillarity - driven flow of sample liquid through wick 14 to its tip which is located near the inlet of capillary tube 4 that passes ion - bearing gas from spray chamber 3 into first pumping stage 5 of the vacuum system containing mass analyzer 8 in second pumping stage 9 . when a suitable potential difference is applied between wick 14 and inlet of capillary tube 4 , sample liquid forms taylor cone 17 at the tip of wick 14 . liquid flow rates through wick 14 depend upon the structure , material , length and diameter of the wick , the composition of the liquid , as well as the voltage difference and the distance between the wick and the inlet face of capillary tube 4 . when tee 12 is made of metal or other conducting material , the desired potential difference between wick and capillary tube can be maintained by connecting one pole of an appropriate power supply to capillary tube 4 or its housing in such a way that the inlet end or face of the tube is maintained at the potential of that pole . the other pole of the power supply can be connected directly to the tee , or one of the tubes through which the convective flow of sample liquid enters or leaves the tee . alternatively , that other pole of the power supply can be connected to a small wire inserted into the wick or wrapped around it so as to establish good electrical contact with the wick liquid . other ways of providing for good electrical contact with the wick tip will readily occur to those skilled in the art . with a 3 cm length of unwaxed dental floss as the wick , we have maintained stable sprays with flow rates through the wick from as low as 30 nl / min or less to as high as 200 nl / min . larger and smaller flows can be achieved respectively with larger and smaller wicks . for flow rates at the low end of this range , the fluid jets from the cones and the resulting droplets are often not visible because their diameters can be submicron in size . even so they are presumed to be similar in form and function to the same components of cone - jet sprays at larger flow rates because measurable spray currents are obtained . moreover , the mass spectra produced from sample liquids are very much the same whether they are sprayed from a wick at very low flow rates or at the usual flow rates of several ul / min from a conventional es injection needle . in fact , the mass spectral peak heights are often higher for wick sprays at low flow rates than for conventional needle sprays at higher flow rates of the same solution . some of the advantages of this wick - spray invention are revealed in results obtained in a particular experiment that serves as an example of the practice of the invention . fig4 a shows a trace of total ion current registered by the detector of a quadrupole mass spectrometer ( nermag 3010 ) fitted with a commercial es source ( analytica of branford ) similar in design to the source shown in fig1 except that injection needle 1 was replaced by a wick injector like that of fig3 wherein wick 14 was a 20 mm length of unwaxed nylon dental floss . the trace of fig4 a was produced by a 100 ul injection of sample solution into a continuous primary stream of water flowing at a rate of one ml / min into arm 11 of tee 12 as shown in fig4 a . the sample solution comprised 2 . 9 um cytochrome c in 50 - methanol - water containing 0 . 5 per cent of acetic acid . this injection simulates the passage of an lc peak of six seconds duration in the effluent from an lc column operating with a mobile phase flow of one ml / min . the base width of the peak is about 30 seconds , roughly a factor of five bigger than the injection time . such broadening indicates an appreciable dead volume that could be substantially reduced with even modest care in the design of the plumbing which was just jury rigged for this experiment . repetitive injections indicated that the peaks for total ion current are highly reproducible . if the exit flow of excess liquid from the tee , i . e . over and above the flow withdrawn by the wick , were passed to an auto sampler , the contents of each such peak in an lc separation could readily be recovered for other purposes such as testing for bioactivity . fig4 b shows a mass spectrum obtained for the same solution with a conventional analytica source and previously mentioned nermag quadrupole mass analyzer . the spectrum was averaged for 70 sec during a steady flow at 2 ul / min of the same sample solution of cytochome c used to obtain the total ion current peak of fig4 a . the mass spectrum of fig4 c was obtained with the wick source of fig3 during a 4 second segment of the injection that produced the total - ion - current trace of fig4 a . the distribution of peak heights in fig4 c between m / z values of 600 and 1000 is a bit more “ normal ” for this analyte than those of fig4 b . moreover , most peaks of fig4 c are substantially higher than their counterparts in fig4 b . in other words the analytical sensitivity obtained in this experiment with the wick source at a primary flow of sample liquid of one ml / min is at least as high as , and apparently substantially higher than , can be obtained with an optimum flow of 2 ul / min in a conventional es source . many other experiments have confirmed this result , repeatedly showing that the analytical sensitivity with the wick source at flow rates of one ml / min or more is usually greater than can be obtained with a conventional es source at customary low flow rates of one or two ul / min . most if not all commercial es sources claiming the ability to accommodate electrospray liquid flow rates as high as one ml / min always seem to show substantially lower analytical sensitivities than are obtained at the more conventional low flow rates of a few ul / min . because the flow rate of sample liquid delivered through the wick to the spray by a wick source is determined by what happens after the liquid enters the wick there is no apparent upper limit to the primary flow rate of liquid to be analyzed . the wick is indifferent to the volume or flow velocity of the sample liquid in which its “ inlet ” section is immersed . thus , the invention provides the possibility of simple sampling for continuous mass spectrometric monitoring of industrial process streams of any magnitude without any need for complex sampling valves or pumps . indeed , wick extraction might well be able to provide convenient sampling of high volume flows for other kinds of sensors and analyzers that require or can accommodate to relatively flow flow rates of liquid to be analyzed . a systematic study of wick structure and composition has not yet been carried out but we have had success with wicks comprising bundles of small fibers made of glass , graphite , paper , cotton and linen that have ranged in diameter from 8 to perhaps 200 microns . nor is the cross sectional shape important . thin flat strips of cloth or paper work just as well as threads or fibers of circular or oval cross section . tubes packed with granular or porous material can also be used . an effective wick can comprise a single monofilament fiber in a tube whose bore has a diameter only slightly larger than that of the wick . if the thickness of the annular gap between wick and tube is sufficiently small , then capillarity can overcome gravity and lift the liquid to a substantial height above the surface level of the liquid in which this filament - cylinder wick is immerged . of course , if liquid is to be electrosprayed from this or any other type of wick , the difference in height between inlet and outlet ends must small enough so that capillarity will raise the liquid to the level at which the applied electric field can pull it into the spray unwaxed dental floss seems to work very well so a short length of this material has comprised the workhorse wick in the majority of our studies involving mass spectrometric analysis . in bench top experiments with electrometer measurements of total spray current we have readily obtained apparently - stable “ sprays ” with a wide variety of liquids . gradually increasing the applied voltage results in a smooth very gradual transition to a corona discharge that seems to be readily reversible without the usual hysteresis loop . a most attractive feature wick sources is that they provide the enhanced analytical sensitivity of esims at very low flow rates while accommodating large flow rates of primary liquid , e . g . through the tee of fig3 . the results just described , along with those of many similar experiments , show that the wick injector of the invention , of which fig3 schematically represents one embodiment , actually provides higher analytical sensitivity with sample liquid flowing into the source at a rate of one ml / min than the standard needle injector in a typical es source can provide at the flow rates of one or two ul / min that are typical of conventional es sources . clearly , the reason for this increase in sensitivity is the very small rate of flow at which a wick of small diameter delivers liquid to the spray . investigators who have studied electrospray dispersion of liquids have long recognized that the size of the charged droplets that are produced decreases with decreasing flow rate into the spray . indeed at flow rates much below one ul / min the droplets become so small that they are invisible . such tiny droplets evaporate very rapidly and completely within in a very short distance from the tip of the taylor cone . consequently , the tip of the wick injector can be located very close to the aperture that passes the mixture of ions and bath gas , e . g . the inlet aperture of capillary tube 4 in fig1 . therefore , the fraction of the total amount of analyte in the spray cone that is intercepted by the aperture , thus passing into the vacuum system and thus to the mass analyzer , is much larger than is the case for more conventional es sources which typically operate at flow rates above one ul / min . at those higher flow rates the tip of the infection needle must be further back from the aperture so that the droplets , which are larger than those from a wick operating at much lower flow rates , will have time to evaporate . consequently , the fraction of the spray cone that passes into the vacuum system for mass analysis is substantially smaller . when the flow rate of sample liquid into the cone - jet spray is small , the total flux of sample is small but the fraction of that total flux that is transformed into ions entering the analyzer is large . in sum , the ratio of mass spectrometer signal to the mass of analyte required and consumed , i . e . the analytical sensitivity and efficiency , can be much larger with the small sample flow rate that a wick injector can provide , than with the higher sample flow rates of conventional es sources . indeed , in many of those conventional sources , especially those that do not use a counter current gas flow to desolvate the droplets and ions , it is customary to offset the injection needle from the axis of the aperture leading to the vacuum system . the reason for this offset is that the droplets on the periphery of the spray cone are usually substantially smaller than those nearer the spray axis . moreover , the drying gas in that peripheral region has less solvent vapor . both of these characteristics mean more rapid and more complete vaporization of the droplets , higher ionization efficiency and thus higher ion currents at the detector , even though the quantity of analyte that enters the vacuum system is very small . the advantages of esi with very low flow rates to obtain small droplets and high sensitivity have gained much attention since m . s . wilm and m . mann [ int . j . mass spectrom ion proc . 136 , 167 ( 1994 )] introduced injectors of small bore glass or quartz tubing with ends drawn out to fine tips by “ pulling ” techniques long used by cell biologists to make tiny probes and “ clamps ”. the inside diameters of these drawn needles can be as small as one or two microns . a thin metal coating applied to the outside surface of the glass down to the tip provides electrical contact with the emerging solution . a desired quantity of sample solution is injected into the large bore end and gas pressure is applied until liquid starts emerging from the tip , after which the pressure can be relieved . by means of a wire clamped to the metal - coated exterior of the injector needle and connected to a power supply an appropriate potential difference can be maintained between liquid emerging from the tip and the inlet aperture of a tube or orifice leading into the vacuum system . flow rates as low as a few nanoliters per minute give rise to an extremely fine spray which can consume as little as one microliter of sample solution in 45 minutes or more . after the spray starts the liquid flows by capillarity alone , just as in the wick source of the invention . dubbed “ nanospray ” this technique has been widely adopted and several companies are now providing the metallized needles ready for use . although this nanospray technique may at first glance seem very similar to the wick injectors of the invention , the latter offer some substantial advantages : 1 . in order to start the flow of liquid and thus the spray with these glass silica needles one must sometimes pressurize the liquid with a gas or a deliberately fracture a bit of the tip by crushing it slightly against a hard surface . flow in the wicks of the invention starts automatically as soon as they are wet by sample liquid and the electric field is turned on . 2 . because the exit aperture of a nanospray tube is so small , one must exercise extreme care in avoiding the presence of any particulate matter in the liquid sample used to load the probe . even when precautions are taken to eliminate particle , it only takes one stray particle to obstruct the flow so that in practice plugging is still a problem . the nature of the wick is that the area over which liquid can enter the wick by capillarity is very large so that very close packing of a large number of particles would be required to prevent liquid from reaching the wick interior . thus , the external surface of the wick filters out or exludes particles from interior passages through which the liquid passes to reach the tip the electric field disperses it into the small droples of the spray . thus no special care is needed in preventing particulates from being included in the sample liquid during its preparation . plugging has never been a problem . 3 . the bore of the needle tip on a nanospray injector is much smaller than the bore of the tube from which the needle is drawn and into which sample liquid is introduced . thus , the flow velocity during operation is very much smaller in the large bore part of the needle upstream than in the much smaller bore of the needle at the tip . a long time is thus required for the small flow through the tip to remove any appreciable amount of fluid from the large bore section . no way has yet been found to couple one of these needles with an lc column so that the liquid composition in the spray can respond quickly to composition changes in the effluent from the lc column . in the wick injector of the invention , the dead volume is minimal and the flow velocity is uniform throughout its length . consequently the response time of the wick injector is fast enough so that chromatograph peaks only a few seconds wide and a few seconds apart can be sampled into an electrospray mass spectrometer in rapid succession with minimal change in the composition - time dependence . such responsive sampling of large lc effluent is not yet possible with nanospray injectors now available . worthy of note in fig4 c is the appearance of peaks in the spectrum at m / z values above 1127 that did not show in the reference spectrum of 4 b . as pointed out above , the 4 c spectrum was obtained during the middle four seconds of the tic peak in panel 4a . in a spectrum taken during the first few seconds of the tic peak duration the peaks at the higher m / z values 4 c do not appear . in a spectrum taken during last few seconds the peaks at lower m / z values are substantially more prominent than in fig4 c . the m / z values and the spacing of all the peaks in both spectra leave no doubt that they all are due to protonated ions of cytochrome c . thus , the question arises as to why the ions with the highest m / z values showed up in fig4 c but not in fig4 b . we believe that these differences can be accounted for by the following scenario . chowdhury et al [ j . am . chem . soc . 12 , 9012 ( 1990 )] found that when cytochrome c molecules have a folded or compact conformation in solution , their es ions have fewer charges than when the molecules in the solution are in an unfolded or denatured conformation . the solution used to obtain the reference spectrum in fig4 b comprised a methanol - water solution of cytochrome c in which the protein molecules were denatured ( unfolded ) by the alcohol . thus , the numbers of charges on its es ions were high enough so that their corresponding peaks in fig4 b all had m / z values less than 1127 . the spectrum of fig4 c , on the other hand , was obtained when a 100 ul sample slug of that same solution was injected into a stream of pure water flowing at 1 ml / min flow . when that slug of methanol - water solution passed through the wick the chromatographic retention time of the solute protein on the wick was longer than the retention time of the methanol . thus , some of these protein molecules were retained long enough to elute into the pure water that followed the slug of sample solution that was injected . in the absence of methanol enough of them were able to refold by the time they were transformed into ions in the electrospray . the ions from these refolded molecules had fewer charges than their denatured counterparts and thus account for the peaks at m / z values above 1127 in fig4 c . this admittedly speculative explanation is at least consistent with the results shown in fig4 b and 4c . it is given further credence by two additional observations . the spectrum obtained during the first four seconds of the peak of fig4 a showed no evidence of ions with m / z values above 1127 . the spectrum obtained during the last four seconds of that peak showed a substantially greater abundance of ions with m / z values below 1127 than are seen in the spectrum of fig4 c which was obtained near the middle of the peak . the ions with m / z value below 1127 have fewer charges because their parent molecules had a more compact conformation . in the experiment of fig4 c the solvent of the injected sample was 50 — 50 methanol - water in which the protein molecules were denatured with a less compact conformation and would be expected to have more charges and thus m / z values below 1127 . in units of time the base width of the injection peak in panel b is 2 . 7 times the injection time , suggesting some retention of the protein molecules by the wick substance . this “ suggestion ” is confirmed by our finding that if the the wick is shortened , the width of the peak decreases . moreover , the peak is appreciably narrower when insulin is the analyte , all other things being the same . insulin is a much smaller molecule than cytochrome c and would seem likely to have a shorter retention time in the wick . the mobile phase into which the sample solution was injected was pure water . thus , the retained molecules desorbing from the cellulose during the last few seconds of peak duration would find themselves in nearly pure water and would fold up to become more compact . therefore , they would have fewer charges when they desorbed from their es droplets which also would be mostly water . this scenario is speculative but it is entirely consistent with our finding that the peaks for ions with higher m / z values ( lower charge states ) were always relatively higher in spectra taken during the later stages of injection of sample solution into the primary flow of pure water . this scenario is also consistent with the observation that with short wicks the peaks at higher m / z values are much less pronounced . indeed when the wick was shortened to a length of 5 mm there were no discernible peaks with m / z values above 1127 . the reason that shorter wicks provide fewer ions with high m / z values is simply their decreased capacity for adsorbing solute molecules . the only protein molecules that can desorb into pure water are those already adsorbed on the wick when the passing solvent mobile phase changes to pure water from methanol - water . for the 5 mm wick the amount of protein in the wick that could desorb into water , and thus refold to produce ions with low charge states , was so small that peaks due to those low - charge - state ions were hardly visible in the spectrum . implicit in the results just described is the idea that the wick was providing some chromatographic retention analogous to what happens in so - called paper chromatography . in that technique some analyte sample ( usually in solution ) is deposited as a “ spot ” on a strip of paper near one end . “ development ” of a chromatogram is then brought about by suspending the paper strip above a pool of a solvent into which the spot end is dipped . driven by capillarity the solvent mobile phase begins to migrate up through the paper strip toward the far upper end . the species in the deposited spot of sample desorb into the advancing solvent mobile phase and are carried along with the flow of liquid but at a lower average velocity relative to the paper than the liquid . this velocity lag or slip of the solute molecules relative to the liquid is due to their repeated adsorption to , and subsequent desorption from , the paper substance . because they are retained at rest on the paper for a short time between each adsorption and desorption their net forward ( upward ) progress is perforce less than that of the liquid . in general the characteristic time of this chromatographic retention , and therefore the effective upward velocity of the solute , is different for each species . consequently , when the capillarity - driven flow of the liquid stops , ( e . g . when the front reaches the upper end of the paper strip or the bottom end is removed from the pool of liquid ), each species of the original sample will occupy a somewhat diffuse spot at a different location ( height ) on the strip . the combination of liquid pool and sample - bearing paper strip is often enclosed in a case or housing so that the surrounding gas is saturated with liquid vapor , thereby preventing evaporation that would dry out the strip and stop the action . when this development process has proceeded as far as it can , or to an earlier satisfactory extent , the strip , which comprises a chromatogram of the sample species , is removed from the enclosure . as background for interpreting such a paper chromatogram it is first appropriate to recall what happens in column chromatography of liquids . in those techniques the retention time for a species in the column is the interval between injection of sample at the column inlet and emergence from the column exit of the peak containing that species . methods for detecting that emergence include among others : spectral absorption or fluorescence , electrical conductivity , voltammetry , and mass spectrometry . the latter is generally the most complex and expensive but has the great advantage of providing fairly positive identification of almost any peak species . whatever the detction method , the relative magnitude of the detector signal ( peak height ) for each species is taken as a measure of its relative abundance in the injected sample . to “ read ” such a paper chromatogram one must somehow determine the loci of the spots or bands for the separated species . a number of methods have been used to make the spots visible so their location can be determined . the include illumination with radiation of appropriate wavelength to make the analyte species fluoresce or to enhance differences in relectance or absorbance of the spot . sometimes application of a reagent solution can react with analytes of interest to produce changes in color . if one or more of the analyte species contains radioactive isotopes , one can image the chromatogram with photographic film or scan it with a counter . by whatever method may be used the location of an analyte species on the paper strip is the counterpart of the retention time of a peak in conventional gas or liquid chromatography . the pc “ retention time ” is thus inversely proportional to the distance of a species spot from the point of deposition of the sample on the strip . in the absence of any other information that distance is the only measure of a species identity . “ paper chromatography ” ( pc ) as just described , was once in widespread use but has now been largely supplanted by so - called “ thin layer chromatography ” ( tlc ) which is an exactly analogous procedure except that the stationary phase is a granular solid distributed in a thin layer on the surface of a plate , usually made of glass or plastic . clearly , this stationary phase must be wettable by the mobile phase so that the latter is indeed mobile by virtue of capillarity . flow of the mobile phase in conventional liquid chromatography is usually maintained by application of sufficiently large pressure differences across the column . even when the stationary phase is not wettable by the mobile phase , as is the case in so - called “ reverse - phase lc ,” a high pressure difference can maintain flow through the column and bring about intimate contact between the two phases . the use of high pressure to maintain the flow of mobile phase through the stationary phase also allows one to increase resolving power by using long columns . in pc or tlc the migration velocity of capillarity - driven flow decreases with increasing distance from the source liquid . consequently , the effective length of the separating region , and therefore the resolving power , are limited to much lower values than can be achieved in lc . however , so - called “ forced flow ” development techniques based on centrigfugal force or hydrostatic pressure are being developed and promise to enhance the latter &# 39 ; s resolving power . even without such enhancement pc and tlc are widely used because of their convenience , simplicity , and economy in particular , by appropriate spacing of the spots at which analyte samples are deposited on the plate or a broad strip of paper one can simultaneously carry out separation in several parallel channels on the same plate or sheet of paper . this multiplexing ability has led to very wide use of tlc in situations where a great number of samples need to be examined and a high resolving power is not required . e . g . for quality control on production lines to determine whether process product is within specifications . however , it is always advantageous and sometimes necessary to obtain more positive identification of a peak or spot species on a pc . for this purpose mass spectrometry would be the most informative and versatile detection method but till now there has been no routine and simple method for applying the virtues of ms detection to the identification of spot species on a pc or tlc chromatogram . a similar problem occurs when one wants to identify the species in a spot or band on a gel electrophoresis plate . some success has been obtained in these situations by excising the stationary phase material , along with its adsorbate , from a spot on the plate , mixing it with a small amount of appropriate solvent , and removing the stationary phase material by filtration or centrifugation . the resulting solution can then be analyzed by esms to identify the spot species . alternatively , one can apply some solvent to the spot or band and then “ blot ” some of the resulting solution into a piece of paper from which the absorbed sample species can be eluted with solvent . the resulting solution is then electrosprayed into a mass spectrometer system . these excising and eluting procedures are effective but relatively slow and awkward to carry out . they require great care because the amount of analyte in the spot is so small . an advantage of the invention is that one can in press a short length of wick , e . g . a strip of paper , cloth or other material , against a spot on the plate to which a drop of solvent has been applied . capillarity will suck some of the resulting spot solution into the wick which can then be removed . one end of the wick can then be immersed in a small pool of appropriate solvent and the other end positioned in front of an aperture leading into a vacuum system containing a mass analyzer as has been described . one pole of a power supply is then connected to the wick , either directly by means of a small wire or strip of metal foil , or indirectly through the pool of solvent in to which the end of the wick is immersed . the other pole of the power supply is connected to the tube or plate housing the aperture . at a sufficiently high potential difference between the wick and the aperture solution will be electrosprayed from the wick to produce ions that will be entrained in the gas entering the aperture and thus transported to the mass analyzer for interrogation . indeed , one can similarly apply a strong field to the end of the paper strip or tlc through which capillarity is maintaining a flow of mobile phase liquid during development of the chromatogram . the field then electrosprays the liquid off the end of the strip to providing ions for mass analysis of analyte in a spot or band as it arrives . it is desirable to chamfer the end of the strip to provide a fairly sharp tip or point at which both the liquid stream lines and electric field lines will converge , thereby providing a well defined origin for the spray . thus the paper strip or tlc plate becomes the “ wick ” of fig1 through which separated analyte species in solution are introduced one at a time into the electrospray from which they emerge as ions . some of those ions pass through the aperture into the vacuum system for analysis by an appropriate mass analyzer . in sum , the process is the counterpart of a standard lc - ms arrangement in which the customary lc has been replaced by the strip of paper or tlc plate through which mobile phase moves by capillarity . this procedure , as described , provides ms detection and identification of every species in the original sample , just as is the case in conventional lc - ms . clearly , this procedure cannot very well be simultaneously carried out on each of a multiplicity of parallel channels on a single plate or sheet of paper . but it is straightforward to cut a strip containing a channel of interest from the plate or sheet of paper and carry on the esms procedure on that strip and subsequently on as many of the other such strips as needed . such a complete analysis can take a substantial amount of time and is not always necessary or desirable . it can happen that one wants positive identification of species in only one or two spots on the developed chromatogram . one then has merely to “ blot ” some of the spot species on to a separate short strip of paper , dip one end of that strip into a source of solvent mobile phase and electrospray that solvent mobile phase off the other end of the strip into the vacuum system containing a mass spectrometer . alternatively , one can cut out from the sheet or plate a small section that contains the spot or spots of interest and carry out the procedure on that section alone . the need for analysis of analyte in one or more particular spots on a pc or tlc chromatogram may become apparent only sometime after it had been developed . in such a situation the pc and tlc technique shows another substantial advantage relative to conventional lc . because the paper and the plates are very inexpensive and compact it becomes feasible to dry and store any or all chromatograms for future reference . then one can at any time and retrieve any stored chromatogram , and apply the above - described methods to one or more of its sections . other variations on these general themes will be obvious to those skilled in the art .	7
the thyristor according to an embodiment has a semiconductor structure with a semiconductor body in which a p - doped emitter , an n - doped base , a p - doped base and an n - doped emitter are arranged successively in the vertical direction of the semiconductor body . furthermore , the semiconductor structure has a radiation - sensitive breakdown structure , a gate electrode which is arranged at a distance from the breakdown structure in the lateral direction of the semiconductor body , and a trigger stage structure , which has at least one trigger stage with an n - doped auxiliary emitter , which forms a pn junction with the p - doped base . in an embodiment , the n - doped auxiliary emitter of a trigger stage is embedded in the p base and may preferably extend as far as the front face of the semiconductor body , that is to say as far as the side of the semiconductor body facing away from the p - doped emitter . in an embodiment , the object of the trigger stage is to amplify a current flowing via the pn junction between the p base and the auxiliary emitter and to pass it on within the p - doped base in the direction of a next trigger stage . the direction of this current which preferably may flow in the lateral direction in the p - doped base is also referred to as the trigger current direction . the trigger current direction depends on the physical form of the thyristor . in the case of a rotationally symmetrical thyristor , the trigger current runs in the radial direction . according to an embodiment , when a plurality of trigger stages are present , at least one of the trigger stages has an electrode which is arranged on the front face and makes contact not only with the n - doped auxiliary emitter but also with the p - doped base . this electrode may be preferably formed from metal , for example aluminum . the electrode can likewise also be formed from heavily n - doped polysilicon . the thyristor according to an embodiment can be triggered both electrically , by application of a voltage to the gate electrode , and by means of radiation which is incident on the radiation - sensitive breakdown structure . if the thyristor is triggered by incident radiation , then a trigger current is created in the area of the radiation - sensitive breakdown structure which propagates in the p - doped base in the trigger current direction in the direction of the n - doped emitter , and is amplified by means of the trigger stage structure . the triggering process for the thyristor is completed when the amplified trigger current reaches the n - doped main emitter . according to an embodiment , the radiation - sensitive breakdown structure is in the form of a bod structure ( bod break over diode ), that is to say a breakdown diode . the trigger stage structure advantageously may comprise a plurality of trigger stages , in order to amplify the trigger current from one trigger stage to the next . these trigger stages in the trigger stage structure are matched to one another and are matched to the breakdown structure in such a manner that the triggering progresses in a controlled manner , starting from the radiation - sensitive breakdown structure , as far as the n - doped main emitter . in order to also allow the thyristor according to an embodiment to be triggered electrically , the gate electrode is provided and is arranged on the front face of the semiconductor body , and the thyristor can be triggered by application of an external electrical voltage to this gate electrode . when an electrical trigger pulse is applied , a trigger current propagates in the direction of the n - main emitter , starting from the area of the gate electrode . the gate electrode can be preferably arranged in the lateral direction between the radiation - sensitive breakdown structure and the n - doped emitter . according to an embodiment , the trigger stage structure comprises at least one inner trigger stage and at least one outer trigger stage , with the at least one inner trigger stage being arranged in the lateral direction between the radiation - sensitive breakdown structure and the gate electrode , and with the at least one outer trigger stage being arranged in the lateral direction between the gate electrode and the n - doped emitter . a trigger current which is produced at the radiation - sensitive breakdown structure first of all passes in the trigger current direction in an arrangement such as this through the inner trigger stage , then through the gate electrode and then through the outer trigger stage before reaching the n - main emitter . the trigger current is in this case amplified from one trigger stage to the next . in order to monitor the triggering process , the electrical voltage can be detected in the p base via the gate electrode , which is arranged between the radiation - sensitive breakdown structure and the n - doped main emitter . in the case of light triggering , when the trigger current which propagates in the p - doped base from the radiation - sensitive breakdown structure in the direction of the n - doped emitter reaches the gate electrode , then the electrical voltage which is applied there changes , and its monitoring allows monitoring of the triggering process . the information obtained in this way can be used , for example , to switch off the thyristor , or to influence it in some other way , or else to drive an external circuit . in order to limit the trigger current which propagates in the p - doped base , particularly when incident radiation is used for triggering , the different embodiments provide for the resistivity to be increased in one section of the p - doped base . in this case , the gate electrode can be arranged in the lateral direction , preferably between this section and the n - doped emitter . if the thyristor in this arrangement is triggered by application of an electrical voltage to the gate electrode , then this section of the p base with an increased electrical resistance does not limit the trigger current . alternatively , the gate electrode can be arranged in the lateral direction both between the radiation - sensitive breakdown structure and the section of the p - doped base with an increased electrical resistance , and within the section of the p - doped base with an increased electrical resistance . furthermore , the embodiments provide for a plurality of such sections with an increased electrical resistance to be arranged in the p - doped base , in which case each individual one of these sections can be arranged in the same way as the section described above . in order in particular to achieve an optimum triggering behavior in this case , different sections such as these may have the same or different absolute resistance values or resistivity values . in order to provide protection against electrical flashovers in particular in the area of the inner trigger stages and / or the areas of the p base with an increased resistance , it is advantageous to provide the front face of the thyristor , if appropriate including the electrodes arranged on it , with a protective lacquer in sections . the protective lacquer should have as high a dielectric constant as possible . the thickness of the protective lacquer layer may be up to several hundred micrometers . according to an embodiment , the area which is provided with the protective lacquer is located between the radiation - sensitive breakdown structure and the gate electrode . in order to avoid adversely affecting any electrical pressure contact with the gate electrode , for example by means of a contact stamp , it is advantageous for the thickness of the protective lacquer layer to be less than the vertical size of the gate electrode . by way of example , the thyristor has a central area in which the radiation - sensitive breakdown structure and at least one trigger stage of the trigger structure are arranged , and may in particular be rotationally symmetrical . in this case , it can be advantageous for the gate electrode and / or at least one auxiliary emitter likewise to be rotationally symmetrical , at least in sections , and preferably to be annular . the central area in this embodiment is located in the area of the axis of symmetry . a contact stamp is provided in order to make electrical contact with the gate electrode of a thyristor according to an embodiment , and is pressed onto the gate electrode . the contact stamp optionally has contouring , such as a projection , a tab , a step , a slot , a groove or the like , in order to prevent the gate electrode from sliding or sliding off in the lateral direction of the semiconductor body . this contouring is designed such that it interacts with the gate electrode and / or with contouring which is complementary to it and is arranged on the semiconductor body . alternatively or additionally , the contact stamp can also be held in its integral position , in which contact is made with the gate electrode , by means of a housing of the thyristor . in order that any protective lacquer layer which may be applied to an area of the front face of the semiconductor body is not damaged by the contact stamp , the distance between the contact stamp , which is pressed onto the gate electrode , and the front face must be greater than or equal to the thickness of the protective lacquer layer in this area . in order to allow the thyristor according to an embodiment to be triggered both electrically and by incident radiation , it is advantageous for the contact stamp to have a radiation channel in order to pass incident radiation into the area of the radiation - sensitive breakdown structure . the radiation channel may optionally be provided with a window , a lens , a prism , a filter or some other optical element through which radiation can pass and through which radiation which is required for triggering of the thyristor can pass , and through which the incident radiation is passed to the radiation - sensitive breakdown structure . if , for certain applications , it is not desirable or is not necessary for the thyristor to be triggered by radiation , it is also possible to use a contact stamp which has no radiation channel , or whose radiation channel is provided with an element which blocks incident radiation . in this case , the thyristor can be triggered only by means of an electrical voltage via the contact stamp . in a corresponding but converse manner , it is also possible to use a contact stamp which has a light channel , but which is electrically isolated from the gate electrode . a contact stamp such as this preferably may have two mutually complementary contoured areas , one of which is arranged on the thyristor and the other of which is arranged on the contact stamp , and which are used to fix the contact stamp with respect to the thyristor . according to an embodiment , the thyristor can be triggered at the same time or with a time offset optically by incident radiation and electrically by means of an electrical trigger pulse . the thyristor according to an embodiment thus provides a universal thyristor which can be matched in a simple manner to the respective requirements without having to modify the thyristor itself . a thyristor according to an embodiment can optionally also have one or more integrated protective functions in any desired combinations . one such protective function is represented by a bod structure , as already mentioned . this protects the thyristor against overvoltage and can be set such that the thyristor triggers reliably at the location of this bod structure when a voltage which is applied in the forward direction exceeds a specific threshold value . by way of example , an externally formed and non - integrated overvoltage protective function for a thyristor which can be triggered electrically is known from l . o . eriksson et al ., conc . record of the 1990 ieee industrial applications society annual meeting , volume 2 , pages 1648 - 1657 . further protective functions are , for example , a du / dt protective function or a tq protective function . the du / dt protective function ensures that the thyristor triggers correctly even when a voltage which is applied in the forward direction to the thyristor rises very quickly . a du / dt protective function such as this is explained in more detail , by way of example , on pages 267 - 270 of the publication h .- j . schulze et al . : ispsd 2000 , toulouse . a tq protective function , as is described by way of example in de 199 47 028 a1 , protects a thyristor against dynamic voltage transients which occur within the recovery time ( recovery time protection ). in the case of a thyristor according to an embodiment which can in principle be triggered both by a light pulse and by a current pulse , a suitable apparatus such as a corresponding contact stamp makes it possible to ensure that the thyristor can be triggered only by light , only by an electrical trigger pulse , or else by light and by an electrical trigger pulse . furthermore , any desired protective functions , in particular the abovementioned functions of overvoltage protection , du / dt protection and recovery time protection , can be combined with one another in a thyristor such as this , and in principle it is even possible not to provide any protective function . the thyristor , only a detail of which is illustrated in fig1 , is symmetrical with respect to the axis a - a which is shown by dashed lines and passes through the center point of the component . the component may be preferably rotationally symmetrical with respect to this axis a - a and thus has a circular shape in plan view , which is not shown in any more detail . the thyristor has a semiconductor body 1 with a front face 11 and a rear face , facing away from the front face . a p - doped emitter 8 , an n - doped base 7 which is adjacent to the p - doped emitter , a p - doped base 6 which is adjacent to the n - doped base , and an n - doped emitter 5 which is embedded in the p - doped base 6 are arranged successively in a vertical direction in the semiconductor body . the p - doped emitter 8 and the n - doped base 7 are also referred to as the anode - side emitter and the anode - side base , and the p - doped base 6 and the n - doped emitter 5 are also referred to in a corresponding manner as the cathode - side base and the cathode - side emitter . the breakdown structure 10 in the form of a bod structure is provided in the central area of the component and is formed in such a way that the n - doped base 7 extends further in this area than in the other areas as far as the front face 11 of the semiconductor body , with curved sections 61 , 62 of the p base 6 being formed adjacent to this area . when a voltage is applied in the forward direction , in which the pn junction between the n base and p base is reverse - biased , the field strength in the area of the curved sections 61 , 62 is higher than the field strength in the other areas of the component , thus fixing the location of the first voltage breakdown in the component to be in the area of this bod structure . a relatively lightly p - doped zone 63 may be preferably provided between the curved sections 61 , 62 of the p base 6 and the sections of the p base 6 adjacent to them . the bod breakdown structure 10 defines the withstand voltage of the component in the forward direction , with the thyristor being triggered when an avalanche breakdown occurs in the area of the breakdown structure 10 . this triggering can be initiated by application of a high forward voltage or , with a forward voltage applied , by incident radiation as well , which strikes the front face in the area of the breakdown structure 10 . the incident radiation can be preferably light at a wavelength in the range between about 800 nanometers and 1000 nanometers . the n - doped emitter 5 forms the main emitter of the component , which makes contact with a main electrode 9 . one or more auxiliary emitters 51 is or are provided in addition to this main emitter . fig1 shows a plurality of such auxiliary emitters 51 , which are arranged at a distance from one another in the lateral direction between the central area with the bod structure 10 and the n - doped main emitter 5 . each of these auxiliary emitters 51 makes contact with an electrode 91 , which short - circuits the auxiliary emitter and the surrounding p - doped base 6 . one of the auxiliary emitters 51 and an electrode 91 which makes contact with the auxiliary emitter 51 in each case form one trigger stage of a trigger stage structure , which is also referred to as an amplifying gate structure ( ag structure ). this trigger stage structure ensures amplification of the trigger current which occurs in the event of an avalanche breakdown , and results in rapid and uniform propagation of the trigger current in the p base 6 , and thus in rapid and uniform triggering propagation in the component . the individual trigger stages 51 , 91 ( 1st ag to 5th ag ) trigger successively from the inside outwards in the radial direction of the component when an avalanche breakdown occurs . in order to limit the current which flows radially outwards in the direction of the main emitter in the base during a triggering process , the p base 6 preferably may have a relatively lightly doped section 64 between two of the ag structures . in the illustrated example , this is the section 64 of the p base , which is located between the third ag structure ( 3rd ag ), and the fourth ag structure ( 4th ag ), originating from the central area . the withstand voltage of the component in the forward direction is governed by the geometry of the p base and of the n base in the area of the bod structure 10 , and by the doping concentration in the area of the p base 6 and of the n base 7 in the area of the bod structure . a gate electrode 92 is arranged on the front face 11 of the semiconductor body 1 , via which the thyristor can be triggered electrically by application of an external trigger voltage . when a trigger voltage is applied and / or a radiation pulse is supplied a contact stamp 200 may be preferably provided , with reference to fig2 , whose dimensions are matched to the thyristor . fig2 shows the central area of the thyristor 1 with the contact stamp 200 applied to it , in the form of a cross - sectional side view . a protective lacquer layer 95 is applied to the front face 11 of the thyristor in an area which is located within the annular gate electrode 92 , in particular for protection against electrical flashovers , and its thickness may be up to a few hundred micrometers . the protective lacquer layer covers the front face 11 of the semiconductor body 1 and the electrodes 91 ( which are arranged in this area ) of the trigger stages , with the exclusion of the area above the radiation - sensitive breakdown structure 20 . the protective lacquer layer may also be designed to allow optical radiation to pass through it . in this case , the protective lacquer layer preferably also may cover the area of the front face 11 above the radiation - sensitive breakdown structure 20 . the contact stamp 200 is pressed by an external force onto the front face 11 of the thyristor , so that a contact surface 201 a of the contact stamp 200 makes an electrically conductive contact with the gate electrode . the contact stamp 200 is rotationally symmetrical and has an electrically conductive element 201 , whose geometry is matched to the geometry of the gate electrode 92 and which has a contact surface 201 a which makes contact with the gate electrode 92 . the electrically conductive element 201 is in the form of a sleeve with a circular cross section , and its preferred thickness dm is between 0 . 1 mm and 1 mm . in the area of its contact surface 201 a , the electrically conductive element 201 has a step 201 b in order to prevent the contact stamp 200 from sliding or sliding off the gate electrode 92 in the lateral direction . instead of a step , a projection , a tab , a slot , a groove or a similar apparatus can also be provided , which is designed such that it interacts with an apparatus which is complementary to it and can be arranged on the semiconductor body 1 , or preferably with the gate electrode , and thus fixes the contact stamp 200 in its intended position . the cross section of the electrically conductive element 201 may also be square , rectangular or may be formed in some other way , even asymmetrically . the important factor is that the electrically conductive element 201 can make sufficiently good contact with the gate electrode 92 of the thyristor . an inner body 202 which is connected to the electrically conductive element 201 is arranged in it . the inner body 202 may be in the form of an electrical conductor or an insulator , in sections or completely . the inner body 202 in particular contributes to the mechanical robustness of the contact stamp 200 although it is not absolutely essential , in particular if the electrically conductive element 201 is sufficiently robust in its own right . the electrically conductive element 201 and the inner body 202 can optionally be formed integrally . on its side facing the semiconductor body 1 , the inner body 202 is sufficiently far away from the protective lacquer layer 95 that the latter is not damaged by the inner body 202 . the contact stamp 200 has a radiation channel 210 through which radiation of any desired type , preferably light including infrared , visible and ultraviolet light , can pass . an optical element 203 through which radiation can pass and which is composed , for example , of plastic is arranged in the radiation channel 210 and is designed such that radiation incident from above strikes the radiation - sensitive breakdown structure 20 . the diameter of the radiation channel 210 is in this case matched to the diameter of the radiation - sensitive breakdown structure 20 . depending on the respective intended use , contact stamp 200 may be designed in widely differing ways , as will be explained in the following text with reference to fig3 to 7 , which illustrate various contact stamps in the form of a cross - sectional side view . fig2 shows a contact stamp which corresponds essentially to the contact stamp shown in fig2 , but in which there is no optical element in the radiation channel . the contact stamp is rotationally symmetrical and has an electrically conductive element 201 with a contact surface 201 a which is arranged on its contact face and is intended to make contact with the gate electrode of a thyristor according to an embodiment . the electrically conductive element 201 is in the form of a sleeve with a circular cross section , and its preferred thickness dm is between 0 . 1 mm and 1 mm . the cross section of the electrically conductive element 201 may also be square , rectangular or may be formed in some other way , even asymmetrically . the important factor is that the electrically conductive element 201 can make sufficiently good contact with the gate electrode 92 of the thyristor . an inner body 202 which is connected to the electrically conductive element 201 is arranged in it . the inner body 202 may be in the form of an electrical conductor or an insulator , in sections or completely . the inner body 202 in particular contributes to the mechanical robustness of the contact stamp 200 although it is not absolutely essential , in particular if the electrically conductive element 201 is sufficiently robust in its own right . the electrically conductive element 201 and the inner body 202 can optionally be formed integrally . the contact stamp illustrated in fig4 corresponds to that illustrated in fig2 , but without any step on the contact face of the electrically conductive element 201 . with reference to fig5 , the inner body 202 may be in the form of an optical element 203 through which radiation can pass . if , in certain applications it is not desirable or is not necessary to trigger a thyristor according to an embodiment by radiation , it is also possible to use a contact stamp 200 whose radiation channel is provided with an element which blocks incident radiation , or which has no radiation channel at all . fig6 shows a cross section through a contact stamp 200 such as this . the inner body 202 has no radiation channel and is composed of a material through which the radiation which would be suitable for triggering of the thyristor cannot pass . furthermore , with reference to fig7 , it is optionally possible to provide the contact stamp 200 with insulation 205 in the area of the inner element 202 on its contact face . the insulation 205 may either allow radiation to pass through it , or may block radiation . by way of example , plastic or quartz glass are suitable as materials for this purpose . insulation through which radiation can pass can be used in conjunction with a radiation channel to also achieve high dielectric strength in the contact - making area of the contact stamp .	7
the drill 10 comprises a steel shank 12 and a carbide tip 14 brazed in the end of the shank or the drill may comprise a single piece of carbide forming both the shank and the tip . the shank 12 is adapted to be held in a chuck and rotated about the central axis a in the direction r for drilling holes having closely controlled diameters in both concrete and steel . the tip 14 has two main flat top surface areas 16 , 18 located between front face 20 and rear face 22 both of which faces are parallel to the central axis a . the top surface 16 forms one main cutting edge 24 where it intersects front face 20 and top surface 18 forms another main cutting edge 26 where it intersects rear face 22 . the top surfaces 16 , 18 extend away from the central axis at an angle b of between 78 and 82 degrees with respect to the central axis a and are at an angle c of between 4 . 5 ° and 10 . 5 ° with respect to a plane p normal to the central axis a . back edges 28 , 30 respectively , are formed where the top surface 16 intersects rear face 22 and top surface 18 intersects front face 20 . a plane through cutting edge 24 and back edge 28 will intersect a plane through front face 20 at an angle h of between 79 . 5 and 82 . 5 degrees axis as does a plane through cutting edge 26 and back edge 30 also intersect a plane through rearface 22 . the two aforementioned planes intersect each other at an obtuse angle d of between 162 and 165 degrees ( acute angle 15 to 18 degrees ). the tip 14 also has two secondary top surface areas 32 , 34 which are located on either side between top surface 16 and the side face 36 , and the top surface 18 and side face 38 , respectively . the secondary top surface 32 forms a cutting edge 40 where it intersects front face 20 and secondary top surface 34 forms a cutting edge 42 where it intersects rear face 22 . the secondary top surfaces 32 , 34 extend from top surfaces 16 and 18 , respectively , at an angle e of 45 ° with respect to the central axis a . in addition to the cutting edges 24 , 26 , 40 and 42 , associated with top surfaces 16 , 18 , 32 and 34 respectively , there is a side cutting edge 44 formed by the intersection of the front face 20 and side face 36 and a side cutting edge 46 formed by the intersection of the rear face 22 and side face 38 . the cutting edges 44 , 46 so formed are parallel to the central axis a and it is the diagonal distance between the cutting edges 44 and 46 through the central axis a that determines the diameter hole capable of being bored . the flutes 48 serve , as in any conventional drill , to transmit the severed material from the area adjacent the cutting edges of the bit , and are concave in shape or shaped as a &# 34 ; v &# 34 ; notch , the intersecting surfaces of which form an included angle of 85 ° to 105 °. the cutting edges 24 , 26 , 40 , 42 , 44 and 46 as well as their novel configuration and angles associated therewith both to the tip surfaces which form the angles as well as those angles measured with respect to the central axis a result in a tip which is very effective in boring holes in concrete with excellent control over the size of the hole being bored . applicant has discovered , in addition , that by forming a v - shaped notch 50 between the top surface areas 16 , 18 and positioning the notch off - center of the central axis a , the tip resulting therefrom is capable of cutting steel as well as concrete . in addition , the control over the size of the hole being bored throughout its length was also materially increased . the notch 50 has side walls 52 , 54 which extend between front face 20 and rear face 22 . as the side wall 52 intersects front face 20 , a cutting edge 56 is formed and as the side wall 54 intersects rear face 22 , a cutting edge 58 is formed . as the tip 14 engages the workpiece ( not shown ), the point 60 where cuttings edges 24 and 56 meet and the point 62 where cutting edges 26 and 58 meet , are the starter or first part of the tip 14 to begin cutting . the cutting edges 24 , 26 are next to engage the workpiece gradually throughout their length . the cutting edges 40 , 42 follow to bring the hole being bored to the exact diameter of the tip 14 whereupon the side cutting edges 44 , 46 take over to smooth out the wall of the hole to the exact diameter . because the v - shaped notch 50 and the cutting edges 56 , 58 associated therewith are off - center of the central axis , the distance x shown in fig2 does not equal the distance y and thus not only are the starter points 60 , 62 off center but the top surfaces 16 and 18 are of unequal area and the cutting edges 24 , 26 associated respectively therewith are also of unequal length . it is this combination of off - center starter points 60 , 62 top surfaces 16 , 18 and cutting edges 24 , 26 that are primarily responsible for enabling applicant &# 39 ; s unique bit to be capable of cutting both concrete and steel . the backoff angle f of the bit surfaces 64 , 66 is approximately 45 ° with respect to the plane p and the helix angle g is between 27 ° and 33 ° also with respect to the central axis a . the drill 10 can also be provided with a bore 70 concentric with the central axis a , as shown by the phantom lines in fig2 and 3 , for permitting a lubricant or coolant to pass to the area of cutting tip . the drill of the present invention as herein described can be used repeatedly to drill a large number of holes in both concrete and steel without becoming dull rapidly in addition , the cutting edges can be often reground before the drill must be discarded . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention .	1
referring now to the drawings , fig1 illustrates an integrated circuit chip 100 that contains a plurality of i / o circuits 104 each electrically coupled to a power distribution network 108 via a corresponding power route 112 . power routes 112 have been sized and / or routed using an integrated power routing system and method of the present invention , e . g ., system 300 of fig3 and method 400 of fig4 . integrated power routing system 300 and integrated power routing method 400 are each described below in detail . however , in order to provide a context for a macro placement system and method of the present invention , chip 100 is described first . chip 100 may be any type that utilizes one or more power distribution networks 108 and i / o circuits 104 that need to be power routed to one of the power distribution networks . chip 100 may be of any type , e . g ., an application specific integrated circuit ( asic ) chip , processor , memory , system on chip or controller , among others . those skilled in the art will readily appreciate that chip 100 may be designed to perform any functions typical of integrated circuits and that the type of chip is generally not relevant to the broad scope of the present invention . power distribution network 108 may comprise a plurality of wires 120 located on one or more metal levels , e . g ., m 1 and m 2 , of chip 100 and a plurality of power pads 124 for connecting the chip to an external power supply ( not shown ). wires 120 may be arranged in any manner suitable for a particular design , such as the rectangular grid arrangement shown . it is clear from the discussion in the background section that power distribution networks , such as power distribution network 108 , are becoming performance limiting factors in modern chip designs . in addition to ir , em , and esd concerns , transient power supply collapse is a serious concern that may cause chip timing violations and potentially functional failure . in order to capture the transient response of the system , power distribution network 108 may be modeled as a linear rlc network . correspondingly , power pads 124 may be modeled as ideal voltage sources , and power distribution network 108 may be excited by time - varying current sources that capture the switching behavior of the active circuits . these current sources are applied at the locations of the circuits they represent . such a model 200 is illustrated in fig2 . referring again to fig1 , although each power distribution network may be modeled as an rlc network , for simplicity , power distribution network 108 may , if desired , be modeled as a resistive model , since dc simulation is sufficient for checking ir , em , and esd requirements . this significantly simplifies , and speeds up , the modeling , analysis , and checking for any electrical violations . correspondingly , the power pads 124 may still be modeled as ideal voltage sources and the active circuits may be modeled as dc current sources . power routes 112 of i / o circuits 104 typically do not follow a grid structure , as power distribution network 108 may . often , i / o power routes 112 look more like signal routes ( not shown ). thus , there is no regular power distribution grid that i / o circuits 104 simply tap into . instead , a connection , i . e ., a corresponding one of power routes 112 , has to be routed from the corresponding pst 128 to on - chip power distribution network 108 of the voltage domain to which the respective i / o circuit 104 belongs . fig1 also shows various blockages 132 , each of which is a physical area on chip 100 where i / o circuits 104 cannot be placed or where power routes 112 cannot pass through because some other circuit ( s ) is / are placed in that area . given a model , e . g ., model 200 ( fig2 ), of power distribution network 108 , modified nodal analysis can be applied to extract the system of equations represented by equation { 2 }. where g is a conductance matrix , x is a vector of node voltages , and i is a set of current stimulus exciting the system . the solution of the system of equation { 2 } provides the voltages at all the nodes and the currents flowing in all the branches . a node is defined as the intersection of two adjacent ( or same ) metal layers of like polarity ( e . g ., vdd , gnd , or vddx ). a branch is the metal segment between two nodes . node voltages are required for ir and esd checking . branch currents , on the other hand , are required for em checking . referring to fig3 , and also to fig1 , fig3 illustrates an integrated power routing system 300 of the present invention that may be used to automatically size and / or route i / o power routes , e . g ., power routes 112 of fig1 . integrated power routing system 300 may include , among other things , a power routing tool 304 , an electrical analysis tool 308 , and a tool integrator 312 that controls the power routing and electrical analysis tools in an iterative manner so as to automatically size and / or route the i / o power routes so as to meet ir , em , and esd and other requirements . power routing tool 304 may be any suitable tool known in the art for routing i / o power routes 112 . similarly , electrical analysis tool 308 may be any suitable tool for electrical analysis of i / o circuits , power network ( s ), power routes and other elements . an example of an electrical analysis tool that may be adapted for use as electrical analysis tool 308 in integrated power routing system 300 of the present invention is voltage storm ®, available from cadence design systems , inc . of san jose , calif . of course , each of power routing tool 304 and electrical analysis tool 308 may be custom made and / or integrated with one another . those skilled in the art readily understand the design and use of power routing and electrical analysis tools 304 , 308 , such that they need not be described herein in any further detail in order for those skilled in the art to make and use the present invention to its fullest scope . tool integrator 312 may be operatively configured to perform an integrated power routing algorithm 316 that utilizes the functionality of power routing tool 304 and electrical analysis tool 308 in an iterative manner to arrive at suitable widths ( w ) and / or routings for i / o power routings 112 being routed using integrated power routing system 300 . the functions of tool integrator 312 are described below in connection with method 400 of fig4 . it is noted that tool integrator 312 need not be separate and distinct from power routing tool 304 and / or electrical analysis tool 308 as shown . rather , tool integrator 312 may be integrated into one , the other , or both of power routing and electrical analysis tools 304 , 308 . tool integrator 312 is shown as separate from power routing and electrical analysis tools 304 , 308 merely to illustrate its separateness in terms of function . referring to fig4 , and also to fig1 and 3 , fig4 illustrates an integrated power routing method 400 of the present invention that may be implemented by tool integrator 312 ( fig3 ) to automatically size and route i / o power routes , e . g ., power routes 112 of fig1 . as those skilled in the art will appreciate , method 400 , and other methods in accordance with the present invention , may be executed in any suitable software / hardware context . at step 404 , method 400 may be started . a typical starting point for method 400 occurs once chip 100 has been floorplanned and all i / o circuits 104 have been assigned and placed . however , it is noted that , depending upon the type of chip 100 , the starting point may be at another stage of design . for example , if chip 100 is of a system on chip design , starting point may occur at a time when a particular region of the chip has been floorplanned and corresponding i / o circuits 104 have been assigned and placed therein . at step 408 , tool integrator 312 , e . g ., via power routing tool 304 , may assign to each power route 112 a minimum width recommended by the technology used to make chip 100 , or portions of the chip , at issue . those skilled in the art will readily understand how to arrive at the value of minimum power route width applicable for the technology they will use . at step 412 , tool integrator 312 may cause power routing tool 304 to perform an initial power routing using the minimum widths assigned at step 408 . the result of this initial power routing is a set of routes for power routes 112 based on these power routes being the minimum width possible . at step 416 , tool integrator 312 extracts the physical design data , e . g ., lengths of power routes 112 , connection locations to power distribution network 108 and placement of i / o circuits 104 , needed for electrical analysis tool 308 to perform an electrical analysis of the power routes . at step 420 , tool integrator 312 may cause electrical analysis tool 308 to perform an electrical analysis of i / o circuits 104 and power routes 112 to determine , perhaps among other things , whether any one or more ir , em , and esd violations exist . at step 424 , electrical analysis tool 308 or tool integrator 312 may determine whether any power route 112 has any ir , em , and esd violations . if not , at step 428 , the routing of i / o power routes 112 is done , and routes and widths of the power routes just analyzed at step 420 may be used in the final floorplan . in this scenario , tool integrator 312 may terminate integrated power routing algorithm 316 . if , on the other hand , electrical analysis tool 308 reports one or more ir , em , and esd violations , then the electrical analysis tool or tool integrator 312 may create a list of all i / o circuits 104 that fail any of the ir , em , and esd checks . if it is determined at step 424 that one or more ir , em , and esd violations exist , electrical analysis tool 308 or tool integrator 312 may , at step 432 , assign an increased width to power route ( s ) 112 corresponding to the one ( s ) of i / o circuits 104 having one or more violations . each existing width that failed may be increased by any incremental amount , such as an incremental amount dictated by the technology used to fabricate chip 100 . for example , in one technology in which the minimum width is 6 μm , the incremental step may be 2 μm , such that the next width is 8 μm . at this point , the routes of power routes 112 may be assumed to be the same routes as just determined in step 412 . at step 436 , tool integrator 312 may cause electrical analysis tool 308 to re - run using the new widths assigned to the failing i / o circuits 104 in step 432 and all of the remaining original minimum widths . at step 440 , similar to step 424 , electrical analysis tool 308 or tool integrator 312 may determine whether any power route 112 has any ir , em , and esd violations . if not , method 300 may loop back to step 412 to re - run power routing tool 304 so that power routes 112 , if any , may be re - routed in the event that any of the width increases made in step 432 result in a new interference with one or more of blockages 132 or other power route ( s ). once any power routes 112 have been re - routed at step 412 , method 400 may continue with steps 416 , 420 , 424 , 432 , 436 and 440 as necessary until the process ends at step 428 with one or more of the power routes being resized and / or re - routed until no ir , em , and esd violations occur . once step 428 has been reached , the routes and widths of power routes 112 determined in the most recent power routing of step 412 may be used in the final floorplan . at this point , tool integrator 312 may terminate integrated power routing algorithm 316 . if , on the other hand , electrical analysis tool 308 reports one or more ir , em , and esd violations at step 440 , then the electrical analysis tool or tool integrator 312 may create a list of all i / o circuits 104 that fail any of the ir , em , and esd checks . in this case , method 400 may proceed back to step 432 so that new greater widths may be assigned to power routes 112 corresponding to the one or more ir , em , and esd violations . method 400 may loop through steps 432 , 436 , 440 and back to step 432 until electrical analysis tool 308 or tool integrator 312 does not find any more ir , em , and esd violations . as explained immediately above in the flow of method 400 , integrated power routing algorithm 316 involves iterations within electrical analysis tool 308 as well as iterations between the electrical analysis tool and power routing tool 304 . integrated power routing algorithm 316 terminates when all the electrical specifications are satisfied for all i / o circuits 104 . using method 400 , electrical analysis tool 308 is automatically and iteratively invoked so as to arrive at a first approximation of the optimal widths for power routes 112 so as to guarantee that all electrical constraints are satisfied . this reduces the number of iterations between power routing tool 304 and electrical analysis tool 308 , thereby reducing churn in satisfying the electrical constraints . furthermore , method 400 targets the power routing of each individual i / o circuit 104 independently . existing techniques break up i / o circuits 104 into classes and define different power route widths for different classes . however , the electrical constraints of different i / o circuits 104 of the same class may be different . this is so because the electrical constraints required to be satisfied by an i / o circuit 104 depend on the current drawn by that i / o circuit and the location of that i / o circuit on chip 100 . the i / o current , in turn , depends on the specific loading conditions and switching activity of that specific i / o circuit 104 . thus , defining a power route width based on an i / o class may result in some i / o circuits 104 having wider power routes 112 than necessary to satisfy the electrical constraints . this is an undesirable result since wider power routes 112 consume wiring resources that make it harder to efficiently wire chip 100 . hence , it is important to define the minimum power route width for each i / o circuit 104 necessary to satisfy the electrical constraints of that i / o circuit . in this example , four test cases , referred to as tc 1 , tc 2 , tc 3 , and tc 4 , are considered in connection with implementing an integrated power routing method of the present invention , e . g ., method 400 , in connection with ir requirements . however , those skilled in the art will readily understand the modifications necessary to implement this method in connection with em and esd requirements as well . the number of i / o circuits in each of test cases tc 1 , tc 2 , tc 3 , and tc 4 is about 150 i / o circuits , as shown in table i . the supply voltage is 1 . 5v for each of test cases tc 1 , tc 2 , tc 3 and tc 4 . the other inputs for this example are the currents drawn by the various i / o circuits . for purposes of this example , it is assumed that each i / o circuit is drawing 30 . 0 ma of current from the power supply . in practice , the current demand for each i / o circuit may be obtained by running spice simulations under accurate loading conditions . those skilled in the art will be familiar with spice , which is an acronym for “ simulation program with integrated circuit emphasis ,” and the variety of spice implementations commercially available . note that in such a scenario , the current demand for the various i / o circuits may be different depending on their loading conditions . however , in order to illustrate the usefulness of the present invention , it is sufficient to assume that all i / o circuits draw equal currents , each having the value of 30 . 0 ma . furthermore , it is noted that the current metric suitable for ir drop analysis may be different than the current metrics suitable for em or esd analysis . typically , the allowed power route widths are limited to a small set of discrete widths that the power routing tool , e . g ., power routing tool 304 of fig3 , can use when connecting the psts of the i / o circuits to a corresponding power distribution network . the results presented in this section are obtained using four possible widths for the power routes , 6 μm , 8 μm , 12 μm and 16 μm . as mentioned earlier , the integrated power routing algorithm , e . g ., algorithm 316 of fig3 , typically starts with the assumption that the width of the power route for every i / o circuit is the minimum possible width , which , in this example , is 6 μm . given the initial minimum - width power routes , an electrical analysis tool , e . g ., electrical analysis tool 308 of fig3 , extracts the necessary data and runs the simulations to identify the i / o circuits failing the electrical requirements . the check that is used in the present example is an ir drop of more than 5 % of the supply voltage . for all the i / o circuits failing this ir check , the electrical analysis tool attempts the second larger width and reruns the simulation . the integrated power routing algorithm continues iterating the electrical analysis with one or more new power route widths until all requirements are satisfied , that is , all i / o circuits have an ir drop of less than 5 % of the supply voltage . table i shows the number of i / o circuits failing the ir drop requirement when considering the different possible widths . the first column corresponds to the different test cases t 1 , t 2 , t 3 , and t 4 . the second column shows the total number of i / o circuits in each test case . the third column reports the number of i / o circuits that fail the ir drop requirement using the initial power route width of 6 μm . then , columns 4 , 5 , and 6 report the number of i / o circuits failing their drop requirement after increasing the power route width to 8 μm , 12 μm , and 16 μm respectively . note that for tc 3 , one i / o circuit still fails the ir requirement even after the maximum possible width is considered . this usually occurs when an i / o circuit is placed in an area congested with other i / o circuits , all of which draw power from the same location of the power distribution network . in such cases , the ir drop violation may be fixed by either changing the location of that i / o circuit or re - routing its power route . observe that the results shown in table i correspond to one iteration between the power routing tool and the electrical analysis tool . basically , the power routing tool started with the minimum width of 6 μm for all i / o power routes . the electrical analysis tool , in turn , provided a set of recommendations of increasing the widths of certain i / o circuits . fig5 shows a histogram 500 of the number of i / o circuits of each possible power route width as recommended by the electrical analysis tool after the first iteration . after the electrical analysis tool is run , the power routing tool was invoked to apply the power route widths recommended by the electrical analysis tool . then , extraction and simulation is repeated again by the electrical analysis tool . the results for these iterations between the power routing tool and the electrical analysis tool are summarized in fig6 , which shows a graph 600 of the number of failing i / o circuits after each iteration for all four test cases tc 1 , tc 2 , tc 3 , and tc 4 . note that iteration 0 corresponds to the initial power routes , which , at that point , all have the minimum width of 6 μm . observe that tc 1 has no violations after iteration 1 . test cases tc 2 , tc 3 , and tc 4 , however , still have four violations each after iteration 1 and require an additional iteration . the reason that more than one iteration may be needed is that the paths of the power routes may change for some i / o circuits . the power router will attempt to follow the minimum distance path from the i / o circuit to the power distribution network . however , as mentioned above , due to blockage and spacing requirements any one of the power routes may have to follow a different path when its width has been increased . finally , it is noted that the run time overhead of the proposed approach is minimal . the cpu time required by the power routing tool is equivalent to any regular run . the overhead of the approach is really introduced in the electrical analysis tool as the integrated power routing algorithm tries the different possible widths before providing recommendations for another iteration of power routing tool . for all four test cases tc 1 , tc 2 , tc 3 , and tc 4 , this overhead is found to be negligible . the run time of each iteration of the electrical analysis tool is less than one second and the memory required is less than 30 mb . in view of the foregoing , it is clear that the present invention offers an advantage in reducing the number of iterations between the power routing tool and the electrical analysis tool . furthermore , it offers an automated solution that results in power routes that satisfy all electrical requirements . although the invention has been described and illustrated with respect to an exemplary embodiment thereof , it should be understood by those skilled in the art that the foregoing and various other changes , omissions and additions may be made therein and thereto , without parting from the spirit and scope of the present invention .	6
the dispersants of the present invention are useful in ester fluids including lubricating oils , particularly those ester fluids useful in high temperature aviation derived turbine engine oil applications . the dispersants exhibit improved deposit inhibiting performance as measured by the inclined panel deposition test . total acid number ( tan ) and viscosity increase of the lubricating oils containing these dispersants are also improved . the dispersant additives of the invention comprise a hydrocarbon carboxylic acid , a polyol such as neopentyl glycol or pentaerythritol , an amine carrier such as succinic anhydride , and a polyamine . the figure below , shown in schematic form , represents the general embodiment of the present invention . different dispersant structures are obtained by varying the hydrocarbon carboxylic acid , the polyol and the polyamine . in addition , any diacid or cyclic anhydride can act as the amine carrier so long as it does not affect the solubility of the overall dispersant molecule . preferably , any polyol containing 2 - 4 oh groups with no hydrogen atoms on the beta - carbon atom can be used , i . e ., any compound with the structure wherein x and y are , independently , 0 or 1 and n = 4 −( x + y ). r 1 and r 2 are , independently , suitably a hydrocarbyl group , more particularly any aromatic , aliphatic or cyclo - aliphatic hydrocarbyl group , preferably an alkyl . the hydrocarbyl group may contain 1 to about 20 or more carbon atoms , and the hydrocarbyl group may also contain substituents such as chlorine , nitrogen and / or oxygen atoms . the hydrocarbyl group may contain one or more oxyalkylene groups and , thus , the polyol compounds include compounds such as polyetherpolyols ( compounds having multiple ether linkages and multiple hydroxyl groups ). the number of carbon atoms ( i . e ., carbon number , wherein the term carbon number as used throughout this application refers to the total number of carbon atoms in either the acid or alcohol as the case may be ) and number of hydroxy groups ( i . e ., hydroxyl number ) contained in the polyol compound used to form the carboxylic esters may vary over a wide range . the following alcohols are particularly useful as polyols : neopentyl glycol , 2 , 2 - dimethylol butane , 2 , 2 - dimethyl - 1 , 3 - propanediol , trimethylol ethane , trimethylol propane , trimethylol butane , mono - pentaerythritol , technical grade pentaerythritol , di - pentaerythritol , tri - pentaerythritol . the most preferred alcohols are technical grade ( e . g ., approximately 88 % mono -, 10 % di - and 1 - 2 % tri - pentaerythritol ) pentaerythritol , monopentaerythritol , di - pentaerythritol , neopentyl glycol and trimethylol propane . preferably , but not necessarily , the choice of polyol in the dispersant structure is equivalent to the polyol base stock in which the dispersant will be blended . more preferably , the choice of polyol in the dispersant structure is directed by two factors : cost and the necessity of high - temperature stability . superior high - temperature performance is achieved if the carbon atoms at the beta position — relative to all of the alcohol groups in the polyol — are not attached to any hydrogen atoms . the preferred polyols used in aviation turbine oil ( ato ) base stocks are neopentyl glycol (“ npg ”) ( n = 2 ; r 1 ═ ch 3 ; r 2 ═ ch 3 ), trimethylolpropane (“ tmp ”) ( n = 3 ; r 1 ═ ch 2 ch 3 ), and pentaerythritol (“ pe ”) ( n = 4 ). all of these polyols have no beta hydrogen atoms and are commercially available , cost effective and are the most preferred polyols of the present invention . neopentyl glycol only has two oh groups to react with the polar dispersing group and / or esterified with the hydrocarbon chain . trimethylolpropane has three oh groups which can react with the amine carrier and then the polar polyamine and / or be esterified with hydrocarbon acids to form the dispersant structure . pentaerythritol has four oh groups which can react with the amine carrier and then the polar polyamine and / or be esterified with hydrocarbon acids to form the dispersant structure . these hydrocarbon acids can be the same acid or a mixture of different acids . in the overall formulation , however , it is likely that there will be a mixture of compounds comprising the dispersant . if pentaerythritol ( pe ) is used as the polyol , for example , in one pe molecule all four of the hydroxyl groups may react with hydrocarbon acid chains while in another , perhaps only two or three of the four hydroxyl groups will react with hydrocarbon chains while the others will react with the polar dispersing ( amine carrier / amine ) group . thus , another aspect of this invention is that the polyol — whether tmp , pe , npg , or any other suitable polyol — can be partially esterified to achieve a mixed ester with any number of free hydroxyl groups available to react with the amine carrier and amine group . in other words , one can synthesize a polyol ester composition from a polyol and a hydrocarbon acid mixture in such a way that it has a substantial amount or a lesser amount of unconverted hydroxyl groups . the number of unconverted hydroxyl groups can be calculated and the mixed ester is given a hydroxyl number . the dispersant compound is then synthesized from the polyol ester , the amine carrier and amine group . thus , the dispersant can be synthesized from a mixed ester having a wide range of hydroxyl groups available for reaction with the amine portion of the compound . a polyol ester with a lower hydroxyl number will have fewer unconverted hydroxyl groups available to react with the amine portion . this will result in a dispersant compound with fewer amine groups , and , fewer dispersant active nitrogen atoms . if the dispersant compound is synthesized from a polyol ester with a higher hydroxyl number ( more commonly known as a high hydroxyl ester or hhe ) more hydroxyl groups are available to react with the amine group and the dispersant compound produced , depending on the amine group used , can have greater dispersant properties . starting with a polyol ester of a particular hydroxyl number provides flexibility so that the dispersant additive may be tailor made for the optimal amount of dispersant activity for a particular application . alternatively , the present invention may be used to synthesize a polyol ester base stock with dispersant properties . this may be accomplished by starting with a polyol ester base stock with low hydroxyl number , reacting the base stock with an optimal amount of the amine carrier and amine group to form a complete base stock with an overall dispersant effect so that a separate dispersant additive is not needed . solubility in the base stock is an important factor that must be considered in the design of any additive . the ester base stock of atos is intermediate in polarity and , therefore , the dispersant additives of the present invention are preferably synthesized to have similar polarity to obtain reasonable solubility . an increase in the number of carbon atoms in the hydrocarbon acid portion of the molecule tends to make it more non - polar , while an increase in the number of polar groups in the amine will increase the overall polarity of the final molecule . both of these factors must be considered in tandem to design a dispersant molecule that has the desired solubility properties . thus , any hydrocarbon carboxylic acid containing up to about 50 carbon atoms may be used , including those with a linear structure , branched , and / or with cyclic or aromatic components . preferably linear , branched , cyclic , or aromatic acids with less than or equal to 18 carbon atoms are used because they are commercially available at a reasonable cost . examples of branched acids include : 2 , 2 - dimethyl propionic acid ( neopentanoic acid ), neoheptanoic acid , neooctanoic acid , neononanoic acid , hexanoic acid , iso - hexanoic acid , neodecanoic acid , 2 - ethyl hexanoic acid ( 2eh ), isoheptanoic acid , isooctanoic acid , isononanoic acid , and isodecanoic acid . some examples of linear acids include acetic , propionic , pentanoic , heptanoic , octanoic , nonanoic , and decanoic acids . selected polybasic acids include any c 2 to c 12 polybasic acids , e . g ., adipic , azelaic , sebacic and dodecanedioic acids . and most preferably stearic acid , isononanoic acid , valeric acid , isovaleric , caproic , cyclohexanoic , benzoic , hexanoic acid , heptanoic acid , octanoic acid , nonanoic acid , and decanoic acid are used . two hydrocarbon carboxylic acids that were readily available — stearic acid ( 18 carbon atoms ) and isononanoic acid ( 9 carbon atoms )— were used in the neopentyl glycol examples 1 - 14 below . a variety of polyamines may be used when synthesizing the dispersant molecule . the amine moieties are linked to the molecular structure of the dispersant through an amide linkage to the amine carrier . thus , any primary or secondary amine containing up to 10 nitrogen atoms could be used as the polyamine in the dispersant structure . preferably , amines containing 2 to 5 nitrogen atoms chosen from the amine groups polyamines , piperazines , morpholines , anilines , piperidines , and pyrrolidines . most preferably : 1 - methylpiperazine , 1 -( 2 - aminoethyl ) piperazine , 1 , 4 - bis ( 3 - aminopropyl ) piperazine , 4 -( 2 - aminoethyl ) morpholine , n -( 3 - aminopropyl )- 1 , 3 - propanediamine , n , n ′- bis ( 3 - aminopropyl ) ethylenediamine , ethylenediamine , diethylenetriamine , triethylenetetramine , tetraethylene - pentamine . however , for every molecule synthesized according to the present invention , there is an upper limit to the number of active nitrogen atoms that can be feasibly incorporated into the final dispersant . the polarity of the final molecule will increase with an increase in the number of polar groups to the point where the dispersant would be incompatible in the ester base stock , and sufficient solubility would not occur . the polar nitrogen - containing functional group is introduced into the overall dispersant molecule through attachment to one of the oh groups of the polyol mediated by an amine carrier . in general , any diacid or cyclic anhydride could potentially be used as the amine carrier . preferably , commercially available diacids that contain up to 16 carbon atoms or cyclic anhydrides with 4 or 5 carbon atoms in the ring are used . most preferably : succinic anhydride , maleic anhydride , glutaric anhydride , malonic acid , succinic acid , maleic acid , glutaric acid are used . in order to synthesize the novel dispersants of the present invention a synthetic procedure was devised . given the generalized structure of the disclosed dispersants ( shown above ), three major steps were required to synthesize the dispersants : ( 1 ) esterify carboxylic acid ( s ) to the polyol leaving at least one free oh group , ( 2 ) esterify free oh group on the polyol with a diacid or cyclic anhydride ( amine carrier ), and ( 3 ) attach the polyamine to a carboxylic acid group from the diacid or cyclic anhydride through an amide linkage . thus the building blocks of the molecular framework of the desired dispersant compounds can be represented by the following general schematic : two possible routes for the synthesis of these molecules were envisioned although one skilled in the art may synthesize the dispersant molecule in a different manner . in one scheme , the chosen carboxylic acid was esterified with the polyol in the presence of a catalytic amount of p - toluenesulfonic acid ( step 1 ). in the second step , the ester / alcohol product from step 1 was reacted with the amine carrier , succinic anhydride , to form a second ester linkage with a carboxylic acid group at one end . in the final step , the carboxylic acid group was activated through the formation of a mixed anhydride using ethyl chloroformate at low temperature . the mixed anhydride was reacted with the desired polar amine entity to form an amide linkage , and the final product . in the second possible synthetic scheme , the amine group was reacted with the amine carrier , succinic anhydride , to form an amide with a free carboxylic acid group at one end . esterification with a free hydroxyl group on the polyol gave the desired product . the first scheme is preferred for the molecules containing the isononanoic acid group , while the second scheme is preferred for the synthesis of the structures containing a stearic acid group . the dispersant additive of the present invention is combined with polyol ester base stocks to form the lubricant composition of the present invention . preferably , the polyol from which the base stock is synthesized comprises 4 to 7 carbon atoms and 2 to 4 esterifiable hydroxyl groups . the aliphatic polyol may be selected from : neopentyl glycol , 2 , 2 - dimethylol butane , trimethylol ethane , trimethylol propane , trimethylol butane , mono - pentaerythritol , technical grade pentaerythritol , di - pentaerythritol , tri - pentaerythritol , and neopentyl glycol . preferred polyols are technical grade pentaerythritol ( e . g ., approximately 88 % mono -, 10 % di - and 1 - 2 % tri - pentaerythritol ), monopentaerythritol , di - pentaerythritol , neopentyl glycol , trimethylol propane , and tripentaerythritol . more preferred polyols are selected from : trimethylolpropane , technical grade pentaerythritol , monopentaerythritol , dipentaerythritol , neopentyl glycol , and tripentaerythritol . even more preferred polyols are selected from technical grade pentaerythritol , trimethylolpropane , and neopentyl glycol . a preferred polyol is technical pentaerythritol ( techpe ). technical pentaerythritol is a mixture that includes about 85 to 92 wt % monopentaerythritol and 8 to 15 wt % dipentaerythritol . a typical commercial technical pentaerythritol contains about 88 wt % monopentaerythritol and about 12 wt % of dipentaerythritol . the technical pentaerythritol may also contain some tri and tetra pentaerythritol which are typically formed as by - products during the production of technical pentaerythritol . the preferred polyol ester base stock contains a mixture of c 5 - 10 acids . even more preferably , the acids are a mixture of c 5 , i - c 9 , and linear c 7 - 10 acids . it is noted that c 7 - 10 is intended to represent a mixture of c 7 , c 8 , c 9 , and c 10 acids . preferably , this mixture comprises linear c 7 , linear c 8 , and linear c 10 . still more preferably , the acids are a mixture of a c 5 , i - c 9 , and linear c 7 ( e . g ., n - heptanoic acid ), c 8 ( e . g ., n - octanoic acid ), and c 10 ( e . g ., n - decanoic acid ) acids . the lubricant composition of the present invention preferably has at least one of the following uses : crankcase engine oils , two - cycle engine oils , catapult oils , hydraulic fluids , drilling fluids , turbine oils ( e . g ., aircraft turbine oils ), greases , compressor oils , gear oils and functional fluids . preferably , the lubricant composition of the present invention is used in an aero - derived , gas turbine engines ( e . g ., jet turbine engines , marine engines , and power generating applications ). the lubricant composition according to the present invention preferably comprises about 90 to 99 . 5 % by weight of the polyol ester base stock and about 0 . 5 to 10 wt %, preferably about 1 to 5 % by weight of the novel dispersant additive . in addition to the synthesized dispersant additive , the lubricant compositions of the present invention may also comprise other conventional lubricant additives . lubricating oil additives are described generally in “ lubricants and related products ” by dieter klamann , verlag chemie , deerfield , fla ., 1984 , and also in “ lubricant additives ” by c . v . smalheer and r . kennedy smith , 1967 , pp . 1 - 11 , the contents of which are incorporated herein by reference . lubricating oil additives are also described in u . s . pat . nos . 6 , 043 , 199 , 5 , 856 , 280 , and 5 , 698 , 502 , the contents of which are incorporated herein by reference . conventional lubricants preferably comprise about 0 to 15 %, preferably 2 to 10 wt %, most preferably 3 to 8 % by weight of a lubricant additive package . thus , the lubricant composition according to the present invention would comprise about 85 to 97 wt % polyol ester base stock , about 2 to 10 wt % conventional additive package and about 1 to 5 wt % of the novel dispersant additive of the present invention . thus , fully formulated turbine oils may contain one or more of the following classes of additives : antioxidants , antiwear agents , extreme pressure additives , antifoamants , detergents , hydrolytic stabilizers , metal deactivators , other rust inhibitors , etc . in addition to the dispersant of the present invention . total amounts of such other additives can be in the range 0 . 5 to 15 wt % preferably 2 to 10 wt %, most preferably 3 to 8 wt % of the fully formulated lubricant . antioxidants , which can be used , include aryl amines , e . g . phenyinaphthylamines and dialkyl diphenylamines and mixtures thereof , hindered phenols , phenothiazines , and their derivatives . the antioxidants are typically used in an amount in the range 1 to 5 wt % of the fully formulated lubricant . antiwear / extreme pressure additives include hydrocarbyl phosphate esters , particularly trihydrocarbyl phosphate esters in which the hydrocarbyl radical is an aryl or alkaryl radical or mixture thereof . particular antiwear / extreme pressure additives include tricresyl phosphate , triaryl phosphate , and mixtures thereof . other or additional anti wear / extreme pressure additives may also be used . the antiwear / extreme pressure additives are typically used in an amount in the range 0 to 4 wt %, preferably 1 to 3 wt % of the fully formulated lubricant . industry standard corrosive inhibitors may also be included in the turbo oil . such known corrosion inhibitors include the various triazols , for example , tolyltriazol , 1 , 2 , 4 benzotriazol , 1 , 2 , 3 benzotriazol , carboxy benzotriazole , allylated benzotriazol . the standard corrosion inhibitor additive can be used in an amount in the range 0 . 02 to 0 . 5 wt %, preferably 0 . 05 to 0 . 25 wt % of the fully formulated lubricant . other rust inhibitors common to the industry include the various hydrocarbyl amine phosphates and / or amine phosphates . foam control can be provided by many compounds including an antifoamant of the polysiloxane type , e . g ., silicone oil or polydimethyl siloxane . another additive that can be used is an anti - deposition and oxidative additive . a typical anti - deposition and oxidation additive is a sulfur containing carboxylic acid ( scca ) as described in u . s . pat . no . 5 , 856 , 280 . the scca derivative is used in an amount in the range 100 to 2000 ppm , preferably 200 to 1000 ppm , most preferably 300 to 600 ppm . as previously indicated , other additives can also be employed including hydrolytic stabilizers , pour point depressants , anti foaming agents , viscosity and viscosity index improver , as well as other additives useful in lubricating oil compositions . the individual additives may be incorporated into the present lubricant composition in any convenient way . thus , each of the components can be added directly to the base stock by dispersing or dissolving it in the base stock at the desired level of concentration . such blending may occur at ambient temperature or at an elevated temperature . preferably , all the additives except for the viscosity modifier and the pour point depressant are blended into a concentrate or additive package , which is subsequently blended into base stock to make finished lubricant . use of such concentrates is this manner is conventional . the concentrate will typically be formulated to contain the additive ( s ) in proper amounts to provide the desired concentration in the final formulation when the concentrate is combined with a predetermined amount of base lubricant . the concentrate is preferably made in accordance with the method described in u . s . pat . no . 4 , 938 , 880 , the contents of which are incorporated herein by reference . that patent describes making a pre - mix of ashless dispersant and metal detergents that is pre - blended at a temperature of at least about 100 ° c . thereafter , the pre - mix is cooled to at least 85 ° c . and the additional components are added . the present invention is further described by reference to the following non - limiting examples . these examples are provided for purposes of explanation and not limitation . specific polyols , carbon acids and polyamines and synthetic procedures are used to synthesize the novel dispersant in order to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that the present invention may be practiced in other embodiments that depart from these specific examples . the examples illustrate the use of neopentyl glycol and pentaerythritol as possible glycols , stearic acid and isononanoic acid as possible hydrocarbon acids for neopentyl glycol dispersants , various c 5 - c 10 carboxylic acids for pentaerythritol dispersants and seven different polyamines as listed in table 1 . for the neopentyl glycol dispersant molecules , two carboxylic acids were chosen for the syntheses : stearic acid ( linear 18 - carbon acid ) and isononanoic acid ( 3 , 5 , 5 - trimethyl hexanoic acid ; branched ). combining these two possibilities for the hydrocarbon portion with the seven possible polar polyamine groups shown in table 1 gives fourteen potential candidates , all of which are described in the following examples . synthesis of polyol ester derivatives of neopentyl glycol , succinic anhydride , 4 -( 2 - aminoethyl ) morpholine and stearic acid procedure : 0 . 15 moles of neopentyl glycol were esterified with 0 . 15 moles of stearic acid in toluene using p - toluenesulfonic acid as a catalyst . the apparatus was fitted with a dean and stark trap and heated to boiling for 8 hours , after which it was allowed to cool naturally to room temperature . the reaction mixture was reheated to boiling , and 0 . 15 moles of succinic anhydride were added to the hot solution , which was refluxed for 3 hours and afterwards allowed to cool naturally to room temperature and sit overnight . the solution was cooled with a saturated salt water / ice bath and 0 . 15 mol of triethylamine were added dropwise with stirring . 0 . 15 mol of ethyl chloroformate in 20 ml of methylene chloride were added dropwise with stirring to the cooled solution over a period of 15 minutes . the reaction was allowed to proceed cooled , stirred , and undisturbed for 2 hours . during this time , the solution turned light purple in color . 0 . 15 moles of 4 -( 2 - aminoethyl ) morpholine in 20 ml of methylene chloride were added dropwise with stirring to the cooled solution over a period of several minutes , and the mixture was stirred and cooled for 2 hours . the mixture was suction filtered and the solvent was discarded . the solid was removed from the filtrate using a rotary evaporator hooked up to a high vacuum pump and a dry ice / acetone trap . the viscous liquid remaining solidified on cooling to room temperature and standing overnight . a sample of the solid was submitted for ir analysis and the analysis was consistent with the proposed schematic structure illustrated above and will hereinafter be referred to as structure 1 . a similar procedure was used to make fourteen neopentyl glycol dispersants in total . the fourteen structures are set forth in table ii below . to test for solubility of the neopentyl glycol additives , 50 g of a 1 . 5 wt % mixture of each individual additive in bpto 2197 , a commercially available jet turbine lubricant from air bp , was prepared and heated to near 80 ° c . with stirring . the mixture / solution was then allowed to cool naturally to room temperature and sit covered and undisturbed for 24 hours . the solutions were then examined for clarity and insoluble particles . if excessive cloudiness or insoluble particles were observed in the test solution after sitting undisturbed for 24 hours , the dispersant additive was deemed insoluble in the commercial lubricant , and the additive was not subjected to any further testing . if the synthesized dispersants were soluble in the commercial lubricant , they were given structure numbers for the purposes of the inclined panel deposit test ( ipdt ). for the most part , the compounds observed to be insoluble at these treat rates were the ones containing long - chain linear polyamines with four or five nitrogen atoms . the inclusion of a large number of polar nitrogen - containing functional groups in the molecular structure likely caused the compound to be too polar to dissolve in the synthetic ester base stock . table ii acid polyamine structure # soluble ? stearic amine 1 structure 1 ✓ stearic amine 2 structure 2 ✓ stearic amine 3 structure 3 ✓ stearic amine 4 structure 4 ✓ stearic amine 5 insoluble x stearic amine 6 insoluble x stearic amine 7 insoluble x isononanoic amine 1 structure 5 ✓ isononanoic amine 2 structure 6 ✓ isononanoic amine 3 structure 7 ✓ isononanoic amine 4 structure 8 ✓ isononanoic amine 5 structure 9 ✓ isononanoic amine 6 structure 10 ✓ isononanoic amine 7 insoluble x pentaerythritol dispersant candidates were synthesized from high hydroxyl pentaerythritol ester base stocks obtained from exxon chemical . in a high hydroxyl ester ( hhe ), most of the hydroxyl groups are esterified with a distribution of various carboxylic acids , but some of the hydroxyl groups are left unreacted . the number of unreacted hydroxyl groups is indicated by the hydroxyl number ( effective mg koh per gram ester ) of the hhe base stock . these free hydroxyl groups can be functionalized with polar amine groups to form pentaerythritol dispersants , with the following general structure : two hhe basestocks were obtained from exxon chemical , which differ in the carboxylic acid distribution used to form the pentaerythritol esters . one basestock ( referred to hereafter as hhe1 ) was composed of 84 . 9 mol % n - valeric acid and 15 . 1 mol % isononanoic acid with a hydroxyl number of 37 . 7 . the carboxylic acid distribution of the second hhe basestock ( hhe2 ) consisted of 51 . 56 mol % n - valeric acid , 0 . 74 mol % n - hexanoic acid , 25 . 20 mol % n - heptanoic acid , 8 . 71 mol % n - octanoic acid , 5 . 39 mol % n - decanoic acid , and 8 . 40 mol % isononanoic acid , with a hydroxyl number of 37 . 5 . synthesis of high hydroxyl ester dispersant additive from high hydroxyl ester ( pentaerythritol : n - valeric / isononanoic acid 84 . 9 mol %; 15 . 1 mol %; hydroxyl #: 37 . 7 ), succinic anhydride and 1 -( 2 - aminoethyl ) piperazine . procedure : 30 . 0 g of the high hydroxyl ester were placed in a round - bottomed flask with 50 ml of toluene and heated with stirring to 100 ° c . 2 . 02 g of succinic anhydride were added to the hot solution which was then refluxed for 4 hours , after which it was allowed to cool naturally to room temperature and sit overnight . the solution was cooled with a saturated salt water / ice bath and 2 . 8 ml ( 0 . 020 mol ) of triethylamine were added dropwise with stirring . 1 . 9 ml ( 0 . 020 mol ) of ethyl chloroformate in 10 ml of methylene chloride was added dropwise with stirring to the cooled solution over a period of 5 minutes . the reaction was allowed to proceed cooled , stirred and undisturbed for 2 hours . during this time the solution turned light purple in color . 2 . 6 ml ( 0 . 020 mol ) of 1 -( 2 - aminoethyl ) piperazine in 50 ml of methylene chloride were placed in a separate cooled round - bottomed flask . the ethyl chloroformate / triethylamine mixture was added slowly to the cooled 1 -( 2 - aminoethyl ) piperazine solution , and the mixture was stirred and cooled for 2 hours . the mixture was suction filtered and the solid was discarded . the solvent was removed from the filtrate using a rotary evaporator hooked up to a high vacuum pump and a dry ice / acetone trap . some solid came out of the resulting orange - colored liquid which was filtered and discarded . a sample of the filtrate was submitted for ir analysis and it was consistent with the proposed structure and will hereinafter be referred to as structure 11 . a series of pentaerythritol dispersant candidates was synthesized from both of the hhe 1 and hhe 2 basestocks and several of the polyamines listed in table 1 and are disclosed in table 3 . the synthetic procedure used to prepare these dispersant compounds was very similar to the procedure described above . for the pentaerythritol dispersants , detailed calculations revealed that a 4 . 5 wt % solution of pentaerythritol dispersant is approximately similar to a 1 . 5 wt % solution of neopentyl glycol dispersant , in terms of maintaining an equal number of moles of dispersant in the test solution . therefore , solubility testing was performed on a 4 . 5 wt % mixture of each pentaerythritol dispersant in commercially available jet turbine lubricant from air bp using the same procedure as described for the neopentyl glycol dispersants . if excessive cloudiness or insoluble particles were observed in the test solution after sitting undisturbed for 24 hours , the dispersant additive was deemed insoluble in the commercially available jet turbine lubricant used , and the additive was not subjected to any further testing . if the synthesized dispersants were soluble in the commercial lubricant , they were given structure numbers for the purposes of the inclined panel deposit test ( ipdt ). for the most part , the compounds observed to be insoluble were the ones containing long - chain linear polyamines with four or five nitrogen atoms . the inclusion of a large number of polar nitrogen - containing functional groups in the molecular structure likely caused the compound to be too polar to dissolve in the synthetic ester base stock . table iii high - hydroxyl polyamine ester structure # soluble ? amine 1 hhe1 not measured ✓ amine 3 hhe1 structure 11 ✓ amine 4 hhe1 structure 12 ✓ amine 5 hhe1 not measured ✓ amine 6 hhe1 insoluble x amine 7 hhe1 structure 13 ✓ amine 1 hhe2 not measured ✓ amine 3 hhe2 structure 14 ✓ amine 4 hhe2 structure 15 ✓ amine 6 hhe2 insoluble x amine 7 hhe2 insoluble x the ipdt is generally used to predict field performance in the oil - washed areas of the engine , and successfully correlates with more expensive bearing rig tests . the ipdt is typically employed as a screener test for additives in base stocks and fully formulated lubricants . during the ipdt , the test oil flows at a rate of 60 ml / h over a heated panel ( stainless steel 304 ) that is inclined at an angle of 4 degrees with respect to the horizontal . moist air flows through the system continuously during the test at a rate of 12 l / h . the panel is heated to a specified temperature ( up to 600 ° f .) which is held constant for the entire test duration of 24 hours . oil flowing off the panel is collected in a sump and is continuously recirculated by a positive displacement pump . when the test is complete , the deposit formed on the panel during the test is rated using a demerit rating scale . the ipdt uses the same deposit demerit system as the high temperature bearing test . during the rating process , the total deposit is portioned into different deposit types , depending on the severity of the deposit . each type of deposit is assigned a demerit factor related to the deposit severity . the demerit factor is multiplied by the area of the deposit type to obtain the demerits for that particular deposit type . the total number of demerits is then obtained by adding together the demerits for each deposit type . dividing the total number of demerits by the total area of the deposits gives the final deposit demerit panel rating . only the oil wetted areas of the panel are rated . the used oil at the end of the test is subjected to total acid number ( tan ) and viscosity analyses . the tan is performed according to astm d664 ( except to a ph = 11 . 00 endpoint ), and the viscosity measurement is performed at 40 ° c . according to astm d445 . for the soluble neopentyl glycol dispersant compounds , separate test formulations were prepared by dissolving 1 . 5 wt % of the additive in the commercial lubricant . similar formulations were prepared from the soluble pentaerythritol dispersant additives , with the exception that each blend contained 4 . 5 wt % dispersant compound in the commercial lubricant . the deposit control capability of each experimental formulation was tested by ipdt at three separate temperatures : 560 ° f ., 580 ° f ., and 590 ° f . each test at a particular temperature was run in duplicate and the final results were averaged . the ipdt results for dispersant additive structures 1 - 15 blended in bpto 2197 , a commercially available turbine oil from air bp , are indicated in table iv . the results are compared to ipdt results obtained for bpto 2197 without dispersant additive . fig1 and 2 are two plots comparing the performance of bpto 2197 alone and with 1 . 5 wt % of dispersant additive structure 3 . fig1 compares ipdt panel demerit rating data , while fig2 compares results from tan and viscosity analyses of the used oil at the end of the test . the ipdt results presented in table iv show that for all of the new dispersant formulations , improved deposit control is obtained relative to the commercial lubricant at 560 ° f . and 580 ° f . and all but two show improved deposit control at 590 ° f . the dispersant blends containing structures 3 , 4 , 8 , 12 , 13 , and 15 show surprisingly improved cleanliness benefit compared to the commercial lubricant alone at all temperatures . fig1 and 2 are graphs depicting the improved deposit rating and viscosity and tan control for structure 3 . table iv structure no . deposit rating bpto 560 ° 580 ° 590 ° final tan final viscosity 2197 plus c . c . c . 560 ° c . 590 ° c . 560 ° c . 590 ° c . 1 ( 1 . 5 %) 2 . 7 4 . 7 5 . 3 0 . 9 5 . 3 29 . 0 64 . 0 2 ( 1 . 5 %) 3 . 3 5 . 0 5 . 4 3 . 6 7 . 7 33 . 9 46 . 8 3 ( 1 . 5 %) 3 . 0 3 . 8 4 . 3 6 . 3 7 . 5 34 . 6 51 . 5 4 ( 1 . 5 %) 2 . 8 3 . 8 4 . 9 0 . 5 7 . 0 28 . 8 40 . 8 5 ( 1 . 5 %) 2 . 6 4 . 6 5 . 7 1 . 2 7 . 6 29 . 2 50 . 1 6 ( 1 . 5 %) 2 . 8 5 . 0 5 . 9 0 . 8 10 . 9 28 . 6 50 . 8 7 ( 1 . 5 %) 3 . 3 4 . 6 5 . 4 3 . 7 8 . 5 30 . 9 54 . 1 8 ( 1 . 5 %) 3 . 0 3 . 7 4 . 5 1 . 2 6 . 6 32 . 8 37 . 7 9 ( 1 . 5 %) 3 . 7 5 . 0 5 . 2 5 . 4 10 . 4 33 . 4 53 . 5 10 ( 1 . 5 %) 3 . 5 4 . 4 5 . 2 3 . 3 11 . 0 32 . 9 55 . 9 11 ( 4 . 5 %) 2 . 4 4 . 8 4 . 5 1 . 6 8 . 2 30 . 8 70 . 4 12 ( 4 . 5 %) 2 . 4 3 . 5 4 . 2 0 . 5 9 . 7 28 . 7 46 . 1 13 ( 4 . 5 %) 2 . 1 3 . 7 3 . 8 2 . 0 5 . 1 32 . 7 46 . 1 14 ( 4 . 5 %) 3 . 3 4 . 4 5 . 1 4 . 8 7 . 0 31 . 4 41 . 3 15 ( 4 . 5 %) 2 . 3 3 . 6 3 . 9 1 . 2 5 . 6 30 . 4 45 . 4 bpto2197 3 . 8 5 . 1 5 . 5 11 . 8 9 . 6 63 . 7 62 . 9 table iv roughly indicates that , all else being equal , an increase in the number of “ active ” dispersing nitrogen atoms in the dispersant structure appears to correlate with greater improvement in deposit control . in addition , tables ii and iii illustrate that there is an upper limit to the number of active nitrogen atoms that can be feasibly incorporated into the final dispersant without impacting the solubility of the dispersant in ester base stock . the polarity of the final dispersant molecule will increase with an increase in the number of polar groups to the point where the dispersant may be incompatible with the ester base stock , and solubility may not occur . the ipdt is traditionally used as a screener test . a more rigorous and extensive evaluation of the deposit forming tendency of turbine oils is provided by the coker mister test . this test is designed to simulate the hot section of a jet engine bearing compartment . it evaluates the tendency of synthetic aviation oils to form deposits in the liquid and vapor phases . during the coker mister test , a sample of the test oil is sprayed into a hot tube set at a specified temperature for the desired time period ( usually 20 hours ). the temperature of the tube is constant for a particular run , and is typically set in the range from 500 ° f . to over 600 ° f . air flow through the system is maintained at 9 l / min and the oil flow rate is 20 ml / min . at the end of the test , the liquid , vapour , and endplate “ wetted ” portions of the coker mister tube are each individually rated using a similar demerit scale as used for the ipdt . the used oil is subjected to a viscosity measurement at 40 ° c . ( according to astm d445 ) and a tan analysis ( astm d664 ; except to a ph = 11 . 00 endpoint ). the dispersant additive formulation — structure 6 — was tested by the coker mister test . a formulation was blended containing 1 . 5 wt % of this dispersant additive dissolved in bpto 2380 . the results comparing bpto 2380 with and without the dispersant additive are shown in table v . table v liquid vapor end plate structure no . rating rating rating final tan temp ° f . 570 590 570 590 570 590 570 590 bpto 2380 6 . 3 7 . 8 4 . 6 7 . 8 7 . 0 9 . 0 6 . 1 17 . 8 with 1 . 5 % structure 6 bpto 2380 7 . 8 8 . 9 7 . 7 9 . 9 9 . 8 10 . 2 15 . 5 24 . 8	2
the aqueous medium of the ink jet recording liquid of the present invention comprises water , glycerol , 1 , 3 - propanediol , and other aqueous solvent which may be added as required . for water , ion exchange water free from a metal ion and other impurities , distilled water , or the like can be used . the ratio by weight of glycerol to 1 , 3 - propanediol is preferably in a range from 1 : 10 to 10 : 1 . if the amount of glycerol to be added is less than the above ratio , the recording liquid tends to dry out or solidify in the nozzle . if the amount of glycerol is more than the above ratio , the recording liquid tends to become viscous , resulting in a clogged nozzle . the ratio of the total amount of glycerol and 1 , 3 - propanediol to the total amount of the recording liquid is preferably in a range from 3 to 50 wt %. if the total amount of glycerol and 1 , 3 - propanediol exceeds 50 wt %, the viscosity of the recording liquid increases resulting in the likelihood of reduced discharge stability . on the other hand , if the total amount of glycerol and 1 , 3 - propanediol is lower than 3 wt %, the recording liquid tends to dry out or solidify in the nozzle . alcohols such as methanol , ethanol , isopropyl alcohol may also be added in the range from 2 to 50 wt . % in the recording liquid to promote drying of the recording liquid on recording paper . for pigment , one can use various pigments used for printing ink , paint , etc . the color index ( c . i .) numbers of such pigments are as follows : c . i . pigment yellow 20 , 24 , 86 , 93 , 109 , 110 , 117 , 125 , 137 , 138 , 147 , 148 , 153 , 154 , 166 and 168 ; c . i . pigment orange 36 , 43 , 51 , 55 , 59 and 61 ; c . i . pigment red 9 , 97 , 122 , 123 , 149 , 168 , 177 , 180 , 192 , 215 , 216 , 217 , 220 , 223 , 224 , 226 , 227 , 228 and 240 ; c . i . pigment violet 19 , 23 , 29 , 30 , 37 , 40 and 50 ; c . i . pigment blue 15 , 15 : 1 , 15 : 4 , 15 : 6 , 22 , 60 and 64 ; c . i . pigment green 7 and 36 ; c . i . pigment brown 23 , 25 and 26 ; c . i . pigment black 7 and titanium black . the pigments listed above may be used in the form of an aqueous slurry after the formation of the pigment or may be used in the powdered form obtained by drying the slurry , by spray drying or by allied methods . it is also possible to use surface - treated pigments having a functionalized surface . the smaller the size of the pigment particles , the better the splash property of the recording liquid . it is thus preferable to use pigment particles having a smaller particle size or to use a pigment which can be finely divided during the dispersion step . the pigment particles have preferably an average particle size not larger than 0 . 2 μm , more preferably not larger than 0 . 1 μm , as measured by centrifugal sedimentation . the use of a pigment of such small particle size facilitates filtering operation during the preparation of the recording liquid and reduces the precipitation as it ages . for the ink jet recording liquid of the present invention , a dye can be used in combination to adjust the hue or impart the recording density as long as it is not used excessively resulting in poor water resistance or light resistance . the use of the dye sometimes deteriorates the dispersion stability of the pigment . accordingly , it is necessary to limit the proportion of the dye to no more than 40 wt . %, preferably no more than 25 wt . % of the pigment . examples of the dye that can be utilized in the present invention include acid dyes , basic dyes , direct dyes , reactive dyes , disperse dyes and metal - containing dyes . preferred are purified dyes from which inorganic salts has been removed . exemples of dyes include c . i . direct black 17 , 19 , 32 , 51 , 71 , 108 , 146 , 154 and 166 ; c . i . acid black 2 , 7 , 24 , 26 , 31 , 52 , 63 , 112 and 118 ; c . i . basic black 2 ; c . i . direct blue 6 , 22 , 25 , 71 , 90 and 106 ; c . i . acid blue 9 , 22 , 40 , 59 , 93 , 102 , 104 , 113 , 117 , 120 , 167 , 229 and 234 ; c . i . basic blue 1 , 3 , 5 , 7 , 9 , 24 , 25 , 26 , 28 and 29 ; c . i . direct red 1 , 4 , 17 , 28 and 83 ; c . i . acid red 1 , 6 , 32 , 37 , 51 , 52 , 80 , 85 , 87 , 92 , 94 , 115 , 180 , 256 , 315 and 317 ; c . i . basic red 1 , 2 , 9 , 12 , 13 , 14 and 37 ; c . i . direct yellow 12 , 24 , 26 and 98 ; c . i . acid yellow 11 , 17 , 23 , 25 , 29 , 42 , 61 and 71 ; c . i . basic yellow 11 and 28 ; c . i . direct orange 34 , 39 , 44 , 46 and 60 ; c . i . direct violet 47 and 48 ; c . i . direct brown 109 ; c . i . direct green 59 ; c . i . acid orange 7 and 19 ; c . i . acid violet 49 ; c . i . basic violet 7 , 14 and 27 . it is preferable to add a resin - type dispersant , surfactant , or the like to the ink jet recording liquid as a dispersant to improve the dispersibility of a pigment . for resin - type dispersants , aqueous acrylic resins , styrene - acryl copolymeric resins , polyester resins , polyamide resins , polyurethane resins , fluororesins , or the like can be used . as surfactants , anionic surfactants , nonionic surfactants , cationic surfactants , or ampholytic surfactants can be used . examples of anionic surfactants include fatty acid salts , alkylsulfate ester salts , alkylarylsulfonate salts , alkylnaphthalenesulfonate salts , dialkylsulfonate salts , dialkylsulfosuccinate salts , alkyldiaryl ether disulfonate salts , alkylphosphate salts , polyoxyethylene alkylether sulfate salts , polyoxyethylene alkylaryl ether sulfate salts , naphthalenesulfonic acid formalin condensate , polyoxyethylene alkylphosphate ester salts , glycerol borate fatty acid esters and polyoxyethylene glycerol fatty acid esters . examples of nonionic surfactant include polyoxyethylene alkyl ethers , polyoxyethylene alkylaryl ethers , polyoxyethylene oxypropylene block copolymers , sorbitan fatty acid esters , polyoxyethylene sorbitan fatty acid esters , polyoxyethylene sorbitol fatty acid esters , glycerin fatty acid esters , polyoxyethylene fatty acid esters and polyoxyethylene alkylamines as well as fluorochemical and silicon group nonionic surfactants . examples of cationic surfactant include alkylamine salts , quaternary ammonium salts , alkyl pyridinium salts and alkyl imidazolium salts . examples of amphoteric surfactant include alkylbetaine , alkylamine oxide and phosphatidyl choline . in the ink jet recording liquid of the present invention , it is preferable to use an aqueous or water - dispersible resin as a vehicle resin in an amount from 0 . 1 to 15 wt . % as a resin solid in the recording liquid . if the fraction of the vehicle resin is less than 0 . 1 wt . %, the fixing capability of the recording liquid onto a recording medium diminishes . on the other hand , if an amount in excess of 15 wt . % is used , the storage stability suffers and it is liable to cause clogging . examples of the aqueous resin are polyvinyl alcohol , polyvinyl pyrrolidone , polyacrylamide , carboxyl - containing aqueous polyester , hydroxyl - containing cellulose resin , and acrylic resin . examples of the water - dispersible resin are an acrylic resin , vinyl acetate resin , butadiene resin , urethane resin , polyester resin , or petroleum resin . preferable water - dispersible resins are those with a particle diameter of less than 0 . 4 μm , more preferably less than 0 . 1 μm . if the particle diameter of the resin is larger , the recording liquid is liable to cause clogging . moreover , various additives as described below can be added as needed to the ink jet recording liquid of the present invention : if a recording sheet is water - permeable , as is the case with paper , it is possible to add a penetrant to accelerate the penetration of the recording liquid into paper , thereby improving the apparent drying rate . examples of the penetrant include glycol ethers such as diethylene glycol monobutyl ether , alkylene glycol , polyethylene glycol monolauryl ether , sodium laurylsulfate , sodium dodecylbenzenesulfonate , sodium oleate and sodium dioctylsulfosuccinate . the penetrant brings about desired effect when used in an amount no more than 5 wt . % of the recording liquid . when one uses an amount in excess of 5 wt . % of the recording liquid , undesirable bleeding of printed images and print - through would result . a mildewproofing agent serves to prevent the growth of mildew in the recording liquid . examples of the mildewproofing agent include sodium dehydroacetate , sodium benzoate and sodium pyridinethion - 1 - oxide , zincpyridinethion - 1 - oxide , and amine salts of 1 , 2 - benzisothiazolin - 3 - one or 1 - benzisothiazolin - 3 - one . the mildewproofing agent is used in an amount ranging from 0 . 05 wt . % to 1 . 0 wt . % of the recording liquid . the chelating agent serves to block metal ions in the recording liquid and prevent the precipitation of metals in the nozzle and of insoluble matters in the recording liquid . examples of the chelating agent include ethylene diamine tetraacetic acid , sodium salt of ethylenediamine tetraacetic acid , diammonium salt of ethylene diamine tetraacetic acid and tetraammonium salt of ethylene diamine tetraacetic acid . the chelating agent is used in an amount ranging from 0 . 005 wt . % to 0 . 5 wt . % of the recording liquid . in addition , a ph regulator such as amine , inorganic salts and ammonia , or a buffer such as phosphoric acid can be added to regulate the ph of the recording liquid , obtain its dispersion stability and protect the tubing of the liquid passage of the ink jet printer . moreover , in order to inhibit foam generation during circulation and transfer of the recording liquid or during the preparing of the recording liquid , anti - foaming agent can be added . as another additive , urea , dimethyl urea or the like can also be added . the ink jet recording liquid of the present invention can be prepared by the following processes . first , a pigment , water , glycerol , 1 , 3 - propanediol , and , as required , dispersant , aqueous or water - dispersible vehicle resin , and aqueous solvent are mixed . the mixture is then dispersed using a dispersing machine such as a sand mill , homogenizer , ball mill , paint shaker , or ultrasonic dispersing machine to produce the ink jet recording liquid . alternatively , an aqueous dispersion of pigment is first produced by dispersing a pigment in an aqueous medium , adding a dispersant as required . an aqueous or water - dispersible vehicle resin , other solvent , or the like are added to the aqueous dispersion of pigment thus obtained to prepare the ink jet recording liquid of the present invention . glycerol and 1 , 3 - propanediol may also be added to the aqueous medium when the aqueous dispersion is being prepared , or it may be added to the aqueous dispersion after the acqueous dispersion of pigment is prepared . the ink jet recording liquid can also be obtained by first preparing a well - kneaded mixture of a pigment , dispersant , and aqueous or water - dispersible resin using a kneader and a twin roll mill , dispersing the mixture further using the sand mill described above or the like , diluting the mixture by appropriate addition of water , and then blending glycerol , 1 , 3 - propanediol , and other optional additives to the resulting mixture . the mixing and stirring can be accomplished by a stirrer with blades , high speed dispersing machine , or emulsifier , or the like . it is preferred that the recording liquid is filtered thoroughly prior to or after dilution through a filter having a pore size of 0 . 65 μm or less , more preferably through a filter having a pore size of 0 . 45 μm or less . prior to the filtration process through a filter , filtration by centrifugal separator can be added to reduce filter clogging to cut down the frequency of filter exchange . viscosity of the prepared recording liquid should be adjusted to fall in the range of 0 . 8 cps to 15 cps ( 25 ° c . ), depending on the design of the ink jet printer . the surface tension should be 25 to 60 dyne / cm . no particular limitation is imposed on the ph but the ph within a range of 4 to 12 is preferred , and weak alkaline range of 7 to 9 ph is particularly preferred . the present invention will hereinafter be described more specifically based on examples . it should , however , be noted that the scope of the present invention is not limited to or by these specific examples , in which all designations of parts and percentages (%) indicate parts by weight and weight percentages ( wt .%), respectively . 15 parts by weight of a cyan pigment (&# 34 ; lionol blue 7351 &# 34 ;, toyo ink mfg . co ., ltd . ), 10 parts by weight of an acrylic resin - type dispersant (&# 34 ; pdx - 6101 &# 34 ;, johnson polymer co ., ltd . : 30 % solid ), and 75 wt . % of purified water were dispersed for two hours using a sand mill to prepare an aqueous dispersion of pigment . the prepared aqueous dispersion of pigment thus prepared was combined with the components listed below to be agitated and mixed with a dispersing machine . the resulting mixture was then filtered using a membrane filter of nitrocellulose resin with a pore size of 0 . 45 μm to obtain the blue recording liquid of preparation 1 . the recording liquids of preparations 2 - 7 were prepared in the same manner as in preparation 1 except that the amounts of glycerol and 1 , 3 - propanediol were varied . components used for these preparationes are shown in table 1 . the blue recording liquids of preparation c1 and c2 were prepared by using the aqueous dispersion of pigment obtained as a step in the production of preparations 1 and 2 , respectively , following the identical procedures as described above except that the additive was limited to either glycerol or 1 , 3 - propanediol and not both . components used for these preparations c1 - c2 are shown in table 1 . the recording liquids of preparations c3 - c6 were prepared in the same manner as in the preparations 1 - 7 except that glycol was added in place of 1 , 3 - parpanediol . components used for these preparations c3 - c6 are shown in table 1 . the clogging resistance , discharge stability , and storage stability of each of the recording liquids preparations 1 - 7 and preparations c1 - c6 were evaluated . this was accomplished by filling the cartridge of an ink jet printer (&# 34 ; hg - 5130 &# 34 ; manufactured by seiko epson co ., ltd .) with the test preparations and then printing . the results of this evaluation are shown in table 1 . the clogging resistance was evaluated by printing one hour after a cap was removed from the printer head . out of the total of 48 nozzles , those clogged were counted . the clogging resistance of the recording liquid was rated according to a number of clogged nozzles . in table 1 , the symbol &# 34 ;&# 34 ; indicates that none of nozzles was clogged , the symbol &# 34 ; δ &# 34 ; indicates that 1 - 24 nozzles were clogged , and the symbol &# 34 ; x &# 34 ; indicates that 24 - 48 nozzles were clogged . the discharge stability was evaluated after continuous printing for 10 minutes . out of the total of 48 nozzles , those clogged were counted . the discharge stability of the recording liquid was rated according to a number of clogged nozzles . in table 1 , the symbol &# 34 ;&# 34 ; indicates that none of nozzles was clogged , the symbol &# 34 ; δ &# 34 ; indicates that 1 - 24 nozzles were clogged , and the symbol &# 34 ; x &# 34 ; indicates that 24 - 48 nozzles were clogged . the storage stability was evaluated by storing the recording liquid at 60 ° c . for three months , after which changes in the particle diameter and viscosity were measured . the storage stability was rated according to the changes in the particle diameter and viscosity . in table 1 , the symbol &# 34 ;&# 34 ; indicates that neither the particle diameter nor the viscosity changed , the symbol &# 34 ; δ &# 34 ; indicates that only the particle diameter changed , and the symbol &# 34 ; x &# 34 ; indicates that both the particle diameter and the viscosity changed . in table 1 , dispersant &# 34 ; a &# 34 ; represents an aqueous solution of an acrylic resin - type high polymer dispersant (&# 34 ; pdx - 6101 &# 34 ;, johnson polymer co ., ltd . ), dispersant &# 34 ; b &# 34 ; a dispersant of an anionic surfactant (&# 34 ; newcol 565 snc &# 34 ;, nippon nyukazai co ., ltd . : 100 % solid ), and dispersant &# 34 ; c &# 34 ; an aqueous solution of an anionic surfactant (&# 34 ; newcol 707 sn &# 34 ;, nippon nyukazai co ., ltd . : 30 % solid ). vehicle resin emulsion &# 34 ; a &# 34 ; represents an emulsion of acrylic resin (&# 34 ; f - 157 &# 34 ;, nippon polymer co ., ltd . : 40 % solid ) and vehicle resin emulsion &# 34 ; b &# 34 ; an emulsion of an acrylic resin (&# 34 ; johncryl 450 &# 34 ;, johnson polymer co ., ltd . : 42 % solid ). glycol &# 34 ; a &# 34 ; represents ethylene glycol , glycol &# 34 ; b &# 34 ; diethylene glycol , glycol &# 34 ; c &# 34 ; 1 , 3 - butanediol , and glycol &# 34 ; d &# 34 ; propylene glycol ( 1 , 2 - propanediol ). table 1__________________________________________________________________________ preparation 1 - 7 preparation c1 - c6 1 2 3 4 5 6 7 c1 c2 c3 c4 c5 c6__________________________________________________________________________dispersionpigment blue blue blue blue blue red black blue blue blue blue blue redof pigment ( c . i .) 15 : 3 15 : 3 15 : 3 15 : 3 15 : 3 122 7 15 : 3 15 : 3 15 : 3 15 : 3 15 : 3 122 ( part ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) ( 15 ) dispersant a ( 10 ) a ( 10 ) a ( 10 ) a ( 10 ) a ( 10 ) b ( 2 ) c ( 10 ) a ( 10 ) a ( 10 ) a ( 10 ) a ( 10 ) a b ( 10 )( part ) purified 75 75 75 75 75 83 75 75 75 75 75 75 75water ( part ) average 100 nm 100 nm 100 nm 100 nm 100 nm 80 nm 60 nm 100 nm 100 nm 100 nm 100 nm 100 80 nmparticle sizerecordingdispersion 20 20 20 20 20 20 20 20 20 20 20 20 20liquidof pigment ( part ) vehicle resin a a a a a b b a a a a a bemulsion ( 2 . 3 ) ( 2 . 3 ) ( 2 . 3 ) ( 2 . 3 ) ( 2 . 3 ) ( 0 . 5 ) ( 1 . 0 ) ( 2 . 3 ) ( 2 . 3 ) ( 2 . 3 ) ( 2 . 3 ) ( 2 . 3 ) ( 0 . 5 )( part ) glycerol 10 5 40 0 . 1 5 5 5 15 / 10 10 10 10 ( part ) 1 , 3 - propane - 5 10 20 0 . 5 0 . 1 10 10 / 15 / / / / diol ( part ) glycol ( part ) / / / / / / / / / a ( 5 ) b ( 5 ) c d ( 5 ) purified 62 . 7 62 . 7 17 . 7 77 . 1 72 . 6 64 . 5 64 . 0 62 . 7 62 . 7 62 . 7 62 . 7 62 . 7 62 . 7water ( part ) results ofclogging ⊚ ⊚ ⊚ δ δ ⊚ ⊚ x x x x x xevaluationresistancedischarge ⊚ ⊚ δ ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ . circleincircle . stabilitystorage ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ ⊚ x x x xstability__________________________________________________________________________	2
fig1 shows an airplane 10 that includes , in accordance with an embodiment of the invention , two electrical energy generator systems 20 placed respectively at the ends of wings 11 and 12 . each system 20 comprises a streamlined fairing 21 corresponding in this example to a shell having the shape of a wing tip tank and of the same type as those fitted to the ends of airplane or missile wings in order to reduce or “ break ” turbulence ( vortices ) at the wing tip and reduce the interfering aerodynamic drag due to such turbulence . the shape of the fairing is essentially that of a wing tip tank or an ovoid that is tapered to a greater or lesser extent depending on the size and the shape of the wing on which the system of the invention is to be mounted . any other shape serving to reduce aerodynamic drag could be used . in addition , or instead of two electrical energy generator systems 20 placed at the ends of wings , the airplane could also have one or more systems 20 placed at the ends of portions of the airplane tail unit , as shown in fig1 . as shown in fig2 , inside its fairing 21 , each system 20 contains a turbine 22 having its shaft 220 connected to the rotor ( not shown ) of an electricity generator 23 . the electricity generator 23 is a rotary machine , e . g . an alternator . in the presently - described example , the shaft 220 is connected to the electricity generator 23 via stepdown gearing 231 . since the speed of the turbine can vary significantly depending on variations in the speed of the airplane , the system 20 also has a regulator 24 connected to the output 230 of the electricity generator . the regulator 24 serves to convert the alternating voltage at varying amplitude produced by the generator into an alternating voltage at constant amplitude and / or a direct current ( dc ) voltage . in the presently - described example , the regulator 24 performs both of these functions , and for this purpose it has a first output 241 delivering an alternating voltage at constant amplitude that is used for injecting directly into the primary electricity power supply network 13 of the airplane , and a second output 242 delivering dc and for use in recharging electrical energy storage elements 25 , specifically batteries that may be constituted by nickel cadmium or lithium ion storage batteries . in variant embodiments , the electrical energy storage elements may also be formed by supercapacitors or by flywheels . the electrical energy stored in the element 25 is injected on demand via an output 251 into the secondary electrical power supply network 14 of the airplane . the electrical energy immediately available from the output 241 of the regulator or the energy previously stored in the storage elements 25 and available at the output 251 , can be used during stages of descent in order to power numerous devices of the airplane , such as in particular : pressurizing the cabin of the airplane ; air conditioning the cabin ; de - icing mats for heating the leading edges of the wings ; an electrical system for extending landing gear ; electrical braking . each electrical energy generator system 20 also has air admission means in the front portion 21 a of the fairing 21 , which air admission means are movable between an open position in which the turbine 22 is exposed to the stream of air outside the fairing ( fig3 ), and a closed position in which the turbine is masked inside the fairing ( fig2 ). in the presently - described embodiment , the air admission means are constituted by flaps or lids 26 of curved shape that are arranged between the nose 210 and the body 211 of the fairing 21 . the upstream end 261 of each flap 26 is fastened to the nose 210 via a hinge connection 262 , while the downstream end 263 of each flap 26 is free . the downstream end 263 presents a portion 2630 of curved shape that presses against the upstream end 2110 of the body 211 when the flaps 26 are in the closed position , as shown in fig2 . in order to reduce potential drag due to turbulence created at the clearance present between the flaps and the fairing , an upstream annular sealing gasket 264 is arranged in the portion present between the nose 210 and the upstream end 261 of the flaps 26 , and a downstream annular sealing gasket 265 is arranged between the upstream end 2110 of the body 211 and the downstream ends 263 of the flaps 26 . in the presently - described example , the flaps 26 are held and moved between a closed position and an open position by actuators 27 , each secured at one end to the inside wall of the fairing 21 and at the other end to a flap 26 via a linkage 28 . in the closing position of the air admission means as shown in fig2 , the actuators 27 exert thrust on the shaft 281 of the linkage 28 so as to hold the flaps 26 in the closed position via hinged arms 282 connected to the opposite end of the shaft 281 . in the closing position of the air admission means as shown in fig3 , the actuators 27 exert traction on the shaft 281 in order to cause it to retract downstream and lower the flaps 26 . in the embodiment shown in fig2 and 3 , the shaft 281 of the linkage 28 passes through the center of the turbine 22 . the shaft 281 is supported by an internal portion 212 of the fairing that is of axisymmetric shape for the purpose of directing the outside air stream penetrating into the fairing 21 towards the blades of the turbine 22 . the internal fairing portion 212 also supports a ball bearing 213 for the turbine 22 . on its rear portion , the turbine 22 includes a gearwheel 221 that is engaged with the shaft 220 of the turbine 22 and that is offset relative to its axis . by acting on the actuators 27 , it is possible to cause the flaps to open and close , and consequently to generate or not generate electrical energy by means of the system 20 . thus , when the air admission means are put into the open position , as shown in fig3 , the flaps 26 are lowered into the inside of the fairing 21 , thereby enabling the outside air stream f flowing over the fairing 21 to enter into the inside of the fairing and drive the turbine 22 in rotation , which by virtue of its coupling with the electricity generator 23 , enables electrical energy to be produced . when there is no need to generate electrical energy by means of the system 20 and / or during stages of takeoff , climbing , or cruising , the flaps 26 are held in the closed position for the air admission means , as shown in fig2 , in order to reduce aerodynamic drag . in this position , the flaps are placed in alignment with the streamlined shape of the fairing 21 , thereby totally masking the turbine 22 inside the fairing , together with all of the other elements used for generating and storing electrical energy . consequently , in the closed position of the air admission means , the flaps 26 do not create longitudinal drag , with the system 20 then acting fully to reduce wing tip turbulence . the rear portion 21 b of the fairing 21 has openings that are formed in this example by louvers or vents 29 enabling the stream of air admitted into the inside of the fairing 21 to escape therefrom when the air admission means are open . this avoids raising pressure inside the fairing 21 . in addition , the stream of air flowing in this way inside the fairing 21 serves to cool the power electronics associated with the electricity generator and also to cool the electrical energy storage means , in particular when they are constituted by batteries that may heat up during charging . the openings may be permanent or they may be closable on command . in a variant embodiment of an electrical energy generator system 120 in accordance with the invention , as shown in fig4 a , 4b , 5a , and 5b , the air admission means may be constituted by slats or butterfly members 126 extending between the nose 1210 and the body 1211 of the fairing 121 . more precisely , the upstream and downstream ends 1261 and 1262 of each slat 126 are fastened respectively to the nose 1210 and to the body 1211 via pivot connections 1212 and 1213 . in the presently - described example , each slat is connected to a pivot shaft 1281 by a link 1282 . pivoting of the shaft 1281 , and consequently pivoting of the slat 126 , is driven by an actuator 127 connected at one of its ends to the opposite free end of the shaft 1281 and at its other end to the inside wall of the fairing 121 . the other portions of the electrical energy generator system 120 are identical to those of the above - described system 20 and are not described again , for simplification purposes . by acting on the actuator 127 , it is possible to open and close the flaps , and consequently to generate or not generate electrical energy by means of the system 120 . thus , when the air admission means are put into the open position as shown in fig5 a and 5b , the actuator 127 is actuated to pivot the shaft 1281 , and consequently to pivot the shafts of the slats 126 so that they occupy the position shown in fig5 b . this position of the slats 126 enables the outside stream of air f flowing over the fairing 121 to enter into the inside of the fairing and drive the turbine 122 in rotation , which by means of its shaft 1220 coupled to an electricity generator ( not shown in fig5 a ), serves to produce electrical energy . in fig5 b , it can be seen that the slats 126 present good aerodynamic transparency ( i . e . low drag ) when they are in their open position . when there is no need for electrical energy to be generated by the system 120 , and / or during stages of takeoff , climbing , or cruising , the slats 126 are held in the closed position of the air admission means , as shown in fig4 a and 4b . in this position , the slats are placed in alignment with the streamlined shape of the fairing 121 , thereby totally masking the turbine 122 inside the fairing , together with all of the other elements used for generating and storing electrical energy . consequently , in the closed position of the air admission means , the slats 126 do not create longitudinal drag , with the system 120 then acting fully to reduce wing tip turbulence . in order to control the speed of rotation of the turbine in the electrical energy generator system of the invention as a function of the speed of the air stream entering the turbine , and as shown in fig4 c , the turbine may have variable pitch blades 123 , with the pitch of the blades 123 being increased when the speed of the air stream is high , and reduced when the speed of the air stream is lower . the electrical energy generator system ( s ) of the invention may be controlled automatically by the control system ( onboard computer ) of the airplane . the airplane control system may be programmed in particular to : cause the air admission means to open automatically at least during a stage of the aircraft descending ; cause the air admission means to open automatically in the event of at least one engine of the aircraft failing ; and to cause the air admission means to open automatically in the event of a failure of a generator of at least one engine of the aircraft . the electrical energy generator system ( s ) may also be controlled manually by means of a control button or switch “ s ” placed in the cockpit of the airplane . the pilot or the copilot can thus act manually to open the air admission means , and consequently to produce electrical energy , whenever they so desire , and in particular in the event of an emergency ( total failure of one or more of the main engines or loss of electricity generator from one or more of said engines ), or in an electric airplane emergency . thus , the electrical energy generator system of the invention advantageously replaces the emergency ram air turbines ( rat ) that exist on present airplanes and that in addition to being heavy and expensive , sometimes present problems of reliability . in addition to the above - mentioned advantages , the electrical energy generator system is placed at locations of the aircraft that are easily accessible , thereby greatly simplify maintenance , in particular maintenance of the power electronics and of the energy storage means , since they are immediately accessible , while being isolated from the inside space of the airplane that is occupied by passengers , thereby preventing possible harmful gases , e . g . generated in the event of thermal runaway of one or more batteries , reaching the cabin of the airplane .	1
for a general understanding of the features of the present invention , reference is made to the drawings . in the drawings , like references have been used throughout to designate identical elements . fig1 illustrates an embodiment of two - path liquid crystal light valve ( lclv ) color display 100 of the present invention . in this first embodiment , a single light source 20 is used to provide illumination for the display . light source 20 may provide a continuous , broadband spectral power distribution or may be constructed so as to produce spectral peaks in the red , green , and blue portions of the visible spectrum . the light emanating from light source 20 is initially passed through one or more optical elements collectively labeled as 30 on fig1 . optical elements 30 may comprise any conventional light collecting , bundling , or collimating elements , such as a conventional spherical or parabolic reflector , condensing lens , or collimating lenses , according to the light requirements of the optical components of the specific implementation of the two path color display . essentially , optical elements 30 serve to collect and bundle the light rays from light source 20 into a telecentric light ray bundle , as for example , via a condensing lens , or into parallel collimated light rays , as for example via one or more collimating lenses . for purposes of the embodiment illustrated in fig1 the light emerging from optical element 30 will be referred to as collimated light , but the term is not intended to limit optical element 30 to one or more collimating lenses , and as noted above , optical element 30 may also include other light collecting and bundling optical elements . the collimated light emerging therefrom is then passed to a heat removing optical element 24 . an appropriate heat removing optical element is a cold mirror which reflects light in the visible portion of the spectrum and transmits infrared radiation , but it is intended that any single or set of optical elements may be used which are suitable for removing nonvisible infrared radiation from the broadband light emanating from light source 20 . the nonvisible infrared radiation transmitted by optical element 24 is manifest as heat and may be dissipated by a convection heat sink or forced air cooling ( not shown ). methods for handling heat generated by light source 20 are generally known in the art . see , for example , dolgoff , u . s . pat . no . 5 , 012 , 274 , entitled , &# 34 ; active matrix lcd image projection system &# 34 ;, at columns 7 and 8 , lines 6 through 68 and lines 1 through 7 , respectively . the collimated light reflected by optical element 24 is passed to a yellow - blue dichroic mirror 26 which reflects middle ( green ) and long ( red ) wavelengths . together , the red and green portions of the spectrum produce what is visually perceived as yellow light - hence the reflected light path from dichroic mirror 26 is hereafter referred to as the yellow path , labeled the y path in fig1 . dichroic mirror 26 transmits the short wavelength or blue portion of the visible spectrum . the blue light is subsequently reflected through a 90 ° angle by a front surface mirror 28 to enter the blue light path , labeled the b path in fig1 . it will be understood by those skilled in the art that optical elements 30 may be positioned at other points in the red - plus - green and blue optical paths . for example , the broadband light emanating from light source 20 may be collimated after separation and reflection by mirrors 24 , 26 , and 28 with one optical element 30 placed at the entry to each of the optical paths . to form the red and green components of a full - color image , the collimated yellow ( combined red and green ) light entering the y path passes through a set 60 of optical elements . specifically , the yellow light is linearly polarized by polarizer 32 prior to entering the twisted nematic liquid crystal ( hereafter , tnlc ) cell 34 where red and green image formation is accomplished . the operation of twisted nematic type liquid crystal cells is well known in the art , and certain components of the cell , such as the transparent substrates , conductive layers , and voltage source have been omitted from the figure . briefly stated the twisted nematic cell varies the rotation of the axis of polarization of the yellow linearly polarized light to transmit plane polarized yellow light without rotation ( zero degrees ) when fully energized , and to cause a 90 ° ( ninety degree ) rotation when the cell is not energized . for voltages less than a predetermined level which represents the fully energized state , plane polarized yellow light incident upon tnlc cell 34 is rotated through an angle less than 90 degrees , depending on the voltage applied to cell 34 . tnlc cell 34 consists of a matrix of display pixels that may either be passively addressed via a conventional multiplexing scheme or actively addressed with an active matrix of thin film transistors ( tfts ) or other conventional &# 34 ; latch - and - hold &# 34 ; circuit elements . methods for activating liquid crystal display pixel matrices are known in the art . for example , johnson , in u . s . pat . no . 4 , 886 , 343 briefly describes such methods in column 5 , lines 41 through 65 , incorporated by reference herein . dolgoff in u . s . pat . no . 5 , 012 , 274 at columns 5 and 6 , lines 66 through 68 and lines 1 through 19 , respectively , provides a discussion , which is also incorporated by reference herein , of a thin film transistor active matrix lcd . a pattern or matrix of red and green thin - film absorption or interference filters 35 , labeled r and g in fig1 typically fabricated as an integral layer with tnlc 34 as shown , is aligned with the matrix of display pixels to select out red and green image components from the composite yellow light path . preferably , the arrangement of the red and green filters 35 alternates in both the horizontal and vertical dimensions . the output from tnlc cell 34 is then passed through conventional linear polarizer 36 , which serves as the analyzer and enables the control of the light intensity at each red and green display pixel of tnlc cell 34 . to form the blue component of the full - color image , the collimated blue light entering the b path in fig1 is linearly polarized by polarizer 40 prior to entering the twisted nematic liquid crystal ( tnlc ) cell 42 . image formation in the b path is similar to that of the y path and is accomplished with tnlc cell 42 , which is also a matrix of display pixels that may either be passively addressed via a multiplexing scheme or actively addressed with an active matrix of tfts or other &# 34 ; latch - and - hold &# 34 ; circuit elements . the output from tnlc cell 42 is then passed through conventional linear polarizer 44 , which serves as the analyzer and enables the control of the light intensity at each blue display pixel of tnlc cell 42 . fig2 a and 2b are simplified diagrams of the display pixel matrices for tnlc cells 34 and 42 , respectively . fig2 a illustrates that tnlc cell 34 has a display pixel resolution of 8 by 8 display pixels , which in turn represents a red and green image resolution of 4 by 8 ( or 8 by 4 ) image pixels . fig2 b illustrates that tnlc cell 42 has a display pixel resolution of 4 by 4 display pixels , which in turn represents a blue image resolution of 4 by 4 image pixels , since each display pixel is the equivalent of a single blue image pixel in the displayed image . to achieve the increased brightness in the color display from a brighter blue image , the display pixels in both the horizontal and vertical dimensions in pixel matrix of tnlc cell 42 are larger than the display pixels in the pixel matrix of red and green image forming tnlc cell 34 . the larger display pixels in tnlc cell 42 provide a blue image with an increased space - average intensity ( luminance ). however , the blue image produced has an overall sampling density , or image resolution , which is less than the image resolution of the red and green image produced by red and green tnlc cell 34 . preferably , the overall reduced sampling density of the display pixel matrix of tnlc cell 42 is in the range of one - half to one - fourth that of the display pixel matrix of red and green image forming tnlc cell 34 . as shown in fig2 a and 2b , the display pixel density reduction of tnlc cell 42 is one - half that of the display pixel matrix of red and green image forming tnlc cell 34 in both the horizontal and vertical directions , resulting in an overall display pixel density or resolution for tnlc 42 of one - fourth the display pixel resolution of tnlc cell 34 , and an overall image resolution reduction for the blue image of one - half that of the image resolution of the red and green image . the research cited earlier relating the characteristics of human spatial sensitivity to different wavelength light energy suggests that a lower image resolution for the blue image component in the range of from one - half to one - quarter the image resolution of the red plus green image component is roughly proportional to the eye &# 39 ; s respective peak spatial frequency responses to blue light and red or green light . however , it will be appreciated by those skilled in the art that other suitable reductions in overall pixel sampling density may work effectively in particular situations to provide a suitable blue image component with increased brightness without effecting the effective resolution of the full color image . however , it will also be appreciated by those skilled in the art that there will be a resolution reduction limit in a particular situation beyond which reducing the resolution of the blue image below that of the red and green image will result in reducing the effective resolution of the full color image . returning now to fig1 to combine the color image components from the y and b light paths into a full - color image , the light in the y path , from the matrix of red and green display pixels , is reflected at 90 ° by front surface mirror 46 and then passes through a yellow - blue dichroic mirror 48 . light in the b path from the array of blue pixels is reflected from yellow - blue dichroic mirror 48 . the combined full - color image is then ready for viewing on a direct - view surface , or it may be passed through conventional projection lens assembly 50 , as shown , which magnifies the full color image and relays the image to an appropriate conventional front or rear viewing surface ( not shown ). examples of suitable image projection methods may be found in dolgoff , u . s . pat . no . 5 , 012 , 274 , at columns 13 and 14 , and in conner et . al ., in u . s . pat . no . 4 , 917 , 465 , at columns 11 and 12 . those skilled in the art will appreciate that the two - path lclv color display of the present invention may be configured as either a direct view display , or a projection display . referring now to fig3 there is illustrated two - path lclv color display 110 , an embodiment of the present invention which utilizes two separate light sources 52 and 54 in place of single light source 20 to provide illumination for the display . two - path lclv color display 110 has fewer optical elements than two - path lclv color display 100 of fig1 and may be more suitable in situations requiring a more compact display . light source 52 provides light energy having a spectral power distribution in the long ( red ) and medium ( green ) wavelength portions of the visible spectrum , and is labeled &# 34 ; y &# 34 ; in fig3 . light source 54 provides light energy in the ( short ) blue wavelength region of the visible spectrum . both light sources 52 and 54 include optical elements , not separately shown , for collimating or bundling the light components as they enter the respective first and second optical paths . the individual yellow and blue light sources of the embodiment illustrated in fig3 eliminate the light separating optical elements of fig1 . to combine the color image components from the y ( red and green ) and blue light paths into a full - color image , the light from the matrix of red and green display pixels passes through yellow - blue dichroic mirror 48 . light from the matrix of blue display pixels is reflected from yellow - blue dichroic mirror 48 . the combined full - color image is passed to a viewing surface using any appropriate mechanism , such as the projection lens 50 of fig1 . alternatively , for direct viewing of the combined image , a light diffuser in the form of an optical screen may be used to diffuse the light exiting the display in a manner to meet the requirements of the application so that the combined image would be visible to a human observer at substantially all on - axis and off - axis viewing angles . such a screen could be a light scattering device such as ground glass which would isotropically diffuse the image . the screen could also be a lenticular lens which would direct the light in a preferred direction or directions . the use of ground glass or lenticular lenses as screen materials is well known in the art . it can be appreciated from the descriptions of two - path lclv color display 100 and 110 of the present invention , illustrated in fig1 and 3 , that two advantages are provided over a device of comparable image pixel density and size which uses spatial juxtaposition of coplanar red , green , and blue image subpixels . first , effective spatial resolution is improved since , as noted above , the long and middle wavelength light propagating along the y light path provide virtually all of the spatial detail for color image reconstruction , and the resolution of the image created along this light path is not degraded by short ( blue ) wavelength image components . in addition , a much brighter display image is produced as a result of using larger sized , lower resolution blue image pixels , and as a result of eliminating an absorptive blue filter in the system . moreover , the color display illustrated in fig1 and 3 may also be constructed with smaller tnlc cells having fewer display pixels than in a single path device , without sacrificing brightness or image quality because of the separate treatment of the blue light . it can also be appreciated from the descriptions of two - path lclv color display 100 and 110 of the present invention that two advantages are provided over a three optical path device using spatial superposition of three separate red , green , and blue images . perhaps most importantly , the elimination of separate red and green optical paths reduces the critical nature of the registration of these paths , since , in the present invention , the red and green image components which contain almost all of the spatial information in the full - color image are constrained to a fixed alignment within a single red and green image forming source , and thus will never be misaligned . moreover , the elimination of one optical path and associated optical elements reduces cost , complexity , and size of the color display device . turning now to fig4 there is illustrated still another embodiment of the present invention which is encompassed by a different set 70 of optical elements for handling light in the y light path to form the red and green components of a full - color image . in this third embodiment , overall perceived brightness in the color display which may be impaired by the red and green thin - film absorption or interference filters 35 ( fig1 and 3 ) is improved by eliminating these filters . yellow light ( that is , combined red and green light ) entering the y path is initially passed through collimating optics 30 which contains optical elements ( not shown ) for producing substantially collimated light . collimating optics 30 could comprise any conventional collimating elements , such as a conventional spherical or parabolic reflector , condensing lens , and collimating lenses . it will be understood by those skilled in the art that the optical alignment requirements of the embodiment illustrated in fig4 discussed in more detail below , require substantial collimation of the red and green light components , and it is preferable to collimate the red and green light components immediately prior to the yellow light entering set 70 of optical elements which form the red and green components of the full - color image . the collimated light is then linearly polarized by conventional linear polarizer 32 prior to entering first tnlc cell 76 . first tnlc cell 76 modulates the intensity of the polarized , collimated light propagating through the y path by rotating the axis of polarization of the incoming polarized light through an angle between 0 ° and 90 °, depending on the voltage applied to the cell , to correspond with the desired intensity level of the light . modulation in tnlc cell 76 is accomplished either passively or actively , in a manner similar to that described for tnlc cell 34 in fig1 . tnlc cell 76 is used in combination with linear polarizer 78 , which acts as a polarization state analyzer , for intensity , or gray scale , control of the red and green display pixels . by way of example , symbol 79 illustrates that polarizer 78 transmits the full spectrum of light polarized in a horizontal orientation , and absorbs light polarized in the vertical orientation . in the remainder of the description of the embodiment illustrated in fig4 which follows , the light emerging from linear polarizer 78 in a horizontal orientation will be considered as being in a first polarization orientation as it enters the remaining optical elements of the set 70 of optical elements . it will be understood by those skilled in the art that references in the following description to polarization orientations of &# 34 ; vertical &# 34 ; and &# 34 ; horizontal &# 34 ; are for illustrative purposes only , and that other pairs of orthogonal polarization orientations are encompassed by the embodiment of the present invention illustrated in fig4 . the intensity controlled and collimated polarized light emanating from linear polarizer 78 is then passed through a second tnlc cell 80 with a matrix of addressable display pixels . tnlc cell 80 is positioned with respect to tnlc cell 76 such that the matrix of addressable display pixels of tnlc cell 80 is substantially aligned with the matrix of addressable display pixels of tnlc cell 76 . because the polarized light emanating from the linear polarizer 78 is substantially collimated , light passing from an individual display pixel in tnlc cell 76 will be optically aligned with a corresponding display pixel in second tnlc cell 80 . tnlc cell 80 controls the selection of color along the red - green colorimetric axis by rotating the axis of polarization of the incoming polarized light through an angle between 0 ° and 90 °, depending on the voltage applied to the cell . selection of colors along the colorimetric axis from red through green is accomplished with two orthogonally oriented color polarizers 82 and 84 which are thin sheet materials with dyes which function as color - specific light analyzers of the polarized light passing through them . first color polarizer 82 absorbs light with a vertical orientation except for red light , so that white light polarized in a vertical orientation ( i . e ., orthogonal to the first polarization orientation ) is transmitted as red light . light polarized in a horizontal orientation ( i . e ., in the first polarization orientation ) is not absorbed , so both red and green light along this y optical path polarized in the horizontal orientation is transmitted . second color polarizer 84 transmits both red and green light with a vertical orientation and transmits only green light for polarized light in the horizontal orientation . intensity controlled and collimated polarized light oriented between the two orthogonal states results in a combination of both red and green light passing through color polarizers 82 and 84 , thereby permitting the selection of a range of colors along the red and green colorimetric axis . in this embodiment , blue light along the b path and the final combination of the red plus green and blue images , while not shown in fig4 are treated in the same manner as described above in conjunction with fig1 . fig5 a , 5b , and 5c illustrate the operation of second tnlc cell 80 and color polarizers 82 and 84 in more detail . with reference first to fig5 a , collimated red and green light , polarized in a horizontal ( first ) orientation by linear polarizer 78 ( fig4 ), is represented by arrow 86 . the collimated , polarized light enters individual display pixel 80a in the display pixel matrix of tnlc cell 80 . through conventional addressing techniques briefly described above , the individual display pixel is addressed and energized to rotate the axis ( plane ) of polarization of the incoming light in a range from zero degrees ( 0 °) when the display pixel should produce a pure green hue to ninety degrees ( 90 °) when the display pixel should produce a pure red hue , depending on the voltage applied to the cell . in fig5 a , display pixel 80a represents a red hue pixel in the final red plus green image . the collimated , polarized red and green light represented by arrow 86 is rotated 90 ° ( ninety degrees ) from its horizontal orientation to represent the color red . light exiting lclv display pixel 80a then enters first color polarizer 82 . color polarizer 82 has a red light transmission axis in the vertical orientation , as shown by the vertical line labeled &# 34 ; r &# 34 ; in polarizer 82 , and its function is to select red light . color polarizer 82 transmits red light polarized in the vertical orientation ( i . e ., orthogonal to the first , or horizontal , orientation ), blocks green light polarized in the vertical polarization orientation , and transmits broadband ( white ) light polarized in the horizontal orientation , as shown by the horizontal line labeled &# 34 ; w &# 34 ; in polarizer 82 . in the case of the light emanating from display pixel 80a in fig5 a , the vertically polarized red light will pass through color polarizer 82 , and vertically polarized green light will not be transmitted . the transmitted red light from color polarizer 82 then enters second color polarizer 84 . color polarizer 84 has a green transmission axis in the horizontal orientation , as shown by the horizontal line labeled &# 34 ; g &# 34 ; in polarizer 84 ( i . e ., orthogonal to the vertical polarization orientation of color polarizer 82 ). color polarizer 84 transmits green light polarized in the horizontal orientation , transmits broadband ( white ) light polarized in the vertical orientation , and blocks red light polarized in the horizontal orientation . thus , the function of color polarizer 84 is to select polarized green light having a horizontal orientation . in the case of the red light emanating from color polarizer 82 in fig5 a , which is still in the vertical orientation , the red light will be transmitted through color polarizer 84 . similarly , fig5 b illustrates the propagation of light through tnlc cell 80 and color polarizers 82 and 84 when display pixel 80b represents a green hue display pixel in the final red plus green image . collimated light , polarized in a horizontal orientation by polarizer 78 ( fig4 ) and shown by arrow 86 , enters lclv display pixel 80b and is rotated 0 ° ( zero degrees ) from its horizontal orientation to represent a green color . light emanating from display pixel 80b thus remains polarized in the first ( or horizontal ) orientation . color polarizer 82 will transmit both red and green light in a horizontal orientation , so the red and green light emanating from display pixel 80b emerges from color polarizer 82 . color polarizer 84 transmits only green light polarized in a horizontal orientation , and so the red light polarized in the horizontal orientation is blocked , and only green light emerges from color polarizer 84 . finally , fig5 c illustrates the propagation of light through tnlc cell 80 and color polarizers 82 and 84 when display pixel 80c represents a color between the red and green colors , such as a yellow hue image pixel , in the final red plus green image which exits the y path . collimated light , polarized in a horizontal orientation by polarizer 78 ( fig4 ) and shown by arrow 86 , enters lclv display pixel 80c and is rotated 45 ° ( forty - five degrees ) from its horizontal orientation to represent the desired yellow hue . the polarized red plus green light emerging from lclv display pixel 80c , shown by arrow 89 , is actually composed of vertically polarized red and green light components and horizontally polarized red and green light components , as shown by the dotted line vectors labeled &# 34 ; r + g &# 34 ;. the polarized red plus green light then enters color polarizer 82 . color polarizer 82 transmits the red light components polarized in a vertical orientation , transmits both red and green light components polarized in a horizontal orientation , and blocks the green light components polarized in the vertical orientation . color polarizer 84 transmits the green light components ( vectors ) polarized in the horizontal orientation , blocks the red light components polarized in the horizontal orientation , and transmits the red light components polarized in the vertical orientation . in this manner , polarization vectors oriented between the two orthogonal states result in a combination of quantities of both red and green light components passing through color polarizers 82 and 84 , thereby permitting the selection of a range of colors along the red and green colorimetric axis . it can be appreciated from this description of a different set 70 of optical elements for handling the light propagating through the y path of two - path lclv color display 100 that many of the advantages described in conjunction with the first embodiment illustrated in fig1 are also preserved in the third embodiment illustrated in fig4 and 5 . however , luminous efficiency and overall perceived brightness of the final full color image will likely be improved over the first embodiment shown in fig1 since more light is lost through absorption by the red and green color filters in fig1 than by the light absorption in the color polarizers 82 and 84 . overall luminous efficiency in the third embodiment , largely determined by the degree of light collimation required , could be comparable to a three - path , three image full color display device . in addition , the third embodiment enables full color control along the red and green colorimetric axis at each addressable display pixel , rather than from combining separate red and green display pixels in one tnlc cell . thus , each addressable red - to - green display pixel is the equivalent of an image pixel in the displayed image . this feature of the third embodiment of the two - path color display provides flexibility in display design to meet a variety of design goals . for example , image resolution and quality can be improved , without sacrificing color control , over a similarly sized lclv which uses additive juxtaposition of display pixels to create a mixture color , since twice as many display pixels may be used to create an image that is the same size as an image which uses additive juxtaposition of display pixels to create a mixture color . similarly , a full color display having greater overall perceived brightness than , but the same effective image resolution as , for example , the display illustrated in fig1 is achievable by simply using larger display pixels having a larger transparent portion in each pixel . alternatively , the display itself could be fabricated with a smaller tnlc cell with no loss of image resolution or brightness but at a lower cost , resulting from decreased fabrication costs and from the use of smaller optical elements . finally , while this third embodiment uses two tnlc cells in one of the optical paths which must maintain careful display pixel alignment , this alignment is relatively easy to achieve and maintain using conventional techniques , since the cells are positioned very close together in the yellow optical path . this alignment is more easily achieved than the alignment of the red and green images required in a three optical path display . in recapitulation , the two - path liquid crystal display system disclosed herein provides several advantages over prior art color display systems . the spatial superposition technique for producing the full color image provides improved effective spatial resolution over a device of comparable image pixel density and size which uses spatial juxtaposition of coplanar red , green , and blue subpixels since , as noted above , the long and middle wavelength ( i . e ., the yellow channel ) elements provide virtually all of the spatial detail for color image reconstruction . moreover , the full color display system of the present invention provides improved luminous efficiency over a device of comparable image pixel density and size which uses spatial juxtaposition of primary color subpixels because of the separate treatment of the red and green light , and because of the lower resolution and consequently larger size of the blue image pixel elements . luminous efficiency is also improved by the elimination of an absorptive blue filter in the system , as found in some prior art color display systems . further , the simplification of the two - path liquid crystal display system over full - color three - path devices requiring the superposition of separate red , green , and blue images by elimination of one optical path and associated optical elements reduces manufacturing costs , size , and the critical nature of the precise registration needed for three separate images in a three - path system . in the two - path system of the present invention , the red and green image components , which contain almost all of the spatial information in the full - color image , are constrained to a fixed alignment within a single red and green image forming source . it is therefore evident that there has been provided in accordance with the present invention , a color display that fully satisfies the objects , aims , and advantages hereinbefore set forth . while the present invention has been described and illustrated in connection with specific embodiments , it will be understood that it is not intended to limit the invention to those embodiments . on the contrary , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , the present invention is intended to cover all such alternatives , modifications , equivalents and variations as may be included within the scope of the invention as defined by the appended claims .	6
according to one aspect of this invention , a remote unit incorporates a microphone while providing , in combination , an optional active distance ranging function , enabling an individual or other audio source to be automatically focussed in accordance with time - of - flight principles . as such , not only does the invention provide a more faithful audio signal , but in addition , the use of active ranging solves problems associated with passive auto - focus systems , such as foreground disturbances and the frequent inability to distinguish between desired subject matter and background scenery . in a preferred physical configuration of this embodiment , a camera is provided with a docking arrangement to receive the remote unit , as shown in fig1 a . although fig1 and 2 will be described in conjunction with a consumer - type hand - held camcorder , the invention is equally applicable to both moving and still image gathering in industrial and professional configurations as well . both stereo and mono audio recording are also readily accommodated by the invention , with the remote unit both in its docked and undocked configurations . in fig1 a , a camera 102 has physically received a remote unit 104 containing a microphone , and an electrical path is formed through a set of electrical contacts not visible in this figure between the camera and remote unit . preferably , in this configuration , with the remote unit 104 docked as shown , certain facilities associated with remote operation are defeated ( if activated ) to save on battery power , and with the microphone delivering an audio signal to the camera in hard - wired fashion . in fig1 b , the remote unit , now labeled 104 ′, has been removed from the docking facility provided on the camera 102 , facilitating at least a remote microphone capability . preferably , the wireless link to the camera is rf in nature , and may be use fm or other modulation techniques and any allocated frequency . an optical or ir link may also be used . thus , with the microphone 104 ′ removed and this mode of operation activated , audio information detected at the microphone is no longer delivered to the camera 102 in hard - wired fashion , but , instead , is transmitted via a wireless signal 106 to the camera body . in the case of an rf signal the camera body may be equipped with an antenna 110 which , conveniently , may be exposed upon removal of the microphone from its docked position . also shown in fig1 b are contacts 108 between the camera 102 and remote unit 104 , these contacts having been exposed upon removal of the microphone from the docking station . activation of the remote configuration may be carried out through switches on the microphone , or on the camera body , or both . alternatively , remote operation of the microphone may automatically be activated through the removal of the microphone from its docked position , for example , by sensing an electrical or mechanical condition , thereby foregoing the need for manually operated switches . according to the remote mode of operation , the unit 104 ′ transmits a wireless signal modulated with audio information in a manner similar to conventional remote microphones , but with several notable differences . firstly , virtue of the docking capability , a rechargeable battery in the microphone 104 may be automatically charged through the battery of the camera through contacts between the camera and remote unit . thus , by docking the remote onto the camera 102 , a separate recharger stand need not be provided according to the invention . another difference is that , as discussed above , even with the remote mode of operation having been selected , with the microphone docked onto the body of the camera 102 , this mode of operation is preferably automatically defeated to save on battery power . as a further difference relative to conventional , non - integrated remote microphones , the directionality of the inventive microphone may be made to change from a broad angle of pick - up when docked to a relatively narrow angle of pick - up when removed . this is preferred , since , with the remote unit docked on the camera , particularly with a wide - angle visual field - of - view , a broad range of audio reception may be desirable . in contrast , with the microphone removed and placed relative to an individual being recorded , for example , a relatively narrow angle of reception may be more preferable . as discussed further with reference to fig2 , this switching in directionality may be accomplished manually or automatically , as by sensing an electronic or mechanical condition . in addition to its use as a remote microphone , the unit 104 ′ may also be used in conjunction with a suitably equipped camera to provide an active distance auto - ranging function based upon time - of - flight . although the same or a different rf frequency or optical link may be used for such purpose , in a preferred embodiment the camera is designed to broadcast an inaudible acoustic signal which is received by the remote unit 104 ′ and relayed back to the camera in wireless fashion for the purpose of performing a distance determination . an acoustic signal such as an ultrasonic signal is preferred due to its relatively lower speed of propagation and greater ease with which a distance calculation may be performed . to limit power consumption , and to simplify the distance determination , a series of acoustic pulses are preferably generated on a periodic basis , having a frequency as low as 20 khz , and a repetition rate as low as one or fewer pulses power second . clearly , it is well within the scope of the invention to use higher or lower frequencies and / or repetition rates . having received a transmitted signal from a suitably equipped camera , the remote unit 104 ′ relays a transponding signal back to the camera and , based upon the difference between the signal sent and that received , distance is determined within the camera , and an output signal is coupled to an auto - focus circuit , which may be of otherwise conventional design . although a different rf or optical frequency may be used for the auto - focus signal relayed back to the camera , in the preferred embodiment , the same carrier as that used for the remote microphone is used to carry the auto - ranging signal , thereby obviating the need for a separate transmitter / receiver pair . much of the circuitry used to gather and modulate the remote audio signal may be used to gather and modulate the inaudible acoustic signal transmitted by the camera , thus simplifying the circuit configuration while providing for a more cost - effective arrangement . if the audio pick - up used for the remote microphone capability is also capable of receiving the inaudible acoustic signal from the camera used for auto - focus purposes , even the same microphone may be used for both audio pick - up and reception of the ranging signal for auto - focussing purposes . fig2 a is a block diagram which illustrates major functional components associated with a remote unit according to the invention . a set of electrical contacts 206 , which are illustrated commonly between fig2 a and 2b , are used to communicate electrical signals between the camera and the remote unit . an audio pick - up 208 , which may be contained within a physical receptacle 209 , delivers an audio signal to a selection circuit 212 controlled by a central - processing unit ( cpu ), which may take the form of a microprocessor or single - chip microcomputer , whether of standard or custom derivation . a separate microphone 210 may be added and selected by block 212 in order to modify directionality . that is , for a broader angle of reception , with the remote unit docked onto the camera body , for example , the pick - up 210 may be selected , whereas , with the remote unit removed , and if a narrower range of reception is desired , microphone 208 may alternatively be selected . there may also be situations where , depending upon the circumstances , both microphones 208 and 210 may be selected for use . in addition , as discussed above , both mono and stereo operation are accommodated by the invention though only mono pick - ups are shown in the figure . depending upon frequency response , microphones such as 208 and / or 210 may be used to receive an inaudible acoustic signal according to the active ranging aspect of the invention . alternatively , however , a separate transducer 216 may be used to receive the auto - focus related signals , or , as a further alternative , in the event that rf signals are used in both directions , a receiver 218 , under control of cpu 214 , may be used , with demodulator circuit 220 being used to provide baseband audio , selectable at block 212 . the purpose of switch 224 is to route baseband audio , either through modulator 226 and rf amplifier 230 and out antenna 232 in the event that a wireless mode of operation has been selected or , alternatively , to route the audio signals through the electrical contacts 206 with the remote unit in its docked position . with the remote unit removed , switches 268 and 270 may be used to activate , respectively , all remote - related functions within the remote unit or , the auto - range feature , in particular . a rechargeable battery 262 is preferably utilized in the remote unit , enabling the battery to be charged when the remote unit is docked through contacts 206 from a power supply contained within the camera . an optional sense capability , shown at block 264 , may be provided to sense voltage level , current flow , or some other electrical aspect to determine docking status without having to rely on alternative mechanical actuators . regardless of how docking status is determined , a signal indicating a docked position may be used to automatically configure switch 224 to ensure that audio signals from the microphone pick - up ( s ) are routed in hard - wired fashion to the camera . fig2 b is a block diagram showing major electronic circuits associated with a camera adapted to cooperate with the remote unit of fig2 a . a corresponding set of contacts 206 ′ are utilized to communicate with the remote unit when docked on the camera body , which is shown with broken line 204 . when so docked , audio signals routed through switch 224 are delivered along line 248 to a select module 246 under control of a separate cpu 250 which , again , may take the form of a conventional microprocessor or single - chip microcomputer . the purpose of select switch 246 is to route an incoming audio signal either through the hard - wired contacts 206 ′, as just described , or , alternatively , by way of antenna 240 , rf receiver 242 , and demodulator 244 , in the event that the remote unit has been removed , and with a remote mode of operation having been selected . as with the remote unit , a sense circuit 266 may be optionally provided as a means for electrically determining whether the remote unit has been docked with respect to the camera body , and a signal from block 266 to the cpu 250 may be used to control select module 246 for the docked and remote modes , as appropriate . regardless of how the audio signal is derived , it is routed from select block 246 through filter 252 , which is used to separate out the auto - focus signal during the remote mode of operation . the filtered - out signal is then fed to a compare circuit 258 to determine time - of - flight . the unfiltered , baseband audio signal is instead output along path 253 for recording purposes . circuits ordinarily associated with audio recording are not shown in this figure , such as automatic gain - control ( agc ) capabilities , stereophonic demultiplexing , and so forth , with the understanding that one of ordinary skill in the art would readily be able to address such extensions under current practice . in the preferred embodiment , wherein acoustic pulses are utilized for a time - of - flight distance measurement , oscillator 256 generates the pulses , which are fed to a transmitter and waveform shaping circuit 254 before being output through transducer 255 . pulses from the transmitter block 254 are also delivered to a compare circuit 258 fed by the output of filter 252 , with the difference between the two signals being used as an indication of the distance to the remote unit . any number of known techniques may be used to ensure waveforms more amenable to comparison , including various filtering techniques , threshold detection , integration , and so forth . in addition , a variety of known techniques may be used to ensure a more accurate comparison between the base signal and return signal , including synchronous detection , auto - correlation , etc . although the time - of - flight of the rf signal from the remote unit to the camera body may be taken into account along with the time required to modulate the distancing signal onto the return rf carrier , in the preferred use of an acoustic ranging signal , a first - order approximation may be realized by assuming that the time required to modulate and return the ranging signal is instantaneous or equal to a constant chosen in conjunction with a typical distance requiring remote microphone operation , such as , say , 20 - 100 feet , or thereabouts . in the event that two - way rf is used for distance measurement , the time - of - flight of the return rf signal will , of course , need to be taken into account for a more precise measurement . a power supply 260 , which may simply represent the battery pack attached to the camera , is not only used to power electrical subsystems associated with the camera , but , as discussed above , may also be used to recharge a battery 262 in the remote unit , with the sense circuits 266 and 264 being used cooperatively to ensure that battery drain is minimized , particularly when the remote unit is in its docked configuration . in a preferred alternative embodiment , the invention may further include a plurality of remote units and means whereby the camera may be trained on a particular remote unit while rejecting all others . different technical approaches are applicable to this aspect of the invention . with audio and distance information being relayed from the remote unit to the camera via an rf signal , one method of singling out a particular remote unit involves the use of a highly directional rf receiving antenna such that only when the camera is pointed substantially in the direction of a particular remote unit will the rf signal from that unit be demodulated and utilized for audio or distance functions . even in the event that more than one rf signal is received , discrimination electronics may be included in the camera to pass only the strongest signal received or to reject all others . in addition to signal strength , different carrier frequencies and / or identification codes may be incorporated into the transmission between the remote unit and the camera to provide further discrimination competing units through frequency selection and / or decoding . as an alternative to the use of a directional rf signal , a different form of wireless transmission may be used , preferably one which operates on a line - of - sight basis . for example , a remote unit may transmit an optical signal to be received by the camera and , based upon the existence and / or strength of this signal , the selection of that remote unit may take place . in a preferred arrangement , each remote unit contains a directional infrared ( ir ) light - emitting diode , and the camera would be equipped with an ir receiver establishing a highly directional path between a particular remote unit and the camera , enabling the camera to single out a particular remote unit on this basis . the infrared receiver may be located at any forward - looking position on the camera and , advantageously , may also be positioned in the optical path of the camera &# 39 ; s image - gathering facilities to ensure that the remote unit is within the picture - taking field - of - view of the camera system so as to enhance the discrimination of a particular remote unit . if an electro - optical image sensor such as a charge - coupled device ( ccd ) is utilized as the picture - taking element , one or more of the pixels of the array may be used to detect the optical signal from a remote unit , be it infrared or otherwise , thereby obviating the need for a separate detector element . as with the use of an rf signal for remote - unit discrimination , an optical or infrared signal from the remote unit may also be modulated with information particular to the remote unit responsible for its transmission , including encoded information identifying that remote unit . audio and / or distance - related information may also be modulated onto an optical carrier . by modulating remote - unit identification information , audio information and auto - ranging information onto the same carrier , whether optical or rf , the invention may accommodate remote microphone and auto - focus distancing functions automatically between plurality of different remote units by simply pointing the camera in the direction of one of the remote units . now turning to fig3 , there is shown a different embodiment of the invention directed to distance measurement apart from optional picture or sound recording . in this embodiment , a first unit 310 communicates with a second unit 320 so as to determine the distance therebetween for indication , for example , on display 312 associated with the first unit 310 . according to this arrangement , an acoustic transducer 314 ( not visible in the figure ) transmits an acoustic pulse , preferably in the form of an inaudible ultrasonic signal 316 to a pick - up 318 on the unit 320 . this signal is modulated onto an rf carrier , as implied by broken line 322 , and broadcast via antenna 324 to antenna 326 via electromagnetic signal 328 . within the unit 310 , this received signal is demodulated to uncover the modulated acoustic signal , and compared to that transmitted to determine a delay therebetween for use in a distance calculation . this particular embodiment is well - suited to small distance - measurement tasks , such as room dimensioning , architectural planning , and so forth , or measurements over greater distances for use in surveying , for instance . in the event that the units 310 and 320 are sufficient displaced physically that raw voice communication is problematic , the pick - up 318 may be selected so as to detect audible acoustic signals in addition to the ranging pulse ( s ), in which case the signal 328 may be modulated to include both distance and voice information . at unit 310 , the voice information is separated from the distance information and output through speaker 322 or headphones 324 . sound recording is optional in this case . in the event that the pick - up 318 is incapable of detecting both audible inaudible acoustic information , a separate microphone 330 may be added for audible sound detection . one shortcoming of many distance - sensing systems is their reliance on non - active time - of - flight measurements . in terms of spherical coordinates , these systems may be quite accurate in determining the radial distance , but are relatively inaccurate in determining the angular position ( or longitude ), since , at beset , they may rely on maximizing the amplitude of the return signal . as such , they easily may be confused by signal cancellation due to reflections and other environmental effects . the angular positioning effect is exacerbated by an accompanying uncertainty in the vertical direction ( or co - latitude ), with the reseult that the system is effective for lens focusing , but is not satisfactory for the complete function of aiming of the camera . in the instant invention , the received rf signal may serve yet a further purpose . in fig4 a , opposite sides of a camera body 400 , such that they are preferably perpendicular to the camera body sides , co - linear , and at a 180 - degree angle relationship to each other . in fig4 b , the electrical signals received by antennas 402 a and 402 b are conducted to rf - signal amplifiers 406 a and 406 b , respectively . the outputs of these amplifiers are supplied to a phase - discriminator circuit 408 , which develops an error signal 410 , the polarity of which is related to the phase error . with this arrangement , if the camera is pointing to the left of a desired target ( bearing an inventive transmitter unit ), the circuit 408 will sense the phase difference of the signal as received at the two antennas , and develop a positive voltage having a predetermined polarity . if , on the other hand , the camera is positioned so as to be pointing to the right of the desired target , then the circuit will develop a voltage of the opposite polarity . this error signal is then conducted to the differential amplifier 412 , which may be used to drive a pan - control motor ( not shown ) for the camera mount . this effective creates an electro - mechanical phase - locked loop , which will constantly adjust the camera pan - angle so as to zero - out the phase - error developed at the two antennas . as the transmitter is moved , the camera will pan to keep the transmitter in the center of the field of view . in an alternative implementation , shown in fig5 , the camera body 500 has been fitted with two antennas , 502 a and 502 b , as in the previous description in regards to fig4 a . however , in this case , the camera body also is fitted with two additional antennas , 502 c and 502 d , preferably disposed on the top and bottom of the camera body and at right angles to the axis of antennas 502 a and 502 b . using a similar circuit to that of fig4 b , the phase difference signal may be derived from the top and bottom antennas , and used to drive a tilt motor circuit , which moves the camera in an up / down action in the vertical plane . in this way , both the vertical positioning and the horizontal positioning of the camera may be effected , utilizing the transmitter to provide the required signal from which the necessary phase information may be derived . it should be noted that many different configurations of the antennas may be utilized to achieve the same effect . for example , instead of four antennas disposed at right angles to each other , three antennas may be disposed at 120 - degree angles from each other , and the appropriate phase - difference information derived for controlling the pan and tilt motors . practitioners skilled in the art will appreciate the applicability of these techniques to the various alternative configurations . it should be apparent from the embodiments just described with reference to fig4 and 5 that a camera need only receive a wireless signal from a remote source through multiple antennas in order to achieve an automatic pan or tilt control function . thus , the signal discrimination and pan / tilt aspects of the invention may be employed with respect to any wireless signal source , including that derived from a conventional remote microphone not equipped with the active range - finding capabilities of the invention . indeed , the location - finding aspects of the invention made possible through the discrimination of signals received by way of multiple antennas may be used in applications not employing a camera , for example , in monitoring the whereabouts of children , pets , or important or valuable objects equipped with a wireless transmitter .	6
throughout the following description , specific details are set forth in order to provide a more thorough understanding of the invention . however , the invention may be practised without these particulars . in other instances , well known elements have not been shown or described in detail to avoid unnecessarily obscuring the invention . accordingly , the specification and drawings are to be regarded in an illustrative , rather than a restrictive , sense . referring first to fig1 a common prior art orienting disk 10 used in both stokes and bürkner wood strand orienters is a plate 11 of generally circular shape , with a plurality of protuberances 12 formed along the circular periphery 14 thereof . “ periphery ”, as that word is used throughout this description , refers not to the actual outer edge of plate 11 , but rather to that circular imaginary line ( shown partially by dashed line 16 in fig1 ) which bounds the generally circular outer edge of plate 11 . “ periphery ” has a similar meaning when the invention is described below . in prior art disk 10 , a plurality of shallow notches 18 are cut into plate 11 from periphery 14 . each of notches 18 has a short rear edge 20 extending inwardly towards the center of disk 10 , and a longer forward edge 22 extending upwardly and forwardly from the bottom of rear edge 20 to periphery 14 . disk 10 has an aperture 24 formed through the center thereof for mounting disk 10 onto a shaft ( not shown ) in a wood strand orienter in a manner known in the art . disk 10 is intended to be rotated in the direction indicated by arrow 26 . [ 0020 ] fig2 illustrates one embodiment of the improved orienter disk of the present invention . in this embodiment , disk 30 is a plate 31 having a generally circular shape and an outer circular periphery 32 . improved disk 30 also has an aperture 34 for mounting disk 30 onto a shaft in a wood strand orienter . disk 30 has a plurality of fin - like teeth 36 which extend outwardly from the periphery 32 of plate 31 . each one of teeth 36 has a leading edge 37 extending outwardly from periphery 32 of plate 31 to a tip 38 of tooth 36 . leading edges 37 face the direction of rotation of disk 30 , as indicated by arrow 40 . each tooth 36 also a trailing edge 39 trailing rearwardly and downwardly from tip 38 of tooth 36 to periphery 32 of plate 31 . it is not essential to the invention that any particular number of teeth 36 be employed by disk 30 . however , it has been determined that too great a number will not allow wood strands to be well aligned by disk 30 , and accordingly , the inventors believe that a disk 30 having between two and eight teeth will be most desired . in preferred embodiments , the teeth 36 are evenly spaced about periphery 32 of plate 31 , and in the most preferred embodiment ( shown in fig2 ), disk 30 has six teeth 36 , each of which is separated from an adjacent tooth by an angle , α , of 60 ° about said periphery of plate 31 . in one embodiment of the invention , leading edge 37 is straight and trailing edge 39 is curved , as shown in fig2 . further , protuberances 42 may be formed about periphery 32 of plate 31 , between fin - shaped teeth 36 . the benefits of the improved orienting disk of the present invention are illustrated by the following experimental results : tests were carried out on the alberta research council ( arc ) pilot plant oriented strand board ( osb ) forming line comparing the performance of the wood strand orienter using the improved orienting disks to the performance of the orienter with a standard commercial design of orienting disk ( the prior art disk ). except for the orienting disks , there were no differences between the orienter set - ups for the comparative tests . the arc pilot plant orienting system is typical of commercial osb strand orienters except that the arc pilot plant orienter has four shafts of rotating disks , whereas commercial orienters typically have about 12 shafts of rotating disks . tests were carried out using a stokes type of orienter arrangement and also using a bürkner type of disk arrangement as well . it was found that results for the two types of orienter disk arrangements were similar . only the results of the stokes type of disk arrangement are reported here for simplicity . disk type : 1 ) prior art disk design used in commercial orienters with small notches on the periphery of the disk ( fig1 disk ). 2 ) improved disk design ( fig2 disk ) disk spacing : 1 ) a common mill spacing of 2 inches ( 50 mm ) between disks on adjacent orienter shafts 2 ) a narrower spacing of 1 . 5 inches ( 38 mm ) between disks on adjacent orienter shafts disk speed : 1 ) constant 30 rpm for all orienter shafts 2 ) low acceleration between orienter shafts ( consecutive shaft speeds of 10 , 20 , 30 and 40 rpm ) 3 ) high acceleration between orienter shafts ( consecutive shaft speeds of 15 , 30 , 45 and 60 rpm ). strand flow rate : 1 ) low flow rate ( typical mill flow rate ). 2 ) medium flow rate ( 1 . 5 times typical mill flow rate ) 3 ) high flow rate ( 2 times typical mill flow rate ). strands : screened mill - produced strands to represent typical face quality strands used throughout the study . strands were not recycled . line speed : constant setting of 30 hz . orienter height above mat : 2 inches ( 50 mm ). replicates : three per test condition . in the first test , the improved disk was compared to the prior art disk using both a normal and narrow disk spacing as defined above . the following parameters were measured , determined or calculated : 1 . the average and median orientation angles of the wood strands in the wood strand mat . 3 . the percentage of strands having an orientation angle of less than 20 °. 4 . the “% error ”- this is an indication of the smoothness of the mat , as discussed below . 5 . the “% overs ”- the percentage of wood strands which “ bridged ” the disks , being carried over all of them to the end of the orienter without being aligned and without falling to the strand mat . as expected , the narrower disk spacing gave lower mean and median orientation angles , a higher predicted modulus of elasticity ( moe ) and a higher incidence of strands with & lt ; 20 ° orientation angle . the trends for these measures of orientation were similar for the prior art and improved orienting disk configurations at the same orienter disk spacings . where the improved orienting disk design differed from the prior art orientation disk design was in smoothness of the mat at the normal disk spacing . the improved orienting disks produced a much smoother strand mat than the prior art disks as evidenced by a much lower incidence of error readings from a laser strand orientation measurement system used to measure flatness of the resultant mat ( 10 . 1 % vs 26 . 0 % of instrument readings ) as shown in table 1 . strands that are not lying sufficiently flat in the furnish mat do not produce a regular ellipse with the laser orientation measurement system and cause an error reading in the system . the incidence of error readings with narrow disk spacing was similar for the improved ( 9 . 6 %) and prior art orienting disks ( 9 . 7 %). a smoother strand mat is advantageous for several reasons . strands falling onto an uneven , partially formed strand mat will have a greater probability of becoming less well oriented . thus the final strand mat produced from multiple layers of uneven strands will tend to have poorer overall orientation than one produced from multiple layers of even strands . an uneven strand mat will have lower bulk density , resulting in a thicker strand mat , which will require greater press daylight and require more time for the press to close to thickness . more strand breakage during press closing would be expected with an uneven strand mat with many strands sticking up out of the mat . broken strands reduce product strength . it is postulated that the fin - like teeth on the improved orienting disks help to control the flow of strands down to the mat , resulting in a smoother strand mat . the difference in the % overs ( strands bridging the orienter disks and carried over the orienter ) between the improved disks ( 7 . 41 %) and prior art disks ( 8 . 23 %) with narrow disk spacing was significant at the 95 % confidence level . it would appear that the improved disks help to reduce the amount of strands bridging the orienter disks . table 2 contains results of statistical t - tests comparing the different variables in table 1 to indicate which ones were statistically significant : table 3 indicates that strand flow rate had little effect on any of the parameters measured , with the possible exception of % error . with narrow disk spacing the improved disks , and possibly the prior art disks , appeared to show a trend toward a flatter mat ( lower % error ) as the strand flow rate increased . table 4 indicates that disk speed had little effect on any of the parameters measured , with the possible exception of % overs , which is the percentage of strands bridging the orienter disks and carried across the top of the orienter without falling through the orienter . for both the prior art disks and improved disks with normal spacing , the % overs appeared to increase as the orienter disk speed was accelerated from one bank of disks to the next . with narrow disk spacing there was no apparent trend for the % overs to increase with increasing orienter disk acceleration for either the prior art disks or the improved disks . it will be clear to those skilled in the art from these experimental data that the improved disk improves strand formation in orienters . as will be apparent to those skilled in the art in the light of the foregoing disclosure , many alterations and modifications are possible in the practice of this invention without departing from the spirit or scope thereof . accordingly , the scope of the invention is to be construed in accordance with the substance defined by the following claims .	1
it is proposed that switch maintenance be carried out using switch check and address data calculated including at least a part of a previous data frame possibly in conjunction with discrepancy checking between duplicate planes . furthermore it is proposed that the introduction of errors in the data frames when connections are changed can be used to a ) confirm the changed connection and b ) to check routinely error detection mechanisms during normal operation . this is achieved by using an additional bit per byte switched . this bit is encoded over a data frame with the input channel address and a parity or crc check on the previous data frame . any data corruption or misrouting will be detected by discrepancy failure between switch planes . subsequent failure of the check bit in the multi - frame will isolate the fault to one plane . when a connection is changed the data frame sequence will be disturbed and so the output port will recognise the connection change . in this case there will be no discrepancy failure between switch planes . by having the input address encoded in the switched data the output port can report to which input port it is connected . this would allow each new connection to be confirmed by both switch replicas before being used . this technique exercises the in essence fault detection mechanism every time a connection is changed and allows each new connection to be path checked and confirmed before use . this happens automatically when a connection is changed without any additional control . in addition all switch plane faults in a duplicated switch are isolated to a plane within a data frame time period . before considering the present invention some ideas for maintenance of synchronous switch planes in a duplicated mode are discussed . it is assumed that the two switch planes are run in bit synchronism and that a fault can be detected by discrepancy checking . the problem is that having detected a fault between duplicated planes by discrepancy checking it must be isolated to the right plane . this requires either extra bandwidth across the planes for checking or choosing a plane arbitrarily and running diagnostics on it . generally for a 64 kb / s switch 8 - bit bytes need to be switched . to allow for parallel switching of corrupt address sequence ( cas ) a ninth bit per byte is required . therefore to allow for extra bandwidth for &# 34 ; through &# 34 ; channel signalling or maintenance at least 10 - bit ` bytes ` need to be switched . further discussion will be confined to ` 10 - bit switches `. it is accepted that for a duplicated switch unless extra delay is introduced errors from a switch plane may be introduced to line whilst a fault is isolated . for british telecommunications ( bt ) synchronous digital hierarchy ( sdh ) equipment if the isolation time is less than 10 ms this error would not need to be included in availability calculations . the only simple way to avoid this delay is triplicated switch planes . the simplest maintenance option is where there is simple parity per byte . in this case the 10th bit is used as a simple parity bit for the other 9 bits in the byte . it will detect single bit data corruption on interconnect or data stores . multiple bit corruptions may be missed . it will not detect routing faults as the mis - routed data will have valid parity . however in a bit - spread architecture where each bit is switched separately muting errors will be detected as a fault is likely to affect only 1 bit . this would not be true in smaller growth stages of bit spread architectures as they require more than one bit to be switched in the same switch device . this is also not a very future proof option as more integration in the future may put a number of bit switches in the same device . using simple parity like this means that output ports will not see any changes if connections are changed . using more than 10 - bits may make possible more complex parity to detect multiple bit faults but still suffers from the failure to detect mis - routing . in this scheme the switched bytes are grouped into multi - frames with each multiframe carrying the check data of the previous multi - frame . there are a number of options for this as described below . the obvious problem with this approach is that when a connection is changed the multi - frame will be broken and cause an error to be detected . however when this happens there should not be any discrepancy detected between the planes . this situation could be ignored at the output port . however if it is ignored the output port can lock to the wrong plane if a switch command is only applied to one plane due to a fault . in this case the plane with the new correct connection would show a fault and there would be discrepancies . therefore any failure of the multi - frame check detected must be reported to the controller . this can be used to confirm to the controller that the connection has changed and / or a fault has been detected . this means that for every connection change the switch plane fault detection mechanism is exercised . if when a connection change is made it is only implemented on one plane then there will be a discrepancy between the planes and a fault detected on the actual good plane . when this is reported to the control system it should recognise that the connection has not been made on both planes and hence that the plane where the connection was not changed and which has been reported good is in fact bad . for single plane working with all errors reported the control system would need to decide if it was a genuine error or a connection change . consider the case of a 1 - byte multi - frame where a byte could carry the parity of the previous byte . this is not that much better than the simple parity described above but gives a 50 % chance of detecting routing faults if the first byte of the mis - routed data has a different parity . the use of more parity bits here would possibly help . for detected faults the detection time would be 1 frame of 125 microseconds . for an x - byte multi - frame a byte carries the parity of a byte x - bytes previous . this has the same problems with multiple bit data errors as the simple scheme but depending on the size of ` x ` is more likely to detect routing faults . however if the data pattern being switched is constant , i . e . all 0 &# 39 ; s , all ` 1 ` s or idle then misrouting could switch in an identical pattern which would he detected . for detected faults the detection time is up to 125 × microseconds . in longitudinal parity over an 9 - byte multi - frame the parity bit in byte 0 is for all the bit ` o ` s in the previous multi - frame , the bit in byte 1 for all the bit ` 1 ` etc . this scheme now starts to address multiple bit errors and ntis - routing faults . could still fail for misrouting of a constant bit pattern . time to detect a fault is up to 2 × 1 . 125 ms i . e . 2 . 25 ms . a variation on this is to generate parity diagonally across the data of a multi - frame e . g . bit 0 byte 0 , with bit 1 byte 1 etc . instead of using parity over a multi - frame a crc check could he generated over the whole multi - frame data . them is obviously a trade - off between fault detection time and fault coverage . a crc4 check could be carried out with a four byte multi - frame . this detects multiple bit errors and routing errors . again however it could miss routing errors involving constant bit patterns . fault detection time is up to 8 frames i . e . 1 ms . all the multi - frame data checking described above can fail to detect mis - routing of constant bit pattern data . one way of detecting this would he to use the check - bit with each byte to carry the input channel address over a multi - frame . for a 1024 port stm - 1 switch with up to 2048 channels per port 21 bits are required to define the address . any mis - routing would corrupt this address multi - frame . the checking process , once it has locked to an address would expect that address to be the same in subsequent multi - frames . the same principle of reporting errors on change of connection can still be applied to confirm change of connections . this avoids the need to inform an output port of the correct input address to receive . additionally the output port can confirm exactly what input channel it is connected to . this approach would detect all routing faults but would not detect data corruptions . fault detection time is up to 2 × 21 frames i . e . 5 . 25 ms . if the multi - frame data checks described above are used with the address check then mis - routing and data corruption faults will be detected . two check bits , one for address checking and one for data could be used but this requires 11 - bit switching . alternatively a longer multi - frame could be used to multiplex both types of check bit in the check bit . the multi - frame address plus longitudinal parity requires a 30 byte multi - frame . fault detection time is up to 2 × 30 frames i . e . 7 . 5 ms . the multi - frame can obviously be shorter for smaller switches which would reduce detection times . also a crc code could be encoded with the address . this would reduce the multi - frame but give less diagnostics in the event of a fault , i . e . it would not be clear if the fault was data corruption or mis - routing . in all the proposals for multi - frame use it is assumed that all ports start on a synchronous boundary . if not some form of alignment signal would be required . fig3 to 6 show an illustration of an algorithm for carrying out the procedure described above . for a synchronous switch fabric the use of an extra bit per byte coded as a multi - frame address plus check digits for the previous multi - frame gives comprehensive maintenance of the switch in duplicated mode . a ) all faults are isolated to a switch plane within 7 . 5 ms ( this may be less if a smaller address range is used ). for sdh switches with shorter frame times the detection times will be within 840 microseconds , b ) change of connection is confirmed by the output port not just by the switch device , e ) a change of connection only applies control changes to the switch matrix not the incoming and outgoing ports . however in order to meet reliability figures any duplicated switch will require to maintain partial planes in service after having detected a fault . this will necessitate additional checks to isolate the faulty area of a plane . in order to implement this technique data storage will be required on a per channel basis at each port to the switch where the planes come together ; the storage required per channel is : ______________________________________for connection address : 21 bitsfor previous frame parity : 9 bitsfor calculating current output parity : 9 bitsflag bits : 5 bitscurrent bytes : 20 bitstotal per channel 64 bits . ______________________________________ for a 2048 channel interface 131072 ( 128 k ) bits of storage are required . for the same bandwidth sdh interface with a reduced switching frame and only channels only 17280 bits are required . obviously the 2048 channel interface could consist of a number of switch input streams mixed together . in this case the storage required at each port would be proportionately reduced . the control bandwidth to and from a switching using the proposed maintenance strategy is determined by the switch request rate required for the switch . the most onerous requirement on a switch will be for a pstn switch . the request rate is determined by the busy hour call attempts ( bhca ) rate for the exchange and the number of switch requests per call determined by the exchange architecture . the exchange architecture is important because if the switch is used to connect tones etc . to subscribers the number of switch requests per call will be much higher than if these are done in remote units nearer the subscriber interface . technically the clears are not necessary as connects can be overridden but it is generally safer to clear connections positively . also the clears could be done with one command but if kept separate all commands to the switch can be for uni - directional connections . if connections are always uni - directional then using the proposed maintenance technique there should always be one response per switch change . a bhca of 2 . 1 million gives a call rate of approx 600 calls / second . this would give a switch update rate of 2400 per second . assuming 30 bits of data to change a switch connection the required bandwidth from control to the switch is 2400 × 30 bits / sec = 72 kb / s . assuming 64 bit messages from the switch ports back to the controller the required bandwidth is 2400 × 64 = 153600 bits / sec . the control bandwidth required to / from a port is not onerous . switches based around stm - 1 ports will have 155 mb / s interfaces to switches . a 10 mb / s interface to each port for control is only 1 / 16 of this bandwidth . the problem is how to control funnelling of messages from each of up to 1024 ports when in a one second period all 2400 could come from one port . a high speed bus at say 10 mb / s as shown in fig7 . the bus protocol would take care of contention between ports . direct links to each port statistically mixed onto links to the controller as shown in fig8 . the control paths can be mixed in with traffic paths to save cabling . it may be necessary to use a nested level of statistical muxes . direct links to each port as shown in fig9 . each link being cyclically scanned by a controller . when a port has infomarion the controller would lock onto the link until it had received the message . again the links can be muxed in with traffic paths . the polling time would obviously use some of the time required for dealing with the messages . all of these options would need considering if the maintenance technique is applied to a specific architecture . different options will be more appropriate to different architectures and switch size . processing 2400 requests per second is 1 every 416 μsec . assuming any control processor used 50 % capacity on switch requests it must allocate 208 μsec of processing per switch request . this is about 1664 instructions at 8 mips .	7
in fig1 there is shown clock recovery apparatus which incorporates features of the present invention . it includes a clock signal generator 10 made up of a summing filter 12 and a vco 14 . the summing filter 12 has a coarse adjustment pump - up input 16 , a coarse adjustment pump - down input 18 , a fine adjustment pump - up input 20 and a fine adjustment pump - down input 22 , and generates a control signal 24 for the vco 14 . a voltage reference signal 26 is also provided to the vco 14 , though this signal may not be necessary for some vco designs . the frequency output of the clock signal generator 10 is controlled by two simultaneous phase - lock loops : a coarse adjustment loop 30 and a fine adjustment loop 32 . the fine adjustment loop is conventional , and includes a phase detector 40 having a feedback signal input 42 coupled to receive the output 28 of the clock signal generator 10 , and a reference signal input 44 coupled to receive the incoming data signal . the pump - up and pump - down outputs of phase detector 40 are connected , respectively , to the fine adjustment pump - up input 20 and fine adjustment pump - down input 22 of summing filter 12 in clock signal generator 10 . the terms pump - up and pump - down , though originally associated with charge pump filter structures , are now often used to refer to any error signal which indicates that the oscillator frequency should be increased or decreased , respectively . this application uses the terms in the latter sense . also , as used herein , a frequency detector is a frequency sensitive circuit which may also preserve some phase information . for example , a circuit which compares the number of edges which appear on its two inputs and generates an error signal in proportion to the difference between the number of edges is inherently a frequency detector . in most designs , however , phase information is also preserved . a phase detector is a phase sensitive circuit which may also preserve some frequency information . for example , a circuit which compares the phase of edges appearing on a clock input to the phase of edges which appear on the other input , when they are present , would be a phase detector . this type of circuit also preserves some frequency information for small frequency ranges , interpreted as a phase difference . large frequency differences will not be preserved since they will simply be interpreted as missed edges . the term phase - frequency detector ( pfd ) is a term which does not distinguish between phase and frequency sensitivity , and includes both frequency detectors and phase detectors . the coarse adjustment feedback loop 30 in fig1 comprises frequency divider apparatus 50 and pfd apparatus 52 . instead of constituting a single counter , however , frequency divider apparatus 50 includes two counters 54 and 56 . the inputs of both are coupled to receive the clock signal generator output 28 , but counter 54 divides by a value n - 1 while counter 56 divides by the value n + 1 . for example , if n = 100 , then counter 54 will divide by 99 while counter 56 will divide by 101 . similarly , pfd apparatus 52 is made up of two frequency detectors 58 and 60 . the reference frequency input of both frequency detectors 58 and 60 are connected to receive a frequency comparison signal 62 , but the feedback input of frequency detector 58 is coupled to receive the output of counter 54 while the feedback input of frequency detector 60 is coupled to receive the output of counter 56 . the pump - up output of frequency detector 58 is coupled to the coarse adjustment pump - up input 16 of summing filter 12 in clock signal generator 10 , and the pump - down output of frequency detector 60 is coupled to the coarse adjustment pump - down input of summing filter 12 in clock signal generator 10 . if the frequency detector 58 includes a pump - down output , it is ignored , as is any pump - up output of frequency detector 60 . a divide by m counter 70 ( typically referred to as a prescaler ) is also provided . the input of divide by m counter 70 is coupled to receive the frequency reference signal , for example from a crystal oscillator , and the output provides the frequency comparison signal 62 . in a typical application of the clock recovery apparatus of fig1 for example , in fddi applications , the nominal output frequency f nom may be 125mhz . in this case , n may be equal to 100 and m may be equal to 10 , thereby permitting the frequency reference oscillator ( not shown ) to operate at a relatively low frequency f ref = 12 . 5mhz . in general operation , it will be seen that the coarse feedback loop 30 constrains the clock signal generator 10 to operate within a window of 1 % above or below the nominal clock frequency f nom = 125mhz , thereby permitting the fine adjustment feedback loop 32 to more easily capture and hold the clock frequency of the incoming data signal . in particular , if the current output signal of the vco 14 has a frequency f o , the counter 54 will generate a signal on its output having a frequency f 1 = f o / 99 and counter 56 will generate on its output a signal having a frequency f 2 = f o / 101 . for example , if f o happens to be exactly equal to 125mhz , then f 1 will equal 1 . 2625mhz and f 2 will equal 1 . 2375mhz . these signals are provided to the feedback inputs of the frequency detectors 58 and 60 , respectively . since m = 10 and the frequency reference signal has a frequency f ref = 12 . 5mhz , the counter 70 will generate on its output 62 a frequency comparison signal having a frequency f comp = 12 . 5mhz / 10 = 1 . 25mhz . this signal is provided to the reference inputs of both frequency detectors 58 and 60 . thus , if the vco 14 is operating at exactly the nominal frequency f nom = 1 . 25mhz , then frequency detector 58 will be comparing the frequency comparison frequency f comp = 1 . 25mhz to the smaller frequency f 1 = 1 . 237mhz while the frequency detector 60 will be comparing f comp = 1 . 25mhz to the larger frequency signal f 2 = 1 . 263mhz . in this situation , therefore , the pump - down output of frequency detector 58 will always be active while the pump - up output will be inactive . similarly , the pump - up output of frequency detector 60 will be active while the pump - down output will be inactive . only the pump - up output of frequency detector 58 and the pump - down output of frequency detector 60 have any effect on clock signal generator 10 . it can be seen that only if f 1 falls below f comp , or f 2 rises above f comp , will the pump - up or pump - down outputs of the pfd apparatus 52 be active and operate on the clock signal generator 10 to bring the output frequency f o back within the predetermined range . thus , the coarse feedback loop 30 will control clock signal generator 10 to have a frequency range of 125mhz ± 1 %. it will be understood that though a nominal frequency of f nom = 125mhz is used in this example , other frequencies will also work . additionally , in a more general illustration of the present invention , the counters 54 and 56 may be divide - by ( n - a ) and divide - by ( n + b ) counters , 0 & lt ; a & lt ; n and 0 & lt ; b & lt ; n , instead of divide by ( n ± 1 ) counters . in this case , the coarse adjustment loop 30 will maintain the output frequency f o within the range f ref ×( n - a )/ m and f ref ×( n + b )/ m . it is preferable that a and b be equal in order to center the window , however , and that a and b both equal 1 in order to keep the window as narrow as possible . however , neither of these conditions is essential to the broadest aspects of the invention . phase detector 40 operates in a conventional manner within fine adjustment feedback loop 32 . it compares the feedback signal 42 to the incoming data signal 44 to generate a fine adjustment pump - up signal if f o is less than the clock frequency of the incoming data signal , and to generate a fine adjustment pump - down signal if f o is greater than the clock frequency of the incoming data signal . it accomplishes this by comparing the phase of the two signals and generating the appropriate pump - up and pump - down signals until the phases match . pfds 58 and 60 are frequency detectors rather than phase detectors , in order to ensure a large capture range . on the other hand , pfd 40 is a phase detector rather than a frequency detector , in order to obtain the quickest and most accurate response possible to changes in the incoming data signal . frequency capture range is less important for phase detector 40 since the coarse adjustment feedback loop already ensures that the vco 14 will be operating at very close to the clock frequency of the incoming data signal . the summing filter 12 in clock signal generator 10 combines the coarse and fine adjustment pump - up and pump - down signals in order to generate the control signal 24 for vco 14 . roughly , it generates a signal responsive to the difference between a weighted sum of the coarse and fine adjustment pump - up signals and a weighted sum of the coarse and fine adjustment pump - down signals . the coarse adjustment pump - up and pump - down signals are preferably given less weight than the fine adjustment pump - up and pump - down signals , since the pulses in the coarse adjustment signals typically last many times longer than those of the fine adjustment signals . a detail of the frequency divider apparatus 50 is shown in fig2 . it consists basically of two conventional counters , and for that reason will not be described in detail . it further includes three mode lines , mode 0 , mode 1 and mode 2 . prior circuitry , not shown , ensures that exactly one of these mode lines is high at any given time . each of the signals in fig2 are shown being carried on a single line , but it will be understood that many of these signals may be carried differentially on two physical conductors . the choice depends mainly on the fabrication technology to be used . the frequency divider apparatus of fig2 as illustrated in fig1 comprises two basically separate counters 54 and 56 . counter 54 comprises seven d flip - flops 104a - 104g , a reset flip - flop 108 , two 4 - input or gates 110 and 112 , and four xor gates 114a , 114b , 114c and 114d . similarly , counter 56 comprises seven d flip - flops 106a - 106g , a reset d flip - flop 118 , two 4 - input or gates 120 and 122 , and four exclusive or gates 124 - 124d . in counter 54 , each of the flip - flops 104a - 104g has its d input connected differentially to its q output . the clock input of each of the flip flops 104b - 104g is connected differentially to the q output of the previous flip - flop 104a - 104f , respectively , and the clock input of flip - flop 104a is connected to receive the differential output 28 of vco 14 ( fig1 ). similarly , in counter 56 , the d input of each of the flip - flops 106a - 106g is connected differentially to the q output of that flip - flop . the clock input of each of the flip - flops 106b - 106g is connected differentially to q output of the previous flip - flop 106a - 106f , and the clock input of flip - flop 106a is connected to receive the differential output 28 of vco 14 . in counter 54 , reset flip - flop 108 has its d input connected to the output of or gate 112 , its clock input connected to the differential output 28 of vco 14 , and its q output connected differentially to the reset input of each of the flip - flops 104a - 104g . similarly , in counter 56 , the reset flip - flop 118 has its d input connected to the output of or gate 122 , its clock input connected to receive the differential output 28 of vco 14 , and its q output connected differentially to the reset input of each of the flip - flops 106a - 106g . the frequency divider apparatus 50 includes three mode lines , mode 0 , mode 1 and mode 2 , for selecting the frequency range which coarse adjustment loop 30 ( fig1 ) will permit . prior circuitry ( not shown ) ensures that exactly one of the mode lines is high at any given time . the mode 2 line is connected to one input of each of the exclusive or gates 114a , 114c , 124a and 124c . the mode 0 line is connected to an input of each of the exclusive or gates 114b , 114d and 124d . the mode 1 line is connected to an input of only exclusive or gate 124b . the other input of exclusive or gates 114a - 114b in counter 54 are connected , respectively , to the q outputs of flip - flops 104b - 104e . in counter 56 , the other input of exclusive or gate 124a and 124b are connected to the q outputs of respective flip - flops 106b and 106c , while the other inputs of exclusive or gates 124c and 124d are connected to the q outputs of respective flip - flops 106d and 106e . in counter 54 , the four inputs of or gate 112 are connected , respectively , to the qoutput of flip - flop 104a , the outputs of exclusive or gates 114a and 114b , and the output of or gate 110 . the four inputs of or gate 110 are connected , respectively , to the outputs of exclusive or gates 114c and 114d , and the q outputs of flip - flops 104f and 104g . in counter 56 , or gate 122 has its four inputs connected , respectively , to the q output of flip - flop 106a , the outputs of exclusive or gates 124a and 124b , and the output of or gate 120 . the four inputs of or gate 120 are connected , respectively , to the outputs of exclusive or gates 124c and 124d , and to the q outputs of flip - flops 106f and 106g . the operation of the frequency divider apparatus 50 shown in fig2 is conventional and will not be described in detail here . it will be appreciated , however , that if mode 1 is high , the q output of flip - flop 104g will undergo one complete cycle for every 99 cycles undergone by the signal on the vco output 28 , while the q output of flip - flop 106g in counter 56 will undergo one complete cycle for every 101 cycles undergone by the vco output 28 . it can be seen that for the three modes , the counters divide the vco output signal 28 by the values shown in table i . table i______________________________________mode counter 54 counter 56 n______________________________________0 ÷ 119 ÷ 121 1201 ÷ 99 ÷ 101 1002 ÷ 109 ÷ 111 110______________________________________ in other words , counters 54 and 56 divide the vco output signal 28 by n ± 1 , where n is as shown in table i for the different modes . the mode may be made user - selectable or may be preset at the factory . fig3 is a detail of frequency detector 58 ( fig1 ). it is basically a modification of a well - known 9 - gate phase - frequency detector , described in u . s . pat . no . 3 , 610 , 954 and incorporated herein by reference . it consists of 11 or gates connected as follows . or gate 150 is coupled to receive the frequency comparison signal 62 from the divide by m counter 70 ( fig1 ) at one input . the inverting output of or gate 150 is connected to one input of an or gate 152 , the inverting output of which is connected to an input of another or gate 154 . inverting output of or gate 154 is connected back to a second input of or gate 152 . the output of divide by ( n - 1 ) counter 54 is connected to one input of another or gate 160 , the inverting output of which is connected to one input of an or gate 158 , the inverting output of which is connected to one input of an or gate 156 . the inverting output of or gate 156 is connected back to a second input of or gate 158 . the inverting outputs of or gates 150 , 152 , 158 and 160 are all connected to respective inputs of a 4 - input or gate 162 , the inverting output of which is connected to a second input of each of the or gates 154 and 156 . the inverting outputs of or gates 150 , 152 and 162 are all connected to respective inputs of a 3 - input or gate 164 , and the inverting outputs of or gates 162 , 158 and 160 are all connected to respective inputs of a 3 - input or gate 166 . the inverting output of or gate 164 is connected back to a second input of or gate 150 , and the inverting output of or gate 166 is connected back to a second input of or gate 160 . an or gate 168 has two inputs coupled to receive the non - inverting output of or gate 164 and the non - inverting output of or gate 160 , respectively , and another or gate 170 has two inputs coupled to receive the non - inverting output of or gate 166 and the non - inverting output of or gate 150 , respectively . or gates 168 and 170 are added to filter unwanted glitches . the inverting and non - inverting outputs of or gate 168 carry differentially the coarse adjustment pump - up signal 16 ( fig1 ). the inverting and non - inverting outputs of or gate 170 differentially carry a pump - down signal , but this signal from frequency detector 58 is ignored . the operation of frequency detector 58 as shown in fig3 will be apparent to a person of ordinary skill and will not be further explained here . frequency detector 60 is identical to frequency detector 58 , except that in frequency detector 60 it is the pump - up output which is ignored . the differential pump - down output signal from or gate 170 ( fig3 ) is the coarse adjustment pump - down signal 18 ( fig1 ). in frequency detectors 58 and 60 , the or gate which provides the signal which is ignored may be omitted if desired . fig4 shows a detail of the phase detector 40 in fine adjustment loop 32 ( fig1 ). the incoming data signal on line 44 is applied differentially to the d input of a d flip - flop 200 , the q output of which is connected to the d input of a second flip - flop 202 . the output 28 of vco 14 is differentially applied to the clock input of flip - flop 200 , and is differentially applied in inverse to the clock input of flip - flop 202 . the incoming data signal on line 44 is also provided differentially to a buffer 204 , the output of which differentially feeds a second buffer 206 , the output of which differentially feeds a third buffer 208 . buffers 204 and 206 are provided to match the clock - to - output delay of the flip - flop 200 . similarly , the q output of flip - flop 200 differentially feeds a buffer 210 , and the q output of flip - flop 202 differentially feeds a buffer 212 . a nor gate 220 has two inputs which are connected to the true outputs of , respectively , buffers 208 and 210 , and another nor gate 222 has two inputs connected to the inverting outputs of , respectively , buffers 208 and 210 . similarly , a nor gate 224 has its two inputs connected to the non - inverting outputs of , respectively , buffers 210 and 212 , and a nor gate 226 has two inputs connected to the inverting outputs of , respectively , buffers 210 and 212 . nor gates 220 and 222 are connected to two inputs of an or gate 230 , the inverting and true outputs of which provide the fine adjustment pump - up signal 20 ( fig1 ) as a differential signal . similarly , the outputs of nor gates 224 and 226 are connected to two inputs of an or gate 232 , the inverting and true outputs of which provide the fine adjustment pump - down signal 22 ( fig1 ) as a differential signal . the operation of phase detector 40 as shown in fig4 is well known and will not be further described here . in fig5 there is shown a detail of the summing filter 12 ( fig1 ). the coarse adjustment pump - up signal 16 is differentially applied to an inverting buffer 250 , the output of which is connected to the input of a current switch 252 . similarly , the coarse adjustment pump - down signal 18 is differentially applied to an inverting buffer 254 the voltage output of which is connected to a current switch 256 . the fine adjustment pump - up signal 20 is differentially applied to the input of an inverting buffer 258 , the output of which is connected to the input of a current switch 260 , and the fine adjustment pump - down signal 22 is differentially applied to an inverting buffer 262 , the output of which is applied to the input of a current switch 264 . the current source transistors 270 , 272 , 274 and 276 of the switches 252 , 256 , 260 and 264 , respectively , have their bases all connected together and to a reference voltage v cs . similarly , the bases of the reference transistors 280 , 282 , 284 and 286 of respective switches 252 , 256 , 260 and 264 are all connected together and to another reference voltage v bbq . the bases of reference transistors 280 , 282 , 284 and 286 are connected to a reference voltage rather than to a non - inverting output of buffers 250 , 254 , 258 and 262 , in order to avoid capacitive coupling from the buffer outputs to the sensitive input of the filter . the current outputs of current switches 252 and 260 are connected together and through a resistor 290 to v cc . similarly , the current outputs of current switches 256 and 264 are connected together and through a resistor 292 to v cc . the current outputs of switches 252 and 260 are further connected through a resistor 296 to the inverting input of an op - amp 300 , and the current outputs of switches 256 and 264 are connected through a resistor 298 to the non - inverting input of op - amp 300 . the output of op - amp 300 is fed back to its inverting input via a filter capacitor 302 and a resistor 304 . the output of op - amp 300 forms the control signal 24 applied to vco 14 in the clock signal generator 10 ( fig1 ). in operation , current switches 252 and 260 convert , respectively , the coarse and fine pump - up signals 16 and 20 to current signals , which are summed by the connection between the two current outputs of these switches and converted back to a voltage signal by resistor 290 . similarly , current switches 256 and 264 , respectively , the coarse and fine pump - down signals 18 and 22 to current signals , which are summed by the connection between the two current outputs of these switches and converted back to a voltage signal by resistor 292 . op - amp 300 then takes the difference between the summed pump - up signal and the summed pump - down signal and filters higher - frequency components of this signal via capacitor 302 . thus , the voltage control signal 24 generated by summing filter 12 is responsive to the difference between a sum of the coarse and fine adjustment pump - up signals and a sum of the coarse fine adjustment pump - down signals . as previously stated , the coarse adjustment signals may be weighted differently than the fine adjustment signals in these sums . this can be done in many ways in the summing filter of fig5 . one example would be to make the current output of the coarse switches different from the current output of the fine switches by adjusting the values of the emitter resistors on the current source transistor . in this way , the current output of switches 252 and 256 can be made smaller than the current output of switches 260 and 264 , giving the fine adjustment signals 20 and 22 greater influence in the summations . the invention has been described with reference to particular embodiments thereof , and it will be understood that numerous modifications may be made without departing from the invention . for example , such modifications can be due to different fabrication technologies , different circuit techniques , different circuit implementations , or different ways of representing various signals . as another example , a frequency divider or other components may be included in the fine adjustment feedback loop if desired , or a third , medium adjustment , feedback loop may be added . these variations and others are intended to be included within the scope of the invention .	7
while the present invention is susceptible of embodiment in various forms , there is shown in the drawings and will hereinafter be described a presently preferred , albeit not limiting , embodiment with the understanding that the present disclosure is to be considered an exemplification of the present invention and is not intended to limit the invention to the specific embodiments illustrated . referring now to the figures , set forth is a cleaning implement 100 comprised of a holding member 102 and an abrasive pad 112 . in a primary embodiment the holding member consists of a fluid retaining sponge material having a cavity 104 formed along one surface . the sponge material is generally an open celled structure that can hold water and when moved over a surface is capable of removing grit , dirt , grime , mildew and other unwanted particles from the surface . the foam sponge is capable of holding liquids and typically has a density between 1 . 30 - 2 . 50 lbs / ft3 and constructed from random - celled hydrophilic urethane . the holding member 102 is defined by a top surface 105 and a bottom surface 106 , first 107 and second 108 side surfaces , and first 109 and second 110 end surfaces . illustrated is a holding member 102 having a length l of about 7 . 3 ″, a width w is about 4 . 25 ″ and a height h of about 2 . 5 ″. the sponge material is of a porosity capable of fluid retention . in a preferred embodiment , the abrasive pad 112 and said cavity 104 are of a substantially rectangular shape , whereby the cavity walls having first sidewall 114 and second sidewall 116 ; and first end wall 115 and second end wall 117 constructed and arranged to frictionally engage the abrasive pad 112 in any direction despite the force applied to the cleaning implement 100 . in this manner the height of the abrasive pad 112 can exceed the height of the side and endwalls . during a cleaning motion , the height of the abrasive pad 112 extends outward from the surface of the holding member to assure the abrasive pad 112 is the primary contact surface . this arrangement allows the individual &# 39 ; s hand to avoid contact with the abrasive pad which may consist of melamine . hand pressure is used applied to the holding element and the abrasive pad for deep cleaning of surfaces , the holding member maintaining a space between the hand and the abrasive pad . the bottom surface of the holding member 102 includes a cavity 104 having a base wall inset from the bottom side surface forming first 114 and second 116 sidewalls and first 115 and second 117 end walls , each having a uniform depth d of about 0 . 75 ″. the cavity 104 sidewalls 114 , 116 and endwalls 115 , 117 form a continuous inner wall having a uniform depth extending into the holding member . the cavity is constructed and arranged to cooperate with an abrasive pad 112 to frictionally engage on all sides . the cavity 104 is of a substantially conjugate shape . the abrasive pad 112 can be defined by a wear surface 120 and an attachment surface 121 with outer sidewalls 124 , 125 and outer endwalls 122 , 123 forming a thickness . the thickness is greater than the height of the cavity wall 0 . 75 inches and preferably about one inch in thickness . the abrasive pad 112 is positioned within the cavity 104 presenting a wear surface that extends outward from the top surface 105 of said holding member . the abrasive pad 112 is removable for ease of cleaning the holding member or for purposes of replacement when the wearable material degrades the performance of the cleaning apparatus . cavity 104 sidewalls and endwalls hold the abrasive pad 112 in position . should the abrasive pad be drawn over a surface imperfection that would otherwise grab the abrasive pad , the cavity sidewalls and endwalls hold the abrasive pad in position . should the surface imperfection damage the abrasive pad 112 , the pad can be easily replaced thereby saving the holding element 102 ( sponge ) from becoming waste . further , a sponge 102 is cleaned by soaking in water and squeezing out the water to expel contaminants . by use of a removable abrasive pad 112 , the sponge 102 can be cleaned properly as the abrasive pad will not hamper the cleaning motion . for instance when a nonporous abrasive pad is inserted , such as melamine , the sponge can entrap fluid behind the nonporous abrasive pad for melamine lacks the ability to pass fluids through its cell structure . the abrasive pad 112 is releasably attached to the holding member 102 by frictional engagement with the sidewalls , or can be supplemented by use of a fastener 142 attached to the base wall of the cavity 104 . the sidewalls and endwalls of the cavity 104 entrap the abrasive pad 112 within the holding member 102 allowing an individual to clean an area using lateral movement in multiple directions . for example , the holding member 102 is made of a fluid retention material namely open cell foam or sponge material , an individual can soak the sponge before cleaning an area . the wet sponge 102 facilitates the abrasive pad by providing lubrication to prevent dirt and grit from marring a surface while the cavity 104 maintains the abrasive pad 112 in position . in a preferred embodiment the abrasive pad 112 is made of a material designed to wear as it is used to scrub an article . in this manner the material being abraded by the frictional contact between the abrasive pad 112 and the surface of the article wherein the sponge operates to pick up dirt , grit and residuals from the wear material . one example of such an abrasive pad 112 that provides a wear material is melamine based foam . typically melamine based foam is used as an independent abrasive pad 112 or is permanently attached to another material . for purposes of this application where the abrasive pad is used in combination with the fluid holding member , the preferred melamine abrasive pad has a density of about 1 kg / m 3 to 11 kg / m 3 . the melamine member being an open foam - like material consisting of a formaldehyde - melamine - sodium bisulfate copolymer . the foam is micro - porous with a polymeric substance so that it operates as an extremely fine abrasive material that wears away , like a pencil eraser . the melamine member being abraded as the melamine member scrubs a surface . while not limiting , it has been discovered that using a melamine based foam with a density in this range provides a significant advantage in that it provides better wear resistance of the material , durability , and improved scrubbing ability , without the material becoming too hard so that it cleans well while remaining flexible and absorbent in a wet environment . by use of an abrasive pad 112 having a depth larger than the sidewalls of the cavity 104 , the consumer can visually determine when the abrasive pad should be replaced so as to lessen damage to the holding member . conventional melamine foam used for cleaning purposes is made from a melamine resin which can be a skin irritant . in addition , the cleaning implement can include a fastener , such as hook 142 and loop 140 , alternatively , fastening can be accomplished by snap , elastic band , button , peel and stick or the like releasable attendant fastener , positioned between said cavity 104 base wall and the mounting surface of the abrasive pad 112 , wherein the abrasive pad is primarily held within the cavity by the sidewalls and endwalls of the cavity and the base wall . this assists in holding an abrasive pad used in commercial environments where deep cleaning a surface with known imperfections or in very wet environment wherein the holding member may lose its shape . for instance , the cleaning of uneven grout between tiles or grates can attempt to draw an unfastened abrasive pad 112 from the cavity 104 . in an alternative embodiment , the holding member 200 consists of a non - fluid retaining member 202 , such as a double - open celled structure capable of holding liquids , having a top surface 205 and a bottom surface 206 with end surfaces 207 and 209 , and side surfaces 208 and 211 . the non - fluid retaining member 202 is laminated to a fluid retaining member 203 , namely conventional sponge foam , having a top surface 220 and a bottom surface 222 with side surfaces 223 and 224 ; and end surfaces 225 and 226 . non - reticulate extra firm scrubber being very porous , low density solid foam , open or closed cell structure , with few if any intact cells windows and it constructed of polyurethane or non - woven polyester , comprising a density of 1 . 8 +/− 10 % lbs / ft 3 . the non - fluid retaining member 202 and the fluid retaining member 203 have a substantially conjugate shape and are superposed upon each other and fixedly attached by adhesive or heat / pressure weldment . the fluid holding member is a double - open celled structure capable of holding liquids with a density between 1 . 30 - 2 . 50 lbs / ft3 and constructed from random - celled hydrophilic urethane . in this embodiment the non - fluid holding member 202 has a centrally disposed cavity 230 . the cavity 230 has a continuous inner wall 232 having a uniform depth d ′ of about 0 . 75 ″ extending through said non - fluid retaining member 202 abutting said fluid retaining member 203 to form a base wall . the cavity 230 is constructed and arranged to cooperate with an abrasive pad 212 to frictionally engage the abrasive pad on the side walls , end walls and base wall . the cavity 230 is of a substantially conjugate shape as the abrasive pad 212 . the abrasive pad 212 having a top surface 214 and a bottom surface 216 with side surfaces 217 and 219 and end surfaces 218 and 221 . the abrasive pad 212 is positioned to extend at a predetermined distance above the top surface 205 of the non - fluid retaining member 202 thus being greater than about 0 . 75 inches in height and preferably about 1 inch in height . the abrasive pad 212 must be removable for cleaning or replacement . in this manner the holding member can be used for a variety of cleaning jobs by simply replacing the abrasive pad 212 with an abrasive pad of higher or lower abrasive material . further , should the cleaning implement be used in a particularly dirty environment , cleaning fish blood off a boat for example , removal of the abrasive pad would be necessary to rinse any material trapped behind the abrasive pad before reuse . the side walls of the holding member may include a grip edge 235 which is ornamental in design . in addition , the cleaning implement can include a fastener , such as hook 242 and loop 240 , alternatively , fastening can be accomplished by snap , elastic band , button , peel and stick or the like releasable attendant fastener , positioned between said cavity 230 base wall and the mounting surface of the abrasive pad 212 , wherein the abrasive pad is primarily held within the cavity by the sidewalls and endwalls of the cavity and the base wall . this assists in holding an abrasive pad used in commercial environments where deep cleaning a surface with known imperfections or in very wet environment wherein the holding member may lose its shape . for instance , the cleaning of uneven grout between tiles or grates can attempt to draw an unfastened abrasive pad 212 from the cavity 230 . in an alternative embodiment , the holding member 300 consists of a fluid retaining member 302 , namely conventional sponge foam , having a top surface 305 and a bottom surface 306 with end surfaces 307 and 309 , and side surfaces 308 and 311 . the fluid retaining member 302 is laminated to a non - fluid retaining member 303 , such as non - reticulated extra firm scrubber foam being very porous , low density solid foam , open or closed cell structure , with few if any intact cell windows and is constructed from polyurethane or non - woven polyester , comprising a density of 1 . 8 +/− 10 % lbs / ft 3 , having a top surface 320 and a bottom surface 322 with end surfaces 323 and 324 ; and side surfaces 325 and 326 . non - reticulate foam being a very porous , low density solid foam with few , if any intact cell windows . the fluid retaining member 302 and the non - fluid retaining member 303 have a substantially conjugate shape and are superposed upon each other and fixedly attached by adhesive or heat / pressure weldment . the fluid holding member is a foam sponge capable of holding liquids and typically has a density between 1 . 30 - 2 . 50 lbs / ft3 and constructed from one of random - celled hydrophilic urethane . in this embodiment the fluid holding member 302 has a centrally disposed cavity 330 . the cavity 330 has a continuous inner wall 332 having a uniform depth d ″ of about 0 . 75 ″ extending through said fluid retaining member 302 abutting said non - fluid retaining member 303 to form a base wall . the cavity 330 is constructed and arranged to cooperate with an abrasive pad 312 to frictionally engage the abrasive pad on the side walls , end walls and base wall . the cavity 330 is of a substantially conjugate shape as the abrasive pad 312 . the abrasive pad 312 having a top surface 314 and a bottom surface 316 with end surfaces 317 and 319 and side surfaces 318 and 321 . the abrasive pad 312 is positioned to extend at a predetermined distance above the top surface 305 of the fluid retaining member 302 thus being greater than about 0 . 75 inches in height and preferably about 1 inch in height . the abrasive pad 312 must be removable for cleaning or replacement . in this manner the holding member can be used for a variety of cleaning jobs by simply replacing the abrasive pad 312 with an abrasive pad of higher or lower abrasive material . further , should the cleaning implement be used in a particularly dirty environment , cleaning fish blood off a boat for example , removal of the abrasive pad would be necessary to rinse any material trapped behind the abrasive pad before reuse . the side walls of the holding member may include a grip edge 335 which is ornamental in design . in addition , the cleaning implement can include a fastener , such as hook 342 and loop 340 , alternatively , fastening can be accomplished by snap , elastic band , button , peel and stick or the like releasable attendant fastener , positioned between said cavity 330 base wall and the mounting surface of the abrasive pad 312 , wherein the abrasive pad is primarily held within the cavity by the sidewalls and endwalls of the cavity and the base wall . this assists in holding an abrasive pad used in commercial environments where deep cleaning a surface with known imperfections or in very wet environment wherein the holding member may lose its shape . for instance , the cleaning of uneven grout between tiles or grates can attempt to draw an unfastened abrasive pad 312 from the cavity 330 . in an alternative embodiment , the holding member 400 consists of a fluid retaining member 402 , namely conventional sponge foam , having a top surface 405 and a bottom surface 406 with end surfaces 407 and 409 , and side surfaces 408 and 411 . the fluid retaining member 402 is laminated to a non - fluid retaining member 403 , such as non - reticulated extra firm scrubber foam being very porous , low density solid foam , open or closed cell structure , with few if any intact cell windows and is constructed from polyurethane or non - woven polyester , comprising a density of 1 . 8 +/− 10 % lbs / ft 3 , having a top surface 420 and a bottom surface 422 with end surfaces 423 and 424 ; and side surfaces 425 and 426 . non - reticulate foam being a very porous , low density solid foam with few , if any intact cell windows . the fluid retaining member 402 and the non - fluid retaining member 403 have a substantially conjugate shape and are superposed upon each other and fixedly attached by adhesive or heat / pressure weldment . the fluid holding member is a foam sponge capable of holding liquids and typically has a density between 1 . 30 - 2 . 50 lbs / ft3 and constructed from one of random - celled hydrophilic urethane . in this embodiment the fluid holding member 402 has a centrally disposed cavity 430 . the cavity 430 has a continuous inner wall 432 having a uniform depth d ″ of about 0 . 75 ″ extending through said fluid retaining member 402 abutting said non - fluid retaining member 403 to form a base wall . the cavity 430 is constructed and arranged to cooperate with an abrasive pad 412 to frictionally engage the abrasive pad on the side walls , end walls and base wall . the cavity 430 is of a substantially conjugate shape as the abrasive pad 412 . the abrasive pad 412 having a top surface 414 and a bottom surface 416 with end surfaces 417 and 419 and side surfaces 418 and 421 . the abrasive pad 412 is positioned to extend at a predetermined distance above the top surface 405 of the fluid retaining member 302 thus being greater than about 0 . 75 inches in height and preferably about 1 inch in height . the abrasive pad 412 must be removable for cleaning or replacement . in this manner the holding member can be used for a variety of cleaning jobs by simply replacing the abrasive pad 412 with an abrasive pad of higher or lower abrasive material . further , should the cleaning implement be used in a particularly dirty environment , cleaning fish blood off a boat for example , removal of the abrasive pad would be necessary to rinse any material trapped behind the abrasive pad before reuse . in addition , the cleaning implement can include a fastener , such as hook 442 and loop 440 , alternatively , fastening can be accomplished by snap , elastic band , button , peel and stick or the like releasable attendant fastener , positioned between said cavity 430 base wall and the mounting surface of the abrasive pad 412 , wherein the abrasive pad is primarily held within the cavity by the sidewalls and endwalls of the cavity and the base wall . this assists in holding an abrasive pad used in commercial environments where deep cleaning a surface with known imperfections or in very wet environment wherein the holding member may lose its shape . for instance , the cleaning of uneven grout between tiles or grates can attempt to draw an unfastened abrasive pad 412 from the cavity 430 . all patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . all patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and any drawings / figures included herein . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the embodiments , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims .	0
as shown in fig1 a , a light - emitting device includes a base 11 , a first reflecting layer 12 , a first insulating layer 13 , a conducting layer 14 , a light - emitting unit 16 , a filling material 17 , a wavelength converting material 17 a , a second insulating layer 18 , and a second reflecting layer 19 . in one embodiment , the base 11 is made of silicon , and has an upper terrace 111 , an incline 112 , and a lower terrace 113 . the first reflecting layer 12 , the first insulating layer 13 , and the conducting layer 14 are sequentially formed on the incline 112 , wherein the first reflecting layer 12 and the first insulating layer 13 overlay the upper terrace 111 , incline 112 , and the lower terrace 113 . the conducting layer 14 overlays the upper terrace 111 and the incline 112 . the light - emitting unit 16 , such as a light - emitting diode chip , is mounted on the conducting layer 14 . the second insulating layer 18 and the second reflecting layer 19 are formed on a side of the light channel opposite to the lower terrace 113 . the filling material 17 is formed between the first insulating layer 13 and the second insulating layer 18 . the first reflecting layer 12 and the second reflecting layer 19 are capable of reflecting or / and scattering light , and the material thereof includes but not limited to au , ag , cu , ti , an alloy of aforementioned materials , a stacking layer of aforementioned materials , and a distributed bragg reflector ( dbr ). the material of the first insulating layer 13 and the second insulating layer 18 includes but not limited to sio 2 , epoxy , benzocyclobutene ( bcb ), and si x n y . the insulating layer preferably has a thickness that the light can pass through and reach the reflecting layer . the material of the conducting layer 14 includes but not limited to au , ag , al , cu , w , sn , and ni . the filling material 17 includes but not limited to expoy , acrylic resin , coc , pmma , pc , polyetherimide , fluorocarbon polymer , and silicone . the filling material 17 may also includes the wavelength converting material 17 a , such as phosphor , which can be excited by the light from the light - emitting unit 16 and generates light with a different wavelength . as shown in fig1 b , the phosphor layer can overlay directly on any light output surface of the light - emitting unit 16 . the phosphor layer thickness may be identical or varied on each of the light output surfaces according to the required light field or color . applicant &# 39 ; s taiwan patent application , sn . 093126439 , which discloses related technology , is incorporated herein by reference . the light - emitting unit 16 can be a horizontal or vertical type light - emitting diode or chip . a horizontal type light - emitting diode has a p - electrode and an n - electrode formed on the same side of a substrate or a carrying layer for carrying the p - and n - electrodes . a vertical type light - emitting diode has a p - electrode and an n - electrode formed on the opposite sides of a substrate or a carrying layer . the details of the conducting layers of the present invention are shown in fig2 a . the conducting layers 14 a and 14 b are formed on the insulating layer 13 , and electrically connected to the p - and n - electrodes respectively . in detail , one of the p - and n - electrodes of the vertical type light - emitting diode is coupled to the conducting layer 14 a , and the other is electrically connected to the conducting layer 14 b via a wire or other connecting means . the p - and n - electrodes of the horizontal type light - emitting diode are respectively coupled to the conducting layers 14 a and 14 b , i . e . mounted to the conducting layer in a flip - chip fashion . when the horizontal type light - emitting diode is carried by an insulating substrate , the insulating substrate can be directly put on one of the conducting layer 14 a and 14 b , or span the two conducting layers , and the p - and n - electrodes are electrically connected to the conducting layer 14 a and 14 b by wiring or other connecting means respectively . the light - emitting diode or chip having an insulating substrate can also be disposed directly on the incline 112 , the first reflecting layer 12 , or the insulating layer 13 . as shown in fig2 b , the reflecting layer 12 is made of conducting material ( s ) and connected to a wiring 16 a , i . e . the light - emitting unit 16 is electrically connected to an outer circuit through the reflecting layer 12 . the covering area of the first reflecting layer 12 and / or the insulating layer 13 can be adjusted in view of the requirement . as shown in fig3 a , according to an embodiment of the present invention , parts of the light from the lateral side of the light - emitting unit 16 strike the first reflecting layer 12 and the second reflecting layer 19 respectively . because the conducting layer 14 on the incline 112 intersects with the first conducting layer 12 and the second reflecting layer 19 at different intersecting angles , the light is reflected to different directions . in one embodiment , the intersecting angle d 1 between the inclines 112 and the lower terrace 113 is 120 degree , and the intersecting angle between the inclined portion of the conducting layer 14 and the first reflecting layer 12 is d 1 . the light r 1 shooting to the second reflecting layer 19 leaves the light - emitting device 10 after two reflections . the light r 2 shooting to the first reflecting layer 12 leaves the light - emitting device 10 after one time reflection or reflection ( s ) between the first reflecting layer 12 and the second reflecting layer 19 . as shown in fig3 b , the portion between incline 112 and the lower terrace 113 is such as a curved surface , which has an intersecting angle d 1 . the curved surface has a constant curvature , or a varying curvature , which is a space function of two or three dimensions . according to the design of the present invention , the light confined in the package structure is released , and the light extraction efficiency is hence improved . as shown in fig4 a , the light output surface 20 of the light emitting device 10 is parallel to the incline 112 , or inclines relative to the lower terrace 113 by d 2 degree . the light is refracted after passing through the inclined light output surface 20 , and changes the direction ; therefore , the light can be directed to a predetermined direction under a properly set degree . in another embodiment , assuming degree d 2 = 60 °, the light field or the light r 3 moves downward . as shown in fig4 b and 4c , the light output surface 20 of the light - emitting device 10 is a curved surface ; the curved surface has a constant curvature , or a varying curvature , which is a 2d or 3d space function . the curved surface may result in various light fields . under a properly designed curved surface , even without the second insulating layer 18 and the second reflecting layer 19 , the light also leaves out the light output surface 20 after one or many times of total reflections on the boundary between the curved surface and the environmental medium . as shown in fig4 d , in another embodiment of the present invention , the light - emitting device 10 has several light output surfaces 20 . the neighboring surfaces intersect respectively with a reference plane , such as the lower terrace 113 , at different angles ; therefore , the light incident at the same angle is refracted out of the several light output surfaces at different angles . moreover , when the angle between the light output surface 20 and the lower terrace 113 becomes smaller , the light field tends to move downward , and on the contrary , the light field tends to move upward . the contour of the light output surfaces may be a part of a polyhedron . in other embodiments , at least part of the light output surface 20 , or several light output surfaces 20 is / are constructed in a formation including a curved surface , a rough surface , and a lens , as shown in fig4 e - 4g . the overall light field of the light - emitting device 10 can be controlled by combining different angles and types of light output surfaces . the light output surface 20 of aforementioned embodiments further include two or more micro lenses 201 . as shown in fig5 a , lenses 201 are laterally arranged on the light output surface 20 . the light leaves the light output surface 20 of the light - emitting device via the guidance of the lenses 201 . by using the lenses 201 , the light - emitting device 10 can display a light field with a larger angle or well - mixed colors of lights . provided two or more colors of lights are emitted by the light - emitting unit 16 of the light - emitting device 10 , the color lights can be well mixed by the lenses 201 . in addition , the lenses 201 also facilitate the mixture of a plurality of light rays . however , the lenses may be vertically arranged according to the requirement . the lens 201 can be a convex or a concave . the radius of the lens 201 is between 50 μm ˜ 60 μm . furthermore , fig5 b illustrates a top view of a light - emitting device 10 , as shown in fig4 c , having lenses 201 . the radius of the lens 201 changes along an extending path . in the present case , the radius of the lens 201 increases from top to down . in addition , as shown in fig5 c , in the light - emitting device 10 having an array of lens 201 , the inner surface 117 of the light channel may be a vertical surface and is not limited to an incline . in the present invention , the light - emitting unit 16 of the light - emitting device 10 is not limited to be disposed on a single side of the light channel , but on any side of the light channel . as shown in fig6 , the light channel includes two or more inclines 112 on different sides thereof . arbitrary quantity of the light - emitting unit 16 can be disposed on the incline 112 . provided two inclines 112 is disposed opposite to each other , the reflecting layer formed on the incline 112 can reflect the light from the opposite side upward . provided each side of the light channel includes an incline 112 , and the reflecting layer is formed on the incline 112 and the lower terrace 113 , the light from the light - emitting unit 16 on each of the incline 112 is reflected upward by the reflecting layer on the incline 112 . according to another embodiment of the present invention , the light - emitting device 10 includes two or more light - emitting units 16 which can emit colorful light having a single color , multi - colors , non - visible wavelength , or a combination of the aforementioned lights . the arrangement of the light - emitting unit 16 is determined by the electrode design of an individual light - emitting unit 16 , which is described in detail in the description of fig2 b . white light can be mixed up by using red , blue , and green light - emitting units 16 , or two light - emitting units 16 having complementary colors . the aforementioned design is beneficial to apply the light - emitting unit to a product requiring a particular light field , such as a backlight module of a liquid crystal display . as shown in fig7 a , an edge type liquid crystal display essentially includes a light guide plate 30 , a reflecting film 31 , an optical film 32 , and a liquid crystal layer 33 . the light input surface of the light guide plate 30 has a geometry changing with the light output surface 20 of the light - emitting device 10 , in present case , the contours of the light input surface and the light output surface are identical , but the present invention is not limited to such implementation , other disposition well adapted to the light - emitting device is acceptable . the light from light - emitting unit 16 , which is refracted at the light input surface and then moves to the bottom of light guide plate , is reflected to the optical film 32 and liquid crystal layer 33 by the reflecting film 31 . in the present embodiment , the angle of the light output surface 20 is different from that disclosed in above embodiments in order to fit the design of the display . the light output angle of the light - emitting device 10 can be adjusted by tuning the inclined angle of the light output angle relative to a reference plane . the horizontal incident light can reach a farther position through a light output surface having a larger inclined angle ; on the contrary , the light through the light output surface having a smaller inclined angle can only reach a closer position . as shown in fig7 b , two light output surfaces 20 a and 20 b having different angles are arranged on the same side of the reflector 34 , wherein , the two light output surfaces 20 a and 20 b can be formed on a single or separate light - emitting device 10 . the light ( light field ) r 5 through a larger angle light output surface 20 a is refracted to a position distant from the light output surface ; while the light ( light field ) r 6 through a smaller angle light output surface 20 b is refracted to a position near the light output surface . the light is reflected by the reflector 34 to a direction leaving away the reflector . by the design , a uniform light distribution can be realized on a predetermined region , even without using the light guide plate of fig7 a . the light output surfaces having different light output angles can be designed into several or individual light - emitting device ( s ). moreover , the light - emitting device can be disposed on one or two or more edges of the reflector . in addition , the surface of the reflector 34 can be a rough surface , which has protrusions and depressions . the light striking the roughing surface is scattered in an arbitrary direction . in one embodiment , the distribution density of the protrusions and depressions is higher in the position leaving away the light output surface . however , the protrusions and depressions can also distribute uniformly or randomly on the surface 35 . the protrusion and depression can be formed in a formation including dot , stripe , hole , or the combination thereof . firstly , as shown in fig8 a , a silicon substrate 11 is prepared . as shown in fig8 b - 8e , a trench 114 having an upper terrace 111 , an incline 112 , and lower terrace 113 , is then formed by performing an anisotropic - etching on the silicon substrate 11 assisted by an oxide mask ( not shown ) and koh etchant . a first reflecting layer 12 and a first insulating layer 13 are sequentially overlaid on the upper terrace 111 , the incline 112 , and the lower terrace 113 . conducting layers 14 and 15 are then overlaid on the area of the first insulating layer above the upper terrace 111 and the incline 112 . the light - emitting unit 16 is mounted on the conducting layer 14 and / or 15 , and a wire is bonded thereto according to the requirement . a filling material 17 is filled into the trench 114 , and a second insulating layer 18 and a second reflecting layer 19 are sequentially overlaid thereon , as shown in fig8 f and 8g . finally , after cutting the silicon substrate 11 , a separate light - emitting device 10 is obtained . in addition , a cut 115 ( the adjacent light - emitting device is shown in dotted lines ) is formed before cutting in order to avoid short circuit caused by metallic residuals or the sidewall of the light - emitting unit 16 being polluted by the solder , as shown in fig8 h and 8i . the cut 115 can be also formed before overlaying the first insulating layer 13 , i . e . the first insulating layer 13 is covered on the cut 115 . in the above description , the thickness of each layer can be identical or varying in view of the manufacture conditions of design requirements . an alternative manufacture process can be used in present invention . as shown in fig9 a and 9b , for example , a si 3 n 4 film 116 is firstly formed on a surface of the silicon substrate 11 , and then etched to form a pattern . in the case , to provide an easy manufacture process , the si 3 n 4 film 116 can be formed simultaneously on the other surfaces of the substrate 11 . by adapting the pattern as a mask , the koh solution is used to etch the substrate 11 to form the trench 114 and the cut 115 . the si 3 n 4 film 116 is then removed by dry etching . a reaction gas , such as oxygen , is introduced to cause the surface of the silicon substrate 11 to become a silica layer 13 . the steps after fig5 d are repeated to complete the light - emitting device 10 . the foregoing description has been directed to the specific embodiments of this invention . it will be apparent ; however , that other variations and modifications may be made to the embodiments without escaping the spirit and scope of the invention .	8
fig1 and 2 show a locking ring assembly 10 disposed on a mill roll shaft 12 . a bearing 14 is retained on the shaft 12 by the locking ring assembly 10 . the shaft 12 is rotatably supported on a first axis of rotation 16 . the shaft 12 has a plurality of cylindrical portions on which are disposed the locking ring assembly 10 and the bearing 14 . a first cylindrical portion of the shaft 18 is a left - most portion of the shaft shown in fig2 . moving to the right , the first cylindrical portion 18 is followed by a second cylindrical portion 20 smaller in diameter than the first cylindrical portion . a third cylindrical portion 22 to the immediate right of the second cylindrical portion 20 has a diameter at least as large as the first cylindrical portion 18 . the fourth cylindrical portion 24 , located to the immediate right of the third cylindrical portion 22 , is shown with a diameter larger than the third cylindrical portion 22 . the fifth cylindrical portion 26 immediately to the right of the fourth cylindrical portion 24 is shown as being larger in diameter than the fourth cylindrical portion . the bearing 14 is disposed on the fourth cylindrical portion 24 , and abuts a shoulder 28 of the fifth cylindrical portion 26 . a bearing retainer 30 has a loading face 32 on a first side disposed against the bearing 14 . the loading face 32 is configured so as to contact an inner race 34 of the bearing 14 and yet avoid contact with the fifth cylindrical portion 26 . the inner race 34 of the bearing 14 is press - fit over the fourth cylindrical portion 24 . the bearing retainer 30 has an opening 35 sized to provide a clearance fit over the third cylindrical portion 22 . a plurality of guide pins 36 project from the bearing retainer 30 parallel to the axis 16 from a first side 38 opposite the loading face 32 . in the present embodiment , six guide pins 36 are evenly spaced from each other on a constant diameter bolt circle a . the guide pins 36 have an elongated cylindrical shank portion 40 of constant diameter . a first end or head 39 of the guide pin 36 has a hex head 41 and radially extending flange 42 larger in diameter than the cylindrical shank portion 40 . a second end of the guide pin 36 has an axially extending threaded stud 44 . the guide pins 36 are received by recessed countersunk bores 45 with threaded apertures . the counter bores 45 provide a very close clearance fit with respect to the shank portion of the pins 36 . the guide pins 36 are fixed to the bearing retainer 30 by threading the studs 44 into the threaded apertures 46 in the bearing retainer 30 on the bolt circle a . a torque sufficient to effectively fix the guide pins 36 to the bearing retainer 30 is applied to the hex head 41 . a pressure ring 48 is disposed in part over the third cylindrical portion of the shaft 22 and also in part over the second cylindrical portion of the shaft 20 . a primary opening 49 in the pressure ring is sized to provide a clearance fit over the third cylindrical portion 22 of the shaft 12 . the clearance fit allows for relative sliding motion between the pressure ring 48 and the shaft 12 . the pressure ring 48 has a plurality , six in this exemplary embodiment , of pressure ring , or adjusting apertures 50 evenly spaced on a bolt circle equal in diameter to bolt circle a and concentric therewith . the apertures 50 are parallel to the axis of rotation 16 . a first side 52 of the pressure ring 48 is disposed toward the second side 38 of the bearing retainer 30 . a second side 54 of the pressure ring 48 is disposed opposite the first side 52 . the adjusting apertures 50 pass from the first side of the pressure ring through the second side of the pressure ring 54 . the adjusting apertures 50 have a threaded portion 56 extending from the second side 54 to a point approximately mid - way between the first side 52 and the second side 54 . a guide portion 58 of the apertures 50 is disposed between the threaded portion 56 and the first side of the pressure ring 52 . the guide portion 58 is of a constant diameter sized to provide a slidable piloting relationship with the flange 42 of the guide pin 36 . a plurality of guide pin retainers 60 are fixed to the first side 52 of the pressure ring 48 over each of the adjusting apertures 50 . each of the guide pin retainers are annular in shape . a central aperture 62 of each retainer 60 is aligned with the adjusting apertures 50 , and is sized to provide a slidable piloting relationship with the shank portion 40 of the guide pins . the sliding relationship of the flange 42 to the guide portion 58 , together with the sliding relationship between the retainer &# 39 ; s primary aperture 62 and the cylindrical shank portion of the guide pin 36 , maintains the pressure ring 48 coaxial with the bearing retainer 30 . the guide pin retainers 60 are made of hardened steel to minimize potential wear , providing longer service life without appreciable deterioration of alignment accuracy . each guide pin retainer 60 is located on the pressure ring 48 by a pair of dowel pins 64 . four socket head screws are used to fix each guide pin retainer 60 to the first side 52 of the pressure ring 48 . it should be appreciated that the function of the guide pin retainer 60 can be integrated into the pressure ring 48 by providing a blind bore therein from the second side 54 and providing a hole through the first side 52 equal in diameter to the primary aperture 62 . a pressure screw 68 is threadingly disposed in the threaded portion 56 of the adjusting aperture 50 . the pressure screw 68 has a length such that it is approximately flush with the second side 54 of the pressure ring 48 when fully installed . a disk shaped thrust button 70 is retained in a cavity of complimentary shape in the pressure screw 68 on a side disposed toward the first end of the guide pin 36 . the thrust button 70 is formed from a material softer than that used for the first end of the guide pin 36 . a hex socket 72 is formed in an end of the pressure screw 68 opposite the thrust button 70 to accommodate a hex shaped drive tool . a axially extending flange 74 provides an axial extension of the second side 54 of the pressure ring 48 . at an end 76 of the flange 74 , there is a circumferential notch or undercut 78 inside the primary opening 49 . the combination of the pressure ring 48 with the pressure screws 68 and guide pin retainers 60 provide an adjusting mechanism capable of producing relative displacement between the pressure ring 48 and the bearing retainer 30 . a retaining ring 80 is disposed in a circumferential groove 82 in the shaft 12 , forming the second cylindrical portion 20 and a shoulder 84 of the first cylindrical portion 18 . the retaining ring 80 has two arcuate members 86 pivotally linked to each other by an intermediate link member 88 . the link member 88 is disposed on each end in a slot 89 of the arcuate members . pins passing through the arcuate members 86 and the link member 88 allow relative pivoting therebetween . when the retaining ring 80 is disposed in the slot 82 , an inside surface of the arcuate members 86 contacts the second cylindrical portion 20 of the shaft 12 , thereby defining a retaining ring outside diameter b . the arcuate members 86 have lengths such that when the retaining ring 80 is disposed in the groove 82 there is a gap c between the arcuate members 86 . the notch 78 in the end 76 of the flange 74 has a diameter greater than b , enabling it to surround the retaining ring . it is to be appreciated that other means for axially engaging the shaft 12 can be employed . any ring type element disposed in the groove 82 would suffice to provide a reaction element for the end 76 of the pressure ring 48 , either with or without the notch 78 . a screw lock assembly 90 is also disposed in the pressure ring . a lock aperture 92 is provided in the pressure ring 48 normal to each pressure screw 68 . the screw lock assembly 90 includes a steel ball 94 , a spring 96 , and a set screw 98 . the ball 94 is disposed in the lock aperture against the pressure screw 68 . the spring 96 is disposed against the steel ball in the lock aperture 92 and is retained therein by the set screw 98 which threadingly engages a threaded portion of the lock aperture 92 . tightening of the set screw 98 increases the force from the spring 96 against the steel ball 94 , thereby increasing the torque required to turn the pressure screw . the screw lock assembly 90 thus maintains the position of the pressure screw 98 in the threaded portion 56 of the adjusting aperture 50 . a stop collar 100 is disposed over the shank portion 40 of the guide pins 36 , and is axially located between the guide pin retainer 60 and the bearing retainer 30 . a retainer pin 102 is disposed in aligned apertures through the collar 100 and pin 36 to hold the collar 100 in place on the guide pin 36 . examples of suitable retainer pins 102 are spring pins and roll pins . a bearing chock 104 of the mill is disposed over an outer race 106 of the bearing 14 . a seal plate 108 is fixed to the bearing chock 104 and together with the retainer 30 forms a labyrinth seal 110 . the locking ring assembly 10 is installed on the mill roll shaft 12 as follows . a guide pin retainer 60 is slipped over the shank portion 40 of each of the guide pins 36 . a stop collar 100 is then slipped over the shank portion 40 and the aperture therein aligned with the corresponding aperture in the guide pin 36 . the retainer pin 102 is then pressed into the aligned apertures to couple the collar 100 with the guide pin 36 . assembled guide pins 36 and retainers 60 are aligned with each of the adjusting apertures 50 with the flanges 42 disposed therein . dowel pins 64 are installed to position the retainers 60 relative to the adjusting apertures 50 . the socket head screws 66 are then installed to fix the guide pin retainers 60 to the first side 52 of the pressure ring 48 . the bearing retainer 30 is then slipped over the mill roll shaft 12 with its loading face 32 disposed towards the bearing 14 . the seal plate 108 is slipped over the retainer 30 and fixed to the bearing chock 104 . the labyrinth seal 110 formed between the seal plate 108 and the retainer 30 substantially prevents dirt and contaminants from reaching the bearing 14 . the pressure ring 48 is next slipped over the mill roll shaft with the extending guide pins 36 directed toward the bearing retainer 30 . the pressure ring 48 is pushed toward the bearing retainer 30 . the primary apertures 62 are aligned with the counterbores 45 and threaded apertures 46 in the bearing retainer 30 . each of the axially extending threaded studs 44 of the guide pins 36 are threaded into the threaded apertures 46 in the bearing retainer 30 with the shank portion 40 seating against a bottom of the counterbore 45 . the guide pins 36 are tightened through the hex heads 41 to a predetermined torque level to prevent their loosening . thrust buttons 70 are pressed into the cavities of the pressure screws 68 . the pressure screws 68 are threaded into the threaded portion 56 of the adjusting apertures 50 , capturing the heads 39 of the guide pins 36 . the steel balls 94 are deposited one by one in each of the lock apertures 92 and backed up by the springs 96 and set screws 98 also installed in the lock apertures 92 . the retaining ring 80 is slipped into the groove 82 , over the second cylindrical portion 20 . the pressure screws 68 are then turned so as to axially displace them toward and into contact with the heads 39 , resultantly pushing the pressure ring 48 away from the bearing retainer 30 . the notch 78 in the pressure ring flange 74 gradually entraps a portion of the retaining ring 80 on its outside diameter . as tightening of the pressure screws continues , force increases between the retaining ring 80 and the bearing 14 with the bearing 14 reacting against the shoulder 28 of the fifth cylindrical portion 26 . throughout the travel of the pressure screws , the guide pins 36 are maintained in an axial orientation by the cooperation of the guide pin flanges 42 with the guide portions 58 , and the primary apertures 62 with the cylindrical shank portions 40 . additional protection against cocking of the pressure ring 48 during tightening of the pressure screws 68 is provided by the stop collars 100 which limit axial travel of the pressure ring 48 relative to the bearing retainer 30 . the desired level of thrust load against the bearing 14 is then developed by the adjusting of the pressure screws 68 acting against the guide pins 36 . when the pressure screws 68 are fully installed , they are flush with the second side 54 of the pressure ring 48 , leaving none of the threads of the screws 68 or the adjusting apertures 50 exposed to contaminants such as airborne grit . the set screws 98 of the screw lock assemblies 90 are tightened to prevent any loss of thrust load against the bearing 14 during operation of the mill . the pressure screws 68 are prevented form backing out or loosening by the pressure exerted on them by the lock assembly 90 . the force applied against each pressure screw 68 by the steel ball 94 is variable , depending on the amount the spring 96 is compressed by the set screw 98 . the set screws 98 can of course be partially unthreaded to reduce the force against the pressure screws 68 to allow their adjustment . after adjusting the pressure screws 68 , the set screws 98 can be retightened against the springs 96 to relock the pressure screws 68 . with the interface between the pressure screw 68 and the head 39 of the guide pin 36 being effectively sealed off and protected from contaminants within the adjusting aperture 50 , a highly reliable and sustainable bearing retainer load is achieved with the present locking ring assembly . it should be appreciated that the mill roll shaft 12 , when worn , can be removed and replaced with a new shaft 12 without removing the bearing or the locking ring assembly 10 from the mill . the bearing 14 and the locking ring assembly 10 are retained by the bearing chock 104 and the seal plate 108 . only the retaining ring 80 need be removed to allow the shaft 12 to be pulled . other aspects , objects , and advantages of this invention can be obtained from a study of the drawings , the disclosure , and the appended claims .	5
the present invention comprises a part of a larger document archive subsystem , which subsystem in turn comprises a part of a larger image archive and retrieval system . fig1 discloses the general configuration of such an archive / retrieval system 10 . the present invention is incorporated within archive subsystem 11 . as the terms are used herein , a document or check comprises the well - known paper , or hard copy , of a document , such as a check . a check contains , for example , printed graphic images and text , alphanumeric data that is usually printed using micr ink , and handwritten data , such as a signature . the terms image and document image , as used herein , mean one or more digital images , or pictures , of the check . the term coded data , as used herein , generally means the optical character reading ( ocr ), magnetic ink character reading ( micr ), and the machine reading of handwritten data from a check . the terms associated data or arbitrary associated data , as used herein , generally mean user - defined data that is associated with a check ( examples of which are voice annotation data that is provided by an operator at the time of document scanning , and a signature that is taken from a signature card that is associated with the checking account ). with reference to fig2 archive subsystem 11 comprises three major structural components that operate to implement the three processes of ( 1 ) image capture , ( 2 ) suspect image processing , and ( 3 ) image archiving ; i . e ., capture system 24 , suspect image system 25 , and archive system 26 . capture system 24 provides the image capture function for archive subsystem 11 , and is implemented by a high speed capture process 29 , one embodiment of which is the ibm imageplus high performance transaction system application library services ( hpts als ) with the ibm check processing control system ( cpcs ) by an image database 36 , one embodiment of which is the ibm imageplus high performance transaction system ( hpts ) check image management system ( cims ) and by an anomalous condition detection process 130 , one embodiment of which is the ibm 3897 that operates to , among other things , detect anomalous conditions and generate anomalous condition flags . suspect image system 25 is implemented by image quality analysis ( iqa ) process 30 of the present invention , a suspect image review ( sir ) process 31 , and an image quality reporting ( iqr ) process 32 . while iqa 30 of the present invention will be described in relation to the apparatus of fig2 it is to be noted that it is of general utility in any image capture system that generates anomalous condition indicators or suspect flags . iqa 30 is the subject matter of this application , and is a batch process system that provides automatic identification , analysis , and quantification of suspect document images , documents and uofw . the suspect image review ( sir ) process 31 provides operator review of suspect images at operator workstations . one embodiment is the sir feature of the ibm hpts high speed image browse ( hsib ) application . iqr 32 is a batch process system that accumulates data from iqa 30 , and generates reports that are based upon this data . iqr 32 also comprises a portion of the present invention . archive system 26 is implemented by a hierarchial index / data consolidation process 33 , one embodiment of which is the ibm image archive consolidation facility , ( iacf ), a hierarchial storage access process 34 , one embodiment of which is the ibm object access method , ( oam ), and archive storage devices 27 . fig3 provides a showing of the operation of iqa 30 and sir 31 of fig2 . in summary , the invention operates to generate an image suspiciousness valve ( isv ) for each captured image . the isv for an image is derived from the status of the suspect flags and / or flag combinations that have been set and are relevant to that image , and are assigned a flag combination weighting factor ( fcwf , to be described ). the invention further provides a document suspiciousness value ( dsv ) for each suspect document ; i . e ., a document having at least one image thereof for which an isv has been generated . in accordance with the invention , the dsv for a given document is derived from the isvs that are associated with that document . finally , a number of unit of work suspiciousness values ( usvs ) are generated for a uofw group of documents in which a dsv has been generated for at least one document of the uofw . operation of iqa 30 provides a pass / fail / conditionally accept decision 71 , 72 , 73 for each uofw based upon a comparison of the generated usvs for that uofw and user parameters 42 . suspect storage file 40 stores the anomalous indicator information relative to all documents as provided by the image capture device . iqa 30 receives the starting delineation of uofws from cpcs mass data set ( cpcs feds ) 41 and operates to evaluate the degree of suspiciousness of that uofw based upon information that is received from cpcs mds 41 and based upon user parameters that are provided at 42 . in accordance with the invention , user parameters 42 can take many forms and , for example , include user defined thresholds , user defined weighting factors , and user defined suspect flags / flag combinations . iqa 30 operates to provide a recommendation 70 that provides one of three outputs ; namely , a pass or proceed with archive recommendation 71 , a fail recommendation 72 , or a conditionally accept recommendation 73 . in the case of both fail recommendation 72 and conditionally accept recommendation 73 , provision is made for human review 31 of the suspect images . the result of this human review can be to either accept for archive at 74 , or to reject 75 the images . in the case of a reject decision 75 , an image recapture function 76 is implemented by capture system 24 of fig2 . in the case of a pass recommendation 71 or an accept decision 74 from human suspect review , the uofw proceeds to the archive system 26 of fig2 . with reference to fig4 the invention operates to order suspect flags and flag combinations by their relative image suspiciousness , thus recognizing that certain flags , and / or flag combinations , are more critical to image quality than are other flags and / or flag combinations . this function is accomplished by user parameters 42 of fig3 which allow the user to specify a flag combination weighting factor ( fcwf ) 47 for each flag and / or flag combination . in fig4 isv determination processor 45 receives the actual flags set 46 for document images . processor 45 also receives user defined flags , and / or flag combinations 47 and fcwfs 48 for these user defined flags and / or flag combinations . as a feature of the invention , processor 45 determines the isv 49 for an individual image , which isv 49 comprises the maximum fcwf 48 that has been assigned to a flag or flag combination that has been set for that image . as a feature of the preferred embodiment , iqa 30 provides default fcwf values 48 for all single flags , and for certain flag combinations by way of user parameters 42 . the dsv 52 for a document is a function of the isvs of all images that are associated with the suspect document , and the relative importance of a given image of that document . dsv determination processor 50 determines dsv 52 for each individual document of a uofw . dsv determination processor 50 receives the isvs 49 for all images of the suspect document , and a user defined image importance weighting factor ( iiwf ) 51 for each image of the document . as a feature of the invention , but without limitation thereto , dsv 52 for an individual document comprises the summation of the isvs 49 for the document after the isvs 49 have been multiplied by their respective iiwfs 51 . the dsvs 52 for all documents in an identified uofw are applied to usv determination processor 55 . the usvs for a uofw are based upon the dsvs of the individual documents within the uofw , and the distribution of images having dsvs greater than a dsv threshold value across the total uofw sample . as a feature of the preferred embodiment , usv determination processor 55 operates to compute four different usv values for a uofw ; more specifically , an absolute number of suspects usv value 56 , a percent suspect usv value 57 , an average dsv usv value 58 and a suspect distribution usv value 59 . this computation is based upon a comparison of the dsvs 52 for all documents within the uofw to a set of user defined thresholds 63 . without limitation thereto , absolute usv 56 is the absolute number of dsvs 52 that are above the specified dsv threshold 44 , percent suspect usv 57 is the ratio of the number of dsvs 52 that are above the specified dsv threshold 44 to the total number of documents in the uofw 64 , average dsv usv 58 is the average of the dsvs 52 that are above the specified dsv threshold 44 , and suspect distribution usv 59 is a measure of the distribution of documents having a dsv 52 that is above the specified dsv threshold 44 across the total number of documents in the uofw 64 . a pass / fail / conditionally accept recommendation 70 for a uofw is made by pass / fail / conditionally accept determination processor 54 . this pass / fail / conditionally accept recommendation 70 is made by comparing the set of computed uofw suspiciousness values 56 - 59 against user defined , or default threshold values 65 . if one of the computed uofw suspiciousness values 56 - 59 exceeds its threshold 65 , the uofw is failed ( 72 on fig3 ); i . e ., it is not archived . if none of the computed usvs 56 - 59 exceed its threshold 65 , the uofw is either passed ( 71 on fig3 ), i . e . the user accepts the recommendation of iqa and will proceed to archive the images ( 78 on fig3 ) or conditionally accepted ( 73 on fig3 ), i . e . iqa has passed the uofw , however the user desires to review ( 31 on fig3 ) the images involved to potentially override iqa &# 39 ; s recommendation 70 . with reference to fig2 iqr 32 provides detailed and summary information reports , in hard copy form , defining the input to , and the output from , iqa 30 and sir 31 . this information enables both short and long - term trends to be evaluated . iqr 32 provides both a current run report and a historical report . the current run report relates to the input to iqa 30 and contains , for example , a summary and detailed report about the suspect flags that were generated for all suspect documents of a uofw , the total number of documents in the uofw , and the frequency of individual suspect flag occurrence . relative to the output from iqa 30 , the current run report includes the isvs for each suspect image , the dsvs for each document having one or more suspect images , and the usvs for each uofw having a document for which a dsv has been generated . in addition , the current run report contains the pass / fail / conditionally accept recommendation for a uofw , and the results of human suspect image review 31 . the historical report that is generated by iqr 32 provides statistical summaries of the current run reports for a specified period of time . relative to iqa 30 input , the historical report includes the same summary and detailed reporting as exists for the current run reports in addition to the frequency of suspect flag occurrence . relative to the output from iqa 30 , the historical report includes usv , dsv and isv statistics for the period . in addition , the historical reports include items , such as pass / fail / conditionally accept recommendation statistics for the period , a review of the action of suspect image review 31 for the period , uofw disposition statistics for the period , and detailed information relative to each uofw . as mentioned , the present invention provides computationally efficient subsets of image suspect flags and flag combinations , or system states , to thus efficiently provide a machine quantitative measure of the quality or degree of suspiciousness of an underlying digital image . fig6 - 9 illustrate examples of operator defined flags and flag combinations by which the isvs of fbw digital image 17 , fgs digital image 18 , bbw digital image 19 and bgs digital image 20 of fig5 are machine calculated for check number 810000 , this calculation being performed by isv determination processor 45 of fig4 . as used herein , the term flag combination may comprise only one flag , or the combination of a number of flags . each of fig6 - 9 includes a vertical line 21 that separates operator defined single flags from operator defined flag combinations . while 40 single flags , denoting 40 anomalous conditions that can occur during the image capture process for a check are shown in fig6 - 9 , the operator has determined that a majority of these flags are don &# 39 ; t care flags , or that the flags do not pertain to the particular image ; for example , flag 20 of fig6 is a don &# 39 ; t care flag for fbw image 17 . other single flags of fig6 - 9 have been defined as flags whose set state is a measure of image quality . thus , in fig6 for example , single flags 4 , 8 , 10 - 16 , 28 , 31 - 36 and 40 have been defined as critical to image quality for fbw image 17 . as stated previously , some of the flags of fig6 - 9 relate to a single image , some are related to all images of a document , and yet others relate to operation of the scanner . as an example , a flag that relates to a single image might be a flag indication that the bgs byte compressed count was under a limit . each image should compress to a reasonable number of bytes , and a flag is set if it does not . a flag that relates to all images might , for example , be a flag indicating that an image portion was removed due to channel error . this suspect event might occur on documents having very cluttered backgrounds . when the number of bytes in an image record is above a specified limit , a portion of the image record is deleted to allow successful image transfer to a host computer . since data is removed from part of the image record , parts of the image may be unusable . a flag that relates to scanner operation might , for example , be a flag indicating a front scanner parity error . image data is tagged with parity information at the scanner , and is tested for data integrity by the image capture process . images with parity errors may not be usable , and flags are set for these documents . in addition , certain flag combinations have been defined as flag combinations whose set state is a measure of image quality . thus , in fig8 for example , eight flag combinations identified as a - h have been defined as critical flag combinations for bbw image 19 . for example , flag combination a requires that flags 5 and 17 both be set in order for flag combination a to be set , and flag combination h requires that all four flags 9 , 11 , 19 and 36 be set in order for flag combination h to be set . note that in the case of flag combination h , flags 9 and 11 are individually don &# 39 ; t care flags . the above - mentioned flags and flag combinations comprise input 47 to isv determination processor 45 of fig4 . the present invention provides that a human operator specify which flags and flag combinations of fig6 - 9 shall be used when making a machine determination or computer computation of isv . the machine interrogates the state of these specified flags and flag combinations to form a quantitative measure of quality and the degree of suspiciousness of the image ; i . e ., the machine forms a number comprising the isv of the image . while this example of a machine based imaging system provides 40 image quality flags that can be set during operation of the imaging system and as a check is scanned , a second smaller plurality of flags and flag combinations ; i . e ., the operator defined flags and flag combinations of fig6 - 9 for which an fcwf has been provided , are used to compute an isv for the digital image as a function of the presence or the set state of one or more of these flags and flag combinations . the invention provides that the machine based determination of isv include fcwfs for the flags and flag combinations that have been operator defined . this is illustrated in fig6 - 9 by way of the boxes that are arranged vertically above each of the operator defined flags and flag combinations . for example , in fig9 the fcwf value of 0 . 2 has been assigned to both of flags 35 and 36 , and the fcwf value of 0 . 9 has been assigned to flag combination d . thus , relatively speaking , flag combination d has been determined by the operator to be more critical to image quality for bgs image 20 than either flag 35 or flag 36 . in this way , a fcwf is assigned to each of the operator defined critical flags and flag combinations . the above - mentioned fcwfs comprise input 48 to isv determination processor 45 of fig4 . the resulting isv 49 that is calculated by isv determination processor 45 is based upon a comparison of the set suspect flags and flag combinations to their fcwf . without limitation thereto , the isv for each of the four digital images of fig5 will be defined as equal to the fcwf of that image &# 39 ; s set flag or flag combination having the highest fcwf , and processor 45 is constructed and arranged to use this definition in performing its calculation of the isv of each of the four images 17 - 20 of fig5 . in fig6 - 9 , the flags and flag combinations that have been set are identified by the associated box being filled in . thus , as indicated in fig6 the boxes 22 and 23 , associated with flag 11 and flag combination b , have been filled in , indicating that flag 11 and flag combination b have been set for fbw digital image 17 of fig5 . as a result , the isv of fbw 17 , fig6 is equal to its highest set fcwf ; namely , an isv of 0 . 5 , this being equal to the fcwf of 0 . 5 that was assigned to flag combination b , as shown by box 23 . in like fashion , the isv of fgs image 18 of fig5 is found to be established by set flag combination e of fig7 and is equal to 0 . 5 , the isv of bbw image 19 of fig5 is found to be established by set flag combination e of fig7 and is equal to 0 . 5 , and the isv of bgs image 20 of fig5 is found to be established by set flag combination e of fig7 and is equal to 0 . 5 . these four isvs are presented as an input 49 to dsv determination processor 50 in fig4 . a second input to processor 50 is the iiwf 51 for each of these four digital images . as will be remembered , these iiwf values are specified by the operator as a portion of the user parameters 42 shown in fig3 . for purpose of explanation , and without limitation thereto , it will be assumed that the three images 17 - 19 of fig5 are of equal importance to document quality and that the iiwf of these three images is set to the value 1 . 0 by the operator or user . relative to bgs image 20 , it will be assumed that this image is of no importance to document quality and that the iiwf of image 20 is , accordingly , set to be equal to 0 . 0 . fig1 illustrates the operation of dsv determination processor 50 of fig4 . processor 50 receives three inputs ; namely , iiwf inputs 51 for each of the four digital images 17 - 20 , a dsv threshold value 44 that is used to determine the acceptability of the document that corresponds to the four digital images 17 - 20 , and the isv inputs 49 that were calculated by processor 45 for each of the four images 17 - 20 . as shown in fig1 , the dsv of document 810000 is computed as the summation of the iiwf of each individual one of the digital images 17 - 20 multiplied by that image &# 39 ; s isv . in this illustrative case , the dsv equals the value 1 . 5 . in fig1 , the value 1 . 5 is plotted and compared to a dsv threshold of 0 . 3 . based upon this comparison , document 810000 is found to be of unacceptable quality ; i . e ., the quality of camera image 15 and / or digital images 17 - 19 are suspect , it being remembered that digital image 20 is a don &# 39 ; t care image in this example . since document 810000 has been machine classified as a suspect document of unacceptable quality , it will be included in the usv calculations . depending on how strict or lenient the user defined usv thresholds 63 have been set , the iqa recommendation 70 of fig3 for the uofw containing document 810000 may still be pass , fail or conditionally accept . in the latter two cases , suspect review 31 will be invoked to convert digital images 17 - 20 to visual images for operator review 31 . the result of human suspect review 31 can be accept 74 or to reject 75 . should the operator determine that the images of the suspect documents are , in fact , acceptable , then the operator would likely adjust user parameters 42 in order to teach processors 45 and 50 of fig4 to more accurately calculate the dsv illustrated in fig1 . a uofw comprises a large number of documents , such as above - mentioned document 810000 which was found to be suspect in fig1 . as shown in fig4 the dsv 52 for each document within the uofw is provided as one input to usv determination processor 55 . other inputs to processor 55 are the total number of documents in the uofw 64 , and user defined usv thresholds 63 . from these three inputs , processor 55 operates to calculate an absolute usv 56 , a percent suspect usv 57 , an average dsv usv 58 , and a suspect distribution usv 59 . fig1 illustrates the manner in which usv determination processor 55 of fig4 calculates the absolute usv for a uofw , and provides this determination to its output 56 . in this illustration , the uofw is arbitrarily identified as uofw number 0074 . the user has defined that the absolute threshold 60 for determining the absolute usv for uofw 0074 shall be the value 200 , ( i . e ., so long as uofw 0074 contains no more than 200 documents whose individual dsvs exceed the threshold value 0 . 3 shown in fig1 , uofw 0074 will be found to be acceptable for archive ). in this illustration , the actual number of documents that exceeded the 0 . 3 threshold 61 is slightly less than 50 . thus , uofw 0074 passes the absolute usv quality test . fig1 illustrates the manner in which usv determination processor 55 of fig4 calculates the percent suspect usv for uofw 0074 , and provides this determination to its output 57 . here the user has defined that the percent suspect threshold 62 for determining the percent suspect usv shall be the value 0 . 50 ( i . e ., so long as uofw 0074 contains no more than 0 . 50 percent documents whose individual dsvs exceed the dsv threshold value 0 . 3 shown in fig1 , uofw 0074 will be found to be acceptable for archive ). in this illustration , the actual percentage of documents that exceeded the 0 . 3 dsv threshold 66 is 0 . 11 , meaning that the percent of good documents in uofw 0074 is 99 . 89 percent . thus , uofw 0074 passes the percent suspect usv quality test . fig1 illustrates the manner in which usv determination processor 55 of fig4 calculates the average dsv usv for uofw 0074 and provides this determination to its output 58 . here the user has defined that the average dsv usv threshold 67 for determining the average dsv usv shall be the value 0 . 7 ( i . e ., so long as the average dsv of all documents of uofw 0074 that exceeded the dsv threshold of 0 . 3 is less than 0 . 7 , uofw 0074 will be found to be acceptable for archive ). in this illustration , the actual average dsv for the documents of uofw 0074 that exceeded the 0 . 3 dsv threshold 68 equalled about 1 . 7 . thus , uofw 0074 failed to pass the average dsv usv quality test . fig1 illustrates the manner in which usv determination processor 55 of fig4 calculates the suspect distribution usv for uofw number 0074 , and provides this determination to its output 59 . here the user has defined that the suspect distribution threshold 69 for determining the suspect distribution usv shall be the value 3 ( i . e ., so long as no more than 3 documents in a moving window comprising a user defined number of documents ( for example 100 documents ) within uofw 0074 exceed the dsv threshold of 0 . 3 , uofw 0074 will be found to be acceptable for archive ). in this illustration , the moving window found the suspect distribution threshold 69 to be exceeded twice within uofw 0074 ; namely , at 80 and at 81 . thus , uofw 0074 failed to pass the suspect distribution usv quality test . in view of the failure of uofw 0074 to pass the average dsv usv quality test , illustrated in fig1 , and the suspect distribution usv quality test illustrated in fig1 , the pass / fail / conditionally accept determination processor 54 of fig4 operates to provide a fail decision at its output 53 relative to uofw 0074 . from the above - detailed description it can be seen that the present invention provides a predefined set of image quality flags and flag combinations as shown , for example , in fig6 - 9 . these set flags from this group of flags and flag combinations is then analyzed , as shown in fig4 to provide isvs . as shown in fig1 , the apparatus of fig4 uses these isvs to compute a dsv for each document of a uofw . finally , the apparatus of fig4 uses these dsvs to calculate four unique usvs , as shown in fig1 - 14 . while the invention has been described while making reference to preferred embodiments thereof , it is recognized that those skilled in the art will readily visualize yet other embodiments that are within the spirit and scope of the invention . thus it is intended that the above detailed description not be taken as a limitation on the invention .	7
fig1 is an exploded perspective view of an exemplary embodiment of an apparatus according to the invention , comprising an insert body 1 made of a hard - elastic synthetic material . said insert body 1 has an approximately cuboid base portion 2 , on which connection nozzles 3 , 4 are formed respectively on mutually opposite wall sides . each connection nozzle 3 , 4 serves to establish a connection to a fluid line of a fluid line system ( not shown in fig1 ). also formed on base portion 2 is a valve locking projection 5 that protrudes beyond one end of base portion 2 and is disposed at the back in the view of fig1 , and in which a non - return valve assembly ( not shown in fig1 ) can be inserted and which can be fastened in the latching recesses 6 formed in valve locking projection 5 . arranged on base portion 2 at the opposite end from valve locking projection 5 , on mutually opposite wall sides , are latching tongues 7 , 8 , which point toward valve locking projection 5 and are adapted to fix insert body 1 in a support part not shown in fig1 . insert body 1 is also configured with a dome - like bearing head 9 , which is joined to insert body 1 at the opposite end from valve locking projection 5 . bearing head 9 has a receiving space 10 that is closed to the outside except for a circular window opening 11 , which faces the viewer in the representation of fig1 . disposed in said receiving space 10 in spaced relation to window opening 11 are a number of resistance projections 12 , which are arranged evenly over the circumferential direction on a side wall 13 bounding the receiving space 10 , and which extend , as elongate bodies , in a longitudinal direction from window opening 11 to a back wall 14 of bearing head 9 that is disposed opposite window opening 11 . the exemplary embodiment of the inventive apparatus that is depicted in fig1 also comprises a spherical body 15 , which is configured on its outer face with a spherical - segment - like jacket surface 16 extending symmetrically on both sides of a great circle . spherical body 15 also has a planar front face 17 and a back face 18 that is disposed opposite said front face 17 , which is toward the viewer in the representation of fig1 . formed in spherical body 15 is a cuboid nozzle receiving space 19 that debouches over its full cross section into front face 17 . finally , depicted in fig1 , as a further element of the inventive apparatus , is a cuboid nozzle body 20 whose dimensions correspond to the dimensions of nozzle receiving space 19 , such that said nozzle body 20 can be inserted so far into nozzle receiving space 19 that a discharge slit 21 formed on nozzle body 20 is in the region of front face 17 , and nozzle receiving space 19 is filled up completely by nozzle body 20 . fig2 is a perspective view of the nozzle body 20 of the exemplary embodiment according to fig1 . as can be seen from fig2 , nozzle body 20 is configured with a closed top 22 that extends over the entire base area of nozzle body 20 . it can be seen from fig2 that nozzle body 20 comprises an antechamber 23 which is disposed opposite discharge slit 21 and which , in this exemplary embodiment , is configured with an inlet opening 24 that is disposed opposite the discharge slit 21 in the longitudinal direction of nozzle body 20 and extends over about one - quarter of the transverse side of nozzle body 20 symmetrically to the central longitudinal axis . antechamber 23 tapers continuously from inlet opening 24 in the direction of an outlet opening 25 that is disposed opposite inlet opening 24 and establishes fluidic communication between antechamber 23 and a subdivided jet - forming chamber 26 disposed between antechamber 23 and discharge slit 21 . jet - forming chamber 26 is configured with a central channel 27 extending symmetrically to the central longitudinal axis from outlet opening 25 toward discharge slit 21 , and comprises lateral arms 28 , 29 , which are disposed one on each side of said central channel 27 and which extend , separated from central channel 27 by separation blocks 30 , 31 , arcuately from outlet opening 25 toward discharge slit 21 , and debouch into central channel 27 again in the region of discharge slit 21 , each lateral arm 28 , 29 having respective outwardly directed convexities in the region where it debouches into central channel 27 . central channel 27 itself widens from outlet opening 25 toward discharge slit 21 . by virtue of this configuration of jet - forming chamber 26 , when jet - forming chamber 26 is impinged upon by a liquid fluid in a known manner , a fan jet oscillating with a given frequency can be generated by pressure - pulse feedback from the side of central channel 27 closest to discharge slit 21 , via lateral arms 28 , 29 to the region of central channel 27 near the outlet opening 25 , and exits the discharge slit 21 of nozzle body 20 . in this exemplary embodiment , the dimension of antechamber 23 in the longitudinal direction of nozzle body 20 is smaller than the dimension of jet - forming chamber 26 in the longitudinal direction . fig3 is a longitudinal section of the insert body 1 , the spherical body 15 and the nozzle body 20 according to the exemplary embodiment of an apparatus according to the invention described in connection with fig1 and 2 , shown fitted together , in the region of bearing head 9 . it can be seen from fig3 that receiving space 10 is provided on its side facing window opening 11 with a circumferential annular shoulder 32 , against which the jacket surface 16 of spherical body 15 rests in a region forward of the center of spherical body 15 . side wall 13 is set back radially outward on the side of annular shoulder 32 that faces back wall 14 , such that a free space 33 is formed between side wall 13 and jacket surface 16 . it will also be noted , in the representation of fig3 , that resistance projections 12 extending as elongate bodies from the back face 18 of spherical body 15 to the back wall 14 of bearing head 9 rest against the jacket surface 16 of spherical body 15 on the side facing away from window opening 11 , causing spherical body 15 to be rotatably and pivotably held in bearing head 9 . it will also be appreciated from fig3 that insert body 1 is configured with a heater receiving space 34 , which extends through base portion 2 and terminates at side wall 13 , which latter bounds receiving space 10 and is configured in this region with a relatively small material thickness . a heating element ( not shown in fig3 ) can be placed in heater receiving space 34 in order to heat said receiving space 10 and particularly a liquid fluid , for example wash water , that is present in receiving space 10 , to prevent freezing . configured adjacent to heater receiving space 34 is a fluid inlet space 35 , which is adjacent to back wall 14 and extends from the valve locking projection 5 depicted in fig1 into base portion 2 , and which communicates , via a communication opening 36 formed in a narrowed debouchment region , with a flow expansion chamber 37 that is formed between the back wall 14 of bearing head 9 and the back face 18 of spherical body 15 . in this arrangement , nozzle body 20 is offset by an angle of more than 45 degrees from the longitudinal direction of fluid inlet space 35 , thus , in combination with an offset of inlet opening 24 transversely to communication opening 36 , effecting a diversion of the fluid that further brings about further homogenization of the flow . the resistance projections 12 are disposed in flow expansion chamber 37 , as the fluidically active region of receiving space 10 , and swirl the fluid flowing in from fluid inlet space 35 , thereby inducing a certain homogenization of the flow in the flow expansion chamber 37 , before the fluid passes through the inlet opening 24 of nozzle body 20 and on into the antechamber 23 thereof . this homogenization of the flow of fluid as far upstream as in the flow expansion chamber 37 serves to create the stable fluidic parameters at outlet opening 25 that are needed for reliably generating an oscillating fan jet in jet - forming chamber 26 , while at the same time permitting relatively short construction for the bearing head 9 in the longitudinal direction of nozzle body 20 , since the antechamber 23 is relatively short . in addition , exerting a fluidic influence on the flow in the region of resistance projections 12 ensures the efficient transfer of thermal energy from heater receiving space 24 into receiving space 10 , and ultimately into the fluid that is to be kept from freezing . while this invention has been described as having a preferred design , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims .	1
referring to fig1 , a diagram of one embodiment of a physical state assessment and training program adjustment system 5 in accordance with the present invention is shown . system 5 preferably operates in concert with the mobile device platform or environment , to afford the convenience and mobility of that platform . in addition , mobile device communication permits real - time assessment of the workload performed by the user . the user - interface that operates on the mobile device to carry out the present invention may evolve as mobile communication evolves without departing from the present invention . system 5 may include a sensor and transmitter unit ( satu ) 10 , user - interface logic 20 that executes on mobile device ( md ) 20 and processing logic ( pl ) 50 that may execute on a cloud - based computer ( or other processor ) 51 . the interface logic may be invoked as an application executing on the mobile device , termed , for example , adaptive training application . depending on the magnitude of the processing load and the power of the mobile device , processing may take place on the cloud and / or the mobile . it is anticipated that initially more robust processing will occur on the cloud computer , yet as mobile device technology improves , some or all of the assessment processing may move to the mobile device , particularly for less robust assessment / adjustments . for pedagogical purposes , the system of fig1 will be described with the assessment and program adjustment logic operating primarily on the cloud computer 51 though it is to be understood that this processing may move to the mobile device to the extent the mobile device can support it , or another computing device . as illustrated diagrammatically in fig1 , components of logic 50 may include : ( 1 ) a database or library or the like 60 for generation of initial training programs ; ( 2 ) sorting and processing procedures 70 to assess functional state and performed workload , and to make adjustments to the training program ( tp ); and ( 3 ) various look up tables or the like 80 used in carrying out the functions of the aal . these are discussed in more detail below . the satu 10 may take many forms without departing from the present invention . in one embodiment , the unit includes a plurality of sensor electrodes 12 that are capable of measuring bio - signals such as cardiac , brain wave and / or electrical muscle signals . such sensors are known in the art . these sensors are connected to a transmitter or transceiver 15 that is capable of transmitting the sensed signals to the md 20 . the satu to md connection it is preferably wireless , though it may be wired . a suitable wireless satu is taught by in co - pending u . s . patent application ser . no . ______ , referenced above , with sensors 41 - 46 and transmitter pod 50 . note , alternatively , that the satu may be wired and the wiring may connect directly to a port on the mobile device , with appropriate channel amplifiers , filters , converters built into the wired connection and / or the md . in this latter instance , the pod 50 of the co - pending application may not be needed . furthermore , wireless sensors ( ie , sensors with built in transmitters ) may be used and may communicate directly to md 20 . md 20 is any suitable md , and may take the form of a mobile phone , tablet computer , blackberry ®, or other mobile electronic communications device . md 20 and / or satu 10 may include gps ( standard on most cell phones ), accelerometers , gyroscope , altimeter and / or other sensing or positioning technology , e . g ., thermometer , wind - direction / speed detector , humidity meter , etc ., for real time data collection . these positioning , environmental and other parameter measuring sensors may be represented generally with reference numeral 14 . the satu 10 may also include an adjustable belt 13 that can be worn around a user &# 39 ; s chest or elsewhere , and the transceiver / transmitter 15 that can be attached to the belt ( or otherwise supported by the user ). the gps , accelerometer , gyroscope , altimeter , thermometer and / or other sensing / positioning technology 14 may be provided in or with ( i . e ., connected to ) the transmitter 15 ( if not otherwise provided on the user or in the mobile device , etc .). placement of these sensors on the user ( for example , with transmitter 15 ) gives an accurate measure of a user &# 39 ; s movement for workload calculation . the adaptive system of the present invention functions , in one embodiment , by establishing a training program ( tp ), assessing the current functional state of a user , assessing the workload performed by a user , and appropriately modifying the training program based on the assessed functional state and / or the workload measurements to provide a more optimum and effective overall training experience . referring to fig2 , a block diagram illustrating one embodiment of initial training program generation is shown . a user is prompted for his or her training parameters ( 211 ). if the user indicates maintenance rather than a event , a similar list of questions is generated to determine the desired training program parameters . these questions might include historic run training , current physical state self - assessment , maintenance performance goals , etc . for purposes of illustration , the assumed answers to the above questions above are : event , marathon , 6 months , and 3h20 pace , respectively . other information such as age , gender , height / weight , injury information , physical state self - assessment ( e . g ., state - stated fitness level ), medical conditions , etc ., may be elicited from a user ( step 213 ). in step 215 , an initial functional state assessment ( fsa ) is conducted to determine an initial or baseline physical state of the user . this information is used to create the initial tp ( as discussed below ). the fsa may be conducted at rest and does not require the user to perform an initial load , e . g ., run five miles . the present invention is unique in being able to assess functional state ( readiness for exercise ) without an initial load performance , and using the assessment result to more accurately craft an initial tp . various body system tests may be investigated during an fsa including cardiac , metabolic , central nervous system ( cns ), hormonal , and electromyography ( emg ), among others . these body system tests provide a picture of the current functional state of the user ( and readiness for work ) without historical knowledge of a person &# 39 ; s physical training regime or subjecting the user to a test - load . for example , the metabolic assessment ( preferably derived from a differentiated ecg type signal ) may give an indication of anaerobic threshold , important for use in generating an initial target heart rate . heart rate and / or heart rate variability ( among other body system assessments ) may be used to determine sympathetic and parasympathetic nervous system states , which are important in generating initial distance and intensity targets , etc ., as discussed in more detail below . the metabolic assessment of the fsa is used to determine at which in turn is used to generate an initial target heart rate ( to maximize aerobic performance ). metabolic assessment is taught in u . s . pat . no . 6 , 572 , 558 referenced above and publications of kiev sports medicine university by beregovog , v . y ., or dushanin , s . a . ( 1986 ). anaerobic exercise is exercise intense enough to trigger lactic acid fermentation . it is used by athletes in non - endurance sports to promote strength , speed and power and by body builders to build muscle mass . muscle energy systems trained using anaerobic exercise develop differently compared to aerobic exercise , leading to greater performance in short duration , high intensity activities , which last from mere seconds to up to about 2 minutes . any activity lasting longer than about two minutes has a large aerobic metabolic component . the anaerobic threshold , also known as the lactate threshold , is the exercise intensity at which lactate ( more specifically , lactic acid ) starts to accumulate in the blood stream . this happens when lactate is produced faster than it can be metabolized in the muscle . when exercising at or below the at , any lactate produced by the muscles is removed by the body without it building up . with a higher exercise intensity the lactate level in the blood reaches the at , or the onset of blood lactate accumulation . the at is a useful measure for deciding exercise intensity for training and racing , particularly in endurance sports ( e . g . long distance running , cycling , rowing , swimming and cross country skiing ), but varies between individuals and can be increased with training . the fsa of step 215 returns data used in a differentiated ecg assessment to identify and / or closely approximate the at of a user , and the target heart rate , bpm , that corresponds with that at . the event information 211 , any relevant supplemental data 213 , and fsa data 215 is preferably propagated to pl 50 . step 217 represents receipt of these data packets at pl 50 . marathon training requires a certain number of miles per week , and a ramp up and ramp down in that number . a considerable amount of known research has been conducted to establish generic or boilerplate training programs . these may be found in the literature . a typical training program is 6 months . the program is often divided into weeks , and daily targets established within those weeks . for example , within a week , days of short runs , long runs and rest may be established . target pace is often selected by the user , in conventional training programs , from past performance or selected as a goal . while prior art training programs tend to rely on selection of a target pace by the user ( or coach ), the present invention preferably specifies a target heart rate determined by reference to at and expressed in beats for minute ( bpm ). pl 50 may default to a conventional training program ( pre - fsa ) for initial distance numbers ( in generating a prospective tp ). the fsa results then preferably considered to provide the initial intensity . the pl 50 may further modify the prospective tp based on other fsa data to arrive at an initial tp that is customized to the user ( step 219 ). this will give miles per week , and workouts per day , and preferably be expresssed in distance and heart rate targets , rather than distance and pace proscriptions . step 221 represents propagation of the initial tp to a user . the initial tp may be viewed on md 20 by day , week , month , all or other ( step 223 ), though what is particularly relevant is the target for the current day as future targets will likely change based on future fsa results and workload measurements ( wlms ). display of tentative future training targets may be helpful to a user in the general scheduling of their day - to - day affairs . interface logic 20 may be configured with the md software so that the training program is integrated into the calendar and alarm functions of the user &# 39 ; s mobile device , so that a user may schedule their workout time in advance and be alerted by their md . food intake needs that support the proscribed physical activity may also be sent to md 20 for display and integration into the md &# 39 ; s scheduling system , to assist a user in timely and appropriate food selections . referring to fig3 , a flow diagram illustrating daily ( or other period ) use of training system 5 is shown . this could be for day 21 , 57 , 132 or any other given day , though if for day 1 , there would be no workload history . the user preferably logs in , step 311 . processing logic 50 loads the user &# 39 ; s settings including the prospective day target for that day , step 313 . the user is prompted for conducting a pre - load fsa , step 315 . this prompting may include prompts for correct sensor placement and then sequentially stepping the user through the appropriate fsa test steps . in step 317 , the results data is sent to pl 50 . in step 319 , pl 50 retrieves or uploads the most recent wlms ( performance history of the user ). the fsa results and the wlms of steps 317 and 319 , respectively , are used to modify the prospective day target . the criteria for and manner of making dt adjustments are discussed in more detail further below . in step 325 , the prospective tp is modified , if necessary , based on the fsa results . in step 327 , the fsa - adjusted prospective tp is modified , in necessary , based on wlms . in step 331 , the target training program for the current day ( i . e ., a day target ) is present to the user . in step 333 , the “ work ” begins . this start may be initiated by a user pushing start on the user - interface or the sensors sensing movement of the user and initiating tracking , etc . the workload parameters are preferably tracked in real - time , step 337 . during the proscribed run , the user may be alerted if they vary from a proscribed bpm , pace , smoothness or other parameter . at completion of the work , the user may press an end button , or the sensors may end based on detected stopping ( for longer than a traffic light , etc . ), step 339 . the user may be prompted for confirmation . workload measurement calculations are preferably performed , step 343 , and the wlms uploaded to pl 50 , step 345 , so they are available during step 319 above as the preceding day &# 39 ; s wlm . referring to fig4 , a spectrum 411 of potential training targets for a given training session is represented . often there will be one training session per day , yet depending on the training program there may be multiple sessions in a day . thus the training targets may be referred to as session targets or sts . while only one st is likely shown to a user , pl 50 may be configured to create session targets along a spectrum of different intensity and volume specifications . in the example of fig4 , st 423 is a “ prospective ” and pre - fsa st . the actual st presented to the user , however , may shift to the left or to the right along the spectrum . note that intensity and volume parameters may differ based on the type of athletic event . for distance running , the intensity parameter is preferably heart rate or bpm and the volume parameter is preferably distance . in other athletic pursuits , intensity might include number of repetitions or repetitions in a certain time period , and volume might include weight lifted or height climbed , etc . in step 325 of fig3 , pl 50 investigates the results of the fsa of step 315 . if all the relevant body systems are in sufficiently good condition , then target 323 is presented to the user . if , however , the results of the fsa suggest that one or more body systems are not optimal then another st is presented . the “ other ” st may have a reduced workload requirement and the type and magnitude of the reduction will depend on the fsa results . in target 322 , the “ intensity ” or bpm is maintained , yet the miles are reduced . in target 321 , the miles are reduced even further , while intensity is unchanged . in target 324 , conversely , the distance is maintained , but the intensity is reduced ( slower run ) and in st 325 , the intensity is reduced even further . st 326 indicates a reduction in both distance and intensity , i . e ., the user has a rather reduced state of readiness . st 327 indicates rest or restorative therapies , i . e ., the user is rather depleted . the intensity and distance proscriptions are influenced by the sympathetic and parasympathetic nervous systems , and other body systems . the sympathetic and parasympathetic nervous systems ( sns , psns ) are the two main divisions of the autonomic nervous system ( ans ). the ans is responsible for regulation of internal organs and glands , which occurs unconsciously . to be specific , the sympathetic nervous system is responsible for stimulation of activities associated with the fight - or - flight response . the parasympathetic system is responsible for stimulation of “ rest - and - digest ” activities that occur when the body is at rest , especially after eating , including sexual arousal , salivation , lacrimation ( tears ), urination , and digestion . sympathetic and parasympathetic divisions typically function in opposition to each other , though in a complementary rather than antagonistic manner . the sympathetic division typically functions in actions requiring quick responses . the parasympathetic division functions with actions that do not require immediate response . it is known in the art that heart rate variability evaluation may be used to assess the state of the sns and psns . good sns levels indicate a person &# 39 ; s ability to run a long distance , but do not well address intensity . good psns levels indicate a person &# 39 ; s ability to perform at higher intensity , but do not well address endurance and the ability to run long . hence , when psns levels are high , but sns levels are low , the st shifts to the left and st 322 or 321 is selected , based on the relative magnitude of psns and sns levels . if the converse is found , the selected st shifts to the right to the appropriate one of st 324 and 325 ( assuming other body system results are satisfactory ). if both sns and psns are not within a sufficiently adequate range or another body system is low in combination with a low sns or psns , then st 326 may be selected . there may be a reduction to 8 miles at 120 bpm or 6 miles at 110 bpm , or other values or combinations , depending on the gravity of the fsa values . further , a very strong negative fsa value in one body system parameter or an accumulation of lower fsa values ( across multiple body systems ) may indicate the need for rest — a day off — or , if lower yet , restorative activities such as massage , acupuncture , etc . in addition to metabolic ( decg , at , bpm ) and cardiac ( hrv , sns / psns , intensity / distance ), other body systems measurements may influence session target selection / creation . these include : dc potential , hormonal , detoxification , gas exchange / pulmonary and emg , among others . the first four of these may be achieved using an omega brain wave test as described in the &# 39 ; 558 patent , and the emg test may be achieved using an emg test as described in the co - pending application . in essence , each of these tests has a normal range of results and the range can vary from person to person . the results for all of these tests are characterized in having an excitation component and an inhibition component . thus , each test result may have an excitement result of : too excited , norm or not excited enough and an inhibition result of : too inhibited , norm , not inhibited enough . the adjustment to the training program will be to bring the user back towards a “ norm ” for each body system . for example , if the cns test ( omega wave - dc potential ) returns a low level , then this infers that the cns is inhibited . high mental work or power exercise is not recommended . if the hormonal system is below a norm , then maximum velocity is not recommended . if the hr test returns a state of over excitement , then a reduced vigor workout is proscribed , to bring the excitement level back towards the norm . for each body system assessment and correction , the path is rather linear — over / under and amount . the aggregate of the corrections / adjustments may be non - linear , however , due to the multiple body system factors influencing the adjustments . referring to fig5 , a flow diagram of computer workload measurement calculation and its influence on st generation is shown . step 327 of fig3 represents adjustment of the tp based on wlm . for running , a desired goal is to increase speed and / or distance at speed . thus , while the fsa tracks the functional state of the body at a given moment , it does not detect performance . the detection of performance provides feedback on whether the proscribed tp is actually working and providing the desired results . a primary measure of workload is distance and speed . assuming the same or approximately same training conditions ( elevation , wind speed , etc . ), then , week by week , for example , improvements in performance should be detected . if the performance is not improving ( speed decreasing , targets not being met or increasingly missed , etc . ), then the body is likely being driven too hard . to address this , the spectrum of day targets is preferably shifted down , which may be achieved primarily through reducing intensity , bpm . mileage may be dropped though preferably merely to let the body recover and is then increased so that requisite mileage is achieved . furthermore , the wlm may be fine tuned by accounting for other factors such as elevation , windspeed , traffic light stoppage and other factors . an appropriate mathematical value can be assigned to one or more of these factors ( and relative magnitude accounted for ) and incorporated into the workload measurement calculation . thus , a first part of fig5 represents determination of wlm ( that generated in step 343 of fig3 ). the distance ( gps ) and time ( clock ) of the run is measured and a speed calculated , step 411 , 413 , 415 . in step 417 , the speed value may be adjusted for any of the condition factorials , etc . the lower part of fig5 illustrates comparison of the wlm , which may occur on a daily ( or other ) basis , yet for a period extending back one to several weeks ( or more ), step 421 . if the performance is improving , no change in made to the tp , step 423 . if , however , performance is not improving then the session targets are adjusted , preferably as discussed above ( shifted down ), step 425 . it should be recognized that in addition to proscribing miles , intensity and other physical acts , the pl 50 , through its database and processing ability , may also provide a user with nutritional information proscriptions to support the physical activity in the sdts . this nutritional information may include the type of food to eat ( protein , vitamin - rich , carbohydrate - rich , etc . ), serving size , caloric intake , and other information , on a day - to - day ( or other period ) basis . the above example is for marathon training . it should be further recognized that the present invention applies to other activities including longer and shorter distance running , sprinting , swimming , cross - country skiing , and cycling activities , etc . while well - suited for aerobic activities , it may also be used for anaerobic conditioning , i . e ., providing repetitions and weight / resistance , and weight - lifting , etc . while the invention has been described in connection with specific embodiments thereof , it will be understood that it is capable of further modification , and this application is intended to cover any variations , uses , or adaptations of the invention following , in general , the principles of the invention and including such departures from the present disclosure as come within known or customary practice in the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth , and as fall within the scope of the invention and the limits of the appended claims .	0
one preferred embodiment of a remote convenience vehicle system 10 in accordance with the present invention is schematically shown in fig1 along with an associated vehicle 12 . the system 10 described herein includes one or more remote transmitter units 14 that communicate , via an electromagnetic command signal 16 , with a vehicle - mounted receiver / controller unit 18 to achieve remote control of at least one vehicle system . hereinafter , the receiver / controller unit is referred to simply as the receiver unit . preferably , each transmitter unit 14 can transmit any of a plurality of command signals 16 to the receiver unit 18 . each command signal 16 is a broadcast signal and conveys a security code and a message that requests performance of a certain vehicle function . upon receipt of an authorized command signal 16 by the receiver unit 18 , the receiver unit provides the function - request message to an appropriate vehicle system control means . an example of a vehicle system that has remotely controllable functions is a power door lock system that locks and unlocks one or more vehicle doors . another example of a vehicle system that has remotely controllable functions is a trunk release system that releases a trunk latch mechanism . yet another example of a remotely controllable vehicle function is what is referred to as a vehicle - find function . specifically , the vehicle &# 39 ; s horn and / or lights are actuated to identify the location of the vehicle for the transmitter unit operator ( e . g ., the vehicle owner ), who is located at a distance from the vehicle . it will be appreciated that other embodiments of the present invention may have other remotely controlled functions ( e . g ., garage door opening , entry light activation ). focusing now on the one or more transmitter units 14 , all of the transmitter units for a specific system are structurally similar . thus , only one transmitter unit 14 is described herein for the example system 10 . the transmitter unit 14 is a portable , hand - held unit . the transmitter unit 14 includes at least one manually operable pushbutton switch 20 . in the example shown in fig1 there are two pushbutton switches 20a , 20b . each pushbutton switch 20 is connected to a signal source circuitry 22 . each actuation , or predefined series of actuations , of one of the pushbutton switches 20 corresponds to a predefined remote function request . in response to the pushbutton actuation , the signal source circuitry 22 provides an appropriate electrical signal 24 to an antenna 26 of the transmitter unit 14 . the antenna 26 , in turn , emits the signal 16 . the signal 16 is a serially transmitted , digital signal that is broadcast . the signal 16 has a carrier frequency that is also referred to as the operating frequency of the transmitter unit 14 . preferably , the carrier frequency is in the ultrahigh frequency ( uhf ) frequency range of the radio frequency ( rf ) spectrum . in one preferred embodiment , the carrier frequency is 315 mhz . also , preferably , the signal 16 is pulse - width modulated to represent the binary 1 and the binary 0 . at this point it is stated that the remote transmitter unit 14 is designed to have a relatively low transmission power level . for example , in the united states , the remote transmitter unit 14 is operating at or below the power threshold for unlicensed transmission devices , as designated by the united states federal communications commission ( fcc ). further , it is noted as being desirable for the receiver unit 18 to receive the transmitted signal 16 for the scenario in which the transmitter unit 14 and the receiver unit 18 are spaced apart a relatively great distance . focusing now on the receiver unit 18 , an antenna 28 of the receiver unit receives the transmitted signal 16 . the antenna 28 outputs an electrical signal 30 to superheterodyne circuitry 32 . the signal 30 has the same characteristics as the signal 16 , in that the signal 30 has the same uhf frequency as the signal 16 and is pulse width modulated to convey the information contained within the signal 16 . the superheterodyne circuitry 32 &# 34 ; converts &# 34 ; the uhf frequency associated with the transmitted signal 16 to an intermediate frequency ( if ). an output signal 34 from the superheterodyne circuitry 32 is at the if frequency and conveys the information of the signal 16 ( i . e ., the security code and message ). in order for the receiver unit 18 to complete processing of the received signal 16 , the output signal 34 from the superheterodyne circuitry 32 must be at or very near a specific if frequency . the if frequency is related to a specific uhf frequency . the specific uhf frequency is referred to as the operating uhf frequency of the receiver unit 18 . the operating uhf frequency of the receiver unit 18 must be substantially identical to the frequency of the signal 16 . in other words , the operating uhf frequencies of the transmitter and receiver units 14 , 18 must substantially match . in order to accomplish a matching of the two operating frequencies , the output signal 34 from the superheterodyne circuitry 32 is provided to automatic tuner circuitry 36 . the automatic tuner circuitry 36 functions to automatically make an adjustment within the receiver unit 18 , in accordance with the present invention . the operating frequency of the receiver unit is matched to that of the transmitted signal 16 ( i . e ., the tuner circuitry 36 automatically adjusts the operating frequency of the receiver unit 18 to &# 34 ; accept &# 34 ; the signal 16 at the frequency at which it was transmitted ). the automatic tuner circuitry 36 operates such that the receiver unit 18 can discern the transmitted signal 16 from the remote transmitter unit 14 with a high level of sensitivity . specifically , the automatic tuner circuitry 36 functions to focus the receiver unit &# 39 ; s capabilities to a relatively narrow bandwidth , thus improving the receiver unit &# 39 ; s sensitivity for receiving the relatively low power transmitted signal 16 . once the automatic tuner circuitry 36 adjusts the operating frequency of the receiver unit 18 to the frequency of the signal 16 , the information contained within the received signal 16 is processed , via signal processing circuitry 38 to verify the security code and to accomplish the requested function . turning now to the specifics of the receiver unit 18 shown in fig2 the superheterodyne circuitry 32 includes a front end amplifier 40 which receives the signal 30 output from the antenna 28 . an output signal 42 of the amplifier 40 is provided as a first input to a mixer 44 . a local or reference oscillator 46 provides an oscillating signal 48 at a reference frequency that is intended to be a selected value . in one example , the reference frequency is 314 . 555 mhz . the signal 48 provided by the reference oscillator 46 is a second input of the mixer 44 . the mixer 44 combines the two input signals 42 , 48 , and outputs a signal 50 having frequency component values that are at the sum and difference of the frequency values of the two input signals 42 , 48 . in other words , the mixer 44 &# 34 ; beats &# 34 ; the first input signal 42 with the second input signal 48 . the &# 34 ; difference frequency &# 34 ; value is the if frequency . the &# 34 ; sum frequency &# 34 ; is ignored . the receiver unit 18 includes a buffer 52 and an amplifier 54 for handling the if frequency signal 50 output from the mixer 44 along a path 56 toward the signal processing circuitry 38 . the buffer 52 receives the signal 50 from the mixer 44 , and provides an output 58 . the amplifier 54 is downstream of the buffer , and provides an output 60 , which is supplied to the path 56 toward the signal processing circuitry 38 at a node 62 . in the preferred embodiment , with the operating ( carrier ) frequency of the transmitter unit 14 at 315 mhz and the reference oscillator frequency at 314 . 555 mhz , the intermediate frequency is 455 khz . however , due to various factors such as manufacturing tolerances , aging and temperature , the carrier frequency of the transmitted signal 16 may vary over a range away from its intended value . in one example , in which the intended transmitted frequency is at 315 mhz , the actual frequency may vary +/- 100 khz . also , the reference frequency of the oscillator signal 48 may vary because of various factors such as manufacturing tolerances , aging and temperature . for example , with the intended reference frequency at 314 . 555 mhz , the actual reference frequency may vary +/- 100 khz . accordingly , the intermediate frequency output by the mixer 44 may vary quite a bit . specifically , in one example , the intermediate frequency may be 455 khz +/- 200 khz . thus , the person of ordinary skill in the art will appreciate the extended possible range of the intermediate frequency output by the mixer 44 . the automatic tuner circuitry 36 includes a tunable bandpass filter 66 which has an adjustable bandpass range for &# 34 ; matching &# 34 ; the operating uhf frequency of the receiver unit 18 to the operating frequency of the transmitter unit 14 via selective passage of the if frequency signal generated by the mixer 44 . specifically , the center frequency of the bandpass is adjusted until the operating frequency of the transmitter passes through the bandpass filter 66 . the range of frequencies passed by the bandpass filter 66 is a relatively narrow range of if frequencies . the bandpass filter 66 is interposed along the path 56 toward the signal processing circuitry 38 . preferably , the bandpass filter 66 is located between the buffer 52 and the amplifier 54 , such that the bandpass filter receives the signal 58 from the buffer 52 and provides a filtered signal 68 to the amplifier 54 . in order to automatically adjust the tunable bandpass filter 66 , the automatic tuner circuitry 36 includes tuning control circuitry 70 and passage detector circuitry 72 . the tuning control circuitry 70 provides a control signal 74 to the bandpass filter 66 to adjust or tune the bandpass of the tunable bandpass filter over a predetermined range of possible intermediate frequencies . the signal is automatically changed or varied to automatically vary the bandpass over the range . this adjustment process is repeated . in other words , the possible range of if frequencies is repeatedly &# 34 ; swept &# 34 ; in search of an if frequency signal created by the mixer 44 and output from the superheterodyne circuitry 32 . the passage detector circuitry 72 is connected to the node 62 to receive the output 60 of the amplifier 54 . the passage detector circuitry 72 monitors whether the bandpass filter 66 passes a particular if frequency signal . a signal 76 that is indicative of the passage of a particular if frequency signal through the bandpass filter 66 is provided to the turning control circuitry 70 . when an intermediate frequency signal passes through the tunable bandpass filter 66 , the signal 76 causes the tuning control circuitry 70 to cease the adjustment and &# 34 ; lock &# 34 ; the bandpass filter onto the if frequency which is passing through the bandpass filter . the passage detector circuitry 72 and the tuning control circuitry 70 include means for resetting and resuming the adjustment once the reception of the signal 16 is complete . preferably , a short delay occurs before the reset / resume occurs , in order to await a subsequent signal 16 . preferably , the bandpass of the bandpass filter 66 is dependent upon the voltage value of the control signal 74 . thus , the bandpass filter 66 has a voltage - controlled device and the control signal 74 has a dc voltage value that is changed to adjust the bandpass . one example configuration of the bandpass filter 66 is shown in fig3 . the bandpass filter 66 has a first resistor 82 connected to receive the output 58 of the buffer 52 . the first resistor 82 is also connected to a node 84 . a second resistor 86 is connected between the node 84 and electrical ground 88 . a first capacitor 90 is connected between the node 84 and an output 92 of an amplifier 94 . the output 92 of the amplifier 94 amplifies the output signal 68 from the bandpass filter 66 . a third resistor 96 is connected between a first input 98 of the amplifier 94 and the amplifier output 92 . a second input 100 of the amplifier 94 is connected to ground 88 . connected between the node 84 and the first amplifier input 98 is a capacitor circuit arrangement 102 . the capacitor circuit arrangement 102 includes a second capacitor 104 of the bandpass filter 66 . the second capacitor 104 is connected between the node 84 and the first amplifier input 98 . the capacitor circuit arrangement 102 also includes a third capacitor 106 of the bandpass filter 66 , and a varactor 108 , which are in series between the node 84 and the first amplifier input 98 . the third capacitor 106 and the varactor 108 are in parallel with the second capacitor 104 . the control signal 74 from the tuning control circuitry 70 is provided as a control input to the varactor 108 . a capacitance value of the varactor 108 is dependent upon the voltage of the control signal 74 . in this example , the cutoff frequency of the bandpass filter 66 is represented by the equation : the capacitance value c is dependent upon the capacitance of the varactor 108 . the capacitance c is represented by the equation : note that fig3 also shows optional capacitor 106 &# 39 ; and varactor 108 &# 39 ; ( phantom connection shown ), that are connected in series with each other , and that are connected in parallel with the capacitor 90 . the varactor 108 &# 39 ; is controlled by the control voltage signal 74 . the capacitor 106 &# 39 ; and varactor 108 &# 39 ; help &# 34 ; balance &# 34 ; the bandpass filter 66 , and their use is preferred . attention is now directed to fig4 which shows a first specific receiver unit embodiment of the invention . the receiver unit of fig4 is designated 18a and illustrates first specific examples of the tuning control circuitry and the passage detector circuitry . in the embodiment of fig4 structure that is identical to structure shown in fig2 is identified by the same reference numerals . the tuning control circuitry and the passage detector circuitry have embodiment - specific structure and are identified by the alphanumeric designations 70a and 72a , respectively . the passage detector circuitry 72a includes a comparator 114 . an output of the comparator 114 is the signal 76a . a first input 116 of the comparator 114 is connected to the output 60 of the amplifier 54 . a second input 118 of the comparator 114 is connected to a reference node 120 , which is in turn connected to a reference voltage source v cc . connected between the first and second comparator inputs 116 and 118 is a first resistor 122 . a second resistor 124 and a capacitor 126 are connected , in parallel , between the reference node 120 ( i . e ., the second comparator input 118 ) and ground 88 . the comparator 114 monitors the output 60 of the amplifier 54 , which has a noise component that is characterized as having a dc value with an ac value added to the dc value . the output 60 of the amplifier 54 consists of only the noise when the intermediate frequency created by the mixer 44 of the superheterodyne circuitry 32 does not pass through the bandpass filter 66 . for this situation , the voltage at the first input 116 of the comparator 114 is less than the voltage at the second input 118 of the comparator 114 . the comparator 114 outputs the signal 76a to have a digital &# 34 ; low &# 34 ; value . when the intermediate frequency signal created by the mixer 44 of the superheterodyne circuitry 32 passes through the bandpass filter 66 , the voltage of the first comparator input 116 exceeds the voltage at the second comparator input 118 , and the comparator 114 outputs the signal 76a to have a digital &# 34 ; high &# 34 ; value . the tuning control circuitry 70a of the embodiment shown in fig4 controls the voltage of the control signal 74a provided to the tunable bandpass filter 66 . the tuning control circuitry 70a includes voltage source scale circuitry 130 and a microprocessor 132 . the voltage source scale circuitry 130 provides the control signal 74a , which has a voltage that has a stair - stepped characteristic . specifically , the voltage of the control signal 74a is adjustable to one of a plurality of discrete voltage levels . the voltage source scale circuitry 130 is controlled by a control signal 134 provided by the microprocessor 132 . of course , a person of ordinary skill in the art will appreciate that a voltage source with a &# 34 ; ramped &# 34 ; output could be used . the possible range of the intermediate frequency that will pass through the bandpass filter 66 is predetermined to extend from a first or lower intermediate frequency if 1 to a second or upper intermediate frequency if 2 . the range if 1 to if 2 is greater than the bandwidth δf of the bandpass filter 66 at each adjustment setting of the bandpass filter . hence , adjustment of the bandwidth δf is necessary to cover the range if 1 to if 2 . during the adjustment process , the microprocessor 132 provides the signal 134 to control the voltage source scale circuitry 130 to vary voltage of the control signal 74a . for each round of adjustments , the bandpass filter 66 initially provides a bandwidth that includes if 1 , and steps towards a bandwidth that includes if 2 . the control by the microprocessor 132 to cause adjustment of the control signal 74a output by the voltage source scale circuitry 130 is continuously repeated so long as the tunable bandpass filter 66 does not pass an intermediate frequency signal . specifically , the microprocessor 132 causes the bandpass frequency adjustment to continue so long as the output signal 76a of the comparator 114 has a digital low value . the low signal value from the comparator 114 occurs while the receiver unit 18a is awaiting a transmitted signal 16 . also , the low signal value from the comparator 114 occurs as a transmitted signal starts to be received and yet the tunable bandpass filter does not pass the if frequency signal created by the mixer 44 of the superheterodyne circuitry 32 . however , when the receiver unit 18a receives a transmitted signal 16 , and the control signal 74a causes the bandpass filter 66 to pass a range of frequencies which include the intermediate frequency provided by the mixer 44 , the output signal 76a of the comparator 114 goes high . in response to the digital high signal 76a , the microprocessor 132 controls the voltage source scale circuitry 130 to hold its control signal 74a at the present voltage level . this &# 34 ; locks &# 34 ; the bandpass of the bandpass filter 66 at a relatively narrow range , which permits passage of the intermediate frequency signal created by the mixer 44 of the superheterodyne circuitry 32 . in order to assure that all possible intermediate frequencies in the range if 1 to if 2 are covered during adjustment via the control signal 74a , at least steps of control voltage is required . this allows the intermediate frequency signal created by the mixer 44 to pass through the bandpass filter 66 one time during each adjustment repetition ( i . e ., stair - step adjustment from lowest to highest voltage levels provided by the voltage source scale circuitry 130 ). as a possible alternative in the embodiment of fig4 a greater number of voltage steps can be used to adjust the voltage level between the lowest and highest voltage levels . if a greater number of voltage levels are used , it is possible that the intermediate frequency signal created by the mixer 44 will pass through the bandpass filter 66 for more than one voltage level . for example , if the minimum required number of voltage levels ( i . e ., is multiplied by n , the intermediate frequency signal will pass through the bandpass filter 66 for n voltage steps . if the number of voltage steps is increased as a multiple of n , the microprocessor 132 includes a function which stores information regarding which of the voltage steps are associated with passage of the intermediate frequency signal through the bandpass filter 66 . the microprocessor 132 does not immediately &# 34 ; lock &# 34 ; the voltage source scale circuitry 130 upon the passage of the intermediate frequency signal through the bandpass filter 66 for a voltage step . instead , the microprocessor 132 waits for the comparator output signal 76a to go low , and determines the average or center voltage level of all of the voltage levels which permitted passage of the intermediate frequency signal . once the microprocessor 132 determines the center voltage level , the microprocessor provides the signal 134 instructing the voltage source scale circuitry 130 to locked the control signal 74a at the determined center voltage level . this allows for finer adjustment of the bandpass filter 66 , to center the intermediate frequency in the bandpass of the bandpass filter . fig5 illustrates an embodiment of the receiver unit that is designated 18b . in the embodiment of fig5 the tuning control circuitry and the passage detector circuitry are identified by the alphanumeric designations 70b and 72b , respectively . further , structure that is identical to structure of the previously described embodiments is identified by the same reference numerals as used for the previous described embodiments . the receiver unit 18b of fig5 is similar to the receiver unit 18a of fig4 but shows an alternative to the comparator 114 of the passage detector circuitry 72a of the embodiment of fig4 . specifically , the embodiment in fig5 includes an analog - to - digital ( a / d ) converter 140 as part of the passage detector circuitry 72b , which is connected to receive the output signal 60 of the amplifier 54 . the a / d converter 140 provides a digital output signal 142 to a microprocessor 144 . the voltage value of the signal 142 is indicative of the signal 68 output from the bandpass filter 66 ( i . e ., the voltage value is indicative of whether the if frequency signal created by the mixer 44 of the superheterodyne circuitry 32 passes through the bandpass filter ). the microprocessor 144 of fig5 is different from the microprocessor 132 of fig4 . in the embodiment of fig5 the microprocessor 144 is part of the tuning control circuitry 70b and part of the passage detection circuitry 72b . as part of the passage detection circuitry 72b , the microprocessor 144 of fig5 monitors the digital signal 142 and compares the value of the digital signal 142 to a predetermined threshold value . when the voltage indicative value of the digital signal 142 is below the predetermined threshold , the microprocessor 144 controls the voltage source scale circuitry 130 to adjust the control signal 74b and cause adjustment of the bandpass of the bandpass filter 66 . when the value of the digital signal 142 exceeds the predetermined threshold value , the microprocessor 144 continues to cause adjustment of the bandpass , but also waits for the digital signal to reach a peak and beings to drop . the microprocessor 144 then controls the voltage control circuitry 130 to lock the control signal 74b at the peak voltage level . fig6 illustrates an embodiment of the receiver unit that is designated 18c . in the embodiment of fig6 the tuning control circuitry and the passage detector circuitry are identified by the alphanumeric designations 70c and 72c , respectively . further , structure that is identical to structure of the previously described embodiments is identified by the same reference numerals as used for the previous described embodiments . the embodiment shown in fig6 is similar to the embodiment shown in fig4 but has alternative elements for its passage detector circuitry 72c and its tuning control circuitry 70c . specifically , the passage detector circuitry 72c of fig6 has a comparator circuit arrangement ( i . e ., comparator 114 , resistors 122 , 124 , and capacitor 126 ) identical to the comparator circuit arrangement of the passage detector circuitry 72a of fig4 . in addition , the passage detector circuitry 72c ( fig6 ) has a npn transistor 150 . the output 152 of the comparator 114 is provided to a base terminal 154 of the npn transistor 150 . an emitter terminal 156 of the transistor 150 is connected to ground 88 and a collector terminal 158 is connected to line 160 extending the tuning control circuitry 70c . accordingly , when the intermediate frequency signal generated by the mixer 44 of the superheterodyne circuitry 32 does not pass through the bandpass filter 66 , the line 160 to the tuning control circuitry 70c is disconnected from electrical ground 88 . however , when the intermediate frequency signal generated by the mixer 44 passes through the bandpass filter 66 , the line 160 to the tuning control circuitry 70c is connected to electrical ground 88 . thus , the signal provided on the line goes low when the if frequency signal passes through the bandpass filter 66 . the tuning control circuitry 70c includes a low frequency signal generator 162 . the voltage of an output signal 164 of the signal generator 162 changes over a predetermined range . in one embodiment , the voltage &# 34 ; sweeps &# 34 ; through the predetermined range from a start voltage to an end voltage , and then repeats ( i . e ., the voltage has a saw - tooth pattern ). the output signal 164 of the signal generator 162 is provided as an input to a switch box 166 . the output of the signal generator 162 is connectable , via a switch 168 within the switch box 166 , to a node 170 . a resistor 172 is connected between an input of the switch box 166 and ground 88 . the resistor 172 is connectable to the node 170 , via a switch 174 of the switch box 166 . the two switches 168 and 174 are represented in the drawings as schematic switches . however , the switches 168 and 174 may be any suitable switching devices . the switches 168 and 174 are configured such that they are both closed or opened concurrently . the concurrent control configuration is schematically shown in fig6 by a dash line 176 . a capacitor 178 is connected between the node 170 and ground 88 . a unity gain voltage follower 180 is connected between the node 170 and the bandpass filter 66 . the amplifier acts to isolate the node 170 from the input of the bandpass filter 66 . the output of the voltage follower 180 is the control signal 74c . when the switches 168 and 174 of the switch box 166 are closed , the voltage at the control node 170 , and hence the voltage of the control signal 74c , follows the output signal 164 from the signal generator 162 . when the switches 168 and 174 of the switch box 166 are opened , the signal generator 162 and the resistor 172 are disconnected from the node 170 . the voltage follower 180 continues to output the control signal 74c , and the voltage value of the control signal 74c stays constant for a period of time . specifically , the input impedance of the voltage follower 180 and the capacitor 178 define a rc circuit . the input impedance of the voltage follower is high , and thus , the time constant of the rc circuit is relatively large . the voltage of the control signal 74c stays constant due to the large time constant . the switches 168 and 174 of the switch box 166 are controlled via a signal 182 from a monostable multivibrator 184 . the multivibrator 184 has an input terminal 186 connected to the line 160 extending to the collector terminal 158 of the npn transistor 150 . when the transistor 150 turns on , the input terminal 186 of the multivibrator 184 is connected to ground 88 ( i . e ., the voltage at the input terminal goes low ). the connection of the input terminal 186 to ground is referred to as a wake - up signal . prior to the multivibrator 184 receiving the wake - up signal , the signal 182 causes the switches to be closed . in response to the wake - up signal , the multivibrator 184 provides the signal such that the switches 168 and 174 are opened . the switches 168 and 174 are held open for a period of time , via the signal 182 from the multivibrator 184 . the period of time is predetermined . upon expiration of the predetermined time period , the switches 168 and 174 are again closed , and adjustment of the voltage of the control signal 74c resumes . fig7 illustrates an embodiment of the receiver unit that is designated 18d . in the embodiment of fig7 the tuning control circuitry and the passage detector circuitry are identified by the alphanumeric designations 70d and 72d , respectively . further , structure that is identical to structure of the previously described embodiments is identified by the same reference numerals as used for the previous described embodiments . the embodiment shown in fig7 is similar to the embodiment shown in fig6 but has alternative structure for its tuning control circuitry 70d . specifically , the embodiment of fig7 has a microprocessor 190 instead of the multivibrator 184 of the embodiment of fig6 . an input terminal 192 of the microprocessor 190 is connected to the line 160 extending from the collector terminal 158 of the npn transistor 150 . the microprocessor 190 is connected to provide a control signal 194 as an input to the switch box for controlling the switches 168 and 174 . when the intermediate frequency signal created by the mixer 44 of the superheterodyne circuitry 32 passes through the bandpass filter 66 , the output of the comparator goes high and the transistor turns on . the input terminal 192 is connected to ground through the transistor 150 . the microprocessor 190 monitors the voltage at the terminal 192 . the &# 34 ; grounding &# 34 ; of the terminal 192 provides a &# 34 ; wakeup &# 34 ; signal for the microprocessor 190 . in response to this wakeup signal , the microprocessor 190 provides the signal 194 such that the switches 168 and 174 of the switch box 166 are opened . the switches 168 and 174 are held open while the terminal 192 is grounded ( i . e ., while the if frequency signal 50 created by the mixer 44 passes through the bandpass filter 66 ). when the transmitted signal 16 ceases , the intermediate frequency signal generated by the mixer 44 ceases . the output of the comparator 114 goes low and the transistor 150 turns off . the terminal 192 of the microprocessor 190 is disconnected from ground 88 . in response to this disconnection from ground , the microprocessor waits for a predetermined delay time and then provides the signal such that the switches 168 and 174 close . the adjustment of the control signal 74c resumes . thus , the receiver unit 18d is ready to lock - in on the next transmitted signal 16 . fig8 illustrates an embodiment of the receiver unit that is designated 18e . in the embodiment of fig8 the tuning control circuitry and the passage detector circuitry are identified by the alphanumeric designations 70e and 72e , respectively . further , structure that is identical to structure of the previously described embodiments is identified by the same reference numerals as used for the previous described embodiments . the embodiment shown in fig8 is similar to the embodiment shown in fig7 . specifically , the passage detector circuitry of the embodiment shown in fig8 is identical to the embodiment of fig7 . however , the tuning control circuitry 70e of the embodiment of fig8 is different . the tuning control circuitry 70e includes a low frequency signal generator 202 , which provides an oscillating output signal 204 , similar to the signal generator 162 of the embodiment of fig6 . the output signal 204 is provided , via a first switch 206 of a switch box 208 , as the control signal 74e for the bandpass filter 66 . when the first switch 206 is closed , the bandpass of the bandpass filter 66 is changed based upon the voltage provided by the signal generator 202 . the output signal 204 of the signal generator 202 is also provided to a microprocessor 210 of the tuning control circuitry 70e . the microprocessor 210 monitors the voltage of the output signal 204 . an output 212 of the microprocessor 210 is a digital signal indicative of the voltage of the signal generator output signal 204 . the digital output signal 212 from the microprocessor 210 is provided to a digital - to - analog ( d / a ) converter 214 . an analog signal 216 provided by the d / a converter 214 has a voltage dependent upon the digital signal 212 provided by the microprocessor 210 . the output of the d / a converter 214 is connected to a second switch 218 of the switch box 208 . the first and second switches 206 , 218 are configured such that when the first switch 206 is closed , the second switch 218 is opened , and when the first switch 206 is opened , the second switch 218 is closed . the output signal 216 is the control signal 74e for the bandpass filter 66 when the second switch 218 is closed . the microprocessor 210 has an input terminal 222 connected to the line 160 extending to the collector terminal 158 of the transistor 150 . also , delay circuitry 224 is connected to the line 160 . the delay circuitry 224 provides a control signal 226 to the switch box 208 to control operation of the switches 206 , 218 . when the transistor 150 is off ( i . e ., an if frequency signal created by the mixer of the superheterodyne circuitry 32 is not passing through the bandpass filter 66 and the comparator output is low ), the delay circuitry 224 provides the signal 226 such that the first switch 206 is closed and the second switch 218 is open . the bandpass of the bandpass filter 66 is progressively adjusted via the control signal 74e provides by the signal generator 202 . when the intermediate frequency signal created by the mixer 44 passes through the bandpass filter 66 , the output of the comparator 114 goes high and the transistor 150 turns on . the wakeup signal is provided both to the delay circuitry 224 and the microprocessor 210 . in response to the wakeup signal , the microprocessor 210 &# 34 ; locks &# 34 ; the digital value provided to the d / a converter 214 . accordingly , the voltage of the output signal 216 remains at a constant value . also in response to the wake - up signal , the delay circuitry 224 provides the signal 226 such that the switches are toggled . the first switch 206 of the switch box 208 is opened and the second switch 218 is closed . the signal generator 202 is disconnected from the bandpass filter 66 and the d / a converter 214 is connected to provide the control signal 74e to the bandpass filter 66 . accordingly , the bandpass of the bandpass filter 66 is held constant . once the predetermined time period associated with the delay circuitry 224 expires , the delay circuitry 224 provides the signal 226 such that the first switch 206 closes and the second switch 218 opens . also , the microprocessor 210 is reset such that the microprocessor resumes providing the digital signal 212 to the d / a converter that is indicative of the voltage of the output signal 204 of the signal generator 202 . from the above description of the invention , those skilled in the art will perceive improvements , changes and modifications . such improvements , changes and modifications within the skill of the art are intended to be covered by the appended claims .	7
referring to fig1 a wrapping machine which embodies the wrapping method according to the present invention and is generally denoted by reference numeral 1 comprises , like a conventional wrapping machine , a conveyer 2 , a film feed section 3 located adjacent to said conveyer and a top sealing section 4 located at the rear ead of the line . in conveyer 2 , reference symbols 2a , 2a , . . . denote partitions and products b , b . . . are placed one by one within the compartments formed by said partitions 2a , 2a , . . . the conveyer also comprises a driving pulley 2b which is driven by a motor 2c . the film feed section 3 which is located immediately downstream of the conveyer in the line comprises a feed roller 3c for feeding a continuous sheet of film 3a which is made of synthetic resin of a known type from a roll of film 3b , a rounder 3e of a known type for rounding said sheet of film 3a to form a tube of film 3d , a center sealing unit 3f for melt - bonding the lateral edge of said tube of film 3d and a transfer table 3g for transferring products b , b . . . along with the tube of film 3d , wherein said feed roller 3h and center sealing unit 3f are driven by a first control motor which is actually a servomotor , a motor provided with an inverter , a cd control motor , a stepping motor or a pulse motor . like a conventional wrapping machine , the above machine further comprises a melt - cutting unit 4a in the top sealing section 4 , which is normally a rotary cutter having a driving blade 4d and an interlocked blade 4c which respectively rotate in the directions indicated by arrows to melt - cut the tube of film 3d with their edges so that the cut and parallelly arranged edges of the tube of film are melt - bonded . while the configuration of the above described wrapping machine resembles that of a conventional wrapping machine in many aspects , the difference between them resides in the facts as described below . firstly , in the wrapping machine that embodies the wrapping method of the invention , the rotary motion of the conveyer 2 is transmitted to a rotary shaft 5a by way of the interlocked pulley 2d and an encoder 5b connected with the rotary shaft 5a generates rotary angle signals ras for the interlocked pulley 2d running at a constant speed of revolution and sends them to an electric controller 6 provided with a function similar to that of a shift register and a computer . it should be noted that film 3a supplied in the form of a roll of film 3b as shown in fig2 is of an ordinary type that can be used for a conventional wrapping machine and carries marks for a conventional wrapping machine and carries marks for cutting 7 , 7 , . . . along the lines to be cut by the melt - cutter 4a in the top sealing section 4 . secondly , the film feed section 3 differs from that of a conventional machine , in that a sensor 8 comprising photoelectric tubes located at appropriate positions is provided and directed to said film 3a . said sensor 8 detects any of products b , b , . . . located in the danger zone d provided immediately before and after the corresponding cutting marks 7 , 7 as shown in fig2 . more specifically , if a product b is not correctly loaded in the space between the corresponding partitions 2a , 2a of the conveyer 2 and placed by mistake on one of the partitions as shown in fig2 ( or , in the case of a wad of chinese noodles , if the bag of condensed soup is placed close to the portion 2a ), the products b are forwarded to the film feed section 3 and further to the top sealing section 4 with the incorrect positioning being carried on , where the product b itself or the bag of soup will be cut by the melt - cutter 4a along with the tube of film 3d , causing a serious trouble to the overall wrapping operation . in order to avoid such a situation , said sensor 8 plays its role as described further later . thirdly , one of the outputs of said electric controller 6 is connected to said first control motor 3h of the film feed section 3 to logically couple the conveyer 2 and the film feed section 3 in terms of power so that they are synchronously operated . fourthly , the other output of said electric controller 6 is connected with the top sealing section 4 as described below . as shown in fig1 the melt - cutter 4a of the top sealing section 4 is of a rotary type and driven by a second control motor 4f which is actually a servomotor or the like and electrically connected in such a manner that it is driven by the output of said electric controller 6 . the melt - cutter 4a which is connected in the manner as described above is controlled with respect to revolution as illustrated in fig3 . the driving blade 4b of the melt - cutter 4a rotates in the direction as indicated by arrow 4d and comes to a temporary halt at the position shown p marked by solid lines , where it resumes its rotary motion upon receiving a start signal triggered by a rotary angle signal rs from the encoder 5b . in other words , the driving blade 4b does not restart its operation , unless a start signal does not reach the second control motor 4b and the melt - cutter 4a remains inoperative . it should be noted that the rotary motion of the driving blade 4b which is resumed at the position p occurs only when it is found within a predetermined angle α defined by the lines before and after the sealing point mp and the speed of the rotary motion is controlled to be exactly same with the moving speed of the tube of film 3d in the film feed section 3 . now , the wrapping method according to the present invention proceeds in a wrapping machine as described above in the following manner . when the wrapping machine 1 is powered , the conveyer 2 which is driven by the motor 2c moves forward products b , b , . . . located in the spaced between portions 2a , 2a , . . . in the film feed section 3 , the feeding roller 3c which is driven by the first control motor 3h feeds film 3a from a roll of film 3b to form it into a cylindrical shape by the rounder 3e and the lateral edges of the rounded film are melt - bonded together by the center sealing unit 3f to produce a tube of film 3d , which is then moved to the right as shown in fig1 on the transfer table 3g by the center sealing unit 3f . thus , said products b , b , . . . which are separated from each other by partitions 2a , 2a , are moved one by one from the conveyer 2 into said tube of film 3d with a predetermined distance . then the tube of film 3d containing the products b , b , . . . is cut at the cutting marks 7 , 7 , . . . on it by the melt - cutter 4 which is driven by the second servomotor electrically connected with the first rotary shaft 5a , encoder 5b , electric controller 6 and operated in synchronism with the conveyer 2 to obtain packed items m one by one of products b , b , ... at this stage , the detector - sensor 8 comprising photoelectric tubes checks if there is a product b located in the danger zone d and , when a product b is detected to be in the zone d , a cut - in danger signal is generated and applied to the second control motor 4f by way of the electric controller 6 so that , whenever a product in the danger zone d is detected , the operation of the melt - cutter 4a is stopped at the position p2 indicated by solid lines as the second control motor 4f stops its motion and is resumed only when the product in question b has passed through the melt - cutter 4a and the product immediately following the product in question is found to be correctly located , which is then separated from the following product at the cutting mark 7 by the cutting operation of the melt cutter 4a . as is apparent from the above description , with a wrapping method according to the present invention , a melt - cutter ceases its operation whenever a product which is not correctly located is detected and reaches the melt - cutter without interrupting the operation so that the wrapping method according to the present invention may eliminate any possibility of not only of wrapping incorrectly positioned products but also of erroneously cutting products while the wrapping operation is incessantly carried on . thus , the wrapping method according to the present invention can significantly enhance the efficiency of wrapping operation and eliminate consumption of time and labor required for resumption of the wrapping operation as in the case of using a conventional wrapping method as well as unpleasant fatigue experienced by the operators when the wrapping machine comes to a sudden halt . the method according to the present invention also increases the durability of a wrapping machine because it does not involve any abrupt stopping actions of the machine .	1
referring now to the drawings , and in particular to fig1 and 5 , a new and improved sequencing disk means is generally shown by numeral 2 and includes a generally cup - shaped check valve means 8 , a stem 4 and a resilient main sealing means 6 also referred to as a main sequencing disk . the cup - shaped disk valve means provides a force balancing function as well as a low flow sequencing function . the main sequencing disk is connected to the lower end of the stem 4 . the cup - shaped check valve means 8 is integral with the stem , see fig4 or connected to the stem , see fig5 . the check valve means 8 is positioned adjacent the upper surface 5 of the main sequencing disk or main disk 6 . the generally cup - shaped check valve means 8 , as shown in fig5 is a separate member that is removeably connected to the stem 4 and the main disk 6 by cam connecting members referred to herebelow . the check valve means 8 as shown in fig4 is part of the stem structure . the check valve means 8 and the main sealing means 6 may be a single molded member . the cup - shaped member is symmetrical about the center line of the centrally located housing inlet to balance the incoming fluid forces engaging the sequencing valve means 2 . the generally cup - shaped check valve means 8 shown in fig1 through 8 includes an upper circular edge or perimeter 36 . the exterior surface 38 and the perimeter 36 of the cup moves into and out of the check valve bore 14 as shown in fig1 . the outer surface 38 of the check valve means 8 moves into contact with the inner surface 15 as shown in fig1 of the check valve bore 14 . surface 15 is shown as surface 40 in fig4 . the sequencing disk means 2 is shown in its upper position in fig1 and in its lowermost position in fig4 . the generally cup - shaped check valve means 8 provides the sequencing disk 6 with a means of collecting incoming water to drive the disk downwardly during its sequencing operation . the weight of the water is not solely dependent on the fluid flow rate . the check valve means 8 has a fluid control exit means 80 , a hole , for draining the check valve means of water when the flow of fluid stops entering into the sequencing valve through the inlet . spring 30 will force the sequencing disk means 2 upwards when the check valve means 8 is empty of water . spring 30 is preferably positioned within stem 4 as shown in the co - pending patent application . the size of the fluid control exit means 80 shown in fig2 , 6 and 7 controls the minimum fluid flow rate for operating the improved sequencing disk means 2 . the cup - shaped member may be designed so that the weight of the water alone , in the cup member will overcome the force of the return spring 30 . preferably the cup member is designed so that the weight of the collected water and the force of the incoming water against the cup member together overcome the force of spring 30 . the generally cup - shaped check valve means 8 provides filtering means for large objects in the incoming fluid to prevent foreign objects from moving between the lower sealing surface 32 of the main sealing means or sequencing disk and the upper sealing area 35 , shown in fig4 of the inner surface of the valve housing around the exit ports . the filtering action insures proper operation of the valve . the generally cup - shaped check valve means or check valve device 6 allows the sequencing disk means 2 to move downwardly when large fluid flow rates as well as small fluid flow rates enter the housing inlet to fill the cup . the exit 80 is preferably locked into a position over opening 22 to provide a faster drain means for the sequencing disk or valve means to speed up completion of a full cycle . when exit 80 is so positioned , the back flow through opening 22 will aid in flushing exit 80 and also allow movement of the resilient main sealing means 6 toward exit 80 to seal said exit . the generally cup - shaped check valve means includes a generally cup - shaped portion having outer surface 38 and caming means 64 and 66 . the cup - shaped portion may be designed in two or more heights to cover extremely small or extremely large fluid flow rates . the cup - shaped portion may include a resilient upper edge not illustrated , with or without short vertical slits 82 , shown in fig5 . the slits 82 allow sideways movement of the upper lip to enlarge the exit area around the upper lip or perimeter 36 of the check valve means . the upper lip or perimeter 36 is moved relative to the exit area of the internal inlet bore 14 to provide the variable internal inlet exit area . the sequencing valve housing , a portion of which is shown in fig1 and 4 , encompasses the sequencing disc means 2 . the sequencing valve includes a housing body 10 with an internal chamber 20 . the housing body 10 includes a fluid inlet connection illustrated by numeral 12 for passing fluid to a check - valve port or internal inlet bore 14 . the fluid then flows through the main cavity or housing chamber 20 and out of the valve through one or more of the outlet ports . two outlet ports are shown at numerals 16 and 18 . the internal inlet 14 is displaced from said outlet ports 16 and 18 at opposite sides of the housing chamber 20 . fluid communication is established between said inlet 12 and outlet ports 16 and 18 through the sequencing disk opening 22 in the sequencing disk means 2 . the sequencing disk means 2 is disposed in said housing chamber 20 . the sequencing disk means 2 reciprocates and rotates in the housing chamber 20 by any well known method such as disclosed in the prior art . the sequencing disk means moves from the upper position shown in fig1 to the lower position shown in fig4 and back to the position shown in fig1 with opening 22 180 ° from that shown to complete one cycle . the next cycle would open outlet 18 , assuming sequencing valve disk 6 rotates counter clockwise as shown in fig2 . the sequencing disk means port 22 cooperates with the outlet ports 16 and 18 to distribute water . additional outlets may be provided . the sequencing disk means 2 has at least a one opening 22 therethrough for fluid to pass from the housing cavity 20 into an outlet , such as shown at 16 in fig4 . the stem 4 includes cam fingers 24 and 26 that cooperate with cams , not shown that are located in cam housing 28 . the cams operate by any well known method such as disclosed in the prior art . the cams and cam fingers cooperate to rotate the main sealing means 6 as the sequencing disk means 2 reciprocates up and down due to the input fluid and the biasing force of spring 30 . the sequencing disk means 2 is normally biased upward by spring or biasing means 30 . spring 30 engages washer 42 that is positioned under and around the end 44 of the stem 4 . referring now to fig6 the sequencing disk means 2 includes three separate components , the stem 4 , the resilient main disk 6 and the generally cup - shaped check valve means 8 . this is further illustrated in fig5 . the stem includes cam members 60 and 62 having sloping surfaces . the generally cup - shaped check valve means 8 includes mating cam means 64 and 66 having mating sloping surfaces . when the cup - shaped check valve means 8 is placed over stem 4 and cams 64 and 66 are moved downwardly past cam members 60 and 62 the cam members 64 and 66 may be brought into engagement under cam members 60 and 62 . when the mating cam members are moved into a locking position , that is into engagement , the camming action drives the lower end 76 of the cup - shaped member into positive engagement with the upper surface 34 or 5 of the main disk . there is a locking notch 72 in the lower surface of the generally cup - shaped member that mates with a bulbous portion 70 on the upper surface 34 of the main disk 5 . when the generally cup - shaped check valve means 8 is in its final position as shown in fig7 the stem 4 and the main disk are releasably locked together and placed in a rigid or fixed position relative to one another . this prevents the main disk from shifting position relative to the longitudinal center line of the stem . this also allows cup members of various sizes to be interchangeable with a sequencing disk means in a sequencing valve . the instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment . it is recognized , however , that departures may be made therefrom within the scope of the invention and that obvious modifications will occur to a person skilled in the art .	8
fig1 shows a simple embodiment of the invention in order to explain the basic principle . two coils 1 and 2 , which each consist of one winding 7 , are disposed on a printed circuit board 8 for generating a dipole 24 . each winding 7 is disposed on the printed circuit board 8 in the form of a strip conductor 9 , and is loaded with current via connections 25 . the windings 7 form rectangular windows 16 with rounded edges , wherein the long sides 17 of the windows 16 are oriented along an imaginary axis 10 . the axis 10 is the optical axis when the multipole coils are used in the field of particle optics . the printed circuit board 8 is made from a flexible material and rolled into a cylinder which is hollow inside , such that the two coils 1 , 2 concentrically enclose the axis 10 . fig2 shows a sectional view of one embodiment , in which the printed circuit board 8 is rolled in several printed circuit board layers 11 , 12 , 13 , 14 . these multipole coils 1 , 2 , 3 , 4 form a quadrupole 31 , since four coils 1 , 2 , 3 , 4 are concentrically disposed about an imaginary axis 10 ( optical axis ). the section in a plane 19 perpendicular to the axis 10 thereby shows the cut strip conductors 9 , which extend perpendicularly to the axis 10 . this illustrates that the strip conductors 9 of the windings 7 of the different printed circuit board layers 11 , 12 , 13 , 14 are precisely stacked in a radial direction . this is particularly important to obtain an exact coil geometry and thereby exact fields when the multipole coils 1 , 2 , 3 , 4 are intended for correcting aberrations in particle optics . gluing can secure exact positioning . in this representation , one can clearly see how reduced the construction height of a multipole coil of this type is , in particular , in a region of the four layers of circuit board 11 , 12 , 13 , 14 , wherein a large number of multipole coils can be configured within this constructional height e . g . a hexapole , octupole or twelve pole . if one compares this to conventional wound coils ( for examples as seen in the figure in nanos , page 27 , op . cit . ), then the constructional size difference is quite clear as is the resulting changed geometry . in this manner , much purer multipole fields can be more easily produced . fig3 shows a perspective view of a printed circuit board 8 rolled into several layers 11 , 12 , 13 , 14 . this example shows the design of the strip conductors 9 as windings 7 in a spiral arrangement 15 . only one spiral arrangement 15 is shown as an example . they are , in fact , superposed like the windings 7 of fig2 . the strip conductors 9 of the spiral arrangement 15 of the different printed circuit board layers 11 , 12 , 13 , 14 can be connected by through - connections 23 , such that all windings 7 of one coil are interconnected . the coils that belong to a multipole element are correspondingly interconnected again to alternately generate one south pole and one north pole of the respective magnetic fields . a rolled printed circuit board 8 of this type may thereby also contain coils 1 , 2 , 3 , 4 , 5 , 6 etc . of several multipoles . the supply lines 34 guided on the edges may serve for interconnecting the coils of one multipole or also for current loading of one or more multipoles at the connections 25 . also shown are the rectangular windows 16 formed by the windings 7 . fig4 shows a section through a printed circuit board 8 with strip conductors 9 . the strip conductors 9 are thereby mounted to the front side 20 of the printed circuit board 8 and covered by an insulating layer 22 . strip conductors 9 may accordingly also be disposed on the rear side 21 of the printed circuit board 8 . this is advantageous in that twice as many windings 7 or spiral arrangements 15 of windings 7 can be formed as there are printed circuit board layers 11 , 12 , 13 , 14 . in this case , the insulating layer 22 is required for electrically separating the strip conductors 9 . during winding of the printed circuit board 8 , a glue layer is additionally provided on the full surface , which secures the positions of the coils and thereby also improves dissipation of heat . for this reason , a connection without air gaps is advantageous . fig5 shows a section through a dipole 24 , in which the printed circuit board 8 is not shown . this figure shows that each coil 1 and 2 extends over an area of 120 °, which is utilized to generate a very pure dipole field . in this view , the strip conductors 9 are cut in a plane 19 perpendicular to the axis 10 , and the winding centers 18 are illustrated which , in simple windings 7 like this , extend in the center of the strip conductors 9 . rolling of the printed circuit board 8 ( not shown ) provides the strip conductors 9 with the illustrated circular arc shape , which is also advantageous for generating fields , which shall act with optimum precision on the area of the axis 10 . fig6 shows a similar section in a plane 19 perpendicular to the axis 10 , with two dipoles 24 and 24 ′ disposed on different printed circuit board layers 11 , 12 . only the strip conductors 9 of the windings 7 of the coils 1 and 2 of the respective dipoles 24 and 24 ′ are thereby illustrated but not the printed circuit board 8 with its layers 11 and 12 . it is rolled in two layers in correspondence with fig2 and 3 . this shows how the dipoles 24 and 24 ′ can be superposed through two printed circuit board layers 11 , 12 , thereby providing an arrangement which cannot be produced using conventional wound coils . the coils 1 and 2 of the respective dipoles 24 and 24 ′ can naturally also be designed as spiral arrangements 15 in order to reinforce the generated magnetic forces . it is thereby also possible to provide more than two printed circuit board layers 11 , 12 to ensure that the number of windings 7 of the two dipoles 24 and 24 ′ can be further increased . fig7 shows one example of a coil arrangement 1 , 2 , of a dipole 24 or 24 ′, wherein the windings 7 are spirally arranged 15 , and wherein the coils 1 and 2 are formed from windings 7 , 15 on the front side 20 of a printed circuit board , shown in the upper area of fig7 , and additional windings 7 , 15 on the rear side 21 of the printed circuit board , shown in the lower area of fig7 . the printed circuit board 8 is not shown either . only the strip conductors 9 mounted to the printed circuit board 8 of the front side 20 are shown in the upper part of the figure and the strip conductors 9 of the rear side 21 of the printed circuit board 8 are shown in the lower part of the figure . the through - connections 23 are connected to each other at a and b to produce an electric connection 35 between a and b in the upper part of the drawing , which is symbolically shown with dashed lines and corresponds to the connection via the windings 7 of the spiral arrangements 15 , shown in the lower part of the figure . the printed circuit board 8 is rolled in correspondence with fig1 . the dipole 24 or 24 ′ must then only be loaded with current via the connections 25 to produce a current flow , as indicated by arrows 33 and 33 ′. in this fashion , two coils 1 , 2 are available which generate reverse - poled magnetic fields . fig8 shows one example of a coil arrangement with coils 1 , 2 , 3 , and 4 , which form a quadrupole 31 . the view corresponds to the above - described , wherein the interconnection is correspondingly varied , such that the connections 35 shown in the upper part exist only between the coils 1 and 2 and the coils 3 and 4 via the corresponding windings 7 on the rear side 21 of the printed circuit board , and the windings 7 of the front side 20 of the printed circuit board are connected directly between the coils 2 and 3 . in this fashion , the coils 1 , 2 , 3 and 4 are also interconnected in the quadrupole 31 , which results in that the north and south poles of the magnetic fields alternate . the printed circuit board 8 is naturally also rolled in this case , such that the coils 1 , 2 , 3 , 4 concentrically enclose the axis 10 . this view also shows that the spiral arrangement 15 has more windings 7 on the front side 20 of the printed circuit board 8 than the spiral arrangement 15 on the rear side 21 of the printed circuit board 8 . in consequence thereof , the outer spiral arrangements 15 have more windings 7 than the inner when the printed circuit board 8 is rolled in such a fashion that its rear side 21 faces to the inside and its front side 20 faces to the outside . the dash - dotted lines show that the winding centers 18 of each spiral arrangement 15 are in the center of the windings 7 , which form the respective spiral arrangements 15 . these winding centers 18 must be arranged in such a fashion that they all coincide with the radii in a plane 19 perpendicular to the axis 10 . this applies not only for the front side 20 and the rear side 21 of a printed circuit board 8 but also for several printed circuit board layers 11 , 12 , 13 , 14 etc . fig9 shows another example of a coil arrangement of a hexapole 32 with six coils 1 , 2 , 3 , 4 , 5 , 6 . the windings 7 are thereby also shown as spiral arrangements 15 on the front side 20 of the printed circuit board 8 ( top ) and the rear side 21 of the printed circuit board 8 ( below ), wherein the printed circuit board 8 itself is not shown . the double arrows also indicate that the electric connections 35 between a and b , c and d , e and f of the windings 7 of the front side 20 are realized via the windings 7 on the rear side 21 by providing through - connections at points a , b , c , d , e and f . otherwise , the above - described applies . fig1 shows an arrangement of the inventive multipole coils 1 , 2 , 3 , 4 , 5 , 6 in a lens 26 which is designed as a magnetic lens . the enumeration of six coils is naturally only an example . any number of multipole elements may be disposed , as mentioned above , even a combination of several multipole elements . they are preferably arranged below the magnetic gap 28 formed by the pole shoes 37 , in the beam passage opening 27 of the lens 26 . the housing of the lens 26 is shown in sectional view , such that the windings 38 , which are also shown in sectional view , can be seen in the sectional view of the iron circuit 39 . the behavior of the electron beam 36 , which is influenced by the lens 26 , is also shown . since the inventive multipole coils 1 , 2 , 3 , 4 , 5 , 6 require very little installation space , they may either be disposed directly in the beam passage opening 27 of the lens 26 without impairing the electron beam 36 , or if more space is required , a recess may be provided in the beam passage opening 27 for inserting the printed circuit board 8 including multipoles . fig1 shows such a recess 29 in an arbitrary particle - optical component , e . g . a steel tube 30 . a recess 29 of this type may be disposed on the outer side ( as shown ) or on the inner side of the beam passage opening 27 in correspondence to the lens 26 of fig1 . the printed circuit board layers 11 , 12 , 13 etc . may thereby be easily inserted into any recess 29 . the recess 29 need not be designed in such a fashion that the rolled printed circuit board 8 can be mounted by sliding it on . the drawings naturally only symbolically show a few embodiments . many variations are feasible . the windings 7 could also be disposed in circles or ovals . the rectangular shapes could also have a different position , or much more complex arrangements could be provided by disposing many multipole coils 1 , 2 , 3 , 4 , 5 , 6 in many printed conductor board layers 11 , 12 , 13 , 14 which are used to correct a plurality of aberrations in particle optics . depending on the purpose of use , the different coils must , of course , be correspondingly interconnected , wherein even separate control of individual coils would be feasible or also an interconnection of several multipole coils , possibly also by introducing further electric or electronic components . the drawing is only designed to give an exemplary idea of the invention . 1 , 2 , 3 , 4 , 5 , 6 multipole coils or coils 35 connection via windings on the rear side of the printed circuit board	7
although specific embodiments of the present invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and merely illustrative of but a small number of the many possible specific embodiments which can represent applications of the principles of the present invention . various changes and modifications obvious to one skilled in the art to which the present invention pertains are deemed to be within the spirit , scope and contemplation of the present invention as further defined in the appended claims . referring to fig1 through 2 ., the present invention is a process to create a three - dimensional image onto a garment such as a shirt 10 . the garment contains cotton 20 and polyester 30 . the process involves chemical etching out images 22 and 24 on the cotton portion 20 and then there is a portion of the fabric 20 that has now been removed which is an etched out image . one process is to coat a silkscreen with a chemical having the image or images and running the silkscreen over the garment to chemically etch the images into the garment . the part of the fabric that remains and has been uncut is referred to as the positive 30 . the part of the fabric that has been etched out and effectively has an image on it is called a negative 20 with the etched out images numbered 22 and 24 . one key innovation of the present invention is what is applied to the back of the garment behind the chemically etched image . referring to fig3 , 4 , 5 and 6 , a printing process is performed on a full second garment 40 such as a shirt . essentially , it is a full shirt 40 but the uniqueness in the present invention is printing the exact same images 42 and 44 on the second shirt 40 which will shine through the exact same images 22 and 24 at the exact location on the outer shirt 20 which has been etched or chemically etched out of the outer shirt 20 so that the exact same image on the interior shirt will shine through the see - through etched out images 22 and 24 on the outer shirt 20 . the images 42 and 44 on the second or inner shirt 40 is printed at the exact same location where the identical image 22 and 24 has been respectively etched out of the outer or front shirt 20 . then the two garments are aligned and tacked near the shoulder and tacked to the underarm . therefore , the second shirt 40 is fairly loose against the first shirt 20 but it is affixed firmly enough away that it can be worn and washed and it will not come apart . the present invention technique as described above is most preferably applied to tank tops , t - shirts and baseball shirts which are known as raglan shirts . the technique is also applied to a shirt known as a henley shirt which is a t - shirt that has buttons . it is therefore an object of the present invention to provide a garment such a t - shirt , baseball shirt , or henley shirt which has a three - dimensional image on the garment created by removing a portion of the garment to create an image on an outer garment , the process being etching or chemical etching , and thereafter affixing a second interior shirt with an exact same image at the exact same location as the etched out image or images on the front shirt . the two shirts affixed together . one key innovation of the present invention is what is applied to the back of the garment behind the chemically etched image . referring to fig3 , 4 , 5 and 6 , a printing process is performed on a full second garment 40 such as a shirt . essentially , it is a full shirt 40 but the uniqueness in the present invention is printing the exact same images 42 and 44 on the second shirt 40 which will shine through the exact same images 22 and 24 at the exact location on the outer shirt 20 which has been etched or chemically etched out of the outer shirt 20 so that the exact same image on the interior shirt will shine through the see - through etched out images 22 and 24 on the outer shirt 20 . the images 42 and 44 on the second or inner shirt 40 is printed at the exact same location where the identical image 22 and 24 has been respectively etched out of the outer or front shirt 20 . then the two garments are aligned and tacked near the shoulder and tacked to the underarm . therefore , the second shirt 40 is fairly loose against the first shirt 20 but it is affixed firmly enough away that it can be worn and washed and it will not come apart . the present invention technique as described above is most preferably applied to tank tops , t - shirts and baseball shirts which are known as raglan shirts . the technique is also applied to a shirt known as a henley shirt which is a t - shirt that has buttons . it is therefore an object of the present invention to provide a garment such a t - shirt , baseball shirt , or henley shirt which has a three - dimensional image on the garment created by removing a portion of the garment to create an image on an outer garment , the process being etching or chemical etching , and thereafter affixing a second interior shirt with an exact same image at the exact same location as the etched out image or images on the front shirt ; the two shirts affixed together . an alternative key innovation of the present invention is what is applied to the back of the garment behind the chemically etched image . referring to fig7 , 8 , 9 and 10 a printing process is performed on a full second garment 80 such as a shirt . essentially , it is a full shirt 80 but the uniqueness in the present invention is printing the a complementary image in color or pattern 82 and 84 on the second shirt 80 which will shine through the exact same images 22 and 24 at the exact location on the outer shirt 20 which has been etched or chemically etched out of the outer shirt 20 so that the complementary image on the interior shirt will shine through the see - through etched out images 22 and 24 on the outer shirt 20 . the images 82 and 84 on the second or inner shirt 80 is printed at the exact same location where the identical image 22 and 24 has been respectively etched out of the outer or front shirt 20 . then the two garments are aligned and tacked near the shoulder and tacked to the underarm . therefore , the second shirt 80 is fairly loose against the first shirt 20 but it is affixed firmly enough away that it can be worn and washed and it will not come apart . the present invention technique as described above is most preferably applied to tank tops , t - shirts and baseball shirts which are known as raglan shirts . the technique is also applied to a shirt known as a henley shirt which is a t - shirt that has buttons . it is therefore an object of the present invention to provide a garment such a t - shirt , baseball shirt , or henley shirt which has a three - dimensional image on the garment created by removing a portion of the garment to create an image on an outer garment , the process being etching or chemical etching , and thereafter affixing a second interior shirt with a complementary image at the exact same location as the etched out image or images on the front shirt , the two shirts affixed together . of course the present invention is not intended to be restricted to any particular form or arrangement , or any specific embodiment , or any specific use , disclosed herein , since the same may be modified in various particulars or relations without departing from the spirit or scope of the claimed invention hereinabove shown and described of which the apparatus or method shown is intended only for illustration and disclosure of an operative embodiment and not to show all of the various forms or modifications in which this invention might be embodied or operated .	0
the related art of the invention will be described in detail before the explanation of an embodiment of the present invention . according to the conventional scale reduction technique , floating fringe capacitive coupling ( fg fringe coupling ) is disregarded . the floating gate fringe capacitive coupling occurs between a floating gate and a diffusion layer of a memory cell . with advances in scale reduction of the floating gate , a non - volatile memory has difficulty sufficiently fulfilling its function . as shown in fig3 , the fg fringe coupling means coupling via a capacitance c 3 existing between the side of the floating gate and a diffusion layer 2 . in addition , the following capacitances c 1 and c 2 exist . the c 1 is a tunnel oxide film capacitance ( tox capacitance ) existing between a floating gate 3 and a semiconductor substrate 1 . the c 2 is an inter - poly dielectric film ( ipd ) capacitance existing between the floating gate 3 and a control gate 4 . the fg fringe capacitance is characterized in that its magnitude does not change even if scale reduction of a stacked gate is made . this is in contrast to the fact that the ipd capacitance and the tox capacitance decrease as the facing area becomes narrow with scale reduction . for this reason , the fg fringe capacitance contribution becomes relatively large with the scale reduction . the fg fringe coupling contributes to capacitive coupling of the semiconductor substrate 1 with the floating gate 3 . thus , when a fg fringe ratio becomes high , capacitive coupling between the floating gate 3 and the control gate 4 becomes relatively low . as a result , this is a factor of reducing a capacitive coupling ratio . the reduction of the capacitive coupling ratio lowers a ratio to an ipd film ( not shown ) of an electric field applied to a tunnel film ( not shown ) between the semiconductor substrate 1 and the floating gate 3 . as a result , ipd leak is increased . fig4 is an energy band diagram showing the foregoing state . in general , the following conditions are preferably required in order to make correct writing . namely , a voltage ( electric field ) of 10 mv / cm or larger is applied to a tunnel film ( tox ), while a voltage ( electric field ) applied to the ipd film is controlled to 3 mv / cm or smaller . if the capacitive coupling ratio becomes low , the voltage distribution relationship changes between the tunnel film and the ipd film . as a result , the tunnel film voltage is reduced while the ipd film voltage increases . therefore , the foregoing conditions are not satisfied . as seen from the foregoing description , it is a serious problem how the capacitive coupling ratio is affected by fg fringe . the following is a description of the relationship between fg fringe and scale reduction . a tunnel film capacitance is proportional to a gate area , and decreases at a ratio of square of a gate length with the scale reduction . this is considerably faster pace as compared with decrease of fg fringe coupling . thus , in the generation beyond 55 nm , an influence of fg fringe coupling on the capacitive coupling ratio becomes negligible . the following is a description of factors of reducing writing efficiency other than the fg fringe . as depicted in an energy band diagram of fig5 , a depletion layer is formed at the interface between the floating gate and the tunnel film in a write operation . this reduces the tunnel film voltage with result that writing efficiency is decreased ( see h . watanabe , ieee ted52 , 2265 , 2005 ). an influence of the depletion layer will be hereinafter considered . fig6 is an energy band diagram showing a state of a depletion layer in an n + polysilicon gate ( see h . watanabe , ieee ted52 , 2265 , 2005 ). unlike a silicon substrate , fermi level exists in a conduction band . therefore , even if a band bends at the polysilicon surface , there remains an area where electrons are not completely lost ( incomplete depletion ). moreover , a complete depletion layer exists between the incomplete depletion layer and an oxide film . however , in fact , the width of the complete depletion layer is remarkably small , so that the depletion layer of an n + polysilicon gate is dominated by the incomplete depletion layer . it is to be noted that depletion approximation normally applied to silicon presumes complete depletion . thus , the depletion layer width of the n + polysilicon gate is underestimated . for this reason , a depletion layer of the floating gate occurring in a write operation is underestimated . in short , as shown in fig5 , reduction of the electrical field in the tunnel film owing to fg depletion layer is disregarded so far . however , a write margin becomes smaller with scale reduction , and thereby , the above reduction is a dangerous factor that must be securely removed . an influence of an accumulation layer will be hereinafter considered . an n + polysilicon accumulation layer is quite disregarded according to the conventional concept based on boltzmann approximation . this results from the following reason . namely , the donor concentration of n + polysilicon is very high , and if a band is slightly bent on the n + polysilicon surface , a charge is accumulated according to an exponential function . thus , it is considered that the band is not almost bent actually . however , the inventors have made a report that the foregoing concept is wrong ( see h . watanabe et al ., ext . abs . ssdm , 504 , 2005 ). more specifically , the accumulation layer width of the n + polysilicon is narrow , and quantum exclusion effect prevents electrons from accumulating according to the exponential function . conversely , as illustrated in fig7 , the band is bent more steeply in order to maintain a surface charge density . thus , the band drop is steeper as compared with the case expected so far . an electron state density increases in accordance with the square root of the band drop . as described above , charge accumulation is made not according to the exponential function of the band drop , but proportional to the square root of the band drop . thus , from the foregoing description , the accumulation layer at the n + polysilicon surface can be called as a weak accumulation layer . fig7 b shows a state that no accumulation of electrons occurs . fig8 shows a state that a weak accumulation layer at fg / ipd film interface generated in a write operation lowers a tunnel barrier of the ipd film . this is a factor of increasing ipd leak on the exponential function , and largely reducing writing efficiency . as described above , the incomplete depletion layer lowers an electric field of a tunnel film . the fg fringe capacitance lowers the capacitive coupling ratio , and reduces an injection current flowing through the tox in a write operation . moreover , the weak accumulation layer at the fg / ipd interface increases ipd leak . the write operation is made based on the difference between the injection current and the ipd leak . thus , the foregoing incomplete depletion and fg fringe capacitance remarkably lowers writing efficiency . in other words , decrease of writing efficiency is a serious problem of a nand flash memory in the generation after 55 nm together with scale reduction . the effective means for collectively solving the foregoing problem is to thin the tunnel film tox . thinning of tox is seemed as if the capacitive coupling ratio is further reduced . however , the effect of increasing the injection current flowing through the tox is usefully given . therefore , decrease of writing efficiency by scale reduction is prevented . conversely , the following demerit is given , that is , data retention characteristic is worsened . at present , it is said that a reallistic memory card can be designed , if the memory card can hold data for about one year . actually , when the memory card is connected to power , write transfer of memory ( block transfer & amp ; block batch erase = flash ), that is , refresh is carried out while user is not aware of it . therefore , if refresh is carried out while data is held , there is no problem . however , it is needed to teach the refresh timing to the memory card . for example , the data retention time is assumed as one year at the worst , and the memory card is once refreshed when inserted into a reader ten times . in this case , if the memory card is inserted into the reader ten times in one year , data is semi - permanently held . actually , memory cards such as compact flash (®) used for mobile phones and digital cameras and sd cards (™) or flash drives are considerably frequently inserted into a reader , or are used in a state of being inserted therein . moreover , non - volatile memory built into mobile phones and music players is powered almost every day . ( probably , a memory left in a power off state for one year will be a discarded memory .) it is to be noted that data retention characteristic is variable every memory cell . in other words , a cell having the shortest data retention time determines the data retention characteristic of a memory system . of course , error correction code ( ecc ) can prevent use of a cell including non desired data retention time . in this case , time determined according to ecc is equivalent to data retention time of a memory system . in a nand flash ( memory ), a series of serial - connected memory cells is all disposed , for example , if one cell having no desired data retention time exists . namely , if a range of data retention characteristic is wide , the number of bits disposed based on ecc becomes much . if this number becomes too much , bit cost also becomes high . of course , the range of the data retention characteristic is different every chip . thus , the number of bits disposed based on ecc is different every chip . in other words , elimination by ecc is regarded as determination of the maximum value in variations between chips . conversely , the tunnel film must be thinned according to advance in scale reduction . this means the number of bits whose data retention time is shortened increases , and the data retention characteristic variation ( in particular , data retention time distribution edge ) becomes large . in other words , if the shortest data retention time to be eliminated according to ecc is kept , it invites cost increase . conversely , if the lower end ( edge ) of the data retention time range ( shortest data retention time ) is lessened , refresh timing must be made earlier . for example , the shortest data retention time is set as three months . in order to semi - permanently hold information recorded in the digital camera or the flush drive , the memory ( card ) must be inserted to a reader ten times for three months . this means that the information is erased depending on users . instead , if refresh timing is increased as three times per 10 times insertion , user frequently feels that the operation speed is late . therefore , basically , there is a problem in refresh control according to the number of refreshing times . thus , if the data retention time is lessened according to scale reduction , the memory card should be automatically refreshed at timing earlier than the lowest end of the data retention time range . the problem is how to teach refresh timing to the memory card . furthermore , elapsed time must be measured while the memory card is in a battery - less / off line state . the inventors provide a non - volatile memory device in which data retention time characteristic is not degraded even if the tunnel film is thinned . in order to realize the foregoing non - volatile memory device , the inventors propose that refresh timing is controlled by elapsed time control instead of frequency control with use of a refresh trigger provided with a power - less semiconductor time switch ( aging device : ssad (™)). an embodiment of the present invention will be hereinafter described with reference to the accompanying drawings . the present invention is not limited to the following embodiment , and various design change may be made . fig1 is a block diagram showing the configuration of a non - volatile semiconductor memory device with a refresh trigger using an aging device according to one embodiment of the present invention . according to this embodiment , a controller 101 sends a signal to make first write ( initialization ) to an ssad 103 . this is equivalent to overturning of an hourglass , and thereby , the initial time is set . the ssad 103 is different from the actual hourglass in that it can optionally set its lifetime according to the foregoing initialization condition . the ssad 103 compares time elapsed from the initialization with the predetermined lifetime . if the elapsed time is shorter than the lifetime , the ssad prepares to send “ 0 ” to a refresh trigger circuit 105 . conversely , if the elapsed time is longer than the lifetime , the ssad prepares to send “ 1 ” to the refresh trigger circuit 105 . in this case , it is to be noted that the time elapse of the ssad 103 advances in a state disconnected from a power source . the off - power state is maintained until the ssad 103 becomes able to send 0 / 1 signal to the refresh trigger 105 . when the memory device is connected to an external power and becomes in a power - on state , the 0 / 1 signal is sent to the refresh trigger circuit 105 . if the received signal is “ 0 ”, the refresh trigger circuit 105 does not make any operation . conversely , if the received signal is “ 1 ”, the refresh trigger circuit 105 gives the controller 101 instructions to refresh a memory cell array 115 . the refresh trigger circuit 105 is configured with conventional logic circuits . the circuit 105 forms and amplifies an output waveform of the ssad 103 to securely operate the controller 101 . the controller 101 controls a word line ( wl ) decoder 111 and a bit line ( bl ) decoder 113 using a high - voltage ( hv ) amplifier 107 and a low - voltage ( lv ) amplifier ( sense amplifier ) 109 . the controller transfers information recorded in part of a memory cell array 115 to a free space of the memory cell array 115 . in this case , the word line decoder 111 is an x decoder designating a position on the x axis . the bit line decoder 113 is a y decoder designating a position on the y axis crossing the x axis . after the write transfer of the memory is completed , the controller 101 again initializes the ssad 103 , and thereby , a series of refresh operation ends . the refresh operation will be summarized . the ssad 103 outputs the 0 / 1 signal only relevant to the lifetime . in contrast , the controller 101 makes various operations such as write , erase , read and address designation . the refresh operation is carried out in the following manner . first , the controller 101 reads data stored in the memory cell array 115 and searches a free space in the memory cell array 115 . after finding the free space , the controller 101 writes the read data therein . in this case , the controller 101 erases the data of the read area . after the write transfer of the memory is completed , the controller 101 again initializes the ssad 103 . the foregoing series of operations is pre - stored in the controller 101 as a program . the refresh trigger circuit 105 issues a trigger signal for operating the foregoing program . according to the foregoing embodiment , when power is turned on after the time set in the ssad 103 elapses , a refresh signal (“ 1 ”) is automatically issued . therefore , even if the tunnel insulating film is thinned , preferable data retention characteristic is maintained . according to the foregoing embodiment , the refresh trigger circuit 105 is used as an independent circuit . of course , the circuit function may be included in the controller 101 ( modification embodiment 1 ). according to the foregoing embodiment , the ssad 103 receives an initialization signal from the controller 101 . instead , the ssad 103 may receive the signal via hv amplifier 107 or an operational amplifier ( op . amp .) 104 ( modification embodiment 2 ). fig2 is a block diagram showing the configuration of a semiconductor memory device according to the foregoing modification embodiment 2 . specifically , according to the modification embodiment 2 , the controller 101 sends a signal to the hv amplifier 107 , which drives the operational amplifier 104 . the operational amplifier 104 determines whether or not the ssad 103 should be initialized . only when the operational amplifier determines that initialization is necessary , the ssad 103 is initialized . this means that a hourglass is turned over , and thus , the initial time is set . the ssad 103 optionally sets its lifetime according to the initialization condition , unlike the actual hourglass . the ssad 103 compares time elapsed from the initialization with the predetermined lifetime . if the elapsed time is shorter than the lifetime , the ssad 103 prepares to send a signal “ 0 ” to the refresh trigger 105 . conversely , if the elapsed time is longer than the lifetime , the ssad 103 prepares to send a signal “ 1 ” to the refresh trigger 105 . in this case , it is to be noted that the time elapse of the ssad 103 advances with a power source disconnected . an off - power state is maintained until the ssad 103 becomes able to send 0 / 1 signal to the refresh trigger 105 . when the memory device is connected to an external power and becomes in a power - on state , the 0 / 1 signal is sent to the refresh trigger circuit 105 . if the received signal is “ 0 ”, the refresh trigger circuit 105 does not make any operation . conversely , if the received signal is “ 1 ”, the refresh trigger circuit 105 gives the operational amplifier 104 instructions to refresh a memory cell array 115 . the operational amplifier 104 controls the wl decoder 111 and the bl decoder 113 using the hv amplifier 107 and the lv amplifier 109 . then , the operational amplifier 104 transfers the information recorded in part of the memory cell array 115 to a free space of the memory cell array 115 . when the write transfer of the memory is completed , the operational amplifier 104 again initializes the ssad 103 , and thus , a series of refresh operation ends . as described above , the operational amplifier 104 makes the refresh of the ssad 103 possible without connecting the controller 101 to the ssad 103 . this improves a degree of freedom in the chip configuration . the operational amplifier 104 has multifunction such as write , erase , read and addressing of a memory cell . according to the modification embodiment , when the predetermined time set in the ssad 103 elapses , a refresh signal is automatically issued via the operational amplifier 104 . therefore , even if the tunnel insulating film is thinned , preferable data retention characteristic is maintained . according to the foregoing embodiment and the modification examples 1 and 2 , it is not specifically limited what kind of memory device is used . this means that the present invention is realizable using an arbitrary non - volatile memory device . for example , the following memories are usable as memory cell . one is a semiconductor memory having a floating gate such as nand flash , nor flash , and eeprom . another is a semiconductor memory having a charge storage layer such as sonos or monos . still another is a novel memory such as fram , feram , pram or rram . the present invention is also applicable to any memory device on the market , such as an mram or hard - disk type magnetic memory . of course , the present invention is applicable to a dvd media or cd media . moreover , the present invention is applicable to a logic - memory embedded product such as a semiconductor chip for an ic card . the minimum unit of information stored in the memory cell array is defined as 1 bit . if the information is configured with 2 bits or more , the information is not necessarily stored on continuous addresses . rather , there are many cases where the information is stored on non - continuous addresses . a free space addresses searched as the destination transferred in the refresh operation may be non - continuous . however , it is desirable that the number of bits is equal to each other before and after the write transfer . moreover , refresh is possible in such a manner that a block including addresses recording the information is transferred to another block as a whole . in this case , the block is one group of the cells on the memory cell array composed of continuous addresses . the foregoing information presumes a state stored in the block . the addresses recording the information are not always continuous in the block . in this case , the capacity of the block must be set larger than that of the information . finally , the semiconductor time switch ( aging device ) used for the present invention will be briefly described . in the present invention , the aging device ( jp - a 2004 - 94922 ) invented by the inventors is effectively used for another purpose . fig9 a to 9d is a view to explain four basic functions of the aging device used for the present invention . fig9 a shows a state where , when time elapses and reaches the lifetime ( τ 1 ), the signal present in the aging device so far is extinct . fig9 b shows a state where time elapses to reach the lifetime ( τ 2 ) and a signal , which does not exist so far , is generated . fig9 c shows a state where , when time elapses and reaches a first lifetime ( τ 1 ), a signal , which does not exist so far , is generated and thereafter , at a second lifetime ( τ 2 ) longer than the first lifetime ( τ 1 ), the signal existing so far is extinct . fig9 d shows a state where , when time elapses and reaches the first lifetime ( τ 1 ), the signal existing so far is extinct , and thereafter , at the second lifetime ( τ 2 ) longer than the first lifetime ( τ 1 ), a signal , which does not exist so far , is generated . fig1 is a cross - sectional view showing one example of a single cell of an aging device ( ssad ) having a floating gate . when the ssad and a memory cell are embedded in one chip , the cell structure of the ssad should be as close as possible to that of a memory cell transistor in order to avoid troublesomeness of the product process . in order to attain this object , the patent applications are independently filed by the inventors in accordance with each structure . here , fig1 is shown as one example of an ssad cell . in this case , a write operation ( initialization of ssad ) can be performed similarly to nand flash or nor flash . in other words , the write operation is performed via fn tunnel injection , or hot electron injection . in the aging device , the data retention time is shorter as compared to the memory cell . thus , various designs are contrived in order to control the data retention time ( lifetime of ssad ). in fig1 , the tunnel film between the floating gate and the channel is formed thinner than that of the memory cell . this utilizes such characteristic that electrons directly tunnel through the floating gate and channel potential changes with elapsed time . this change with elapsed time causes a change with elapsed time of a current ( drain current , id ) between the source and drain . however , a method of realizing the foregoing change with elapsed time is not simply obtained as described above . as seen from fig1 , four ways are given in accordance with a transistor type . a normally - on type realizes a function of “ remember ” in the aging device ( corresponding to fig9 b ). a normally - off type realizes a function of “ forget ” in the aging device ( corresponding to fig9 a ). according to the normally - off type , electrons ( in the case of a pmosfet ) or holes ( in the case of an nmosfet ) are accumulated ( stored ) in the floating gate ( write ). as a result , the channel is inverted , and the transistor turns on . with elapsed time , electrons or holes leak out of the floating gate , and thus , the transistor turns off . time is the lifetime of a normally - off ssad . conversely , according to the normally - on type , holes ( in the case of a pmosfet ) or electrons ( in the case of an nmosfet ) are accumulated ( stored ) in the floating gate ( write ). as a result , the channel is turned off . with elapsed time , a charge leaks out of the floating gate , and thus , the transistor turns on . time is the lifetime of a normally - on ssad . the lifetime control of the ssad is performed by arranging the thickness of the tunnel film ; in this case , another method of using the features of the floating gate structure may be employed . as described above , fig9 a shows a function of a normally - off aging device , and fig9 b shows a function of a normally - on aging device . fig1 is a cross - sectional view showing one example of an aging device realizing a function of fig9 c . a normally - on cell is arranged on the left side and a normally - off cell is arranged on the right side . aging device cells arranged on the right and left sides may share the same diffusion layer to be connected in series , or , as shown in fig1 , the adjacent diffusion layers may be serially connected using an interconnect formed of such as metal . if the condition that the normally - on type cell and the normally - off type cell are connected in series is satisfied , plural normally - on type cells may be connected in parallel , or plural normally - off type cells may be connected in parallel , as shown in fig1 . the above configuration is sometimes necessary in order to precisely control the lifetime of the aging device . in fig1 , the lifetime of the left normally - on type cell is τ 1 , and the lifetime of the right normally - on type cell is τ 2 . in fig1 , the lifetime of the normally - on type cells connected in parallel on the left side is τ 1 . the lifetime of the normally - on type cells connected in parallel on the right side is τ 2 . in this case , the lifetime has a relationship of τ 1 shorter than τ 2 . in this case , τ 1 is a first lifetime , and τ 2 is a second lifetime . if the normally - off type having the lifetime τ 1 and the normally - on type having the lifetime τ 2 are connected in parallel under the condition that a relation of τ 1 & lt ; τ 2 , the function of fig9 d is realized . therefore , in all functions of fig9 a to 9d , parallel connection of the same type cells having relatively similar lifetime improves controllability of lifetime . fig1 shows one example of connection to improve the controllability . four basic operations of the ssad have been described using the ssad having the floating gate . of course , the four basic operations are realized by using various new memories , magnetic memories or dvd / cd media in addition to nand or nor flash memories and eeprom having the floating gate . in the present invention , use of the function of fig9 a or fig9 b is preferable in the four functions described in fig9 a to 9d . for example , in initialization , a read signal is sent to the ssad to read whether the output is on or off . the memory card is taken out of a reader , and it is left for a while as the power is in an off state . while the memory card is left , the ssad is in an output issuance standby state . the memory card is again inserted into the reader , and when the memory card becomes power - on state , the output of the ssad is read . if the output of the ssad is the same as initialized , the refresh trigger issues a refresh signal “ 0 ”. when the output of the ssad is different from that at the initialization , the refresh trigger issues a refresh signal “ 1 ”. when the refresh signal is “ 0 ”, the memory cell is not refreshed . conversely , when the refresh signal is “ 1 ”, the memory cell is refreshed . in this case , a fixed margin called as “ offset ” must be given between a signal level equivalent to on and a signal level equivalent to off in order to read the signal as a 0 / 1 digital signal . moreover , the data retention time characteristic is different every chip ; for this reason , refresh intervals ( that is lifetime of aging device ) is different . therefore , it is preferable to arrange the lifetime , which is set in initializing the aging device , in accordance with data retention time of the chip previously measured before delivery ( data retention time distribution edge determined according to ecc ). when refresh is carried out every block , the lifetime of the aging device is preferably arranged in its initialization , to adapt to different data retention time of each block . the refresh signals “ 0 ” and “ 1 ” may be replaced in its function , of course . according to the present invention , the refresh trigger circuit is used in combination with a battery - less time switch . therefore , even if the average value of the tunnel film thickness is made small , and bit data retention time is partially shorter than a predetermined standard , there can be provided a non - volatile memory which secures storage contents . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .	6
in the exemplary embodiment of the invention , shown in fig1 a card - controlled mobile station 1 comprises a master control unit mcu , a user interface ui , a high - frequency part rf , a low - frequency part audio , a power unit 2 , a first means for data transfer ir , and an application module connection unit 6 . the operation of the mobile station 1 is controlled by the mcu , which has a program code stored in advance for performing different operations . the user interface ui comprises components which are known from prior art mobile phones , namely a display 7 , a keypad 8 and status indicators 23 . the mcu produces various , situation - specific messages , operation instructions , menus etc . on the display 7 . using the keypad 8 , the user can enter different kind of information to the mobile station 1 , such as the identification number and telephone number , and select operations from the menus . the status indicators 23 can preferably be used to indicate the internal modes of operation of the mobile station 1 . the radio frequency component rf is a known component of mobile phones , which is used to transmit and receive calls and messages using radio frequencies in a radio communication network , such as a gsm network , e . g . through a mobile services switching center , msc . the low - frequency part audio preferably comprises a microphone 9 , a head - phone 10 and a buzzer 11 or the like . the operation power for the mobile station 1 is supplied by a battery 12 , which is charged when required . the power unit 2 monitors the charge status and charging procedure of the battery 12 , among other things . the power unit 2 sends the information to the central unit mcu when the charge status of the battery 12 falls below a predetermined value , whereby the mcu announces this preferably by sounding the buzzer 11 and / or showing a message on the display 7 . a module card 13 , like the one shown in fig3 a , is connected to the module card connector ( not shown ) located in the mobile station 1 . the module card 13 can contain , among other things , a subscriber identity module ( sim ) for user identification . application module connectors have been arranged in the application modules 19 in the module card 13 . fig3 b shows the internal structure of the sim as a simplified flowchart . the central processing unit cpu controls the operation of the sim on the basis of the program code stored in the program memory . various user - specific information can be saved in the data memory eeprom , and this information stays in the memory even if the control card sim is removed from the application module connection unit 6 . the application module connection unit 6 is located in the mobile station 1 as shown in fig1 and 2 . during the operation of the control card , the operation memory ram ( fig3 b ) can be used as a temporary data storage . the bus adapter data - i / o fits the sim card to the application module bus 14 and to the control and data line i / o ( fig2 ). other module cards 13 can also be connected to the application module connection unit 6 of the exemplary embodiment in fig1 whereby they are preferably connected to their own module card connectors . the application module 19 ( fig3 c ) on the module card 13 can have a similar mechanic and electric construction as the sim card shown in fig3 a and 3b . from the application module connection unit 6 to the central processing unit of the mobile station 1 ( mcu ), there is an application module bus 14 , by means of which the application modules 19 connected to the application module connection unit 6 communicate with the mcu . the at commands , known e . g . from modems , can be used for the transfer of data and commands . the at commands have been described in more detail e . g . in the master of science thesis of petri heinonen , &# 34 ; proposal for standard at commands used with gsm mobile equipment &# 34 ;, 1994 , tampere university of technology . in addition to the application module bus 14 , there is a separate control and data line i / o , i / o &# 39 ;, i / o &# 34 ; ( fig2 ) from each application module connector 15 , 16 , 17 , of the application module connection unit 6 . thus it is possible to use a structure based on the standard series iso 7816 in the control and data line . the standard series iso 7816 includes the voltage levels and timing diagrams , according to which the application modules 19 ( fig3 c ) are connected to the control and data line i / o , i / o &# 39 ;, i / o &# 34 ;. for each application module 19 , the application module connecting unit 6 has a connector , through which the application module bus 14 is led to the application module 19 . more than one application modules 19 can be connected to the same module card 13 , as shown in fig3 c . the second application module 19 &# 39 ; on the module card 13 can be a sim module , for example . the mobile station 1 also comprises a first means of data transfer , such as an infra red ir transmitter / receiver . the first means of ir data transfer can be used to transfer data , with relatively short distances , between the mobile station 1 and a cash register ( payment terminal ) 21 or , e . g ., between two different mobile stations 1 ( fig7 ). the first means of data transfer ir may also include a data connector 20 , which can be used to connect a computer to the mobile station 1 ( fig1 ). fig4 a and 4b show how the application 18 is activated and inactivated , and how the application 18 is switched from the first mode of operation to the second mode of operation and vice versa . in this patent application , the first mode of operation means a mode in which the application does not do anything actively , but gets instructions through an application in the second mode of operation or through the mcu . the second mode of operation means a controlling mode , whereby an application in the second mode of operation can control the operation of various units of the mobile station 1 , including the central unit mcu , and send messages to other applications . the mcu can also have two different modes of operation : 1 ) normal mode and 2 ) application mode . in the normal mode , the central unit mcu operates like in a known mobile phone , controlling the operation of the mobile station . in the application mode , the mcu can be controlled by an application 18 ( fig3 c ), which is in the second mode of operation . even in the application mode , the central unit mcu can read the keypad 8 and send information of keypad input to the application 18 in the second mode of operation , if the said application 18 requests it . in the example shown in fig4 a , the procedure starts from the switching on ( 100 ) of the mobile station 1 , whereafter the mcu of the mobile station 1 sets the control and data line i / o of the first application module connector 15 ( fig1 and 2 ) to the reset status ( block 101 ). if an application module 19 ( fig3 c ) has been connected to the first application module connector 15 , and the said module 19 sends an acceptable iso 7816 answer ( block 102 ) to the mcu , the mcu sets the control and data line i / o of the first application module connector 15 to the allow status ( block 103 ). in block 104 the mcu concludes whether all application module connectors 15 , 16 , 17 , have been examined . if all application module connectors 15 , 16 , 17 have not yet been examined , the procedure returns to block 101 , in which the next application module connector 16 , 17 , is examined . if the mcu gets no response in block 102 , or if the reply is not acceptable , the procedure continues in block 105 , in which the mcu concludes that an iso 7816 based application module 19 has not been attached to the application module connector 15 , 16 , 17 . when all application module connectors 15 , 16 , 17 have been examined , the procedure continues in block 106 , in which the user identification , which is a known operation e . g . from a gsm network , is performed . if the user identification fails , the power - up procedure of the mobile station 1 is stopped ( block 107 ). the user has generally three opportunities to give his / her own personal identification number . if the identification number is not given right at the third time , the user must give a longer identification code , after which the user has again three opportunities to give his / her own personal identification number right . if the user does not give the right identification number at any of these three extra opportunities , either , the user must give the longer and shorter identification code again . if the identification number is not given right after the allowed number of attempts , the control card destroys the information contained in it , whereby the control card sim is permanently disabled . when the personal identification number has been given successfully , the mcu moves to block 108 , in which the mcu queries the information of applications 18 contained in the application module 19 connected to the first application module connector 15 . if the application module 19 contains applications 18 , the mcu reads the information of applications 18 ( block 109 ) and saves them to its memory ( block 110 ). if the examined application module 19 does not have applications 18 , or there is no application module in the connector , the mcu saves this information in its memory ( block 111 ). in block 112 the mcu concludes whether all application modules 19 have been examined . if there are still application modules 19 , which have not been examined , the procedure returns to block 108 , which queries the information of applications 18 contained in the next application module 19 . when the mcu has examined all application modules 19 , the procedure continues after block 112 in block 113 , in which the mcu prints a menu on the display 7 of the mobile station 1 , and the user can select from the menu the application 18 , which is to be switched to the second mode of operation , to control the mcu . if the user selects an application 18 , the mcu asks which parts of the user interface ui are required by the application 18 , such as the display 7 , the keypad 8 and / or the status indicators 23 . if the mcu does not get an acceptable answer from the selected application 18 , the procedure returns to block 113 . whereas if the mcu gets an acceptable answer from the selected application 18 , the mcu switches to the application mode , i . e . to be controlled by the selected application 18 ( block 115 ). if the user does not select an application 18 ( block 113 ), the mcu switches to the normal mode ( block 116 ), in which no application 18 controls the mcu , but all applications 18 are in the first mode of operation . in the normal mode , block 117 , the mcu can print a menu on the display 7 of the mobile station 1 , a menu which contains the applications 18 available in the application modules 19 . from the menu , the user can select the application which is to be switched to the second mode of operation ( block 118 ). if the module card 13 is detached from the module card connector , all applications 18 in the detached module card 13 will be removed from the menu of the mobile station 1 ( block 128 ). in block 118 , the situation , where the mcu queries the applications 18 contained in the selected application module 19 , is described . if the mcu gets an acceptable answer from the application module 19 , the mcu ignores power - up - type applications 18 , but saves information of other applications ( block 119 ). if the mcu does not get an acceptable answer from the application 18 , no new applications 18 will be added ( block 120 ). if the mcu is in the normal mode of operation in block 116 , and the user selects an application 18 from a menu , or an application 18 of an automatic type informs the mcu that it is switching to the second mode of operation , the mcu will ask which units of the user interface ui of the mobile station 1 the application 18 , switching to the second mode of operation , will need ( block 121 ). if the mcu does not get an acceptable answer from the application 18 , the operation of the mcu will move to block 117 . if the application 18 gives an acceptable answer to the mcu , the mcu will switch to the application mode ( block 115 ). when the mcu is in the application mode ( block 115 ), and the precondition for an application 18 of the automatic type to switch to the second mode of operation is satisfied , that moment the application 18 in the second mode of operation is queried whether the application of an automatic type can switch to the second mode of operation ( block 122 ). if switching is not allowed , the procedure returns to block 115 . if switching is possible , the mcu asks the application of an automatic type 18 which units of the user interface ui of the mobile station 1 it needs ( block 123 ). if the answer is not acceptable , the operation of the mcu returns to block 115 again . when the answer is acceptable , the application 18 of an automatic type switches to the second mode of operation to control the operation of the mcu , and at the same time the application 18 , which was in the second mode of operation , switches to the first mode of operation . if the module card 13 , containing application modules 19 , the applications 18 of which are in the first mode of operation , is removed from the module card connector , the said applications 18 will be removed from the menu . if a new module card 13 is added to the mobile station 1 , the identifying parameters of applications 18 of application modules 19 in the module card 13 are queried in block 125 . if the application module 19 sends the identifiers to the mcu , the mcu rejects power - up - type applications 18 and saves the other applications 18 contained in the application module 19 in block 126 . if no acceptable answer is received from the application module 19 , the information of the application module will not be added ( block 127 ). if a module card 13 is removed from the module card connector , the said card 13 containing a power - up or automatic type of application 18 , which is the second mode of operation , the mobile station 1 is switched off . otherwise the mcu returns to the normal mode ( block 116 ). an application 18 of the menu or automatic type being in the second mode of operation can also return automatically or be returned manually by the user to the first mode of operation ( 129 ). in the following , the operation of a cash card or other payment card application in a mobile station 1 representing an embodiment of this invention will be described in principle ( fig6 ). the mobile station 1 has both the control card sim and one application module 19 connected to it , and the said module 19 contains an application 18 ( not shown in fig6 ), which in this example is a cash card application . the application 18 has at least one account corresponding to the user &# 39 ; s bank account , whereby the user can make payments from the account in the application 18 . preferably , when the application 18 has been brought into use , the balance information has been read from the bank account , e . g . using the normal data channel of the gsm network or as a sms message , and saved to the data memory eeprom , which is part of the application module 19 and is used by the application 18 . in connection with the payment , the application 18 reduces the balance of the account in the application 18 accordingly . the updating of payment transactions etc . in the application 18 to the user &# 39 ; s bank account can take place preferably automatically , controlled by the application 18 , e . g . at a certain time , and / or as selected by the user from a menu of the mobile station 1 , and / or in connection with the payment . when the bank account is updated , the application 18 guides the mcu to establish a connection for data transfer through a mobile services switching center msc , and most often through some private wired network , to the computer 22 in the bank . establishing the connection can take place either by asking the user for the telephone number first , or by using a number saved in the memory of the application , which makes the procedure easier . preferably , if sms messages are used to update the balance information , the normal speech / data channel is free for other activities . in the mobile station 1 , the user can have many different accounts at the same time , such as a bank account , a credit account and / or a cash account , and they can be in different applications 18 , even in different application modules 19 . an advantage of this method is , among other things , the fact that the user can transfer money between the accounts , e . g . from a credit account to a bank account or cash account . the application 18 can be brought into use e . g . after the mobile station 1 has been switched on , as is shown in the flowchart of fig4 a and 4b . the mcu prints a message to the display 7 for entering the identification number . the user enters his / her own identification number , which is read by the mcu and transmitted to the sim card . the central processing unit cpu in the sim examines the entered identification number by comparing it to the previously saved identification number and informs the mcu whether the identification number has been given right . if the identification number was not right , the mcu can ask the user to give it again . if the identification number has been given right , the mcu operates in accordance with the phases described above . because there are no other application modules 19 in the other connectors 16 , 17 , in this embodiment , the mcu prints a menu to the display 7 , from which the user can select an application 18 of the application module 19 , which application is a cash card application , whereafter the application 18 switches to the second mode of operation , and the mcu switches to the application mode . ordinary phone calls can be made with the mobile station 1 . all the other functions of the mobile station 1 are also available . the essential difference is that when the user enters a telephone number from the keypad 8 , the mcu transmits the key press information to an application in the second mode of operation , which guides the mcu to establish a connection . if a user wants to inquire the balance of his / her bank account , he / she will first select the menu function using the keypad 8 , whereby the mcu transmits the key press information to the application 18 . the application 18 guides the mcu to print a menu to the display 7 , from which the user can select a balance query . after the user has selected a balance query from the menu , the mcu transmits the key press to the application 18 , which examines it and sends a message to the mcu , which then prints a text on the display 7 , telling the user that the mobile station 1 is performing a balance query . next the application retrieves the balance saved in the data memory eeprom of the application module and forms a message by which the mcu prints the balance on the display 7 . the following is an example of the implementation of the aforementioned balance query using at commands : ______________________________________event code : + ckev : 91 , 1 ( choose menu ) at command : at + cdis =&# 34 ; nokset &# 34 ;, &# 34 ; view &# 34 ;,&# 34 ; menuv &# 34 ;,&# 34 ; &# 34 ;,&# 34 ; &# 34 ;,&# 34 ; quit &# 34 ; ( update display ) at command : at + cind =,,,, 11 , 11 ( update indicators ) event code : + ckev : 91 , 0event code : + ckev : 49 , 1 ( choose menu number 1 . . . ) at command : at + cind =,,,, 11 , 1event code : + ckev : 49 , 0event code : + ckev : 53 , 1 (. . . number 15 ) at command : at + cind =,,,, 1 , 5event code : + ckev : 53 , 0at command : at + cdis =&# 34 ; nokset &# 34 ;,&# 34 ; amount of &# 34 ;,&# 34 ; balance &# 34 ;,&# 34 ; &# 34 ;, &# 34 ; ok &# 34 ;,&# 34 ; quit &# 34 ; ( display menu 15 ) at command : at + cind =,,,, 0 , 0event code : + ckev : 91 , 1 ( choose &# 34 ; ok &# 34 ;) at command : at + cdis =&# 34 ; nokset &# 34 ;,&# 34 ; requesting . . . &# 34 ;,&# 34 ; &# 34 ;,&# 34 ; &# 34 ;,&# 34 ; &# 34 ;, &# 34 ; quit &# 34 ; event code : + ckev : 91 , 0at command : at + cmgs =&# 34 ; 12345678 &# 34 ; request amount of balance message z ( send short message ) event code : + cmt text : &# 34 ; 12345678 &# 34 ;, 12 ( receive result ) 125232 , 69 mk 0 , 0 , 0 ,, 94102610100058 , 8 , at command : at + cdis =&# 34 ; nokset &# 34 ;,&# 34 ; you have &# 34 ;,&# 34 ; 125232 , 69 mk &# 34 ;, &# 34 ; &# 34 ;,&# 34 ; &# 34 ;,&# 34 ; quit &# 34 ; ( display result ) ______________________________________ in the previous example , the balance inquiry was done from the memory of the application module in the mobile station . typical for these account based applications is the need of data transfer between the mobile station and the bank . if that data transfer fails , for some reason , it may be necessary to do the balance inquiry or update &# 34 ; manually &# 34 ; from the bank . if the user selects direct balance inquiry , using e . g . a menu , the mobile station transmits a balance inquiry to the bank using e . g . short message service sms , if available . in the message there is the current balance of the account in the application , from the application module &# 39 ; s memory , included . therefore , when the bank returns the updated balance , preferably both the changes in the application module &# 39 ; s and bank &# 39 ; s accounts can be taken into account . payments from the account can also be made easily by entering the appropriate information from the keypad 8 of the mobile station 1 . the following is a description of one exemplary embodiment of the invention , in which the application 18 is a cash application , by which payments can be made e . g . in shops or buses . the application 18 is identified as shown in the previous example . when the application 18 has switched to the second mode of operation , the user can establish a connection with the mobile station 1 to the computer 22 in the bank , and transfer money from his / her account to the cash application . in practice , the transfer takes place electronically , whereby the balance of the cash card increases and the balance of the bank account decreases . the user performs internal bank transfers with the mobile station 1 from the bank account of the payment application to the cash application or vice versa . internal bank transfers require that the information on the transfers must be updated to the computer 22 in the bank . for making the payment , the user enters a certain code , by which he / she informs the application 18 that he / she wants to pay for the shopping . after this , the application establishes a connection through the mcu to the first means for data transfer ir , such as an ir transmitter / receiver or the like . second means of data transfer are arranged in the cash register 21 or the like in the shop , through which means the application 18 and the epos ( electronic point of sale ) terminal application of the cash register can have a mutual connection for data transfer . when the connection has been established , the user enters the identification number of the cash card , and the cash card application compares it to the previously saved identification number . if the identification number has been given right , and the application 18 has sufficient balance , the payment transaction is registered both in the cash register 21 and the application 18 of the mobile station 1 , whereby the balance on the cash card is decreased correspondingly . the updating of the payment transaction to the computer 22 can take place either from an epos application or from the application 18 of the mobile station 1 . in ir data transfer , it is preferable to use a known standard , such as the protocol stack defined by irda ( infrared data association ), which is based on the osi ( open systems interconnection ) model of iso . the protocol stack uses the layers of the osi model : 1 ) physical layer , 2 ) data link layer , 3 ) network layer and 7 ) application layer . on the physical layer , data transfer can be based on infrared , but other known methods of data transfer , such as ultrasound , electromagnetic induction or radio waves , can also be used . data transfer is secured in the data link layer , e . g . by error correction algorithms . in addition , the functions of the data link layer are used for identifying the means for data transfer in situations in which many means of data transfer can be operating simultaneously , e . g . in shops where there are many epos applications . in the network layer , the messages going through the means for data transfer can be distributed to the receivers regardless of the number of means for data transfer in operation . in addition , the information to be transmitted can be enciphered in the network layer , which is particularly important in payment applications . the application 18 is capable of data transfer through the application layer , in which the application 18 sends and receives information needed for data transfer through the mcu preferably to the first means for data transfer , ir , or to the radio communication network . correspondingly , the other piece of equipment participating in the data transfer , such as the cash register 21 ( fig6 ), has an epos terminal application , which handles messages it has received through other means of data transfer ir2 , in accordance with the layer structure described above . fig5 shows a simplified diagram of a telephone call between the application and the mobile services switching center msc , which is part of a mobile services network . at step 200 , the application sends the telephone number to be called to the mcu of the mobile station 1 , which sends to the mobile switching center msc the identification data and other data needed for establishing a connection ( steps 201 , 202 and 203 ). the switching center msc transmits information of the progress of the call ( step 204 ) and the state of the connection ( step 205 ) to the mobile station 1 , after which the mobile station 1 sends acknowledgment of connection to the msc ( step 206 ) and to the application 18 ( step 207 ). for closing the connection , the application 18 sends a close connection command to the mcu of the mobile station 1 ( step 208 ), which sends a close connection request to the mobile services switching center ( step 209 ). the msc sends a connection closed acknowledgment to the mcu of the mobile station 1 ( step 210 ). finally , the mcu of the mobile station 1 sends to the application 18 information of the closing of the connection ( step 211 ). in the previous exemplary embodiment of the invention the money was stored in an account , finally located in a money server in a bank . therefore it was necessary to update the balance in the mobile station and in the bank . in another embodiment of this invention the electric money is stored to the mobile station itself . when that kind of electric money ( also referred as &# 34 ; digital cash &# 34 ;) is used , e . g . for paying parking fees or phone bills , the corresponding amount of money is cut down from the electric money purse of the mobile station . the &# 34 ; digital cash &# 34 ; can be stored e . g . as a code word in mobile stations memory . no link between the payment terminal 21 ( fig6 ) and the money server 22 is required at the moment when the payment is made when the &# 34 ; digital cash &# 34 ; has run out or more is needed , the electric money purse of the mobile station needs reloading . there are several methods to do that . one method , close to the approach with real money and atm ( automatic teller machine ) machines , would be to walk to the nearest &# 34 ; digital cash atm &# 34 ; to download more money from the account . this is not very handy , because it will take some time before these kind of &# 34 ; digital cash atm &# 34 ; machines are widely available . the present invention offers a much more convenient way to do the reloading of &# 34 ; digital cash &# 34 ;. using the sms service , it is possible to download more &# 34 ; digital cash &# 34 ; from the bank account to the mobile station , using a method close to the one described in the previous embodiment of the invention concerning balance inquiry . the mobile station sends a request to send more &# 34 ; digital cash &# 34 ;, e . g . as a sms message , to the money server responsible for the user &# 39 ; s account . as a response , suppose the account has balance , the money server sends &# 34 ; digital cash &# 34 ; to the mobile station , where it is stored to the memory . the network , where the mobile station in accordance with the invention is used is not limited to gsm only , gsm is a good example of a system that offers required data transfer possibilities . particularly the sms messages available in gsm network are handy , because the normal phone / data channel is not effected when transferring sms messages . in addition to payment applications , the method of the invention can also be used for other kinds of applications . for example gathering and presenting other information , such as timetables , stock prices , exchange rates , etc . each of the previous examples can be implemented in a separate application module , or the wanted functions and applications can be combined to a multi - functional application module for the mobile station . fig7 shows an application in which two mobile stations 1 do communicate with each other by means of the first means of data transfer ir . it is possible to transfer e . g . data and / or speech . preferably the first means of data transfer ir makes it possible to connect the mobile station 1 also e . g . to a movable pc which has the corresponding means for data transfer ir or to a wireless lan ( local area network ). the method of the invention provides a flexible means for increasing the usability of the mobile station 1 . a mobile station 1 in accordance with the invention can make use of various services from suppliers who produce and sell applications 18 . for credit card companies , a method like this is one way of reducing misuse of credit cards . the invention is not limited to the above described exemplary embodiments only , but its details can be modified without departing from the scope defined by the attached claims .	6
to achieve the desired alkali resistance , replacement of fatty acid dimer based polyamide resins such as uni - rez 2633 from arizona chemical is required . direct replacement can be costly but effective , however , often additional stabilizers and plasticizers are also needed in the final composition to endure the longer term flexibility and stability demands on preformed thermoplastic pavement markings . for example , escorene ultra ad2528 ® and escorene ultra ul7510 ® are both such vinyl acetate copolymers provide by exxon - mobile corporation which can be used as a major component in the preferred hot melt adhesive . one preferred hot melt adhesive is formulated with the ad 2528 as well as ester modified rosins , fillers , extenders , levelers and other conventional components . the general alkali resistant formulation generally comprises a tackifier resin ( 5 - 15 weight percent ), an ethylene vinyl acetate ( eva ) polymer , pigment ( 2 - 10 weight percent ) that is normally titanium dioxide with or without an organic ye ( depending on the desired color ) and 60 - 80 weight percent of a filler that is calcium carbonate , glass beads , funed silica , and aggregate . common test methods for measuring the effectiveness of these pavement markings for alkali resistance include bs en 1871 : 2000 and also includes methods for testing heat stability , cold impact , softening point , indentation , and wear resistance . all of these parameters are important in finalizing compositions which meet the needs of the alkaline concrete environments that are the subject of the present disclosure . it has also been shown that it is possible to use single grit size aggregate in the intermix . the use of an intermix of different grit sized aggregates in different proportions based on the need for the future use of different materials ( larger sizes for thicker and larger thermoplastic sheets and smaller aggregates for narrow strips ) is also part of the present disclosure . in the present invention , the use of uniform particulate material or blends of particulate materials for the aggregate with differing hardness values , providing more economical solutions , can be introduced into the intermix during formulation . the introduction of these blends usually occurs prior to extrusion and completion of the thermoplastic pavement marking . the aggregates and other particles such as glass beads and the inorganic choices stated above can also , however , be dropped on the hot material during installation and completely embedded into body of the thermoplastic marking material in that fashion . the preformed thermoplastic surface marking product can be applied using pressure sensitive adhesives as well as by flame torching . in addition , in recent years increasing numbers of municipalities , office complexes , shopping centers and other commercial developments have utilized thermoplastic pavement markings with various patterns and designs to guide , decorate , and protect high traffic areas such as highways , pedestrian crosswalks , parking lots and business entrances . such patterns may include a first section or grid , for example to represent the mortar joints in a “ brick ” design and a plurality of second sections or “ bricks ” which are coplanar therewith , usually in a color different from the mortar color . the second section or bricks which are separately manufactured are inserted into the first section or grid before application of the pattern to the pavement . various two section marking patterns are commonly available such as : herringbone , standard brick , cobblestone , paving slabs and many other designs . marking patterns with more than two sections are also commonly available such as horizontal highway and street signage , logos and many others . as hereinbefore mentioned , these marking patterns consist of two or more independent sections which must be carefully assembled and handled before applying to pavements such as asphalt , concrete or other suitable substrates . these marking patterns are placed at desired locations such as road crosswalks , intersections , parking lots or other sites . in some cases heat is then applied to soften the pavement marking pattern causing it to firmly adhere to the substrate . various adhesives can also be used to adhere the marking pattern to the substrate . while the purchase of such pavement marking patterns is relatively inexpensive , much time and labor is devoted to the assembly and application of the pattern to the substrate . most patterns consist of two or more sections which are independently formed for manual assembly at the job site and time and effort is needed to assemble and maintain the integrity of a pattern before the heat treatment . usually the pattern placed on the substrate must be moved manually for adjustment purposes . during such movement , the independent sections in the pattern inadvertently become unaligned , requiring reinsertion or realignment . if the realignment is not precisely accomplished , the marking pattern will have lost its integrity and the entire pattern must be removed manually from the substrate , the substrate cleaned and a second attempt at the application made with the reinserted or new marking pattern . this re - application results in extra time , labor , and materials . in the past , to maintain the integrity of the marking pattern before the heat treatment and during the handling and placement , “ spot adhesives ” have been used which remain somewhat “ tacky ” after being applied to the bottom of the patterns at the grid intersections to maintain pattern integrity . however , these small adhesive circles or “ spots ” are generally a different type of polymer than the marking pattern and can prevent proper attachment and easy movement of the marking pattern on the substrate at the spot adhesive locations before and during the heat application of the marking . also , certain spot adhesives are not compatible with the plastic materials from which the patterns are formed and can cause the pavement marking sections to separate from the substrate after the heat application , as only a weak bond is formed with the substrate . the above stated objectives are realized by providing a conventional pavement marking pattern formed of a thermosetting or thermoplastic which may have two or more sections , manually joined by bridging the bottom surface thereof with an adhesive having substantially the same temperature softening point as the sections of the marking pattern . the adhesive can be sprayed primarily along the intersections of the pattern to cover a percentage ( approximately from 5 % to 90 %) of the patterned bottom surface area while bridging the intersections . the more intricate the pattern ( with more joints or intersections ) the greater the percentage of adhesive coverage required . the spray adhesive can be a typical polyamide , eva based hot melt adhesive or other , such as styrene - isoprene - styrene copolymers , styrene - butadiene - styrene copolymers , ethylene ethyl acrylate copolymers , and polyurethane reactive , and preferably for the purposes of this disclosure consists of a hot melt eva resin based adhesive which is sprayed in a circular or spiral string like configuration at a temperature at or above its softening point . the sprayed hot adhesive strikes the marking pattern and adheres , bridging and bonding the pattern sections to maintain pattern integrity during subsequent handling . in a typical manufacturing process , various sections of a pavement marking pattern ( e . g . a brick and mortar pattern or any other desired pattern ) are factory assembled and while in assembled form , the bottom of the pattern is sprayed with the hot melt adhesive described above using preferably spray gun model : hysol - 175 - spray as manufactured by loctite corporation of 1001 tout brook crossing , rocky hill , conn . 06067 , having various pressures and nozzle settings to select from , depending on the viscosity of the particular adhesive employed . a circular or spiral string - like adhesive configuration is preferred for the spray . once the sprayed hot melt adhesive has cooled , the grid and inserts are suitably bridged and joined and the pavement marking pattern is packaged for shipment . upon receipt at the job site , the packages are opened and after the intended substrate , usually asphalt or concrete is properly cleaned and swept , the marking pattern is then placed on the substrate without concern of disassembly during handling , movement and adjustment . once suitably placed , a heat application is delivered from a conventional source which softens the marking pattern and the underlying sprayed adhesive , both of which have the approximate same temperature softening point to thereby affix the pavement marking pattern to the substrate . time and labor are thereby saved as the marking pattern sections have been adhered to form a unified pattern by the hot melt adhesive . among additional objectives of the invention include providing a relatively inexpensive pavement marking pattern having two or more sections in which the sections are joined by use of an applied alkaline resistant adhesive and to provide a method for forming a pavement marking pattern which allows cost efficient factory assembly of the pattern and which prevents dislodging and separation of the pattern sections during handling , transportation and application . other objects of the invention are to provide an adhesive which can be conveniently sprayed onto the back of pavement marking patterns which will sufficiently adhere thereto and prevent separation of the sections during handling , and not deteriorate the bond between the pavement marking pattern and the substrate and to provide a method for easy application of the adhesively sprayed marking pattern to the substrate . it should be understood that although examples are given it should not be construed that these are examples provide the only examples of the invention and that variations of the present invention are possible , while adhering to the inventive concept herein disclosed . fig1 , 2 , and 3 provide photographs of actually tests conducted in the file don concrete surfaces in texas over a time period of 11 months . it is clear that the test is to determine visual differences that occure for the preformed thermoplastic markings on actual road surfaces over time . the only formulation which passed the visual indication test ( less than 5 percent of the area coverage missing after 11 month )— as shown in fig3 , was as follows ; an example of the eva resin composition for the preformed thermoplastic of the present invention is provided as follows : using a flint - 2000 propane torch , the material composition was applied on two square cement boards ( 20 inches by 20 inches ). as an illustration , comparative example 1 uses polyamide resin with the intermix . although the invention has been described in considerable detail with reference to certain preferred versions thereof ; other versions are possible . for example , the coating compositions can include one or more ingredients that enhance other film properties such as gloss , etc . therefore , the spirit and scope of the claims should not necessarily be limited to the description of the preferred embodiments contained herein .	2
fig4 is a plan view of a semiconductor device according to an embodiment of the present invention , and fig5 through 7 are sectional views illustrating a process for manufacturing the semiconductor device , taken along line a - a ′ of fig4 . referring to fig4 and 5 , the top surface of a semiconductor substrate 20 , which is , for example , formed of a silicon single crystal , is divided into two regions : a cell region c , on which semiconductor memory devices will be formed , and a peripheral region p , which is formed around the cell region c and on which some control devices and dummy devices will be formed . a real active region 21 a , surrounded and defined by a device isolating region 22 , is formed in the cell region c . a plurality of dummy active regions 21 c , surrounded and defined by the device isolating region 22 , are formed in the peripheral region p . real active regions 21 b are also formed in the peripheral region p . when the peripheral region p is formed as a single device isolating region without forming the plurality of dummy active regions 21 c , chemical mechanical polishing cannot be performed smoothly due to a relatively large device isolating region when shallow trench isolation ( sti ) is applied in the peripheral region p , and thus a plurality of the dummy gates 21 c , which have no relevance to circuit operations , are formed in the peripheral region p . semiconductor devices such as a control device carrying out circuit operations , which is , for example , a transistor , may also be located in a certain area of the peripheral region p , and a plurality of real gate parts 24 b can also be formed on the real active region 21 b of the peripheral region p by having a gate insulation layer ( not shown ) therebetween . as shown in fig4 , the dummy active regions 21 c formed in the peripheral region p extend linearly in the present embodiment . the device isolating region 22 is formed by forming a mask pattern defining the device isolating region 22 on the top surface of the semiconductor substrate 20 , forming a trench by etching a portion of the semiconductor substrate 20 by using the mask pattern as an etch mask , and filling the trench with insulating materials , such as an oxide and / or a nitride , through a gap filling operation . after the device isolating region 22 is formed , a gate insulation layer ( not shown ) is formed over the semiconductor substrate 20 , a gate part forming material is formed to a predetermined thickness , and a gate part pattern is formed through a lithography operation . as shown in fig4 and 5 , the real gate parts 24 a are densely formed on the real active regions 21 a in the shape of line / space pattern in the cell region c . in the peripheral region p , the dummy gate parts 24 c are formed on the dummy active region 21 c having a linear shape in a stripe pattern . each of the dummy gate parts 24 c covers two of the dummy active regions 21 c in the present embodiment . however , the present invention is not limited to that configuration , and each of the dummy gate parts 24 c can cover two or more dummy active regions 21 c . for example , n dummy active regions and ( n − 1 ) device isolating regions between the dummy active regions can be either bundled by using one of the dummy gate parts or bundled by a plurality of the dummy gate parts . as the single dummy gate part covers a plurality of the dummy active regions 21 c and device isolating regions 22 , density of the dummy gate parts 24 c in an overall area of the peripheral region p can be increased . while only one dummy gate part 24 c is shown in fig4 and 5 for simplicity of description , a plurality of the dummy gate parts 24 c may be formed adjacent to each other . after the real gate parts 24 a and 24 b and the dummy gate parts 24 c are formed , ions are implanted to expose a portion of the semiconductor substrate 20 by using the real gate parts 24 a and 24 b and the dummy gate parts 24 c as an ion - implanting mask . therefore , it may be preferable for each of the dummy gate parts 24 c to completely cover the dummy active regions 21 c below the dummy gate part 24 c to prevent the dummy active regions 21 c from becoming conductive due to ions being implanted into the dummy active regions 21 in a subsequent ion - implanting operation . the number of dummy active regions corresponding to the number of dummy gate parts is increased to increase the area occupied by the dummy gate parts 24 c in the peripheral area p , that is , to increase the density of the dummy gate parts 24 c , because each of the dummy gate parts 24 c corresponds to one of the dummy active regions 21 c in a semiconductor device having a dummy gate in the prior art . while either each of the dummy active regions , or the device isolating region 22 surrounding each of the dummy active regions 21 c needs to be minimized to increase the number of the dummy active regions 21 within the device isolating region having a limited area in the peripheral region p , there is a limit in making the patterns for the dummy active regions and the device isolating regions finer . also , the area of the device isolating region 22 between the dummy active regions 21 c become smaller as the number and area of the dummy active regions 21 c increase . furthermore , it becomes less suitable for performing sti to form the device isolating region 22 . however , since the dummy active regions 21 c and the dummy gate parts 24 c do not correspond to each other in a one - to - one basis , the density of the dummy active regions 21 c and the density of the dummy gate parts 24 c can be optimized separately . therefore , after the dummy active regions 21 c are formed in the density optimal for performing sti smoothly , the dummy gate parts 24 c can be formed in any density concerning the density of the real gate parts 24 a in the cell region c , where it is not necessary to concern the density of the dummy active regions 21 c . the term ‘ density ’ here refers to a ratio of an area occupied by a certain component to the entire surface area . for example , the density of the real gate parts 24 a in the cell region c refers to the ratio of the area occupied by the real gate parts 24 a in the cell region c to the entire surface area of the cell region c . referring to fig6 , a thick interlayer insulation layer 26 is formed over the real gate parts 24 a and the dummy gate parts 24 c on the semiconductor substrate , wherein the interlayer insulation layer 26 may be formed of , for example , an oxide or a nitride . at this point , the interlayer insulation layer 26 in the cell region c is formed evenly due to the densely concentrated real gate parts 24 a . since the dummy gate parts 24 c have a sufficient density , less of the material forming the interlayer insulation layer fills spaces between the dummy gate parts 24 c , and thus the interlayer insulation layer 26 in the peripheral region p can also be formed evenly . referring to fig7 , cmp is performed on the interlayer insulation layer 26 to even the surface of the interlayer insulation layer 26 . since the density of the real gate parts 24 a in the cell region c is not significantly different from the density of the dummy gate parts 24 c in the peripheral region p , the volumes of slurries used for the cmp are nearly same in both regions c and p , and thus the loading effect can be prevented . also , there is little level difference between the cell region c and the peripheral region p , and thus the evenness of entire surface is significantly improved . therefore , a circuit layer or other interlayer insulation layer ( not shown ), which is to be formed later , can be formed to be flat with little level difference between the cell region c and the peripheral region p , and thus the formation of circuit patterns on the layers can be performed successfully . fig8 is a plan view showing a positional relationship between dummy active regions 34 and dummy gate parts 36 in a peripheral region of a semiconductor device according to another embodiment of the present invention . referring to fig8 , while the dummy active regions 21 c , surrounded by the device isolating region 22 , are formed to extend linearly in the semiconductor device shown in fig4 , the dummy active regions 34 in the semiconductor device of the present embodiment are formed in island shapes by a device isolating region 32 , and a plurality of the dummy active regions 34 are formed in matrix shape in the peripheral region . as described in the previous embodiment , the density of the dummy active regions 34 may be set to an optimal density for smoothly performing sti to isolate devices in the peripheral region . thus , the sti can be performed smoothly without minimizing either size of the dummy active regions 34 or width of the device isolating region 36 between the dummy active regions 34 . the dummy active regions 34 arranged in matrix shape can be bundled by dummy gate parts 36 having appropriate sizes . although a case in which four dummy active regions 34 are bundled by one dummy gate part 36 is shown in fig8 , the present invention is not limited thereto . the dummy gate parts 36 can be arranged in various combinations as long as each dummy gate part 36 can cover any number of the dummy active regions 34 and the number of the dummy active regions 34 is two or more . also , it is advantageous that the dummy gate parts 36 are formed to have a specific size and arrangement such that a difference between the density of real gate parts in the cell region and the density of the dummy gate parts 36 is within a permissible range and is as small as possible to ensure surface evenness of an interlayer insulation layer , which is to be formed later , after performing cmp on the interlayer insulation layer . fig9 is a plan view showing a positional relationship between dummy active regions 44 and dummy gate parts 46 in a peripheral region of a semiconductor device according to another embodiment of the present invention . referring to fig9 , the dummy active regions 44 , defined by a device isolating region 42 , are arranged in a line and island pattern , and the dummy gate parts 46 are arranged in various patterns in correspondence to the pattern of the dummy active regions 44 . while the embodiments of the present invention have been particularly shown and described , the invention may , however , be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein . for example , the embodiments of the present invention have been described under an assumption that density of real gate parts in a cell region of a semiconductor device is greater than density of dummy gate parts in a peripheral region of the semiconductor device . however , when density of real gate parts in cell region of a semiconductor device is smaller than density of dummy gate parts in peripheral region of the semiconductor device , dummy gate parts can be further formed in the cell region to minimize density difference between the gate parts of both of the regions , and the dummy gate parts can be formed in various sizes and shapes in correspondence to dummy active regions , which may be formed in the cell region . furthermore , dummy active regions formed in a peripheral region of a semiconductor substrate and dummy gate parts formed on the dummy active regions are described in the embodiments of the present invention . however , if cmp is performed on a material layer within stacked layers of a semiconductor device as may be required , it is clear that dummy gate parts can be formed in a cell region and / or the peripheral region in various sizes and shapes according to the present invention prior to the cmp operation .	7
we disclose a toy and game that releases fluid onto a player when another player successfully projects a projectile onto a target . the toy and game may also be used to release fluid , such as a beverage , into a beverage glass when a player successfully projects a projectile onto a target . the toy may include a fluid container , a valve , and an actuating arm . the fluid container may remain substantially stationary and upright throughout game play and may have a fluid escape opening . a valve may regulate fluid escape from the container . an actuating arm may regulate the actuation state of the valve . for example , the actuating arm may include a target for a projectile . when a player throws a projective and successfully strikes the target , the actuating arm may actuate the valve to release fluid from the container . the dousing game may be made of light materials which are easy to assemble , disassemble , store , and carry . the dousing game may be scaled to various sizes . for example , the dousing game may be scaled to permit the placement of an adult chair beneath the container . alternatively or additionally , the dousing game may be scaled to accommodate a child &# 39 ; s chair . alternatively or additionally , the dousing game may be scaled to accommodate a beverage glass . fig1 illustrates one variation of a dousing game . in this variation , the dousing game includes a dousing game assembly 100 , a player 102 and a thrower 104 . in this illustration , the player 102 is seated ; however , the player 102 may also be standing . a thrower 104 may throw a projectile 106 at a target 108 . when the projectile 106 strikes the target 108 , fluid may be released onto the player 102 . the projectile 106 may be a bean bag , a ball , a frisbee , a dart , a paint gun , a laser gun , a water balloon , or any other item . the target 108 may have any shape ; it may be , for example but not limited to , a circle , square , star , box . the target may be triggered by the force of the projectile , or alternatively or additionally , by a laser target and laser receiver . the target may also include a net for retaining the target or alternatively or additionally , a back board or other device for halting the trajectory of the target . the dousing game assembly 100 may include a support assembly 110 , an actuator assembly 112 , and a container 114 . the support assembly 110 supports the container 114 above the player 102 . the actuator assembly 112 actuates the release of fluid from the container 114 on to the player 102 such that the player 102 is doused . as shown in fig2 , the support assembly 110 may comprise one or more vertical posts , e . g ., a first vertical post 202 and a second vertical post 204 ; one or more diagonal posts , e . g ., a first diagonal post 206 and a second diagonal post 208 ; and one or more horizontal posts 210 . the support assembly 110 may further include a horizontal support bar 212 . the horizontal posts 210 may engage the diagonal posts 206 , 208 , and the vertical posts 202 , 204 , to create the frame of the support assembly 110 . the support assembly 110 may engage the ground such that the support assembly 110 is held upright during normal use . for example , in one variation , four horizontal posts 210 may form a four - cornered base 214 . the vertical posts 202 , 204 may engage , for example at a 90 ° angle , two adjacent corners of the four - cornered base 214 . the diagonal posts 206 , 208 may engage the two remaining corners of the four - cornered base 214 . the diagonal posts 206 , 208 may engage the two remaining corners of the four - cornered base 214 at an angle 216 . the angle 216 , may be for example but not limited to , about 5 ° to about 90 °; about 20 ° to about 70 °; about 40 ° to about 60 °; or otherwise . if the angle 216 is less than 90 °, then the diagonal posts 206 , 208 , may also engage the vertical posts 202 , 204 , at some location along the length of the vertical posts 202 , 204 . in any variation of the dousing game , the support posts , frame , legs , or otherwise , may be adjustable . for example , the support posts , frame , legs , or otherwise may adjust to smaller or larger dimensions . the support posts , frame , legs , or otherwise may additionally or alternatively adjust and fold for , among other things , storage and / or carrying . in this example , the horizontal support bar 212 engages the vertical bars 202 , 204 at a location distal from the ground and above the player 102 . the horizontal support bar 212 supports the container 114 and also supports a portion of the actuator assembly 112 . the container 114 may be attached to the horizontal support bar 212 by an attachment means 218 . the container 114 may be attached such that it is maintained in a substantially upright and stationary position during play . the attachment means 218 may be , for example but not limited to , a screw , bolt ( e . g ., a j - bolt or otherwise ), pin , bar , zip tie , wire , chain and etc . the container 114 may be , for example but not limited to , a bucket , funnel , box , jar , or otherwise . for simplification , in this example , the container 114 , may be a bucket . the bucket may have a top opening and a bottom 220 . the bottom 220 may include a fluid escape opening 222 . the fluid escape opening 222 may be a single opening or may be an arrangement of multiple openings . fig3 shows a blow up of the actuator assembly 212 of this variation . the actuator assembly may include a swivel arm 302 , which may be a horizontal bar that is suspended parallel to the horizontal support arm 212 when the game is in “ play mode .” for example , the game may be in “ play mode ” when the container 114 contains a fluid , for example , when the fluid is maintained within the container 114 and is not leaking or flowing out of the container 114 . then the game is in “ release mode ,” the fluid escape opening 222 of container 114 may be exposed and fluid may be leaking or flowing out , for example , onto a player fig1 , 102 . when the game is in “ release mode ” the swivel arm 302 may be still horizontal and above the horizontal support bar 212 , but may be off - set from it &# 39 ; s parallel position . ( this is further demonstrated in fig4 ). the container 114 may remain substantially upright and stationary during “ release mode .” the actuator assembly 112 may include a valve assembly 300 . the valve assembly may comprise an actuation housing 320 , an actuation rod 304 and a valve 306 . the horizontal support bar 212 may pass horizontally through the actuation housing 320 . the actuation rod 304 may have a cap 308 on one end and may be connected to the valve 306 at the other end . the actuation rod 304 may pass vertically through the actuation housing 320 , and suspend the valve 306 from the horizontal support bar 212 such that the valve 306 is supported inside the container 114 . the cap 308 may have a larger diameter than the actuation rod 304 and may therefore maintain the actuation rod 304 in assembly with the actuation housing 320 by proving an obstruction that is unable to pass through the hole through which the actuation rod passes . the actuation rod 304 may be assembled with a spring 310 . for example , a spring 310 , for example but not limited to a tension spring may be a coil of material ( e . g ., stainless steel , plastic , resin , or otherwise ). the coil may have through its middle a hole . the actuation rod 304 may be assembled with the spring 310 by passing the actuation rod 304 through the hole in the spring 310 . the actuation rod 304 and spring 310 may be assembled inside of the actuation housing 320 . further figures illustrate other methods of assembling the actuation rod 304 with the spring 310 . however , for this example , we show the actuation rod 304 assembled with the spring 310 by passing through a hole in the spring 310 , the actuation rod 304 and the spring 310 assembled inside an actuation housing 320 . the valve 306 may be assembled over the fluid escape opening 222 . when the game is in “ play mode ” the valve 306 may seal the fluid escape opening 222 such that fluid is maintained inside the container 114 . when the game is in “ release mode ,” the valve 306 may move away from and reveal the fluid escape opening 222 such that fluid is released from the container 114 . the valve 306 may be , for example but not limited to , a rubber valve , a plunger , or any other device . the valve may operate by simply obstructing the fluid escape opening 222 . alternatively or additionally , the valve 306 may be a plunger — or like object — which may create a suction seal against the fluid escape opening 222 . for example , the pressure of the swing arm 302 against the cap 308 , the cap 308 against the actuation rod 304 , and the actuation rod 304 against the valve 306 may create increased suction , pressure , or otherwise , and seal the valve 306 against the fluid escape opening 222 . the swivel arm 302 may have two ends . for example , the swivel arm 302 may have a first end that lines up with a second vertical post 204 and an end that lines up with a first vertical post 202 . the swing arm 302 may be attached to a target 108 at one end . the swivel arm 302 may rotate around a swivel arm rod 314 . the swivel arm rod 314 may pass vertically through , for example , the junction 316 of the second vertical post 204 and the horizontal support bar 212 . when the game is in “ play mode ,” the swivel arm 302 may , by exerting force upon the cap 308 push the actuation rod 304 deep into the actuation housing 320 which may push the valve 306 against the bottom 220 of the container 114 such that the valve 306 tightly covers and prevents fluid escape from the fluid escape opening 222 in the container 114 . the swivel arm 302 may be connected at one end to a target 108 . when a projectile fig1 , 106 strikes the target 108 , it may cause the swivel arm 302 to swivel on the swivel arm rod 314 and to dislodge from its parallel position . when the swivel arm 302 dislodges from its position parallel to the horizontal support bar 212 , it no longer exerts force upon the cap 308 . when the force of the swivel arm 302 pushing down on the cap 308 is released , the force of the spring 310 inside the actuation housing 320 may push the cap 308 upwards and away from the actuation housing 320 . as the cap moves upwards the connected actuation rod 304 may also travel vertically upward through the actuation housing 320 such that the valve 306 moves closer to the actuation housing 320 . as the valve 306 moves closer to the actuation housing 320 , the valve 306 may disengage from the fluid escape opening 222 . disengagement of the valve 306 from the fluid escape opening 222 may allow fluid release from the container through the fluid escape opening 222 . a retaining device 318 may restrict the movement of the swing arm 302 relative to the horizontal support bar 212 . in one variation , the retaining device 318 may be a device similar to an eye and eye turn buckle . for example , the retaining device 318 may be a bar with a length and two ends . one end may attach to the swing arm 302 and the other end may attach to the horizontal support bar 212 . if the retaining device 318 is an eye and eye turn buckle , one eye may attach to the to the swing arm 302 and the other eye may attach to the horizontal support bar 212 . the length of the retaining device 318 may be adjusted so that , when the swing arm is in “ play mode ,” the swing arm is pressed tightly against the cap 308 of the actuation rod 304 providing the force necessary to keep the valve 306 over and sealing the fluid escape opening 222 . when the swing arm 302 is activated to swing away from its horizontal parallel position , the retaining device 318 may restrict the distance ( e . g ., fig4 , 400 ) that the swing arm 302 may move . this may , for example but not limited to , prevent the swing arm 302 from moving too far and wounding a bystander , and may make it easier to reassemble the swing arm 302 into “ play mode .” other restraining devices 318 have been contemplated , for example but not limited to , rubber bands , restraining frames , and other methods of restraining the movement of the swing arm 302 and , perhaps , providing additional force to push the swing arm 302 against the cap 308 . alternatively or additionally , the swing arm 302 may be weighted , for example with sand , cement , metal , or etc . fig4 illustrates the working of one variation of a dousing game . fig4 a 1 illustrates the swing arm 302 in “ play mode ” from above . fig4 b 1 illustrates the swing arm 302 relative to the horizontal support bar 212 from above in “ release mode .” fig4 a 2 illustrates the orientation of the valve 306 over the fluid escape opening 222 as well as the orientation of the swing arm 302 relative to the cap 308 and the cap 308 relative to the actuation housing 320 when the game is in “ play mode .” fig4 b 2 illustrates the orientation of the valve 306 over the fluid escape opening 222 as well as the orientation of the cap 308 relative to the actuation housing 320 when the game is in “ play mode .” for convenience , the swing arm 302 is not shown in this fig4 b 2 . as shown in fig4 a 1 , the swivel arm 302 may rotate around a swivel arm rod 314 . the swivel arm rod 314 may pass vertically through , for example , the junction 316 of the second vertical post 204 and the horizontal support bar 212 ( not shown ). when the game is in “ play mode ,” the swivel arm 302 may , by exerting force upon the cap fig4 b 2 , 308 push the actuation rod 304 deep into the actuation housing 320 which may push the valve 306 against the bottom 220 of the container 114 such that the valve 306 tightly covers and prevents fluid escape from the fluid escape opening 222 in the container 114 . as discussed and illustrated before , the swivel arm 302 may be connected at one end to a target 108 . when a projectile fig1 , 106 strikes the target 108 , it may cause the swivel arm 302 to swivel on the swivel arm rod 314 and to dislodge from its parallel position ( see fig4 b 1 ). fig4 b 1 illustrates an example that when the swivel arm 302 dislodges from its position parallel to the horizontal support bar 212 by a distance 400 , it no longer exerts force upon the cap 308 ( see fig4 b 2 ). when the force of the swivel arm 302 pushing down on the cap 308 is released , as in fig4 b 2 , the force of the spring 310 inside the actuation housing 320 may push the cap 308 upwards and away from the actuation housing 320 . as the cap moves upwards the connected actuation rod 304 may also travel vertically upward through the actuation housing 320 such that the valve 306 moves closer to the actuation housing 320 . as the valve 306 moves closer to the actuation housing 320 , the valve 306 may disengage from the fluid escape opening 222 . disengagement of the valve 306 from the fluid escape opening 222 may allow fluid release from the container through the fluid escape opening 222 . fig5 illustrates a second variation of a dousing game . in this variation , the game includes a dousing game assembly 100 , a drinking container 502 and a thrower 104 ( not shown ). in this illustration , the drinking container 502 placed beneath the container 114 . a thrower 104 may throw a projectile 106 at a target 108 . when the projectile 106 strikes the target 108 , fluid may be released into the drinking container 502 . the projectile 106 may be a bean bag , a ball , a frisbee , a dart , paint from a paint gun , or any other item . in this or any other variation , a tube 504 may be included with the game assembly 100 . the tube 504 may direct the fluid , which may be a beverage , from the container into the drinking container 502 . the tube 504 may therefore prevent spilling . the dousing game assembly 100 may include a support assembly 110 , an actuator assembly 112 , and a container 114 . the support assembly 110 supports the container 114 above the drinking container 502 . the actuator assembly 112 actuates the release of fluid from the container 114 into the drinking container 502 ( in one variation , through an attached tube 504 ) such that the fluid enters the drinking container 502 for consumption by a player . the fluid could be a fluid that the thrower 104 may enjoy , such as cola , beer , hot chocolate . alternatively or additionally , the fluid may be monetary coins , confetti , or any other demonstrative item . as shown in fig5 , the support assembly 110 may comprise one or more vertical posts , e . g ., a first vertical post 202 and a second vertical post 204 ; and one or more horizontal posts 506 . the support assembly 110 may further include a horizontal support bar 212 . the horizontal posts 210 may engage the vertical posts 202 , 204 , to create the frame of the support assembly 110 . the support assembly 110 may engage the ground such that the support assembly 110 is held upright during normal use . for example , in one variation , the vertical posts 202 , 204 may engage , for example at a 90 ° angle , two a central region of the horizontal posts 506 . in this example , the horizontal support bar 212 engages the vertical bars 202 , 204 at a location distal from the ground and above the drinking container 502 . the horizontal support bar 212 supports the container 114 and also supports a portion of the actuator assembly 112 . the container 114 may be attached to the horizontal support bar 212 by an attachment means 218 . the attachment means 218 may be , for example but not limited to , a screw , bolt ( e . g ., a j - bolt or otherwise ), pin , bar , and etc . the container 114 may be , for example but not limited to , a bucket , funnel , box , jar , or otherwise . for simplification , in this example , the container 114 , may be a funnel . the funnel may have a top opening and a bottom 220 . the bottom 220 may include a fluid escape opening 222 , which may be the tapered opening of the funnel . the tapering of the funnel may provide a male end for attaching the alternative hose 504 . the actuator assembly may include a swivel arm 302 , which may be a horizontal bar that is suspended parallel to the horizontal support arm 212 when the game is in “ play mode .” for example , the game may be in “ play mode ” when the container 114 contains a fluid , for example , when the fluid is maintained within the container 114 and is not leaking or flowing out of the container 114 . then the game is in “ release mode ,” the fluid escape opening 222 of container 114 may be exposed and fluid may be leaking or flowing out , for example , into a drinking container 502 , or alternatively , through a tube 504 into a drinking container . when the game is in “ release mode ” the swivel arm 302 may be still horizontal and above the horizontal support bar 212 , but may be off - set from it &# 39 ; s parallel position . ( this is further demonstrated in fig4 ). the actuator assembly 112 may include a valve assembly fig3 , 300 . the valve assembly may comprise an actuation housing 320 , an actuation rod 304 and a valve 306 . the horizontal support bar 212 may pass horizontally through the actuation housing 320 . the actuation rod 304 may have a cap 308 on one end and may be connected to the valve 306 at the other end . the actuation rod 304 may pass vertically through the actuation housing 320 , and suspend the valve 306 from the horizontal support bar 212 such that the valve 306 is supported inside the container 114 . the cap 308 may have a larger diameter than the actuation rod 304 and may therefore maintain the actuation rod 304 in assembly with the actuation housing 320 by proving an obstruction that is unable to pass through the hole through which the actuation rod passes . the actuation rod 304 may be assembled with a spring 310 . for example , a spring 310 , for example but not limited to a tension spring may be a coil of material ( e . g ., stainless steel , plastic , resin , or otherwise ). the coil may have through its middle a hole . the actuation rod 304 may be assembled with the spring 310 by passing the actuation rod 304 through the hole in the spring 310 . the actuation rod 304 and spring 310 may be assembled inside of the actuation housing 320 . further figures illustrate other methods of assembling the actuation rod 304 with the spring 310 . however , for this example , we show the actuation rod 304 assembled with the spring 310 by passing through a hole in the spring 310 , the actuation rod 304 and the spring 310 assembled inside an actuation housing 320 . the valve 306 may be assembled over the fluid escape opening 222 . when the game is in “ play mode ” the valve 306 may seal the fluid escape opening 222 such that fluid is maintained inside the container 114 . when the game is in “ release mode ,” the valve 306 may move away from and reveal the fluid escape opening 222 such that fluid is released from the container 114 . the valve 306 may be , for example but not limited to , a rubber valve , a plunger , or any other device . the valve may operate by simply obstructing the fluid escape opening 222 . alternatively or additionally , the valve 306 may be a plunger — or like object — which may create a suction seal against the fluid escape opening 222 . for example , the pressure of the swing arm 302 against the cap 308 , the cap 308 against the actuation rod 304 , and the actuation rod 304 against the valve 306 may create increased suction , pressure , or otherwise , and seal the valve 306 against the fluid escape opening 222 . the swivel arm 302 may have two ends . for example , the swivel arm 302 may have a first end that lines up with a second vertical post 204 and an end that lines up with a first vertical post 202 . the swing arm 302 may be attached to a target 108 at one end . the swivel arm 302 may rotate around a swivel arm rod 314 . the swivel arm rod 314 may pass vertically through , for example , the junction 316 of the second vertical post 204 and the horizontal support bar 212 . when the game is in “ play mode ,” the swivel arm 302 may , by exerting force upon the cap 308 push the actuation rod 304 deep into the actuation housing 320 which may push the valve 306 against the bottom 220 of the container 114 such that the valve 306 tightly covers and prevents fluid escape from the fluid escape opening 222 in the container 114 . the swivel arm 302 may be connected at one end to a target 108 . when a projectile 106 strikes the target 108 , it may cause the swivel arm 302 to swivel on the swivel arm rod 314 and to dislodge from its parallel position . when the swivel arm 302 dislodges from its position parallel to the horizontal support bar 212 , it no longer exerts force upon the cap 308 . when the force of the swivel arm 302 pushing down on the cap 308 is released , the force of the spring 310 inside the actuation housing 320 may push the cap 308 upwards and away from the actuation housing 320 . as the cap moves upwards the connected actuation rod 304 may also travel vertically upward through the actuation housing 320 such that the valve 306 moves closer to the actuation housing 320 . as the valve 306 moves closer to the actuation housing 320 , the valve 306 may disengage from the fluid escape opening 222 . disengagement of the valve 306 from the fluid escape opening 222 may allow fluid release from the container through the fluid escape opening 222 . a retaining device 318 may restrict the movement of the swing arm 302 relative to the horizontal support bar 212 . the height of the dousing game may be adjusted so that it rests on the ground , or alternatively , for example if the object is to dispense a beverage into a container 502 , the game may rest on a table or counter . the valve 306 may be , for example but not limited to , a rubber valve , a plunger , or any other device . the valve may operate by simply obstructing the fluid escape opening 222 . alternatively or additionally , the valve 306 may be a plunger — or like object — which may create a suction seal against the fluid escape opening 222 . for example , the pressure of the swing arm 302 against the cap 308 , the cap 308 against the actuation rod 304 , and the actuation rod 304 against the valve 306 may create increased suction , pressure , or otherwise , and seal the valve 306 against the fluid escape opening 222 . fig6 is a exploded view of one variation of the cap 308 , actuation rod 304 , valve 306 , spring 310 , and actuation housing 320 . this view illustrates one manner in which the spring 310 may store potential energy such that , when potential energy is released , ( e . g . by release of the swing arm 302 from the cap 308 ) the spring 310 releases potential energy , and in this variation , extends to pull the valve 306 away from the fluid escape opening 222 . in this example , the actuation rod 304 is assembled with the spring 310 inside the actuation housing 320 . the spring 310 has a first end 602 and a second end 604 . the first end 602 of the spring 310 may be immobilized relative to the actuation rod 304 . for example , the actuation rod 304 may include a cotter pin hole . an immobilization device 600 , which may be a cotter pin ( or similar device ) fed through the cotter pin hole . the immobilization device 600 may immobilize one end of the spring 310 restricting it from expanding further up on the actuation rod 304 toward the cap 308 . the second end 604 of the spring 310 may not be immobilized relative to the actuation rod 304 . actuation housing 320 may have a floor 606 through which the actuation rod 304 may pass . when the swing arm 302 is in “ release mode ” the spring 310 may be in a more relaxed state ( see fig4 b 2 ). when the swing arm 302 is in “ play mode ” it may exert force on the cap 308 of the actuation rod 304 . because the immobilization device 600 is attached to the actuation rod 304 , the immobilization device 600 may exert force against the first end of the spring 602 . as the actuation rod 304 travels through the actuation housing 320 the distance between the immobilization device 600 and the floor 606 of the actuation housing 320 shortens . the floor 606 of the actuation housing 320 eventually exerts a force up against the second end 604 of the spring 310 causing the spring 310 to become more tightly coiled or compressed ; the compression storing elastic potential energy in the spring 310 . the movement of the spring arm 302 off of the cap 308 releases the downward pressure ( e . g ., the pressure that asserts compression on the spring 310 ) causing release of the potential energy stored in the spring 310 . fig7 illustrates a variation of the orientation and operation of the actuation arm 302 relative to the actuation housing 320 . fig7 is an exploded view of another variation of the cap 308 , actuation rod 304 , valve 306 , spring 704 , and actuation housing 320 . this view illustrates one manner in which the spring 704 may store potential energy , when pressure is released from the cap 308 the spring 310 releases potential energy resulting in pulling the valve 306 away from the fluid escape opening 222 . in this example , the actuation rod 304 is assembled inside the actuation housing 320 . the spring 704 is a rubber or other elastic material band . the spring 704 , which may be a rubber band , is assembled with the actuation housing and the actuation rod 304 . in this example , the spring 704 , which may be a rubber band , is wrapped around the neck of the actuation housing and also wrapped around a screw 702 driven through the actuation rod 304 . ( other orientations are possible , the spring 704 may be also attached to the actuation housing 320 by a screw , may be attached inside or outside of the actuation housing 320 , and otherwise .) when the swing arm 302 is in “ release mode ” the spring 704 may be in a more relaxed state , e . g ., if the spring 704 is a rubber band , it may be in an unstretched state . when the swing arm 302 is in “ play mode ” it may exert force on the cap 308 of the actuation rod 304 . because the spring 704 , which may be a rubber band , is attached to the actuation housing 320 and the actuation rod 304 , as the actuation rod 304 travels through the actuation housing 320 the distance between the neck 706 of the actuation housing 320 and the screw 702 on the actuation rod 304 increases . the increased distance between the two attachment points of the spring 704 , which may be a rubber band causes stretching of the rubber band , the stretching storing elastic potential energy in the spring 704 . the movement of the spring arm 302 off of the cap 308 releases the downward pressure ( e . g ., the pressure that asserts compression on the spring 310 ) causing release of the potential energy stored in the spring 704 , as the spring 704 returns to a relaxed state . fig8 is an exploded view of another variation of the cap 308 , actuation rod 304 , valve 306 , spring 310 , and actuation housing 320 . this view illustrates one manner in which the spring 310 may store potential energy such that , when potential energy is released , ( e . g . by release of the swing arm 302 from the cap 308 ) the spring 310 releases potential energy , and in this variation , extends to allow the valve 306 to pull away from the fluid escape opening 222 . in this example , the actuation rod 304 is assembled with the spring 310 outside and on top of the actuation housing 320 . the spring 310 has a first end 802 and a second end 804 . the cap 308 may act as an immobilization device and may immobilize one end of the spring 310 restricting it from expanding further up on the actuation rod 304 . the second end 804 of the spring 310 may be immobilized relative to the actuation rod 304 by the top of the actuation housing 320 . in this variation , when the swing arm fig3 , 302 is in “ release mode ” the spring 310 may be in a more relaxed state ( e . g ., uncompressed ). when the swing arm 302 is in “ play mode ” the swing arm 302 may exert force on the cap 308 of the actuation rod 304 . as the actuation rod 304 travels through the actuation housing 320 the distance between the cap 308 and the top of the actuation housing 320 shortens . because the spring 310 is located between the cap 308 and the top of the actuation housing 320 , as the distance 806 shortens , the spring 310 is compressed . the compression stores elastic potential energy in the spring 310 . the movement of the spring arm 302 off of the cap 308 releases the downward pressure ( e . g ., the pressure that asserts compression on the spring 310 ) causing release of the potential energy stored in the spring 310 . fig9 is an exploded view of another variation of the cap 308 , actuation rod 304 , valve 306 , spring 310 , and actuation housing 320 . this view illustrates one manner in which the spring 310 may store potential energy such that , when potential energy is released , ( e . g . by release of the swing arm 302 from the cap 308 ) the spring 310 releases potential energy , and in this variation , extends to allow the valve 306 to pull away from the fluid escape opening 222 . in this example , the actuation rod 304 is assembled with the spring 310 outside and on top of the actuation housing 320 . furthermore , in this example , the actuation rod 304 is not inserted through the spring &# 39 ; s 310 coil . the spring 310 has a first end 902 and a second end 904 . the first end 902 and second end 904 may be immobilized , for example , the first end 902 may be immobilized by a screw attaching it to a location just above the valve 306 , the second end 904 may be immobilized by a screw attaching it to an outer or inner surface of the actuation housing 320 . in this variation , when the swing arm fig3 , 302 is in “ release mode ” the spring 310 may be in a more relaxed state ( e . g ., uncompressed ). when the swing arm 302 is in “ play mode ” the swing arm 302 may exert force on the cap 308 , causing the actuation rod 304 to travel through the actuation housing 320 . as the actuation rod 304 travels through the actuation housing 320 a distance 908 between the valve 308 and the actuation housing 320 lengthens . because the spring 310 is located between the valve 306 and the actuation housing 320 , as the distance 908 lengthens , the spring 310 is pull tightly . the stretching stores elastic potential energy in the spring 310 . the movement of the spring arm 302 off of the cap 308 releases the downward pressure ( e . g ., the pressure that asserts compression on the spring 310 ) causing release of the potential energy stored in the spring 310 as it springs into a relaxed ( in this case , coiled ) state . the dousing game may be made of many materials . for a light and sturdy construction , the dousing game may be made out of pvc pipe . however , the dousing game may alternatively or additionally be made out of metal , plastic , rubber , or other composite or similar materials . if made out of pvc pipe , the entire dousing game assembly may weigh under 30 pounds , for example , if the dousing game assembly is made out of pvc with a 6 foot frame , such that an adult may sit comfortably beneath the container 114 , the assembly may weigh as little as about 20 pounds . the dousing game may be completely assembled and disassembled simply and quickly , may be stored in a compact box , and may weigh very little , making it simple to store , transport , assemble , and use . in one variation , the dousing game may be scaled for table - top used , for example , the object of the game may be to strike the target 108 in order to trigger a beverage to pour into a drinking container 502 . in this variation , the materials may be pvc pipe , alternatively or additionally , the materials may be metal , plastic , rubber , composite , or otherwise . the weight of the table - top dousing game may be about 7 pounds . the dousing game may be completely assembled and disassembled simply and quickly , may be stored in a compact box , and may weigh very little , making it simple to store , transport , assemble , and use . in one variation , the dousing game may be scaled for use by children . for example , the dousing game may be made in , for example but not limited to , a 4 foot tall floor version of the game . the dousing game may be completely assembled and disassembled simply and quickly , may be stored in a compact box , and may weigh very little , making it simple to store , transport , assemble , and use . the dousing game may have additional configurations , including a double , triple , or other variation . for example , two dousing assemblies may be set up side - by - side or back - to - back for team play , as shown in fig1 . the dousing game may also have variations in the size of the target , may have the addition of a water hose or other device for re - filling the container 114 between uses . while various embodiments of the invention have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of the invention . for instance , steps of a method as displayed in the figures or reflected in the claims do not require a specific order of execution by way they are presented , unless specified . the disclosed steps are listed as exemplary such that additional or different steps may be executed or the steps may be executed in a different order	5
the preferred embodiment in accordance with the present invention will be discussed in detail with reference to fig1 to fig1 . it is understood that the type of semiconductor regions , device layout , and polarity of voltages are chosen solely for illustration , and person having ordinary skill in the art would recognize other alternatives , variations , and modifications . please refer to fig1 . fig1 is a block diagram schematically showing an integrated circuit ( ic ) embedded with a single - poly non - volatile memory ( nvm ) therein according to the present invention . as shown in fig1 the ic 10 comprises a core circuit 12 and an input / output ( i / o ) circuit 14 . the core circuit 12 comprises a plurality of core circuit devices ( either pmos or nmos , not shown in this figure ), which are operated at relatively low voltages and high speed and are fabricated using advanced logic process such as 0 . 25 - micron technology . that is , the core circuit devices have a critical dimension of about 0 . 25 microns , thinner gate oxide thickness , and therefore smaller device dimension and faster speed . it is understood that , heretofore , some chip manufacturers have advanced to 0 . 18 - micron , 0 . 13 - micron , even beyond 100 - nanometer technology , and the present invention is not limited thereto . the i / o circuit 14 comprises i / o circuit devices , which can sustain relatively higher voltages such as 3 . 3v . a portion of the 3 . 3v i / o circuit devices are used to constitute an array of non - volatile memory ( embedded nvm ) 141 and a memory control circuit 142 thereof . the communication ( bus ) between the embedded nvm 141 and the memory control circuit 142 and between the core circuit 12 and the memory control circuit 142 employs technologies known in the art and the details are therefore omitted . please refer to fig2 through fig1 . it is also an object of the claimed invention to provide a unique embedded high - density single - poly nvm device and related operation methods . referring first to fig2 and fig3 fig2 is a circuit of a nvm cell according to the present invention . fig3 is an enlarged top view showing the layout of the nvm cell according to the present invention . as shown in fig2 and fig3 the nvm device 20 comprises two serially connected pmos transistors 201 and 202 . the pmos transistor 201 acts as a select transistor or switch transistor and the select gate of the pmos transistor 201 is electrically connected to a word line . in operation , a select gate voltage ( v sg ) is applied to the select gate of the pmos transistor 201 via the specific word line . the pmos select transistor 201 further comprises a source terminal 301 biased to a source line voltage ( v sl ) and a drain terminal 302 coupled to the pmos transistor 202 . that is , the drain terminal 302 of the pmos transistor 201 simultaneously serves as a source terminal of the pmos transistor 202 . the pmos transistor 202 further comprises a single - poly floating gate 306 and a drain terminal 303 that is biased to a bit line voltage ( v bl ). the drain terminal 302 of the pmos transistor 201 ( also the source of the pmos transistor 202 ) and the drain terminal 303 define a p - channel under the floating gate 306 . referring to table 1 and fig4 through fig7 a best mode for low - voltage memory operations is listed in table 1 , and the programming / reading modes regarding the single - poly eprom device of the present invention are illustrated in cross sectional views . as shown in fig4 in a programming mode for writing “ digital one ”, the selected word line is grounded . the unselected word lines are applied with a positive voltage of about 3v - 8v , preferably 5v . the selected bit line is grounded and the unselected bit lines are applied with a positive voltage of about 3v - 8v , preferably 5v . a source line voltage v sl of about 5v is applied on the source terminal of the select transistor 201 . a well voltage of about 5v is applied to the n - well ( nw ). under these conditions , the p - channel of the select transistor 201 and the p - channel under the floating gate of the pmos transistor 202 turn on and hot channel electrons inject into the floating gate of the single - poly pmos transistor 202 . as shown in fig5 in a programming mode for writing “ digital zero ”, the selected word line is grounded . the unselected word lines are applied with a positive voltage of about 3v - 8v , preferably 5v . the selected bit line is applied with a positive voltage of about 3v - 8v , preferably 5v . a source line voltage v sl of about 5v is applied on the source terminal of the select transistor 201 . a well voltage of about 5v is applied to the n - well . under these conditions , the p - channel under the floating gate of the pmos transistor 202 is in an “ off ” state . as shown in fig6 in a data reading operation , the selected word line is grounded . the unselected word lines are biased to a voltage of about 2 . 5v - 5v . the selected bit line is biased to a voltage of about 0v - 2 . 5v . the unselected bit lines are biased to a bit line voltage of about 3 . 3v . the source line voltage is about 2 . 5v - 5v . the n - well voltage is about 2 . 5v - 5v . when reading a programmed cell , the floating gate of the programmed cell is charged , then v fg − v s & lt ; v thp ( v thp : threshold voltage of pmos transistor 202 ), the memory cell maintains at a status of “ on ”. the floating gates of those un - programmed memory cells have no charge injected therein , then v fg − v s & gt ; v thp , these memory cells are in a status “ off ”. [ 0035 ] fig8 depicts the relation between the drain current i d and the floating gate voltage . fig9 plots the gate currents i g versus gate voltages of the floating gate regarding a selected pmos transistor ( channel hot electron ( che ) operation ) at different drain to n - well biases ( v d = v bl − v nw ). as shown in fig8 and fig9 according to a best mode of the present invention , the drain to n - well bias ( v d ) is about − 5v to − 6v . a maximum gate current of about 1 . 0 × 10 − 9 to 5 × 10 − 11 μa / μm is observed at a floating gate voltage of about − 1v to − 1 . 5v . more specifically , at a drain bias v d =− 5v , for example , the floating gate acquires a relatively low - level coupling voltage of about − 1 ˜− 2v . at the same time , the p channel thereof is just turned on and reaches a gate current approaching a maximum value of about 5 × 10 − 11 μa / μm . in other words , a better performance during the writing operation can be achieved according to the present invention , since the gate current to drain current ratio ( i g / i d ) is improved . [ 0036 ] fig1 is a top view illustrating a portion of the memory array of the single - poly nvm according to the present invention . as shown in fig1 , for programming ( writing “ digital one ”) the cell i ( as specifically indicated with dash line cycle ), a bit line voltage v bl of about 5v to 6v is applied to the drain terminal of the floating gate pmos transistor of the memory cell i . the select gate of the memory cell i is grounded . along the same bit line , the other un - programmed memory cells ( cell ii , cell iii , and cell iv ) will not suffer from the drain disturbance that typically occurs during programming for a conventional stacked gate memory device . referring to fig1 and fig1 , fig1 is a circuit of a nvm cell according to another preferred embodiment of the present invention . fig1 is an enlarged top view showing the layout of the nvm cell of fig1 . as shown in fig1 and fig1 , the nvm device 20 comprises two serially connected nmos transistors 401 and 402 . the nmos transistor 401 acts as a select transistor or switch transistor and the select gate of the nmos transistor 401 is electrically connected to a word line . in operation , a select gate voltage ( v sg ) is applied to the select gate of the nmos transistor 401 via the specific word line . the nmos select transistor 401 further comprises a source terminal 601 biased to a source line voltage ( v sl ) and a drain terminal 602 coupled to the nmos transistor 402 . that is , the drain terminal 602 of the nmos transistor 401 simultaneously serves as a source terminal of the nmos transistor 402 . the nmos transistor 402 further comprises a single - poly floating gate 606 and a drain terminal 603 that is biased to a bit line voltage ( v bl ). the drain terminal 602 of the nmos transistor 401 ( also the source of the nmos transistor 402 ) and the drain terminal 603 define an n - channel under the floating gate 606 . referring to fig1 through fig1 , a best mode for programming / reading the single - poly n - type nvm device of the present invention is illustrated in cross - sectional views . as shown in fig1 , in a programming mode for writing “ digital one ”, the selected word line is applied with a positive voltage of about 3v - 8v , preferably 6v . the selected bit line is applied with a positive voltage of about 3v - 8v , preferably 6v . a source line voltage v sl = 0v is applied on the source terminal of the select transistor 401 . a well voltage of 0v is applied to the p - well ( pw ). under these conditions , the n - channel of the select transistor 401 is turned on and hot holes inject into the floating gate of the single - poly nmos transistor 402 . as shown in fig1 , in a programming mode for writing “ digital zero ”, the selected word line is applied with a positive voltage of about 3v - 8v , preferably 6v . the selected bit line is applied with a voltage of 0v . a source line voltage v sl = 0v is applied on the source terminal of the select transistor 401 . a well voltage of 0v is applied to the p - well ( pw ). under these conditions , the n - channel under the floating gate of the pmos transistor 402 is in an “ off ” state . as shown in fig1 , in a data reading operation , a select gate voltage v sg = 3 . 3v is applied on the selected word line . the selected bit line is biased to a voltage of about 0v - 2 . 5v , preferably 1 v . as shown in fig1 , the unselected word lines are biased to a voltage of 0v . the unselected bit lines are biased to a bit line voltage of about 0v - 2 . 5v , preferably 1v . the source line voltage is 0v . the n - well voltage is 0v . the operations of the memory cell as set forth through fig1 to fig1 are based on the relation plotted in fig1 . to sum up , the present invention provides an ic embedded with unique nvms such as eprom or otp cells , which is suited for different - generation ( such as 0 . 25 - micron , 0 . 18 - micron , or 0 . 13 - micron ) advanced logic processes . no matter what generation logic process the core circuit of the ic uses , a portion of the 3 . 3v i / o devices can be utilized to create an array of nvm and memory control circuit thereof . no additional mask is required for the nvm . the development cycle for the embedded logic nvm memory can thus be shortened for each generation logic process . further , the high voltage used to program the nvm cells is decoupled in i / o devices such that the high field is not observed between the gate oxide of the i / o devices and the junction - to - well of the i / o devices , thus guarantee the reliability of the device . those skilled in the art will readily observe that numerous modification and alterations of the device may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims .	6
a first embodiment of this invention will be described using fig4 to fig9 . fig4 is a schematic diagram showing a structure of inspection equipment used in this embodiment , fig5 is a schematic diagram showing a position of an inspected chip on a wafer in this embodiment , fig6 is a flowchart showing a part of a procedure of analyzing a two - dimensional signal intensity distribution obtained by observation , fig7 is a fourier spectrum displayed on a display of the inspection equipment , fig8 is a window used for specifying by inputs a region where measurement results of the roughness data are fourier transformed and absolute values of the fourier coefficients squared are integrated , and fig9 is a diagram showing an integration region displayed on the spectrum shown in fig7 and a roughness index 3σ c obtained from an integration value of the power spectrum σ c 2 , which are evaluation results displayed on the display of the inspection equipment when analysis of one line pattern is ended . this embodiment shows an example where inspection using equipment of this invention was performed in an inspection process at the time of semiconductor device production and the yield of manufacture was improved by monitoring the long - period roughness . in the semiconductor manufacturing process described in this embodiment , the transistor with a structure that is resistant to the short channel effect was produced . therefore , an influence of line width roughness of a short period was comparatively small . however , performance variation in a transistor by roughness of a long period cannot be disregarded , and might bring a critical yield drop . so , it was necessary to monitor the long - period roughness at the time of dimensional inspection after the end of a lithography process . any wafer whose index of roughness is equal to or less than a fixed value is put into the next process , but wafers whose indexes of roughness exceed the fixed values go through the lithography again after resist peeling . first , a wafer that went through the lithography process was put in the inspection equipment shown in fig4 . a wafer 407 is placed on a stage 408 and irradiated with an electron beam 403 . the chips on the wafer to be inspected were decided as shown in the shaded portions in fig5 . the line pattern 5 μm long and about 100 nm wide existing on the same relative coordinates on this chip is the inspection target pattern . the stage 408 and the irradiating electron beam 403 were moved so that an almost center position of each pattern was set to the center of the field of view , and each pattern was inspected . fig6 shows a procedure of this inspection . first , a two - dimensional signal intensity distribution of the line pattern was obtained in step 601 . here it was displayed as a two - dimensional image . in this occasion , magnification in the x - direction ( a horizontal direction when facing the image ) was 150 , 000 times and magnification in the y - direction ( a direction perpendicular to the x - direction ) was 50 , 000 times . the field of view of the obtained image is 900 nm in the x - direction and 2700 nm in the y - direction . the image was adjusted so that the line pattern was almost parallel to the y - direction . after performing noise reduction processing ( step 602 ) on this image , an inspection area is set in the central part of the image ( step 603 ) and the line width was measured ( step 604 ). the interval of measurement points in the y - direction is 7 . 8125 nm , the number of measurement points was 256 , and the length of the area that was measured ( inspection area ) in the y - direction was 2000 nm . the roughness data of line widths thus obtained is defined as w 1 , w 2 , . . . , w 256 . next , in step 605 , these roughness data was fourier transformed to yield the absolute values a ( f ) of the fourier coefficients . f is the spatial frequency expressed by the following numerical expression , and its unit was chosen to be μm − 1 . f = 1 l · n ( n ⁢ ⁢ is ⁢ ⁢ an ⁢ ⁢ integer . ) [ numerical ⁢ ⁢ expression ⁢ ⁢ 7 ] l is the length of the inspection area in the y - direction and , in the case of this embodiment , it is 2 . 0 . next , the flow proceeded to step 606 , where the fourier amplitude spectrum and a window for integration - region input were displayed on a display of the inspection equipment . moreover , on the fourier amplitude spectrum , the line width average value computed from the fourier amplitude corresponding to f 0 and three times the standard deviation of the line width distribution , namely 3σ , were displayed as cd and lwr , respectively . the former is a value exclusive of variation components of the line width . fig7 and fig8 show these values . as shown in fig8 , a calculation value ( in the figure , indicated as output ) and the lower limit and the upper limit of spatial frequency region where the operator intends to perform integration can be set using the window for integration - region input . the calculation value can be selected from among the standard deviation σ c of variation of the data , two times of it ( 2σ c ), three times of it ( 3σ c ), six times of it ( 6σ c ), and the deviation ( σ c 2 ) by mouse operation . the default was 3σ c . this is because it is general that the degree of line - edge roughness is expressed by three times the standard deviation in the semiconductor manufacture . moreover , the default value of the lower limit field of the spatial frequency region was set to 0 . 5 . this is because it is desirable to measure roughness in an area whose length is equal to or more than 2 μm along with the line , as mentioned above . furthermore , the default value of the upper limit field was set to 5 . this is based on the background that this invention was made generally for transistors of small gate widths that come with the necessity of measuring the long - period roughness . according to the trend in recent years , small devices , such as memory , have gate widths of about 200 nm . therefore , corresponding spatial frequency of 5 μm − 1 was decided as a default value . next , the upper limit and the lower limit of the spatial frequency region where the operator intends to perform integration were entered on the window for integration - region input shown in fig8 ( step 607 ). here , for the lower limit value , a default value of 0 . 5 was used , and for the upper limit value , a value of two was entered . these values were decided by the following way of thinking . first , when the value of 0 . 5 of the former is converted into a spatial period of 2 μm , being equivalent to the length of the inspection area . in order to measure the long - period roughness as correctly as possible , the lower limit of the integration region was set to a value corresponding to this . regarding the resist material used here , a lot of fourier amplitude spectra of the line - edge roughness of that pattern have been obtained , and it was confirmed that the parameter f 0 became about 2 . this production factory is making devices of various gate widths simultaneously . however , dimensional inspection by varying boundary between the long and short periods responsive to the gate width w g could not be performed . therefore , a frequency f 0 at which f - dependency of a ( f ) in the spectrum shape changed was defined as a boundary of the long period and short - period roughnesses , and a component whose spatial period was longer than 1 / f 0 was defined as the long - period roughness . when the integration region was entered , the flow proceeded to step 608 , where a region corresponding to frequencies from f = 0 . 5 to f = 2 on the spectrum shown in fig7 is displayed with shading , and at the same time the roughness index 3σ c obtained from an integration value σ c 2 of the power spectrum was outputted on a screen . fig9 shows this situation . the measurement results were saved in a storage area of the inspection equipment , and inspection of this pattern was ended . this inspection of the process shown in fig6 was performed to all the line patterns that were intended to be done so on the chip shown in fig5 . next , the quality of the wafer was determined . in the semiconductor manufacturing process of this embodiment , wafers whose cd values were 95 to 105 nm were determined to be acceptable . this criterion was established because the inspected pattern was the gate pattern of a gate length of 100 nm , and only patterns whose gate lengths fall on a range from 95 to 105 nm should be determined to be acceptable in order to achieve necessary performance ( threshold voltage ), which was known from a result obtained by simulating the relation between the gate length and the device performance . moreover , regarding 3σ , 10 nm or less was adopted as the acceptance criterion . this is because it was empirically confirmed that a pattern not satisfying this criterion suffered degradation in the pattern feature and a short circuit occurred in the next process of dry etching . moreover , regarding the long - period roughness component 3σ c , 2 . 5 nm or less was adopted as the acceptance criterion . this is because from a result of simulation ran in advance , it was predicted that in chips not satisfying these criteria , 10 % or more of transistors contained therein did not have necessary performance and did not function as devices . if the total 10 patterns of inspected chips all satisfy this criterion , the wafer is determined to be acceptable and put into the next process . this is because as a guidance of achieving a yield of 90 % or more , it was necessary for the all the ten chips selected in a wafer to be acceptable . since this wafer does not satisfy the criteria of the acceptable in the above - mentioned chip , this wafer was put into the lithography process again . thus , since execution of this invention made it possible to remove such a wafer as has high possibility of being determined to be unacceptable in the early stage and repeat the manufacture , the yield was improved and the number of waste wafers decreased largely , reducing an environmental load . moreover , cd values acquired in the above - mentioned procedure are hardly affected by line - edge roughness . therefore , when computing cd uniformity across a wafer plane and cd variation among wafers , the use of these values enables the amounts of these values to be computed more accurately . incidentally , it is also possible to execute the above - mentioned procedure automatically without the operator . in that case , entry of the integration region has been made in advance , and there is no need to enter numerical values in fig8 for each inspection pattern . moreover , the inspection results obtained for each chip are put in a file and saved automatically . note that in the above - mentioned procedure , the spectrum displayed on the display was chosen to be fourier amplitude spectrum , but a power spectrum may be used . calculation actually done is the integration on the power spectrum . displaying the power spectrum brings a merit that it is easy for the operator to understand intuitively and that the display helps the operator notice improper operations . a second embodiment of this invention will be described using fig4 and fig1 . fig4 is a schematic diagram showing a structure of the inspection equipment that was used in this embodiment . fig1 is a flowchart showing a part of procedure for analyzing a two - dimensional signal intensity distribution obtained in this embodiment as a result of observation . this embodiment shows an example where inspection that uses the equipment of this invention is performed in an inspection process at the time of semiconductor device production , and the yield of manufacture is improved by monitoring the short - period roughness besides the long - period roughness . in the semiconductor manufacturing process described in this embodiment , transistors of gate widths w g of about 300 nm were mainly made , and there was a possibility that performance variation in a transistor by the roughness whose spatial period is longer than 300 nm might cause a yield drop . at the same time , there was found out a phenomenon that if small roughness whose spatial period was equal to or less than 100 nm existed on the resist pattern , the part was damaged in dry etching and scraped off . for this reason , at the time of dimensional inspection after the end of the lithography process , there arose a need to monitor the short - period roughness whose spatial period was equal to or less than 100 nm as well as the long - period roughness whose spatial period was equal to or more than 300 nm . hereafter , a concrete procedure of this embodiment will be presented . incidentally , all of used inspection equipment , chip placement on a wafer , and an inspection target pattern are the same as those in the first embodiment . similarly with the first embodiment , first , a wafer having gone through the lithography process was put in the inspection equipment shown in fig4 . an inspected pattern and its position were the same as those in the first embodiment . contents of inspection performed to each pattern will be described using fig1 . first , in step 1001 , an electron microscope observation image of the line pattern was obtained . observation magnification and the size of the field of view were the same as values in step 601 of the first embodiment . noise reduction processing ( step 1002 ) was performed on this image , and the inspection area was set up appropriately ( step 1003 ). next , roughness data of line widths was acquired , as shown in step 1004 . conditions in this case were the same as those in step 604 of the first embodiment . next , the flow proceeded to step 1005 , where the roughness data is fourier transformed , and in step 1006 , its spectrum was displayed . at the same time , the window for integration - region input was displayed . next , on the displayed window for integration - region input , a lower limit and an upper limit of the integration spatial frequency region were entered ( step 1007 ). here , first , they were set to 0 . 5 and 3 . 3 , respectively , as a calculation region of the index of long - period roughness . these values were decided by the following way of thinking . first , a value of 0 . 5 of the former is 2 μm in terms of spatial period , corresponding to the length of an inspection area . according to previous research , if roughness is measured up to a spatial period of about 2 μm , its rough tendency can be grasped . then , the inspection area length was set to 2 μm and the lower limit of the integration region was also set to a value corresponding to this . moreover , since transistors of gate widths of 300 nm were mainly made on the wafer , a component whose spatial period is longer than this value was intended to be observed . a value of 3 . 3 is a spatial frequency corresponding to a spatial period of 300 nm . when the integration region was entered , the flow proceeded to step 1008 , where an integration value σ c 2 of the power spectrum of a region corresponding to frequencies from f = 0 . 5 to f = 3 . 3 was calculated , and the roughness index 3σ c obtained from this value was outputted . next , since the index of short - period roughness was also intended to be obtained , the flow did not end in step 1008 ( selecting n in step 1009 ), but proceeded to step 1007 . other values were entered on the window for integration - region input . the entered lower limit was 10 and the entered upper limit was 100 . this lower limit value is a frequency corresponding to the maximum period ( 100 nm ) that is considered to cause a large effect on the pattern after dry etching . moreover , since components whose spatial periods were shorter than 10 nm were filtered by noise reduction , the upper limit of the integration region was set to a frequency to which this value corresponded . when these numerical values were entered , the flow proceeded to step 1008 , where the index of short - period roughness was outputted . since the inspection for this pattern ended by this , the flow proceeded to step 1010 , where all the evaluation results described above were saved in the storage area of the inspection equipment , and the inspection of this pattern was ended . this inspection was performed to all the line patterns that were intended to be done so on the chip shown in fig5 . next , the quality of the wafer was estimated . in a semiconductor manufacturing process of this embodiment , acceptance criteria were : cd value was from 95 to 105 nm ; 3σ was 10 nm or less ; the long - period roughness 3σ c was 5 nm or less ; and the short - period roughness 3σ c was 2 . 5 nm or less . if total 10 patterns of the chips inspected in a wafer all satisfy these acceptance criteria , the wafer was determined to be acceptable and was put into the next step . since all the chips in this wafer satisfied these criteria , this wafer was put into the next step , dry etching . thus , since execution of this invention makes it possible to remove such a wafer as has high possibility of becoming a defective in its early stage and repeat the manufacture , the yield is improved and the number of waste wafers decreased largely , reducing an environmental load . a third embodiment of this invention will be described using fig6 , fig1 , and fig1 . fig6 is a flowchart showing a part of a procedure of analyzing an electron microscope observation image in this embodiment , fig1 shows a pattern under a resist film of a sample inspected in this embodiment , and fig1 is an example of a resist pattern inspected in this embodiment . this embodiment shows an example where inspection using the equipment of this invention is performed in an inspection process at the time of semiconductor device production and a variation in a line width that has a specific frequency is monitored , whereby the yield of manufacture is improved . in the semiconductor manufacturing process described in this embodiment , prior to steps in which a layer of important line pattern is processed , a line pattern of a metal material running in a direction perpendicular to a line for gate was formed as shown in fig1 . an insulating material is deposited on this metal pattern and processed to be flat . subsequently an anti - reflective layer is formed , a resist film is deposited by spin - coating , and this resist film is processed into the form of a line . however , if thickness of anti - reflective layer is not proper , reflection from the metal pattern of the underlayer affects the resist pattern and the line width may be varied as shown in fig1 . numeral 1201 in the figure is a line pattern of a metal existing under the anti - reflective layer , and the resist pattern 1202 is thinned in a portion above the metal . because of this , there arose a need to monitor components of line width variation that synchronized with a spatial period of the metal pattern underlying the resist at the time of dimensional inspection after the end of the lithography process . incidentally , in an image of the metal pattern of this embodiment , a pitch in the y - direction was 0 . 4 μm . in this inspection , each pattern described in the first embodiment was inspected . the procedure is expressed in fig6 as with the first embodiment . the field of view was moved on the inspection target pattern , and a two - dimensional signal intensity distribution was acquired in step 601 . observation magnification and a size of the field of view were the same as those in the first embodiment . next , the flow proceeded to step 602 , when noises were reduced , and subsequently the inspection area was set in step 603 . next , roughness data of line widths was acquired in step 604 . also here , the measurement parameters were the same as those in the first embodiment . next , the result of performing the fourier transform in step 605 was displayed on an inspection equipment monitor along with the window for integration - region input in step 606 . here ( in step 607 ), a lower limit of 2 and an upper limit of 3 were entered for the integration region , and the component 3σ c was extracted . this component 3σ c was 4 . 7 nm , whereas a roughness index of the whole region ( 3σ ) was 10 . 2 nm . these numerical values were saved in the storage area of the inspection equipment . the above - mentioned value indicates that a variation in the line width of a frequency corresponding to pitch 0 . 4 μm is very large . in this embodiment , when a ratio of 3σ c computed in the above - mentioned integration region to a roughness index of 3σ of the whole region became a value of 0 . 4 or more , it was determined that thickness of the antireflective layer was not proper . therefore , it was concluded that thickness of antireflective layer is not proper . by this invention , it was possible to monitor a variation in the line width resulting from a specific cause . moreover , based on this result , a film forming process of the anti - reflective layer was inspected . the inspection showed that a deadline of the material of the anti - reflective layer was expired , which caused occurrence of nonuniformity in its viscosity . thus , it becomes possible to specify the cause of roughness occurrence and undertake remedial measures . a fourth embodiment of this invention will be described using fig4 , fig5 , fig1 , and fig1 . fig4 is a schematic diagram showing a configuration of the inspection apparatus in this embodiment ; fig1 a schematic diagram showing a position on a chip that is inspected in this embodiment ; fig1 is a flowchart showing a part of a procedure of analyzing a two - dimensional signal intensity distribution obtained by observation in this embodiment ; and fig1 is an outline diagram of a widow displayed on the screen as results of the analysis in this embodiment . this embodiment shows an example where the inspection using the equipment of this invention is performed in the inspection process at the time of semiconductor device production , and the yield of manufacture is improved by monitoring both the short - period roughness causing performance degradation and the long - period roughness causing performance variation of the transistor of a gate width to which attention is paid . in the semiconductor manufacturing process described in this embodiment , transistors of gate widths w g of about 500 nm were mainly made , and there was a possibility that performance variation in a transistor caused by the roughness whose spatial period is longer than 500 nm might cause a yield drop . at the same time , it was also necessary to evaluate rapidly the roughness in the transistor area that is related to performance degradation of a transistor . for this reason , there arose a need to monitor the long - period roughness and the short - period roughness without increasing inspection time at the time of dimensional inspection after the end of the lithography process . a concrete procedure is shown below . first , a wafer after completing the lithography process was put in the inspection equipment shown in fig4 . the wafer 407 was placed on the stage 408 and irradiated with the electron beam 403 . the chips on the wafer to be inspected were specified as shown in shaded portions in fig5 . the line pattern that exists on the same relative coordinates and has a length of 3 μm and a width of about 60 nm on each chip is the inspection target pattern . the stage 408 and the irradiation electron beam 403 were moved so that almost center position of each pattern is set to the center of the field of view , and each pattern was inspected by software of the inspection equipment . a procedure of this inspection is shown in fig1 . first , a two - dimensional signal intensity distribution of the line pattern was obtained in step 1301 . here , this was displayed as a two - dimensional image . in this occasion , magnification is 200 , 000 times in an x - direction ( a horizontal direction facing the image ) and 60 , 000 times in a y - direction ( a perpendicular direction to the x - direction ); the field of view of the obtained image measures 675 nm in the x - direction and 2250 nm in the y - direction . the image was adjusted so that the line pattern was almost parallel to the y - direction . after noise reduction processing on this image ( step 1302 ), an inspection area was set in the central part of the image ( step 1303 ). then , measurement was done automatically and the roughness data was acquired ( step 1304 ). the interval of the measurement point in the y - direction was 10 nm and the number of measurement points was 200 . the length of the area where measurement was done in the y - direction was 2000 nm . the roughness data of the line widths obtained in this way are defined as w 1 , w 2 , . . . , w 200 . next , in step 1305 , the standard deviation σ 0 of these 200 data was calculated . this value was 3 . 5 nm . next , the flow proceeded to step 1306 . here , 200 data was divided into total 10 groups each of which consisted of 20 data . the 20 data must be consecutive . that is , the data contained in the first group were w 1 , w 2 , . . . , w 20 ; the data contained in the second group were w 21 , w 22 , . . . , w 40 ; and the data contained in the tenth group were w 181 , w 182 , . . . , w 200 . each of the groups newly created here constitutes roughness data of line widths of an area corresponding to a length of 200 nm . next , the flow proceeded to step 1307 , where the average and the standard deviation of the 20 data in each group were computed for the ten groups obtained in the previous step . for these data , the standard deviations are defined as σ 1 , 1 , σ 1 , 2 , . . . , σ 1 , 10 , and the averages are defined as cd 1 , cd 2 , . . . , cd 10 . further , the average σ 1 of the 10 standard deviations and the standard deviation σ 2 of the 10 averages were calculated . in the next step 1308 , the calculation results were outputted on an observation image display window . in this manufacturing process , since conventionally a value of three times the standard deviation was used as a criterion rather than the standard deviation , values of 3σ 0 , 3σ 1 , and 3σ 2 were outputted . next the flow proceeded to step 1309 , where for three set of values ( l 1 , σ 0 ), ( l 2 , σ 1 ), and ( l 2 , σ 2 ) functions shown in ( numerical expressions 4 ) were fitted using theoretical curves g ( l ) and h ( l ). here , l 1 = 200 nm and l 2 = 2000 nm . a set of the theoretical curves g ( l ) and ( l ) was saved in advance in the storage area of the inspection equipment . these theoretical curves were calculated by simulation . after values of fitting parameters were determined , the flow proceeded to step 1310 , where the gate with of a transistor to which attention was paid or a length w g that the operator intended to define as a boundary of the long and short periods was set . here , it was set to 500 nm . next , in step 1311 , values of an index of the short - period roughness 3σ_intra ( w g ) and an index of the long - period roughness 3σ_inter ( w g ) were calculated to be with 7 . 4 nm and 7 . 6 nm from ( numerical expression 6 ), respectively . these results were outputted on the screen in step 1312 and saved in the storage area of the inspection equipment . fig1 shows this situation . this inspection was performed to all the line patterns that were intended to be done so on the chip shown in fig5 . next , the quality of the wafer was determined . in the semiconductor manufacturing process of this embodiment , the criteria were as follows : cd value was 55 to 65 nm ; 3σ was 12 nm or less ; the index of short - period roughness 3σ_intra ( w g ) was 9 nm or less ; the index of long - period roughness 3σ_inter ( w g ) was 8 nm or less . if total 10 patterns of the chips that were inspected all satisfy the criteria , the wafer was determined to be acceptable , and was put into the next process . since all the chips in this wafer satisfied these criteria , this wafer was put into the next process , dry etching . incidentally in the above - mentioned example , a value of w g was entered in each inspection , but it was possible to eliminate a step of entering the value of w g by setting this value in advance . in this case , the inspection time is shortened . moreover , by using the above - mentioned indexes of short - period and long - period roughnesses , it is possible to estimate performance degradation in a transistor and its variation , for example , by means of techniques described in non - patent document 1 and non - patent document 7 . concretely , from the result of 3σ_intra , assuming that an internal gate length distribution of transistors is a gaussian distribution with a center value equal to a design value and the variance equal to σ_intra 2 , a fall of threshold voltage and an increase in dark current can be calculated . moreover , from the result of 3σ_inter , assuming that the internal gate length distribution described above becomes a gaussian distribution with the center value of the gate length distribution described above having a width of about σ_inter , a distribution of threshold voltages in the case where a plurality of transistors exist can be calculated . a fifth embodiment of this invention will be described using fig1 . fig1 is a schematic diagram of a power spectrum obtained in this embodiment . this embodiment shows an example where this invention is applied to two pattern images having different observation conditions and the magnitude of roughness is determined in a research and development phase for constructing a semiconductor device production process . in this embodiment , the equipment used in the embodiment 1 was used . when this embodiment was executed , no wafer sample was loaded in the equipment , and the equipment was used in order to analyze two images saved in the storage area inside the computer . the pattern shown in these two observation images was a line pattern of one line and was almost in the center of the image . first , a first observation result was called up from the storage area and displayed on the screen . observation magnification of this image was 150 , 000 both in the x - direction and the y - direction . the length and width of the area displayed in the image were both 900 nm . the image consisted of 512 pixels both in vertical and horizontal directions , and it was necessary to measure the line width etc . at a position corresponding to the pixel . as a result of noise reduction processing on the image , substantial resolution in the y - direction became 5 . 3 nm . 128 points of local line widths of the line pattern within this image were measured at intervals of 5 . 3 nm and a first roughness data was obtained . it has no meaning to set measurement interval to smaller than substantial resolution ( here 5 . 3 ). however , since it is preferable to measure as high a frequency component as possible , it was set equal to substantial resolution . second , a reason why roughness data was specified to have 128 terms was that it was necessary to set the number to any numerical value of powers of 2 in order to perform fast fourier transform , and that the number was set to as large a value as possible within a range in which a product of the number and the measurement interval did not exceed 900 nm . this set of roughness data is equivalent to a length of 675 nm on the line . these data were fourier transformed and the power spectrum was displayed . next , the second observation result was called up from the storage area and displayed . the observation magnifications of this image were 150 , 000 times in the x - direction as 40 , 000 times in the y - direction . the height and width of the area displayed in the image were 3375 nm and 900 nm , respectively . as a result of noise reduction processing on the image , the substantial resolution in the y - direction became 13 . 2 nm . 128 points of local line widths of the line pattern within this image were measured at intervals of 13 . 2 nm and a second roughness data was obtained . how to choose these values is the same as that in the case of the first image . this data is equivalent to the length of 1687 . 5 nm on the line . a power spectrum of this set of roughness data was also displayed on the same graph as the power spectrum of the first roughness data . fig1 shows this situation . for a value of integration region , it is recommended to use a frequency region common to the first and second spectra may be used . this can be easily determined by seeing a power spectrum . here , the integration region was set to 2 μm − 1 to 30 μm − 1 , these values were entered in the window for integration - region input of each set of data . 3σ c = 4 . 2 nm for the first roughness data and 6 . 3 nm for the second roughness data were obtained , and it was found that the pattern of the first image had smaller roughness . calculating the integral value 3σ c with the integration range being set is equal to deciding the sampling conditions ( whole length and sampling interval ) of roughness data , calculating the roughness data , and finding 3σ from the data . however , without this function , it is impossible to sample under the same conditions two images observed under different conditions because of complexity of the procedure . this invention makes it possible to decide an integration region with an easy procedure and compare two data . the evaluation method of fine pattern feature and its equipment according to this invention evaluates frequency components that cause important effects on device performance among frequency components of the line - edge roughness . this evaluation enables pattern feature inspection that suits a devise structure and final specifications of a device , thereby improving device productivity .	6
fig1 is a perspective view of a modular building 10 constituting a dual module embodiment of the present invention . building 10 is shown comprising front wall panels 12 and 14 , a pair of end wall panels 16 , 18 , a partition panel 20 and floor panels 22 , 24 . each of the front wall panels 12 , 14 , has an opening in which is mounted a roll - up door 26 . the roll - up door 26 is a commercially available item which may be obtained from roll a flex doors corporation of anaheim , california . other types of doors , as well as windows , screens , etc . may be utilized as portions of the wall panels in the modular building system of this invention . the building 10 comprises two bays 11a and 11b each of which corresponds to a basic module of the invention . fig2 is an exploded view showing the various elements utilized in the modular building system of the present invention and may be taken as corresponding to building 10 of fig1 with the omission of the intermediate partition 20 for ease of illustration . rear wall panels 30 , 32 and roof panels 34 , 36 , not visible in fig1 are also shown in fig2 as are the various elements making up the frame of the building to which the respective panels are mounted . the building frame of the dual module version represented in fig2 comprises three main frames 40 -- one each , designated 40a , for the front and back walls of the basic module 11a and a third , designated 40b being mounted at the end of the basic module 11b aligned with the end wall panel 18 . the main frames 40 are interconnected by connector beams 42 , of which there are eight . the four connector beams which are designated 42a extend between respective pairs of corners of the main frames of the basic module 11a these main frames having been designated by the numeral 40a . the remaining four connector beams , which have been designated 42b , are aligned as extensions of the main frames 40a and in the same planes therewith and connect orthogonally to the end wall main frame 40b . fig3 shows a main frame 40 which is constructed by welding together sections of 4 &# 34 ;× 4 &# 34 ; continuous welded box tubing having a wall thickness of 1 / 8 &# 39 ;. the main frame 40 comprises two horizontal sections 50 , each 10 &# 39 ; 8 &# 34 ; long , which are welded to two vertical sections 52 which are 8 &# 39 ; in length . this establishes an opening which is exactly 8 &# 39 ;× 10 &# 39 ;. the overall dimensions are 8 &# 39 ; 8 &# 34 ;× 10 &# 39 ; 8 &# 34 ;. fabrication in this manner leaves the ends 54 of the horizontal box tube sections accessible . a stub carrier 56 is welded at each corner of the main frame 40 to extend approximately 4 &# 34 ; in a direction orthogonal to the plane of the main frame 40 . the stub carriers 56 are dimensioned to fit the interior opening of the 4 &# 34 ;× 4 &# 34 ; box tubing and are provided to engage the connector beams which attach to the main frame 40 . fig4 shows details of the fabrication of the ends of a connector beam 42 , also cut from 4 &# 34 ;× 4 &# 34 ; box tubing . each beam end is provided with a cutout 44 whereby one wall of the box tubing is removed for an extent of about four inches . this permits the end of the beam 42 to be readily slipped over one of the stub carriers 56 during assembly . at the end of the cutout region , a cross plate 46 is welded in place transversely of the longitudinal axis of the beam 42 . the cross plate 46 has a central opening and a coarse - threaded nut 48 welded or otherwise affixed to the back side of the cross plate 46 in alignment with its central opening . this construction permits the attachment of the connector beams 42 to the main frames 40 . this is better illustrated in fig5 and 6 which show a single connector beam 42 coupled between a pair of parallel main frames 40 , interconnecting a pair of opposed corners of the two main frames . once the connector beam 42 is in place extending between and resting upon the stub carriers 56 , spacers 57 ( see fig7 ) and bolts 58 are inserted into the main frames 40 . as particularly shown in the detailed view of fig6 the bolt 58 extends through openings in opposite walls of the ends of the horizontal sections of the main frame 40 , through the central opening of the cross plate 46 to threadably engage the nut 48 . tightening the bolt 58 into the nut 48 fastens the connector beam 42 to the main frame 40 in a rigid connection . the spacer 57 , particularly shown in fig7 comprises a pair of opposed plates 60 which are welded to a tube 62 through which the bolt 58 is inserted . the plates 60 support the tube 62 at the proper position for alignment with the main frame bolt holes so that the fastening bolt may be readily slipped into the tube 62 and at the same time the spacer tube serves as a guide for the bolt in establishing alignment with the second hole in the main frame . the spacer 57 also serves to prevent the corners of the main frame 40 from being deformed as the bolt 58 is tightened to rigidize the joint between the connector beam 42 and main frame 40 . fig8 and 9 show wall brackets of two different configurations , z - shaped and w - shaped , for mounting at the inside corners of the building to secure the wall panels and roof panels in the openings defined by the building frame . each of the wall and roof panels comprises a core positioned within a surrounding mounting flange . the flange is typically formed of extruded sections which are welded together at mitered corners to form a rectangular frame . the wall panel mounting flanges are drilled with suitably located holes through which mounting bolts are inserted for attachment to the mounting brackets 70 , 72 . fig1 a shows one configuration of a wall panel such as 18 and flange strip 74 fastened to a column of a main frame 40 means of the z - shaped bracket 70 . after the building frame is erected by connecting the main frames 40 and connector beams 42 in the manner previously described , the wall panels such as 18 with flange 74 and bolts 76 affixed are placed in the vertical openings of the building frame . from the interior of the building , the z - shaped brackets 70 are then placed against vertical columns of the main frame 40 with the openings of the bracket 40 matching the bolts 76 , and nuts 78 are secured thereon . because of the clearance between the z - bracket 70 and the wall panel 18 , tightening the nut 78 on the bolt 76 draws the exterior flange 74 tightly against the column of the main frame 40 , thereby securely holding the wall panel in place . when installed in this manner , the wall panels and the building frame work as an integral unit to further rigidize and firm up the building structure . fabrication and assembly in this manner eliminates the need to drill any mounting holes on the site , since there are no holes in the beams of the main frame 40 nor is it necessary to drill any of the holes in the wall panels on the site or to worry about matching up any of the mounting holes . it will be understood that , prior to the installation of the building panels to the frame , all mating surfaces between the panels and the frame are coated with an appropriate sealant to make the structure weather tight and insect proof . fig1 b shows an extruded flange 74 &# 39 ; which is provided as an alternative to the extruded frame 73 and flange strip 74 shown in the panel mounting arrangement of fig1 a . the installation of the panel 18 and flange 74 &# 39 ; through use of the z - shaped wall bracket 70 is the same as already described . fig1 shows the use of a w - shaped bracket 72 in the mounting of two wall panels 18 or a wall panel 18 and a roof panel 36 to a main frame 40 or connector beam 42 . mounting of the w - shaped bracket 72 to the associated panels is similar to the mounting by tee z - shaped bracket 70 of fig1 a and 10b , except that the w - shaped bracket 72 is capable of connecting simultaneously to two right - angled panels . fig1 - 15 are &# 34 ; stick &# 34 ; figures provided to show various arrangements of the basic elements herein which may be used in constructing different modular buildings according to my invention . in these figures , only the main frames and connector beams are indicated . the additional connector elements which permit these combinations will be shown and described in connection with succeeding figures of the drawings . as indicated in fig1 , a two - bay modular building may be constructed from three main frames 40 and eight connector beams 42 . main frames 40a and 40b will be erected with their stub carriers 56 facing each other and then the four connector beams 42a would be connected as indicated in fig5 . connections for the attachment of the connector beams 42b to the main frame 40b may be in accordance with the connection arrangement indicated in fig1 a and 16b , described hereinbelow . fig1 illustrates a two - bay modular building frame design which may be constructed from four main frames 40 and eight connector beams 42 . in this design , adjacent main frames 40a and 40b may be tied together in line by means of the connector arrangement illustrated in fig1 a and 17b , described hereinbelow . attachment of the connector beams 42 is by use of the stub carriers 56 and the connector scheme shown in fig5 and 6 . fig1 and 15 are similar &# 34 ; stick &# 34 ; figure diagrams showing ways of achieving a three - bay modular building in accordance with the present invention . the design shown in fig1 utilizes four main frames 40 and twelve connector beams 42 . fig1 represents the addition of a basic module to the two - bay design shown in fig1 , by resort to the connection design which requires only one additional main frame 40 . fig1 is a three - bay building frame design which utilizes five main frames 40 and twelve connector beams 42 . this arrangement basically corresponds to the addition of a single main frame 40 and attaching connector beams 42 at right angles to the two - bay structure represented in fig1 . fig1 a and 16b illustrate one way in which a basic module may be extended through the attachments of connector beams to a transverse main frame from the side of the main frame opposite the position of the stub carriers . in fig1 a , a portion of a transverse main frame 40 is shown having a stub carrier 56 on its left - hand face . a portion of a connector beam 42a is shown ready for attachment over the stub carrier 56 in the manner already described . for attachment of the second connector beam 42b in line with the connector beam 42a , an extender coupler 80 is provided . the coupler 80 is essentially a cube , open along one face and having a bolt hole 82 and a slot 84 in opposed faces adjacent the open face . in a preferred connection method , the extender coupler 80 is attached to the end of the connector beam 42b by means of a short connector bolt ( not shown ) which is fed into the coupler 80 through the open face and then through the hole 82 to engage the coarse - threaded nut in the cross plate at the end of the beam 42b ( see fig4 ). the beam 42b is then ready for attachment to the main frame 40 by slipping the edges of the slot 84 under the head of the connector bolt ( not shown ) which is used to secure the beam 42a to the main frame 40 illustrated in fig1 a . the bolt may be tightened by a wrench which is provided access through the open face of the coupler 80 . the completed assembly is represented in fig1 b , where the connector beams 42a and 42b are shown drawn tightly up against the main frame 40 so that only the spacer 57 is visible from this angle . this connecting method would be utilized in construction of the two - bay module represented in fig1 , for example . fig1 a and 17b show an arrangement for connecting a pair of main frames 40a and 40b in an in - line configuration corresponding to the design depicted in fig1 . this connection method utilizes a main frame coupler 90 which is essentially a short section of box tubing dimensioned to fit within the 4 &# 34 ;× 4 &# 34 ; box tubing of the main frames . two opposing faces of the coupler 90 are provided with pairs of holes 92 which are positioned to be aligned with the holes in the main frames 40a and 40b . typically spacers 57 are inserted in the coupler element 90 in alignment with the holes 92 , and then one end of the element 90 is slipped into the opening at the base of the main frame 40a and the first bolt 58 is used to hold it in place and to engage the corresponding connector beam 42 in the manner previously described . the second main frame 40b is then moved into position over the extending end of the coupler 90 and the second bolt 58 is inserted to connect to a corresponding connector beam . fig1 b shows the completed assembly of the main frames 40a and 40b for this type of connection arrangement . the space between the main frames 40a and 40b is variable depending upon the dimensions selected for the in - line coupler 90 . thus the space between the in - line main frames 40a and 40b may be varied from almost zero , as shown in fig1 b , to several inches or a few feet , as desired . fig1 illustrates an arrangement for constructing an l - shaped modular building , corresponding to the design indicated in fig1 , for example . fig1 shows a single main frame 40 with connector beams 42a and 42b attached in the manner of fig1 a and 16b . with the addition of an orthogonal coupler 100 , a third connector beam 42c can be attached to the same common junction of the beams 42a and 42b . the coupler 100 is dimensioned to fit into the openings 44 of the connector beam 42c and 54 of the main frame 40 . it has a pair of holes 102 in its opposite sides and a third hole 104 in a closed end plate of the coupler 100 . the hole 104 is for the purpose of permitting attachment to the end of the beam 42c in the manner described with respect to the extender coupler 80 of fig1 a . holes 102 are for engaging the bolt 58 ( see fig6 ) which ties together the beams 42a and 42b . a different sized spacer 57 &# 39 ; is used in this arrangement , the spacer 57 &# 39 ; being like the spacer 57 except that it is dimensioned to fit within the coupler 100 in alignment with the holes 102 . with the coupler 100 attached t the beam 42c , and before the bolt 58 is inserted to tie together the beams 42a and 42b , the beam 42c and coupler 100 are moved into position within the opening 54 at the base of the main frame 40 . the attachment bolt is then slipped through the slot 84 of the coupler 80 at the end of the beam 42b , through the aligned holes in the main frame , coupler 100 and spacer 57 &# 39 ;, and then tightened in engagement with the nut in the end plate 46 of beam 42a . this versatility in providing connector elements adapted to extend the modular building in any direction from the main frames of the basic module permits the construction of buildings which may be l - shaped , square or rectangular with any number of basic modules ( or bays ) as desired . as noted above , additional modules can be stacked , one above the other , so that a multi - story construction can be achieved . the structural elements making up the modular building design are almost totally prefabricated in a central factory , thereby contributing to a substantial reduction in overall cost while extending the versatility of the modular shell design because of the fact that erection of the housing on the building site can be accomplished quickly and easily with a minimum number of special tools and skilled workmen . the modular housing design of the present invention also permits ready disassembly for re - use or storage , as desired . the various components making up the modular design are all essentially two - dimensional elements so that stacking of the components into a very compact package for transportation or storage is possible . fig1 illustrates one particular arrangement for stacking the components making up a single basic module . in this arrangement , a pair of main frames 40a , 40b are stacked with the stub carriers 56 facing each other . sleeves 110 are placed over the stub carriers 56 to hold the main frames 40a , 40b in position , and shipping bolts 112 are inserted to lock the combination together . in the spaces between the two main frames , the connecting beams 42 are positioned , together with the side wall panels . two roof panel sections 34a and 34b and two floor panel sections 22a and 22b are shown stacked below the main frame / connector beam combination to make up the basic module package . although there have been described above specific arrangements of a modular building system in accordance with the invention for the purpose of illustrating the manner in which the invention may be used to advantage , it will be appreciated that the invention is not limited thereto . accordingly , any and all modifications , variations or equivalent arrangements which may occur to those skilled in the art should be considered to be within the scope of the invention as defined in the annexed claims .	4
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . in the drawings , the thickness of layers and regions are exaggerated for clarity . like numbers refer to like elements throughout . it will also be understood that when a layer is referred to as being &# 34 ; on &# 34 ; another layer or substrate , it can be directly on the other layer or substrate , or intervening layers may also be present . fig7 is a plan view showing pixel arrangements of ccd solid - state image sensors according to the present invention . as illustrated , a five phase ccd is used as a charge transferring means . a first photodiode pd1 and a second photodiode pd2 are arranged to be vertically adjacent to each other , and first through fifth gate electrodes φv1 to φv5 are arranged vertically so as to correspond to the first and second photodiodes pd1 and pd2 . charge accumulated in the first photodiode pd1 is transferred to a vertical region in a lower portion of the second gate electrode φv2 through a first transmission channel ch1 . charge accumulated in the second photodiode pd2 is transferred to the vertical transfer region in the lower portion of the fifth gate electrode φv5 through a second transmission channel ch2 . the charge transferred to the vertical transfer region is transmitted in a vertical direction by clock pulses applied to the first to fifth gate electrodes φv1 to φv5 . while two or three gate electrodes are arranged to correspond to every unit photodiode in fig1 and 4 , five gate electrodes φv1 through φv5 are arranged to correspond to every two adjacent photodiodes pd1 and pd2 , in fig7 . therefore , ccd area efficiency is 2 / 5 , which is larger than conventional efficiencies of 1 / 4 or 1 / 3 . fig8 is a layout diagram which may be used for realizing ccd solid - state image sensors of fig7 . reference numerals pd1 and pd2 respectively denote first and second photodiodes . reference numerals 10 , 20 , 30 and 32 respectively denote a vertical transfer region of a vertical ccd ( indicated by a single dashed line ), a channel stop region which separates the respective photodiodes ( the dotted region ), and first and second transmission channels ( the oblique - lined regions ). reference numerals 40 , 50 , 60 , 70 and 80 respectively denote a mask pattern for forming a first gate electrode ( indicated by a dotted line ), a mask pattern for forming a third gate electrode ( indicated by a dotted line ), a mask pattern for forming a second gate electrode ( indicated by a double dashed line ), a mask pattern for forming a fifth gate electrode ( indicated by a double dashed line ) and a mask pattern for forming a fourth gate electrode ( indicated by a solid line ). reference numerals φv1 - φv5 respectively denote first to fifth gate electrodes . the first and the second photodiodes pd1 and pd2 are arranged to be vertically adjacent each other , and the first to fifth gate electrodes φv1 to φv5 are arranged to be elongated in a vertical direction so as to correspond to the two photodiodes . the respective photodiodes are separated by the channel stop region 20 . the first photodiode pd1 is formed to transmit charge to the vertical transfer region in the lower portion of the second gate electrode φv2 by the first transmission channel 30 . the second photodiode pd2 is formed to transmit charge to the vertical transfer region in the lower portion of the fifth gate electrode φv5 by the second transmission channel 32 . the charge transmitted to the vertical transfer regions in the lower portions of the second and fifth gate electrodes are transferred in a vertical direction by the clock pulses applied to the respective gate electrodes . the portions indicated by the same kind of lines , for example , solid lines , dashed lines , etc , in the mask patterns of fig8 denote the same material layers . in other words , the first and third gate electrodes φv1 and φv3 indicated by the dashed lines are both formed of a first conductive layer . the second and fifth gate electrodes φv2 and φv5 indicated by the double dashed lines are formed of a second conductive layer . the fourth gate electrode φv4 indicated by the solid line is formed of a third conductive layer . also , the mask patterns 40 , 60 , 50 and 70 for forming the first , second , third and fifth gate electrodes are elongated in a horizontal direction with respect to the arrangement direction of the photodiodes . the mask pattern 80 for forming the fourth gate electrode is elongated in a vertical direction with respect to the arrangement direction of the photodiodes . the first to fifth gate electrodes φv1 to φv5 are also designed so that the areas in which they come into contact with the semiconductor substrate are the same size as each other . fig9 and 10 are sectional views taken along the ix - ix &# 39 ; and x - x &# 39 ; lines of fig8 . the first and third gate electrodes 104 and 106 are formed of a first conductive layer . the second and fifth gate electrodes 110 and 112 are formed of a second conductive layer . the fourth gate electrode 116 is formed of a third conductive layer . also , referring to fig1 , it is noted that the first photodiode pd1 can transfer charge to the vertical transfer region 10 through a first transmission channel 15 by a voltage applied to the second gate electrode 110 . the respective photodiodes are electrically separated from the vertical transfer region 10 by a channel stop region 3 . in fig9 and 10 , the remaining reference numerals will be described in connection with fig1 a - 11c . fig1 a to 11c are sectional views illustrating methods for manufacturing ccd solid - state image sensors according to the present invention . fig1 a shows a process for forming the first and third gate electrodes 104 and 106 , which includes the steps of : ( 1 ) blanket forming a gate insulating film 102 on the entire surface of a semiconductor substrate in which the first and second photodiodes ( not shown ), the vertical transfer region ( not shown ), the first and second transmission channels ( not shown ) and a channel stop region ( not shown ) are formed ; ( 2 ) forming a first conductive layer by depositing a layer such as polysilicon ; and ( 3 ) forming the first and third gate electrodes 104 and 106 by patterning the first conductive layer . the first gate electrode 104 is formed to be spaced apart from the third gate electrode 106 by a predetermined distance . fig1 b shows a process for forming the second and fifth gate electrodes 110 and 112 , which includes the steps of : ( 1 ) forming a first insulating layer 108 by oxidizing the surfaces of the first and third gate electrodes 104 and 106 ; ( 2 ) blanket forming a second conductive layer by depositing a conductive layer such as polysilicon ; and ( 3 ) forming the second and fifth gate electrodes 110 and 112 by patterning the second conductive layer . the second gate electrode 110 is arranged between the first gate electrode 104 and the third gate electrode 106 , and the fifth gate electrode 112 is formed to be spaced apart from the third gate electrode 106 by a predetermined distance . fig1 c shows a process for forming the fourth gate electrode 116 and an insulating layer 118 , which includes the steps of : ( 1 ) forming the second insulating layer 114 by oxidizing the surfaces of the second and fifth gate electrodes 110 and 112 ; ( 2 ) blanket forming the third conductive layer on the entire surface of the resultant substrate on which the second insulating layer 114 is formed ; ( 3 ) forming the fourth gate electrode 116 by patterning the third conductive layer ; and ( 4 ) blanket forming the insulating layer 118 on the fourth gate electrode 116 . the fourth gate electrode 116 is formed between the third gate electrode 106 and the fifth gate electrode 112 . also , in fig1 a to 11c , the areas in which the first through fifth gate electrodes come into contact with the semiconductor substrate are the same as each other . fig1 is a waveform of clock pulses applied to ccd solid - state pixel sensors according to the present invention . fig1 is a conceptual view of the vertical charge when the clock pulses shown in fig1 are applied to the ccd solid - state image sensors according to the present invention . referring to fig1 and 13 , charge transferring methods of ccd solidstate image sensors according to the present invention in which a five - phase clock is used , will be described . during a period &# 34 ; t0 &# 34 ;, a clock pulse of 0 v is applied to the first , third and fourth gates φv1 , φv3 and φv4 , respectively , and a clock pulse of more than vcc is applied to the second and fifth gate electrodes φv2 and φv5 . therefore , the potential well of the vertical transfer region in the lower portions of the second and fifth gate electrodes φv2 and φv5 is lowered and the charge accumulated in the first and second photodiodes pd1 and pd2 is respectively transferred to the vertical transfer regions in the lower portions of the second and the fifth gate electrodes φv2 and φv5 through the first and second transmission channels ch1 and ch2 . during a period &# 34 ; t1 &# 34 ;, a clock pulse of 0 v is applied to the first , the third and fourth gate electrodes φv1 , φv3 and φv4 , and a clock pulse of vcc is applied to the second and fifth gate electrodes φv2 and φv5 . the potential well of the vertical transfer regions in the lower portions of the second and fifth gate electrodes φv2 and φv5 becomes higher than that of &# 34 ; t0 &# 34 ;. during a period &# 34 ; t2 &# 34 ;, a clock pulse of 0 v is applied to the first and fourth gate electrodes φv1 and φv4 and a clock pulse of vdd is applied to the second , third and fifth gate electrodes φv2 , φv3 , and φv5 . the potential well of the vertical transfer region in the lower portion of the third gate electrode φv3 is lowered . thus , the charge existing only in the vertical transfer region in the lower portion of the second gate electrode φv2 is diffused into the vertical region in the lower portion of the third gate electrode φv3 . during a period &# 34 ; t3 &# 34 ;, the clock pulse of 0 v is applied to the first , second and fourth gate electrodes φv1 , φv2 , and φv4 , and vcc is applied to the third and fifth gate electrodes φv3 and φv5 . the potential well of the vertical transfer region in the lower portion of the second gate electrode φv2 becomes higher and that of the vertical transfer region in the lower portion of the third gate electrode φv3 is lowered . thus , the charge existing over the vertical transfer regions in the lower portions of the second gate electrode φv2 and third gate electrode φv3 moves to the vertical transfer region in the lower portion of the third gate electrode φv3 . as a result , in the periods from &# 34 ; t0 &# 34 ; to &# 34 ; t3 &# 34 ;, the charge existing in the vertical transfer region in the lower portion of the second gate electrode φv2 is transferred to the vertical transfer region in the lower portion of the third gate electrode φv3 . during a period &# 34 ; t4 &# 34 ;, a clock pulse of 0 v is applied to the second and fourth gate electrodes φv2 and φv4 , and a clock pulse of vcc is applied to the first , third and fifth gate electrodes φv1 , φv3 and φv5 . the potential well of the vertical transfer region in the lower portion of the first gate electrode φv1 is lowered . thus , the charge existing in the vertical transfer region in the lower portion of the fifth gate electrode φv5 is diffused to the vertical transfer region in the lower portion of the first gate electrode φv1 . during a period &# 34 ; t5 &# 34 ;, a clock pulse of 0 v is applied to the second , fourth and fifth gate electrodes φv2 , φv4 and φv5 , respectively , and a clock pulse of vcc is applied to the first and third gate electrodes φv1 and φv3 , respectively . the potential well of the vertical transfer region in the lower portion of the fifth gate electrode φv5 becomes higher . thus , the charge existing over the vertical transfer regions in the lower portions of the fifth gate electrode φv5 and the adjacent first gate electrode φv1 move to the vertical transfer region in the lower portion of the adjacent first gate electrode φv1 . as a result , in the periods from &# 34 ; t4 &# 34 ; to &# 34 ; t5 &# 34 ;, the charge existing in the vertical transfer region in the lower portion of the fifth gate φv5 is transferred to the vertical transfer region in the lower portion of the adjacent first gate electrode φv1 . during a period &# 34 ; t6 &# 34 ;, a clock pulse of 0 v is applied to the second and fifth gate electrodes φv2 and φv5 , and a clock pulse of vcc is applied to the first , third and fourth gate electrodes φv1 , φv3 , and φv4 . the potential well of the vertical region in the lower portion of the fourth gate electrode φv4 is lowered . thus , the charge existing in the vertical transfer region in the lower portion of the third gate electrode φv3 are diffused to the vertical transfer region in the lower portion of the fourth gate electrode φv4 . during a period &# 34 ; t7 &# 34 ;, a clock pulse of 0 v is applied to the second , third and fifth gate electrodes φφv2 , φv3 and φv5 , and a clock pulse of vcc is applied to the first and fourth gate electrodes φv1 and φv4 . the potential well of the vertical transfer region in the lower portion of the third gate electrode φv3 becomes higher . thus , the charge existing over the vertical regions in the lower portion of the third gate electrode φv3 and fourth gate electrode φv4 move to the vertical region in the lower portion of the fourth gate electrode φv4 . as a result , in the periods from &# 34 ; t6 &# 34 ; to &# 34 ; t7 &# 34 ;, the charge existing in the vertical transfer region in the lower portion of the third gate φv3 is transferred to the vertical transfer region in the lower portion of the fourth gate electrode φv4 . during a period &# 34 ; t8 &# 34 ;, a clock pulse of 0 v is applied to the third and fifth gate electrodes φv3 and φv5 , and a clock pulse of vcc is applied to the first , second and fourth gate electrodes φv1 , φv2 and φv4 . the potential well of the vertical transfer region in the lower portion of the second gate electrode φv2 is lowered . thus , the charge existing in the vertical transfer region in the lower portion of the first gate electrode φv1 is diffused to the vertical transfer region in the lower portion of the second gate electrode φv2 . during a period &# 34 ; t9 &# 34 ;, a clock pulse of 0 v is applied to the first , third and fifth gate electrodes φv1 , φv3 and φv5 , and a clock pulse of vcc is applied to the second and fourth gate electrodes φv2 and φv4 . the potential well of the vertical transfer region in the lower portion of the first gate electrode φv1 becomes higher . thus , the charge existing over the vertical transfer regions in the lower portions of the first gate electrode φv1 and second gate electrode φv2 moves to the vertical transfer region in the lower portion of the second gate electrode φv2 . as a result , in the periods from &# 34 ; t8 &# 34 ; to &# 34 ; t9 &# 34 ;, the charge existing in the vertical transfer region in the lower portion of the first gate φv1 is transferred to the vertical transfer region in the lower portion of the second gate electrode φv2 . during a period &# 34 ; t10 &# 34 ;, a clock pulse of 0 v is applied to the first and third gate electrodes φv1 and φv3 , and a clock pulse of vcc is applied to the second , fourth and fifth gate electrodes φv2 , φv4 and φv5 . the potential well of the vertical transfer region in the lower portion of the fifth gate electrode φv5 is lowered . thus , the charge existing in the vertical transfer region in the lower portion of the fourth gate electrode φv4 is diffused to the vertical transfer region in the lower portion of the fifth gate electrode φv5 . during a period &# 34 ; t11 &# 34 ;, a clock pulse of 0 v is applied to the first , third and fourth gate electrodes φv1 , φv3 and φv4 , and a clock pulse of vcc is applied to the second and fifth gate electrodes φv2 and φv5 . the potential well of the vertical transfer region in the lower portion of the fourth gate electrode φv4 becomes higher . thus , the charge existing over the vertical transfer regions in the lower portions of the fourth gate electrode φv4 and fifth gate electrode φv5 moves to the vertical transfer region in the lower portion of the fifth gate electrode φv5 . as a result , in the periods from &# 34 ; t10 &# 34 ; to &# 34 ; t11 &# 34 ;, the charge existing in the vertical transfer region in the lower portion of the fourth gate φv4 is transferred to the vertical transfer region in the lower portion of the fifth gate electrode φv5 . therefore , according to the above - mentioned driving method , the charge accumulated in the vertical transfer regions in the lower portions of the second and fifth gate electrodes are transferred by a five phase driving voltage applied to the first to fifth gate electrodes φv1 to φv5 . structures , manufacturing methods , and driving methods of the present invention can be applied to solid - state image sensors having at least first through nth photodiodes and first through 2n + 1th gate electrodes corresponding to the photodiodes , where n is at least two . thus , solid - state image sensors having the first and second photodiodes and the first through fifth gate electrodes corresponding to the photodiodes are the minimum size . a clock pulse of 2n + 1 phases is applied to the 2n + 1 gate electrodes . therefore , solid - state image sensors and methods for manufacturing and driving the same according to the present invention , can improve charge transferring performance since ccd area efficiency of 2 / 5 can be obtained , using three - layer polysilicon processing . in the drawings and specification , there have been disclosed typical preferred embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims .	7
during dvd playback , typical mobile computing device users set their display configuration once and maintain that display setting through most or all of the dvd viewing . unless the display settings change during playback , the mobile computing device will generate identical display images and overlay constantly changing video images on the display images to form the sequence of display frames . generating many identical display images involves reading identical display data from main memory and performing identical graphics computations to generate the display images . additionally , decoding the video images read from the dvd player typically includes numerous read and write operations on video data stored in memory . efficiencies may be realized by storing a copy of display data and some or all video data within the gpu , thereby eliminating or reducing the need to fetch both sets of data from main memory . further efficiencies may be realized by using run - length encoding (“ rle ”) to reduce the amount of memory used when storing the display data in the gpu . overall , the aforementioned efficiencies may substantially reduce the power consumed in the mobile computing device relative to prior art solutions while maintaining high graphics performance . fig2 illustrates functional components of a gpu 202 according to an embodiment of the invention . in the description of the invention provided below , the gpu 202 is used in place of the gpu 102 in the mobile computing device 100 shown in fig1 . as shown in fig2 , the gpu 202 includes display logic 206 , which generates display frames by overlaying video pixels onto display pixels during video playback as previously described in the discussion of fig1 , a frame buffer 204 , which generates display pixels from display data and video pixels from video data , and a bus interface controller 208 , which transfers video data and display data between the frame buffer 204 and the main memory 106 during pixel generation . the frame buffer 204 includes a local memory 220 , an rle engine 222 , which encodes display pixels and internally stores the encoded display pixels , an mpeg engine 226 , which decodes video data into video pixels , and composite and reorder logic 224 , which receives video pixels and display pixels from the mpeg engine 226 and rle engine 222 , respectively , and reorders these pixels into two continuous and ordered series of pixels . additionally , the frame buffer 204 includes a state bit memory 216 , snoop logic 218 , and control logic 214 . the state bit memory 216 maintains a state bit for the encoded display data stored in the rle engine 222 . the snoop logic 218 monitors the bus 112 for operations that invalidate the encoded display data stored in the rle engine 222 . if the snoop logic 218 detects that display data in main memory 106 is written to , the snoop logic 218 clears the state bit that corresponds to the encoded display data stored in the rle engine 222 , causing future read or write operations on the display data to access the main memory 106 . the control logic 214 directs the function of each element within the frame buffer 204 and includes a base address register file (“ bar ”) 228 , which stores base addresses and block sizes of video data stored in the main memory 106 . the state bit memory 216 also includes a state bit for each of the main memory address range defined in bar 228 . these state bits are set under software control and a state bit of “ 1 ” signifies that the corresponding main memory address range is valid . in one embodiment of the invention , up to eight address ranges may be defined in the bar 228 . in other embodiments of the invention , any technically feasible number of address ranges may be defined by the bar 228 without departing from the scope of the invention . in the embodiment of the invention illustrated in fig2 , the local memory 220 is a 2 mb embedded dynamic random access memory (“ edram ”). in other embodiments of the invention , the local memory 220 may be any technically feasible type or size of memory without departing from the scope of the invention . referring to fig1 and 2 , when the user initiates video playback , the application program 136 begins by reading video data from the dvd player 110 and storing the video data in the main memory 106 in encoded form . next , the gpu 202 reads display data from the main memory 106 and uses that data to generate display pixels for the display image . additionally , the gpu 202 reads the video data from the main memory 106 and uses the video data to generate video pixels for the video image . finally , the display logic 206 overlays the video image over the display image and generates a display frame from the overlaid result . this display frame generation process is repeated to form a sequence of display frames , with one display frame for each video image on the dvd , unless the user interrupts the dvd playback by changing system settings , such as display resolution , or manually interrupting dvd playback . during display pixel generation , the gpu 202 reads display data from the main memory 106 and performs operations on that display data to generate display pixels . the rle engine 222 performs run - length encoding on the generated display pixels and stores the encoded display pixels in the rle engine 222 , allowing the gpu 202 to avoid reading display data from the main memory 106 and generate display pixels from that display data during subsequent display frame generation operations . however , future use of display data stored in the rle engine 222 is dependent on the validity of that stored data , as determined by the value of the display data state bit in the state bit memory 216 . if the snoop logic 218 determines that the display data in the main memory 106 has changed , snoop logic 218 clears the display data state bit , which causes the gpu 202 to regenerate the display pixels from display data in the main memory 106 when generating the next display frame . during video pixel generation , the video data undergoes operations , such as inverse discrete cosine transforms ( idct ) and motion compensation , that require multiple read and write operations on the video data . the gpu 202 enables such operations to be carried out using local memory 220 for some or all of the video data . the control logic 214 directs all read and write operations of video data that are stored at addresses that fall within a valid main memory address range to be performed using the local memory 220 rather than the main memory 106 . also , when the mpeg engine 226 is reading and writing video data during video data decoding , memory operations whose addresses are within the ranges of addresses stored in the bar 228 are directed to the local memory 220 by the control logic 214 if the state bit within the state bit memory 216 corresponding to the addresses is set ( e . g ., state bit value = 1 ). alternatively , during video data decoding , memory operations whose addresses are not within the ranges of addresses configured in the bar 228 , or whose corresponding state bits in the state bit memory 216 are clear ( e . g ., state bit value = 0 ), are directed to the main memory 106 as described in the discussion of fig1 . additionally , once the mpeg engine 226 generates the video pixels for the next display frame , this group of pixels must be combined into a single , contiguous and ordered stream of pixel data to allow the display logic to use that stream of pixel data for overlaying the video image onto the display image and generating the next display frame . the composite and reorder logic 224 performs this function by unifying and ordering the video pixels from the mpeg engine 226 for use by the display logic 206 . by contrast , the rle engine 222 produces a single , contiguous and ordered stream of display pixels and no further processing is done to the display pixels by the composite and reordering logic 224 . the display pixels are unified and ordered by the composite and reorder logic 224 for use by the display logic 206 . fig3 a and 3b illustrate a flowchart of a method 300 for performing video playback using display data and video data stored in the gpu 202 . as shown , the method 300 begins at a step 302 , where a user initiates video playback using a dvd player application program . the next four steps , steps 304 - 310 , are configuration steps . in step 304 , the application program requests the graphics adapter software driver to configure the gpu 202 for video playback in preparation for beginning playback . in step 306 , the software driver clears the state bits for the video data and the state bit for the display data . in step 308 , the software driver programs the bar 228 with starting addresses and block sizes that are associated with blocks of video data and sets the state bits for each of these video data blocks . as previously described , when the address of a read or write operation is within a range of addresses defined by a bar register , the read or write operation will use the local memory 220 rather than the main memory if the state bit that corresponds to the matching entry in the bar 228 is set . in step 310 , the software driver configures the overlay functionality by selecting an overlay reference color ( e . g ., magenta ) and filling some or all of the display image region to be overlaid with a rectangular display image of the reference color . if the aspect ratios of the display image and video image cause borders to also be generated during overlay , the software driver configures the borders with the border color ( e . g ., black ) in this step . steps 312 - 322 are repeatedly carried out to display a sequence of display frames generated by the gpu 202 until the global display conditions or display data change or dvd playback is complete . first , the application program reads video data from the dvd player ( step 312 ) and stores the video data in the main memory ( step 314 ). in step 316 , the gpu 202 generates video pixels for the next display frame from the video data and display pixels for the next display frame from the display data . the video data and the display data used in generating the video pixels and the display pixels may be read from the main memory or the local memory 220 , as described in further detail in fig4 and 5 . upon completing step 316 , video pixels are overlaid onto display pixels ( step 318 ) and a complete display frame is generated therefrom ( step 320 ). in step 322 , the gpu 202 checks whether any global settings changed since the beginning of the last frame generation which warrant reconfiguring the gpu 202 before generating the next frame . the changes in global settings would occur , for example , in response to any change to the display resolution or a request for the application program to skip ahead during dvd playback . if global conditions have changed since the beginning of the last frame generation , the method 300 proceeds to step 306 where the software driver reconfigures the bar 228 to support the change to global conditions . on the other hand , if global conditions are unchanged since the beginning of the last frame generation , the method 300 continues to step 324 where the gpu 202 determines whether dvd playback has completed . if the dvd playback is complete , the method 300 proceeds to step 326 where it terminates . if dvd playback is not complete , the method 300 proceeds to step 312 where the application program reads video data for the next display frame from the dvd player . fig4 illustrates a flowchart of a method 400 for generating display pixels from display data stored in main memory or the rle engine 222 during frame generation . the display pixels generated in accordance with the method 400 are subsequently used in step 318 of the method 300 . as shown , the method 400 for generating display pixels during frame generation begins with step 402 , where the gpu 202 determines whether the display data state bit in the state bit memory 216 is set . if the display data state bit is not set , display data is not stored in the rle engine 222 , so the method 400 proceeds to step 404 , where the gpu 202 reads display data from main memory as described in the discussion of fig1 . in step 406 , the gpu 202 generates display pixels from the display data read in step 404 . in step 408 , the rle engine 222 run - length encodes the display pixels generated in step 406 and internally stores the encoded data . in step 410 , the control logic 214 sets the display data state bit in the state bit memory 216 , which causes display data to be read from the rle engine 222 rather than from the main memory during future frame generation . in step 414 , the gpu 202 transmits the display pixels generated in step 406 to the composite and reorder logic 224 , which orders and unifies pixels for the display logic 206 , as previously described . the method 400 concludes in step 416 . returning back to step 402 , if the display data state bit is set , the method 400 proceeds to step 412 , where the rle engine 222 generates display pixels from display data stored in the rle engine 222 during generation of a previous frame . subsequently , in step 414 , the gpu 202 transmits the display pixels generated in step 412 to the composite and reorder logic 224 . the method 400 concludes in step 416 . fig5 illustrates a flowchart of a method 500 for decoding mpeg data read from the dvd player into video pixels . the video pixels generated in accordance with the method 500 are subsequently used in step 318 of the method 300 . as shown , the method 500 for generating video pixels during frame generation begins with step 502 , where some or all of the video data read from the dvd player and stored in main memory is copied to the local memory 220 . a main memory block is copied to the local memory 220 for each range of addresses configured in the bar 228 that have corresponding state bits set to 1 . in step 506 , the mpeg engine 226 is initialized to begin the generation of a new video image by selecting a first video data computation in a series of video data computations for generating a video image from the current set of video data . since the mpeg engine 226 performs a large number of computations , including read operations and write operations , to generate the video pixels for a single video image , the mpeg engine 226 repeats steps 508 , 510 and 512 until all computations are complete for decoding the current video image into video pixels . in step 508 , the mpeg engine 226 performs a series of read operations , mpeg decoding computations and write operations on the current video data being mpeg - decoded , which results in one or more video pixels being generated for the portion of the video image currently being mpeg - decoded . reading and writing video data to main memory and the local memory 220 is described in the discussion of fig6 and 7 , respectively . in step 510 , the mpeg engine 226 determines whether it has completed the video data decoding for the entire current video image . if the mpeg engine 226 has not completed the video data decoding for the entire current video image , the method 500 proceeds to step 512 , where the mpeg engine 226 selects the next video data computations for generating the video pixels of the current video image , before continuing to step 508 . returning back to step 510 , if the mpeg engine 226 has completed the video data decoding for the entire current video image , the method proceeds to step 514 , where the mpeg engine 226 transmits the video pixels to the composite and reorder logic 224 , which unify and order the pixels for the display logic 206 . the method concludes in step 516 . fig6 illustrates a flowchart of a method 600 for reading video data from either the local memory 220 or main memory . the method 600 is carried out when reading video data in conjunction with the mpeg decoding method 500 . as shown , the method 600 for reading video data from either the local memory 220 or main memory begins with step 602 , where the gpu 202 determines whether the address of the current read operation is within an address range defined in the bar 228 . if the address of the current read operation is within an address range in the bar 228 , the method proceeds to step 604 , where the state bit in the state bit memory 216 corresponding to the matching entry in the bar 228 from step 602 is read . in step 606 , the gpu 202 determines whether the state bit read in step 604 is set . if the state bit read in step 604 is set , the method proceeds to step 608 , where the gpu 202 reads the video data from the portion of the local memory 220 that corresponds to the matching bar entry from step 602 . the method then concludes in step 610 . alternatively , if the address of the current read operation is not within an address range in the bar 228 ( step 602 ) or if the state bit read in step 604 is clear ( step 606 ), the method proceeds to step 612 , where the gpu 202 reads the video data from the main memory , as described in the discussion of fig1 . the method then concludes in step 610 . fig7 illustrates a flowchart of a method 700 for writing video data to either a local memory 220 or main memory . the method 700 is carried out when writing video data in conjunction with the mpeg decoding method 500 . as shown , the method 700 for writing video data to either the local memory 220 or main memory begins with step 702 , where the gpu 202 determines whether the address of the current write operation is within an address range defined in the bar register file 228 . if the address of the current write operation is within an address range in the bar 228 , the method proceeds to step 704 , where the state bit in the state bit memory 216 corresponding to the matching entry in the bar 228 from step 702 is read . in step 706 , the gpu 202 determines whether the state bit read in step 704 is set . if the state bit read in step 704 is set , the method proceeds to step 708 , where the gpu 202 writes the video data to the portion of local memory 220 that corresponds to the matching bar entry from step 702 . the method then concludes in step 710 . alternatively , if the address of the current write operation is not within an address range in the bar 228 ( step 702 ) or if the state bit read in step 704 is clear ( step 706 ), the method proceeds to step 712 , where the gpu 202 writes the video data to the main memory . the method then concludes in step 710 . one advantage of the disclosed technique is that the power consumed by mobile computing devices may be reduced by generating display images from display pixels stored in the rle engine 222 rather than reading display data from main memory and generating display pixels from that display data . another advantage of the disclosed technique is that the power consumed by mobile computing devices may be reduced by generating video images from video data stored in the local memory 220 rather than the main memory . yet another advantage of the disclosed technique is that the graphics performance of the gpu 202 is not reduced by the technique , due to encoding and storing display pixels “ on - the - fly ” in the rle engine 222 during frame generation . fig8 a - 8c illustrate sample display frames 800 , 810 and 820 generated with embodiments of the present invention . fig8 a illustrates a sample display frame 800 generated with embodiments of the present invention when the aspect ratio of the display monitor matches that of the aspect ratio of the video image . in this example , a video image 802 fully obscures a display image 804 after overlay . the display image 804 comprises display pixels of a single reference color ( e . g ., magenta ) and the display pixels are run - length encoded as a single region by the rle engine 222 and stored therein . fig8 b illustrates a sample display frame 810 generated with embodiments of the present invention when the aspect ratio of a display image 812 is greater than the aspect ratio of a video image 818 . in this example , the video image 818 is displayed with left and right borders 814 , 816 of a color determined by the software driver ( e . g ., black ). the display image in this example comprises display pixels of a single reference color ( e . g ., magenta ) for an image region 819 , on top of which the video image 818 is overlaid , and display pixels of a single color for the left border 814 and the display pixels of a single color for the right border 816 . the display pixels are run - length encoded as three regions by the rle engine 222 and stored therein . fig8 c illustrates a sample display frame 820 generated with embodiments of the present invention when the aspect ratio of a display image 816 is less than the aspect ratio of a video image 828 . in this example , the video image 828 is displayed with top and bottom borders 824 , 826 of a color determined by the software driver ( e . g ., black ). the display image 816 comprises display pixels of a single reference color ( e . g ., magenta ) for an image region 829 , on top of which the video image 828 is overlaid , and display pixels of a single color for the top border 824 and the display pixels of a single color for the bottom border 826 . these display pixels are run - length encoded as three regions by the rle engine 222 and stored therein . as used herein , “ local memory ” is used to refer to any memory that is local to a processing unit and is distinguished from main memory or system memory . thus , any of the memory units inside the frame buffer 204 are “ local memory ” to the gpu 202 , including the local memory 220 , state bit memory 216 , bar 228 , and the memory inside the rle engine 222 . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof . the scope of the present invention is determined by the claims that follow .	6
referring now to fig1 of the drawings , a schematically illustrated test system 10 includes a test gear box 12 , a slave gear box 14 , a prime mover 16 and a torque applier 18 according to this invention . the test gear box 12 includes a single planetary gear set 20 consisting of a sun gear 22 , a ring gear 24 and a plurality of planet gears 26 rotatably supported on a carrier 28 . the sun gear 22 is rigidly attached to a tubular sun gear shaft 30 representing the test gear box input shaft . the shaft 30 is supported on a housing 32 of the test gear box by a schematically illustrated bearing 34 for rotation about a main axis 36 of the test gear box . a tubular ring gear shaft 38 representing one output shaft of the test gear box is supported on the housing 32 for rotation about the axis 36 by another schematically illustrated bearing 40 and is rigidly connected to the ring gear 24 . a tubular carrier shaft 42 representing the other output shaft of the test gear box is connected to the carrier 28 and disposed within the ring gear shaft 38 . the shaft 42 is supported for rotation about the axis 36 by a schematically illustrated bearing 44 between the shaft 42 and the shaft 38 . the slave gear box 14 is identical to the test gear box 12 and is arranged relative to the latter in mirror image or nose - to - nose fashion . more particularly , and identifying the elements of the slave gear box 14 with the same reference characters applied to the corresponding elements of the test gear box 12 but primed to denote the slave gear box , the slave gear box includes a single planetary gear set 20 &# 39 ; consisting of a sun gear 22 &# 39 ;, a ring gear 24 &# 39 ; and a plurality of planet gears 26 &# 39 ; on a carrier 28 &# 39 ;. tubular sun gear , ring gear and carrier shafts 30 &# 39 ;, 38 &# 39 ; and 42 &# 39 ;, respectively , are connected to the sun gear , the ring gear and the planet carrier and rotatably supported on a housing 32 &# 39 ; of the slave gear box by schematically illustrated bearings 34 &# 39 ;, 40 &# 39 ; and 44 &# 39 ;. the slave gear box 14 is supported on a test stand , not shown , in alignment with the test gear box 12 such that the main axis of the slave gear box , not specifically identified , is colinear with the main axis 36 of the test gear box 12 . a first sleeve 46 rigidly couples the carrier shafts 42 and 42 &# 39 ; of the test and slave gear boxes , respectively , and a second sleeve 48 rigidly connects the ring gear shafts 38 and 38 &# 39 ;. accordingly , rotation of the sun gear shaft 30 of the test gear box 12 effects simultaneous rotation of the sun gear shaft 30 &# 39 ; of the slave gear box 14 in the same direction and at the same speed . conversely , if one of the sun gear shafts 30 and 30 &# 39 ; is held fixed while a torsional moment is applied to the other , the gears and bearings of the planetary gear sets 20 and 20 &# 39 ; are stressed in a simulated torque transmission mode . referring now to fig1 and 2 , the torque applier 18 is mounted on the fixed support between the slave gear box 14 and the prime mover 16 and includes a housing 50 defining a main axis 52 and a pair of satellite axes 54 and 56 parallel to and equidistant from the main axis 52 . in the preferred embodiment , the main axis 52 and the satellite axes 54 and 56 are disposed in a common horizontal plane of the torque applier . a tubular torque applier main shaft 58 is supported on the housing 50 for rotation about the main axis 52 by a ball bearing 60 and a roller bearing 62 . the main shaft 58 is drive connected to the prime mover through a collar 64 spline connected to the main shaft and a coupling 66 between the collar 64 and an output shaft 68 of the prime mover 16 . the torque applier 18 further includes a pair of outer tubular actuator shafts 70 and 71 supported on the housing 50 for rotation about satellite axes 54 and 56 , respectively , by two pairs of roller bearings 72 and 73 . each outer tubular shaft 70 and 71 has a flange 74 and 75 , respectively , at an end thereof outboard of the housing 50 . a pair of driven spur gears 76 and 77 are supported on corresponding ones of the outer tubular shafts 70 and 71 for rotation as units therewith . each of the driven gears 76 and 77 meshes with a first pinion gear 78 integral with the main shaft 58 . accordingly , the outer tubular shafts 70 and 71 rotate in the same direction and at the same speed whenever the main shaft 58 rotates . as seen best in fig2 an intermediate tubular shaft 80 is supported on the housing 50 for rotation about the main axis 52 by a ball bearing 82 and by a pair of spaced roller bearings 84 . the intermediate tubular shaft 80 is connected to the sun gear shaft 30 &# 39 ; of the slave gear box 14 through a collar 86 spline connected to the tubular intermediate shaft outboard of the roller bearings 84 and a coupling 88 between the collar 86 and the sun gear shaft 30 &# 39 ;. a second pinion gear 90 formed integrally with the intermediate tubular shaft 80 meshes with each of a pair of driven spur gears 92 and 93 supported on the housing 50 for rotation about the satellite axes 54 and 56 , respectively , by corresponding pairs of roller bearings 94 and 95 . a pair of inner tubular actuator shafts 96 and 97 are disposed within corresponding ones of the outer tubular actuator shafts 70 and 71 with spline connections at one end to the driven gears 92 and 93 , respectively . the distal ends of the inner tubular actuator shafts 96 and 97 project outboard of the housing 50 within the confines of the outer tubular actuator shafts and each includes a plurality of internal splines 98 and 99 . the first pinion gear 78 is identical to the second pinion gear 90 and the driven gears 76 , 77 , 92 and 93 are identical to each other . accordingly , when the main shaft 58 and the tubular intermediate shaft 80 rotate about the main axis 52 in the same direction and at the same speed , the inner tubular actuator shafts 96 and 97 and the outer tubular actuator shafts 70 and 71 rotate at the same speed and in the same direction . the torque applier 18 further includes a pair of commercially available rotary actuators 100 and 101 disposed between respective pairs of inner and outer actuator shafts 70 , 96 and 71 , 97 . rotary actuators commercially available under the trade name &# 34 ; rotac &# 34 ; from ex - cell - o corporation , microprecision operations , 525 berne street , berne , ind . 46711 are preferred . the rotary actuators 100 and 101 include schematically represented outer cases 102 and 103 and schematically represented center shafts 104 and 105 . the housings 102 and 103 are bolted to the flanges 74 and 75 of the outer tubular actuator shafts 70 and 71 and rotate as units therewith . the center shafts 104 and 105 include external splines which engage the internal splines 98 and 99 on the inner tubular actuator shafts 96 and 97 thereby coupling the center shafts of the rotary actuators and the inner tubular actuator shafts for unitary rotation . the rotary actuators 100 and 101 include internal structure , not shown , operative to generate or develop opposite torsional moments on the pairs of inner and outer tubular actuator shafts 96 , 70 and 97 , 71 as the shafts rotate together proportional in magnitude to a hydraulic pressure supplied to the rotary actuators . a tubular main shaft extension 106 is aligned on the coincident main axes of the test and slave gear boxes 12 and 14 and the torque applier 18 and includes a torque applier end 108 and a gear box end 110 . at the torque applier end 108 , the extension 106 includes a plurality of internal splines which engage a corresponding plurality of external splines on the torque applier main shaft 58 whereby the two shafts are rotatable as a unit by the prime mover 16 . at the gear box end 110 , the extension 106 includes a plurality of external splines 112 , fig1 engaging a corresponding plurality of internal splines 114 on the sun gear shaft 30 whereby the sun gear shaft and the sun gear 22 are rotatable by the prime mover 16 . in addition , a torque path is defined between the inner tubular actuator shafts 96 and 97 and the outer tubular actuator shafts 70 and 71 through the driven gears 76 and 77 , the first pinion 78 and the shafts 58 and 106 , the planetary gear sets 20 and 20 &# 39 ;, the shaft 80 , the second pinion 90 , and the driven gears 92 and 93 . accordingly , the rotary actuators 100 and 101 , when hydraulically pressurized , urge the sun gear shafts 30 and 30 &# 39 ; in opposite directions thereby loading the gear teeth and bearings of the planetary gear sets 20 and 20 &# 39 ; in a simulated torque transfer mode . the degree of torque transfer simulation by the rotary actuators 100 and 101 is independent of the speed of rotation of the output shaft 68 of the prime mover because the rotary actuators rotate as units with corresponding pairs of tubular actuator shafts 70 , 96 and 71 , 97 . the torque applier 18 is particularly suited for testing high speed , high horsepower aircraft propulsion gear boxes because it provides the capability , in a convenient in - line system , of summing the outputs of a plurality of commercially available rotary actuators which are typically employed in lower speed applications and are individually incapable of developing the necessary torque to simulate transfer of rated aircraft propulsion horsepower . in the test system 10 , for example , the test gear box 12 has a horsepower rating in excess of 10 , 000 hp at 10 , 000 rpm input speed to the sun gear shaft 30 . in operation , with the test gear box 12 , the slave gear box 14 and the torque applier 18 mounted on a suitable platform with the main axes of the gear boxes and the torque applier coincident , the prime mover 16 provides rotary power sufficient only to overcome the frictional and windage losses within the gear boxes and the torque applier at a speed corresponding to the rated speed of the test gear box 12 . for example , where the horsepower ratings of the test gear box is about 10 , 000 hp , the prime mover 16 need be capable of supplying only about 10 percent or 1 , 000 hp to overcome losses within the gear boxes . with the rotary actuators 100 and 101 inactive , the prime mover 16 rotates the sun gear shaft 30 at rated input speed , about 10 , 000 rpm , providing output rotation of the sun gear shaft 30 &# 39 ; of the slave gear box 14 at the same speed and in the same direction . accordingly , both the first and second pinion gears 78 and 90 in the torque applier 18 rotate at the same speed and in the same direction . the first and second pinions , meshing simultaneously with each of the driven gear pairs 76 , 77 and 92 , 93 , rotate each of the inner and outer tubular actuator shafts 70 , 71 and 96 , 97 in the same direction and at the same speeds . the speeds of the tubular actuator shafts , however , are less than the speeds of the first and second pinions by amounts proportional to the gear ratio between the pinions and driven gears . with the tubular actuator shafts thus rotating , hydraulic pressure is applied to the rotary actuators 100 and 101 which then impart opposite torsional moments to the tubular actuator shafts corresponding in magnitude to the pressure supplied . the oppositely directed torsional moments on the tubular actuator shafts operate through the driven gears and the first and second pinion gears to simulate torque transfer through the planetary gear sets 20 and 20 &# 39 ; of the test and slave gear boxes 12 and 14 . the torsional moments applied by each of the rotary actuators 100 and 101 are summed or added together through simultaneous meshing of each of the driven gears 76 , 77 with the first pinion 78 and each of the driven gears 92 , 93 with the second pinion gear 90 so that in the embodiment illustrated , the rotary actuators 100 , 101 need only be capable of supplying about one - half of the torsional moment required to simulate transfer of 10 , 000 hp through the test gear box 12 . in addition , if desired , the mounting facility for the test gear box 12 may be adapted to apply loads identified as f1 and f2 in fig1 which simulate external aircraft operating loads such as prop loads and moments .	6
one embodiment of the invention is a flexible stretchable fabric shoe cover that is designed to conformably cover the shoe upper without compromising the sole or the heel . the shoe cover when properly installed on a shoe leaves the sole and the heel exposed by the provision of openings through which the sole and the heel extend . the edges of the shoe cover conform to the path of the top and bottom edges of the shoe upper . another embodiment of the invention includes the flexible fabric shoe cover as described in the previous paragraph along with a decorative element attached to the front of the shoe cover , generally in the area of the toe box . a further embodiment of the invention includes the flexible fabric shoe cover as described in the first paragraph of this section along with a decorative element attached to the rear of the shoe cover , generally in the area of the rearward facing shoe counter . a still further embodiment of the invention includes the flexible fabric shoe cover as described in the first paragraph of this section along with a shoe cover tightening element attached to the rear of the shoe cover , generally in the area of the rearward facing shoe counter . the character of the invention , however , may best be understood by reference to one of the structural forms , as illustrated by the accompanying drawings . referring first to fig1 , in which a typical woman &# 39 ; s high heeled shoe 10 is shown , the relevant parts of a typical shoe are noted . the shoe 10 consists of an upper 15 and a sole 55 . the upper 15 includes generally , a forward facing toe box 20 , behind which is a foot covering vamp 25 , a top line edge 30 defining the rearwardly facing edge of the vamp 25 , a right side 35 , a left side 40 , a right quarter 45 , a left quarter 47 , a rearwardly facing counter 50 , and an upper foot opening 49 , which foot opening is defined by the top line edge , the right side top edge , the left side top edge and the top edge of the shoe counter . the sole 55 includes a forward facing out sole 60 who &# 39 ; s edges conform generally to the bottom edges of the upper toe box 20 , upper vamp 25 and upper side portions 30 and 35 , a shank portion 65 who &# 39 ; s edges conform to the bottom edges of the upper side portions 30 and 35 , and upper quarter portions 45 and 47 , and who &# 39 ; s rearwardly facing edge extends to the heel 75 , which heel includes a forward facing heel breast 70 , and a heel seat 67 who &# 39 ; s edges conform generally to the rearwardly facing edge of the shank 65 and the bottom edges of the upper quarter portions 45 and 47 , and the upper counter portion 50 . now referring to fig2 where a stretchable fabric shoe cover 80 is shown in an uninstalled state , the fabric shoe cover 80 includes a right portion 81 and left portion 82 , each of which covers , and each of which is flexibly conformable to , the contour of the right and the left sides of a shoe along with the right quarter and the left quarter portions of the shoe . furthermore , the shoe cover 80 includes a front facing top portion 83 which covers and which is flexibly conformable to a shoe toe box portion , a vamp cover 84 which is connectedly behind the front facing top portion 83 which vamp cover 84 covers , and which is flexibly conformable to , a vamp portion of the shoe , and a rear facing portion 86 which covers and which is flexibly conformable to a shoe counter , and a bottom connecting fabric bridge portion 85 which connects the right side of the cover 81 with the left side of the cover 82 , generally across the middle shank portion of the shoe sole and which fabric bridge portion 85 contributes to the shoe cover &# 39 ; s state of elastic tension when installed and which thereby contributes to the conformance of the shoe cover to the shape of the shoe . the construction of this embodiment of the fabric shoe cover 80 includes three openings : a first upper shoe cover opening 87 defined by the upper edge of the right and left side 81 and 82 , the rearward facing top line edge of the vamp portion 84 and the forward top edge of the rear facing counter portion 86 and which upper opening 87 conforms to the contours of the shoe upper opening ; a second forwardly located bottom opening 88 defined by the bottom forward facing edge of the toe box cover portion 83 , the bottom edges of the vamp cover portion 84 , and the forward facing edge of the connecting fabric bridge portion 85 , which forwardly located bottom opening edges define an opening having the contours , when properly installed , of the outer edges of the shoe out sole ; and a third rearwardly located bottom opening 89 defined by the bottom edge of the right and left quarter portions 45 and 47 , the rearwardly facing edge of the connecting fabric bridge portion 85 , and the bottom edge of the rearwardly facing counter portion 86 , and , when properly installed on a shoe , which opening conforming to the contours of the heel seat and which opening as well allowing for the shoe heel to extend through the shoe cover . now referring to fig3 , one embodiment of the stretchable fabric shoe cover 80 is shown installed on a shoe 10 . now referring to fig4 , a bottom view of a shoe 10 shows one embodiment of the stretchable fabric shoe cover 80 including a forwardly located bottom opening 88 allowing the outsole 60 to remain uncovered and functional , and a rearwardly located bottom opening 89 allowing the shoe heel 75 to remain uncovered and functional . now referring to fig5 , one embodiment of the stretchable fabric shoe cover 80 is shown installed on a shoe 10 including a toe box decorative element 90 which is attached to the fabric shoe cover 80 generally in the area of the shoe toe box 20 . now referring to fig6 , one embodiment of the stretchable fabric shoe cover 80 is shown installed on a shoe 10 including a rear counter decorative element 95 which is attached to the fabric shoe cover 80 generally in the area of the shoe counter portion 86 . now referring to fig7 , one embodiment of the stretchable fabric shoe cover 80 is shown installed on a shoe 10 including a rear counter tightening element 100 which is attached to the fabric shoe cover 80 generally in the area of the shoe counter portion 86 and which is adapted to provide adjustable tension over the surface of the shoe cover such that the shoe cover fabric conforms tightly and securely on a wide variety of shoe sizes . one function of the shoe cover is to reversibly change the appearance of the shoe . the shoe has an outside surface which is normally visible . the shoe cover covers that visible outside surface of the shoe . the outside surface of the shoe cover may have a color , or a texture , or a usual design that is different from the outside surface of the shoe , so that the installation of the shoe cover on the shoe changes the appearance of the shoe . it is obvious that minor changes may be made in the form and construction of the invention without departing from the material spirit thereof . it is not , however , desired to confine the invention to the exact form herein shown and described , but it is desired to include all such as properly come within the scope claimed .	0
generally speaking , a shaft is subjected to a torque during acceleration or while transmitting energy even at a constant angular velocity . the torque measuring arrangement of fig1 and 2 utilizes a section of the shaft 11 of length 10 which section is twisted by the torque experienced by the shaft 11 . the section 10 has a series of teeth such as 13 end 15 near one end on a rim 23 and additional teeth such as 16 , 17 and 19 supported on an annulus 25 which is fixed to the shaft near the other end of the section . thus , alternate teeth are fixed to portions of the shaft which are separated by the distance 10 yet the annulus or hollow cylindrical member 25 is effective to position those teeth close to one another . such an arrangement is known in the art as a &# 34 ; torque tube &# 34 ;. the teeth provide some sort of record of their passage and could , for example , be magnetic poles which function to close the contacts of a normally open reed switch when they pass in close proximity to that switch . in the preferred form , the teeth are ferromagnetic proturbulences which are effective to change the reluctance of the magnetic circuit associated with sensing coil 21 as they rotate pass that sensing coil . optical sensing schemes as well as other sensing devices for deriving a series of interleaved pulses alternate ones of which are associated with the respective alternate ends of a section of the shaft 11 also may be used . when the shaft section 11 is subjected to a torque , the relative angular orientation of the teeth supported near one shaft section end changes with respect to those supported at the other end . thus , there is either a precession or a recession by an angle θ of alternate ones of the teeth relative to the other intermediate teeth when torque is applied to the shaft 11 . fig3 a depicts the no torque condition while fig3 b shows torque induced twisting of the shaft section 10 by the angle θ . this angular deviation or twist θ is related to the actual shaft torque t in inch pounds by the relationship : where g is the modulus of elasticity in shear in pounds per square inch and the radius r and length 10 are in inches . thus , all the parameters are known properties of the shaft section 10 and , within the elastic limits of the shaft section 10 , the actual torque t and the torque angle θ are directly proportional and related by a constant ( πr 2 g / 21 ) which is known to the designers . hence , for a given transducer and shaft configuration , measurements of the torque angle or twist differ from measurements of the actual torque by a known constant and the determination of one provides an immediate indication of the other . a single sensor , such as a normally open reed switch or the variable reluctance sensing coil 21 , is positioned near the teeth and senses the passage of each of the teeth to produce a series of pulses . as illustrated , there are four equiangularly spaced teeth at each end of the shaft section and the teeth at one shaft end are offset form the teeth at the other end . in general , consecutive teeth at either end will be equiangularly separated by ↑+ φ degrees while consecutive teeth as seen by the sensor ( one associated with each end ) are separated by a no - torque angle of β followed by a separation between the next consecutive pair of φ degrees . it will be noted that every pair of pulses or switch closures generated by the teeth such as 13 and 15 associated with the one shaft end is separated by a pulse generated by a tooth such as 17 indicative of the position of the other end of the shaft . furthermore , shaft torsion ( twisting ) delays the pulses corresponding to one shaft end relative to the pulses generated by the teeth at the opposite end and this delay or increase of θ in one angle ( β or φ depending on the direction of twist ) between consecutive teeth and decrease by θ in the next subsequent angle ( the other of β or φ ) between consecutive teeth provides a measure of the torsion to which the shaft is subjected . resolution of the direction of applied torque is materially aided if the angle β is selected so that β + θ ≠ φ + θ at any torque magnitude . in fig3 a , the angle β + φ is an arbitrary angle between a pair of radially adjacent teeth associated with the same shaft end ( 45 degrees in the case of the four teeth shown ). one of the teeth at the opposite end is positioned between these two teeth and spaced from one of them by the angle β as shown when the shaft section is not subjected to any torque . thus the no - torque angle between adjacent teeth ( one associated with each shaft end ) which actuates the switch 21 , i . e ., the angle between adjacent pulses generated by the switch is alternately β and φ . as the shaft experiences increasing torsion , the poles 17 and 19 move , for example , clockwise as illustrated in fig3 b , so that the angle β between poles 13 and 17 becomes greater by an angular increment 0 while the angle between poles 15 and 17 is decreased by the angle θ . a stopwatch or other timing or uniform counting scheme may be employed to measure the time it takes for the stressed shaft to rotate from pole to pole and the difference between two consecutive time intervals provides a measure to the angle t . this measure is , however , speed dependent . to normalize this measure , it may be divided by the sum of the two consecutive time intervals and to obtain an actual angular measure , the ratio of the time difference to the time sum is multiplied by the angle 1 / 2 ( β + φ ). the normalization of this indication is that it is independent of shaft angular velocity without the need for , nor the expense of the circuitry for performing these computations may be accomplished by utilizing speed dependent &# 34 ; timing &# 34 ; pulses as illustrated in fig4 . in fig4 the pulse train of fig5 a ( no - torque ) or 5c ( exemplary torsion in the direction of the arrows 29 and 31 in fig2 ) is supplied from the monopole reluctance sensor 21 to a phase comparator 27 . to eliminate phase modulation in the input signal supplied to phase comparator 27 , the input signal due to the difference between b and φ as shown in fig5 a or between b + φ and φ + θ in fig5 c is divided by 1 / 2 . the phase comparator 27 along with filter 33 and a voltage controlled oscillator 35 are connected together as a phase - locked loop with the feedback being by way of a divide by n counter 37 . such division by n in the feedback loop effectively causes the phase - locked loop to multiply the input frequency by n while the filter 33 is effective to eliminate noise . hence , the output on line 39 to the counter 41 is a uniform pulse train having a repetition rate of n times the repetition rate of 1 / 2 the fig5 a or fig5 c waveforms , i . e ., nk pulses per shaft revolution where k is the number of teeth per end ( k = 4 , in the illustrated embodiment ), or nkw hertz where w is the angular velocity of the shaft in revolutions per second . for the illustrated four teeth on each end , the input to counter is a shaft speed dependent signal of 4nw hertz . the control logic circuit 43 responds to each pulse of the pulse train shown in fig5 a or 5c to reverse the direction in which the counter 41 is counting , i . e ., it reverses between the incrementing and decrementing . by selecting β and θ unequal , the control logic is also capable of sensing an overflow from the counter 41 which indicates hat the roles of &# 34 ; up &# 34 ; and &# 34 ; down &# 34 ; are reversed and can remedy that situation . by selecting b + θ at an angle which is less than 180 electrical degrees , the phase angle , either + or - is always known . the control logic is also effective to latch , clear and restart the counting after each complete revolution . this averaging over a complete revolution eliminates many tolerance errors . as a specific example , suppose a no - torque condition with β & lt ; 0 , i . e ., p & gt ; b . over a complete revolution counter 41 will accumulate 4b - 4p & lt ; 0 as a count . by preloading an offset value μ = 4p - 4b & gt ; 0 into the counter , the final count at the end of each revolution will be 0 indicating the no - torque ( θ = 0 ) condition . the offset latch 45 preloads this value μ ( which is programmably selectable to match the circuit to a particular shaft ) into the counter 41 at the beginning of each revolution . when the shaft is subjected to torque , the counter accumulates 4 ( b + t )- 4 ( p - t )+ μ = 4b - 4p + 8tμ = 4b - 4p + 8t + 4p - 4b = 8t each revolution . from the proportion nk / 360 = t / θ the value v in the counter at the end of each complete shaft revolution is related to 0 the actual angular shaft strain by the formula θ = ( v / 8 )( 360 / 2nk ). if nk = 45 , the value in counter 41 which is displayed by display unit 49 will numerically be the angular shaft strain in degrees , however , it has been found to be more practical to select n to be on the order of 1 , 500 to get a sufficient number of counts for adequately fine resolution and then to rescale the result in the counter as needed to be sent to and displayed by display 49 . the value of n is programmably selectable via gain latch 47 to match the circuit to a given shaft installation . fig6 is a somewhat more detailed block diagram for a circuit similar to the one described in fig4 but lacking the versatility of selecting the numerical value of n ( n is fixed at 1 , 500 ) and lacking the versatility of programmably setting the offset value μ . similar component blacks in fig4 and 6 are identified by like reference numerals . the signal conditioning circuit 51 of fig6 is shown in greater detail in fig7 . the input signal is connected to a monopole pickup sensor 21 and provides for common and differential mode filtering . further , a zero crossover detector 86 is included in this signal conditioning circuit 51 along with a digital pulse filter 88 to condition the output signal 61 going to the phase - phase locked loop portion 84 of the circuit . the phase - locked loop portion 84 of the circuit of fig6 illustrated in fig8 uses a commercially available integrated circuit 53 such as a type hc4046 , available for rca and national semiconductor for the phase detector 27 , loop filter 33 and voltage controlled oscillator 35 . the divide by n circuit is implemented on hc163 type counter 37 , also available from rca and national semiconductor , associated with integrated circuits 55 , 57 and 59 . the output signal on line 61 in fig7 is the input on the like numbered line in fig8 . fig8 the actual counter is implemented on the three chips 65 , 67 and 69 which receive the up or down instruction from the synchronization and control logic block 77 of fig6 on line 75 and the counter enable signal on line 81 . the outputs on these counter chips are coupled to the display drivers 71 and 73 . these chips are cleared at the time the power is turned on by a power up clear signal on line 79 from control logic circuit 77 . from the foregoing , it is now apparent that a novel arrangement has been disclosed meeting the objects and advantageous features set out hereinbefore as well as others , and that numerous modifications as to the precise shapes , configurations and details may be made by those having ordinary skill in the art without departing from the spirit of the invention or the scope thereof as set out by the claims which follow .	6
the present invention is directed to method and structure for eliminating collector - base band gap discontinuity in an hbt . the following description contains specific information pertaining to the implementation of the present invention . one skilled in the art will recognize that the present invention may be implemented in a manner different from that specifically discussed in the present application . moreover , some of the specific details of the invention are not discussed in order not to obscure the invention . the specific details not described in the present application are within the knowledge of a person of ordinary skill in the art . the drawings in the present application and their accompanying detailed description are directed to merely exemplary embodiments of the invention . to maintain brevity , other embodiments of the invention which use the principles of the present invention are not specifically described in the present application and are not specifically illustrated by the present drawings . fig3 shows a cross - sectional view of structure 300 , which is utilized to describe one embodiment of the present invention . certain details and features have been left out of fig3 that are apparent to a person of ordinary skill in the art . although structure 300 illustrates an exemplary npn sige hbt , the present invention manifestly applies to other similar or related structures , such as pnp hbts . structure 300 includes collector 302 , base 304 , and emitter 306 . collector 302 is n - type single crystal silicon , which might be deposited epitaxially using a reduced pressure chemical vapor deposition (“ rpcvd ”) process in a manner known in the art . base 304 is a p - type silicon - germanium single crystal which might be deposited epitaxially in a “ nonselective ” rpcvd process . as seen in fig3 base 304 is situated on top of , and forms a junction with , collector 302 . in the present exemplary embodiment , emitter 306 , which is situated above and forms a junction with base 304 , comprises n - type polycrystalline silicon . collector 302 , base 304 , and emitter 306 thus form the present exemplary npn sige hbt , which is generally referred to by numeral 308 in fig3 . as seen in fig3 buried layer 310 , which comprises n + type material , i . e . heavily doped n - type material , is formed in silicon substrate 312 in a manner known in the art . collector sinker 314 , which also comprises n + type material , is formed by diffusion of heavily concentrated dopants from the surface of collector sinker 314 down to buried layer 310 . buried layer 310 , along with collector sinker 314 , provide a low resistance electrical pathway from collector 302 through buried layer 310 and collector sinker 314 to a collector contact ( not shown in fig3 ). as further seen in fig3 deep trench structures 316 and 318 and field oxide structures 320 , 322 , and 324 provide electrical isolation from other devices on silicon substrate 312 . deep trench structures 316 and 318 and field oxide structures 320 , 322 , and 324 comprise silicon oxide material and are formed in a manner known in the art . dielectric segments 326 and 328 , which can comprise silicon oxide , provide electrical isolation between emitter 306 and base 304 . by way of background , characteristics and functionality of the present exemplary npn sige hbt 308 are affected and can be tailored by varying steps of the fabrication process . one useful tool for controlling the resultant performance characteristics of npn sige hbt 308 is the dopant profiles . in particular , it is desirable to accurately control the dopant profiles of base 304 to achieve a desired npn sige hbt performance . in the present application , a dopant profile in base 304 is also referred to as a concentration of base dopant , such as boron , in base 304 . graph 400 in fig4 shows exemplary boron , germanium , and carbon profiles in the base of an exemplary npn sige hbt in accordance with one embodiment of the present invention . in particular , boron profile 402 , germanium profile 404 , and carbon profile 406 , respectively , in graph 400 show boron , germanium , and carbon profiles in base 304 in fig3 . graph 400 includes concentration level axis 408 plotted against depth axis 410 . concentration level axis 408 shows relative concentration levels of boron , germanium , and carbon respectively , in boron profile 402 , germanium profile 404 , and carbon profile 406 . depth axis 410 shows increasing depth into base 304 in fig3 starting at the top surface of base 304 . thus , “ 0 ” on depth axis 410 indicates the approximate transition from emitter 306 to base 304 . additionally , depth 422 on depth axis 410 indicates the collector - base junction , i . e . the transition from base 304 to collector 302 , of npn sige hbt 308 in fig3 . boron profile 402 shows the concentration of boron in base 304 , plotted against depth , i . e . distance into base 304 . boron profile 402 includes boron peak 412 , which represents the peak concentration level of boron in base 304 . boron peak 412 occurs at depth 416 in base 304 . it is noted that boron is used as an exemplary p - type dopant in the present exemplary npn hbt for the purpose of illustrating the present invention by way of a specific example . however , the principles of the present invention apply equally to an npn hbt using a different p - type dopant in its base and even to a pnp hbt using an n - type dopant in its base . continuing with graph 400 in fig4 germanium profile 404 shows the concentration of germanium in base 304 , plotted against depth , i . e . distance into base 304 . germanium profile 404 begins at depth 414 in base 304 , and it ( i . e . germanium profile 404 ) ends at depth 422 , which corresponds to the collector - base junction , i . e . the transition from base 304 to collector 302 in fig3 . in one embodiment , depth 422 substantially corresponds to the collector - base junction of exemplary npn sige hbt 308 . the germanium concentration level in base 304 starts at 0 . 0 germanium concentration at depth 414 and increases to germanium concentration level 430 at depth 418 . by way of background , increasing the concentration of germanium in a base of an npn sige hbt results in a reduction in band gap in the base . for example , 10 . 0 atomic percent of germanium is equivalent to a reduction in band gap of approximately 10 . 0 mev . the reduction in band gap allows an electric field to build up in the base , which produces the desirable result of increasing performance of the npn sige hbt . in addition , increasing the concentration of germanium in a base of an npn sige hbt correspondingly increases the in - plane stress and changes the electronic band structure favorably to enhance carrier mobility , thereby increasing performance of the npn sige hbt . continuing with graph 400 , the ramp up of germanium concentration builds a desirable electric field in base 304 . for example , the distance between depth 414 and depth 418 can be approximately 200 . 0 angstroms . when , for example , germanium ramps up to a concentration level of 20 . 0 atomic percent at depth 418 , which corresponds to a band gap change of approximately 20 . 0 mev over 200 . 0 angstroms ( 10 . 0 atomic percent of germanium is equivalent to a reduction in band gap of approximately 10 . 0 mev ). the corresponding electric field gradient would be approximately 20 . 0 mev / 200 . 0 angstroms or approximately 1 . 00 * 10 4 volts per centimeter . at depth 418 , the concentration of germanium reaches concentration level 430 . the concentration level of germanium remains at germanium concentration level 430 from depth 418 to depth 420 . for example , germanium concentration level 430 can be 20 . 0 atomic percent of germanium . in the present application , it is noted that the constant germanium concentration level between depth 418 and depth 420 is also referred to as the “ germanium plateau region .” between depth 420 and depth 422 , the germanium concentration level decreases from germanium concentration level 430 at depth 420 to a germanium concentration level of 0 . 0 at depth 422 . continuing with graph 400 , carbon profile 406 shows the concentration of carbon in base 304 , plotted against depth , i . e . distance into base 304 . it is noted that carbon is also referred to as a “ diffusion suppressant ” or as “ impeding ” diffusion in the present application . as shown in fig4 carbon profile 406 begins at depth 416 , where a concentration of carbon is introduced into base 304 . in other words , carbon doping begins at depth 416 in base 304 . carbon is introduced into a base of the present exemplary npn sige hbt to suppress boron diffusion , which can undesirably increase the effective width of the base . for example , the thermal annealing process utilized in the fabrication of the npn sige hbt can cause boron to diffuse into adjoining silicon regions of the npn sige hbt , which can severely degrade the performance of the npn sige hbt . although carbon effectively suppresses boron diffusion , the addition of carbon into the base results in an undesirable increase in band gap in the base . for example , an introduction of 1 . 0 atomic percent of carbon in the base increases the band gap by approximately 10 . 0 milli - electron volts ( mev ). continuing with graph 400 , at depth 416 , the concentration of carbon increases abruptly from 0 . 0 concentration level to carbon concentration level 424 . for example , carbon concentration level 424 can be approximately 0 . 5 atomic percent of carbon . the increase in concentration of carbon at depth 416 also results in a corresponding increase in band gap in base 304 . for example , the addition of 0 . 5 atomic percent of carbon at depth 416 can result in an approximate 5 . 0 mev increase in band gap in base 304 . the concentration of carbon remains at carbon concentration level 424 down to depth 419 . according to an embodiment of the present invention , at depth 419 , the concentration of carbon is decreased from carbon concentration level 424 to 0 . 0 carbon concentration at depth 421 . as shown in graph 400 , depth 419 , i . e . the depth at which the concentration of carbon starts to ramp down , is situated in the germanium plateau region , which extends from depth 418 to depth 420 as discussed above . it is appreciated that the concentration of carbon can start to ramp down at any depth in the germanium plateau region or at any depth in the germanium ramp down region . in one embodiment , the concentration of carbon can start to ramp down at depth 418 , i . e . the start of the germanium plateau region . as discussed above , the addition of carbon in base 304 results in an increase in band gap . likewise , a decrease in carbon concentration in base 304 results in a corresponding decrease in band gap . also , as discussed above , an increase in concentration of germanium in base 304 results in a decrease in band gap . likewise , a decrease in concentration of germanium in base 304 results in a corresponding increase in band gap . thus , by appropriately ramping down the carbon concentration between depth 419 and depth 421 , the present invention partially offsets the increase in band gap resulting from the decrease in germanium concentration between depth 420 and depth 422 . as a result , the band gap in base 304 increases relative to a reference band gap of a “ silicon - only ” base , i . e . the band gap of a base comprising only silicon , at approximately depth 422 , while substantially eliminating any band gap discontinuity , i . e . a decrease in band gap , at approximately depth 422 . in one embodiment , the band gap discontinuity , i . e . a decrease in band gap , is prevented at a depth approximately equal to depth 422 . thus , the present invention provides the advantage of preventing a band gap discontinuity at approximately depth 422 by ramping down the carbon concentration between depth 419 and depth 421 to counteract the effect of a ramp down of germanium concentration between depth 420 and depth 422 . furthermore , the present invention preserves the advantage of a narrow boron profile in base 304 by utilizing carbon to prevent the diffusion of boron from increasing the effective size , i . e . widening , base 304 . graph 500 in fig5 shows an exemplary band gap curve in the base in the exemplary npn sige hbt in accordance with one embodiment of the present invention . graph 500 shows band gap curve 502 , which shows the change tin band gap caused by carbon profile 406 and germanium profile 404 in fig4 in base 304 in fig3 . graph 500 includes change in band gap axis 504 plotted against depth axis 510 . it is noted that “ 0 ” on change in band gap axis 504 refers to the band gap of a reference base comprising only silicon , i . e . a “ silicon - only ” base . it is also noted that an upward move on band gap curve 502 indicates a decrease in the band gap of base 304 relative to the band gap of a silicon - only base . conversely , a downward move on band gap curve 502 indicates an increase in the band gap of base 304 relative to the band gap of a silicon - only base . depth axis 510 corresponds to depth axis 410 in fig4 . in particular , depths 514 , 516 , 518 , 520 , 521 , and 522 , respectively , on depth axis 510 correspond to depths 414 , 416 , 418 , 420 , 421 , and 422 on depth axis 410 in fig4 . as shown in graph 500 , band gap curve 502 indicates a decrease in band gap of base 304 from depth 514 to depth 516 . the decrease in band gap from depth 514 to depth 516 is caused by the increase in germanium concentration from depth 414 to depth 416 in fig4 . at depth 516 , band gap curve 502 indicates an abrupt increase in band gap caused by the abrupt increase in carbon concentration at depth 416 . as shown in graph 500 , band gap curve 502 indicates a decrease in band gap from depth 516 to depth 518 as a result of an increase in germanium concentration from depth 416 to depth 418 in fig4 . band gap curve 502 shows constant level between depth 518 and depth 519 , which is caused by the constant concentration level of germanium between depth 418 and depth 419 in fig4 . band gap curve 502 indicates a decrease in band gap between depth 519 and depth 520 . the decrease in band gap between depth 519 and depth 520 is caused by the decrease in carbon concentration between depth 419 and depth 420 . band gap curve 502 indicates an increase in band gap between depth 520 and depth 521 . the increase in band gap between depth 520 and depth 521 is caused by the interaction of the invention &# 39 ; s ramp down in carbon concentration from depth 419 to depth 421 and the ramp down in germanium concentration from depth 420 to depth 421 . band gap curve 502 indicates an increase in band gap between depth 521 and depth 522 . the increase in band gap between depth 521 and depth 522 is caused by the decrease in germanium concentration between depth 421 and depth 422 . thus , the present invention &# 39 ; s ramp down in carbon concentration from depth 419 to depth 421 results in a band gap curve with substantially no discontinuity at approximately depth 522 , i . e . the approximate collector - base junction of exemplary npn sige hbt 308 . in contrast to the present invention , conventional band gap curve 202 in fig2 shows an increase in band gap from depth 220 to depth 222 , followed by an abrupt decrease , i . e . a discontinuity , in band gap at approximately depth 222 . thus , conventional band gap curve 202 in fig2 shows an undesirable discontinuity in band gap at approximately depth 222 , resulting from the abrupt decrease in carbon in the base of the exemplary npn sige hbt . thus , by providing a decrease in carbon from depth 419 to depth 421 to compensate for a decrease in germanium from depth 420 to depth 422 , the present invention prevents a decrease in band gap at approximately depth 522 . accordingly , the present invention provides the advantage of a decreasing electric field , i . e . a decreasing electric field without a discontinuity , at approximately depth 522 , i . e . the approximate collector - base junction of npn sige hbt 308 . the elimination of the discontinuity in the electric field at approximately depth 522 provided by the present invention results in an increase in performance of npn sige hbt 308 . from the above description of the invention it is manifest that various techniques can be used for implementing the concepts of the present invention without departing from its scope . it is noted that although reference is made to germanium as a band gap altering material throughout the present application , the principles of the present invention apply to any other band gap altering material which causes a change in the band gap where such change is used to counteract an opposing change caused by another material , such as a diffusion suppressant like carbon . while the invention has been described with specific reference to certain embodiments , a person of ordinary skills in the art would recognize that changes can be made in form and detail without departing from the spirit and the scope of the invention . for example , the principles of the present invention are also applicable to npn sige hbts using a p - type dopant other than boron , or using a diffusion suppressant other than carbon . moreover , the present invention is applicable to npn hbts using semiconductors other than silicon or germanium . further , the present invention &# 39 ; s principles can also be applied to pnp sige hbts or to non - sige pnp hbts . as such , the described embodiments are to be considered in all respects as illustrative and not restrictive . it should also be understood that the invention is not limited to the particular embodiments described herein , but is capable of many rearrangements , modifications , and substitutions without departing from the scope of the invention . for example , the specified layouts , dimensions , and doping levels are provided solely for the purpose of illustrating the present invention by way of a specific example and such dimensions , layouts , and doping levels can be manifestly varied without departing from the scope of the present invention . thus , method and structure for eliminating collector - base band gap discontinuity in an hbt have been described .	7
fig1 shows a drill 11 which generally includes a drill body 13 , an adjustable power transmitting device 15 and a chuck 17 for holding a drill bit 19 . the drill body 13 may be a conventional hand - held motor - driven drill which includes a motor 21 for driving a shaft 23 in rotation . the shaft 23 is mounted by a sealed bearing 24 carried by a plate or wall 26 of the drill body 13 . the adjustable power transmitting device 15 mounts the chuck 17 for pivotal movement about two mutually perpendicular pivot or adjustment axes 25 and 27 . the device 15 also transmits rotary motion from the shaft 23 to the chuck 17 so that the drill bit 19 can be rotated . this power transmitting function can occur in all angular positions of the chuck 17 about the adjustment axes 25 and 27 . with reference to fig2 the device 15 includes a rounded or curved housing 29 , which may be constructed of two half shells , mounted on the drill body 13 as described hereinbelow . the device 15 includes an input shaft 31 rotatably mounted on the housing 29 for rotational movement about a first rotational axis which coincides with the longitudinal axis of the input shaft 31 by a ball bearing 33 , the shaft 23 and a bearing 32 . the shaft 23 drives the input shaft 31 through a gear reduction unit which comprises a first pinion 35 keyed or otherwise fixed to the shaft 23 , a second pinion 37 suitably rotatably mounted on the plate 26 of the drill body 13 by a bearing and shaft assembly 39 and driven by the first pinion 35 , and a ring gear 41 driven by the second pinion and coupled to , or integral with , the input shaft 31 . the gear reduction unit also includes a gear housing 42 mounted on the wall 26 and housing the pinions 35 and 37 and the ring gear 41 . an output shaft 43 is rotatably mounted on a carrier 45 in any suitable manner , such as by a ball bearing 47 and a needle bearing 49 . the carrier 45 is in turn mounted on the housing 29 by spaced opposed flanges 51 and 53 for slidable movement in opening means in the form of a slot 55 in the housing 29 . the input shaft 31 drives the output shaft 43 via an input bevel gear 57 keyed or otherwise secured to the input shaft 31 , an output bevel gear 59 suitably mounted on the output shaft 43 , and opposed intermediate bevel gears 61 and 63 . the intermediate gears 61 and 63 drivingly engage the input gear 57 and the output gear 59 . in the embodiment illustrated , the intermediate gears 61 and 63 are mounted on a mounting shaft 65 which is pivotally mounted on the opposite sides of the housing 29 . the mounting shaft 65 extends through the intermediate gears 61 and 63 , and needle bearings 67 and 69 mount the gears 61 and 63 for rotation , respectively , on the shaft 65 . releasable means in the form of set screws 71 and 73 bears against thrust bearings 75 to normally hold the intermediate gears 61 and 63 in driving engagement with the gears 57 and 59 and against thrust bearings 76 . a coil compression spring 77 acts between one of the thrust bearings 76 and the bearing 69 to resiliently urge the intermediate gear 63 out of driving engagement with the gears 57 and 59 . accordingly , upon loosening of the set screw 73 , the spring 77 automatically disengages the intermediate gear 63 from the gears 57 and 59 . the output shaft 43 has an inner end portion 83 which projects through the output gear 59 and is received within a bearing 84 mounted in a blind bore 85 in the mounting shaft 65 . the mounting shaft 65 is mounted for pivotal movement about the adjustment axis 25 by coaxial blind bores in the set screws 71 and 73 . the adjustment axis 25 coincides with the longitudinal axis of the mounting shaft 65 . the adjustment axis 25 , in the embodiment illustrated , is perpendicular to the axis of rotation of the input shaft 31 . by releasing the set screw 73 to disengage the intermediate gear 63 from the gears 57 and 59 , the output shaft 43 can be pivoted about the adjustment axis 25 to a desired angular position . in the embodiment illustrated , the output shaft 43 can be adjusted through 90 degrees from a position in which the output shaft 43 is coaxial with the input shaft 31 . of course , the slot 55 is configured to accommodate this pivotal movement of the output shaft 43 . the interior of the housing 29 can be filled with a suitable lubricant , such as grease . seals 86 prevent leakage of lubricant out of the housing 29 along the input shaft 31 and the output shaft 43 , respectively . to prevent loss of the lubricant through the slot 55 , it is desirable to close the slot 55 as much as possible for all angular positions of the output shaft 43 about the adjustment axis 25 . in the embodiment illustrated , this is accomplished by a collapsable curtain 87 ( fig3 and 4 ) and a curtain 89 which are normally slidably retained in pockets 91 and 93 , respectively . the collapsable curtain 87 includes curtain segments 95 and 97 having engageable interlocking shoulders 98 . one end of the curtain segment 95 is coupled to the carrier 45 . the leading edge of the curtain 89 is coupled to the opposite end of the carrier 45 . as the output shaft 43 and the carrier 45 are pivoted clockwise as viewed in fig4 about the adjustment axis 25 , the curtain segment 95 slides over the curtain segment 97 , and the curtain 89 is pulled out of the pocket 93 to cover the portions of the slot 55 to the left of the output shaft 43 . if clockwise pivotal movement of the output shaft 43 continues , the upper end of the curtain segment 97 engages the carrier 45 and is pushed thereby further into the pocket 91 as required to accommodate this pivotal movement of the output shaft . on the return pivotal movement of the output shaft 43 , the steps described above are reversed , with the curtain 89 being pushed back into its pocket 93 to accommodate such motion of the output shaft and with the curtain segments 95 and 97 being pulled out of the pocket 93 and expanding as permitted by the engageable shoulders 98 to cover the portion of the slot 55 to the right of the output shaft 43 as viewed in fig4 . if pivotal movement of the output shaft 43 about the adjustment axis 27 is desired , this can advantageously be provided by mounting of the housing 29 on the drill body 13 for rotational movement . although this can be accomplished in different ways , in the embodiment illustrated , a plurality of guide segments 99 ( only one being illustrated ) is mounted on the drill body 13 for cooperation with a flange 101 on the housing to permit this relative motion . in the embodiment illustrated , the adjustment axis 27 is coincident with the axis of rotation of the input shaft 31 . the position of the output shaft 43 about the axis 25 and the position of the housing 29 about the adjustment axis 27 can be fixed in various different ways . for example , the flange 101 ( fig1 ) may have notches 103 arranged in a pattern along the periphery of the flange . the angular position of the housing 29 and hence the output shaft 43 can be fixed by one or more locking elements 105 mounted on the gear housing 42 . for example , each of the locking elements 105 may be in the form of a pin , threaded fastener or spring biased detent which can be resiliently retracted within the gear housing 42 . in any event , the locking element 105 can be effectively removed from the notch 103 to allow the housing 29 to be rotated about the adjustment axis 27 to the desired angular position and , thereafter , the locking element 105 can be appropriately reinserted into the confronting notch 103 . in the embodiment illustrated , the carrier 45 and hence the output shaft 43 can be incrementally pivoted about the adjustment axis 25 . the region of the housing 29 which is swept by the carrier 45 is preferably spherical . the carrier 45 can be fixed in any one of a number of locations by spring biased detents 107 of conventional construction which are carried by the carrier 45 and which may be received within recesses 109 of the housing 29 . the recesses 109 preferably do not completely penetrate the housing as this would provide a potential opening for lubricant to leak out of the housing . fig5 shows a drill 11a which is identical to the drill 11 in all respects not shown or described herein . the primary differences between the drill 11 and the drill 11a is that the latter has the adjustable power transmitting device 15a retrofit on an existing drill 13a and the power transmitting device 15a does not include the gear reduction mechanism , i . e ., the pinions 35 and 37 and the gear 41 . portions of the drill 11a corresponding to portions of the drill 11 are designated by corresponding reference numerals followed by the letter &# 34 ; a .&# 34 ; in the embodiment illustrated , the retrofit is structurally accomplished by mounting rods 111 which are attached to the drill body 13a and to a base plate 113 of the device 15a . the drill body 13a includes the usual rotatable chuck 115 . rotary input is provided to the device 15a by inserting the shaft 23 ( fig2 ) into the chuck 115 . the housing 29a can be pivoted about the adjustment axis 27a relative to the base plate 113 as permitted by the guide segments 99a and the locking elements 105a ( only one being shown in fig5 ). although the locking elements 105a can be identical to the locking elements 105 described hereinabove , as illustrated in fig5 each of the locking elements includes a toggle latch which can be secured in place within an associated one of the notches 103a . adjustment of the chuck 17a about the adjustment axis 25a can be accomplished with the construction of fig5 in the same manner described above with reference to fig1 - 4 . although an exemplary embodiment of the invention has been shown and described , many changes , modifications and substitutions may be made by one having ordinary skill in the art without necessarily departing from the spirit and scope of this invention .	5
fig1 depicts one environment to deploy an embodiment of the present invention . as depicted , the underlying digital mobile network system in this environment is the global system for mobile communications ( gsm ) 100 standard . under the gsm standard , each of the mobile devices 105 and 110 includes a subscriber information module ( sim ) card that contains unique identification information that enables the gsm system to locate the mobile devices within the network and route data to them . a current commercial example of a mobile device ( e . g ., smartphone , pda , handheld , etc .) that might be used in fig1 could be research in motion &# 39 ; s ( rim ) blackberry handheld devices , which include a qwerty keyboard to facilitate the typing of text . as depicted , a gsm architecture . includes the following components : base transceiver stations ( bts ) 115 and base station controllers ( bsc ) ( 120 a or 120 b ) for managing the transmission of radio signals between the msc ( defined below ) and the mobile devices , mobile service - switching centers ( msc ) ( 125 a and 125 b ) for performing the all switching functions and controlling calls to and from other telephone and data systems , a home location register ( hlr ) 130 for containing all the administrative , routing and location information of each subscriber registered in the network , visitor location registers ( vlr ) ( 135 a and 135 b ) for containing selected administrative information about subscribers registered in one hlr who are roaming in a another hlr , and an equipment identity register ( eir ) ( not shown ) for containing a list of all valid mobile equipment on the network ). as depicted in fig1 , in one architecture of a gsm network , there may be exist one hlr while there may exist multiple mscs ( each with a related vlr ) which each serves a different geographic area . the mscs also provide the interface for the gsm network to more traditional voice networks 170 such as the pstn . this underlying gsm architecture provides radio resources management ( e . g ., access , paging and handover procedures , etc . ), mobility management ( e . g ., location updating , authentication and security , etc . ), and communication management ( e . g ., call routing , etc .) in order to enable mobile devices in the gsm network to send and receive data through a variety of services , including the short message service ( sms ), an asynchronous bi - directional text messaging service for short alphanumeric messages ( up to 160 bytes ) that are transported from one mobile device to another mobile device in a store - and - forward fashion . a gsm network within which the present invention may be deployed would also support a page - mode messaging service , such as sms , that relies upon the underlying gsm mechanisms to resolve routing information in order to locate destination mobile devices . a gsm network supporting sms text messaging may further include the following sms specific components : a short message service center ( smsc ) ( 140 a or 140 b ) for storing and forwarding messages to and from one mobile device to another , an sms gateway - msc ( sms gmsc ) for receiving the short message from the smsc ( 140 a or 140 b ) and interrogating the destination mobile device &# 39 ; s hlr 130 for routing information to determine the current location of the destination device to deliver the short message to the appropriate msc ( 125 a or 125 b ). the sms gmsc is typically integrated with the smsc 140 . in a typical transmission of an sms text message from an originating mobile device 105 to a receiving mobile device 110 , ( i ) the text message is transmitted from the mobile 105 to the msc 125 a , ( ii ) the msc 125 a interrogates its vlr 135 a to verify that the message transfer does not violate any supplementary services or restrictions , ( iii ) the msc 125 a sends the text message to the smsc 140 a , ( iv ) the smsc 140 a , through the sms gmsc , interrogates the receiving mobile device &# 39 ; s hlr 130 ( by accessing the ss7 network ) to receive routing information for the receiving mobile device 110 , ( v ) the smsc sends the text message to the msc 125 b servicing receiving mobile device 110 , ( vi ) the msc 125 b retrieves subscriber information from the vlr 135 b , and ( vii ) the msc 125 a transmits the text message to the receiving mobile device 110 . similar to other transactions on the gsm network , sms text messaging utilizes telephone numbers as identifying addresses for mobile devices and as such , utilizes the ss7 network signaling system through which cellular service providers share information from the hlr with other service providers . as depicted in fig1 , ss7 based signaling communication is represented by the broken lines . in contrast , the solid lines in fig1 represent data or voice based communications . in addition to a page - mode messaging service such as sms , a gsm network within which the present invention may be deployed would also support a data packet based communications service , such as the general packet radio service ( gprs ), that enables tcp / ip transmission protocol based communications between mobile devices within the network . as depicted in fig1 , a core gprs network exists in parallel to the existing gsm core network . the bsc 120 may direct voice traffic through the msc ( 125 a or 125 b ) to the gsm network and data traffic through the serving gprs support note ( sgsn ) ( 145 a or 145 b ) to the gprs network . such communication between the bsc ( 125 a or 125 b ) and the sgsn ( 145 a or 145 b ) may be , for example , based upon the ip network protocol communication 155 . as such , gprs signaling and data traffic do not flow through the core gsm network . instead , the core gsm network is used by gprs only for table look - up in the hlr 130 and vlr ( 135 a or 135 b ) to obtain routing , location and other subscriber information in order to handle user mobility . the sgsn ( 145 a or 145 b ) serves as a “ packet - switched msc ,” delivering data packets to mobile devices in its service area . the gateway gprs support note ( ggsn ) ( 150 a or 150 b ) communicates with the sgsn ( 145 a or 145 b ) through an ip based gprs backbone 160 and serves as an interface to other external ip networks 165 such as the internet and other mobile service providers &# 39 ; gprs services . in order to provide direct data transfer capabilities between mobile devices , an initiating mobile device must have knowledge of the ip address ( and possibly , a port ) of the target device in order to establish a direct data transfer . current mobile multimedia messaging solutions , such as mms do not provide direct data transfer capabilities because the initiating mobile device is not able to obtain the receiving mobile device &# 39 ; s ip address . in essence , servers such as the mmsc that are used in current multimedia messaging solutions serve as a forwarding agent between the two mobile devices that are unable to determine the other devices ip address . in contrast , in accordance with the present invention , a multimedia server such as the mmsc can be eliminated on a mobile network environment such as that depicted on fig1 . through the use of a page - mode messaging service , such as sms , which transmits messages to mobile devices based upon their telephone numbers , an initiating mobile device can transmit its ip address ( and a listening port ) in an invitation message to a target mobile device through the target device &# 39 ; s telephone number . once the target device receives the invitation message , it is able to contact the initiating mobile device through the received ip address and the two devices can establish a reliable virtual connection , such as a tcp connection , for reliable data transfer session . fig2 depicts a flow chart depicting the steps taken by an initiating and target mobile device to establish a direct data transfer session in accordance with the present invention . initially , the initiating mobile device opens a tcp port to listen for communications from the target mobile device 210 . the target mobile device has also similarly opened an sms listening port to receive invitation sms text messages at the specified sms port 220 . the initiating mobile device then transmits its ip address ( and tcp port ) in an invitation sms text message to the telephone phone number and a specified sms port of the target mobile device 230 . the target mobile device receives the sms text message containing the initiating mobile device &# 39 ; s ip address ( and tcp port ) at the specified sms port 240 . the target mobile device extracts the ip address and tcp port from the sms text message and opens its own tcp port 250 . the target mobile device then transmits a request to establish a tcp connection to the initiating mobile device &# 39 ; s ip address and tcp port 260 . the initiating mobile device receives this request 270 and a tcp connection is established between the ip addresses and tcp ports of the initiating and listening mobile devices and these devices are able to engage in a data transfer session over a reliable virtual connection 280 . alternative , fig3 depicts a flow chart for an alternative embodiment depicting steps to establish a direct data transfer session in accordance with the present invention . initially , the initiating mobile device opens a tcp port to listen for communications from the target mobile device 310 . the initiating mobile device , through its supporting telephone company , then embeds its ip address ( and tcp port ) in the telephony ringing signal that is transmitted to the target mobile device 320 . for example and without limitation , the telephone company may use a frequency shift keyed ( fsk ) signal to embed the ip address ( and tcp port ) into the telephony signal , similar to the traditional techniques used to embed other special service information , such as a caller id , in the traditional telephony context . the target mobile device receives the telephony ringing signal from the initiating mobile device 330 . the target mobile device extracts the ip address and tcp port from the telephone ringing signal and opens it &# 39 ; s own tcp port 340 . the target mobile device than transmits a request to establish a tcp connection to the initiating mobile device &# 39 ; s ip address and tcp port 350 . the initiating mobile device receives this request 360 and a tcp connection is established between the ip addresses and tcp ports of the initiating and listening mobile devices and these devices are able to engage in a direct data transfer session over a reliable virtual connection 370 . while the foregoing detailed description has described the present invention using sms , gsm , gprs , and tcp / ip , other similar services and protocols may be used in a variety of similar environments in which the present invention may be implemented . for example and without limitation , rather than using sms to transmit an ip address ( and port ) from the initiating mobile device to the listening mobile device through the devices &# 39 ; telephone numbers , an alternative embodiment of the present invention might use a pin - to - pin messaging technology ( as , for example , offered in rim &# 39 ; s blackberry handheld devices ) to transmit the ip address ( and port ) through unique pin numbers associated with the mobile devices , or an alternative paging protocol using telephone numbers . similarly , rather than using fsk to embed the ip address ( and port ) into the telephony ringing signal , an alternative embodiment of the present invention might use a duel tone multi - frequency ( dtmf ) transmission to embed the ip address and port . furthermore , the present invention contemplates that the actual protocol used during an established im session may also vary depending upon the preference of the implementation . for example and without limitation , message session relay protocol ( msrp ) or any proprietary based protocol may be used during the im session that is established in accordance with the present invention . thus , various modifications , additions and substitutions and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the following claims .	7
an advantageous design of the invented box for lures and the like is shown with an open lid in fig1 . the box 1 has a lid 2 . on the latter a locking flap 3 can be seen . there is a rise 4 inwardly formed in the bottom of the box , which rise extends from at least one gable of the box some length along the box . the rise ends with a groove 5 . below the box in fig1 an attachment device to fasten the box 1 to a fishing rod is shown . this attachment device consists of half a cylinder 6 , one longitudinal beam 7 , and , above the beam 7 , a stick or rod 8 . the leading part 9 of the stick is conical or otherwise tapered . on the box there is a venthole 10 , which over a slit 11 is connected to the brim of the box . the lid 2 is closed over the box 1 in fig2 . the lid 2 is hinged on one of the long sides of the box . this can be performed in many ways ; here a hinge is made when manufacturing box as well as lid . this technique is well known by the skilled man . in fig3 some drawing views ( i . e ., top view and left , right , and front elevational views ) of a box without lid can be seen . according to these views , the depth of the box 1 is relatively small , but this is not characteristic for the invention . the depth of the box can easily be chosen by the skilled man and adapted to a desired volume . the rise 4 in the bottom of the box 1 is clearly seen in fig3 . the groove or slit 5 in the plane part of the bottom is also well displayed . in this figure , the length of the rise 4 and the slit 5 are each approximately equal to a third of the box &# 39 ; s length . this length relation is however not fixed for the invention . men skilled in the art can chose any length relation relative the size of the lures which are to be packed in the box . on some occasions , no rise is used as other designs of attachments come to use . the rise 4 is at least partially defined by a wall 12 with a hole 13 formed at one gable of the box . the width of the hole equals the diameter of the stick 8 with some additional clearance . it has been found that box and stick interrelate well even without the wall 12 , but in such cases it is advisable to make the slit 5 considerably longer . in fig4 the stick 8 attached to that over the beam 7 is fastened on half a circular cylinder 6 . the latter is supposed to be fastened on a fishing rod , pole or the like by some known method like tape or glue . the pin 8 ends with a conical part 9 to simplify the mounting of the box on the stick . the cooperation of the two parts , the stick 8 and the box 1 , is shown in fig5 where the stick has been hatched . it can be seen that the height of the beam 7 is a little larger than the thickness of the box &# 39 ; s bottom , which gives a secure attachment . the groove or slit 5 in the box is a little longer than the beam 7 . according to the present invention , the beam 7 orients the box 1 along the stick 8 . in addition , the conical or pointed part 9 of the stick simplifies the mounting of the box on the attachment device . men skilled in the art understand that the box 1 should be preferably mounted with the venthole 10 and adjoining slit 11 facing the point of the rod , away from the user . the pointed end of the stick will thus face the casting reel or the handle of the rod . from this alignment it follows that a lure or bait fastened to a line and stored in the closed box will force the box to stay on the attachment device if the line is pulled taut . also , during casting , the box will be forced to stay in place by centrifugal forces . nevertheless , some kind of locking device to anchor the box on the stick may be provided . in fig5 one example of a locking mechanism is shown . the conical part 9 of the stick 8 is long enough to be guided through a hole 14 in the right gable of the box . this part 16 of the stick is clearly shown in fig5 . the locking can , as the skilled individual understands , be performed by other methods like with grooves in the conical stick facing the bottom of the box . some rises of the bottom might then form a locking device between the box and the stick . the experienced artisan can however find other locking methods , which all are covered by the following claims . the experienced man might also use dovetail slots in the box to form a dovetail joint with the beam of the attachment device . this will give a secure fastening and guidance of the box . trials with a rise along the whole of the box &# 39 ; s bottom have given some good results , but the box has a tendency to rotate around the rod if the attachment device is not similar to the one described above . this kind of design is shown in fig6 . the walls 17 of the rise are parallel . a skilled individual understand that those walls could be produced in a way so , that they should meet on the opposite side of a rod . in fig7 two views of one box &# 39 ; s gable is shown . fig7 a is identical with one of the views in fig3 . one observes , that the bottom of the box is in contact with the stick . in fig7 b the stick is thinner , which makes it possible to lower the rise 4 in the bottom . however , the latter design gives less stability . the stick 8 shown in fig4 completing the beam 7 of the attachment device and facing the box , can , as skilled users understand , be replaced by , for example , flanges of a beam . this is shown from the side in fig9 where the upper part of fig4 shows the same device from above . the flanges 21 could be made in a dovetail shape matching a dovetail slot in the bottom of the box . the pointed part 9 of this dovetail simplifies the mounting of the box on the attachment device . keeping the venthole 10 for a line or trace the box can be fastened on a plane attachment device . this is shown in fig8 which has the same layout as fig3 and 4 . the different views of the box are shown at the top . here the hole 13 shown in the first box has been transformed into an laterally elongated opening 17 . through this opening , one leg 18 of the attachment device is guided into the box . preferably now the device has plate - like form with a profile that is shown below the box in fig8 . the other leg of the device is , after a short distance below the box , bent to form half a cylinder 20 , that , in a known way , may be fastened to a rod . the lid is not shown in this figure either , as it has no other function but to close the box . it is advantageous to produce the box and the lid in the same operation and form them from plastics . the chose of compound is left to the experienced . the beam with its stick 8 or flanges 21 together with the fastening half cylinder 6 is preferably also manufactured in one operation . using glue for the fastening process should be considered . the half cylinder 6 also has to be flexible enough so that the attachment device can be used on rods with varying diameters . other designs of the attachment device will be covered by the following claims . the dimensions of the box can be chosen by the skilled user considering the size of the lures or baits that are supposed to be packed and used during fishing . big wobblers need boxes with large volume whereas small spinners or spoons only need boxes of the size , for example , 8 × 4 × 4 cm . the invented box for lures like spinners and wobblers could imply an innovation in the marketing of those products . it is the goal for the inventor that those products by routine shall be packed in this kind of box . with a consistent fixed attachment device on separate rods boxes with different fishing baits should easily be changed on a rod , which simplifies its utility for anglers and fisherman . good order of gear can be thereby maintained without lures hooking or tangling with each other .	0
referring to the drawings , a toothbrush holder and sanitizing apparatus 10 according to the present invention has a removable lid 12 in the form of a housing 14 having a top surface 16 , front , back and side surfaces ( not numbered ), and a bottom surface 18 . a chamber 20 in lid 12 stores a supply of a viscous disinfectant 24 , and chamber 20 has a porous or permeable wall 22 which permits the disinfectant 24 to escape by seepage at a slow rate . in an alternative embodiment , chamber 20 is a prepackaged container having porous walls and which is filled with a viscous disinfectant . a first sponge or similar absorbent material 26 abuts the porous wall 22 and absorbs the viscous disinfectant 24 which seeps through porous wall 22 . a second sponge or similar absorbent , pliable material 28 abuts first sponge 26 and has a slot 30 which is adapted to receive the handle 6 of toothbrush 2 . first sponge 26 and second sponge 28 function to transport the absorbed viscous disinfectant 24 from chamber 20 to slot 30 where the toothbrush handle 6 will be exposed to disinfectant 24 and maintained in a sanitary environment . sponge 28 is flexible and pliable so as to accommodate the variations in the shapes of toothbrush handles . the bottom surface 18 of lid housing 14 has an opening 32 which is aligned with toothbrush handle slot 30 . the preferred viscous disinfectant 24 is a hypo chlorite , however , alternatives such as alcohol or any commercially available disinfectant non - injurious to oral tissues could be used to obtain the desired results . an input port 17 in housing top surface 16 permits the supply of viscous disinfectant 24 to be replenished . an alternative embodiment to the disinfectant chamber 20 having a permeable wall which permits disinfectant to escape by seepage can be a supply of disinfectant in a porous package which is in contact with the first sponge 26 . a toothbrush aligning member 40 is positioned below bottom surface 18 of lid 12 . member 40 has a generally cylindrical shape with a top opening 42 , a lower rim 44 and a bottom opening 46 having a circumference smaller than that of rim 44 . top opening 42 will be aligned with opening 32 in bottom surface 18 . the lower rim 44 of member 40 will rest on the top of a toothbrush storage canister 56 and bottom opening 46 will fit into the top of canister 56 . referring to fig3 a ring shaped element 48 is aligned with member 40 and canister 56 . element 48 has a flexing member 50 which is designed to contact and flex the bristles 4 to remove particles of food from the bristles each time the toothbrush is inserted or withdrawn from the storage compartment 54 . member 50 may consist of bristles or a flexible rubber insert in element 48 . it will be recognized that flexing member 48 may be positioned in alignment member 40 or in canister 56 , or in between alignment member 40 and canister 56 . a toothbrush storage compartment 54 consists of a canister 56 having a top opening 58 and a closed bottom 60 . a quantity of sterilizing solution 62 in canister 56 covers the bristles 4 of toothbrush 2 and the toothbrush handle 6 extends through the top opening 58 . canister 56 has first and second sanitizing solution input ports 64 and 66 , preferably positioned on canister 56 above the point to which the canister will be filled with sanitizing solution . first and second sanitizing solution supply lines 68 and 70 connect the ports 64 and 66 on canister 56 to a sanitizing solution reservoir 80 and function as fluid conduits to transport sterilizing solution from reservoir 80 to canister 56 . the canister 56 has a spout 57 ( fig3 ) which is normally closed but which may be opened to permit the canister to be flushed by the removal of used sterilizing solution through spout 57 and the addition of fresh sterilizing solution through solution supply lines 68 and 70 . unidirectional flow valves 72 and 74 in lines 68 and 70 permit sterilizing solution to flow from the reservoir 80 to canister 56 , but prevent the flow of used sterilizing solution from canister 56 to reservoir 80 . the toothbrush storage compartment 54 has a shelf 19 on which the lid housing 14 sits ( see fig2 ), and shelf 19 has an opening 33 therein which is aligned with the toothbrush handle slot 30 , the bottom opening 32 in lid 12 , and opening 42 of the toothbrush aligning member 40 . the toothbrush storage compartment 54 has lateral sides 55 which receive and support the lid housing 14 and which extend downwardly to engage and rest on a pressure plate 82 which forms the top surface of a reservoir housing 81 . a sterilizing solution reservoir 80 consists of a housing 81 having a depressable top side pressure plate 82 . housing 81 is designed to receive and hold a supply of sanitizing solution 84 . fluid supply lines 68 and 70 are connected through pressure plate 82 to the supply of sanitizing solution 84 . in a first embodiment ( fig1 a ), the housing 81 receives a plastic bag or similar pre - filled , deformable container 86 of sterilizing solution 84 . the bag 86 is connected to supply lines 68 and 70 and application of pressure on plate 82 causes the solution in bag 86 to be forced through lines 68 and 70 into canister 56 . in an alternative embodiment , the housing 81 is designed to hold the sanitizing solution and is filled with sanitizing solution 84 , whereby pressure exerted on reservoir housing top side 82 exerts pressure on the sanitizing solution 84 in housing 81 to force the solution to flow through supply conduits 68 and 70 into canister 56 . in a third embodiment ( fig1 b ), the single deformable container 86 of sterilizing solution 84 is replaced by 2 pre - filled , deformable containers 86a and 86b which contain different sanitizing solutions 84a and 84b . the supply conduits 68 and 70 are connected directly to containers 86a and 86b , whereby pressure applied by hand or other means directly to containers 86a and 86b will cause sanitizing solutions 84a and 84b to flow through lines 68 and 70 to canister 56 where the two solutions combine to perform the sterilizing function . the use of pre - packaged bags of sterilizing solution affords a high degree of quality control over the purity , strength and efficacy of the sterilizing agent . such pre - packaged containers of sterilizing agent can easily be replaced by removing the lines 68 and 70 from a depleted bag of sterilizing solution and attaching lines 68 and 70 to a fresh bag of solution . alternatively , the entire reservoir assembly 80 may be removed and replaced as a unit by disconnecting the lines 68 and 70 from a depleted bag of sterilizing solution , removing the reservoir assembly consisting of the housing 81 , the pressure plate 82 , and depleted sterilizing solution container 86 , and inserting therefor a replacement reservoir assembly unit consisting of a new housing 81 , plate 82 and pre - packaged container 86 of fresh sterilizing solution . the sides 55 of toothbrush storage compartment 54 extend downwardly to engage and rest on the top surface of pressure plate 82 of the reservoir housing 81 , whereby the application of a downward pressure on lid 12 will be transferred through the toothbrush storage compartment housing sides 55 to the reservoir pressure plate 82 to cause sterilizing solution 84 to flow through lines 68 and 70 to canister 56 . the preferred sterilizing solution 84 is a hypo chlorite , but alternative antiseptic solutions such as alcohol or any of the commercially available disinfectants non - injurious to oral tissues could be used to obtain the desired results . it will be apparent that this invention is capable of application to store and sanitize a plurality of toothbrushes by providing a plurality of toothbrush storage canisters 56 which are each connected to the sanitizing solution reservoir 80 through conduits 68 and 70 , and a lid 12 which has a number of slots 30 equal to the number of canisters 56 for receiving the handles of toothbrushes 2 . it will also be apparent that a plurality of individual toothbrush holders each capable of holding and storing a single toothbrush may be mounted side - by - side on an appropriate mounting rack to provide the capability of holding and sanitizing a plurality of toothbrushes simultaneously . the toothbrush holder and sanitizing flush apparatus of the present invention is illustrated and preferably constructed of plastic for durability and ease of maintenance and cleaning . however , other materials such as ceramics and glass could be used to obtain the desired results . the toothbrush holder and sanitizing flush apparatus of the present invention is used by removing the lid 12 and inserting the bristles of a toothbrush through the bristle flexing member 50 and into the bottom of canister 56 . the toothbrush handle 6 is then inserted into the slot 30 in lid 12 and the lid is then placed on toothbrush storage compartment 54 . then , a pressure on the top of lid 12 is transferred through storage compartment sides 55 to the reservoir pressure plate 82 to cause sufficient sanitizing solution 84 to be pumped through lines 68 and 70 to canister 56 to cover toothbrush bristles 4 . the canister 56 is flushed by opening the flush spout 57 to permit used sterilizing solution and food particles flexed from the bristles to drain from the canister while fresh sterilizing solution is pumped into the canister from reservoir 80 . the addition of fresh sanitizing solution may be accomplished either simultaneously with or subsequently to the draining of used solution from canister 56 . this invention of a toothbrush holder and sanitizer flush apparatus provides a useful and hygienic apparatus for simultaneously storing and sanitizing toothbrushes between uses . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the inventive concept thereof . it is understood , therefore , that this invention is intended to cover all modifications which are within the spirit and scope of the invention as defined by the appended claims .	0
a simplified block diagram of the present invention is provided in fig1 . the oscillator 8 provides a sinusoidal ac output on lead 9 . the ac output or a sinusoidal signal representing the ac output ( as will be described subsequently ) is provided to a demodulator 12 on input 13 . the demodulator 12 is comprised of a fullwave rectifier 14 and a high frequency smoothing filter 16 . the rectified and smoothed control signal is fed from the filter 16 to the amplifier 18 on lead 19 . the amplifier 18 compares the signal to a dc reference voltage provided to input 20 . a control current is provided at the output of the amplifier 22 for control of the oscillator 8 through input 26 . a second input 24 to the amplifier is connected to a current source to limit the control current output from the amplifier as discussed in more detail subsequently . a positive feedback loop is provided from the output 9 of the oscillator to a second input 10 to the oscillator 8 . referring now to fig2 the present embodiment of the invention has a transformer t1 having a primary winding 28 and a secondary winding 30 . a first transistor pair q4 and q5 with emitter collector electrodes in a push - pull connection has the emitter of q5 connected to input terminal a of the primary winding 28 and the emitter of transistor q4 connected to the input terminal c of primary winding 28 . a center tap b on primary winding 28 provides dc excitation power to the oscillator through connection to the positive power supply terminal at connection v1 . positive feedback is provided in the oscillator through the transformer windings by connection in proper phase of the collector electrode of transistor q4 to the output terminal d of the secondary winding 30 of transformer t1 and connection of the collector electrode of transistor q5 to output terminal f of the secondary winding 30 . a capacitive element c3 is also connected across the secondary winding 30 output terminals d and f . power return on the oscillator is achieved through the connection of center tap e on the secondary winding 30 to the negative power supply terminal at terminal v5 . the frequency of oscillation of the oscillator is determined by the tuned circuit formed by the capacitive element c3 and the secondary winding 30 of the transformer t1 . amplitude control of the oscillator output signal is achieved by the negative feedback loop containing the demodulator 12 and amplifier 18 . in the embodiment shown in fig2 the demodulator 12 of fig1 comprises a second transistor pair q1 and q2 . the second transistor pair q1 and q2 are both connected common emitter to the center tap of the secondary winding and the negative power supply terminal v5 . the base of q1 is connected through resistor r10 to terminal d of the secondary winding and the base of q2 is connected through resistor r9 to terminal f of the secondary winding . the collector of q1 is connected between resistors r5 and r11 to terminal f of the secondary winding and to a common output s . the collector of q2 is similarly connected between resistors r6 and r7 to terminal d of the secondary winding and to the common output s . operation of the demodulator can be best understood with reference to fig3 . in fig3 all wave shapes are shown referenced to the negative power supply terminal v5 as ground . the signals at terminals d and f of the secondary winding are sine waves which are 180 degrees out of phase . the voltage applied through resistors r9 and r10 to the bases of q2 and q1 respectively alternately drive each transistor into saturation . when &# 34 ; f &# 34 ; is positive , q2 is saturated and &# 34 ; m &# 34 ; is essentially connected to &# 34 ; e &# 34 ; ( ground ). the negative signal from &# 34 ; d &# 34 ; is ineffective . at the same time , the positive &# 34 ; f &# 34 ; signal is divided by r11 , r5 and r6 so that the voltage drop across r6 appears at &# 34 ; s &# 34 ;. the signal at &# 34 ; 0 &# 34 ; is negative and the same magnitude as at &# 34 ; d &# 34 ; provided that the zener voltage of the emitter / base junction of q1 is not exceeded . on the next half cycle , the voltage at &# 34 ; s &# 34 ; is the voltage drop across r5 . points m and p are therefore alternately connected to ground through the saturated transistor for one half cycle . during the other half cycle the transistor is shut off creating an open circuit . the resulting wave forms are shown in fig3 for points d , f , 0 , n , m , and p . the signal appearing at the common output s is therefore rectified and 1 / 3 the voltage of the signal appearing at either terminal d or f . the values of resistors r5 through r11 are not critical . since the resistors may be viewed as a string starting at the base of q1 and ending at the base of q2 of r10 , r7 , r6 , r5 , r11 , and r9 , a common size may have advantages in construction and assembly . the control signal from common output s is provided to the amplifier 18 of fig1 . the amplifier includes an operational amplifier u1 and a transistor q3 . the control signal from the demodulator is provided to the operational amplifier u1 at pin g . capacitor c1 effectively filters any high frequency ripple so that the voltage at pin i becomes a direct current voltage . a reference voltage generated by a voltage divider formed by resistors r1 and r2 is connected to the operational amplifier u1 at pin h . in the embodiment shown in fig2 the voltage divider formed by resistors r1 and r2 is connected across the power supply input and return v1 and v5 . this voltage divider arrangement could be replaced by a zener diode configuration where replacement of resistor r1 with a zener diode would provide a closely controlled supply voltage for reference to pin h of the operational amplifier u1 . operational amplifier u1 compares the reference voltage present on pin h and the control signal present on pin g to provide a voltage controlled output on pin i . a second stage of the amplifier 18 comprises a transistor q3 . transistor q3 is incorporated into the circuit as an emitter follower . a control voltage is provided to the base electrode of transistor q3 by the voltage controlled output at pin i of the operational amplifier u1 . the emitter electrode of q3 is connected to resistor r8 . current flows through resistor r8 and the emitter / collector circuit of transistor q3 , increasing or decreasing consistent with bias changes on the base electrode . resistor r8 acts as a load to convert the base voltage of transistor q3 to a proportional collector current from a second voltage present on connection v4 . the second voltage may be provided by a second voltage divider from the power input and return or other appropriate means . the collector electrode of transistor q3 is connected to the base electrodes of both transistor q4 and transistor q5 , the first transistor pair of the oscillator 8 . the collector electrode of transistor q3 thereby provides a common bias for transistors q4 and q5 in the form of a control current , which increases or decreases in response to the voltage controlled output from the operational amplifier u1 . this completes the negative feedback path for control of the oscillator 8 . as an alternative to the embodiment shown in fig2 resistor r8 and transistor q3 may be replaced by a field effect transistor ( fet ) to provide constant current proportional to gate voltage on the fet . in the embodiment shown , resistor r4 is connected to pin l of operational amplifier u1 to provide supply current control . connections v2 and v3 shown in fig2 provide feedback points for linearizing the oscillator output as described in prior art u . s . pat . no . 3 , 837 , 227 to tavis . resistor r3 is a balance resistor for the linearizing feedback connection v2 . capacitor c1 in conjunction with resistors r3 , r5 and r6 provides filtering for the control signal for input g of the operational amplifier u1 . multiple outputs x for the stabilized oscillator are provided for operation of transducers and the like . operation of the oscillator and control circuit is best described by assuming a start with no power applied to the system . when power is applied to the power input and return connections v1 and v5 , pin h of operational amplifier u1 will be positive with respect to pin g . comparison of the signals present on pin g and pin h will result in a control output current from pin i of operational amplifier u1 to the base electrode of transistor q3 . pin i of operational amplifier u1 will be positive with respect to the emitter electrode of transistor q3 , thereby providing a positive bias . current flow in transistor q3 , regulated by the reference current source , will result in biasing of transistors q4 and q5 in the oscillator 8 . either q4 or q5 will conduct a high current to begin oscillation . as oscillation builds in the primary and secondary windings of the transformer t1 , the output of the oscillator across the secondary winding 30 is detected by the demodulator and rectified as previously described by alternate operation of transistors q1 and q2 . saturated transistors q2 and q1 have very low resistance when conducting . further , they conduct in both directions . therefore no instantaneous rectified noise signal can seriously modify the average detected signal by transistors q1 and q2 . noise rejection of the invention as shown in the embodiment of fig2 is significant . the noise is reduced to as little as one part in one million . use of the present embodiment of the invention with variable reluctance pressure transducers allows measurement of pressure changes which are in the order of 1 × 10 - 6 of full scale due to the extremely high signal to noise ratio . the rectified sine wave signal across resistors r5 and r6 is smoothed by the drain from capacitor cl to provide the control signal to the operational amplifier u1 . as the output of the oscillator 8 builds , the control signal derived through transistors q1 and q2 drives pin g of the operational amplifier u1 equal to the voltage at pin h . close regulation now takes place by comparison of the reference voltage present at terminal v3 input to the operational amplifier on pin h and the control signal input to the operational amplifier at pin g . positive and negative changes in the output of the operational amplifier u1 increase or reduce the bias on transistor q3 which in turn results in corresponding changes in the collector current of transistor pair q4 and q5 of the oscillator , thereby controlling the oscillator output amplitude . the ac voltage appearing across the terminals d and f of the secondary winding is averaged and divided by three to equal the input dc reference voltage across r1 ( provided that r5 , r6 , r7 , r9 , r10 and r11 are of equal resistance ). therefore the rms ac output is given by the equation : the circuit elements used in the preferred embodiment shown in fig2 are as follows : table i______________________________________u1 op22 q1 2n 2432ar1 25 . 5 kohms q2 2n 2432ar2 249 kohms q3 2n 2222ar3 100 kohms q4 2n 2907ar4 2 . 7 mohms q5 2n 2907ar5 100 kohms c1 1 . 0 mfdr6 100 kohms c3 . 0047 mfdr7 100 kohmsr8 22 . 1 kohms t1 p / n 19161r9 100 kohms v1 - v5 5 volts dcr10 100 kohmsr11 100 kohms______________________________________ those skilled in the art will recognize that replacement of pnp transistors with npn transistors and vice versa and reversing of positive and negative power input and return at terminals v1 and v5 will result in identical circuit operation . the embodiment of the invention shown uses very little power ( approximately 500 uwatts { 0 . 1 ma at 5 volts }) yet maintains good wave shape and regulation when loaded . typical idling current in the preferred embodiment as described is less than 0 . 1 milliampere with 30 microampere idling current quite feasible . further , the output low frequency noise at frequencies of 0 . 1 hz to 5 hz is very low . when used to drive a variable reluctance pressure transducer , the combined noise from the oscillator , the transducer , and the rest of the circuit is approximately 13 parts per million of the full scale range of the transducer . this compares with the circuit of u . s . pat . no . 3 , 763 , 444 which has a noise level of about 1 part in 5000 or 1000 parts per million . thus the present invention is at least 75 times as quiet as the &# 39 ; 444 circuit . this provides great advantage in many pressure measuring applications . having now described the invention in detail in accordance with the requirements of the patent statutes , those skilled in the art will have no difficulty in making changes and modifications in the individual parts or their relative assembly in order to meet specific requirements or conditions . such changes and modifications may be made without departing from the scope and spirit of the invention as set forth in the following claims .	7
the present invention provides a method for quantifying classification confidence of obstructions . when each sensor detects obstructions in front of itself , the present invention tracks position information of the obstructions , quantifies a existence confidence of each sensor , and merges with a classification belief assignment of each sensor to quantify an obstruction classification confidence , which is provided to the system for classifying and filtering errors , so as to improve reliability and precision of overall classification . fig3 is a diagram schematically showing a system of using a method for quantifying classification confidence of obstructions according to an embodiment of the present invention . a vehicular computer 26 in a vehicle comprises a classifier 27 and a perception mergence system 28 , and the vehicular computer 26 is connected with an image - retrieving unit 20 , a vehicle body signal sensor 24 and a plurality of range sensors 22 . the range sensors 22 are radars or lidars ( laser radars ) and obtain obstruction information of at least one obstruction in front of the vehicle . the image - retrieving unit 20 retrieves at least one piece of image information corresponding to the obstruction information . the vehicle body signal sensor 24 obtains a plurality of vehicle body signals , including those of vehicle speed or a rotational angle of a steering wheel . fig4 is a flow chart showing a method for quantifying classification confidence of obstructions according to an embodiment of the present invention . in step s 10 , the vehicular computer receives obstruction information of at least one obstruction , at least one piece of image information corresponding to the obstruction information and a plurality of vehicle body signals , and a classifier is used to classify the obstruction information , the image information and the vehicle body signals . the classifier is a function module in the vehicular computer . then , in step s 12 , the perception mergence system calculates a detection result of each range sensor to calculate a existence confidence , wherein the existence confidence is a probability that the obstruction detected by the range sensor is an entity . each range sensor obtains the existence confidence corresponding to the obstruction . if a plurality of obstructions is detected , each range sensor obtains a plurality of existence confidences corresponding to the obstructions . in the present invention , each range sensor tracks coordinates of the obstruction presently detected , namely position information of the obstruction . besides , each range sensor compares with an actual value and a plurality of tracking values subsequently - received to determine a probability that the tracked obstruction presently exists whereby the probability is viewed as the existence confidence . the tracking and comparison of the obstruction and determination of the existence confidence are calculated using joint integrated probabilistic association ( jipda ). then , in step s 14 , precision of the classifier is read , wherein the precision is set by a developer of the classifier . then , in step s 16 , the existence confidences and the precision of the classifier read in the preceding step are used to calculate a classification belief assignment of each range sensor corresponding to each obstruction . the classification belief assignment of each classifier equals to the existence confidence multiplied by the precision of the classifier . then , in step s 18 , mergence calculation is performed on all the classification belief assignments to respectively quantify an obstruction classification confidence of all the range sensors corresponding to each obstruction . in the step , the perception mergence system firstly defines detection situations of each obstruction , including those of four situations { φ , {∃}, { }, {∃, }}. φ denotes null , and {∃} denotes existence of the obstruction , and { } denotes inexistence of the obstruction , and {∃, } denotes possible existence or possible inexistence of the obstruction . meanwhile , three parameters are required to calculate an obstruction classification confidence of a specific obstruction . the three parameters include the classification belief assignment of each range sensor corresponding to the specific obstruction , precision of the range sensors and at least one obstruction continuous detection probability . the precision of the range sensors is provided by an industry in a factory . not all precision of the range sensors are identical . in general , the precision of the range sensors is impossible to reach 100 %. if the precision , for example , is lowered and different from an initial value thereof , the precision can be manually adjusted . as a result , the precision of each range sensor is a predetermined value in advance , and the obstruction continuous detection probability is a probability that the range sensors continuously detect the identical obstruction . if the vehicle is provided with the image - retrieving unit 20 , the images are used to directly determine whether the obstruction is a vehicle and the range sensors are responsible for auxiliary determination . if the vehicle does not be provided with the image - retrieving unit 20 to retrieve the images , only the range sensors are used to determine whether the obstruction is a vehicle . in such a case , a determination way of the obstruction continuous detection probability is shown in fig5 . firstly , in step s 30 , the obstruction information detected by the range sensor is received to determine whether the obstruction is a vehicle . then , in step s 32 , the preceding obstruction information is compared with the received obstruction information to determine whether the obstructions corresponding to the preceding obstruction information and the received obstruction information are identical . if the answer is no , the process determines that the obstruction is not a vehicle , as shown in step s 34 . if the answer is yes , the process determines whether the identical obstruction is continuously detected more than predetermined times , as shown in step s 36 . if the answer is yes , the process determines the obstruction is a vehicle , as shown in step s 38 . if the answer is no , the process determines that the obstruction is not a vehicle , as shown in step s 34 . in step s 18 , the mergence calculation merges with all the information of the specific obstruction using dempster - shafer theory . refer to fig6 , which is a flow chart showing the mergence calculation . firstly , in step s 182 , the classification belief assignments of all the range sensors detecting the specific obstruction , the precision of the range sensors and the obstruction continuous detection probability are introduced . then , in step s 184 , basic belief assignments of the range sensors according to existence or inexistence of the specific obstruction are calculated . then , in step s 186 , the specific obstruction has four detection situations comprising null , existence , inexistence , possible existence , and possible inexistence , and the basic belief assignments of step s 184 is used to calculate a mergence confidence assignment according to the four detection situations . finally , in step s 188 , an object existence probability of the specific obstruction is calculated according to the mergence belief assignment , and the object existence probability is the obstruction classification confidence of the present invention . firstly , in step s 182 , the classification belief assignment p i (∃ x ) of each range sensor corresponding to the obstruction , the precision p trust i of the range sensors and the obstruction continuous detection probability p p i ( x ) are introduced . then , in step s 184 , the basic belief assignment of each range sensor is calculated , as shown by formulas ( 1 ) and ( 2 ). m i ({∃})= p p i ( x )· p trust i · p i (∃ x ) ( 1 ) m i ({ })= p p i ( x )· p trust i ·[ 1 − p i (∃ x )] ( 2 ) m i ({∃}) is the basic belief assignment during existence of the obstruction , and m i ({ }) is the basic belief assignment during inexistence of the obstruction . in the embodiment , existence {∃} and inexistence { } of the obstruction are adopted without considering null φ , and possible existence and possible inexistence {∃, } of the obstruction . then , in step s 186 , the mergence belief assignment is calculated only using {∃} and { }, as shown by formula ( 3 ). wherein , a ={∃}, b ={ }. finally , in step s 188 , an object existence probability of the specific obstruction is calculated according to the mergence belief assignment , as shown by formula ( 4 ). bel f ({∃}) is a situation without considering not determining existence or inexistence of the obstruction , and pl f ({∃}) is a situation with considering not determining existence or inexistence of the obstruction . formula ( 4 ) represents that the existence probabilities are weighted to obtain the average of various situations as the object existence probability of the obstruction , namely the obstruction classification confidence . in fig4 , the final step is step s 20 . in step s 20 , a classification ineffectiveness filtering mechanism is performed according to the obstruction classification confidence . when the obstruction classification confidence is less than a predetermined value , the detection or classification of the obstruction is not reliable . in such a case , the perception mergence system excludes the obstruction , and the process is specifically shown in fig7 . refer to fig7 . in step s 202 , the obstruction classification confidence of one obstruction is retrieved , wherein the obstruction classification confidence is obtained from merging all the range sensors . then , in step s 204 , the process determines whether the retrieved obstruction classification confidence is less than the predetermined value . if the answer is yes , the process classifies the obstruction into misjudgment and filters it out , as shown in step s 206 . if the answer is no , the process returns to step s 202 and retrieves the obstruction classification confidence of another obstruction for determining again until the classification ineffectiveness filtering mechanism is performed on all the obstructions detected in front of the vehicle . in step s 202 , the vehicular computer informs a driver of the vehicle of the obstruction information of the obstruction in front of the driver in hearing , touch or vision ways . besides , the vehicular computer informs the driver of a probability of the obstruction being a vehicle or a pedestrian . in this case , the autonomous driving system can automatically brake . in step s 204 , the predetermined value of the obstruction classification confidence is adjusted by the driver . for example , if the driver starts a semi - autonomous driving system , the predetermined value should be increased to above 70 % lest most obstructions be determined as vehicles so that the vehicular computer controls the semi - autonomous driving system to endlessly brake quickly when the predetermined value is decreased . when the driver drives the vehicle by himself and the obstruction classification confidence is used as auxiliary reference , the predetermined value , for example , is decreased to 30 - 50 %. in this way , the driver himself can determine whether to slow down or brake although the perception mergence system usually sends notices such as the front obstructions being vehicles , slowing down or braking . for example , suppose that the range sensor is a radar . the existence confidence of the range sensor is 0 . 9999 , and the precision of the classifier is 0 . 87 , and the classification belief assignment of the range sensor is 0 . 9999 * 0 . 87 = 0 . 8699 . the existence confidence of the image - retrieving unit is 0 . 94 , and the precision of the classifier is 0 . 95 , and the classification belief assignment of the image - retrieving unit is 0 . 94 * 0 . 95 = 0 . 895 . the obstruction classification confidence is 0 . 895 after the mergence calculation . the present invention retrieves an obstruction classification confidence to determine whether it is larger than a predetermined value such as 0 . 6 . due to 0 . 895 larger than 0 . 6 , the present invention determines that the obstruction is a vehicle and informs the obstruction information of the driver . the traditional technology obtains the classification and existence confidences of the obstructions , and then activates the system . however , the traditional technology does not check how high the classification confidence again . the classification is ineffective , which misjudges that the noise represents a vehicle and incorrectly activates a safe mechanism , and which results in quick braking whereby rear - end collisions of vehicles from the rear occur . on the contrary , the present invention quantifies the probabilities ( the existence confidences ) that the obstructions detected by the range sensors are entities , and then uses the existence confidences and the precision of the classifier to figure out the classification belief assignments , and finally adds a mechanism merging and quantifying the obstruction classification confidence to correct the ineffective classification and to improve the precision of classification lest the system at a rear end do mistaken action . the range sensors such as radars or lidars are used to classify the obstructions without images . the present invention never loses protection abilities because of no images to greatly improve classification confidence and driving safety . the embodiments described above are only to exemplify the present invention but not to limit the scope of the present invention . therefore , any equivalent modification or variation according to the shapes , structures , features , or spirit disclosed by the present invention is to be also included within the scope of the present invention .	6
[ 0040 ] fig1 a to 1 c show a simplified separating device in which the operating principle of a separating device is explained . the separating devices shown in the figures and thus also the separating devices as shown in fig1 a to 1 c are designed such that with them , for example , blood plasma can be separated from whole blood . with the separating device , the blood plasma contained in the whole blood can be separated from the hematocrit contained in the blood . the separating device , as shown in fig1 a to 1 c for this purpose has a transport channel 6 and a separating area 3 , like the other separating devices shown in the figures . the supplied blood is transported in the transport channel 6 in the transport direction 30 . the blood can be transported solely by capillary forces between the start and the end of the transport channel 6 . next to the transport channel 6 there is a separating area 3 . in this separating area 3 the flow velocity of the hematocrit is slowed down relative to the flow velocity of the blood plasma such that in the transport direction 31 at the end of the separating area 3 the blood plasma which has been isolated from the hematocrit collects . both the transport channel 6 and also the separating area 3 are provided as a recess in the surface of the carrier . the transport channel 6 has a greater depth than the separating area 3 . the transition between the transport channel 6 and the separating area 3 is therefore formed by a shoulder . the recesses , i . e . the transport channel 6 and the separating area 3 , can be covered with a cover which can consist for example of the same material as the carrier or of a foil or film . the shoulder , the cover and the side walls of the separating area form the microstructure of the separating area 3 with a defined passage opening . this passage opening is dimensioned such that the larger cellular components cannot travel through the passage opening and are washed away from the blood flowing in the transport channel 6 , and cannot close the passage opening of the separating area . these components are predominantly the white blood cells . the passage opening is advantageously dimensioned such that smaller cellular components can only pass through the passage opening when these smaller cellular components deform and adapt to the size of the passage opening . within the separating area 3 the blood plasma and the smaller components of the blood are transported by capillary forces . the capillary forces in the separating area are lager than the capillary forces in the transport channel 6 . another effect which arises in a separating device especially for separation of the blood plasma from the smaller cellular components of the blood is the “ chromatographic effect ”. the chromatographic effect results in that the blood plasma is transported more rapidly through the separating area 3 than cellular components , for example red blood cells which can penetrate into the separating area 3 , but are moved along in the separating area 3 more slowly than the blood plasma . before the cellular components can reach the collecting area at the end of the separating area 3 , it is already completely filled with blood plasma . the red blood cells can no longer penetrate into the collecting area and travel into the blood plasma . [ 0045 ] fig2 shows a carrier with a separating device in which there are an inlet 1 and an outlet 2 which are interconnected via the transport channel 6 . the transport channel 6 is adjoined by the separating area 3 . the blood plasma which is to be separated flows through this separating area 3 in the direction 31 . in the direction 31 the separating area 3 is adjoined by a collecting element which is made as a collecting chamber 4 . this collecting chamber 4 is connected to the environment via a removal and vent channel 5 . a syringe or a pump can be connected to the end of the vent and removal channel in order to remove the separated blood plasma from the collecting chamber . the air which is contained in the collecting chamber 4 and in the separating area 3 and which is displaced when the blood plasma enters the collecting chamber 4 and the separating area 3 is removed via the removal and vent channel . in exactly the same way the collecting area and the collecting chamber can be vented through an opening in the cover . the inlet 1 , the outlet 2 , the transport channel 6 , the separating area 3 , the collecting chamber 4 and the removal and vent channel 5 are provided as recesses in the carrier . the inlet , the transport channel 6 and the outlet 2 are made such that blood delivered into the inlet 1 is transported from the inlet 1 via the transport channel 6 to the outlet 2 by the capillary forces acting in the inlet 1 , the transport channel 6 and the outlet 2 . in the separating area 3 capillary forces act which are greater than the capillary forces in the transport channel 6 . in this way part of the blood flowing in the transport channel is branched off into the separating area 3 . the bottom of the carrier in the separating area 3 , the side walls of the recess and the cover on the carrier form a passage opening with a height which is less than the height of the transport channel 6 . since the height of the collecting chamber 4 is greater than the height of the passage opening of the separating area 3 , the microstructure of the separating area 3 is made as a crosspiece 23 . the height of the passage opening between the crosspiece 23 and the cover is dimensioned such that especially the larger cellular components of the blood cannot pass between the crosspiece 23 of the separating area 3 and the cover of the separating device . only the blood plasma , and depending on the height of the passage opening , possibly the smaller cellular components of the blood , can be transported from the transport channel 6 into the collecting chamber 4 by the capillary forces acting in the separating area 3 . the cellular components of the blood which collect upstream of the entry opening of the separating area 3 are not deposited , which could clog the separating area 3 , but are transported by the blood which is flowing after out of the inlet in the transport direction 30 to the outlet 2 , where blood with an increased concentration of hematocrit is optionally collected . in the separating area 3 , as a result of the “ chromatographic effect ”, the blood plasma is separated from the smaller cellular components which are still possibly contained in the liquid . various separating devices with a transport channel 6 , a separating area 3 and a collecting chamber 4 as well as a removal and vent channel 5 are described using fig3 a to 10 b , as they can be used accordingly in a carrier as shown in fig2 or in other carriers . the separating devices of fig3 a to 10 b differ from the separating device used in the carrier as shown in fig2 essentially by the configuration of the separating area 3 or by the configuration of the collecting chamber 4 . in the separating device as shown in fig3 a and 3 b , in contrast to the separating area 3 as shown in fig2 in the transition from the separating area 3 to the collecting chamber 4 there are two notches 32 in the side surface of the crosspiece . as is apparent from the sectional view of fig3 b , these notches connect the separating area 3 to the bottom of the collecting chamber 4 . these notches overcome the capillary stop which may be formed by the sudden change of geometrical properties in the area of the transition from the separating area 3 to the collecting chamber 4 . the blood plasma which flows via the separating area 3 is transported in the notches . another difference between the separating device as shown in fig2 and the separating device as shown in fig3 a and 3 b is that in the separating device as shown in fig3 a and 3 b in the bottom of the collecting chamber 4 there are grooves 33 which lie transversely to the transport direction 31 . these grooves make the approaching liquid front of blood plasma more uniform and regulate it . the grooves 33 first stop the liquid front until the entire area between the groove 33 and the separating area 3 is filled with blood plasma . the blood plasma which is flowing after forces the blood plasma away via the groove 33 . the collecting chamber 4 is uniformly filled with blood plasma in this way . the air which is contained initially in the collecting chamber 4 is routed out of the collecting chamber 4 via the removal and vent channel 5 , without the formation of air bubbles . the embodiment shown in fig4 for a separating device differs from the separating device as shown in fig2 in that instead of a straight crosspiece 23 with edges which are parallel to the transport direction 30 a toothed crosspiece 23 ′ is used . the toothed shape of the crosspiece 23 ′ increases the contact area of the crosspiece 23 ′ and the effective contact area in the separating area 3 . in the separating devices used in fig5 a to 7 there is a crosspiece in which columns 22 extend between the surface of the crosspiece and the bottom of the cover ( not shown in fig5 a , fig6 and fig7 ). because of the columns 22 the separating area 3 has not only a passage opening , but the separating area 3 is divided by the columns 22 into several passage openings . the columns 22 are located in two rows with successive columns in the separating device as shown in fig5 a and 5 b . the passage openings which are bordered by the columns of the first row can have the same width as the passage openings which are bordered by the columns of the second row . the separating device as shown in fig5 a and 5 b in the collecting chamber 4 has a crosspiece 34 which lies transversely to the transport direction 31 . the crosspiece 34 first dams up the liquid in front of it . as soon as the area in front of the crosspiece 34 is completely filled , the liquid overcomes the crosspiece 34 and penetrates into the area of the collecting chamber 4 which is downstream of the crosspiece 34 . in a manner similar to that accomplished by the grooves 33 , this results in that the blood plasma which penetrates into the collecting chamber 4 uniformly fills the collecting chamber 4 and the air contained in the collecting chamber 4 escapes through the vent and removal channel 5 without the formation of air bubbles in the collecting chamber 4 . in contrast to the separating device as shown in fig5 a and 5 b , in the separating device as shown in fig6 the columns 22 are arranged offset behind one another in three rows , i . e . the columns of the second row are flush with the passage openings between the columns of the first row and the columns of the third row are flush with the passage openings between the columns of the second row . this offset arrangement of the columns 22 slows down the smaller cellular components which are entrained in the liquid by colliding with the columns , by which the blood plasma which is flowing faster has more time to fill the collecting chamber 4 before the first cellular component reaches the collecting chamber 4 . in the separating device as shown in fig7 the passage openings between the columns of the first row have a greater width than the passage openings between the columns of the second row . the passage openings between the columns of the second row have a greater width than the passage openings between the columns of the third row . this microstructure has the advantage that cellular components which have possibly penetrated from the transport channel 6 into the separating area 3 , depending on the size in the first , second or third row of the columns 22 , are stopped without clogging the separating area . the separating device as shown in fig8 as the microstructures has both a crosspiece 23 and also columns 22 . the crosspiece 23 is located in the area of the separating area 3 bordering the transport channel 6 and extends in a zigzag next to the transport channel 6 . behind the crosspiece 23 staggered in three rows and set to a gap there are the columns 22 . the height of the passage opening in the area of the crosspiece 23 is made such that smaller cellular components of the blood , such as for example the red blood cells , can pass through the intermediate space between the crosspiece 23 and the cover , but these components are stopped by the columns 22 . [ 0060 ] fig9 a and 9 b shows a separating device in which the separating area 3 is formed by a ramp 20 . this ramp 20 rises from the level of the bottom of the transport channel 6 . the smallest cellular components cannot pass through the passage opening at the end of the ramp . the forward area of the ramp 20 which directly adjoins the transport channel 6 is continuously flushed by the blood flowing in the transport channel . the particles present in this area are washed away from the liquid flow in the transport channel 6 . the separating device as shown in fig1 a and 10 b has a separating area 3 with a microstructure which is formed by stairs 21 . the stairs 21 gradually reduce the height between the stairs 21 and the cover . the smallest cellular components of the blood , i . e . especially the red blood cells , do not pass through the passage opening between the last stage and the cover , or only pass with a delay . [ 0062 ] fig1 a and 11 b show another version of the separating device . this separating device as the inlet 1 has a channel which adjoins the transport channel 6 which is c - shaped in an overhead view . the transport channel 6 is connected in the area of the crosspiece which joins the two legs of the “ c ”. the transport channel 6 has two transport channel halves which are connected to the end of the inlet 1 . the separating area 3 extends , likewise c - shaped in an overhead view , along the inner side of the two halves of the transport channel 6 . the interior of this separating area 3 is the collecting chamber 4 which is connected to the removal and vent channel 5 which is routed through the open side of the separating area 3 which is c - shaped in an overhead view and of the transport channel 6 which is c - shaped in an overhead view . both the inlet 1 and also the transport channel 6 or the transport channel halves are made such that the blood which has been delivered via the inlet into the separating device is transported by the capillary forces acting in the inlet 1 and the halves of the transport channel 6 from the end of the inlet 1 to the ends of the halves of the transport channel 6 . the ends of the transport channel halves are connected for example to an outlet which holds the excess blood from the transport channel halves . the separating device 3 has a microstructure which is formed by a crosspiece 23 which extends between the transport channel halves 6 and the collecting chamber 4 . between the crosspiece 23 and the cover of the separating device as claimed in the invention which covers the channels 5 , 6 , the separating area 3 and the collecting chamber 4 , a passage opening remains which is so high than the larger cellular components cannot penetrate through it . the crosspiece in the transport direction 31 has an extension which is dimensioned such that smaller cellular components , such as for example red blood cells , only reach the inner edge of the crosspiece 23 when the collecting chamber 4 is already completely filled with blood plasma . as soon as the collecting chamber 4 is completely filled , the red blood cells which are located in the separating area 3 cannot be transported into the collecting chamber 4 as a result of the stopping transport mechanisms , so that mixing of the blood plasma with the red blood cells is prevented . in this version the removal and vent channel 5 forms a capillary stop 35 which can be overcome by applying an external pressure , for example by a syringe or by a pump , in order to remove the separated blood plasma from the collecting chamber .	8
the compounds of this invention inhibit the farnesylation of ras . in a first embodiment of this invention , the ras farnesyl transferase inhibitors are illustrated by the formula i : ## str2 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; b ) c1 - c6 alkyl unsubstituted or substituted by alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , no 2 , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 8 ) 2 , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; or r 3 and r 4 are combined to form -( ch 2 ) s -; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocycle group , wherein the substituent is selected from f , cl , br , n ( r 8 ) 2 , no 2 , r 8 o -, r 8 s ( o ) m - , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; r 5a and r 5b are combined to form --( ch 2 ) s -- wherein one of the carbon atoms is optionally replaced by a moiety selected from : o , s ( o ) m , -- nc ( o )--, and -- n ( cor 8 )--; ## str3 ## r 7a is selected from a ) hydrogen , e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; p0 z 1 and z 2 are independently h 2 or o , provided that z 1 is not o when in a second embodiment of this invention the prodrugs of compounds of formula i are illustrated by the formula ii : ## str4 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 - , c ) aryl , heterocycle , cycloalkyl , alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , no 2 , ( r 8 ) 2 n c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and . c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 8 ) 2 , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; or r 3 and r 4 are combined to form --( ch 2 ) s --; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocycle group , wherein the substituent is selected from f , cl , br , n ( r 8 ) 2 , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , - n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; or r 5a and r 5b are combined to form --( ch 2 ) s - wherein one of the carbon atoms is optionally replaced by a moiety selected from : o , s ( o ) m ,-- nc ( o )--, and -- n ( cor 8 )--; a ) substituted or unsubstituted c 1 - c 8 alkyl , wherein the substituent on the alkyl is selected from : b ) ## str5 ## x - y is ## str6 ## r 7a is selected from a ) hydrogen , e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; r 10 is independently selected from hydrogen and c 1 - c 6 alkyl ; r 11 is independently selected from c 1 - c 6 alkyl ; z 1 and z 2 are independently h 2 or o , provided that z 1 is not o when in a third embodiment of this invention , the inhibitors of farnesyl transferase are illustrated by the formula iii : ## str7 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , no 2 , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 8 ) 2 , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; or r 3 and r 4 are combined to form --( ch 2 ) s --; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; z 1 and z 2 are independently h 2 or o , provided that z 1 is not o when in a fourth embodiment of this invention the prodrugs of compounds of formula ill are illustrated by the formula iv : ## str9 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , no 2 , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 8 ) 2 , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr . sup . - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; or r 3 and r 4 are combined to form --( ch 2 ) s --; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; z 1 and z 2 are independently h 2 or o , provided that z1 is not o when in a more preferred embodiment of this invention , the ras farnesyl transferase inhibitors are illustrated by the formula i : ## str11 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; a ) a side chain of a naturally occurring amino acid , wherein the amino acid is selected from alanine , leucine , isoleucine , norleucine , valine and norvaline : b ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and c ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; and r 2b is selected from hydrogen and c 1 - c 6 alkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocycle group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; z 1 and z 2 are independently h 2 or o , provided that z 1 is not o when in a second more preferred embodiment of this invention , the prodrugs of the preferred compounds of formula i are illustrated by the formula ii : ## str13 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, cn , r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; a ) a side chain of a naturally occurring amino acid , wherein the amino acid is selected from alanine , leucine , isoleucine , norleucine , valine and norvaline ; and b ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and c ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; r 2b is selected from hydrogen and c 1 - c 6 alkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocycle group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 -, c 1 - c 20 alkyl , or heterocycle : a ) a side chain of a naturally occurring amino acid , wherein the amino acid is selected from methionine and glutamine , b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; x - y is ## str14 ## r 6 is a ) substituted or unsubstituted c 1 - c 8 alkyl , wherein the substituent on the alkyl is selected from : e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; r 10 is independently selected from hydrogen and c 1 - c 6 alkyl ; z 1 and z 2 are independently h 2 or o , provided that z 1 is not o when in a third more preferred embodiment of this invention , the inhibitors of farnesyl transferase are illustrated by the formula iii : ## str16 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; a ) a side chain of a naturally occurring amino acid , wherein the amino acid is selected from alanine , leucine , isoleucine , norleucine , valine and norvaline ; and b ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and c ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; r 2b is selected from hydrogen and c 1 - c 6 alkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocycle group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected from pyrrolidinyl , imidazolyl , pyridmyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; z 1 and z 2 are independently h 2 or o , provided that z 1 is not o when in a fourth more preferred embodiment of this invention , the prodrugs of the preferred compounds of formula iii are illustrated by the formula iv : ## str18 ## wherein : r 1 is selected from : b ) r 8 s ( o ) 2 -, r 8 c ( o )-, ( r 8 ) 2 nc ( o )- or r 9 oc ( o )-, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , or r 9 oc ( o ) nr 8 -; wherein the amino acid is selected from alanine , leucine , isoleucine , norleucine , valine and norvaline : b ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m -, r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and c ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; r 2b is selected from hydrogen and c 1 - c 6 alkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocycle group , wherein the substituent is selected from f , cl , br , no 2 , r 8 o -, r 8 s ( o ) m , r 8 c ( o ) nr 8 -, cn , ( r 8 ) 2 n - c ( nr 8 )-, r 8 c ( o )-, r 8 oc ( o )-, n 3 , -- n ( r 8 ) 2 , r 9 oc ( o ) nr 8 - and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected frown pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; e ) c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , f ) a carbonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl , and g ) a sulfonyl group which is bonded to an unsubstituted or substituted group selected from aryl , heterocycle , cycloalkyl and c 1 - c 6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl , heterocycle and cycloalkyl ; wherein heterocycle is selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl ; r 8 is independently selected from hydrogen , c 1 - c 6 alkyl and aryl ; r 9 is independently selected from c 1 - c 6 alkyl and aryl ; z 1 and z 2 are independently h 2 or o , provided that z 1 is not o when n -[ 1 -( 2 ( r )- amino - 3 - mercaptopropyl )- 2 ( s )- pyrrolidinylmethyl ] n -( 1 - naphthylmethyl ) glycyl - methionine ## str20 ## n -[ 1 -( 2 ( r )- amino - 3 - mercaptopropyl )- 2 ( s )- pyrrolidinylmethyl ]- n -( 1 - naphthylmethyl ) glycyl - methionine methyl ester ## str21 ## 2 ( s )-[[ 1 -[ 2 ( r )- amino - 3 - mercapto ] propyl ]- 2 ( s )-( pyrrolidinyl )- methyloxy ]- 3 - phenylpropionyl - methionine ## str22 ## 2 ( s )-[[ 1 -[ 2 ( s )- amino - 3 - mercapto ] propyl ]- 2 ( s )-( pyrrolidinyl ) methyloxy ]- 3 - phenylpropionyl - methionine ## str23 ## or the pharmaceutically acceptable salts thereof . in the present invention , the amino acids which are disclosed are identified both by conventional 3 letter and single letter abbreviations as indicated below : ______________________________________alanine ala aarginine arg rasparagine asn naspartic acid asp dasparagine oraspartic acid asx bcysteine cys cglutamine gln qglutamic acid glu eglutamine orglutamic acid glx zglycine gly ghistidine his hisoleucine ile ileucine leu llysine lys kmethionine met mphenylalanine phe fproline pro pserine ser sthreonine thr ttryptophan trp wtyrosine tyr yvaline val v______________________________________ the compounds of the present invention may have asymmetric centers and occur as racemates , racemic mixtures , and as individual diastereomers , with all possible isomers , including optical isomers , being included in the present invention . as used herein , &# 34 ; alkyl &# 34 ; is intended to include both branched and straight - chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms . as used herein , &# 34 ; cycloalkyl &# 34 ; is intended to include nonaromatic cyclic hydrocarbon groups having the specified number of carbon atoms . examples of cycloalkyl groups include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl and the like . &# 34 ; alkenyl &# 34 ; groups include those groups having the specified number of carbon atoms and having one or several double bonds . examples of alkenyl groups include vinyl , allyl , isopropenyl , pentenyl , hexenyl , heptenyl , cyclopropenyl , cyclobutenyl , cyclopentenyl , cyclohexenyl , 1 - propenyl , 2 - butenyl , 2 - methyl - 2 - butenyl , isoprenyl , farnesyl , geranyl , geranylgeranyl and the like . as used herein . &# 34 ; aryl &# 34 ; is intended to include any stable monocyclic , bicyclic or tricyclic carbon ring ( s ) of up to 7 members in each ring , wherein at least one ring is aromatic . examples of aryl groups include phenyl , naphthyl , anthracenyl , biphenyl , tetrahydronaphthyl , indanyl , phenanthrenyl and the like . the term heterocycle or heterocyclic , as used herein , represents a stable 5 - to 7 - membered monocyclic or stable 8 - to 11 - membered bicyclic or stable 11 - 15 membered tricyclic heterocycle ring which is either saturated or unsaturated , and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of n , o , and s , and including any bicyclic group in which any of the above - defined heterocyclic rings is fused to a benzene ring . the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure . examples of such heterocyclic elements include , but are not limited to , azepinyl , benzimidazolyl , benzisoxazolyl , benzofurazanyl , benzopyranyl , benzothiopyranyl , benzofuryl , benzothiazolyl , benzothienyl , benzoxazolyl , chromanyl , cinnolinyl , dihydrobenzofuryl , dihydro - benzothienyl , dihydrobenzothiopyranyl , dihydrobenzothio - pyranyl sulfone , furyl , imidazolidinyl , imidazolinyl , imidazolyl , indolinyl , indolyl , isochromanyl , isoindolinyl , isoquinolinyl , isothiazolidinyl , isothiazolyl , isothiazolidinyl , morpholinyl , naphthyridinyl , oxadiazolyl , 2 - oxoazepinyl , 2 - oxopiperazinyl , 2 - oxopiperidinyl , 2 - oxopyrrolidinyl , piperidyl , piperazinyl , pyridyl , pyridyl n - oxide , pyridonyl , pyrazinyl , pyrazolidinyl , pyrazolyl , pyrimidinyl , pyrrolidinyl , pyrrolyl , quinazolinyl , quinolinyl , quinolinyl n - oxide , quinoxalinyl , tetrahydrofuryl , tetrahydroisoquinolinyl , tetrahydro - quinolinyl , thiamorpholinyl , thiamorpholinyl sulfoxide , thiazolyl , thiazolinyl , thienofuryl , thienothienyl , and thienyl . as used herein , the terms &# 34 ; substituted aryl &# 34 ;, &# 34 ; substituted heterocycle &# 34 ; and &# 34 ; substituted cycloalkyl &# 34 ; are intended to include cyclic group which is substituted with 1 or 2 substitutents selected from the group which includes but is not limited to f , cl , br , cf 3 , nh 2 , n ( c 1 - c 6 alkyl ) 2 , no 2 , cn , ( c 1 - c 6 alkyl ) o -, -- oh , ( c 1 - c 6 alkyl ) s ( o ) m , ( c 1 - c 6 alkyl ) c ( o ) nh -, h 2 n - c ( nh )-, ( c 1 - c 6 alkyl ) c ( o )-, ( c 1 - c 6 alkyl ) oc ( o )-, n 3 , ( c 1 - c 6 alkyl ) oc ( o ) nh - and c 1 - c 20 alkyl . the following structure : ## str24 ## represents a cyclic amine moiety having 5 or 6 members in the ring , such a cyclic amine which may be optionally fused to a phenyl or cyclohexyl ring . examples of such a cyclic amine moiety include , but are not limited to , the following specific structures : ## str25 ## it is also understood that substitution on the cyclic amine moiety by r 2a and r 2b may be on different carbon atoms or on the same carbon atom . when r 3 and r 4 are combined to form --( ch 2 ) s --, cyclic moieties are formed . examples of such cyclic moieties include , but are not limited to : ## str26 ## when r 5a and r 5b are combined to form --( ch 2 ) s -, cyclic moieties as described hereinabove for r 3 and r 4 are formed . in addition , such cyclic moieties may optionally include a heteroatom ( s ). examples of such heteroatom - containing cyclic moieties include , but are not limited to : ## str27 ## the pharmaceutically acceptable salts of the compounds of this invention include the conventional non - toxic salts of the compounds of this invention as formed , e . g ., from non - toxic inorganic or organic acids . for example , such conventional non - toxic salts include those derived from inorganic acids such as hydrochloric , hydrobromic , sulfuric , sulfamic , phosphoric , nitric and the like : and the salts prepared from organic acids such as acetic , propionic , succinic , glycolic , stearic , lactic , malic , tartaric , citric , ascorbic , pamoic , maleic , hydroxymaleic , phenyl - acetic , glutamic , benzoic , salicylic , sulfanilic , 2 - acetoxy - benzoic , fumaric , toluenesulfonic , methanesulfonic , ethane disulfonic . oxalic , isethionic , trifluoroacetic and the like . it is intended that the definition of any substituent or variable ( e . g ., r 8 , z , n , etc .) at a particular location in a molecule be independent of its definitions elsewhere in that molecule . thus , -- n ( r 8 ) 2 represents -- nhh , -- nhch 3 , -- nhc 2 h 5 , etc . it is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art as well as those methods set forth below . the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods . generally , the salts are prepared by reacting the free base with stoichiometric amounts or with an excess of the desired salt - forming inorganic or organic acid in a suitable solvent or various combinations of solvents . the compounds of the invention can be synthesized from their constituent amino acids by conventional peptide synthesis techniques , and the additional methods described below . standard methods of peptide synthesis are disclosed , for example , in the following works : schroeder et al ., &# 34 ; the peptides &# 34 ;, vol . i , academic press 1965 , or bodanszky et al ., &# 34 ; peptide synthesis &# 34 ;, interscience publishers , 1966 , or mcomie ( ed .) &# 34 ; protective groups in organic chemistry &# 34 ;, plenum press , 1973 , or barany et al ., &# 34 ; the peptides : analysis , synthesis , biology &# 34 ; 2 , chapter 1 , academic press , 1980 , or stewart et at ., &# 34 ; solid phase peptide synthesis &# 34 ;, second edition , pierce chemical company , 1984 . the teachings of these works are hereby incorporated by reference . abbreviations used in the description of the chemistry and in the examples that follow are : ______________________________________ac . sub . 2 o acetic anhydride ; boc t - butoxycarbonyl ; dbu 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ; dmap 4 - dimethylaminopyridine ; dme 1 , 2 - dimethoxyethane ; dmf dimethylformamide ; edc 1 -( 3 - dimethylaminopropyl )- 3 - ethyl - carbodiimide - hydrochloride ; hobt 1 - hydroxybenzotriazole hydrate ; et . sub . 3 n triethylamine ; etoac ethyl acetate ; fab fast atom bombardment ; hoobt 3 - hydroxy - 1 , 2 , 2 - benzotriazin - 4 ( 3h )- one ; hplc high - performance liquid chromatography ; mcpba m - chloroperoxybenzoic acid ; mscl methanesulfonyl chloride ; nahmds sodium bis ( trimethylsilyl ) amide ; py pyridine ; tfa trifluoroacetic acid ; thf tetrahydrofuran . ______________________________________ compounds of this invention are prepared by employing the reactions shown in the following reaction schemes a - j , in addition to other standard manipulations such as ester hydrolysis , cleavage of protecting groups , etc ., as may be known in the literature or exemplified in the experimental procedures . some key bond - forming and peptide modifying reactions are : reaction a . amide bond formation and protecting group cleavage using standard solution or solid phase methodologies . reaction b . preparation of a reduced peptide subunit by 1 reductive alkylation of an amine by an aldehyde using sodium cyanoborohydride or other reducing agents . reaction c . alkylation of a reduced peptide subunit with an alkyl or aralkyl halide or , alternatively , reductive alkylation of a reduced peptide subunit with an aldehyde using sodium cyanoborohydride or other reducing agents . reaction d . peptide bond formation and protecting group cleavage using standard solution or solid phase methodologies . reaction e . preparation of a reduced subunit by borane reduction of the amide moiety . reaction schemes a - e illustrate bond - forming and peptide modifying reactions incorporating acyclic peptide units . it is well understood that such reactions are equally useful when the -- nhc ( r a )-- moiety of the reagents and compounds illustrated is replaced with the following moiety : ## str28 ## these reactions may be employed in a linear sequence to provide the compounds of tile invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in tile reaction schemes . ## str29 ## where r a and r b are r 3 , r 4 , r 5a or r 5b as previously defined ; x l is a leaving group , e . g ., br -, i - or mso -; and r y is defined such that r 7b is generated by the reductive alkylation process . certain compounds of this invention wherein x - y is an ethenylene or ethylene unit are prepared by employing the reaction sequences shown in reaction schemes f and g . reaction scheme f outlines the preparation of the alkene isosteres utilizing standard manipulations such as weinreb amide formation , grignard reaction , acetylation , ozonolysis , witrig reaction , ester hydrolysis , peptide coupling reaction , mesylation , cleavage of peptide protecting groups , reductive alkylation , etc ., as may be shown in the literature or exemplified in the experimental procedure . for simplicity , substituents r 2a and r 2b on the cyclic amine moiety are not shown . it is , however , understood that the reactions illustrated are also applicable to appropriately substituted cyclic amine compounds . the key reactions are : stereoselective reduction of the boc - amino - enone to the corresponding syn amino - alcohol ( scheme f , step b , part 1 ), and stereospecific boron trifluoride or zinc chloride activated organomagnesio , organo - lithio , or organo - zinc copper ( l ) cyanide s n 2 &# 39 ; displacement reaction ( scheme f , step g ). through the use of optically pure n - boc amino acids as starting material and these two key reactions , the stereo - chemistry of the final products is well defined . in step h of scheme f , the amino terminus sidechain , designated r x is incorporated using coupling reaction a and r x cooh ; the alkylation reaction c using r x cho and a reducing agent ; or alkylation reaction c using r x ch 2 x l . the alkane analogs are prepared in a similar manner by including an additional catalytic hydrogenation step as outlined in reaction scheme g . ## str30 ## the oxa isostere compounds of this invention are prepared according to the route outlined in scheme h . an aminoalcohol 1 is acylated with alpha - chloroacetyl chloride in the presence of trialkylamines to yield amide 2 . subsequent reaction of 2 with a deprotonation reagent ( e . g ., sodium hydride or potassium t - butoxide ) in an ethereal solvent such as thf provides morpholinone 3 . alkylation of 3 with r 3 x l , where x l is a leaving group such as br -, i - or cl - in thf / dme ( 1 , 2 - dimethoxyethane ) in the presence of a suitable base , preferably nahmds [ sodium bis ( trimethylsilyl ) amide ], affords 4 , which is retreated with nahmds followed by either protonation or the addition of an alkyl halide r 4 x to give 5a or 5a , respectively . alternatively , 5a can be prepared from 3 via an aldol condensation approach . namely , deprotonation of 3 with nahmds followed by the addition of a carbonyl compound r y r z co gives the adduct 6 . dehydration of 6 can be effected by mesylation and subsequent elimination catalyzed by dbu ( 1 , 8diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ) or the direct treatment of 6 with phosphorus oxychloride in pyridine to give olefin 7 . then , catalytic hydrogenation of 7 yields 5a ( wherein - chr y r z constitutes r 3 ). direct hydrolysis of 5 with lithium hydrogen peroxide in aqueous thf , or aqueous hcl , produces acid 8a . compound 8a is then derivatized with boc - on or boc anhydride to give 8b . the pepfide coupling of acid 8b with either an alpha - aminolactone ( e . g ., homoserine lactone , etc .) or the ester of an amino acid is carried out under the conditions exemplified in the previously described references to yield derivative 9 . treatment of 9 with gaseous hydrogen chloride gives 10 , which undergoes reductive alkylation in the presence of a protected aldehyde pror x cho ( 11 ) and a reducing agent ( e . g ., sodium cyanoboro - hydride ); or acylation in the presence of pror x cooh ( 12 ) and a peptide coupling reagent affording , after removal of the trityl protecting group , the products 13 and 14 . hydrolysis of compounds 13 and 14 to the corresponding hydroxy acids and acids , respectively , is accomplished by standard methods such as treatment with naoh in alcoholic or aqueous milieux followed by careful acidifcation with dilute hcl . an alternative method for the preparation of the prolyl oxa isostere ( compounds 23 and 24 ) is illustrated in scheme h - 1 . referring to scheme h - 1 , the aminoalcohol 1 is protected with trifluoroacetic anhydride and the blocked compound 15 treated with diphenyl disulfide in the presence of tributylphosphine to provide the thioether 16 . chlorination of compound 16 provides compound 17 which can be reacted with the appropriate carboxylic acid alcohol in the presence of silver perchlorate and tin ( ii ) chloride , to afford the mixed acetal 18 . removal of the phenylmercapto moiety with raney nickel provides compound 19 . compound 19 is doubly deprotected , then selecteively boc protected to provide acid 20 , which undergoes the steps previously described for incorporating terminal amino acid . the appended free amine 22 then undergoes reductive alkylation in the presence of an aldehyde pror x cho ( 11 ) and a reducing agent ( e . g ., sodium cyanoboro - hydride ); or acylation in the presence of pror x cooh ( 12 ) and a peptide coupling reagent affording , after removal of the trityl protecting group , the products 23 and 24 . hydrolysis of compounds 23 and 24 to the corresponding hydroxy acids and acids , respectively , is accomplished by standard methods such as treatment with naoh in alcoholic or aqueous milieux followed by careful acidifcation with dilute hci . yet another alternative method for the preparation of the prolyl oxa isostere ( compounds 23 and 24 ) is described in the literature [ ruth e . tenbrink , j . org . chem ., 52 : 418 - 422 ( 1987 )]. ## str31 ## the thia , oxothia and dioxothia isostere compounds of this invention are prepared in accordance to the route depicted in scheme i . aminoalcohol 1 is derivatized with boc 2 to give 25 . mesylation of 25 followed by reaction with methyl alpha - mercaptoacetate in the presence of cesium carbonate gives sulfide 26 . removal of the boc group in 26 with tfa followed by neutralization with di - isopropylethylamine leads to 27 . sequential alkylation of 27 with the alkyl halides r 3 x and r 4 x in thf / dme using nahdms as the deprotonation reagent produces 28 . hydrolysis of 28 in hydrochloride to yield 29a , which is derivatized with boc anhydride to yield 29b . the coupling of 29b with an alpha - aminolactone ( e . g ., homoserine lactone , etc .) or the ester of an amino acid is carried out under conventional conditions as exemplified in the previously described references to afford 30 . sulfide 30 is readily oxidized to sulfone 31 by the use of mcpba ( m - chloroperoxybenzoic acid ). the n - boc group of either 30 or 31 is readily removed by treatment with gaseous hydrogen chloride . the resultant amine hydrochloride 32 undergoes reductive alkylation in the presence of an aldehyde pror x cho ( 12 ) and a reducing agent ( e . g ., sodium cyanoborohydride ); or acylation in the presence of pror x cooh ( 13 ) and a peptide coupling reagent to afford , following removal of the trityl group , the products 33 and 34 . ## str32 ## the compounds of this invention inhibit ras farnesyl transferase which catalyzes the first step in the post - translational processing of ras and the biosynthesis of functional ras protein . these compounds are useful as pharmaceutical agents for mammals , especially for humans . these compounds may be administered to patients for use in the treatment or cancer . examples of the type of cancer which may be treated with tile compounds of this invention include , but are not limited to , colorectal carcinoma , exocrine pancreatic carcinoma , and myeloid leukemias . the compounds of this invention may be administered to mammals , preferably humans , either alone or , prefrably , in combination with pharmaceutically acceptable carriers or diluents ,. optionally with known adjuvants , such as alum , in a pharmaceutical composition , according to standard pharmaceutical practice . the compounds can be administered orally or parenterally , including intravenous , intramuscular , intraperitoneal , subcutaneous , rectal and topical routes of administration . for oral use of a chemotherapeutic compound according to this invention , the selected compound may be administered , for example , in the form of tablets or capsules , or as an aqueous solution or suspension . in the case of tablets for oral use , carriers which are commonly used include lactose and corn starch , and lubricating agents , such as magnesium stearate , am commonly added . for oral administration in capsule form useful diluents include lactose and dried corn starch . when aqueous suspensions are required for oral use , the active ingredient is combined with emulsifying and suspending agents . if desired , certain sweetening and / or flavoring ; agents may be added . for intramuscular , intraperitoneal , subcutaneous and intravenous use , sterile solutions of the active ingredient are usually prepared , and the ph of the solutions should be suitably adjusted and buffered . for intravenous use , the total concentration of solutes should be controlled in order to render the preparation isotonic . the present invention also encompasses a pharmaceutical composition useful in the treatment of cancer , comprising the administration of a therapeutically effective amount of the compounds of this invention , with or without pharmaceutically acceptable carriers or diluents . suitable compositions of this invention include aqueous solutions comprising compounds of this invention and pharmacologically acceptable carriers , e . g ., saline , at a ph level , e . g ., 7 . 4 . the solutions may be introduced into a patient &# 39 ; s intramuscular blood - stream by local bolus injection . when a compound according to this invention is administered into a human subject , the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age , weight , and response of the individual patient , as well as the severity of the patient &# 39 ; s symptoms . in one exemplary application , a suitable amount of compound is administered to a mammal undergoing treatment for cancer . administration occurs in an amount between about 0 . 1 mg / kg of body weight to about 20 mg / kg of body weight per day , preferably of between 0 . 5 mg / kg of body weight to about 10 mg / kg of body weight per day . the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl - protein transferase ( fptase ) in a composition . thus the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of fptase ( for example a tetrapeptide having a cysteine at the amine terminus ) and farnesyl pyrophosphate and , in one of the mixtures , a compound of the instant invention . after the assay mixtures are incubated for an sufficient period of time , well known in the art , to allow the fptase to farnesylate the substrate , the chemical content of the assay mixtures may be determined by well known immunological , radiochemical or chromatographic techniques . because the compounds of the instant invention are selective inhibitors of fptase , absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of fptase in the composition to be tested . it would be readily apparent to one of ordinary skill in the art that such an assay as described above would be useful in identifying tissue samples which contain farnesyl - protein transferase and quantitating the enzyme . thus , potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample . a series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl - protein transferase , an excess amount of a known substrate of fptase ( for example a tetrapeptide having a cysteine at the amine terminus ) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention . the concentration of a sufficiently potent inhibitor ( i . e ., one that has a ki substantially smaller than the concentration of enzyme in the assay vessel ) required to inhibit the enzymatic activity of the sample by 50 % is approximately equal to half of the concentration of the enzyme in that particular sample . examples provided are intended to assist in a further understanding of the invention . particular materials employed , species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof . the standard workup referred to in the examples refers to solvent extraction and washing the organic solution with 10 % citric acid , 10 % sodium bicarbonate and brine as appropriate . solutions were dried over sodium sulfate and evaporated in vacuo on a rotary evaporator . n -( t - butoxycarbonyl )- l - prolinal ( 9 . 16 g , 0 . 046 mol ) and glycine methyl ester hydrochloride salt ( 5 . 78 g , 0 . 046 mol ) were dissolved in meoh ( 180 ml ) at 0 ° c . under nitrogen , treated with sodium cyanoborohydride ( 4 . 34 g , 0 . 069 mol ), and stirred for 18 h . the mixture was concentrated , and the residue was partitioned between etoac ( 100 ml ) and satd aq nahco 3 soln ( 100 ml ). the basic layer was washed with etoac ( 2 × 50 ml ), the organics combined , washed with brine , and dried over na 2 so 4 ). filtration and concentration to dryness gave the title compound as a pale yellow oil . 1 h nmr ( cdcl 3 ) δ 3 . 7 - 3 . 9 ( m , 1h ), 3 . 72 ( s , 3h ), 3 . 43 ( s , 2h ), 3 . 33 ( s , 2h ), 2 . 7 - 2 . 9 ( m , 1h ), 2 . 5 - 2 . 65 ( m , 1h ), 1 . 75 - 2 . 0 ( m , 4h ), 1 . 47 ( s , 9h ). n -[( 2s )-( t - butoxycarbonylpyrrolidinylmethyl ) glycine methyl ester ( 3 . 0 g , 0 . 011 mol ) was dissolved in 1 , 2 - dichloroethane ( 100 ml ) and 3a molecular sieves ( 3 g ) were added followed by 1 - naphthaldehyde ( 1 . 63 ml , 0 . 012 mol ) and sodium triacetoxyborohydride ( 4 . 64 g , 0 . 022 mol ). the mixture was stirred at ambient temperature for 5 h , and filtered through glass fiber paper and concentrated . the residue was partitioned between etoac and sat . nahco 3 ( 100 ml / 25 ml ). the aqueous layer was washed with etoac ( 3 × 50 ml ). the organic layers were combined , dried with na 2 so 4 , filtered , and concentrated to give crude product which was purified by chromatography ( silica gel 1 : 6 etoac / hexane ) to give the title compound . 1 h nmr ( cdcl ) 67 8 . 24 - 8 . 4 ( m , 1h ), 7 . 7 - 7 . 9 ( m , 2h ), 7 . 35 - 7 . 5 ( m , 4h ), 4 . 43 ( d , 1h , j = 12 hz ), 3 . 8 - 4 . 1 ( m , 2h ). 3 . 68 ( s , 3h ), 3 . 15 - 3 . 5 ( m , 4h ), 2 . 94 ( t , 1h , j = 12 hz )., 2 . 44 ( t , 1h , j = 11 hz ), 1 . 7 - 1 . 8 ( m , 2h ), 1 . 5 - 1 . 7 ( m , 2h ), 1 . 47 ( s , 9h ). n -[( 2s )-( t - butoxycarbonylpyrrolidinylmethyl )- n -( 1 - naphthylmethyl ) glycine methyl ester ( 2 . 91 g , 7 . 10 mmol ) was dissolved in meoh ( 60 ml ) and 1n naoh ( 21 . 3 ml , 21 . 3 mmol ) was added . the mixture was stirred at ambient temperature for 5 h and concentrated . the resulting residue was dissolved in h 20 ( 25 ml ) and neutralized with 1n hci ( 21 . 3 ml ). the aqueous layer was washed with etoac ( 3 × 50 ml ). the organic layers were combined , dried with na 2 so 4 , filtered , and concentrated to give product . 1 h nmr ( cd 3 od ); δ 8 . 57 ( d , 1h , j = 9 hz ), 7 . 5 - 8 . 0 ( m , 6h ), 5 . 13 ( d , 1h , j = 12 hz ), 4 . 71 ( d , 1h , j = 12 hz ), 4 . 05 - 4 . 15 ( m , 1h ), 3 . 71 ( abq , 2h ), 3 . 2 - 3 . 4 ( m , 3h ), 3 . 0 - 3 . 1 ( m , 1h ), 2 . 0 - 2 . 1 ( m , 1h ), 1 . 6 - 1 . 75 ( m , 2h ), 1 . 5 - 1 . 6 ( m , 1h ), 1 . 30 ( s , 9h ). n -[( 2s )-( t - butoxycarbonylpyrrolidinylmethyl )- n -( 1 - naphthylmethyl ) glycine ( 1 . 44 g , 3 . 6 mmol ), dissolved in ch 2 cl 2 ( 30 ml ), was treated with hobt ( 0 . 581 g , 4 . 3 mmol ), edc ( 0 . 831 g , 4 . 3 mmol ), and methionine methyl ester hydrochloride ( 0 . 859 g , 4 . 3 mmol ). the ph was adjusted to 7 . 5 with et3n ( 1 . 1 ml , 7 . 9 mmol ) and the mixture was stirred at ambient temperature for 18 h . the mixture was concentrated , and the residue was partitioned between ch 2 cl 2 ( 50 ml ) and saturated nahco 3 solution ( 25 ml ). the aqueous layer was extracted with ch 2 cl 2 ( 2 × 50 ml ). the organic layers were combined , washed with brine ( 1 × 25 ml ), dried ( na 2 so 4 ), filtered , and concentrated to give crude product which was purified by chromatography ( silica gel eluting with 1 : 3 to 1 : 1 ethyl acetate in hexane ) to give the title compound . 1 h nmr ( cdcl 3 ); δ 8 . 22 ( d , 1h , j = 9 hz ), 7 . 8 - 7 . 95 ( m , 2h ), 7 . 4 - 7 . 6 ( m , 4h ), 4 . 54 ( d , 1h , j = 16 hz ), 4 . 3 - 4 . 5 ( m , 2h ), 4 . 07 - 4 . 15 ( m , 1h ), 3 . 7 - 3 . 9 ( m , 2h ), 3 . 68 ( s , 3h ), 3 . 25 - 3 . 4 ( m , 3h ), 3 . 04 - 3 . 15 ( m , 1h ), 2 . 85 - 3 . 0 ( m 1h ), 2 . 4 - 2 . 5 ( m , 1h ), 1 . 89 ( s , 3h ). 1 . 53 - 2 . 5 ( m , 5h ), 1 . 48 ( s . 9h ), 1 . 2 - 1 . 45 ( m , 2h ). n -[( 2s )-( t - butoxycarbonylpyrrolidinylmethyl )- n -( 1 - naphthylmethyl )- glycyl - methionine methyl ester ( 1 . 5 g , 2 . 76 mmol ) was dissolved in etoac ( 50 ml ) and cooled to 0 ° c . hcl was bubbled through the mixture until tlc ( 95 : 5 ch 2 cl 2 : meoh ) indicated complete reaction . argon was bubbled through the mixture to remove excess hcl and the mixture was then concentrated to give the title compound . 1 h nmr ( cd 3 od ); δ 8 . 23 ( d , 1h , j = 8 hz ), 7 . 9 - 7 . 95 ( m , 2h ), 7 . 45 - 7 . 65 ( m , 4h ), 4 . 4 - 4 . 6 ( m , 4h ). 3 . 7 - 3 . 8 ( m , 1h ), 3 . 71 ( s , 3h ), 3 . 5 - 3 . 7 ( m , 2h ), 3 . 12 - 3 . 28 ( m , 2h ), 2 . 9 - 3 . 05 ( m , 1h ), 2 . 35 - 2 . 5 ( m , 2h ), 1 . 93 - 2 . 15 ( m , 4h ), 2 . 02 ( s , 3h ), 1 . 77 - 1 . 89 ( m , 1h ), 1 . 6 - 1 . 7 ( m , 1h ). anal . calcd for c 24 h 33 n 3 o 3 s . 2hcl . 0 . 5h 2 o : n -(( 2s )- pyrrolidinylmethyl )- n -( 1 - naphthylmethyl )- glycylmethionine methyl ester hydrochloride ( 0 . 20 g , 0 . 39 mmol ) was dissolved in meoh ( 10 ml ) in an ice - h 2 o bath , treated with koac ( 0 . 15 g , 2 . 3 mmol ), n -( t - butoxycarbonyl )- s - triphenylmethyl cysteinal ( 0 . 26 g , 0 . 59 mmol ) and sodium cyanoborohydride ( 0 . 074 g , 1 . 17 mmol ) then stirred at ambient temperature under argon for 18 h . the reaction mixture was filtered through glass fiber paper , concentrated , and partitioned between etoac and 5 % nh 4 oh soln ( 50 ml / 50 ml ). the aqueous layer was washed with etoac ( 50 ml ), organics combined , washed with brine ( 50 ml ) and dried over na 2 so 4 . filtration and concentration to dryness gave the title compound after chromatography on silica gel ( ch 2 cl 2 : meoh , 98 : 2 ). 1 h nmr ( cd 3 od ); δ 8 . 29 ( d , 1h , j = 9 hz ), 7 . 90 ( d , 1h , j = 9hz ), 7 . 81 ( d , 1h , j = 9 hz ), 7 . 3 - 7 . 55 ( m , 19 h ), 4 . 25 - 4 . 34 ( m , 2h ), 3 . 89 ( d , 1h , j = 16 hz ), 3 . 65 ( s , 3h ), 3 . 55 - 3 . 65 ( m , 1h ), 3 . 0 - 3 . 2 ( m , 2h ), 2 . 55 - 2 . 85 ( m , 4h ), 2 . 25 - 2 . 45 ( m , 4h ), 2 . 05 - 2 . 15 ( m , 1h ), 1 . 8 - 2 . 0 ( m , 3h ), 1 . 89 ( s , 3h ), 1 . 55 - 1 . 8 ( m , 3h ), 1 . 45 ( s , 9h ), 1 . 25 - 1 . 4 ( m , 2h ). n -[ 1 -( 2 ( r )-( t - butoxycarbonyl ) amino - 3 - triphenylmethyl mercaptopropyl )- 2 ( s )- pyrrolidinylmethyl ]- n -( 1 - naphthylmethyl ) glycylmethionine methyl ester ( 0 . 129 g , 0 . 147 mmol ) was dissolved in ch 2 cl 2 ( 2 ml ) and treated with trifluoroacetic acid ( tfa ) ( 1 ml ) and triethylsilane ( 0 . 094 ml , 0 . 589 mmol ) with stirring at ambient temperature . after 4 h the mixture was concentrated , triturated with hexane , and the residue dissolved in 0 . 1 % tfa / h 2 o and chromatographed by rp hplc to give the title compound . 1 h nmr ( cd 3 od ); δ 8 . 20 ( d , 1h , j = 9 hz ), 7 . 85 - 7 . 95 ( m , 2h ), 7 . 5 - 7 . 65 ( m , 4h ), 4 . 62 - 4 . 68 ( m , 1h ), 4 . 40 ( abq , 2h ), 3 . 7 - 3 . 8 ( m , 1h ), 3 . 73 ( s , 3h ), 3 . 35 - 3 . 6 ( m , 4h ), 3 . 0 - 3 . 3 ( m , 6h ), 2 . 8 - 2 . 9 ( m , 1h ), 2 . 65 - 2 . 8 ( m , 1h ), 2 . 4 - 2 . 6 ( m , 2h ), 2 . 06 ( s , 3h ), 1 . 85 - 2 . 2 ( m , 4h ), 1 . 62 - 0 . 7 ( m , 1h ). ms ( m + 1 ) 533 . n -[ 1 -( 2 ( r )-( t - butoxycarbonyl ) amino - 3 - triphenylmethyl - mercaptopropyl )- 2 ( s )- pyrrolidinylmethyl ]- n -( 1 - naphthylmethyl ) glycylmethionine methyl ester from example 1 , step f ( 0 . 091 g , 0 . 104 mmol ) was dissolved in meoh ( 2 . 5 ml ) and 1n naoh ( 0 . 416 ml , 0 . 416 mmol ) with stirring at 0 ° c . after 6 h the mixture was concentrated , and the residue was partitioned between etoac and h 2 o ( 25 ml / 25 ml ). the aqueous layer was washed with etoac ( 2 × 20 ml ), the organics combined , washed with brine and dried over na 2 so 4 . filtration and concentration gave the product . 1 h nmr ( cd 3 od ); δ 8 . 05 - 8 . 1 ( m , 1h ), 7 . 75 - 7 . 90 ( m , 2h ), 7 . 15 - 7 . 5 ( m , 19h ), 4 . 35 ( d , 1h , j = 16 hz ), 4 . 05 - 4 . 25 ( m , 2h ), 3 . 6 - 3 . 7 ( m , 1h ), 3 . 44 ( abq , 2h ), 2 . 93 - 3 . 05 ( m , 1h ), 2 . 75 - 2 . 95 ( m , 2h ), 2 . 6 - 2 . 75 ( m , 2h ) 2 . 25 - 2 . 6 ( m , 5h ), 2 . 04 ( s 3h ), 1 . 8 - 2 . 1 ( m , 4h ), 1 . 45 - 1 . 6 ( m , 1h ), 1 . 44 ( s , 9h ). n -[ 1 -( 2 ( r )-( t - butoxycarbonyl ) amino - 3 - triphenylmethyl mercaptopropyl )- 2 ( s )- pyrrolidinylmethyl ]- n -( 1 - naphthylmethyl ) glycylmethionine ( 0 . 089 g , 0 . 104 mmol ) was deprotected as described in example 1 , step g to give the title compound . 1 h nmr ( cd 3 od ); δ 8 . 22 ( d , 1 h , j = 9 hz ), 7 . 94 ( d , 1h , j = 8 hz ), 7 . 89 ( d , 1h , j = 8 hz ), 7 . 5 - 7 . 63 ( m , 4h ), 4 . 59 - 4 . 64 ( m , 1h ), 4 . 42 ( abq , 2h ), 3 . 7 - 3 . 84 ( m , 2h ), 3 . 4 - 3 . 64 ( m , 4h ), 3 . 25 - 3 . 33 ( m , 1h ), 3 . 1 - 3 . 2 ( m , 1h ), . 0 - 3 . 1 ( m , 2h ) 2 . 82 - 2 . 9 ( m , 1h ), 2 . 65 - 2 . 75 ( m , 1h ), 2 . 42 - 2 . 6 ( m , 2h ), 2 . 07 ( s , 3h ), 1 . 86 - 2 . 2 ( m , 4h ), 1 . 62 - 1 . 7 ( m , 1h ). ms ( m + 1 ) 519 . to a solution of 2 ( s )- hydroxymethylpyrrolidine ( 25 . 32 g , 0 , 250 mol ) in ch 2 cl 2 ( 720 ml ) under argon was added et 3 n ( 38 . 0 ml , 0 , 273 mol ). after cooling this mixture to - 20 ° c ., chloroacetyl chloride ( 20 . 0 ml , 0 . 251 mol ) was added dropwise over 0 . 75 h maintaining the reaction temperature at - 20 °± 3 ° c . the reaction was stirred at ambient temperature for 18 h and evaporated in vacuo . an impurity which precipitated during concentration was removed by filtration . the crude product was purified by chromatography ( silica gel , 1 : 39 to 1 : 19 meoh / ch 2 cl 2 ) to give the title compound as a yellow oil . 1 h nmr ( cdcl 3 , 400 mhz ): δ 4 . 37 ( dd , j = 8 , 3 hz , 1h ), 4 . 22 ( qd , j = 7 , 3 hz , 1h ), 4 . 08 ( s , 2h ), 3 . 71 ( td , j = 8 , 3 hz , 1h ), 3 . 68 - 3 . 50 ( m , 3h ), 2 . 14 - 1 . 86 ( m , 3h ), 1 . 72 - 1 . 62 ( m , 1h ). to a solution of n - chloroacetyl - 2 ( s )- hydroxymethypyrrolidine ( 12 . 8 g , 0 . 072 mol ) in thf ( 240 ml , distilled from na / benzophenone ) under argon at 0 ° c . was added nah ( 3 . 16 g of a 60 % dispersion in mineral oil . 0 . 079 mol ) slowly in several portions . after complete addition , the reaction was stirred at ambient temperature for 18 h , then quenched by adding glacial acetic acid ( 400 ml ), diluted with toluene , and evaporated in vacuo to give a thick gray liquid . water was cautiously added dropwise until no further gas evolution was observed . this mixture was diluted with meoh and ch 2 cl 2 and dried ( na 2 so 4 ). since filtration was unsuccessful , silica gel ( 60 g ) was added and the mixture was evaporated in vacuo . the crude product was purified by chromatography ( silica gel , 7 : 13 to 1 : 1 etoac / ch 2 cl 2 ) to give the title compound as a white solid . 1 h nmr ( cdcl 3 , 400 mhz ): δ 4 . 25 ( d , j = 17 hz , 1h ), 4 . 19 ( dd , j = 12 , 4 hz , 1h ), 4 . 02 ( d , j = 17 hz , 1h ), 3 . 76 - 3 . 64 ( m , 2h ), 3 . 50 ( td , j = 10 , 2 . 5 hz , 1h ), 3 . 24 ( dd , j = 12 , 10 hz , 1h ), 2 . 09 - 1 . 99 ( m , 2h ), 1 . 92 - 1 . 78 ( m , 1h ), 1 . 39 ( qd , j = 12 , 8 hz , 1h ). a solution of 6 ( s )- 2 - oxo - 1 - aza - 4 - oxabicyclo -[ 4 . 3 . 0 ]- nonane ( 6 . 013 g , 0 . 0426 mol ) in thf ( 170 ml , distilled from na / benzophenone ) was cooled to - 78 ° c . under argon and transferred via cannula to a second flask containing 1 . 0 m lithium bis ( trimethylsilyl ) amide in thf ( 52 ml , 0 . 052 mol ) also at - 78 ° c . under argon . after stirring for 0 . 5h at - 78 ° c ., benzyl bromide ( 7 . 20 ml , 0 . 0605 mol ) was added dropwise over 5 min . the reaction was stirred for 1 h at - 78 ° c . followed by 1 h at - 50 ° c . then quenched by adding saturated aq nh 4 cl ( 60 ml ) and warming to ambient temperature . the reaction was diluted with h 2 o ( 60 ml ) and saturated aq nacl ( 180 ml ), and the layers were separated . the aqueous layer was extracted twice with etoac ( 300 , 200 ml ). the organic extracts were washed in succession with saturated aq nacl ( 150 ml ), combined , dried ( na 2 so 4 ), and evaporated in vacuo . the crude product was purified by chromatography ( silica gel , 1 : 4 etoac / ch 2 cl 2 ) to give the title compound as a yellow oil . 1 h nmr ( cdcl 3 , 400 mhz ): δ 7 . 31 - 7 . 19 ( m , 5h ), 4 . 44 ( dd , j = 10 , 4 hz , 0 . 07h ), 4 . 27 ( dd , j = 8 , 4 hz , 0 . 93h ), 4 . 12 ( dd , j = 12 , 4 hz , 0 . 93h ), 3 . 94 ( dd , j = 12 , 5 hz , 0 . 07h ), 3 . 72 - 3 . 62 ( m , 1h ), 3 . 54 - 3 . 18 ( m , 4h ), 3 . 01 ( dd , j = 15 , 8 hz , 0 . 93h ), 3 . 00 ( dd , j = 14 , 8 hz , 0 . 07h ), 2 . 04 - 1 . 91 ( m , 2h ), 1 . 83 - 1 . 69 ( m , 1h ), 1 . 33 ( qd , j = 11 , 8 hz , 1h ). a soln of 3 ( r , s ), 6 ( s )- 2 - oxo - 3 -( phenylmethyl )- 1 - aza - 4 - oxabicyclo -[ 4 . 3 . 0 ]- nonane ( 8 . 818 g , o . o38 mol ) in thf ( 170 ml , distilled from na / benzophenone ) was cooled to - 78 ° c . under argor and transferred via cannula to a second flask containing 1 . 0 m lithium bis ( trimethylsilyl ) amide in tetrahydrofuran ( 57 ml , 0 . 057 mol ) also at - 78 ° c . under argon . after stirring for 10 min at - 78 ° c ., the reaction was placed in an ice bath for 0 . 5 h . the reaction was again cooled to - 78 ° c . for 10 min , quenched by adding hoac ( 3 . 30 ml ), and allowed to warm to ambient temperature . the reaction was diluted with h 2 o ( 50 ml ) and saturated aq nacl ( 100 ml ) and extracted twice with etoac ( 300 , 200 ml ). the organic extracts were combined , washed with saturated aq nacl ( 200 ml ), dried ( na 2 so 4 ), and evaporated in vacuo to give the title compound as a golden orange oil . 1 h nmr ( cdcl 3 , 400 mhz ) δ 7 . 34 - 715 ( m , 5h ), 4 . 43 ( dd , j = 10 , 3 hz , 0 . 33h ), 4 . 27 ( dd , j = 8 , 3 hz , 0 . 67h ), 4 . 11 ( dd , j = 11 , 4 hz , 0 . 67h ), 3 . 94 ( dd , j = 11 , 4 hz , 0 . 33h ), 3 . 74 - 3 . 17 ( m , 5h ), 3 . 07 ( dd , j = 14 , 10 hz , 0 . 33h ), 3 . 01 ( dd , j = 14 , 8 hz , 0 . 67h ), 2 . 06 - 1 . 91 ( m , 2h ), 1 . 89 - 1 . 71 ( m , 1h ), 1 . 39 - 1 . 24 ( m , 1h ). 3 ( r , s ), 6 ( s )- 2 - oxo - 3 -( phenylmethyl )- 1 - aza - 4 - oxabicyclo [ 4 . 3 . 0 ]- nonane ( 8 . 569 g , 0 . 037 mol ) was dissolved in 6n aq hcl ( 400 ml ) and stirred at reflux under argon for 24 h . the reaction was cooled to ambient temperature , evaporated in vacuo , diluted with toluene , evaporated in vacuo , diluted with toluene , and evaporated in vacuo to give the title compound as an orange oil . 1 h nmr ( cd3od , 400 mhz ) δ 7 . 35 - 7 . 10 ( m , 5h ), 4 . 33 - 4 . 26 ( m , 1h ), 3 . 84 - 3 . 53 ( m , 3h ), 3 . 30 - 3 . 09 ( m , 3h ), 3 . 05 - 2 . 96 ( m , 1h ), 2 . 17 - 1 . 88 ( m , 3h ), 1 . 80 - 1 . 65 ( m , 1h ). 2 ( r , s )-[ 2 ( s )-( pyrrolidinyl ) methyloxy ]- 3 - phenylpropionic acid hydrochloride ( 9 . 48 g , 0 . 033 mol ) was dissolved in h 2 o ( 70 ml ) and neutralized with 1 . 0 n aq naoh ( approx . 40 ml ). to this mixture was added a soln of na 2 co 3 ( 7 . 304 g , 0 . 069 mol ) in h 2 o ( 40 ml ). the resulting mixture ( ph = 11 . 5 ) was cooled to 0 ° c . under argon ; di - tert - butyl dicarbonate ( 8 . 2 ml , 0 . 036 mol ) was added , followed by thf . the reaction was stirred at ambient temperature for 18 h , cooled to 0 ° c ., acidified to ph = 3 with 10 % aq citric acid , and extracted with etoac ( 2 × 250 ml ). the organic extracts were washed in succession with saturated aq nacl ( 250 ml ), combined , dried ( na 2 so 4 ), and evaporated in vacuo to give the title compound as an orangish - brown oil . 1 h nmr ( cd 3 od , 400 mhz ) δ 7 . 29 - 7 . 17 ( m , 5h ), 4 . 05 - 3 . 99 ( m , 1h ), 3 . 82 - 3 . 77 ( m , 1h ), 3 . 69 - 3 . 59 ( m , 1h ), 3 . 54 - 3 . 16 ( m , 2h ), 3 . 13 - 2 . 97 ( m , 2h ), 2 . 94 - 2 . 85 ( m , 1h ), 1 . 88 - 1 . 62 ( m , 4h ), 1 . 42 ( s , 9h ). to a soln of 2 ( r , s )-[ n -( tert - butoxycarbonyl )- 2 ( s )-( pyrrolidinyl ) methyloxyl ]- 3 - phenylpropionic acid ( 263 . 6 mg , 0 . 754 mmol ) in dmf ( 8 . 0 ml ) were added 3 - hydroxy - 1 , 2 , 3 - benzotriazin - 4 ( 3h )- one ( hoobt , 137 mg , 0 . 840 mmol ), edc ( 164 mg , 0 . 855 mmol ), l - methionine methyl ester hydrochloride ( 176 mg , 0 . 88 1 mmol ), and et 3 n ( 0 . 35 ml , 2 . 5 mmol ). the reaction was stirred under argon at ambient temperature for 18 h , diluted with etoac ( 70 ml ), and washed with 10 % aq citric acid ( 70 ml ), saturated aq nahco 3 ( 40 , 20 ml ), and saturated aq nacl ( 40 ml ). the organic layer was dried ( na 2 so 4 ) and evaporated in vacuo . the diastereomeric crude products were purified and separated by chromatography ( silica gel , 1 : 19 to 1 : 2 etoac / ch 2 cl 2 ) to give the title compound . 1 h nmr ( cd 3 od , 400 mhz ) δ 7 . 35 - 7 . 17 ( m , 5h ), 4 . 63 - 4 . 55 ( m , 1h ), 4 . 08 - 3 . 90 ( m , 2h ), 3 . 72 ( s , 3h ), 3 . 55 - 3 . 46 ( m , 2h ), 3 . 34 - 3 . 22 ( m , 1h ), 3 . 09 ( dd , j = 14 , 4 hz , 1h ), 2 . 91 ( dd , j = 14 , 7 hz , 1h ), 2 . 38 - 2 . 20 ( m , 2h ), 2 . 10 - 2 . 00 ( m , 1h ), 2 . 04 ( br s , 3h ), 1 . 97 - 1 . 86 ( m , 6h ), 1 . 44 ( s , 9h ). 2 ( s )-[ n -( tert - butoxycarbonyl )- 2 ( s )-( pyrrolidinyl )- methyloxy ]- 3 - phenylpropionyl - methionine methyl ester ( 2 . 138 g , 4 . 322 mmol ) was dissolved in etoac ( 80 ml ). the mixture was cooled to 0 ° c . and hcl gas was bubbled in until saturated . the mixture was stirred at ambient temperature for 1 . 25 h and evaporated in vacuo to give the title compound as a yellow foam which was used without further purification . 1 h nmr ( cd 3 od , 400 mhz ) δ 7 . 35 - 7 . 20 ( m , 5h ), 4 . 67 ( dd , j = 10 , 5 hz , 1h ), 4 . 21 ( dd , j = 8 , 5 hz , 1h ), 3 . 81 - 3 . 75 ( m , 2h ), 3 . 75 ( s , 3h ), 3 . 58 ( q , j = 6 hz , 1h ), 3 . 30 - 3 . 11 ( m , 3h ), 2 . 99 ( dd , j = 14 , 8 hz , 1h ), 2 . 53 - 2 . 36 ( m , 2h ), 2 . 19 - 2 . 10 ( m , 1h ), 2 . 08 ( s , 3h ), 2 . 07 - 1 . 88 ( m , 4h ), 1 . 79 - 1 . 68 ( m , 1h ). step i preparation of 2 ( s )-[[ n -[ 2 ( r , s )-( tert - butoxycarbonyl )- amino - 3 - triphenyhnethylmercapto ] propyl ]- 2 ( s )-( pyrro - lidinyl ) methyloxy ]- 3 - phenylpropionyl - methionine methyl ester -- diastereomers a and b 2 ( s )-[( 2 ( s )-( pyrrolidinyl ) methyloxy ]- 3 - phenylpropionyl - methionine methyl ester hydrochloride ( 69 . 0 mg , 0 . 160 mmol ) was dissolved in meoh ( 1 . 40 ml ). n -( t - butoxycarbonyl )- s - triphenyl methylcysteine aldehyde ( 95 . 6 mg , 0 . 214 mmol ) was added followed by 4a molecular sieves ( 0 . 26 g ), koac ( 17 . 4 mg , 0 . 183 mmol ) and 1 . 0 m sodium cyanoborohydride in thf ( 0 . 21 ml , 0 . 21 mmol ). the mixture was stirred under argon at ambient temperature for 18 h and filtered . the filtrate was diluted with etoac ( 15 ml ), and washed with saturated aq nahco 3 ( 15 ml ) and saturated aq nacl ( 15 ml ). the organic layer was dried ( na 2 so 4 ) and evaporated in vacuo to give crude material which was purified by chromatography ( silica gel , 1 : 4 etoac / ch 2 cl 2 ) to give the high r f diastereomer ( a ) and the low r f diastereomer ( b ) of the title compound . high r f diastereomer ( a ): 1 h nmr ( cd 3 od , 400 mhz ) δ 7 . 41 - 7 . 35 ( m , 6h ), 7 . 30 - 7 . 16 ( m , 14h ), 4 . 59 ( dd , j = 9 , 5 hz , 1h ) 3 . 96 ( dd , j = 8 , 4 hz , 1h ), 3 . 75 - 3 . 54 ( m , 1h ), 3 . 68 ( s , 3h ), 3 . 42 - 3 . 20 ( m , 3h ), 3 . 05 ( dd , j = 13 , 5 hz , 1h ), 2 . 89 ( dd , j = 14 , 7 hz , 1h ), 2 . 88 - 2 . 78 ( m , 1h ), 2 . 68 - 2 . 54 ( m , 2h ), 2 . 40 - 2 . 14 ( m , 5h ), 2 . 10 - 1 . 96 ( m , 1h ), 2 . 03 ( s , 3h ), 1 . 94 - 1 . 82 ( m , 1h ), 1 . 82 - 1 . 70 ( m , 1h ), 1 . 69 - 1 . 54 ( m , 2h ), 1 . 54 - 1 . 42 ( m , 1h ), 1 . 45 ( s , 9h ). low r f diastereomer ( b ): 1 h nmr ( cd 3 od , 400 mhz ) δ 7 . 43 - 7 . 36 ( m , 6h ), 7 . 33 - 7 . 15 ( m , 14h ), 4 . 59 ( dd , j = 9 , 5 hz , 1h ), 3 . 99 ( dd , j = 8 , 4 hz , 1h ), 3 . 74 - 3 . 60 ( m , 2h ), 3 . 65 ( s , 3h ), 3 . 47 ( dd , j = 10 , 5 hz , 1h ), 3 . 14 - 2 . 70 ( m , 7h ), 2 . 65 - 2 . 52 ( m , 2h ), 2 . 42 - 2 . 23 ( m , 3h ), 2 . 23 - 2 . 11 ( m 1h ), 2 . 03 ( s , 3h ), 1 . 98 - 1 . 85 ( m , 1h ), 1 . 82 - 1 . 55 ( m , 3h ), 1 . 45 ( s , 9h ). 2 ( s )-[[ n -[ 2 ( r , s )-( tert - butoxycarbonyl )- amino - 3 - triphenylmethylmercapto ] propyl ] 2 ( s )-( pyrrolidinyl ) methyloxy ]- 3 - phenylpropionyl - methionine methyl ester -- diastereomer a ( 27 . 6 mg , 0 . 0334 mmol ) was dissolved in meoh ( 0 . 8 ml ) under argon . 1 . 0 n aq lioh ( 37 ml , 0 . 037 mmol ) was added and the mixture was stirred at ambient temperature for 18 h . additional 1 . 0 n aq lioh ( 18 ml , 0 . 018 mmol ) was added . after stirring for 3 h at ambient temperature , the reaction was evaporated in vacuo , diluted with meoh ( 1 ml ), neutralized with glacial acetic acid ( 1 drop ), and evaporated in vacuo to give the title compound ( crude ) which was used without further purification or characterization . 2 ( s )-[[ n -[ 2 ( r , s )-( tert - butoxycarbonyl )- amino - 3triphenylmethylmercapto ]- propyl ]- 2 ( s )-( pyrrolidinyl ) methyloxy ]- 3 - phenylpropionyl - methionine -- diastereomer a ( 34 . 7 mg crude , 0 . 0334 mmol ), dissolved in ch 2 cl 2 ( 1 ml ) under argon was treated with tfa ( 0 . 5 ml ) followed by triethylsilane ( 50 ml ). the mixture was stirred at ambient temperature for5 h . the mixture was evaporated in vacuo and the residue purified by preparative hplc using a novaprep 5000 semi preparative hplc system and a waters preppak cartridge ( 47 × 300 mm , c18 , 15 mm , 100 a ) eluting with 5 - 95 % acetonitrile / water ( 0 . 1 % tfa ) at 100 ml / min to give the title compound . 1 h nmr ( cd 3 od , 400 mhz ) δ 7 . 32 - 7 . 20 ( m , 5h ), 4 . 61 ( dd , j = 10 , 5 hz , 1h ), 4 . 25 ( dd , j = 8 , 5 hz , 1h ), 3 . 83 - 3 . 74 ( m , 1h ), 3 . 71 ( dd , j = 12 , 4 hz , 1h ), 3 . 64 ( dd , j = 12 , 5 hz , 1h ), 3 . 59 - 3 . 45 ( m , 3h ), 3 . 27 - 3 . 12 ( m , 2h ), 3 . 09 - 2 . 85 ( m , 4h ), 2 . 59 - 2 . 39 ( m , 2h ), 2 . 23 - 1 . 90 ( m , 5h ), 2 . 09 ( s , 3h ), 1 . 87 - 1 . 75 ( m , 1h ). fab hrms exact mass calc &# 39 ; d for c 22 h 36 n 3 o 4 s 2 : 470 . 214726 ( mh + ); found 470 . 213392 . anal . calc &# 39 ; d for c 22 h 35 n 3 o 4 s 2 . 2 . 40 cf 3 co 2 h . 0 . 45 h 2 o : the title compound was prepared according to the methods of example 3 , steps j and k , using the low r f diastereomer ( b ) instead of the high r f diastereomer ( a ) obtained from step i . 1 h nmr ( cd 3 od , 400 mhz ) δ 7 . 34 - 7 . 21 ( m , 5h ), 4 . 60 ( dd , j = 10 , 5 hz , 1h ), 4 . 22 ( dd , j = 10 , 5 hz , 1h ), 3 . 78 - 3 . 66 ( m , 2h ), 3 . 64 - 3 . 56 ( m , 2h ), 3 . 50 - 3 . 38 ( m , 2h ), 3 . 14 ( dd , j = 14 , 5 hz , 1h ), 3 . 09 - 2 . 80 ( m , 2h ), 2 . 87 ( br d , j = 6 hz , 2h ), 2 . 58 - 2 . 39 ( m , 2h ), 2 . 22 - 1 . 80 ( m , 7h ), 2 . 09 ( s , 3h ). fab hrms exact mass calc &# 39 ; d for c 22 h 36 n 3 o 4 s 2 : 470 . 214726 ( mh + ); found 470 . 214101 . partially purified bovine fptase and ras peptides ( ras - cvls , ras - cvim and ras - cail ) were prepared as described by schaber et al ., j . biol . chem . 265 : 14701 - 14704 ( 1990 ), pompliano , et al ., biochemistry 31 : 3800 ( 1992 ) and gibbs et al ., pnas u . s . a . 86 : 6630 - 6634 ( 1989 ). bovine fptase was assayed in a volume of 100 μl containing 100 mm n -( 2hydroxy ethyl ) piperazine - n &# 39 ;-( 2 - ethane sulfonic acid ) ( hepes ), ph 7 . 4 , 5 mm mgcl 2 , 5 mm dithiothreitol ( dtt ), 100 mm [ 3 h ]- farnesyl diphosphate ([ 3 h ]- fpp ; 740 cbq / mmol , new england nuclear ), 650 nm ras - cvls and 10 μg / ml fptase at 31 ° c . for 60 min . reactions were initiated with fptase and stopped with 1 ml of 1 . 0 m hcl in ethanol . precipitates were collected onto filter - mats using a tomtec mach ii cell harvestor , washed with 100 % ethanol , dried and counted in an lkb β - plate counter . the assay was linear with respect to both substrates , fptase levels and time ; less than 10 % of the [ 3 h ]- fpp was utilized during the reaction period . purified compounds were dissolved in 100 % dimethyl sulfoxide ( dmso ) and were diluted 20 - fold into the assay . percentage inhibition is measured by the amount of incorporation of radioactivity in the presence of the test compound when compared to the amount of incorporation in the absence of the test compound . human fptase was prepared as described by omer et al ., biochemistry 32 : 5167 - 5176 ( 1993 ). human fptase activity was assayed as described above with the exception that 0 . 1 % ( w / v ) polyethylene glycol 20 , 000 , 10 μm zncl 2 and 100 nm ras - cvim were added to the reaction mixture . reactions were performed for 30 min ., stopped with 100 μl of 30 % ( v / v ) trichloroacetic acid ( tca ) in ethanol and processed as described above for the bovine enzyme . the compounds of the instant invention were tested for inhibitory activity against human fptase by the assay described above and were found to have ic 50 of & lt ; 10 μm . the cell line used in this assay is a v - ras line derived from either rat1 or nih3t3 cells , which expressed viral ha - ras p21 . the assay is performed essentially as described in declue , j . e . et al ., cancer research 51 : 712 - 717 , ( 1991 ). cells in 10 cm dishes at 50 - 75 % confluency are treated with the test compound ( final concentration of solvent , methanol or dimethyl sulfoxide , is 0 . 1 %). after 4 hours at 37 ° c ., the cells are labelled in 3 ml methionine - free dmem supple - meted with 10 % regular dmem , 2 % fetal bovine serum and 400 mci [ 35 s ] methionine ( 1000 ci / mmol ). after an additional 20 hours , the cells are lysed in 1 ml lysis buffer ( 1 % np40 / 20 mm hepes , ph ; 7 . 5 / 5 mm mgcl 2 / 1 mm dtt / 10 mg / ml aprotinen / 2 mg / ml leupeptin / 2 mg / ml antipain / 0 . 5 mm pmsf ) and the lysates cleared by centrifugation at 100 , 000 × g for 45 min . aliquots of lysates containing equal numbers of acid - precipitable counts are bought to 1 ml with ip buffer ( lysis buffer lacking dtt ) and immunoprecipitated with the ras - specific monoclonal antibody y13 - 259 ( furth , m . e . et al ., j . virol . 43 : 294 - 304 , ( 1982 )). following a 2 hour antibody incubation at 4 ° c ., 200 ml of a 25 % suspension of protein a - sepharose coated with rabbit anti rat igg is added for 45 min . the immunoprecipitates are washed four times with ip buffer ( 20 nm hepes , ph 7 . 5 / 1 mm edta / 1 % triton x - 100 . 0 . 5 % deoxycholate / 0 . 1 %/ sds / 0 . 1 m nacl ) boiled in sds - page sample buffer and loaded on 13 % acrylamide gels . when the dye front reached the bottom , the gel is fixed , soaked in enlightening , dried and autoradiographed . the intensities of the bands corresponding to famesylated and nonfarnesylated ras proteins am compared to determine the percent inhibition of farnesyl transfer to protein . to determine the biological consequences of fptase inhibition , the effect of the compounds of the instant invention on the anchorage - independent growth of rat 1 cells transformed with either a v - ras , v - raf , or v - mos oncogene is tested . cells transformed by v - raf and v - mos maybe included in the analysis to evaluate the specificity of instant compounds for ras - induced cell transformation . rat 1 cells transformed with either v - ras , v - raf , or v - mos are seeded at a density of 1 × 10 4 cells per plate ( 35 mm in diameter ) in a 0 . 3 % top agarose layer in medium a ( dulbecco &# 39 ; s modified eagle &# 39 ; s medium supplemented with 10 % fetal bovine serum ) over a bottom agarose layer ( 0 . 6 %). both layers contain 0 . 1 % methanol or an appropriate concentration of the instant compound ( dissolved in methanol at 1000 times the final concentration used in the assay ). the cells are fed twice weekly with 0 . 5 ml of medium a containing 0 . 1 % methanol or the concentration of the instant compound . photomicrographs are taken 16 days after the cultures are seeded and comparisons are made .	2
the process of the present invention for facilely producing ( 2r - trans )- n -( 2 -( 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2 &# 39 ;- oxospiro [ 2h - aro [ 2 , 3 - a ] quinolizine - 2 , 4 &# 39 ;- imidozalidin ]- 3 &# 39 ;- yl ) ethyl ) methanesulfonamide ( i ) comprises the following sequence of reactions : 1 ) intimately contacting ( 2r - trans )-[ 2 -[( 2 - cyano - 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - aro [ 2 , 3 - a ] quinolizine - 2 - yl )- amino ] ethyl ] methanesulfonamide bis - hydrochloride ( compound b • 2hcl ) with carbonyldiimidazole in the presence of 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene to obtain a novel intermediate , ( trans )- 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2 - 3 -( methylsulfonyl )- 2 - oxo - 1 - imidazolidinyl ]- 2h - benzofuro [ 2 , 3 - a ] quinolizine - 2 - carbonitrile ( compound d ); 2 ) intimately contacting ( trans )- 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2 -[ 3 -( methanesulfonyl )- 2 - oxo - 1 - imidazolidinyl ]- 2h - aro [ 2 , 3 - a ] quino - lizine - 2 - carbontrile with hydrogen in the presence of raney nickel catalyst and sodium methoxide to obtain ( 2r - trans )- n -[ 2 -( 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2 &# 39 ;- oxospiro [ 2h - aro [ 2 , 3 - a ]- quinolizine - 2 , 4 &# 39 ;- imidazolidin )- 3 &# 39 ;- yl ) ethylmethanesulfonamide and then contacting said methanesulfonamide with methanol and acetyl chloride to obtain the monohydrochloride thereof ( compound i • hcl ). the foregoing steps may be illustrated in the following flow diagram : ## str9 ## ( 2r - trans )-[ 2 -[( 2 - cyano - 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2h - aro -[ 2 , 3 - a ] quinolizine - 2 - yl )- amino ] ethyl ] methanesulfonamide bis - hydrochloride , compound b . 2hcl , which is the starting material for the sequence of reactions which constitute the present invention may be obtained by bringing alcoholic hydrogen chloride into intimate contact with compound b ( free base ) prepared as subsequently outlined and more fully described in the aforementioned copending application u . s . ser . no . 76 , 495 and south african patent 87 / 6400 , the teachings of which are incorporated by reference . the crystalline hydrochloride salt which forms may be recovered by filtration , washed and dried in a conventional way . in the process of the present invention , the first step of reacting compound b as the bis - hydrochloride with carbonyldiimidazole is carried out by adding compound b . 2hcl to a reaction medium containing carbonyldiimidazole and a hydrogen chloride acceptor in solution in an inert solvent at a temperature in the range of about 15 ° to 50 ° c ., preferably ambient temperature , for up to several hours until the reaction is substantially complete . the completion of the reaction may be determined by liquid chromatography . the carbonyldiimidazole is employed in substantial molar excess . generally , from about three - to five - fold molar excess is satisfactory . a strong base is desired as the hydrogen chloride acceptor . many of the conventional tertiary amines are not completely satisfactory . suitable hydrogen chloride acceptors include 1 , 8 - diazabicyclo -[ 5 . 4 . 0 ] undec - 7 - ene ; 1 , 5 - diazabicyclo [ 4 . 3 . 0 ] non - 5 - ene ; and [ 1 , 8 - bis ( dimethylamino )- naphthalene , n , n , n &# 39 ;, n &# 39 ;- tetramethyl - 1 , 8 - naphthalene ] (&# 34 ; proton sponge &# 34 ;); and other strong bases . imidazole also may be employed but tends to produce lower yields . the reaction is carried out in a solvent . suitable solvents include tetrahydrofuran , dioxane , dimethylformamide , dimethyl sulfoxide , acetonitrile and the like . chlorinated solvents are generally not satisfactory because of the relatively low solubility of the reactant in the chlorinated solvents . after completion of the reaction , the reaction mixture is concentrated under reduced pressure and to the concentrated solution are added a water - immiscible organic solvent and deionized water and the components of the reaction mixture partitioned . the organic product layer is then washed , preferably with brine and then concentrated under reduced pressure to form crystals of compound d in the concentrated mixture . the resulting slurry is flushed into a non polar solvent , cooled and aged to obtain the desired intermediate compound d , a novel compound , as a crystalline solid . the second step of the process of the present invention is carried out by charging a high pressure hydrogenation vessel with raney nickel catalyst , methanol solvent , sodium methoxide and compound d , introducing hydrogen and then maintaining the temperature and pressure at 50 ° c .± 1 ° c . and 40 psig until the reaction is substantially complete . after completion of the hydrogenation , the vessel is cooled to ambient temperature , the catalyst removed and washed , and the filtrates combined and concentrated . methylene chloride and saturated sodium bicarbonate solution are added . after a short ( few minutes ) aging period , the organic and aqueous layers are separated , and the organic layer concentrated to obtain compound i as a slurry . the slurry is washed with methanol , and concentrated . to a separate vessel charged with methanol and acetyl chloride and maintained below about 20 ° c . for in situ generation of hydrogen chloride , is added the methanolie slurry of compound i . the slurry is then aged first at 20 °- 25 ° c . and thereafter at about 0 ° c . to complete the formation of the hydrochloride of compound i . the slurry is then filtered washed and dried to obtain compound i &# 39 ;. hcl product . a compound particularly useful in the treatment of diabetes , ( 2r - trans )- n -[ 2 -( 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2 &# 39 ;- oxospiro [ 2h - benzofuro [ 2 , 3 - a ]- quinolizine - 2 , 4 &# 39 ;- imidazolidin ]- 3 &# 39 ;- yl ) ethyl ] methanesulfonamide , may be produced facilely by this method which as applied to this compound comprises the steps of : ( 1 ) intimately contacting ( 2r , trans )- n -[ 2 -[( 2 - cyano -( 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2h - benzofuro [ 2 , 3 - a ] quinolizin - 2 - yl ) amino ] ethyl ] methanesulfonamide - bis - hydrochloride with carbonyldiimidazole in the presence of 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene to obtain ( trans )- 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2 -[ 3 -( methylsulfonyl )- 2 - oxo - 1 - imidazolidinyl ]- 2h - benzofuro [ 2 , 3 - a ]- quinolizine - 2 - carbonitrile ; and ( 2 ) intimately contacting said ( trans )- 1 , 3 , 4 , 5 , 7 , 12b - hexahydro - 2 -[ 3 -( methylsulfonyl )- 2 - oxo - 1 - imidazolidinyl ] 2h - benzofuro [ 2 , 3 - a ] quinolizine - 2 - carbonitrile with hydrogen in the presence of raney nickel catalyst to obtain ( 2r - trans )- n -[ 2 -( 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2 &# 39 ;- oxospiro [ 2h - benzofuro -[ 2 , 3a ]- quinolizine - 2 , 4 &# 39 ;- imidazolidin ]- 3 &# 39 ;- yl ) ethyl ]- methanesulfonamide and thereafter intimately contacting the methanesulfonamide with a mixture acetyl chloride and methanol to obtain the monohydrochloride salt thereof . the following example illustrates the invention but is not to be construed as limiting . 7 . 5 kg of carbonyldiimidazole was charged to 95 kg of dried tetrahydrofuran and the mixture aged at 25 ± 2 ° c . for 10 minutes . 3 . 6 kg of 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene was pumped thereinto followed by a pump and line rinse with 3 - 5 liters of tetrahydrofuran . 5 . 3 kg of ( 2r - trans )-[ 2 -[( 2 - cyano - 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2h - benzofuro [ 2 , 3a ] quinolizine - 2 - yl )- amino ] ethyl ] methanesulfonamide bis - hydrochloride , ( compound b &# 39 ;• bis hcl ) was added as a solid and the mixture aged at about 25 ° c . for two hours to produce compound d &# 39 ; in the reaction mixture . when the reaction is substantially complete as determined by liquid chromatography , the reaction mixture was vacuum concentrated at 35 ° c ./ 50 mm hg to a volume of 10 gallons . to the concentrate was added 240 kg of ethyl acetate and 28 gallons of deionized water and the concentrate partitioned to recover the intermediate compound d &# 39 ; in the organic layer . the organic solution was washed twice with saturated sodium chloride solution and vacuum concentrated at 30 ° c ./ 50 mm hg to 10 gallons . the concentrate was flushed with 300 kg of ethyl acetate to kf = 80 mcg / ml ( karl fischer assay ) and then vacuum concentrated at 30 ° c ./ 50 mm hg to 15 gallons . crystallization of the intermediate ( compound d ) occurred during the flush . the slurry was flushed into 210 kg hexane , vacuum concentrated at 30 ° c ./ 50 mm hg to a final volume of 25 gallons , and then cooled to about 0 ° c ., aged for one hour and then filtered . the filter cake was washed with 14 kg hexane and vacuum dried at 25 ° c . to a loss on drying of less than 0 . 1 percent . the yield of compound d &# 39 ; was 4 . 8 kg or 91 percent of theoretical . 1 h nmr ( cdcl 3 , 300 mhz ) δ 7 . 35 - 7 . 50 ( m , 2h ), 7 . 15 - 7 . 32 ( m , 2h ), 3 . 80 - 3 . 95 ( m , 2h ), 3 . 69 ( dd , j = 11 . 9 , 2 . 1 hz ), 3 . 55 - 3 . 65 ( m , 2h ), 3 . 34 ( s , 3h ), 2 . 55 - 3 . 23 ( m , 8h ) 2 . 14 ( dt , 1h , j = 4 . 5 , 12 . 8 hz ), 1 , 91 ( t , 1h , j = 12 . 8 ). 13 c nmr ( cdcl 3 ) δ 154 . 5 , 154 . 1 , 150 . 6 , 127 . 6 , 123 . 7 , 122 . 6 , 118 . 8 , 117 . 5 , 111 . 7 , 111 . 1 , 55 . 9 , 55 . 1 , 51 . 3 , 50 . 7 , 40 . 8 , 40 . 5 , 40 . 3 , 35 . 6 , 33 . 4 , 20 . 9 . 10 kg of raney nickel catalyst previously dehydrated via methanol decantation was charged to a hydrogenation bomb . thereafter 190 kg methanol was charged via residual vacuum , followed by 1 . 3 kg sodium methoxide and 4 . 8 kg compound d &# 39 ;. the bomb was pressure tested at 50 psig with nitrogen then hydrogen was introduced and hydrogenation was carried out at 50 ± 1 ° c ./ 40 psig until the reaction was complete ( about 5 hours ). the bomb was cooled to 25 ° c ., the catalyst filtered , and the filter cake washed with 75 kg of methanol . the combined filtrate was then vacuum concentrated at 60 ° c ./ 50 mm hg to a volume of 12 gallons . 308 kg of methylene chloride and 63 kg of saturated sodium bicarbonate solution were added to the concentrated , the mixture aged for 5 minutes at 20 °- 25 ° c . and the layers separated . the organic product layer was flushed with 120 kg of methylene chloride to kf = 1 mg / ml and then vacuum concentrated at 25 ° c ./ 50 mm hg to a volume of 12 gallons . the concentrate was then flushed with 72 kg of methanol and vacuum concentrated at 30 ° c ./ 50 mm hg to a volume of 12 gallons . the concentrate was recovered , the vessel rinsed with 3 to 5 liters of methanol and the rinse separately saved . a separate vessel was charged with 15 kg methanol and 1 . 0 kg of acetyl chloride while maintaining the temperature at less than 20 ° c . for an in situ generation of hydrogen chloride . to the vessel then was charged the methanolic solution of the hydrogenation product followed by a methanol rinse . the resulting slurry was aged at 20 °- 25 ° c . for one - half hour , then cooled to about 0 ° c . and aged for an additional two hours . at the end of this period the slurry was filtered , the filter cake washed with 9 kg methanol and the cake dried at 25 ° c . to a loss on drying of less than 71 %. the yield of the product was 3 . 2 kg or 71 percent . in an operation carried out in a manner similar to that described in example i , 5 . 5 kg of ( 2r - trans )-[ 2 -[( 2 - cyano -( 1 , 3 , 4 , 6 , 7 , 12b - hexahydro - 2h - benzothieno ( 2 , 3 - a ) quinolizine - 2 - yl )- amino ] ethyl ]- methanesulfonamide bis - hydrochloride is added to mixture of 7 . 5 kg of carbonyldiimidazole in 95 kg of tetrahydrofuran and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene and the resulting mixture allowed to stand at ambient temperature to obtain compound d &# 34 ;. the reaction mixture is concentrated and then partitioned between ethyl acetate and water to recover compound d &# 34 ; in the organic layer . 4 . 5 kg of compound d &# 34 ; is added to a hydrogenation bomb containing 10 kg raney nickel catalyst and 190 kg methanol and hydrogenation carried out at 50 ° c . at 40 psig until the reaction is complete to obtain compound d &# 34 ;. compound d &# 34 ; is separated from the catalyst , the filtrate concentrated and 308 kg methylene chloride and 63 kg of saturated sodium bicarbonate added thereto and thoroughly mixed and they hydrogenation product recovered from methylene chloride solution and concentrated in the manner described in example i . the hydrogenation product is then added to the hcl generation mixture of acetyl chloride and methanol to obtain the desired compound i &# 34 ;. in a manner similar to that described in the preceding examples , the following compounds may be prepared : the starting material ( compound a ) may be prepared by the following sequence of reactions as described in the aforecited south african patent 87 / 6400 and also in u . s . pat . no . 4 , 710 , 504 , dec . 1 , 1987 , the teachings of which are incorporated by reference . ## str13 ## in carrying out the foregoing process , the aminomethyl compound ( a ) is heated with ethyl formate at about 60 ° c . for several hours , the reaction mixture then poured into dilute hydrochloric acid , the resulting mixture extracted with methylene chloride , the extract purified , dried , and the solvent evaporated to obtain the formamido compound ( b ). the latter is added to a strong acid or to a dehydrating agent such as polyphosphoric acid , phosphorus pentoxide , or methane sulfoncic acid at 100 ° c . and the mixture heated for 1 - 2 hours to obtain an ar - condensed dihydropyridine compound ( c ) which may be recovered by conventional procedures . compound ( c ) may than be converted to the quinolizin - 2 - one ( a ) by adding 2 - trimethylsilyloxy - 1 , 3 - butadiene , then zinc chloride , heating the mixture at 60 ° c . for 1 - 2 hours and thereafter recovering by conventional procedures .	2
in the top view of fig1 , the aluminum or lucite tray of the invention is shown at 10 having a triangular cutout at one end 12 for mounting at its apices over the legs of a camera tripod . in one construction of the invention , the following dimension were found quite useful for a tray thickness of ⅛ - ¼ inches : length 101 21 inches width 102 13 inches spacing 103 ¾ inches width 104 1⅛ inches length 105 6½ inches , and with the apice dimensions being selected in accordance with the dimensions of the tripod legs ( which for a professional grade tripod is typically of the order of 1 inch ). the three clamps 20 are screw - type adjustable clamps 14 of a plastic or metal composition openable and closable to tighten around the tripod legs . they may each be of a 1 inch nominal diameter — and a cushion matte 16 sits atop the tray 10 at its end opposite the cutout 12 . such matte may be of closed - cell foam fabrication . fig2 shows the tray 10 mounted on the legs 15 , 17 and 19 of a tripod . clamps 21 and 23 represent two of the three clamps for adjusting the height of the tripod by adjusting the length of its legs . two screw - type adjustable clamps of the invention 14 a and 14 b are mounted on the tripod legs 17 and 19 at the same , fixed lower height position than the third , screw - type adjustable clamp 14 c mounted on the third tripod leg 15 . in such manner , the tray 10 is entirely self - supported , locked under the front tray support clamp 14 c and resting on the rear support clamps 14 a , 14 b in a cantilever configuration . ( see the rear top view of fig3 , and the rear top view of fig4 with a camcorder 50 coupled with the tripod by its mount 52 .) with a laptop 55 placed on the tray cushion as in fig5 , the computer &# 39 ; s weight on the tray further acts to lock the tray in place without any additional fasteners , simply by the cantilever effect produced by the positionings of the clamps 14 a , 14 b and 14 c . adjustment of the clamp 14 c up and down the leg 15 for a fixed positioning of the clamps 14 a and 14 b serves to optimize the cantilever results for the weight to be placed on the tray 10 . as will be appreciated by those skilled in the art , the tray 10 of the invention may be of different sizes to accommodate different dimensions of computers , monitors or other electronic equipment . similarly , the tray may be drilled with other varying size cutouts , to hold such photographic equipment as the lenses to be used , for example . also , the tray may be hinged in the center if desired , to fold into a more compact size for storage when not being used . where the computer , monitor or other electronic equipment is of a greater mass , additional thumb - screw adjustable clamps could be positioned above the tray 10 in fig3 and 4 , slid down the legs 17 and 19 , and tightened to further lock the tray in place . in the configuration of fig6 and 7 , on the other hand , such additional clamps are particularly useful in locking pairs of trays together to provide two working surfaces on a single tripod . the additional two clamps are shown at 75 , with the trays indicated at 10 a and 10 b . the camera mount is shown at 52 , the camcorder at 50 and the laptop at 55 — and with the additional tray 10 b used to support a notepad 80 and pen 82 for information recording . in operation , with the tripod , clamps , tray ( s ), camera and computer set up , everything seen by the camera can be viewed on the computer monitor and stored , for later use as a training tool to optimize the performance of an athlete . the tray or trays continue to rest on the two lower clamps 14 a , 14 b , with the third higher clamp 14 c continuing to secure the tray in place through the cantilevered action . the weight of the equipment on the tray pulls the front end of the tray upwardly where it is locked by the raised clamp 14 c . while there have been described what are considered to be preferred embodiments of the present invention , it will be readily appreciated by those skilled in the art that modifications can be made without departing from the scope of the teachings herein . thus , whereas the tripod tray has been described specifically for use in analyzing and coaching athletic performance motions , the teachings can also be used in the medical field by chiropractors , physical therapists and hospitals , for example , for use in conjunction with a rehabilitation movement program . in essence , then , the tripod tray of the invention will be seen to represent a generic , general purpose type tool that can be used in studying anything having to do with motion activity . for at least such reason , therefore , resort should be had to the claims appended hereto for a true understanding of the scope of the invention .	5
approx . 1 . 5 liters of water for injection purposes are prepared in a suitable glass vessel . 210 g water for injection purposes are prepared in another glass vessel and 91 . 17 g acetic acid are added . the amount of cetrorelix acetate calculated ( 1 . 62 - 1 . 695 g , depending on the content of the batch used ) is dissolved in the prepared 30 % acetic acid with stirring . this solution is transferred to the glass vessel with 1 . 5 liters of water for injection purposes , 82 . 2 g mannitol are added , dissolved and made up to 3039 g with water for injection purposes . the solution is sterilized by filtration through an appropriate membrane filter ( pore size 0 . 2 μm ) under aseptic conditions . 100 ml first runnings should be discarded . the filters should be sterilized with superheated steam before sterile filtration . cetrorelix freeze - dried solution should be protected from recontamination during storage . the solution is immediately filled into colorless injection bottles din 2r , hydrolytic class i under aseptic conditions and provided with sterile freeze - drying stoppers . the nominal filling amount is 2 . 0 ml = 2 . 026 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned , freeze - drying stoppers were autoclaved . the closed injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying program with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers secured with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . cetrorelix lyophilizate 1 mg is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with gray freeze - drying stoppers and yellow flip - off crimped caps . 420 g water for injection purpose are prepared in a suitable vessel and 121 . 56 g acetic acid are added . the amount of the nonapeptide ( about 3 . 783 g , depending on the content of the batch used ) is dissolved in the prepared 20 % acetic acid and with stirring . 82 ., 2 niannitol are added and dissolved . this solution is sterilized by filtration through an appropriate membrane filter ( pore size 0 . 2 μm ) under aseptic conditions . the same membrane filter is used for the water for injection purpose to make up the solution to 3064 g . the filters should be sterilized with superheated steam . the solution should be protected from recontamination during storage . the solution is filled in to sterile colorless injection bottles din 2 r , hydrolytic class i under aseptic conditions and provided with sterile freeze - drying stoppers . the nominal filling amount is 1 . 0 ml = 1 . 022 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned freeze - drying stoppers were autoclaved . the injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying programme with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers are sealed with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . the lyophilisate of the nonapeptide ( 1 mg ) is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with grey freeze - drying stoppers and flip - off crimped caps . 143 . 5 g water for injection purpose are prepared in a suitable vessel and 61 . 5 g acetic acid are added . the amount of the protirelin acetate calculated ( equivalent to 800 mg of the peptide base ) is dissolved with stirring . this solution is transferred to another vessel with approximately 1 l water for injection purpose . 109 . 6 g mannitol are added , dissolved and made up to 2048 g with water for injection purposes . the solution is filled in to sterile colorless injection bottles din 2 r , hydrolytic class i under aseptic conditions and provided with sterile freeze - drying stoppers . the nominal filling amount is 1 . 0 ml = 1 . 024 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned freeze - drying stoppers were autoclaved . the injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying programme with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers are sealed with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . the protireline lyophilizate ( 0 . 4 mg ) is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with grey freeze - drying stoppers and flip - off crimped caps . 245 g water for injection purpose are prepared in a suitable vessel and 61 . 5 g acetic acid are added . the amount of somatostatine acetate calculated ( 0 . 52 - 0 . 66 g , dependent on the content of the batch used ) is dissolved with stirring . this solution is transferred to another vessel with approximately 1 l water for injection purpose . 109 . 6 g mannitol are added , dissolved and made up to 2049 g with water for injection purposes . the solution is filled in to sterile colorless injection bottles din 2 r , hydrolytic class i under aseptic conditions and provided with sterile freeze - drying stoppers . the nominal filling amount is 1 . 0 ml = 1 . 024 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned freeze - drying stoppers were autoclaved . the injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying programme with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers are sealed with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . the lyophilizate ( 0 . 25 mg somatostatine acetate ) is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with grey freeze - drying stoppers and flip - off crimped caps .	8
the inventors discovered that in a nitride semiconductor substrate of , for example , al x ga y in 1 −( x + y ) n ( 0 ≦ x ≦ 1 , 0 ≦ y ≦ 1 , x + y ≦ 1 ), having a physically flat principal surface , by controlling local variation δθ in off - axis angle θ within that principal surface , predetermined choice properties are obtained for a substrate , as described below . a nitride semiconductor substrate implementation in which the variation δθ in off - axis angle θ is greater than 0 ° and less than 1 °, makes it possible to obtain a substrate having uniform optical and electrical properties equal to those of the situation in which δθ = 0 °, in which case there is absolutely no variation in the off - axis angle θ . in this implementation , the variation δθ in the off - axis angle θ preferably is less than 0 . 5 °. in the case of a nitride semiconductor substrate in which the variation δθ in the off - axis angle θ is more than 0 . 05 °, the direction of splitting due to cleavage of the nitride semiconductor substrate is dispersed , so mechanical properties with good resistance to cracking and breakage when processing and cutting the substrate are obtained . in this case , not less than 0 . 1 ° is preferable . the variation δθ in the off - axis angle θ can , for example , be obtained by measuring the off - axis angle θ in 5 - mm intervals using xrd ( x - ray diffraction ) on the principle surface of a wafer with a two - inch diameter , and taking the variation δθ in the measured off - axis angle θ . a nitride semiconductor substrate in which the variation δθ in the off - axis angle θ is greater than 0 . 05 ° and less than 1 ° can be manufactured by , for example , designing such that during epitaxial growth using a technique such as a sublimation or hvpe ( halide vapor phase epitaxy ), the amount of warping of the substrate due to such causes as heat expansion is within the above off - axis angle distribution range , and afterward processing the upper and lower faces of the substrate to be flat . in a range of not less than 50 % of the principle surface of that substrate ( mainly excluding the peripheral margin ), the dislocation density can be brought to 10 × 10 7 cm − 2 or less , and more preferably can be brought to 10 × 10 5 cm − 2 or less . by performing epitaxial growth on the principal surface of a nitride semiconductor substrate in which the variation δθ in the off - axis angle θ is not less than 1 °, it is possible to efficiently identify the optimum off - axis angle of the nitride semiconductor substrate under exactly the same conditions as the conditions of actual production with a furnace in which an actual device structure is manufactured . that is , a nitride semiconductor substrate in which the variation δθ in the off - axis angle θ is not less than 1 ° can be used as a substrate for finding the optimum off - axis angle θ . described more specifically , a satisfactory epitaxial growth layer is not obtained using the same substrate off - axis angle θ in all production devices ; the optimum off - axis angle θ for the nitride semiconductor in a particular device changes depending on various factors , such as temperature , gas density , and gas flow rate . given this understanding , by using , for example , a nitride semiconductor substrate that has a spherically processed surface ( in which the off - axis angle θ changes continuously ), it is possible to find the optimum off - axis angle θ for the nitride semiconductor substrate . however , when the substrate surface is curved , since the gas flow in the vicinity of the curved substrate surface is not the same as the gas flow in the vicinity of a substrate principle surface that is flat , the found off - axis angle θ substrate may not be appropriate . on the other hand , employing a nitride semiconductor substrate having a flat principle surface in which the variation δθ in the off - axis angle θ is 1 ° or more , enables the optimum off - axis angle θ under the same gas flow conditions as the actual conditions of production to be found , because the off - axis angle θ 1 ° or more by local region of the flat principal surface . a nitride semiconductor substrate in which the variation δθ in the off - axis angle θ is not less than 1 ° can be manufactured by — in hetero - epitaxial growth using for example hvpe — controlling the surface roughness and amount of warping of the base substrate to fixed values . employing a nitride semiconductor substrate according to the present invention as described above , makes it possible to improve the characteristics of : light - emitting elements such as light - emitting diodes and laser diodes ; electronic devices such as rectifiers , bipolar transistors , field - effect transistors , and hemts ; semiconductor sensors such as temperature sensors , pressure sensors , radiation sensors , and visible / ultraviolet light detectors ; and also saw ( surface acoustic wave ) devices . also , with the nitride semiconductor substrate according to the present invention , the dislocation density of the nitride semiconductor substrate can be reduced to not more than 10 × 10 7 cm − 2 in a range of not less than 50 % of the principle surface of the nitride semiconductor substrate ( mainly excluding the peripheral margin ), and under preferable conditions can be reduced to not more than 10 × 10 5 cm − 2 . moreover , a nitride semiconductor substrate according to the present invention can be an exact ( θ = 0 °) substrate having as its principle surface a low - miller - index plane such as a { 0001 } plane , a { 11 2 0 } plane , a { 10 1 2 } plane , a { 10 1 0 } plane , or a { 10 1 } s plane , or the nitride semiconductor substrate according to the present invention can be a misoriented ( θ ≠ 0 °) substrate having a principle surface sliced inclined in a desired direction from these low - miller - index planes . further , in the principle surface of the nitride semiconductor substrate according to the present invention , it is preferable that the surface is processed such that rms ( root - mean - square roughness ) is not more than 500 å within the range of a 10 micron angle ( the range of device production ). only selected embodiments have been chosen to illustrate the present invention . to those skilled in the art , however , it will be apparent from the foregoing disclosure that various changes and modifications can be made herein without departing from the scope of the invention as defined in the appended claims . furthermore , the foregoing description of the embodiments according to the present invention is provided for illustration only , and not for limiting the invention as defined by the appended claims and their equivalents .	2
the present invention will be further explained by the specific embodiments , but are not intended to limit the scope of the present invention . the skilled in the art can make improvements to the process and the used instruments within the scope of the claims , and those improvements should be considered as falling into the scope of the present invention . accordingly , the protective scope of the present invention patent should be defined by the appended claims . x - ray powder diffraction pattern in the present invention was acquired by a panalytical empyrean x - ray powder diffractometer . the parameters of the x - ray powder diffraction method of the present invention were as follows : the pattern of differential scanning calorimetry ( dsc ) in the present invention was acquired by a ta q2000 . the parameters of the differential scanning calorimetry ( dsc ) method of the present invention were as follow : the pattern of thermal gravimetric analysis ( tga ) in the present invention was acquired by a ta q5000 . the parameters of the thermal gravimetric analysis ( tga ) method of the present invention were as follow : dynamic vapor sorption ( dvs ) was measured via a sms ( surface measurement systems ) dvs intrinsic . typical parameters for dvs test are listed below . 10 . 5 mg of compound i freebase was added into ethanol , and 3 . 0 mg of succinic acid was added , then stirred at room temperature for 12 hours until solids precipitate out . hemi - succinate form a was analyzed by xrpd , dsc , tga and 1 h nmr . the xrpd data of the hemi - succinate form a produced in this example is listed in table 1 . the dsc data shows an endothermic peak at 180 ° c . ( onset temperature ). the tga data shows 12 . 5 % weight loss up to 118 ° c . the xrpd pattern is displayed in fig1 , the 1 h nmr spectrum is displayed in fig2 . 1 h nmr data of hemi - succinate form a produced in this example is shown as following : 1 h nmr ( 400 mhz , dmso ) δ 9 . 29 ( s , 1h ), 8 . 76 ( s , 1h ), 8 . 16 ( d , j = 9 . 0 hz , 1h ), 8 . 00 ( d , j = 2 . 9 hz , 1h ), 7 . 44 ( dd , j = 9 . 2 , 3 . 0 hz , 1h ), 6 . 60 ( s , 1h ), 3 . 15 - 2 . 93 ( m , 14h ), 2 . 32 ( s , 2h ), 1 . 98 ( s , 4h ), 1 . 65 ( s , 2h ). 10 . 2 mg of compound i freebase was added into tetrahydrofuran , and 2 . 8 mg of succinic acid was added , then stirred at room temperature for 12 hours until solids precipitate out . the xrpd data of the hemi - succinate form a produced in this example is listed in table 2 . about 10 . 0 mg of hemi - succinate form a was analyzed by dvs . the solid form was tested by xrpd before and after dvs . the result showed that it has a 3 . 5 % weight gain at 80 % rh , which is slightly hygroscopic . the dvs curve was displayed in fig3 , the xrpd overlay pattern is displayed in fig4 . about hygroscopicity characterization description and definition of hygroscopicity ( chinese pharmacopoeia 2010 edition appendix xixj drug hygroscopic test guidelines , test at 25 ° c .+/− 1 ° c ., 80 % relative humidity ) deliquescent : sufficient water is absorbed to form a liquid ; very hygroscopic : increase in mass is equal to or greater than 15 percent ; hygroscopic : increase in mass is less than 15 percent and equal to or greater than 2 percent ; slightly hygroscopic : increase in mass is less than 2 percent and equal to or greater than 0 . 2 percent . no or almost no hygroscopic : increase in mass is less than 0 . 2 % conversion relationship between hemi - succinate form a and mono - succinate non - hydrate form in patent cn103201275a : about 10 mg of the non - hydrate form in patent cn103201275a as starting form was added in different solvents or mixed solvents ( v / v ), then stirred at 5 - 50 ° c . for about 48 hours . finally , the starting form converted to hemi - succinate form a . solvents used in this example is shown in table 3 . 3 . 1 mg of the non - hydrate form ( prepared according to patent cn103201275a ) was added into 0 . 5 ml of ethanol / n - heptane ( v / v = 4 / 1 ), then stirred at room temperature for 48 hours until solids precipitate out . the xrpd data of the mono - succinate form i produced in this example is listed in table 5 . about 10 mg of mono - succinate form i of the present invention and non - hydrate form in patent cn103201275a were analyzed by dvs . the solid was tested by xrpd before and after hygroscopicity test . the dvs curve was displayed in fig9 , the xrpd overlay pattern before and after hygroscopicity test is displayed in fig1 . the result showed that it adsorbed 1 . 7 % water at 25 ° c ./ 90 % rh , and form i of the present invention did not change after hygroscopicity test . it indicated that form i of the present invention was stable at high humidity . according to the data in patent cn103201275a , the non - hydrate form adsorbed 2 . 0 % water at 25 ° c ./ 90 % rh , and 7 . 35 % of the non - hydrate form converted to hydrate form . furthermore , 0 . 52 % of the non - hydrate form in patent cn103201275a converted to hydrate form at 25 ° c ./ 80 % rh . as shown in fig9 and fig1 , form i of the present invention adsorbed 4 . 0 % water at 25 ° c ./ 95 % rh , and form i of the present invention did not change after test . as shown in fig1 , the non - hydrate form adsorbed 18 . 3 % water at 25 ° c ./ 95 % rh , and the solid form changed after test . the results indicated that form i of the present invention was stable at high humidity and the solid form did not change , while the non - hydrate form in patent cn103201275a was not stable as it would easily have crystal transformation at high humidity . stability of form i of the present invention and mono - succinate non - hydrate form in patent cn103201275a in different temperatures : about 10 mg of the non - hydrate form in patent cn103201275a as starting form was added in different solvents or mixed solvents ( v / v ), then stirred at 5 - 50 ° c . for about 48 hours . finally , the starting form converted to form i . solvents and temperature used in this example is in the following in table 6 . 200 mg of compound i freebase powder was added into 10 . 0 ml of acetone / water ( v / v = 19 / 1 ), and 68 mg of adipic acid was added to the solution , then stirred at room temperature , the solid was obtained . the 1 h nmr spectrum is displayed in fig2 . 1 h nmr data of adipate form a produced in this example is shown as following : 1 h nmr ( 400 mhz , dmso ) δ 9 . 31 ( s , 1h ), 8 . 76 ( s , 1h ), 8 . 15 ( d , j = 9 . 1 hz , 1h ), 7 . 99 ( d , j = 2 . 8 hz , 1h ), 7 . 42 ( dd , j = 9 . 1 , 3 . 0 hz , 1h ), 6 . 60 ( s , 1h ), 4 . 78 - 4 . 67 ( m , 1h ), 3 . 06 ( d , j = 4 . 9 hz , 10h ), 2 . 95 - 2 . 82 ( m , 4h ), 2 . 48 - 2 . 38 ( m , 2h ), 2 . 25 - 2 . 09 ( m , 4h ), 1 . 98 ( s , 4h ), 1 . 64 ( d , j = 4 . 9 hz , 2h ), 1 . 54 - 1 . 38 ( m , 4h ). the result shows the solid is adipate form a . the xrpd data of the adipate form a produced in this example are listed in table 7 . the xrpd pattern is displayed in fig1 , the dsc curve is displayed in fig1 , the tga curve is displayed in fig1 . 10 . 3 mg of compound i freebase powder was added into 0 . 4 ml of acetone / water ( v / v = 19 / 1 ), and 3 . 9 mg of adipic acid was added to the solution , then stirred at room temperature , the solid was obtained . the solid is adipate form a after analysis . xrpd data is displayed in table 8 200 . 63 mg of compound i freebase powder was added into 10 . 0 ml of acetone / water ( v / v = 19 / 1 ), and 56 mg of maleic acid was added to the solution , then stirred at room temperature , the solid was obtained , the 1 h nmr spectrum is displayed in fig2 . 1 h nmr data of the maleate form a produced in this example are shown as following : 1 h nmr ( 400 mhz , dmso ) δ 9 . 49 ( s , 1h ), 8 . 77 ( s , 1h ), 8 . 20 ( d , j = 9 . 1 hz , 1h ), 8 . 07 ( d , j = 2 . 8 hz , 1h ), 7 . 52 ( dd , j = 9 . 1 , 2 . 8 hz , 1h ), 6 . 62 ( s , 1h ), 6 . 04 ( s , 2h ), 4 . 80 - 4 . 66 ( m , 1h ), 3 . 34 ( d , j = 5 . 6 hz , 4h ), 3 . 28 ( d , j = 5 . 3 hz , 4h ), 3 . 06 ( s , 6h ), 2 . 48 - 2 . 35 ( m , 2h ), 1 . 98 ( s , 4h ), 1 . 65 ( d , j = 5 . 3 hz , 2h ). the result shows the solid is maleate form a . the xrpd data of the maleate form a is listed in table 9 . the xrpd pattern is displayed in fig1 , the dsc curve is displayed in fig1 , the tga curve is displayed in fig1 . 10 . 3 mg of compound i freebase powder was added into 0 . 4 ml of acetone , and 2 . 8 mg of maleic acid was added to the solution , then stirred at room temperature , the solid was obtained . the solid is maleate form a after analysis . xrpd data is displayed in table 10 . 199 . 0 mg of compound i freebase powder was added into 10 . 0 ml of acetone / water ( v / v = 19 / 1 ), and 34 . 0 mg of glycolic acid was added to the solution , then stirred at room temperature , the solid was obtained . the h 1 nmr spectrum is displayed in fig2 . 1 h nmr data of glycollate form a produced in this example is shown as following : 1 h nmr ( 400 mhz , dmso ) δ 9 . 09 ( d , j = 10 . 7 hz , 1h ), 8 . 53 ( s , 1h ), 7 . 93 ( d , j = 9 . 1 hz , 1h ), 7 . 78 ( d , j = 2 . 9 hz , 1h ), 7 . 21 ( dd , j = 9 . 1 , 2 . 9 hz , 1h ), 6 . 37 ( s , 1h ), 4 . 55 - 4 . 45 ( m , 1h ), 3 . 54 ( s , 2h ), 2 . 95 - 2 . 87 ( m , 4h ), 2 . 83 ( s , 6h ), 2 . 79 - 2 . 74 ( m , 4h ), 2 . 24 - 2 . 17 ( m , 2h ), 1 . 75 ( s , 4h ), 1 . 41 ( d , j = 5 . 0 hz , 2h ). the result shows the solid is glycollate form a . the xrpd data of the glycollate form a is listed in table 11 . the xrpd pattern is displayed in fig1 , the dsc curve is displayed in fig2 , the tga curve is displayed in fig2 , 10 . 3 mg of compound i freebase powder was added into 0 . 4 ml of acetone / water ( v / v = 19 / 1 ), and 4 . 2 mg of glycolic acid was added to the solution , then stirred at room temperature , the solid was obtained . the solid is glycollate form a after analysis . xrpd data is displayed in table 12 . two samples prepared by example 9 , example 11 and example 13 were stored for 30 days under 25 ° c ./ 60 % rh and 40 ° c ./ 75 % rh . the samples before and after storage were tested by xrpd , the results were summarized in table 13 . the results indicate that the crystalline salt forms of compound i did not change after 30 days . in conclusion , the result proves excellent stability of crystalline salt forms of compound i . stability of salts in present invention and mono - succinate in patent cn103201275a at high humidity : about 10 mg of adipate form a , maleate form a , glycollate form a and mono - succinate non - hydrate form in patent cn103201275a were analyzed by dvs . the solid was tested by xrpd before and after hygroscopicity test . the results were displayed in table 14 , the dvs curve of adipate form a was displayed in fig2 , the xrpd overlay pattern is displayed in fig2 . the dvs curve of maleate form a was displayed in fig3 , the xrpd overlay pattern was displayed in fig3 . the dvs curve of glycollate form a was displayed in fig3 , the xrpd overlay pattern was displayed in fig3 . the dvs curve of non - hydrate form in patent cn103201275a was displayed in fig3 , the xrpd overlay pattern was displayed in fig3 ( the pattern below is before dvs , the pattern above is after dvs ). the results indicated that adipate form a , maleate form a and glycollate form a were stable at high humidity and the solid form did not change . while the non - hydrate form in patent cn103201275a was not stable as it changed in high humidity . the examples described above are only for illustrating the technical concepts and features of the present invention , and intended to make those skilled in the art being able to understand the present invention and thereby implement it , and should not be concluded to limit the protective scope of this invention . any equivalent variations or modifications according to the spirit of the present invention should be covered by the protective scope of the present invention .	2
a lens system 10 with a lens assembly 12 and a linear drive system 14 in accordance with embodiments of the present invention are illustrated in fig1 a - 3 . the present invention provides a number of advantages including providing a linear drive system which effectively meets the radical size and cost reductions which are now required in a variety of different markets . referring more to fig1 a - 3 , the lens system 10 includes a module 16 which substantially surrounds the lens assembly 12 and the linear drive system 14 , although the lens system 10 could have other types of housings in other configurations . the module 16 includes a cover 18 with an opening 20 to the lens assembly 12 , although other numbers and types of covers and openings could be used . in this particular embodiment , the dimensions of module 16 are 8 . 5 × 8 . 5 × 4 . 3 millimeters , although the module 16 could have other dimensions and shapes . the module 16 is sized and shaped to provide space to receive the linear drive system 14 with the lens assembly 12 nested inside , although the module could be sized and shaped to accept other systems , device , and components . the lens assembly 12 includes a lens 22 and a casing 24 secured around an outer , side edge of the lens 22 , although the lens assembly 12 could include other types and numbers of components including other types and numbers of lens in other arrangements . in this particular embodiment , the lens assembly 12 has a cylindrical shape with a diameter of 5 . 5 millimeters , although other lens assemblies which other shapes and dimensions could be used . the linear drive system 14 provides a space which is substantially symmetric and conforms to an outer shape of the lens assembly 12 , although the linear drive system 14 could engage the lens assembly in other manners . the linear drive system 14 supports and moves the lens assembly 12 parallel to and in either direction along the optical axis a - a when engaged by the drive control system 36 , although other types and numbers of guide elements with other configurations could be used . the linear drive system 14 includes rails 26 ( 1 )- 26 ( 2 ), piezoelectric plates 28 ( 1 )- 28 ( 2 ), piezoelectric plates 30 ( 1 )- 30 ( 2 ), spring flexure supports 32 ( 1 )- 32 ( 2 ), and lens guide elements 34 ( 1 )- 34 ( 2 ), although the linear drive system 14 can include other types and numbers of components in other configurations . the rails 26 ( 1 )- 26 ( 2 ) have a rectangular shape , are spaced apart , and are substantially parallel to each other , although other types and numbers of rails in other shapes and configurations could be used . in this particular embodiment , the rails 26 ( 1 )- 26 ( 2 ) are made of 303 stainless steel which is a strong , corrosion resistant and electrically conductive material , although other types of metals and polymers , such as polycarbonate by way of example only , could be used for the rails 26 ( 1 )- 26 ( 2 ). piezoelectric plate 28 ( 1 ) is secured to one surface of the rail 26 ( 1 ) and piezoelectric plate 28 ( 2 ) is secured to an opposing surface of the rail 26 ( 1 ), although other numbers and types of plates could be secured to the rail 26 ( 1 ) in other manners . piezoelectric plate 30 ( 1 ) is secured to one surface of the rail 26 ( 2 ) and piezoelectric plate 30 ( 2 ) is secured to an opposing surface of the rail 26 ( 2 ), although other numbers and types of plates could be secured to the rail 26 ( 2 ) in other manners . the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) are each bonded to the rails 26 ( 1 )- 26 ( 2 ), respectively , using high strength adhesive with all the poling directions aligned as shown by the arrows 29 ( 1 )- 29 ( 2 ) in fig2 a and 2c , although other manners for securing the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) and other poling alignments could be used . in this embodiment , the thickness of the securing adhesive is thin enough to insure direct electrical contact with negligible resistance between the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) and the conductive rails 26 ( 1 )- 26 ( 2 ), although other bonding methods that are electrically insulating and other electrical connection methods may also be used . the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) are made of a hard piezoelectric ceramic with low dielectric losses at ultrasonic frequencies above 20 , 000 hz , although piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) made out of other materials and with other types of properties could be used . in this embodiment , the piezoelectric material is a commonly available “ hard ” composition with low dielectric losses and high depoling voltage . thus , by way of example only , one may use a piezoelectric material sold as “ pzt - 4 ” by the morgan matroc company of bedsford , ohio . this material typically has several important properties as described below , although the piezoelectric materials could have other properties . this piezoelectric material has a dielectric loss factor of less than about 1 percent at a frequency greater than about 20 , 000 hertz , although piezoelectric materials with other dielectric loss factors could be used , particularly lower dielectric loss factors are beneficial . for example , in another embodiment the piezoelectric material has a dielectric loss factor of less that about 0 . 5 percent at a frequency greater than about 20 , 000 hertz and in yet another embodiment the piezoelectric material has a dielectric loss factor of about 0 . 4 percent at a frequency greater than about 20 , 000 hertz . additionally , the piezoelectric material has a d33 piezoelectric charge coefficient of at least about 250 picocoulomb / newton &# 39 ; s , although piezoelectric materials with other beneficial d33 piezoelectric charge coefficients could be used . for example , in other embodiments the piezoelectric material can have one of the following d33 piezoelectric charge coefficients of at least : 90 picocoulomb / newton &# 39 ; s ; 105 picocoulomb / newton &# 39 ; s ; 115 picocoulomb / newton &# 39 ; s ; 270 picocoulomb / newton &# 39 ; s ; and 285 picocoulomb / newton &# 39 ; s . further , the piezoelectric material is a single crystal piezoelectric material with a d33 piezoelectric charge coefficient of at least about 2500 picocoulomb / newton &# 39 ; s , and a d31 piezoelectric charge coefficient of at least about 900 picocoulomb / newton &# 39 ; s , although piezoelectric materials with other crystal structures and charge coefficients can be used . in this particular embodiment , each of the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) is about 0 . 2 millimeters thick , although the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) could have other thicknesses and other shapes and dimensions . additionally , in this particular embodiment the exposed outer surface of each of the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) are coated with a conductive metal , although the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) could be coupled to other types and numbers of conductors in other manners and locations . further , in this particular embodiment the ceramic material from which the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) are made in this example is poled to activate the piezoelectric properties , although piezoelectric could be activated in other manners . the spring flexure supports 32 ( 1 )- 32 ( 2 ) are spaced apart form each other , are each secured at opposing ends to rails 26 ( 1 ) and 26 ( 2 ), and are sized to nest within the space for the lens assembly 12 the linear drive system 14 in module 16 , although other types and numbers of force biasing elements could be used . the spring flexure supports 32 ( 1 )- 32 ( 2 ) generate a preload bias force that squeezes the guide elements 34 ( 1 ) and 34 ( 2 ) on opposite sides of the lens assembly 12 and precisely constrain the lens assembly 12 to move in a straight line substantially parallel to the optical axis a - a , although other force biasing systems configured in other manners and with other preloads could be used . the spring flexure supports 32 ( 1 )- 32 ( 2 ) have a low stiffness in the preload direction and high stiffness parallel to the optical axis a - a . by way of example only , in this particular embodiment the spring flexure supports 32 ( 1 )- 32 ( 2 ) generate a preload of about twenty grams on each side of the lens assembly 12 and the coefficient of friction of each of the guide elements 34 ( 1 )- 34 ( 2 ) is 0 . 2 which produces about eight grams of holding friction , although other amounts of preload and other coefficients of friction could be used . in this particular embodiment , the static friction is at least ten times greater than the mass of the lens assembly 12 so the focus position is maintained precisely with zero power . the guide elements or devices 34 ( 1 )- 34 ( 2 ) are used to support and guide the lens assembly 12 parallel to the optical axis a - a , although other types and numbers of guide elements in other configurations could be used . lens guide element 34 ( 1 ) is secured to an inner surface of rail 26 ( 1 ) and lens guide element 34 ( 2 ) is secured to an inner surface of rail 26 ( 2 ), although the guide elements can be secured in other manners and locations . in this particular embodiment , the thickness of the lens assembly 12 is approximately 3 . 0 millimeters and the thickness of the linear drive system 14 is approximately 1 . 2 millimeters , although the lens assembly 12 and linear drive system 14 could have other dimensions . the total stroke is limited by the engagement of the guide elements 34 ( 1 )- 34 ( 2 ). in this particular embodiment , the maximum stroke is 3 . 0 millimeters − 1 . 2 millimeters = 1 . 8 millimeters , although the maximum stroke could be designed to have other dimensions . as illustrated by this example , the present invention provides the lens system 10 with the lens assembly 12 and the linear drive system 14 with a stroke which is much greater than the typical auto focus requirement of 0 . 4 millimeters in a very compact package . drive control system 36 is coupled to piezoelectric plates 28 ( 1 )- 28 ( 2 ) and piezoelectric plates 30 ( 1 )- 30 ( 2 ), although other types and numbers of control system can be coupled to other types and numbers of elements in other manners to drive the linear drive system 14 . in this particular embodiment , connection va from the drive control system 36 is coupled to the electrode on the exposed outer surface of piezoelectric plates 28 ( 1 ) and 30 ( 1 ) and connection vb from the drive control system 36 is coupled to the electrode on the exposed outer surface of piezoelectric plates 28 ( 2 ) and 30 ( 2 ), although the drive control system 36 can be coupled to control the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) in other manners . in this particular embodiment , the drive control system 36 applies a positive electric field by supplying a voltage ranging from about zero volts to thirty - three volts to the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ), although other ranges of voltages and other manners for bending the rails 26 ( 1 )- 26 ( 2 ) can be used . when the drive control system 36 applies this positive voltage bias and corresponding positive electric field ( va - vb & gt ; 0 ) the rails 26 ( 1 )- 26 ( 2 ) bend resulting in tens of nanometers of movement at the center of the rails 26 ( 1 )- 26 ( 2 ), although other manners for bending the rails 26 ( 1 )- 26 ( 2 ) can be used . examples of the operation of the lens system 10 with the lens assembly 12 and the linear drive system 14 in accordance with embodiments of the present invention will now be described with reference to fig1 a - 6 . with the present invention , when a positive electric field ( an electric field in the same direction as the poling voltage ) is applied by drive control system 36 to the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ), the piezoelectric plates 28 ( 1 )- 30 ( 1 ) shrink in length and piezoelectric plates 28 ( 2 )- 30 ( 2 ) grow in length due to the d31 piezoelectric effect . the piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ) on opposite sides of the linear drive system 14 have opposite polarity and strain which causes the rails 26 ( 1 )- 26 ( 2 ) to bend as shown in fig4 b , 4 c , 5 , and 6 . when the rails 26 ( 1 )- 26 ( 2 ) bend the movement is symmetrical with the centers of the rails 26 ( 1 )- 26 ( 2 ) moving in one direction and ends of the rails 26 ( 1 )- 26 ( 2 ) moving in the opposite direction , although the rails 26 ( 1 )- 26 ( 2 ) could be bent in other manners . more specifically , when the drive control system 36 does not supply a voltage to piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ), the lens assembly 12 is held in place by the static friction produced by the preload from the spring flexure supports 32 ( 1 )- 32 ( 2 ) acting on the rails 26 ( 1 )- 26 ( 2 ) with the guide elements 34 ( 1 )- 34 ( 2 ) as shown in fig4 a . as discussed earlier , the static friction is at least ten times greater than the mass of the lens assembly 12 so with the present invention the focus position of the lens assembly 12 can be maintained precisely without expanding any power . this helps to reduce overall power consumption in the lens system 10 . when the drive control system 36 applies a rapidly rising or falling voltage ( va - vb ) to piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ), the application of the positive electric field causes the rails 26 ( 1 )- 26 ( 2 ) to rapidly bend . the rate of acceleration at which the rails 26 ( 1 )- 26 ( 2 ) rapidly bend is sufficient to overcome static friction between the guide elements 34 ( 1 )- 34 ( 2 ) and lens assembly 12 . it is well understood to one of ordinary skill in the art that for most material surfaces the static friction is typically twice the dynamic friction . as a result , guide elements 34 ( 1 )- 34 ( 2 ) on rails 26 ( 1 )- 26 ( 2 ), respectively , slip relative to the lens assembly 12 as shown in fig4 b and also as shown at the designated “ slip ” stages in fig5 and 6 . when the drive control system 36 applies a more slowly rising or falling voltage to piezoelectric plates 28 ( 1 )- 28 ( 2 ) and 30 ( 1 )- 30 ( 2 ), the application of the positive electric field causes the rails 26 ( 1 )- 26 ( 2 ) to bend at a slower rate . this slower rate of acceleration at which the rails 26 ( 1 )- 26 ( 2 ) bend is insufficient to overcome static friction between the guide elements 34 ( 1 )- 34 ( 2 ) on rails 26 ( 1 )- 26 ( 2 ), respectively , and lens assembly 12 . as a result , the guide elements 34 ( 1 )- 34 ( 2 ) stick relative to the lens assembly 12 resulting in movement of the lens assembly 12 as shown in fig4 c and also as shown at the designated “ stick ” stages in fig5 and 6 . accordingly , by combining these “ slip ” and “ stick ” stages in one vibration cycle the net movement of the lens assembly 12 with linear drive system 14 is generated . by way of example only , timing diagrams of alternating asymmetric voltage waveforms along with a series of side views illustrating the corresponding slip and stick movement of the linear drive system 14 with respect to the lens assembly 12 in opposing directions are illustrated in fig5 and 6 . in this example , a saw tooth waveform is show where the slower voltage rise or drop is the “ stick ” portion of the cycle and the fast voltage rise or drop is the “ slip ” portion of the cycle , although other types of waveforms which provide the “ stick ” portion and the “ slip ” portion could be used . as illustrated in fig5 - 6 , the direction of motion of lens assembly 12 is determined by changing the orientation of the saw tooth waveform with drive control system 36 . the symmetric reaction forces and small size enable the linear drive system 14 to operate in the ultrasonic frequency range above 20 , 000 hertz . in this particular embodiment , the range of ultrasonic operating frequencies is between about 20 , 000 hz to about 70 , 000 hz , although other operating frequencies can be used . to achieve an asymmetric vibration cycle with fast ( slip ) and slow ( stick ) portions , resonant vibrations which are fundamentally symmetric and do not generate net movement of lens assembly 12 should be avoided . accordingly , as illustrated and described herein present invention provides a linear drive system which effectively meets the radical size and cost reductions which are now required in a variety of different markets . additionally , the present invention provides a linear drive system with not only reduced size , but also fewer parts which helps to reduce the overall cost of the linear drive system . further , the present invention reduces operating power by eliminating the need for a separate position sensors , limit stops , or limit switches and in a digital camera applications helps to reduce power by holding the lens assembly using zero power . even further , the present invention provides a linear drive system which is acoustically quieter than prior linear drive systems . having thus described the basic concept of the invention , it will be rather apparent to those skilled in the art that the foregoing detailed disclosure is intended to be presented by way of example only , and is not limiting . various alterations , improvements , and modifications will occur and are intended to those skilled in the art , though not expressly stated herein . these alterations , improvements , and modifications are intended to be suggested hereby , and are within the spirit and scope of the invention . additionally , the recited order of processing elements or sequences , or the use of numbers , letters , or other designations therefore , is not intended to limit the claimed processes to any order except as may be specified in the claims . accordingly , the invention is limited only by the following claims and equivalents thereto .	6
although any substrate may be employed where surface enhancement is desirable , a primary substrate for the present invention is typically one employed in building construction and is conventionally referred to in the art as a solid surface material . such substrate may be employed in a horizontal mode such as a countertop or in a vertical mode such as a wall surface covering . a preferred substrate of the present invention functions as a kitchen countertop . the two - step coating modification , which is also referred to herein as a surface modification system , when applied to a substrate improves the surface appearance , including sheen . it also improves the tactile characteristics of the surface , and the stain resistance , cleanability , and the ability to withstand abrasion due to constant use . the modified surface also withstands contact with both highly basic and highly acidic foods as well as some cleaning chemicals . accordingly , the coating or surface modification system of the invention enhances the color , i . e . sheen , depth of image of the substrate and , depending on the substrate , may provide improved stain resistance and abrasion resistance . the formulations of the invention are easy to apply by hand , have low voc emissions in a preferred mode , produce minimal waste , are economical and easily transportable . a fabricator and / or installer of the substrate is able to apply the surface modification system to a substrate either directly or to a primer layer in a fabrication shop or in the field such as a home . the application is useful for new installations as well as refurbishing existing installations . the method of application of the present invention employs two separate formulations . the first step modification formulation is a uv curable formulation which serves to anchor the second step formulation . it has been found that the enhancements of the modification system can be restored by periodically reapplying the second step formulation , with no need to reapply the first step formulation . the present invention is suitable for substrates where surface modification is desirable . in general , substrates will fall into several distinct classes , a material comprised of ( a ) polymer only , ( b ) a material comprised of at least 50 % by weight polymer but also containing a filler , ( c ) a material of at least 80 % by weight mineral and also containing a polymer binder , and ( d ) a mineral material which does not contain polymer . a well - known example of a polymer and filler substrate , is sold as corian ® solid surface by e . i . du pont de nemours . a further example of such a substrate is one in which the polymer functions as a binder in a material which is primarily mineral particles . an example is zodiaq ® quartz surfacing , also sold by e . i . du pont de nemours and company . substrates comprised of all mineral components include natural stone and manmade stone such as granite , quartz , sandstone , soapstone , marble , concrete , terrazzo , and the like . the modification system of the present invention is found particularly useful on dimensioned natural stone used as building products , such as granite countertops . as employed herein , an ethylenically unsaturated resin denotes components of polymer , oligomer and monomer separately or in combination . useful resins include , but are not limited to those monomers , oligomers , and polymers derived from esters of acrylic acid , esters of methacrylic acid , urethane acrylates , urethane methacrylates , epoxy acrylates , epoxy methacrylates , melamine acrylates , melamine methacrylates , acrylate - functionalized unsaturated polyesters , methacrylate - functionalized unsaturated polyesters , vinyl monomers , allylic monomers , urethanes , acrylics , epoxies , unsaturated polyesters , siloxanes , silanes , and combinations thereof . a preferred class includes an acrylic functionalized resin . by “ acrylic functionalized ” is meant a material having at least one reactive acrylic or methacrylic group appended thereto . such resin is a component of the first step formulation applied to the substrate or a primer layer . in a preferred mode the resin will be employed in dilute form as a minor portion of the overall first step formulation to allow hand application . generally , a maximum of not more than 35 % by weight , more preferably not more than 30 % resin by weight , is used . a practical lower limit is 10 % by weight . a solvent for the ultraviolet ethylenically unsaturated resin is chosen so that it is volatile at room temperature and is substantially inert to the substrate or primer layer , if employed . conventional solvents include toluene , xylene , butyl acetate , acetone , methyl isobutyl ketone , methyl ethyl ketone , methanol , isopropanol , butanol , hexane , ethylene glycol , propylene glycol , propylene glycol monoethyl ether , naptha and mineral spirits . a preferred solvent class is known as mineral spirits . mineral spirits are understood to mean any of the various light hydrocarbons that are distillates of petroleum and specified according to astm d235 - 02 “ standard specification for mineral spirits ( petroleum spirits )”. a preferred solvent , odorless mineral spirits ( oms ), is understood to mean any of the above mineral spirits which are further refined to have an aromatic content less than 1 %. specifically , oms cuts that have a boiling point range of 300 - 365 ° f . and a density range of 0 . 75 - 0 . 78 g / cc are most preferred . emulsifiers useful for the present invention may be a broad range of materials well known in the art . their function is to compatibilize and stabilize mixtures of unlike materials such as oil and water . these materials may be anionic , cationic or nonionic in nature . they may be derived from and / or be comprised of fatty acids , natural oils , amines , ammonium salts , silicones , polyethers , oligomers , co - oligomers , polymers , copolymers , natural product extracts and the like . it is found that an emulsifier formed in - situ is most useful . one or more components are included in each of the two or more phases to be combined , and upon combination , the two or more phases react to create an emulsifier to result in a stable emulsion composition . as one of the components is commonly classified as an emulsifier , and its corresponding component is commonly classified as a surfactant , these can be considered emulsifier / surfactant systems . for purposes of this invention , emulsifier is understood to include the emulsifer / surfactant systems that are formed in - situ . an example of such an emulsifier / surfactant system is e - z - mulse ® from florida chemical company , inc of winter haven , fla . exemplary emulsifiers include morpholine oleate soap , oleic acid triethanolamine soap , oleic acid / morpholine mixtures , oleic acid / triethanolamine mixtures , stearic acid / morpholine mixtures , stearic acid / triethanolamine mixtures , sodium oleate , sodium alkyl benzene sulfonate , polyoxyethylene alkylphenol ether , polyoxyethylene alkyl ether , polyoxyethylene fatty acid esters , ethylene oxide adducts of nonyl phenol , sorbitan mono - oleate , and mixtures of these emulsifiers . depending on the formulation of components , the coating composition of the present invention may be oil - in - water emulsions , wherein water is the continuous phase and oil is the disperse phase , or water - in - oil emulsions , wherein oil is the continuous phase and water is the disperse phase . the preferred emulsifier is a combination of stearic acid and morpholine which may be added as a stearic acid morpholinium salt . in situ formation of the emulsifier in this invention entails addition of the morpholine to the water - based fraction and stearic acid to the oil - based fraction . combination of the two fractions in a mixing process creates the stearic acid morpholinium salt which stabilizes the resulting emulsion . additional emulsifiers may be added to further improve the stability of the emulsion versus long term storage under different environmental conditions . preferably , such additional emulsifiers are chosen from the nonionic class of these compounds . photoinitiators are well - known in the art of ultraviolet ( uv -) polymerizable coatings . these initiators have strong absorption in the ultraviolet and near - ultraviolet region of the electromagnetic spectrum . choice of uv initiator , or combinations thereof , can be made to optimize absorption versus the peak wavelength offered by the uv irradiation source . the photoinitiators decompose to provide free radicals which initiate free radical polymerization of the coating when they are exposed to uv radiation of the correct intensity and wavelength . a preferred uv photoinitiator is from the class of phosphineoxide photoinitiators . hand application of the uv - curable surface modification results in a thin coating relative to typical spray - applied uv - curable coating . the resulting unfavorable surface - to - volume ratio of the applied surface enhancement makes the uv photocuring much more susceptible to oxygen inhibition versus typical uv - curable coatings . one method to inhibit oxygen in thin coats is to remove oxygen from the system . this can be accomplished by flooding the area with an inert gas such as nitrogen or argon . this is expensive and introduces potential health and safety hazards . alternatively , an oxygen barrier can be applied such as an uv - transparent oil . again , this is impractical in this application . oxygen inhibition in thin coatings has also been addressed in the art by addition of initiator adjuvants such as 2 - isopropylthioxanthone / 4 - isopropylthioxanthone ( esacure ® itx , sartomer company ). in this invention , a phophineoxide initiator with a suitable uv absorption spectrum is used in combination with 2 - isopropylthioxanthone / 4 - isopropylthioxanthone are used to initiate free radical polymerization of the resin . water is a critical component of the first step formulation and acts as the primary carrier agent that aids the formulation to be spread as a thin layer . once the layer is spread , the water evaporates along with the oms solvent to leave a thin layer of polymerizable resin composition . volume of volatile organic constituent ( voc ) is greatly reduced by using water as the primary carrier . use of distilled or deionized water is highly preferred to avoid introduction of metal ion impurities which could interfere with photocuring and / or shelf life of the composition . various additives can be included in the initial formulation such as to impart physical , visual , and / or tactile performance characteristics . solid additives in fine particle size can be added to not only adjust rheology , but to also impart improved hardness and scratch resistance , slip modification , etc . examples include microfine and nano - sized clays , aluminas and silicas , microfine perfluorinated powders , and organic microsphere powders . although not critical , a preferred mode of the present invention includes an optional rheology modifier . the rheology modifier is an additive that adjusts the viscosity of the composition to allow greater ease of handling and application . the rheology modifier can be chosen from a variety of materials known as thickeners , associative thickeners , bridging agents and the like . these can be inorganic or organic in nature and are added at low levels to impart the desired effect . for purposes of illustration the following ranges by weight are suitable : uv curable ethylenically unsaturated resin ( 15 - 30 %, preferably 18 - 25 %), resin solvent ( 10 - 25 %, preferably 15 - 20 %), emulsifier such as stearic acid / morpholine - based with nonionic surfactant stabilizer ( 1 - 5 %, preferably 24 %), initiator system ( 0 . 1 - 3 %, preferably 1 - 2 %), water such as deionized ( 40 - 70 %, preferably 45 - 60 %), and optionally rheology modifier such as bentonite clay ( 0 . 1 - 2 %, preferably 0 . 5 - 1 . 5 %). alternatively , additives to introduce phosphorescent or luminescent pigments to the coating can be used to provide unique aesthetic enhancements . brightening agents , well - known in the art can also be added to adjust the visual appearance . functional additives can be added to introduce antistatic character , anti - microbial / anti - bacterial activity , and uv protection , among others . finally , emulsion and resin stabilizers can be added to extend shelf life of the emulsion under various environmental storage conditions by emulsion stabilization and / or inhibition of polymerization . the above - mentioned formulation is applied to a clean , uniform substrate surface by hand application . by hand application is meant application either by hand - held applicator or by hand - held and controlled machine . once applied , the excess material is removed by hand wiping to leave a thin coating of polymerizable material . at this time water and solvent / carriers have evaporated . the visual appearance of the treated surface will be the appearance after exposure to uv irradiation and subsequent cure . the above - described and applied formulation is cured employing uv radiation . uv irradiation sources are well - known in the art . uv irradiation sources include new uv light emitting diode ( led ) technology which is less dangerous regarding operator exposure compared to standard high energy mercury vapor lamps commonly used in the industry . a second surface modification is undertaken with a second surface enhancement formulation . the second formulation comprises a wax , a solvent for the wax which is substantially inert to the previously cured coating , an amino functional silicone , a silicone which is not amino functional , one or more mineral oils , and water . preferably the wax has a melting point of at least 60 ° c . and more preferably 70 ° c . and most preferably 80 - 95 ° c . if the melting point of the wax is unduly low , the wax may be blended with a higher melting first wax . natural or synthetic waxes are permitted . useful waxes include paraffinic waxes , microcrystalline waxes , mineral waxes , vegetable waxes , animal waxes , hydrocarbon waxes , organometallic waxes such as aluminum stearates , zinc stearates , and polyoxoaluminum monostearate , hydrogenated oil waxes , and chlorinated waxes . a preferred wax is carnauba wax or a blend of carnauba wax with another wax . in most cases , the same solvent employed in formation of the first layer can be used . as previously discussed a preferred class of solvents are mineral spirits . most preferable is the class known as odorless mineral spirits ( oms ) defined above which exhibit a desirable evaporation rate and maintain good solvent activity . also , oms does not dissolve or otherwise disturb the initial uv - curable application discussed above . addition of silicone such as an oil to commercial polishes and waxes is well - known in the art to impart greater ease of application , greater water resistance to the final coating , and to reduce surface friction . typically , one or more molecular weight ranges are employed as mixtures to achieve the desired consistency and performance in the final product . silicone oils are generally considered to be polydimethylsiloxane oils , but can also include added substitution and functionalities . a specific functionality of interest to the present invention is inclusion of a silicone oil with a primary amine functionality . additives of this sort are well - known in the art and are added to take advantage of residual unsaturation in the substrate or substrate coating by undergoing michael addition reaction with units of unsaturation to thus covalently derivatize the surface with the silicone oil . in this case , this functional silicone is designed to react with unreacted ethylenically unsaturated moieties in the uv - cured first application . numerous silicone oil emulsions containing amino groups bound via si — c bonds are known from the literature . crosslinked silicone structures in emulsion are usually prepared by introduction of t or q moieties ( trifunctional or tetrafunctional siloxane units ). a process for preparing silicone microcapsules by means of a reaction of silicones containing acryl and amino groups via a michael addition is described in u . s . pat . no . 4 , 876 , 039 to lo , et al . mineral oil is often added to commercial polishes and to impart greater ease of application , greater water resistance to the final coating , and to reduce surface friction . typically , one or more molecular weight ranges are employed as mixtures to achieve the desired consistency and performance in the final product . the mineral oil can be combined with silicone oils to achieve the desired effect and to lower material costs . water is a critical component of the second step formulation and acts as the primary carrier agent , allowing the formulation to be spread as a thin layer . after application to the substrate , the water evaporates along with the oms solvent to leave the nonvolatile oils and waxes as a thin , uniform coating . volume of voc is greatly reduced versus compositions utilizing organic carriers by using water as the primary carrier . use of distilled or deionized water is preferred . inorganic clays and diatomaceous earth materials can be added not only as rheology modifiers , but as polishing agents to smooth out and / or fill in surface imperfections that may exist in the substrate . they also act as hazing agents to indicate when the composition has dried and is ready for buffing . an example of useful clay additives are kaolin clays which are anhydrous aluminum silicates and bentonite clays . other additives which may be useful in the second step formulation include functional additives which can impart antistatic character , anti - microbial / anti - bacterial activity , uv protection , among others . solid additives in fine particle size can be added to not only adjust rheology , but to also impart improved hardness and scratch resistance , slip modification , etc . examples include microfine and nano - sized clays , aluminas and silicas , microfine perfluorinated powders , and organic microsphere powders . additives to introduce phosphorescent or luminescent pigments to the coating can be used to provide unique aesthetic enhancements . brightening agents , well - known in the art can also be added to adjust the visual appearance . the second step formulation is applied to the substrate which has been pretreated with the uv - curable first step formulation . the second step formulation is applied by hand such as a polish or wax is typically applied . by hand application is meant application using a hand - held applicator or a hand - operated mechanical applicator such as a commercial buffer . the formulation is applied to spread it uniformly over the substrate . the material is allowed to dry , which is indicated by a visual hazing . the surface is then hand - buffed to a final finish . hand - buffing can be accomplished by use of a hand - held buffer cloth or a hand - operated electrical buffer . the resulting surface exhibits a high gloss and a deep aesthetic . after application of the second composition , the overall application can be reexposed to uv irradiation . by application of the second step formulation , an oxygen barrier , as discussed above , is applied over the exposed first application . due to the fact that oxygen inhibition is a significant challenge in achieving consistent cure in the first application , a second irradiation with an oxygen barrier in place can serve to further improve the final cure of the overall application . thus , the second step formulation not only imparts the final aesthetic , it also derivatizes the treated surface and affords enhanced uv - initiated cure of the first composition application . in the cases of an all - mineral or a mineral - filled substrate , a primer treatment may optionally be employed . such primer treatments are well known particularly for metals , minerals and mineral - filled polymers . they typically involve application of functional silanes , phosphoric acid esters , carboxylic acids , and the like to the surface of the substrate prior to applying any further coating . these materials serve as a tie layer between the substrate and the first step formulation . one such material is gamma - aminopropyl triethoxy silane offered as a - 1100 by ge silicones . such materials can be applied to the clean substrate surface as dilute solutions in volatile solvents such as isopropyl alcohol or odorless mineral spirits . application of any optional primer must precede application of the first step formulation . in the following examples , all parts and percentages are by weight unless otherwise indicated . the first step formulation was prepared by first mixing 27 . 35 parts deionized water with 0 . 5 part bentone lt ( elementis specialties ) under high shear . when ready , 0 . 6 part morpholine ( 99 %, aldrich chemical ) was added . this room temperature aqueous solution was set aside . in a separate vessel , 27 . 35 parts deionized water was heated to 200 ° f . when ready , 0 . 5 part bentone lt ( elementis specialties ) was added under high shear . when mixed in , 0 . 6 part morpholine ( 99 %, aldrich chemical ) was added . this hot aqueous solution was maintained at 190 - 200 ° f . until use . in a separate vessel , 16 . 7 parts oms and 1 . 35 parts century 1218 stearic acid ( arizona chemical ) were heated to 170 ° f . with agitation until the stearic acid was dissolved . this organic solution was added to the heated aqueous solution above . in a separate vessel , 8 . 9 parts isobornyl acrylate ( sr506 , sartomer company ), 4 . 8 parts urethane 8210 ( fairad company ), 8 . 6 parts actilane 890 ( akzo nobel ), 0 . 15 parts uv3530 ( byk - chemie ), 1 . 2 parts irgacure 819 ( ciba - geigy ), 0 . 4 part esacure itx ( sartomer company ) and 1 . 0 part ez - mulse ( florida chemical ) were mixed at room temperature . this organic solution was added to the room temperature aqueous solution under high shear mixing . when ready , the warm emulsion solution prepared above was added to the room temperature emulsion solution under high shear mixing . final solution temperature was 110 - 120 ° f . cooling was initiated immediately to minimize time above 100 ° f . the formulation was cooled to room temperature to provide a stable , light yellow emulsion . the second step formulation was prepared by heating 70 . 1 parts deionized water to 190 ° f . when hot , 0 . 3 parts bentone lt ( elementis specialties ) was added under high shear mixing . 1 . 6 parts morpholine ( 99 %, aldrich chemical ) were then added . the following were combined in a wax melter and heated to 190 ° f . : 10 . 44 parts oms , 2 . 5 parts ge sf - 96 ( ge silicones ), 1 part ge viscocil 5m ( general electric ), 1 . 5 parts century 1218 stearic acid ( arizona chemical ), 1 . 5 parts bleached montan wax lge ( srohmeyer & amp ; aarpe ). when ready , the melted organic mixture was added slowly to the above heated aqueous mixture under high shear mixing . when complete , cooling was initiated . when the solution temperature reached 135 ° f ., a room temperature mixture of 1 . 56 parts oms and 1 . 5 parts ge sf - 1706 ( ge silicones ) were added under high shear . when the solution temperature reached 100 ° f ., 8 parts kaopolite sf ( eastech specialties ) were added under high shear . cooling was continued to room temperature to yield a stable , white emulsion . a sample plaque of a dark color alumina trihydrate - filled acrylic solid surface material ( corian ®) was prepared by sanding to a matte finish . the prepared coating composition was applied to this surface using a cotton cloth applicator . once applied , excess coating composition was wiped away using a second clean cloth . wiping was continued until an even appearance was achieved . the coated surface was then irradiated with uv radiation generated by a four - inch standard mercury arc lamp commonly used in the art . the resulting surface exhibited a significantly darker appearance with an apparent deeper translucency . the surface also had a silky tactile feel . the coating was not removed by water , mild detergents , standard nonabrasive cleaning agents including household cleaning solutions such as formula 409 ® and windex ®, bleach , and ammonia . everyday scratch whitening damage was reduced as measured in practical testing . instrumented microscratch ( machine description ) results showed a 2 to 3 - fold increase in the force needed to induce observable scratch whitening by a 1 mm steel ball tool . the second - step modification formulation was applied over the sample substrate which had been previously coated with the first - step formulation . immediately , the color of the composite coating was darkened further , the apparent translucency was increased , and the gloss level increased significantly . in addition , the surface resistance was further reduced , providing a smooth tactile feel . scratch testing demonstrated a further improvement in scratch resistance . the treated surface exhibited increased cleanability and resistance to common household stains . the surface modification system described above was applied to a sample plaque of engineered stone ( zodiaq ®) prefinished with a matte finish using the technique of example 3 . while no significant impact on scratching or staining was observed , significant aesthetic effects were noted . the apparent colors were darker with a deeper visual aesthetic and the tactile character was smooth and silky to the touch . in addition , presence of the coating caused a higher degree of water beading on the finished surface . the surface modification system described above was applied to a sample of polished , commercially available granite . no significant impact on scratch resistance was observed . however , significant improvement was noted in preventing stains , particularly oil - based stains such as cooking oil and lard . visual and tactile effects were also enhanced .	8
as illustrated in fig1 - 3 , a semiconductor wafer 1 comprising a substrate 2 , for example made of monocrystalline silicon , is subjected to initial steps of fabrication as described also in the u . s . published patent application no . us2003168711 , assigned to stmicroelectronics s . r . l . in particular , ( see fig1 ) after a first mask 3 has been formed , the wafer 1 is etched anisotropically , and rectilinear deep trenches 4 are dug . the deep trenches 4 are adjacent and parallel to one another and extend in a direction perpendicular to the plane of the drawing . the first mask 3 is then removed , and an epitaxial layer 5 is grown , which closes the deep trenches 4 forming buried cavities 4 ′, completely surrounded by silicon ( fig2 ). during the epitaxial growth , the silicon is deposited in part also inside the deep trenches 4 , before they are closed , and hence the buried cavities 4 ′ have a substantially elliptical cross section , with the major axis perpendicular to the surface 5 a free from the epitaxial layer 5 . a thermal step of annealing is then carried out , in which the cross section of the buried cavities 4 ′ is modified ( fig3 ). in practice , when the wafer 1 is heated in deoxidizing atmosphere , the surface silicon atoms that surround the buried cavities 4 ′ migrate and tend to assume a minimum - energy configuration , as explained in the article “ a new substrate engineering for the formation of empty space in silicon ( ess ) induced by silicon surface migration ” by t . sato , n . aoki , i . mizushima , and y . tsunashima , iedm 1999 , pp . 517 - 520 . for example , if the wafer 1 is heated at 1150 ° for 5 hours , the buried cavities 4 ′ assume the shape of parallel buried channels 8 , having a substantially circular cross section and separated from one another by silicon diaphragms 10 . the width of the diaphragms 10 is determined both by the initial distance between immediately adjacent deep trenches 3 , and by the duration of the annealing step . at the end of the annealing step , the channels 8 are overlaid by a structural silicon layer 5 ′ having a thickness s that is determined by the duration of the step of epitaxial growth and by the duration of the annealing step . the thickness s is preferably comprised between 1 μm and 50 μm and , still more preferably , between 10 μm and 20 μm . furthermore , the structural layer 5 ′ is partially suspended above the substrate 2 and is constrained to the substrate 2 itself by means of the diaphragms 10 , which function as temporary anchorages . as illustrated in fig4 - 6 , first and second service trenches 11 , 12 are then dug , which have a depth equal at least to the thickness s of the structural layer 5 ′ so as to reach the buried channels 8 , and are preferably slightly deeper . in practice , then , the channels 8 are accessible from the outside through at least some of the service trenches 11 , 12 , when the latter are free . the first service trenches 11 are parallel to the channels 8 , whereas the second service trenches 12 are substantially perpendicular thereto . furthermore , the first and second service trenches 11 , 12 intersect one another forming a grid and laterally delimit portions 13 of the structural layer 5 ′, which are then to be separated by the substrate 2 to form respective semiconductor chips . in this step of the process , the portions 13 are laterally isolated from one another by the trenches 11 , 12 and are connected to the substrate 2 by means of the diaphragms 10 . furthermore , the portions 13 are partially suspended above the substrate 2 . next , the wafer 1 is thermally oxidized for a first controlled time interval , as illustrated in fig7 and 8 . in this step , the service trenches 11 , 12 are filled , and the walls of the channels 8 are coated with an oxide layer 15 . since the oxide layer 15 grows both towards the inside of the channels 8 and within the silicon , the duration of the step of thermal oxidation , i . e ., the first time interval , is controlled in such a way that the diaphragms 10 are completely oxidized , without however occluding the channels 8 . after removing the oxide from the surface of the wafer 1 ( fig9 ), standard manufacturing steps are performed to provide a respective device 16 in each of the portions 13 of the structural layer 5 ′. in fig9 , the devices 16 have been schematically illustrated using electrical symbols of active and passive components . in practice , the devices 16 can be of any type that may be integrated in a semiconductor chip , such as for example micro - electromechanical circuits or structures . the corresponding fabrication steps can be standard steps of fabrication of any type of semiconductor devices and may comprise , for example , masking , implantation , diffusion , etching , deposition and growth of layers , metallizations , etc . after the devices 16 have been completed , the wafer 1 is protected with a second photoresist mask 17 , which leaves exposed only the first and second service trenches 11 , 12 , which are still filled with oxide . the wafer 1 is then etched in a bath or in vapors of hydrofluoric acid hf for a second controlled time interval . during this step , initially the first and second trenches 11 , 12 are freed from the oxide , which is selectively removed , laterally isolating once again the portions 13 of the structural layer 5 ′. then , also the buried channels 8 are made accessible from the outside through at least the second service trenches 12 . consequently , the hydrofluoric acid hf can reach and etch the oxide layer ( designated by 15 ′ in fig1 and 11 is a residual oxide layer , which remains after etching ). the service trenches 11 , 12 hence perform the dual function of delimiting laterally the portions 13 of the structural layer 5 ′ and of providing an access from the outside to the buried channels 8 for etching of the oxide layer 15 ′. the step of etching with hydrofluoric acid hf is interrupted before the residual oxide layer 15 ′ is completely removed and , in particular , before the portions 13 of the structural layer 5 ′ are separated from the substrate 2 . in practice , in this step , the residual oxide layer 15 ′ functions as a temporary anchorage for the portions 13 of the structural layer 5 ′, but it is weakened with respect to the silicon diaphragms 10 . after steps of testing of the devices 16 , the portions 13 of the structural layer 5 ′ are separated from the substrate 2 by a mechanical action ( fig1 ). more precisely , in succession on each portion 13 of the structural layer 5 ′ a force f is applied , which is directed perpendicularly to the surface of the wafer 1 and is has a sufficient intensity to overcome the mechanical resistance of the residual oxide layer 15 ′. the residual oxide layer 15 ′ fails where it is weaker , i . e ., substantially along a median plane of the buried channels 8 parallel to the surface of the wafer 1 . preferably , together with the force f , a torque t is applied , which facilitates failure of the residual oxide layer 15 ′. the mechanical action for separating the portions 13 from the substrate 2 can be obtained conveniently using vacuum pipettes 18 , of the type commonly used for picking up the chips singled out after the operations of traditional cutting ( pick - and - place operation ). chips 20 are thus obtained , each of which contains a respective device 16 , as illustrated in fig1 . the chips 20 have substantially the thickness s determined by the steps of epitaxial growth and of annealing of the silicon . the chips 20 are finally packaged in purposely provided protective structures equipped with contact pins , according to conventional process steps ( not illustrated herein ). advantageously , then , it is possible to obtain chips of extremely contained thickness , even less than 10 μm , without increasing appreciably the risks of microcracks in the wafer during its fabrication . instead , the yield can be increased . in traditional processes , in fact , the portions of the initial wafer which are then to form the chips must be arranged at a distance apart from one another by an amount sufficient to enable passage of the cutting saw without any damage to the integrated devices , in practice at least 60 - 100 μm . according to one embodiment of the invention , instead , the service trenches are sufficient to guarantee lateral separation between the portions which are then to form the chips and can have a width even of just 1 μm . the density is hence much greater , and it is possible to increase the number of chips per wafer . the above - described process overcomes another limitation of traditional processes , which are tied to rectilinear cutting paths and consequently exclusively enable square or , at the most , rectangular chips to be obtained . according to the process described , instead , the shape of the chips is defined by the service trenches , which can extend in any pattern . consequently , also the chips can have any appropriate shape . for example , fig1 and 15 illustrate two alternative embodiments of the process . in the embodiment of fig1 , in a wafer 25 service trenches 26 are dug , which delimit hexagonal chips 27 . fig1 shows , instead , a wafer 30 , in which service trenches 31 have been dug , which delimit c - shaped chips 32 . according to a further embodiment of the invention , illustrated in fig1 - 18 , in which parts that are the same as the ones already illustrated are designated by the same reference numbers , in a wafer 35 some adjacent channels 8 are separated by diaphragms 36 having a width greater than that of the diaphragms 10 . during the step of thermal oxidation ( fig1 ), in which oxide layers 37 are formed , the diaphragms 36 are thinned out , but not completely oxidized , so as to form thin temporary silicon anchorages 38 . in the subsequent etching step with hydrofluoric acid hf , which is performed after the devices 16 have been made , the oxide layer 37 is removed completely , and the portions 13 of the structural layer 5 ′ remain constrained to the substrate 2 through the temporary anchorages 38 ( fig1 ). in the final step of singling of the chips , the temporary anchorages 38 are broken by applying the force f and , possibly , the torque t , as explained previously . in this way , a smaller precision in the control of the duration of the etching with hydrofluoric acid hf is required . it should be noted that the temporary - anchorage silicon structures may have any suitable shape so as to present a controlled mechanical resistance ( for example , they could be pillars ). finally , it is clear that modifications and variations can be made to the process described , without departing from the scope of the present invention as defined in the annexed claims . all of the above u . s . patents , u . s . patent application publications , u . s . patent applications , foreign patents , foreign patent applications and non - patent publications referred to in this specification and / or listed in the application data sheet , are incorporated herein by reference , in their entirety .	7
general experimental approaches : materials 5 - ismn was obtained from sifa ltd . purified human serum butyrylcholinesterase ( ec 3 . 1 . 1 . 8 ), rabbit liver carboxylesterase ( ec 3 . 1 . 1 . 1 ), bnpp ( bis - 4 - nitrophenylphosphate ), iso - ompa ( tetraisopropylpyrophosphoramide ), pooled human liver microsomes , 3 - chloromethylbenzoyl chloride , 4 - chloromethylbenzoyl chloride , silver nitrate , phthalide , dichlorotriphenylphosphorane and hplc grade solvents were obtained from sigma - aldrich . collagen and adp was obtained from chronolog ( havertown , pa ., u . s . a .). allophycocyanin ( apc )- conjugated monoclonal antibody against high - affinity gpiib / iiia ( pac - 1 - apc ) and apc - conjugated monoclonal antibody against human platelet p selectin ( cd62p ) were purchased from bd biosciences ( oxford , uk ). all other solvents and reagents were analytical grade . pooled human intestinal microsomes were obtained from bd gentest in the uk . the compounds of the invention are easily prepared from isosorbide - mono - nitrate aspirinate ( ismna ), itself prepared by esterification of isosorbide - mono - nitrate ( ismn ) with and acetyl salicoyl chloride according to gilmer et al 2001 . the nitrate is selectively removed by treatment with palladium on carbon under an atmosphere of hydrogen generating the key intermediate isosorbide - 2 - aspirinate . the compounds may also be obtained by selective 5 - esterification of isosorbide followed by attachment of the aspirinate group at position - 2 ( the 5 - position in isosorbide despite being endo is more reactive towards acylation than the 2 - exo position because the 5 - oh is activated by an intramolecular h - bond ) in the case of isosorbide - 2 - aspirinate - 5 - salicylate ( isas ) direct acylation with salicylic acid would be complicated by competition between the salicylate - oh and the isosorbide - oh . consequently a benzyl - ether protected salicylic acid is introduced first using standard dcc coupling procedure and the benzyl protection removed under reductive conditions ( fig1 ). other ester compounds of the invention can be prepared by directed acylation using dcc coupling or by treatment with the appropriate acid chloride in the presence of a tertiary base such as triethylamine . nitroxy - substituted esters may be prepared by linking directly to the appropriately substituted acids . alternatively , nitroxy - substituted compounds may be obtained by first esterifying with an acid bearing a chloride or bromide which can be subsequently displaced by nitrate by treatment with agno 3 in acetonitrile . synthesis of isosorbide - 2 - aspirinate - 5 - esters : molecular formulae appear in fig2 . to a solution of isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) in dichloromethane ( 15 ml ) was added triethylamine ( 0 . 11 ml , 0 . 98 mmol ) and 2 - toluoyl chloride ( 0 . 09 ml , 0 . 72 mmol ). the reaction mixture was stirred at room temperature for 24 hours and then was washed with water ( 2 × 25 ml ), hcl ( 1 m , 25 ml ) and saturated aqueous nahco 3 before drying over anhydrous mgso 4 . solvent was removed in vacuo to give 0 . 41 g of crude product as brown oil . purification by column chromatography using hexane and ethyl acetate ( 2 : 1 ) as eluant gave product as yellow oil . this was recrystallised in ethanol to yield compound 1 as a white solid ( 0 . 11 g , 39 . 6 %) m pt . 104 - 106 ° c . ir vmax ( kbr ): 2987 . 1 and 2922 . 8 ( c — h stretching ), 1762 . 0 and 1718 . 1 ( c ═ o ), 1259 . 5 and 1199 . 8 ( c ( o ) or aromatic ), 1072 . 4 ( c — o — c ) cm − 1 . hrms : requires : 449 . 1212 ( m + + 23 ), found : 449 . 1238 ( m + + 23 ), 1 h nmr δ ( cdcl 3 ): 2 . 38 ( 3h , s , ococh3 ), 2 . 65 ( 3h , s , arch 3 ), 4 . 01 ( 1h , dd , j 5 . 52 and 5 . 52 hz , is6 - h [ α ]), 4 . 12 ( 3h , m , is1h [ αβ ] and is6h [ β ]), 4 . 66 ( 1h , d , j 4 . 52 hz , ish - 3 ), 5 . 04 ( 1h , t , j 5 . 04 and 5 . 0 hz , ish - 4 ), 5 . 41 ( 1h , q , j 5 . 52 , 5 . 52 and 5 . 52 hz , ish - 5 ), 5 . 47 ( 1h , d , j 2 . 0 hz , ish - 2 ), 7 . 13 ( 1h , dd , j 1 . 0 and 1 . 0 hz , arh - 4 ), 7 . 33 ( 1h , t , j 7 . 0 and 6 . 52 hz , arh - 2 ), 7 . 59 ( 1h , t , j 6 . 52 and 6 . 52 hz , arh - 3 ), 8 . 02 ( 1h , dd , j 1 . 52 and 2 . 0 hz , arh - 1 ). 13 c nmr ppm ( cdcl 3 ): 20 . 43 ( ar — ch 3 ), 21 . 12 ( ococh 3 ), 70 . 29 ( isc - 1 ), 72 . 72 ( isc - 6 ), 73 . 81 ( oc ( o ) ar ), 78 . 22 ( isc - 4 ), 80 . 52 ( isc - 2 ), 85 . 63 ( isc - 3 ), 122 . 32 ( ar 1 c - 1 ), 123 . 38 ( ar 1 c - 4 ), 125 . 58 ( ar 1 c - 2 and ar 2 c - 4 ), 128 . 46 ( ar 2 c - 2 and ar 2 c - 5 ), 130 . 19 ( ar2c - 3 ), 133 . 78 ( ar 1 c - 3 ), 140 . 08 ( ar 2 c - 1 ), 150 26 ( ar 1 c - 5 ), 163 . 12 ( arocome ), 169 . 15 ( arcoor ) 2 - benzyloxybenzoic acid ( 364 . 8 mg = 1 . 6 mmol ) was dissolved in dry dcm ( 20 mls ) and stirred . is - 2 - asp - 5 - oh ( 500 mg = 1 . 6 mmol ) and 10 % dmap was added . the flask was cooled to 0 ° c . and dcc ( 340 mg , 1 . 6 mmol ) was added . stirring was continued for five minutes and the temperature was allowed to come to room temperature where it was stirred over night . the reaction was filtered and the filtrate was washed with 0 . 1 m hcl , 5 % nahco 3 and water . dried over sodium sulfate and evaporated to an oil . this was purified by column chromatography hexane / ethyl acetate ( 2 : 1 ) to give a white product ( rf = 0 . 4 , 228 mg ). this was dissolved in methanol / ethyl acetate ( 1 : 1 ). pd / c was added and the reaction was stirred under hydrogen over night . reaction was filtered and concentrated . oil was purified by column chromatography using hexane / ethyl acetate ( 1 : 1 ) to yield a white solid ( 107 mg rf = 0 . 67 ).). 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 38 ( 3h , s , ococh 3 ), 4 . 02 ( 4h , m , ish - 1 , ish - 1 ′, ish - 6 and ish - 6 ′), 4 . 63 ( 1h , d , ish - 3 ), 5 . 03 ( 1h , t , ish - 4 ), 5 . 43 ( 2h , dd , ish - 2 , ish - 5 ), 6 . 91 ( 1h , t , ar — h ), 7 . 01 ( 1h , d , ar — h ), 7 . 1 ( 1h , d , ar — h ), 7 . 28 ( 1h , t , ar — h ), 7 . 48 ( 1h , t , ar — h ), 7 . 53 ( 1h , t , ar — h ), 7 . 89 ( 1h , d , arh ), 8 . 00 ( 1h , d , arh ), 10 . 61 ( 1h , s , oh ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 51 ( ococh 3 ), 70 . 46 ( isc - 1 ), 72 . 78 ( isc - 6 ), 74 . 31 ( isc - 5 ), 77 . 91 ( isc - 2 ), 80 . 69 ( isc - 4 ), 85 . 70 ( isc - 3 ), 117 . 30 ( ar 2 c - 1 ), 118 . 90 , 123 . 41 , 125 . 65 , 129 . 47 , 131 . 42 , 133 . 94 , 135 . 65 , 150 . 24 ( ar 1 c - 2 ), 163 . 12 ( arococh 3 ), 168 . 87 ( arc ( o ) or ). isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) was dissolved in toluene ( 15 ml ) at 0 ° c ., to which was added dcc ( 0 . 13 g , 0 . 65 mmol ) and dmap ( 0 . 08 g , 0 . 07 mmol ). after 10 mins the reaction vessel was returned to room temperature and 3 - toluic acid ( 0 . 09 g ) was added and allowed to stir for 24 hours . after washing with hcl ( 30 ml , 1 m ), saturated aqueous nahco 3 ( 30 ml ), saturated brine solution ( 30 ml ) and water ( 3 × 30 ml ) the reaction mixture was dried over anhydrous na 2 so 4 and solvent removed in vacuo to yield crude product as a clear oil . purification by column chromatography using hexane and ethyl acetate ( 3 : 2 ) as eluant yielded compound 3 as white crystals ( 0 . 12 g , 43 . 2 %): m . pt . 96 - 98 ° c . ir vmax ( kbr ): 2987 . 1 and 2922 . 8 ( c — h stretching ), 1762 . 0 and 1718 . 1 ( c ═ o ), 1259 . 5 and 1199 . 8 ( c ( o ) or , aromatic ), 1072 . 4 ( c — o — c ) cm − 1 . hrms : requires : 449 . 1212 ( m + + 23 ), found : 449 . 1234 ( m + + 23 ), 1 h nmr δ ( cdcl 3 ): 2 . 36 ( 3h , s , ococh 3 ), 2 . 43 3h , s , arch 3 ), 4 . 09 ( 4h , m , is1 - h 2 [ α + β ] and is6 - h 2 [ α + β ]), 4 . 65 ( 1h , d , j 5 . 0 hz , ish - 3 ), 5 . 04 ( 1h , t , j 5 . 04 and 5 . 0 hz , ish - 4 ), 5 . 43 ( 2h , m , ish - 5 and ish - 2 ), 7 . 12 ( 1h , d , j 8 . 0 hz , arh - 4 ), 7 . 35 ( 3h , m , arh - 2 ), 7 . 58 ( 1h , q , j 1 . 0 , 6 . 56 and 1 . 48 hz , arh - 3 ), 8 . 01 ( 1h , dd , j 1 . 0 and 1 . 52 hz , arh - 1 ). 13 c nmr ppm ( cdcl 3 ): 20 . 42 ( arch 3 ), 20 . 79 ( ococh 3 ), 70 . 39 ( isc - 1 ), 72 . 77 ( isc - 6 ), 73 . 92 ( isc - 5 ), 78 . 19 ( isc - 4 ), 80 . 66 ( isc - 2 ), 85 . 66 ( isc - 3 ), 122 . 35 ( ar 1 c - 1 ), 123 . 39 ( ar 1 c - 4 ), 125 . 57 ( ar 1 c - 6 ), 126 . 45 ( ar 1 c - 2 ), 12 . 89 ( ar 2 c - 4 ), 129 . 80 ( ar 2 c - 5 ), 131 . 37 ( ar 2 c - 3 ), 133 . 77 ( ar 2 c - 1 ), 150 . 25 ( ar 1 c - 5 ), 163 . 15 ( arococh 3 ), 165 . 58 ( isocoar ), 169 . 12 ( aroco ). to a solution of isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) in dichloromethane ( 20 ml ) was added triethylamine ( 0 . 09 ml , 0 . 65 mmol ) and acetic anhydride ( 0 . 06 ml , 0 . 65 mmol ). the reaction vessel was stirred at room temperature for 24 hours before washing with water ( 2 × 20 ml ), hcl ( 1 m , 30 ml ), saturated aqueous nahco 3 ( 30 ml ) and drying over mgso 4 . solvent was removed by rotary evaporation to yield 0 . 52 g of crude product . purification by column chromatography using hexane and ethyl acetate ( 3 : 2 ) as eluant afforded compound 4 as white crystalline material ( 0 . 1 g , 43 . 8 %). m . pt . 96 - 98 ° c . ir vmax ( kbr ): 2966 . 9 and 2928 . 6 ( c — h stretching ), 1751 . 6 and 1734 . 0 ( c ═ o ), 1607 . 8 ( c ═ c stretching ), 1262 . 0 and 1193 . 9 ( c ( o ) or aromatic ), 1082 . 5 ( c — o — c ) cm − 1 . hrms : requires : 373 . 0899 ( m + + 23 ), found : 373 . 0877 ( m + + 23 ), 1 h nmr δ ( cdcl 3 ): 2 . 13 ( 3h , s , is - ococh 3 ), 2 . 37 ( 3h , s , ar — ococh 3 ), 3 . 85 ( 1h , q , j 5 . 52 , 4 . 52 and 4 . 96 hz , is6α - h ), 3 . 99 ( 1h , q , j 6 . 0 , 3 . 52 and 6 . 04 hz , is6β - h ), 4 . 10 ( 2h , t , j 3 . 52 and 2 . 0 hz , is1h 2 [ α + β ]), 4 . 59 ( 1h , d , j 4 . 52 hz , ish - 3 ), 4 . 90 ( 1h , t , j 5 . 0 and 5 . 04 hz , ish - 4 ), 5 . 19 ( 1h , d , j 5 . 52 hz , ish - 5 ), 5 . 44 ( 1h , d , j 5 . 52 hz , ish - 2 ), 7 . 12 ( 1h , d , j 8 . 04 hz , arh - 4 ), 7 . 33 ( 1h , t , j 7 . 52 and 7 . 56 hz , arh - 2 ), 7 . 59 ( 1h , m , arh - 3 ), 8 . 01 ( 1h , dd , j 6 . 04 hz , arh - 1 ). 13 c nmr ppm ( cdcl 3 ): 20 . 43 ( arococh 3 ), 20 . 18 ( is - ococh 3 ), 69 . 91 ( isc - 2 ), 72 . 78 ( isc - 6 ), 73 . 52 ( isc - 5 ), 78345 ( isc - 3 ), 80 . 32 ( isc - 1 ), 122 . 29 ( arc - 5 ), 123 . 39 ( arc - 1 ), 125 . 58 ( arc - 3 ), 131 . 36 ( arc - 2 ), 133 . 81 ( arc - 4 ), 154 . 32 ( arc - 6 ), 167 . 15 ( ocoar ), 168 . 48 ( arococh 3 ), 171 . 27 ( ococh 3 ). isosorbide - 2 - aspirinate 17 ( 0 . 3 g , 0 . 98 mmol ) was dissolved in dichloromethane ( 20 ml ) to which was added proprionic anhydride ( 0 . 14 ml , 1 . 07 mmol ) and triethylamine ( 0 . 09 ml , 1 . 07 mmol ). this was allowed to stir at room temperature for 24 hours before washing with hcl ( 30 ml , 1 m ), saturated aqueous nahco 3 ( 30 ml ) and water ( 2 × 30 ml ). reaction was dried over anhydrous na 2 so 4 and solvent was removed in vacuo to yield crude product as a yellow oil ( 0 . 19 g ). purification by column chromatography using hexane and ethyl acetate ( 5 : 2 ) as eluant yielded product as white crystals ( 0 . 3 g , 84 . 3 %): m . pt . 54 - 56 ° c . ir vmax ( kbr ): 2989 . 0 and 2933 . 0 ( c — h stretching ), 1764 . 0 and 1734 . 5 ( c ═ o ), 1606 . 3 ( c ═ c stretching ), 1254 . 3 and 1193 . 6 ( c ( o ) or , aromatic ), 1080 . 6 ( c — o — c ) cm − 1 . hrms : requires : 387 . 1056 ( m + + 23 ), found : 387 . 1069 ( m + + 23 ). 1 h nmr δ ( cdcl 3 ): 1 . 19 ( 3h , t , j 8 . 04 and 7 . 52 hz , ch 3 ), 2 . 37 ( 3h , s , ococh 3 ), 2 . 44 ( 2h , q , j 7 . 52 , 8 . 04 and 7 . 52 hz , och 2 ), 3 . 86 ( 1h , q , j 5 . 52 , 4 . 52 and 5 . 04 hz , is6α - h ), 3 . 98 ( 1h , q , j 5 . 52 , 4 . 04 and 6 . 0 hz , is6β - h ), 4 . 08 ( 2h , m , is1h 2 [ α + β ]), 4 . 59 ( 1h , d , j 4 . 52 hz , ish - 3 ), 4 . 91 ( 1h , t , j 5 . 0 and 5 . 04 , ish - 4 ), 5 . 20 ( 1h , q , j 5 . 04 , 6 . 0 and 5 . 52 hz , ish - 5 ), 5 . 43 ( 1h , d , j 3 . 0 hz , ish - 2 ), 7 . 12 ( 1h , dd , j 1 . 0 and 1 . 0 hz , arh - 4 ), 7 . 33 ( 1h , t , j 1 . 0 , 6 . 56 and 8 . 0 hz , arh - 2 ), 7 . 59 ( 1h , t , j 6 . 0 and 6 . 52 hz , arh - 3 ), 8 . 01 ( 1h , dd , j 1 . 48 and 2 . 0 hz , arh - 1 ). 13 c nmr ppm ( cdcl 3 ): 8 . 62 ( ch 2 ch 3 ), 20 . 49 ( coch 3 ), 26 . 84 ( ococh 2 ), 70 . 08 ( isc - 2 ) 72 . 72 ( isc - 6 ), 73 . 32 ( isc - 5 ), 78 . 12 ( isc - 3 ), 80 . 37 ( isc - 1 ), 85 . 45 ( isc - 4 ), 122 . 22 ( arc - 5 ), 123 . 41 ( arc - 1 ), 125 . 64 ( arc - 3 ), 131 . 41 ( arc - 2 ), 133 . 89 ( arc - 4 ), 150 . 24 ( arc - 6 ), 163 . 09 ( ocoar ), 169 . 28 ( ococh 3 ), 173 . 40 ( ococh 2 ). to a solution of isosorbide - 2 - aspirinate 17 ( 1 . 0 g , 3 . 25 mmol ) in dichloromethane ( 20 ml ) was added benzoic acid ( 0 . 59 g , 4 . 88 mmol ), dcc ( 1 . 34 g , 6 . 49 mmol ) and dmap ( 0 . 38 g , 3 . 11 mmol ). the reaction mixture was allowed to stir at room temperature for three hours before filtering off precipitate and washing the filtrate with hcl ( 30 ml , 1 m ), saturated aqueous na 2 hco 3 ( 30 ml ) and water ( 3 × 30 ml ). it was dried over anhydrous na 2 so 4 and solvent was removed in vacuo to give colourless oil , which was recrystallised in ethanol to afford product as white crystals ( 1 . 13 g , 84 . 3 %): m . pt . 80 - 82 ° c . ir vmax ( kbr ): 2991 . 1 and 2932 . 9 ( c — h , stretching ), 1762 . 9 and 1720 . 6 ( c ═ o ), 1275 . 5 and 1199 . 1 ( c ( o ) or aromatic ), 1078 . 4 ( c — o — c ) cm − 1 . hrms : requires : 435 . 1056 ( m + + 23 ), found : 435 . 1043 ( m + + 23 ). 1 h nmr δ ( cdcl 3 ): 2 . 37 ( 3h , s , ococh 3 ), 4 . 07 ( 1h , m , is1α - h ), 4 . 11 ( 3h , m , is6h [ α +] and is1β - h ), 4 . 65 ( 1h , d , j 5 . 0 hz , ish - 5 ), 5 . 05 ( 1h , t , j 5 . 5 and 5 . 0 hz , ish - 3 ), 5 . 56 ( 1h , m , ish - 4 ), 7 . 13 ( 1h , d , j 8 . 04 hz , ar 1 h1 - 5 and ar 1 h - 3 ), 7 . 27 ( 1h , t , j 8 . 04 and 6 . 52 hz , ar 2 h — and ar 2 h - 5 ), 7 . 33 ( 1h , d , j 7 . 56 hz , ar 1 h - 4 ), 7 . 49 ( 2h , t , j 7 . 52 and 7 . 56 hz , ar 2 h - 5 ), 8 . 01 ( 1h , d , j 7 . 56 hz , ar 1 h1 - 2 ), 8 . 12 ( 2h , d , j 7 . 52 hz , ar 2 h - 2 and ar 2 h - 6 ). 13 c nmr ppm ( cdcl 3 ): 20 . 44 ( ococh 3 ), 70 . 42 ( isc - 1 ), 72 . 79 ( isc - 6 ), 73 . 97 ( isc - 5 ) 78 . 16 isc - 2 ), 80 . 67 ( isc - 4 ), 85 . 67 ( isc - 3 ), 123 . 39 ( ar 1 c - 5 ), 125 . 58 ( ar 1 c - 1 ), 128 . 00 ( ar 1 c - 3 ), 129 . 31 ( ar 2 c - 3 and ar 2 c - 5 ), 131 . 39 ( ar 1 c - 2 and ar 2 c - 6 ), 132 . 82 ( ar 2 c - 2 and ar 2 c - 1 ), 133 . 79 ( ar 2 c - 4 ), 134 . 81 ( ar 1 c - 4 ), 154 . 32 ( ar 1 c - 6 ), 167 . 10 ( ococh 3 ), 168 . 2 ( ocoar 1 and ocoar 2 ). isosorbide - 2 - aspirinate 17 ( 0 . 3 g , 0 . 98 mmol ), in dichloromethane ( 20 ml ) at 0 ° c . was stirred for 10 mins in the presence of dcc ( 0 . 2 g , 0 . 98 mmol ) and dmap ( 0 . 12 g , 0 . 98 mmol ). the reaction vessel was returned to room temperature , nicotinic acid ( 0 . 12 g , 0 . 98 mmol ) was added and allowed to stir for 24 hours . the reaction mixture was washed with hcl ( 20 ml , 1 m ), saturated aqueous nahco 3 ( 20 ml ), water ( 3 × 20 ml ), dried over anhydrous na 2 so 4 and solvent removed in vacuo to give product as a crude oil ( 0 . 95 g ). purification by column chromatography over silica gel using dichloromethane and ethyl acetate ( 95 : 5 ) as eluant yielded compound 7 as white crystals ( 0 . 12 g , 29 . 7 %): m . pt . 94 - 96 ° c . ir vmax ( kbr ): 3327 . 6 ( n ═ c ), 2929 . 6 ( c — h stretching ), 1731 . 7 and 1718 . 7 ( c ═ o ), 1654 . 4 ( c ═ c stretching ), 180 . 7 and 1195 . 9 ( c ( o ) or aromatic ), 1090 . 4 ( c — o — c ) cm − 1 . hrms : requires : 436 . 1008 ( m + + 23 ), found : 436 . 1011 ( m + + 23 ). 1 h nmr δ ( cdcl 3 ): 2 . 36 ( 3h , s , ococh 3 ), 4 . 11 ( 9h , m , is1 - h 2 [ α + β ] and is 6 - h 2 [ α + β ]), 6 . 64 ( 1h , d , j 4 . 52 hz , ish - 3 ), 5 . 05 ( 1h , t , j 5 . 04 and 5 . 52 hz , ish - 4 ), 5 . 46 ( 2h , dd , j 2 . 0 and 2 . 52 hz , ish - 5 and ish - 2 ), 7 . 11 ( 1h , d , j 8 . 52 hz , ar 1 h - 2 ), 7 . 32 ( 1h , q , j 6 . 52 , 8 . 04 and 8 . 52 hz , ar 1 h - 3 ), 7 . 43 ( 1h , q , j 6 . 53 , 8 . 04 and 8 . 52 hz , ar 1 h - 5 ), 7 . 59 ( 1h , t , j 6 . 04 and 6 . 52 hz , ar 1 h - 4 ), 8 . 00 ( 1h , dd , j 1 . 52 and 2 . 0 hz , ar 2 h - 5 ), 8 . 34 ( 1h , m , ar 2 h - 6 ), 8 . 82 ( 1h , dd , j 2 . 0 and 1 . 48 hz , ar 2 h - 4 ), 9 . 28 ( 1h , d , j 2 . 0 hz , ar 2 h - 2 ). 13 c nmr ppm ( cdcl 3 ): 20 . 52 ( ococh 3 ), 79 . 32 ( isc - 1 ), 72 . 75 ( isc - 6 ), 74 . 38 ( isoc ( o ) ar ), 74 . 43 ( isc - 5 ), 78 . 27 ( isc - 4 ), 80 . 60 ( isc - 2 ), 85 . 60 ( isc - 3 ), 122 . 26 ( ar 1 c - 1 ), 122 . 88 ( ar 1 c - 4 ), 123 . 38 ( ar 2 c - 4 ), 125 . 57 ( ar 1 c - 6 ), 131 . 35 ( ar 2 c - 6 ), 133 . 83 ( ar 1 c - 2 ), 136 . 68 ( ar 1 c - 3 ), 150 . 55 ( ar 2 c - 5 ), 153 . 30 ( ar 2 c - 1 ), 164 . 13 ( ar 1 c - 5 ), 164 . 13 ( ar 2 c - 3 ), 170 . 59 ( arcoor ). isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) was dissolved in dichloromethane ( 20 ml ) at 0 ° c . to which was added dcc ( 0 . 13 g , 0 . 65 mmol ) and dmap ( 0 . 08 g , 0 . 65 mmol ). after 10 mins the reaction vessel was returned to room temperature and iso - nicotinic acid ( 0 . 08 g , 0 . 65 mmol ) was added and stirred for 24 hours . the reaction was washed with hcl ( 20 ml , 1 m ), saturated aqueous nahco 3 ( 20 ml ), water ( 3 × 20 ml ), dried over anhydrous mgso 4 and solvent removed in vacuo to yield compound 8 as white powder ( 0 . 17 g , 63 . 1 %): m . pt . 86 - 88 ° c . ir vmax ( kbr ): 3327 . 8 ( n ═ c ), 2929 . 3 ( c — h stretching ), 1751 . 8 and 1710 . 7 ( c ═ o ), 1628 . 0 ( c ═ c stretching ), 1249 . 0 and 1194 . 1 ( c ( o ) or aromatic ), 1082 . 8 ( c — o — c ) cm − 1 . hrms : requires : 436 . 1008 ( m + + 23 ), found : 436 . 1004 ( m + + 23 ). 1 h nmr δ ( cdcl 3 ): 2 . 37 ( 3h , s , ococh 3 ), 4 . 09 ( 5h , m , is1 - h 2 [ α + β ] and is6 - h 2 [ α + β ]), 4 . 65 ( 1h , d , j 4 . 52 hz , ish - 3 ), 5 . 05 ( 1h , t , j 5 . 52 and 5 . 04 hz , ish - 4 ), 5 . 46 ( 2h , dd , j 5 . 52 and 5 . 04 hz , ish - 5 and ish - 2 ), 7 . 12 ( 1h , d , j 7 . 04 hz , ar 1 h - 2 ), 7 . 33 ( 1h , m , ar 1 h - 3 ), 7 . 59 ( 2h , t , j 6 . 04 and 6 . 04 hz , ar 1 h - 5 and ar 1 h - 4 ), 7 . 90 ( 1h , d , j 5 . 04 hz , ar 2 h - 6 ), 8 . 01 ( h , dd , j 2 . 0 and 1 . 52 hz , ar 2 h - 2 ), 8 . 84 ( 1h , s , ar 2 h - 5 ), 8 . 98 ( 1h , s , ar 2 h - 3 ). to a solution of isosorbide - 2 - aspirinate 17 ( 0 . 27 g , 0 . 87 mmol ) in dichloromethane ( 20 ml ) was added benzyloxy benzoic acid ( 0 . 20 g , 0 . 87 mmol ), dcc ( 0 . 18 g , 0 . 87 mmol ) and dmap ( 0 . 01 g , 0 . 09 mmol ). the reaction vessel was stirred at room temperature for 24 hours before filtering and washing the filtrate with hcl ( 30 ml , 0 . 1 m ), saturated aqueous nahco 3 ( 30 ml ) and water ( 2 × 30 ml ). after drying over anhydrous na 2 so 4 , the dichloromethane was removed in vacuo to give 0 . 7 g of crude product as colourless oil . purification by column chromatography over silica gel using hexane and ethyl acetate ( 3 : 1 ) as eluant yielded 0 . 19 g of compound 9 as white crystals ( 41 . 5 %): m . pt . 76 - 78 ° c . ir vmax ( kbr ): 1772 . 7 and 1726 . 2 ( c ═ o ), 1276 . 6 ( c ( o ) or aromatic ), 1078 . 1 ( c — o — c ) cm − 1 . hrms : requires : 541 . 1475 ( m + + 23 ), found : 541 . 1460 ( m + + 23 ). 1 h nmr δ ( cdcl 3 ): 2 . 05 ( 2h , s , aroch 2 ar ), 2 . 36 ( 3h , s , ococh 3 ), 3 . 92 ( 1h , q , j 5 . 0 , 5 . 04 and 5 . 0 hz , is6α - h ), 4 . 02 ( 3h , m , is1h [ α + β ]), 4 . 13 ( 1h , q , j 7 . 04 , 7 . 0 and 7 . 56 hz , is6h - β ), 4 . 62 ( 1h , d , j 5 . 0 hz , ish - 3 ), 5 . 02 ( 1h , t , j 5 . 04 and 5 . 0 hz , ish - 4 ), 5 . 19 ( 2h , s , ish - 5 ), 5 . 39 ( 2h , m , ish - 5 ), 7 . 03 ( 2h , m , 2 × ar — h ) 7 . 11 ( 1h , d , j 7 . 56 hz , ar — h ) 7 . 33 ( 2h , m , ar — h ), 7 . 41 ( 2h , t , j 6 . 04 and 7 . 04 hz , ar — h ), 7 . 48 ( 3h , m , ar — h ) 7 . 58 ( 1h , m , ar — h ), 7 . 92 ( 1h , dd , j 1 . 52 and 2 . 0 hz , ar — h ) 8 . 01 ( 1h , dd , j 1 . 48 and 2 . 0 hz , ar — h ). 13 c nmr ppm ( cdcl 3 ): 20 . 49 ( ococh 3 ), 70 . 12 ( isc - 6 ), 70 . 19 ( isc - 2 ), 72 . 59 ( isc - 5 ), 73 . 84 ( isc - 3 ), 78 . 28 ( aroch 2 ), 80 . 48 ( isc - 1 ), 85 . 59 ( isc - 4 ), 113 . 18 ( ar 2 c - 5 ), 119 . 29 ( ar 2 c - 1 ). 120 . 10 ( ar 2 c - 3 ), 122 . 30 ( ar 1 c - 5 ), 123 . 41 ( ar 1 c - 1 ), 125 . 64 ( ar 1 c - 3 ), 126 . 78 ( ar 3 c - 2 and ar 3 c - 6 ), 127 . 51 ( ar 3 c - 4 ), 128 . 08 ( ar 3 c - 3 and ar 3 c - 6 ), 128 . 13 ( ar 1 c - 2 ), 131 . 44 ( ar 2 c - 2 ), 131 . 81 ( ar 1 c - 4 ) 133 . 44 ( ar 2 c - 4 ), 136 . 09 ( ar 3 c - 1 ), 150 . 21 ( ar 1 c - 6 ), 157 . 95 ( ar 2 c - 6 ), 163 . 16 ( aroc ( o ) me ), 165 . 20 ( arc ( o ) or ), 169 . 28 ( arc ( o ) or ). isosorbide - 2 - aspirinate 17 ( 0 . 69 g , 2 . 2 mmol ) was dissolved in dcm ( 20 mls ) to which was added dcc ( 0 . 44 g , 2 . 2 mmol ) and dmap ( 0 . 05 g , 0 . 22 mmol ) and the reaction vessel was stirred at 0 ° c . for 10 minutes . after returning to room temperature , anthranillic acid ( 0 . 29 g , 2 . 2 mmol ) was added allowed to stir for 3 hours . the reaction mixture was washed with hcl ( 20 ml , 1 m ), saturated aqueous nahco 3 ( 20 ml ), saturated brine solution ( 20 ml ) and water ( 2 × 20 ml ), dried over anhydrous na 2 so 4 and solvent removed in vacuo to yield product as crude yellow oil . purification by column chromatography over silica gel using hexane and ethyl acetate ( 4 : 1 ) as eluant yielded compound 10 as a yellow solid ( 0 . 39 g , 41 . 5 %). product was stored at 0 - 4 ° c . until required for testing . m . pt . 150 - 152 ° c . ir vmax ( kbr ): 3443 . 4 ( n — h stretching ), 2920 . 5 ( c — h stretching ), 1742 . 7 ( c ═ o ), 1548 . 0 ( n — h bending ), 1220 . 9 and 1158 . 6 ( c ( o ) or , aromatic ), 1047 . 4 ( c — o — c ) cm − 1 . 1 h nmr δ ( cdcl 3 ): 2 . 07 ( 3h , s , ococh 3 ), 4 . 04 ( 2h , m , nh 2 ), 3 . 88 ( 1h , q , j 5 . 52 , 4 . 52 and 5 . 0 hz , ish - 1 ), 4 . 16 ( 2h , m , ish - 2 and ish - 5 ), 4 . 69 ( 2h , dd , j 4 . 52 and 4 . 52 , ish - 1 and ish - 3 ), 4 . 95 ( 1h , t , j 5 . 04 and 5 . 0 hz , ish - 4 ), 6 . 69 ( 1h , t , j 57 . 52 and 7 . 52 hz , ar 2 h - 5 ), 6 . 91 ( 1h , t , j 8 . 0 and 7 . 04 , ar 2 h - 3 ), 7 . 01 ( 2h , d , j 8 . 52 , ar 1 h - 3 and ar 1 h - 5 ), 7 . 31 ( 1h , m , ar 2 h - 4 ), 7 . 51 ( 1h , m , ar 1 h - 4 ), 7 . 82 ( 1h , dd , j 2 . 0 and 2 . 0 hz , ar 2 h - 2 ), 7 . 92 ( 1h , d , j 7 . 04 , ar 1 h - 2 ). 13 c nmr ppm ( cdcl 3 ): 20 . 13 ( arococh 3 ), 69 . 82 ( isc - 1 ), 70 . 02 ( isc - 5 ), 75 . 01 ( isc - 2 ), 75 . 03 ( isc - 6 ), 79 . 29 ( isc - 3 ), 81 . 86 ( isc - 4 ), 115 . 02 ( ar 2 c - 5 ), 117 . 49 ( ar2c - 1 ), 119 . 32 ( ar 2 c - 3 ), 121 . 63 ( ar 1 c - 5 ), 123 . 59 ( ar 1 c - 1 ), 125 . 42 ( ar 1 c - 3 ), 130 . 23 ( ar 1 c - 2 ), 130 . 59 ( ar 2 c - 2 ), 133 . 27 ( ar 1 c - 4 ), 133 . 36 ( ar 2 c - 4 ), 147 . 99 ( ar 2 c - 6 ), 154 . 32 ( ar 1 c - 6 ), 167 . 02 ( ocoar ), 167 . 06 ( ocoar ), 168 . 92 ( ococh 3 ). isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) was dissolved in toluene ( 15 ml ) at 0 ° c . to which was added dmap ( 0 . 08 g , 0 . 65 mmol ) and dcc ( 0 . 13 g , 0 . 65 mmol ). after 10 mins the reaction vessel was returned to room temperature , 2 - anisic acid ( 2 - methoxybenzoic acid , 0 . 10 g , 0 . 65 mmol ) was added and allowed to stir for 12 hours . the reaction mixture was washed with hcl ( 20 ml , 1 m ), saturated aqueous nahco 3 ( 20 ml ), saturated brine solution ( 20 ml ) and water ( 3 × 20 ml ), dried over anhydrous na 2 so 4 and solvent removed in vacuo to yield product as a crude oil . purification by column chromatography over silica gel using hexane and ethyl acetate ( 3 : 1 ) as eluant yielded compound 11 as white crystals ( 0 . 23 g , 79 . 8 %): m . pt . 132 - 134 ° c . ir vmax ( kbr ): 2920 . 5 ( c — h stretching ), 1764 . 9 and 1720 . 4 ( c ═ o ), 1253 . 2 ( c ( o ) or , aromatic ), 1075 . 2 ( c — o — c ) cm − 1 . hrms : requires : 465 . 1162 ( m + + 23 ), found : 465 . 1131 ( m + + 23 ), 1 h nmr δ ( cdcl 3 ): 2 . 89 ( 3h , s , ococh 3 ) 3 . 95 ( 3h , m , aroch 3 , 4 . 06 ( 1h , m , is6 - hα ), 4 . 14 ( 3h , m , is1 - h 2 [ α + β ] and is6 - hβ ), 4 . 64 ( 1h , d , j 5 . 0 hz , ish - 3 ), 5 . 03 ( 1h , t , j 5 . 04 and 5 . 52 hz , ish - 4 ), 5 . 40 ( 1h , t , j 5 . 0 and 5 . 52 hz , ish - 5 ), 5 . 45 ( 1h , d , j 2 . 0 hz , ish - 2 ), 7 . 01 ( 2h , q , j 4 . 52 , 2 . 52 and 6 . 0 hz , ar 2 h - 3 and ar 2 h - 5 ), 7 . 11 ( 1h , d , j 8 . 04 hz , ar 1 h - 2 ), 7 . 31 ( 1h , m , ar 1 h - 3 ), 7 . 50 ( 1h , m , ar 1 h - 4 ), 7 . 58 ( 1h , m , ar 1 h - 5 ), 7 . 88 ( 1h , dd , j 2 . 04 and 1 . 52 hz , ar 2 h - 4 ), 8 . 01 ( 1h , dd , j 1 . 52 and 1 . 48 hz , ar 2 h - 6 ). 13 c nmr ppm ( cdcl 3 ): 20 . 42 ( arococh 3 ), 55 . 52 ( aroch 3 ), 70 . 41 ( isc - 1 ), 72 . 66 ( isc - 6 ), 73 . 69 ( isocoar ), 76 . 58 ( isc - 5 ). 78 . 25 ( isc - 4 ), 80 . 56 ( isc - 2 ), 85 . 64 ( isc - 3 ), 111 . 74 ( ar 2 c - 3 ) 118 . 83 ( ar 2 c - 1 ), 122 . 39 ( ar 2 c - 5 ), 122 . 91 ( ar 1 c - 5 ), 123 . 38 ( ar 1 c - 1 ), 125 . 42 ( ar 1 c - 3 ), 125 . 56 ( ar 1 c - 2 ), 131 . 38 ( ar 2 c - 6 ), 133 . 45 ( ar 1 c - 4 ), 133 . 75 ( ar 2 c - 4 ), 150 . 24 ( ar 1 c - 6 ), 159 . 09 ( ar 2 c - 6 ), 164 . 79 ( arcoor ), 169 . 13 ( aroc ( o ) ch 3 ). isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) was dissolved in toluene ( 15 ml ) at 0 ° c . to which was added dmap ( 0 . 08 g , 0 . 65 mmol ) and dcc ( 0 . 13 g , 0 . 65 mmol ). after 10 mins the reaction vessel was returned to room temperature , 3 - anisic acid ( 3 - methoxybenzoic acid ) ( 0 . 10 g , 0 . 65 mmol was added and allowed to stir for 12 hours . the reaction mixture was washed with hcl ( 20 ml , 1 m ), saturated aqueous nahco 3 ( 20 ml ), saturated brine solution ( 20 ml ) and water ( 3 × 20 ml ), dried over anhydrous na 2 so 4 and solvent removed in vacuo to yield product as a crude oil . purification by column chromatography over silica gel using hexane and ethyl acetate ( 3 : 1 ) as eluant yielded compound 12 as white crystals ( 0 . 23 g , 79 . 8 %): m . pt . 125 - 128 ° c . ir vmax ( kbr ): 2980 . 9 ( c — h stretching ), 1768 . 3 and 1723 . 8 ( c ═ o ), 1298 . 5 and 1253 . 5 ( c ( o ) or , aromatic ), 1075 . 9 ( c — o — c ) cm − 1 . hrms : requires : 465 . 1162 ( m + + 23 ), found : 465 . 1168 ( m + + 23 ), 1 h nmr δ ( cdcl 3 ): 2 . 36 ( 3h , s , ococh 3 ) 3 . 87 ( 3h , s , aroch 3 ), 4 . 05 ( 1h , d , j 5 . 0 hz , is6 - hα ), 4 . 09 ( 2h , t , j 3 . 0 and 2 . 52 hz , is1 - h 2 [ α + β ]), 4 . 14 ( 2h , d , j 7 . 52 hz , is6 - hβ ), 4 . 64 ( 1h , d , j 5 . 04 hz , ish - 3 ), 5 . 03 ( 1h , t , j 5 . 04 and 5 . 52 hz , ish - 4 ), 5 . 43 ( 1h , q , j 5 . 0 , 5 . 52 and 5 . 52 hz , ish - 5 ), 5 . 47 ( 1h , s , ish - 2 ), 7 . 13 ( 2h , q , j 4 . 52 , 2 . 52 and 6 . 0 hz , ar 2 h - 3 and ar 2 h - 5 ), 7 . 33 ( 2h , m , ar 1 h - 2 and ar 1 h - 3 ), 7 . 58 ( 2h , m , ar 1 h - 4 and ar 1 h - 5 ), 7 . 69 ( 1h , d , j 7 . 52 hz , ar 2 h - 4 ), 8 . 01 ( 1h , dd , j 1 . 52 and 1 . 52 hz , ar 2 h - 6 ). 13 c nmr ppm ( cdcl 3 ): 20 . 41 ( arococh 3 ), 54 . 99 ( aroch 3 ), 70 . 43 ( isc - 1 ), 72 . 74 ( isc - 6 ), 74 . 05 ( isocoar ), 76 . 58 ( isc - 5 ), 78 . 17 ( isc - 4 ), 80 . 49 ( isc - 2 ), 85 . 67 ( isc - 3 ), 113 . 96 ( ar 2 c - 2 ), 119 . 21 ( ar 2 c - 4 ), 121 . 67 ( ar 1 c - 5 ), 122 . 34 ( ar 2 c - 6 ), 123 . 38 ( ar 1 c - 1 ), 125 . 56 ( ar 1 c - 3 ), 129 . 03 ( ar 2 c - 5 ), 130 . 39 ( ar 1 c - 2 ), 131 . 36 ( ar 2 c - 1 ), 133 . 77 ( ar 1 c - 4 ), 150 . 24 ( ar 1 c - 6 ), 159 . 20 ( ar 2 c - 3 ), 163 . 14 ( arcoor ), 169 . 11 ( arococh 3 ). isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) was dissolved in toluene ( 15 ml ) at 0 ° c . to which was added dmap ( 0 . 08 g , 0 . 65 mmol ) and dcc ( 0 . 13 g , 0 . 65 mmol ). after 10 mins the reaction vessel was returned to room temperature , 4 - anisic acid ( 4 - methoxybenzoic acid ) ( 0 . 10 g , 0 . 65 mmol was added and allowed to stir for 12 hours . the reaction mixture was washed with hcl ( 20 ml , 1 m ), saturated aqueous nahco 3 ( 20 ml ), saturated brine solution ( 20 ml ) and water ( 3 × 20 ml ), dried over anhydrous na 2 so 4 and solvent removed in vacuo to yield product as a crude oil . purification by column chromatography over silica gel using hexane and ethyl acetate ( 2 : 1 ) as eluant yielded product as white crystals ( 0 . 17 g , 58 . 9 %): m . pt . 141 - 144 ° c . ir vmax ( kbr ): 2994 . 1 and 2936 . 7 ( c — h stretching ), 1764 . and 724 . 9 ( c ═)), 1605 . 8 ( c ═ c stretching ), 1260 . 5 ( c ( o ) or , aromatic ), 1078 . 6 ( c — o — c ) cm − 1 . hrms : requires : 465 . 1162 ( m + + 23 ), found : 465 . 1157 ( m + + 23 ). 1 h nmr δ ( cdcl 3 ): 2 . 32 ( 3h , s , ococh 3 ), 3 . 84 ( 3h , s , aroch 3 , 3 . 99 ( 1h , m , is6 - hα ), 4 . 07 ( 6h , m , is1 - h 2 [ α + β ] and is6 - hβ ), 4 . 59 ( 1h , d , j 4 . 52 hz , ish - 3 ), 4 . 98 ( 1h , t , j 5 . 52 and 5 . 0 hz , ish - 4 ), 5 . 38 ( 1h , t , j 5 . 0 and 5 . 52 hz , ish - 5 ), 5 . 43 ( 1h , d , j 2 . 0 hz , ish - 2 ), 6 . 91 ( 2h , d , j 8 . 52 hz , ar 2 h - 3 and ar 2 h - 5 ), 7 . 08 ( 1h , d , j 8 . 0 hz , ar 1 h - 4 ), 7 . 28 ( 1h , t , j 7 . 56 and 9 . 52 hz , ar 1 h - 2 ), 7 . 54 ( 1h , t , j 8 . 0 and 7 . 52 hz , ar 1 h - 3 ), 7 . 99 ( 3h , q , j 9 . 0 , 7 . 04 and 8 . 04 hz , ar 1 h - 1 , ar 2 h - 2 and ar 2 h - 6 ). 13 c nmr ppm ( cdcl 3 ): 20 . 48 ( arococh3 ), 59 . 83 ( aroch 3 ), 70 . 41 ( isc - 1 ), 72 . 82 ( isc - 6 ), 73 . 58 ( isocoar ), 76 . 58 ( isc - 5 ). 78 . 26 ( isc - 4 ), 80 . 47 ( isc - 2 ), 85 . 46 ( isc - 3 ), 113 . 33 ( ar 2 c - 3 and ar 2 c - 5 ), 121 . 46 ( ar 1 c - 5 ), 122 . 35 ( ar 2 c - 1 ), 123 . 36 ( ar 1 c - 1 ), 125 . 54 ( ar 1 c - 3 ), 131 . 35 ( ar 1 c - 2 ), 133 . 73 ( ar 2 c - 2 and ar 2 c - 6 ), 133 . 76 ( ar 1 c - 4 ), 150 . 23 ( ar 1 c - 6 ), 163 . 12 ( aroch 3 and ar 2 c - 4 ), 165 . 09 ( arcoor ), 169 . 08 ( arcoor ), 170 . 52 ( arococh 3 ). a solution of isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) was dissolved in toluene at 0 ° c . to which was added triethylamine ( 0 . 13 mls , 0 . 98 mmol ) and 4 - toluoyl chloride ( 0 . 93 ml , 0 . 78 mmol ). the reaction vessel was returned to room temperature and allowed to stir for 10 hours , then washed with hcl ( 30 ml , 1 m ), saturated aqueous nahco 3 ( 30 ml ), water ( 3 × 30 ml ) and saturated nacl solution ( 30 ml ). the reaction was dried with anhydrous na 2 so 4 and solvent was removed in vacuo using ethyl acetate as co - solvent to give crude product . purification by column chromatography using hexane and ethyl acetate ( 9 : 1 ) as eluant gave compound 14 as white crystals ( 0 . 1 g , 35 . 99 %): m . pt . 102 - 104 ° c . ir vmax ( kbr ): 2982 . 7 and 2923 . 6 ( c — h stretching ), 1763 . 9 and 1717 . 8 ( c ═ o ), 1608 . 5 ( c ═ c ), 1275 . 4 and 1202 . 0 ( c ( o ) or ), 1100 . 3 ( c — o — c )) cm − 1 . hrms : requires : 449 . 1212 ( m + + 23 ), found : 449 . 1229 ( m + + 23 ), 1 h nmr δ ( cdcl 3 ): 2 . 19 ( 3h , s , ococh 3 ), 2 . 43 ( 3h , s , ar — ch 3 ), 4 . 05 ( 2h , d , j 5 . 0 hz , is1h 2 [ α +] and is6h 2 [ α +]), 4 . 09 ( 2h , t , j 4 . 04 and 3 . 52 hz , ish - 6 ), 4 . 14 ( 1h , t , j 7 . 04 and 7 . 52 hz , ish - 5 ), 4 . 63 ( 1h , d , j 5 . 0 hz , ish - 3 ), 5 . 03 ( 1h , t , j 4 . 8 and 5 . 0 , ish - 4 ), 5 . 44 ( 2h , m , ish - 2 ), 7 . 11 ( 1h , d , j 8 . 04 hz , ar — h ), 7 . 27 ( 2h , d , j 8 . 56 hz , ar — h ), 7 . 33 ( 1h , t , j 7 . 52 and 7 . 52 hz , ar — h ), 7 . 55 ( 1h , t , j 1 . 52 and 6 . 04 hz , ar — h ), 8 . 00 ( 3h , m , ar — h ). 13 c nmr ppm ( cdcl 3 ): 13 . 71 ( arch 3 ), 20 . 54 ( ococh 3 ), 70 . 49 ( isc - 1 ), 72 . 75 ( isc - 6 ), 73 . 78 ( isc - 5 ), 78 . 13 ( isc - 4 ), 80 . 72 ( isc - 2 ), 85 . 62 ( isc - 3 ), 122 . 25 ( ar 1 c - 1 ), 123 . 38 ( ar 1 c - 4 ), 125 . 64 ( ar 1 c - 6 ), 126 . 26 ( ar 1 c - 2 and ar 2 c - 4 ), 128 . 74 ( ar 2 c - 2 and ar 2 c - 5 ), 129 . 36 ( ar 2 c - 6 ), 131 . 42 ( ar 2 c - 3 ), 133 . 87 ( ar 1 c - 3 ), 143 . 62 ( ar 2 c - 1 ), 150 22 ( ar 1 c - 5 ), 163 . 15 ( arococh 3 ), 165 . 48 ( is - ocoar ), 169 . 27 ( arcoo ). ( please note a compound 16 is not included in this description ) isosorbide - 2 - aspirinate 17 ( 0 . 2 g , 0 . 65 mmol ) was dissolved in dcm ( 10 mls ) at room temperature . to the reaction vessel was added 4 - nitrobenzoylchloride ( 0 . 15 g , 0 . 78 mmol ) and triethylamine ( 1 . 12 ml , 0 . 78 mmol ). the reaction was allowed to stir at room temperature for 48 hours before washing with hcl ( 20 ml , 1 m ), saturated aqueous nahco 3 ( 25 ml ), saturated brine solution ( 20 ml ) and water ( 2 × 20 ml ), dried over anhydrous na 2 so 4 and solvent removed in vacuo to yield product as a crude yellow oil . purification by column chromatography over silica gel using hexane and ethyl acetate ( 3 : 2 ) as eluant yielded compound 15 as a colourless oil which when recrystallised in ethanol afforded product as white crystals ( 0 . 15 g , 50 . 5 %). m . pt . 66 - 68 ° c . ir vmax ( kbr ): 1772 . 7 and 1726 . 2 ( c ═ o ), 1276 . 6 ( c ( o ) or , aromatic ), 1078 . 1 ( c — o — c ) cm − 1 . hrms : requires : 480 . 0907 ( m + + 23 ), found : 480 . 0922 ( m + + 23 ), 1 h nmr δ ( cdcl 3 ): 2 . 34 ( 3h , s , ococh 3 ), 4 . 07 ( 4h , m , ish - 3 ), 4 . 64 ( 1h , d , j 4 . 52 hz , ish - 1 and ish - 4 ), 5 . 04 ( 1h , t , j 5 . 04 and 5 . 0 hz , ish - 5 ), 5 . 45 ( 2h , m , ish - 2 and ish - 6 ), 7 . 10 ( 1h , dd , j 1 . 0 and 1 . 0 hz , ar 1 h - 2 ), 7 . 31 ( 1h , m , ar 1 h - 3 ), 7 . 53 ( 1h , m , ar 1 h - 4 ), 7 . 99 ( 1h , dd , j 2 . 04 and 1 . 52 hz , ar 1 h - 5 ), 8 . 25 ( 4h , dd , j 2 . 0 and 2 . 04 hz , ar 2 h - 2 and ar 2 h - 6 ), 8 . 31 ( 2h , dd , j 2 . 0 and 2 . 04 hz , ar 2 h - 3 and ar 2 h - 5 ). 13 c nmr ppm ( cdcl 3 ): 20 . 41 ( arococh 3 ), 70 . 26 ( isc - 1 ), 72 . 76 ( isc - 5 ), 74 . 88 ( isc - 2 and isc - 6 ), 80 . 52 ( isc - 4 ), 85 . 68 ( isc - 3 ), 123 . 16 ( ar 1 c - 5 ), 123 . 36 ( ar 1 c - 1 ), 125 . 58 ( ar 2 c - 3 and ar 2 c - 5 ), 130 . 39 ( ar 1 c - 2 ), 131 . 32 ( ar 2 c - 2 and ar 2 c - 6 ), 133 . 87 ( ar 1 c - 4 ), 150 . 32 ( ar 2 c - 4 ), 163 . 07 ( ocoar ), 163 . 53 ( ocoar ), 169 . 09 ( ococh 3 ). a stirred solution of acetylsalicyloyl chloride ( m . w . 198 . 60 g / mol , 10 . 9 g = 54 . 9 mmol ) in dichloromethane ( 160 ml ) was treated with triethylamine ( m . w . 101 . 19 g / mol , d = 0 . 726 g / ml , 9 . 1 ml = 65 . 4 mmol ). the mixture was cooled to 0 ° c . and 5 - ismn ( m . w . 191 . 12 g / mol , 10 g = 52 . 3 mmol ) was added . the flask was stirred at room temperature overnight and protected from light . mixture was washed with hcl ( 2 m ), 5 % nahco 3 and water , dried over sodium sulfate and concentrated to an oil . this was recrystallised using hot ethanol ( crystallization can be quite slow ) to give 10 g of yellow crystals . this was dissolved in methanol / ethyl acetate ( 1 : 1 ), pd / c was added and a hydrogen balloon was attached . stirred overnight and monitored by tlc ( hexane / ethyl acetate 2 : 1 ) to determine reaction completion . mixture was filtered and the solvent removed . some dichloromethane added and concentrated , diethyl ether added , allowed to stand for 10 - 15 mins and concentrated to white crystals ( 7 . 4 g ). 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 37 ( 3h , s , ococh 3 ), 3 . 6 ( 1h , m , ish - 6 ), 3 . 9 ( 1h , m ish - 6 ′), 4 . 07 ( 2h , 2 × dd , ish - 1 / h - 1 ′), 4 . 3 ( 1h , q , ish - 3 ), 4 . 58 ( 1h , d , ish - 4 ), 4 . 69 ( 1h , m , ish - 2 ), 5 . 45 ( 1h , d , ish - 5 ), 7 . 11 ( 1h , d , ar — h ), 7 . 28 ( 1h , t , ar — h ), 7 . 57 ( 1h , t , ar — h ), 8 . 00 ( 1h , dd , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 48 ( ococh 3 ), 71 . 56 ( isc - 1 ), 72 . 91 ( isc - 6 ), 73 . 11 ( isc - 5 ), 78 . 44 ( isc - 2 ), 81 . 56 ( isc - 4 ), 85 . 09 ( isc - 3 ), 122 . 18 ( ar 2 c - 2 / c - 6 ), 123 . 42 , 125 . 66 ( ar 2 c - 4 ), 131 . 37 ( ar 1 c - 4 ), 133 . 95 , 150 . 23 ( ar 2 oco ), 163 . 03 ( ocoarch 2 ono 2 ), 169 . 27 ( arc ( o ) or ). to a solution of isosorbide - 2 - aspirinate - 5 - salicylate ( 0 . 15 g , 0 . 35 mmol ) and dbu ( 0 . 052 ml , 0 . 35 mmol ) in dichloromethane ( 5 ml ) was added bromoacetyl chloride ( 0 . 03 ml , 0 . 35 mmol ) and the reaction mixture was allowed to stir overnight . the reaction was washed with water ( 2 × 5 ml ) and the solvents removed in vacuo to yield compound 18 as a colourless oil ( 0 . 13 g ). ir vmax ( film ) cm − 1 : 1765 . 6 and 1724 . 3 ( c ═ o ), 1608 . 1 ( c ═ o ), 1288 . 4 and 1251 . 4 ( c ( o ) or ), 1196 . 9 and 1135 . 6 ( c — o — c ), 732 . 6 ( c — br ). hrms : requires : 531 . 1013 ( m + ); found : 570 . 4453 ( m + + 23 ). δh ( 400 mhz ; cdcl 3 ): 2 . 37 ( 3h , s , ococh 3 ), 4 . 07 ( 4h , m , is1 , 6 - h ), 4 . 48 ( 2h , s , ch 2 ), − 4 . 63 ( 1h , m , is4 - h ), 4 . 98 ( 1h , m , is3 - h ), 5 . 40 ( 2h , m , is2 , 5 - h ), 7 . 11 ( 1h , d , j8 . 0 and 7 . 5 hz , ar — h ), 7 . 60 ( 2h , m , 2 × arh ), 8 . 11 ( 1h , d , j1 . 5 hz , ar — h ), 8 . 12 ( 1h , d , j 1 . 5 hz , ar — h ); δ 13 c ( 100 mhz ; cdcl 3 ): 20 . 86 ( ococh 3 ), 40 . 99 ( ch2 ), 70 . 47 ( is - c ), 73 . 24 ( is6 - c ), 74 . 69 ( is4 - c ), 78 . 40 ( is3 - c ), 81 . 09 ( is5 - c ), 86 . 07 ( is2 - c ), 123 . 61 , 123 . 83 , 126 . 01 , 126 . 65 and 131 . 78 , 132 . 21 , 134 . 26 , 134 . 42 , 150 . 23 , 150 . 69 , 163 . 5 , 166 . 11 , 169 . 55 . cycolpropane carbonyl chloride ( m . w . 104 . 54 g / mol , d = 1 . 152 g / ml , 250 μl = 2 mmol ) was dissolved in dcm ( 10 ml ). triethylamine ( 500 μl = 6 mmol ) was added and the mixture was cooled to 0 ° c . isosorbide - 2 - aspirinate , 17 was added ( 506 . 2 mg = 1 . 6 mmol ) and the reaction was stirred overnight at room temperature . washed with 2 m hcl ( 10 ml ), 5 % nahco 3 ( 10 ml ) and water ( 10 ml ). dried over sodium sulfate and concentrated . purified by column chromatography ( hexane / ethyl acetate 2 : 1 ) rf = 0 . 3 to give 396 mg of an oil . 1 h nmr δ ( cdcl 3 ) 400 mhz : 0 . 9 - 1 . 18 ( 2 × dd and t , 4h , 2 × ch 2 ), 2 . 32 ( 3h , s , ococh 3 ), 3 . 78 ( m , 1h , ish - 1 ), 3 . 9 ( m , 1h , ish - 6 ), 4 . 06 ( 2h , d , ish - 1 ′ and ish - 6 ′), 4 . 5 ( 1h , d , ish - 3 ), 4 . 83 ( 1h , t , ish - 4 ), 5 . 12 ( 1h , q , ish - 2 ), 5 . 38 ( 1h , s , h - 5 ), 7 . 06 ( 1h , d , ar — h ), 7 . 26 ( 1h , t , ar — h ), 7 . 52 ( 1h , t , ar — h ), 7 . 95 ( 1h , d , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 9 and 10 ( 2 × ch 2 ), 12 . 15 ( ch ), 20 . 43 ( ococh 3 ), 69 . 96 ( isc - 1 ), 72 . 71 ( isc - 6 ), 73 . 40 ( isc - 5 ), 78 . 14 ( isc - 2 ), 80 . 39 ( isc - 4 ), 85 . 35 ( isc - 3 ), 122 . 20 ( arc - 6 ), 123 . 37 ( arc - 2 ), 125 . 59 ( arc - 4 ), 131 . 36 ( arc - 3 ), 133 . 86 ( arc - 5 ), 150 . 19 ( arc - 1 ), 163 . 05 ( ar 2 oco ), 169 . 18 ( ch 3 ocoar ), 173 . 78 ( ococyclopropane ). isosorbide - 2 - aspirinate 17 ( 200 mg , 0 . 6 mmol ) and 4 - cyanobenzoylchloride ( 120 mg , 0 . 72 mmol ) were reacted together according to gp2 to give 213 mg ( 81 %) of a yellow oil after flash chromatography with etoac : hex 1 : 4 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 2 ( 2h , d , j = 8 . 5 hz ), 8 . 0 ( 1h , dd , j = 8 hz , 1 . 5 hz ), 7 . 8 ( 2h , d , j = 10 hz ), 7 . 6 ( 1h , dt , j = 8 hz , 1 . 5 hz ), 7 . 35 ( 1h , dt , j = 6 . 5 hz , 1 hz ), 7 . 1 ( 1h , d , j = 8 . 5 hz ), 5 . 45 ( 2h , m ), 5 . 05 ( 1h , t , j = 5 hz ), 4 . 65 ( 1h , d , j = 5 hz ), 4 . 1 ( 4h , m ), 2 . 4 ( 3h , s ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 3 , 163 . 8 , 163 . 1 , 150 . 3 , 133 . 9 , 132 . 8 , 131 . 9 , 131 . 4 , 129 . 8 , 125 . 7 , 123 . 4 , 122 . 1 , 117 . 4 , 116 . 3 , 85 . 7 , 80 . 7 , 80 . 5 , 77 . 9 , 76 . 8 74 . 8 , 72 . 7 , 70 . 3 , 20 . 5 . hrms ( ei ) c 23 h 19 o 8 n , [ m + h ] + requires 438 . 4068 , found 438 . 4183 . anal . c 23 h 19 o 8 n requires c : 63 . 16 , h : 4 . 38 , n : 3 . 20 , found c : 63 . 46 , h : 4 . 51 , n : 2 . 97 . isosorbide - 2 - aspirinate 17 ( 200 mg , 0 . 6 mmol ) and 4 - phenylbenzoylchloride ( 156 mg , 0 . 72 mmol ) were reacted together to give 185 mg ( 65 %) of a colourless oil after flash chromatography with etoac : hex 1 : 4 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 2 ( 2h , d , j = 8 . 5 hz ), 8 . 0 ( 1h , dd , j = 8 hz , 1 . 5 hz ), 7 . 7 ( 2h , d , j = 8 . 5 hz ), 7 . 65 ( 2h , d , j = 7 hz ), 7 . 6 ( 1h , dt , j = 8 hz , 1 . 5 hz ), 7 . 5 ( 2h , t , j = 7 . 5 hz ), 7 . 45 ( 1h , t , j = 8 hz ), 7 . 35 ( 1h , dt , j = 6 . 5 hz , 1 hz ), 7 . 1 ( 1h , d , j = 8 . 5 hz ), 5 . 45 ( 2h , m ), 5 . 05 ( 1h , t , j = 5 hz ), 4 . 65 ( 1h , d , j = 5 hz ), 4 . 1 ( 4h , m ), 2 . 4 ( 3h , s ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 3 , 165 . 3 , 163 . 1 , 150 . 3 , 145 . 6 , 139 . 5 , 133 . 9 , 131 . 4 , 129 . 8 , 128 . 5 , 127 . 8 , 127 . 7 , 126 . 8 , 126 . 7 125 . 7 , 123 . 4 , 122 . 1 , 85 . 7 , 80 . 7 , 78 . 12 , 77 . 2 , 76 . 8 73 . 9 , 72 . 7 , 70 . 5 , 20 . 5 . hrms ( ei ) c 28 h 24 o 8 , [ m + h ] + requires 489 . 4933 , found 489 . 5021 . anal . c 28 h 24 o 8 requires c : 68 . 85 , h : 4 . 95 , found c : 68 . 88 , h : 5 . 08 . isosorbide - 2 - aspirinate 17 ( 250 mg , 0 . 8 mmol ) and 6 - chloronicotinoylchloride ( 230 mg , 0 . 9 mmol ) were reacted together according to gp2 to give 256 mg ( 70 %) of a white solid after flash chromatography with etoac : hex 3 : 7 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 9 . 3 ( 1h s ) 8 . 9 ( 1h , s ), 8 . 3 ( 2h , d , j = 8 . 5 hz ), 8 . 0 ( 1h , dd , j = 8 hz , 1 . 5 hz ), 7 . 6 ( 1h , dt , j = 8 hz , 1 . 5 hz ), 7 . 45 ( 1h , t , j = 1hz ) 7 . 35 ( 1h , dt , j = 6 . 5 hz , 1 hz ), 7 . 1 ( 1h , d , j = 8 . 5 hz ), 5 . 45 ( 2h , m ), 5 . 05 ( 1h , t , j = 5 hz ), 4 . 65 ( 1h , d , j = 5 hz ), 4 . 1 ( 4h , m ), 2 . 4 ( 3h , s ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 3 , 164 . 2 , 163 . 1 , 153 . 3 , 150 . 5 , 150 . 2 , 136 . 8 , 133 . 9 , 131 . 4 , 125 . 7 , 123 . 4 , 123 . 0 , 122 . 2 , 85 . 7 , 80 . 6 , 77 . 9 , 76 . 8 , 74 . 4 , 72 . 8 , 70 . 4 , 20 . 5 . hrms ( ei ) c 21 h 18 clno 8 , [ m + h ] + requires 448 . 8304 , found 448 . 8295 . anal . c 21 h 18 clno 8 requires c : 56 . 32 , h : 4 . 05 , n : 3 . 13 found c : 56 . 20 , h : 4 . 21 , n : 3 . 02 . isosorbide - 2 - aspirinate 17 ( 250 mg , 0 . 8 mmol ) and 2 - chloro - 6 - methylpyridine - 4 - carbamoylchloride ( 247 mg , 0 . 9 mmol ) were reacted together according to gp2 to give 196 mg ( 53 %) of a white foam after flash chromatography with etoac : hex 2 : 6 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 0 ( 1h , dd , j = 8 hz , 1 . 5 hz ), 7 . 74 ( 1h , s ), 7 . 68 ( 1h , s ) 7 . 6 ( 1h , dt , j = 8 hz , 1 . 5 hz ), 7 . 45 ( 1h , t , j = 1hz ) 7 . 35 ( 1h , dt , j = 6 . 5 hz , 1 hz ), 7 . 1 ( 1h , d , j = 8 . 5 hz ), 5 . 45 ( 2h , m ), 5 . 05 ( 1h , t , j = 5 hz ), 4 . 65 ( 1h , d , j = 5 hz ), 4 . 1 ( 4h , m ), 2 . 65 ( 3h , s ), 2 . 4 ( 3h , s ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 3 , 163 . 1 , 151 . 1 , 150 . 2 , 139 . 3 , 134 . 0 , 131 . 4 , 125 . 7 , 123 . 4 , 122 . 1 , 120 . 8 , 120 . 4 , 85 . 7 , 80 . 4 , 77 . 8 , 77 . 6 , 75 . 1 , 72 . 8 , 70 . 2 , 23 . 8 , 20 . 5 . hrms ( ei ) c 22 h 20 clno 8 , [ m + h ] + requires 462 . 8570 , found 462 . 8601 . anal . c 22 h 20 clno 8 requires c : 57 . 21 , h : 4 . 36 , n : 3 . 03 found c : 56 . 91 , h : 4 . 38 , n : 2 . 94 . isosorbide - 2 - aspirinate 17 ( 200 mg , 0 . 65 mmol ) and 3 , 5 - ethoxybenzoyl chloride ( 157 mg , 0 . 72 mmol ) were reacted together according to gp2 to give 296 mg ( 74 %) of a viscous yellow oil after flash chromatography with etoac : hex 1 : 4 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 1 ( 1h , d , j = 8hz , asp h5 ), 7 . 6 ( 1h , dt , j = 8 hz , 1 . 5 hz , asp h4 ), 7 . 35 ( 1h , t , j = 1 hz , asp h3 ), 7 . 2 ( 2h , d , 1 hz , benz h2 + 6 ), 7 . 1 ( 1h , d , 8 . 5 hz , asp h2 ), 6 . 7 ( 1h , t , j = 2 . 25 hz , benz h4 ), 5 . 45 ( 2h , m , is h5 + h2 ), 5 . 05 ( 1h , t , j = 5 hz , is h4 ), 4 . 65 ( 1h , d , j = 5 . 5 hz , is h3 ), 4 . 05 ( 8h , m , is1 - h 2 [ α + β ], is6 - h 2 [ α + β ], ethoxy - ch 2 ), 2 . 4 ( 3h , s , acet - ch 3 ), 1 . 45 ( 6h , t , j = 3 . 5 hz , eto - ch 3 ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 8 , 165 . 8 , 163 . 6 , 160 . 0 , 150 . 7 , 134 . 3 , 131 . 9 , 131 . 1 , 126 . 1 , 123 . 8 , 122 . 7 , 107 . 9 , 106 . 6 , 86 . 1 , 81 . 1 , 78 . 6 , 76 . 7 , 74 . 5 , 73 . 2 , 71 . 0 , 63 . 8 , 61 . 2 , 20 . 9 , 14 . 8 . hrms ( ei ) c 26 h 28 o 10 , [ m + h ] + requires 500 . 4945 , found 500 . 4932 . anal . c 26 h 28 o 10 requires c : 62 . 39 , h : 5 . 64 , found c : 62 . 45 , h : 5 . 79 isosorbide - 2 - aspirinate 17 ( 200 mg , 0 . 65 mmol ) and 3 - methyl - isoxazole - 4 - carboxylic acid ( 127 mg , 0 . 72 mmol ) were reacted together according to gp1 to give 228 mg ( 83 %) of a white foam after flash chromatography with etoac : hex 1 : 3 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 55 ( 1h , s , isox ), 8 . 0 ( 1h , d , j = 8 hz , asp h5 ), 7 . 65 ( 1h , dt , j = 8 hz , 1 . 5 hz , asp h4 ), 7 . 3 ( 1h , t , j = 1 hz , asp h3 ), 7 . 1 ( 1h , d , 8 . 5 hz , asp h2 ), 5 . 4 ( 2h , m , is h5 + h2 ), 5 . 0 ( 1h , t , j = 5 hz , is h4 ), 4 . 6 ( 1h , d , j = 5 . 5 hz , is h3 ), 4 . 1 ( 4h , m , is1 - h 2 [ α + β ], is6 - h 2 [ α + β ]), 3 . 8 ( 3h , s , isox - ch 3 ), 2 . 35 ( 3h , s , asp - acet - ch 3 ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 2 , 163 . 0 , 160 . 4 , 150 . 2 , 149 . 6 , 133 . 9 , 131 . 4 , 125 . 6 , 123 . 4 , 122 . 1 , 85 . 6 , 80 . 5 , 73 . 9 , 72 . 7 , 70 . 2 , 33 . 5 , 24 . 5 , 20 . 5 , 12 . 3 . isosorbide - 2 - aspirinate 17 ( 200 mg , 0 . 65 mmol ) and 4 - methyl - 1 , 2 , 3 - thiadiazole - 5 - carboxylic acid were reacted together to give 228 mg ( 83 %) of a pale pink foam after flash chromatography with etoac : hex 1 : 3 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 1 ( 1h , d , j = 8 hz , asp h5 ), 7 . 7 ( 1h , dt , j = 8 hz , 1 . 5 hz , asp h4 ), 7 . 35 ( 1h , t , j = 1 hz , asp h3 ), 7 . 15 ( 1h , d , 8 . 5 hz , asp h2 ), 5 . 5 ( 2h , m , is h5 + h2 ), 5 . 05 ( 1h , t , j = 5 hz , is h4 ), 4 . 65 ( 1h , d , j = 5 . 5 hz , is h3 ), 4 . 1 ( 4h , m , is1 - h 2 [ α + β ], is6 - h 2 [ α + β ]), 3 . 05 ( 3h , s , thiad - ch 3 ), 2 . 4 ( 3h , s , asp - acet - ch 3 ). 13 c nmr ( cdcl 3 400 mhz ) 6 169 . 7 , 163 . 5 , 162 . 9 , 159 . 1 , 150 . 7 , 134 . 4 , 131 . 8 , 126 . 1 , 123 . 8 , 122 . 5 , 86 . 2 , 80 . 9 , 78 . 2 , 75 . 9 , 73 . 2 , 70 . 8 , 21 . 0 , 14 . 1 . isosorbide - 2 - aspirinate 17 ( 200 mg , 0 . 65 mmol ) and 4n - boc - isonipecotic acid ( 162 mg , 0 . 72 mmol ) were reacted together to give 166 mg ( 49 %) of an off white oil after flash chromatography with meoh : dcm 3 : 97 . 1 h nmr ( cdcl 3 , 400 mhz ) δ8 . 1 ( 1h , d , j = 8 hz , asp h5 ), 7 . 7 ( 1h , dt , j = 8 hz , 1 . 5 hz , asp h4 ), 7 . 35 ( 1h , t , j = 1 hz , asp h3 ), 7 . 15 ( 1h , d , 8 . 5 hz , asp h2 ), 5 . 5 ( 1h , d , j = 1 . 5 hz is h2 ), 5 . 5 , ( 1h , dd , j = 5 hz , 1 hz ) 4 . 95 ( 1h , t , j = 5 hz , is h4 ), 4 . 65 ( 1h , d , j = 5 . 5 hz , is h3 ), 4 . 1 ( 8h , m , is1 - h 2 [ α + β ], is6 - h 2 [ α + β ], 4 nip h ), 2 . 6 ( 1h , m , nip - methine - h ), 2 . 4 ( 3h , s , asp - acet - ch 3 ), 1 . 7 ( 4h , m , 4 nip h ), 1 . 5 , ( 9h , s , t - bu ). 13 c nmr ( cdcl 3 400 mhz ) δ 173 . 9 , 169 . 8 , 163 . 5 , 154 . 7 , 150 . 7 , 134 . 4 , 131 . 9 , 126 . 1 , 123 . 9 , 122 . 6 , 85 . 9 , 80 . 7 , 79 . 6 , 78 . 5 , 77 . 2 , 76 . 5 , 73 . 9 , 73 . 0 , 70 . 7 , 42 . 9 , 40 . 9 , 28 . 4 , 28 . 1 , 27 . 9 , 20 . 9 . hrms ( ei ) c 26 h 33 o 10 n , [ m + h ] + requires 520 . 4616 , found 520 . 4631 . anal . c 26 h 33 o 10 n requires c : 60 . 11 , h : 6 . 40 , n : 2 . 69 found c : 60 . 15 , h : 6 . 79 , n : 2 . 76 isosorbide - 2 - aspirinate 17 ( 200 mg , 0 . 65 mmol ) and m - acetamidobenzoic acid ( 128 mg , 0 . 72 mmol ) were reacted together to give 202 mg ( 66 %) of a white solid after flash chromatography with meoh : dcm 3 : 97 . 1 h nmr ( cdcl 3 , 400 mhz ) δ8 . 0 ( 3h , m , asp h5 , ar h2 + 4 ), 7 . 85 ( 1h , d , j = 8 hz , ar h6 ), 7 . 6 ( 1h , dt , j = 8hz , 1 . 5hz , asp h4 ), 7 . 45 ( 1h , t , j = 7 . 5 hz , ar h5 ), 7 . 35 ( 1h , t , j = 1 hz , asp h3 ), 7 . 15 ( 1h , d , 8 . 5 hz , asp h2 ), 5 . 5 ( 2h , m , is h5 + h2 ), 5 . 05 ( 1h , t , j = 5 hz , is h4 ), 4 . 65 ( 1h , d , j = 5 . 5 hz , is h3 ), 4 . 1 ( 4h , m , is1 - h 2 [ α + β ], is6 - h 2 [ α + β ]), 2 . 4 ( 3h , s , asp - acet - ch 3 ), 2 . 2 ( 3h , ar - acet - ch 3 ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 3 , 168 . 0 , 165 . 0 , 163 . 1 , 150 . 2 , 137 . 7 , 133 . 9 , 131 . 4 , 129 . 7 , 128 . 9 , 125 . 6 , 125 . 0 , 124 . 4 , 123 . 4 , 122 . 2 , 120 . 2 , 85 . 7 , m80 . 7 , 78 . 1 , 74 . 12 , 72 . 8 , 70 . 4 , 60 . 0 , 24 . 2 , 20 . 5 , 13 . 8 . hrms ( ei ) c 24 h 23 o 9 n , [ m + h ] + requires 470 . 4392 , found 470 . 4403 . anal . c 24 h 23 o 9 n requires c : 61 . 41 , h : 4 . 93 , n : 2 . 98 found c : 61 . 52 , h : 5 . 09 , n : 2 . 86 . isosorbide - 2 - aspirinate 17 ( 250 mg , 0 . 8 mmol ) and m - benzyloxybenzoic acid ( 182 mg , 0 . 88 mmol ) were reacted together according to gp1 to give 346 mg ( 85 %) of a white solid after flash chromatography with etoac : hex 1 : 2 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 0 ( 1h , d , j = 8hz , asp h5 ), 7 . 7 ( 3h , m , asp h4 , ar2h ), 7 . 35 ( 2h , m , asp h3 , arh ), 7 . 1 ( 2h , m , asp h2 , arh ), 7 . 25 ( 5h , m , bnh ), 5 . 5 ( 3h , m , is h2 , bn - ch 2 ), 5 . 05 ( 1h , t , j = 5 hz , is h4 ), 4 . 65 ( 1h , d , j = 5 . 5 hz , is h3 ), 4 . 1 ( 4h , m , is1 - h 2 [ α + β ], is6 - h 2 [ α + β ]), 2 . 4 ( 3h , s , asp - acet - ch 3 ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 76 , 165 . 2 , 163 . 6 , 150 . 7 , 135 . 8 , 134 . 4 , 133 . 7 , 132 . 9 , 131 . 9 , 130 . 8 , 130 . 3 , 130 . 2 , 129 . 2 , 126 . 1 , 123 . 9 , 122 . 7 , 97 . 7 , 86 . 1 , 81 . 1 , 78 . 5 , 74 . 7 , 73 . 2 , 70 . 8 , 43 . 9 , 20 . 9 . hrms ( ei ) c 29 h 26 o 9 , [ m + h ] + requires 518 . 4344 , found 518 . 4357 . anal . c 29 h 26 o 9 requires c : 67 . 19 , h : 5 . 05 found c : 67 . 28 , h : 5 . 09 . isosorbide - 2 - aspirinate ( 250 mg , 0 . 8 mmol ) and m - benzyloxybenzoic acid ( 182 mg , 0 . 88 mmol ) were reacted together according to gp1 to give 346 mg ( 85 %) of a white solid after flash chromatography with etoac : hex 1 : 2 . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 0 ( 1h , d , j = 8 hz , asp h5 ), 7 . 7 ( 1h , dt , j = 8 hz , 1 . 5 hz , asp h4 ), 7 . 45 ( m , 4h , arh ), 7 . 35 ( 1h , t , j = 1hz , asp h3 ), 7 . 25 ( 5h , m , bnh ) 7 . 1 ( 1h , d , 8 . 5 hz , asp h2 ), 5 . 5 ( 3h , m , is h2 , bn - ch 2 ), 5 . 05 ( 1h , t , j = 5 hz , is h4 ), 4 . 65 ( 1h , d , j = 5 . 5 hz , is h3 ), 4 . 1 ( 4h , m , is1 - h 2 [ α + β ], is6 - h 2 [ α + β ]), 2 . 4 ( 3h , s , asp - acet - ch 3 ). 13 c nmr ( cdcl 3 400 mhz ) δ 169 . 76 , 165 . 2 , 163 . 6 , 150 . 7 , 136 . 9 , 135 . 2 , 133 . 0 , 132 . 2 , 131 . 9 , 130 . 8 , 130 . 3 , 130 . 2 , 129 . 2 , 126 . 1 , 123 . 9 , 122 . 7 , 97 . 7 , 86 . 1 , 81 . 1 , 78 . 5 , 74 . 7 , 73 . 2 , 70 . 8 , 43 . 9 , 20 . 9 . hrms ( ei ) c 29 h 26 o 9 , [ m + h ] + requires 518 . 4344 , found 518 . 4338 . anal . c 29 h 26 o 9 requires c : 67 . 19 , h : 5 . 05 found c : 67 . 35 , h : 5 . 18 . phthalide ( m . w . 134 . 13 g / mol , 5 . 03 g = 37 mmol ) and dichlorotriphenylphosphorane ( m . w . 333 . 19 g / mol , 12 . 3 g = 38 mmol ) were heated at 180 ° c . for 4 hrs with stirring [ 3 ] . colour change from green to brown was seen over the course of 4 hrs . tlc ( hexane / ethyl acetate 2 : 1 ) showed 3 spots and nmr determined that the top spot ( rf 0 . 77 ) was that of 2 - chloromethylbenzoyl chloride , the second spot ( rf 0 . 57 ) was phthalide and the bottom spot ( rf 0 . 14 ) was triphenylphosphorous . a large amount of the phthalide was unreacted . 2 - chloromethylbenzoyl chloride ( fig1 ) ( m . w . 189 . 04 g / mol , 600 μl ) was dissolved in dichloromethane ( 10 ml ). triethylamine ( m . w . 101 . 19 g / mol , d = 0 . 726 g / ml , 600 μl = 4 . 3 mmol ) was added and the mixture was cooled to 0 ° c . compound 17 ( m . w . 308 . 14 g / mol , 0 . 5298 g = 1 . 7 mmol ) was added and the mixture was stirred at room temperature overnight while protected from light . the mixture ( green colour ) was washed with hcl ( 2 m , 10 ml ), 5 % nahco 3 ( 10 ml ) and distilled water ( 10 ml ) and dried over sodium sulfate . mixture was concentrated producing 769 . 5 mg of a brown / green oil . this was chromatographed using hexane / ethyl acetate ( 2 : 1 ) resulting in 419 . 4 mg of a brown solid ( rf 0 . 38 ). 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 38 ( 3h , s , ococh 3 ), 4 . 03 ( 4h , m , ish - 1 , ish - 1 ′, ish - 6 and ish - 6 ′), 4 . 66 ( 1h , d , ish - 3 ), 5 . 04 ( 2h , m , ch 2 cl ), 5 . 10 ( 1h , ss , ish - 4 ), 5 . 42 ( 2h , m , ish - 2 / h - 5 ), 7 . 12 ( 1h , d , ar — h ), 7 . 28 ( 1h , m , ar — h ), 7 . 42 ( 1h , m , ar — h ), 7 . 6 ( 3h , m , ar — h ), 8 . 01 ( 2h , dd , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 51 ( ococh 3 ), 43 . 95 ( ch 2 cl ), 70 . 15 ( isc - 1 ), 72 . 78 ( isc - 6 ), 74 . 33 ( isc - 5 ), 78 . 11 ( isc - 2 ), 80 . 52 ( isc - 4 ), 85 . 58 ( isc - 3 ), 122 . 21 ( ar 2 c - 2 / c - 6 ), 123 . 42 , 125 . 65 ( ar 2 c - 4 ), 128 . 03 ( ar 1 c - 6 ), 128 . 07 ( ar 1 c - 2 ), 130 . 60 ( ar 1 c - 5 ), 130 . 73 ( ar1c - 1 ), 131 . 43 ( ar 1 c - 4 ), 133 . 45 ( ar 2 c - 5 ), 133 . 92 , 138 . 54 , 150 . 25 ( ar 2 oco ), 163 . 12 ( ocoarch 2 ono 2 ), 165 . 47 ( arococh 3 ), 169 . 29 ( arc ( o ) or ). 400 mg was dissolved in ch 3 cn / thf ( 6 ml , 4 / 2 v / v ) and treated with agno 3 ( m . w . 169 . 87 g / mol , 0 . 30 g = 1 . 7 mmol ) and refluxed for 4 hours before stirring overnight at room temperature while protected from light . mixture was filtered and concentrated . this was reconstituted in ethyl acetate ( 10 ml ) and water ( 2 ml ). the organic phase was washed with water ( 3 × 2 ml ), brine ( 2 ml ) and dried over sodium sulfate . concentrated , producing an oil which was chromatographed using hexane / ethyl acetate ( 2 : 1 ) resulting in 95 mg of yellow wax - like material . 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 38 ( 3h , s , ococh 3 ), 4 . 01 ( 4h , m , ish - 1 , ish - 1 ′, ish - 6 and ish - 6 ′), 4 . 65 ( 1h , d , ish - 3 ), 5 . 02 ( 1h , t , ish - 4 ), 5 . 41 ( 2h , m , ch 2 ), 5 . 86 ( 2h , ss , ish - 2 / h - 5 ), 7 . 11 ( 1h , d , ar — h ), 7 . 28 ( 1h , t , ar — h ), 7 . 49 ( 2h , q , ar — h ), 7 . 61 ( 2h , q , ar — h ), 8 . 01 ( 1h , d , ar — h ), 8 . 10 ( 1h , d , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 51 ( ococh 3 ), 70 . 37 ( ch 2 ono 2 ), 72 . 78 ( isc - 1 ), 73 . 46 ( isc - 6 ), 74 . 30 ( isc - 5 ), 78 . 01 ( isc - 2 ), 80 . 61 ( isc - 4 ), 85 . 64 ( isc - 3 ), 122 . 19 ( ar 2 c - 2 / c - 6 ), 123 . 40 , 125 . 66 ( ar 2 c - 4 ), 128 . 76 ( ar 1 c - 6 ), 129 . 77 ( ar 1 c - 2 ), 129 . 85 ( ar 1 c - 5 ), 130 . 30 ( ar1c - 1 ), 131 . 41 ( ar 1 c - 4 ), 132 . 44 ( ar 2 c - 5 ), 133 . 25 , 133 . 93 , 150 . 23 ( ar 2 oco ), 163 . 12 ( ocoarch 2 ono 2 ), 164 . 71 ( arococh 3 ), 169 . 28 ( arc ( o ) or ). 3 - chloromethylbenzoyl chloride ( m . w . 189 . 04 g / mol , d = 1 . 33 g / ml , 500 μl = 3 . 5 mmol ) was dissolved in dichloromethane ( 10 ml ). triethylamine ( m . w . 101 . 19 g / mol , d = 0 . 726 g / ml , 600 μl = 4 . 3 mmol ) was added and the mixture was cooled to 0 ° c . compound 17 ( m . w . 308 . 14 g / mol , 0 . 511 g = 1 . 6 mmol ) was added and the mixture was stirred at room temperature overnight while protected from light . the mixture was washed with hcl ( 2 m , 10 ml ), 5 % nahco 3 ( 10 ml ) and distilled water ( 10 ml ) and dried over sodium sulfate . mixture was concentrated producing 1 . 18 g of an oil . this was chromatographed using hexane / ethyl acetate ( 3 : 1 ) resulting in 903 . 4 mg of an oil ( rf 0 . 2 ). 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 37 ( 3h , s , ococh 3 ), 4 . 06 ( 4h , m , ish - 1 , ish - 1 ′, ish - 6 and ish - 6 ′), 4 . 65 ( 3h , ds , ish - 3 and ch 2 cl ), 5 . 03 ( 1h , t , ish - 4 ), 5 . 43 ( 2h , dd , ish - 2 , ish - 5 ), 7 . 10 ( 1h , d , ar — h ), 7 . 32 ( 1h , t , ar — h ), 7 . 47 ( 1h , t , ar — h ), 7 . 57 ( 2h , m , ar — h ), 8 . 00 ( 2h , m , ar — h ), 8 . 10 ( 1h , s , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 49 ( ococh 3 ), 45 . 01 ( ch 2 cl ), 70 . 41 ( isc - 1 ), 72 . 76 ( isc - 6 ), 74 . 20 ( isc - 5 ), 78 . 04 ( isc - 2 ), 80 . 64 ( isc - 4 ), 85 . 63 ( isc - 3 ), 122 . 18 ( ar 2 c - 2 / c - 6 ), 123 . 39 , 125 . 67 ( ar 2 c - 4 ), 128 . 61 ( ar 1 c - 6 ), 129 . 28 ( ar 1 c - 2 ), 129 . 36 ( ar 1 c - 5 ), 129 . 52 ( ar1c - 1 ), 131 . 41 ( ar 1 c - 4 ), 133 . 02 ( ar 2 c - 5 ), 133 . 93 , 137 . 57 , 150 . 20 ( ar 2 oco ), 163 . 16 ( ocoarch 2 ono 2 ), 164 . 94 ( arococh 3 ), 169 . 37 ( arc ( o ) or ). this was dissolved in ch 3 cn / thf ( 6 ml , 4 / 2 v / v ) and treated with agno 3 ( m . w . 169 . 87 g / mol , 0 . 67 g = 3 . 9 mmol ) and refluxed for 4 hours before stirring overnight at room temperature while protected from light . mixture was filtered and concentrated . this was reconstituted in ethyl acetate ( 10 ml ) and water ( 2 ml ). the organic phase was washed with water ( 3 × 2 ml ), brine ( 2 ml ) and dried over sodium sulfate . concentrated , producing an oil which was chromatographed using hexane / ethyl acetate ( 1 : 1 ) resulting in 184 . 3 mg of yellow wax - like material . 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 38 ( 3h , s , ococh 3 ), 4 . 09 ( 4h , m , ish - 1 , ish - 1 ′, ish - 6 and ish - 6 ′), 4 . 65 ( 1h , d , ish - 3 ), 5 . 05 ( 1h , t , ish - 4 ), 5 . 5 ( 4h , dd , ish - 2 , ish - 5 and ch 2 ), 7 . 12 ( 1h , d , ar — h ), 7 . 29 ( 1h , t , ar — h ), 7 . 50 ( 3h , m , ar — h ), 7 . 65 ( 1h , d , ar — h ), 8 . 01 ( 2h , broad s , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 51 ( ococh 3 ), 70 . 37 ( ch 2 ono 2 ), 72 . 78 ( isc - 1 ), 73 . 46 ( isc - 6 ), 74 . 30 ( isc - 5 ), 78 . 01 ( isc - 2 ), 80 . 61 ( isc - 4 ), 85 . 64 ( isc - 3 ), 122 . 19 ( ar 2 c - 2 / c - 6 ), 123 . 40 , 125 . 66 ( ar 2 c - 4 ), 128 . 76 ( ar 1 c - 6 ), 129 . 77 ( ar 1 c - 2 ), 129 . 85 ( ar 1 c - 5 ), 130 . 30 ( ar1c - 1 ), 131 . 41 ( ar 1 c - 4 ), 132 . 44 ( ar 2 c - 5 ), 133 . 25 , 133 . 93 , 150 . 23 ( ar 2 oco ), 163 . 12 ( ocoarch 2 ono 2 ), 164 . 71 ( arococh 3 ), 169 . 28 ( arc ( o ) or ). 4 - chloromethylbenzoyl chloride ( m . w . 189 . 04 g / mol , 650 μl ) was dissolved in dichloromethane ( 10 ml ). triethylamine ( m . w . 101 . 19 g / mol , d = 0 . 726 g / ml , 600 μl = 4 . 3 mmol ) was added and the mixture was cooled to 0 ° c . compound 17 ( m . w . 308 . 14 g / mol , 0 . 5320 g = 1 . 7 mmol ) was added and the mixture was stirred at room temperature overnight while protected from light . the mixture was washed with hcl ( 2 m , 10 ml ), 5 % nahco 3 ( 10 ml ) and distilled water ( 10 ml ) and dried over sodium sulfate . mixture was concentrated and was chromatographed using hexane / ethyl acetate ( 2 : 1 ) resulting in 100 mg of white solid material . 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 35 ( 3h , s , ococh 3 ), 4 . 04 ( 4h , m , ish - 1 , ish - 1 ′, ish - 6 and ish - 6 ′), 4 . 6 ( 4h , m , ish - 3 and ch 2 cl , imp ), 5 . 04 ( 1h , d , ish - 4 ), 5 . 42 ( 2h , t , ish - 2 , ish - 5 ), 7 . 09 ( 1h , d , ar — h ), 7 . 26 ( 1h , t , ar — h ), 7 . 47 ( 2h , m , ar — h ), 7 . 51 ( 1h , q , ar — h ), 8 . 00 ( 1h , d , ar — h ), 8 . 06 ( 2h , m , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 51 ( ococh 3 ), 44 . 87 ( ch 2 cl ), 70 . 47 ( isc - 1 ), 72 . 76 ( isc - 6 ), 74 . 11 ( isc - 5 ), 78 . 05 ( isc - 2 ), 80 . 67 ( isc - 4 ), 85 . 64 ( isc - 3 ), 122 . 22 ( ar 2 c - 2 / c - 6 ), 123 . 40 , 125 . 65 ( ar 2 c - 4 ), 128 . 53 ( ar 1 c - 6 ), 128 . 96 ( ar 1 c - 2 ), 129 . 77 ( ar 1 c - 5 ), 130 . 16 ( ar1c - 1 ), 130 . 56 ( ar 1 c - 4 ), 131 . 43 ( ar 2 c - 5 ), 139 . 91 , 142 . 23 , 150 . 23 ( ar 2 oco ), 163 . 14 ( ocoarch 2 ono 2 ), 164 . 91 ( arococh 3 ), 169 . 31 ( arc ( o ) or ). this was dissolved in ch 3 cn / thf ( 6 ml , 4 / 2 v / v ) and treated with agno 3 ( m . w . 169 . 87 g / mol , 75 mg = 0 . 4 mmol ) and refluxed for 4 hours before stirring overnight at room temperature while protected from light . mixture was filtered and concentrated . this was reconstituted in ethyl acetate ( 10 ml ) and water ( 2 ml ). the organic phase was washed with water ( 3 × 2 ml ), brine ( 2 ml ) and dried over sodium sulfate . concentrated , producing an oil which was chromatographed using hexane / ethyl acetate ( 2 : 1 ) resulting in 28 . 3 mg of off - white solid . 1 h nmr δ ( cdcl 3 ) 400 mhz : 2 . 35 ( 3h , s , ococh 3 ), 4 . 04 ( 4h , m , ish - 1 , ish - 1 ′, ish - 6 and ish - 6 ′), 4 . 62 ( 1h , d , ish - 3 ), 5 . 01 ( 1h , t , ish - 4 ), 5 . 41 ( 2h , m , ch 2 ), 5 . 48 ( 2h , s , ish - 2 / h - 5 ), 7 . 09 ( 1h , d , ar — h ), 7 . 31 ( 1h , t , ar — h ), 7 . 48 ( 2h , d , ar — h ), 7 . 55 ( 1h , t , ar — h ), 8 . 00 ( 1h , d , ar — h ), 8 . 10 ( 2h , d , ar — h ). 13 c nmr ppm ( cdcl 3 ) 400 mhz : 20 . 51 ( ococh 3 ), 70 . 44 ( ch 2 ono 2 ), 72 . 76 ( isc - 1 ), 73 . 18 ( isc - 6 ), 74 . 23 ( isc - 5 ), 78 . 02 ( isc - 2 ), 80 . 65 ( isc - 4 ), 85 . 65 ( isc - 3 ), 122 . 19 ( ar 2 c - 2 / c - 6 ), 123 . 41 , 125 . 66 ( ar 2 c - 4 ), 128 . 17 ( ar 1 c - 6 ), 129 . 85 ( ar 1 c - 2 ), 129 . 92 ( ar 1 c - 5 ), 131 . 41 ( ar1c - 1 ), 133 . 93 ( ar 1 c - 4 ), 137 . 19 ( ar 2 c - 5 ), 150 . 24 ( ar 2 oco ), 163 . 14 ( ocoarch 2 ono 2 ), 164 . 75 ( arococh 3 ), 169 . 29 ( arc ( o ) or ). to a solution of isosorbide - 2 - aspirinate 17 ( 0 . 49 g , 1 . 6 mmol ) in dichloromethane ( 10 ml ) was added dcc ( 0 . 33 g , 1 . 6 mmol ), dmap ( 0 . 02 g , 0 . 16 mmol ) and nitrooxy acetic acid ( 0 . 19 g , 1 . 6 mmol ). the mixture was stirred at room temperature overnight before filtering and washing the filtrate with hcl ( 2 × 10 ml , 0 . 1 m ), saturated aqueous nahco 3 ( 2 × 10 ml ) and water ( 2 × 10 ml ). after drying over anhydrous na 2 so 4 , the dichloromethane was removed in vacuo to afford product as crude oil . purification by column chromatography over silica gel using hexane and ethyl acetate ( 5 : 2 ) as eluant yielded compound 23 ( 0 . 38 g ) as colorless oil . ir vmax ( film ) cm − 1 : 1759 . 0 and 1727 . 5 ( c ═ o ), 1643 . 6 ( no 2 ), 1287 . 7 ( no 2 ), 1256 . 3 ( c ( o ) or , aromatic ), 1193 . 5 ( c — o — c ). hrms : requires 411 . 0802 ( m + ), found : ( m + ). δh ( 400 mhz ; cdcl 3 ): 2 . 36 ( 3h , s , ococh 3 ), 2 . 68 ( 1h , d , j 7 . 52hz , is - h ), 3 . 61 ( 1h , q , j 6 . 04 , 3 . 52 and 6hz , is - h ), 3 . 92 ( 1h , q , j 6 . 04 , 3 . 52 and 6 hz , is - h ), 4 . 12 ( 2h , m , is - h 2 ), 4 . 33 ( 1h , m , is - h 2 ). 4 . 58 ( 1h , d , j 4 hz , is - h ), 4 . 67 ( 1h , t , j 5 and 5 . 04 hz , is - h ), 5 . 44 ( 2h , s , och 2 o ), 7 . 11 ( 1h , d , j 8 . 04 hz , ar — h ), 7 . 33 ( 1h , t , j 8 and 7 . 52 hz , ar — h ), 7 . 59 ( 1h , t , 7 . 06 and 8 . 26 hz , ar — h ), 8 . 01 ( 1h , d , j 6 . 52 hz , ar — h ). δ 13 c ( 100 mhz ; cdcl 3 ): 20 . 91 ( ococh 3 ), ( ch 2 ), 72 . 36 ( is - c ), 73 . 41 ( is - c ), 73 . 69 ( is - c ), 78 . 96 ( is - c ), 82 . 04 ( is - c ), 85 . 64 ( is - c ), 122 . 77 ( arc - 1 ), 123 . 89 , 126 . 07 , 131 . 81 and 134 . 31 ( aromatic methine ), 150 . 74 ( co ), 163 . 51 ( aroc ( o ) me ), 169 . 59 ( arc ( o ) or ). to a solution of is - 5 - mn ( 5 g , 26 . 65 mmol ) in toluene ( 100 ml ) at 0 ° c . was added triethylamine ( 5 . 52 ml , 3 . 96 mmol ) and acetylsalicyloyl chloride ( 6 . 31 g , 31 . 74 mmol ). the reaction was returned to room temperature and allowed to stir for 6 hours before washing with water ( 2 × 50 ml ), hcl ( 1 m , 2 × 50 ml ), saturated aqueous nahco 3 ( 2 × 50 ml ) and brine ( 100 ml ). the organic phase was dried with na 2 so 4 and solvent removed in vacuo to yield product as oil . this was crystallised from ethanol to yield 5 . 42 g of product as white crystals . ( 58 . 05 %): m . pt . 82 - 84 ° c . ir vmax ( kbr ): 1757 . 6 and 1733 . 4 ( c ═ o ), 1651 . 8 ( no 2 ), 1261 . 4 ( c ( o ) or , aromatic ), 915 . 5 ( ono 2 ) cm − 1 . hrms : requires : 376 . 0645 ( m + + 23 ), found : 376 . 0640 ( m + + 23 ). 1 h nmr δ ( cdcl 3 ): 2 . 37 ( 3h , s , ococh 3 ), 3 . 93 ( 1h , dd , j 6 . 0 , 11 . 5 and 6 . 0 hz , is6a - h ), 4 . 09 ( 3h , m , is1h [ αβ ] and is6h [ β ]), 4 . 58 ( 1h , d , j 4 . 5 hz , is3 - h ), 5 . 03 ( 1h , t , j 5 . 0 and 5 . 5 hz , is4 - h ), 5 . 38 ( 1h , m , is5 - h ), 5 . 45 ( 1h , d , j 3 . 0 hz , is2 - h ), 7 . 12 ( 1h , d , j 8 . 0 hz , ar — h ), 7 . 33 ( 1h , t , j 7 . 5 and 8 . 0 hz , ar — h ), 7 . 60 , ( 1h , t , j 7 . 5 and 8 . 0 hz , ar — h ), 8 . 01 ( 1h , d , j 7 . 5 hz , ar — h ). 13 c nmr ppm ( cdcl 3 ): 20 . 40 ( ococh 3 ), 68 . 88 and 72 . 84 ( isc - 1 and isc - 6 ), 77 . 50 ( isc - 5 ), 80 . 83 ( isc - 4 ), 81 . 08 ( isc - 2 ), 122 . 19 ( arc - 1 ), 123 . 41 , 125 . 61 , 131 . 37 , 133 . 92 ( aromatic methine ), 150 . 24 ( arc - 2 ), 163 . 09 ( aroco ( me )), 169 . 17 ( arc ( o ) or ). pooled plasma / serum solutions ( 4 ml ) were prepared to the correct strength by dilution of plasma with phosphate buffer ph 7 . 4 ( e . g . for a 10 % solution 0 . 4 ml of plasma / serum was added to 3 . 6 ml of phosphate buffer ph 7 . 4 ). following equilibration of the plasma / serum sample at 37 ± 0 . 5 ° c . 100 μl of a stock solution of test compound in acetonitrile ( 1 × 10 − 4 m ) was added and 250 μl aliquots were removed at specified time intervals . samples were transferred to 1 . 5 ml eppendorf tubes containing 500 μl of a 2 % w / v solution of nso 4 . 7h 2 o ( water : acetonitrile , 1 : 1 ). tubes were vortexed for 2 minutes , then centrifuged at 10 , 000 rpm for 3 minutes at room temperature . supernatant was aspirated off and analysed by hplc . the concentration of test compound and metabolites were determined with reference to calibration curves run on that day in the same concentration range and under the same experimental conditions . in order to mimic conditions during the first passage of the drugs after intestinal absorption selected compounds were incubated in phosphate buffer at 37 ° c . in the presence of microsomes from human liver ( hlm ) and intestinal epithelium ( him ). the metabolic fate of the esters under these conditions was also determined by rphplc by measuring the concentration of drug and metabolites in the medium as a function of time . the identity of participating enzymes was confirmed by using purified enzyme in the case of plasma ( buche ) and by repeating the hydrolysis experiments in the presence of esterase specific inhibitors — isoompa for buche and bnpp for carboxylesterase . the buche activity of plasma and microsomal samples was determined using the ellman assay ( ellman et al ., 1964 ). high performance liquid chromatography was performed using a system consisting of a waters 600 pump and controller , waters 717 autosampler and a waters 2996 photodiode array detector controlled by empower software . a hichrom nucleosil c18 column ( 4 . 0 × 250 mm ) was used . mobile phase was filtered prior to use and sparged with helium throughout assays . the final gradient method used was as follows : the method was validated for linearity , precision and for the metabolites for loq and lod . developing a method that gave good separation of aspirin and salicylic acid was a lengthy task as the initial choice of a spherisorb ods c18 column with buffer ph 3 . 19 gave extreme tailing and poor separation ( buffer with a ph of 3 . 19 was chosen as it &# 39 ; s close to their pka &# 39 ; s — aspirin is 3 . 5 and salicylic acid is 2 . 97 [ 2 ] ). this was eventually solved by using the hichrom nucleosil column and buffer ph 2 . 5 . as aspirin is a weak acid with a pka of 3 . 5 reducing the buffer ph below its pka decreases retention as the compound becomes more hydrophobic . the nucleosil column gave excellent peak shape and resolution of the two compounds . initially monohydrate salts were used which produced a large buffer peak at 18 mins . using dihydrate salts eliminated the peak . although nearing the end of this work some large buffer peaks began to appear again . there are also methods for measuring platelet aggregation inhibition , txb 2 , platelet gp2b3a expression , mda and corresponding data that demonstrate that the key compounds have aspirin - like activity . a 500 μl aliquot of blood was mixed with 500 μl of physiological saline and allowed to incubate at 37 ° c . for 10 mins in the incubation well of a chrono - log whole blood aggregometer model 591 / 592 . the sample was then transferred to the assay well , baseline was established and appropriate volume of reagent as above was added . aggregation was monitored over 6 mins with impedance output recorded on a chart recorder . when testing inhibitors whole blood was pre - incubated with appropriate concentrations of inhibitor in dmso at 37 ° c . for a specified length of time before adding the stimulant ( 10 mins with stirring ). three different aggregating agents , aa ( 0 . 5 mm ), adp ( 10 μm ) and collagen ( 5 μg / ml ) were used . where no aggregation response was observed in the presence of an inhibitor a control experiment was performed with no inhibitor present . dmso in high concentrations ( above 0 . 25 %) can induce a concentration dependent change in platelet cytoplasmic ionised calcium . before each experiment a control was run using prp to obtain normal aggregating responses . a sample was also incubated for 10 min at 37 ° c . with 10 μl dmso to ensure it was having no inhibitory effect on the aggregation response . two metabolites of isas , salicylic acid and isosorbide were examined to determine if they had inhibitory effect on platelets . in this model isas exhibited significantly greater potency than aspirin or isda in the inhibition of platelet aggregation to all of the aggregatory stimuli . blood was collected from healthy volunteers who had not taken any drugs known to affect platelet function for at least 14 days prior to the study . platelet rich plasma ( prp ) and washed platelet suspensions ( 2 . 5 × 10 8 platelets / ml ) were prepared from blood as previously described . platelet aggregation was measured by light aggregometry as previously described . briefly , prp and washed platelet samples ( 2 . 5 × 10 8 / ml ) were placed in a whole blood ionized calcium lumi - aggregometer ( chronolog corp ., havertown , pa ., u . s . a ), and ( bio / data corporation ) and incubated for 10 min at 37 ° c ., with stirring at 900 r . p . m ., prior to the addition of aggregating agents . aggregation was initiated by the addition of agonists , and monitored by aggro - link software for at least 6 min . for experiments using inhibitors , aggregation was initiated after 10 min preincubation with these compounds to study the aggregatory potency of adp , the concentration - response ( 0 . 3 - 10 um ) curves were generated . collagen at different concentrations ( 3 - 5 ug / ml ) was also used to induce platelet aggregation . the submaximal concentrations of agonists , i . e . the concentrations that gave approximately 95 % of the maximal aggregation were used to study the effects of inhibitors of aggregation . results were expressed in percent changes in maximal light transmission , with 100 % representing light transmission of platelet medium alone . aspirin inhibits platelet aggregation by attenuating cyclooxygenase mediated synthesis of pgh2 , which is converted in cells to the powerful aggregator txa 2 by thromboxane synthase . txa 2 is highly evanescent and unsuitable for direct measurement but its metabolite txb 2 is generally believed to provide a useful index of the parent . aspirin treatment of tissue in vivo or in vitro is reflected in a depression of txb 2 . in order to compare the compounds of the invention with aspirin in this regard untreated whole blood was allowed to clot in the presence of aspirin or the test compounds over the course of 1 hour at 37 ° c . the samples were then centrifuged . serum was collected and txb 2 was measured using enzyme linked immunosorbent assay ( elisa ) kits obtained from cayman chemicals . the experiments were performed with aspirin in descending concentration from values that gave complete inhibition of txb 2 synthesis . in these assays isas was significantly more potent than aspirin as reflected in a lower ic 50 . in order to analyze receptor expression on the surface of individual platelets and to minimize platelet activation caused by sample preparation procedures , no stirring or vortexing steps were used . the abundance of activated gpiib / iiia and p - selectin on the surface of platelets in the presence and absence of inhibitors was measured by flow cytometry . platelet samples were first activated with agonists either collagen or adp . when platelet aggregation reached 50 % maximal light transmission the reaction was terminated by 10 - fold dilution with physiologic saline . resting platelets were used as control . in most of the experiments , platelets were preincubated with inhibitors for 10 min prior to the addition of agonists . platelet samples were then incubated in the dark without stirring for 5 min at room temperature in the presence of saturating concentrations ( 10 μg / ml ) of p - selectin ( cd62p - apc ). the activated gpiib / iiia platelet receptors were measured using pac - 1 monoclonal antibody at the same concentration as above . pac - 1 specifically recognizes an epitope on the high - affinity gpiib / iiia complex of activated platelets at or near the platelet 5 . following incubation , samples were diluted in facs flow fluid and analyzed within 5 min using a bd facsarray ( bd biosciences , oxford , uk ). flow cytometry was performed on single stained platelet samples as described before 3 . the instrument was set up to measure the size ( forward scatter ), granularity ( side scatter ) and cell fluorescence . a two - dimensional analysis gate of forward and side scatter was drawn in order to include single platelets and exclude platelet aggregates and microparticles . antibody binding was measured by analyzing individual platelets for fluorescence . the mean fluorescence intensity was determined after correction for cell autofluorescence . for each sample , the fluorescence was analyzed using a logarithmic scale . fluorescence histograms were obtained for 10 , 000 individual events . data were analyzed using cytometer rxp software and expressed as a percentage of control fluorescence in arbitrary units . human blood samples were collected by venipuncture into li - heparin sarstedt monovette tubes ( 9 ml ). plasma samples were obtained by centrifugation of blood at 10 , 000 rpm for five minutes and were frozen in aliquots until required for testing . pooled human liver microsomes ( hlm ) were diluted to 5 ml with phosphate buffer ph 7 . 4 ( 0 . 1 m ) giving a stock solution of 2 mg / ml . aliquots were frozen until required for testing . pooled human intestinal microsomes ( him ) were diluted to 5 ml with phosphate buffer ph 7 . 4 ( 0 . 1 m ) giving a stock solution of 80 μg / ml . aliquots were frozen until required for testing . butyrylcholinesterase ( bche ) activity in hlm and him was determined spectrophotometrically ( 405 nm ) at 37 ° c . by the ellman method ( ellman et al ., 1964 ). butyrylthiocholine iodide ( btci ) ( 0 . 5 mm ) was used as the substrate . the reaction took place in a 96 - well plate with a final volume of 250 μl . initially phosphate buffer ph 8 . 0 ( 0 . 1 m ) and microsomes were mixed and incubated for 30 mins . dtnb ( 0 . 3 mm ) and btci were added and the reaction was measured . the assay was also performed using sonication bursts ( 4 × 5 sec ) on the microsomes and placing on ice for 1 min in between . this ensures that the microsomes are open to penetration by reagents [ 5 ] . the activity was calculated according to eqn 1 : table 2 shows the compounds with numbering and the amount of aspirin as a percentage of the initial ester concentration in moles measured at peak aspirin production following addition of candidate esters to buffered human plasma at 37 ° c . at ph 7 . 4 ( phosphate buffer ). half - life and molar % aspirin released in 10 % human plasma half - life and molar % aspirin released in 50 % human plasma 2 . 17 min 46 . 02 % 0 . 83 min 58 . 53 % 4 . 90 min 72 . 23 % 1 . 14 min 85 . 56 % 9 . 72 min 38 . 54 % 1 . 21 ( min ) 53 . 66 % 3 . 63 min 1 . 17 % 0 . 57 ( min ) 1 . 19 % 3 . 76 min 6 . 82 % 0 . 66 ( min ) 6 . 71 % 3 . 32 min 18 . 93 % 0 . 64 ( min ) 28 . 51 % 1 . 29 min 27 . 58 % 0 . 37 ( min ) 17 . 92 % 3 . 68 min 18 . 76 % 0 . 33 ( min ) 27 . 62 % 20 . 63 min 12 . 87 % 4 . 27 ( min ) 18 . 89 % 50 . 22 min 2 . 82 % 1 . 55 ( min ) 4 . 68 % 3 . 59 min 5 . 16 % 0 . 99 ( min ) 7 . 08 % 3 . 28 min 18 . 91 % 0 . 85 ( min ) 17 . 00 % 3 . 17 min 2 . 53 % 1 . 10 ( min ) 3 . 75 % 6 . 23 min 15 . 85 % 2 . 16 ( min ) 14 . 49 % 2 . 86 min 18 . 46 % 1 . 37 ( min ) 22 . 25 % 4 . 43 min 51 . 0 % 0 . 68 ( min ) 60 . 47 % unsubstituted , r = h ( isosorbide - 2 - 4 . 08 min 2 . 95 % not tested not tested aspirinate ) 17 1 . 85 min 74 . 2 % n / a n / a 1 . 9 min & lt ; 2 % n / a n / a not tested not tested 4 . 3 min & lt ; 1 % not tested not tested & gt ; 1 hour & lt ; 1 % not tested not tested 1 . 4 min 45 % not tested not tested 2 . 7 min 48 % not tested not tested 3 . 1 min & lt ; 1 % not tested not tested & lt ; 1 min 72 % not tested not tested & lt ; 1 min 68 % not tested not tested 4 . 1 min & lt ; 1 % not tested not tested 1 . 3 min 21 % not tested not tested & gt ; 5 min & lt ; 1 % not tested not tested 2 . 5 min & lt ; 1 % not tested not tested 3 . 2 min 81 % not tested not tested 2 . 7 min 78 % 5 . 99 min 2 % not tested not tested 3 . 61 min & lt ; 0 . 5 % not tested not tested qualitative hydrolysis screening of is - 2 - aspirinate - 5 - salicylate 2 ( 0 . 1 mm ) was studied using guinea pig , hamster , rabbit and monkey plasma . the purpose of this test was to determine a suitable species for biological testing and preclinical development . the results were also expected to confirm the role of the human enzymes already identified because these are variously distributed in laboratory animals . once a gradient method was successfully developed hydrolysis of 2 in 50 % rabbit plasma was run as the rabbit is a potential model for platelet aggregation studies . the ellman assay revealed bche activity at 1 . 1 μmol / l / min . the results suggest that hamster and monkey would make suitable candidates for preclinical testing . since plasma from these species has similar levels of buche to humans the role of that enzyme in human metabolism is also supported . hydrolysis results for is - 2 - aspirinate - 5 - salicylate , isas ( 2 ) in the presence of intestinal or liver microsomes hydrolysis studies in human blood plasma had indicated that isas ( 2 ) is a successful aspirin pro - drug . this work aimed to broaden the analysis to include liver and intestinal microsomal preparations in order to assess how much aspirin release would occur in other tissues during the absorption phase principally at the gastric epithelium and later in the liver . when the drug was incubated in the presence of human liver microsomes and human intestinal microsomes 9 μm and 56 μm of aspirin were produced ( fig1 ) and ( fig1 ) respectively . this raised the question as to whether this was due to the presence of bche or to some other enzyme ( s ) because whereas human blood contains only butyrylcholinesterase the liver and intestinal epithelium also contain carboxylesterases ( ce )— mainly ce - 1 in the liver and ce - 2 in the intestine . the microsomal preparations was therefore pre - incubated with iso - ompa an established bche inhibitor prior to addition of the pro - drug so as to allow sufficient time to inhibit any bche that might have been present in the microsomal preparations . hydrolysis assays were then carried out as previously described to see what effect if any there was on aspirin production . the use of the specific bche inhibitor did not diminish aspirin production suggesting that some other enzyme is involved . the ellman assay was performed on both microsomal preparations so as to determine what levels of bche are present , if any . only minimal amounts were found ( table 3 . 1 ) and could not be attributed to the high levels of aspirin production . bnpp a know carboxylesterase inhibitor was incubated with him and hlm for 10 mins prior to addition of the drug so as to knock out carboxylesterase activity . a marked decrease in aspirin production was seen and after 60 mins the drug had not disappeared . it can be concluded that isas is a substrate for ce - 1 and ce - 2 as well as buche . these enzymes belong to the same family but have marked difference in substrate specificity . for example the ce enzymes are inefficient in the hydrolysis of positively charged substrates such as those favoured by buche , including choline esters . these enzymes are not normally grouped together . surprisingly in the case of isas , ce - 2 present in the him preparations exhibits the same specificity and efficiency as buche and is as good a vector for aspirin release . the result indicates that more than one enzyme is capable of releasing aspirin from the compounds . the hydrolysis of two non - isosorbide based aspirin esters i . e ., 2 - methoxyphenyl - 2 - acetoxybenzoate ( guaicol ester ) and 2 - acetoxybenzoic acid phenyl ester was evaluated in human intestinal microsomes ( 40 μg / ml ). neither of these esters acts as an aspirin prodrug in human plasma i . e . human plasma esterase action does not cause the release of aspirin from these esters . the phenyl aspirinates produced negligible amounts of aspirin in contact with human intestinal microsomes , illustrating that for these substrates the ce - 2 preference is slightly different to buche , in the presence of which hydrolysis occurs without the evolution of aspirin . however , relative to isas and the nitroxymethyl analogues there was little aspirin production . in other words these compounds are not aspirin prodrugs in human plasma and are inefficient aspirin prodrugs in the presence of ce - 2 . the data illustrates that the interaction between ce - 2 and the prodrugs of the invention is special in that effective aspirin production occurs . etminan m , gill s , samii a . 2003 . effect of non - steroidal anti - inflammatory drugs on risk of alzheimers disease : systematic review and meta - analysis of observational studies . bmj . july 19 ; 327 ( 7407 ): 128 . fiorucci s et al , gastrointestinal safety of no - aspirin ( ncx - 4016 ) in healthy human volunteers : a proof of concept endoscopic study . gastroenterology . 2003 ( 3 ): 600 - 7 . fiorucci , s . and del . soldato , p . ( 2003 ) no - aspirin : mechanism of action and gastrointestinal safety . digestive and liver disease 35 ( suppl 2 ), 9 - 19 . gilmer j . f . gilmer j f , murphy m a , shannon j a , breen c g , ryder s a , clancy j m . et al 2003 , single oral dose study of two isosorbide - based aspirin prodrugs in the dog . pharm . pharmacol . 55 , 10 , 1351 - 7 . gilmer j . f ., moriarty l m , lally m n , clancy j m . 2002 . isosorbide - based aspirin prodrugs . ii . hydrolysis kinetics of isosorbide diaspirinate . european journal of pharmaceutical sciences . 16 ( 4 - 5 ). 297 - 304 . gilmer j f , moriarty l m , clancy j m . 2007 . evaluation of nitrate - substituted pseudocholine esters of aspirin as potential nitro - aspirins . bioorg . med . chem . lett . 2007 jun . 1 ; 17 ( 11 ): 3217 - 20 . epub 2007 mar . 12 . gilmer j f , moriarty l m , mccafferty d f , clancy j m . 2001 . synthesis , hydrolysis kinetics and anti - platelet effects of isosorbide mononitrate derivatives of aspirin . eur j pharm sci . october ; 14 ( 3 ): 221 - 7 . jones g ., 1985 . decreased toxicity and adverse reaction via prodrugs . in bundgaard h ., ( ed .) design of prodrugs , elsevier , amsterdam , 199 - 241 . jurasz , p ., stewart , m . w ., radomski , a ., khadour , f ., duszyk , m . & amp ; radomski , m . w . ( 2001 ). role of von willebrand factor in tumour cell - induced platelet aggregation : differential regulation by no and prostacyclin . british journal of pharmacology , 134 , 1104 - 12 . kelly j p , kaufman d w , jurgelon j m , sheehan j , koff r s , shapiro s . 1996 . risk of aspirin - associated major upper - gastrointestinal bleeding with enteric - coated or buffered product . lancet . november 23 ; 348 ( 9039 ): 1413 - 6 . laheij r j , 2001 , helicobacter pylori infection as a risk factor for gastrointestinal symptoms in patients using aspirin to prevent ischaemic heart disease . aliment pharmacol ther , 15 : 1055 - 9 . levin r i . et al 2004 theriac found nitric oxide - aspirin and the search for the universal cure . j am coll cardiol . 44 , 642 - 3 . li , b ., sedlacek , m ., manoharan , i ., boopathy , r ., duysen , e . g ., masson , p . and lockdridge , o . ( 2005 ) butyrylcholinesterase , paraoxonase , and albumin esterase , but not carboxylesterase , are present in in human plasma . biochemical pharmacology 70 , 1673 - 1684 . mashita et al , taniguchi m ., yokota a ., tanaka a ., takeuchi k ., 2006 oral but not parenteral aspirin upregulates cox - 2 expression in rat stomachs digestion 73 , ( 2 - 3 ), 143 - 132 . morgan g ., 2003 , a quantitative illustration of the public health potential of aspirin . med hypotheses 60 : 900 - 2 . moriarty , l . m . ( 2002 ) studies in the synthesis and in vitro hydrolysis of novel aspirin prodrugs . ph . d thesis , trinity college dublin 2 , ireland . moriarty l m , lally m n , carolan c g , jones m , clancy j m , gilmer j f . discovery of a true aspirin prodrug . j med chem . 2008 dec . 25 ; 51 ( 24 ): 7991 - 9 . newton , j . l ., johns , c . e . may , f . e . b 2004 . the ageing bowel and intolerance to aspirin . alimentary pharmacology & amp ; therapeutics . 19 ( 1 ): 39 - 45 . nielsen n m , bundgaard , h . 1989 . evaluation of glycolamide esters and various other esters of aspirin as true aspirin prodrugs . j med chem . 32 ( 3 ): 727 - 34 . pedersen a . k . & amp ; fitzgerald g . a . 1984 dose - related kinetics of aspirin . presystemic acetylation of platelet cyclooxygenase . n engl j med . 311 , 1206 - 11 . qu s y , li w , chen y l , sun y , hang y q , hong t ., 1990 . the physiologic disposition and pharmacokinetics of guaiacol acetylsalicylate in rats . yao xue xue bao 25 , 664 - 669 . radomski , a ., stewart , m . w ., jurasz , p . & amp ; radomski , m . w . ( 2001 ). pharmacological characteristics of solid - phase von willebrand factor in human platelets . british journal of pharmacology , 134 , 1013 - 20 . soars , m . g ., burchell , b . and riley , r . j . ( 2002 ) in vitro analysis of human drug glucuronidation and prediction of in vivo metabolic clearance . journal of pharmacology and experimental therapeutics 301 , 382 - 390 . st pierre t , jencks w p . 1968 intramolecular catalysis in the reactions of nucleophilic reagents with aspirin . j am chem soc . july 3 ; 90 ( 14 ): 3817 - 27 . tesei a , ricotti l , ulivi p , medri l , amadori d , oli w . tesei a et al . 2003 . ncx 4016 , a nitric oxide - releasing aspirin derivative , exhibits a significant antiproliferative effect and alters cell cycle progression in human colon adenocarcinoma cell lines . 2003 . int j oncol 22 ( 6 ): 1297 - 302 . gilmer j . f . et al 2003 , pharm . pharmacol . 55 , 10 , 1351 - 7 . velzquez c , praveen rao p n , knaus e e . 2005 . j med chem . 2005 jun . 16 ; 48 ( 12 ): 4061 - 7 . novel nonsteroidal antiinflammatory drugs possessing a nitric oxide donor diazen - 1 - ium - 1 , 2 - diolate moiety : design , synthesis , biological evaluation , and nitric oxide release studies . j med chem . june 16 ; 48 ( 12 ): 4061 - 7 . walker j , robinson j , stewart j , jacob s . 2007 does enteric - coated aspirin result in a lower incidence of gastrointestinal complications compared to normal aspirin interact cardiovasc thorac surg . august ; 6 ( 4 ): 519 - 22 . williams f . m , 1989 . williams f m , moore u , seymour r a , mutch e m , nicholson e , wright p , wynne h , blain p g , rawlins m d . 1989 . benorylate hydrolysis by human plasma and human liver . br . j . clin . pharmacol . 28 , 703 - 8 .	2
referring to fig1 a , there is a cots processor board 10 on which is affixed the vpn encryptor 12 , which is a pmc daughter card that makes use of an approved infosec chip . this daughter card is designed to support red / black separation and is not a cots product . the processor board runs on the red side . the backplane 14 isolates power and simple controls and forms another red / black boundary using techniques such as filters 16 18 . the cots processor board 20 typically includes processors and memories 22 , 24 , 26 , and 28 which are interconnected with a data switch 30 . the data switch 30 is interconnected with a vpn encryptor 32 which has a key manager function 34 and a zeroised function 36 which are explained in greater detail hereafter . referring to fig2 , there is a cots general purpose processor board ( gpp ) 38 with an encrypted vpn 40 having a key 42 which is interconnected by way of a bus 43 to a second general purpose processor 44 with an encrypted vpn having a key 48 . this key 48 is the same as key 40 ; therefore , data 49 contained in general purpose processor 38 is encrypted by the vpn card 40 , transferred over the data fabric of bus 43 , is decrypted by the vpn card 46 and received by general purpose processor 44 . the information 49 exchanged between gpp 38 and gpp 44 ( and received at gpp 44 as information 50 ) cannot be intercepted by unclassified gpp 52 or gpp 53 because the data is encrypted as it is transferred over the data fabric or bus 43 . referring to fig3 , gpp 54 with an encrypted vpn 56 and key 58 is shown . this gpp is interconnected through bus 59 to a general purpose processor 60 with an encrypted vpn 62 and key 64 . key 64 is different from key 58 ; therefore , data or message 66 in general purpose processor 54 is not encrypted as data message 67 in gpp 60 . still referring to fig3 , there are two vpn cards 56 and 62 on gpp &# 39 ; s 54 and 60 respectively which are keyed for two different classification levels , e . g . confidential designated pink and secret designated purple and there is a message 66 which gets encrypted and gets put on the bus 59 , and is sent to the gpp 60 via the vpn 62 . this board tries to decrypt the message 66 with the wrong key , so that garbled information is received so it does not get the final message . all the information that goes across the data fabric is unclassified information which is either purely unclassified or classified information that has been encrypted and so unclassified gpps 68 and 69 , cannot access any classified information . accordingly , computers at the secret level can talk to each other . computers at the top secret level can talk to each other . computers at the unclassified level can talk to each other . computers of different classification cannot directly communicate . if , for example , a secret computer tries to talk to a confidential computer the information cannot go through . the only way the user can do that is to go through a government certified device that allows that type of information flow which is called the guard function . the guard function examines the content of messages , rate of messages , and other message parameters and determined , by a series of pre - defined security policies , whether the information should be permitted to cross between classification levels . so each type of gpp has a key at its own classification level and so if it is desired to change these from , for example , from top secret to secret , first the trusted software of this implementation deletes the keys and that makes the two boards unclassified . the key management function of this implementation then provides new keys . for example , if the user wants to change to the confidential level he can have four boards that can run at the confidential level . the user can also use the same boards to process unclassified information by zero zing the key . now the user can run the gpp at the bypass mode and can run unclassified information on it . referring to fig4 , there is an infosec module with a vpn card 64 with keys 66 , 68 , and 70 . there are also cots general - purpose processors ( gpp ) with vpn cards 72 , 74 , 76 , 78 , 80 , and 82 . there are also unclassified gpp = s 84 , 86 , 88 , and 90 . in this arrangement the infosec module 64 controls intra - level communications and key management . it is understood from the previous discussions that information can be passed over the data fabric or bus 91 between like classification levels , but not between different classification levels . it will be understood from fig4 that information can be transferred between different classification levels only by passing the information through the trusted guard function on the infosec module . it can be passed between the unclassified gpp &# 39 ; s 84 , 86 , 88 and 90 . the information can also be passed directly between the boards at one classification level 80 , 82 which are the same classification level . the information can be passed between boards at a different classification level 76 and 78 and all of these information transfers can occur at the same time . if a board at one classification level at gpp 80 attempts to send information to another gpp allocated to a different classification level at gpp 74 that information cannot be passed as was described in connection with fig3 . instead , that information must got through an information security module which contains the keys for all classification levels and includes a trusted guard function which implements the security policies for sending information between different classification levels . if cots gpp 82 has information that needs to be sent to cots gpp 72 which is operating at a different classification level it is first sent to the infosec module . the data is encrypted by the vpn at gpp 82 , goes across the data fabric , is decrypted by the vpn with the orange key . that information and then checked by the trusted guard function . if it meets the security policies , it is re - encrypted with the pink gpp 72 and the information is then sent over the data fabric encrypted with that key , decrypted by the vpn on processor 72 and the information then can be received . referring to fig5 , there is an infosec module with vpn card 92 with keys 94 , 96 , and 98 . there are also cots gpp &# 39 ; s with vpn cards 100 , 102 , 104 , 106 , 108 , and 110 which have respectively keys 112 , 114 , 116 , 118 , 120 , and 122 . there are also unclassified gpp = s 124 , 126 , 128 , and 130 . in this arrangement the encrypted vpn permits dynamic allocation of assets to different security levels . it will be understood from fig5 that the classification level of processors can be changed by the trusted software by deleting the key in the vpm module , zeroizing the cots processor , which means wiping out any information in the memory , and reloading it with a different key . in this way the cots processor can dynamically change from one classification level to another without the need to effect any physical changes to the system . referring to fig6 , an arrangement is shown with an antenna 132 , a t / r switch 134 , a tuner 136 , an fpga card 138 , gpp &# 39 ; s with vpn cards 140 and 142 , which in this instance are set to perform unclassified processing , government authorized cryptographic equipment 144 implemented on the infosec modules discussed earlier , and red side processing gpp with vpn card 146 . there is also a user interface ( i / f ) with vpn card 148 as well as another gpp with vpn card 150 , an exciter with vpn card 152 , a pa 154 , a t / r switch 156 and an antenna 158 . it will be understood from fig6 and fig7 generally , that one possible application of the invention in which the user has a multi - mission system which is to be capable of simultaneously performing communications , signal intelligence ( sigint ) and jamming . conventionally these three capabilities are implemented by three totally separate systems and the security approach used today would prohibit those functions from being implemented simultaneously in the same system . it will be understood that the method and apparatus of this invention can allow information to be separated and allows the two functions to occur simultaneously . the solid line shows the receive communications path from the antenna 158 being received by the tuner 136 implementing a modem in the fpga card 138 in the black side general purpose processor 140 . additional black side processing occurring on the general purpose processor 142 . information then goes to the crypto device 144 which may be the ifosec module 144 described in connection with fig6 . the information then gets the key change as described on fig4 and is sent to the classified processing on the general purpose processor 146 is then sent out to the user to receive the data through the user interface 148 . the information to be transmitted from the user out the radio communication functions is received by the user interface 148 as secret level data and is sent over to a gpp the same classification level where the red side processing of the radio occurs . it is then sent over the data fabric to the crypto logical device located on the information security module 144 where the data is encrypted for transmission . from where it goes to the transmit black side processing at gpp 142 it then goes to a gpp 150 also on the black side where the transmit half of the modem is prepared , over the vpn in this case in the bypass mode because data is being transferred from a black processor to a black processor , out to the excitor 152 and the information is sent through the power amplifier 154 out to the transmit receive ( tr ) switch 156 and transmitted out the antenna 158 . in this way , the user can implement a secure radio using the invention as a reconfigurable software programmable radio . referring to fig7 , an arrangement is shown in which there is an antenna 160 , a tuner 162 , an fpga card 164 , a gpp with vpn card 166 for signal detection , a gpp with vpn card 168 for signal identification , a guard with vpn card 170 , and a gpp with vpn card 172 . there is also a user i / f with vpn card 174 , gpp with vpn card 176 , an exciter with vpn card 178 , a pa 180 and an antenna 182 . it will be understood from fig7 that it is shown that the same hardware configuration used for communications in fig6 can be used simultaneously for signals intelligence ( sigint ) simultaneously with communications signal jamming . for sigint the target signal is received by the antenna 160 and processed by the tuner 162 and then sent to the fpga card 164 which implements a fast transform fft . that information is then passed over the switch data fabric to the general purpose processor 166 which implements the signal detection function . the information is then passed to provide some additional classified processing . in order to accomplish this processing the information is sent to the guard function on the infosec module 170 where it allows information to be passed in an unrestricted way from the unclassified side of the system to the classified side of the system but has a means to insure that no information can accidentally be leaked back in the other direction . the information is then encrypted with the classified level key on the vpn card mounted on the infosec module 170 and sent over to the general purpose processor 168 which is running at the classified level . the processor then does a signal identification . that information is further processed and sent to another computer operating at the same classification level 172 that performs additional processing such as target identification . that information then is reported to the user , operating at the classified level and so it is sent across the vpn across the user interface and out to the user . in this way the user can get the sigint information that was processed by the system . using the same hardware and running at the same time , communication signal jamming may be accomplished . a command comes from the user to perform the jamming through the user interface 174 this is a classified level command that is then sent over the vpn to the general - purpose processor 176 . that information is then sent to the exciter 178 where the rf signal is generated and it is sent to the power amplifier 180 and out the antenna 182 . it will be appreciated that a method and apparatus for operating a multi - level security system has been described which efficiently makes use of all available computer assets . it will also be appreciated that this method and apparatus can make use of off the shelf or other computers , which may be available through commercial sources . while the present invention has been described in connection with the preferred embodiments of the various figures , it is to be understood that other similar embodiments may be used or modifications and additions may be made to the described embodiment for performing the same function of the present invention without deviating therefrom . therefore , the present invention should not be limited to any single embodiment , but rather construed in breadth and scope in accordance with the recitation of the appended claims .	6
the purpose of the present invention is to effect a biochemical treatment or cure of the condition acne vulgaris . the present invention is based on the proposition that the fundamental pathology of acne vulgaris is a deficiency in fat metabolism . this deficiency in fat metabolism is caused by a shortening of supply of vitamins that serve as coenzymes in such metabolic processes . the most important vitamin relating to these metabolic processes is pantothenic acid . nicotinic acid and biotin also contribute significantly to these processes . by replenishing the body with sufficient amount of these vitamins , through systemic administration or topical application to the affected areas , or by a combination of these two venues , the ultimate goal of prevention and cure of the disease process is achieved . and through the effect of these vitamins on the structure of the cell and cell membrane , and in particular , through the effect of pantothenic acid on the systhesis of estrogens , the skin becomes more firm , more smooth , more elastic and more turgid . ultimately , the skin looks younger and the effect of retardation of aging of the skin is achieved . since the treatment of the condition with a sufficient amount of the vitamins is directed at the root of the trouble , the treatment process is expected to be very efficient and very effective . once treatment is initiated , if the dosage is large enough , the response is almost immediate , usually within two or three days of initiating treatment . the first noticeable change is that there is a decrease in sebum secretion on the acne bearing area , notably the face . this is of course due to a decrease in the activity of the sebaceous glands . normally , following an increase in sebum secretion , a full - blown lesion goes through the stages of an eruption of comedone , then a papule is formed , followed by the formation of pustule , cyst , nodule and finally scar . within days of onset of treatment , which probably represents the building up of the vitamins to an optimum level , and following the reduction of sebum production , the development of the comedones and papules is arrested . for pustules and cysts , because the element of infection has already set in , reversing the disease process will be difficult . they have to be dealt with in the conventional manner by expressing and draining the contents . administration of a short course of antibiotics in such instances is well indicated . when these pustules and cysts are all healed , antibiotics should no longer be required , as any such new lesions are not expected to develop from the existing papules . instead , the papules and comedones will start to subside , making the skin much more smooth . this is especially noticeable when the comedones are deeply seated . the normal course of events is for these comedones and papules to grow , to ripe , before they can reach the skin surface and be expressed and drained . with the fat metabolism corrected , these lesions will not grow , instead , they will shrink in the course of a few days . so that , in a matter of weeks , all the lesions will resolve . unless the lesion has gone so far as to reach the stage of infection , the lesion is still in a reversible state , provided that enough of the vitamins are administered . sometimes , when the individual is badly affected by the disease process , even with a large daily dosage of the vitamins , the disease process will take some time to respond . this is because the body has to be saturated with the vitamins before they can exert their effect on the acne lesions . this seems to suggest that , of the many functions these vitamins have to perform in the body , fat metabolism relating to acne vulgaris occupies a very low position in the priority list . it is interesting to note that individuals on weight control with pantothenic acid will frequently develop acne vulgaris when the calorie intake is really low , even if these individuals normally have no inclination to develop acne . this strongly suggests that in fat metabolism , the relief of starvation overrides the relief of acne vulgaris . during this initial stage of treatment , when the body is still in the process of saturating itself with the vitamins , new lesions will continue to form . however , once the body is saturated with these vitamins , new lesions will stop coming up , while at the same time . the already formed lesions will begin to subside . the rapidity of response is related to the dosage administered , up to a certain limit , beyond which the response levels off . for the more severe form of acne lesions , once infection sets in there is no way to deal with the lesion except to drain it , either by expressing it manually , or to wait for it to burst through the skin naturally . once pus is drained , with a sufficient amount of vitamins in the body , the subsequent response will be the same as a comedo in its formation . under normal circumstances , the response is prompt . with the pustules and cysts drained and treated , the whole disease process is under control . continual administration of the vitamins will lead to rapid subsidence of the existing lesions , and new lesions will not be formed . a concomitant administration of antibiotics in such instances will be very helpful . this is because new papules will not be formed , not to say its further progression into pustules and cysts . however , because of the severity of the disease , implying that the vitamins are in extreme short supply , significant improvement will take a longer time , maybe 4 to 5 weeks . aside from the already gross deficiency of the vitamins in the body , which by itself will take a longer time to replenish , another possible reason may be related to an impairment of absorption of these vitamins from the bowel , otherwise the disease process would not be so bad to begin with . this will make a satisfactory blood level more difficult to achieve so that a longer period of time will be required for the clinical response to be observed . here again , once good clinical response is observed , the eventual progress will be sure and steady . in most instances , excellent response is achieved within 3 months of treatment . it is interesting to note that in these patients with severe acne lesions , many already have previous scars left on their face , some of the deeper scars with an uneven base actually become less conspicuous . for more shallow scars , the change is less obvious . one of the earliest and most striking responses seen with this form of treatment is that the pore size of the hair follicle is reduced . an enlarged pore size of the hair follicle is a constant feature of acne vulgaris , and contributes much to the rough look of the facial skin of acne patients . as explained , this is in part a physiological response to increased sebum secretion and in part relates to the hyperkeratinization process of the follicular ducts . in order - to discharge the sebum produced in excessive quantity , the natural thing the gland will do is to increase the size of the pore and the ductal system in an attempt to relieve the obstruction that is likely to ensue . this is the hypertrophy process of the ductal system . however , at this stage of the disease process , there is the hyperkeratinization of the ductal epithelium going on , and this process will narrow the ductal diameter , and will cancel out the original purpose of the hypertrophy process . so , in order to achieve the original intention of making the conduit bigger , the hypertrophic process of the ductal system is further enhanced . this is the reason why the pore size is so greatly enlarged . with the basic deficiency problem corrected by administration of these vitamins relating to fat metabolism , sebum secretion is reduced , and physiologically , a wide - bored hair follicle is no longer required . and since the hyperkeratinization process is also reversed by these vitamins , thus making the ductal system more patent , the whole ductal system can be further reduced so that the size of the hair follicle is greatly and noticeably reduced . this feature of reducing the pore size of the hair follicle alone will make the facial skin a lot finer and younger , very similar to the skin of individuals before puberty . there are , however , two other factors that are thought to play a part in making the skin look younger . there is the direct action of the vitamins on fat metabolism relating to the cell as a whole , and to the cell membrane . the lipids in the body cells are of 2 main types : structural lipids , which form a very important part of the cell membranes and also other parts of the cell ; and neutral fat , stored in the adipose cells of the fat depots . ( 1 ) phospholipids or phosphoglycerides including lecithin or choline phosphoglyceride and cephalin or ethanolamine phosphoglyceride . ( 3 ) certain specialized lipids like the sphingomyelins and cerebrosides of the central nervous system . the biosynthesis of these structural lipids requires the participations of many different enzyme systems . many of these have pantothenic acid , nicotinic acid , and biotin as their coenzymes . this is particularly true of pantothenic acid . it is easy to visualize that the integrity of the cell membrane and the cell as a whole depends very much on these vitamins . with the administration of these vitamins in the course of treatment of acne vulgaris , it is observed that there is definite improvement of the smoothness , firmness , turgidity and elasticity of the skin , particularly the facial skin , making the individual look younger . it is interesting to note that the skin of the face benefits more from the treatment than the other parts of the body skin . this probably relates to the fact that the skin of the face , being exposed to the sun and the weather , and is commonly referred to as the weather - beaten face , is being depleted of the vitamins locally during the wear and tear process , and is being insufficiently replenished because there is an overall deficiency of the vitamins . replacement of these vitamins will eventually return the texture of the skin to its former state . the other factor that may play a part in making the skin look younger probably acts through the effect of the estrogen group of hormones . it is known that the estrogen group of hormones causes the skin to develop a texture that is soft and smooth that is characteristic of the female skin , and will generally make the skin look younger . when there is a very strained supply of pantothenic acid , even though there is a preference in synthesis of the hormones , the optimal amount that is required may not be synthesized . with a liberal replacement of pantothenic acid , the optimal amount of estrogens will be synthesized , and the skin will respond by developing the typical feminine texture that will make the skin feel and look younger . although estrogen is known to make the skin younger , it is seldom administered systemically to achieve this aim , even for the females . the reason is due to the fact that estrogen administration , usually for replacement therapy , aside from having some very unpleasant side effects , is known to have a certain risk of developing cancer . the cause of carcinogenesis is not known . here is a situation where a naturally occurring hormone , once it is being used as a replacement agent , will have the undesirable effect of causing cancer . the probable answer lies in the dosage . it has to be remembered that there is a biochemical variability in the requirements of hormones between individuals . and the exact dosage is different for each individual . the optimal amount that is required is finely tuned by the auto - regulatory mechanism of the body . any excess in amount will have some very undesirable effects . furthermore , the estrogens in fact represent a group of different hormones whose precise functions in the body , the delicate balance of their ratio in terms of absolute amount have not been defined . normally , the body depends on the auto - regulatory system to sort out the details , and it is probably a delicate balance of these hormones , in terms of composition and dosage , that ensure the body to function smoothly , without producing any objectionable effects , not to say the development of cancer . replacement therapy of the estrogens , whatever the combinations and the dosage , will somewhat upset this delicate balance , with a consequence that a small proportion of individuals will develop cancer and other side effects . administration of pantothenic acid , however , can achieve the best possible effect by leaving everything to the auto - regulatory system , whereby the body , be it a male or a female , will have the optimal level of the estrogens in the blood to make the skin look young , and yet can sidestep all the untoward effect of estrogen . trials of the three vitamins separately and in combinations have been conducted . various dosages have also been tried . it has been found that , when administered separately , pantothenic acid is always by far the most effective agent . nicotinic acid is also effective , but is definitely less potent than pantothenic acid . it has an added disadvantage in that , when given in high dosage in the region of 5 gm or more a day , there is a possibility that the patient may suffer from its side effects , notably hepatotoxicity with liver enzyme elevation . biotin is one of the most active biological substances known . as a single agent , its effectiveness is probably less than even nicotinic acid . however , it has the advantage that when given in a dosage as high as 20 mg a day , there is no side effect observed . and in terms of absolute quantity , this is a much smaller dosage than is required of either pantothenic acid or nicotinic acid . using pantothenic acid as the principal agent , combinations of these three vitamins in various strengths were tested . it is found that these three vitamins tend to potentiate each other &# 39 ; s effect . that is to say , they tend to have a synergistic effect . while there are clear biochemical variabilities between different individuals , and depending on their own specific deficiencies in the vitamins , and unless the disease process is so mild that as little as 2 gm may suffice , it is found that a good initial dosage for treatment would consist of a daily dosage of approximately 2 to 10 gm of pantothenic acid , supplemented by approximately 0 . 3 to 3 gm of nicotinic acid , and approximately 0 . 5 to 50 . 0 mg of biotin . the vitamins can be administered individually or in combination . preferably , the vitamins are combined and administered at about 4 - hour intervals so that up to about 5 doses per day are administered . in mild to moderate cases , the response is always very prompt . in just a few days , a good response is normally observed . in severe cases , it may take a few more days for the body to saturate itself with these vitamins before any effect is observed . in any case , a good clinical response is always observed within the first two weeks of treatment irrespective of the initial condition . and , once clinical response is observed , the subsequent response is always steady and satisfactory . because of the nontoxic nature of these vitamins even at high dosage , the treatment regimen involving dosages that are many times above the recommended daily allowance for each of the three vitamins can be continued week after week , without reducing the dosage and without any worry that there may be any side effects developing . the treatment is continued until all the lesions have subsided . depending on the severity of the condition , this treatment period varies from patient to patient . unless the condition is very severe , the length of treatment normally is less than 12 weeks . and in many instances , it takes a much shorter time . normally , by the time all the ache lesion subsides , the body will be so saturated with the vitamins that cessation of treatment for a limited period of time will not lead to the recurrence of the disease process . however , with these patients , there is probably a problem with their absorption of the vitamins , or due to some biochemical variation , there is a higher requirement of these vitamins , the disease process frequently recurs after a period of time , though the severity is much less most of the time . for this reason , it is always advisable to put these patients on a maintenance regimen . because of the wide range of biochemical variation between individuals , the maintenance dosage varies from individual to individual . on the average , even for those that are severely affected , a daily maintenance dosage consisting of about 2 gm of pantothenic acid , about 300 mg of nicotinic acid and about 5 mg of biotin is normally sufficient . for those that are only mildly affected , a lower maintenance dosage is possible . for those who still have occasional acne eruptions , the simple thing to do is to increase the pantothenic acid dose . the effect of the vitamins on the skin texture begins very soon after the commencement of the treatment regime . in about 2 to 3 weeks , the skin , especially the facial skin and the skin that is normally exposed , shows signs of increased smoothness , and is more turgid and elastic . this effect of the vitamins on the structure of the cells and cell membranes , and indirectly through the action of estrogens has been explained earlier . the treatment regimen is aided by the topical application of creams made up of pantothenic acid in concentration of approximately 0 . 5 to 25 % by weight , nicotinic acid in concentration of approximately 0 . 5 to 10 % by weight , and biotin in concentration of approximately 0 . 02 to 0 . 5 % by weight . preferably , the pantothenic acid , nicotinic acid and biotin are present in the dermatologically acceptable carrier at a ratio of approximately 10 : 2 . 5 : 0 . 5 , respectively . treatment of ache vulgaris with topical application alone is effective in certain mild cases . in more severe cases , its role is more of a supportive nature in supplementing systemic treatment . even with maintenance therapy , topical application about 1 to 6 times a day is more of an adjuvant nature to that of systemic therapy . aside from the effectiveness obtained from administration of these vitamins , either systemically or topically , or a combination of sytemic and topical application , another major benefit from this treatment protocol is that there are no side effects experienced and that there are no contraindications to its application . this is because these agents are vitamins , they are natural foods required by the body , and hence have no unwanted side effects , even at the high . dosage level recommended . a brief account of the three vitamins is perhaps warranted here . chemistry . pantothenic acid , (+)-( r )- 3 -( 2 , 4 - dihydroxy - 3 , 3 - dimethylbutyramido ) propionic acid , is an optically active organic acid and biological activity is characteristic only of the d isomer . the vitamin functions in the body following its incorporation into coenzyme a . pharmacological actions . pantothenic acid has no outstanding pharmacological actions when it is administered to experimental animals or normal man . the vitamin is essentially nontoxic ; as much as 10 gm can be given daily to man without producing symptoms . see , dumm , m . e . and ralli , e . p ., metabolism 2 , 153 ( 1953 ). in accordance with martindale , the extra pharmacopoeia ( 1989 ), the adverse effects of pantothenic acid consist of just one sentence : &# 34 ; pantothenic acid is reported to be generally nontoxic .&# 34 ; physiological functions . coenzyme a , the physiological active form of pantothenic acid , serves as a cofactor for a variety of enzyme - catalyzed reactions involving transfer of acetyl ( two - carbon ) groups ; the precursor fragments of various lengths are bound to the sulfhydryl group of coenzyme a . such reactions are important in the oxidative metabolish of carbohydrates , gluconeogenesis , synthesis and degradation of fatty acids , and the synthesis of sterols , steroid hormones , and porphyrins see , wright , l . d ., &# 34 ; pantothenic acid &# 34 ;, present knowledge in nutrition , the nutrition foundation , washington , d . c ., pp . 226 - 231 ( 1976 ). human requirements . according to martindale , the extra - pharmacopoeia , 29th edition ( 1989 ), &# 34 ; pantothenic acid is widely distributed in foods . meat , legumes , and whole grain cereals are particularly rich sources ; other good sources include eggs , milk , vegetables , and fruits . recommended daily intakes of pantothenic acid have not been set in the u . k . or in the u . s ., but human requirements are adequately met by a daily intake of about 4 to 10 mg .&# 34 ; according to goodman and gilman &# 39 ; s the pharmacological basis of therapeutics , &# 34 ; pantothenic acid is a required nutrient , but the magnitude of need is not precisely known . accordingly , the committee on dietary allowances provides provisional amounts in the form of ranges of intakes ( in different age groups ). for adults , the provisional allowance is 4 to 7 mg per day . intakes for other groups are proportional to calorie consumption . ( thus , infants will require 2 - 3 mg per day , children and adolescents 3 - 7 mg per day .) in view of the wide - spread distribution of pantothenic acid in foods , dietary deficiency is very unlikely .&# 34 ; chemistry . nicotinic acid is chemically pyridine - 3 - carboxylic acid . it is a white , odorless or almost odorless , crystal or crystalline powder . it is also known as niacin , a term introduced to avoid confusion between the vitamin and the alkaloid nicotine . nicotinic acid functions in the body after conversion to either nicotinamide adenine dinucleotide ( nad ) or nicotinamide adenine dinucleotide phosphate ( nadp ). it is to be noted that nicotinic acid occurs in these two nucleotides in the form of its amide , nicotinamide , so that , for practical purposes , administration of nicotinic acid or nicotinamide are one and the same thing . adverse effects . nicotinic acid produces frequent adverse effects , but they are usually not serious , tend to decrease with time , and can be managed easily . the exact dosage that will give rise to adverse effects probably varies from individual to individual , and is difficult to determine . however , it is mentioned in martindale , the extra pharmacopoeia ( 1989 ), that massive doses of nicotinic acid , usually 3 to 6 gm daily as a hypolipidaemic agent , has been administered and studied in several clinical trials , with some side effects being observed . and in the present study , adverse effects have not been observed with a maximum daily dosage of 1 . 0 gm . in fact , this complete absence of side effects of nicotinic acid at 1 . 0 gm a day is unique , and may be related to the simultaneous administration of pantothenic acid . it is not an uncommon experience to note that when the b complex vitamins are prescribed to patients in dosages ranging from a few times to a dozen times higher than the recommended daily allowance , acne vulgaris lesions begin to erupt a few days after the initiation of treatment . the following is a possible explanation . during the administration of the b complex vitamins , the biochemical reactions requiring the participation of these vitamins are potentiated due to the increase in concentration of these vitamins . these chains of biochemical reactions may also require the participation of pantothenic acid , so that pantothenic acid reserved for fat metabolism actually decreases despite the fact that it is also included in the b complex . this is because the amount of pantothenic acid included in the b complex is just not enough . other acneigenic drugs probably act through the same mechanism of depleting that portion of pantothenic acid that is reserved for fat metabolism . to reason along this line , it can be said that the &# 34 ; side effects &# 34 ; of acne due to the b complex can be relieved by pantothenic acid . similarly , the various side effects of nicotinic acid is being relieved by the simultaneous administration of pantothenic acid . human requirements . the recommended allowance of the dietary allowances committee of the national research council , expressed in nicotinic acid equivalents , is 6 . 6 mg / 1000 kcal . for people who consume few calories , daily intake should not fall below 13 mg . chemistry . biotin is also known as coenzyme r or vitamin h . chemically , it is cis - 5 -( hexahydro - 2 - oxo - 1h - thienol - 3 , 4 - d - imidazol - 4 - yl ) valetic acid . it is a practically white , crystalline powder , and is only very slightly soluble in water and in alcohol . adverse effects and pharmacological actions . relatively large amounts of biotin have been administered to man with impunity . as a therapeutic agent , large doses , 5 to 10 mg daily , are administered to babies with infantile seborrhea with very good response and no adverse effects . human requirements . the daily requirement of adults for biotin has been assigned a provisional value of 100 to 200 micrograms by the committee on dietary allowances . about 100 patients with acne vulgaris in varying degrees of severity , aged between 10 and 35 ( the majority being in the range of 13 to 25 ) were given a combination of approximately 10 gm of pantothenic acid , 1 . 0 gm of nicotinic acid and 15 mg of biotin daily in divided doses four times a day . a cream containing 20 % of pantothenic acid , 5 % of nicotinic acid , and 0 . 2 % of biotin by weight was also applied to the affected area 4 times a day . within a few days , the secretion of sebum was markedly reduced , resulting in a much less greasy appearance . unless the disease process was very severe , the ache lesions also responded by regressing in size within the first few days of initiating treatment . new eruption became noticeably fewer . pore size of the hair follicles became smaller . the improvement was further enhanced if the patient adhered to a diet containing little or reduced oily or creamy foods . a premenstrual flare was normally still present initially , though the degree was definitely a lot less . this probably relates to the fact that the body initially is quite depleted of the vitamins , particularly pantothenic acid . however , with a few more weeks of treatment , by the time the next period occurred , the premenstrual flare was minimal . as a matter of academic interest , 20 patients were put on the systemic treatment only without the concomitant local application of the creams , and 20 patients were treated with local application of the cream only . it was found that those who were treated with systemic therapy only , the result was still extremely good , except that the response was just a bit delayed because with local application , the concentration of the vitamins is achieved sooner . however , with local application of the cream alone , though a definite clinical response was still achieved , it never completely eradicated the disease process unless the nature of the disease process was very mild . all this time , about 2 to 3 weeks after the treatment began , the existing ache lesions continued to subside . new lesions only came up very occasionally . along with the decrease in size of the pore of the hair follicles , the skin became more smooth , firmer , more elastic and more turgid , making the appearance such younger . the patient was more agile together with an improvement of the general well - being . in fact , this improvement in agility and general well - being was even more remarkable with these ache patients than the patients being put on a low calorie diet , further enhancing the belief that pantothenic acid is a most important vitamin in the body . with due consideration of its effect on the cell as a whole and on the cell membrane , its strategic position in the common metabolic pathway , and its ubiquitous occurrence in the cells ( which is another implication of its importance ), it will come as no surprise that pantothenic acid may eventually prove to be an anti - aging factor to the organism as a whole . that is to say , it not only improves the appearance and texture of the skin , but it has the potential of improving the longevity of the organism as a whole . however , to prove this point , a long - term study will be necessary . it will be recognized by those skilled in the art that changes may be made to the above - described embodiments of the invention without departing from the broad inventive concepts thereof . it is understood , therefore , that this invention is not limited to the particular embodiments disclosed , but it is intended to cover all modifications which are within the scope and spirit of the invention as defined by the appended claims .	0
fig4 shows the double alternate interconnection . the symbols are the same as those previously used . phases ac 1 ( aqueous solution subjected to the extraction procedure ) and ac 2 ( elution aqueous solution ) flow in opposite directions . the organic phase alternatively flows from the extraction reactors to the elution reactors forming one single double cycle . fig5 registers the alternate interconnection in closed cycles . the organic phase circulates from each extraction reactor to each stripping reactor in parallel cycles . fig6 shows the alternate zig - zagging interconnection . the organic phase flows in a simple cycle , alternating from the extraction to the elution reactors . finally , the scope of this improvement comprises any &# 34 ; alternate &# 34 ; solvent extraction process particularly for metals involving the main operations of loading and unloading of an organic solvent . as examples of organic solvents suitables for the extraction of metals it can be mentioned : oximes , amines , phenols , ketones , alcohols , fatty acids , organophosphoric acids , naphthenic acids , etc . similarly , some of the elements which can be extracted are : beryllium , boron , cadmium , cobalt , copper , gold , nickel , phosphorus , tungsten , thorium , silver , uranium , rare earths , zinc , and many other metals . all these cases are suitable to apply to this improvement . experiments carried out lead to the conclusion that the economic yield of this new system of the present invention represents values that are far superior to those of the counter current flow system , and from similar to superior compared with the yields of the crossed flow system . yet , the present system does not require additional installations and also it does not require more organic inventory than that used in the counter current system ( it requires less than the crossed flow system ), in spite of the fact that the recovery factor is higher and the effective load of the organic phase is higher too . from the example that follows as shown in the following chart , the best result of the invention may be appreciated , as compared to the known procedures . the following example is included to illustrate the invention . the example is illustrative only and does not constitute limitations on the invention . an aqueous feed solution to be extracted was prepared having a concentration of copper of 25 grams per liter ( g / l ) and the ph 2 . 5 . pure aqueous stripping solution was prepared having a copper concentration of 10 g / l and 400 g / l of sulfuric acid . the organic phase was prepared diluting a selective reagent ( a substituted oxime , commercially known as lix ), in kerosene . the equipment used were laboratory scale mixer - settlers . the volumetric ratios of the organic phases to the aqueous phases were : 4 . 0 for the extraction stages and : 2 . 0 for the stripping stages . in all the cases the flow of the aqueous feed solution to be extracted was extrapolated ( with comparative purposes ) to 25 milliliters per minute . ( a ) using a co - current flow like that indicated in fig1 . ( d ) the proposed alternate flow used in fig6 ( similar results were obtained using the arrangements of fig4 and 5 ). the copper analysis profile of each arrangement is indicated in the table , the concentrations being in grams per liter . table______________________________________ casesstages a b c d______________________________________1 . sup . st extraction organic 4 . 0 8 . 0 6 . 3 6 . 2 aqueous 17 . 0 17 . 8 8 . 0 9 . 02 . sup . nd extraction organic 5 . 5 6 . 2 3 . 5 3 . 6 aqueous 11 . 0 7 . 0 2 . 0 2 . 63 . sup . rd extraction organic 6 . 7 3 . 5 2 . 4 2 . 9 aqueous 8 . 0 1 . 0 0 . 4 0 . 21 . sup . st stripping organic 4 . 2 2 . 9 2 . 5 2 . 0 aqueous 15 . 0 20 . 2 13 . 2 11 . 82 . sup . nd stripping organic 2 . 4 2 . 0 2 . 0 2 . 3 aqueous 18 . 6 22 . 0 11 . 0 19 . 63 . sup . rd stripping organic -- -- -- 2 . 2 aqueous -- -- -- 22 . 4effective organic loading ( per cycle ) 4 . 3 6 . 0 2 . 1 6 . 2copper extracted % 68 96 98 . 4 99 . 2relative flows used : organic 100 100 300 100aqueous feed sol . 50 50 150 50aqueous strip . sol . 25 25 25 25______________________________________ the results of the example shown ( and of many other similar experiments performed with other parameters ) indicate that the cases c and d give always the best performance in terms of copper recovery , but case c requires ( for the same performance ) three times the organic volume of case d , so greatly increasing its expensive inventory . on the other hand , the effective organic load is better for case d , in such a way that with the same circuit and organic volume it could treat 25 % more aqueous feed solution than case b .	2
a terminal unit for an electric motor according to an embodiment of the present invention will be described referring to fig1 and 2 . as shown in fig1 a through hole 6 for taking out leads 7 of windings of respective phases of a stator 2 and for mounting a terminal base 20 for connecting the leads 7 with power cables 70 is formed on a housing 1 of an electric motor . the terminal base 20 is fixed on the housing 1 of the electric motor at a periphery or at least in the vicinity of the through hole 6 by means of fixtures such as set screws ( not shown ). in this embodiment , the terminal unit has six power cable connection terminals . as shown in fig2 six terminal mounts are formed on the terminal base 20 and six lead connectors 21 are respectively attached to the six terminal mounts . the six power cable connection terminals are constituted by the six terminal mounts of the terminal base 20 , the six lead connectors 21 and six screws 24 fixed to the six lead connectors 21 . each of the lead connectors 21 has a presser portion 22 for connection with an end of the lead 7 and a conducting portion 23 formed integrally with the presser portion 23 , for electric connection with the power cable 70 . each end of the lead 7 is connected with the lead connector 21 by the presser portion 22 formed at an end of the lead connector 21 towards the end of the lead 7 . the conducting portion 23 at the other end of the lead connector 21 is made in contact with a terminal member 84 of the power cable 70 by means of the screw 24 so that the lead 7 is electrically connected with the power cable 70 . the lead connector 21 is arranged so that the presser portion 22 is positioned below , i . e ., more inside than , the conducting portion 23 and the end of the lead 7 is inserted into the presser portion 22 from underside and fitted with the presser portion 22 . specifically , the presser portion 22 is positioned more closer to the central axis x - x of the rotor shaft 4 than the conducting portion 23 on a plane perpendicular to the central axis x - x . an upper end of the conducting portion 23 is bent at substantially right angle to come in contact with the power cable 70 at the upper position of the terminal base 20 . the terminal box 10 is arranged so as to cover the terminal base 20 and the terminal base 20 is arranged to be positioned at extremity in the terminal box 10 . a reference numeral 11 denotes a lid of the terminal box 10 . the six power cable connection terminals for connection with the power cables 70 are formed stepwise , on the terminal base 20 in two rows . three terminal mounts are provided on each row and the lead connectors 21 are mounted on the terminal mounts to form the six terminals with the screw 24 . the terminal members 84 attached to the ends of the power cables 70 are fixed to the conducting portion 23 of the lead connector 21 by means of the screw 24 to come in contact with the conducting portion 23 . as shown in fig1 and 2 , the terminal base 20 is positioned at the extremity in the terminal box 10 to form a sufficient space for drawing the power cables 70 with a large radius of curvature , so that power cables of large diameter can be connected to the lead connector 21 with ease . [ 0038 ] fig3 shows another embodiment of the terminal base having three power cable connection terminals . [ 0039 ] fig4 a - 4 d are detailed views of the lead terminal 21 shown in fig1 - 3 . the lead terminal 21 is formed from conductive material to have a shape of a hook . the presser section 22 is formed cylindrically at the bottom of the lead terminal 21 for fitting the end of the lead 7 by caulking . the conducting section 23 is formed integrally with the presser portion 22 and bent at substantially right angle to form an end part . the end part of the presser portion 23 is formed into two forks to allow the screw 24 to be inserted therebetween . a surface of the two forks are arranged to lie perpendicular to a direction of insertion of the lead 7 . the forked end of the conducting portion 23 constitutes the power cable connection terminal cooperatively with the screw 24 . [ 0040 ] fig5 a - 5 d are detailed views showing mounting of the lead connector 21 on the terminal base 20 . a nut 25 is fixed at each of the terminal mounts of the terminal base 20 by hot - melt fitting , as shown in fig5 b , 5 c and 5 e . the screw 24 is threadedly engaged with the nut 25 . grooves 26 for guiding the forked ends of the conducting portion 23 are formed at the terminal mount on both sides of the screw 24 . the end of the lead 7 is inserted into the cylindrical presser portion 22 of the lead connector 21 and caulked to be fixed therewith . the engagement of the screw 24 on the nut 25 is loosen to form a gap between a head of the screw 24 and the nut 25 . then , the forked ends of the conducting portion 23 are inserted into the gap to position a threaded rod of the screw 24 therebetween . the forked ends are guided by the grooves 26 to be inserted below the head of the screw 24 , as shown in fig5 d and 5 e . the terminal member 84 of the power cable 70 is inserted between the head of the screw 24 and the forked ends of the conducting portion 23 and the terminal member and the lead connector 21 are fastened together to be electrically connected with each other by rotating the screw 24 to be fitted with the nut 25 . thus , the power cable 70 is connected with the lead of the winding of the rotor . the attachment of the terminal base and the terminal box to the housing of the electric motor will be described . first , the ends of the leads 7 of the windings are drawn out of the housing 1 through the through hole 6 and the lead connectors 21 are fixed to the respective ends of the leads 7 by inserting the ends into the cylindrical presser portions 22 and pressing the presser portions 22 towards the respective ends . then , the terminal base 20 is mounted on the housing at the periphery of the through hole 6 . the lead connector 21 is fitted to the terminal mount by inserting the forked ends of the conducting portion 23 into the gap between the nut 25 and the screw 24 and rotating the screw 24 to be fitted into the nut 24 . then , the terminal box 10 is mounted on the housing 1 so that the terminal base 20 is positioned at extremity in the terminal box 10 . finally , the lid 11 is fitted on the terminal box 10 . after the assemble of the terminal base and the terminal box is completed , an inspection of the winding is performed . since the lead connectors 21 are fitted on respective terminal mounts of the terminal base 20 to fix the positions of respective leads 7 , the inspection of the windings can be performed easily by moving a prove to the fixed positions of the leads 7 . the leads 7 are connected with the lead terminals below the terminal base 20 with the substantially same orientation as the lead 7 is drawn out of the housing 1 at the position of the through hole 6 . therefore , the leads 7 do not occupy any substantial space in the terminal box 10 . the power cables 70 are connected with the power terminals in a plane substantially parallel to an upper surface of the housing 1 in a sufficient space in the terminal box 10 . the power cables 70 can be connected with the power cable connection terminals without being bent at small radiuses of curvature , to make a connection operation easy . in the above first embodiment , the forked end of the conducting portion 23 of the lead connector 21 is formed above the presser portion 22 in the direction of inserting the lead 7 into the presser portion 23 , as shown in fig4 . namely , the forked end of the conducting portion 23 is formed across a line of insertion of the lead 5 into the cylindrical presser portion 22 . with this arrangement , the end of the lead 7 may reach the forked end of the conducting portion 23 to cause an obstacle in inserting the lead connector 21 into the terminal base . particularly , the obstacle may frequently occur in the case where the cut end of the lead 7 is not sufficiently trimmed . in the case of the lead comprising a hard and thick enamel wire , even if the cut wire is sufficiently trimmed before insertion into the presser portion 22 , the end of the lead 7 may deform to have an irregular form while inserting the end into the presser portion 22 and caulking the presser portion 22 towards the end , to disturb the fitting of the lead connector 21 to the terminal base . in order to overcome the above problem , a lead connector 21 ′ having a presser portion 22 ′ with a closed end as shown in fig6 may be adopted . with this structure , the inserted end of the lead 7 is brought into contact with the closed end of the presser portion 22 ′ to prevent the end of the lead 7 from obstructing the fitting of the lead connector 22 ′ into the terminal base . with this structure , however , it would be difficult to find out a lead insufficiently inserted into the presser portion 22 ′. [ 0048 ] fig7 a - 7 d show an alternative of the lead connector 21 , which is capable of preventing the end of the lead 7 from obstructing the mounting of the lead connector on the terminal base 20 and also confirming a sufficient insertion of the end of the lead 7 into the presser portion . a lead connector 121 is formed from conducting material and comprises a cylindrical presser portion 122 for connection with an end of the lead 7 by caulking and a conducting portion 123 formed integrally with the presser portion 122 in the same manner as the lead connector 121 shown in fig4 but different from the lead connector 121 in a structure of the conducting portion 123 . the conducting portion 123 comprises a forked end 123 a for the power cable connection terminal , and a midsection 123 b for connecting the forked end 123 a and the presser portion 122 . the midsection 123 b extends from the presser portion 122 in a direction of insertion of the lead 7 and bent at a position apart from an end of an upper end plane of the presser portion 122 at right angle to form a wall 123 c parallel to the end plane of the presser portion 122 , and bent at right angle to extend in the direction of insertion of the lead 7 and then bent at right angle to form the forked end 123 a . as shown in fig7 c and 7 d , the end of the lead 7 is inserted into and through the presser portion 122 to be brought into contact with the wall 123 c of the midsection 123 b which is parallel to the upper plane of the presser portion 122 . in this insertion , a load of insertion force increases when the end of the lead 7 comes in contact with the wall 123 c to notify an operator of the contact with the wall 123 c . a clearance between the wall 123 c and the presser portion 122 is utilized as a window 123 d for confirming a connection between the lead 7 and the presser portion 122 . the end of the lead 7 is arrested by the wall 123 c not to reach the position of the forked end 123 a , not to obstruct the fitting of the lead connector 121 to allow the operator to easily fit the lead connector to the terminal base . [ 0051 ] fig8 shows another embodiment of the lead connecting member . the lead connecting member 221 differs from the lead connecting member 121 shown in fig7 in a structure of the midsection 223 b of the conducting plate 223 . the midsection 223 b extending from a presser portion 222 is bent at right angle to extend parallel to an upper face of the calking portion 222 and further bent at 180 ′ to form a wall 223 c by the folded plates for preventing access of the end of the lead 7 to the conducting plate 223 . the conducting plate 223 is then bent at right angle to extend in the direction of insertion of the lead 7 and further bent at right angle to form the forked end 223 a . a gap 223 d is formed between the wall 223 c and the upper end face of the presser portion 222 . the function and effects are the same as that of the lead connector 121 as shown in fig7 . [ 0052 ] fig9 shows still another embodiment of the lead connecting member . an upper end face of a cylindrical conducting portion 322 is closed by a wall 323 c to prevent access of the end of the lead 7 . the wall may be formed by bending the midsection 323 b of the conducting portion 323 . a window 323 d is formed at the upper and side position on the presser portion 322 so that state of the end of the lead 7 inserted into the presser portion 222 is confirmed through the window 323 d . in this embodiment , the end of the lead 7 is arrested by the wall 323 c not to reach the position of the forked end 323 a , not to obstruct the fitting of the lead connector 121 to allow the operator to easily fit the lead connector to the terminal base . in the above embodiments of the lead connector , the wall for preventing access of the lead 7 is formed by a part of the conducting portion . the wall may be provided by adding an additional member to the conducting portion . for example , an additional member may be added to the conducting portion 23 between the presser portion 222 and the upper end of the conducting portion 23 in fig4 . [ 0054 ] fig1 shows a terminal base according to a second embodiment of the present invention . in this embodiment , the terminal base 30 has fitting holes for fitting in lead connectors 31 at respective terminal mounting portions . the lead connector 31 comprises a presser portion 32 for connection with an end of the lead 7 by caulking , and a conducting portion 33 formed integrally with the presser portion 32 , for connection of the power cable 70 . the presser portion 32 has a cylindrical shape to form a hole inside into which the end of the lead 7 is inserted from a lower position . the conducting portion 33 has a female thread formed inside in an axial direction of the lead connector 31 ( the same direction as that of the hole of the presser portion 32 ) at the central position thereof . the conducting portion 33 is fitted into the fitting hole 35 formed in the mounting portion . then , a threaded portion of the screw 34 is brought into engagement with the female thread of the conducting member 33 of the lead connector 31 . the lead connector 31 with its conducting portion filled into the fitting hole 35 is shown on the left side of the lead terminal base at a mounting portion in the upper row . in this second embodiment , each terminal comprises the lead and power terminal mounting portions of the terminal base 30 , the lead connector 31 and the screw 34 . the power terminal member of each power cable 70 is inserted between the head of the screw 34 and the conducting portion 33 of the lead connector 31 and the power terminal member is connected with the conducting portion 33 , so that the power cables 70 are electrically connected with the leads 70 from the windings of the stator . [ 0057 ] fig1 a - 11 e show a terminal unit according to a third embodiment of the present invention . in this embodiment , a lead connector 41 is fitted into a fitting groove 45 formed at a terminal mount of a terminal base 40 . the arrangement of this embodiment is different from the first embodiment in that a female thread is formed at the bent end portion of a conducting portion 43 of a lead connector 41 having a larger thickness , and a screw 44 is engaged with the female thread of the conducting portion 43 . the end of the conducting portion 43 is fitted into the fitting groove 45 to fix the lead connector 41 to the mounting portion of the terminal base 40 . [ 0059 ] fig1 d shows an alternative of the lead connector in this embodiment . a nut 55 is fixed by welding on an end of a conducting portion 53 of a lead connector 51 . the end of the lead connector 51 with the nut 55 is inserted into the groove formed at the mounting portion of the terminal base . [ 0060 ] fig1 e shows another alternative of the lead connector . a protrusion 65 is formed at an end of a conducting portion 63 by a burring process and a female thread is formed at the protrusion 65 to be engaged with a nut 64 . the end of the lead connector 61 with the protrusion 65 is inserted into the groove formed at the mounting portion of the terminal base . in the above described embodiments , the insertion hole formed at the presser portion of the lead connector is directed to substantially the same direction as the leads are drawn out of the housing of the electric motor ( the direction of the through hole formed in the housing ). the direction of the power cable lays in a plane perpendicular to the axial direction of the insertion hole which is substantially parallel to an upper surface of the housing of the electric motor . with this arrangement , the leads can be connected to the lead connectors and then fixed to the mounting portions of the terminal base without bending excessively or applying excessive force . the power cables can be connected with the power terminal mounting portions with an orientation substantially the same as the power cables are drawn along the surface of the housing . the terminal base is arranged offset to one side in the terminal box and the leads extend downwardly from the lead connector not to appear in the terminal box , a large space for connection of the power cables to the power terminal mounting portions is formed in the terminal box . the power cables can be easily connected to the power terminal mounting portions with a larger radius of curvature in the large space in the terminal box even if the power cables have large diameters . according to the present invention , the space capable of being occupied by the power cables in connection of the power cable to the power terminal mounting portions is made larger so that a switching of windings of the stator for improving a performance of the electric motor is easily carried out . in manufacturing of the electric motor , the drawing and assembling of the leads are made easy . further , the positions of the leads are fixed to make the inspection of the windings easy , to facilitate a full automatic assembling of the electric motor to lower the cost of manufacture .	7
the following detailed description and the accompanying drawings are intended to describe some , but not necessarily all , examples or embodiments of the invention . the contents of this detailed description and the accompanying drawings are not necessarily all - inclusive and do not limit the scope of the invention in any way . fig1 and fig2 shows a programmable infusion system 10 of the present invention which comprises the following components : 10 programmable infusion system 11 infusion pump — dual channel 12 channel a pump head 13 channel b pump head 14 lcd display 15 air detection sensor — one sensor for each channel 16 prescription drug i . v . solution bag 17 tubing from i . v . bag to channel a for medication delivery to the patient . 18 tubing from i . v . bag to channel b for medication delivery to the patient . 19 tubing placed into the pump head to be operated on by the pumping mechanism — channel a and channel b 20 tubing exiting channel a 21 tubing exiting channel b 22 tubing fitting connecting tubing sections from channel a and channel b into a single tubing for medication delivery to the patient 23 tubing section delivering medication through channel a & amp ; b to the patient . 24 patient 25 indicator for channel a operating state ( green is normal & amp ; red is alarm ) 26 indicator for channel b operating state ( green is normal & amp ; red is alarm ) in the example of fig1 , the programmable infusion system 10 generally comprises a dual channel programmable infusion pump 11 with its controller , having channel a pump head 12 with its own controller , and channel b pump head 13 with its own controller , an infusate - containing vessel 16 , an input tubing component 17 for channel a , an input tubing component 18 for channel b , an output tubing component 20 for channel a , an output tubing component 21 for channel b , a connecting fitting 22 , a tubing component 23 to the patient site , an air - in - line detector 15 a for channel a , an air - in - line detector 15 b for channel b , a tubing pumping segment 19 a for channel a , a tubing pumping segment 19 b for channel b , a user interface such as touch screen and keypad 14 , a status display 25 for channel a , and status display 26 for channel b . it will be appreciated that the pump head of channel a and channel b may be any suitable type of pump such as traditional peristaltic pumps . fig1 shows the infusion system 10 operating two channels a and b to infuse a single drug in a fault tolerant mode under normal operating state . as an example of a use case scenario , the infusion system is programmed to infuse , the infusate ( e . g . a life supporting medication ) at a rate of 50 ml / hr . each of the pump head channels a and b will run independently and concurrently at a rate of 25 ml / hr to deliver a combined flow rate of 50 ml / hr through tubing segment 23 to the patient 24 . this will be a normal operating state with no faults and / or alarms . fig2 shows the infusion system 10 described in fig1 with the event of fault detection on channel b . in fig2 , when the fault is detected , the pump head controller of channel b , running at the rate of 25 ml / hr , will stop the infusion and issue an alarm status . then the pump head controller of channel a will be commanded to increase the rate of infusion on channel a from 25 ml / hr to 50 ml / hr while the channel b pump head is stopped . this will ensure an accurate and uninterrupted delivery of medication to the patient as prescribed . this fault tolerant mode of delivery of 50 ml / hr on channel a will continue until the fault condition is cleared on channel a by the attending nurse or clinician . when the fault and alarm are cleared , the programmable infusion pump will revert back to normal operation , and continuing medication delivery on channel a and channel b concurrently at the rate of 25 ml / hr on each channel for a combined rate of 50 ml / hr through tubing segment 23 to the patient 24 . in another example illustrated in fig2 a , the fault detected in channel b is due to an air - in - line detection , where an air bolus may have formed and accumulated due to outgassing of the infusate in the pumping segment 19 b . in this event , where the infusion rate of channel a is 25 ml / hr and channel b is 25 ml / hr for a combined infusion rate of 50 ml / hr to the patient , the infusion on channel b will stop and reverse the flow at 10 ml / hr , while the rate on channel a will increase from 25 ml / hr to 60 ml / hr . this will allow the net infusion rate to the patient to continue at the prescribed rate of 50 ml / hr and allows the air bolus in the pumping segment 19 b of channel b to gravitate towards the vessel 16 . this mode of operation will continue for a short period of time sufficient to allow for the flow of the air bolus through the input segment 18 to the vessel 16 . after this fault correction , the system can revert back to the normal operation . fig3 illustrates the infusion system 10 operating in an independent dual channel mode . in this example , the system includes the same components as the system shown in fig1 with independent dual channel drug delivery mode . channel a and channel b are programmed to operate independent of one another , where channel a is programmed to infuse , infusate c in vessel 16 a at a rate of 50 ml / hr , and channel b is programmed to infuse , infusate d in vessel 16 b at a rate of 125 ml / hr . illustrated is tubing segment 20 connecting the output of pump head 12 to fitting 22 a , and the tubing segment 21 connecting the output of pump head 13 to fitting 22 a . the fitting 22 a connecting each of tubing segments 20 and 21 to a dual lumen tubing segment 23 to transfer the infusates c and d separately to patient 24 . in yet another embodiment of this invention illustrated in fig4 , the programmable infusion system 10 operates in an interdependent dual channel drug delivery mode with feedback loop . in the example of fig4 , the system includes the same components as the system 10 shown in fig1 and , in addition , includes the following : 27 vital signs monitoring equipment acquiring patient vital signs data 28 communication link for data transfer from vital signs monitoring equipment to the infusion pump . 29 algorithm built into the infusion system the will analyze the data from the vital signs monitors and command the infusion rate for the two channels a and b . this interdependent dual channel drug delivery mode with feedback loop is suitable for the infusion of sedative and analgesic drugs that may cause complications including cardiorespiratory compromise . some of the commonly used sedative drugs ( e . g . fentanyl ), which may cause cardiorespiratory complications , have reversal agents ( e . g . naloxone is a reversal agent for fentanyl ). these reversal agents are administered to reverse the over sedation of the sedative drug in the event the patient receiving the sedation experiences cardiorespiratory complications such as respiratory depression . in this invention illustrated in fig4 , the programmable infusion system 10 generally comprises a dual channel programmable infusion pump 11 with its controller , having channel a pump head 12 with its own controller , channel b pump head 13 with its own controller , and user interface such as a touch screen and keypad 14 , an infusate vessel 16 a containing a sedative drug agent c , an infusate vessel 16 b containing a reversal drug agent d , a tubing segment 17 connecting vessel 16 a to the input of pump head 12 , a tubing segment 18 connecting vessel 16 b to the input of pump head 13 , a tubing segment 20 connecting the output of pump head 12 to a fitting 22 a , a tubing segment 21 connecting the output of pump head 13 to a fitting 22 a , a fitting 22 a connecting each of tubing segments 20 and 21 to a dual lumen tubing segment 23 a , a dual lumen tubing segment 23 a to transfer sedative agent c and reversal agent d separately to patient 24 , a set of vital signs monitors 27 including but not limited to pulse oximeter , blood pressure monitor , respiratory rate monitor , etc . acquiring vital signs data from patient 24 , a data transfer means 28 including but not limited to wired transfer e . g . rs 232 serial port and / or wireless transfer e . g . wifi 802 . 11 and bluetooth to establish communication between the vital signs monitors 27 and the infusion pump 11 , a controller of the infusion pump having an algorithm 29 to decide on the infusion rates , within a pre - set parameters , of sedative agent c in vessel 16 a and reversal agent d in vessel 16 b . in this embodiment of the invention illustrated in fig4 the programmable infusion pump 11 is programmed to infuse sedative agent c from vessel 16 a utilizing pump head 12 ( channel a ) at a pre - set infusion rate or range of rates , and to infuse reversal agent d from vessel 16 b utilizing pump head 13 at a pre - set infusion rate or range of rates . the output tubing segment 23 a is connected to the patient 24 usually intravenously or epidural for drug delivery . the patient 24 is also connected to various sensors to detect and monitor vital signs through a set of vital signs monitors 27 . when the procedural sedation in the acute care setting in the hospital starts , the programmable pump 11 will start infusing sedative agent c from vessel 16 a to the patient 24 utilizing pump head 12 ( channel a ) at a set ramp - up rate , while pump head 13 ( channel b ) is on standby zero infusion rate . the patient 24 is monitored for sedation via various vital signs monitors 27 . when optimal sedation levels are achieved as indicated by the vital signs monitors 27 , the data received by the programmable infusion pump 11 via data transfer means 28 is analyzed by the controller algorithm 29 , and the infusion rate on pump head 12 ( channel c ) will be maintained at a steady rate . in the event of an adverse reaction of over - sedation , the vital signs monitors will issue an alarm and continuous stream of data received by the programmable pump 11 via data transfer means 28 is analyzed by the controller algorithm 29 and the pump head 12 ( channel a ) will be commanded to stop the infusion of sedative agent c in vessel 16 a and the pump head 13 ( channel b ) will be commanded to initiate and start the infusion of reversal agent d in vessel 16 b while the patient 24 continues to be monitored to reverse the over - sedation adverse reaction and stabilize the patient . it will be appreciated that the pump head of channel a and channel b of the invention illustrated in fig4 may be of a syringe drive type , and the vessel for the infusate is a syringe . it is to be appreciated that the invention has been described hereabove with reference to certain examples or embodiments of the invention but that various additions , deletions , alterations and modifications may be made to those examples and embodiments without departing from the intended spirit and scope of the invention . for example , any element or attribute of one embodiment or example may be incorporated into or used with another embodiment or example , unless otherwise specified of if to do so would render the embodiment or example unsuitable for its intended use . also , where the steps of a method or process have been described or listed in a particular order , the order of such steps may be changed unless otherwise specified or unless doing so would render the method or process unworkable for its intended purpose . all reasonable additions , deletions , modifications and alterations are to be considered equivalents of the described examples and embodiments and are to be included within the scope of the following claims .	0
reference now will be made in detail to the presently preferred embodiments of the invention , one or more examples of which are illustrated in the accompanying drawings . each example is provided by way of explanation of the invention , which is not restricted to the specifics of the examples . in fact , it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention . for instance , features illustrated or described as part of one embodiment , can be used on another embodiment to yield a still further embodiment . thus , it is intended that the present invention cover such modifications and variations as come within the scope of the appended claims and their equivalents . the same numerals are assigned to the same components throughout the drawings and description . a presently preferred embodiment of the faucet assembly of the present invention is shown in fig1 and is represented generally by the numeral 10 . as shown in fig1 the faucet assembly 10 is configured for regulating the flow of water from a pressurized water service such as is found in any modern city wherein fresh water is supplied from a reservoir through pipes into the city to provide a pressurized water service . the faucet assembly includes a main faucet body 12 that is configured to be connected in communication with a pressurized water service . as shown in fig1 for example , a pair of wall fixtures 13 , 14 connects the main faucet body 12 to the pressurized water service ( not shown ) of the building in which the faucet assembly 10 is installed . a flow of hot water is regulated through the faucet body 12 by a valve ( not shown ) having a manual control that can be activated by a handle 15 . similarly , a flow of cold water is regulated through the faucet body 12 by another valve ( not shown ) having a manual control that can be activated by a handle 16 . as shown in fig2 a , 2 b , 2 c and 3 for example , the main faucet body can include an internal passage wall 17 that defines an internal passage 18 . it is this internal passage that eventually is connected in communication with the pressurized water service via the fixtures 13 , 14 in the wall . as shown in fig1 for example , the faucet assembly includes a riser 20 . one end of the riser 20 is detachably connected to the main faucet body 12 and extends vertically therefrom . the opposite end of the riser can be detachably connected to one end of a flexible hose 21 . the opposite end of the flexible hose 21 can be connected in communication with a spray nozzle valve 22 that has a lever 23 for manual operation to open and close the valve 22 . the assembly 10 also can include a rigid support such as a wall bracket 24 having one end connected to the riser 20 and an opposite end ( not shown ) configured to be attached to a nearby structure . as shown in fig1 for example , the wall bracket 24 is fixed to a wall ( not shown ) near the main faucet body 12 . the manner of fixation can be any known mechanical means such as screws , nails , glue , bolts and the like . additionally , a retention hook 25 can have one end connected by mechanical means to the riser 20 and be configured with an opposite end that can be used to retain the spray valve nozzle 22 at a convenient location near the riser 20 when the spray valve nozzle 22 is not in use by the operator . as shown in fig1 for example , the grasping end of the retention hook 25 is configured as a semi - circular arcuate member . in addition to the main faucet body 12 , the faucet assembly 10 desirably includes an adaptor sleeve 40 and a resiliently compressible , positive locking mechanism that prevents relative rotation between the adaptor sleeve and the main faucet body . the main faucet body defines a cavity that receives the adapter sleeve 40 . the positive locking mechanism can be provided by a star lock washer 30 that is disposed in the bottom of the cavity of the main faucet body 12 , and the bottom of the adapter sleeve 40 rests against the star lock washer 30 . desirably , the exterior of one end of the adapter sleeve 40 retains a sealing member that is configured and disposed to provide a water - tight seal between the adapter sleeve 40 and the surrounding wall of the cavity of the main faucet body 12 . the riser 20 is detachably connected to the adapter sleeve 40 . a retaining nut 60 slides over the riser 20 and is detachably connected to the main faucet body 12 to retain the adapter sleeve 40 in place in the cavity of the main faucet body . an example of these components now will be described more particularly in accordance with the configuration that is presently deemed desirable in the present invention . as embodied herein and shown in fig3 for example , the main faucet body 12 includes a base 26 and a sidewall 27 disposed orthogonally with respect to the base 26 . the sidewall 27 extends axially from the base 26 to define an opening 28 opposite the base 26 . the sidewall 27 defines an axially extending interior surface . as shown in fig3 for example , the interior surface of the sidewall 27 is generally cylindrical throughout and defines a throat portion 29 at one end and a mouth portion 31 opposite to the throat portion 29 . as shown in fig2 a , 2 b , 2 c and 3 for example , the interior surface of the sidewall 27 defines an annular ledge 32 that extends in a plane that is generally parallel to the base 26 . as shown in fig3 for example , one end of the ledge 32 is connected to the upper edge of the throat portion 29 of the interior surface of the sidewall 27 . the opposite end of the ledge 32 defines an edge that is connected to the lower section of the mouth portion 31 of the interior surface of the sidewall 27 . though ledge 32 is shown in the embodiment of fig2 b , the ledge 32 can be eliminated from this embodiment if desired . as shown in fig3 for example , the interior surface of the sidewall 27 and the base 26 combine to define the side and bottom , respectively , of an axially extending cavity that is defined in the main faucet body 12 . this cavity is configured to receive the adaptor sleeve 40 . the sidewall 27 of main faucet body 12 also defines a free edge surface 27 b that resides in an annular plane that is parallel to the annular plane defining the base 26 . as shown in fig2 a , 2 b , 2 c and 3 for example , the main faucet body 12 includes an internal passage wall 17 that defines an internal passage 18 . as shown in fig3 for example , the main faucet body 12 defines a conduit wall 35 that defines a conduit that connects the internal passage 18 to the cavity . as shown in fig3 for example , the base 26 is connected between the throat portion 29 of the interior surface of the sidewall 27 and the conduit wall 35 . as shown in fig2 a , 2 b , 2 c and 3 for example , the sidewall 27 of the main faucet body 12 defines an exterior surface that is configured with a threaded portion 36 that is defined axially along the exterior surface . in accordance with the present invention , a resiliently compressible , positive locking mechanism can be disposed in the cavity of the main faucet body and rests on the base of the cavity . as shown in fig2 a , 2 b and 2 c for example , the resiliently compressible , positive locking mechanism can be provided by a lock washer 30 that is disposed in the cavity that is defined in the main faucet body 12 . the lock washer 30 rests on the base 26 of the cavity in the main faucet body 12 . as shown in fig2 a for example , the star lock washer 30 is configured so that it is biased with a predetermined thickness as measured in the axial direction . as shown in fig2 b and 2c for example , the star lock washer 30 can be compressed so as to diminish the thickness of the star lock washer 30 as measured in the axial direction . thus , the star lock washer 30 is resiliently compressible in the axial direction . moreover , when the star lock washer 30 becomes compressed , the pressures act so as to prevent rotation of the star lock washer with respect to the base 26 of the main faucet body 12 and the adapter sleeve 40 . as embodied herein and shown in fig2 a , 2 b , 2 c and 3 for example , the faucet assembly includes an adapter sleeve 40 . as shown in fig3 the adapter sleeve 40 has a first end 41 and a second end 42 opposed to the first end 41 . as shown in fig2 a , 2 b , 2 c and 3 for example , the adapter sleeve 40 has an axially extending length that extends between the two ends 41 , 42 . as shown in fig2 a , 2 b , 2 c and 3 for example , the first end 41 of the adapter sleeve 40 defines a seat portion 44 . as shown in fig2 a , 2 b , 2 c and 3 for example , the adapter sleeve 40 is configured to be received and disposed in the cavity of the main faucet body 12 , and the seat portion 44 is configured to rest against the star lock washer 30 . as shown in fig2 a , 2 b , 2 c and 3 for example , the adapter sleeve 40 has a groove 43 that is defined in the exterior near the first end 41 of the adapter sleeve 40 . the groove 43 extends circumferentially around the exterior of the adapter sleeve 40 and is configured to receive an o - ring 50 . as shown in fig2 a , 2 b , 2 c and 3 for example , a flow channel 46 is defined through the seat portion 44 to permit fluid flow therethrough . as shown in fig3 for example , the exterior of the adapter sleeve 40 is surrounded by a forward edge 45 that is disposed between the seat portion 44 and the groove 43 at the first end 41 of the adapter sleeve 40 . as shown in fig2 a and 2c for example , the forward edge 45 of the adapter sleeve 40 is aligned generally with the ledge 32 that is formed in the interior surface of the sidewall 27 of the main faucet body 12 . in the alternative embodiment of fig2 c , the ledge 32 prevents the approach of the seat portion 44 of the adapter sleeve 40 closer than a certain predetermined distance to the base 26 of the main faucet body 12 . this distance depends on the distance between the forward edge 45 and the seat portion 44 as well as the axial length of the throat portion 29 of the interior surface of the sidewall 27 of the main faucet body 12 that exists between the ledge 12 and the base 26 of the main faucet body 12 . as shown in fig2 a , 2 b , 2 c and 3 for example , the adapter sleeve 40 includes a retaining flange 48 that projects radially from the exterior of the adapter sleeve 40 near the second end 42 of the adapter sleeve 40 . as shown in fig2 a , 2 b , 2 c and 3 for example , the interior wall of the adapter sleeve 40 defines a tapered threaded portion 49 that is disposed between the second end 42 of the adapter sleeve and the seat portion 44 of the adapter sleeve . as shown in fig3 for example , the diameter of the channel that runs axially through the adapter sleeve 40 and that is defined by the tapered threaded portion 49 , decreases as one proceeds from the second end 42 of the adapter sleeve 40 to the first end 41 of the adapter sleeve 40 where the flow channel 46 is defined through the seat portion 44 . as shown in fig2 a , 2 b , 2 c and 3 for example , an o - ring 50 is disposed in the groove 43 that is formed in the exterior of the adapter sleeve 40 . the o - ring 50 desirably is comprised of a deformable resilient material such as rubber , nylon , and the like . as shown in fig2 a , 2 b and 2 c for example , the o - ring 50 engages the interior surface of the sidewall 27 of the main faucet body 12 . in so doing , the ring 50 forms a sealing member that is configured and disposed to provide a water - tight seal between the exterior of the adapter sleeve 40 and the interior surface of the sidewall 27 of the main faucet body 12 . as shown in a truncated view in fig2 a , 2 b , 2 c and 3 for example , the riser 20 defines an axially extending hollow rigid tube . the riser 20 has opposed ends . the tube defines an exterior surface . at one end of the tube , the exterior surface of the riser 20 defines a tapered threaded portion 33 that is configured to mate with the tapered threaded portion 49 of the adapter sleeve 40 . the diameter of the tapered threaded portion 33 of the end of the riser 20 increases as one moves away from the free end of the riser 20 . as shown in fig2 a , 2 b and 2 c for example , the tapered threaded portion 33 of the riser 20 is screwed into the tapered threaded portion 49 of the adapter sleeve 40 . accordingly , the riser 20 is detachably connected to the adapter sleeve 40 . as embodied herein and shown in fig2 a , 2 b , 2 c and 3 for example , a retaining nut 60 defines an axially extending hollow nut . as shown in fig3 for example , the retaining nut 60 has a first end 61 that defines a first opening 63 . the retaining nut 60 has a second end 62 that defines a second opening 64 . the first opening 63 is configured to allow the retaining nut 60 to be screwed onto the threaded exterior surface 36 of the sidewall 27 of the main faucet body 12 . the second opening 64 is configured and sized to allow passage of the riser 20 and the second end of the adaptor sleeve , but not passage of the retaining flange 48 of the adaptor sleeve 40 . adjacent the first opening 63 , the retaining nut 60 defines an axially extending interior surface that has a threaded portion 65 defined thereon . the threaded portion 65 is configured to mate with the threaded portion 36 of the exterior surface of the sidewall 27 of the main faucet body 12 . as shown in fig2 a , 2 b and 2 c for example , the threaded portion 36 of the exterior of the sidewall 27 of the main faucet body 12 is screwed into the threaded portion 65 of the retaining nut 60 . as shown in fig2 a , 2 b , 2 c and 3 for example , the retaining nut 65 defines a shoulder portion 68 . the shoulder portion 68 of the retaining nut 60 extends radially from the axially extending interior surface of the retaining nut 60 to define the second opening 64 . as shown in fig2 a , 2 b and 2 c for example , as the retaining nut 60 is screwed onto the sidewall 27 of the main faucet body 12 , the shoulder portion 68 of the retaining nut 60 engages the retaining flange 48 of the exterior of the sidewall of the adapter sleeve 40 . in so doing , further tightening rotation of the nut 60 forces axial movement of the seat 44 of the adaptor sleeve 40 toward the base 26 of the cavity in the main faucet body 12 . this axial movement eventually causes the seat 44 to compress the washer 30 against the base 26 of the cavity defined in the main faucet body 12 . when the star lock washer 30 is sufficiently compressed between the seat portion 44 of the adapter sleeve 40 and the base 26 of the cavity defined in the main faucet body 12 , the star lock washer 30 functions as a locking mechanism that prevents relative rotation between the adapter sleeve 40 and the main faucet body 12 . thus , the compression of the star washer 30 functions to prevent relative rotation between the adapter sleeve 50 and the main faucet body 12 . since the riser 20 is fixed to the adapter sleeve 40 by being screwed into the adapter sleeve 40 , the riser 20 is also prevented from rotating relative to the main faucet body 12 once the retaining nut 60 is screwed onto the sidewall 27 of the main faucet body 12 . accordingly , the relative orientation of the spray nozzle valve 22 can be selected by the installer in a relatively simple fashion . moreover , the present invention eliminates the need for the installer to completely rotate the riser 20 round and round relative to the main faucet body 12 when installing the riser 20 of the faucet assembly 10 . each of fig2 b and 2c shows a different embodiment in its locked mode wherein the locking nut is sufficiently tightened so that the compression of the star washer 30 functions to prevent relative rotation between the adapter sleeve 40 and the main faucet body 12 . as shown in fig2 b , which depicts the embodiment that is presently preferred , when the underside surface 68 a of the shoulder portion 68 of retaining nut 60 contacts the upperside surface 48 b of retaining flange 48 of adaptor sleeve 40 , further tightening rotation of the nut 60 forces axial movement of the adaptor sleeve 40 so as to compress the washer 30 against the base 26 of the cavity defined in the main faucet body 12 . in the embodiment of fig2 b , contact between the underside surface 48 a of retaining flange 48 of adaptor sleeve 40 and the free edge surface 27 b of the sidewall 27 of main faucet body 12 prevents any further axial movement of the adaptor sleeve 40 to compress the washer 30 against the base 26 of the cavity defined in the main faucet body 12 . the retaining flange 48 of the adapter sleeve 40 and the sidewall 27 of the main faucet body 12 are desirably configured so that the flange 48 contacts the free edge surface 27 b of the sidewall 27 before the star lock washer 30 is completely compressed between the seat portion 44 of the adapter sleeve 40 and the base 26 that defines the bottom of the cavity of the main faucet body 12 . in the alternative embodiment shown in fig2 c , the axial movement of the adaptor sleeve 40 that compresses the washer 30 against the base 26 of the cavity defined in the main faucet body 12 is limited by contact between the forward edge 45 of adaptor sleeve 40 and the ledge 32 of the interior surface of sidewall 27 of main faucet body 12 . the retaining flange 48 of the adapter sleeve 40 and the ledge 32 of the interior surface of the sidewall 27 of the main faucet body 12 are desirably configured so that the flange 48 contacts the ledge 32 before the star lock washer 30 is completely compressed between the seat portion 44 of the adapter sleeve 40 and the base 26 that defines the bottom of the cavity of the main faucet body 12 . in operation , the main faucet body 12 would be installed and fixed to the wall or sink , as the case may be . the o - ring 50 is inserted into the groove 43 in the adapter sleeve 40 . the second opening 64 of the retaining nut 60 is pushed over the end of the riser 20 with the threaded portion 33 . the tapered threaded portion 33 of the riser 20 is screwed into the tapered threaded portion 49 inside the adapter sleeve 40 . the star lock washer 30 is dropped into the cavity formed in the main faucet body 12 and rests on the base 26 of the main faucet body 12 . the adapter sleeve 40 that is screwed onto the end of the riser 20 is axially inserted into the cavity of the main faucet body 12 so that the seat 44 rests against the star washer 30 . the o - ring 50 formed by a deformable elastic material forms a water - tight seal between the exterior of adapter sleeve 40 and the interior surface of the sidewall 27 of the main faucet body 12 . the first opening 63 of the retaining nut is aligned with the threaded outer surface 36 of the sidewall 27 of the main faucet body 12 . as shown in fig2 a for example , the retaining nut 60 is then rotated and screwed onto the threaded outer portion 36 of the sidewall 27 of the main faucet body 12 . further rotation of retaining nut 60 causes the shoulder portion 68 of retaining nut 60 to contact the retaining flange 48 of adapter sleeve 40 . once such contact has been made , continued rotation of the retaining nut 60 causes axial movement of the adapter sleeve 40 toward the base 26 . as shown in fig2 b for example , contact between the underside surface 48 a of retaining flange 48 of adaptor sleeve 40 and the free edge surface 27 b of the sidewall 27 of main faucet body 12 prevents any further axial movement of the adaptor sleeve 40 toward the base 26 . the two arrows shown in fig2 c schematically illustrate the relative axial movement of the adapter sleeve 40 toward the base 26 of the main faucet body 12 and the resulting compression of the star lock washer 30 . the shoulder portion 68 of retaining nut 60 prevents axial movement of the adapter sleeve 40 and riser 20 in the direction opposite to the direction of the arrows shown in fig2 c . loosening of the retaining nut 60 permits the operator to lift the adapter sleeve 40 and riser 20 so that the seat portion 44 of the adapter sleeve disengages from the star lock washer 30 and permits rotation of the adapter sleeve 40 relative to the sidewall 27 of the main faucet body 12 . this relative rotation permits the operator to orient the position of the spray nozzle valve 22 relative to main faucet body 12 . once the desired orientation has been obtained , the operator can rotate the retaining nut 60 to produce axial movement in the direction indicated by the arrows in fig2 c and secure the adapter sleeve 40 against rotation relative to the sidewall 27 as the star lock washer 30 engages the base 26 of the main faucet body and engages the seat portion 44 of the adapter sleeve 40 . while at least one presently preferred embodiment of the invention has been described using specific terms , such description is for illustrative purposes only , and it is to be understood that changes and variations may be made without departing from the spirit or scope of the following claims .	5
fig1 shows the simplified version of an actuator for valve control used normally in the process technology for flowing materials and mediums , e . g . in the water or sewage technology , the chemical industry or power station technology . an electric motor ( 2 ) is mounted to a support plate ( 1 ). using a gearbox ( 4 ), the electric actuator ( 2 ) operates the output shaft ( 5 ) of the actuator in accordance to the control signals given by an actuation electronics ( 3 ). the electric motor ( 2 ) and the actuation electronics ( 3 ) including the support plate ( 1 ) are placed in a housing ( 9 ) which is closed off by the attached gearbox ( 4 ). the actuation electronics ( 3 ) are mounted onto the actuator . the actuation electronics ( 3 ) are normally placed inside the actuator but may also be attached to the outside of the actuator . the output shaft ( 5 ) has a connecting part ( 6 ) into which the operating shaft ( 7 ) of the valve ( 8 ), which has to be controlled , is inserted , transferring the movement of the actuator to the valve . the actuator can have either a stroke or a rotational movement . the actuation electronics ( 3 ) is of modular design , consisting of the following components according to fig . ( 2 ): a power module ( 11 ) for carrying out the process control and regulating the electric motor ( 2 ), and an interface module ( 12 ) for connecting the actuator to a process central unit ( 14 ). an operating panel ( 13 ) is placed outside the actuator and functions as manual actuation control . it can also be used for parametering the actuation functions . the operating panel should be attached to the outside of the actuator ( fig1 ). it can either be mounted permanently or designed as a plug - in connection . it is also possible to design the operating panel ( 13 ) as a remote control in which case the actuator would require a receiver for wireless signals such as infrared signals . in another design , the operating panel ( 13 ) has a mobile , i . e . cable connection to the actuation electronics ( 3 ) ( not depicted ). the actuation electronics ( 3 ), in particular the power module ( 11 ) is always connected to the operating panel ( 13 ) using a bi - directional data cable . this operating panel ( 13 ) has a keyboard ( 13 a ) and a display ( 13 b ) so that the operator can directly act upon the actuator to carry out all important functions . fig3 shows the design of the power module ( 11 ). it consists of a process controller ( 15 ) with inputs connecting it to external sensors that supply process - specific data . these are a temperature sensor ( 17 ), a pressure sensor ( 18 ) and a flowmeter ( 19 ). in addition , the process controller ( 15 ) can be connected to an external sensor measuring the wear at the valve ( 8 ). further to this , internal sensors are connected to the inputs of the process controller ( 15 ) measuring data which characterize the operational behavior of the actuator , such as a motor temperature sensor ( 20 ) and a device measuring the actuator &# 39 ; s internal temperature ( 21 ). the process controller ( 15 ) has a memory bank ( 22 ) where the process parameters and operating parameters are saved . the storage ( 22 ) is of the eeprom type . the process controller ( 15 ) is connected to the storage ( 22 ) using a bi - directional data link . a serial interface ( 23 ) facilitates the communication of the power module ( 11 ) with a personal computer or laptop . the output of the process controller ( 15 ) is connected to the motor controller ( 24 ). this motor controller ( 24 ) has a positional controller ( 25 ) which acts upon the electric motor ( 2 ) via a final stage ( 26 ). a comfort version of the process controller ( 15 ) can do without the positional controller because here , its function is carried out by the process controller itself . the controller acts directly upon the motor in dependence on the external sensor signals . in the case shown here , an electronically commutated dc motor is used . it is connected to a device measuring the motor current ( 27 ) which leads to the inlet of the process controller ( 15 ). the process controller ( 15 ) calculates the torque or the nominal force at the actuator output from the motor current measured . the process control inside the actuator works as follows : through the interface ( 12 ), a set reference variable , e . g . the setpoint value of the process , is transmitted to the process controller ( 15 ) from the process control unit ( 14 ) using a bus system . a process feedback value is determined from the signals sent by the sensors 17 , 18 and 19 which is then compared to the process setpoint value . provided that the sensor signals represent the process feedback value , it is compared to the process setpoint value and then the positional setpoint value for the positional controller ( 25 ) is calculated . the positional controller ( 25 ) ensures the proportionality between the positional setpoint value and the angle of turn or the stroke of the valve ( 8 ). the positional controller ( 25 ) constantly compares the electric input signal supplied by the process controller ( 15 ) to the feedback value of the valve position . the feedback value of the valve position is determined by a sensor ( 28 ), which should be a potentiometer , placed at the output shaft ( 5 ) in the actuator . the signal from this sensor is fed back to the positional controller ( 25 ). the controller determines the speed , the force or torque and the position of the actuator output in dependence to the designated setpoint and to the values measured by the sensors . the process control unit ( 14 ) only supplies the manipulating signal to the actuator and displays the condition of the individual feedback loops . the regulating magnitude is calculated inside the actuator which is then sent to the positional controller ( 25 ) controlling the motor ( 2 ). it is recommended to design the process controller ( 15 ) using a micro - processor with freely parameterable software , as illustrated in fig4 . a pid controller can easily be realized using the micro - processor . this pid controller is well - suited for the control task described above . where continuous positioning is required , the pid controller creates the positional setpoint value for the actuator inside the actuator itself . this setpoint value is compared to the feedback value of the position . the differential signal resulting from it is the magnitude for controlling the motor . the motor is controlled until the differential signal is almost 0 . this principle causes the actuator to follow the setpoint value continuously even if deviations are minimal , and the actuator is constantly in action . the memory bank ( 22 ) for storing the process and operational parameters is located inside the micro - processor . alternatively , it can be outside the microprocessor and is connected to it by a bi - directional data link . operational parameters stored for diagnosis purposes are operating data such as the operating time and the switching frequency of the motor . the last ten measuring values of the external and internal sensors are also stored . other relevant data for diagnosis are the motor temperature , the motor current , the temperature of the housing and the actuator position . it is possible to carry out preventative maintenance on the actuator due to the self - monitoring electronics and the registration of the motor operating times in certain critical conditions . the data for diagnosis is read out using the serial interface ( 23 ) or the fieldbus interface ( 12 ). the measured values of the external and internal sensors , which are connected to the inlets of the micro - processor ( 15 ), are cyclically queried . if critical values are detected , safety positions are automatically taken or potential - free relays are switched which signal the critical condition . data for correcting the characteristic line of the actuator are stored in the memory bank ( 22 ). they are presented either as a table or as a characteristic line . nominal process magnitudes are calculated from the values measured by the internal and external sensors . this data is transmitted for further use , e . g . for display in the process control unit ( 14 ) using the interface module ( 11 ). the p , pi or pid controller can operate as an independent fixed value controller , if it is connected to the external sensor inlets and the internal sensors . it can also be used as an analogue or digital process controller guided from the process control unit ( 14 ). the modular design of the control and regulating device ensures that the actuators are manufactured extremely economically . the software of the micro - processor is freely parameterable and therefore , the actuator can be programmed after the actuator and the control and regulating device have been completely assembled . the actuator - specific parameters are set at the actuator manufacturer &# 39 ; s . similarly , the basic parameters of the pid controller are stored in the memory bank ( 22 ) of the micro - processor ( 15 ), using the interface module ( 12 ) or the serial interface ( 23 ). the parameters for a continuous pid control which can be freely set are the proportionate range , the holding and adjusting times . these parameters are set and stored independently of each other at the manufacturer &# 39 ; s and depend on the type of actuator . the basic specific actuator parameters are stored in non - erasable memory . the user can then create the data specific for each application , which is based on the actuator - specific data , and store them in the memory bank ( 22 ) as well . these parameters which are specific to a certain application and any other parameters required are stored in a re - writable memory . this has the advantage that the actuator application can be decided after the mechanical assembly . all parameters stored are maintained even in case of a mains failure . parametering should only be made by authorized personnel and therefore the stored data must be protected by an identification code . this code is also stored in the micro - processor ( 15 ) memory bank ( 22 ). data can only be entered on condition that the micro - processor ( 15 ) has recognized and approved the code . complex regulation tasks comprising of several input magnitudes can be solved most efficiently and comfortably by means of an intelligent actuator equipped with an integrated process controller and several analogue inlets for external sensors . consider as an example a flow - rate control . the pressure is measured in front of and behind the valve ( 8 ) at standardized measuring points by a differential pressure transformer , not described any further . the characteristic curve of the valve is stored in the non - erasable memory ( 22 ). the flow - rate can be exactly calculated from the differential pressure and the valve stroke measured and therefore a special flow - rate controller is not required . in the simplest case , the setpoint value of the valve position is directly preset by the central process control unit ( 14 ); the flow - rate calculated by the micro - processor ( 15 ) is sent to the process control unit ( 14 ) where it is displayed . in this way it is possible to transmit not only the actuator position but also limit values and error messages to the central process control unit ( 14 ). moreover , a set reference variable can be supplied , which corresponds to the desired flow - rate . here the stroke or angle of turn of the valve ( 8 ) are adjusted until the result of the current calculation coincides with the desired valve .	6
to facilitate the description of the invention , it is worthwhile to define some conventions solely for this purpose . these conventions are somewhat arbitrary and should not be construed as limiting to the generality of the invention . for the purpose of this description : ( b ) each working day is assigned a sequential number called the &# 34 ; date &# 34 ; representing calendar date or point in time ; the number increases with later calendar dates . ( c ) slack is defined as the requirement date minus the availability date ; therefore , if the requirement date is later in time ( a higher number ) than the availability date ( a lower number ) the slack is positive . ( d ) least slack is defined in the algebraic sense , meaning the most negative amount ; e . g ., negative 6 (- 6 ) is less than positive 4 (+ 4 ). the product that is manufactured in the preferred embodiment of the control system invention is mechanical gearboxes . this control system invention is applicable to an enormous range of manufactured products and the use of gearboxes in this embodiment should not be construed as limiting . in fig1 in the manufacture of gearboxes , particularly those of small - order - quantity , produced on a job - shop rather than a continuous assembly line basis , the time - consuming manufacturing operations such as gear cutting , gear hobbing , gear grinding , etc ., may be defined as activities , 1 , 2 , 3 , 4 , 5 , and each one identified by the letter &# 34 ; a &# 34 ; and a numerical suffix ; e . g ., &# 34 ; a1 &# 34 ;, a2 &# 34 ;, a3 &# 34 ;. at the beginning and end of each activity , 1 , 2 , 3 , 4 , 5 , there exists a condition of state which occurs at a moment in time and which are defined as events 6 , 7 , 8 , 9 , 10 , 11 ; e . g ., &# 34 ; activity a1 completed , activity a2 ready to begin &# 34 ;. events , 6 , 7 , 8 , 9 , 10 , 11 , are identified by the letter &# 34 ; e &# 34 ; and a numeric suffix ; e . g ., &# 34 ; e1 &# 34 ;, &# 34 ; e2 &# 34 ;, &# 34 ; e3 &# 34 ;. fig1 shows network of activities , 1 , 2 , 3 , 4 , 5 , and events , 6 , 7 , 8 , 9 , 10 , 11 , flowing from left to right . the interconnecting arrows show the direction of time and material flow and the independencies between activities , 1 , 2 , 3 , 4 , 5 , and events , 6 , 7 , 8 , 9 , 10 , 11 . for example , activity a5 , 5 , cannot begin until event e3 , 8 , as occurred , which is &# 34 ; activity a2 complete , activity a4 complete , activity a5 ready to begin &# 34 ;. within each activity block , 1 , 2 , 3 , 4 , 5 , has also been added the estimated time duration of the activity . this estimate includes time waiting in queue , machine time , and time to transport to the next workstation . the foregoing parallels the critical path method ( cpm ) of network analysis . a network such as that in fig1 is generated for all the manufacturing steps that are to be controlled by the subject invention . typically , this is done by the production control personnel and will include all of the manufacturing steps ( such as gear cutting , gear hobbing , gear grinding ) for all the components required in the complete assembly . the production control personnel will also identify the purchased material required at each event , 6 , 7 , 8 , 9 , 10 , 11 , to support the next activity , 1 , 2 , 3 , 4 , 5 ; e . g ., gear blanks , gear case castings , fasteners , bearings , paint , etc . this identification task is the same as that normally performed by the production control personnel in many existing manual systems of control . the next step is the assignment of dates to each event . the desired final completion date is assigned to the final completion event , e6 , 11 in fig1 . in this example , &# 34 ; day 215 &# 34 ; is used . the remaining events are assigned their dates by moving from right to left ( backward with respect to time ) and subtracting the time duration estimate of the intervening activity from the prior determined date . for example , the date for e3 , 8 , equals the date for e6 , 11 , less the duration of a5 , 5 ; i . e ., day 209 equals day 215 less 6 days . the result shown in fig1 is the baseline schedule . this step may be performed manually or automatically on a digital computer . the network shown in fig1 has no slack ( or waiting ) time within the flow . therefore , the time duration between any two points on any path through the network will be equal to the sum of the time durations of the activities included in the subject path . this is a major difference with the critical path method ( cpm ) and with pert , both of which typically have embedded slack time in their networks . the information from the baseline schedule in the form of each event and its associated schedule date is loaded via a terminal , 13 , into memory field a , 14 , in the control computer , 12 , in fig2 . at this point it is beneficial to describe the control system in two parts : the first being the control of external components and the second ( to be described later ) being the control of internal operations . an external component is an item that has not entered the network yet . the information prepared by the production control personnel linking each required external component with an event is loaded via a terminal 13 into memory field b , 15 , in the control computer , 12 . each external component is assigned a unique number for identification purposes . the estimated availability date for each external component is loaded via a terminal , 13 , into memory field c , 16 , in the central computer , 12 . using pre - programmed instructions , the external slack calculator , 17 , in the control computer , 12 , serially retrieves each external component and its associated event from memory field b , 15 , retrieves the baseline schedule date associated with that event from memory field a , 14 , and retrieves the external component &# 39 ; s availability date from memory field c , 16 . the external slack calculator , 17 , then subtracts the availability date from the baseline schedule date and defines the result as the &# 34 ; external slack variable &# 34 ; for that external component . the external slack variable associated with each external component , its event , baseline schedule date , and availability date are transmitted and stored in memory field d , 18 , in the control computer , 12 . when the external slack variable for each of external components has been calculated and stored , the control computer , 12 , prints out the collected and calculated data from memory field d , 18 , on printer 19 . an example printout is simulated in table 1 . column 1 is the identification number of each external component . column 2 is the first event at which the external component is required . at all subsequent events , it is an internal item and controlled by a method to be explained later . column 3 is the baseline schedule date associated with the event in column 2 . column 4 is the availability date associated with the external component in column 1 . column 5 is the external slack variable which is equal to the date in column 3 minus the date in column 4 . the last columns are a graphical representation of the slack variable in column 5 . the final completion date will be determined by the external component that has the least slack value and by an amount equal to that component &# 39 ; s slack value . in the table 1 example , external component 91005 will pace the final completion date since it has the least slack value of - 2 . external component 91005 has the most late availability with respect to its baseline schedule date . the final completion date will be two days late (- 2 days of slack ) due to this component . using this control system , the critical component and the component &# 39 ; s impact on final completion date are immediately determined . in order to improve the final completion date , only resources concentrated on the critical component ( 91005 ) will have an impact on the final completion date . the rest of the components will not have any effect on the final completion date as long as their slack values are not the least . therefore , the slack values of the non - critical components can decrease within this limitation without producing any schedule impact . when management personnel review the information shown in table 1 , they can readily determine the impact of each external component upon the final completion date and they can predict the final completion date based on the item with the least slack . if this slack is negative , the final completion will be late . management personnel must determine if the lateness and the degree of lateness are acceptable , and , if not , what degree of lateness is acceptable . this is translated into a slack value ; e . g ., negative one (- 1 ), and is called the &# 34 ; project external slack &# 34 ;. this management decision process , 23 , is shown in fig2 . this information is transmitted via terminal , 13 , to memory field d , 18 , in the control computer , 12 . this is the value that all external component slack variables will be measured against . any external component , with a slack variable less than the project external slack variable must have its slack increased to be at lease equal to the project external slack value . this can be done by improving the component &# 39 ; s availability date or rescheduling its requirement data to be later in time . then a subroutine , 24 , in the control computer , 12 , searches memory field d , 18 , and identifies the external components with slack variables less than the project external slack . these components are critical and their availabilities must be improved by the allocation of additional resources so that their new slack variables are greater to or equal to the project external slack variable . the external project slack value and the critical components listing are transmitted to production control personnel , via a terminal , 13 , with the instruction to concentrate on improving the availabilities on the listed items in order to satisfy the project external slack value . as availability dates are revised , they are transmitted via terminal , 13 , by production control personnel to memory field c , 16 , in the control computer , 12 . the external slack calculator , 17 , will calculate the new slack variable and update memory field d , 18 , and periodically present the results to management personnel via a printer , 19 , for reconsideration of the project external slack variable decision , 23 . since these functions are so simple and straightforward , the control computer , 12 , can quickly determine the new external slack variable based on a component &# 39 ; s new availability , compare it to the project external slack , determine its criticality and respond to the production control personnel via the terminal , 13 , within a few seconds . this allows the production control personnel to take immediate action if the subject component is reported critical . the second portion of the control system controls the internal operations . after an external component enters the system , its progress through the network is monitored at each work station and it is termed an internal component . when an activity is complete , the internal component is sent to its next activity . when it arrives at the next activity workstation , it is checked against the list of components ( internal and external ) required for the next activity . when all of the necessary components have arrived at the workstation , they are placed at the end of the work queue , and the event preceeding the activity that is to take place at the workstation is considered to have occurred . as shown in fig3 at least once per day , all events that have occurred in the queue for each workstation are identified and transmitted via a computer terminal , 13 , to memory field e , 20 , in the control computer , 12 , along with the present date . for each event , the event slack calculator , 21 , in the control computer , 12 , retrieves the schedule date for its event from memory field a , 14 , ( previously loaded for external components ), and calculates the internal slack variable which is equal to the schedule date minus the present date . the internal slack calculator then arranges the events for each workstation in the order of increasing slack and transmits this listing to the terminal , 13 , for the subject workstation . the workstation personnel can now order the queue with respect to increasing slack from the list . therefore , those events with the least slack ( and therefore most critical ) are at the head of the queue . the event slack calculator also directs the event slack to memory field f , 22 , where is accumulated and at least one per day printed on the printer , 19 , for review by management personnel . management personnel have received the external slack information and the event slack information from the control computer , 12 . the final completion date will be determined by the external components or events with the least slack . management personnel may allocate additional resources to improve the slack of the critical and near critical external components or internal events ( by expediting activities to minimize their durations ). the cost of these additional resources must be justified based on avoiding penalty costs for late completion or gaining additional revenue for early completion . to aid management personnel in this process , the cost of availability improvement can be calculated . for each of the most critical external components and internal events , the costs for availability improvement per day are estimated . these costs are shown graphically in table 2 for external components . the costs for internal events would be shown in a similar manner . table 2 , column 1 identifies the external component by number . since it is only necessary to concentrate on the items with the least slack , the components from table 1 with slack of + 2 or greater are not shown . column 2 shows the event that the external component is required to support . column 3 shows the present slack value . the next 5 columns graphically show the cost to improve a component &# 39 ; s availability . for example , component 91001 requires $ 200 for each day of improvement in its availability . it now has a slack value of - 1 . to improve its availability three days to a slack value of + 2 , will cost $ 600 . on the bottom row of the table is accumulated the network cost of schedule improvement ( increased slack ). the accumulation is computed by starting at the right - most column , and moving to the left , summing the entries in each column with the entries from all columns to the right , and entering the accumulated total under the subject column . in this example , the cost to improve the final completion date by 1 through 4 days ( change the slack to - 1 , 0 , + 1 , + 2 , respectively ) is $ 200 , $ 600 , $ 5000 , and $ 9600 respectively . these additional costs can be compared to the external costs of a delay in the final completion date , and a determination can be made if the additional internal costs are justified . management personnel can adjust the project slack variable accordingly . the control of internal events can also utilize project event slack variable that would be determined by management personnel and operate in a manner similar to the project external slack variable used to control external components . the structure of the computerization may be changed to use a number of small personal computers , each used by an individual responsible for the control of several events , since this control system may be readily modularized . a minimum of communication is required between the personal computers and management personnel : the external components and events with the least slack and their associated availability improvement costs must be transmitted to management personnel , and , after aggregating the data from all the personal computers and reviewing it , management personnel must respond with the project external slack variable and a project event slack variable ( if used ). in similar manner , a very large project extending over many companies , can use this control system . each company would be analogous to the individual with the personal computer , transmitting critical component slack information to a central management and recieving project timing directions via project slack variable information from the central management . while the invention has been particularly shown and described in reference to a preferred embodiment thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and detail may be made therein without departing from the spirit and scope of the invention . table 1__________________________________________________________________________ baseline schedule estimated slackitem no . event no . date avail . date slack + 5 + 4 + 3 + 2 + 1 0 - 1 - 2__________________________________________________________________________91001e1 13 oct . 14 oct . - 1 x91002e1 13 oct . 12 oct . + 1 x91003e2 17 oct . 15 oct . + 2 x91004e2 17 oct . 14 oct . + 3 x91005e3 20 oct . 22 oct . - 2 x91006e3 20 oct . 19 oct . + 1 x91007e4 12 oct . 12 oct . 0 x91008e4 12 oct . 10 oct . + 2 x91009e5 17 oct . 12 oct . + 5 x91010e5 17 oct . 13 oct . + 4 x__________________________________________________________________________ table 2__________________________________________________________________________event slack slack cost toitem no . no . no . + 2 + 1 0 - 1 - 2 improve avail__________________________________________________________________________91001e1 - 1 200 200 200 x $ 200 / day91002e2 + 1 100 x $ 100 / day91005e3 - 2 200 200 200 200 x $ 200 / day91006e3 + 1 100 x $ 200 / day91007e4 0 4000 4000 x $ 4000 / daycost to improve $ 9600 $ 5000 $ 600 $ 200 $ 0final compl . date : __________________________________________________________________________	6
a preferred embodiment of the present invention , the terrain mapping ladar , is depicted in block diagram form in fig1 . a system controller 1 controls the functions of the major components of the terrain mapping ladar system . system controller 1 connects to pulsed laser transmitter 2 through bidirectional electrical connections which transfer commands from system controller 1 to pulsed laser transmitter 2 and return monitoring signals from pulsed laser transmitter 2 to the system controller 1 . an optical sample of the outbound laser pulse is routed to a corner of the detector array 5 as an automatic range correction ( arc ) signal , typically over a fiber optic cable . the pulsed laser transmitter 2 may be a solid - state laser , monoblock laser , semiconductor laser , fiber laser , or an array of semiconductor lasers . it may also consist of more than one individual laser to increase the data rate . in the preferred embodiment , pulsed laser transmitter 2 is a disc shaped solid state laser of erbium doped phosphate glass pumped by 976 nanometer semiconductor laser light . in an alternative embodiment , pulsed laser transmitter 2 is an array of vertical cavity surface emitting lasers ( vcsels ). in operation , the system controller 1 initiates a laser illuminating pulse by sending a logic command to pulsed laser transmitter 2 , which responds by transmitting an intense pulse of laser light through transmit optics 3 . transmit optics 3 diffuses the high intensity spot produced by pulsed laser transmitter 2 substantially uniformly over the desired field of view to be imaged by the terrain mapping ladar sensor as can be seen in fig2 & amp ; 3 . an optical sample of the transmitted laser pulse ( termed an arc signal ) is also sent to the detector array 5 via optical fiber . a few pixels in a corner of detector array 5 are illuminated with the arc ( automatic range correction ) signal , which establishes a zero time reference for the timing circuits in the readout integrated circuit ( roic ) 6 . each unit cell of the readout integrated circuit 6 has an associated timing circuit which is started counting by an electrical pulse derived from the arc signal . when some portion of the transmitted laser pulse is reflected from a feature in the scene in the field of view of the terrain mapping ladar sensor , it may be reflected onto an individual detector element of the detector array 5 . this reflected laser light optical signal is then detected by the affected detector element and converted into an electrical current pulse which is then amplified by an associated unit cell electrical circuit of the readout integrated circuit 6 , and the time of flight measured . thusly , the range to each reflective feature in the scene in the field of view is therefore able to be measured by the terrain mapping ladar sensor . an optional motorized pivot mount allows the illuminating beam of the pulsed laser transmitter 2 to be advanced or retarded in the direction of motion of the ladar platform . in a second preferred embodiment , for high speed platform motion or high altitude mapping , the mechanical pivot is eliminated and the focal plane detector array 5 is moved linearly rearward by a linear motion translation stage , so the illuminating laser pulse will be incident upon one of the rows of the focal plane array . the focal plane array and readout integrated circuit may be an m × n or n × n large array . transmit optics 3 consisting of a cylindrical lens , holographic diffuser , diffractive grating array , or microlens array , condition the output beam of the pulsed laser transmitter 2 into a proper fan shaped beam for illuminating a thin and wide section of terrain or ocean bottom underneath the ladar platform . the combination of pulsed laser transmitter 2 , transmit optics 3 , and optional motorized pivot or linear translation stage , comprise a velocity compensating illuminator 20 , which is shown with the dashed line boundary in fig1 . the preferred embodiment of the terrain mapping ladar sensor is for a lightweight unmanned aerial vehicle or remotely controlled submersible , and is designed to be as low cost , low weight and low volume as reasonably practical . a single axis motorized pivot raises the cost , mass , and power consumption of the terrain mapping ladar sensor but may be necessary for high altitude or high speed mapping applications . a linear translation stage for adjusting the position of the focal plane array fore and aft may be an even lower cost and lower weight velocity compensation structure as an alternative to a motorized pivot . a dual axis gimbal pivot is a third alternative embodiment of the terrain mapping ladar sensor , though not a preferred option , owing to the even greater expense , mass , and power consumption . a dual axis gimbal can be useful for increasing swath width or coverage area and would typically be used with a square or rectangular ( m × n ) fpa as opposed to a 2 × n fpa . the associated scan pattern might be left to right and then right to left where the fpa advances one or more rows in the direction of motion each time the gimbal scans laterally . continuing with fig1 , receive optics 4 consisting of a convex lens , spherical lens , cylindrical lens , or diffractive grating array captures pulsed laser light reflected from a scene in the field of view of the terrain mapping ladar sensor . receive optics 4 collect the light reflected from the scene and focus the collected light on the detector array 5 . detector array 5 is typically formed on an indium phosphide semiconducting substrate with a set of cathode contacts exposed to the light and a set of anode contacts electrically connected to the supporting readout integrated circuit 6 . the cathode contacts of the individual detectors of detector array 5 are typically connected to a high voltage detector bias grid on the illuminated side of the detector array 5 and then to a supporting circuit assembly . each anode contact of the detector elements of detector array 5 is independently connected to an input of a unit cell electronic circuit of readout integrated circuit 6 . readout integrated circuit 6 comprises a rectangular array of unit cell electrical circuits , each unit cell with the capability of amplifying a low level photocurrent received from an optoelectronic detector element of detector array 5 , sampling the amplifier output , and detecting the presence of an electrical pulse in the unit cell amplifier output associated with a light pulse reflected from the scene and intercepted by the detector element of detector array 5 connected to the unit cell electrical input . the detector array 5 may be a p - on - n design or n - on - p design with the dominant carrier being holes or electrons respectively ; the corresponding roic would have the requisite polarity . additionally , particularly for underwater mapping , the semiconductor substrate may be silicon . the hybrid assembly of detector array 5 and readout integrated circuit 6 is mounted to a camera electronics and image processor 9 printed circuit assembly . the camera electronics and image processor 9 circuit assembly supplies conditioned power and ground , a reference clock signal , calibration constants , and selection inputs for the readout column and row , among other support functions , while receiving and registering range and intensity outputs from the readout integrated circuit 6 for the individual elements of the detector array 5 . a detector bias control circuit 7 applies a time varying detector bias to the detector array 5 which provides optimum detector bias levels to reduce the hazards of saturation in the near field of view of detector array 5 , while maximizing the potential for detection of distant objects in the field of view of detector array 5 . the contour of the time varying detector bias supplied by detector bias control circuit 7 is formulated by image analysis and bias vector processor 8 based on the reflectivity and distance of objects or points in the scene in the field of view of the detector array 5 . system controller 1 also controls the interactions with external systems hosted on the ladar platform through bidirectional communications interface 16 , which may be a serial or parallel communications interface , depending on the application and level of integration with the ladar platform electronics . communications interface 16 is an ethernet serial interface in a preferred embodiment . system controller 1 also receives inputs from a system memory 15 which loads operating firmware on wake - up , acts as a cache for system controller 1 , and may also act as a permanent data recording device in a manner similar to a flight data recorder . system memory 15 is typically flash memory in the preferred embodiment , but may also be a combination of volatile and non - volatile memory , or magnetic memory in some cases . the connection between system controller 1 and system memory 15 is a bidirectional parallel or serial electrical interface . the terrain mapping ladar sensor also has a positional reference 11 , typically a global positioning system ( gps ) receiver which receives position data through antenna 10 mounted to the ladar platform . an inertial reference 12 allows the terrain mapping ladar sensor to calculate position of the platform between updates of the positional reference 11 . there are zones where gps may be unavailable , or times where the gps system may be unavailable , so inertial reference 12 may be a simple mems based tuning fork type of reference , or a more capable aviation type gyroscope or even a ring laser gyroscope . a pressure sensor 13 provides an underwater mapping platform a depth gauge for underwater mapping applications . the system controller 1 controls and receives data via bidirectional electrical interfaces 14 which may be parallel , serial , or a combination of serial and parallel structures , or may be a single parallel bus architecture using shared media . the bidirectional electrical interfaces 14 connect the system controller 1 to the camera electronics and image processor 9 , the image analysis and bias vector processor 8 , the positional reference 11 , the inertial reference 12 , and the pressure sensor 13 , at minimum . if the terrain mapping ladar sensor is to be used in guidance of the ladar platform a bidirectional interface will exist between the system controller 1 and the navigation guidance and control system for the ladar platform . fig2 shows two typical terrain mapping applications which are addressed by the terrain mapping ladar sensor . an aerial ladar platform 17 , typically an unmanned aerial vehicle ( uav ) is flying through a distance x in a forward direction at a height h . the uav 17 will travel forward a distance δx in a time δt . the incremental time δt is a measure of the time of flight of a laser pulse from the time it leaves the transmit optics 3 until it reflects off a feature in the terrain and returns through receive optics 4 and is detected by an element of detector array 5 . a gps antenna 18 receives positional reference data from orbiting satellites , and a radome 19 is positioned on a lower surface and forward on ladar platform 17 . radome 19 is transparent at the wavelength of the laser light emanating from the pulsed laser transmitter 2 . given a fixed and minimum forward velocity of the uav ladar platform , the distance travelled in the forward direction δx will increase with increasing height h , and it may be necessary to advance the illuminating pulsed laser beam a small angle θ as shown in the diagram of fig2 . normally , the path of the illuminating pulsed laser beam is boresighted with the receive optics 4 at low altitudes . at low altitude , because the speed of light is so great , no appreciable forward movement δx takes place during the time of flight δt , so it is not necessary to advance the illuminating pulsed laser beam . at high altitude h or with high speed forward motion of the ladar platform , an increase in the advance angle θ may be necessary . for example , at a height h of 300 meters the round trip time of flight will be approximately 2 us . if the uav 17 travels in a forward direction at 25 mph , then the ladar platform 17 will have moved only 23 microns , less than one third of the diameter of a typically sized detector element of detector array 5 . in this case , it would not be necessary to create an advance angle to compensate for forward motion of the ladar platform 17 . with the detectors typically of 70 micron diameter on an 80 micron pitch , forward motion of the ladar platform would not need to be compensated unless the forward speed increased beyond 75 - 100 mph at the 300 meter height , since there are at least two rows of detector elements in detector array 5 , and the second row of detector elements would receive the reflected pulsed laser light as the forward speed of the ladar platform increased up to the 100 mph rate . in a second preferred embodiment , detector array 5 is mounted on a small linear translation stage within system / receiver 26 . velocity compensation may be accomplished in this second preferred embodiment by moving detector array 5 forward or rearward in the line of motion of ladar platform 17 . higher speeds and altitudes may in a third alternative embodiment be accommodated by increasing the number of rows beyond the two rows of the preferred embodiment , though with some negative effect on system power consumption and complexity . the number of rows may increase up to 128 in a preferred embodiment , resulting in a detector array 5 of 128 × 128 detector elements . high altitude performance may additionally require a higher power output pulse from pulsed laser transmitter 2 . in any event , camera electronics and image processor 9 compensates each measurement of range and intensity for motion of the ladar platform 17 , by using the positional reference 11 and the inertial reference 12 to remove the effects of ladar platform 17 motion . the drawing of fig2 shows a velocity compensating illuminator 20 within radome 19 and the remainder of the terrain mapping ladar sensor shown as system / receiver 26 which comprises the optional linear translation stage and all of the remaining elements 1 - 16 of fig1 minus the pulsed laser transmitter 2 , transmit optics 3 , and optional motorized pivot . velocity compensating illuminator 20 is illustrated within the circular dashed line at top left of fig2 , and comprises mounting bracket 21 with mounting holes shown as dashed lines , pedestal yoke 22 , pivot bearing 23 , rotor 24 , and ladar transmitter 25 . ladar transmitter 25 comprises pulsed laser transmitter 2 and transmit optics 3 , and is securely attached to rotor 24 by screws , rivets , or other reliable mechanical means . pedestal yoke 22 houses an electrical motor stator portion , and rotor 24 is the accompanying rotor for the electrical motorized pivot . flying over the zone to be mapped , ladar platform 17 enables the terrain mapping ladar sensor to send out a laser pulse from velocity compensating illuminator 20 ( dashed lines ), and receives a return laser pulse in system / receiver 26 which has been reflected from a feature in the terrain . in the drawing of fig2 , the feature in the scene is quonset hut 27 built on the land 28 close to the tidal zone of an ocean 29 . if the wavelength of the laser light transmitted by the pulsed laser transmitter 2 of the preferred embodiment is 0 . 53 microns , penetration of the ocean depth is anticipated to approximately 2 to 5 diffuse attenuation lengths ( a measure of water turbidity ), allowing for the terrain mapping ladar sensor to view and map the storm sewer pipe 35 at a depth of a few meters , the tethered anti - shipping mine 34 at a depth of approximately 10 meters or less and the ocean bottom 33 shipwreck 32 at a depths 50 to 100 meters . floating mine 34 a may be a surface floating mine , a subsurface floating mine , or an oscillating mine which floats up to the surface and back down to a prescribed depth in a periodic fashion . depending upon water turbidity ; the terrain mapping ladar sensor may also be configured to map the ocean waves . the velocity compensating illuminator 20 may also be used to provide a multiple look capability to image regions that may have been obscured by a breaking wave . under these circumstances , after taking a frame of data from a particular position on the ocean surface , the terrain mapping ladar sensor would be made to look back at the same position after the time it takes a typical wave to break . a multiple look capability prevents blank regions in the mapping data record , because breaking foam is highly reflective of laser light , and it is particularly obstructive in the mapping of the ocean bottom 33 in the surf zone . the use of a specially adapted submarine ladar platform 30 which uses a blue ( 450 - 490 nm ) or green ( 520 - 540 nm ) pulsed laser transmitter 2 , within a pressure vessel allowing it to dive to some depth , will increase the depth capability of the underwater survey . mapping of the ocean depths is referred to in the art and later herein , as bathymetry . submarine ladar platform 30 has a terrain mapping ladar with all the described features of the instant invention , including velocity compensating illuminator 20 and system / receiver 26 , mounted within a pressure resistant radome 31 which is transparent to light in the preferred blue or green wavelengths between 0 . 45 - 0 . 53 um of the pulsed laser transmitter 2 . very deep ocean bottoms may be mapped by a combination of higher power laser pulses from pulsed laser transmitter 2 , and / or a submarine ladar platform 30 capable of operating at greater depths . in the case of underwater mapping , camera electronics and image processor 9 compensates each measurement of range and intensity for motion of the submarine ladar platform 30 using the onboard positional reference 11 , the inertial reference 12 , and the pressure sensor / depth gauge 14 to remove the effects of motion of submarine ladar platform 30 . if the width of the sweep of the terrain mapping ladar sensor is not great enough , the path of the ladar platform 17 or 31 may be controlled to produce a spiral search pattern , a rectangular rastered pattern , or any other preferred search protocol . a slight roll may be introduced into the ladar platform 17 or 31 to produce an increase in the mapped terrain to the left or right of the direction of travel . the optional motorized pivot may also be used to compensate for pitch up or pitch down due to external forces on the ladar platform 17 or 31 . additionally , the optional motorized pivot may be used to rescan areas which might have been temporarily obscured , e . g ., a submerged rock obscured by a wave breaking in shallow water . fig3 is an illustration of a preferred embodiment of the velocity compensating illuminator 20 . common to fig2 are the mounting bracket 21 , pedestal yoke 22 , motorized pivot 23 , and rotor 24 . the pulsed laser transmitter 2 is positioned interior to the cylindrical lens 36 of the preferred embodiment . on the left side of fig3 is shown a side view of velocity compensating illuminator 20 , with the symmetrical lens supports 37 counterbored to provide lens mount recesses 38 designed to hold the circular profile of cylindrical lens 36 securely . the right side of fig3 shows a section of the velocity compensating illuminator 20 taken along line aa , clearly showing the circular profile of cylindrical lens 36 . the fan - shaped projection 40 of the light from pulsed laser transmitter 2 is also shown as the hatched pattern on landscape 41 . other types of diffusing lenses are anticipated which are capable of shaping the illuminating beam in a similar fashion , including diffractive arrays and holographic diffusing lenses . fig4 is a cutaway diagram of a hermetically packaged detector array 5 and readout ic 6 hybrid structure . the package is broadly described in the industry parlance as a “ quad flatpack ”, though other terms may be used , and the present embodiment has several features which distinguish it from a standard quad flatpack . shown at the left of fig4 is a left side cutaway view showing a covar ® base 42 , selected for its excellent matching with the thermal expansion coefficients of glass and silicon . covar ® base 42 is typically formed in the shape of a four sided tub , and may be deep - drawn in volume production , or machined in small quantities . an optional thermal enhancement to the package , formed by making a cutout in the center of the bottom of the base 42 , and brazing heat sink / spreader 43 of copper - tungsten or copper molybdenum alloy to the base 42 , will assist in the removal of heat from the readout integrated circuit 6 , which is eutectically bonded or epoxied to the base 42 . the four side walls 44 of tub shaped base 42 are perforated to allow for flat leads 45 to be inserted and held in place by glass seals 46 . flat leads 45 are typically in leadframes , and are photo - etched or stamped from sheets of beryllium - copper alloy which have a thickness from 0 . 25 mm to 1 . 0 mm , each lead with a width of 0 . 4 mm to 0 . 675 mm . in the preferred embodiment , all four sides 44 of base 42 are utilized , with a total of 176 leads split among the four sides . a rectangular metal cover 47 with an integral glass window 48 is welded , soldered , or epoxied to the entire periphery of side walls 44 . in a preferred embodiment , a continuous seam is formed by weldment 49 to create a hermetically sealed package for detector array 5 and readout integrated circuit 6 . prior to attachment of the cover 47 , a circuit substrate 51 is attached to the base 42 to breakout the fine pitch leads which are on 0 . 1 mm centers on the readout ic 6 to the 1 . 25 mm pitch typical of the package periphery . also prior to attachment of the cover 47 , the flat leads 45 are soldered to the circuit substrate 51 using solder 50 , and wirebonds 53 are made between readout ic 6 and circuit substrate 51 . the thickness of substrate 51 is chosen to closely match the thickness of readout ic 6 so minimal length wirebonds 53 can be made between readout ic 6 and substrate 51 , enhancing high frequency electrical performance of the package . circuit substrate 51 is typically formed of alumina or aluminum nitride , with a bondable gold thick film circuit screened and fired on the surface . multiple layers of dielectric and additional circuit layers and conductive vias are added , to accommodate the complexity of the readout ic 6 and the circuits external to the package . additionally , resistors and low value capacitors and inductors may be screened on and co - fired with the circuit layers . high value inductors and capacitors may be picked and placed on circuit substrate 51 and epoxied with a conductive epoxy or soldered in place prior to attachment of the substrate 51 to the base 42 . circuit substrate 51 may also be formed using a thin film process which starts by uniformly coating substrate 51 with thin metal films , and removing portions of the film photolithographically as in standard printed circuit board processing . in some applications , a printed circuit board of glass - epoxy laminate may be used as circuit substrate 51 , with a bondable gold plating applied selectively to the wirebond pads . shown at the right of fig4 is an alternative method of connecting circuit substrate 51 to flat leads 45 using wirebonds 52 to make the connection . flat leads 45 may alternatively be of a circular cross - section , or of other geometry suited to a particular application without reducing or substantially altering the many benefits of the instant invention . an optional tube 54 allows for backfilling of the package with an inert gas such as argon or nitrogen , or evacuation of the atmosphere in a vacuum environment . tube 54 may be pinched , filled with solder , or otherwise sealed upon completion of any backfilling or evacuation process . fig5 shows a top view of the detector array 5 and readout integrated circuit 6 hybrid assembly . wirebondable bond pads 55 on readout integrated circuit 5 occupy the periphery of the chip , and are typically comprised of a thin metal coating applied by evaporation in a vacuum chamber . a sequence of titanium followed by platinum and then gold produces a bondable gold pad with excellent adhesion to silicon readout integrated circuit 6 with an adequate barrier to gold migration . other metallization schemes such as titanium / nickel / gold may be used with a similar beneficial effect . the unit cell electronics 56 associated with each detector element 57 of detector array 5 are shown interior to the boundary formed by bond pads 55 . because the detector array 5 consists of two rows of detector elements 57 , there is a great deal of additional room to the top and bottom of detector array 5 to expand the area of unit cell electronics 56 . an increase in area of unit cell electronics 56 allows for significant expansion of the number of memory cells in unit cell electronics 56 . this additional area will be utilized in a manner described later herein to enable enhanced performance of the terrain mapping ladar sensor . the detector array 5 of the preferred embodiment is a 2 × 128 array of detector elements , though the drawing of fig5 shows a 2 × 16 array of detector elements for purposes of clarity in the presentation . a high voltage detector bias grid 582 is a metallic film deposited on the surface of detector array 5 to distribute the 40 - 80 vdc typically utilized by the preferred detector structure 65 of the instant invention , an avalanche photodiode . a capacitive voltage distribution grid is formed by evaporating insulating film 581 atop high voltage detector bias grid 582 , and then forming grounding mesh 58 on top of insulating film 581 . ground connecting wirebonds 620 are then connected at both ends of the detector array 5 to provide for a low inductance ground reference plane atop detector array 5 . voltage connecting wirebonds 622 are then connected at both ends of detector array 5 to provide for a low inductance voltage plane atop detector array 5 . the top surface of detector array 5 in the preferred embodiment is the cathode connection of an array of avalanche photodiode detector elements 57 formed by diffusion into a semiconducting substrate or epitaxial growth of a semiconductor compound onto a semiconducting substrate . the semiconducting substrate of the preferred embodiment is indium phosphide , but may be gallium arsenide , silicon , silicon carbide , gallium nitride , mercury cadmium telluride , or other known semiconductor material suitable to the intended wavelength of operation of the terrain mapping ladar sensor . different wavelengths may be suitable for many specialized terrain mapping applications , depending on the features being observed , and the nature of any obscuring aerosols or vapors . an indium bump 60 connects the anodes of the detector element of detector array 5 to the inputs of the corresponding unit cell electronic circuit 56 of readout integrated circuit 6 . in the preferred embodiment , the detector array 5 and readout integrated circuit 6 are patterned with indium bumps , and the detector array 5 is flipped over and bonded to readout integrated circuit 6 by compression . in an alternative embodiment , a similar process is utilized wherein small solder bumps are applied to both parts , and the detector array 5 is flipped and bonded to readout integrated circuit 6 by means of solder reflow . at the bottom of fig5 a side view of the detector hybrid is shown mounted to printed circuit substrate 61 , which may be alumina , aluminum nitride , glass / epoxy laminate , or other suitable printed material appropriate to the application . in order to feed the high voltage detector bias to the anodes of the detector array 5 , a long wirebond 59 is used to connect detector bias voltage pad 66 from the printed circuit substrate up to metal film pad 64 on the detector array 5 . the metal film pad 64 is part of the same metal film as the bias grid 582 , but shown in profile , and relabeled for clarity . however , long wirebonds are to be avoided in hybrid assembly for a number of reasons . long wirebonds are not conducive to low inductance bias voltage connections , and are also subject to additional mechanical stress in high vibration environments , which could cause failure in some scenarios . a stair stepped solution is shown making connection to the grounding mesh 58 of detector array 5 , with lower wirebond 63 and upper wirebond 62 , using the readout integrated circuit 6 as an intermediate height step . in cases where lower speed operations are envisioned , or where absolute minimum cost is desired , the long wirebond 59 or stair stepped solutions 62 , 63 , may prove adequate . however , a solution where both high speed operations and reliability are facilitated is preferred and is shown in the next figure , fig6 . fig6 shows a top view and front side view of several features designed to overcome the limitations of standard techniques used to implement the hybrid assembly of detector array 5 and readout integrated circuit 6 . metallic leaf spring 67 overlaps the edges of detector bias grid 582 and attaches with solder to metal film pad 64 , which is the lateral aspect of a portion of detector bias grid 582 . alternatively , metallic leaf spring 67 may be attached to detector bias grid 582 and metallic film pad 64 with conductive epoxy , or allowed to make electrical contact to detector bias grid 582 through pressure alone . if a pressure contact is the sole method for connecting leaf spring 67 to metallic film pad 64 , both must have soft gold plating to ensure a proper electrical connection . leaf spring 67 has a pair of holes 68 punched or etched at the corners , and a pin 70 soldered thereto . metallic leaf spring 67 is a thin metal strip in the preferred embodiment , formed in ¾ hard beryllium copper 1 / 64 inch thick , making possible a very low inductance and high quality electrical connection of the detector bias supply from circuit substrate 73 to detector bias grid 582 . pin 70 penetrates circuit substrate 73 to connect to the high voltage detector bias feed . pin 70 may also be used in conjunction with a third or fourth metallic leaf spring 671 to make flying ground connections to the top of the substrate comprising detector array 5 where a ground connection is required atop detector array 5 to effect a distributed capacitive voltage grid as detailed in fig5 , and later in this application with respect to fig1 - 18 . circuit substrate 73 is shaped like a picture frame and is shown in a section view at bottom of fig6 . a recess 71 is counter bored in metallic base plate 42 to avoid potential short circuits which might be caused by base plate 42 making contact with pin 70 . base plate 42 may also have thermal enhancements not shown in the figure for the purpose of clarity . pin 70 may be enhanced by an integral coaxial capacitor 72 with a high voltage rating of typically 100 vdc . in the preferred embodiment , the body of pin 70 is the high voltage conductor , and the pin 70 is surrounded by a highly capacitive dielectric and the capacitor is terminated in a cylindrical outer electrode which is typically connected to circuit ground on circuit substrate 73 . this use of integral coaxial capacitor 72 with pin 70 allows for decoupling of high speed voltage transients imposed on the detector bias grid 582 by digital circuits residing on readout integrated circuit 6 or circuit substrate 73 , thus improving the performance of detector array 5 through use of the innovative structure . the system of pins 70 and pins with coaxial capacitors 72 together with metallic leaf springs 67 and 671 may be used on all four sides of readout integrated circuit 6 if desired . metallic leaf springs 67 and 671 may be replaced with a flexible circuit of nickel / gold plated copper on mylar ®, kapton ®, or other polymer film for high volume production . circuit substrate 73 is of the same or similar thickness as readout integrated circuit 6 to allow for minimal length lateral wirebonds 69 to be made between the bond pads 55 of readout integrated circuit 6 and the bond pads 74 resident on circuit substrate 73 . use of minimal length lateral wirebonds 69 allows for very high speed circuit operation for any signals which must be driven onto the readout integrated circuit 6 from circuit substrate 73 or received by circuit substrate 73 from readout integrated circuit 6 . fig7 shows a top view and front section view taken along line aa of an integrated receive sensor 78 comprised of detector array 5 and readout integrated circuit 6 and several notable features . the detector array 5 and readout integrated circuit 6 comprising integrated receive sensor 78 are formed on the same semiconducting substrate ; in the preferred embodiment , indium phosphide . other substrate materials may be used depending on the wavelength of interest for the terrain mapping ladar sensor . bond pads 55 at the periphery of the integrated receive sensor 78 provide locations for low inductance lateral wirebonds 69 to connect electrical inputs and outputs from the receive sensor 78 to the bond pads 74 of the supporting circuits residing on circuit substrate 73 . circuit substrate 73 is a picture frame shape in the preferred embodiment , with a rectangular outside geometry and a rectangular cutout centrally located to allow for mounting of the receive sensor 78 . unit cell electrical circuits 56 are disposed laterally to detector elements 57 , and may be formed by diffusions 75 into the semiconducting substrate , or by epitaxial regrowth on the surface of the semiconducting substrate of integrated receive sensor 78 . detector elements 57 are formed on the surface of the semiconducting substrate by epitaxial regrowth regions 77 or by diffusions into the semiconducting substrate . in the first preferred embodiment , the highest quality detectors are formed by epitaxial regrowth through rectangular windows opened in a mask after unit cell electrical circuits have been formed by diffusions 75 into the semiconducting substrate . a great number of transistors can be formed within regions 75 by appropriately patterning the substrate , semiconducting n - type or p - type diffusions , and forming oxides , etc ., as is well known in the literature . in a second preferred embodiment , where applications dictate the lowest possible cost , detector elements 57 and unit cell electrical circuits 56 may both be formed by diffusion , and epitaxial regrowth of semiconducting films may be foregone , though a lower performing detector array 5 may be the expected result . in a third preferred embodiment , where applications demand the highest performance , all or a portion of unit cell electrical circuits 56 may also be formed by epitaxial regrowth of semiconducting films onto the semiconducting substrate simultaneously with detector elements 57 , or by a later , lower temperature profile regrowth . the vertical profile of epitaxial layers needed for detector elements 57 and the transistors of unit cell electrical circuits 56 are different enough in the third preferred embodiment to prohibit formation of both structures simultaneously ; therefore a sequential epitaxial regrowth process is necessary to realize both on the same semiconducting substrate . the order of the epitaxial regrowths may be reversed , with detector elements 57 being formed in a first process , and the epitaxial films required for the transistors of unit cell electrical circuits 56 formed subsequently . several references , including u . s . pat . no . 4 , 771 , 325 issued to cheng , et al ., u . s . pat . no . 5 , 189 , 296 issued to kwark , u . s . pat . no . 6 , 727 , 530 issued to feng et al ., u . s . pat . no . 5 , 063 , 426 issued to chandrasekhar et al ., and u . s . pat . no . 6 , 583 , 445 issued to reedy , et al . provide background in this area . the detector bias grid 582 is connected to the cathode of each detector element of the detector array 5 by overlapping metal film portion 76 , which contacts at least one side , and preferably all four sides , of each detector element 57 of detector array 5 . an insulating layer and ground plane can be added to this structure as well , providing a distributed capacitance voltage distribution grid as in fig5 and 6 , though for clarity in this diagram it is omitted . also not shown , for the sake of clarity are electrical connections between individual detector elements 57 and the corresponding unit cell electrical circuits 56 of the readout integrated circuit 6 , both residing on integrated receive sensor 78 . typically a semiconducting film of indium gallium arsenide or indium gallium arsenide phosphide is regrown epitaxially to form detector elements 57 or unit cell electrical circuits 56 on integrated receive sensor 78 , though in alternative embodiments , gallium arsenide or gallium arsenide phosphide may be formed as one or both of the epitaxial films . substrate material for the integrated receive sensor may be indium phosphide as in the preferred embodiment , but may alternatively be indium gallium arsenide , or gallium arsenide , depending on the desired operating wavelength of the integrated receive sensor 78 . in a fourth preferred embodiment , a silicon substrate is processed normally , with cmos circuitry having features as fine as 28 nm forming the unit cell electrical circuits 56 and supporting circuitry of the readout integrated circuit 6 . subsequently , a low temperature process is used to epitaxially form the detector elements 57 of detector array 5 . the low temperature epitaxial process used may be liquid phase epitaxy ( lpe ), metal organic chemical vapor deposition ( mocvd ), or molecular beam epitaxy ( mbe ). in the embodiments described herein , detector elements 57 are typically avalanche photodiodes , but may alternatively be pin diode structures or phototransistors . both circuit substrate 73 and integrated receive sensor 78 comprised of detector array 5 and readout integrated circuit 6 are attached to base plate 42 using solder or conductive epoxy . base plate 42 may be thermally enhanced as described previously herein with respect to fig4 . fig8 describes a further embodiment of detector array 5 and illustrates features of the hybrid assembly with readout integrated circuit 6 . a top view shows a plan layout of the detector array 5 employing a number of discrete detector die 79 , while not showing a number of features of the assembly such as wirebonds , lenses , conductive bumps , and vias , which are evident in the front side view at the bottom of fig8 . bond pads 55 occupy the periphery of readout integrated circuit 6 , and provide connection points for the vertical wirebonds 82 used to connect the high voltage detector bias to the top of glass window 80 . glass window 80 has a conductive through hole via 84 which connects detector bias grid 582 to a pad 87 on the top side of glass window 80 . an insulating layer and ground plane can be added to this structure as well , providing a distributed capacitance voltage distribution grid as in fig5 and 6 , though for clarity in this diagram it is omitted . detector elements 57 of detector array 5 are now individual detector die 79 , with the cathode of each detector element 57 provided with gold or indium conductive bumps 83 . in the preferred embodiment , the detector array 5 is formed by using a pick and place robot to place individual detector die 79 on the inverted glass window 80 ( lens face down ), and in contact with detector bias grid 582 which has been pre - tinned or screened with solder paste . the glass window 80 with detector die 79 in place is then placed in a solder reflow oven and the solder reflowed to make electrical and mechanical connection of the individual detector die 79 to glass window 80 . alternatively , thermo - compression or thermo - sonic bonding may be used to establish connections between individual detector die 79 and the detector bias grid 582 of glass window 80 . detector bias grid 582 is formed as a thin metallic layer on glass window 80 with microlenses 81 integrally molded on the reverse side of glass window 80 over each detector element 57 site in the detector array 5 . detector array 5 is shown as a microlensed glass window 80 with an array of two rows of individual detector die 79 , each row with 5 columns . once electrical connections have been made to the detector dice 79 cathodes , the glass window 80 and array of detector die 79 may be considered equivalent to detector array 5 , though to distinguish this structure , it may be termed a discrete focal plane array ( dfpa ), and it can be shown to have several advantages in systems with a limited number of pixels . once the dfpa 5 is formed , it is flipped over and the hybrid assembly is mated to the readout integrated circuit 6 and the solder reflow process is repeated . glass window 80 is a borosilicate glass in the preferred embodiment , though it may also be a window of calcium fluoride , fused quartz , sapphire , or other semi - transparent material depending on the wavelength of operation and the application . detector array 5 is a discrete array of 2 × 128 detector elements 57 in the preferred embodiment , though in this drawing only a 2 × 5 array is shown for the purpose of clarity . in an alternative embodiment , glass window 80 may be eliminated , and the discrete detector elements 57 picked and placed directly on the readout integrated circuit 6 and affixed by means of conductive epoxy or solder reflow . detector dice 79 are typically connected with the cathodes attached to the detector bias grid 582 , though the opposite connection may be used in some applications , with the detector dice 79 anodes connected to a common detector bias grid 582 , and the applied detector voltage bias reversed , without significantly altering the invention or the beneficial effects thereof . the detector elements 57 of dfpa 5 are avalanche photodiodes in the preferred embodiment , but may be pin , nip , or other detector structure useful in a desired wavelength and application . one of the major advantages of the dfpa 5 hybrid structure is all of the elements may be pre - tested before being assembled , thus allowing for matching of the response characteristics . detector elements 57 of the dfpa 5 may be selected for reverse leakage , breakdown voltage , linearity , frequency response , parasitic capacitance , series resistance , quantum efficiency , or any other relevant electronic or optoelectronic parameter desired . further , since the individual detector elements 57 are fully isolated detector die 79 , electrical isolation is vastly increased , thereby greatly reducing electrical crosstalk between detector elements 57 of the detector array 5 . other advantages accrue to the benefit of the dfpa 5 structure which are virtually impossible to reproduce in a single die detector array as described in fig5 - 7 ; the dfpa 5 may be repaired if one detector element 57 of the dfpa 5 is damaged . further , because the individual detector dice 79 are pretested , arrays with no “ bad pixels ” are common . in single die detector arrays 5 where all detector elements 57 are formed on the same semiconducting substrate , there is almost always a number of “ bad pixels ” which are caused by defects in the crystallography of the semiconducting substrate and other processing irregularities . these “ bad pixels ” are a common affliction for any ladar sensor , and result in a 3 - d picture with the appearance of “ measles ”, or “ acne ”. with high performance pick and place machines capable of placing 136 , 000 components per hour , a 2 × 128 array may be placed in less than 7 seconds , while a 128 × 128 array typical of larger format flash ladar sensors can be placed in 6 . 5 minutes . one drawback to the dfpa is the minimum size of any detector die 79 is in the range of 250 microns , since the detector die 79 must be picked up by a vacuum chuck and positioned mechanically , whereas single die detector arrays 5 may be fabricated with a pitch of 50 microns or less . therefore , for a single die detector array 5 of a given complexity , the same dfpa 5 would result in a much larger square area , requiring concomitantly larger optical apertures . if very high resolution arrays , larger than 256 × 256 square are required , the option of a dfpa 5 becomes problematic , and the resulting size may be hard to accommodate . the dfpa therefore has maximum advantage in lower complexity , high performance arrays , and can provide significant cost savings in applications requiring zero defects or well matched optoelectronic performance , owing to higher yields over single die detector arrays 5 . fig9 shows the preferred structure for assembling a dfpa 5 and readout integrated circuit 6 into the hybrid package of fig4 . the subassembly of dfpa 5 and readout integrated circuit 6 is placed on base plate 42 of the hybrid package and is attached using solder or conductive epoxy . circuit substrate 73 has been previously attached to base plate 42 and receives lateral bond wires 69 on bond pads 74 . lateral bond wires 69 terminate on bond pads 55 at the periphery of readout integrated circuit 6 . basic pins 70 or coaxial capacitor pins 72 are soldered to circuit substrate 73 , and leaf spring 67 is soldered thereto . leaf spring 67 is then connected to pad 87 atop glass window 80 with solder or conductive epoxy . pad 87 is connected to the detector bias grid 582 through glass window 80 by conductive through hole vias 84 . except for the different height and appearance of dfpa 5 , the hybrid assembly of dfpa 5 and readout integrated circuit 6 proceeds in a like manner to the assembly of a single die detector array 5 . fig1 is a block diagram of the unit cell electronics 56 associated with each detector element 57 of detector array 5 . the input of input amplifier 88 of each unit cell electronics 56 is connected to an anode of a detector element 57 of detector array 5 . the output of input amplifier 88 connects to the input of a trigger circuit 89 and to a number of sampling circuits 93 . each sampling circuit 93 behaves as an analog switch connected to a storage capacitor represented in fig1 as memory cell 94 . when activated by a select signal from circular selector 92 , sampling circuit 93 closes an internal analog switch for a short period of time , typically less than a nanosecond , charging the internal storage capacitor of memory cell 94 , and then reopens the internal analog switch , saving a sample of the input amplifier 88 output voltage . the number of sampling circuits 93 matches the number of memory cells 94 . only three memory circuits 94 are shown in fig1 for the purpose of clarity , although there are many more in the preferred embodiment , in a typical configuration 20 to 44 . the sampling is accomplished by the clock 96 , circular selector 92 and sampling circuits 93 . clock 96 resides outside the unit cell electronics 56 , on the common portion of readout integrated circuit 6 . the circular selector 92 has as many outputs as there are memory cells 94 . at each pulse of clock 96 , the circular selector 92 shifts , turning on a separate and independent sampling circuit 93 which connects the input amplifier 88 output to one memory cell 94 . after all memory cells 94 have been filled , the memory cells 94 are overwritten as new data arrives . consequently , the memory cells 94 are always filled with the most recently sampled waveform data . the period of clock 96 is typically much shorter than the pulse width of the reflected laser illuminating pulse , and so the reflected pulse shape is captured in the memory cells 94 . if the input amplifier 88 is a transimpedance amplifier the detector 57 current is transformed to a voltage and the memory cells 94 sample this voltage . if the input amplifier 88 is a current amplifier the detector element 57 current is amplified and the memory cells 94 integrate this current . the circular selector 92 is a simple sequential shift register in the preferred embodiment , but could be based upon an algorithm and therefore may not be sequential . also connected to the output of input amplifier 88 is a trigger circuit 89 which is a schmitt trigger in the preferred embodiment with an internal reference voltage level set globally by the common portion of readout integrated circuit 6 to detect the presence of a reflected laser transmit pulse in the output of input amplifier 88 . a delay circuit 90 allows for data to continue to be accumulated in the memory cells 94 even in the case of a strong input signal or transient , so a complete picture of the reflected light pulse may be captured . when the output of the trigger circuit 89 transitions , the circular selector 92 is frozen after the delay time programmed into delay circuit 90 , again allowing for sufficient time to accumulate an entire waveform of a reflected and detected laser illuminating pulse . counter 91 accumulates the number of clock cycles fed to circular selector 92 before trigger circuit 89 transitions and freezes the circular selector 92 , terminating the data acquisition period and freezing the contents of memory cells 94 . counter 91 is a 12 bit binary counter in the preferred embodiment , but may be more , or may be as few as 8 bits or less depending on the application . the output of the counter 91 is directly proportional to the two way time of flight of a transmitted and reflected laser illuminating pulse . the two way time of flight of a laser illuminating pulse sent from pulsed laser transmitter 2 to a reflective object in a scene in the field of view of the terrain mapping ladar sensor , and returned therefrom , is directly proportional to twice the range to the same reflective object . both the counter output 91 and the memory cell 94 contents may be read out by readout integrated circuit 6 during the time between laser illuminating pulses . output control 97 is a section of readout integrated circuit 6 , which selects the memory cells 94 in sequence during a readout cycle of readout integrated circuit 6 . output amplifier 95 buffers the output of the selected memory cells 94 of each unit cell electrical circuit 56 . laser illuminating pulses typically occur 10 - 30 times per second , though faster or slower rates are also anticipated and provided for by the preferred embodiments described herein . the terrain mapping ladar sensor may be operated in a range gated mode , in which samples of the reflected laser light signals are analyzed by an external digital processor . in the range gated mode , large signal reflections in the near field may be ignored , or “ range gated ” out of the target space and objects in the targeted range space may be detected with greater sensitivity . in this way , referring back to fig2 , a glint , or glare from the surface of water 29 could be the returned signal with the greatest strength , but it might be range gated out , and thus the terrain mapping ladar sensor may develop a greater sensitivity to oscillating mine 34 a in previous publications of the present inventors , this range gated mode is referred to as sular mode . in fig5 - 9 it has been shown there is a great deal of additional area adjacent to the individual detector elements 57 , owing to the nature of the organization of the detector array as a 2 row detector array 5 . this particular geometric arrangement is conducive to a major expansion of the unit cell electronics 56 , creating the opportunity to have several hundred up to perhaps a thousand memory cells 94 , allowing for very long ranges to be accommodated by the terrain mapping ladar sensor of the instant invention . these described advantages may also be realized by reducing the feature sizes of the unit cell electronic circuits 56 photolithographically in the alternative where a square or rectangular detector array 5 of more than 2 rows and columns is required . in such an alternative embodiment , circuit features are reduced photolithograpically , and the readout integrated circuit 6 and detector array 5 are fabricated as a 128 × 128 array or larger m × n array of detector elements 57 and unit cells 56 . fig1 shows an alternative embodiment of the hybrid package of fig4 which may have some advantages in certain lower speed applications . the package is known in the industry as a low temperature co - fired ceramic ( ltcc ) package . features have been added to the typical ltcc package which adapt the package specifically to the needs of the detector array 5 and readout integrated circuit 6 hybrid assembly . a glass window 48 is fuzed to ceramic cover 98 . ceramic base 100 contains a circuit zone 101 made up of alternating layers of conductive traces and insulating ceramic in a manner similar to common thick film ceramic circuit substrates . an optional recess 102 in the ceramic base 100 allows for minimum length lateral wirebonds 69 to be utilized . the conductive traces of circuit zone 101 connect to the bond pads 55 at the periphery of readout integrated circuit 6 through lateral wirebonds 69 as described previously herein . a rectangular array of gold plated beryllium copper pins 103 is attached to the external aspect of the conductive traces embedded in circuit zone 101 by soldering or brazing . in a second alternative embodiment , the array of beryllium copper pins 103 is replaced by metallic bumps for high volume automated assembly . a typical assembly sequence begins with a die attach operation of the detector array 5 and readout integrated circuit 6 hybrid sub - assembly to ceramic base 100 which will already have an array of pins 103 or metallic bumps in place . next , lateral wirebonds 69 are made from readout integrated circuit 6 to the conductive traces of circuit zone 101 . vertical or angled wirebonds may be used in a basic configuration where no recess 102 is formed in ceramic base 100 . finally , in a vacuum or in an inert gas environment , a low temperature glass frit powder or slurry is applied at hermetic joint 99 and the package sealed under temperature and pressure . fig1 is a schematic diagram of a preferred circuit configuration which will enable the terrain mapping ladar sensor by increasing the sensitivity of the detector circuit associated with each detector element 57 of the detector array 5 . increased sensitivity is achieved through a reduction of noise coupled in to the detector element 57 through the bias feed , reducing the effects of random noise as well as reducing self interference sourced from adjacent pixels and coupled through the power supply . shown in fig1 is a pin photodiode comprising detector element 57 of a preferred embodiment , though nip , pn , and apd detector structures may be employed as detector element 57 in a series of alternative embodiments using the circuit of fig1 . isolation to fluctuations and noise in the vbias voltage is achieved through use of series limiting resistor rbias 105 and decoupling capacitor cbias 104 connected in parallel to circuit ground . each unit cell 56 of the readout integrated circuit 6 is comprised of an input transimpedance amplifier 88 and a feedback resistance rfb . rbias may be of a nominal value of 20 k ohms and may be sized to fuse at a given current level of 2 milliamperes or less , indicative of a short circuit in the detector element 57 or unit cell electrical circuit 56 . designing rbias to fuse at a chosen level allows the terrain mapping ladar sensor system to avoid possible damage to the remaining operational circuits of readout integrated circuit 6 and detector array 5 in the case of a single pixel failure . cbias 104 is typically 500 femtofarads due mainly to the geometry of the conductive and insulative structures used to implement the desired capacitance cbias 104 . the parasitic capacitance cpin of the 70 micron diameter pin structure is typically less than 50 femtofarads , meaning the nominal value of 500 femtofarads for cbias is quite significant in relative terms . two structures are detailed in fig1 and 14 which implement all or a portion of the circuit of fig1 . fig1 is a diagram of a focal plane array ( fpa ) comprised of a number of mesa pin array structures which incorporates a capacitive detector bias grid but not the series limiting resistor rbias 105 . shown in fig1 for the sake of clarity is a simplified series of three mesa type pin structures , though the typical array of the preferred embodiment is a 2 × 128 array of pin detector elements 57 . a semiconducting substrate 106 is typically made of a single crystal of indium phosphide , indium gallium arsenide , or indium gallium arsenide phosphide , though other materials are anticipated and may be substituted depending on the wavelength of light to be received . an array of microlenses 107 is formed on the reverse side of substrate 106 to concentrate the incoming light and reduce optical losses due to a less than unity fill factor due to the area given up to the conductors 108 and 110 between detector elements 57 of detector array 5 . each microlens 107 is situated over the center of an individual detector element 57 of detector array 5 and may be formed by etching of the substrate material 106 or may be molded over the substrate 106 . if microlens array 107 is overmolded , a glass with a matching coefficient of thermal expansion is selected , or a polymer may be used . polymer materials used for microlens array 107 should also have a matching coefficient of thermal expansion , though the polymer will typically show greater tolerance to lateral stress in heating and cooling cycles . between each mesa structure , voltage plane metallic film 108 acts to distribute the detector bias voltage directly to the cathode of each apd detector element 57 of detector array 5 . each pin detector element 57 of the detector array 5 in the preferred embodiment has a square aspect when viewed from the top , so a mesh pattern is made by voltage plane metallic film 108 when viewed from above . the mesh pattern of voltage plane metallic film 108 is similar to the ground plane grid 120 of fig1 for reference . an insulating layer 109 of silicon nitride , glass , or other suitable material is then formed atop voltage plane metallic film 108 , again forming a mesh or screen pattern when viewed from above . finally , a ground plane metallic film 110 is formed atop insulating layer 109 in a mesh pattern with setbacks from the edge of insulating layer 109 as shown . once the ground plane metallic film 110 and voltage plane metallic film 108 are connected externally via wirebonds or leaf springs , a distributed capacitance is formed by the overlapping metallic film mesh patterns 108 and 110 separated by a thin dielectric layer 109 , which improves the performance and isolation of the individual pin detector elements 57 of detector array 5 . metallic films 108 and 110 and insulating film 109 may be formed by physical vapor deposition or sputtering , or by any other suitable process , including electroplating . metallic film 108 is typically a sequence of titanium for adhesion to the semiconductor substrate 106 , followed by a nickel barrier and then gold in selected areas where external electrical connections are to be made . likewise , metallic film 110 may be titanium or other suitable base metal , followed with nickel and then gold in areas selected for external electrical connection . the individual detector elements 57 are typically a pin photodiode mesa structure as shown in fig1 , with a cathode 111 formed of highly doped n - type indium phosphide . the anode 115 of the apd detector element 57 shown in fig1 is of highly doped p - type indium phosphide . an epitaxial layer of intrinsic ( π - type ) indium phosphide 114 completes the structure of the pin detector element 57 of detector array 5 . the mesa structures are formed in a preferred embodiment on a substrate 106 of n + type indium phosphide , indium gallium arsenide , or indium gallium arsenide phosphide , which has been augmented by additional epitaxial growths of a cathode contact region 111 of n + indium phosphide , an intrinsic region 114 of π - type indium phosphide , and an anode contact region 115 of p + type indium phosphide . once all of the epitaxial layers 111 , 114 , and 115 have been grown , the mesas are formed by dry etching in areas not covered by a photoresist etch stopping mask . finally , an ohmic anode contact 116 is formed by selectively evaporating a metallic film atop each mesa , typically titanium / platinum / gold or titanium / nickel / gold . the proximity of voltage plane metallic film 108 to n + inp region 111 means an effective cathode connection of each apd detector element 57 is formed as a common connection through the highly conductive semiconductor substrate 106 . the number of individual detectors 57 shown in fig1 is limited to a line of 3 , part of a 3 × 3 detector array 5 , for the purpose of clarity . the nominal detector array 5 in the preferred embodiment is an array of 2 × 128 individual detectors 57 , and the technology described is anticipated to be used on m × n detector arrays 5 of 128 × 128 and larger . fig1 is side view diagram of a more advanced type of focal plane array which may offer even greater sensitivity to weak reflected light signals returning from distant targets . the hybrid structure is formed from two pieces , the first one a glass substrate 117 with molded lenses 118 centered over each site of a detector element 57 of the detector array 5 . atop the glass substrate 117 are a ground plane metallic film 120 , a silicon nitride insulating layer 121 , a number of capacitive cathode ring contacts 124 , an equal number of tantalum nitride film resistors 123 , and a voltage plane metallic film 122 . the metallic films 120 , 122 , and 124 are applied via physical vapor deposition , sputtering , electroplating , or other suitable process . the insulating layer 121 and resistive film layer 123 are applied via physical vapor deposition in the preferred embodiment , though sputtering may also be used . the insulating layer 121 may be silicon nitride , silicon dioxide , or other suitable material . the resistive film 123 may be tantalum nitride , nickel chromium , chromium silicon oxide , or other suitable material . the structure of the cathode ring contacts 124 overlayed atop insulating layer 121 and ground plane metallic film 120 form a high quality distributed capacitor cbias 104 which decouples the bias voltage directly at the pin cathode as shown in the schematic of fig1 . the value of cbias may be as high as 500 femtofarads , depending on the geometry of the cathode ring contact 124 , and the thickness and dielectric constant of the insulating layer 121 . higher values of cbias 104 may be realized by reducing the thickness of insulating layer 121 , or by increasing the area of cathode ring contact 124 , or by adding additional ground plane metallic film 120 in selected areas . the artwork for each layer 120 - 124 is shown in the succeeding fig1 - 18 . the second piece of the hybrid structure is a pin focal plane array formed on a solid substrate of n + indium phosphide material , comprising a trapezoidally shaped pin mesa structure 126 with layers 111 , 114 , and 115 grown epitaxially as described in the discussion of fig1 . a metallic film anode contact 127 is then evaporated or sputtered atop the anode semiconductor material 115 as shown in the diagram . the metallic film anode contact 127 may be selectively gold plated or covered with a photoresist to act as an etch stop . prior to etching back the anode face of the semiconductor substrate to form the mesa structures , the n + indium phosphide wafer substrate ( 106 in fig1 ) is thinned to 125 microns in the preferred embodiment , though thinning to less than 125 microns is anticipated and may produce additional benefits . once the substrate has been thinned , metallic ohmic cathode contacts 125 are formed on the cathode side of each detector element 57 of detector array 5 in a square ring shape . an anti - reflection coating 119 is evaporated onto the cathode face of each detector element 57 of detector array 5 as well . the thinned semiconductor substrate ( 106 in fig1 ) is then attached to the glass substrate 117 by soldering , thermosonic bonding , or thermocompression bonding at the interface between ohmic cathode contacts 125 and capacitive cathode ring contacts 124 . finally , the mesas are etched completely through , fully isolating the mesa structures 126 from each other . typically , this etching process selectively removes the epitaxial layers 111 , 114 , and 115 plus the remaining thickness of substrate 106 which has not been removed by any previous wafer thinning operation , in areas between the individual detector elements 57 of detector array 5 . this process fully implements the schematic of fig1 , providing isolation between detector elements , filtering of the external power supply , localized decoupling of the detector voltage supply , and fuse protection of each detector element 57 of detector array 5 . the bias feed network described in connection with fig1 and 14 comprised of a series connected fusible resistance rbias 105 ( 123 ) and a parallel connected decoupling capacitance cbias 104 ( 124 ) may also be applied to any variant of the discrete focal plane array ( dfpa ) described in association with fig8 and 9 . fig1 and 14 show innovative structures of the detector array 5 , but do not show assembly of the detector array 5 with readout integrated circuit 6 for the purpose of clarity . the hybrid assembly of these unique detector array 5 structures with the readout integrated circuit 6 may be completed in the normal manner , by soldering or compression of indium bumps . an alternative process to realize the embodiment of the structure of fig1 starts with a thick semiconductor substrate ( 106 in fig1 ), typically in the range of 300 - 400 microns . cathode contacts 125 and anti - reflection coating 119 are then formed on substrate 106 prior to attachment to the glass substrate 117 by means of thermocompression bonding , solder , or conductive epoxy . the substrate is then thinned to as few as 75 microns , and epitaxial layers 111 , 114 , and 115 are then grown . the anode contacts 127 are then formed and mesas etched either partially or fully through the remaining thickness . this process results in reduced time to thin the substrate 106 . it also results in a potentially thinner wafer , as it is already bonded to glass substrate 117 in final position . however , it is often not desirable to import solder , epoxy , or certain other bonding materials into the mocvd ( metal organic chemical vapor deposition ) chambers often used to grow epitaxial films 111 - 115 , so the alternative process of this paragraph may not be the best option for some wafer processors . the process described in the previous paragraph above typically involves another attachment process to a lapping and polishing puck . the resultant de - attach and handling processes require a certain strength in the wafer which means the thinning operation must leave the wafer somewhat thicker ( 125 microns ) than in the alternate process described in this paragraph ( 75 microns ). either process sequence produces a similar structure . additionally , the order of epitaxial layers 111 , 114 , and 115 may be reversed , resulting in an anode - up ( towards lens 118 ) structure versus the cathode - up structure of fig1 . the polarity of the bias voltage supplied by the voltage plane metallic film 122 would then also need to be reversed , with the result being the anode - up structure having the same or similar performance advantages of the cathode - up structure depicted in fig1 and 14 . fig1 shows the artwork for a ground plane metallic film 120 which acts as a distribution grid for a circuit ground connection in the schematic of fig1 and the advanced pin detector array 5 of fig1 . fig1 shows the artwork for the silicon nitride insulating layer 121 overlayed on the same ground plane metallic film 120 of the preferred embodiment described in the associated text and diagram of fig1 . fig1 shows the artwork for the capacitive cathode ring contacts 124 overlayed on the silicon nitride insulating layer 121 and the ground plane metallic film 120 of the preferred embodiment described in the associated text and diagram of fig1 . fig1 shows a top view of the completed assembly of fig1 , including a view of the art work for the voltage plane metallic film 122 overlayed on the insulating layer 121 , an outer portion of the capacitive cathode ring contacts 124 , and the ground plane metallic film 120 . also shown is a top view of the metallic film anode contact 127 and the tapering aspect of the trapezoidal pin mesa structure 126 . the resistor rbias of fig1 is provided for by resistive film segment 123 , shown in 9 places on fig1 . the number of individual detectors 57 shown in fig1 is limited to a 3 × 3 detector array 5 , for the purpose of clarity . the nominal detector array 5 in the preferred embodiment is 2 × 128 , and the technology described is anticipated to be used on m × n detector arrays 5 of 128 × 128 and larger . although the invention of the terrain mapping ladar sensor and associated circuits and systems have been specified in terms of preferred and alternative embodiments , it is intended the invention shall be described by the following claims and their equivalents .	7
disclosed herein , in various embodiments , are photoconductive imaging members having improved anti - curl back coatings and methods for producing such imaging members . the imaging members of this development can be used in a number of different known imaging and printing processes including , for example , electrophotographic imaging processes , especially xerographic imaging and printing processes wherein charged latent images are rendered visible with toner compositions of an appropriate charge polarity . moreover , the imaging members of this disclosure are also useful in color xerographic applications , particularly high - speed color copying and printing processes . in these applications , the imaging members are in embodiments sensitive in the wavelength region of from about 500 to about 900 nanometers , and in particular from about 650 to about 850 nanometers ; thus , diode lasers can be selected as the light source . the exemplary embodiments of this disclosure are more particularly described below with reference to the drawings . although specific terms are used in the following description for clarity , these terms are intended to refer only to the particular structure of the various embodiments selected for illustration in the drawings and not to define or limit the scope of the disclosure . the structures in the figure are not drawn according to their relative proportions and the drawing should not be interpreted as limiting the disclosure in size , relative size , or location . in addition , though the discussion will address flexible imaging members used in negatively charged systems , the imaging members of the present disclosure may also be designed for use in positively charged systems . an exemplary embodiment of the negatively charged imaging member of the present disclosure is illustrated in fig1 . the substrate 32 has an optional conductive layer 30 . an optional hole blocking layer 34 can also be applied , as well as an optional adhesive layer 36 . the charge generating layer 38 is located between the adhesive layer 36 and the charge transport layer 40 . an optional ground strip layer 41 operatively connects the charge generating layer 38 and the charge transport layer 40 to the conductive layer 30 . an optional overcoat layer 42 may also be included . an anti - curl back coating 33 is applied to the side of the substrate 32 opposite from the electrically active layers to render imaging member flatness . imaging members with the acbc of the present disclosure avoid or minimize attacks by ozone species in the corona effluents , suppressing molecular chain scission in the acbc and thereby extending the service life of the imaging member . the mechanism of protecting the polymer coating from chain scission degradation against ozone attack , as a result incorporating a vinyl ( or allyl ) containing liquid oligomer described above into the acbc , can be illustrated with reference to the chemical reaction below : the anti - curl back coating ( acbc ) comprises a film - forming polymer binder resin , a polyester adhesion promoter , and a liquid oligomer . a layer of from about 7 to about 30 micrometers in thickness is found to be adequately sufficient for balancing the curl and rendering the imaging member flat . the acbc is optically transparent ; it transmits at least about 98 percent of an incident light energy through the layer . it should also have good adhesion with the substrate . the acbc comprises a film - forming polymer and polyester adhesion promoter which , after drying , forms a polymer matrix . the polymer and the adhesion promoter should both be soluble in methylene chloride , chlorobenzene , or some other solvent suitable for use in the manufacturing process . typical film - forming polymers soluble in methylene chloride include polycarbonate resin , polyvinylcarbazole , polyester , polyarylate , polyacrylate , polyether , polysulfone , polystyrene , polyamide , and the like . molecular weights can vary from about 20 , 000 to about 250 , 000 . in specific embodiments , the film - forming polymer is a polycarbonate resin . polycarbonate resins having a weight average molecular weight mw of from about 20 , 000 to about 250 , 000 are suitable for use , and in embodiments from about 50 , 000 to about 120 , 000 , may be used based on the ease of forming a coating solution having proper viscosity for application and on the mechanical strength of the resulting charge transport layer . the electrically inactive resin material may include poly ( 4 , 4 ′- dipropylidene - diphenylene carbonate ) with a weight average molecular weight ( m w ) of from about 35 , 000 to about 40 , 000 , available as lexan 145 from general electric company ; poly ( 4 , 4 ′- isopropylidene - diphenylene carbonate ) with a molecular weight of from about 40 , 000 to about 45 , 000 , available as lexan 141 from the general electric company ; and a polycarbonate resin having a molecular weight of from about 20 , 000 to about 50 , 000 available as merlon from mobay chemical company . in specific embodiments , a poly ( 4 , 4 ′- isopropylidene diphenyl ) carbonate known as makrolon , available from mobay chemical company , and having a molecular weight of from about 130 , 000 to about 200 , 000 , is used . in one exemplary embodiment , the liquid oligomer is a diethylene glycol bis ( allyl carbonate ) represented by formula ( i ): wherein n is an integer from about 1 to about 6 . in a specific embodiment , n = 1 . in another exemplary embodiment , the liquid oligomer is a bis ( allyl carbonate ) of bisphenol a shown as formula ( ii ) below : wherein n is an integer from about 1 to about 6 . in a specific embodiment , n = 1 and the carbonate is bis ( allyl carbonate ) of bisphenol a . in addition , other alternative oligomers of aromatic bisphenol a carbonate derived from the extension of formula ( ii ) suitable for the liquid oligomer are represented by formulas ( ii - a ), ( ii - b ), and ( ii - c ) wherein n is an integer from about 1 to about 6 : in another exemplary embodiment , the liquid oligomer is a polystyrene represented by formula ( iii ) below : wherein m is the degree of polymerization and m is an integer from about 3 to about 10 . the liquid oligomer is selected based on its high compatibility with the film forming polymer . this simplifies coating solution preparation and insures that its presence in the coating layer matrix does not cause material phase separation in the resulting acbc nor alter the adhesion bond strength between the acbc and the substrate . the liquid oligomer comprises from about 2 to about 10 wt -% of the anti - curl back coating , based on the total weight of the anti - curl back coating . in further specific embodiments , the liquid oligomer comprises about 5 wt -% of the anti - curl back coating . inclusion of the liquid oligomer in the acbc provides several advantages . first , it suppresses polymer degradation in the acbc by protecting it from ozone attack . this provides better wear resistance and increases the life of the imaging member . second , it flushes out any residual solvent remaining from the acbc after the coating solution has been applied to the imaging member and dried . this reduces internal strain due to residual solvent outgassing . for example , it can flush out the residual solvent to a minimum of less than 0 . 3 wt -% of the acbc . the acbc may further comprise a slip agent . the agent comprises from about 0 . 01 to about 5 wt -% of the anti - curl back coating , based on the total weight of the anti - curl back coating . in further specific embodiments , the slip agent comprises from about 0 . 5 to about 4 wt -% of the anti - curl back coating . in one exemplary embodiment , the slip agent is a liquid polyester modified polysiloxane represented by formula ( iv ) below : wherein r1 and r2 are independently selected from alkylene groups containing from 1 to 10 carbon atoms ; r3 is hydrogen or alkyl having 1 to 3 carbon atoms ; n is an integer from 0 to 10 ; x and y are independently integers from 5 to 500 ; and z is an integer from 1 to 30 . polysiloxane liquids characterized by the formula above are commercially available slip agents , such as for example byk 310 ®, available from byk chemie usa . the material is a chemically modified dimethipolysiloxane oligomers in which some of the methyl groups are extended and altered to give long organic side chains that increase the compatibility of the polysiloxane molecule with the film forming polycarbonate of the anti - curl layer and provide good side chain mechanical anchoring to the material matrix of the resulting anti - curl layer . still another polyester modified polysiloxane is byk 370 ®, available also from byk chemie usa . preferably , the dried anti - curl layer contains between about 0 . 01 and about 5 percent by weight of the polysiloxane slip agent , based on the weight of the acbc . the dried anti - curl layer containing the polysiloxane slip agent has a surface energy of between about 40 dynes / cm and about 22 dynes / cm . incorporating a slip agent into the acbc has several advantages . it reduces the surface energy of the acbc . this reduces the surface contact friction between the acbc and mechanical parts such as belt rollers . it also lubricates the acbc , reducing wear from , for example , mechanical sliding action over each surface of the belt support module &# 39 ; s backer bars . this also reduces acbc static charge build - up during imaging machine cyclic belt function . the anti - curl layer of this disclosure may optionally contain organic and / or inorganic particles dispersed therein . the particles are easily dispersed by conventional coating solution mixing techniques and result in no particle agglomerations in the acbc . because the particles have inherent wear resisting characteristics , their presence in the material matrix should enhance the wear resistance of the acbc . the particles have refractive indices closely matched with that of the polycarbonate so that particle dispersions in the acbc matrix do not affect the optical transmittance of the layer . also , the presence of the particles produces no adverse impact on the anti - curl capability and does not alter the adhesion bonding of the acbc to the substrate . examples of suitable organic particles include , but are not limited to , polytetrafluoroethylene polymers such as polymist from solvay solexis and zonyl from dupont ; waxy polyethylene such as acumist or acrawax ; fatty amides such as erucamide , oleamide , and stearamide ; kevlar ; and stearates . examples of suitable inorganic particles include , but are not limited to , silica ; metal oxides ; metal carbonate ; metal silicates ; and the like . the acbc also includes a small quantity of a saturated copolyester adhesion promoter to enhance its adhesion bond strength to the substrate support . in one embodiment , the saturated copolyester adhesion promoter ( 1 ) has a linear or branched structure including organic diacids , ethylene glycols , and diols and ( 2 ) is generally described as poly ( 1 , 4 - cyclohexylene - dimethylene terephthalate / isophthalate ). typical copolyester adhesion promoters are vitel polyesters from goodyear rubber and tire company , mor - ester from morton chemicals , eastar petg from eastman chemicals , and the like . other layers of the imaging member comprise a flexible supporting substrate 32 , a conductive layer 30 , an optional charge blocking layer 34 , an optional adhesive layer 36 , a charge generating layer 38 , a charge transport layer 40 , an optional ground strip layer 41 , and an optional overcoat layer 42 . each of these layers is described below . the substrate may be opaque , but is usually substantially transparent to allow imaging member back erase by light energy during the imaging process . the substrate may comprise numerous suitable materials having the required mechanical properties . when the substrate material is an electrically non - conductive material , the substrate may further be provided with an electrically conductive layer ; i . e . the electrically conductive layer may be optional . accordingly , the substrate may comprise a layer of an electrically non - conductive or conductive material such as an inorganic or organic composition . as electrically non - conducting materials , there may be employed various resins known for this purpose including polyesters , polycarbonates , polyamides , polyurethanes , and the like . the electrically insulating or conductive substrate may be flexible , semi - rigid , or rigid , and may have any number of different configurations such as , for example , a sheet , a scroll , an endless flexible belt , a cylinder , and the like . the substrate may be in the form of an endless flexible belt which comprises a commercially available biaxially oriented polyester known as mylar ™, melinex ™, and kaladex ™ available from e . i . du pont de nemours & amp ; co . the thickness of the substrate layer depends on numerous factors , including mechanical performance and economic considerations . the thickness of this layer , especially for a flexible imaging member belt , may range from about 50 micrometers to about 200 micrometers . the surface of the substrate layer is preferably cleaned prior to coating to promote greater adhesion of the deposited coating composition . cleaning may be effected by , for example , exposing the surface of the substrate layer to plasma discharge , ion bombardment , and the like methods . however , in specific embodiments , the substrate has a thickness of from about 50 micrometers to about 125 micrometers , based on the considerations of optimum light energy transmission for effective back erase , adequate substrate flexibility , and cost impact . a substrate of polyethylene naphthalate ( pen ) is also effectively used in embodiments of the present disclosure . the conductive layer on the flexible substrate may vary in thickness over substantially wide ranges depending on the optical transparency and degree of flexibility desired for the electrophotographic member . accordingly , for a flexible photoresponsive imaging device , the thickness of the conductive layer may be from about 20 angstrom units to about 750 angstrom units , and more preferably from about 100 angstrom units to about 200 angstrom units for an optimum combination of electrical conductivity , flexibility and light transmission . the electrically conductive substrate surface layer may be an electrically conductive metal layer formed , for example , on the substrate by different coating technique , such as a vacuum depositing technique . typical metals include aluminum , zirconium , niobium , tantalum , vanadium and hafnium , titanium , nickel , stainless steel , chromium , tungsten , molybdenum , and the like . regardless of the technique employed to form the metal layer , a thin layer of metal oxide forms on the outer surface of most metals upon exposure to air . thus , when other layers overlying the metal layer are characterized as “ contiguous ” layers , it is intended that these overlying contiguous layers may , in fact , contact a thin metal oxide layer that has formed on the outer surface of the oxidizable metal layer . in embodiments , for rear erase exposure , an electrically conductive substrate surface layer light transparency of at least about 15 % is desirable . the electrically conductive substrate surface layer need not be limited to metals . other examples of electrically conductive substrate surface layers may be combinations of materials such as conductive indium tin oxide as a transparent layer for light having a wavelength between about 4000 angstroms and about 7000 angstroms or a transparent copper iodide ( cui ) or a conductive carbon black dispersed in a plastic binder as an opaque conductive layer . an optional charge blocking layer may be applied to the electrically conductive substrate surface layer . generally , electron blocking layers for positively charged photoreceptors allow holes from the imaging surface of the photoreceptor to migrate toward the conductive layer . any blocking layer capable of forming an electronic barrier to holes between the adjacent photoconductive layer and the underlying conductive layer may be utilized . the blocking layer may be nitrogen containing siloxanes or nitrogen containing titanium compounds as disclosed , for example , in u . s . pat . no . 4 , 338 , 387 , u . s . pat . no . 4 , 286 , 033 and u . s . pat . no . 4 , 291 , 110 , the disclosures of which are incorporated herein by reference . in embodiments , a preferred blocking layer comprises a reaction product between a hydrolyzed silane and the oxidized surface of a metal ground plane layer . the blocking layer may be applied by different techniques such as spraying , dip coating , draw bar coating , gravure coating , silk screening , air knife coating , reverse roll coating , vacuum deposition , chemical treatment and the like . for convenience in obtaining thin layers , the blocking layers in embodiments are preferably applied in the form of a dilute solution , with the solvent being removed after deposition of the coating by techniques such as by vacuum , heating and the like . the blocking layer should be continuous and have a thickness of less than about 0 . 2 micrometer . a greater thickness may lead to undesirably high residual voltage . an optional adhesive layer may be applied to the hole blocking layer . typical adhesive layer materials include , for example , polyesters , dupont 49 , 000 ( available from e . i . du pont de nemours and company ), vitel pe100 ( available from goodyear tire & amp ; rubber ), and polyurethanes . in embodiments , satisfactory results may be achieved with an adhesive layer thickness from about 0 . 05 micrometer ( 500 angstroms ) to about 0 . 3 micrometer ( 3 , 000 angstroms ). techniques for applying an adhesive layer coating mixture to the charge blocking layer include spraying , dip coating , roll coating , wire wound rod coating , gravure coating , bird applicator coating , and the like . drying of the deposited coating may be effected by techniques such as oven drying , infrared radiation drying , air drying and the like . a photogenerating layer or charge generating layer may be applied to the adhesive blocking layer which can then be overcoated with a contiguous charge transport layer as described hereinafter . examples of photogenerating layers include inorganic photoconductive particles such as amorphous selenium , trigonal selenium , and selenium alloys comprising selenium - tellurium , selenium - tellurium - arsenic , selenium arsenide and mixtures thereof , and organic photoconductive particles including various phthalocyanine pigment such as the x - form of metal free phthalocyanine described in u . s . pat . no . 3 , 357 , 989 , the disclosure of which is incorporated herein by reference , metal phthalocyanines such as vanadyl phthalocyanine and copper phthalocyanine , dibromoanthanthrone , squarylium , quinacridones available from dupont under the tradename monastral red , monastral violet , and monastral red y , vat orange 1 and vat orange 3 ( tradenames for dibromo anthanthrone pigments ), benzimidazole perylene , substituted 2 , 4 - diamino - triazines disclosed in u . s . pat . no . 3 , 442 , 781 , the disclosure of which is incorporated herein by reference , polynuclear aromatic quinones available from allied chemical corporation under the tradenames indofast double scarlet , indofast violet lake b , indofast brilliant scarlet , and indofast orange , dispersed in a film forming polymeric binder . multi - photogenerating layer compositions may be utilized where a photoconductive layer enhances or reduces the properties of the photogenerating layer . examples of this type of configuration are described in u . s . pat . no . 4 , 415 , 639 , the entire disclosure of which is incorporated by reference . other photogenerating materials known in the art may also be utilized . charge generating binder layers comprising particles or layers of a photoconductive material such as vanadyl phthalocyanine , metal free phthalocyanine , benzimidazole perylene , amorphous selenium , trigonal selenium , selenium alloys such as selenium - tellurium , selenium - tellurium - arsenic , selenium arsenide , and the like and mixtures thereof may be utilized because of their sensitivity to white light . vanadyl phthalocyanine , metal - free phthalocyanine and tellurium alloys may also be incorporated because these materials provide sensitivity to infrared light . a polymeric film forming binder material may be employed as the matrix in the photogenerating binder layer . typical polymeric film forming materials include those described , for example , in u . s . pat . no . 3 , 121 , 006 , the disclosure of which is incorporated herein by reference . organic polymeric film forming binders include thermoplastic and thermosetting resins including polystyrene - co - 4 vinyl pyridine , polycarbonates , polyesters , polyamides , polyurethanes , polystyrenes , polyarylethers , polyarylsulfones , polybutadienes , polysulfones , polyethersulfones , polyethylenes , polypropylenes , polyimides , polymethylpentenes , polyphenylene sulfides , polyvinyl acetate , polysiloxanes , polyacrylates , polyvinyl acetals , polyamides , polyimides , amino resins , phenylene oxide resins , terephthalic acid resins , phenoxy resins , epoxy resins , phenolic resins , polystyrene and acrylonitrile copolymers , polyvinylchloride , vinylchloride and vinyl acetate copolymers , acrylate copolymers , alkyd resins , cellulosic film formers , poly ( amideimide ), styrene - butadiene copolymers , vinylidenechloridevinylchloride copolymers , vinylacetate - vinylidenechloride copolymers , styrene - alkyd resins , polyvinylcarbazole , and the like . these polymers may be block , random or alternating copolymers . the photogenerating composition or pigment is present in the resinous binder composition in amounts , generally , of from about 5 % by volume to about 90 % by volume and is dispersed in from about 10 % by volume to about 95 % by volume of resinous binder , and in embodiments preferably from about 20 % by volume to about 30 % by volume of photogenerating pigment is dispersed in about 70 % by volume to about 80 % by volume of resinous binder composition . in one embodiment , about 8 % by volume of photogenerating pigment is dispersed in about 92 % by volume of resinous binder composition . the photogenerating layer containing photoconductive compositions and / or pigments and the resinous binder material generally ranges in thickness of from about 0 . 1 micrometers to about 5 micrometers , and in embodiments has a thickness of from about 0 . 3 micrometers to about 3 micrometers . the photogenerating layer thickness is related to binder content . higher binder content compositions generally require thicker layers for photogeneration . numerous techniques may be utilized to mix and thereafter apply the photogenerating layer coating mixture ; these techniques include spraying , dip coating , roll coating , or wire wound rod coating . drying of the deposited coating may be effected by different techniques such as oven drying , infra red radiation drying , air drying and the like . the charge transport layer may include any suitable transparent organic polymer or non - polymeric material capable of supporting the injection of photogenerated holes and electrons from the charge generating layer and capable of allowing the transport of these holes or electrons through the organic layer to selectively discharge the surface charge . the active charge transport layer not only serves to transport holes or electrons , but also protects the photoconductive layer from abrasion or chemical attack and therefore extends the operating life of the photoreceptor imaging member . the charge transport layer should exhibit negligible , if any , discharge when exposed to a wavelength of light useful in xerography , e . g ., about 4000 angstroms to about 9000 angstroms . therefore , the charge transport layer is substantially transparent to radiation in a region in which the photoconductor is to be used . thus , the active charge transport layer is a substantially non - photoconductive material which supports the injection of photogenerated charges from the charge generating layer . the active transport layer is normally transparent when exposure is effected through the active layer to ensure that most of the incident radiation is utilized by the underlying charge generating layer for efficient photogeneration . the charge transport layer in conjunction with the charge generating layer is a material which is an insulator to the extent that an electrostatic charge placed on the transport layer is not conducted in the absence of illumination . an inactive thermoplastic resin binder soluble in methylene chloride or other solvent may be employed to form the thermoplastic polymer matrix of the charge transport layer of the imaging member . typical inactive resin binders soluble in methylene chloride include polycarbonate resin , polyvinylcarbazole , polyester , polyarylate , polyacrylate , polyether , polysulfone , polystyrene , polyamide , and the like . molecular weights can vary from about 20 , 000 to about 150 , 000 . the film - forming binder is usually a polycarbonate resin . the active charge transport layer may include any suitable charge transport molecule useful as an additive dispersed in electrically inactive polymeric materials making these materials electrically active . these charge transport molecules may be added to polymeric materials which are incapable of supporting the injection of photogenerated charges from the generation material and incapable of allowing the transport of these charges therethrough . this will convert the electrically inactive polymeric material to a material capable of supporting the injection of photogenerated charges from the generation material and capable of allowing the transport of these charges through the active layer in order to discharge the surface charge on the active layer . some diamines suitable for use as charge transport molecules include , but are not limited to , n , n , n ′, n ′- tetra ( o - methylphenyl )-[ p - terphenyl ]- 4 , 4 ′- diamine ; n , n ′- bis ( 4 - methylphenyl )- n , n ′- bis [ 4 -( 1 - butyl )- phenyl ]-[ p - terphenyl ]- 4 , 4 ′- diamine ; n , n ′- bis ( 3 - methylphenyl )- n , n ′- bis [ 4 -( 1 - butyl )- phenyl ]-[ p - terphenyl ]- 4 , 4 ′- diamine ; n , n ′- bis ( 4 - t - butylphenyl )- n , n ′- bis [ 4 -( 1 - butyl )- phenyl ]-[ p - terphenyl ]- 4 , 4 ′- diamine ; n , n , n ′, n ′- tetra [ 4 -( 1 - butyl )- phenyl ]-[ p - terphenyl ]- 4 , 4 ′- diamine ; n , n , n ′, n ′- tetra [ 4 - t - butyl - phenyl ]-[ p - terphenyl ]- 4 , 4 ′- diamine ; n , n ′- diphenyl - n , n ′- bis ( 4 - methylphenyl )- 1 , 1 ′- biphenyl - 4 , 4 ′- diamine ; n , n ′- bis ( 4 - methylphenyl )- n , n ′- bis ( 4 - ethylphenyl )- 1 , 1 ′-( 3 , 3 ′- dimethylbiphenyl )- 4 , 4 ′- diamine ; 4 , 4 ′- bis ( diethylamino )- 2 , 2 ′- dimethyltriphenylmethane ; n , n ′- diphenyl - n , n ′- bis ( 3 - methylphenyl )-[ 1 , 1 ′- biphenyl ]- 4 , 4 ′- diamine ( m - tbd ); n , n ′- diphenyl - n , n ′- bis ( alkylphenyl )- 1 , 1 ′- biphenyl - 4 , 4 ′- diamine ; and n , n ′- diphenyl - n , n ′- bis ( chlorophenyl )- 1 , 1 ′- biphenyl - 4 , 4 ′- diamine . other known charge transport molecules are triphenylmethane ; bis ( 4 - diethylamino - 2 - methylphenyl ) phenylmethane ; stilbene ; hydrazone ; tritolylamine ; and enamine phenanthrene diamine . polycarbonate resins having a weight average molecular weight mw , of from about 20 , 000 to about 250 , 000 are suitable for use , and in embodiments from about 50 , 000 to about 120 , 000 , may be used based on the ease of forming a coating solution having proper viscosity for application and on the mechanical strength of the resulting charge transport layer . the electrically inactive resin material may include poly ( 4 , 4 ′- dipropylidene - diphenylene carbonate ) with a weight average molecular weight ( m w ) of from about 35 , 000 to about 40 , 000 , available as lexan 145 from general electric company ; poly ( 4 , 4 ′- isopropylidene - diphenylene carbonate ) with a molecular weight of from about 40 , 000 to about 45 , 000 , available as lexan 141 from the general electric company ; and a polycarbonate resin having a molecular weight of from about 20 , 000 to about 50 , 000 available as merlon from mobay chemical company . in specific embodiments , makrolon , available from mobay chemical company , and having a molecular weight of from about 130 , 000 to about 200 , 000 , is used . methylene chloride is used as a solvent in the charge transport layer coating mixture for its low boiling point and the ability to dissolve charge transport layer coating mixture components to form a charge transport layer coating solution . in embodiments , the charge transport layer comprises from about 25 weight percent ( wt %) to about 75 wt % of a charge transport molecule and from about 75 % to about 25 % by weight of the film - forming polymeric binder resin , both by total weight of the charge transport layer . in specific embodiments , the charge transport layer comprises from about 45 wt % to about 55 wt % of all charge transport molecules and from about 55 wt % to about 45 wt % of the film - forming polymeric binder resin . different techniques may be utilized to mix and thereafter apply the charge transport layer coating mixture to the charge generating layer . typical application techniques include spraying , dip coating , roll coating , wire wound rod coating , and the like . drying of the deposited coating may be effected by different techniques such as oven drying , infra red radiation drying , air drying and the like . generally , the thickness of the charge transport layer is from about 10 to about 50 micrometers , but thicknesses outside this range can also be used . in general , the ratio of the thickness of the hole transport layer to the charge generating layer is in embodiments from about 2 : 1 to 200 : 1 and in some instances from about 2 : 1 to about 400 : 1 . a protective overcoat layer may be used to protect the charge transport layer against abrasion , scratching , and voc attack . the overcoat layer is between about 1 to about 10 micrometers in thickness , and in specific embodiments a thickness of from about 2 to about 5 micrometers gives optimum mechanical / photoelectrical function . the overcoat comprises a thermoplastic film forming polymer and optionally a small quantity of charge transport molecules . the polymer and charge transport molecule may be selected from those listed for the charge transport layer . it may also contain a small amount of anti - oxidant , such as irganox , to suppress corona species induced lcm problems or an antiozonant to protect against degradation . it may further include nanoparticle dispersions of silica , ptfe , and / or metal oxides to impart wear resistance . the imaging member may also contain a narrow electrically conductive ground strip ( not shown ) coated at one edge of the imaging member belt in contact with the charge transport layer , charge generating layer and the conductive layer to effect electrical continuity . ground strip formulations are well known ; they are typically comprised of conductive particles dispersed in a film forming binder . the development of the present disclosure will further be illustrated in the following non - limiting working examples , it being understood that these examples are intended to be illustrative only and that the disclosure is not intended to be limited to the materials , conditions , process parameters and the like recited herein . all proportions are by weight unless otherwise indicated . a flexible electrophotographic imaging member web was prepared by providing a 0 . 02 micrometer thick titanium layer coated on a substrate of a biaxially oriented polyethylene naphthalate substrate ( kadalex , available from dupont teijin films .) having a thickness of 3 . 5 mils ( 89 micrometers ). the titanized kadalex substrate was extrusion coated with a blocking layer solution containing a mixture of 6 . 5 grams of gamma aminopropyltriethoxy silane , 39 . 4 grams of distilled water , 2 . 08 grams of acetic acid , 752 . 2 grams of 200 proof denatured alcohol and 200 grams of heptane . this wet coating layer was then allowed to dry for 5 minutes at 135 ° c . in a forced air oven to remove the solvents from the coating and effect the formation of a crosslinked silane blocking layer . the resulting blocking layer had an average dry thickness of 0 . 04 micrometer as measured with an ellipsometer . an adhesive interface layer was then applied by extrusion coating to the blocking layer with a coating solution containing 0 . 16 percent by weight of ardel polyarylate , having a weight average molecular weight of about 54 , 000 , available from toyota hsushu , inc ., based on the total weight of the solution in an 8 : 1 : 1 weight ratio of tetrahydrofuran / monochloro - benzene / methylene chloride solvent mixture . the adhesive interface layer was allowed to dry for 1 minute at 125 ° c . in a forced air oven . the resulting adhesive interface layer had a dry thickness of about 0 . 02 micrometer . the adhesive interface layer was thereafter coated over with a charge generating layer . the charge generating layer dispersion was prepared by adding 0 . 45 gram of iupilon 200 , a polycarbonate of poly ( 4 , 4 ′- diphenyl )- 1 , 1 ′- cyclohexane carbonate ( pc - z 200 , available from mitsubishi gas chemical corporation ), and 50 milliliters of tetrahydrofuran into a 4 ounce glass bottle . 2 . 4 grams of hydroxygallium phthalocyanine type v and 300 grams of ⅛ inch ( 3 . 2 millimeters ) diameter stainless steel shot were added to the solution . this mixture was then placed on a ball mill for about 20 to about 24 hours . subsequently , 2 . 25 grams of poly ( 4 , 4 ′- diphenyl - 1 , 1 ′- cyclohexane carbonate ) having a weight average molecular weight of 20 , 000 ( pc - z 200 ) were dissolved in 46 . 1 grams of tetrahydrofuran , then added to the hydroxygallium phthalocyanine slurry . this slurry was then placed on a shaker for 10 minutes . the resulting slurry was thereafter coated onto the adhesive interface by extrusion application process to form a layer having a wet thickness of 0 . 25 ml . however , a strip of about 10 millimeters wide along one edge of the substrate web stock bearing the blocking layer and the adhesive layer was deliberately left uncoated by the charge generating layer to facilitate adequate electrical contact by a ground strip layer to be applied later . this charge generating layer comprised of poly ( 4 , 4 ′- diphenyl )- 1 , 1 ′- cyclohexane carbonate , tetrahydrofuran and hydroxygallium phthalocyanine was dried at 125 ° c . for 2 minutes in a forced air oven to form a dry charge generating layer having a thickness of 0 . 4 micrometers . this coated web stock was simultaneously coated over with a charge transport layer and a ground strip layer by co - extrusion of the coating materials . the charge transport layer was prepared by introducing into an amber glass bottle in a weight ratio of 1 : 1 ( or 50 weight percent of each ) of makrolon ® 5705 , a bisphenol a polycarbonate thermoplastic having a molecular weight of about 120 , 000 commercially available from farbensabricken bayer a . g . and n , n ′- diphenyl - n , n ′- bis ( 3 - methylphenyl )- 1 , 1 ′- biphenyl - 4 , 4 ′- diamine , a charge transport compound . the resulting mixture was dissolved to give 15 percent by weight solid in methylene chloride . this solution was applied on the charge generating layer by extrusion to form a coating which upon drying in a forced air oven gave a charge transport layer 29 micrometers thick . the strip , about 10 millimeters wide , of the adhesive layer left uncoated by the charge generator layer , was coated with a ground strip layer during the co - extrusion process . the ground strip layer coating mixture was prepared by combining 23 . 81 grams of polycarbonate resin ( makrolon ® 5705 , 7 . 87 percent by total weight solids , available from bayer a . g . ), and 332 grams of methylene chloride in a carboy container . the container was covered tightly and placed on a roll mill for about 24 hours until the polycarbonate was dissolved in the methylene chloride . the resulting solution was mixed for 15 - 30 minutes with about 93 . 89 grams of graphite dispersion ( 12 . 3 percent by weight solids ) of 9 . 41 parts by weight of graphite , 2 . 87 parts by weight of ethyl cellulose and 87 . 7 parts by weight of solvent ( acheson graphite dispersion rw22790 , available from acheson colloids company ) with the aid of a high shear blade dispersed in a water cooled , jacketed container to prevent the dispersion from overheating and losing solvent . the resulting dispersion was then filtered and the viscosity was adjusted with the aid of methylene chloride . this ground strip layer coating mixture was then applied , by co - extrusion with the charge transport layer , to the electrophotographic imaging member web to form an electrically conductive ground strip layer having a dried thickness of about 19 micrometers . the imaging member web stock containing all of the above layers was then passed through 125 ° c . in a forced air oven for 3 minutes to simultaneously dry both the charge transport layer and the ground strip . the web stock , if unrestrained at this point , will spontaneously curl upwardly into a 1 . 5 - inch tube . an anti - curl coating was prepared by combining 88 . 2 grams of polycarbonate resin ( makrolon ® 5705 ) and 1 , 071 grams of methylene chloride in a carboy container to form a coating solution containing 8 . 9 percent solids . the container was covered tightly and placed on a roll mill for about 24 hours until the polycarbonate was dissolved in the methylene chloride to form the anti - curl back coating solution . the anti - curl back coating solution was then applied to the rear surface ( side opposite the charge generating layer and charge transport layer ) of the electrophotographic imaging member web by extrusion coating and dried to a maximum temperature of 120 ° c . in a forced air oven for 2 minutes to produce an optically transparent dried anti - curl back coating having a thickness of 17 micrometers . a flexible electrophotographic imaging member web was fabricated using the same materials and the same process as that described in control example 1 , except that the anti - curl back coating solution was prepared to include a bisphenol a bisallyl carbonate monomer as shown in formula ( ii ) ( hiri ®, commercially available from ppg , inc .). the coating solution was then applied onto the rear surface of an imaging member web and followed by subsequent drying at elevated temperature to give an imaging member web stocks having 5 wt % hiri ® based on the resulting dried weight of the anti - curl back coating . the thickness of the layer was 17 micrometers . to assess the extent of polycarbonate degradation as a result of ozone exposure , 8 ″× 10 ″ free standing anti - curl back coating ( acbc ) coatings were prepared according to control example 1 and disclosure example 1 and subjected to an ozone exposure test . in essence , two sets of test samples were cut from each free standing coating for testing . one set was subjected to an ozone exposure test from corona effluent and the other unexposed set was used as a control . corona effluents were generated by turning on a charging device in an enclosed large glass tube operated under 700 micro - amperes and 8 kv conditions . the corona effluent exposure test was accomplished by placing each acbc coating inside an enclosed glass tube and simultaneously exposing the coating to the ozone containing gaseous effluents generated by the charging device for 6 hours . all four acbc coatings were then analyzed by gel permeation chromatography ( gpc ) for makrolon molecular weight distribution comparison to assess the extent of polymer degradation due to ozone attack . the results obtained are given in table a below : table a mw mn mp sample id ( kpse ) ( kpse ) ( kpse ) disclosure example 1 exposed 90 . 7 4 . 1 133 disclosure example 1 control 163 37 146 control example 1 exposed 30 . 1 4 . 9 37 . 6 control example 1 control 163 40 140 in the above table , mw is weight average molecular weight , mn is number average molecular weight , and mp is the peak molecular weight . the data showed that molecular degradation of makrolon caused by ozone attack in the control example 1 acbc coating was very severe , while addition of hiri ® in the disclosure example 1 acbc coating provided effective protection against polymer chain scission that would otherwise have occurred as seen in the mw and mn columns . to assess the impact of polymer degradation on the wear properties of the anti - curl back coating , the acbc surfaces of the imaging members ( each cut to give 2 ″× 12 ″ test samples ) of control example 1 and disclosure example 1 were both exposed to corona effluents according to the procedures described above . they were then evaluated for susceptibility to wear by subjecting the sample to a mechanical sliding wear testing method . the wear testing was conducted by means of a dynamic mechanical cycling device in which glass tubes were skidded across the surface of the acbc on each imaging member . more specifically , one end of the test sample was clamped to a stationary post and the sample was looped upwardly over three equally spaced horizontal glass tubes and then downwardly over a stationary guide tube through a generally inverted “ u ” shaped path with the free end of the sample secured to a weight which provided one pound per inch ( 0 . 17 kilogram per cm ) width tension on the sample . the outer surface of the imaging member cut piece bearing the acbc faced downwardly so that it would periodically be brought into sliding mechanical contact with the glass tubes to effect wear . the glass tubes had an outer diameter of one inch . each tube was secured at each end to an adjacent vertical surface of a pair of disks that were rotatable about a shaft connecting the centers of the disks . the glass tubes were parallel to and equidistant from each other and equidistant from the shaft connecting the centers of the disks . although the disks were rotated about the shaft , each glass tube was rigidly secured to the disk to prevent rotation of the tubes around each individual tube axis . thus , as the disk rotated about the shaft , two glass tubes were maintained at all times in sliding contact with the outer surface of the acbc . the axis of each glass tube was positioned about 4 cm from the shaft . the direction of movement of the glass tubes along the acbc surface was away from the weighted end of the sample toward the end clamped to the stationary post . since there were three glass tubes in the test device , each complete rotation of the disk was equivalent to three wear cycles in which the surface of the acbc was in sliding mechanical contact with a single stationary support tube during the testing . the rotation of the spinning disk was adjusted to provide the equivalent of 11 . 3 inches ( 28 . 7 cm .) per second tangential speed . the extent of acbc wear was measured using a permascope at the end of a 90k wear cycles test . the results given in table b below demonstrate the effectiveness of 5 wt % hiri ® in imparting wear resistance . table b amt of amt of acbc worn off sample id hiri ® after 90k wear cycles control example 1 exposed 0 2 . 4 microns disclosure example 1 exposed 5 % 1 . 6 microns three flexible electrophotographic imaging member webs were fabricated using the same materials and the same process as described in disclosure example 1 , except that the anti - curl back coating solution also contained slip agent ( from byk - chemie usa ). the resulting three webs incorporated 5 wt % hiri ® and 0 . 5 , 2 , and 4 wt % slip agent respectively , based on the total weight of the anti - curl back coating . the coefficient of friction , wear resistance , and lubricity of the three acbcs of disclosure example 2 were evaluated against the acbc of control example 1 ( which had no hiri or slip agent ). the coefficient of friction ( cof ) was measured against a charge transport layer ( ctl ) ( made of 50 wt % makrolon and 50 wt % n , n ′- diphenyl - b , n ′- bis ( 3 - methylphenyl )- 1 , 1 ′- biphenyl - 4 , 4 ′- diamine ) and also against act rubber . the act rubber simulated mechanical interaction between the acbc and the belt support drive - roll during dynamic imaging belt machine function conditions . wear resistance was carried out as described above . lubricity was assessed using adhesion strength measurement of scotch ® magic tape 810 ( available from 3m ) 180 ° peeling off from the acbc . the results are given in table c below : table c cof amt of acbc sample cof against against worn off after 180 ° tape peel id act rubber ctl 90k wear cycles ( gm / cm ) control 1 . 20 3 . 2 2 . 5 microns 390 0 . 5 wt % 1 . 05 1 . 7 1 . 9 microns 240 slip agent 2 wt % slip 1 . 01 1 . 4 1 . 8 microns 245 agent 4 wt % slip 1 . 02 1 . 4 1 . 6 microns 237 agent the data showed that the slip agent was efficient in lowering the surface energy of the acbc , as reflected in the lowering tape peel strength . it also lubricated the acbc , reducing wear - off as reflected in the wear cycle results ; this is due to the lower sliding resistance between the acbc and the glass contacting surfaces . the reduction in interfacial contact friction was reflected in the lower coefficients of friction against ctl . though the coefficient of friction was slightly reduced against the act rubber , this reduction was not substantial enough to cause belt slippage problems . in other words , the belt module &# 39 ; s driving roller would still be able to grip this acbc well enough to drive and spin the imaging belt . in addition , the lubricity effect provided by the slip agent was further supported by water contact measurements which showed that all the acbcs of disclosure example 2 had a water contact angle approximately 16 ° higher than the acbc of control example 1 . while particular embodiments have been described , alternatives , modifications , variations , improvements , and substantial equivalents that are or may be presently unforeseen may arise to applicants or others skilled in the art . accordingly , the appended claims as filed and as they may be amended are intended to embrace all such alternatives , modifications variations , improvements , and substantial equivalents .	8
as shown in the drawings for purposes of illustration , the present invention is embodied in an all - terrain baby stroller 10 , as shown in fig1 , having a foldable , tubular metal frame 12 and a transversely extending rear axle assembly 14 with a transverse , non - rotating tubular rear axle 15 . left and right side rear wheels 16 are rotatably mounted to the ends of the rear axle assembly 14 . the forward end of the frame 12 has a single front wheel 18 rotatably mounted thereto . the frame 12 has no base frame members extending rearwardly from the front wheel 18 to the rear axle assembly 14 as do most conventional all - terrain strollers . instead , the frame 12 includes left and right side , downwardly and forwardly sloping front wheels frame members or supports 20 , which each extend downward from a corresponding one of left and right side folding assemblies 22 in a converging configuration to the front wheel 18 . a forward free - end 20 a of each of the left and right side front wheel supports 20 has a plastic front wheel connector 20 b fixedly attached thereto and a corresponding one of the left and right ends of an axle 18 a of the front wheel 18 removably attached thereto to mount the front wheel to the stroller frame 12 . the front wheel supports 20 are interconnected by a foot rest 23 that spans between them toward but rearward of their forward free - ends 20 a and that is fixedly attached to each at a position rearward of the axle 18 a of the front wheel and extending partially over the front wheel 18 . as a result of the interconnection provided by the foot rest 23 , and also the front wheel 18 when attached to the left and right side front wheel connectors , the left and right side front wheel supports 20 form a stationary unit with respect to the left and right side folding assemblies 22 upon folding and unfolding of the stroller 10 , as will be described in greater detail below . the frame 12 also includes left and right side , upwardly and rearwardly sloping handle frame members or supports 24 , which each extend upward from the corresponding one of the left and right side folding assemblies 22 in a generally parallel configuration to a handle 26 extending between the left and right side handle supports . the handle 26 is covered by a foam grip . the handle supports 24 are interconnected by the handle 26 that spans between them at their rearwardmost and uppermost extension and that is fixedly attached to each . as a result of the interconnection provided by the handle 26 , the left and right side handle supports 24 move as a unit with respect to the left and right side folding assemblies 22 upon folding and unfolding of the stroller 10 , as will be described in greater detail below . it is noted that in lieu of the interconnecting handle 26 , the handle supports 24 may each be provided with a handle portion at the upper end thereof such as used with umbrella style strollers . in the illustrated embodiment of the invention the left and right side handle supports 24 and the handle 26 are formed as an integral unit by bending a single length of aluminum tube . the left and right side handle supports 24 are movable relative to the left and right side front wheel supports 20 for folding of the stroller 10 and do not together form an integrated rigid upper frame . the frame 12 also includes left and right side , downwardly and rearwardly sloping rear wheel frame members or supports 30 , which each extend downward from the corresponding one of the left and right side folding assemblies 22 in a generally parallel configuration to the rear axle assembly 14 . a rearward free - end 30 a of each of the left and right side rear wheel supports 30 is fixedly attached to the tubular rear axle 15 toward a corresponding one of the left and right ends of the tubular rear axle 15 . the rear wheel supports 30 are interconnected by the rear axle assembly 14 that spans between them at the rearward free - ends 30 a thereof . a cross - frame member 31 with a u - shape extends between the left and right side rear wheel supports 30 . as a result of the interconnection provided by the rear axle assembly 14 and the cross - frame member 31 , the left and right side rear wheel supports 30 move as a unit with respect to the left and right folding assemblies 22 for folding and unfolding of the stroller 10 , as will be described in greater detail below . the left and right side rear wheel supports 30 are also movable relative to the left and right side front wheel supports 20 and the left and right side handle supports 24 for folding of the stroller 10 . further , the left and right side rear wheel supports 30 and the rear axle assembly 14 connected thereto do not form a part of a base frame extending between the rear and front wheels 16 and 18 . much of the structural strength of the stroller 10 and the interconnection of the front wheel supports 20 , the handle supports 24 , and the rear wheel supports 30 are provided by the centrally positioned left and right side folding assemblies 22 , and not by a base frame . in the illustrated embodiment of the stroller 10 , the left and right side front wheel supports 20 , the left and right side handle supports 24 , and the left and right side rear wheel supports 30 are made from aluminum tube . suitable alternative materials may be used . the left and right outward ends of the tubular rear axle 15 are open and internally threaded to receive a threaded stub axle 32 forming a part of the corresponding one of the left and right rear wheels 16 . a lock nut ( not shown ) when tightened against the face of the stub axle 32 locks the stub axle against loosening during usage of the stroller 10 . alternative constructions may be used to fixedly or removably attach the rear wheels 16 to the tubular rear axle 15 , and any suitable alternative manner of mounting the rear wheels 16 to the real wheel supports 30 may be used . the frame 12 of the stroller 10 is shown in fig1 in the fully unfolded state with a fabric seat 33 a , and a fabric leg support and guard 33 b . the seat 33 a is suspended from the left and right side handle supports 24 , and the leg guard 33 b spans between and is supported by the left and right side front wheel supports 20 . for purposes of illustration , the frame 12 is shown in fig2 without the seat 33 a and the leg guard 33 b . for the depicted implementation , user operation of the left and right side folding assemblies 22 will now be described . the left and right side folding assemblies 22 have the same construction , with one being the mirror image of the other , and the description below , while in the singular , is applicable to both . each of the left and right rear wheel supports 30 supports an inwardly extending lever 34 , which has a predominantly vertical orientation , as shown in fig3 , when the frame 12 of the stroller 10 is locked in the fully unfolded position . to begin the procedure to fold the frame 12 , each of the levers 34 is pulled upward and inward as depicted by arrows r 1 to thereby put the left and right side folding assemblies 22 in an unlocked state as further explained below . a strap ( not shown ) may be connected by its ends to the levers 34 to facilitate movement of both levers at the same time . with each of the left and right folding assemblies 22 in an unlocked state , the left and right handle supports 24 , along with the handle 26 , and the left and right front wheel support 20 , along with the front wheel 18 , can be rotated about the left and right folding assemblies , respectively , toward the left and right rear wheel supports 30 , respectively , as depicted by arrows r 2 shown in fig4 . as shown , when the stroller 10 is folded , the folding assemblies 22 allow a greater rotation angle for the handle supports 24 ( greater than 90 °) than for the front wheel supports 20 ( less than 90 °). as explained further below , the front wheel supports 20 move in geared coordination with movement of the handle supports 24 . as the frame 12 is being folded , the front wheel supports 20 are rotated clockwise about the folding assemblies 22 as viewed in fig4 , while the handle supports 24 are also rotated counterclockwise about the folding assemblies as viewed in fig4 . the frame 12 is shown in a partially folded state in fig5 . in a fully folded state , both the front wheel supports 20 and the handle supports 24 have been rotated in geared coordination with each other about the folding assemblies 22 to be positioned in close proximity to the rear wheel supports 30 as shown in fig6 . to do so the front wheel 18 is removed . the right side folding assembly 22 is shown in exploded view in fig7 and includes a laterally outward positioned forward rotatable member 35 ′ and a laterally inward rearward rotatable member 35 ″, each with a flat face facing toward the other . the forward rotatable member 35 ′ has a plate or disk 36 ′ with a central plate portion having a central aperture 37 ′. the forward rotatable member 35 ′ also includes a notch 38 ′, a radially outward internal gear 39 ′ in an elongated aperture 41 ′, and an arm 40 ′. the rearward rotatable member 35 ″ has a plate or disk 36 ″ with a central plate portion having a central aperture 37 ″. the rearward rotatable member 35 ″ also includes a notch 38 ″, a radially inward internal gear 39 ″ in an elongated aperture 41 ″, and an arm 40 ″. for each of the rotatable members 35 ′ and 35 ″, the disks 36 ′ and 36 ″ and the arms 40 ′ and 40 ″ are depicted as being formed as part of a single flat plate piece ; however , in other implementations the disks and arms are individual pieces that are fixedly attached together . the rotatable members 35 ′ and 35 ″, along with a corresponding one of the rear wheel supports 30 , are contained between inner and outer slotted halves of a housing 42 that allow the arms 40 ′ and 40 ″ to protrude outside of the housing . the inside wall of each half of the housing 42 has a recess 42 a sized and shaped such that when the two halves of the housing are positioned together , the recesses form a cavity to receive an upper free - end portion 30 b of the corresponding rear wheel support 30 therein and an upper free - end portion of the cross - frame member 31 . a bolt ( not shown ) extends through an aperture 42 f in each half of the housing 42 and through an aperture 30 c in the upper free - end portion 30 b of the rear wheel support 30 and an aperture of the upper free - end portion of the cross - frame member 31 to securely clamp the rear wheel support and the cross - frame member between the inner and outer halves of the housing . the central apertures 37 ′ and 37 ″ of the disks 36 ′ and 36 ″, respectively , are sized to receive a bushing 43 therethrough having a length longer than the cumulative thickness of the two disks . the rotatable members 35 ′ and 35 ″ are rotatably mounted on the bushing for rotation within the housing 42 in parallel rotation planes about an axis of rotation transverse to the plane of the disks 36 ′ and 36 ″. the end portions of the bushing extending beyond the central apertures 37 ′ and 37 ″ each have a circumferential groove 43 a to receive a c - clip 43 b to retain the bushing 43 in place . the bushing 43 also extends through a washer 43 d positioned between the disks 36 ′ and 36 ″ of the rotatable members 35 ′ and 35 ″ to serve as a spacer and bearing surface for rotational movement of the rotatable members about the bushing 43 . each of the disks 36 ′ and 36 ″ has a flat face in face - to - face juxtaposition with the flat face of the other disk with the washer 43 d positioned therebetween . the end portions of the bushing 43 extending beyond the c - clip 43 b are each positioned in and retained by a retaining cup 42 b formed by the inside wall of a correspondingly positioned one of the inner and outer halves of the housing 42 . each of the inner and outer halves of the housing 42 has an aperture 42 c in communication with the corresponding retaining cups 42 b . the bushing 43 has a longitudinally extending central aperture 43 c aligned with apertures 43 b of inner and outer halves of the housing 42 , and sized to receive a bolt 45 therethrough that extends fully through the inner and outer halves of the housing . a nut 45 a is threaded onto a threaded end portion of the bolt 45 to clamp the inner and outer halves of the housing 42 of the folding assembly 22 securely together with the disks 36 ′ and 36 ″ freely rotatable on the bushing 43 and being spaced apart by the washer 43 d , and with the arm 40 ′ extending forwardly through a forward portion of a slot 42 e in the housing and the arm 40 ″ extending rearwardly through a rearward portion of the housing slot . the arms 40 ′ and 40 ″ are flat elongated plates . as noted above , the disks 36 ′ and 36 ″ of the rotatable members 35 ′ and 35 ″ have their flat faces in face - to - face juxtaposition . this provides laterally adjacent parallel plates with elongated apertures 41 ′ and 41 ″, each having the gear teeth of a corresponding one of the radially outward and inward gears 39 ′ and 39 ″ formed along an edge portion of the corresponding one of the elongated apertures 41 ′ and 41 ″. the gear teeth of the radially outward gear 39 ′ of the disk 36 ′ are formed along the radially outward edge of the elongated aperture 41 ′, and the gear teeth of the radially inward gear 39 ″ of the disk 36 ″ are formed along the radially inward edge of the elongated aperture 41 ″. the planar disks 36 ′ and 36 ″ are arranged in spaced apart parallel planes , and the radially outward and inward gears 39 ′ and 39 ″ are similarly arranged in spaced apart parallel planes and not in a common plane or in direct engagement with each other . the elongated apertures 41 ′ and 41 ″ are positioned on the disks 36 ′ and 36 ″ so as to be at least in part overlapping during the rotation of the rotatable members 35 ′ and 35 ″ between the folded and unfolded states of the stroller 10 . a pinion gear 44 is positioned within the elongated apertures 41 ′ and 41 ″ in simultaneous geared engagement with both the radially outward gear 39 ′ of the forward rotatable member 35 ′ and the radially inward gear 39 ″ of the rearward rotatable member 35 ″. the pinion gear 44 is positioned to extend through and beyond each of the elongated apertures 41 ′ and 41 ″ of the disks 36 ′ and 36 ″ at a position where the elongated apertures overlap during folding and unfolding of the stroller 10 , and span fully between the radially outward and inward gears 39 ′ and 39 ″ of the disks 36 ′ and 36 ″ in simultaneous geared engagement with both of the gears . the pinion gear 44 transmits the driving rotational force between the front wheel supports 20 and the handle supports 24 which causes one to rotate in response to rotation of the other . the pinion gear 44 is rotatably mounted on a pin 44 a that has each of its end portions extending beyond the pinion gear 44 positioned in the aperture of a flat bushing 44 b and rotatably retained by the flat bushing . each of the flat bushings 44 b is positioned in and retained by a retaining cup 44 c formed by the inside wall of a correspondingly positioned one of the inner and outer halves of the housing 42 . as such , the pinion gear 44 is supported by the housing 42 , which is rigidly attached to the corresponding one of the rear wheel supports 30 for movement therewith , of course , being rotatable about the axis of the pin 44 a . with such arrangement , the pinion gear 44 is rotatable about an axis of rotation transverse to the plane of the disks 36 ′ and 36 ″, and parallel to and spaced apart from the axis of rotation of the disks 36 ′ and 36 ″. the pinion gear 44 engages both the radially outward gear 39 ′ of the forward rotatable member 35 ′ and the radially inward gear 39 ″ of the rearward rotatable member 35 ″. consequently , through the pinion gear 44 , the radially outward gear 39 ′ and the radially inward gear 39 ″ are mutually drivingly engaged with each other so that if either is rotated , the rotational force is transmitted through the pinion gear to the other to cause the other to also rotate about the bushing 43 . as such , if the front wheel supports 20 or the handle supports 24 are rotated relative to the rear wheel supports 30 , the other of the front wheel supports and the handle supports is driven to rotate as well . the radially outward and inward gears 39 ′ and 39 ″ have the same pitch since the pinion gear 44 engages both , but each has a larger pitch diameter than the pinion gear . however , the radially inward gear 39 ″ have a smaller radius of curvature or pitch diameter than the radially outward gear 39 ′, thus the resulting rotational movement of the rearward rotatable member 35 ″ will be greater than the rotational movement of the forward rotatable member 35 ′. in other words , for any amount the pinion gear 44 is rotated , the rearward rotatable member 35 ″ and hence the handle support 24 attached thereto will rotate more than the forward rotatable member 35 ″ and hence the front wheel support 20 attached thereto . this is useful since as noted above , and as shown in fig4 , to fold the front wheel supports 20 and the handle supports 24 tightly about the rear wheel supports 30 requires a greater rotation angle for the handle supports ( in one embodiment about 108 °) than for the front wheel supports ( in that same embodiment about 72 °). in another embodiment the rotation angle for the handle supports and the front wheel supports is the same ( in the second embodiment about 90 ° for each ). the pitch diameter for each of the radially outward gear 39 ′ of the forward rotatable member 35 ′ and the radially inward gear 39 ″ of the rearward rotatable member 35 ″, and the pitch diameter of the pinion gear 44 , are selected to produce the desired ratio of rotational movement for the forward and rearward rotatable members 35 ′ and 35 ″ to fold the stroller 10 into a compact form with the handle supports 24 and the front wheel supports 20 nested tightly against the rear wheel supports 30 . however , while the ability to select different pitch diameters for the radially outward and inward gears 39 ′ and 39 ″ is helpful , even a greater degree of design flexibility may be desirable . in another embodiment of the folding assembly 22 shown in fig1 and 12 , a pinion gear 44 ′ is shown having first and second pinion gear portions 44 x and 44 y , with the first pinion gear portion having a first pitch , a first pitch diameter and a first number of gear teeth , and the second pinion gear portion having a different second pitch , a second pitch diameter and a different second number of gear teeth . the first and second pinion gear portions 44 x and 44 y are made as a single part and rotate together as a unit in coaxial arrangement on the pin 44 a , but are essentially two pinion gears , each with its own gear parameters . the first pinion gear portion 44 x is positioned to engage the radially outward gear 39 ′ and has a pitch corresponding thereto and five gear teeth , and the second pinion gear portion 44 y is positioned to engage the radially inward gear 39 ″ and has a pitch corresponding thereto and four gear teeth . the first and second pinion gear portions 44 x and 44 y may have the same or different pitch diameters . in such manner , the radially outward and inward gears 39 ′ and 39 ″ and the first and second pinion gear portions 44 x and 44 y that engage them , respectively , may be designed with gear parameters to produce a wider range of differing amounts of rotational movement of the forward and rearward rotatable members 35 ′ and 35 ″ when folding and unfolding the stroller 10 . in effect , there is more design freedom and flexibility permitted since the radially outward gear 39 ′ and the first pinion gear portion 44 x pair can be designed with first gear parameters to produce a first rotational movement of the forward rotatable member 35 ′, and the radially inward gear 39 ″ and the second pinion gear portion 44 y pair can be designed with different second gear parameters to produce a different second rotational movement of the rearward rotatable member 35 ″, with independence in the first and second gear parameters selected . as noted above , with the first embodiment described only the pitch diameters of the radially outward and inward gears 39 ′ and 39 ″ differed , but in the embodiment of fig1 and 12 , the radially outward gear 39 ′ and the first pinion gear portion 44 x pair and the radially inward gear 39 ″ and the second pinion gear portion 44 y pair can be designed essentially independent of the other to produce a desired result , such as a desired ratio of rotational movement of the radially outward gear 39 ′ and the radially inward gear 39 ″, and hence the desired ratio of rotational movement of the forward and rearward rotatable members 35 ′ and 35 ″ when folding and unfolding the stroller 10 . for example , this permits design of the folding assemblies 22 with more control over the amount of movement of both the handle supports 24 and the front wheel supports 20 relative to the rear wheel supports 30 resulting during folding of the stroller 10 and hence allows folding into a compact form where the handle supports and the front wheel supports can be moved to nest tightly against the rear wheel supports . in yet another embodiment of the folding assembly 22 shown in fig1 and 13 , a pinion gear 44 ″ is shown having first and second pinion gears 44 xx and 44 yy made as separate parts but fixedly attached together for rotation together as a unit on the pin 44 a , such as by welding , an insertion pin or some other manner . alternatively , the first and second pinion gears 44 xx and 44 yy may be keyed to the pin 44 a so long as the pin is free to rotate . the first pinion gear 44 xx has a first pitch , a first pitch diameter and a first number of gear teeth ( shown as five in this embodiment ), and the second pinion gear 44 yy has a different second pitch , a second pitch diameter and a different second number of gear teeth ( shown as four in this embodiment ). the first pinion gear 44 xx is positioned to engage the radially outward gear 39 ′, and the second pinion gear 44 yy is positioned to engage the radially inward gear 39 ″. as above , the radially outward gear 39 ′ and the first pinion gear 44 xx pair and the radially inward gear 39 ″ and the second pinion gear 44 yy pair can be designed with gear parameters essentially independent of the other to providing greater flexibility in designing the folding assemblies 22 to produce a desired ratio of rotational movement of the radially outward gear 39 ′ and the radially inward gear 39 ″, and hence the desired ratio of rotational movement of the forward and rearward rotatable members 35 ′ and 35 ″ when folding and unfolding the stroller 10 . the length of the radially outward gear 39 ′ of the forward rotatable member 35 ′ and the radially inward gear 39 ″ of the rearward rotatable member 35 ″, and also the length of the elongated apertures 41 ′ and 41 ″ within which the pinion gear 44 is positioned , impact the amount of rotation possible for the forward and rearward rotatable members 35 ′ and 35 ″. the range of movement is limited by stops 51 ′ and 51 ″ attached to the perimeter portion of the forward and rearward rotatable members 35 ′ and 35 ″, respectively . each of the stops 51 ′ and 51 ″ extends laterally toward the adjacent rotatable member and radially outward of the perimeter of the adjacent rotatable member . the stops 51 ′ and 51 ″ are attached to the rotatable members 35 ′ and 35 ″ at positions along the perimeter of the rotatable member to which attached such that when the rotatable members are rotated to place the folding assemblies 22 in the fully unfolded state , as shown in fig8 , the stops 51 ′ and 51 ″ are in engagement and prevent further rotational movement of the rotatable members in that rotational direction . in the depicted implementation , the stops 51 ′ and 51 ″ are positioned to allow a rotation angle for the handle supports 24 of about 108 ° and for the front wheel supports 20 of about 70 °. it should be understood that while in the depicted implementation the front wheel supports 20 and the handle supports 24 are attached to the rotatable members 35 ′ and 35 ″ of the left and right side folding assemblies 22 ( and the rear wheel supports 30 fixedly attached to the housing 42 ), other implementations may have the rear wheel supports 30 and the handle supports 24 attached to the rotatable members 35 ′ and 35 ″ of the folding assemblies 22 ( and the front wheel supports 20 fixedly attached to the housing 42 ) such that they rotate to fold about the front wheel supports . similarly , the rear wheel supports 30 and the front wheel supports 20 may be attached to the rotatable members 35 ′ and 35 ″ of the folding assemblies 22 ( and the handle supports 24 fixedly attached to the housing 42 ) such that they rotate to fold about the handle supports . to prevent the unintended folding of the stroller 10 when the folding assemblies 22 are in a fully unfolded state , as shown in fig8 , each folding assembly has a releasable locking mechanism with a slidably mounted head 50 having a locking lug 52 . a spring 54 applies a bias force to the head 50 to maintain the locking lug 52 in contact with a smooth , rounded perimeter portion of each of the disks 36 ′ and 36 ″ of the folding assembly as the rotatable members are rotated close to the stroller fully unfolded state . the notches 38 ′ and 38 ″ of the disks 36 ′ and 36 ″ are positioned along a reinforced perimeter portion of the disks in a location where when the stroller 10 reaches the fully unfolded state , the notches are in alignment and the spring 54 will drive the head 50 forward to position the locking lug 52 in both notches , and hence prevent rotation of the disks toward the folded state . the portion of the disks 36 ′ and 36 ″ around the notches 38 ′ and 38 ″ has increased thickness for added strength . the head 50 is slidably mounted in the housing 42 at a position above the recess 42 a receiving the upper free - end portion 30 b of the rear wheel support 30 . the upper end of the spring 54 engages the head 50 and the lower end engages a spring support 56 positioned inside the upper free - end portion 30 b of the rear wheel support 30 . the lever 34 for the folding assembly 22 is pivotally mounted to the rear wheel support 30 and has a nose portion extending through an aperture in the head 50 and in engagement with a pin within the head so that when the lever 34 is pulled upward and inward as depicted by the arrows r 1 in fig3 , the head 50 is moved downward , away from the disks 36 ′ and 36 ″, thereby causing the locking lug 52 to be retracted from the notches 38 ′ and 38 ″ and permitting the disks 36 ′ and 36 ″ to rotate toward the fully folded state shown in fig6 in a generally clam shell movement to position the handle supports 24 and the front wheel supports 20 nested tightly against the rear wheel supports 30 . the folding assembly 22 is shown in fig9 between the unfolded and folded states with the locking lug 52 of the head 50 retracted from the notch 38 ′ and 38 ″. while the spring 54 supplies enough force to the head 50 to keep the locking lug 52 in the notches 38 ′ and 38 ″ to lock the stroller 10 in the fully unfolded state , the force is not so great as to require undue force to be applied to the lever 34 by the user to retract locking lug from the notches when the folding assembly is to be folded . each of the left and right side folding assemblies 22 has the corresponding left or right front wheel support 20 bolted onto the arm 40 ′ of the forward rotatable member 35 ′ and the corresponding left or right handle support 24 bolted onto the arm 40 ″ of the rearward rotatable member 35 ″. it should be understood that while the rotatable members 35 ′ and 35 ″ were depicted as including the disks 36 ′ and 36 ″, in other implementations the rotatable members 35 ′ and 35 ″ may have other shapes . another embodiment of an all - terrain baby stroller 10 ′ is shown in fig1 . this embodiment has the basic same design as the stroller 10 , but is designed to carry two children is side by side arrangement . the frame 12 of the stroller 10 ′, in addition to having the left and right side frame supports 24 , has a center frame support 24 ′ which extends upward from a center folding assembly 22 ′ ( shown in fig1 ) of the same construction as the previously described folding assemblies 22 , except the center folding assembly 22 ′ has left and right side outwardly extending levers 34 . either of the levers for the center folding assembly 22 ′ may be pulled upward and outward to place the center folding assembly 22 ′ in an unlocked state . much as with the folding assembly 22 described above , each lever 34 for the center folding assembly 22 ′ is pivotally mounted to a rear wheel support 30 ′ and has a nose portion extending through an aperture in the head 50 of the center folding assembly 22 ′, although from opposite sides thereof . movement of either lever 34 when pulled upward and outward causes the head 50 of the center folding assembly 22 ′ to moved downward , away from the disks 36 ′ and 36 ″ of the center folding assembly 22 ′, thereby causing the locking lug 52 to be retracted from the notches 38 ′ and 38 ″ and permitting the disks 36 ′ and 36 ″ to rotate toward the fully folded state . a strap ( not shown ) may be connected by its ends to the lever 34 of the left side folding assembly 22 and to the left side lever 34 of the center folding assembly 22 ′, and another strap ( not shown ) may be connected by its ends to the lever 34 of the right side folding assembly 22 and to the right side lever 34 of the center folding assembly 22 ′ to facilitate movement of both levers to which the strap is connected at the same time . from the foregoing it will be appreciated that , although specific embodiments of the invention have been described herein for purposes of illustration , various modifications may be made without deviating from the spirit and scope of the invention . accordingly , the invention is not limited except as by the appended claims .	8
fig1 schematically shows a perspective view of an integrated glucose measurement module 2 and a hand - held processing device 4 , such as preferably a personal digital assistant ( pda ) 4 or a mobile phone or combined pda / phone or other wireless device with a processor as may be understood by those skilled in the art . hereinafter when the term pda is used it is meant to refer to any of these or other hand - held processing devices , any of which may also be operated using hands - free accessories and / or equipment . the glucose measurement module 2 ( hereinafter “ module 2 ”) is shown in fig1 mechanically attached to the pda 4 . the module 2 is in this way physically mounted to and integrated with the pda 4 . the module 2 is also electrically connected to the pda 4 when mounted into the pda 4 . in addition , the module 2 is software interfaced with the pda 4 when mounted into the pda 4 . the module 2 shown in fig1 preferably does not have a display , since the display of the pda 4 may be used for displaying information . the pda 4 may be replaced by another processing device having a display such as a mobile phone having a connector for attaching the module 2 . the module is shown having a slot 6 for insertion of an in vitro test strip 8 . some details may be found at u . s . patent application ser . no . 09 / 413 , 565 , which is assigned to the same assignee as the present application and is hereby incorporated by reference . when the test strip 8 is inserted into the slot 6 , preferably blood such as whole blood , plasma and / or serum , and alternatively another body fluid such as interstitial fluid , sweat , urine , tears , saliva , dermal fluid , spinal fluid , etc ., is applied to the strip 8 and the module 2 measures the glucose level of the body fluid applied to the strip 8 . hereinafter , whenever blood or body fluid is referred to for being applied to the strip 8 , it is meant to include whatever body and / or biological fluid that may be applied to strip 8 for testing . the glucose level data automatically transfers to the pda 4 ( the data transfer mechanism is described in more detail below with reference to fig2 - 5 ), and the glucose level in the blood tested is displayed on the display 10 of the pda 4 , or transmitted through a speaker or otherwise to a user of the device shown in fig1 . the pda 4 is configured to hotsync with a pc for transmitting data to a pc . the pda 4 may also transmit data by wireless rf and / or ir connection to a remote or host client or server computer . the pda 4 also preferably has internet connectability or is otherwise configured for logging into a network for transmitting and receiving data from the network . fig2 shows a block diagram of electrical modules of the integrated glucose measurement module 2 and pda 4 of fig1 . at the point of the in vitro test strip slot 6 at the top of fig2 is a strip interface 12 including circuitry for connecting to an in vitro test strip for passing a current through blood applied to the strip . glucose measurement circuitry 14 is shown connected to the strip interface 12 for measuring one or more parameters indicative of a blood glucose level of the blood applied to the strip . an isolated power module 15 provides power to the glucose measurement circuitry 14 and strip interface 12 and ultimately to the test strip . an isolation barrier 16 is shown for isolating the power at the module from the power at the pda 4 . the isolation barrier 16 is provided to protect the user from having a high current pass through his or her body when the pda 4 is in a hotsync cradle 18 and thus is connected to ac power . since an electrically conductive part of the integrated measurement module 2 / pda 4 system ( i . e ., a strip ) contacts the patient , the system may be considered to have a “ patient applied part ” and would be bound to comply with applicable standards ( aami es1 , iec60601 - 1 - 2 , etc ) for isolated patient connections . these standards contain requirements for a maximum amount of current that can flow in either direction between the patient and an ac power line or ground with either the module 2 or the patient in contact with 1 10 % of line voltage . when the glucose measurement module 2 is inserted into the pda 4 and the pda 4 is connected to it &# 39 ; s hotsync cradle 18 as shown in fig2 , ac ground is connected to the module 2 . this connection is made because the ground connection of the hotsync cradle 18 to the pda 4 is connected to ground at the computer to which the hotsync cradle is connected , which is in turn connected to earth ground at the ac outlet . if ac voltage is applied to the strip connector 12 , a large amount of current would flow to ac ground through the module 2 , pda 4 , hotsync 18 , and / or computer circuitry . referring to fig3 a , a module 20 connected to pda circuitry 22 and not having the electrical isolation barrier 16 of fig2 is illustrated . a patient 28 is shown contacting a test strip 30 , e . g ., for applying blood to the strip or for inserting the strip into the module 20 . the patient 28 is also contacting ac power 26 which also powers a computer 24 . the computer 24 is shown communicating with the pda 22 through the hotsync cradle 18 . ac ground is shown connected to the computer 24 , the hotsync cradle 18 , the pda circuitry 22 , and the module 20 . if the user 28 became in contact with the test strip 30 and inadvertently came in contact with any earth referenced potential , large currents would flow through the user 28 , and back to earth ground via this path . conversely , if the module 20 or test strip 30 were to be inadvertently raised to a high potential reference to earth ground , again large currents would flow through the user 28 . the risk in each case is electrocution of the user 28 and the standards consider having the user 28 in contact with significant potentials a viable scenario . should even very small currents flow across the heart , e . g ., there is significant risk of causing fibrillation . in order to prevent this potentially dangerous situation , electrical connections which come into contact with the user 28 at the strip connector 30 are advantageously isolated from earth ground or ac in accord with a preferred embodiment . fig3 b illustrates the scenario described above with respect to fig3 a except that the module 2 includes the isolation barrier 16 referred to above with reference to fig2 . the user 28 who is shown in fig3 b in contact with ac power 26 to the computer 24 is also contacting the strip 30 which is connected to the module 2 . in contrast with the scenario illustrated by fig3 a , the strip 30 is not connected to ac ground , and thus no currents pass through the user 28 . this isolation barrier 16 is preferably created via a physical or otherwise insulating gap in the circuitry on the pc board or the module 20 . a preferred dimension of this gap is around 4 mm and is generally dictated by electrical safety standards . referring back now to fig2 , the glucose measurement circuitry 14 and strip interface 12 are shown on the isolated side of the barrier 16 . power for this isolated circuitry is created by power transfer circuitry 32 , which is a transformer coupled , switching power supply according to a preferred embodiment . the transformer 32 bridges the isolation barrier 16 and transfers isolated power 15 to the isolated side of the barrier 16 from the pda - to - module interface connector 34 . for sufficiently low power consumption requirements , a capacitively - coupled supply would be a viable alternative power transfer circuitry 15 . switching control circuitry 36 is on the pda ( ground referenced ) side of the isolation barrier 16 . a glucose value is calculated by circuitry 14 on the isolated side of the barrier 16 . the glucose value , status , and errors are communicated across the isolation barrier 16 preferably via a bidirectional serial interface 38 . control commands may be preferably received from the pda 4 via this same interface 38 . serial communication lines of the serial interface 38 bridge the isolation barrier 16 preferably via optoisolators ( not shown , but see fig5 and discussion below ). serial information is converted to parallel by serial to parallel conversion circuitry 40 within the module 2 on the pda side of the barrier 16 , so that the module 2 can communicate with the pda 4 . the pda interface 42 at the module connector 34 is parallel access directly to a pda data / address bus of pda circuitry 44 . this interface 42 includes control lines as well as power connections . as an alternative to providing an electrical isolation barrier between module 2 and pda 4 , features can be incorporated into module 2 that prevent it from being used at the same time that pda 4 is connected to a hotsync cradle or cable , thereby eliminating the risk of passing high levels of electric current through the cradle or cable to or from the patient . this can be accomplished by providing an extended portion of the housing of module 2 that extends down along pda 4 to interfere with the attachment of a cradle and / or cable to pda 4 when module 2 is first attached thereto , or prevent the attachment of module 2 when a cradle or cable is already attached to pda 4 . fig4 shows an electrical circuitry schematic of a glucose measurement module for integrating with a pda according to a preferred embodiment . the electrical schematic shown in fig4 shows a strip connector 52 for making electrical connection to a strip 8 inserted into the slot 6 of the module 2 of fig1 . analog front end signal acquisition circuitry 54 is shown for acquiring signals indicative of a blood glucose level in blood applied to the strip 8 ( fig1 ). a microprocessor 56 is shown for controlling the module 4 . the microprocessor 56 receives isolated power ( see element 15 of fig2 ) as isolated voltage ivcc from an unregulated voltage at point 58 of the schematic of fig4 appearing on the isolated side of the barrier ( which is the barrier 16 of fig2 ), and regulated through regulator 60 . fig5 shows an electrical circuitry schematic of a pda for integrating with a glucose measurement module according to a preferred embodiment . a connector 62 for mounting the module 2 with the pda 4 as shown in fig1 is shown next to a memory 64 for storing digital data . at the right in fig5 is a universal asynchronous receiver / transmitter or uart 66 . the uart is on the non - isolated side of the barrier 16 of fig2 . the uarts perform the serial to parallel conversion of element 40 of fig2 . data is transmitted serially from the glucose module 2 to the uart 66 ( or converter 40 of the module 2 of fig2 ) through optoisolator 68 . data is transmitted serially from the uart 66 to the isolated side of the barrier 16 of fig2 through the optoisolator 70 . data may alternatively be transferred across the barrier 16 in parallel . additional optoisolator components would be used for parallel data transfer compared with serial transfer . serial transfer is preferred and allows the module 2 to be smaller , more economical to manufacture and more power efficient than if parallel transfer and additional optoisolators are used . power is transferred from the pda 4 through the transformer ( corresponding to the power transfer circuitry 32 of fig2 ). the transformer is preferably a 1 : 1 transformer , and may be a step - down or step - up transformer of a desired ratio . through the transformer , power as voltage vcc is transferred from the non - isolated side of the barrier 16 to the isolated side as isolated power 76 . the power may be around 3 . 3 volts according to a preferred embodiment . fig6 a schematically shows a plan view of a glucose measurement module 78 for integrating with a pda ( not shown , but see fig7 a - 7 b ) according to a preferred embodiment . the module 78 includes a mounting portion 80 and a specially shaped extension portion 82 . when the module 78 is inserted into a pda and is mechanically and electrically attached to the pda and configured to transfer data to / from the pda , the mounting portion 80 is within the pda and the extension portion 82 protrudes outside of the pda . the module 78 ( corresponding to the module 2 of fig2 ) is about 54 mm wide at the mounting portion 80 which plugs into the pda 4 and scales down to around 23 mm at the end 86 of the extension portion 82 where the strip 8 of fig1 is inserted . the extension portion 82 itself measures about 54 mm in width at the other end where the mounting portion 80 begins and the extension portion 82 is preferably about 28 mm long from the mounting portion 80 to the strip insertion end 86 . the shoulder from which the extension portion 82 narrows most drastically in about 8 . 5 mm in extent to the approximately 28 mm extent of the extension portion 82 . the curvature from the shoulder is about 0 . 5 rho , which changes direction at a curvature of about 0 . 5 rho and which changes direction again at a curvature of about 0 . 6 rho to the strip insertion end 86 . as the shoulder flattens out , it makes an angle of about 100 ° with the elongated direction of the module 78 from the strip end 86 , or 80 ° looking at it from the direction of the mounting portion 80 , which angle can be varied somewhat while maintaining the shoulder and also the smoothness of the rounding of the extension portion 82 . the extension portion 82 is shown symmetric , but may have an arbitrary curvature on one side the module 78 will be used by resting the extension portion on only the side with rounded features as just described , i . e ., it is preferred there are no sharp corners on at least one side of the extension portion 82 , and it is more particularly preferred that no sharp corners exist anywhere on the extension portion 82 , nor even on the mounting portion 80 . the mounting portion 80 connects electrically and for data transfer to the pda by preferably a 68 pin electrical connector 84 as shown in fig6 b for connecting to a complementary 68 pin male connector of the pda , wherein the male and female configuration may be reversed or mixed . the thickness of the module 78 is indicated as preferably around 19 mm . fig6 b schematically shows a rear view of the glucose module of fig6 a . although not shown , the module 78 attaches mechanically in place in the pda receptacle by a pair of mechanical latches preferably on opposing sides , e . g ., the left and right side in fig6 a , of the pda receptacle . the extension portion 82 is particularly ergonometrically and / or arthopometrically configured so that a patient may insert a strip into a strip insertion slot ( corresponding to slot 6 of fig1 ) at the end 86 of the extension portion 82 , and so that the patient can contact the strip with a drop of blood on the skin of the patient &# 39 ; s body . the device is configured so that the patient may choose to use his or her arm , leg or any convenient anatomic location including the finger . this is advantageous because conventional systems often require application of blood to the strip at the finger . a feature of the shape of the extension portion 82 is its protruding and / or telescoping trapezoidal profile . a utility design is provided at the extension portion 82 of the module 78 that promotes easy and efficient manipulation of the glucose strip on the blood drop whether if be on or off - finger or at an alternate site . the pda module design incorporates a telescoping trapezoidal profile that allows ease of placement and inhibits the pda body from encroaching or otherwise interfering with the placement , e . g ., at a patient &# 39 ; s arm . at the same time , the design is unobtrusive , streamlined and safe . the telescopic and / or protruding trapezoidal profile of the module includes generous radii on each of the compound edges shown in fig6 a . the design allows easy and effective collection of a blood sample from any approved site on the body . the design allows for ease of positioning the module in the proximity of the blood drop and when actually placing the glucose strip on the blood drop . the preferred radii of curvature of each of the three bends on each side of the slot 86 of the extension portion 82 of fig6 a are drawn to scale . the curvatures are selected such that the pda does not interfere with the blood application to the strip , e . g ., from a patient &# 39 ; s arm , leg or other approved off - finger location , and such that the shoulders of the extension portion 82 of the module 78 may rest gently on the patient &# 39 ; s arm while the blood is applied , if the patient chooses , e . g ., for support and / or stability . in addition , the design allows for a discreet and unobtrusive profile extending from the pda . the design is compact and portable and preferably does not include cumbersome and potentially hazardous cables and extra attachments . the extension 82 is preferably rounded in three dimensions or at least two dimensions , e . g ., as illustrated by the various views of the preferred embodiment shown in fig6 c - 6 f , and as mentioned , preferably has no sharp corners on at least one side which may be rested upon an arm or leg near an alternate site testing location , and for displaying information while testing on each arm for different tests such as on different days , the extension 82 is preferably rounded on both side and is particularly preferably symmetric as shown . fig6 c schematically shows a bottom perspective view of the glucose module 78 of fig6 a with extension portion 82 , mounting portion 80 and pin connector 84 . fig6 d schematically shows a top perspective view of the glucose module 78 of fig6 a with mounting portion 80 , extension portion 82 and strip insertion end 86 . fig6 e schematically shows a side view of the glucose module 78 of fig6 a , indicating a total length of about 85 mm , a thickness of about 14 mm at the extension portion 82 and a thickness of about 0 . 9 mm at the mounting portion 80 , wherein the extension portion 82 and mounting portion 80 couple in a staggered fashion with each portion 80 and 82 having an edge which looks out somewhat over the other . fig6 f schematically shows a front view of the glucose module of fig6 a with the strip insertion portion 86 showing at the end of the extension portion 82 . the corners are rounded with radius of curvature about 2 . 6 mm in the middle of the curve . fig6 g , 6 h and 6 i schematically show another side view , a top view and another rear view of the preferred glucose module with preferred dimensions shown in millimeters . referring to fig6 g , the mounting portion 80 of the module 78 has a thickness of around 14 . 3 mm , which differs from the 0 . 9 mm thickness shown at fig6 e . the thickness , as well as the width and / or length , of the mounting portion 82 is preferably set to adapt to the dimensions of the receptacle of the hand - held processing device ( e . g ., pda , mobile phone , combined pda / phone , etc .) that the module 78 is to be connected , and these dimensions will vary depending on the device , and so no fixed numeric dimensions are necessarily universally preferred . the rounding of the strip insertion end 86 of the extension portion 82 is shown as having minimum radii of curvature of 9 mm on the bottom side and 2 . 5 mm on the top side . referring to fig6 h , the rounding from the shoulder of the extension portion has a minimum radius of curvature around 12 mm , while the rounding which is opposite in direction as the rounding from the shoulder has a curvature radius of about 33 mm and that final rounding near the strip insertion end 86 is about 22 mm at minimum . referring to fig6 i , a thickness of around 19 . 5 mm is shown for the rear view , which shows the pin connector 84 , including the thickness of the mounting portion 80 added with the staggered overlooking portion of the extension portion 82 , as briefly described above , i . e ., so that the staggered overlook portion of the extension portion 82 is about 5 mm . as shown in fig6 a - 6 i , the extension portion 82 is rounded away from each side of the slot 86 in two orthogonal directions , and rounds from the slot 86 toward the mounting portion 80 , corresponding to a third direction in which the extension portion 82 of the module 78 is rounded . this advantageous design prevents potential hazards such as pinching , lacerations , cuts or skin abrasions , during normal use and handling . the module 78 serves as a housing for the strip connector , pc board and the opto - isolation components , while not appearing bulky or obtrusive . as mentioned above , the module 78 does not include a display such as a lcd screen because the pda display may be used as an advantageous pda accessory for displaying blood glucose levels without delay due to the integrated design of the module 78 with the pda ( see fig1 ). this contributes to the compactness feature of the design , enabling the module 78 to extend less than two inches beyond the end of the pda , and as shown in fig6 a , less than 1 . 5 inches and even below 1 . 2 inches . the module 78 at the extension portion 82 is around or less than 0 . 25 inches thicker than the pda . the module 78 weighs less than two ounces and the preferred embodiment shown is around 1 . 1 ounces , while the design may be configured at less than one ounce . in contrast , if a display such as an lcd were included in the module 78 , the module 78 would likely be 50 - 60 % longer , 0 . 25 inches thicker and be at least two ounces . the preferred module 78 thus does not have a display , and is thus smaller and lighter than if it did have a display , while the integrated module - pda system has full display capability . obtaining power to run module 78 from the pda rather than from an internal power source also contributes to the light , compact arrangement shown . the module 78 shown and described with respect to fig6 a and 6 b including the telescoped , trapezoidal - shaped design has fully - radiused shoulders in an advantageous profile . some preferred radii and compound angle values are shown in fig6 a . from the slot 86 , the design rounds toward the pda at a preferred radius of curvature of 0 . 6 rho , then rounds in the opposite direction away from the slot 86 at a preferred 0 . 5 rho and then reverses its curvature again toward the pda at a preferred 0 . 5 rho . the module 78 advantageously mates with a pda device and forms a single , hand - held unit for glucose measuring and data management . the mechanical design shown in fig6 a - 6 f allows measurements to be taken that suppress problems that might otherwise present themselves such as interference by the bulky pda in the blood application process , improper strip placement and positioning , potential for injury , and obtrusiveness . the glucose monitoring strip may be positioned to apply the blood drop , while being attached to the module 78 which is itself mounted into the pda . the sheer size of the pda in relation to the module 78 does not inhibit the application process due to the design of the extension portion 82 such that the pda body does not interfere with or become a hindrance to placement . the shape the profile of the module actually conforms to the shape of a body part such as an arm to which it rested , without presenting itself with an “ armsliding ” problem , as the user positions the module 78 in close proximity to the blood drop . the rounded shape , generous radii and material selection reduce potential hazards to the user , in terms of cuts , lacerations or skin abrasions . alternative designs would provide for a more pointed profile to the module 78 to presumably provide easier access to the glucose strip or the module 78 may be alternatively connected through a strip connector and a flexible cable to allow flexibility of placement , independent of the pda body . these alternative designs are not preferred , however , as the size of the pointed profile may be limited by the size of the strip connector and would likely not allow the user to effectively position the strip due to a lack of plastic real estate . additionally , a flexible cable , although affording flexibility of placement , would be cumbersome and visibly obtrusive . the preferred design thus has the slightly wider tip such as shown in fig6 a and no cumbersome cable is used in the preferred embodiment which includes the module 78 directly mechanically coupled with the pda . the module 78 and particularly the extension portion 82 are made of a low durometer material or thermoplastic elastomer facepad detail on both sides of the enclosure , to act as a gripping surface for module insertion and extraction , as well as afford the module a measure of shock absorption . the material may preferably be a pc - abs alloy or other non - filled plastic resin . fig7 a schematically shows a side view of the measurement module 78 of fig6 a integrated with a pda 4 according to a preferred embodiment . an indication of an staggered overlook portion of the extension portion 82 being 6 . 25 mm as opposed to the 5 mm shown about , again indicates that the dimensions of the module 78 can be varied to meet the specifications of the particular hand - held device 4 being used . the mounting portion 80 is shown inserted into the pda 4 while the extension portion 82 is shown protruding from the pda 4 . fig7 b schematically shows a plan view of the integrated measurement module 78 , with mounting portion 80 and extension portion 82 , and pda 4 of fig7 a . as shown , the extension portion 82 , with length of about 28 mm , protrudes from the pda 4 while the mounting portion 80 of the glucose measurement module 78 , with overall length of about 73 mm , is inserted within the receptacle of the pda 4 ( or other hand - held processing device , see above ). fig8 illustrates generally a glucose data handling system software according to a preferred embodiment in block diagram form . fig8 shows a measurement module 90 which receives a glucose strip 92 for measuring a glucose level of blood applied to the strip 92 . the measurement module 90 communicates with the pda which may be running a palm operating system or other pda operating system software . the measurement module 90 is preferably configured to turn off nonessential electronics when no measurement is being made . the measurement module preferably includes a microprocessor that controls internal timing , algorithms , result calculation and fault determination , among other responsibilities . the module 90 includes circuitry to connect the serial output of its internal microprocessor to pda electronics including a mechanism for program initiation and data transfer . the module 90 also preferably provides electronic esd protection on analog strip connector lines and flash memory for storage of meter firmware and associated user preferences . the module 90 is preferably powered by the pda , but could alternatively include its own power source , such as button or aaa - size batteries . the module 90 includes electrical isolation between the strip connector and the hotsync port . the pda communicates with a pc when the pda is preferably hotsynced to the pc . the pda includes ram as a temporary database for diabetes management application data and / or programs and non - volatile memory for permanent data and / or program storage . the measurement of the glucose level may however be advantageously performed when the pda is not hotsynced to the pc , and the pda includes many data processing features itself for managing data without support from the pc . for example , charts and / or graphs maybe generated on the pda display . the pc system includes standard peripheral devices such as a monitor 98 , keyboard 100 , cd - rom 102 and a printer 104 . fig9 illustrates a hardware / software block diagram of an integrated glucose measurement module 2 and pda 4 according to a preferred embodiment . the measurement module 2 shown includes a strip connector 52 and analog front end electronics 54 , such as those shown in fig4 . the measurement module 2 also shows a processor running firmware 110 , wherein the processor may be as the processor 56 shown in fig4 . the processor is shown having access to non - volatile data storage 112 . the isolation barrier 16 is shown wherein the above - mentioned components of the measurement module 2 , i . e ., the strip connector 52 , analog front end electronics 54 , processor and firmware 110 and nonvolatile data storage 112 , are on the isolated side of the barrier 116 . pda meter user interface firmware 114 permits the module 2 to communicate with the pda 4 . a serial to parallel interface , such as that shown in fig2 , is also shown in fig9 for converting the serial data transmitted across the barrier 16 using optoisolators 68 , 70 such as those described above with respect to fig5 . an interface 116 is shown between the module 2 and pda 4 . the pda 4 is shown having a pda ram and non - volatile storage 118 , a pda processor 120 , a pda display and touchscreen 122 and a pda serial interface 124 . the pda is configured to hotsync to a pc system 96 , such as that described above with respect to fig8 , including a monitor 98 , keyboard 100 , cd - rom 102 and printer 104 . the pc system shown in fig9 also includes a hard drive 126 , a cpu 128 and a serial i / o 130 which alternatively may be usb . the data may be entered on the pda 4 . this data may be hotsynced to the pc 96 . the data may also be entered on the pc 96 and reverse hotsynced to the pda 4 . in the former case , e . g ., the pc 96 would have an application stored in its memory for accepting this data . this pc application would display and print logbook data in various formats . the pc application would also export data to various data processing applications . the application may use a microsoft access database or mdb format , while the data on the pda may be stored using the palm pdb format . the user is preferably able to reverse hotsync data from the pc in order to restore the data to the state it was when it was last hotsynced . the user might want to do this in the event the database on the pda becomes corrupted . the pc application and database may store a complete history of data that was entered on the pda . the pda user may choose to archive some of the pda data on the pc . a conduit program may be used . the program may perform the following steps : ( 1 ) create a replica of the data stored on the pda , on the pc ; and ( 2 ) synchronize data from the pda to the database on the pc . the two steps may be performed in two separate conduit programs . synchronizing the data may include reading data from a pdb file and writing it to the pc database . microsoft visual studio may be used for opening , reading and writing data in the pc database . the data may be read from the pda , matched to data on the pc , format converted , and written to the pc database . similarly , data entered or modified on the pc may be matched to data on the pda . the data on the pda may be updated to reflect the changes made on the pc . to match data from the pda to the pc , unique id numbers may be used in records on the two systems . these id numbers may be created on the pda as logbook records or on the pc as logbook entries there . the uniqueness of the id numbers may be achieved by pre / post fixing the id with an origin code identifying pc or pda , or alternatively perhaps a guid . to read data from a pda file and write it to the pc database , it is recognized herein that data in the pc database may be organized into tables , which may be organized into records , which may be broken down into predefined fields . similarly , at some level data will be organized into records with a consistent field structure on the pda . the conduit program reads the data from the pda file ( s ) and writes it out to pc tables . the conduit program also reads data from the pc tables and writes them out to pda file ( s ). various types of data conversion may be used . for example , data residing in fields in the pda file may be converted from the format it exists in the pda file to a format compatible with the pc and vice - versa . the logical structure of the records in the two systems may be different . tables may be created ( either in code or in an external file such as a database ) which define the mapping of data in fields of one system to data in fields in the other . data may be stored in temporary table ( s ) that may later be synchronized with main table ( s ) that contain a complete logbook history , or the conduit program may write to these tables directly . fig1 shows a data flow diagram of an integrated glucose measurement module 2 and pda 4 according to a preferred embodiment . current is flowed to a strip 8 from the measurement module 2 which , as mentioned , is powered by the pda 4 as shown and described with respect to fig5 . the measurement module 2 includes a setup component 132 , which the module 2 communicates to the pda 4 , and a user preferences , calibration code and glucose log component 134 . component 134 serves to convert an electrical reading , such as the current that passes through the blood on the strip 8 , to a glucose level , saves a glucose log , saves user preferences , and provides status and error data to the pda 4 . error data may include glucose errors and charge errors . the pda 4 is also configured to send user preferences and a calibration code to the measurement module 2 for use or storage by the component 134 . the pda 4 also receives firmware revision data , measurement state data and temperature data from the measurement module 2 . the measurement state and temperature are preferably displayed on a display 10 of the pda 4 or otherwise provided to a patient by sensory output such as audio or vibration output . the display 10 is preferably also configured to function with touchscreen software and electronics 135 . the pda 4 includes a timer and power module 136 , information about which is also displayed . data regarding the current time is also sent to the module 2 from the timer and power module 136 of the pda 4 . the pda advantageously also includes an event database 138 and a user preferences database 140 . the event database 138 generally includes information relevant to diabetes management , such as glucose readings . fields of an event may include time , data , event type . the glucose and error data are stored to the event database 138 after the pda 4 receives the data from the module 2 . the event database includes a logbook which collects glucose , insulin , carbohydrate and exercise data and time . the data in the event database 138 may be graphed in many ways according to helpful default or preprogrammed graphs or according to filtering and preferences inputs from a user . some exemplary graphs that may be generated on the pda display 10 from the event database and software loaded on the pda without the pda being hotsynced or otherwise connected to a pc or other processing device . in addition , the data including glucose data is automatically sent to the pda 4 from the module 2 to be stored in the event database 138 where the data can be used to generate graphs that help a user such as a diabetes patient to track glucose and other information . the data measured by the module 2 does not need to be manually entered by the user into a computer before the data can be processed into graphs and the like , or so that the pda &# 39 ; s own software can process or analyze the data to provide useful data analysis to the patient regarding the glucose and other information relating to the condition of the patient . software on the pda also preferably includes insulin and carbohydrate tools , and software for communicating with a pc . the user preferences database 140 may store user input such as units of measure , date and time format , an audible or otherwise sensory alert level , the language to be used and other user preferences . the pc 96 such as that schematically shown at fig8 and 9 may have additional features . for example , the pc may be configured for viewing and printing the logbook stored on the pda 4 and transferred to the pda 4 . the pc may be configured to take glucose values and put them into a data management database of its own that may have the same or different capabilities as the event database loaded on the pda 4 . the pc would be helpful for backing - up data and for downloading applications programs to the pda and also for communicating with other computers over one or more networks . additional data processing features of the system of the preferred embodiment herein are set forth below with reference to fig1 . fig1 shows a software data flow diagram of an integrated glucose measurement module 2 and pda 4 according to a preferred embodiment . fig1 shows how four software applications according to a preferred embodiment interact and illustrate functions of these applications and databases that the applications are programmed to utilize . the applications include a meter application 150 , a logbook application 152 , a diabetes management application 154 and a data management application 156 . each of these applications preferably runs on the pda which has been described above ( e . g ., see fig1 ). these applications may also each run on a pc to which the pda is configured to communicate . the applications may be downloaded to the pda or another device from the pc or a server or other digital data storage device such as a cd - rom or magnetic disk . fig1 also shows a logbook database 158 and a carbohydrate (“ carbo ”) database 160 . the databases 158 and 160 are generally electronic stored records . these may be separate databases or parts of a same database . the logbook and carbo databases may be part of the event database 138 mentioned above with reference to fig1 . the logbook database 158 is preferably utilized by each of the applications 150 , 152 , 154 and 156 mentioned above and shown in fig1 , and includes automatic and manual glucose entries , insulin , exercise , meal and other data , and applies user preference filters . the carbo database 160 is preferably utilized by the diabetes management application 154 , and includes default carbohydrate data and user entered data . diabetes management generally refers to activities performed by an individual with diabetes to organize and optimize aspects of life with diabetes such as medication , diet , and exercise that are involved in treating and managing the diabetic condition . the diabetes management application facilitates these activities for the diabetic . the data management application generally provide graphic representations and / or text summaries of data relevant to diabetes management . the logbook database 158 preferably includes time and date tagged events which are automatically or manually stored such as glucose measurements , manually entered glucose readings , exercise records , insulin injection records , meal time records , state of health records , note records , and medication among others . the user may input entries to the logbook database 158 , e . g ., that are derived from other glucose meters . manually entered glucose readings may be flagged as user input rather than meter input . the user may enter other items such as insulin amount , type , and time period , meal times and carbohydrate values , exercise time , type , and degree of exertion ( e . g ., high , medium , low ), state of health , comments and medications . these items may be available to the user from a predefined drop down list that can be edited and added to , or can be manually entered . data associated with a past event may be entered or modified in the database 158 by the user . events may be tagged with time periods . each application 150 - 156 is configured to process user inputs including glucose measurements . for example , the meter application is configured to process calibration code input , glucose readings and button presses . the glucose readings are advantageously automatically stored in the logbook database 158 on the pda according to the programming of the meter application 150 . the logbook application 152 is configured to process stored log data and manual entries , and to store and retrieve the log stored log data and manual entries into and from the logbook database 158 , respectively . the diabetes management application 154 is configured to process a daily regimen and events such as exercise , meals , insulin dosages and times , etc . and to store and retrieve the daily regimen and events into and from the logbook database 158 , respectively . the diabetes management application 154 is also configured to store and retrieve carbo data and manual carbo entries into and from the carbo database 160 , respectively . the data management application 156 is configured to process structured data with user filters applied , and to store and retrieve automatic and manual entry information into and from the logbook database , respectively . the data management application 156 may be configured to allow the user to view data summaries in graphical and text formats . the user may be able to select the length of time to be viewed . the user may also be able to set a default length of time to be viewed from within user preferences . the user may be able to view a complete data set or filter the screen display to show only a selected time period to view . the user may be able to select the event type to be displayed , more than one event type may be selected to be displayed simultaneously . glucose summary statistics may be displayed by a selected date range and time period . both selected date range and time period may appear on the display . the summary statistics may include the number of measurements , the highest measurement , the lowest measurement , the average measurement , the standard deviation of the measurements , the percentage of measurements within the target range , the percentage of measurements above the target range , the percentage of measurements below the target range , and insulin and carbohydrate statistics summary . graphical summaries may also be provided such as line graphs and pie charts ( see fig1 - 13 ). the user may be able to select a point on a line graph and see the logbook entry associated with that point . the diabetes management application 154 may be configured with diabetes management tools such as carbohydrate tables , insulin tables , fast acting carbohydrate list , daily regimen ( food and exercise patterns ) and target glucose levels . the application 154 may process one or more carbohydrate tables and a food database . the user may be able to choose entries from a database listing carbohydrate values of foods per listed serving size . the user may be able to customize the food database by adding food items to the food database . the user may be able to tag entries as “ quick picks ”. the diabetes management application 154 may include a lookup table containing the dose of insulin required to lower glucose concentration by a known amount . the user may input insulin dosages based on a health care professional &# 39 ; s recommendations . one or more of the applications 150 - 156 may be configured to issue “ alerts ”. these alerts may be warnings directed to the user that are audible , or otherwise sensory such as by vibration , and displayed with graphics and / or text using the display screen on the pda . alerts may indicate that a planned activity is due to begin . event markers may be used to indicate that the user makes an entry into the logbook 158 to designate a specific condition or incident that relates to a specific blood glucose measurement such as meals , time before or after exercise , medication taken , sickness , feeling hypoglycemic , etc . the applications 150 - 156 , and particularly the diabetes management application 154 , may be used for self - monitoring of glucose in whole blood , and may be used by people with diabetes and by healthcare professionals as an aid to monitor the effectiveness of diabetes management . the applications 150 - 156 , and particularly the meter application 150 , may be used to provide direction to a user taking a glucose measurement and control data flow to the logbook 158 . for example , when the user inserts a test strip into the module , the module is programmed to check the strip and perform a self test . the display then indicates to the user when to apply the blood . the user then applies the blood sample to the strip . the measurement module monitors for fill ( the pda may , e . g ., beep on fill ) and takes the measurement . the module is programmed to then determine the glucose level and the pda displays the result . the glucose value is then automatically entered into the electronic logbook , i . e ., without user intervention , and the meter waits for further user input . once the glucose measurement is complete , the meter application 150 may be configured to relinquish control to one or more of the other applications 152 - 156 . fig1 illustrates a line graph of blood glucose data generated by an integrated measurement module and pda according to a preferred embodiment . the data used to generate this graph is stored in the logbook database . the line graph of fig1 shows glucose levels according to the date that the glucose level was taken . as shown , a glucose level that was recorded on november 5 at around 500 mg / dl is labeled as being “ hi ” while a glucose level recorded on october 21 at around 20 mg / dl is labeled as “ lo ”. a range between around 80 mg / dl and 140 mg / dl is indicated by dashed lines in fig1 suggesting an optimal glucose level range . fig1 illustrates pie charts of blood glucose data generated by an integrated measurement module and pda according to a preferred embodiment . the data used to generate the illustrative graphs of fig1 is stored in the logbook database . all of the pie charts shown in fig1 may be displayed on a display screen 166 of the pda at the same time , or one or more may be displayed at a single time . the graphs show the percentage of readings that are below , within or above target . for example , chart ( a ) shows that overall 39 % of the time the readings are within target or within the optimal glucose level range of fig1 . charts ( b )-( g ) show the percentages of readings that are below , within or above target pre - breakfast , pre - lunch , pre - dinner , post - breakfast , post - lunch and post - dinner , respectively . the user can understand his or her glucose level trends from these graphs . as described above , the advantageous glucose measurement module 2 , as schematically shown , e . g ., at fig1 , including its rounded - contour , tapered - shape narrowed end portion protruding from an inset shoulder of a connector end , and its composition , facilitates off - finger or alternate site testing . the strip 8 , and / or any of various embodiments thereof are described at pct published application no . wo 01 / 33216 and u . s . patent application ser . no . 09 / 434 , 026 , which are assigned to the same assignee as the present application and are hereby incorporated by reference . for example , the invention may use an electrochemical coulometric test strip such as the freestyle brand strip sold by therasense , inc . of alameda , calif . the freestyle strip uses a so - called “ sidefill ” arrangement . “ coulometry ” is the determination of charge passed or projected to pass during complete or nearly complete electrolysis of the analyze , either directly on the electrode or through one or more electron transfer agents . the charge is determined by measurement of charge passed during partial or nearly complete electrolysis of the analyte or , more often , by multiple measurements during the electrolysis of a decaying current and elapsed time . the decaying current results from the decline in the concentration of the electrolyzed species caused by the electrolysis . “ amperometry ”, another method of electrochemically measuring glucose , includes steady - state amperometry , chronoamperometry , and cottrelltype measurements . another example embodiment is directed to a system that includes several methods of providing immediate contextual feedback to diabetics by connecting to existing technology such as personal digital assistants , ( pdas ), and wireless phones . pdas can store and operate on glucose readings , not only to provide graphs of glucose levels , but to also provide immediate correlation of the glucose level with sleep , exercise , food , and insulin intake and to provide immediate recommendations as to possible steps for better glucose control . cell phones ( or pdas with wireless connectivity ) can transmit glucose reading ( s ) to a computer network such as the internet . this allows for immediate verbal and / or written recommendations , retransmission of information to a health care provider either in real time or on a delayed basis , emergency services , and immediate or delayed feedback to others that the diabetic is in control . to obtain these benefits , the integration from the measurement device to the external device should be seamless and transparent , in other words , a natural extension of use , much the way a vcr and tv work together . otherwise , the majority of diabetics , despite good intentions , will not be successful in consistently using the system and will not reap the benefits of tight glucose control . a diabetes disease state processing system according to an example embodiment is shown in fig1 . this system includes a variety of components which are described below . the system includes a sensor , or more particularly a glucose sensor / measurement device such as the freestyle brand ( therasense , inc ., alameda , calif .) glucose strip for single use , or , a continuous ( e . g . implantable ) blood glucose sensor . the sensor works by breaking down the glucose molecule , releasing an electron for each glucose molecule as is well known in the art . the electrons are measured by a meter and converted to an equivalent glucose reading . the system of fig1 also includes a meter , or a device that takes the current from the sensor , converts it to an equivalent glucose reading , displays the result , stores it in memory , and connects to other devices to permit the analysis and sharing of data . also included as part of the system is one or more patient local processors , or personal computers such as a desktop , laptop , palm or other programmable device that has storage and information display capabilities . the system may also include a wired interface , or more particularly , an interface to a web server / network node through an existing fixed infrastructure such as phone lines , cable modems , dsl , etc . additionally , the system may include a wireless interface , or an interface to the web server / network node through rf or other non - wired media . several devices are available for this purpose such as , but not limited to , mobile phones , two way pagers , and rf equipped pdas . each has one or more frequencies and protocol standards that must be complied with in order to have a successful data transmission . for the purpose of this disclosure , any wireless technology that allows digital communication will suffice . as indicated , the system includes a web server / network node , or a computer on the internet that contains data and programs to allow other computers to interact with and access its content . the computer may also include irda , or infrared data access , that uses short range , point - to - point non - contact data transmission to move data from one device to another . further , the system typically may include a gateway , or a computer that takes incoming messages , decodes them , provides protocol conversion and routes them to other processors on the internet . further , the system uses one or more protocols , which is the data format used to convey information . examples of internet protocols include sms , tcp , ip and war . additionally , the system has a local processor , or a computer that is directly accessible and whose data can be modified by the user . optionally , the system may also incorporate voice recognition technology which allows the input of data through spoken word or the control of a device through spoken word . referring again to fig1 , data is generated by the glucose transducer sensor system , which converts glucose molecules to electric current or charge , which is then sent to a meter . the meter converts the data to a glucose reading and generates status information . this information is output to a lcd screen and to a standard phone using analog or bluetooth ( rf ) technology . the information also may be output digitally to a phone or two way pager . this can be over a irda link , or rs232 link , or bluetooth rf interface . further , the information may be output to a local processor such as a pc , notebook pc or pda either using irda , rs232 , or card type interface . in this case , the data can be augmented by event information , graphed to show trends , and used to generate suggestions as to insulin , food intake , or exercise needed to control blood glucose levels . in an optional embodiment , the local computer forwards the information using tcp / ip directly to a database on a web server / network node . the phone connects the information to a gateway programmed to accept the information and forward it using wap or tcp / ip protocol to a database on a web server / network node . similarly , a cell phone or two - way pager forwards the information to a gateway programmed to accept the information and forward it using wap , tcp / ip or other protocol to a database on a web server / network node . the system can implement identified protocols in potentially dangerous situations . for example , a global positioning system may be incorporated into or used in conjunction with the system . when glucose readings indicate a hypoglycemic event is possible ( e . g ., characterized by rapidly falling blood glucose levels ) the system can be programmed to generate an emergency call ( to a specified care - giver or to an emergency service provider , such as ‘ 911 ’) and the gp system will transmit the location of the user as well . additionally , in another example embodiment , the web server / network node database is programmed to store the data for later viewing in a variety of formats and forward it in real time to a caregiver or hcp using tcp / ip protocol to a gateway . in addition , it can calculate ideal patient actions based upon glucose reading , time since the last meal and insulin dosage and ada recommendations and send recommendations back to the patient using the original connection . messages that are to be forwarded go through a gateway that formats the messages according to the final media : email , voicemail , pager , facsimile ( fax ), or short message service ( sms ) and retransmits the messages to their final destination . the caregiver , health care provider ( hcp ), or patient can access the web server / network node database through their own local computers to get a recent history of patient information . in one example embodiment , the control of data may be accomplished in two ways . first , the diabetic ( or patient ) either provides consent or takes action to transmit data to the web . secondly , the retransmission of data is based upon information and rules provided by the patient , caregiver and hcp . as an example , the caregiver may wish to be notified on every reading , on a missed reading , or when the data is outside of a certain range . likewise , the hcp may wish immediate notification if a patient is known to be out of control and the glucose reading falls outside a given range . it is up to the patient or the caregiver to set up the original forwarding information in conjunction with the hcp &# 39 ; s input . the local processor interfaces with the patient &# 39 ; s database to supply information as to the message destination , type of message , and forwarding conditions . this would then be frozen under password protection . in one example embodiment , to ensure that the data is not corrupted , some type of crc ( cyclic redundancy check ) or checksum is sent with each message . to prevent electronic eavesdropping , encryption prior to initial transmission may be implemented . as known to those skilled in the art , bluetooth and wap have built - in encryption methods . for a standard phone link or use of a local processor to transmit a message to the web server / network node , encryption may be designed into the transmission protocol . data on the web server / network node may also be protected from unauthorized copy and dissemination . while the meter serial number may serve as the method to access an individual &# 39 ; s data record , additional protection may be required to insure that data can not be used by unauthorized people . therefore , each person authorized to access the database may have an identification code . this code can limit access to those areas authorized . for an hcp or caregiver , it would be all patients under care plus the rules for automatic data forwarding . a patient or caregiver would be able to access only the meters being used and the rights of other people to access that information . transfer of data from the database to other computer systems will also be encrypted allowing only the recipient to decrypt it . additionally , to manage diabetes , event information may include meal information , insulin information , exercise information and other information , all of which is described as follows . meal information may include , but is not limited to time since last meal and carbohydrate count . insulin information may include , but is not limited to insulin dosage , type of insulin , and bolus information . exercise information may include , but is not limited to time and degree of exercise . other information may include , but is not limited to illness , therapy , and emotional state . potential services that may be offered to the diabetic ( e . g ., patient ) as a result of the input event information , include , but are not limited to , reading reminders , notifications , event information , shared data , voice recognition , reading response , reading notification , non - specific glucose recommendation , patient specific glucose recommendation , and real time help . in another example embodiment , a meter with wireless interface is described . a meter with a wireless interface may be useful for caregivers with children or parents that need assistance with diabetes management . such a system could also be useful with newly diagnosed diabetics who wish connection to a caregiver or help controlling their disease . the system would also be useful to insurance companies , hmos , or insulin manufacturers who want to increase active management of the diabetic &# 39 ; s glucose . this system consists of a meter tied into a wireless communications system . variations include a meter having built - in gsm sms communications that connects to a standard wireless phone over irda , rs232 ( cable or cradle ), or bluetooth rf link that connect to a standard phone system using a modem or bluetooth rf link . referring now to fig1 , a schematic of a wireless diabetes disease state processing system is illustrated . the wireless diabetes disease state processing system includes the ability to upload glucose information coupled with voice annotation in real time to a database using a form of encryption . the system further allows for the retransmission of information in real time to a caregiver based upon a set of recipients with specified data formats and rules programmed into the database to provide additional patient assistance . a collection of the glucose information is stored in a database and allows for automated suggestions to improve glucose control . these suggestions can be based upon ada guidelines or customized by the hcp . further , the system may optionally provide reminders from the database that a glucose measurement is needed , food intake is required , exercise is required , etc . the system provides the ability of allowing designated individuals , whether they be caregivers , the patient , or a hcp , to review the patient &# 39 ; s recent records in a choice of graphical formats . this is done by accessing the database from the reviewers local computer . alternatively , the database can generate records in a designated format and either send them to the designated individuals by fax , mail , or electronic mail ( email ). additionally , the wireless diabetes disease state processing system provides a way of background checking the database against the meter to ensure that all recent glucose measurements have been uploaded . further , the system provides a mechanism to designate who has access to the information in the database . referring back to fig2 , another example embodiment a pda based glucose meter system is provided and described . in this described embodiment , the meter is fashioned as a module . for example , a “ springboard ” module sized and shaped to match the handspring brand pda is provided that is able to mate with a pda to form an analyte monitoring system . a module 2 mates with a pda 10 thereby permitting a user to interact with the meter using the input mechanisms native to the pda 10 . the modules is fashioned with a receptacle 6 that permits the insertion of a sensor 8 . software necessary for the display and analysis of the analyte level information is contained in the memory unit of the pda 10 . accordingly , the module 2 uploads analyte level information to the pda 10 , so that the software contained therein can operate upon the information , and present the information to the user in a meaningful and useful fashion . for example , the pda 10 may be programmed to display a chart of analyte levels upon which event markers indicating meals and exercise are indicated . other examples of the functionality provided by the software / firmware on the pda include , but are not limited to an electronic logbook , a data management tool providing graphic representation and / or textual summaries of data relevant to the monitoring and / or control of the analyte level being monitored , and a diabetes management tool for informing a user about all aspects of activities regarding managing diabetes . in some embodiments , the module 2 may also include an rf receiver and antenna to permit the module to receive a transmission containing information regarding the analyte level of a patient &# 39 ; s bodily fluid . this information may be automatically entered in the electronic logbook . in one system embodiment , such a transmission emanates from an analyte - sensing system affixed to a patient and configured with a transmitter . optionally , the analyte - sensing system may initiate such a transmission periodically , thereby providing the pda / meter unit with a series of analyte level information , which may be related temporally by either the processing circuitry of the module 2 or of the pda 10 . in still other embodiments , the module 2 contains circuitry permitting the module 2 to transmit information to a remote computer , or the like . alternatively , the pda 10 may uplink the information to a home computer , or the like . the normal user input / output mechanisms of the pda 10 may be utilized by the user / patient . by making use of these mechanisms ( such as a touch screen input mechanism ), the user / patient may indicate the occurrence of certain events likely to impact the level of the particular analyte being monitored . for example , the user / patient may indicate that the patient just had a meal or just engaged in exercise . to assist a user / patient in entering such event data , the pda may be programmed to provide drop - down menus that include common forms of insulin that the patient may have taken . a drop down menu may also include options to automatically note breakfast , lunch , dinner , snack , bedtime , or sleep in the electronic logbook . other drop down menus may permit the patient to note the presence of a cold / virus , high stress , fatigue , a large meal , alcohol , fever , or depression . the patient may also select self - customized meal lists or select a carbohydrate counter function . the pda may use its built - in alarm capabilities to alert the user / patient of certain activities that are to take place , such as taking of insulin , testing of blood sugar , eating of a meal , and exercise . the system of the invention may be useful to insurance companies , hmos , or insulin manufacturers who want to increase active management of the diabetic &# 39 ; s glucose , or may be used by adults who wish to combine diabetes management with other aspects of their lives . this system consists of a coulometer with glucose strip interface and optionally a digital rf link ( or other type of data link ) to a continuous glucose sensor . these components are integrated with the pda using either a module that plugs into the pda or a rs232 link tied to the pda &# 39 ; s hot sync interface . in order to manipulate the glucose strip to place it on the blood drop , the connector must be placed in such a way that the pda &# 39 ; s body does not interfere with placement . this can be accomplished by having the strip interface telescope outward , either by having the complete module extend , just a portion of it , or include the strip connector at the end of a flexible cable . power to run the coulometer may come from the pda itself . alternatively , a standard freestyle brand or other brand of blood glucose meter can interface directly to a pda using , e . g . an irda interface . the meter can connect to the pda using a docking station approach , connect via a three conductor rs232 cable , or use the irda interface . the diabetes disease management processing system provides real time feedback and data entry capabilities to the diabetic for self - control . the system provides for the ability to annotate glucose measurements with event information turning the pda into the diabetics log book . further , the system allows for the upload of glucose and event information to a database server through either the pda &# 39 ; s wireless interface or by hot syncing through a computer into the database . once in the database , the information is available to a hcp as in the example above . the system also permits optional reminders to be sent from the database of a meter that a glucose measurement is needed , food intake is required , exercise or insulin is required , etc . additionally , the system provides for the ability to graph the glucose data in one of several formats . further , the system also allows for the ability to combine event data with the glucose data in a graphical format to provide an overall view of the major influences on glucose levels . this makes it easier for the diabetic to see the results of daily activities on glucose levels . recommendations can be calculated based upon event , glucose , and ada or other health care provider guidelines and then presented to the diabetic . further , the system provides for the ability to update the program by downloading more recent versions of software via particular website access . in an additional embodiment for disseminating data representing a level of an analyte in a bodily fluid , the system comprises an analyte sensor configured and arranged to detect the level of the analyte in the bodily fluid . additionally , the system comprises a processing device configured and arranged to respond to the detection of the analyte by producing data representing the level of the analyte in the bodily fluid . the processing device is also configured and arranged to transmit the data to and / or across a network . finally , the system comprises a server , accessible via the network . the server is configured and arranged to receive the data representing the level of the analyte in the bodily fluid . further , the server is configured and arranged to create a presentation of the data and to translate the presentation into a semantic representation ( such as html ). an additional embodiment of the invention disclosed herein is a system for detecting a level of an analyte in a bodily fluid of a patient and transmitting data representing the level of the analyte to a remote processing device . the system comprises an analyte sensor configured and arranged to detect the level of the analyte in the bodily fluid . additionally , the system comprises an analyte monitor configured and arranged to receive the analyte sensor and to respond to the detection of the analyte by producing analyte data representing the level of the analyte in the bodily fluid . the analyte monitor is also configured and arranged to receive event data regarding the occurrence of an event affecting the level of the analyte in the patient . the analyte monitor is further configured and arranged to temporally relate the analyte data and the event data . optionally , the processing device is configured and arranged to modulate a radio frequency signal with the analyte data and the event data and to transmit the modulated signal through the atmosphere to a remote processing device . while exemplary drawings and specific embodiments of the present invention have been described and illustrated , it is to be understood that that the scope of the present invention is not to be limited to the particular embodiments discussed . thus , the embodiments shall be regarded as illustrative rather than restrictive , and it should be understood that variations may be made in those embodiments by workers skilled in the arts without departing from the scope of the present invention as set forth in the claims that follow , and equivalents thereof . in addition , in the method claims that follow , the steps have been ordered in selected typographical sequences . however , the sequences have been selected and so ordered for typographical convenience and are not intended to imply any particular order for performing the steps , except for those claims wherein a particular ordering of steps is expressly set forth or understood by one of ordinary skill in the art as being necessary .	6
the invention provides a plot of the amplitude response of a telephone line by measuring the energy present at 32 frequencies from 300 hz to 3400 hz spaced 100 hz apart . the data collected at the 32 points are stored in a 32 location memory buffer for display . a display function extracts the data from each of 32 memory locations at a rate sufficient to display a complete plot on an oscilloscope . a block diagram of the inventive system is shown in fig1 . analog receiver data signals are sampled by a / d converter 1 at a 9600 hz rate . the sampled data are passed to the inventive circuit and to a modem demodulator for normal processing . in the inventive circuit the sampled data are mixed by the quadrature amplitude demodulator 2 , 3 with oscillator 6 ( not shown in fig1 ), after it has been modified by sine and cosine lookup element 27 , to provide the selected one of 32 frequencies . oscillator 6 comprises a delay element 28 and a summer 29 . the in - phase and quadrature data are filtered by low pass filters 4 and 5 respectively to remove the double frequency components of the mixing operation . low pass filter 4 comprises multiplier element 30 for multiplying by a scaling constant and multiplier element 31 for multiplying by a filter constant , summers 32 and 33 and delay element 34 . low pass filter 5 comprises multiplier element 35 for multiplying by a scaling constant and multiplier element 36 for multiplying by a filter constant , summers 37 and 38 , and delay element 39 . the outputs of low pass filters 4 and 5 contain a dc output that is proportional to the instantaneous energy present at the frequency selected by oscillator 6 . the outputs of lpfs 4 and 5 are sampled at a 300 hz rate by sampler switches 40 and 41 ( in order to reduce processor load ) and squared by elements 7 , 8 . the outputs of squaring units 7 and 8 are summed and integrated by an ideal integrator 9 . integrator 9 has an input from summer 60 and consists of summer 61 and a delay element 44 . integrator 9 integrates the energy present at the selected frequency for 13 seconds in order to obtain an accurate measurement . at the end of the 13 second integration period switch 12 closes , the output of integrator 9 is converted to a logarithmic scale by converter 10 and the log value is stored in the appropriate frequency data memory locations in frequency data buffer 14 . after the data is stored in buffer 14 , integrator 9 is cleared , commutator 13 moves to the next frequency memory location in buffer 14 , the frequency selection is incremented 100 hz by integrator 18 which comprises delay element 42 , and summer 43 , and the integration begins at the new frequency . switch 11 is used to load a constant into integrator 18 . the constant is preselected so as to provide a 100 hertz increment to the oscillator 6 . this process repeats continuously updating all 32 memory locations . in order to display the spectral measurements , the data in 14 must be presented at a much faster rate than it was stored . thus , commutator 16 rotates through each of the 32 memory locations at a 2400 hz rate . the digital data contained in the frequency memory location is converted to analog by d / a converter 22 and applied to the y input of an external oscilloscope 24 . coincident with the movement of commutator 16 , switch 17 closes to increment the x display offset generator 19 which comprises summer 45 and delay element 46 . device 19 generates a ramp that is scaled by elements 20 , 21 , converted to analog by d / a converter 23 and applied to the x input of oscilloscope 24 . this x input spaces the 32 frequency data points to provide a display shown on oscilloscope 24 and fig2 and 3 . fig2 and 3 respectively show a sample output of the inventive circuit as compared to an output from halcyon 520b3 telephone line tester . an important consideration is that the results achieved by the modem spectrum analyzer of the present invention as shown in fig2 do not require the test tones which would be required for the measurements shown in fig3 . the analyzer output can be converted to decibels by a log table to give greater dynamic range . a full scale log table can be implemented by shifting and counting shifts until the desired mantissa accuracy is achieved for a look - up table . the log scale can be computed each time a new frequency is selected . with regard to the logarithmic conversion table shown below , the modem digital agc word is scaled for 3 db = hexadecimal 100 . numbers within the modem processor can be converted to the same scale by shifting and counting shifts to determine the characteristic , and then computing the mantissa by the look - up table . for each shift of v add hexadecimal 200 to the characteristic and for v 2 add hexadecimal 100 . when the shifted value is less than hexadecimal 010 then look up the mantissa in a 16 entry table . an entry table is accurate to 1 / 2 db . the output is 1 . compute v 2 . if v 2 is greater than or equal to 008 then db = 0 and exit . 2 . test if v 2 is less than 16 and skip to # 5 if true . 3 . shift v 2 right ( 1 / 2 ) and add 256 to db 6 . look up mantissa and add to db for final value . ______________________________________ re - man - v v . sup . 2 shift db sum level mainder tissa level______________________________________2048 1024 7 1792 21 db 15 232 2 . 73 db1448 512 6 1536 18 db 14 207 2 . 43 db1024 256 5 1280 15 db 13 179 2 . 11 db 724 128 4 1024 12 db 12 150 1 . 76 db 512 64 3 768 9 db 11 118 1 . 38 db 362 32 2 512 6 db 10 82 0 . 97 db 256 16 1 256 3 db 9 44 0 . 51 db 181 8 0 0 0 db 8 0 0 . 00 db______________________________________ fig5 shows a schematic of a portion of the circuit of fig1 with the addition of a double precision low pass filter and a prairie corporation automatic gain control loop . as with fig4 elements which are the same as those shown in fig1 have the same reference numerals . additional elements include low pass filter 47 , multiplier 48 , summer 49 , integrator 50 , summer 51 , transformer 52 , modem digital automatic gain control module 53 , and automatic gain control module 54 . the double precision filters are required for a band width on the order of 1 second in the loop . a small phase error is added to oscillator 50 to enable the &# 34 ; tracking &# 34 ; filters to detect tones that may not be exactly on the sweep frequency which is generated in 100 hz increments . the v 2 modules 40 and 50 require a double precision filter due to the wide dynamic range of v 2 . the modem automatic gain control agc module 53 is added to the log scaled output for absolute calibration ( 3 . 01 db / 256 10 ). advantages of the aforestated invention include the fact that it improves on the prior art in not interrupting data traffic and not requiring external equipment to perform an amplitude spectral analysis . integrating the diagnostic tools into the system itself not only provides more features for users but aids fields service personnel and users in problem solving without additional test equipment . although a preferred embodiment of the invention has been shown herein , it will be appreciated that many other embodiments can be contemplated within the scope of the appended claims .	6
the critical feature sanitary diaphragm valve is the pressure obtain when mating the stem bottom , the diaphragm , and the flow area . if the valve diaphragm warps and a valve stem no longer provides proper sealing force when the operator places the valve in the fully closed position , then the valve will leak until it is disassembled and the diaphragm manually adjusted . by expanding the valve stem travel range of operation and modifying the valve handle to “ slip ” when a pre - set torque is reached , a reproducible seal pressure is achieved resulting in superior cost effective manufacturing capabilities . pressure sensitive sanitary diaphragm valves contain five major components : a housing , a stem , a handle , a diaphragm , and a slipping mechanism . in one example of this invention the housing contains a flow housing area and a stem housing area . the flow housing area is a location on a pipe , tubing , or other structure utilized to facilitate the flow of solutions between two areas where there is a desired to prevent the flow of the solutions . the stem housing area is a hollow structure , such as a tube , with a first opening attached to the flow housing area and a second opening threaded for the stem . the stem has a top , a middle , and a bottom . the top of the stem is attached to a slipping mechanism . the slipping mechanism is attach to the handle . the middle of the stem is counter - threaded for the stem housing &# 39 ; s second opening . the bottom of the stem is shaped to mate with the shape of the flow housing area . the diaphragm is a flexible material that has a chemical contact side and a stem contact side . the diaphragm is located in the first opening of the stem housing between the stem and the flow housing area . the slipping mechanism is located between the handle and the stem . closing the valve is accomplished by rotation of the handle causing the threaded and counter - threaded stem housing &# 39 ; s stem attachment area and stem &# 39 ; s stem housing attachment area respectively to move the stem vertically down the stem housing area until the bottom of the stem moves through the first opening of the stem housing into the flow housing area . during rotation of the handle , the stem contacts the diaphragm pushing the diaphragm &# 39 ; s chemical contact side into the flow housing area ultimately forming a seal with the surrounding flow housing area as the bottom of the stem mates with the flow housing area obstructing the flow of solutions . as diaphragm compresses , the stem will begin to exert pressure on the handle requiring an increase the amount of torque necessary to continue rotating the handle . when a pre - set torque is exerted on the handle , the slipping mechanism will allow the handle to rotate but will not allow the threaded stem housing and counter - threaded stem to further engage preventing the stem from apply additional pressure on the diaphragm . opening the valve is accomplished by counter - rotation of the handle causing the threaded and counter - threaded stem housing &# 39 ; s stem attachment area and stem &# 39 ; s stem housing attachment area respectively to move the stem vertically up the stem housing area and the bottom of the stem out of the flow housing area back through the first opening of the stem housing into the hollow area of the stem housing . the slipping mechanism can be created in variety of ways well - know to those skilled in the art . for example , the embodiments of this invention include a slipping mechanism that contains a top and a bottom that engage each other . the top attached to the handle is affixed with a gear , such as a sprocket . the bottom attached to the stem contains a cylinder with flexible strips of metal placed to reside within the notches of the gear and affixed to the inner cylinder . when the torque is sufficient the strips of metal will bend allowing the gear to rotate ; thus , creating a “ slip ” in the handle . in another example of this invention the housing contains a flow housing area and a stem housing area . the flow housing area is a location on a pipe , tubing , or other structure utilized to facilitate the flow of solutions between two areas where there is a desired to prevent the flow of the solutions . the stem housing area is a hollow structure , such as a tube , with a first opening attached to the flow housing area , a second opening , and a handle attachment area threaded for attachment of the handle . the stem has a top , a middle , and a bottom . the top of the stem is attached to the handle . the stem is attached to the handle in a manner allowing the handle to rotate freely or pivot without rotation of the stem . the middle of the stem is enclosed in the stem housing area . the bottom of the stem is shaped to mate with the shape of the flow housing area . the handle contains a counter - threaded stem housing attachment area for attachment to the threaded stem housing &# 39 ; s handle attachment area . the diaphragm is a flexible material that has a chemical contact side and a stem contact side . the diaphragm is located in the first opening of the stem housing between the stem and the flow housing area . the slipping mechanism is located either between the stem housing and the stem housing &# 39 ; s threaded handle attachment area or between the handle and the handle &# 39 ; s counter - threaded stem housing attachment area . closing the valve is accomplished by rotation of the handle causing the threaded and counter - threaded stem housing &# 39 ; s handle attachment area and handle &# 39 ; s stem housing attachment area respectively to move the stem vertically down the stem housing area until the bottom of the stem moves through the first opening of the stem housing into the flow housing area causing obstruction of the flow of solutions through the flow housing area . during rotation of the handle , the stem contacts the diaphragm pushing the diaphragm &# 39 ; s chemical contact side into the flow housing area ultimately forming a seal with the surrounding flow housing area as the bottom of the stem mates with the flow housing area obstructing the flow of solutions . as diaphragm compresses , the stem will begin to exert pressure on the handle requiring an increase the amount of torque necessary to continue rotating the handle . when a pre - set torque is exerted on the handle , the slipping mechanism will allow the handle to rotate but will not allow the threaded stem housing and counter - threaded handle to further engage preventing the stem from apply additional pressure on the diaphragm . opening the valve is accomplished by counter - rotation of the handle causing the threaded and counter - threaded stem housing &# 39 ; s handle attachment area and handle &# 39 ; s stem housing attachment area respectively to move the stem vertically up the stem housing area and the bottom of the stem out of the flow housing area back through the first opening of the stem housing into the hollow area of the stem housing . in another embodiment of this invention the housing contains a flow housing area and a stem housing area . the stem housing area is a hollow structure , such as a tube , with a first opening attached to the flow housing area , a second opening , and a handle attachment area . the stem has a top , a middle , and a bottom . the middle and top of the stem are threaded as an area for attachment of the handle . the bottom of the stem is shaped to mate with the shape of the flow housing area . the middle and bottom of the stem is enclosed in the stem housing area , and the top of the stem protrudes out through the second stem housing opening . the handle contains a stem housing attachment area and a counter - threaded stem attachment area . the handle is attached to the stem housing in a manner allowing the handle to rotate freely or pivot without rotation of the stem housing . the diaphragm is a flexible material that has a chemical contact side and a stem contact side . the diaphragm is located in the first opening of the stem housing between the stem and the flow housing area . the slipping mechanism is located either between the stem and the stem &# 39 ; s threaded handle attachment area or between the handle and the handle &# 39 ; s counter - threaded stem attachment area . the closing and opening of the valve is accomplished as described in the previous embodiments . another embodiment of this invention is a pharmaceutical valve for use with biological and chemical transfer equipment having a housing with a flowing housing area having a shape for the transfer of a solution through the flow housing area , and a stem housing area having a first opening attached to the flow housing area and a second opening threaded for vertical motion within the stem housing area , the pharmaceutical valve comprising : a stem with a top , a middle counter - threaded for the stem housing &# 39 ; s second opening , and a bottom shaped to mate with the shape of the flow housing area ; a handle ; a diaphragm with a chemical contact side and a stem contact side located in the first opening of the stem housing between the stem and the flow housing area ; and a slipping mechanism located between the handle and the stem . another embodiment of this invention is a pharmaceutical valve for use with biological and chemical transfer equipment having a housing with a flowing housing area having a shape for the transfer of a solution through the flow housing area , and a stem housing area having a first opening attached to the flow housing area and a second opening threaded for vertical motion within the stem housing area , the pharmaceutical valve comprising : a stem with a top , a middle counter - threaded for the stem housing &# 39 ; s second opening , and a bottom shaped to mate with the shape of the flow housing area ; a handle counter - threaded for attachment to the stem housing attachment area and affixed to the stem allowing the handle to pivot without rotation of the stem ; a diaphragm with a chemical contact side and a stem contact side located in the first opening of the stem housing between the stem and the flow housing area ; and a slipping mechanism located either between the stem housing and the stem housing &# 39 ; s threaded handle attachment area or between the handle and the handle &# 39 ; s counter - threaded stem housing attachment area . another embodiment of this invention is a pharmaceutical valve for use with biological and chemical transfer equipment having a housing with a flowing housing area having a shape for the transfer of a solution through the flow housing area , and a stem housing area having a first opening attached to the flow housing area and a second opening having a handle attachment area for vertical motion within the stem housing area , the pharmaceutical valve comprising : a stem with a top and a middle both threaded as an area for attachment of the handle , and a bottom shaped to mate with the shape of the flow housing area ; a handle counter - threaded for attachment to the threaded stem &# 39 ; s handle attachment area and attached to the stem housing allowing the handle to pivot without rotation of the stem housing ; a diaphragm with a chemical contact side and a stem contact side located in the first opening of the stem housing between the stem and the flow housing area ; and a slipping mechanism located between the handle and the stem . another aspect of this invention are methods of preventing the flow of fluids in equipment making biological or chemical therapeutics using torque sensitive sanitary diaphragm valves according to the embodiments of this disclosure .	5
self - locking parcel delivery box 5 comprises : a vertical support plate 10 , a floating base plate 20 , a floating stanchion 30 , at least one spring 40 , a swing arm 50 , a striker plate 60 , a latch assembly 70 , and a container 80 . container 80 comprises : a container bottom 82 , at least one container side 84 , a hinged lid 86 , and a hinge 88 . container 80 is a secure hollow container in the shape of a rectangular cuboid , a cube , or a cylinder with an interior and an exterior . container 80 is impervious to water . in the cases of a rectangular cuboid shaped container 80 and a cube shaped container 80 , container 80 comprises four container sides 84 that are each rigid planar members that are impervious to water with a width , a height , an inner surface , an outer surface , an upper end , and a lower end . in the case of a cylindrical shaped container 80 , container 80 comprises one container side 84 that is a rigid cylindrical shaped member that is impervious to water with a circumference , a height , an inner surface , an outer surface , an upper end , and a lower end . container bottom 82 is a rigid planar member that is impervious to water with an upper surface and a lower surface . inner surfaces of container sides 84 face the interior of container 80 . exterior surfaces of container sides 84 face the exterior of container 80 . in the case of a rectangular cuboid shaped container 80 , container bottom 82 is rectangular shaped or square shaped . in the case of a cube shaped container 80 , container bottom 82 is square shaped . in the case of a cylindrical shaped container 80 , container bottom 82 is circular shaped . all outer edges of container bottom 82 are rigidly attached to container side ( s ) 84 to form a watertight connection or seam there between . watertight connection or seam must be sturdy , waterproof , weatherproof , and able to withstand attempts to pry the seam open in order to prevent someone from breaking into the container 80 . container bottom 82 and container side ( s ) 84 form an open - topped watertight receptacle . hinged lid 86 is a rigid planar member that is impervious to water with an outer edge , an upper surface , and a lower surface . in the case of a rectangular cuboid shaped container 80 , hinged lid 86 is rectangular shaped or square shaped . in the case of a cube shaped container 80 , hinged lid 86 is square shaped . in the case of a cylindrical shaped container 80 , hinged lid 86 is circular shaped . hinge 88 is a hinge or bearing member that pivotally attaches or connects hinged lid 88 to a container side 84 . hinge 88 is positioned vertically so that its axis of rotation is positioned horizontally . hinge 88 has an upper end and a lower end . the lower end of hinge 88 is rigidly attached to the upper end of a container side 84 . the upper end of hinge 88 is rigidly attached to the outer edge of hinged lid 86 . hinge 88 functions to allow the pivotal attachment of hinge 88 to a side 84 of container 80 to allow for the rotation of hinged lid 82 about hinge 88 . hinged lid 86 rotates upwards to open hinged lid 86 and rotates downwards to close hinged lid 86 . when hinged lid 86 is closed , it is positioned horizontally and forms a waterproof and weatherproof connection with the upper end ( s ) of all container side ( s ) 84 . when hinged lid 86 is closed and locked shut , it forms sturdy connection with the upper end ( s ) of all container side ( s ) 84 that is able to withstand attempts to pry hinged lid 86 open in order to prevent someone from breaking into container 80 when it is locked shut . in best mode , there are two hinges 88 . vertical support plate 10 is a rigid oblong planar member with an overall width , an overall height , a lower end , an upper end , an inner surface , and an outer surface . vertical support plate 10 is positioned vertically inside the interior of container 80 with its lower end rigidly affixed to the upper surface container bottom 82 with the longitudinal axis of vertical support plate 20 perpendicular to container bottom 80 . the inner surface of vertical support plate 10 faces the interior of container 80 . the outer surface of vertical support plate 10 faces the exterior of container 80 . vertical support plate 10 is positioned adjacent to a container side 84 so that there is about 0 . 125 to 2 . 0 inches of space between the outer surface of vertical support plate 10 and the inner surface of the adjacent container side 84 . floating stanchion 30 , at least one spring 40 , swing arm 50 , and rotating striker plate 6 are located and housed between the outer surface of vertical support plate 10 and the inner surface of the adjacent container side 84 as depicted . vertical support plate 10 is a sturdy vertical support member that solely supports floating base plate 20 , floating stanchion 30 , at least one spring 40 , swing arm 50 , rotating striker plate 60 , and the weight of a package or parcel 100 placed inside self - locking parcel delivery box 5 . floating base plate 20 , floating stanchion 30 , at least one spring 40 , swing arm 50 , rotating striker plate 60 , and package or parcel 100 move or float upwards and downwards relative to vertical support plate 10 , which is stationary and rigidly affixed to container bottom 82 . vertical support plate 10 also functions as a housing , firewall , or divider plate to separate floating stanchion 30 , at least one spring 40 , swing arm 50 , and rotating striker plate 6 , which are moving parts , from the interior of container 80 where a package or parcel 100 is placed , in order to all keep moving parts from physically contacting or touching package or parcel 100 . overall width of vertical support plate 10 must be less than the width or circumference of container side 84 and height of vertical support plate 10 must be less than that of container side 84 to allow vertical support plate 10 to fit inside container 80 . any know attachment means may be used to attach lower end of vertical support plate 10 to upper surface of container bottom 82 such as weld , glue , epoxy , bolts , screws , rivets , clips , or snaps . in best mode , vertical support plate 10 is rectangular . vertical support plate 10 further comprises a floating base plate window 12 . floating base plate window 12 is a rectangular shaped void or notch in the lower end of vertical support plate 10 as depicted . floating base plate window 12 has a width , a height , a left end , a right end and an upper end . floating base plate window 12 functions to provide clearance for floating base plate 20 to freely float or move vertically upwards and downwards . the width of floating base plate window 12 is slightly large than the width of floating base plate 20 . the height of floating base plate window 12 must be large enough to allow for sufficient vertical movement of floating base plate 20 to yield sufficient rotation of rotating striker plate 60 to allow successful locking and unlocking of latch assembly 70 . this mechanism is described in more detail below . vertical support plate 10 further comprises at least one spring attachment point 14 on its outer surface at its upper end . typically , there is one spring attachment point 14 for each spring 40 . spring attachment point 14 is a means to reversibly attach the upper end of a spring 40 thereto . spring attachment means could be any known means such as a hook , a ring , an eye , a hole , a connector , a fitting , fastener , screw , bolt , staple , nail , or any other known means . vertical support plate 10 further comprises a rotating striker plate pivotal attachment means 16 on its outer surface at its upper end . rotating striker plate pivotal attachment means 16 functions to pivotally attach rotating striker plate 60 to the outer surface of vertical support member 10 at a location just below rotating striker plate window 18 as depicted . rotating striker plate pivotal attachment means 16 is a means to pivotally attached rotating striker plate 60 to vertical support plate 10 , which could be accomplished by a hinge , a bearing , an axle , a hub , a spindle , a pin , a rivet , a screw , a bolt , or any other know means of pivotal attachment . vertical support plate 10 further comprises a striker plate window 18 . striker plate window 18 is a rectangular shaped or semi - rectangular shaped void or hole in the upper end of vertical support plate 10 that functions to receive a spring loaded latch 72 when hinged lid 86 is locked shut . striker plate window 18 must be sized slight larger than spring loaded latch 72 so that spring loaded latch 72 may penetrate through striker plate window in order to lock latch assembly 70 to striker plate window 18 . one end of rotating striker plate 60 , called the striker plate protrusion 66 , is inserted through striker plate window 18 as depicted . rotating striker plate 60 rotates back and forth within striker plate window 18 in order to either disallow hinged lid 86 from locking shut or to allow hinged lid to lock shut . as discussed below , rotating striker plate 60 rotates back and forth to block striker plate window 18 so that spring loaded latch 72 cannot penetrate into striker plate window 18 or to unblock striker plate window 18 to allow spring loaded latch 72 to penetrate striker plate window 18 and lock hinged lid 86 shut . floating base plate 20 is a rigid horizontal planar member with an upper surface and a lower surface . in the case of a rectangular cuboid shaped container 80 , floating base plate 20 is rectangular shaped or square shaped . in the case of a cube shaped container 80 , floating base plate 20 is square shaped . in the case of a cylindrical shaped container 80 , floating base plate 20 is circular shaped . the outer dimensions of floating base plate 20 are slightly smaller than the inner dimensions of container 80 so that floating base plate may freely slide upwards and downwards without its edges touching the inner surface of container side ( s ) 84 but also without leaving too much clearance to allow for a package or parcel 100 to fall there between . the upper surface of floating base plate 20 is rigidly attached to the lower end of floating stanchion 30 . floating base plate 20 further comprises at least one spring attachment point 22 on its upper surface . typically , there is one spring attachment point 22 for each spring 40 . spring attachment point 22 is a means to reversibly attached the lower end of spring 40 thereto . spring attachment means could be accomplished any known means such as a hook , a ring , an eye , a hole , a connector , a fitting , fastener , screw , bolt , staple , nail , or any other known means . floating stanchion 30 is a rigid oblong planar member with an overall width , an overall height , a lower end , an upper end , an inner surface , and an outer surface . floating stanchion 30 is a sturdy vertical support member . floating stanchion 30 is positioned vertically between the outer surface of vertical support plate 10 and the inner surface of the adjacent container side 84 as depicted . the lower end of floating stanchion 30 is rigidly affixed to the upper surface of floating base plate 20 with the longitudinal axis of floating stanchion 30 perpendicular to floating base plate 20 . floating stanchion 30 further comprises a slideable attachment means 32 . slideable attachment means 32 is a means to slideably attach floating stanchion 30 to the outer surface of vertical support plate 10 so that floating stanchion 30 may slide vertically upwards and downwards , but is prevented from movement in all other directions . slideable attachment means 32 may be accomplished by any know means such as : wheel and track , tongue and groove , guide , bearing , loop , collar , or any other known means . in best mode , slideable attachment means 32 is two horizontal collars or loops rigidly attached to the inner surface of vertical support member 10 , one at the upper end of floating stanchion 30 , one at the lower end of floating stanchion 30 , with floating stanchion 30 running vertically and inserted through each as depicted . with this mode the two collars or loops each have an inner dimension that is sized to make a slip fit with the outer dimension of the horizontal cross section of floating stanchion 30 so that floating stanchion 30 may freely slide upwards and downwards but is retained from moving in all other directions . at least one spring 40 is a vertical spring member with an upper end and a lower end . at least one spring 40 is a coil spring , flat spring , machined spring , compression spring , cantilever spring , leaf spring , v - spring , gas spring , torsion spring , hairspring , rubber band , elastic band , or any other type of spring . best mode at least one spring 40 is a coil spring . the upper end of at least one spring 40 is connected to spring attachment point 14 on vertical base plate 10 . the lower end of at least one spring 40 is connected to spring attachment point 22 on floating base plate 20 . at least one spring 40 must be of the proper length and tension to apply continuous upward tension on floating base plate 20 to pull the floating base plate 20 all the way upwards to contact and rest against upper end of floating base plate window 12 when there is no package or parcel 100 sitting on the upper surface of floating base plate 20 , but still allow the floating base plate 20 fall all the way downwards to rest on the upper surface of container bottom 82 when a package or parcel 100 sitting on the upper surface of floating base plate 20 . in best mode , there are two springs 40 , where one is positioned on each side of floating stanchion 30 to provide equal or balanced upward tension on each side of floating stanchion 30 . swing arm 50 is a rigid oblong member with an upper end and a lower end . swing arm 50 has a lower pivotal attachment means 52 at its lower end and an upper pivotal attachment means 54 at its upper end . lower pivotal attachment means 52 is a means to pivotally attach the lower end of swing arm 50 to the upper end of floating stanchion 30 . pivotal attachment is such that swing arm 50 may freely rotate around the point of pivotal attachment and remains connected to the upper end of floating stanchion 30 . pivotal attachment could be accomplished by a hinge , a bearing , an axle , a hub , a spindle , a pin , a rivet , a screw , a bolt , or any other know means of pivotal attachment . upper pivotal attachment means 54 is a means to pivotally attach the upper end of swing arm 50 to swing arm pivotal attachment point 63 on rotating striker plate 60 . pivotal attachment is such that swing arm 50 may freely rotate around the point of pivotal attachment and remains connected to the pivotal attachment point 63 on rotating striker plate 60 . pivotal attachment could be accomplished by a hinge , a bearing , an axle , a hub , a spindle , a pin , a rivet , a screw , a bolt , or any other know means of pivotal attachment . rotating striker plate 60 is a rigid tri - planar member wherein two parallel planar members are rigidly connected together by a third planar member perpendicular thereto . rotating striker plate 60 comprises a plane one , a plane two , and a plane three , each with a first and second end . planes one and two are parallel to each other and plane three is perpendicular to planes one and two . the first end of plane three rigidly attached to second end of plane one and the second end of plane three rigidly attached to first end of plane two to yield a rigid step - shaped structure with two steps . rotating striker plate 60 is positioned within rotating striker plate window 18 so that : plane one is adjacent to and parallel with the outer surface of vertical support plate 10 , plane two is adjacent to and parallel with the inner surface of vertical support plate 10 , and plane three is perpendicular to vertical support plate 10 and straddles rotating striker plate window 18 with its first end adjacent to the outer surface of vertical support plate 10 and its second end adjacent to the inner surface of vertical support plate 10 , as depicted . rotating striker plate 60 further comprises a swing arm pivotal attachment point 62 located on the first end of plane one . rotating striker plate 60 is pivotally attached to swing arm 50 by rotating striker plate pivotal attachment means 16 . as stated , pivotal attachment could be accomplished by a hinge , a bearing , an axle , a hub , a spindle , a pin , a rivet , a screw , a bolt , or any other known means of pivotal attachment . rotating striker plate 60 further comprises a swing arm pivotal attachment point 63 also located on plane one , at a location that is above vertical support plate pivotal attachment point 62 . as stated , rotating striker plate 60 is pivotally attached to the upper end of swing arm 50 by upper pivotal attachment means 52 . rotating striker plate 60 further comprises a striker plate protrusion 64 . striker plate protrusion 64 is plane two of striker plate 60 . striker plate protrusion 64 functions to either : block striker plate window 18 to prevent spring loaded latch 72 from penetrating through striker plate window 18 in order to keep hinged lid 86 from locking shut or unblock striker plate window 18 to allow spring loaded latch 72 to penetrate through striker plate window 18 in order to lock hinged lid 86 shut . as a result of its mechanical connection or linkage to floating base plate 20 , rotating striker plate 60 blocks striker plate window 10 when floating base plate 20 is in its upper most position and unblocks striker plate window 10 when floating base plate 20 is in its lower most position . latch assembly 70 comprises a housing , an internal lock mechanism ( not depicted ), a spring loaded latch 72 , a key 74 , and a keyhole 76 . internal lock mechanism is a lock mechanism that functions to retract spring loaded latch 72 in response to the turning of key 74 when positioned in keyhole 76 . internal lock mechanism is a standard lock mechanism that allows the user to retract spring loaded latch 72 with the rotation of key 74 when properly inserted into keyhole 76 . spring loaded latch 72 is a standard latch with bias pressure forcing the latch to extend outward , which can be overcome by pressing the spring loaded latch 72 inward with about 0 . 25 - 10 pounds of force . to use self - locking parcel delivery box 5 , self - locking parcel delivery box 5 is placed in empty unlocked condition at a location where packages or parcels are normally delivered . at the time of package or parcel 100 delivery , hinged lid 86 is lifted or opened , the package or parcel 100 is placed inside , where the weight of the package or parcel 100 pushes or forces floating base plate 20 downwards so that rotating striker plate 60 rotates downwards to unblock striker plate window 18 . hinged lid 86 is then closed and pushed shut so that spring loaded latch 72 penetrates through striker plate window 18 to effectuate the locking shut of hinged lid 86 on container 80 . at the time of package or parcel 100 retrieval from self - locking parcel delivery box 5 , key 74 is placed in keyhole 76 and rotated therein to cause spring loaded latch 72 to retract from penetrating through striker plate window 18 to allow for hinged lid 86 to unlock . hinged lid 86 is then lifted or opened and package or parcel 100 is lifted off of floating base plate 20 and retrieved from container 80 . the lifting of package or parcel 100 off of floating base plate 20 causes the floating base plate 20 to rise upwards to cause rotating striker plate 60 to rotate back upwards to block striker plate window 18 to allow for hinged lid to remain openable and unlocked until another package or parcel 100 is placed inside container 80 .	0
hereinafter , examples of the present invention , comparative examples , and evaluation examples are described . these examples , however , are not in any sense to be interpreted as limiting the scope of the invention . an electrode was manufactured according to a process schematically shown in fig1 . a thin film was formed by dispersing a gold nanosheet ( width : 10 μm , length : 15 μm , thickness : 5 nm ) in butanol to prepare a solution ( a concentration : 5 wt %)) and dropping the solution on the surface water and then , transferred into a pdms ( polydimethylsiloxane ) substrate . the process was 7 to 8 times repeated on the substrate to form a 2 cm - wide , 2 cm - long , and 1 μm - thick first conductive film . on the first conductive film , a sbs block copolymer solution ( a concentration : 10 wt %, viscosity : 10 poise ) was spin - coated . herein , the spin coating was performed under a condition ( a rotation speed : 2000 rpm , time : 60 seconds ). accordingly , a 2 cm - wide , 2 cm - long , and 40 μm - thick composite film was formed on the substrate . the composite film has a structure that a gold nanosheet was embedded in an elastic polymer matrix consisting of a sbs block copolymer , wherein the gold nanosheet / the elastic polymer matrix had a weight ratio of 10 / 100 and with a total thickness of 40 μm . a second conductive film was formed by transferring a gold nanosheet on the composite film according to the same method as above . however , the second conductive film was formed on both surfaces of the composite film by seven times transferring the second conductive material only on one surface of the composite film to form a gold nanosheet aggregate ( i . e ., a second conductive film ) and forming another second conductive film on the other surface of the composite film . then , the substrate was removed and then , bonded with the second conductive film , so that the other surface of the composite film might be exposed outside . on the exposed composite film , the second conductive material was seven times transferred to form each 1 μm - thick second conductive film on both surfaces of the composite film . in other words , a structure of the second conductive film / the composite film / the second conductive composite film was obtained . a negative active material was spin - coated on the second conductive film . specifically , as for the negative active material , l 4 ti 5 o 12 ( an average particle diameter : 200 nm ) was used to prepare electrode active material slurry , and the electrode active material slurry was used to form an electrode active material layer on the second conductive film . more specifically , the negative active material slurry was prepared by mixing the negative active material : carbon black ( an average particle diameter : 20 nm ): cmc ( carboxylmethyl cellulose ) in a weight ratio of 8 : 1 : 1 and adjusting its slurry phase with a solvent ( deionized water ). the negative active material slurry was spin - coated on the second conductive film at a rotation speed of 2000 rpm for 60 seconds and then , heat - treated and dried at 100 ° c . accordingly , the second conductive film having the negative active material layer ( a loading amount : 0 . 0018 g / cm 2 ) was obtained . in other words , a negative electrode having a structure of the conductive film / the composite film / the conductive film / the negative active material was obtained . a positive electrode was manufactured according to the same process as the above process of manufacturing the negative electrode except for using lifepo 4 ( an average particle diameter : 150 nm ) as a positive active material instead of the negative active material . accordingly , the positive electrode having a structure of the conductive film / the composite film / the conductive film / the positive active material was obtained . a rechargeable lithium battery coin half - cell was manufactured by using the negative electrode manufactured in ( 1 ) of example 1 and a li - metal as a counter electrode . on the other hand , a rechargeable lithium battery pouch half - cell was also manufactured by using the negative electrode manufactured in ( 5 ) of example 1 and a li - metal as a counter electrode . each battery used a gel electrolyte prepared by using sebaconitrile as a solvent and litfsi ( lithium bis - trifluoromethanesulphonimide ) as a lithium salt . when the lithium salt was used in a concentration ranging from 0 . 1 to 2 . 0 m , the electrolyte had appropriate conductivity and viscosity during an elongation process and showed excellent electrolyte performance . as for the rechargeable lithium battery pouch half - cell , pdms ( poly dimethlysiloxane ) was used as a packing material in a commonly known method . an sbs block copolymer solution was spin - coated on a substrate without forming the first conductive film unlike . accordingly , only a 2 cm - wide , 2 cm - long , and 40 μm - thick elastic polymer matrix was formed on the substrate . a rechargeable lithium battery coin half - cell was manufactured according to the same method as example 1 by using the electrode according to comparative example 1 . 1 ) fig2 is a sem photograph showing the first conductive film according to example 1 . referring to fig2 , 10 μm - wide , 15 μm - long , and 2 nm - thick gold nanosheets were three dimensionally aggregated to form a film . 2 ) fig3 is a sem photograph showing the composite film of example 1 , fig4 is a photograph enlarging the sem photograph of fig3 , and fig5 is a photograph showing the cross section of fig4 . referring to fig3 to 5 , a structure that the gold nanosheets were uniformly embedded inside the elastic polymer matrix with high density was found through spin coating . 3 ) fig6 is a sem photograph showing the conductive film coated with the negative active material layer according to example 1 . referring to fig6 , the negative active material layer had a total thickness of 5 μm by uniformly coating a negative active material having an average particle diameter of 100 nm and a conductive material having an average particle diameter of 10 nm . evaluation example 2 : electrical conductivity and tensile strength of electrode in elongation state electrical conductivity and tensile strength were measured by respectively elongating the negative electrodes according to example 1 and comparative example 1 . the results are shown in graphs of fig7 and 8 . referring to fig7 , the negative electrode of example 1 showed almost no resistance increase when twice elongated ( i . e ., an x axis is 100 %) relative to that of the negative electrode before the elongation ( i . e ., the x axis is 0 ). the electrode of comparative example 1 showed greater than or equal to 100 times increased resistance when twice elongated compared with that of the electrode before the elongation ( i . e ., an x axis is 0 ). referring to fig8 , the negative electrode of example 1 was finally broken when greater than or equal to 900 % elongated . an initial voltage profile of positive and negative electrodes about the rechargeable lithium battery cell of example 1 was evaluated , and the results are shown in fig9 ( negative electrode ) and fig1 ( positive electrode ). the voltage profile was evaluated at a 0 . 1 c rate within a voltage range of 1 v to 3 . 0 v as for the negative electrode but within a voltage range of 2 . 5 v to 4 v as for the positive electrode . in fig9 , since a descending curved line indicates discharge capacity , while an ascending curved line indicates charge capacity , electrochemical characteristics may be evaluated referring to fig9 . in fig9 , when the negative electrode of ( 1 ) of example 1 was used , initial discharge capacity was 170 mah / g , charge capacity was 165 mah / g , and initial coulomb efficiency was 97 %. in addition , in fig1 , when the positive electrode of ( 1 ) of example 1 was used , initial discharge capacity was 181 mah / g , and charge capacity was 172 mah / g . accordingly , each electrode of example 1 secured electrochemical safety at a potential where lithium ion battery cells were operated . cycle characteristics of the rechargeable lithium battery cells of example 1 were evaluated , and the results are shown in fig1 and 12 . in fig1 and 12 , a lower graph indicates charge capacity , and an upper graph indicates coulomb efficiency . the cycle characteristics were evaluated by performing charge / discharge at a 1 c rate within the same voltage range as evaluation example 3 . referring to fig1 , when the negative electrode of example 1 was used , the cell exhibited capacity of 155 mah / g after 50 cycles and maintained greater than or equal to 99 . 5 % of the capacity . in addition , referring to fig1 , when the positive electrode of ( 1 ) of example 1 was used , the cell exhibited capacity of 165 mah / g after 15 cycles . a capacity change of rechargeable lithium battery cells respectively using the negative active materials of example 1 and comparative example 1 depending on an elongation was evaluated , and the results are shown in fig1 and 14 . separately , a capacity change of the rechargeable lithium battery cell of comparative example 1 depending on an elongation was evaluated , and the results are shown in fig1 . referring to fig1 , the electrode showed stable cycle performance and greater than or equal to 99 . 5 % of coulomb efficiency when 15 % elongated . on the contrary , in fig1 , the electrode of comparative example 1 showed five times reduced capacity of 30 mah / g after 5 cycles relative to the initial capacity . while this invention has been described in connection with what is presently considered to be practical example embodiments , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .	7
shown in fig1 is an example of a switched wireless network 10 in which the principles of the invention can be incorporated . the wireless network 10 includes access points 12 (“ aps ”) and clients 14 ( also referred to as stations ). the aps 12 provide the clients 14 with wireless access to a network 16 to which the aps 12 are coupled . each ap 12 includes an ap controller 18 . each client 14 includes a client controller 20 . algorithms operate in the controllers 18 and 20 that serve to dedicate as much bandwidth as possible to each of the clients 14 in the wireless network 10 . the algorithms handle moves , adds and changes of both aps 12 and stations 14 . the algorithms also enable the aps 12 and stations 14 to adapt to changing traffic patterns . the algorithms also enable detection and elimination of unauthorized systems . the algorithms accomplish these goals without user interaction . described following is : i . mechanisms for initializing various wireless network configurations ; ii . mechanisms for supporting continuos operation ; iii . mechanisms for naming wireless aps 12 so that they can be distinguished from each other . i . the following is a description of an algorithm for automatically assigning cell frequencies , automatically adjusting transmit power , handling flash crowds , moving / adding clients or access points , and rogue detection / elimination . 1 . referring to fig2 , aps 12 are positioned and installed using two installation leds 22 and 24 . one led 22 is for determining the maximum distance between aps 12 to get full coverage . the other led 24 is for determining the minimum distance between aps 12 to get maximum bandwidth . referring to fig3 , installation proceeds as follows : a . upon power - up ( step 30 ) aps 12 are put in an installation mode ( e . g . via a switch ) ( step 32 ). they all transmit on the same frequency . they all listen on this frequency . they send a special installation message packet that can be differentiated from other transmissions from other sources ( step 34 ). when this packet is received ( step 36 ), the maximum distance led 22 flashes , flash rate proportional to signal strength ( step 38 ). the user moves away from an adjacent ap 12 until the flashing stops , and then moves towards it until the flashing just starts . that defines maximum distance . if there are multiple adjacencies , the user needs to activate installation mode on a pair at a time for each of the adjacent pairs . b . to insure the user doesn &# 39 ; t put the aps 12 too close together , the minimum distance led 24 is provided . this led 24 is default set to approximately 12 ′ spacing , but can be reset by the user by pressing a button , and moving any transmission source ( client or ap ) to the minimum distance ( steps 40 , 42 ). this distance is the minimum distance between a client 14 and the ap 12 . 12 ′ was chosen to represent a default ceiling height . c . the algorithm continues until the aps 12 stop moving relative to each other ( step 44 ). 2 . after aps 12 are installed , an algorithm runs that determines ap to ap adjacencies . each ap 12 knows what ap 12 cells it borders on when the algorithm completes . referring to fig4 : a . all aps 12 transmit a maximum power on the same frequency ( step 46 ). all aps 12 listen ( step 48 ), and make a list 49 of who they can hear ( step 50 , 52 ). b . all aps 12 gradually reduce their power output ( step 54 ). the lists 49 are ordered based on attrition , the bottom of the list for each ap 12 has the aps that disappeared first . the list consists of an ap 12 plus the signal level at which it disappeared ( step 56 ). c . the list 49 eventually gets to zero as power levels go to zero ( step 58 ). each ap 12 now has a completely ordered list 49 . aps at the top of the list are adjacent . those at the bottom are far apart . in fig5 there are shown example lists 49 for each ap 12 in the configuration shown . d . the lists 49 from all aps 12 are compared ( either centrally or distributed ). a network map is inferred ( step 60 ). 3 . ap 12 power levels are adjusted so that the entire space is covered by rf . all aps 12 stay on the same frequency , for now . ( step 62 ) a . power levels are set so that adjacent aps 12 cannot hear each other , just barely . turn down power just below the level of adjacent reception ( step 64 ). 4 . now clients 14 associate with particular aps . all the clients stay on the same frequency initially . referring to fig6 : a . clients 14 start transmitting at max power ( step 68 ). clients 14 gradually turn down transmit power until they can be heard by at least 1 ap 12 ( steps 70 , 72 ). b . set the power level ( step 74 ). c . aps 12 remember who was close but not picked as adjacent . this is a secondary adjacency and helps determine later which side of an ap 12 a client is on . 5 . now use the ap map inferred from the lists 49 to pick non - interfering cell frequencies and move the clients to these frequencies . the following describes the behavior of a new client 14 that shows up in a particular cell . referring to fig7 : 1 . the client 14 scans all available frequencies ( step 76 ) and picks the strongest , thus picking the closest ap 12 ( step 78 ). 2 . the client 14 notes the close , but not hottest frequencies , and identifies and keeps track of those aps 12 ( call this a secondary adjacency ) ( step 80 ). 3 . the client 14 picks the strongest frequency and turns down power until the ap 12 can just barely hear it ( step 82 ). a flash crown occurs , for example , when a group of people move to one side of the building . referring to fig8 : 1 . an ap 12 notices traffic above a certain threshold ( step 84 ). 2 . one or more adjacent aps 12 are relatively underloaded , as indicated by traffic falling below a minimum threshold ( step 86 ). 3 . one or more of the adjacent underloaded aps 12 turn up their power ( step 88 ). 4 . the overloaded ap 12 starts releasing clients 14 . it chooses the clients 14 with the appropriate secondary adjacencies as described above ( this means they are likely to be positioned between the old ap 12 and the new ap 12 ) ( step 90 ). 5 . they move to the frequency of the new ap 12 . 6 . the new ap 12 starts associating them ( step 92 ). a new ap 12 is placed in a cluster of existing aps 12 . it needs to pick a channel , power , and associate some clients 14 . referring to fig9 : 1 . the new ap 12 needs to ascertain its relative location . transmit round robin on all frequencies , one at a time ( step 96 , 102 , 104 ). the adjacent aps 12 hear this action . the new ap 12 is listening to the adjacent aps 12 , one frequency at a time as it does this ( step 98 ). 2 . turn down the new ap &# 39 ; s power , and adjacent aps &# 39 ; power to get just beyond the reach of each other ( like the initial install description ) ( step 100 ). 3 . pick a new minimally interfering channel ( step 106 ). after all frequencies have been tested , pick the least interfering channel ( step 108 ). 4 . adjacent aps 12 disassociate and the new ap 12 re - associates clients 14 . again the secondary adjacencies come into play , the new ap 12 associates clients 14 that are closer to the new ap 12 , on the appropriate side of the old ap 12 . a rogue ap 12 or a rogue client 14 arrives , and is identified by a legitimate ap 12 . referring to fig1 : 1 . move clients 14 onto adjacent aps 12 using an algorithm similar to that described in the above section . that is , once a rogue ap 12 or client 14 is detected by an ap 12 ( step 110 ), the ap 12 notifies adjacent aps 12 to turn up power ( step 112 ). the ap 12 then disassociates its clients 14 ( step 114 ). 2 . the ap 12 that detected the rogue now turns into the jammer , transmitting loudly to block the rogue ( step 116 ). when the rogue is no longer detected ( step 118 ) the ap 12 returns to normal operation ( step 120 ). ii . the following sets forth various scenarios that take place to support continuous operation : a . wired — routing control packets , commands are sent via a wired network , such as an ethernet network 122 , to adjacent aps 12 to listen on a specific channel for a roaming client . b . radio — radio frequency 124 , used only for power measurement and adjacency determination . radio communication between aps 12 is continuous but infrequent . all transmissions are on the same channel , for example channel 1 , and always at full power a . radio — when a station 14 is going out of range , it is sent to channel 1 until is strongly associated with another ap 12 . referring to fig1 , there is shown an example configuration management packet that can be exchanged between aps 12 : 1 . what channels are in use ( 126 ) 2 . how many stations 14 are on each channel ( 128 ) 3 . a flag is set for all topology changes and causes all aps 12 to rerun the “ continuous operation algorithm ” ( 130 ) 4 . when handoff of stations 14 happens , extant “ station context ” ( security , ip ) is passed to the new ap 12 ( 132 ). 1 . aps 12 go through their list of adjacent aps 12 starting from “ closest ” to “ furthest ” ( step 134 ). 2 . for each adjacent ap 12 , negotiate a non - overlapping channel for operation ( step 136 ). 3 . each ap 12 maintains a table including , amongst other things , stations 14 associated with the ap 12 and their power levels . for each adjacent ap 12 for which a different channel has been successfully negotiated , exchange station tables ( step 138 ). 4 . aps 12 claim any station 14 which is “ closer ,” as indicated by power levels in the station tables . round robin assignment is used for ties ( step 140 , 142 ). 5 . aps 12 adjust their power down on the selected channel to the lowest possible to reach the “ furthest ” station ( step 144 ). 1 . an ap 12 detects a power change in a station 14 ( historesis on the power change measurement can reduce false movement detection ) ( step 146 ). 2 . the ap 12 then sets “ topology change flag ” ( step 148 ). 3 . the ap 12 tells the moving station 14 to raise power to a maximum ( step 150 ). 4 . the ap 12 tells other aps 12 to listen on that channel ( step 152 ). 5 . optional : shift all moving stations 14 to channel 1 until the stations 14 stop moving , then re - associate with appropriate ap 12 . 1 . optimize channel assignment so that introducing a new ap perturbs the least number of current channel assignments . 2 . dampen station power measurements : a . not continuous ; b . samples at an interval ; c . “ n ” new power levels observed before the ap signals a topology change . a . signal to ip or other layers , applications ; b . each station has a “ context page ” that gets passed to whichever ap the station gets associated with ; c . signal to pre - authenticate via 802 . 1x at the next ap . to prevent 2 adjacent ( independent ) ap based networks from attempting to merge with each other a unique identifier ( ie , a “ name ”) associated with a given ap based network needs to be created . this operation is fundamentally a manual operation . this is because to the extent that there is wireless - to - wireless communications between aps , the aps need to know which ones are part of “ their network ” as opposed to an adjacent one . if there is no ap - to - ap wireless ( control ) communications then the aps do not need to be named . there are several alternative approaches to name aps . they are as follows : 1 . select an arbitrary ap 12 , usually during initial installation of the network . it will be the “ master ” ( step 154 ). 2 . push a “ teach ” button on the master ap 12 ( step 156 ). this causes it to transmit very low power rf . notice that a led 157 ( fig2 ) indicates it is in “ teach mode ”. this prevents it from being heard by aps 12 in adjacent networks . it may only transmit a few feet . 3 . select any other ap 12 . bring it close to the master ap 12 while it is in “ teach mode ” ( step 158 ). the master ap 12 tells the other ap 12 the name . the name the ethernet id from the master ap 12 . this will be a 48 bit number which is unique over all space . notice that an ap led 159 indicates that it is ( a ) first learning ( blinking led ) ( step 160 ), and then ( b ) completed learning the name ( step 162 ). at that point there are 2 aps 12 with the name . either can be used to teach other aps 12 the name in the same fashion . each time a new ap 12 learns the name , it can then be used to teach other aps 12 . 4 . repeat steps 2 and 3 until all aps 12 have learned the name . 5 . when a new ap 12 is to be added to a running network ( which already has a name ), select any random ap 12 in the operational network and place it into teach mode . bring the new ap 12 close to it as in step 3 . when learning is complete on the new ap 12 , place the teaching ap 12 back into operational mode . 6 . note that if the aps 12 have a separate control radio then this would be used for the learning operation . in that case , the aps 12 could continue normal operation while this is happening . however , if this is the case , they cannot remain in “ teach mode ” for a long time because this would prevent ap - to - ap wireless control communications . 7 . if an ap 12 is in “ teach mode ” and it has not taught the name to another ap 12 for t 1 seconds then it should automatically revert back to normal mode . 8 . if an ap 12 is in “ learn mode ” it should remain there for t 2 seconds and then automatically revert back to “ uninstalled mode ”. note that t 2 & gt ; t 1 . since ir has line - of - sight attributes , this eliminates the need to reduce the rf power of the control channel to prevent outsiders from hearing / learning the name . 1 . the algorithm is identical to the rf scheme above 2 . the learning ap 12 must be pointed carefully at the teaching ap 12 because it uses line - of - sight ir this approach involves a network management pc in the naming operation . each ap 12 is assumed to have visible on it a 48 bit ethernet id . they may also have a bar code on them which encodes this information . 1 . select an arbitrary ap 12 , usually during initial installation of the network . it will be the “ master ”. 2 . read the ethernet id from the ap 12 . type it into the management pc , or 3 . scan the bar code on the master ap 12 using a simple bar code scanner plugged into the management pc .	7
referring to fig1 a drive motor 1 with a reduction gear is built - in in a frame base 2 on which stands a frame 3 perpendicularly . a press section 5 is detachably attached , to the right side of the frame 3 as viewed in fig1 . a stock feeding device 6 for feeding a metal strip is provided detachably on the right side of the press section 5 . a central driving wheel gear 4 is mounted in the frame 3 so as to be able to rotate about a horizontal axis . as will be seen from fig4 a front working table 3a and a rear working table 3b are provided on the front and the rear sides of the central driving wheel gear 4 so as to present flat vertical surfaces . the central driving wheel gear 4 is driven by the drive motor 1 through a pulley 11 attached to the output shaft of the drive motor 1 , a pulley 12 which is drivingly connected to the pulley 11 through a belt , a drive shaft 13 , a sprocket 501 , a sprocket 503 drivingly connected to the sprocket 501 through a chain 502 , an intermediate shaft 570 , a bevel gear train 14 and an intermediate gear train 15 . the central driving wheel gear 4 is rotatably carried through rollers 303 by an annular ridge 302 fixed to a holder plate 301 which constitutes an outer peripheral portion of the rear working table 3b . a plurality of holes 304 for receiving pinions which are meshed with the central driving wheel gear 4 are formed through the frame 3 and the holder plate 301 on a circle which is concentric with the central driving wheel gear 4 . a front plate 306 is attached to the center of the front working table 3a and a front tool plate 307 is attached to the center of the front plate 306 . a rear plate 308 is attached to the center of the holder plate 301 . various forming tools necessary for the forming operations are attached to slide units which in turn are provided on the front working table 3a . the slide units have slide bases 401 which are secured radially in such a manner that the tool mounting portions of the slide units are directed radially inwardly towards the center such that they can effect forming operations on an object at the forming position which is on the center of the front working table 3a . as will be seen from fig3 each slide base 401 rotatably carries a drive shaft 402 perpendicularly thereto . a driving pinion 403 carried by the end of the drive shaft 402 meshes with the central driving wheel gear 4 . a cam 404 is keyed to the drive shaft 402 as will be seen from fig1 . cam followers 406 and 407 provided on a slide 405 contact with the cam 404 , so that the slide 405 carrying the tool is moved back and forth in the radial direction in accordance with the rotation of the central driving wheel gear 4 . in most cases , the slide units are arranged radially around the central forming position or , alternatively , arranged in parallel on the upper and lower sides of a path along which the stock strip is fed . a mandrel 410 having a configuration conforming with the shape of the article to be formed is replaceably secured to the front tool plate 307 at the central forming position so as to extend perpendicularly to the front tool plate 307 . the forming machine also is provided with a stripper device which is adapted for removing the formed article from the mandrel 410 . the stripper device has a stripper base 411 at which it is secured to the rear plate 308 and the holder plate 301 by means of bolts in such a manner as not to interfere with any slide units . as will be seen from fig3 the stripper base 411 rotatably carries a cam shaft 413 which is drivingly connected through level gears to the pinion shaft having a pinion 412 which meshes with a central driving wheel gear 4 and extending in parallel with a surface of the rear plate 308 . a stripper cam 414 , which is a groove cam in the illustrated embodiment , is attached to the cam shaft 413 . a cam follower 415 engaging with the stripper cam 414 is connected through a guide rod 417 slidably penetrating the front tool plate 307 to a stripper tool 416 which is adapted to slide along the mandrel 410 on the front tool plate 307 . referring back to fig1 the press section 5 attached to the right side of the frame 3 is adapted to be attached selectively in accordance with the configuration of the article to be produced . the press section 5 has an upper shaft 51 and a lower shaft 52 for actuating pressing means such as a ram . as will be seen from fig2 the lower shaft 52 is driven by the drive shaft 13 through the sprocket 501 , chain 502 , sprocket 503 , the intermediate shaft 570 driven by the sprocket 503 , an intermediate shaft 504a driven through a coupling 571 , a sprocket 506a fixed to the intermediate shaft 504a , a chain 507a and a sprocket attached to the lower shaft 52 . on the other hand , the upper shaft 51 is driven by the same drive shaft 13 through the sprocket 501 , the chain 502 , sprocket 503 , intermediate shaft 570 driven by the sprocket 503 , the intermediate shaft 504a driven through the coupling 571 , meshing intermediate gears 505a , 505b , another intermediate shaft 504b which rotate in the counter direction to the direction of rotation of the intermediate shaft 504a , sprocket 506b chain 507b and a sprocket fixed to the upper shaft 51 . t - shaped grooves 566 are formed in a base 555 of the press section 5 , so that the positions of the units attached to the base 555 such as a press unit , tapping unit , knock - out unit and a welder are adjustable in the left and right directions by virtue of the t - shaped grooves 566 . bearings for rotatably supporting the upper shaft 51 and the lower shaft 52 are provided on the upper and lower sides of the base 555 . in this embodiment , the upper shaft 51 or the lower shaft 52 driven by the driven shaft 13 causes a pressing cam 508a or a pulling cam 508b to be rotated , thereby activating punches 510a to 510f fixed to a ram 509 . in consequence , the punches 510a to 510f cooperate with a die 511 fixed to the underside of the press section 5 , thereby effecting press works such as punching , bending and so forth . similarly , knock - out punches 513a and 513b of the knock - out unit are activated by a cam 512 on the lower shaft 52 and the tapping unit 515 is driven by a cam 514 which is carried by the upper shaft 51 . the thus machined strip is then fed onto the mandrel 410 by means of a stock feeding device 6 , while being guided by a stock guide 27 which is fixed to the surface of the front working table 3a . the stock feeding device 6 has a stock feeding cam shaft 22 which is driven by the central driving wheel gear 4 through an intermediate gear 18 connected to the central driving wheel gear 4 , a sprocket 20 secured to a shaft 19 carrying the intermediate gear 18 , a chain 21 and a sprocket 23 . when the article to be formed does not necessitate any press work to be conducted by the press section 5 , the stock feeding device 6 is attached directly to the right side of the frame 3 . in such a case , it is necessary to replace the chain 21 with a shorter one . an eccentric pin 602 is attached to a gripper cam 601 fixed to the stock feeding cam shaft 22 adapted to be rotated in synchronism with the central driving wheel gear 4 . the amount of eccentricity of the eccentric pin 602 is adjustable . a rod 603 pivotally connected to the eccentric pin 602 is connected to a link lever 604 the lower end of which is connected to a feed block 607 . the feed block 607 is adapted to slide on a guide rod 605 . the stroke ends of the feed block 607 and , hence , the amount of feed is determined by stoppers 606a and 606b the positions of which are adjustable . the rod 603 has two springs in the end thereof adjacent to the link lever 604 . the arrangement is such that , when the feed block 607 is stopped by the stopper 606a or 606b each one of the springs is compressed so a to stop the movement of the link lever 604 . a cam follower 609 attached to one end of an l - shaped lever 251 engages with the gripper cam 601 , while the other end of the l - shaped lever 251 is pivotally connected to a parallel link 608 . the other end of the parallel link 608 is pivotally connected to the lower end of rocker lever 254 . the arrangement is such that , when the parallel link 608 suspended by the l - shaped lever 251 and the rocker lever 254 is made to rock , it moves slightly up and down while keeping horizontal posture . normally , the parallel link 608 is urged by a spring 257 towards the press section 5 , so as to keep the cam follower 609 in pressure contact with the gripper cam 601 . a gripper lever 611 is pivotally connected to the feed block 607 . the gripper lever 611 is provided on the distal end thereof with a roller 612 and on the base portion thereof with a gripper 610 . the gripper lever 611 is normally urged upward by a spring 260 , so that the roller 612 rolls on the lower surface of the parallel link 608 when the feed block 607 slides on the guide rod 605 . at the same time , a stock check cam 613 is secured to the stock feeding cam shaft 22 in a side - by - side fashion to the gripper cam 601 . a roller 616 provided on an end of a stock check cam lever 615 is adapted to engage with the stock check cam 613 . a fixing member 614 secured to the stock check cam lever 615 is adapted to be urged upward by means of a spring 263 . the stock feeding device 6 has the construction described hereinabove . in operation , as the feed block 607 moves forward , the parallel link 608 is lowered by the gripper cam 601 so that the gripper lever 611 also is lowered with the result that the gripper 610 is lowered to grip the stock so as to feed the same towards the press section 5 . when the feed block 607 is moved backward , the gripper cam 601 is in the phase in which it lifts up the parallel link 608 , so that the gripper 610 is moved upward while releasing the stock . the stock check cam 613 operates in synchronism with this operation , such as to activate the fixing member 614 thereby lowering the same while the gripper 610 is opened , thus stationarily holding the stock . the operation of the forming machine of the invention having the described construction will be explained hereinunder . it is assumed here that an article shown in fig5 provided with tapped hole and an aperture with a visor in its two sides is to be formed from a stock cut from a strip . in order to form the aperture with the visor and the tapped hole in predetermined regions along the length of the strip , the press section 5 is attached to the right side of the frame 3 , and the intermediate shaft 504a of the press section 5 is drivingly connected to the intermediate shaft 570 of the central driving wheel gear 4 through the coupling 571 . then , the positions of the stoppers 606a and 606b are adjusted so as to determine the amount of feed to be performed by the stock feeding device 6 . the mandrel 410 having a configuration conforming with the shape of the article to be produced is secured and the stripper tool 416 is mounted so as to be able to slide on the mandrel 410 . the slide unit carrying a forming tool no . 1 is vertically fixed at a position right above the mandrel 410 and the driving pinion 403 thereof is made to mesh with the central driving wheel gear 4 . a cutting tool t1 is secured to the end of the slide 405 of this slide unit . a u - bending tool t2 is secured to the slide 405 leaving a small gap between itself and the tool t1 , together with a pressing tool t3 which is vertically slidable in the u - bending tool t2 and normally urged downward by a spring . slide units which carry forming tool nos . 2 and 3 for inwardly bending the ends of the sheet stock which has been bent in an inverted u - shape are secured at positions which are spaced from the slide unit carrying the forming tool no . 1 by 140 ° both in the clockwise and counter - clockwise directions , such that the inner ends of these slide units are directed towards the center . l - bending tools t4 and t5 which are provided in their end surfaces with notches cut at 90 ° are attached to the ends of the slides of these slide units . another slide unit for a forming tool no . 4 which is intended for determining the final bend of the stock is secured vertically so as to direct its end towards the center . a final pressing tool t6 is attached to the slide 405 of this slide unit . the forming tools nos . 1 , 2 , 3 and 4 and the stripper device are activated by respective cams which operate in accordance with a sequence as shown in fig8 . more specifically , the forming tool no . 1 operates first followed by simultaneous operation of the forming tool nos . 2 and 3 . then , the forming tool no . 4 and the stripper device operate successively . the operation will be explained in more detail with reference to fig6 to 8 . for the purpose of simplification of explanation , it is assumed here that the operation begins from the state in which the angle of rotation of the driving pinion 403 is zero degree in fig8 . before the forming machine starts to operate , the strip extracted from the hoop is supplied to the stock feeding device 6 . then , as the drive motor 1 starts to operate , the drive shaft 13 is rotated so that the gripper cam 601 and the stock check cam 613 of the stock feeding device 6 , the upper shaft 51 , lower shaft 52 of the press section 5 , and the central driving wheel gear 4 start to rotate simultaneously . in the stock feeding device 6 , when the gripper cam 601 is in the phase for leaving the cam follower 609 from the parallel link 608 , the parallel link 608 is urged towards the press section 5 by the force of the spring 257 so as to rotate the gripper lever 611 counter - clockwise thus causing the gripper 610 to cooperate with the feed block 607 in gripping the stock therebetween . during this phase the stock check cam 613 releases the fixing member 614 . when the eccentric pin 602 is rotated in accordance with the rotation of the gripper cam 601 , the link lever 604 is made to rock by the action of the rod 603 . in consequence , the feed block 607 continues to move ahead towards the press section 5 . thus , the strip which has not been severed from the hoop yet is intermittently fed to the central forming position . the gripper cam 601 pushes , in the later half part of its rotation , the cam follower 609 which in turn upwardly pushes the parallel link 608 through the action of the l - shaped lever 251 , so that the gripper 610 of the gripper lever 611 releases the strip . meanwhile , the stock check cam 613 causes the stock check cam lever 615 to rotate , so that the fixing member 614 clamps the strip between itself and a base member 617 , thus fixing the strip against movement . then , the feed block 607 is returned by backward movement of the link lever 604 . a series of forming operations as shown in fig6 and 7 are conducted successively each time the strip as the stock is stopped . more specifically , in a first step of operation , the ram 509 is lowered by rotation of the upper shaft 51 of the press section 5 , while the rotation of the lower shaft 52 causes the knock - out punch 513a of the knock - out unit to rise , whereby a hole is formed in the stock by the punch 510a . then , the stock is fed so that the hole formed in the first step is brought to a position where a second step of operation is conducted in which the stock is perforated by a punch 510b and a pilot hole is formed by a punch 510c . then , the stock is further fed so that the machined portion of the stock is brought to a position where a third step of operation is conducted in which a bending is effected by a cooperation between a punch 510d and a knock - out punch 513a and a burring is conducted by a cooperation between a punch 510e and a knock - out punch 513b . the stock is further moved to bring the worked portion of the stock to a position for a fourth step of operation in which a flattening punching is effected by a punch 510f . then , the tapping unit 515 rotated by the upper shaft 51 is activated to effect a tapping on the hole the top brim of which has been flattened in the forth step of operation . the worked portion of the stock is then fed through the stock guide 27 to the central forming position where the mandrel 410 is placed . meanwhile , the driving pinions of the forming tool nos . 1 , 2 , 3 and 4 and the pinion 412 of the stripper are rotating in synchronism with the rotation of the central driving wheel gear 4 in a timed relation to the feeding operation of the stock , so that a series of forming operation is conducted by these forming tools . more specifically , the slide of the forming tool no . 1 is lowered as shown in fig9 a so that the pressing tool t3 presses the stock onto the mandrel 410 and then the cutting tool t1 operates to cut a piece of worked stock from the stock as shown in fig9 b . subsequently , the u - bending tool t2 bends the stock into u - shaped form as shown in fig9 c . while the stock is still held by the u - bending tool t2 , the forming tool nos . 2 and 3 are moved upward from the left and right lower positions so that the l - bending tools t4 and t5 act to bend both ends of the u - bent stock inward in forms like l in conformity with the shape of the mandrel 410 , thus imparting a cross - section of a shape as shown in fig9 d to the stock . while the stock is held by the forming tool nos . 1 , 2 and 3 , the forming tool no . 4 is raised as shown in fig9 e so as to press the bend ends of the stock onto the mandrel 410 by the final pressing tool t6 . subsequently , all the forming tools are retracted and the stripper cam 414 of the stripper device pushes the stripper tool 416 forward thereby separating the formed article from the mandrel . when the separation of the formed article is completed , the gripper cam 601 and the stock check cam 613 of the stock feeding device 6 operate to feed the stock so as to bring the worked portion of the stock to the central forming position . as has been described , in the module - type forming machine in accordance with the invention , a multiplicity of forming tools are radially mounted on the surface of a front working table 3a so as to be activated by a central driving wheel gear 4 , so that articles having a complicated configurations can be formed without substantial difficulty . in addition , a press section 5 is selectively installed between a frame 3 of the machine and a stock feeding device 6 so as to perform various press works such as hole punching , formation of pilot hole by punching , burring , surface flattening and knock - out work , as well as works such as cut - bending , tapping and welding which cannot be performed by the forming tools arranged radially on the front working table 3a . thus , the module - type forming machine of the present invention can cope with demands for the production of a variety of articles . in addition , the positions of various forming units with respect to the central forming position can be changed without difficulty , thus facilitating selection of the optimum working sequence and working positions .	1
referring now to the drawings , there is shown apparatus for conveying and storing cigarettes , the apparatus comprising a conveyor having a conveyor belt 4 extending around a belt pulley 1 which is downstream in the direction of conveying of the cigarettes , an upstream belt pulley 11 , and a lower belt pulley 7 serving as a tensioning pulley . the belt 4 and the belt pulleys 1 , 7 and 11 are of divided construction and are mounted on a carrier member 6 arranged between the divided portions of the belt and pulleys , the pulleys 1 and 11 being respectively mounted on two axles 2 and 12 . the carrier 6 is arranged to be pivotable about the axle 2 , which is journalled in the upper part of a machine frame comprising vertical members 3 and 47 , horizontal members 16 , base members 17 , feet 18 and tie rods 42 . the belt pulley 1 is driven by a motor 10 via a drive belt extending around a drive pulley on the axle 2 . the carrier member 6 is pivotable about the axle 2 of the belt pulley 1 by means of a motor 9 which drives a wheel 41 having pivotably and eccentrically connected thereto a sleeve 40 at one end of a forked arm 39 , the other end of the arm 39 being pivotably connected to the carrier member 6 . arranged in the machine frame are store side walls 13 on both sides of the belt 4 , and a back wall 14 in the form of a metal plate , which is bent into a circularly arcuate shape and along which the downstream end of the belt 4 moves when the carrier member 6 is pivoted . the carrier member 6 can be pivoted through angles of , for example , 15 °, 30 °, 45 ° and 60 °, or even more , to define with the side walls 13 and the back wall 14 a store having a volume which is increased as the angle of pivoting is increased . to ensure that a quantity of cigarettes does not remain in the store when the carrier member 6 is pivoted downwardly , the belt 4 is provided over its entire length with a plurality of substantially triangular section entraining members 5 , which are arranged at a spacing from one another and which are approximately the same size as a cigarette . accordingly , any cigarettes lying on the belt 4 in the lower part of the store are conveyed out of the store even when the conveyor is inclined . to avoid wedging of cigarettes between the belt 4 and the back wall 14 , the entraining members 5 on each divided portion of the belt 4 are themselves divided , and the back wall 14 is provided over its entire length and on its side facing the belt 4 with recesses 15 into which the entraining members 5 project , so as to avoid any gap between the entraining members 5 and the back wall 14 . the side walls 13 project beyond the belt 4 in such a manner as to form a channel above the belt 4 , and extend downwardly to such an extent that the belt 4 remains between the side walls in the lowermost setting of the conveyor . to avoid the presence of a gap , through which the cigarettes could fall , between the side walls 13 and the conveyor in the region of the axle 12 of the pulley 11 , the carrier member 6 is , as already explained , arranged centrally between the divided belt 4 and belt pulleys . arranged upstream of the belt 4 is a feed belt 37 guided around a pulley 51 , and arranged above the belts 4 and 37 is a level control belt 28 serving to ensure that the cigarettes are evenly distributed over the belts 4 and 37 . the belt 28 is relatively long compared to the belt 4 and is guided at each end around a roller 26 mounted on a shaft 43 attached to one of the machine frame members 47 and intermediate its ends around tensioning rollers 29 , 30 and 31 , the latter rollers being provided to reduce the degree of droop of the belt 28 , i . e . by about half . nevertheless , the belt 28 should still have some degree of droop . the space between the tensioning rollers 29 and 30 is closed by a cover member 55 , so as to prevent cigarettes from entering this space . the tensioning rollers are mounted on a rail 32 , which also serves to support the upper run of the belt 28 above the rollers . a control switch 34 with a contact maker 33 , which is operated when too many cigarettes 35 collect on the belt 4 , is arranged above the lower run of the belt 28 . the switch 34 can be connected to reduce the operating speed of the machine upstream of the belt 4 , for example a filter strand machine , or increase that of the machine downstream of the belt 4 , for example a packing machine . between the upstream end of the belt 4 and the wall 14 there is defined a space s , and to prevent cigarettes from remaining for an undue period of time in this space when the carrier member 6 is in a downwardly pivoted position , the entraining members 5 on the belt 4 project into the recesses 15 in the wall 14 . to provide a smooth transition when the carrier member 6 is pivoted up into an upper setting in which the upper run of the belt 4 is horizontal , i . e . the position shown in solid lines in fig1 a guide element 60 , which is also provided with recesses for the entraining members 5 , is arranged above the pulley 11 and between the pulley 11 and the pulley 51 for the feed belt 37 . the guide element 60 ensures that all the cigarettes are removed from the store and conveyed on to the packing machine , when the carrier member 6 is pivoted into its upper setting . from the belt 4 , the conveyed cigarettes are guided over an intermediate member 27 to a further conveyor belt 51 , which extends around rollers 49 and 50 and which conveys the cigarettes to a supply funnel 45 of the packing machine , the supply funnel having internal partition walls 44 to separate the cigarettes into streams . disposed above the funnel 45 and ahead of an end wall thereof is a level monitor in the form of a metal plate 22 , which is pivotable about an axle 23 and which comprises a shorter arm adapted to bear on an abutment 25 and a longer arm having a bent over end portion adapted to actuate contacts 21 of a switch 20 when the plate 22 is pivoted by a build up of cigarettes in the funnel area . the switch 20 is connected to influence the operating speed of either the filter strand machine or the packing machine , whereby overfilling of the funnel can be prevented . the belt 4 normally always runs at a speed corresponding to the operating speed of the packing machine , being driven by the motor 10 , if required , by way of suitable gearing . the motor 10 can be a geared motor . if insufficient cigarettes for the packing machine are conveyed by the belt 4 , the operating speed of the packing machine is appropriately reduced by means of a level control monitor 48a in the funnel 45 . if too many cigarettes are conveyed , the motor 9 is set into operation and the carrier member 6 with the belt 4 is pivoted downwardly into an intermediate setting 11 &# 39 ; or a lower setting 11 &# 34 ;. in the intermediate setting , the operating speed of the filter strand machine is reduced until equilibrium is present or the operating speed of the packing machine is increased . control in these circumstances can be effected by way of , for example , a displacement meter , which can be in the form of , for example , a potentiometer or slider resistance . the regulation can be carried out electronically . in the foregoing , the normal mode of operation exists when the cigarettes are conveyed by the belt 4 with the carrier member 6 in its upper setting . it is advantageous , however , to select the intermediate setting as the normal operating state , rather than the upper setting . in this case , cigarettes are always conveyed upwardly by the belt 4 , including those cigarettes in the lowermost part of the store , due to the action of the entraining members 5 on the belt . since the belt 4 is operating at the base of the store and the store is gradually filled with cigarettes fed by the belt 37 , movement of the cigarettes takes place from above and below . if the packing machine is stopped for a short period of time , the carrier member 6 is lowered into its lower setting 11 &# 34 ; to increase the volume of the store . conversely , if the filter strand machine is stopped , the carrier member 6 is moved upwardly into its upper setting and the store is emptied . if the spacing between the belt pulleys 1 and 12 is , for example , and 2 meters and the carrier member is pivotable downwardly through a maximum of 45 °, then a store side area of about 2 square meters is provided . as a cigarette has a diameter of approximately 8 millimeters , the store can thus accept roughly 30 , 000 cigarettes . since one cigarette pack contains 20 cigarettes and the packing machine may operate to deliver , for example , 300 packs per minute , this would provide a store filling time of 30 , 000 ÷ 20 × 300 = 5 minutes . proceeding from the intermediate setting of the carrier member 6 , the store would be able to exclusively deliver or exclusively receive for 21 / 2 minutes . it is possible to arrange two or more additional conveyors and stores in series downstream of the belt 4 to increase the total available storage capacity , and to operate the additional conveyors and stores either in like manner or else one for reception of cigarettes and on for delivery of cigarettes . a quantity of 30 , 000 cigarettes weighs about 30 kilograms , which can easily be managed by the carrier member in a conveyor having the dimensions mentioned above . irrespective of which setting the carrier member 6 is in , the level of cigarettes present should always be above a horizontal plane containing the upper run of the belt 51 , the cigarettes in the funnel 45 being maintained above this plane by the level monitor 48a . if the level of cigarettes present falls below this plane , the carrier member 6 is pivoted upwardly into its uppermost setting , and if in this setting the level of cigarettes again falls below this plane , the packing machine is stopped until the filter strand machine delivers a sufficient volume of cigarettes . the level control monitor 48a can be in the form of , for example , a photoelectric cell or a pneumatic element . as is shown in fig4 and 5 , the carrier member 6 can be provided with a central extension 54 , as well as with two lateral extensions 53 on each side of and adjacent to the divided belt 4 , the extension 54 extending into a corresponding recess in the wall 14 and the extensions 53 laterally partially encompassing the wall 14 . by this means , cigarettes are prevented from entering the space s , so as to avoid any damage to the cigarettes in the store when the carrier member 6 is pivoted upwardly . the guide element 60 is also provided with a recess to receive the extension 54 .	0
the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventor of carrying out his invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principles of the present invention have been defined herein specifically to provide readily manufacturable and implemented commercial embodiments . fig1 is a schematic diagram illustrating an illustrative installation of a low cost night vision enhancement system in a public safety vehicle ( shown in phantom ). the system 1000 includes a night vision camera 1 mounted in a pointing mechanism 500 on top of a public safety vehicle 1010 ( shown in phantom ). the night vision camera 1 and the pointing mechanism 500 are secured to the top of the vehicle 1010 by suitable mounting hardware 1012 ( not shown ). as further shown in fig1 the night vision camera 1 is connected to a display unit which , in the illustrative embodiment , may implemented as a &# 34 ; datavision &# 34 ; head - up display ( hud ) available from hughes aircraft company . the datavision hud includes a projector 587 , a combiner 1030 , display electronics 1040 located in the trunk , and data harness and power harness cables 1038 , 1039 . the combiner 1030 is mounted on the windshield 1032 ( shown in phantom ) of the vehicle 1010 for displaying a real image from the projector 587 . the cables 1038 , 1039 are shielded and are stowed in suitable mounting brackets . the video display is not limited to a datavision hud . alternatively , an active matrix liquid crystal display ( lcd ) mounted on the dashboard of the vehicle can be used to display the real image from the camera . active matrix lcds are available from citizen , sharp , and toshiba , to name a few . instead of displaying a real image , the video display can display a virtual image . the virtual image can be displayed by &# 34 ; virtual image glasses &# 34 ; available from virtual vision in redmond , wash . the virtual image glasses project a tv - like , wide screen image in front of the bumper of the vehicle . an officer wears the glasses to view the scene ahead . data is transmitted either through hard - wired connections or wireless ( e . g ., spread spectrum ) transmission from the camera to the glasses . instead of the glasses , a helmet - mounted visor can be used to project the tv - like , wide screen image in front the bumper of the vehicle . alternatively , a virtual image can be displayed directly on the vehicle windshield by the virtual display disclosed and claimed in u . s . patent application ser . no . 07 / 971 , 799 , entitled virtual image instrument panel display and assigned to the assignee of the present invention . this system , which includes mirrors and an active matrix lcd as a source , can be installed at the vehicle manufacturer , or it can be installed as an aftermarket add - on . the system 1000 is controlled by a remote control unit 566 mounted inside the vehicle 1010 . in the preferred embodiment , the remote control unit 566 is implemented with a joystick 568 and a plurality of switches 572 . the camera 1 , remote control 566 and the projection unit are inter - connected by the data harness cable 1038 and a power harness cable 1039 to display electronics 1040 located in the trunk of the vehicle 1010 . further details of the vision enhancement system 2 may be had by reference to the aforementioned u . s . patent applications , herein incorporated by reference . fig2 schematically illustrates an optical system 13 employing an infrared sensor 11 , such as camera 1 used in the night vision enhancement system of fig1 . the optical system 13 focuses equally - spaced points 15 along a roadway 17 onto a focal plane array 19 . as disclosed in the aforementioned patent applications , the focal plane array 19 may be an array of uncooled detectors from which an image is ultimately supplied via suitable cables 21 to a display 23 . the optical system 13 of fig2 is a wide - angle optical system , i . e ., one that includes both near and far field points out in front of the vehicle 1010 . in such a system , equally - spaced points in object space are nonlinearly distributed on the focal plane array 19 . this nonlinear distribution of chief optical rays creates a misjudgment of distance in the driver &# 39 ; s mind . analyzing the system of fig2 one sees that , as the sensor field of view narrows in the horizontal dimension , the display aspect ratio must decrease to present the same amount of vertical information to the driver ( i . e ., a constant vertical field angle ). thus , in a series of photographs of the same vehicle with varying lens angles , judging how far away the vehicle is becomes progressively more difficult as the lens angle becomes wider and wider . there is so much extraneous information in the scene that the observer loses the ability to relate the displayed image to the real world . in addition , although the size of the vehicle becomes progressively smaller as the lens angle widens , the driver sees basically the same relative &# 34 ; distance &# 34 ; in each view . the foregoing assumes the size of a vehicle is relatively known to any driver . the foregoing analysis demonstrates the inherent relationship between sensor and display fields of view . this relationship is quantified empirically in the following table , where &# 34 ; hfov &# 34 ; indicates horizontal field of view : table i______________________________________sensorhfov optimum display aspect ratio ( degrees ) ( horizontal to vertical ) ______________________________________58 5 : 233 4 : 227 5 : 316 4 : 3______________________________________ all aspect ratios given in table i are for an 8 . 5 - inch horizontal width display viewed at approximately 30 inches with the camera / sensor mounted on the roof of a vehicle , as shown in fig1 . once the display aspect ratio is optimized for depth perception , the system designer can be assured that the absolute minimum amount of displayed information has been presented to the driver . such optimization reduces to displaying only as much information as the driver normally sees through the windshield with the naked eye . it is also considered desirable by the inventor to minimize the number of eye fixations required to view the display 23 . it is known in the art of designing and integrating avionics displays into aircraft that the number of eye fixations required to assimilate information from a display is directly proportional to angular area . a good rule of thumb is that one eye fixation is composed of up to three fine eye movements or saccades , and that each saccade provides useful information over a five - degree angular ( circular ) area . thus , minimizing the number of eye fixations is desirable for safety and efficiency in a display for aircraft , automobiles , trucks , recreational vehicles , or any other form of moving apparatus . the preferred embodiment minimizes the number of eye fixations by minimizing the amount of displayed information the viewer must deal with . also , the importance of the overall system magnification between an object in the real world and an object as viewed on the display should be noted . the system magnification may be computed as follows : ## equ1 ## where θ o = angular subtense of feature in object space θ d = angular subtense of feature as viewed on display at the driver &# 39 ; s eye position ## equ2 ## where a = linear dimension of displayed feature , inches given the above relationships , it is noted that a system magnification which is less than 1 creates a problem in judging depth in the display 23 . if the system magnification were always held to the value &# 34 ; 1 ,&# 34 ; the field of view of the sensor 11 would not matter . this , however , requires a very large display 23 for wide field angles in the sensor 11 . since a large display is impractical to package in many vehicles , the relationships described herein become very useful when a wide field angle is desired for the horizontal field of view of the sensor 11 . in a particularly preferred embodiment constructed according to the invention , the field of view of the sensor 11 is 27 degrees horizontal and 9 degrees vertical . with a mean distance 22 from the display 23 to the driver &# 39 ; s eye 24 of 30 inches and an image magnification of 0 . 5 : 1 , the display aspect ratio is selected at 3 : 1 , resulting in a display 23 which is 7 . 2 inches in width ( horizontal ) and 2 . 4 inches high ( vertical ), as shown in fig3 . the display 23 is placed directly in front of the driver , in place of the normal automobile instrument panel cluster , although this is by no means the only possible location for the display 23 . the above teachings are thought to apply to all forms of displays possible in a vehicle . flat panels , crts , projected or direct view , may be implemented in this fashion , regardless of display location in the vehicle . any empirically - derived relationship between aspect ratio and sensor or camera field of view ( if the camera is visible ) will change to some degree as the sensor or camera perspective with respect to the driving &# 34 ; scene &# 34 ; in front of the vehicle changes . a general formula has not been derived to date , though one could readily be derived geometrically with applied trigonometry . the important consideration in the selection of display aspect ratio ( in this case 3 : 1 ) is to avoid overwhelming the driver with extraneous information in the vertical field . therefore , the wider the horizontal field of view of the sensor is , the narrower the display vertical dimension becomes . a 9 - degree vertical field of view is optimal in the preferred embodiment , as determined through empirical testing . in preferred installation , a particular objective was to reduce the amount of time the driver &# 39 ; s eyes were off the view through the windshield and on the displayed image . those skilled in the art will appreciate that various adaptations and modifications of the just - described preferred embodiment can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein .	6
the tube package generally designated 1 in the drawings is composed of a tube body 2 manufactured , for example , from plastic or metal , e . g . aluminum or an aluminum alloy , of a nozzle - shaped applicator 3 manufactured , for example , as a molded part from plastic and of a closure cap 4 , likewise manufactured from plastic . the tube body 2 is designed as one piece with a tube sleeve 5 enclosing the tube interior , with a tube shoulder 6 adjoining the tube sleeve 5 and with a tube nipple 7 provided on the tube shoulder 6 . the tube interior , which is limited in particular by the tube sleeve 5 and the tube shoulder 6 and also by the tube nipple 7 and which contains the respective product , is sealed in a suitable manner , for example , by folding and / or welding or in some other manner , on the side of the tube body 2 facing away from the tube nipple 7 after filling of the tube body 2 . the tube nipple 7 which forms the dispensing opening 8 and is essentially cylindrical on its outer surface is provided , starting from the tube shoulder 6 , on the outer side with a protruding ring - shaped collar 9 concentrically enclosing the axis of the tube nipple 7 , or the tube axis , and adjoining thereon with an outer thread 10 . furthermore , the dispensing opening or tube opening 8 is sealed on the free end of the tube nipple 7 with a thin puncturable wall section or with a thin wall section 11 which can be perforated . this wall section is constituted , for example , by a thin metal and / or plastic foil , which is fastened on the free end of the tube nipple 7 by welding or another suitable manner or is manufactured as one piece with the tube body 2 . the applicator 3 consists essentially of a cap - shaped or screw cap - shaped section 3 . 1 and a thereon adjoining section 3 . 2 which respectively have an essentially cylindrical design and adjoin each other axially congruent . in section 3 . 1 the applicator 3 is provided with an essentially cylindrical peripheral wall or cap wall 12 , which in a limited interior space 13 limited by the wall 12 encloses a sleeve - shaped projection 15 jutting out over a cap bottom 14 at a distance . on the inner surface of the cap wall 12 , starting from the inside of the cap bottom 14 an inner thread 16 is provided which is designed for engagement with the outer thread 10 and at a distance from said inner thread 16 on the free end of the cap - shaped section 3 . 1 or in the area of the opening there , a projection 17 is provided , extending into the interior 13 and enclosing in a ring - like manner the axis of the applicator 3 and , with the tube package 1 in assembled state , also the axis of the tube nipple 7 . in the projection 15 an open channel 18 is formed on the free end of said projection at 18 . 1 , the channel also continues in the applicator section 3 . 2 , namely all the way to the end of the applicator 3 located at a distance from the applicator section 3 . 1 and forms an applicator opening 18 . 2 there . on its outer surface the projection 15 is cylindrical or slightly tapered toward the opening 18 . 1 , but in any case with a diameter that corresponds to the diameter of the dispensing opening 8 , so that with the projection 15 inserted into the dispensing or tube opening there a sealed transition exists between the tube interior and the channel 18 . furthermore , when the tube package 1 is in its original state , i . e . in the state in which the tube package 1 , filled with the product , is delivered , stored and / or handed over to the respective buyer , the applicator 3 is placed with its applicator section 3 . 1 on the tube nipple 7 so that the projection 17 engages behind the collar 9 , thus captively holding the applicator 3 on the tube nipple . furthermore , the inner thread 13 in this original or as - delivered state of the tube package 1 is located in the direction of the axis of the tube nipple 7 laterally from the outer thread 10 , so that turns of the inner thread 13 and of the outer thread 10 can mutually support each other without engaging with each other , so that the applicator 3 is therefore secured on the tube nipple 7 against axial movement in the direction of the tube body 2 . the end of the projection 15 constituting the opening 18 . 1 in this first position corresponding to the original or as - delivered state is at a distance from the wall 11 . for use of the tube contents the inner thread 12 is increasingly screwed onto the outer thread 10 by turning the applicator 3 on the applicator axis , so that the applicator 3 is moved axially in relation to the tube nipple 7 , perforating or puncturing the wall 11 with the projection 15 . with the projection 15 tightly inserted into the dispensing or tube opening 8 in a second position corresponding to the use state and with the closure cap 4 removed , the product can then be dispensed from the interior of the tube body 2 by pressing or squeezing said tube body at the application opening 18 . 2 . on the outer surface the applicator section 3 . 1 is provided with fluting 19 , forming a gripping surface to facilitate handling . the applicator 3 is further provided on the outer surface of the applicator section 3 . 2 directly at the transition to the applicator section 3 . 1 or directly on the outer surface 14 . 1 of the cap bottom 14 with several projections 20 , which are distributed evenly around the axis of the applicator . the projections 20 are designed respectively to be saw tooth - shaped with a front surface 20 . 1 , which is located in a plane radial to the axis of the applicator 3 , and with a rear oblique surface 20 . 2 , which is respectively located in a plane which encloses an acute angle with the axis of the applicator . following the projections 20 the applicator section 3 . 2 is designed on its outer surface with a projection or collar 21 enclosing the applicator axis in a ring - like manner . the closure cap 4 is composed of a sleeve - shaped cap body 22 with a cylindrical sleeve opening 23 , which is closed on an end by a cap bottom 24 and is open on the other end . on the inner side of the cap bottom 24 a projection 25 functioning as a seal is formed on which , with the closure cap 4 placed on the applicator 3 , engages into the applicator opening 16 . 2 , closing or sealing the latter . in the area of the open end of the cap body 22 the sleeve opening 23 is provided with several projections 26 , which , complementary to the projections 20 , are saw tooth - shaped with front surfaces 26 . 1 located radially to the axis of the closure cap 4 and with rear surfaces 26 . 2 extending obliquely , so that with the closure cap 4 placed on the adapter 3 , the mutually adjacent projections 20 and 26 with their front surfaces 10 . 1 and 26 . 1 respectively form a pivotal connection between the closure cap 4 and the adapter 3 , the pivotal connection enables the described opening or changing of the tube package 1 from its original state into a use state , also by manual turning of the closure cap . the rear oblique surfaces 20 . 2 and 26 . 2 serve as assembly aids in the automated assembly of the tube package 1 , for example to turn the closure cap 4 slightly on its axis when it is pushed onto the applicator section 3 . 2 , in case the projections 20 and 26 inadvertently come into axial contact with each other , and by this turning of the closure cap 4 to achieve the required arrangement of the projections 26 between the projections 20 . at the aperture of the sleeve opening 23 the closure cap 4 is further provided with a ring - shaped , inwardly projecting projection 27 , which in engagement with the collar 21 produces a locking connection for the closure cap 4 on the applicator section 3 . 2 . instead of the saw tooth - shaped projections 20 and 26 , other elements and / or contours can be provided to produce a pivotal connection between the closure cap 4 and the applicator 3 , namely in particular also in a form which enables trouble - free automated assembly of the tube package 1 . the assembly of the tube package takes place or is performed for example in the form that in a preliminary assembly step or in a preliminary assembly line , the adapters 3 are respectively pre - assembled by pushing on or snapping on their closure cap 4 and then assembled by being pushed or snapped onto the tube bodies 2 or the tube nipples 7 there , so that the respective projection 15 is at a distance from the wall 11 provided on the tube nipple 7 . in this state the tube package provided with the necessary design on its outer side can be filled by the user with the product and then closed . the tube package 1 is suitable for medical and / or cosmetic products , in particular also for single - dose applications . the invention was described above based on an exemplary embodiment . it goes without saying that modifications and variations are possible without abandoning the underlying inventive idea upon which the invention is based . 12 peripheral wall or cap wall of the screw cap - shaped applicator section 3 . 1	1
referring now to the figures and to fig1 in particular , there is shown a schematic diagram of an edge - based bandwidth broker ( bb ) solution for qos control in a battlefield network . in fig1 the wireless links of the encrypted wide area network 100 represent the scarce network resource . however , because of the cryptographic boundary formed by the inline network encryptor ( ine ) pair 102 , 104 situated at the ingress and egress points of the wireless network , respectively , the source - destination pair is unable to directly measure the available bandwidth for the end - to - end path . in operation , packets are transmitted from a first protected network 106 ( red subnet “ a ”), through an ingress bandwidth broker 108 comprising a policing - shaping - marking ( psm ) function 110 where an ingress timestamp is written into an 8 byte option field of ip header and an admission control algorithm 112 . admission control algorithms are known to those skilled in the art . admitted packets pass through a router 114 ( alternatively , depending on implementation , the router 114 may be absent ) and inline network encryptor 102 to tunnel ingress point 116 and then through encrypted network 100 . the packets exit the network via tunnel egress point 120 and travel through inline encryptor 104 and a router 122 into egress bandwidth broker 124 . the egress bandwidth broker 124 comprises traffic sensor 126 and bandwidth estimation algorithm 128 . the packets exiting the egress bandwidth broker 124 enter protected network 130 ( red subnet “ b ”). the available bandwidth , effective bandwidth and path utilization computed by bandwidth estimation algorithm 128 is provided to the admission control algorithm 112 of the ingress bandwidth broker 108 . the path 132 represents logically the feedback loop formed by sending control packet from the egress bandwidth broker 124 to ingress bandwidth broker 108 . the feedback signal along path 132 is via a black network tunnel through the encrypted network 100 . the strict segregation of control information on either side of the inline network encryptor ( 102 and 104 ), drives an edge - based solution for admission control and bandwidth estimation as shown in fig1 . the quality of service ( qos ) decisions are based on admission control , policing - shaping - marking ( psm ), traffic sensing and bandwidth estimation functions that are pushed to the edge of the network on the classified side of the inline network encryptor boundary . all of this functionality is collectively referred to as an edge - based bandwidth broker ( bb ). fig1 also shows how the functionality of the bandwidth broker is applied differently at the ingress and egress sides of a communication session . at the ingress side , the bandwidth broker is responsible for admission control ( i . e ., admission , denial and preemption of flows ) and psm . at the egress side , the bandwidth broker is responsible measuring traffic ( e . g ., packet count , packet length , packet delay ) at the traffic sensor and for computing an estimate of available bandwidth based on the traffic measurements . the ingress - egress bandwidth broker pair form a feedback loop by having the egress bandwidth broker periodically send a control packet to the ingress bandwidth broker with an estimate of the available bandwidth for the end - to - end path . the estimate can then be used by a bandwidth broker - based admission control function at the ingress bandwidth broker that accepts , denies and preempts sessions based on the available bandwidth estimate computed at the egress bandwidth broker . fig1 shows the insertion of an 8 byte time stamp field at the ingress bandwidth broker . fig2 is similar to the arrangement shown in fig1 . the difference is that fig2 shows an edge - based bandwidth broker ( bb ) solution for qos control in a commercial ( non - encrypted ) network . in operation , packets are transmitted from a first local area network 206 ( subnet “ a ”) through an ingress bandwidth broker 208 comprising a policing - shaping - marking ( psm ) 210 where an ingress timestamp is written into an 8 byte option field of ip header and an admission control algorithm 212 . admission control algorithms are known to those skilled in the art . admitted packets pass through a tunnel ingress point 216 and then through a multi - hop network 200 . the packets exit the network via a tunnel egress point 220 and travel into egress bandwidth broker 224 . the egress bandwidth broker 224 comprises a traffic sensor 226 and a bandwidth estimation algorithm 228 . the packets exiting the egress bandwidth broker 224 enter local area network 230 ( subnet “ b ”). the available bandwidth and effective bandwidth path utilization computed by bandwidth estimation algorithm 228 is provided along path 232 to admission control algorithm 212 . the feedback signal along path 232 is fed via a reverse network path . in order to generate an available bandwidth estimate , the end - to - end packet delay , packet length and ingress timestamp information is extracted from received packets at the egress bandwidth broker . this data is then applied to compute an estimate of available bandwidth without the need to inject probe packets . the approach , known as resource friendly bandwidth estimation ( rfbe ), comprises the following two core techniques : fast packet heuristics and packet dispersion analysis . received packet data provides a measurement of the end - to - end delay ( t ) for each packet ( time when packet is received at the egress bandwidth broker − ingress timestamp ). the measured value t comprises three disjoint components : d ≡ total end - to - end “ deterministic ” delay ( e . g ., propagation delay , clock offset processing delay ) if the constituent elements of t can be isolated , then it is possible to obtain insight into the end - to - end path characteristics . for example , knowledge of w can indicate whether the received packet spent time waiting in router queues en route to the destination . this provides the egress bandwidth broker with insight into the path utilization . to resolve t into d , w and x , rfbe applies a technique based on received fast packets . this technique is motivated by the observation that over the course of a communication session , there will be a fraction of packets that traverse the end - to - end network path without experiencing any queuing delay . that is , they arrive at intermediary routers when the router queues are empty . such packets that experience no queuing delay are identified as fast packets and w fast = 0 : equation ( 2 ) consists of one known ( t fast ) and two unknowns ( d and x ). thus , there are two unknowns but only one equation . this is resolved by analyzing fast packets of different lengths . from equation ( 2 ) it is evident that fast packet end - to - end delay comprises two components , d and x . the transmission delay component x is a function of the hop - by - hop link capacity and the packet length ( l ). on the other hand , the deterministic delay component d is invariant in l . this suggests that among all packets of some length , for example , l = 12000 bits ( i . e ., 1500 byte packet ), a received 12000 - bit packet whose end - to - end delay is minimum among all 12000 bits packet should be declared a 12000 - bit fast packet . similarly , a 320 - bit packet ( i . e ., 40 bytes ) whose end - to - end delay is minimum among all received 40 - byte packets is declared a 320 - bit fast packet . it is not practical to identify fast packets for every possible packet length . instead , rfbe exploits the fact that the distribution of packet lengths tends to be dominated by a small number of modes ( e . g ., 40 bytes — 40 %, 44 bytes — 5 %, 552 bytes — 5 %, 576 bytes — 6 % and 1500 bytes — 10 %). that is , the received packets at the egress bandwidth broker are sorted by length . from an array of sorted packets , the packet length modes ( e . g ., 40 bytes , 576 bytes and 1500 bytes ) may be easily discovered and each received packet is assigned to a single bin associated with one of the packet length modes . fast packets are then identified based on the packet with the minimum value of t for each of the bins . one consequence of equation ( 1 ) is that the clock offset contribution to d can produce very large values of t ( e . g ., on the order of hours or days ) and even negative values for t ( e . g ., ingress clock is set to 3 : 00pm while egress clock is only 1 : 00pm ). further , large propagation delay contributions to d can ( e . g ., satellite links ) result in d dominating the end - to - end delay measurement and obscure the effects of queuing delay and transmission delay . thus , one of the important benefits of the rfbe fast packet heuristic is to eliminate the impact of clock offset and propagation delay by isolating the effect of d . recalling equation ( 2 ) and observing the fact that d is invariant in packet length , it is possible to use fast packets to form a second equation that will allow d and x of equation ( 2 ) to be resolved . as an illustration of this , a scenario where received packets are assigned to one of two bins is considered ( i . e ., a bin for small packets and a bin for large packets ). the fast packets for small and large bins have the 2 - tuples ( t fast , small , l fast , small ) and ( t fast , large , l fast , large ), respectively , where defining β as the end - to - end transmission delay per bit , the following demonstrates how to resolve transmission delay with only two fast packet measurements assuming that the fast packets have non - zero packet length differential ( i . e ., l fast , large & gt ; l fast , small ): in general , if the packet length distribution is multi - modal , any pair of fast packet 2 - tuples is sufficient for the application of equations ( 4a ) and ( 4b ). having computed an estimate of β , it is straightforward to resolve the deterministic delay component by combining equation ( 4b ) with any one of the fast packet 2 - tuples ( t fast , l fast ): combining equation ( 5 ) with equation ( 1 ) allows the effects of clock offset , propagation delay , etc . to be subtracted from the end - to - end delay , thereby , permitting subsequent processing on the queuing and transmission delay components of t . last , it is noted that the reciprocal of β provides a lower bound ( b min ) on the effective bandwidth of a path : for the cases where the end - to - end path comprises a single hop or where the end - to - end transmission delay is dominated by a single narrow link , the lower bound provided by equation ( 6 ) actually represents a close approximation for effective bandwidth , i . e ., eb ≅ 1 / β . the occurrence of a fast packet represents an instance where a packet “ sees ” no cross traffic in its end - to - end path . this implies that the fraction of packets that are fast packets ( p fast ) is correlated with the fraction of time that the path is not utilized . hence , an estimate for the path utilization ( ρ ) may be computed as the complement of p fast : the computation of p fast requires a means for determining whether a received packet with 2 - tuple ( t , l ) is a fast packet . using the identification above , “ baseline ” fast packets are selected from the set of bins to which received packets are assigned . however , for each packet received , a determination of whether it also is a fast packet must be made . for each received packet with 2 - tuple ( t , l ), the rfbe adds one to the fast packet count if the following inequality is satisfied : e . g ., ε = 0 . 1 . p fast is then computed by dividing the number of packets satisfying equation ( 8 ) for the current reporting interval by the total number of packets received for the reporting interval . the application of packet dispersion techniques for estimation of narrow link capacity is considered . rfbe extends the earlier work in this area to provide reliable estimates of effective bandwidth by exploiting naturally occurring packet pairs in the traffic stream ( i . e ., “ passive probing ”). the effective bandwidth estimate is then combined with the utilization estimate computed by equation ( 7 ) to produce an estimate of available bandwidth . the essential idea of packet dispersion for narrow link capacity estimation is that ( equal size ) probe packets ( i . e ., packet pairs ) are injected “ back - to - back ” into the network . assuming that neither of the back - to - back packets experienced cross traffic , the difference in the end - to - end delay measurements ( δ = t 1 − t 2 , where t 1 is the end - to - end delay of the lead packet and t 2 is the end - to - end delay of the second packet of the pair ) is inversely proportional to the capacity of the narrow link ( c ). an estimate of c may be straightforwardly computed from t 1 , t 2 and the received packet lengths ( l ): again , instances of packet pairs that experience no cross traffic yield estimates of c that correspond to the true narrow link capacity . however , when one or both of the packets experience cross traffic , then equation ( 9 ) will yield an erroneous estimate of c . thus , packet pair dispersion yields varying estimates of c depending on the effect of the cross traffic . in practice , a large number of packet pairs produce a narrow link capacity distribution of various modes . these modes fall into one of three categories : 2 ) sub - capacity dispersion range ( scdr ): range of modes corresponding to estimates below the cm . 3 ) post - narrow capacity modes ( pncms ): modes corresponding to estimates that exceed the cm . a substantial fraction ( approximately 15 - 20 %) of tcp traffic is injected into the network back - to - back . this suggests that naturally occurring packet pairs in the received traffic stream may be used to estimate narrow link capacity via equation ( 9 ). rfbe compares the ingress timestamps of each pair of consecutively received packets . if the difference in the ingress timestamps is smaller than a predetermined threshold ( δ ) and the lengths of the two packets are equal , then these two packets represent a back - to - back packet pair . however , packet pairs may experience cross traffic which lead to erroneous estimates of effective bandwidth . to alleviate these effects , the following test has been devised for each packet pair : apply the end - to - end delay ( t ) and length ( l ) of the lead packet of the packet pair to the inequality of equation ( 8 ). if the inequality is satisfied , then the packet pair is accepted as a valid packet pair for estimation of narrow link capacity via equation ( 9 ). if the inequality is not satisfied , the packet pair is not used for estimating effective bandwidth . the benefit of applying this rule is that it ensures the packet pair does not yield a post - narrow link capacity mode ( pncm ). that is , the bandwidth estimate will not over - estimate the effective bandwidth . this improves the reliability of the narrow link capacity estimate . provided the received packet stream is sufficiently rich in naturally occurring packet pairs , rfbe obviates the need for active packet probing . applying the rfbe fast packet - based packet pair test , packet pairs with dispersion ( δ ) that is at least l / c may be identified . as packet pairs with packet length and dispersion 2 - tuple ( l m , δ m ) which pass the test above are identified , they are added to the set m of valid packet pairs . the packet pair in this set yielding the maximum narrow link capacity estimate will be selected as the rfbe estimate for effective bandwidth : should no valid packet pair be observed , the estimate of effective bandwidth falls back to the lower bound provided by equation ( 6 ). in order to obtain an estimate of available bandwidth ( ab ), equation ( 10 ) is combined with the estimate of utilization ( ρ ) given by equation ( 7 ). fig3 is a flow diagram of a bandwidth estimation algorithm useful for practicing the present invention . the algorithm relies on the equations described and shown above . the algorithm starts at step 300 . first , from the received packets deterministic delays are identified 302 . next , fast packets are identified 304 , i . e . packets that do not undergo queuing delays . after the fast packets are identified , an estimate of the utilization is calculated 306 . also , after the fast packets are identified , back - to - back fast packets are identified 308 . packet dispersion is applied to the back - to - back fast packets identified in step 308 in order to compute the narrow link bandwidth 310 . using the estimated utilization computed in step 306 and the effective bandwidth computed in step 310 , the available bandwidth is computed 312 . the algorithm then ends 314 . the computed narrow link bandwidth and available bandwidth values from the bandwidth estimation algorithm are used by the ingress bandwidth broker to control the packets injected into the either the encrypted network or the multi - hop commercial network as the case may be . in summary , novel methods for efficient estimation of the available bandwidth for an end - to - end path have been described and illustrated . in the process of estimating available bandwidth , the methods obtain estimates of narrow link capacity and utilization of the path as well isolating the contributions of deterministic , transmission and queuing delays to total end - to - end delay . the methods also provide robustness to the effects of clock offset . the methods described and illustrated are applicable to both a wireless battlefield network context and also to wired or wireless commercial networks . the methods here have been demonstrated to be effective by simulation for network paths comprising work - conserving serial links ( i . e ., packets may be queued for transmission if the transmission media is not currently transmitting another packet ). this represents an important class of transmission scheme and encompasses many types of wireless and wired links . for non - work - conserving links , the methods herein may not be as effective . while there has been described and illustrated a method and systems for estimating narrow link bandwidth and available bandwidth using existing user traffic , it will be apparent to those skilled in the art that modifications and variations are possible without deviating from the teachings and broad principles of the present invention which shall be limited solely by the scope of the claims appended hereto .	7
fig1 a through 4 , discussed below , and the various embodiments used to describe the principles of the present disclosure in this patent document are by way of illustration only and should not be construed in any way to limit the scope of the disclosure . those skilled in the art will understand that the principles of the present disclosure may be implemented in any suitably arranged system . fig1 a , 1 b and 1 c are exploded perspective views of a pushbutton illuminated switch ( or components thereof ) with electronic latching and / or blinking according to one embodiment of the present disclosure . the pushbutton switch 100 includes a switch cap 101 and a switch body 102 . the switch cap 101 is located at the front of the switch 100 and is received by the switch body 102 . the switch cap 101 includes a switch cap housing 103 receiving an array 104 of light sources such as light emitting diodes ( leds ) or incandescent lamps . the 2 × 4 led array 104 in the exemplary embodiment has two rows of four surface mount diode ( smd ) leds arranged to illuminate four quadrants of a face plate ( not shown ) on the front of switch cap body 103 , with two leds ( a 1 × 2 subarray ) per quadrant . the leds are mounted over a switch cap back plate 105 and are connected to an electrical driving circuit ( not visible in fig1 b ) mounted on the switch cap back plate 105 . a member 106 for mechanical latching and release of the pushbutton switch when the switch cap 101 is depressed within the switch body 102 protrudes from the rear of switch cap back plate 105 . electrical connections ( not shown ) to the display driving circuit are also exposed on the rear surface of switch cap back plate 105 . the structure depicted and described is consistent with the design of the switch bodies for the 4 pole , models 95 , led ( r 2 ) and lr3 pushbutton illuminated switches sold by aerospace optics , inc . of fort worth , tex . each of the circuits and applications may be housed within such switches in the manner described in further detail below . in some embodiments , switch body 102 includes a housing 107 receiving a mechanical and electrical subsystem 108 for mechanical latching and release of the pushbutton switch 100 , for transmitting electrical signals to the driving circuit , and for transmitting mechanical forces to actuate four - pin snap - action switching devices 109 a through 109 d . pins for the switching devices 109 a through 109 d are received by mounting block 110 and provide electrical switching by connections of the pins to external signal sources and / or through the subsystem 108 to the driving circuit . the pins of devices 109 a through 109 d extend through the mounting block 110 and may be connected at the rear of pushbutton switch 100 to external signals , to each other , and / or through subsystem 108 to the driving circuit . those skilled in the art will recognize that the complete structure and operation of a pushbutton switch of the type normally used in avionics is not depicted or described herein . instead , for simplicity and clarity , only so much of the structure and operation of a pushbutton switch as is necessary for an understanding of the present disclosure is depicted and described . for example , filters between the leds and the switch cap face plate allow legends on the switch cap face plate to be illuminated in different colors as disclosed in u . s . pat . no . 6 , 653 , 798 , which is incorporated herein by reference . numerous other features are also not depicted or described herein are or may be included within pushbutton switch 100 . fig1 d and 1e are perspective views illustrating incorporation of an electronic latching and / or blinking module into the pushbutton illuminated switch of fig1 a - 1c . as shown in fig1 d , an electronic latching and / or blinking module 111 is inserted in place of switching devices 109 b and 109 c , with pins received by mounting block 110 . fig1 e depicts a mounting frame 112 on which integrated electronic circuitry may be mounted , within one of the recesses 113 . the electronic module 111 is coupled to a plurality of interface pins 114 ( eight in the exemplary embodiment ) each extending from the electronic circuitry through a portion of the mounting frame 112 to an endpoint and configured to pass through additional frames or housings ( not shown ) and engage additional electronic circuitry ( not shown ), in the same manner as pins for switching devices 109 b and 109 c . this approach provides the added functionality of the electronic module 111 with no increase in length , weight or mounting depth while retaining two uncommitted snap - action switching devices 109 a and 109 d that can be used to interact with the electronic module 111 or control other system functions . fig1 f through 1j are perspective views illustrating several alternatives for incorporating configurable electronic latching with multiple latched states into the pushbutton illuminated switch of fig1 a - 1c . in the examples shown , the center two snap - action switches 109 b and 109 c depicted in fig1 c have been replaced with an electronic module 111 . in addition , each of these embodiments employs an alternative mounting block 110 a having a recessed central region surrounded around portions of the peripheral by sidewalls , configured to receive portions of devices 109 a through 109 d and / or electronic module 111 , as well as portions of a configurable electronic latching module 115 a or 115 b when such module replaces one or both of devices 109 a or 109 d as depicted and described below . however , the pins of switching devices 109 a or 109 d , electronic module 111 , and / or configurable electronic latching modules 115 a or 115 b still extend through the mounting block 110 a as previously described . as shown in fig1 f , an electronic latching module 115 a is inserted in place of one of the snap - action switching devices 109 d , with pins received by mounting block 110 a ( an alternate design to mounting block 110 depicted in fig1 c and 1d ). fig1 g illustrates substitution of an electronic latching module 115 b for switching device 109 a , while fig1 h illustrates substitution of electronic latching modules 115 a and 115 b for both switching devices 109 d and 109 a , respectively . the recessed central region of mounting block 110 a allows for a more compact structure , taking less space within the pushbutton switch 100 , and a mechanically more stable structure . fig1 i and 1j depict just the configurable electronic latching module 115 a or 115 b , respectively , and the alternative mounting block 110 a to better illustrate the outer configuration of configurable electronic latching modules 115 a and 115 b . the body of each configurable electronic latching module 115 a and 115 b has , at the end from which the pins project , a smaller thickness than a remainder of the body , forming a peripheral lip . the width of the body at that region matches a width of the recessed region of mounting block 110 a , such that the portion below the lip is received by the recessed central region . an opposite ( inner ) face of each configurable electronic latching module 115 a and 115 b has grooves . these grooves are complementary to and fit within grooves provided on the adjacent face of electronic latching and / or blinking module 111 in the embodiments of fig1 f through 1j . the grooves may have a dovetail shape , such that the surfaces are fit together by sliding . regardless , the presence of the complementary grooves improves mechanical strength of the assembly supported by the mounting block 110 a , such that mounting block 110 a does not need to provide as much mechanical rigidity to the assembly . fig2 is a circuit diagram for an electronic latching and / or blinking circuit according to one embodiment of the present disclosure . electronic latching and / or blinking circuit 200 is contained within the electronic module 111 within switch 100 . table i below contains the input and output signal descriptions for circuit 200 , while table ii describes the logic input and output functions : note 1 : / blink output is held steady on ( ground ) while / reset is held low . / blink output goes off ( open ) when / reset returns to the inactive high level . this feature provides essentially three states to the / blink output : off , on and blink . note 2 : / toggle input causes / blink output to alternate between 1 hertz ( hz ) blink state and off ( open ). note 3 : this is an illegal state that will have unpredictable effect upon the outputs when the inputs are returned to their normal inactive high state . the logic input circuitry 201 has a total of eight ( 8 ) interface pads each connected to an external pin of electronic module 111 . three interface pads are inputs : / set , / reset and / toggle . three interface pads are outputs : / n_open ( normally open ), / n_closed ( normally closed ) and / blink . two additional interface pads are devoted to power : + 28 vdc ( volts , direct current ) and ground . each input pad is connected by two parallel resistors : resistors r 1 and r 2 for input / set ; resistors r 3 and r 4 for input / toggle ; and resistors r 5 and r 6 for input / reset . one resistor of each parallel pair ( r 1 , r 3 and r 5 ) is connected at the other terminal to the + 28 vdc input power . the other resistor of each pair ( r 2 , r 4 and r 6 ) is connected to one terminal of a capacitor ( c 1 , c 2 and c 3 , respectively ) and to the cathode of a zener diode ( d 1 , d 2 and d 3 , respectively ). the other capacitor terminals and the anodes of the zener diodes are connected to ground . resistors r 1 , r 2 , r 3 , r 4 , r 5 and r 6 each have a resistance of 33 kilo - ohms ( kω ). capacitor c 1 has a capacitance of 0 . 1 micro - farads ( μf ) and each of capacitors c 2 and c 3 has a capacitance of 1 . 0 μf in the example depicted . each input to circuit 200 includes input filter circuitry designed to protect the integrated circuits from electromagnetic interference ( emi ), voltage transients , electromechanical contact bounce and shift the 28 vdc logic level to a 5 vdc logic level . resistors r 2 , r 4 and r 6 and zener diodes d 1 , d 2 and d 3 provide emi protection and voltage transient protection to circuit 200 , and shift the 28 vdc logic level to a 5 vdc logic level . furthermore , complementary metal - oxide - semiconductor ( cmos ) latch - up on extreme transients such as lightning or a conducted electromagnetic pulse ( emp ) is prevented by clamping the inputs 0 . 5 vdc below the logic power supply voltage . capacitors c 1 , c 2 and c 3 suppress electro - mechanical contact bounce . resistors r 5 and r 6 and capacitor c 3 on the / reset input guarantee a default power - up state for circuit 200 since the power - up time constant of those components is substantially longer than that of both the logic power supply vcc ( which has a lower resistance ) and the / set input ( which has a much smaller capacitance ). pull - up resistors r 1 , r 3 and r 5 establish a default static logic level for the inputs , preventing floating logic states on unconnected inputs . the logic power supply functional unit 202 generating the logic power supply voltage vcc for circuit 200 includes resistor r 7 ( which has a resistor of 15 kω ), zener diode d 4 and capacitor c 4 ( which has a capacitance of 1 . 0 μf ) from the + 28 vdc power input . due to the low operating current of the cmos logic circuitry within circuit 200 , the value of resistor r 7 is selected to limit the current of any emi or voltage transient on the + 28 vdc power pad . transient suppression and voltage regulation on the + 5 . 6 vdc logic power supply is provided by d 4 while c 4 provides filtering of input and logic transients . because the logic power supply is a simple shunt voltage regulator , circuit 200 can operate over a wide input voltage range from below + 10 vdc to in excess of + 30 vdc . circuit 200 includes two high speed cmos integrated circuits : a dual d - type latch ( ff 1 and ff 2 ) and a quad schmidt trigger nand gate ( nand 1 , nand 2 , nand 3 and nand 3 ) implementing the latch logic 203 and the blink circuitry 204 . the inverted preset input pre of latch ff 1 is connected by resistor r 1 to the / set input , while the input d of latch ff 1 is connected to the inverting output of latch ff 1 . the clock input clk of latch ff 1 is coupled by nand gate nand 4 , configured as an inverter with the inputs tied together , by resistor r 4 to the / toggle input . the inverted clear input clr of latch ff 1 is connected by resistor r 6 to the / reset input . schmidt trigger logic gates are used to assure consistent performance on low slew - rate input signals . latch ff 1 is the primary latching circuit that responds to the inputs / set , / reset and / toggle as described in table ii above . nand gate nand 4 is connected between the / toggle input and the clock input of latch ff 1 for the purpose of inverting the positive ( leading ) edge trigger of latch ff 1 to a negative ( trailing ) edge trigger . the inverting output of latch ff 1 is connected to the d input so that successive / toggle inputs to latch ff 1 result in a toggling action of latch ff 1 non - inverting and inverting outputs q and / q . the non - inverting output q from latch ff 1 drives the normally open output / n_open via n - channel enhancement mode metal - oxide - semiconductor field effect transistor ( mosfet ) q 3 , and the inverting output / q from latch ff 1 drives the normally closed output / n_closed via mosfet q 2 . the non - inverting output q of latch ff 1 also holds latch ff 2 in the reset state any time latch ff 1 is in the reset state . blink circuitry 204 includes series connected nand gates nand 1 and nand 2 configured as inverters with the respective inputs tied together and are interconnected as a dual inverting buffer that , together with resistor r 8 ( having a resistance of 220 kω ) connecting a feedback loop from the output of nand gate nand 2 to the input of nand gate nand 1 with the input to nand gate nand 2 and capacitor c 5 ( having a capacitance of 1 . 9 μf ) connected in the feedback loop , form a free running square wave oscillator with a fundamental frequency f = 1 /( 2 . 2 × r 8 × c 5 ) of approximately 2 hertz ( hz ). the output of that oscillator feeds the clock input clk of latch ff 2 , where the inverting output / q of latch ff 2 is connected to the d input so that latch ff 2 functions as f / 2 frequency divider . the inverted preset input pre of latch ff 2 is tied to the logic supply voltage vcc . because the inverted clear input clr of latch ff 2 is connected to the non - inverting output q of latch ff 1 , the f / 2 divider circuit is effectively disabled any time latch ff 1 is in the reset state . the f / 2 divided frequency output of latch ff 2 creates the 1 hz blink mode oscillator , enabled only when latch ff 2 is in the set state . the enabled 1 hertz blink signal from the inverting output / q of latch ff 2 is connected , along with the filtered / reset input , each to one input of nand gate nand 3 . nand gate nand 3 thus serves as blink logic , forcing the / blink output to be held in a steady on state any time the / reset input signal is held low . the output of nand gate nand 3 is connected to mosfet q 1 to provide the / blink output of circuit 200 . each output from the circuit 200 includes a power mosfet q 1 , q 2 or q 3 each rated at 2 . 5 ampere ( a ) at 45 vdc ( both parameters chosen to be substantially greater than operational requirements ) and an output filter designed to protect each output device from transients and overload conditions . a pull - down resistor ( e . g ., 220 kω ) r 12 , r 13 and r 14 is connected to the input of each mosfet q 1 , q 2 and q 3 to ensure that the mosfets turn off cleanly should a power - down of the circuit 200 occur under heavy load conditions . transient protection for the mosfets q 1 , q 2 and q 3 is provided by impedances z 1 , z 2 and z 3 , each having a breakdown voltage of 39 vdc . overload protection may be provided by resettable positive temperature coefficient ( ptc ) resistors with a holding current of 0 . 5 a at elevated temperatures between the mosfets q 1 , q 2 and q 3 and the respective / blink , / n_closed and / n_open outputs . those devices would perform the function of a fuse , limiting current in the event of a short or overload , but automatically returning to their normal state when the short or overload is removed . preferably , however , 3 . 0 a fast - acting fuses f 1 , f 2 and f 3 are provided to break the circuit in a fail - safe state prior to possible destruction of the mosfets from inrush current of an external short circuit condition . in order to provide the highest possible reliability , each output / n_open , / n_closed and / blink is derated to a maximum operating current of 0 . 5 a , or 2 . 0 a in the embodiment using fast - acting fuses . fig3 is a circuit diagram for a configurable electronic latching module providing multiple latched states according to one embodiment of the present disclosure . configurable electronic latching circuit 300 is contained within the configurable electronic latching modules 115 a and 115 b when either or both of those modules is mounted within switch 100 . table iii below contains the input and output signal descriptions for circuit 300 , while table iv describes the logic input and output functions : table iv outputs inputs output output output output / reset / clock 1 2 3 4 h h → l output transitions from high impedance ( open drain ) to ground when state is active . l l output is high high high ground impedance impedance impedance ( open ( open ( open drain ) drain ) drain ) the “ 4 - pole housing pin ” referenced in table iii identifies the corresponding pin of an existing aerospace optics 4 - pole switch into which the configurable electronic latching module providing multiple latched states is incorporated . the logic input circuitry 301 for configurable electronic latching circuit 300 has a eight ( 8 ) interface pads each connected to an external pin of the configurable electronic latching modules 115 a or 115 b . two interface pads are inputs : / clk and / reset . four interface pads are outputs : / q 1 , / q 2 , / q 3 and / q 4 . two additional interface pads are devoted to power : + 28 vdc ( volts , direct current ) and ground . each input pad is connected , via a diode d 1 or d 2 , to two parallel resistors : resistors r 1 and r 2 for input / clk ; resistors r 3 and r 4 for input / reset . one resistor of each parallel pair ( r 1 and r 3 ) is connected at the other terminal to the + 28 vdc input power . the other resistor of each pair ( r 2 and r 4 ) is connected to one terminal of a capacitor ( c 1 and c 3 ) and to the cathode of a zener diode ( d 1 and d 3 , respectively ). the other capacitor terminals and the anodes of the zener diodes are connected to ground . resistors r 1 and r 2 each have a resistance of 33 kilo - ohms ( kω ). capacitor c 1 has a capacitance of 1 . 0 micro - farads ( μf ) and capacitor c 2 has a capacitance of 2 . 2 μf in the example depicted . resistors r 2 and r 4 and zener diodes d 1 and d 2 provide electromagnetic interference ( emi ) protection and voltage transient protection from the respective inputs to circuit 300 , and shift the 28 vdc logic level to a 7 . 5 vdc logic level . furthermore , cmos latch - up on extreme transients such as lightning or a conducted emp is prevented by clamping the inputs 0 . 5 vdc below the logic power supply voltage . capacitors c 1 and c 2 suppress electromechanical contact bounce . resistors r 3 and r 4 and capacitor c 2 on the / reset input have a power - up time constant substantially longer than that of both the logic power supply vcc ( which has a lower resistance on the 28v power input ) and the / clk input ( which has a much smaller capacitance ). those components thus guarantee a default power - up state for integrated circuit 304 . in addition , pull - up resistors r 1 and r 3 prevent floating logic states on unconnected inputs , establishing a default static logic level for the inputs . diodes d 6 , d 7 and d 9 , resistors r 6 , r 7 , r 8 , r 9 and r 11 ( each having a resistance of 33 kω ), and bipolar junction transistors ( bjts ) q 1 and q 2 provide inverting circuits for / clk and / reset inputs . the logical signals applied to the / clk and / reset inputs are inverted before being applied to integrated circuit 304 . the logic power supply functional unit 302 generating the logic power supply voltage vcc for circuit 300 includes diode d 5 connected between the + 28 vdc power supply input pad and the power supply connection to other circuit elements within circuit 300 . the opposite terminal of diode d 5 is connected , via resistor r 5 ( which has a resistance of 15 kω ), to a terminal of each of zener diode d 8 , capacitor c 3 ( which has a capacitance of 4 . 7 μf ), and resistor r 10 ( which has a resistance of 220 kω ). transient suppression and voltage regulation on the + 7 . 5 vdc logic power supply is provided by d 8 while c 3 provides filtering of input and logic transients . because the logic power supply is a simple shunt voltage regulator , circuit 300 can operate over a wide input voltage range from below + 10 vdc to in excess of + 30 vdc . circuit 300 includes a high speed cmos integrated circuit 4 - stage johnson counter 304 . counter 304 is the primary latching circuit that responds to the logic inputs / clk and / reset as described above . the “ 0 ,” “ 1 ,” “ 2 ” and “ 3 ” outputs of counter 304 are coupled to outputs / q 1 , / q 2 , / q 3 and / q 4 . in the default condition , output / q 1 is low with all other outputs / q 2 , / q 3 and / q 4 having high impedance . each / clk input pulse will increment the counter 304 and rotate the outputs / q 1 , / q 2 , / q 3 and / q 4 through each state — that is , the next output goes low and the previous output returns to high impedance . thus , after the / clk input is pulsed once , output / q 2 goes low and outputs / q 1 , / q 3 and / q 4 have high impedance . after the / clk input has been pulsed twice , output / q 3 goes low and outputs / q 1 , / q 2 and / q 4 have high impedance . after the / clk input has been pulsed three times , output / q 4 goes low and outputs / q 1 , / q 2 and / q 3 have high impedance . pulsing the / clk input four times will cycle the outputs / q 1 , / q 2 , / q 3 and / q 4 through all four states , returning to the default condition to restart and repeat the cycle . pulsing the / reset input at any time restores the default condition . outputs “ 2 ” or “ 3 ” from the counter 304 may be routed and combined by a logical or with the / reset input , allowing the circuit 300 to act as a two state , three state or four state latch . an external jumper may provide the requisite connection . thus , for example , if the output “ 3 ” of counter 304 4 is externally connected to the / reset input , the circuit 300 operates as a three position latch with output “ 3 ” resetting the circuit 300 back to the default condition . each output pad / q 1 , / q 2 , / q 3 and / q 4 is coupled to an output of the counter 304 through a power mosfet q 3 , q 4 , q 5 and q 6 rated at 4 . 0 ampere at 45 vdc , voltage and current parameters that are substantially greater than operational requirements . transient protection for the mosfets is provided by impedances z 1 , z 2 , z 3 , and z 4 with a breakdown voltage of 39 vdc . the input of each mosfet q 3 , q 4 , q 5 and q 6 is coupled to ground by a resistor r 12 , r 13 , r 14 and r 15 having a resistance of 220 kω . overload protection may be provided by 3 . 0 a fast - acting fuses f 1 , f 2 , f 3 and f 4 providing fail - safe protection as described above . in order to provide the highest possible reliability , each output is derated to a maximum operating current of 2 . 0 ampere . fig4 is a circuit diagram for a single - state electronic latching module according to one embodiment of the present disclosure . single - state electronic latching circuit 400 is contained within the configurable electronic latching modules 115 a and 115 b when either or both of those modules is mounted within switch 100 . the logic input circuitry 401 for configurable electronic latching circuit 400 has four ( 4 ) interface pads each connected to an external pin of the configurable electronic latching modules 115 a or 115 b . two interface pads are inputs : / clk and + 28 vdc . one interface pad is an output / q 1 . one additional interface pad is devoted to power : ground . the input pad for the / clk signal is connected , via a diode d 1 , to two parallel resistors r 1 and r 2 , each having a resistance of 33 kω . one resistor r 1 is connected at the other terminal via resistor r 3 ( having a resistance of 133 kω ) to the clear input of flip - flop 404 , to the / reset input pad . the other resistor r 2 is connected to one terminal of a capacitor c 2 ( having a capacitance of 1 . 0 μf ) and to the cathode of a zener diode d 2 . the clear input to flip - flop 404 is also connected to one terminal of a capacitor c 3 ( having a capacitance of 2 . 2 μf ). the other capacitor terminals and the anodes of the zener diodes are connected to ground . the logic power supply functional unit 402 for circuit 400 includes a connection to the ground input pad . circuit 400 includes a flip - flop 404 receiving the / clk signal at a clock input thereof . the non - inverting output of flip - flop 404 is coupled to output / q 1 . output pad / q 1 is coupled to the output of the flip - flop 404 through a power mosfet q 1 rated at 4 . 0 ampere at 45 vdc , voltage and current parameters that are substantially greater than operational requirements . transient protection for the mosfet is provided by impedance z 1 with a breakdown voltage of 39 vdc . the input of mosfet q 1 is coupled to ground by a resistor r 7 having a resistance of 220 kω . overload protection may be provided by a fuse f 1 . in order to provide the highest possible reliability , the output is derated to a maximum operating current of 2 . 0 ampere . the features of activating switch functions from a remote location , energizing or blinking a local or remote display , resetting the switch state automatically upon remote acknowledgement , changing the state of a switch or display at one location based on another , remote switch controlling the same function being depressed , automatic reset to a default state after loss of power , multi - state configurable electronic latching and single - state electronic latching are implemented in the present disclosure by replacing the traditional electromagnetic holding coil within the illuminated pushbutton switch housing with one or more subminiature electronic logic modules . the logic modules provide many additional features beyond the simple latching or on / off toggling functionality that is typical of an electromagnetic holding coil , including lower size and weight , longer switch life , no electrical spikes , remote set and reset capability , display blinking , and high reliability electronic driver circuits that can drive modest electrical loads . although the above description is made in connection with specific exemplary embodiments , various changes and modifications will be apparent to and / or suggested by the present disclosure to those skilled in the art . it is intended that the present disclosure encompass all such changes and modifications as fall within the scope of the appended claims .	7
in general , the terms and phrases used herein have their art - recognized meaning , which can be found by reference to standard texts , journal references and contexts known to those skilled in the art . the following definitions are provided to clarify their specific use in the context of this description . as used herein , “ top ” and “ bottom ” surfaces of fuel tank access doors are described relative to the upright aircraft orientation . thus , the top surface of the inner fuel tank door , which faces the inside of a fuel tank , forms the top of the fuel tank access door stack and the bottom surface of the outer fuel tank door , which faces outside the aircraft , forms the bottom of the fuel tank access door stack . a “ system ” is a combination of components operably connected to produce one or more desired functions . a “ component ” is used broadly to refer to an individual part of a system . “ encapsulated ” refers to the orientation of one structure such that it is at least partially , and in some cases completely , surrounded by one or more other structures , such as an encapsulating layer . “ partially encapsulated ” refers to the orientation of one structure such that it is partially surrounded by one or more other structures , for example , wherein 30 %, or optionally 50 % or optionally 90 %, of the external surfaces of the structure are surrounded by one or more other structures . “ completely encapsulated ” refers to the orientation of one structure such that it is completely surrounded by one or more other structures . “ dielectric ” refers to a non - conducting or insulating material . specific examples of dielectric materials include , but are not limited to , silicon nitride , silicon dioxide , fiberglass and plastics . “ plastic ” or “ plastic material ” refers to a polymer material comprising macromolecules composed of repeating structural units connected by covalent chemical bonds or the polymerization product of one or more monomers , often characterized by a high molecular weight . the term polymer includes homopolymers , or polymers consisting essentially of a single repeating monomer subunit . the term polymer also includes copolymers , or polymers consisting essentially of two or more monomer subunits , such as random , block , alternating , segmented , grafted , tapered and other copolymers . useful polymers include organic polymers or inorganic polymers that may be in amorphous , semi - amorphous , crystalline or partially crystalline states . crosslinked polymers having linked monomer chains are particularly useful for some applications . “ alignment ” is used herein to refer to the relative arrangement or position of surfaces , objects or components . “ contiguous ” refers to materials or layers that are touching or connected throughout in an unbroken sequence . a contiguous object may be a monolithic object . “ unitary ” refers to an object formed as a single piece or undivided whole . the terms “ direct ” and “ indirect ” describe the actions or physical positions of one component relative to another component , or one layer relative to another layer . for example , a component or layer that “ directly ” acts upon or touches another component does so without intervention from an intermediary . contrarily , a component or layer that “ indirectly ” acts upon or touches another component does so through an intermediary ( e . g ., a third component or layer ). fuel tank access door systems and associated methods will now be described with reference to the figures , which are not drawn to scale . fuel tank access doors are typically selected from four sizes ranging in diameter between 11 inches and 18 inches , although those of skill in the art will recognize that larger or smaller fuel tank access doors may be prepared . fig1 a and fig1 b show top and bottom perspective views , respectively , of an exemplary outer fuel tank access door , according to an embodiment . fuel tank access door systems disclosed herein utilize a metal plate ( required for fuel pooling fire requirements ) encapsulated within a dielectric material that prevents lightning and p - static build - up , thereby eliminating the need for p - static paint and conductive gaskets . it is not possible to simply use composite skins for this application , due to the fuel pooling fire requirement . the door must be made of , or be as good as , aluminum ; by using a dielectric material to encapsulate a metal plate , the lightning / p - static advantages of the dielectric material and the fuel resistant properties of the metal are both realized . in the embodiment shown in fig1 , the outer fuel tank access door comprises a rim of thicker material around a circumference of the top surface of the door and a plurality of holes disposed around the rim for receiving fasteners . fig2 a is a cross - sectional and exploded view of the outer fuel tank access door of fig1 showing a metal plate completely encapsulated by a dielectric material , according to an embodiment . fig2 b shows a cross - sectional view of the holes of the outer fuel tank access doors of fig1 a , fig1 b and fig2 a in greater detail . it can be seen , for example , that the dielectric material coats the inside of each of the holes in the rim of the outer door . in an embodiment , the outer fuel tank access door comprises aluminum , stainless steel , titanium , or alloys thereof encapsulated by the dielectric material . in an embodiment , the outer fuel tank access door comprises a metal or alloy having a melting point of 950 ° f . or higher . the dielectric material may , for example , be selected from the group consisting of silicon nitride , silicon dioxide , fiberglass , plastic and combinations thereof . the dielectric material typically forms an encapsulation layer having a thickness selected from a range of 0 . 25 μm to 10 mm , or 0 . 1 μm to 5 mm , or 1 μm to 2 mm . in an embodiment , a dielectric material forms an encapsulation layer having a thickness of at least 0 . 25 μm . fig3 a and fig3 b show top and bottom perspective views , respectively , of an exemplary inner fuel tank access door , according to an embodiment . the inner fuel tank access door may , for example , be a monolithic component made of dielectric material , selected from the group consisting of nylon , fiberglass or other plastics . in the embodiment shown , the top surface of the inner door ( fig3 a ) comprises two drainage features . for example , the inner fuel tank access door may comprise a raised lip with drainage features configured as channels extending radially through the raised lip . in an embodiment , the channel has a minimum width selected from the range of 1 cm to 6 cm and a length selected from the range of 2 cm to 10 cm . the top figure of fig4 a shows a cross - sectional view of a drainage feature that is taken perpendicular to the dashed line shown in the middle figure of fig4 a , as well as greater detail of the inner fuel tank access doors of fig3 a and fig3 b ( middle and bottom ). as shown in fig4 a the surfaces of the drainage feature are smooth and tapered to prevent liquid adhesion , in an embodiment . fig4 b shows a perspective view of a top surface of an inner fuel tank access door 400 comprising exemplary drainage features 402 , 404 , according to multiple embodiments . drainage feature 402 is a tapered channel having a wider opening near a center portion of inner fuel tank access door 400 and a narrower opening near the outer perimeter of inner fuel tank access door 400 to help direct fuel on the surface toward the perimeter . likewise , drainage feature 404 is tapered to direct fuel away from a center portion of inner fuel tank access door 400 and toward its perimeter . the channel of drainage feature 404 is formed by curved walls . fig5 shows a fuel tank access door system 100 having at least one drainage feature aligned along the direction of arrow a and substantially along a longitudinal axis of an aircraft wing 500 , according to an embodiment . aligning a drainage feature substantially along the longitudinal axis of the wing provides gravity assistance for removing fuel from the top surface of the inner fuel tank access door . the bottom surface of the inner fuel tank access door , shown in fig3 b , comprises a raised central portion that mates with the central portion on the top surface of the outer door to prevent a cavity from forming between the doors . the bottom surface also includes a plurality of threaded holes disposed around a circumference of the inner fuel tank access door for aligning with the holes of the outer fuel tank access door and receiving fasteners . fig6 shows the outer fuel tank access door of fig1 and the inner fuel tank access door of fig3 joined together by fasteners and clamped to the skin of an aircraft wing , according to an embodiment . sealants may be applied between the aircraft skin and the fuel tank access doors to prevent the ingress or egress of fluids , such as fuel , fuel vapors , water and other atmospheric gases , or environmental irritants , such as sand , ice and the like . according to some embodiments , a method of providing an aircraft with a fuel tank access door system comprises : providing an inner fuel tank access door comprising at least one drainage feature ; orienting the inner fuel tank access door such that the at least one drainage feature is aligned substantially along a longitudinal axis of the aircraft wing ; providing an outer fuel tank access door completely encapsulated by a dielectric material ; and fastening the outer fuel tank access door to the inner fuel tank access door . in an embodiment , a method of providing an aircraft with a fuel tank access door system comprises : providing an inner fuel tank access door comprising at least one drainage feature ; orienting the inner fuel tank access door such that the at least one drainage feature is aligned substantially along a longitudinal axis of the aircraft wing ; providing an outer fuel tank access door ; and fastening the outer fuel tank access door to the inner fuel tank access door . in an embodiment , a method of providing an aircraft with a fuel tank access door system comprises : providing an inner fuel tank access door ; providing an outer fuel tank access door completely encapsulated by a dielectric material ; and fastening the outer fuel tank access door to the inner fuel tank access door . in some embodiments , the outer fuel tank access door is secured directly to the inner fuel tank access door , with only a clamping action securing the doors to the aircraft skin . for example , the outer fuel tank access door may be secured directly to the inner fuel tank access door with at least one screw mounted in a fiberglass insert . in an alternate embodiment , the outer fuel tank access door may be secured indirectly to the inner fuel tank access door . for example , the outer fuel tank access door may be secured indirectly to the inner fuel tank access door with at least one screw mounted in a fiberglass insert . in some embodiments , the system does not include a high impedance gasket or provide a purposeful arcing path . thus , in some embodiments , the outer fuel tank access door may be in direct contact with a corrosion preventative primer on the aircraft skin . all references cited throughout this application , for example patent documents including issued or granted patents or equivalents ; patent application publications ; and non - patent literature documents or other source material ; are hereby incorporated by reference herein in their entireties , as though individually incorporated by reference , to the extent each reference is at least partially not inconsistent with the disclosure in this application ( for example , a reference that is partially inconsistent is incorporated by reference except for the partially inconsistent portion of the reference ). the terms and expressions which have been employed herein are used as terms of description and not of limitation , and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof , but it is recognized that various modifications are possible within the scope of the invention claimed . thus , it should be understood that although the invention has been specifically disclosed by preferred embodiments , exemplary embodiments and optional features , modification and variation of the concepts herein disclosed can be resorted to by those skilled in the art , and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims . the specific embodiments provided herein are examples of useful embodiments of the invention and it will be apparent to one skilled in the art that the invention can be carried out using a large number of variations of the systems , system components , and method steps set forth in the present description . as will be apparent to one of skill in the art , methods and systems useful for the present methods can include a large number of optional composition and processing elements and steps . when a group of substituents is disclosed herein , it is understood that all individual members of that group and all subgroups are disclosed separately . when a markush group or other grouping is used herein , all individual members of the group and all combinations and subcombinations possible of the group are intended to be individually included in the disclosure . it must be noted that as used herein and in the appended claims , the singular forms “ a ”, “ an ”, and “ the ” include plural reference unless the context clearly dictates otherwise . thus , for example , reference to “ a door ” includes a plurality of such doors and equivalents thereof known to those skilled in the art , and so forth . as well , the terms “ a ” ( or “ an ”), “ one or more ” and “ at least one ” can be used interchangeably herein . it is also to be noted that the terms “ comprising ”, “ including ”, and “ having ” can be used interchangeably . the expression “ of any of claims xx - yy ” ( wherein xx and yy refer to claim numbers ) is intended to provide a multiple dependent claim in the alternative form , and in some embodiments is interchangeable with the expression “ as in any one of claims xx - yy .” unless defined otherwise , all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs . although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , the preferred methods and materials are described . nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention . whenever a range is given in the specification , for example , a range of integers , a temperature range , a time range , a composition range , or concentration range , all intermediate ranges and subranges , as well as all individual values included in the ranges given are intended to be included in the disclosure . as used herein , ranges specifically include the values provided as endpoint values of the range . as used herein , ranges specifically include all the integer values of the range . for example , a range of 1 to 100 specifically includes the end point values of 1 and 100 . it will be understood that any subranges or individual values in a range or subrange that are included in the description herein can be excluded from the claims herein . as used herein , “ comprising ” is synonymous and can be used interchangeably with “ including ,” “ containing ,” or “ characterized by ,” and is inclusive or open - ended and does not exclude additional , unrecited elements or method steps . as used herein , “ consisting of ” excludes any element , step , or ingredient not specified in the claim element . as used herein , “ consisting essentially of ” does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim . in each instance herein any of the terms “ comprising ”, “ consisting essentially of ” and “ consisting of ” can be replaced with either of the other two terms . the invention illustratively described herein suitably can be practiced in the absence of any element or elements , limitation or limitations which is not specifically disclosed herein . all art - known functional equivalents of materials and methods are intended to be included in this disclosure . the terms and expressions which have been employed are used as terms of description and not of limitation , and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof , but it is recognized that various modifications are possible within the scope of the invention claimed . thus , it should be understood that although the invention has been specifically disclosed by preferred embodiments and optional features , modification and variation of the concepts herein disclosed can be resorted to by those skilled in the art , and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims .	1
reference will now be made to preferred embodiments of this invention . the current invention relates to biological threat agent simulants and to methods and products in which simulants replace biological threat agents during the development , testing , and / or training of biological defense technology . in order to better understand the invention , the following terms have been defined . the term “ biological defense technology ” means a device , product and / or method able to detect a threatening biological agent , protect people , plants , livestock or other assets from contact with a threatening biological agent , and / or render harmless one or more threatening biological agents . examples of biological defense technology include filters , masks , protective clothing , protective creams or gels , decontamination products and solutions , and devices or methods to detect and / or identify threat agents . a device includes a machine and / or equipment . a product includes a filter , gel , foam or other non - mechanical item . a method includes the use of a product and / or device . the term “ inactivate ” means to kill threat agent organisms , cells , spores or viruses and render them harmless or nonviable . the term “ virion ” means a budded virus , or a virus not enmeshed in a polyhedrin matrix . the term “ simulant ” means an agent having similar biological characteristics to a threatening biological agent but when used in place of the threatening biological agent is not harmful . the term includes one or more simulants and / or any combination of simulants . the term “ threatening biological agent ” or “ biological threat agent ” means microorganisms , toxins , and / or viruses that are dangerous to human , animal , and / or plant life and as defined in this patent application . the term includes one or more threatening biological agents and / or any combination of threatening biological agents . the term “ virus threat agent ” means a threatening biological agent that is a virus dangerous to human , animal , and / or plant life . a simulant of the present invention is one or more agent ( s ), such as a nucleic acid sequence , preferably a dna sequence that corresponds to one or more threatening biological agents . such a simulant of the present invention takes the place of one or more threatening biological agents during the development , testing , and training of biological defense technologies . specifically , the simulant ( s ) of the present invention are chimeras ; a genetic element made up of a plurality of nucleic acid segments , wherein each segment corresponds to the nucleic acid sequences of a threatening biological agent . the chimerical simulants are by design non - infectious to humans . threatening biological agents are described within the center for disease control ( cdc ) list of today &# 39 ; s most dangerous biological agents , that is , within category a , category b , and / or category c of the list . the cdc &# 39 ; s list of the most dangerous biological agents includes organisms such as anthrax , plague , smallpox , tularemia , and viral hemorrhagic fevers . the present invention specifically includes design and construction by genetic engineering of non - infectious chimeras that include the nucleic acid signature of most or all bacterial and viral biological threat agents . one embodiment of the present invention is chimeras that simulate biological threat agents whose genomes are dna . examples of biological threat agents whose genomes are dna include : bacillus anthracis ( signatures from both virulent plasmids ), yersinia species , burkholderia species , francisella species , brucella species , coxiella burnetii , ricketsia species , enterohemorrhagic escherichia species , and variola virus ( smallpox ). another embodiment of the present invention is chimeras that simulate biological threat agents whose genome is rna . biological threat agents whose genome is rna include members of the arenaviruses , filoviruses , alphaviruses , flaviviruses , and hantaviruses , more particularly the viruses : ebola , lassa , yellow fever , eastern equine encephalitis , junin , marburg , dengue , crimean - congo , venezuelean equine encephalitis , rift valley fever , machupo , and influenza . the chimeras once identified have been cloned into vectors such as viruses , plasmids or any other vehicle that allows the storage and amplification of the chimera sequences . the risk of human injury or death is minimized when a simulant is used in the place of a threatening biological agent during the development , testing and / or training of a biological defense technology . because the simulant and the threatening biological agent are selected to have similar characteristics ( corresponding nucleic acid sequences ) with the simulant being non - pathogenic , a simulant of the present invention may take the place of a threatening biological agent for product development , testing and evaluation , training , as positive controls , and wherever a non - infectious surrogate can beneficially replace actual threat agents . the results generated from such development , testing and / or training of a biological defense technology are then used to create new and effective biological defense technology , or improve existing biological defense technologies . discussion will now focus on examples of biological defense technology and their functions . biological defense technology able to detect a threatening biological agent includes devices , products , and / or methods able to detect such agents in the air , in water , in food , in bodily fluids , or on solid surfaces . detection of such agents in air generally consists of three steps : sample collection ; sample processing ; and sample analysis . instrumentation accomplishing each step may be part of an integrated system , or samples may be collected , processed , and analyzed by separate systems ( or by humans working with laboratory equipment ). some detection systems may sample the air passively , using currents in ambient air to cause airborne agents to move into the portion of the device that performs the analysis ( in much the same way as a smoke detector detects smoke particles only when particle - laden air wafts into the interior of the detector ). most active samplers that draw agents from air exploit one or more physical characteristics of the agents targeted for collection and contact with the biological defense technology . such methods include but are not limited to the use of filters causing separation of particles from air based on size . air can be drawn by fans ( or other methods of moving air ) and passed through filters designed with pore sizes small enough to retard the passage of airborne particles that carry virions . another class of samplers accelerates air ( and therefore airborne agents ) and increases the momentum of airborne agents , then passes such particles through a path in the instrument in such a way that the momentum of particles causes them to leave the airstream and impact on a surface or into a fluid where they are arrested . such devices are often said to work by “ impaction ” and may be called an “ impaction sampler ”. conceivably , air samplers for threatening biological agents could also work by adsorption ( an adsorption sampler ), in which air is passed through a column filled with a porous substrate that has an affinity for the threatening biological agents based on one or more methods , including but not limited to : charge , the complementarily of molecular surface structures ( including but not limited to an antibody - antigen interaction ), relative hydrophobicity / hydrophilicity . sample collection from liquid samples employs many of the same techniques listed above . sample collection from surfaces usually employs the use of a swab ( often composed of cotton , but can be any of a large number of materials ) or other material or device that is wiped over a surface with the intent that particles on the surface adhere to the swab . samples from food can involve the use of swabs or a more frequently a disruption of a portion of the food into a proper media and further analysis . collection of samples from bodily fluids , including sputum , bronchial swabs or lavage , urine , feces , spinal fluid , or blood , is well known to those involved in the art . the term “ sample processing ” refers to methods of preparing a sample for analysis , which is making the threatening biological agent or components thereof such as membrane proteins , dna , and / or rna accessible ( able to come in contact with ) to a detection device so that the detection device is able to detect the presence of a molecule characteristic to a biological threatening agent . such molecules include rna , dna , protein and / or lipid ( i . e ., content and / or composition ). typically , the integrity of a threatening biological agent &# 39 ; s cell , spore , or virion is disrupted by chemical , enzymatic , electrical , mechanical and / or other means . for example , such disruption means may cause the release of nucleic acids from a threatening biological agent and make them available for methods of analysis that rely upon nucleic acid sequence information for detection and identification . another reason a sample might require preparation is that a molecule characteristic of a threatening biological agent may have to be modified or combined with other compounds before analysis . an example of this kind of modification is the derivatization of small molecules before gas chromatographic analysis . a biological defense technology may detect a nucleic acid signature of a threatening biological agent . nucleic acid hybridization is used to detect a biological agent by contacting a target nucleic acid ( i . e . the nucleic acid signature specific to a particular threatening biological agent or simulant ) with a nucleic acid probe capable of selectively hybridizing to at least a portion of the target nucleic acid sequence . the chimeras of the present invention are nucleic acid and can be detected by nucleic acid probes . nucleic acid hybridization methods applicable to this invention are described in sambrook et al . the detection may also occur by polymerase chain reaction ( pcr ) as described in barlett et al . pcr is typically used in nucleic acid based detection methods . small amounts of biological threat agents may be present in a suspect sample and the corresponding low amount of nucleic acid sequences of the biological threat agents may have to be amplified to be detected . in order to amplify the nucleic acid sequences of a biological threat agent , lysis of the cell , or virus particle , preferably occurs by conventional methods . then the nucleic acid sequences present in the sample are heated so that it becomes denatured to form single stranded nucleic acid sequences . the denatured nucleic acid sequences are cooled and nucleic acid probes are annealed . the probes are specific to the biological threat agent thought to be in the sample . taq or equivalent polymerase binds the 3 ′ end of each nucleic acid probe annealed to nucleic acid sequences and extends each of these primers in the 5 ′ to 3 ′ direction along the nucleic acid sequences . pcr typically results in a doubling of the number of copies of nucleic sequences after each round of dna synthesis and a geometric increase in number of copies after each reaction cycle . the chimera in the present invention can be used to test different primers ( probes ), conditions , specificity , and sensitivity to be used in the pcr amplification method , or nucleic acid based detection methods . the pcr product ( amplified nucleic acid sequence ) can be observed afterwards by separation of the dna by agarose gel electrophoresis , capillary electrophoresis , real time fluorescence , or other detection methods known to those familiar in the art . some biological defense technology must be able to detect very small amounts of threatening biological agents in a relative large amount of material ; for example , a small number of anthrax spores in a thick layer of dust on top of a computer . such non - pathogenic material collected with a threatening biological agent must be removed before a threatening biological agent may be detected and identified . methods for the removal of such non - pathogenic materials may include , but are not limited to , purification by means of ligand - receptor affinity ( of which antibody - antigen affinity or nucleic hybridization are possible examples ). other types of decontamination technologies include but are not limited to methods and devices that transmit radiant energy ( such as ultraviolet radiation ) to threatening biological agent cells , spores , or virions in such a way that the absorbance of the radiant energy disrupts threatening biological agent cells , spores , or virions in the ways mentioned above . another class of decontamination technology includes methods or devices that generate aerosols or gaseous emissions of substances that inactivate threatening biological agent cells , spores , or virions in the ways described above . an example of such a technology is a vaporous hydrogen peroxide ( vhp ) generator . hydrogen peroxide vapors , chlorine dioxide , paraformaldehyde vapors , or combinations thereof , are capable of penetrating the interiors of equipment and destroying threatening biological agent cells by chemically ( oxidatively or otherwise ) modifying small or macromolecules of threatening biological agent cells , spores , or virions so that they are no longer viable or able to cause disease . a simulant of the present invention is a chimera containing segments of nucleic acid sequences , which is safe when in contact with humans and is able to take the place of a biological threat agent , preferably during the development , testing , and training of biological defense technology . design and synthesis of a nucleic acid segments for detecting biological threat agents having dna genomes a single molecule chimera was made of dna segments , each segment corresponding to the nucleic acid sequences of a biological threat agent having a dna genome . the segments were identified using a novel bioinformatics approach . as shown in fig1 , this bioinformatics approach has multiple steps and uses computational tools to search and select non - infectious signature sequences corresponding to bacterial and viral threat agents whose genome is dna , including bacillus anthracis , yersinia pestis , coxielila bumeti , brucella sp ., francicella tularensis , entherohemorragic e . coli , o157 : h7 , burkholderia mallei , burkholderia pseudomallei and variola virus ( smallpox virus ). once these nucleic acid sequences ( or segments of the chimera ) were identified , each segment was then prepared by pcr amplification . synthetic chimeras were designed to produce pcr amplicons of different sizes than the amplified fragments from the original pathogenic genome ( to identify any false positives ). segments of the sizes shown in fig2 were chosen to create the chimera for detecting biological threat agents having dna genomes . added to each fragment were two restriction sites in the middle of the sequence ( ecori - gaattc - and smai - cccggg -). these enzymes won &# 39 ; t cut the amplified segments from the microbial genomes ; therefore the enzymes can be used to digest these segments in case of suspected contamination with the simulant . when the simulant amplicons were digested with internal restriction enzymes , two small fragments were obtained . ( see right two columns in fig2 ) for example , the francisella tularensis simulant amplicon was a size of 100 bp and was digested by ecor1 into two fragments of 37 bp and 63 bp were obtained . the corresponding fragment in the threat agent francisella tularensis is 230 by and is not digested by ecor1 . based on the bioinformatics study described in fig1 and the primers ( underlined in bold below ) designed from segment sequences using the fastpcr software , dna segments were selected as follows : [ seq id no . 1 ] ggatccgacaagcttatggctttgc agccacttttgcaatcgctgtgtg ag cccgggcagcgaattcccatttagatttttttgaatatgcttgtaaa g accgaggctcagaactaatcgcagct agaggacaag yersinia segment [ seq id number : 2 ] ggatcctgaaagcttgctggggcga acccacctcattggctatggcggc gt cgcctgtcacgtcctgtttgagtgggataaacgccacgatgagttcg atctcgccatactggagaaaggatggaaccagctcatcgcacgccacga tatgttgcgtatggtggttgcccggggcctgaattctgaggatcctcat tatgtcaatatcggtacggtgttagacaaggccgactg acgccggagta tcacatcccgcgtg acgatctgcgc burkholderia segment [ seq id number : 4 ] ggatccctcaagcttttacacgttt tgctgaccaatctaagcctgcgtt cttcgtaaatggttttgcagcgaatgatccctcatcaacattacgtatt tgggaacgtgtggatgattttggatatagtaatctagctccaattgccc gggagatgaattctacatctgcgcgaatgatatattggtttactgacga ggagcaaccgattaagcgccgta gcgttgatcgtactgagcagtttgct agggatgttt rickettsia segment [ seq id number : 6 ] ggatcctctaagcttgaaaaaggattggat ttcaagttgtactggaccg at tctcaaaataaaaaagaagtgatttctagtgataacttacaattgcc agaattaaaacaaaaatcttcgaactcaagaaaacccggggaaagaatt ctcatctcctgaaaaatggagcacggcttctgatccgtacagtgatttc gaaaaggt tggacctacggttccagaccgtgaca atgatggaat coxiella segment [ seq id number : 8 ] ggatccataaagcttcggaagagat gcagcaccgtatacaccacccaat gg aatcattagtatactctacaccttatcctcagacacagatatctaaa aaaataggtgatgatgcaactctatcatgtagtagaaataatatacccg ggacgtgaattccaaacaaaatgtggaataggatacggagta tccggac acacgtctgttggagacgt catctgttct brucella segment [ seq id number : 9 ] ggatcctagaagcttaattgtgggc cgatggcgtcatccatgtgctgg gtg tcgggctggcgcttgccggtgccattgccatgctgttctatttcc tcccgggaatggaattctatgggcgaccgcgcggtgcccctgctgctg ttcgtgtggagcgtg gctttcgtcggcatcatgctcaaact gttcatg ccg escherichia segment [ seq id number : 10 ] ggatccctgaagcttgcgcgctaac gcaggcctgaactcatcgtcgga tga attacaggcccagacgcgtattgccggaatgcgctcaacgctgga gcaatatcacccggggcacgaattcaagcgcaatactggccaacgctc agtattcaggggggtaaaacgcgctaccag accagcgaccgctcgtat tgggatga tcagctacaa a chimera able to mimic many different types of biological threat agents was created by dna synthesis and the joining of the above - identified segments . the whole chimera sequence for dna genome threat agents is seq id number : 12 . a plasmid map comprising the whole chimera is shown in fig4 . design and synthesis of a nucleic acid segments for detecting biological threat agents having rna genomes the strategy used to identify nucleic acid segments unique to biological threat agents was different than that used in example 1 . the reason is that there is a higher probability of finding a unique dna in larger bacterial genomes ( example 1 ) than in smaller viral genomes due to the significant disparity in genomic size between bacteria and viruses . smaller viral genomes ( example 2 ) have been sequenced completely , unlike bacterial genomes requiring the need of large sequencing efforts . to obtain segments , or conserved regions of nucleic acid , among all isolates of one viral species , the genome sequences from all available isolates were aligned using clustalw software ( thompson , j . d . et al 1997 ). the selection of possible primer sequences was performed manually looking at the alignments . this analytical approach was used to determine target nuclei acid sequence representing several rna virus whose genome is rna , including but not limited to , nucleic acids in veev ( venezuelan equine encephalitis virus ), influenza virus , rift valley fever virus , machupo virus , lassa virus , yellow fever virus , ebola zaire virus , eastern equine encephalitis virus , junin virus , marburg virus , dengue virus , crimean congo virus . primer sequences were then selected manually by looking at the sequence alignments . then fast pcr was used as described in example 1 . the following dna sequences were selected , based on the manual selection described above , and primers ( underlined in sequences below ) were designed from segment sequences using the fastpcr software for purposes of designing and chemically synthesizing the whole chimera as follows : [ seq id number : 16 ] aagcttcgcggatccat gaagttgctagtttcaagcaggcgt tgagcaacc tagcccgacatggagaatacgcaccgttcgcacgggttctgaatttatcag ggattaacaacctcgaacatggactctatcgaattctaccccgggttcaga aaactgaaatcacacacagtcagacacta gccgtcctcagccagaaacgag aaa aa [ seq id number : 17 ] aagcttcgcggatcctt tcaatatgctgaaacgcgagagaaaccg cgtgtc aactgtttcacagttggcgaagagattctcaaaaggattgctttcaggcca aggacccatgaaattggtgatggcttttatagcgaattctaccccgggtta tgtgaggacacaatgacctacaaatgcccccggatcactgagacg gaacct gaagacattgactgttggtgcaa tg [ seq id number : 18 ] aagcttcgcggatccta gttagttgcgacgggtacgt cgttaaaagaatag ctatcagtccaggcctgtatgggaagccttcaggctatgctgctacgatgc accgttaaaagaatagctatcaggaattctaccccgggggctatgctgcta cgatgcaccgttaaaagaatagctatcagtccaggcctgtatgggaagcct tcaggctatgctgctacgatgcac cgcgagggattcttgtgctgc aa [ seq id number : 19 ] aagcttcgcggatccaa ttgatgatgagcatgtcaggcat tgattgtataa aatatcccacagggcagcttatcacccatggaagagtgagtgcaaaacata acgatgggaacctgaaagatagaagcgagaattctaccccgggaacctgtg ccctttcaggttgactgtatattgttcaaagaagtggcagctgaatgcatg aagaggtac attggcacaccttatgagggaatt gt [ seq id number : 20 ] aagcttcgcggatccaa accatttgaatggatgtcaatccgac tctactgt tcctaaaggttccagcgcaaaatgccataagcaccacattcccttatactg gagatcctccatacagccatggaacagtctactgttgaattctaccccggg tggaacagtctactgttcctaaaggttccagcgcaaaatgccataagcacc acattcccttatactggagatcctccatacagccatggaacag gaacagga tacaccatggacacagtc aa [ seq id number : 21 ] aagcttcgcggatcctt atgagtgcactgctcagtacgcca atgcctattg ttcacatgctaatgggtcagggattgtgcagatacaagtatcaggggtctg gaagaagcctttatgtgtagggtatgagagagtggttgtgaagagaggaat tctaccccgggacatgctaatgggtcagggattgtgcagatacaagtatca ggggtctggaagragcctttatgtgtagggtatgagagagtggttgtgaag agagaactctctgcca agcccatccagagagttgagccttgc ac [ seq id number : 22 ] aagcttcgcggatcctt cattcatcatgtctaaagcaatgc agacatccag aaattttagcctcccgctatccattgttctgctgacctgaagatcattcat aaatggagtcaagtgttcgtcaaaaagaactggataatttctccttataga ttgaattctaccccgggtctgctgacctgaagatcattcataaatggagtc aagtgttcgtcaaaaagaactggataatttctccttatagattgcagaaca tggttcattcccagttggtcttcaatttg tctcaccactttaggcttcaca gcc ca these segments were then joined together to form a chimera to mimic many different types of biological threat agents whose genome is rna . dna synthesis was used to create the whole chimera based on the joining of segments . the entire chimera sequence for threat agents having rna genomes is seq id no : 26 . [ seq id number : 26 ] aagcttcgcggatcctt atcctgggtgaccacttcat tttggttgatgcta agtcgctcataaatggcagtatgtgtttttcaaatacagatgggaattcta ccccggg aagacccatgcacccagttctattgc agaagcttcgcggatc cg cgtccgccccgcgagcacagagcc tcgcctttgccgatccgccgcccgtcc acacccgccgccagctcaccatggatgatgatatcgccgcgctcgtcgtcg acaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgcccccc gggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatgg tgggcatgggtcagaaggattccgaattctaccccgggtatgtgggcgacg aggcccagagcaagagaggcatcctcaccctgaagtaccccatcgagcacg gcatcgtcaccaactgggacgacatggagaaaatctggcaccacaccttct acaatgagctgcgtgtggctcccgaggagcaccccgtgctgctgaccgagg cccccctgaaccccaaggccaaccg cgagaagatgacccagatcatgtttg agaccttcaaaagcttcgcggatcctgc taagctgtgaggcagtgcaggct gg gacagccgacctccaggttgcgaaaaacctggtttctgggacctcccac cccagagtaaaagaattctaccccggg cagtttgctcaagaataagcagac ct ttaagcttcgcggatcctt cattcatcatgtctaaagcaatgc agacat ccagaaattttagcctcccgctatccattgttctgctgacctgaagatcat tcataaatggagtcaagtgttcgtcaaaaagaactggataatttctcctta tagattgaattctaccccgggtctgctgacctgaagatcattcataaatgg agtcaagtgttcgtcaaaaagaactggataatttctccttatagattgcag aacatggttcattcccagttggtcttcaatttg tctcaccactttaggctt cacagcc caaagcttcgcggatcccg gcaattgcactcggagtcgccacag c acacgggagtaccctcgcaggagtaaatgttggagaacagtatcaacaac tcagagaggctgccactgaggctgagaagcaagaattctaccccggg tgct gcgtcactgcccaaaacaagtg gaaagcttcgcggatcctt atgagtgcac tgctcagtacgcca atgcctattgttcacatgctaatgggtcagggattgt gcagatacaagtatcaggggtctggaagaagcctttatgtgtagggtatga gagagtggttgtgaagagaggaattctaccccgggacatgctaatgggtca gggattgtgcagatacaagtatcaggggtctggaagaagcctttatgtgta gggtatgagagagtggttgtgaagagagaactctctgcca agcccatccag agagttgagccttgc acaagcttcgcggatcctt tacttgtctgcggcgcc ttgggcg ccgtagtcgaacgcccaggttatgcacccgttcacctacagata cagctggttaataccaggataattccatcaagaattctaccccgggacagg tgtttacccattcatgtgg ggaggagcctactgcttctgcg acaagcttcg cggatccaa accatttgaatggatgtcaatccgac tctactgttcctaaag gttccagcgcaaaatgccataagcaccacattcccttatactggagatcct ccatacagccatggaacagtctactgttgaattctaccccgggtggaacag tctactgttcctaaaggttccagcgcaaaatgccataagcaccacattccc ttatactggagatcctccatacagccatggaacag gaacaggatacaccat ggacacagtc aaaagcttcgcggatccgc acctctgatccagacatgcagt cga cccttaactttgacatcaaatccacatgatggatttgatttgcatatg ccatcaagaaatatcttagaccttgtaaaaatgtctggttccgaattctac cccgggcccattgatggatagatagatagaat agcaccttgacttctcacc tgttt ttaagcttcgcggatcctagtta gttgcgacgggtacgt cgttaaa agaatagctatcagtccaggcctgtatgggaagccttcaggctatgctgct acgatgcaccgttaaaagaatagctatcaggaattctaccccgggggctat gctgctacgatgcaccgttaaaagaatagctatcagtccaggcctgtatgg gaagccttcaggctatgctgctacgatgcac cgcgagggattcttgtgctg c aaaagcttcgcggatccat gaagttgctagtttcaagcaggcgt tgagca acctagcccgacatggagaatacgcaccgttcgcacgggttctgaatttat cagggattaacaacctcgaacatggactctatcgaattctaccccgggttc agaaaactgaaatcacacacagtcagacacta gccgtcctcagccagaaac gagaaa aaaagcttcgcggatccaa ttgatgatgagcatgtcaggcat tga ttgtataaaatatcccacagggcagcttatcacccatggaagagtgagtgc aaaacataacgatgggaacctgaaagatagaagcgagaattctaccccggg aacctgtgccctttcaggttgactgtatattgttcaaagaagtggcagctg aatgcatgaagaggtac attggcacaccttatgagggaatt gtaagcttcg cggatcctt tcaatatgctgaaacgcgagagaaaccg cgtgtcaactgttt cacagttggcgaagagattctcaaaaggattgctttcaggccaaggaccca tgaaattggtgatggcttttatagcgaattctaccccgggttatgtgagga cacaatgacctacaaatgcccccggatcactgagacg gaacctgaagacat tgactgttggtgcaa tgaagcttcgcggatcc once these nucleic acid sequences ( or segments of the chimera ) were identified , each segment was then prepared by pcr amplification . synthetic chimeras were designed to produce pcr amplicons of different sizes ( as indicated in fig3 ) than the amplified fragments from the original pathogenic genome ( to prevent that any contamination with stimulant could create false positives ). the chimera containing sequences corresponding to biological threat agents having rna genomes was inserted in the plasmid vector pbluscript skii . a plasmid drawing comprising the whole chimera is described in fig5 , that shows the location in the plasmid vector of segments specific to each biothreat agent ( separated by a barn h1 restriction site ), as well as the positions of restriction enzymes ( saci and xhoi ) at the extremes of the insert . the correct design and construction of the chimerical simulants ( one for dna agents and the other for rna agents ) was experimentally confirmed by releasing the inserts from the plasmid vector by digestion with one of the intersegment restriction enzymes ( bamh1 ), performing multiplex pcr ( using as primers the oligonucleotides underlined in sequences 1 - 26 ), and subsequent electrophoretic analysis shown in fig6 . the two vertical columns pointed by arrows in the gel in fig6 correspond to nucleic acid fragments of the expected size ( as indicated in fig3 ) for agents whose genome is rna ( bands in column pointed by short downward arrow ), and nucleic acids of the expected size ( as indicated in fig2 ) for agents whose genome is dna ( bands in column pointed by long downward arrow ). the names of the agents are aligned to the corresponding fragments and their sizes are indicated ( in base pairs , bp ) at each side of the image representing the gel electrophoresis analysis . sambrook , j ., e . f . fritsch , and t . maniatis . 1989 . molecular cloning : a laboratory manual , 2nd ed . cold spring harbor laboratory press , cold spring harbor , n . y . bartlett j . m . s ., stirling d ., eds . 2003 . pcr protocols , 2 nd ed . ( volume 226 in the series methods in molecular biology .) humana press , totowa , n . j . thompson j . d ., gibson t . j ., plewniak f ., jeanmougin f ., and higgins d . g . the clustal_x windows interface : flexible strategies for multiple sequence alignment by quality analysis tools . nucleic acids res . 1997 dec . 15 ; 25 ( 24 ): 4876 - 82 . the foregoing description of embodiments of the present invention provides an exemplary illustration and description , but is not intended to be exhaustive or to limit the invention to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from practice of the invention .	2
referring to fig1 a thin walled sleeve 10 is illustrated having a premachined window 12 . sleeve 10 is preferably constructed of steel with a thickness of from 0 . 125 inch to 0 . 250 inch . a preferred thickness of 0 . 197 inch is selected to facilitate relatively easy swaging yet provide sufficient resiliency in the sleeve to ensure a close proximity of a liner extending therethrough to said sleeve sufficient to facilitate bridging of a particular matter which would otherwise pass between said sleeve and said liner to contaminate produced fluids . in another preferred embodiment the liner is sealed against said sleeve . in a preferred embodiment , bands 13 are positioned around sleeve 10 to aid in sealing and anchoring sleeve 10 against casing 20 . bands 13 are preferably elastomeric . it should be understood that one or more bands 13 may be employed as desired . the bands are visible in fig1 and 10 but are not visible in other figures because they are compressed between sleeve 10 and the casing of the borehole . fig2 schematically illustrates a running tool 14 on which sleeve 10 is mounted for being run into the hole ( not shown ). running tool 14 may be any one of several commercially available running tools capable of releasably retaining a sleeve to be run downhole . running tool 14 does however include a schematically illustrated locating dog 16 unique to applications of the thin walled sleeve 10 . locating dog 16 preferably is mounted on pin 18 which includes a torsional spring ( not shown ). locating dog 16 follows an id of a casing 20 until it reaches a milled window 22 whereat locating dog 16 automatically protrudes through window 22 while running tool 14 proceeds farther downhole . as locating dog 16 reaches a lower vee 24 of window 22 , it will orient itself both linearly and rotationally to window 22 . because sleeve 10 is carefully oriented on running tool 14 at the surface to place locating dog 16 in a selected position relative to premachined window 12 , the action of locating dog 16 in vee 24 linearly and rotationally orients sleeve 10 to the milled window 22 . once sleeve 10 is oriented properly within the hole , running tool 14 is used to swage an uphole end 26 , a downhole end 28 or both 26 and 28 into contact with an id 30 of casing 20 . one preferred method for swaging sleeve 10 is to employ an inflatable swaging device incorporated into the running tool . if both uphole end 26 and downhole end 28 are intended to be swaged then preferably two inflatable tools will be utilized simultaneously . fig3 illustrates , schematically , sleeve 10 swaged at uphole end 26 and downhole end 28 . referring to fig4 an alternate construction for new wells is disclosed wherein casing 32 is premachined with a window and includes recess 34 which is of sufficient dimension and configuration to receive a preinstalled sleeve 10 while providing an id 36 of sleeve 10 which substantially equals id 38 of casing 32 . by employing such casing 32 there is no restriction at the junction which might otherwise be problematic with respect to tools passing through the junction . as best illustrated in fig3 and 4 , window 12 in sleeve 10 is preferably of smaller dimension than the window 22 ( in fig3 ) and 42 ( in fig4 ) so that a lateral liner being urged into a sealing engagement at the junction will seal against the id 36 of sleeve 10 at window 12 . referring to fig5 the depiction of fig4 has been repeated but with a lateral liner installed . thus , it is illustrated that flange 44 of lateral liner 46 is seated against the window 12 in sleeve 10 and is sealed thereto . it should be noted that at the interface ( arrow 48 ) may be an elastomeric sealing material such as polyurethane or a metal sealing material such as bronze or steel . it should also be noted that it is possible to machine the premachined window 12 slightly smaller than liner 46 to provide an interference fit with the liner 10 . because of the proximity of the sleeve to the liner in the area of the premachined window , sand and other particulate matter from the area of the junction 50 is substantially excluded from the wellbore system . this can be by one of bridging or sealing depending upon the tightness of the liner against the sleeve . referring to fig6 - 13 , a sequential illustration of one embodiment for installing the sand device is illustrated . in fig6 casing 20 is illustrated with a whipstock 52 therein oriented and maintained in place by anchor 54 . in fig7 a drill string 56 is illustrated being introduced to the downhole environment just prior to contact with whipstock 52 . referring to fig8 a milled window 22 and lateral borehole 58 are illustrated . referring to fig9 the whipstock 52 has been removed from the wellbore leaving anchor 54 in place . it should be noted that anchor 54 is not required for installation of the sand exclusion device described herein but could be used if desired as a locating device . referring to fig1 , a running tool 14 as described hereinabove , has been introduced to the downhole environment and into the vicinity of lateral borehole 58 . dog 16 orients linearly and rotationally to milled window 22 . once dog 16 has landed in vee 24 , as described above , the sleeve 10 is swaged with inflatable packer 60 which is illustrated in fig1 . referring to fig1 , the swaged sleeve 10 is left in position within the wellbore and anchored to casing 20 with window 12 oriented linearly and rotationally to borehole 58 . fig1 illustrates a lateral liner 60 installed with flange 62 firmly seated against sleeve 10 and creating a seal thereagainst with either an elastomeric sealant such as polyurethane , metal - to - metal seal or other suitable seal . the above discussed method for orienting rotationally and linearly using dog 16 , while a preferred embodiment , is but one embodiment . another preferred embodiment referring to fig1 and 15 is to stab into anchor 54 with a running tool 80 having an orientation anchor 82 so that sleeve 10 is orientable to the milled window ( not shown in subject figure ) based upon the original whipstock anchor 54 and not the vee 24 of the window . the orientation anchor 82 further seals the downhole end and thus removes the need to swage the downhole end of sleeve 10 . the uphole end therefore is the only end needing swaging . fig1 illustrates the uphole end swaged as has been previously described herein . in another embodiment referring to fig1 , a schematic illustration carrying identical numerals for identical components is provided for understanding of another preferred arrangement where the sand exclusion sleeve 10 is employed in connection with a hook hanger liner 70 having hook 72 to engage with vee 24 . although a flange 44 is not available in this embodiment , an interference fit between liner 70 and sleeve 10 is nevertheless crated which causes the bridging of particulates and thus their exclusion from the junction . it should be noted that while the foregoing method for creating a sand excluding junction is effective , it is only necessary to place the sleeve 10 at a desired location , and run a liner through the premachined winds and into close enough proximity therewith to facilitate bridging of particulate matter . swaging the sleeve in place is a preferred operation as well . milling of a window in the primary casing and drilling a lateral borehole may have been accomplished as part of an earlier operation . while preferred embodiments of the invention have been shown and described , various modifications and substitutions may be made thereto without departing from the spirit and scope of the invention . accordingly , it is to be understood that the present invention has been described by way of illustration and not limitation .	4
fig2 a , 2 b and 2 c are a top view and two section views along different axes ( aa and bb of fig2 a ) of a flash memory cell in accordance with one embodiment of the invention . as shown in fig2 ( b ), the inter - poly oxide in the conventional flash memory is replaced with air gap by releasing the sacrificial between the control gate and the floating gate . the two ends of the control gate are anchored on the isolation area . the movement of the control gate is controlled by proper voltage biasing applied as shown in fig3 , which is a cross section view along bb line . the control gate bends toward the floating gate and touch it as long as the voltage drop across them exceeds a certain pull - in voltage . the potential of the floating gate is determined by the coupling of the floating gate to the source , drain , well , and control gate . the coupling ratio of the floating gate to the source , drain , well , and control gate can be adjusted by properly designing the gate oxide thickness and the air gap height . the floating gate is more coupled to the source / drain / well instead of to the control gate in a properly designed memory cell . the coupling coefficients are defined as : here c s , c d , c b and c g are the capacitance of the floating gate to the source , drain , well and control gate , respectively , while α s , α d , α b and α g are the corresponding coupling ratio coefficients respectively . a set of typical coupling ratio coefficients for conventional flash memory are given as follows : α s = 0 . 1 , α d = 0 . 1 , α b = 0 . 6 and α g = 0 . 2 . the floating gate potential can be expressed as : here q is the charge stored in the floating gate . for simplicity , q is assumed to be 0 at the beginning of the programming / erasing pulse . the voltage difference between the floating gate and the control gate is the programming / erasing voltage . it is expressed as : please note that in the proposed memory cell , the floating gate is more coupled to the well comparing to the conventional flash memory so we can control the potential on the floating gate more effectively by adjusting the well bias . another benefit is that small floating gate can be used , so there is less coupling between adjacent floating gates in the memory array , while tall floating gate is required to achieve a large coupling to the control gate in conventional flash memory . with equation ( 6 ), we then can estimate the needed voltage in order to make the proposed memory cell functional . fig4 shows the dimension of a single micro - electro - mechanical flash memory cell in 0 . 13 μm technology . here , e is young &# 39 ; s modulus ( 1 . 6 gpa for poly - si ), w is channel length , l is cell width , h is the thickness of the control gate . plugging in the numbers as shown in the embodiment of fig4 , the required pull - in voltage is 1 . 02v , much lower than the state - of - the - art flash memory operation voltage . as scaling continues , we could scale h , l , g with the same factor such that operating voltage scales the same factor as well . so the proposed memory is very scaling friendly . the factor that will affect the retention time of the proposed memory cell is discharge in the air gap . in the 19 th century , paschen , a german scientist , conducted experiments to determine electrical arc characteristics as ambient pressure changed . at higher pressure , the breakdown voltage is a function of the gas pressure and the width of the gap . and townsend avalanche is the dominant mechanism for breakdown . fig5 is shown the “ paschen curve ” for air , two flat parallel copper electrodes for pressures between 30 mtorr and 760 torr . it is predicted that as the pressure is reduced below a few torr ( as shown in the diagram below ) the curve of breakdown voltage versus pressure reaches a minimum , and then , as pressure is further reduced , rises steeply again . however , paschen curve did not predict the breakdown accurately for the narrow gaps as often used in micro - electro - mechanical systems . in narrow gaps , there are few ionizable molecules which could be approximately treated as in vacuum . field emission will be the main breakdown mechanism and is estimated to be 1v / nm for vacuum . the embodiment of this invention can stand up to 5 v . and the required voltage for proper operation is 2 v . hence , discharging will not happen in the proposed memory cell . in operations , there are no electrons tunneling happening through gate oxide . thus , the quality of the gate oxide is conserved . thus , superior retention time performance is obtained in the embodiment of this invention . array operation will now be described with reference to the top view of a nand memory array is shown in fig6 . all the cells along each bit line share one p - well . the p - well corresponding to the bit line “ bl ” are labeled as “ pw ”. detailed operation of programming , reading , erasing will be given below . to be concise , programming is done by injecting electrons into the floating gate as an example . the operation could also be done by removing electrons from the floating gate by flipping the bias polarity . write operation ( programming “ 1 ”)— in fig6 , only the selected cell is programmed while the other cells are prevented from being programmed . the word line “ wl 2 ” and bit line “ pw 3 ” is biased at − 1 . 0v and 1 . 0v , respectively , while other word lines and p - well are grounded . all of the bit lines are floated . the potential of the source and drain junction of the cell ( wl 2 , bl 3 ) will follow the potential of its well and reaches 0 . 3v for the worse case , assuming that a turn on voltage of a pn junction is 0 . 7v . programming voltages v prog = v cg − v fg ( potential difference between the control gate and the floating gate ) for each cell are : v prog =− 1 . 46v on the selected cell ( wl 2 , pw 3 ). along the word line “ wl 1 ”, “ wl 3 ” and “ wm 4 ”, v prog = 0v on the cell that shares any one of the bit line “ bl 1 ”, “ bl 2 ” and “ bl 4 ”. along the bit line “ bl 3 ”, v prog =− 0 . 66v on the cell that shares any one of the word line “ wl 1 ”, “ wl 3 ” and “ wl 4 ”. along the word line “ wl 2 ”, v prog =− 0 . 8v for every cell except the selected cell . since the pull - in voltage is calculated to be 1 . 02v , it is obvious that only the selected cell will be programmed , while all of the other cells will be immune to “ soft programming ”. ( b ) write operation ( programming “ 0 ”)— in this operation , the bias are adjusted such that there is no pull - in happening . the floating gate remains in the previous state of no electrons , corresponding to a “ 0 ” state . ( c ) read operation — during read operation , just like conventional nand flash memory , both select transistors are enabled , causing a conditional discharge of the bit line . ( d ) erase operation — during the erasing cycle , every word line is biased at 2 . 0v , every p - well is biased at 1v and the bit lines are floated . according to equation ( 6 ), the erasing voltage for each cell will be approximately 1 . 5v depending on the amount of electrons stored in the floating gate . then the whole block is erased simultaneously . during erasure , all the cell modules will be programmed to become depletion devices . individual cell erasure is possible with proper biasing . ( e ) multi - bit operation — as described in the previous section , the proposed memory cell could perform multi - bit operation . this is done by adjusting the potential difference of the control gate and the floating gate through appropriate biasing of the control gate and the well . so we could control the amount of the electrons injected into the floating gate to achieve multi - bit operation . 5 ) comparison with other memory technology — table 2 illustrates a performance comparison among volatile memory ( dram and sram ), nonvolatile memory ( flash , fram , mram and phase change memory ) devices and the embodiment of this invention . among the other nonvolatile memory technologies , flash memory is the only memory compatible with the current cmos process flow . the observation of table 2 is that the embodiment of this invention inherits almost all the advantages of the conventional flash memory technology . meanwhile , it solves the problems that conventional flash memory technology faces today , such as high voltage , low speed and scaling issue . comparing to other novel memory technology , the embodiment of this invention does not involve new materials , has good compatibility with cmos , low power consumption , and demonstrates high performance . in an alternative embodiment , a simpler memory cell design does not include a floating gate electrode . the moveable element mostly comprises a single gate electrode . the cell can have a thin (& lt ; 1 nm ) coating layer ; the resistance between the source and drain will depend on the position of the gate electrode . for example , the single - gate memory device could be an n - channel mos transistor with a high - work - function gate electrode ( e . g ., heavily p - type doped poly - si ). when the gate electrode is close to ( or in contact ) with the gate insulator overlying the channel region , the threshold voltage of the transistor is high , so that it is off ( i . e ., high resistance between the source and drain ). when the gate electrode is suspended away from the gate insulator , the threshold voltage of the transistor is low ( due to the classic “ short channel effect ”), so that it is on ( i . e ., low resistance between the source and drain ). the process flow to fabricate the memory is demonstrated in the following steps illustrated in the cross sections of fig7 a - 7 h : a ) the starting material is a p - type doped silicon substrate . after n - well and p - well formation , channel implantation is done to adjust the threshold voltage of the memory cells , as shown in fig7 a . a 5 nm gate oxide is grown thermally , followed by deposition of a 20 nm n + in - situ doped amorphous silicon film layer as the floating gate . then a 50 nm nitride is deposited and patterned as a hard mask . the nitride width defines the channel width of the memory cells . c ) a dry etching method etches holes through the floating gate , gate oxide , p - well and portion of the n - well . d ) silicon dioxide is deposited on top of the wafer . chemical mechanical polishing method ( cmp ) polishes the oxide to form shallow trench isolation ( sti ). g ) after germanium film is patterned , a 100 nm n + in - situ doped poly - silicon layer is deposited . ( fig7 g ). ( h - a ) a 50 nm germanium film is deposited on top of the poly - silicon layer , followed by deposition of 100 nm silicon dioxide hard mask . then word lines are patterned . ( fig7 h - a ). the cross - section along the bit line direction is shown in fig7 ( h - b ). ( h - b ) cross - section view along bit line direction after patterning and etching of word lines in shown in fig7 h ( b ). ( i ) a thin layer of germanium film (− 15 nm ) is deposited and is etched back to form germanium spacers . the source / drain of the memory cells are implanted ( fig7 i ). ( note : from this step on , only a cross - section along bit line direction is shown , except that cross - section along word line direction will be shown in the poly - silicon release step .) ( j ) then a thick silicon oxide layer is deposited as the passivation layer . ( fig7 j ). ( k ) after the germanium film is selectively etched by hot water , the poly - silicon word lines are released . the cross - section along the bit line direction ( fig7 k 1 ) and the cross - section along the word line direction ( fig7 k 2 ) are shown . vent holes that are used to release the control gate are sealed after release . then a standard backend process finishes the memory array fabrication . the invention provides a low - voltage , high speed , superior retention time , and high density micro - electro - mechanical flash memory . since the electrons are injected into the floating gate via a direct current from the control gate , the novel flash cell offers program / erase speed as fast as nanoseconds as well as low voltage operation . the memory core density is comparable to the state - of - the - art flash memory , while the peripheral circuit can be aggressively scaled to achieve high density memory chip . additionally , the scalability of the proposed memory is very good which offers a solution beyond the 65 nm technology node . while the invention has been described with reference to specific embodiments , the description is illustrative of the invention and is not to be construed as limiting the invention . various modifications and applications may occur to those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims .	7
fig1 depicts a block diagram of communications system 10 for exchanging modulated data between a transmitter 12 and a receiver 14 via a communications link 16 . communications link 16 may be an air link for satellite communications or hard - wired interconnection , such as an electrical connection or fiber optic connection . transmitter 12 includes a modulator 18 . modulator 18 receives a data stream at a baseband frequency and modulates the data stream utilizing a quadrature amplitude modulation ( qam ) format . in particular , modulator 18 modulates the data utilizing a m - ary qam modulation format . typically modulator 18 modulates data bits of the data stream onto an analog carrier wave using mixer 22 . during modulation , modulator 18 identifies for each bit pattern a symbol that includes a in - phase and quadrature - phase component , and maps the symbols into a m - ary constellation pattern , as will be described in greater detail herein . modulator 18 may be any quadrature amplitude modulator suitable for implementing the m - ary constellations as described herein . modulator 18 outputs a radio frequency ( rf ) signal at a baseband frequency . typically for satellite communications , the rf signal is up - converted to a high frequency for transmission . a mixer 22 up - converts the baseband frequency with a high frequency signal , such as cos ( ω 0 t ). mixer 22 up - converts the in - phase and quadrature - phase representation of the complex voltage from modulator 18 to a single high frequency rf signal . the up - converted rf signal is then applied to amplifier 24 to significantly increase the signal gain for transmission . operation of the mixing step and amplification step for a transmitter of this type is well understood by those skilled in the art . the up - converted , amplified signal from amplifier 24 is applied to rf filter 26 for subsequent rf filtering , such as may be required by federal communications commission ( fcc ) requirements . the filtered signal is output to an antenna 30 for transmission to receiver 14 . in the configuration of fig1 , amplifier 24 introduces a distortion into the signal output by modulator 18 . the output for amplifier 24 , which is applied to rf filter 26 has an inherent distortion . as will be described in greater detail herein with respect to fig3 and 4 , modulator 18 operates so as to introduce a predistortion into the signal output by modulator 18 and applied to mixer 22 . amplifier 24 thus adjusts the predistorted signal to output a distortion compensated signal input to rf filter 26 . antenna 30 receives the filtered signal and outputs over communications link 16 a communications signal which is received by antenna 32 of transmitter 12 . antenna 32 is connected to an amplifier 34 , which is preferably a low - noise , linear amplifier . note that although communication system 10 is shown as having a wireless communications link 16 , communications link 16 may be a hard - wired connection , as described above . in such a situation , antennas 30 and 32 are unnecessary . the signal received by antenna 32 at receiver 14 is input to a filter 36 . filter 36 provides initial filtering of the received signal to filter channel noise and the like . typically , filter 36 is closely matched to the transmitted signal frequency . the output of filter 36 is applied to a mixer 38 to down - convert the rf signal to an intermediate frequency signal by mixing the rf signal with a high frequency cos ( ω 0 t ) signal . the down - converted signal from mixer 38 includes baseband in - phase and quadrature - phase components . the down - converted signal is applied to low - pass filter 40 to provide filtering at baseband frequencies . thus , in receiver 14 , filter 36 acts as a course filter . the filtered baseband signal from low - pass filter 40 is applied to a demodulator 42 . demodulator 42 demodulates the received signal in accordance with the m - ary qam format implemented in modulator 18 . demodulator 42 thus outputs the data initially modulated by modulator 18 . in a particular feature of the subject invention , fig2 depicts a 24 - ary qam constellation arranged on a cartesian coordinate system defined by an in - phase axis 46 and quadrature - phase axis 48 . the 24 - ary constellation of fig2 includes an upper amplitude level 50 and a lower amplitude level 52 . upper amplitude level 50 and lower amplitude level 52 represent differing power levels for driving amplifier 24 of fig1 . upper amplitude level 50 represents the peak power of amplifier 24 , and lower amplitude level 52 represents a power level less than the peak power of amplifier 24 . a plurality of upper amplitude symbols 54 are arranged on upper amplitude level 50 . similarly , a plurality of lower amplitude symbols 56 are arranged on lower amplitude level 52 . in the 24 - ary constellation of fig2 , 16 upper amplitude symbols 54 are arranged along upper amplitude level 50 , and 8 lower amplitude symbols 56 are arranged along lower amplitude level 52 . amplitude levels 50 , 52 of the 24 - ary constellation of fig2 define two concentric circles with the upper amplitude level 50 having an amplitude greater than lower amplitude level 52 . upper amplitude level 52 has a unit radius of 1 , and inner amplitude level 52 has a radius of 0 . 54 . upper amplitude symbols 54 are separated along the upper amplitude level 50 by 22 . 5 ° with one upper amplitude symbols 54 located at cartesion coordinates x = 1 and y = 0 , ( 1 , 0 ). similarly , lower amplitude symbols 56 are arranged along lower amplitude level 52 and are separated by 45 °, with one lower amplitude symbol 56 located at cartesian coordinate x = 0 . 54 and y = 0 , ( 0 . 54 , 0 ). the 24 - ary constellation enables modulation of an average 4 . 58 bit word or symbol . to implement a practical 24 - ary system requires mapping of a large number of binary bits ( m ) to a number ( m / 4 . 58 ) of 24 - ary symbols . the arrangement of symbols of upper amplitude level 50 and lower amplitude 56 is particularly selected to maximize the number of points in which amplifier 24 can operate at saturation . in particular , by placing the maximum number of points on upper amplitude level 50 , amplifier 24 operates in saturation mode for transmission of the maximum number of symbols . the symbols placed on lower amplitude level 52 represent operation of amplifier 24 in a backed - off mode . however , due to signal - to - noise - ratio ( snr ) considerations , not all points can be placed on upper amplitude level 52 . arranging and placing symbols on each of upper amplitude level 50 and lower amplitude level 52 preferrably maximizes the number of symbols for which amplifier 24 operates in saturation mode while pursuing good performance in the presence of noise . fig3 depicts a constellation similar to fig2 , but shows a 32 - ary constellation for use by modulator 18 of fig1 . the 32 - ary constellation of fig3 enables modulation of up to a 5 bit word or symbol . the 32 - ary constellation of fig3 includes three amplitude levels : a first amplitude level 60 , a second amplitude level 62 , and a third amplitude level 64 . first amplitude level 60 has an amplitude greater than second amplitude level 62 , and second amplitude level 62 has a greater amplitude than third amplitude level 64 . each amplitude level 60 , 62 , 64 defines three concentric circles . first amplitude level 60 includes first amplitude symbols 66 , second amplitude level 62 includes second amplitude symbols 68 , and third amplitude level 64 includes third amplitude symbols 70 . first amplitude level 60 has a unit radius of 1 , second amplitude level 62 has a radius of 0 . 662 , and third amplitude level 64 has a radius of 0 . 25 . first amplitude level 60 includes 16 first amplitude level symbols 66 , second amplitude level 62 includes 12 second amplitude symbols 68 , and third amplitude level 64 includes four third amplitude symbols 70 . the following chart lists the position of each of the 32 points in polar coordinates and in cartesian coordinates . symbols 1 – 16 define first amplitude symbols 66 , symbols 17 – 28 define second amplitude symbols 68 , and symbols 29 – 32 define third amplitude symbols 70 . as can be seen in the chart , each first amplitude symbol 66 is separated by 22 . 5 °, each second amplitude symbol 68 is separated by 30 °, and each third amplitude symbol 70 is separated by 90 °. similarly to fig2 , amplitude levels 60 , 62 , and 64 are selected to maximize the number of symbols for which amplifier 24 operates in saturation . further , second amplitude level 62 and third amplitude level 64 are selected so that amplifier 24 operates as efficiently as possible when amplifying the symbols placed on second amplitude level 62 and third amplitude level 64 . further yet , the symbols are selected in order to provide suitable signal - to - noise ration for the symbols placed on each restective amplitude level . as discussed above , modulator 18 introduces a predistortion into the signal output by modulator 18 and applied to mixer 22 . amplifier 24 thus distorts the predistorted signal to output a desired signal for input to rf filter 26 . fig4 depicts a constellation diagram similar to the constellation diagram of fig3 . the symbols , however , fig4 are arranged to show a sample , predistorted constellation output by modulator 18 . it should be noted that similar symbols from fig3 have been referenced using the same reference number but including a prime (′) to designate the predistorted symbol . the constellation diagram of fig4 represents the output from modulator 18 . the constellation diagram of fig3 represents a preferred arrangement for the 32 - ary constellation diagram . amplifier 24 receives symbols arranged in accordance with fig4 and outputs symbols arranged in accordance with fig3 . fig5 depicts a 64 - ary constellation utilized for qam by modulator 18 . the 64 - ary constellation is depicted as a four level constellation on a cartesian coordinate system having an in - phase axis 46 and a quadrature - phase axis 48 . the 64 - ary constellation includes a first amplitude level 76 , a second amplitude level 78 , a third amplitude level 80 , and fourth amplitude level 82 . as previously described , each respective amplitude level has a plurality of first amplitude symbols 84 , second amplitude symbols 86 , third amplitude symbols 88 , and fourth amplitude symbols 90 . first amplitude level 76 has a radius of 1 , second amplitude level 78 has a radius of 0 . 75 , third amplitude level 80 has a radius of 0 . 54 , and fourth amplitude level has a radius of 0 . 308 . first amplitude level 76 includes 24 first amplitude symbols 84 , second amplitude level 78 includes 16 second amplitude symbols 86 , third amplitude level 80 includes 16 third amplitude symbols , and fourth amplitude level includes eight fourth amplitude symbols 90 . first amplitude symbols 84 are separated by 15 °, with one first amplitude symbols 84 falling at cartesian coordinates x = 0 . 980785 and y = 0 . 195 ( 0 . 980785 , 0 . 195 ). second amplitude symbols 86 are separated by 22 . 5 °, with one second amplitude symbols 86 being located at x = 0 and y = 0 . 75 , ( 0 , 0 . 75 ). third amplitude symbols 88 are arranged similarly to second amplitude symbols 86 , within one third amplitude symbol 88 located at x = 0 . 54 and y = 0 , ( 0 . 54 , 0 ). fourth amplitude symbols 90 are separated by 45 °, with a fourth amplitude symbol being located at x = 0 . 308 and y = 0 , ( 0 . 308 , 0 ). alternative four ring implementations to those described with respect to fig3 may be utilized . for example , a 62 - ary constellation may have four rings having 32 , 16 , 12 , and 4 respective symbols . each ring may have respective amplitude levels of 1 . 0 , 0 . 75 , 0 . 54 , and 0 . 33 . an alternate four - ring implementation may include four rings having 32 , 16 , 8 , and 8 respective symbols . the amplitude level of each respective ring may be 1 . 0 , 0 . 8 , 0 . 6 , and 0 . 4 . fig6 depicts a second implementation of a 64 - ary constellation . the 64 - ary constellation of fig6 is implemented as a 5 - level constellation . the constellation enables encoding of up to a 6 bit word . the 64 - ary constellation of fig6 includes a first amplitude level 92 , a second amplitude level 94 , a third amplitude level 96 , a fourth amplitude level 98 , and fifth amplitude level 100 . the respective amplitude levels include respective first amplitude symbols 102 , second amplitude symbols 104 , third amplitude symbols 106 , fourth amplitude symbols 108 , and fifth amplitude symbols 110 . first amplitude level 92 has a unit radius of 1 ; second amplitude level 94 has a radius of 0 . 75 ; third amplitude level 96 has a radius of 0 . 516 ; fourth amplitude level 98 has a radius of 0 . 323 ; and fifth amplitude level 100 has a radius of 0 . 141 . first amplitude level 92 has 24 first amplitude symbols 102 ; second amplitude level 94 has 16 second amplitude symbols 104 ; third amplitude level 96 has 12 third amplitude symbols 106 ; fourth amplitude level 98 has eight fourth amplitude symbols 108 ; and fifth amplitude symbols 100 has four fifth amplitude symbols 110 . first amplitude symbols 102 are separated by 15 °, with one first symbol 102 located at coordinates x = 1 , y = 0 , ( 1 , 0 ). second amplitude symbols 104 are separated by 22 . 5 °, with a second amplitude symbol 104 located at coordinates x = 0 . 738965 , y = 0 ( 0 . 738965 , 0 ). third amplitude symbols 106 are separated by 30 °, with one third amplitude symbol 106 being located at coordinates x = 0 . 511516 and y = 0 . 067342301 ( 0 . 5115616 , 0 . 067342301 ). fourth amplitude symbols 108 are separated by 45 °, with one fourth amplitude symbol 108 located at coordinate x = 0 . 323195 , y = 0 , ( 0 . 323195 , 0 ). fifth amplitude symbols 110 are separated by 90 °, with one fifth amplitude symbol 110 located at cartesian coordinates x = 0 . 130657 and y = 0 . 54120018 , ( 0 . 130657 , 0 . 54120018 ). similarly , as described above , for each 64 - ary constellation of fig5 and 6 , the number of symbol and position of each symbol placed on the respective amplitude levels is selected so that amplifier 24 operates at peak efficiency for the greatest number of symbols . thus , the particular number of amplitude levels and the particular number of symbols placed on each amplitude level and the relative position of each symbol is specifically selected to maximize operation of amplifier 24 . the above - described invention utilizes concentric constellations to provide simple compensation amplitude distortion . by utilizing concentric constellations , the expansion of inner constellations is controlled by one setting for a 24 - ary constellation , two settings for a 32 - ary constellation , and three or four settings , depending upon the number of amplitude levels , for a 64 - ary constellation . the spacing between symbols in each m - ary constellation is selected to arrive at a suitable tradeoff between resolution and power and enables available power . further , fewer amplitude levels may be used when employing the teachings described herein . for example , only three amplitude levels are used rather than five amplitude levels for traditional 32 - qam implementations . further , when compared to conventional square constellations , the circular constellations defined herein utilize peak - power more efficiently . while the invention has been described in its presently preferred form , it is to be understood that there are numerous applications and implementations for the present invention . accordingly , the invention is capable of modification and changes without departing from the spirit of the invention as set forth in the appended claims .	7
fig1 is an exploded view of a battery case embodying the present invention , fig2 is a side view of the battery case shown in fig1 from which the battery is taken away , fig3 is a side view of the battery case containing the battery . fig4 shows the bottom of the battery case shown in fig2 fig5 shows the bottom of the battery case shown in fig3 . the drawings include a battery case 1 for loading the battery 15 , a movable battery contact 2 urged downward against a movable contact spring 11 when the battery is loaded , a release lever 3 fixed on a slide shaft or axis 6 and a release shaft or axis 5 so as to be operated along the direction of the axis and rotation , a change over release 4 fixed on the slide axis 6 and the release axis to switch into a mechanical release in response to the operation of a change over cam . the release axis 5 is fixed on the release lever 3 and the change over lever 4 so as to connect the electromagnetic release axis or release operation member 13 with the mechanical release axis or member 14 when the release is to be mechanically operated . the slide axis 6 is to be rotated with the operation of the change over cam 10 and to move along the axial direction with the electromagnetic release axis 13 when the battery is taken out . an electromagnetic release switch 7 serves for operating the electromagnetic release , a release spring 8 for urging the slide axis 5 upwards and counterclockwise , and a spring stop 9 fixed on the slide axis 6 with the set screw to adjust the strength of the release spring 8 . a change over cam is rotated by the movable contact 2 so as to disconnect the release axis 5 when the battery is loaded , and a movable contact spring 11 urges the movable contact 2 upwards . the drawings further show a fixed contact 12 for battery , an electromagnetic release axis 13 operatively engaged with an unshown release button to open and close the electromagnetic release switch 7 and transmit the operation of the release button to the mechanical release axis 14 when the release is to be mechanically operated , so the mechanical release axis 14 operates the mechanical release mechanism , a battery 15 , a set screw 16 for securing the spring stop , a mechanical release slide plate 17 for disengaging the automatic diaphragm holding lever 22 from the automatic diaphragm lever 21 , and an attraction type magnet 18 for electromagnetic release for attracting the armature 20 against the force of the spring 20a when the current is supplied . an armature 20 disengages the knock lever 19 for disengaging the automatic diaphragm holding lever 22 with the operation of the magnet 18 , and is normally separated from the magnet . an automatic diaphragm lever 21 operates the automatic diaphragm , the shutter mechanism and the mirror driving mechanism , and the automatic diaphragm holding lever for holding the automatic diaphragm lever 21 . the operation of the release change over device of the present invention in accordance with fig1 to 5 is as follows . when in fig1 and 5 the battery is loaded in the battery case 1 , the movable contact 2 is pushed down by the contact of the battery 15 and the portion 2a of the movable contact 2 depresses the portion 10a of the change over cam 10 so as to rotate the change over cam 10 counterclockwise ( of the arrow ). thus , the portion 10b of the change over cam 10 depresses the portion 4a of the change over lever 4 so as to rotate the lever 4 clockwise ( of the arrow ). thus , the release lever 3 and the change over lever 4 withdraw from the connecting position of the electromagnetic release axis 13 and the mechanical release axis 14 , and the condition in fig2 and 5 shifts to the condition in fig3 and 4 . in the state in fig3 and 4 operation of the electromagnetic release axis 13 engaged with the release button ( not shown ) opens and closes only the electromagnetic release switch 7 and does not influence the mechanical release axis 14 so that the mechanical release is not operated . when the battery is then taken away and the condition in fig2 and 5 is established the movable contact 2 , the change over cam 10 , the release lever 3 and the change over lever 4 resume the positions shown in response to the force of the release spring 8 which moves the electromagnetic release axis 13 and the mechanical release axis 14 so are connected to each other , and a mechanical release is possible . although at this time the electromagnetic release switch is also opened and closed , the electromagnetic release is not operated because the battery is taken away . when in this state the release button is depressed down the mechanical release axis 14 is pushed downwards and the mechanical release slide plate 17 presses and rotates the automatic diaphragm holding lever 22 clockwise with the pin 17a . this is done in such a manner that the automatic diaphragm holding lever 22 is disengaged from the automatic diaphragm lever 21 and the lever 21 is rotated clockwise by the force of the spring 21a . this drives the not shown shutter mechanism and so on and carries out the diaphragm closing and the shutter release operation . when using the electromagnetic release the release button is depressed as mentioned above so as to close the switch 7 . current is now supplied to the magnet 18 and the armature 20 is attracted and rotated clockwise so the aperture 20 is disengaged from the knock lever 19 . the knock lever 19 is turned counterclockwise to operate the automatic diaphragm holding lever 22 and disengages the automatic diaphragm lever 21 , so the shutter release operation and so on are carried out . in the above embodiment the change over is carried out by mechanically detecting the position of the movable contact when the battery is loaded in the battery case and not . it goes without saying that any system in accordance with which the change over is carried out by mechanically detecting the presence and the absence of the battery in the battery case will do . for example it is possible to provide a pin for detecting the presence of the battery at the side wall of the battery case . as so far explained in detail in accordance with the embodiments , taking away the battery out of the battery case of the camera changes the electromagnetic release into a mechanical release . because the release button is common for both the mechanical and the electromechanical release the camera can be used without losing operability even when the battery is absent . an extra operation member is unnecessary on the exterior of the camera . also , because the change over device of the present invention is not changed over into the mechanical release mode unless the battery is taken away , the consumed battery is seldom left in the battery case . hence , there is little fear of leakage and production of gas . further in the device of the present invention if the release mechanism is changed over when the battery is consumed , all the mechanically controlled shutter times can be used different from the system for compulsorily operating the shutter mechanism .	6
until recently , there was no requirement for automatic periodic starting of an electric motor driven fire pump , and reliance on the performing of periodic testing were governed by human interest , supported by requirements not rigidly enforced , or even monitored . since that time , however , all new fire pump controllers are equipped to meet the automatic periodic starting requirement of simulated output system pressure decrease to the normal starting pressure , followed by an immediate alarm indication if the fire pump controller fails to start the motor . this invention identifies each of the two components of the fire pump controller most likely to have failed prior to an automatic periodic start attempt . this identification by nontechnical personnel makes correction of the failure much more timely , hence , reducing the out of service time of the fire pump system . this invention makes the periodic testing less dependent on human capability . further , it identifies the two leading causes of failure of the fire pump controller to start the fire pump motor when needed , the contactor coil and the power on / off pressure switch . the distinguishing feature of this invention is the improved data presentation of the fire pump controller component or components failure which enables faster correction of the failed condition . furthermore , this data presentation makes it possible for operating personnel having limited electrical knowledge to provide considerable information to a follow - up technical repair technician . this invention is intended to periodically monitor the readiness of the fire pump controller to start the motor when needed . it is not intended to monitor other deficiencies which may exist in the fire pump system such as closed system discharge valve , open - circuited motor , broken motor - pump coupling and other potential problems . it does not monitor fire pump controller control and alarm components not associated with the starting equipment . now referring to fig1 , the typical electric fire pump system 104 of the prior art can be seen . electrical power input 118 is delivered to the circuit breaker 114 and then delivered to contactor ( sometimes referred to as “ contactor assembly ”) 116 . the contactor 116 is a contactor switch 230 having an electrically operating closing contactor coil 200 , which when activated by power on / off pressure switch 120 will allow electrical power to flow to the electric motor 122 when there is a pressure decrease in sprinkler system 136 . between electric motor 122 and fire pump 132 is a coupling 130 which connects the two in a working relationship . the mechanical output power of the electric motor 122 is delivered to the fire pump 132 where it is converted to hydraulic power in the fire pump 132 and becomes usable power when there is water flow in the sprinkler or standpipe piping system 136 . either the sprinkler or standpipe piping system 136 is normally a static hydraulic system , but becomes dynamic when activated directly or indirectly by heat or smoke , usually during a fire scenario . automatic starting because of a fire is accomplished by sensing the pressure on the sprinkler system 136 at the pump discharge check valve 134 . the resulting rate of water flow is dependent upon the number of sprinkler heads or standpipe hoses 136 opened ; thereby determining the hydraulic power delivered to extinguish the fire . now referring to fig2 a , the monitoring of the typical electrical fire pump system 104 by the periodic tester 100 can be seen . electrical power input 118 is delivered to the circuit breaker 114 and then delivered to contactor 116 . the contactor 116 is a contactor switch 230 having an electrically operating closing contactor coil 200 , which when activated by power on / off pressure switch 120 will allow electrical power to flow to the electric motor 122 when there is a pressure decrease in sprinkler system 136 . automatic starting because of a fire is accomplished by sensing the pressure on the sprinkler system 136 at the pump discharge check valve 134 . the pressure is transmitted by the pilot piping 156 to a power on / off pressure switch 120 . the pilot piping 156 contains two orifice unions 154 which minimize pressure surges to the power on / off pressure switch 120 . fire pump 132 is preferably a centrifugal pump with output characteristics of decreasing pressure with increasing flow . fire pump 132 is connected to the public water supply or any suitable supply of water in great enough amounts to properly extinguish a fire . periodic tester 100 can monitor different versions of the existing systems including those with a solenoid valve 148 and those without . some versions of pilot piping 156 have a solenoid valve 148 to discharge water to waste 150 at the end of the pilot piping 156 . a periodic time clock 140 activates solenoid valve 148 whereupon there is a fairly rapid drop in pressure at the power on / off pressure switch 120 due to the limited water flow through the orifice unions 154 . when the pressure at the power on / off pressure switch 120 falls to the start setting of the power on / off pressure switch 120 as a result of either a fire or an automatic periodic command to start , the electric motor 122 starts . electric motor 122 starts when the power on / off pressure switch 120 activates the contactor 116 via the contactor coil 200 to supply electric power to the electric motor 122 to start . between electric motor 122 and fire pump 132 is a coupling 130 which connects the two in a working relationship . now adding fig3 , fig4 , fig5 , fig6 a , and fig6 b to the consideration , periodic time clock 140 is programmed for repetitive on / off operation with the on time being much shorter than the off time . one complete cycle is usually one week , but can be set for a lesser time if premise protection from fire damage is paramount . there is only one attempt to start on each on - off cycle , whether successful or not . upon periodic time clock 140 closing its contacts , it energizes time delay relay 170 as well as the third control relay 178 ( sometimes referred to as “ cr3 ”). the contact of the periodic time clock does not directly close the contactor 116 to start the fire pump 132 but applies power to solenoid valve 148 causing it to open and start water flow in the water to waste 150 which decreases pressure to the power on / off pressure switch 120 in the fire pump controller 110 . fire pump controller 110 is contained in a housing . if the power on / off pressure switch 120 is functioning properly , then prior to the completion of the timing period set on time delay relay 170 , the power on / off pressure switch contacts 120 will close and cause voltage to be applied to the contactor coil 200 which , if not open or short circuited will energize the contactor 116 to deliver power 118 to start electric motor 122 . lastly , under this normal operating mode , at a slightly later time when time delay relay 170 time period expires , third control relay 178 will dropout , the solenoid valve 148 will close again , and pressure in the pressure sensing line 102 up to the solenoid valve 148 will rise to the pump discharge pressure . the fire pump controller 110 will remain energized until both the running period timer in the controller 110 and the pressure on the power on / off pressure switch 120 exceeds its stop setting . time delay relay 170 does not reset itself until periodic time clock 140 transfers to the off period , thereby providing the single start attempt during each on - off cycle . third control relay 178 has a normally open contact which closes immediately with the transfer of periodic time clock 140 from off to on . this closure energizes alarm time delay relay 172 ( sometimes referred to as “ tdr 1 ”) through the instantaneously closed time delay relay 170 contacts which remains closed and continue to time out until first control relay 174 ( sometimes referred to as “ cr1 ”) energizes . first control relay 174 is connected across two of the three output power terminals of the contactor 116 . the setting of the time delay period of the time delay relay 170 must be greater than the normal interval of time between closure of the power on / off pressure switch contacts and the closure of the contactor 116 in fire pump controller 110 to prevent the conclusion of the single start attempt before the contactor 116 normally closes . now , the malfunction of fire pump controller 110 is added to the consideration and illustrated . as mentioned earlier , the time opening contact of time delay relay 170 must be greater than the time closing contact of alarm time delay relay 172 . the third control relay 178 drops out as time delay relay 170 times out which causes alarm time delay relay 172 to dropout if it is still energized . if in the normally operating sequence , if no water discharges to waste 150 when solenoid valve 148 is opened , a malfunction is present . the malfunction is likely the result of a plugged or otherwise distorted pressure sensing line 102 . if , however water discharges to waste and the pump does not start , then the power on / off pressure switch 120 is most likely unresponsive , improperly set , or otherwise defective , causing the malfunction . or , the malfunction may be a failed contactor coil 200 . the malfunction may be a combination of more than one of the above , or not related to any of the above . at this point , a further analysis of the system is necessary . in the event of this malfunction , alarm time delay relay 172 will time out because first control relay 174 did not pick up which energized first alarm relay 160 ( sometimes referred to as “ ar1 ”) which results in the illumination of failure to start light 180 and the sounding of audible alarm 186 . audible alarm 186 is silenced and failure to start light 180 is extinguished by pressing alarm reset switch 184 . at this point , the periodic tester 100 will remain in the quiescent state until the next operation of the periodic time clock 140 . adding to the consideration , another scenario is when the periodic tester activates a malfunctioning system . in this scenario , the sequence follows the normal sequence and solenoid valve 148 opens and water flows to waste 150 . however , fire pump controller 110 does not start fire pump 132 . alarm time delay relay 172 times out , causing the first alarm relay 160 to pick up and the failure to start light 180 is illuminated , and audible alarm 186 sounds , but , in addition , second control relay 176 ( sometimes referred to as “ cr2 ”) which is connected across contactor coil 200 , is energized which indicates there is voltage present across an open circuited contactor coil 200 . if a short circuited contactor coil 200 occurs , it will burn to an open circuited coil rapidly as there is no overload current protection in the contactor coil circuit 200 . when second control relay 176 is energized , its normally open contact closes which illuminates the coil failure alarm light 182 . in actuality , both failure to start light 180 and coil failure alarm light 182 will illuminate almost simultaneously . when the second control relay 176 is energized but the first control relay 174 has not picked up because of contactor coil 200 failure , the contact of the second control relay 176 will cause the second alarm relay 162 ( sometimes referred to as “ ar2 ”) to pick up and the coil failure alarm light 182 is illuminated . now adding fig4 to the consideration , the contents of cabinet 106 , housing periodic tester 100 , can be clearly seen . first control relay 174 , second control relay 176 , and third control relay 178 are present and interconnected to terminal block 142 . first alarm relay 160 and second alarm relay 162 are present and connected to terminal block 142 and second control relay 176 and third control relay 178 . time delay relay 170 and alarm time delay relay 172 are present and connected to terminal block 142 and first control relay 174 , third control relay 178 , first alarm relay 160 , and second alarm relay 162 . also , the periodic time clock 140 is present and connected to the terminal block 142 , third control relay 178 , time delay relay 170 , first alarm relay 160 , second alarm relay 162 , alarm time delay relay 172 . now adding fig2 b and fig6 b to the consideration , in an alternate embodiment , periodic tester 100 can be retrofitted to an existing system which lacks a solenoid valve 148 . in this embodiment the periodic tester 100 connects directly to the power on / off pressure switch 120 . periodic tester 100 functions the same as described with a few minor variations , mainly in the initial phases . periodic tester 100 directly activates the power on / off pressure switch 120 and simulates a water pressure drop . the periodic tester 100 connects to power on / off pressure switch 120 through connections with terminal block 142 and more specifically with direct connections to terminals 12 and 13 . the periodic tester 100 jumper starts the power on / off pressure switch 120 . a relay switch may be used to jumper start the power on / off pressure switch 120 or any other suitable mechanism to provide the desired connection . in this embodiment , the output from the third control relay 178 is used to jumper start the power on / off pressure switch 120 . referring specifically to fig5 to the consideration , the contents of door 108 , of cabinet 106 which houses periodic tester 100 , can be clearly be seen . door 108 has a series of name plates 210 which indicate which light or signal is represented at each place . door 108 has failure to start light 180 . if the fire pump 132 fails to start during a testing cycle , then failure to start light 180 is activated to indicate the failure . this allows personnel to contact appropriate service technicians to remedy the problem . also , door 108 has coil failure alarm light 182 . if contactor coil 200 is responsible for the failure of fire pump 132 during testing operations , this light is activated . this allows personnel to contact appropriate service technicians to remedy the problem . finally , door 108 has reset button 184 . if the fire pump 132 fails to start during a routine testing operation , audible alarm 186 will sound . personnel can press reset button 184 to shut off audible alarm 186 . an optional embodiment is counter 202 which counts the number of times reset button 184 has been successively reset before appropriate service technicians repair the problem . counter 202 can be reset once the problem has been addressed by an appropriate repair technician . counter 202 can be electrical , mechanical , or any other suitable mechanism . counter 202 can be on the exterior or interior of cabinet 106 . now adding fig7 to the consideration , the components of cabinet 106 can be clearly seen . cabinet 106 is depicted with door 108 in the open position 192 . on the interior of cabinet 106 is the periodic time clock 140 . also , cabinet 106 had lock 190 to prevent unauthorized access to the interior components . terminal block 142 has wiring attaching to failure to start light 180 , coil failure alarm light 182 , reset button 184 , and audible alarm 186 . also , first control relay 174 , second control relay 176 , third control relay 178 are present and interact with coil failure alarm light 182 . moreover , first alarm relay 160 and second alarm relay 162 are present and interact with audible alarm 186 . finally , time delay relay 170 and alarm time delay relay 172 time out . now adding fig8 to the consideration , the cabinet 106 has door 108 in closed position 194 . the exterior surface of door 108 has failure to start light 180 , coil failure alarm light 182 , reset button 184 , and the audible alarm 186 . these emergency warning features are on the exterior of door 108 so any passerby can view the activated light and take appropriate action . also , door 108 has lock 190 which prevents unauthorized people from accessing the interior components of cabinet 106 . this application — taken as a whole with the abstract , specification , claims , and drawings — provides sufficient information for a person having ordinary skill in the art to practice the invention disclosed and claimed herein . any measures necessary to practice this invention are well within the skill of a person having ordinary skill in this art after that person has made a careful study of this disclosure . because of this disclosure and solely because of this disclosure , modification of this tool can become clear to a person having ordinary skill in this particular art . such modifications are clearly covered by this disclosure .	0
this problem is solved according to this invention by the measures contained in the characterizing part of claim 1 ; any further developments of this invention are characterized by the features contained in the dependent claims . according to this invention , the control valve in the compressed - air supply line that leads to the screw or bolt tightener is designed in the form of a pressure - regulating valve which is adjustable with respect to the pressure and the compressed - air supply . this makes it possible to adjust the compressed - air supply to the screw or bolt tightener and thus the kinetic energy delivered by the screw or bolt tightener to the actual situation . these measures also ensure that the accuracy of the screwed connections varies as little as possible , which is of special significance particularly in the case of series assembly . to accomplish this , various control mechanisms can be used . for example , the tightening process may start at a certain cut - in pressure which , after reaching a preset threshold ms of the torque , is increased , for example , to a higher final pressure , which ensures that the screwing and tightening process takes place at different levels of kinetic energy . this is particularly useful for various groups of products , for example , if a magazine containing different sizes of screws and nuts is connected to an electronic measuring and control unit ; as a specific nut is withdrawn , the pressure - regulating valve is automatically set to a certain initial or cut - in pressure by the electronic measuring and control unit , and after a preset threshold value of the torque has been reached , a predetermined final pressure is set as a function of the size of the nut for the remaining screwing and tightening process . according to another variation of this invention , a freely programmable cut - in pressure is set . after a threshold value of the torque has been reached , the pressure is switched to a variable value , and the increase or decrease in pressure is automatically calculated on the basis of the increase or decrease of the torque . the pressure - regulating valve makes it possible to adjust the pressure to any particular screwing and tightening situation ; this means that if , for example , less kinetic energy is required for the screwing and tightening process , the flow of compressed air through the pressure - regulating valve is throttled as required . as explained earlier , this may be accomplished automatically or according to predetermined constant values . this control can be used both with an impulse and with a torque screw or bolt tightener . the pressure - regulating valve is preferably located outside the tool in the compressed - air supply line , thus making it possible to use standard components for the pressure - regulating valve . it is , of course , also possible to integrate the pressure - regulating valve directly into the screw or bolt tightener , thus making it possible for the operator to adjust the kinetic energy on site to the actual screwing and tightening situation . however , in this case , it is not possible to use standard components for the pressure - regulating valve ; instead , the pressure - regulating valve has to be adapted to the tool or vice versa . the result is that the tool itself will be larger . with respect to the measures according to this invention , it is very important that the screwing and tightening process can be modified . for example , in the case of a hard material into which the screw is to be screwed , where fewer impulses are accompanied by a correspondingly higher increase in torque , the increase in torque can be controlled or , more precisely , reduced by means of the pressure - regulating valve , which results in an improvement of the screwing accuracy . below , this invention will be described in greater detail on the basis of a practical example shown in the drawings . fig1 is a diagrammatic view of a screw or bolt tightener which is connected to a control unit , fig2 shows a diagram of the torque characteristics of an impulse screw or bolt tightener , fig3 shows the diagram of the torque characteristics of an impulse screw or bolt tightener with a different control unit , and fig4 shows the torque characteristics of a torque screw or bolt tightener . fig1 shows a screw or bolt tightener 1 which comprises a conventional - type pneumatically operated driving motor . its driving shaft 2 is designed to be able to hold a nut or a nut insert . in addition , the screw or bolt tightener 1 is fitted with a conventional device for recording the torque so that the torque characteristics of a screwed connection can be determined . the signals of the torque characteristics are transmitted via signal line 3 to an external electronic measuring and control unit 4 where the signals are compared to the desired values to control a valve 6 which is located in the compressed - air line 5 . valve 6 has the form of a pressure - regulating valve which ensures that the compressed - air supply or the pressure of the compressed air is controlled as a function of the setting of the valve . this differs from a valve that is simply triggered to open and close in that it is possible to adapt the kinematic [ sic ] energy delivered by the screw or bolt tightener during the screwing and tightening process to the actual situation by appropriately setting the pressure - regulating valve 6 . fig2 shows a control unit which makes it possible to set the pressure - regulating valve and thus the compressed air delivered to the screw or bolt tightener as a function of the torque value and the hardness of the material into which the screw is to be screwed . the cut - in pressure po and the final pressure p1 can be programmed , i . e ., these values are fixed values . this offers advantages especially in the case of a relatively large machine with a magazine that contains several different screws and bolts as certain predetermined values can be assigned to the individual screw and bolt sizes . when a particular size if screw or bolt is taken from the magazine which is connected to the external electronic measuring and control unit 4 , the pressure - regulating valve is set , in this case for a cut - in pressure po and a final pressure p1 , with the values po and p1 depending on the size of screw or bolt chosen . at the beginning of the tightening process , the pressure of the pressure - regulating valve is set to value po ( as seen in fig2 ). as soon as the torque exceeds a specific predetermined threshold value ms , the pressure - regulating valve is switched to pressure p1 . after the valve has been reset , the tightening process continues at a different kinetic energy corresponding to pressure p1 which is higher than pressure po . the left drawing in fig2 shows a case in which the material into which the screw is to be screwed is soft , the right drawing shows a case in which the material into which the screw is to be screwed is hard , which is marked by few impulses or torque peaks but by a higher torque increase from one pulse to the next . fig3 shows a practical example of an impulse screw or bolt tightener , for which the cut - in pressure po can be freely programmed and in which the pressure - regulating valve is switched to a variable pressure increase as soon as a predetermined threshold value ms of the torque has been reached . the variable pressure increase dp is automatically calculated on the basis of the increase of the torque dmd . again , the left drawing of the figure refers to a case in which the material into which the screw is to be screwed is soft and the right drawing shows a case in which the material into which the screw is to be screwed is hard . the advantage of this particular example is that the initial pressure of the pressure - regulating valve for a specific nut size is set to a predetermined value po at the beginning of the tightening process and that an automatic pressure regulation takes place as a function of the increase of the torque as soon as a specific threshold value ms has been reached . this means that the pressure of the compressed - air delivered to the screw or bolt tightener is increased or decreased as a function of the increase in torque . thus , the tool automatically adjusts to the actual screwing and tightening situation as soon as the threshold value ms of the torque has been exceeded . this ensures that the pressure used during the screwing and tightening process is always at the ideal level . this type of control is to be preferred especially in the case of self - tapping screws , for example ; in this case , the resistance at the beginning of the screwing cycle is very high , but as soon as the screw has penetrated the sheet metal , the torque decreases . as a result of the automatic control , the pressure drops to an appropriate value as soon as the screw has pierced the sheet metal , thus reducing the energy with which the tool operates . this means that the stress and strain on the self - tapping screw is reduced , thus considerably reducing the risk of fracturing the screw or destroying the thread . fig4 shows an automatic control for a torque screw or bolt tightener ; in this case , a continuous curve of the torque response is seen instead of the torque peak shown in fig2 and 3 . again , the cut - in pressure po is freely programmable , i . e ., it can be adjusted to fit various product groups , and the switch to a variable pressure takes place as soon as a predetermined threshold value ms of the torque has been reached . this particular embodiment has the same advantages as the practical example described on the basis of fig3 .	1
it has been recognized that conventional library controllers such as ones described above encounter three primary problems . first , the wiring point - to - point harness creates problems in library expansion and large size libraries . second , the centralized controller architecture creates a bottleneck in controlling all the hardware elements of the library . third , because the centralized library controller architecture must retain intimate knowledge about each hardware element it controls , the controller configuration becomes complex and difficult to change or upgrade . the conventional library controller requires extensive wiring to each library hardware element to send / receive motion control signals and receive various sensor inputs . therefore , each library hardware element generally requires multiple wires or electrical connections to the library controller . the library controller wiring harness places severe limitations on the extensibility and overall library configuration of the mass data storage library due to fixed electrical connectivity provisions , wiring length considerations , and mechanical movement of the wiring harness . furthermore , the wiring harness must be extended or replaced when the data storage library is expanded or changed in any way . for example , in order to add a data storage tower , several i / o ports on the library controller must be allocated and physically linked to the data storage tower via separate electrical lines . therefore , the conventional library architecture with fixed point - to - point wiring connections is too rigid and not easily adaptable to mass data storage libraries of any substantial size . such an architecture is also not sufficiently flexible to adapt to scalable library size and configurations to meet changing needs . the centralized library controller architecture also becomes a cause for bottleneck in large sized libraries . because of the large number of i / o and low level communications the library controller must manage and control , a fast and powerful central processing unit ( cpu ) becomes a necessity . even so , slower speed in large libraries is inevitable . furthermore , the conventional mass data storage library controller is required to retain information on the hardware elements it controls . for example , the controller must know which i / o port to use , which motor to actuate , and for how long in order to move the medium transport element to a specific location . such a control protocol is difficult to manage , and to upgrade or change . [ 0017 ] fig1 is a simplified top - level block diagram of a mass data storage library system 10 constructed according to an embodiment of the present invention . library system 10 includes a network 12 such as token ring , local area network ( lan ), ethernet , fiber optic , controller area network ( can ), and the like that links the intelligent library components together . network 12 may couple the library components in any suitable configuration , such as ring , tree , linear , etc . a communications protocol , such as the can serial communications bus protocol defined by the international standard organization ( iso ), tcp / ip , or other suitable protocols may be used to define and provide for transmission of data on network 12 . network 12 is linked to a master library controller 14 , which is a central processing unit ( cpu ) or computing platform that distributes command tasks among all the intelligent library components involved in the execution of the command request . multiple movable data storage elements 16 , such as rotatable storage towers or movable shelving units , are coupled to master library controller 14 via network 12 . mass data storage library 10 may also include fixed data storage elements ( not shown ) which typically need not be linked to master library controller 14 . also coupled to network 12 is one or more medium transport elements 18 , which may each include two primary components , a medium transport mechanism 19 and a gripper assembly 20 , that may be separately coupled to master library controller 14 via network 12 . although not shown in particularity , gripper assembly 20 is coupled to medium transport mechanism 19 , which may move along predetermined paths defined by a track and the like to carry gripper assembly 20 from one location to another according to the commands issued by master library controller 14 . gripper assembly 20 is used to get the data storage media once properly situated , to hold the data storage media during transport , and to put the data storage media in a specified location . network 12 also links a data transfer element controller 22 to master library controller 14 . data transfer element controller 22 is coupled to one or more data transfer elements 24 , whose task is to read from and write to various types of data storage media delivered thereto by medium transport element 18 . data transfer elements 24 may be data cartridge processors which function to retrieve data from or record information to data cartridges . data cartridges may include different types of recording media such as cassettes , compact disks , optical disks , tapes , and the like . mass data storage library system 10 also includes an import / export facility 26 , which is used to add and remove data media to and from the collection in library system 10 . import / export facility 26 also interfaces with medium transport element 18 to receive data media therefrom or provide data media therefor . an operator interface 28 may also be coupled to master library controller via network 12 . operator interface 28 may be a computer terminal , personal computer , computer workstation , touch panel or any suitable device with a display and means to receive data input from an operator , such as a keyboard , mouse , touch pad , touch panel , etc . operator interface 28 may provide text or a graphical interface to convey information about library system 10 , such as current status , error flags , error processing . further , operator interface 28 may provide menus , pull - down menu selections , clickable buttons , tool bars , and other ways to solicit and receive input from the operator , such as operator requests . operator interface 28 may include one or more additional operator interfaces which may be linked to network 12 remotely via radio wave , modem , dial - up , internet , world wide web , scsi ( small computer systems interface ) and other suitable connections . for example , an operator interface may communicate with master library controller 14 via a scsi connection and convey operator or host application software requests thereby . constructed in this manner , master library controller 14 is operable to receive operator requests from the operator via operator interface 28 . operator requests may be high - level commands in the form of “ load cartridge 128 ”, “ read cartridge 128 ”, “ move cartridge 128 to cell 200 ”, “ move cartridge from cell 100 to cell 200 ”, “ eject cartridge 100 ”, “ import cartridge 101 ”, for example . master library controller 14 is operable to intelligently instruct , in parallel , the various intelligent library components that must act in concert to carry out the operator request . for example , master library controller 14 may determine that a logical cell number 100 may house cartridge 128 , and that cell number 100 is assigned to storage tower c . it also determines that data transfer element x is currently available to accept a data cartridge . if more than one medium transport element is part of library system 10 , then master library controller 14 also makes a determination as to which medium transport element is currently available to make the transport . then master library controller 14 may issue specific commands to each intelligent library component . for example , it may instruct data storage tower c to present cell number 100 . to carry out the instruction , data storage tower c rotates until cell number 100 is oriented so that it is accessible to medium transport element 18 . master library controller 14 may also instruct medium transport element 18 to move to storage tower c , and at the same time , instruct gripper assembly 20 to open its clamps , fingers or gripping mechanism to be ready for grasping the data cartridge . while master library controller 14 is carrying out the first operator request of loading a particular data cartridge , it may simultaneously carry out additional operator requests in parallel . compare this to conventional systems where the library controller must retain intimate details of each hardware component and give very specific detailed instructions . for example , instead of telling a data storage tower to “ home ” to return to a predetermined initial position now made possible by the present invention , the library controller must generate an electrical signal on a specific wire connected to the motor of the data storage tower for a computed amount of time or until it receives a signal from the data storage tower that the desired orientation has been reached . [ 0024 ] fig2 is a more detailed block diagram of the mass data storage library system 10 constructed according to an embodiment of the present invention . an exemplary embodiment of master library controller 14 includes a host interface for interacting and communicating with operator interface 28 . master library controller 14 further includes a processing unit 32 , support hardware 34 , and a network connection controller 36 . processing unit 32 provides the computing resources for master library controller 14 , which may be of any computing power suited to the size and demands of library system 10 . processing unit 32 receives operator requests from operator interface 28 and issues instructions or commands to intelligent library components linked by network 12 to carry out the operator requests . processing unit 32 may also execute failure analysis and supervisory functions . support hardware 34 may include any required hardware components , such as i / o ports , random access memory or other data storage , etc . network connection controller 36 may include hardware and software needed to manage and control data transmission on network 12 . for example , software for network connection controller 36 may be responsible for functionalities in the lower layers , such as data link and physical layers , in the osi layered network architecture . intelligent data storage elements 16 each includes a processing unit 42 which is a component of the distributed processing architecture of library system 10 . processing unit 42 makes data storage element 16 an intelligent library component which participates in performing decision making , error analysis , and other tasks to carry out the operator requests from the operator . data storage element 16 also includes a network connection 40 which couples element 16 to network 12 and performs lower layer network functions . support hardware 44 of data storage element 16 may include memory and any other devices . data storage element 16 also includes sensors 46 and motors 48 . sensors 46 may be used to properly position and orient medium transport element 18 to enable gripper assembly 20 to reach for and accurately grasp the targeted data cartridge housed within data storage element 16 . sensor 46 may include optical sensors , bar code scanners , cameras , and any other suitable means of providing feedback to align the medium transport element . further , sensors 46 may also be used to provide feedback regarding the movement of the data storage element itself . motors 48 drive actuators which provide one or more axes of movement of data storage element 16 . for example , storage towers are generally rotatable about a central vertical axis . intelligent medium transport element 18 includes an intelligent medium transport mechanism 19 and intelligent gripper assembly 20 . medium transport mechanism 19 includes a processing unit 50 , network connection 52 , support hardware 54 , sensors 56 and motors 58 . processing unit 50 performs decision making , error analysis , and other tasks to carry out the commands issued by master library controller 14 . network connection 52 provides for lower layer network functions to enable medium transport mechanism 19 to communicate with master library controller 14 and other library components . support hardware 54 may include memory and any other necessary device or components . sensors 56 of medium transport mechanism 19 may include optical sensors , bar code scanners , cameras and other means of receiving feedback regarding the location , position and / or orientation of medium transport mechanism 19 . motors 58 drive the actuators used to move medium transport mechanism 19 from one location to another , such as from a first predetermined position in front of a data storage element 16 to a second predetermined position in front of a data transfer element 24 . gripper assembly 20 includes the mechanism that is used to reach for , grasp and then hold a data cartridge or any other data storage media during transport . gripper assembly 20 includes a processing unit 60 , which shares processing tasks with master library controller 14 and performs certain decision making and error analysis functions . gripper assembly 20 also includes a network connection 62 provides for the interface to transmit data to and receive data from network 12 . a scanner 64 may be a bar code scanner which aids in the locating , positioning and orientation of gripper assembly 20 with respect to data cartridge cells , data transfer element cartridge slots , and other locations into which the gripper must reach to get or put a data cartridge . although scanner 64 is shown as part of gripper assembly 20 , it may be alternatively coupled more less directly to network 12 . other sensors 56 may also be included to provide other position and orientation feedback . gripper assembly 20 also includes support hardware 66 which may include memory and / or other hardware devices and components . motors 70 of gripper assembly 20 drive the actuation of the gripper to enable it to open and close its fingers to rotate the gripper , and to extend and retract the grippers to reach to get and put the data cartridges . intelligent data transfer element controller 22 is also coupled to master library controller 14 via network 12 . data transfer element controller 22 may include a processing unit 72 which shares processing tasks with master library controller 14 such as decision making and error analysis in the management and control of data transfer elements 78 - 82 . data transfer element controller 22 also includes a network connection 74 which interfaces with network 12 to receive data that are addressed therefor . support hardware 76 may include any necessary hardware and couples data transfer elements 78 - 82 to data transfer element controller 22 . data transfer elements 78 - 82 may include data cartridge processors , tape drives , and other devices which are operable to read and write the various types of data storage media in library system 10 . import / export facility 26 includes a processing unit 90 that is part of the distributed control network architecture of library system 10 . processing unit 90 performs decision making , error processing , and other tasks to carry out the instructions from master library controller 14 in response to operator requests entered by the operator . import / export facility 26 also includes a network connection 92 which supports the network protocol implemented on network 12 to receive data . support hardware 94 may include any necessary devices and components . import / export facility 26 further includes actuators 96 , sensors 98 , and motors 100 . actuators 96 and motors 100 enable import / export facility 26 to be rotated or otherwise oriented a certain way in order to accept or eject data media into or from the library . coupling operator interface 28 and network 12 is an intelligent network interface 102 , which may include a network connection 104 , support hardware 106 , and processing unit 108 . intelligent network interface 102 enables operator interface 28 to communicate with master library controller 14 and other intelligent library components via network 12 . intelligent network interface 102 may be a common network interface module that is incorporated into all library components to enable network communications , decision making capabilities , failure analysis , and other functions . [ 0031 ] fig3 is a diagram showing the layered architecture 110 of an exemplary embodiment of the library system . data link layer 112 and physical layer 114 are the lowest layers of the layered architecture , which are responsible for the protocol of transmitting data over network 12 . for example , layers 112 and 114 may be responsible for receiving a data packet , stripping off the destination address , and providing the data contained in the packet to the upper layers . the upper layers are abstraction layers that removes the need for the operator or the master library controller to know specific information about the library components , such as the location of the library components or how a library component accomplishes certain tasks . the uppermost layer may be an operator request layer 116 , which provides a definition of a plurality of operator requests that an operator may issue at the operator interface . the operator requests may include one or more parameters that are also supplied by the operator . the next layer is a master library controller command layer 118 , which interprets the operator requests and generates one or more command messages to carry out the operator request . master library controller command layer is operable to break down the operator request into lower level commands to specific intelligent library components . the master library controller issues the command messages to the intelligent library components , which respond by generating or receiving one or more component level commands or electrical signals to devices such as actuators and motors , and receiving inputs from sensors such as scanners and optical sensors . abstraction layer 120 is responsible for taking a master library controller command and interpreting it into the electrical signals needed to accomplished the requested tasks . [ 0032 ] fig4 a and 4b are flowcharts of an exemplary move data cartridge process 130 as performed by mass data storage library system 10 constructed according to an embodiment of the present invention . assume that an operator issued a request such as “ move cartridge from cell 100 to cell 200 ” at operator interface 28 . alternatively , the operator request may be of the type “ move cartridge 123 to cell 200 ”, which requires another layer of abstraction since master library controller 14 then must first look up the location of cartridge 123 . this operator request may be input as text , or entered by selecting from a list of operator request choices and providing the cell ids as parameters . operator interface 28 sends the operator request to master library controller 14 . in blocks 132 and 134 , a determination is made as to the origin and destination of the move operator request . cell a , the origin , is determined to be cell 100 , and cell b , the destination , is determined to be cell 200 . thereafter in blocks 136 and 138 , a determination is made as to whether cell a ( cell 100 ) is currently occupied and cell b ( cell 200 ) is currently empty . this decision may be made by consulting a look up table that lists all the cells in the library system and the content of each cell . if cell a is occupied and cell b is empty , then the type of data storage element that contains cell a is identified in block 140 . in this scenario , the data storage type is a particular data storage tower , as shown in block 142 . in block 144 , the data storage tower identifier is determined . again , this may be performed by using the same or a different lookup table . in block 146 , a command message is generated and sent to the data storage tower housing cell a that requests it to present cell a . by requesting it to present cell a , the processing unit in data storage tower must first determine its current orientation by receiving sensor inputs . then the processing unit in data storage tower determines how long and in which direction to rotate in order to present cell a so that it may be accessed by the gripper assembly . the processing unit in data storage tower may also continuously receive sensor inputs in order to determine when to halt the rotation . while data storage tower is acting on the present command , master library controller 14 continues in block 148 to determine the media type of the cartridge stored in cell a . in block 150 , the cell &# 39 ; s side is determined . the media type and the cell &# 39 ; s side are information used to adjust the gripper position or orientation . the gripper &# 39 ; s identifier is determined in block 152 . an open command is generated and sent to the gripper assembly , as shown in block 154 . a second command requesting the gripper to move to the cell &# 39 ; s side is also generated and sent to the gripper assembly , as shown in block 156 . this command may request the gripper to position or orient itself to be ready for grasping the cartridge in cell a . in block 158 , a move command is generated and sent to the medium transport mechanism . one or more parameters in the move command provide information on the new location of the medium transport mechanism . the master library controller may simply identify the destination library component , such as data storage tower x , and the medium transport mechanism processing unit is responsible for determining where data storage tower x is and what it must do to position its associated gripper assembly at a location so that it may reach and grip the data cartridge in cell a . it may be seen that these commands may be received by the intelligent library components and performed simultaneously . in blocks 160 - 164 , master library controller 14 determines whether the commands it issued to the various intelligent library components have been carried out without errors unresolved by the components themselves . master library controller 14 may look at the response messages it received from each library component to determine if any unresolved error occurred in positioning the library components . if all commands were executed and no error occurred , then it generates and sends a get command to the gripper assembly , as shown in block 166 . when the gripper has the data cartridge securely held , then it is ready to be moved . in blocks 168 and 170 , the type of data storage element housing the destination cell b is determined to be another data storage tower y . data storage tower y &# 39 ; s identifier is determined , as shown in block 172 . a present command message requesting data storage tower y to present cell b is generated and sent to data storage tower y , as shown in block 174 . upon receiving this command message , data storage tower y rotates or otherwise orients itself so that cell b becomes accessible . in block 176 , a move command message is generated and sent to the medium transport element to request that it moves from data storage tower x to data storage tower y . again , because of distributed processing , the master library controller need not know where data storage tower y is located , or where it is located with respect to data storage tower x , the intelligence needed to make these determinations is contained within the processing unit of the medium transport mechanism . in block 178 , the master library controller determines whether the medium transport successfully completed the move command . the master library controller may do this by looking at the content of a response message from the medium transport mechanism indicates that no error was encountered . further , the master library controller also determines whether data storage tower y was successful in presenting cell b , as shown in block 180 . a determination is then made regarding the cell &# 39 ; s side , as shown in block 182 . the gripper identifier is then determined and used again in an orient command to the gripper assembly , as shown in blocks 184 and 186 . a put command message is then generated and sent to the gripper assembly to request it to put the data cartridge it is holding into cell b , as shown in block 188 . the master library controller then determines whether the gripper put command was successfully completed , as shown in block 190 . the move cartridge process ends in block 192 . whenever an error is not resolvable by the intelligent library components , the master library controller may provide further error processing functions , as shown in block 137 . it may be instructive to provide exemplary command and response message formats and to provide additional description associated with the message formats and operations thereof . the gripper command and response message packets may have the following exemplary data structure : typedef struct { uint8 action ; uint8 angle ; uint8 media ; uint16 parameter1 ; uint16 parameter2 ; } gripper_command ; typedef struct { uint8 status ; uint16 parameter1 ; uint16 parameter2 ; uint16 parameter3 ; } gripper_response ; in the data structure definition above , one - byte size is indicated as “ uint8 ”, which has eight bits ; two bytes are indicated as “ uint16 ”, which have 16 bits . characters , “ char ”, are represented in eight bits , and may form a character string when listed as an array of characters . command value meaning initialize 01 calibrate griper axis to determine location and state of gripper axis home 02 move gripper to a predetermined zero position extend 03 extend gripper forward retract 04 retract gripper backward open 05 open gripper fingers close 06 close gripper fingers pivot 07 pivot ( turn ) gripper get 08 move a cartridge from a location into the gripper put 09 move a cartridge from the gripper into a location push 10 push a cartridge forward test 11 perform gripper test action angle media parameter1 parameter2 01 n / a n / a n / a n / a 02 n / a n / a n / a n / a 03 n / a n / a distance n / a 04 n / a n / a distance n / a 05 n / a n / a n / a n / a 06 n / a n / a n / a n / a 07 angle n / a n / a n / a 08 angle media type get distance n / a 09 angle media type put distance n / a 10 angle media type push distance n / a 11 n / a n / a test type expected result the following table lists the possible status for the response message packet and the respective meaning : status value meaning ok 00 command completed successfully fail 01 command failed with non - specific failure pivot fail 02 pivot failed reach fail 03 reach failed open fail 04 open failed close fail 05 close failed home fail 06 gripper could not move to home position test fail 07 gripper test failed status parameter1 parameter2 parameter3 00 n / a n / a n / a 01 axis 1 axis 2 axis 3 02 specific reason n / a sensor status 03 specific reason distance sensor status 04 specific reason distance sensor status 05 specific reason distance sensor status 06 specific reason distance sensor status 07 specific reason sub - test sensor status as another example , data storage tower command and response message packets may have the following structure : typedef struct { uint8 action ; uint16 param1 ; uint16 param2 ; uint16 param3 ; char volser [ 8 ]; } tower_command ; typedef struct { uint8 status ; uint16 param1 ; uint16 param2 ; uint16 param3 ; char volser [ 8 ]; } tower_response ; action value meaning home 01 determine and move tower to a predetermined zero position rotate 02 rotate to position config0 receive configuration data up - load 04 receive database information down - load 05 report database information status 06 report configuration status test 07 perform tower test action parameter1 parameter2 parameter3 volser 01 n / a n / a n / a n / a 02 position n / a n / a n / a 03 row column media type n / a numbers numbers 04 database database media type bar - code element status label 05 database n / a n / a n / a element 06 config tower taught database n / a valid loaded 07 test expected n / a n / a result the following table lists the tower return status and the respective meaning : status value meaning ok 00 command completed successfully fail 01 command failed with non - specific failure rotate fail 02 tower rotate failed home fail 03 tower could not move to home position db fail 04 configuration or database information incorrect test fail 05 tower test failed status parameter1 parameter2 parameter3 volser 00 n / a n / a n / a bar - code label if requested 01 axis 1 n / a n / a n / a 02 specific n / a sensor n / a reason status 03 specific location sensor n / a reason status 04 specific element n / a n / a reason 05 specific sub - test sensor n / a reason status therefore , a received operator request gives rise to one or more commands intended for one or more intelligent library component . in general , the master library controller determines which data cartridge is involved in the operator request . it then issues command messages to the medium transport element to get the targeted cartridge . movable data storage elements are also issued command messages to present the targeted cartridge or otherwise enable the medium transport element to access the targeted cartridge . the cartridge may simply be moved from one cell to another . the cartridge may also be loaded into a data transfer element for data access , ejected from the library , imported into the library , or subjected to other library functions . operating in this manner , the configuration of the distributed architecture of mass data storage library system may be expanded or otherwise changed without having to make substantial changes to the remaining portions of the system to accomplish the change . further , with distributed processing , master library controller is operable to issue logically defined commands that can be interpreted by the intelligent library components instead of issuing specific electrical signals to specific i / o ports which are coupled to actuators , sensors , motors , and other subcomponents of the library components to effect movement and action . in this manner , the master library controller need not maintain intimate knowledge regarding the manner in which the intelligent library components perform certain tasks . one or more layers of abstraction is therefore created between the master library controller and the generation of electrical signals to create movement in the library system . these layers of abstraction further enhances the flexibility and scalability of the system . it is contemplated by the present invention that the various components of the library system may be linked by a network composed of electrical wiring , optical fiber , radio signals , or other means of communicating data . it is contemplated by the present invention to incorporate the operator interface functionality into the master library controller . in this embodiment , the master library controller includes a display and a means for the operator to enter operator requests . it is further contemplated by the present invention that the operator interface may include a remotely located operator interface which is still operable to communicate with the master library controller via the network or by other electronic communications means . although several embodiments of the present invention and its advantages have been described in detail , it should be understood that mutations , changes , substitutions , transformations , modifications , variations , and alterations can be made therein without departing from the teachings of the present invention , the spirit and scope of the invention being set forth by the appended claims .	6
fig1 and 3 show one embodiment of a suture clip 20 formed in accordance with the present invention . the suture clip 20 includes an upper leg 21 and a lower leg 22 , joined at a flexible hinge 23 . the legs 21 , 22 move about the hinge 23 between an open position ( fig1 ) and a closed position ( fig3 ). the clip 20 is formed of resilient material that normally biases the clip toward the open position , wherein the legs 21 , 22 assume a v - shaped orientation . a first prong 24 and a second prong 25 are attached to the lower leg 22 and extend toward the upper leg 21 . the prongs 24 , 25 are attached between the hinge 23 and the free end 26 of the lower leg 22 . the upper leg 21 has an opening 27 that is located to receive the prongs 24 and 25 whenever the clip 20 is moved to the closed position , as described more fully below . whenever the clip is in the open position , the prongs 24 , 25 extend partly into the opening 27 ( fig2 ). a passageway 28 is defined between the first prong 24 and second prong 25 , and between the lower leg 22 and the upper leg 21 . the passageway 28 has no lateral opening . consequently , one or more sutures 12 may be threaded through the passageway 28 , and the open clip 20 may be slid along the length of the sutures 12 without moving laterally away from the sutures . for example , an open clip 20 may be slid along the sutures that extend from a suturing site that is located inside a joint that is accessible only by surgical instruments . as used herein , the term suturing site means the location adjacent to the tissue to which the suture is connected . the free ends of the sutures 12 that are exposed outside of the joint are threaded through the passageway 28 of the clip , and the clip is slid down the sutures 12 . the clip 20 will remain in contact with the sutures as it is slid to the suturing site because , as noted earlier , the passageway 28 in the open clip 20 has no lateral opening . in this regard , the sutures act as a guide for moving the clip to the suturing site . once in position at the suturing site , the suture is tensed and the clip is closed ( fig3 ) by an appropriate surgical instrument , such as a clamp . the prongs 24 , 25 serve to lock the clip 20 in a closed position . to this end , a hook 29 is formed on the end of the first prong 24 and a correspondingly shaped hook 30 is formed on the second prong 25 . the hooks 29 and 30 extend apart a distance that is greater than the length of the opening 27 in the upper leg 21 . consequently , as the upper leg 21 is forced toward the lower leg 22 , the first prong 24 and second prong 25 are deflected toward one another as the opening 27 is slid over the curved tops of the hooks . once the hooks 29 and 30 extend through the opening 27 , the prongs 24 and 25 snap apart so that the hooks 29 and 30 extend partly over the outer surface 31 of leg 21 near the opening 27 , thereby locking the clip 20 in the closed position . with the clip locked in the closed position , the sutures 12 are firmly pinched between the legs 21 , 22 ( fig3 ) so that the clip is unable to slide along the sutures 12 . as best shown in fig2 a curved platform 32 is formed between the prongs 24 , 25 . the platform 32 provides a surface that is raised slightly above the inner surface 33 of the lower leg 22 . the platform 32 effectively carries the sutures 12 above the inner surface 33 of the lower leg 21 to ensure the sutures 12 will be tightly pinched between the legs 21 , 22 when the clip is closed . the clip 20 is of unitary construction and is preferably made of plastic . the plastic material provides the resiliency for urging the clip 20 into the open position and for permitting deflection of the prongs 24 , 25 as described above . preferably , the clip 20 is made of material that is gradually absorbed . such materials are polyglycolic acid , polyactic acid and trimethylene carbonate copolymers . alternatively , the clip may be formed of permanent or non - absorbable materials , such a acetal homopolymers or copolymers , polyethylene , polyproplylene , and copolymers thereof . fig4 , and 6 show another embodiment of the invention wherein the passageway 128 of the clip 120 is defined by a single prong 124 attached to the end of the lower leg 122 . the hinge 123 biases the clip 120 into a v - shaped open position ( fig5 ). in the embodiment of fig4 the single prong 124 is attached to the distal end of lower leg 122 and extends toward the upper leg 12 -. when the clip is in the open position , the prong 124 is in contact with the free end 126 of upper leg 121 , thereby forming a passageway 128 surrounded by the prong 124 , the lower leg 122 , and the upper leg 121 . the passageway 128 has no lateral opening . any sutures 12 that are threaded through the passageway 128 are , therefore , substantially surrounded . as a result , the open clip 120 may be slid along the sutures 12 without moving laterally away from the sutures . the prong 124 serves to lock the clip 120 in a closed position . a hook 131 is formed on the end of the prong 124 . as the upper leg 121 is forced toward the lower leg 122 , the prong 124 is deflected away from the upper leg 121 as the free end 126 of the upper leg 121 slides over the angled top of the hook . once the hook 131 extends over the upper surface 133 of upper leg 121 , the prong snaps back so that the hook 124 extends partly over the upper surface 133 of leg 121 near the free end 126 , thereby locking the clip 120 in the closed position . when the clip is locked in the closed position , the sutures 12 are firmly pinched between the legs 121 , 122 . fig7 - 11 show another embodiment of the suture clip 220 of the present invention . this embodiment includes an upper leg 221 and a lower leg 222 , connected together at a flexible hinge 223 . as with the other embodiments , this clip is formed of a resilient material that biases the clip toward the open position , wherein the legs 221 , 222 assume a v - shaped orientation . a first prong 224 and a second prong 225 are attached to the lower leg 222 and extend toward the upper leg 221 . the prongs 224 , 225 are attached between the hinge 223 and the free end 226 of lower leg 222 . each prong 224 , 255 includes an inwardly protruding hook 230 , 231 . the upper leg 221 has a first notch 227 located to receive the prong 224 , and a second notch 228 located to receive prong 225 when the clip is forced into the closed and locked position ( fig1 ). when the clip 220 is in the open position ( fig8 ), the hook 230 on prong 224 contacts the leg 221 at one notch 227 , and the hook 231 on prong 225 contacts the leg 221 at the other notch 228 . a passageway 229 is defined between the first prong 224 and the second prong 225 , and between the lower leg 222 and the upper leg 221 . one side 232 of the first prong 224 and the corresponding side 233 of the second prong 225 are curved such that the passageway 229 is essentially circular ( fig8 ) when the clip is in the open position . the passageway 229 has no lateral opening and , as with the other embodiments , the open clip 220 may be slid along the sutures 12 without laterally moving away from them . with the sutures 12 threaded through the passageway 229 , and the clip 220 adjacent to the suturing site , the clip 220 is locked in the closed position . in this regard , the hooks 230 , 231 formed on the end of the first and second prongs 224 , 225 have inclined facing surfaces that permit the upper leg 221 to be forced between the prongs 224 , 225 as the clip 220 is moved into the closed position . as the upper leg 221 is forced toward the lower leg 222 , the first prong 224 and second prong 225 are deflected away from one another as the portions of the upper leg 221 within the notches 227 and 228 push against the inclined surfaces of the hooks 230 , 231 . once the hooks 230 , 231 extend past the notches 227 and 228 , the prongs 224 and 225 snap together so that the hooks 230 , 231 extend partly over the top surface 234 of upper leg 221 , thereby locking the clip 220 in the closed position . with the clip locked in the closed position , the sutures 12 are firmly pinched between the legs 221 , 222 ( fig1 ) so that the clip is unable to slide along the sutures 12 . while the present invention has been described in accordance with several embodiments , it is recognized that variations and changes may be made therein without departing from the scope of the invention as set forth in the claims .	0
referring now to fig1 and 2 , an exemplary embodiment of the invention is described in connection with tendon - to - tendon or ligament - to - ligament repair . in this embodiment , a soft tissue anchor assembly 10 comprises a helical anchor 12 and a core portion or tendon fiber retaining member 14 . helical anchor 12 has proximal and distal ends 16 , 18 and retaining member 14 likewise has proximal and distal ends 20 , 22 . the distal end 18 of helical anchor 12 extends distally beyond the distal end 22 of retaining member 14 and is sharpened to a point 24 to aid in insertion . in addition , retaining member 14 is tapered at its distal end 22 creating a space 26 between coils 13 of the helical anchor 12 and the outside surface 28 of the retaining member 14 for receiving and retaining tendon or ligament fibers therein , at least at a location near distal ends 18 , 22 as will be discussed more fully below . the proximal end 16 of helical anchor 12 is fixed to retaining member 14 at its proximal end 20 . this may be accomplished in various ways , however , in the preferred embodiment , the proximal end 16 of helical anchor 12 is retained in a slot 30 that extends along a longitudinal axis of retaining member 14 and is welded such as through a laser or resistance welding operation . the proximal end 20 of retaining member 14 further includes a slot 32 for receiving an insertion tool and , if necessary , a removal tool to be described below . retaining member 14 includes a central longitudinal bore 34 for receiving an elongate , preferably flexible , tensile member as will be described more fully below . the retaining member 14 may be secured to the tensile member by a crimpable stop member 60 provided as a separate member or it may be integral with retaining member 14 , as described in copending application ser . no . 09 / 969 , 947 , or a different type of locking member may be used instead . referring to fig3 - 4 , there is shown another exemplary soft tissue anchor assembly 10 a of the present invention . soft tissue anchor assembly 10 a is similar to the assembly 10 of fig1 and 2 and similar components have been correspondingly numbered . the tissue anchor assembly 10 a comprises first and second helical anchors 12 , 12 a coupled to a retaining member 14 a . the helical anchors 12 , 12 a are arranged so that the coils 13 a of the second helical anchor 12 a are disposed between corresponding coils 13 of the first helical anchor 12 , as best seen in fig3 and 5 . as shown in fig5 the second helical anchor 12 a has a coil diameter which is greater than the coil diameter of the first helical anchor 12 , however the helical anchors 12 , 12 a are otherwise similar . proximal ends 16 , 16 a of the first and second helical anchors 12 , 12 a are secured to the retaining member 14 a within slots 30 , 30 a at the proximal end 20 of the retaining member 14 a , as best seen in fig4 . another exemplary soft tissue anchor assembly 40 is shown in fig6 . the anchor assembly 40 includes an anchor body 42 having a first end 44 and second end 46 . in the exemplary embodiment shown , the anchor body 42 tapers from the second end 46 toward the first end 44 to form a generally frustoconically - shaped section . several barbs extend radially outward from the outer surface of the body and along a circumferential direction of the body so that when anchor assembly 40 is inserted into a tendon or ligament , rotation of the anchor assembly 40 within the tendon or ligament will cause the barbs 48 to engage the fibers of the tendon or ligament . the anchor assembly 40 further includes a central bore 50 extending longitudinally along the body 42 and between the first and second ends 44 , 46 . the central bore 50 is sized for coupling the anchor assembly 40 to an elongate tensile member , such as a flexible suture . in an exemplary embodiment , anchor assembly 40 is formed from an absorbable , or biodegradable , material , such as polylactide or any other suitable material , as is known in the art . while anchor assembly 40 is particularly suited to being formed from an absorbable material , it will be appreciated that any of the implantable devices described herein may be formed from such material . with reference to fig7 there is shown an exemplary anchor assembly 40 a , similar to the anchor assembly 40 of fig6 . the anchor assembly 40 a further includes a second body section 52 adjacent the second end 46 of the anchor body 42 and tapered in a direction opposite the first body section 42 . a central bore 50 a extends longitudinally through the second body section 52 and communicates with the bore 50 of anchor body 42 to provide a continuous passage by which the anchor assembly 40 a may be coupled to an elongate tensile member . in fig8 there is shown an exemplary crimpable stop member 60 having a generally cylindrical shape and including a central bore 62 through the stop member 60 for coupling the stop member 60 to an elongate tensile member . stop member 60 further includes a circumferential groove 64 which facilitates crimping the stop member on an elongate tensile member and also facilitates registration of the stop member 60 with a crimp tool which will be described below . [ 0102 ] fig9 and 10 a illustrate an exemplary anchor assembly insertion tool 70 for inserting soft tissue anchors , such as anchor assembly 10 , 10 a of fig1 - 4 , within a tendon or ligament . insertion tool 70 comprises an elongate body portion 72 having a rotatable knob 74 at a proximal end 76 and having a needle - shaped drive portion 78 ( see fig1 ) at a distal end 80 . the tool 70 may be provided with a guard 81 fixed to the distal end 80 , as depicted in fig9 to protect the drive portion 78 prior to use . a flexible cable or shaft 82 is coupled between knob 74 and needle - shaped drive portion 78 and , in the preferred embodiment , this flexible shaft 82 is both rotated and translated as knob 74 is rotated in the direction of arrows 84 ( see fig1 ). a threaded coupling 86 within the elongate body portion 72 allows the simultaneous rotation and translation around and along axis 88 as knob 74 is rotated . needle - shaped drive portion 78 is rigidly affixed to flexible shaft 82 , as shown in fig1 a , through the use of a coupling member 90 and , preferably , an anchor assembly , such as anchor assembly 10 shown in fig1 - 2 , is retained within a curved , tubular housing 92 which does not rotate but retains rotatable shaft 82 therein . as shown in fig1 a , needle - shaped drive portion 78 includes a needle 94 which extends through anchor assembly 10 and further includes a projecting portion 96 which is complimentary to the tool engaging slot portion 32 of anchor assembly 10 ( shown most clearly in fig1 and 4 ). the projecting portion 96 fits within slot 32 to allow rotation and translation of anchor assembly 10 as the needle 94 is both rotated and translated into a tendon or ligament in the direction of the arrow shown in fig1 a . as more specifically shown in fig1 and 12a , anchor assembly 10 is rotated and translated , or moved axially , into a tendon or ligament 100 generally through an incision 110 proximate a severed end 112 and collagen fibers 114 are captured during this insertion process between the coils 13 of anchor 12 and the outside surface 28 of retaining member 14 . during the insertion process , the coils 13 expand slightly outward away from the outer surface 28 of retaining member 14 due to their inherent spring action and , also due to their spring action , the coils 13 spring back to apply a force against the tendon or ligament fibers 114 and against the outer surface 28 of the retaining member 14 . this forcefully traps fibers 114 and strengthens the connection between anchor assembly 10 and the tendon or ligament fibers 114 . [ 0105 ] fig1 b shows an anchor 10 installed in the tendon 100 and an elongate tensile member 116 routed through bore 34 of anchor 10 and secured with a crimpable stop member 60 as will be described in more detail below . while fig1 b illustrates separate stop member 60 crimped to the elongate tensile member 116 , it will be recognized that a stop member may alternatively be provided as an integral portion of retaining member 14 of anchor 10 , or some other type of locking member may be used as desired . [ 0106 ] fig1 a and 13b illustrate a pistol grip device 120 for driving the shaft 82 of the tool 70 , generally shown in fig9 and 10 . device 120 replaces knob 74 and is coupled to tool 70 by a coupling 138 at the end of flexible shaft 82 to allow one - handed operation by a surgeon . in this embodiment , a firing lever 122 may be actuated toward a handle 124 with a single hand of the surgeon to rotate the firing lever 122 about a pivot 126 and thereby drive a rack gear 128 upwardly , via a connecting pin 130 , to rotate a pinion gear 132 coupled for rotation with flexible shaft 82 . in this embodiment , shaft 82 includes an externally threaded portion 134 and an internally threaded nut 136 is rigidly affixed , so as not to rotate , within device 120 . shaft 82 extends through a tube 139 that is coupled to housing 121 by collar 137 and threaded portion 134 engages the internal threads of nut 136 and as shaft 82 rotates through the interaction of rack and pinion 128 , 132 , shaft 82 also translates to the left , as viewed in fig1 a to move drive portion 78 and anchor assembly 10 ( fig1 a ) into a tendon or ligament 100 . alternatively , if a translation mechanism were not provided , the surgeon could translate the anchor assembly 10 manually into the tendon or ligament 100 by simultaneously pushing the pistol grip handle assembly 120 while actuating the firing lever 122 to rotate shaft 82 . other forms of pistol grip or other one - handed actuators may be used and configured in any number of ways by those of ordinary skill to simultaneously rotate and , optionally , translate shaft 82 . [ 0107 ] fig1 a - 14g illustrate one exemplary method out of many possible methods for utilizing anchor assembly 10 of fig1 to repair a tendon or ligament 100 . in this example , two anchor assemblies 10 are respectively driven into tendon or ligament segments 100 a , 100 b as shown in fig1 a and in a manner as described above . an assembly 140 comprising a distal needle 142 coupled with a flexible elongate tensile member 116 , such as a multi - filament suture , and a preset stop member , such as crimpable stop 60 , crimped onto a proximal end 144 of elongate tensile member 116 is threaded through a first one of the anchor assemblies 10 using a tool 146 a until needle 142 is positioned between tendon or ligament segments 100 a , 100 b as shown in fig1 a . although it may not specifically be stated herein , it is to be understood that passing elongate tensile member 116 through an anchor assembly 10 which has been driven into a tendon or ligament 100 includes passing the elongate tensile member 116 through the tendon or ligament 100 . from the opposite side , a second tool 146 b is used to thread a capturing member , which may be a conventional syringe or vena - puncture needle 148 having a tip 150 , through the second anchor assembly 10 and into the space 152 between tendon or ligament segments 100 a , 100 b . the first needle 142 is then captured by inserting its end into the hollow interior of the syringe needle 148 and the connected assembly is then withdrawn through the second anchor assembly 10 , as shown in fig1 b and 14c . alternatively , elongate tensile member 116 may be pushed through the second anchor assembly 10 without first being captured in space 152 . tendon or ligament segments 100 a , 100 b are then drawn together using the well - secured anchor assemblies 10 as shown in fig1 d and 14e . anchor assembly 10 in ligament segment 100 a is pulled by preset crimp member 60 as anchor assembly 10 in ligament segment 100 b is pushed using a second stop member 60 and a crimp tool 160 . exemplary crimp tool 160 is then used to crimp second stop member 60 onto the flexible elongate tensile member 116 to retain the second anchor assembly 10 in position within segment 100 b . the first anchor assembly 10 is retained in position by the preset stop member 60 as previously described . thus , the tendon or ligament segments 100 a , 100 b are held at the desired positions relative to each other as determined by the surgeon . the excess length of the elongate tensile member 116 is then cut with a cutting tool 154 at a location adjacent the proximal end of the second stop member 60 as generally shown in fig1 f and , as shown in fig1 g , the access incisions 110 a , 110 b are closed , using sutures 156 , for example , and an epitendinous suture 158 , or other means , may be used to further secure the ends of the tendon or ligament segments 100 a , 100 b . [ 0109 ] fig1 shows the jaws 162 , 164 of crimp tool 160 in more detail . a first jaw 162 includes a projection 166 for collapsing stop member 60 against a recess 168 formed in the second jaw 164 . the recess 168 in jaw 164 includes a ridge 170 which engages groove 64 on stop member 60 to help retain stop member 60 in place within the jaws 162 , 164 , such as during shipping and during use by the surgeon . referring to fig1 d and 14e , one or more flexible bars 172 are provided between opposing handles 174 a , 174 b of crimp tool 160 . these bars 172 retain the jaws 162 , 164 at predetermined positions to hold the stop member 60 in place during packaging , shipping and storage , but prevent jaws 162 , 164 from coming together during application of relatively light loads which might otherwise prematurely collapse the stop member 60 . during use by the surgeon , however , the flexible bar or bars 172 do not prevent manual actuation of the handles 174 a , 174 b to bring the jaws 162 , 164 together to collapse the stop member 60 as shown in fig1 e . [ 0110 ] fig1 and 17 illustrate an exemplary removal tool 180 which , in certain cases , may be necessary to remove an anchor assembly 10 . specifically , removal tool 180 is in the general form of a rotatable hand tool , generally similar to a screwdriver , having a handle 179 and shaft 181 , which may be flexible . as best shown in fig1 , tool 180 further includes a head portion 182 having a needle 184 extending from a drive portion 186 . needle 184 extends through the central bore 34 of anchor assembly 10 and drive portion 186 engages slot 32 of anchor assembly 10 in a manner similar to a screwdriver to thereby allow rotation of anchor assembly 10 . in the configuration shown , counterclockwise rotation of tool 180 and anchor assembly 10 will back the anchor assembly 10 out of a tendon or ligament 100 , for example , if the anchor assembly 10 is malpositioned . referring to fig1 a - 18e , an exemplary method for repairing a tendon or ligament which has been cut or severed will now be described . this method is particularly useful because the anchor assembly is inserted into the severed end . in surgery , it is frequently advantageous to approach the repair site in this manner . in fig1 a , an elongate tensile member 116 , such as a multi - filament suture , is inserted into the severed end 112 a of a first tendon segment 100 a . the elongate tensile member 116 has a needle 190 , attached to the distal end which is inserted into the tendon segment 100 a , to facilitate insertion of the elongate tensile member 116 into the tendon segment 100 a . alternatively , the end of elongate tensile member 116 may be sharpened to facilitate insertion into the tendon or ligament segment 100 a . a crimpable stop member 60 is also provided on the elongate tensile member 116 adjacent the needle 190 so that the crimpable stop member 60 is inserted into the tendon segment 100 a with the needle 190 . alternatively , the stop member 60 may be provided pre - clamped to the elongate tensile member 116 , or it may be applied to the elongate tensile member 116 for crimping by the surgeon after an end of the elongate tensile member 116 has been extended outside of the tendon segment 100 a . soft tissue anchor 10 is coupled to the elongate tensile member 116 and is inserted into the severed end 112 a of the first tendon segment 100 a using , for example , insertion tool 70 . referring to fig1 b , soft tissue anchor 10 is driven into tendon segment 100 a to grip fibers 114 of the tendon segment . the needle 190 and elongate tensile member 116 are directed along the tendon segment 100 a and then outside of a longitudinal sidewall of the tendon segment 100 a so that the end of the elongate tensile member 116 extends beyond the sidewall of the tendon segment 100 a , as depicted in fig1 b . the needle 190 is removed by cutting the elongate tensile member 116 using a cutting tool 154 and the stop member 60 may then be crimped to the elongate tensile member 116 using a tool , such as crimp tool 160 previously described . tension is then applied to the elongate tensile member 116 to draw the extended portion of the elongate tensile member 116 and the stop member 60 back within the tendon segment 100 a and to seat the stop member 60 against the soft tissue anchor 10 , as shown in fig1 c . a second soft tissue anchor 10 is coupled to the elongate tensile member 116 and the opposite end of the elongate tensile member 116 is inserted into a second tendon segment 100 b , following the procedure described above , as depicted in fig1 d . after the second needle 190 has been removed , tension is applied to the elongate tensile member 116 while urging a second stop member 60 along the elongate tensile member 116 to seat against the second tissue anchor 10 . tension is continued to be applied to the elongate tensile member 116 while applying force to the stop member 60 and second tissue anchor 10 to approximate the tendon segments 100 a , 100 b , as shown in fig1 e , using for example , crimp tool 160 , as previously described with respect to fig1 d and 14e . after the tendon segments 100 a , 100 b have been approximated and stop member 60 has been crimped , the elongate tensile member 116 may be cut using a cutting tool 154 and sutures may be applied as was described with respect to fig1 f and 14g . while the method for repairing a tendon or ligament has been described above with respect to using one soft tissue anchor 10 in each segment of the tendon or ligament , it will be recognized that two or more soft tissue anchors may be used in each segment , as may be desired , to repair a tendon or ligament . referring to fig1 and 20a , there is shown an exemplary tool 200 for installing a soft tissue anchor into a tendon or ligament and driving a needle and elongate tensile member into the tendon or ligament . the tool 200 includes an elongate tubular housing 202 having a first end 204 and a second end 206 . the first end 204 of the housing 202 is configured to receive a soft tissue anchor 10 and a handle 208 is provided at the second end 206 . as shown in fig2 a , a tubular shaft 210 is disposed within the housing 202 and is coupled with a first knob 218 ( fig1 ) provided on handle 208 at an end opposite the housing 202 . shaft 210 extends through the housing 202 to the first end 204 and is coupled to a drive head 212 having a projecting portion 214 near the first end 204 of the housing 202 . the projecting portion 214 is configured to engage the drive slot 32 on a soft tissue anchor 10 and first knob 218 may be manipulated to rotate the shaft 210 while advancing the shaft 210 to extend beyond the first end 204 of the housing 202 in a manner similar to the operation of the anchor insertion tool 70 described above . accordingly , the soft tissue anchor 10 received in the first end 204 of the housing 202 is driven into a tendon or ligament by the drive head 212 when the first knob 218 is manipulated . the tool 200 further includes a tubular inner member 216 disposed concentrically within the shaft 210 and having an inner channel sized to receive an elongate tensile member 116 such as a multi - filament suture . the tubular inner member 216 is coupled at one end to a second knob 220 located on handle 208 adjacent first knob 218 ( see fig1 ). when the second knob 220 is manipulated , either by rotation or , alternatively , by axial movement , the inner member 216 is advanced along the inner bore 222 of the tubular shaft 210 to extend beyond the first end 204 of the housing 202 . advantageously , when an elongate tensile member 116 disposed within the tubular inner member 216 is provided with a needle 190 , the tubular inner member 216 may be used to advance the needle 190 and elongate tensile member 116 into a tendon or ligament as the second knob 220 is manipulated to advance the inner member 216 . referring to fig2 e , there is shown an alternative exemplary embodiment of tool 200 , wherein housing 202 a is configured to include anti - rotation structure for preventing the tendon 100 from rotating with anchor assembly 10 during installation of the anchor assembly . in the embodiment shown , the anti - rotation structure includes spikes 224 which flare outwardly into a tendon from the first end 204 of housing 202 a when extended from a retracted position within housing 202 a , as disclosed in pct application pct / us99 / 24098 , filed oct . 18 , 1999 and herein incorporated by reference in its entirety . [ 0117 ] fig2 b - 20d illustrate operation of tool 200 to insert a soft tissue anchor assembly 10 within a tendon or ligament 100 and to advance an elongate tensile member 116 into the tendon 100 . in fig2 b , the first end 204 of the housing 202 has been inserted through an incision in the tendon 100 and the first knob 218 has been manipulated to rotate and advance the shaft 210 along the housing 202 so that the anchor assembly 10 is advanced from within the first end 204 of the housing 202 and into the interior of the tendon 100 . as the soft tissue anchor assembly 10 moves forward into the tendon 100 while rotating , the fibers 114 of the tendon 100 are captured between the coils 13 of the helical anchor 12 and the retaining member 14 , as previously described . in fig2 c , the needle 190 and elongate tensile member 116 are advanced beyond the first end 204 of the housing 202 and through the tendon 100 , being urged by the inner member 216 which is advanced by manipulation of the second knob 220 . the needle 190 and elongate tensile member 116 are extended by the inner member 216 until they protrude from the severed end 112 of the tendon 100 . once the needle 190 and elongate tensile member 116 have protruded through the severed end 112 of the tendon 100 , the housing 202 of tool 200 is withdrawn from the tendon 100 through the incision , leaving the soft tissue anchor assembly 10 embedded in the tendon 100 and coupled to the elongate tensile member 116 , as depicted in fig2 d . a stop member 60 may then be coupled to the elongate tensile member 116 and the elongate tensile member 116 pulled to seat the stop member 60 against the soft tissue anchor assembly 10 , similar to the process described above for fig1 b and 18c . referring to fig2 and 22a - 22 c , an exemplary tool 230 for crimping a crimpable stop member 60 and cutting an elongate tensile member 116 will now be described . the crimp - and - cut tool 230 , shown in fig2 , includes an elongate housing member 232 having a first end 234 and a second end 236 . the first end 234 of the tool 230 has a crimp jaw 238 for receiving a crimpable stop member 60 therein . an aperture 239 adjacent crimp jaw 238 permits the elongate tensile member 116 , to which the stop member 60 will be secured , to pass through the housing 232 and holds the elongate tensile member 116 for cutting . a handle 240 , which may include a thumb brace 242 , is provided at the second end 236 of the housing 232 . tool 230 further includes a crimp bit 244 , having a crimping edge 246 , and a cutting member 248 , having a cutting edge 250 , disposed proximate the first end 234 of the housing 232 . the crimp bit 244 and cutting member 248 are moveable with respect to the housing 232 to engage stop member 60 and elongate tensile member 116 , respectively , retained in the crimp jaw 238 and aperture 239 . an actuating structure 252 , shown in this exemplary embodiment in the form of a lever 252 , is pivotally attached by a pin 254 near the second end 236 of the housing 232 . the lever 252 is coupled to the crimp bit 244 and the cutting member 248 , whereby rotation of the lever 252 toward the handle 240 moves the crimp bit 244 and cutting member 248 in a direction toward the crimp jaw 238 and aperture 239 so that stop member 60 is crimped by the crimp bit 244 and elongate tensile member 116 is then cut by cutting member 248 after stop member 60 has been crimped . a biasing member 253 between the handle 240 and the actuating lever 252 keeps the lever 252 in a position relative to the handle 240 whereby the crimping edge 246 and cutting edge 250 of the tool 230 are maintained at a desired position with respect to a stop member 60 retained in crimp jaw 238 . while the actuating structure of crimp - and - cut tool 230 has been depicted and described as a pivotable lever 252 , the actuating structure may have other configurations , such as a sliding lever , a gear train , a push button , or any other structure suitable to initiate movement of crimp bit 244 and cutting member 248 for crimping stop member 60 and cutting elongate tensile member 116 . in the exemplary embodiment shown , the actuating lever 252 is coupled to the crimp bit 244 by a crimp bit engagement arm 256 and to the cutting member 248 by a cutting member engagement arm 258 . the tool 230 may further include a spring element 245 disposed between crimp bit 244 and crimp bit engagement arm 256 to bias crimp bit 244 toward first end 234 and thereby hold a stop member 60 in jaw 238 without crimping the stop member 60 . in an exemplary embodiment , the biasing member 253 maintains the crimp bit engagement arm 256 at a position where crimping edge 246 abuts the stop member 60 , while spring element 245 provides a pressure sufficient to retain the stop member 60 in the crimp jaw 238 without crimping the stop member 60 . biasing member 253 also helps to prevent premature actuation of actuating lever 252 to crimp stop member 60 . in the exemplary embodiment depicted in fig2 , engagement of biasing member 253 with protrusion 251 on actuating lever 252 creates a threshold force which must be overcome to cause a free end 255 of biasing member 253 to move over the protrusion so that actuating lever 252 can be pivoted about pin 254 toward handle 240 . operation of the exemplary cut - and - crimp tool 230 to crimp a stop member 60 and simultaneously cut an elongate tensile member 116 will now be described with respect to fig2 a - 22c . referring to fig2 a - 22b , a crimpable stop member 60 is installed into the crimp jaw 238 of the tool 230 and elongate tensile member 116 coupled to the stop member 60 extends through aperture 239 in the housing 232 . in fig2 b , actuating lever 252 is shown in an extended position , away from the handle 240 , whereby the crimping edge 246 of crimp bit 244 abuts stop member 60 and cutting member 248 is spaced from the elongate tensile member 116 . spring element 245 urges crimp bit 244 toward first end 234 with a force sufficient to retain stop member 60 in jaw 238 . in fig2 c , the actuating lever 252 has been pivoted about pin 254 , in a direction toward the handle 240 , whereby first and second cam surfaces 257 , 259 located at a driving end 260 of the actuating lever 252 urge the crimp bit engagement arm 256 and the cutting member engagement arm 258 , respectively , in a direction toward the first end 234 of housing 232 . as the crimp bit engagement arm 256 and the cutting member engagement arm 258 are moved forward , the crimp bit 244 and cutting member 248 are forced into engagement with the stop member 60 and elongate tensile member 116 , respectively , whereby the crimping edge 246 of the crimp bit 244 crimps the stop member 60 and the cutting edge 250 of cutting member 248 severs the elongate tensile member 116 adjacent the stop member 60 . in an exemplary embodiment , the cam surfaces 257 , 259 on driving end 260 are configured such that crimp bit 244 crimps stop member 60 immediately before cutting edge 250 cuts elongate tensile member 116 . advantageously , the first end 234 of the housing 232 may be inserted within a tendon or ligament to facilitate the crimping of a stop member 60 and cutting of an elongate tensile member 116 during the repair of a tendon or ligament . [ 0124 ] fig2 a - 23f depict an alternative embodiment of the exemplary crimp - and - cut tool 230 a , similar to the crimp - and - cut tool 230 of fig2 and 22 , but having an alternate tip configuration proximate first end 234 . fig2 a - 23e further illustrate a stop member loading device 261 , which may be used to load stop members 60 into the crimp jaw 238 of the crimp - and - cut tool 230 , 230 a . loading tool 261 includes an elongate handle 262 with first and second pins 263 , 264 positioned on a proximal end 265 of the handle 262 , as best depicted in fig2 c . the first pin 263 is configured to receive a stop member 60 and the second pin 264 is configured to engage a recess 266 in the crimp bit 244 whereby the proximal end 265 of the loading tool 261 may be coupled with the first end 234 of the crimp - and - cut tool 230 , 230 a to move crimp bit 244 away from crimp jaw 238 and insert stop member 60 into the crimp jaw 238 . specifically , the second pin 264 is inserted into the recess 266 in the crimp bit 244 through an aperture 267 in a cap plate 268 located near the first end 234 of housing 232 , as illustrated in fig2 d . with the second pin 264 inserted within the recess 266 , the loading tool 261 may be used to slide the crimp bit 244 in a direction toward the second end 236 , against the bias force created by spring member 245 , thereby moving the crimping edge 246 away from the crimp jaw 238 so that stop member 60 positioned on first pin 263 may be placed within the crimp jaw 238 , as shown in fig2 d . after stop member 60 has been inserted within crimp jaw 238 , handle 262 may be rotated in the direction of the arrow in fig2 d , such that second pin 264 is withdrawn from recess 266 in the crimp bit 244 whereby crimp bit 244 is urged toward the first end 234 of housing 232 under the action of the spring member 245 to engage stop member 60 with a pressure sufficient to retain the stop member 60 between the crimp jaw 238 and the crimping edge 246 , as illustrated in fig2 e . when it is desired to crimp the stop member 60 on an elongate tensile member 116 which has been coupled with stop member 60 , the first end 234 of crimp - and - cut tool 230 , 230 a may be positioned proximate a tendon repair location and the actuating lever 252 moved in a direction toward handle 240 to crimp the stop member 60 and severe the elongate tensile member 116 , as illustrated in fig2 f and described in detail above . [ 0125 ] fig2 g depicts another exemplary loading tool 261 a , similar to loading tool 261 of fig2 a , but further including a downwardly extending arm 269 located at the proximal end 265 adjacent first pin 263 . arm 269 is configured to register against the first end 234 of the crimp - and - cut tool 230 , 230 a to facilitate installation of stop member 60 into crimp jaw 238 . with reference to fig2 a - 24d , there is shown another exemplary soft tissue anchor assembly 270 of the present invention , described in conjunction with a method of inserting the soft tissue anchor assembly 270 within a tendon or ligament 100 . as best shown in fig2 b , the exemplary soft tissue anchor assembly 270 comprises a helical coil anchor 272 and an expandable retaining member 274 . the retaining member 274 may be expanded from a first state ( see fig2 a , 24b ) wherein the outer surface of the retaining member 274 is spaced from the interior of the helical anchor 272 to a second , expanded state ( see fig2 c - 24e ) wherein the outer surface of the expandable retaining member 274 engages the interior of the helical anchor 272 . advantageously , the anchor assembly 270 may be inserted within a ligament or tendon 100 whereby the fibers 114 of the ligament or tendon 100 may be captured between helical anchor 272 and the contracted retaining member 274 , whereafter , upon expansion of the retaining member 274 , the fibers 114 will be captured and held between the helical anchor 272 and the expanded retaining member 274 . fig2 e illustrates the retaining member 274 expanded against helical anchor 272 to capture fibers 114 therebetween . with further reference to fig2 a - 24d , a method of installing the anchor assembly 270 will now be described . in fig2 a , the anchor assembly 270 is coupled to an elongate tensile member 116 , having a needle 190 coupled to its leading end , and is inserted into the severed end 112 of a ligament or tendon 100 using an appropriate insertion tool 273 , similar to those previously described . as the tissue anchor 270 is inserted within the tendon 100 , fibers 114 of the tendon 100 are gathered between the helical coil 272 and the contracted retaining member 274 as the helical coil 272 is rotated and advanced into the tendon 100 . in fig2 b , the insertion tool 273 is removed and an expansion actuator 276 , such as a hollow tube installed over elongate tensile member 116 , is positioned proximate the anchor assembly 270 . in fig2 c , the expansion actuator 276 is placed into engagement with the retaining member 274 to expand the retaining member 274 and thereby capture fibers 114 as described above . specifically , the actuator 276 is moved along the elongate tensile member 116 in the direction of arrow 277 while tension is applied to the elongate tensile member 116 in the direction of arrow 278 to compress the retaining member 274 between the needle 190 and the actuator 276 and thereby expand the retaining member 274 . after the retaining member 274 has been expanded , the actuator 276 may be removed from the elongate tensile member 116 as depicted in fig2 d . the opposite end of the elongate tensile member 116 may then be attached to another tendon or ligament segment using methods , for example , similar to those previously described , or to a bone 280 using a bone anchor 282 , as depicted in fig2 f . with reference to fig2 - 26 , methods for repairing a torn achilles tendon using exemplary anchor assemblies of the present invention will now be described . referring to fig2 a , there is shown an achilles tendon which has been severed such that a first tendon segment 100 a , attached to the calcaneus , or heel bone , 286 has separated from a second tendon segment 100 b which is connected to the gastrocnemius ( not shown ) of the calf muscle . in one exemplary method , the severed tendon segments 100 a , 100 b may be repaired by inserting first and second soft tissue anchor assemblies 10 within the first segment of the tendon 100 a through incisions 110 a which have been made in the surface of the tendon segment 100 a and installing third and fourth soft tissue anchor assemblies 10 into the second tendon segment 100 b through corresponding incisions 110 b . soft tissue anchor assemblies 10 may be inserted into the respective tendon segments 100 a , 100 b using , for example , any of the installation tools and methods previously described . if the tissue anchors 10 are installed using insertion tool 70 , then elongate tensile members 116 may be subsequently coupled to the tissue anchors 10 , such as by the method previously described with respect to fig1 a - 14e . if insertion tool 200 is used to install at least some of the anchor assemblies 10 , these anchor assemblies will be installed with elongate tensile members 116 already coupled to them and the elongate tensile members 116 need only be coupled to corresponding anchor assemblies 10 in the other tendon segment , such as by the method described above with respect to fig1 a - 14e . in the exemplary method illustrated in fig2 a - 25b , two elongate tensile members 116 a , 116 b are coupled to anchor assemblies 10 and are inserted within tendon segments 100 a , 100 b . first and second stop members 60 a , 60 b may be provided pre - secured to elongate tensile members 116 a , 116 b or they may be coupled to the elongate tensile members 116 a , 116 b after installation of the elongate tensile members , as previously described . after the anchor assemblies 10 and elongate tensile members 116 have been installed within the respective tendon segments 100 a , 100 b , the first and second elongate tensile members 116 a , 116 b may be tensioned to approximate the severed ends 112 a , 112 b of the tendon segments 100 a , 100 b as shown in fig2 b . after the tendon segments 100 a , 100 b have been approximated , third and fourth stop members 60 a , 60 b are coupled to the elongate tensile members 116 a , 116 b and secured to the elongate tensile members 116 a , 116 b using , for example , crimp tool 160 or crimp - and - cut tool 230 , as previously described . in another exemplary method , the corresponding soft tissue anchor assemblies 10 in the respective tendon segments 100 a , 100 b may be joined using a single elongate tensile member 116 looped through each of the anchor assemblies 10 , as depicted in fig2 a . when the tendon segments 100 a , 100 b are attached using this method , the elongate tensile member 116 may be provided with a stop member 60 pre - secured to an end of the elongate tensile member 116 , or the stop member 60 may be secured to the elongate tensile member 116 in situ using either crimp tool 160 or crimp - and - cut tool 230 . after the elongate tensile member 116 has been coupled to each of the anchor assemblies 10 , tension is applied to the elongate tensile member 116 to approximate the severed ends 112 a , 112 b of the tendon segments 100 a , 100 b , as depicted in fig2 b . a second stop member 60 may then be secured to the elongate tensile member 116 and the excess portion of the elongate tensile member 116 trimmed using a cutting tool 154 . alternatively , crimp - and - cut tool 230 may be used to secure the second stop member 60 and to cut the elongate tensile member 116 . while fig2 and 26 have depicted methods for repairing an achilles tendon through incisions which have been made on the lateral sides of tendon segments 100 a , 100 b , it will be recognized that the soft tissue anchor assemblies 10 and elongate tensile members 116 may alternatively be inserted through the severed ends 112 a , 112 b of the tendon segments 100 a , 100 b as described above with respect to fig1 a - 18e . furthermore , while the methods described above have utilized four soft tissue anchors 10 , it will be recognized that a greater number or a fewer number of soft tissue anchors 10 may be used to repair an achilles tendon , as may be desired . the foregoing methods have focused on tendon repair between severed segments of a tendon or ligament , however , it is sometimes desired to reattach a tendon or ligament to a bone , such as during the repair of a rotator cuff . accordingly , fig2 - 29 illustrate exemplary methods of attaching a ligament or tendon 100 to the humerus bone 290 during a rotator cuff repair . to attach a tendon or ligament 100 to the humerus 290 using elongate tensile members 116 and soft tissue anchor assemblies 10 , the elongate tensile members 116 must be secured to the head 292 of the humerus 290 . in one exemplary method , the surface of the humeral head 292 is prepared , such as by abrading the surface or forming a trough 294 , using a bone burr for example , and holes 296 are drilled through a segment of the humeral head 292 , as depicted in fig2 a . with continued reference to fig2 a , first , second , third and fourth soft tissue anchor assemblies 10 are inserted within the tendon or ligament 100 , such as through incisions 110 formed in a surface of the tendon 100 and using an installation tool such as those previously described . elongate tensile members 116 may either be coupled to at least some of the anchor assemblies 10 prior to installation and driven by an installation tool through the tendon 100 , or elongate tensile members 116 may be coupled to the tissue anchors after installation of the anchor assemblies 10 , as previously described . in the exemplary embodiment depicted in fig2 a , two elongate tensile members 116 a , 116 b are used to secure the tendon 100 to the humeral head 292 whereby each elongate tensile member 116 a , 116 b is coupled to two of the anchor assemblies 10 , near the ends of the elongate tensile members 116 a , 116 b , and intermediate portions of the elongate tensile members 116 a , 116 b are routed through the holes 296 in the humeral head 292 . the elongate tensile members 116 a , 116 b are tensioned to approximate the tendon 100 to the humeral head 292 such that the severed end 112 of the tendon 100 seats in the trough 294 , as depicted in fig2 b . stop members 60 are then secured to the free ends of elongate tensile members 116 a , 116 b , as previously described . [ 0135 ] fig2 a and 28b depict methods of securing a rotator cuff tendon 100 wherein the elongate tensile members 116 are secured to the humeral head 292 using stop members 60 and load distributing members , such as washers 298 . referring to fig2 a , two holes 296 are formed through a segment of the humeral head 292 and two soft tissue anchor assemblies 10 are inserted within the tendon 100 similar to the method described above for fig2 a . an elongate tensile member 116 is routed through each of the anchor assemblies 10 and through the holes 296 such that tension applied to the elongate tensile members 116 approximates the tendon 100 to the humeral head 292 . washers 298 are coupled to each of the elongate tensile members 116 and are secured to the elongate tensile members 116 using stop members 60 . while the load distributing members have been illustrated and described as flat washers 298 , it will be recognized that other types of load distributing members may also be used , such as belleville washers . in fig2 b , another exemplary method of securing the rotator cuff tendon 100 to the humeral head 292 comprises installing first and second soft tissue anchor assemblies 10 within the tendon 100 such that the longitudinal axes of the anchor assemblies 10 are aligned substantially transverse to the longitudinal direction of the tendon 100 . a single elongate tensile member 116 is inserted within the tendon 100 and routed through both anchor assemblies 10 . the ends of the elongate tensile member 116 extend from the tendon 100 and are routed through the holes 296 and secured by washers 298 and stop members 60 , as described above with respect to fig2 a . [ 0137 ] fig2 a - 29b illustrate another exemplary method of securing a rotator cuff tendon 100 to the humeral head 292 wherein a bone anchor 282 is installed proximate the desired attachment site , as depicted in fig2 a . the surface of the humeral head 292 may be prepared at the attachment site , such as by abrading the surface or forming a trough 294 , as previously described . according to this method , one or more soft tissue anchor assemblies 10 are installed within the tendon 100 and at least one elongate tensile member is coupled between the bone anchor 282 and the soft tissue anchor assemblies 10 . tension is applied to the elongate tensile member 116 to approximate the tendon 100 to the attachment site and stop members 60 are secured to the elongate tensile member 116 to fix the position of the tendon 100 proximate the attachment site , as depicted in fig2 b . while the foregoing methods of securing a rotator cuff tendon 100 to the humeral head 292 have been described with respect to fig2 - 29 as utilizing specific quantities of soft tissue anchor assemblies 10 , elongate tensile members 116 , bone anchors 282 , and other implantable devices , it will be recognized that the quantities of these implantable devices may be varied , as may be desired , to secure the tendon 100 to the humeral head 292 , in the general manner described herein , without departing from the present invention . referring to fig3 - 32 , methods and apparatus for securing soft tissue to bones using bone anchors will now be described . in fig3 a there is shown an exemplary bone anchor 300 of the present invention . the bone anchor 300 is configured to be secured within a hole 301 which has been formed in a bone 280 . the bone anchor 300 has a generally cylindrically - shaped body 302 with a tapered first end 304 and a second end 305 having a flared aperture 306 . a central bore 303 extends along the body 302 between the tapered end 304 and the flared aperture 306 . the bore 303 is sized to receive an elongate tensile member 116 , such as a multi - filament suture . the elongate tensile member 116 is secured near the tapered end 304 by a pointed tip 310 and extends through bore 303 to exit the anchor 300 through flared aperture 306 . one or more lateral projections 308 extend outwardly from the body 302 and in a direction toward the flared aperture 306 . the lateral projections 308 are configured to engage the cancellous bone after the anchor 300 has been inserted into the hole 301 to thereby secure the anchor within the bone 280 . advantageously , the flared aperture 306 permits a tendon 100 to be secured substantially perpendicular to the longitudinal axis of the bone anchor 300 using an elongate tensile member 116 , while protecting the elongate tensile member 116 from exposure to sharp corners which may damage the elongate tensile member 116 . as further depicted in fig3 a , the elongate tensile member 116 may be secured at an opposite end to a tendon 100 using a soft tissue anchor , such as anchor assembly 10 , or any of the soft tissue anchors described herein , and a stop member 60 , as previously described . [ 0141 ] fig3 b depicts another exemplary bone anchor 300 a , similar to bone anchor 300 of fig3 a , but further including a flange 311 at second end 305 and extending radially outward from flared aperture 306 . advantageously , flange 311 helps to position bone anchor 300 a at an appropriate depth within hole 301 formed into bone 280 . [ 0142 ] fig3 depicts another exemplary bone anchor 300 b , similar to the bone anchors 300 a , 300 b depicted in fig3 a and 30b , but having a swivel member 312 provided at the second end 305 of the anchor 300 b . the elongate tensile member 116 extends through a bore 314 in the swivel member 312 , whereby a tendon or ligament 100 may be attached substantially perpendicular to the longitudinal axis of the bone anchor 300 b without damaging the elongate tensile member 116 . specifically , swivel member 312 accommodates orientation of the elongate tensile member 116 between the bone anchor 300 b and the tendon or ligament 100 , and may also permit movement of the tendon or ligament 100 without exposing elongate tensile member 116 to sharp edges . referring now to fig3 a and 32b , there is shown yet another exemplary bone anchor 316 of the present invention . bone anchor 316 is similar to the bone anchors 300 , 300 a , 300 b depicted in fig3 and 31 . the anchor 316 has a generally cylindrically - shaped body 318 with a first end having a pointed tip 320 . lateral projections 308 extend outwardly from the body 318 to engage the cancellous bone 280 after the anchor 316 has been inserted into a hole 301 in the bone 280 . a second end 305 of the bone anchor 316 , opposite the pointed tip 320 , includes a crimp member 322 having an aperture 324 sized to receive an elongate tensile member 116 therethrough . as depicted in fig3 b , the crimp member 322 may be crimped to secure the elongate tensile member 116 within the aperture 324 after elongate tensile member has been tensioned to approximate the tendon or ligament 100 to a desired position adjacent the bone anchor 316 . [ 0144 ] fig3 c depicts another exemplary bone anchor 330 and a method for securing a tendon or ligament 100 to a bone 280 . in this embodiment , a bone anchor 330 includes lateral projections in the form of screw threads 332 disposed along a generally cylindrical body 334 . the bone anchor 330 further includes a projection 336 which preferably extends beyond the surface of the bone 280 and has an aperture 338 sized to receive an elongate tensile member 116 therethrough . after the elongate tensile member 116 has been tensioned to position the tendon or ligament 100 at a desired location adjacent the bone anchor 330 , a stop member 60 may be secured to the elongate tensile member 116 to attach the tendon or ligament 100 . the opposite end of the elongate tensile member is secured to the tendon or ligament 100 using a soft tissue anchor , such as anchor assembly 10 , or any of the soft tissue anchors described herein , and a stop member 60 , as previously described . [ 0145 ] fig3 d depicts yet another exemplary bone anchor 340 having a generally cylindrical body 342 and a pointed tip 344 . lateral projections 308 extend outwardly from the cylindrical body 342 to engage the cancellous bone 280 as previously described . the anchor 340 further includes a projection 346 having an aperture 348 configured to receive elongate tensile member 350 that has a series of serrations 352 or other similarly contoured surface along its length , whereby engagement of the serrations 352 with the aperture 348 secures the elongate tensile member 350 to the bone anchor 340 . the opposite end of the elongate tensile member 352 may be secured to a tendon or ligament 100 , using a soft tissue anchor assembly 10 , or any other soft tissue anchor such as those described herein , and a stop member 60 , in a manner similar to that previously described with respect to elongate tensile member 116 . while the projections are depicted in the figures as elongate members and screw threads , the projections may alternatively be barbs , screw threads , spikes , or other structure which is capable of engaging the bone 280 upon insertion into the hole 301 , or after insertion . referring to fig3 , there is shown another exemplary anchor 360 of the present invention which is configured to attach a soft tissue directly to a hard tissue . the anchor 360 has a first portion 362 figured to engage hard tissue , such as bone , and a second portion 364 configured to engage soft tissue . the first portion 362 includes an elongate shaft 366 having screw threads 368 disposed along its length and configured to bore into hard tissue to securely attach the anchor 360 within the hard tissue . alternatively , a plurality of barbs ( not shown ) may be disposed along shaft 366 to permit secure attachment of the anchor 360 within the hard tissue . the second portion 364 of anchor 360 comprises a soft tissue anchor assembly similar to the anchor assembly 10 of fig1 and 2 , wherein the second portion 364 includes a helical anchor 370 and a retaining member 372 . second portion 364 further includes a slot 373 formed into proximal end 374 and configured to engage a drive tool , whereby the anchor 360 may be driven into hard tissue . other features of the second portion 364 are similar to the anchor assembly 10 of fig1 and 2 . as depicted in fig3 , the pitch p 1 of the first portion 362 of the anchor 360 is greater than the pitch p 2 of the second portion 364 to allow soft tissue engaged by the second portion 364 to be compressed while the anchor 360 is being screwed into hard tissue . [ 0148 ] fig3 depicts a top section view of a shoulder joint and illustrates an exemplary use of the anchor 360 to stabilize the shoulder . the anchor 360 is inserted into the scapula 380 near the glenoid socket 382 and through the glenoid labrum 384 to reattach the labrum 384 to near glenoid socket 382 . [ 0149 ] fig3 a - 35c illustrate another apparatus 390 which may be used to reattach the glenoid labrum 384 to the glenoid socket 382 . with reference to fig3 a , the apparatus 390 includes a flexible cable 392 having a tip 394 which is adapted to bore through bone and tissue as the cable 392 is rotated about its longitudinal axis . advantageously , the apparatus 390 may be used to install the cable 392 through the glenoid socket 382 , from a position inside the shoulder capsule , and subsequently through the glenoid labrum 384 as depicted in fig3 b . once the cable 392 has been extended through the glenoid labrum 384 , a soft tissue anchor , such as anchor assembly 10 or any other soft tissue anchor described herein , may be coupled to the cable 392 and inserted into the glenoid labrum 384 to be secured with a stop member 60 according to methods previously described . the opposite end of the cable 392 which extends through the glenoid socket 382 may be secured using a load distributing member , such as washer 396 , having a crimpable portion 396 a . alternatively , a flat washer 298 and stop member 60 may be used to secure cable 392 in a manner similar to that depicted in fig2 a - 28b . other types of load distributing members may be used as well . in an exemplary embodiment , cable 392 is configured to have elasticity in the longitudinal direction , whereby cable 392 may be tensioned to compress the glenoid labrum 384 against the glenoid socket 382 with a desired spring force . alternatively , a relatively inextensible cable 392 may be coupled with a spring element , such as a belleville washer 397 , to create a desired spring force , as depicted in fig3 c . in this embodiment , belleville washer 397 may be secured to the end of the cable 392 using , for example , a stop member 60 . with reference to fig3 - 46 , a method of reattaching a rotator cuff ligament 402 to the humeral head 292 of the humerus 290 will now be described . in preparation for repairing a torn rotator cuff , one or more cannulas 400 a , 400 b , 400 c may be inserted into the shoulder of a patient near the humeral head 292 of the humerus bone 290 , as depicted in fig3 . while the method below is described with respect to using cannulas , it will be recognized that the attending surgeon may alternatively reattach the rotator duff ligament 402 through incisions at appropriate locations without using cannulas and in a manner similar to that herein described . fig3 also illustrates relevant anatomy of the patient , such as the scapula 380 , the acromium 381 and the glenoid labrum 384 . to reattach the rotator cuff tendon 402 to the humeral head 292 , a scalpel 404 , or any other cutting device , such as an electro - surgical cutting device , is inserted through a first cannula 400 a and is used to make an incision , or tenotomy , 406 at a location where it is desired to install a soft tissue anchor . a bone anchor 408 , which may be a conventional bone anchor or any of the bone anchors described herein , is inserted through a second cannula 400 b and is installed to a pre - drilled hole 412 using a bone anchor installation tool 410 . after the incision 406 has been made in the rotator cuff tendon 402 , a soft tissue anchor assembly may be installed within the tendon 402 using installation tool 200 inserted through the first cannula 400 a as depicted in fig3 . as illustrated in fig3 , the attending surgeon manipulates first knob 218 of tool 200 to rotate the soft tissue anchor assembly ( not shown ) while advancing the anchor assembly into the tendon 402 , as was previously described with respect to fig2 a - 20b . after the soft tissue anchor assembly has been secured within the tendon 402 , the attending surgeon may then manipulate the second knob 220 of the installation tool 200 to advance an elongate tensile member 116 , such as a multi - filament suture , through the tendon 402 as illustrated in fig3 and previously described with respect to fig2 c . stop member 60 may be applied to the elongate tensile member 116 by the attending surgeon using , for example , the crimp - and - cut tool 230 , previously described above , as illustrated in fig4 . the elongate tensile member 116 is routed from the end of the tendon 402 to couple with the bone anchor 408 and is pulled out through the second cannula 400 b using forceps 414 or any other appropriate tool as illustrated in fig4 and 41 . once the elongate tensile member 116 has been routed through second cannula 400 b , it may then be drawn tight to approximate the tendon 402 to a desired location adjacent the bone anchor 408 and a second stop member 60 may be applied to the elongate tensile member 116 using , for example , the cut - and - crimp installation tool 230 as illustrated in fig4 and 43 . as shown in fig4 , the tendon 402 is thus fixed to the humeral head 292 in a secure attachment which utilizes the natural strength of the collagen fibers of the tendon 402 while minimizing the amount of foreign material external to the tendon 402 at the repair site . while elongate tensile member 116 may be coupled to anchor assembly 10 prior to installation of the tissue anchor 10 into the tendon 402 and subsequently routed through bone anchor 408 as described above with respect to fig4 and 41 , elongate tensile member 116 may alternatively be routed through the soft tissue anchor 10 and bone anchor 408 using a shuttle suture 416 which has been coupled to the soft tissue anchor 10 and installed , for example , using installation tool 200 as previously described with respect to fig3 - 39 . as illustrated in fig4 a , shuttle suture 416 includes a needle tip 418 and a flexible suture member 420 . the shuttle suture 416 is configured to have a loop 422 through which one end of the elongate tensile member 116 may be inserted . after the shuttle suture 416 has been driven through tendon 402 and routed through bone anchor 408 , it is withdrawn through the second cannula 400 b to shuttle the elongate tensile member 116 through the first cannula 400 a , the soft tissue anchor ( fig4 ), the bone anchor 408 ( see fig4 b ), and the second cannula 400 b using forceps 414 , as illustrated in fig4 . alternatively , shuttle suture 416 may be routed in the opposite direction , entering through second cannula 400 b and being withdrawn from first cannula 400 a , as depicted in fig4 . while the foregoing methods have been described with regard to the installation of a single soft tissue anchor assembly 10 of the present invention , it will be recognized that more than one anchor assembly 10 may be installed into the tendon 402 to affect the repair . for example , fig4 a and 47b illustrate two alternative configurations wherein two anchor assemblies 10 may be inserted into a tendon 402 and coupled to a single bone anchor 408 . in fig4 a , each anchor assembly 10 is coupled to the bone anchor 408 using a separate elongate tensile member 116 . in fig4 b , two anchor assemblies 10 are coupled to a bone anchor 408 using a common elongate tensile member 116 . in a similar fashion , it will be recognized that a single soft tissue anchor assembly 10 may be coupled to two or more bone anchors 408 to affect a tendon repair . furthermore , it will be recognized that , in certain instances , the various steps of methods described herein may be performed in orders other than those described . accordingly , the methods are not limited to being performed in any particular order of steps . referring now to fig4 and 49 , there are shown exemplary soft tissue anchor assemblies similar to the anchor assembly 10 of fig1 and 2 , wherein the anchor assemblies are further configured to be secured to an elongate tensile member and wherein like components are similarly numbered . in fig4 , there is shown an exemplary soft tissue anchor assembly 430 having a stop member 432 integral with the retaining member 146 and configured to engage a contoured surface of an elongate tensile member 434 , which may be coupled to the anchor assembly 430 . in the exemplary embodiment shown , the contour of elongate tensile member 434 includes a series of serrations 436 and integral stop member 432 is configured to engage the serrations 436 to securely fix the anchor assembly 430 to the elongate tensile member 434 . in fig4 , there is shown an exemplary soft tissue anchor assembly 440 wherein the retaining member 14 c includes an integral stop member 442 which is configured to be secured to an elongate tensile member 116 by crimping the integral stop member 442 in a manner similar to the crimping of stop members 60 previously described . referring to fig5 , there is shown yet another exemplary apparatus for repairing a tendon or ligament . the apparatus includes a soft tissue anchor assembly 10 , as depicted in fig1 and 2 , and a stop member 450 which may be secured to a contoured surface of an elongate tensile member 434 . in the exemplary embodiment shown , the stop member 450 is similar to the stop member 60 previously described , and further includes an integral engagement member 454 configured to engage serrations 436 in the elongate tensile member 434 to thereby secure the stop member 450 to the elongate tensile member 434 . referring now to fig5 , there is shown an exemplary anchor assembly 460 for attaching soft tissue to bone . the anchor assembly 460 is similar to the anchor assembly 360 of fig3 and includes first and second portions which may be coupled together to form the anchor assembly 460 . the first portion 462 includes an elongate shaft 468 having an enlarged head 464 at one end and bone engaging structure 470 at an opposite end . the enlarged head 464 includes a slot 466 for receiving a drive tool which facilitates installation of the anchor assembly 460 . in the exemplary embodiment shown , the bone engaging structure 470 includes screw threads 472 , but may alternatively include other structure for engaging the bone , such as barbs ( not shown ) extending outwardly from the shaft 468 . the second portion of the anchor assembly 460 comprises a soft tissue anchor 10 , previously described with respect to fig1 and 2 . as shown in fig5 , the first portion 462 may be coupled to the anchor assembly 10 such as through bore 34 in anchor assembly 10 . advantageously , the anchor assembly 460 may be used to secure soft tissue to a bone in a manner similar to that described for anchor assembly 360 of fig3 . [ 0160 ] fig5 a - 52c illustrate another apparatus for securing soft tissue to a bone . as shown in fig5 a , the apparatus includes a bone anchor 480 which may be inserted into a cavity , such as a drilled hole 301 , formed in a bone 280 . the bone anchor assembly 480 includes a collapsible member 482 which is configured to expand in a direction substantially normal to a lengthwise direction of the member to thereby securely engage the anchor assembly 480 to the bone 280 . in the embodiments illustrated in fig5 a and 52b , the collapsible member 482 is made up of one or more buckling elements which extend outwardly to engage the bone 280 as the anchor assembly 480 is collapsed along its lengthwise direction . the apparatus further includes an elongate tensile member 116 coupled to the bone anchor assembly 480 such as by an end member 484 integral with said collapsible member 482 . alternatively , end member 484 may be secured to elongate tensile member 116 to abut collapsible member 482 as tension is applied to elongate tensile member 116 . to facilitate expanding collapsible member 482 , an actuating member , such as a tube 486 installed over elongate tensile member 116 , may be inserted through the soft tissue 481 to abut the anchor assembly 480 while tension is applied to elongate tensile member 116 to collapse the collapsible member 482 . as illustrated in fig5 c , the elongate tensile member may be secured to the soft tissue 481 using , for example , a soft tissue anchor 10 and a stop member 60 , as previously described . with reference to fig5 and 54a - 54 c , there is shown another exemplary soft tissue anchor assembly 490 similar to the anchor assembly 10 of fig1 and 2 , and including an expandable retaining member 492 . the retaining member 492 is coupled to a helical anchor 12 in the manner previously described , whereby the retaining member and helical anchor may be simultaneously driven into a tendon or ligament to receive fibers of the tendon or ligament between the helical anchor 12 and the retaining member 492 . an expansion member 494 is configured to engage the retaining member 492 to thereby expand the retaining member to grip the fibers of the tendon or ligament between the helical anchor 12 and the retaining member 492 . in the exemplary embodiment shown , retaining member 492 includes one or more slots 496 formed longitudinally along the retaining member 492 to separate the retaining member 492 into outwardly expandable portions 497 . as shown most clearly in fig5 a and 54b , retaining member 492 further includes a bore 34 extending through the retaining member and sized to receive an elongate tensile member 116 therethrough . the retaining member 492 further includes an aperture 498 which is configured to receive expansion member 494 . aperture 498 has a tapered surface 500 which is configured to mate with a corresponding tapered surface 502 on the expansion member 494 , whereby the expandable portions 497 may be driven outward by the interaction between the tapered surfaces 500 , 502 when expansion member 494 is urged into engagement with retaining member 492 as depicted in fig5 b . in an exemplary embodiment , retaining member 492 further includes an annual detent disposed within aperture 498 and configured to engage a corresponding groove 506 formed into expansion member 494 . advantageously , the annular detent 504 engages the groove 506 on the expansion member 494 to secure the expansion member 494 to the retaining member 492 after expandable portions 497 have been expanded outwardly against the helical anchor 12 . anchor assembly 490 , including expansion member 494 , may be secured to an elongate tensile member 116 using a stop member 60 in a manner such as previously described . alternatively , the expansion member 494 may include a crimpable portion 508 that permits the anchor assembly 490 to be secured to an elongate tensile member 116 , as depicted in fig5 a and 54 b . alternatively , expansion member 494 a may be provided pre - secured to an elongate tensile member 116 whereby the retaining member 492 may be expanded by applying tension to elongate tensile member 116 to urge expansion member 494 a into engagement with expandable retaining member 492 to expand the expandable portions 497 as described above and as depicted in fig5 . while the present invention has been illustrated by the description of the various embodiments thereof , and while the embodiments have been described in considerable detail , it is not intended to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . the invention in its broader aspects is therefore not limited to the specific details , representative apparatus and methods and illustrative examples shown and described . accordingly , departures may be made from such details without departing from the scope or spirit of applicant &# 39 ; s general inventive concept .	0
referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown a flowchart of conversion principle from a given duration data set to a target data set ( _m , _s ). first , the given duration data set is retrieved in step 1 a from the database and converted to the iso 8601 format in step 2 a , yielding the intermediary data set whose data set members are then applied to the first and the second equation , yielding the converted duration data set formed by a tuples of months and seconds values . the converted duration data set is then stored back into the database or into a memory device for immediate usage . fig2 shows a flowchart of conversion principle from a converted duration data set ( _m , _s ) to an intermediary iso 8601 duration data set . in step 1 b , the converted duration data set ( _m , _s ) is retrieved from the database . in step 2 b the converted months value _m is compared to a value of 12 . if the converted months value is less than 12 , the months value m is set to the converted months value _m , the years value is set to 0 in step 3 b 1 and step 3 b 2 is skipped . if the converted months value _m is higher than or equal to 12 , then a first integer division of _m by 12 is performed , whereby the months value m is set to a remainder and the years value y is set to an answer of the first integer division in step 3 b 2 . in step 4 b , a second integer division of the converted seconds value _s by a value of 60 is performed , whereby the seconds value s is set to a remainder of the second integer division . in step 5 b , an answer of the second integer division is compared to 60 . if the answer ( x ) of the second integer division is less than 60 , in step 6 b 1 the hours value is set to a value of 0 , the minutes value is set to the answer of the second integer division and step 6 b 2 is skipped . if the answer of the second integer division is higher or equal to 60 , a third integer division of the answer of the second integer division by 60 is performed and the minutes value is set to a remainder of the third integer division in step 6 b 2 . in step 7 b , a fourth integer division of the answer of the third integer division by a value of 24 is performed , whereby the hours value is set to a remainder of the fourth integer division and the days value is set to an answer of the fourth integer division . in step 8 b , all results , meaning the years value y , the months value m , the days value d , the hours value h , the minutes value n and the seconds value s are converted , in other words organized , into the standard iso 8601 format , yielding the intermediary duration data set , which , in step 9 b , is stored back into the database or in a memory entity for further processing . fig3 shows a flowchart of a conversion example for a target duration data set ( _m , _s ) to an intermediary iso 8601 duration data set . in this example , a duration expressed in a format of the target duration data set of ( 1 , 172920 ) is converted into the standard iso 8601 duration data set format , thus , the converted months value is _m = 1 month and the converted seconds value is _s = 172920 seconds . after the set ( 1 , 172920 ) has been retrieved from the database and _m is found to be less than 12 , the month value is set to 1 month and the years value is set to 0 . then _s is divided by 60 , yielding an answer of 2882 and a remainder of 0 . thus , the seconds value equals 0 . the answer 2882 is compared to 60 and found to be less . in a next step , the answer 2882 is divided by 60 and yields an answer of 48 and a remainder of 2 . thus , the minutes value equals 2 . the answer 48 is then divided by 24 and yields an answer of 2 and a remainder of 0 . thus , the days value equals 2 and the hours value equals 0 . now , all the results are converted into the standard iso 8601 format , yielding the intermediary duration data set p0y1ma1dt0h2mb0s , in other words one month , one day and two minutes . the intermediary data set is then stored into memory , optionally in a short form of the standard iso 8601 , containing only relevant , non - zero values , thus p1ma1dt2mb . according to a preferred method , the result of the first equation f1 ( y , m ), being the converted months value _m , is computed by adding the months value m to a factor 12 of the years value y . in other words , in a first step , the equation f1 ( y , m )= _m = 12 * y + m is solved by extracting the years value y and the months value m from the intermediary data set and inserting the two values into the equation f1 ( y , m ), the result of the first equation f1 ( y , m ) yielding the converted months value . in a second step , the result of the second equation f2 ( d , h , n , s ), being the converted seconds value _s , is computed according to following steps : adding the hours value h to a factor 24 of the days value d , yielding a first interim solution , adding the minutes value n to a factor 60 of the first interim solution , yielding a second interim solution , adding the seconds value s to a factor 60 of the second interim solution , yielding the result of the second equation f2 ( d , h , n , s ). in other words , the equation f 2 ( d , h , n , s )= — s = 60 ( 60 ( 24 * d + h )+ n )+ s is solved by extracting the days value d , the hours value h , the minutes value m and the seconds value s from the intermediary data set and inserting the four values into the equation f2 ( d , h , n , s ), the result of the second equation f2 ( d , h , n , s ) yielding the converted months value . the first and the second step are further explained below by an example 1 . example 1 shows a conversion from intermediary iso 8601 duration data sets to a target data set . conversion of a given data set pt2mb . a conversion to the intermediary data set is performed , yielding p0y0ma0dt0h2mb0s . this step is not shown in the example . having the intermediary data set , following associations are performed and inserted in a pair of the two equations , the first equation f1 ( y , m ) and f2 ( d , h , n , s ): y = 0 ; m = 0 ; d = 0 , h = 0 ; n = 2 ; s = 0 ; if we insert this in the two equations , we obtain : thus , the result is a target data set ( _m , _s )=( 0 , 120 ). as can be seen , the minutes value of 2 is expressed in the target data set ( 0 , 120 ) in seconds . conversion of a given data set p1d . a conversion to the intermediary data set is performed , yielding p0y0ma1dt0h0mb0s . this step is not shown in the example . having the intermediary data set , following associations are performed and inserted in a pair of the two equations , the first equation f1 ( y , m ) and f2 ( d , h , n , s ): y = 0 ; m = 0 ; d = 1 , h = 0 ; n = 0 ; s = 0 ; if we insert this into the two equations , we obtain : thus , the result is a target data set ( _m , _s )=( 0 , 86400 ). as can be seen , the days value of 1 is expressed in the target data set ( 0 , 86400 ) in seconds . conversion of a given data set p1y1ma2d . a conversion to the intermediary data set is performed , yielding p0y1ma2dt0h0mb0s . this step is not shown in the example . having the intermediary data set , following associations are performed and inserted in a pair of the two equations , the first equation f1 ( y , m ) and f2 ( d , h , n , s ): y = 1 ; m = 1 ; d = 2 , h = 0 ; n = 0 ; s = 0 ; if we insert this into the two equations , we obtain : thus , the result is a target data set ( _m , _s )=( 13 , 172800 ). the days value of 2 is expressed in the target data set ( 13 , 172800 ) in seconds and the years value is expressed in months . according to a preferred method , the converted duration data set is adapted to be used in a database management system for at least following operations : a summation of the converted months value _m and the converted seconds value _s to a date , a summation of a first converted months value _m 1 and a first converted seconds value _s 1 belonging to a first converted duration data set _m 1 , _s 1 to a second converted months value _m 2 and a second converted seconds value _s 2 belonging to a second converted duration data set _m 2 , _s 2 respectively , a subtraction of the first converted months value _m 1 and the first converted seconds value _s 1 from the second converted months value _m 2 and the second converted seconds value _s 2 respectively . the summation of the first converted duration data set _m 1 , _s 1 to the second converted duration data set _m 2 , _s 2 as well as the subtraction of the first a first converted duration data set _m 1 , _s 1 from the second converted duration data set _m 2 , _s 2 are further explained below by an example 2 . a summation of two converted data sets is performed as follows : ( — m 1 , — s 1 )+( — m 2 , — s 2 )=( — m 1 + — m 2 , — s 1 + — s 2 ) a subtraction between two converted data sets is performed as follows : ( — m 2 , — s 2 )−( — m 1 , — s 1 )=( — m 2 − — m 1 , — s 2 − — s 1 ) as example 2 shows , an advantage of the present method is that arithmetic operations are simple , thus increasing speed of computations in systems implementing the method , as opposed to the prior art , wherein all variables like y , m , d , etc . had each to first be converted in order to be used in arithmetic operations . according to a preferred method , the converted months value _m is stored in an integer data format and the converted seconds value _s is stored in a floating point data format . the target month value , as it is restricted to describe either months or years , only needs integral numbers because smaller time portions than a month are described in days , hours , minutes and seconds . the converted seconds value however uses a floating point type in order to advantageously account for time sensitive processes , requiring sub - second accuracies . according to a preferred method , the converted months value _m and the converted seconds value _s of the converted duration data set _m , _s comprised in the process description data set is converted to the intermediary data set by following the steps of : a1 ) performing a first integer division , whereby the converted months value _m is divided by 12 , a2 ) an answer of the first integer division is stored as the years value y and a remainder of the first integer division is stored as the months value m , a3 ) performing a second integer division , whereby the converted seconds value _s is divided by 60 , a4 ) an answer of the second integer division is stored as a minutes subtotal and a remainder of the second integer division is stored as the seconds value s , a5 ) performing a third integer division , whereby the minutes subtotal is divided by 60 , a6 ) an answer of the third integer division is stored as an hours subtotal and a remainder of the second integer division is stored as the minutes value n , a7 ) performing a fourth integer division , whereby the hours subtotal is divided by 60 , a8 ) an answer of the fourth integer division is stored as the days value d and a remainder of the second integer division is stored as the hours value h , a9 ) creating the intermediary data set by writing the first delimiter p and appending the years value y , the years value field identifier y , the months value m , the months value field identifier ma , the days value d , the days value field identifier d , the second delimiter t , the hours value h , the hours value field identifier h , the minutes value n , the minutes value field identifier mb , the seconds value s and the seconds value field identifier s . this advantageously allows interoperability to higher layer applications , such as graphical user interfaces used for configuration of product chains and product processes , by providing process duration data in a format compatible to the said higher layer applications . a module for implementing the method comprises software code , the software code being adapted to be used as a plug - in , the plug - in being importable into database software systems . advantageously , a flexible possibility of using the method described herein is to incorporate the method in a plug in , the plug in being loadable by a data management system and / or a process modeling software whenever it is needed without having to recompile the said software systems . another module for implementing the method comprises a software library , the software library being adapted to be included into a code base of database software systems . typically , an implementation of the method in a computer program is realized by using for example a dynamic link library which is included into the code of a database management system and compiled together with the said code the present invention makes it possible to handle durations in a precise , reproducible way . it eliminates overhead and approximation problems , as well as allows fast arithmetical operations like summation without having to perform conversions every time an operation has to be carried out . this aspect has the further advantage that it avoids accumulation of conversion errors and / or approximations which , in prior art systems , occur due to numerous back and forth conversions . another advantage lies in storage size reduction , as each converted data set only requires and integer and a floating point storage place , whereas intermediary data sets require several character and variable storage places , this aspect further having the advantage that database access is optimized in terms of speed . the following list of references and abbreviations may aid the reader in understanding the foregoing specification : p = first delimiter y = years value y = years value field identifier m = months value ma = months value field identifier d = days value d = days value field identifier t = second delimiter h = hours value h = hours value field identifier n = minutes value mb = minutes value field identifier s = seconds value s = seconds value field identifier ( _m , _s )= target duration data set _m = converted months value _s = converted seconds value f1 ( y , m )= first equation f2 ( d , h , n , s )= second equation 1 a = retrieve given duration data set 2 a = convert given duration data set to iso form pyymmddthhnmss 3 a = apply the first and the second equation 4 a = store the converted duration data set 1 b = retrieve the converted duration data set 2 b = is m less than 12 ? 3 b 1 = set m = _m 3 b 2 = first integer division of _m by 12 . set m to the remainder of the first integer division and y to the answer of the first integer division 4 b = second integer division of _s by 60 . set s to the remainder of the second integer division 5 b = is the answer of the second integer division less than 60 ? 6 b 1 = set h to zero , set the minutes value to the answer of the second integer division 6 b 2 = third integer division of the answer of the second integer division by 60 . set n to the remainder of the third integer division 7 b = fourth integer division of the answer of the third integer division by 24 . set h to the remainder of the fourth integer division and d to the answer of the fourth integer division . 8 b = convert y , m , d , h , n , s to the iso 8601 standard 9 b = store result of conversion to the iso 8601 standard pyymmddthhnmss .	6
fig1 illustrates the general configuration of sense amps in a memory array . a pulldown sense amp 20 includes cross coupled n - channel transistors q 1 and q 2 , as well as a pulldown transistor q 3 , which is an n - channel transistor driven by a signal designated as lensa . these elements play a part in sensing and amplifying a voltage difference between d and d * caused by shorting a memory cell 22 to d by way of access transistor q 4 . the sources of q 1 and q 2 are connected to a common pulldown node 24 , and the gate of each is connected to the other &# 39 ; s drain . the gate of q 1 also connects to the line d , whereas the gate of q 2 connects to the line d . as discussed above , each line d and its corresponding line d are initially at the same voltage dvc 2 . for purposes of explanation , dvc 2 is assumed to be 1 . 65 volts , or one half of the source voltage v cc , which is 3 . 3 volts . lines d and d * connect to opposite sides of each sense amp 20 . common pulldown nodes 24 found in the sense amp arrays will also be at dvc 2 . a signal sent through the path wl will cause a storage capacitor 150 of particular memory cell 22 to discharge to a line d , thereby slightly changing d &# 39 ; s voltage while the voltage of d * remains at dvc 2 . again , for purposes of explanation , a memory cell discharge will be assumed to cause a 0 . 2 volt difference in d . the pulldown sense amp 20 will then turn on when the common pulldown node 24 is one transistor threshold voltage below d or d , whichever is highest . for instance , if a memory cell 22 is storing a logic 1 , a discharge to d will increase d &# 39 ; s voltage to 1 . 85 volts . as a result , the pulldown sense amp transistor gated by d ( q 2 ) turns on faster than the one gated by d ( q 1 ). with transistor q 2 on , d &# 39 ; s voltage is pulled down from 1 . 65 volts towards ground as the common pulldown node 24 is pulled down as well . further , the lowering voltage of d serves to turn on the pullup sense amp transistor gated by d * ( q 14 ) before the other pullup sense amp transistor turns on . the voltage supply v cc then charges line d . on the other hand , if the memory cell 22 had been storing a logic 0 , then a discharge to d would slightly lower d &# 39 ; s voltage to 1 . 45 volts . the pulldown sense amp transistor gated by d * ( q 1 ) would turn on first and d &# 39 ; s voltage would be further decreased toward ground by the pulldown sense amp , thereby allowing the pullup sense amp to increase d &# 39 ; s voltage toward v cc . in this way , a small voltage difference between d and d is sensed and amplified . once the voltage difference has been amplified , d and d * can drive less sensitive circuitry not shown in fig1 . it should be noted that , if a logic 0 is transmitted to d , then the pulldown sense amp need only pull down d from 1 . 45 volts . if a logic 1 is transmitted to d , then the pulldown sense amp must pull d * from the higher dvc 2 level — 1 . 65 volts . therefore , if many logic 1 &# 39 ; s in a memory array row are read , the extra voltage that must be pulled contributes to saturating the pulldown transistor q 3 with drive current , thereby slowing any further pulldown . the problem created by slow pulldown is illustrated in fig2 where slope x denotes the initial discharge to d from a memory cell 22 storing a logic 0 . fig2 further illustrates the amplification of the difference in voltage between d and d . slope y denotes the time required for d to drop in voltage given a situation where a row of cells contains a roughly equal number of logic 1 &# 39 ; s and logic 0 &# 39 ; s . should there be many logic 1 &# 39 ; s read amongst a single logic 0 , then the outcome changes : as the logic 0 is read , the pulldown transistor q 3 , having approached saturation , takes much longer to pull down d &# 39 ; s voltage . this result is illustrated by slope z . other circuitry elements ( not shown ) that are driven by d may read d before its transition to a lower voltage has been completed . as a result , a logic 0 value may be misread as a logic 1 . as illustrated in fig3 increasing the voltage to the gate of the pulldown transistor allows the transistor to pulldown more current before saturation . one preferred embodiment of the current invention that uses this principal is detailed in fig4 where the pulldown transistor q 3 is driven by a test circuit 26 through an inverter 27 . in this embodiment , the inverter 27 comprises a p - channel transistor q 6 and an n - channel transistor q 8 . the coupled gates of inverter transistors q 6 and q 8 form an input node 28 for receiving a signal ensa , which may be v cc , ground , or a signal from another driver . the coupled drains of the inverter transistors q 6 and q 8 output the lensa signal that drives the pulldown transistor q 3 . the source of q 8 is coupled to ground . the source of q 6 is coupled to a source node 30 that branches into a first conducting path 32 and a second conducting path 34 . the first conducting path 32 is coupled to an n - channel transistor q 10 , which has a channel width - to - length ratio of around 500 / 2 . the drain of transistor q 10 is coupled to a contact pad 36 . it should be understood that the term “ contact pad ” includes any conductive surface configured to permit electrical communication with a circuit or a node . the gate of transistor q 10 is coupled to an inverter 60 through another n - channel transistor q 36 . together , inverter 60 and transistor q 36 comprise a latch device , and both are coupled to v ccp . further , inverter 60 receives a test * signal as an input . in addition , the gate of transistor q 10 is also coupled to a feedback capacitor 62 . this feedback capacitor 62 comprises an n - channel transistor having a size of approximately 100 / 100 , wherein the drain and source are shorted and coupled to the first conductive path 32 . the second conducting path 34 is coupled to a p - channel transistor q 12 , driven by a signal test , which is understood to be the complement of test . the transistor q 12 is also coupled to v cc , although no voltage source is considered to be a part of the invention . during testing , test transmits a low voltage signal which is received by the inverter 60 . in response , the inverter 60 initiates a v ccp signal , sending it through transistor q 36 which outputs the v ccp signal to the gate of transistor q 10 , thereby switching on q 10 . the feedback capacitor 62 serves to maintain and replenish this v ccp signal in the event of leakage . capacitive coupling between the gate and drain of transistor q 10 allows q 10 to carry signals having a range of voltages for modifying the drive of the pulldown transistor q 3 . simultaneously , the test signal , applying a high voltage to transistor q 12 , isolates v cc . a test data pattern is entered into the memory cells 22 and read with varying voltages driving the pulldown transistor q 3 . the data read at various alternate voltages sent through bond pad 36 can be compared with the data as originally written . this series of readings indicates the range of voltages through which the pulldown transistor q 3 is capable of allowing accurate data readings . once testing has ended , test * sends a high voltage signal and test becomes low , thereby isolating the bond pad and allowing the v cc signal to transmit to the pulldown transistor q 3 . the embodiment illustrated in fig5 is a package part of the semiconductor circuit device and receives a plurality of voltage sources with different magnitudes . the test circuit 26 allows selection among these sources for driving the gate of the pulldown transistor q 3 . the inverter 27 is the same as in fig4 . in this exemplary embodiment , however , source node 30 is coupled to three discrete voltage sources . first , source node 30 is coupled to v ccp through a p - channel transistor q 20 that is driven by a low signal a . source node 30 is also coupled to dvc 2 through another p - channel transistor q 22 that is driven by a low signal b . finally , source node 30 is coupled to v cc by way of a p - channel transistor q 24 . this p - channel transistor q 24 is gated by the output of a logic unit , such as a nand gate 46 , which will drive transistor q 24 in response to receiving a high signal a as a first input and a high signal b as a second input . given the input vector scheme of this embodiment , one of the transistors q 20 , q 22 , or q 24 will be operable to the exclusion of the other two . thus , a low signal a * will drive the p - channel transistor q 20 , thereby allowing v ccp to drive the pulldown transistor q 3 . simultaneously , signal b will be high , turning off p - channel transistor q 22 . further , the nand gate output will also be high and turn off p - channel transistor q 24 . if , on the other hand , signal b is low and signal a is high , then only p - channel transistor q 22 will be on , allowing dvc 2 to transmit to the pulldown transistor q 3 . only when both signals a and b are high does the nand gate 46 output a low signal and allow v cc drive the pulldown transistor q 3 . the data read at these three voltage levels can then be compared with the data as originally written . it should be noted that this configuration does not require the die space needed for the contact pad 36 . another embodiment concerns varying the voltage applied to a pullup sense amp 40 . as seen in fig1 the pullup sense amp 40 includes cross coupled p - channel transistors q 14 and q 16 as well as a pullup transistor q 18 . as one of ordinary skill in the art understands , there is generally a pullup sense amp 40 corresponding to every pulldown sense amp . nevertheless , for purposes of clarity , only one pullup sense amp 40 is shown . the sources of q 14 and q 16 are connected to a common pullup node 42 , and the gate of each is connected to the other &# 39 ; s drain . further , the gate of q 14 connects to line d , and the gate of q 16 connects to line d . common pullup node 42 is coupled with pullup transistor q 18 , which is another p - channel transistor . pullup transistor q 18 is also coupled to the voltage source v cc . the pullup transistor q 18 is driven by a signal lepsa . fig6 illustrates that the voltage driving pullup transistor q 18 may also be varied through the use of a test circuit 26 analogous to that used with the pulldown transistor q 3 in fig5 . fig6 depicts an inverter 27 comprising a p - channel transistor q 26 and an n - channel transistor q 28 . the coupled gates of inverter transistors q 26 and q 28 form an input pathway 48 for a control signal designated epsa . the coupled drains transmit the inverted output signal epsa * which , in turn , is received by a prior art device 50 that outputs the lepsa * signal used to drive the pullup transistor q 18 . the source of q 26 is coupled to v cc , whereas the source of q 28 is coupled to the test circuit 26 which , in this embodiment , includes three conductive paths . the first path 52 leads to dvc 2 by way of an n - channel transistor q 30 , which is driven by a signal c . the second path 54 is coupled to a voltage source v bb through an n - channel transistor q 32 , as driven by a signal d . the third path 56 leads to ground by way of n - channel transistor q 34 . the gate of n - channel transistor q 34 is coupled to the output of a nor gate 58 . the nor gate 58 accepts signal c as a first input and signal d as a second input and will activate transistor q 34 only when both signals are low . further , this embodiment is configured in a manner analogous to the embodiment in fig5 in that signals c and d will never simultaneously activate their respective transistors q 30 and q 32 . the three n - channel transistors q 30 , q 32 , and q 34 will turn on if a high , or logic 1 , signal is transmitted to their respective gates . as with the embodiment shown in fig5 for the pulldown sense amp , the signals and transistors are configured to allow only selective communication between one voltage source and the pullup transistor q 18 . as a result , if signal c is high , it will latch the n - channel transistor q 30 and provide electrical communication between dvc 2 and the pullup transistor q 18 . at the same time , the low signal from d turns off n - channel transistor q 32 . under these circumstances , the signals c and d also result in a low signal output from the nor gate 58 , thereby turning off n - channel transistor q 34 . thus , all of the other voltage sources are isolated . similarly , if signal d is high , then only n - channel transistor q 32 is turned on and v bb electrically communicates with pullup transistor q 18 . when both signals are low , the nor gate 58 outputs a high signal , thereby grounding the source of the n - channel inverter transistor q 28 . this embodiment has benefits similar to the embodiment in fig5 . returning to fig1 a prior art equilibration circuit can be seen as part of the memory device . for purposes of explaining the following embodiments of this invention , v cc is now presumed to be 5 volts . a transistor q 101 is coupled between digit line d and its complementary digit line d . the transistor is driven by an equilibration signal eq . it should be noted that the signal eq results from a logic function and is distinguishable from the equilibrate voltage veq , which represents the common mid - range voltage level of the complementary digit lines before a reading operation . the signal eq also drives two additional transistors q 102 and q 103 , which are connected together in series at a node 120 . these connected transistors q 102 and q 103 are also coupled between lines d and d . moreover , node 120 is coupled to a cell plate 64 and a dvc 2 voltage generator 68 through a bleeder device 122 . the dvc 2 voltage generator 68 transmits a cell plate signal cp of voltage dvc 2 to the node 120 . for purposes of explaining the following embodiments of this invention , dvc 2 is now 2 . 5 volts . the bleeder device 122 is driven by a signal of voltage v ccp , wherein v ccp results from having pumped v cc to an even higher potential . at the beginning of a precharge cycle , digit line d and its complementary digit line d * are at different voltages as a result of a discharge of the memory cell 22 during the reading cycle . one line will have a charge equal to the v cc value of 5 volts , while the other line will have a 0 volt charge . the equilibrate signal eq is then sent , activating transistor q 101 , which shorts d and d * together . moreover , the signal eq activates transistors q 102 and q 103 , which not only provide another short between d and d * but also allow the cp signal to be communicated to those lines . as a result , the lines d and d * equilibrate , both gaining a charge of potential dvc 2 ( 2 . 5 volts ), which is the desired equilibrate voltage veq in this example . once the lines are equilibrated , they are ready for further testing . for various reasons , a particular portion of the memory array may be defective . hopefully , testing processes will identify those defects . as discussed above and illustrated in fig7 a , a first defect 124 that may exist is a short to ground of the digit line d . fig7 b illustrates the effect of the first defect 124 . during the precharge cycle , the cp signal is trying to charge the digit lines d and d * to the 2 . 5 volt dvc 2 level and maintain that level . however , if the resistance of the short is not too great , the first defect 124 may cause the digit lines to discharge toward ground faster than cp can charge them to 2 . 5 volts . as a result , once the precharge process has ended at time t 1 , the digit lines may be equilibrated at a potential lower than 2 . 5 volts , such as 1 . 7 volts . having a veq at a level other than dvc 2 makes the memory array susceptible to reading errors . for example , in the present situation illustrated in fig7 b , where veq is too low , line noise on d occurring at time t 2 is more likely to register as a logic 0 discharge when in fact the storage cell 150 contains a logic 1 and has not yet discharged . alternatively , assuming that a logic 1 is properly discharged and sensed at time t 2 ′, a reading error is still likely : as seen in fig7 c , veq may be so low due to the short that the pullup sense amp may not be able to sufficiently pull up the digit line &# 39 ; s voltage by the time t 3 , when external circuitry accesses line d . in order to find such a reading error , prior art requires an extended precharge time , up to time t 1 , in order to allow the discharge from the first defect 124 to overtake the charge from cp . the current invention , however , provides an alternative to requiring a long precharge time . fig7 a illustrates that the v ccp signal driving the bleeder device has been replaced with the test circuit 26 that applies a different voltage v reg to regulate the bleeder device . in the case of the first defect 124 , the test circuit 26 transmits a signal having a voltage lower than v ccp to drive the bleeder device 122 . this causes a slower charge rate and allows the discharge from the first defect 124 to quickly overtake the charging from cp , as seen by the dashed lines in fig7 b and 7 c . with the resulting increased disparity between the charge rate and the discharge rate , the precharge period need only endure until time t 1 ′ in order to increase the likelihood of detecting an error . the design of test circuit 26 can be the same as those used in fig4 and 5 , wherein a source node 30 has access to at least one test voltage , either through a bond pad 36 or from a discrete voltage source . in this application , however , the source node 30 is coupled to the bleeder device 122 . furthermore , v ccp is the voltage used in non - test as operations to drive the bleeder device , and v cc and dvc 2 are used to slow the charge rate . it should be further understood that the number of voltage options could be increased . alternatively , the number of voltage options could be decreased to offer only one test voltage and one non - test voltage . these circuit embodiments , as well as others falling under the scope of the invention , have uses in detecting other defects . fig8 a illustrates another defect 136 that might occur within a memory array . the cross - sectional view in fig8 a shows the cell plate 138 coupled to a first n - region 140 of access transistor q 4 . ideally , the only way for the dvc 2 voltage generator 68 to charge the digit line d through the cell plate 138 is to drive the gate 142 of transistor q 4 so that the charge may pass from the first n - region 140 to a second n - region 144 . from there , the charge travels through a tungsten plug 146 , which serves as a contact between the second n - region 144 and the digit line d . occasionally , however , a second defect 136 in the memory array may occur in the form of a short between the cell plate 138 and the tungsten plug 146 . as discussed above , a long ras low signal is used to detect this second defect 136 . assuming line d is charged to 0 volts , fig8 b shows that the long ras signal allows line d to be charged to a higher voltage . thus , when the low ras signal ends at time t 1 and the digit lines are shorted to begin equilibration , the digit lines will no longer have an initial tendency to reach an average potential between 5 and 0 volts ( 2 . 5 volts ). rather , because line d is now higher than 0 volts , the shorted lines will settle at a higher midpoint , such as 3 . 5 volts . at this point , the margin between the new equilibrate voltage and the voltage representing a logic 1 has decreased . thus , an erroneous reading is more likely , as discussed above . conversely , if line d is initially charged to v cc ( fig8 c ), the short to the cell plate will cause d &# 39 ; s voltage to lower during a long ras low period . the resulting equilibrate voltage of lines d and d * could be lower than the preferred 2 . 5 volts . the lower equilibrate would again make an error in reading more likely . in either case , the cp signal will restore the equilibrate voltage to 2 . 5 volts by time t 2 . however , by decreasing the drive to the bleeder device 122 , any of the embodiments of the current invention will serve to slow down the restoration of veq to dvc 2 . with restoration time extended to time t 2 ′, any circuit embodiment of the current invention increases the likelihood of detecting errors that would suggest the existence of the second defect 136 . alternatively , fig8 d shows that a circuit embodiment of the current invention could be used during a non - test mode to compensate for the second defect 136 by driving the isolation device 122 at a higher - than - normal level . as discussed above , the bleeder device 122 is normally driven at v ccp , a voltage level representing one or two v t &# 39 ; s above v cc . the potential v t , in turn , is the threshold voltage of the bleeder device 122 . a further increase in the potential of v ccp would allow the bleeder device 122 to quickly restore veq to 2 . 5 volts by time t 2 ″. the shorter restoration period reduces the chances of an erroneous reading . fig9 a demonstrates yet another instance wherein the current invention could shorten test time . this instance concerns a third defect 148 comprising a short that may be caused by a nitride defect within the storage capacitor 150 of a memory cell 22 . it should also be noted that one of the plates of the storage capacitor 150 is in fact the cell plate 138 or 64 and is therefore connected to the dvc 2 generator . given this third defect 148 , fig9 b indicates that the cp signal , having a potential of dvc 2 , will charge the storage capacitor 150 toward that potential even though a logic 0 has been written to that cell for test purposes . during a static refresh pause , the word line wl leading to the memory cell 22 will continuously transmit a low signal , which turns off access transistor q 4 of the memory cell 22 and allows the storage capacitor 150 to take on a greater charge . with the stored charge having a higher voltage , such as 2 volts , it is more likely that the logic 0 will be misread at line d as a logic 1 . in order to speed up the leakage into the storage capacitor 150 , dvc 2 is forced to a voltage higher than the normal 2 . 5 volts . unfortunately , this would not result in much benefit under the prior art , as demonstrated by fig9 c : because the cp signal has a voltage of dvc 2 and is in communication with d and d * during the static refresh pause , the cp signal would also charge lines d and d * to a higher voltage . with the circuit embodiments of the present invention , however , a lower voltage could be used to drive the bleeder device 122 and thereby slow the charging of the digit lines , as illustrated in fig9 d . thus , while d and d * are regulated to substantially remain at 2 . 5 volts despite the forced dvc 2 voltage , the storage capacitor may be quickly charged to a higher potential , such as 2 . 7 volts , which exceeds the equilibrate voltage and makes it very likely that a logic 1 will be mistakenly recognized . one of ordinary skill can appreciate that , although specific embodiments of this invention have been described for purposes of illustration , various modifications can be made without departing from the spirit and scope of the invention . concerning the invention as used with a sense amp , for example , a test circuit for the pullup sense amp could be configured to transmit an entire range of voltages through a contact pad , as done with the pulldown sense amp depicted in fig4 . in addition , the test circuit 26 in fig6 could be used with a pulldown sense amp . conversely , the test circuit 26 in fig5 could be used with a pullup sense amp . moreover , both of these test circuits could be coupled to the same inverter and used to test drive either type of sense amp . further , regarding the embodiments use with a cell plate , it should be noted that the embodiments may be applied for other testing . any circuit embodiment , for instance , may be used during the precharge cycle discussed above in order to detect a short between a row line and a column line . moreover , a circuit embodiment of the current invention could also be used during a non - test mode to overcome other defects in addition to the short between a digit line and cell plate , as described above . it should also be noted that , given a particular voltage source used in an embodiment , that source can be independent of v cc rather than a mere alteration of v cc , such as v ccp or dvc 2 . accordingly , the invention is not limited except as stated in the claims .	6
before any embodiments of the invention are explained in detail , it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . fig1 is a perspective view of a container 100 that can be used for transporting cargo of various types . coupled to one end of the container is a climate control system 10 such as a refrigeration system which is used to control the climate , including e . g ., the temperature and the humidity level , of the interior of the container 100 . the container 100 could alternatively be a trailer , a railroad car , a straight truck cargo space , or other storage compartment used to transport cargo . fig2 is a schematic view of the refrigeration system 10 which includes a dehumidification system . the illustrated embodiment includes a refrigeration system 10 with a compressor 20 which in operation compresses a fluid refrigerant used in the climate control system 10 . compressed and hot refrigerant is conducted from the compressor 20 through conduits 21 and 31 to a condenser 30 where heat energy is removed from the refrigerant . the shown condenser 30 is fan assisted , and condensed and cooled refrigerant leaves the condenser 30 through a conduit 32 and enters a receiver tank 33 . if additional cooling of the refrigerant is desired , e . g ., if sufficient cooling with air is not sufficient , an optional water - cooled condenser 30 ′ ( shown in a dash - line frame ) may be used . from the receiver tank 33 ( or optionally the water - cooled condenser 30 ′) the condensed refrigerant is conducted through a conduit 34 ( e . g ., a liquid line ) through a drier oil filter 35 to an economizer heat exchanger 40 and through a conduit 41 and a thermostatic expansion valve 42 to an evaporator 50 . fans 55 circulate the air through the evaporator 50 and through the interior of the container 100 in a direction shown by the arrows . the evaporator 50 has a first part 102 and a second part 104 . the evaporator 50 is a tube - fin - type heat exchanger . the refrigerant in the first part 102 and the second part 104 reaches a discharge point 105 where the refrigerant leaves the evaporator 50 and is returned to the compressor 20 via a return conduit 22 . the climate control system 10 has a first distributor 51 and a second distributor 52 each of which is connected to receive cold condensed refrigerant from the conduit 41 and the thermostatic expansion valve 42 . the first distributor 51 may also receive refrigerant through a conduit 56 and feeds refrigerant to the tubes of the first part 102 of the evaporator 50 , and the second distributor 52 feeds refrigerant to the tubes of the second part 104 of the evaporator 50 . control valves 53 and 54 control the flow of refrigerant to the respective distributors 51 and 52 . a conduit 56 connects the outlet of the second control valve 54 with the inlet of the first distributor 51 . reference numerals 21 , 22 , 31 , 32 , 34 , 41 and 56 denote conduits for conducting refrigerant . a controller 110 controls the operation of the climate control system 10 . a temperature sensitive element 108 measures the temperature of the interior of the container 100 and relays a signal representing the temperature to the controller 110 . an electric heating element 60 arranged adjacent the evaporator 50 is used for defrosting and heating . a humidity sensor 106 is arranged for sensing the relative humidity of the air in the container 100 and outputs a corresponding signal to the controller 110 for determining whether the relative humidity is within acceptable limits . according to the invention in - service diagnostic testing includes automatically testing the functioning of the climate control system 10 and its individual components at a time which may be pre - scheduled and may depend on the period of time since a previous or the latest pre - trip inspection . each component to be tested in in - service diagnostic testing is tested at a time where the test does not intervene in the normal operation of the climate control system , or when its effect on the normal operation is known and can be compensated for or can be neglected . in in - service diagnostic testing according to the invention the power consumption of individual components of the climate control system is determined , preferably both in an activated state and in a deactivated state , where the determined power consumption is compared to a nominal value . excessive deviations from a nominal value may indicate component failure and should be handled accordingly . a . in a state of no activity of the climate control system 10 , or where no activity is expected , in - service diagnostic testing may include observing the power consumption of the climate control system as a whole but also of individual components of the system . in this state only the controller 110 and possibly a few other components on standby are expected to consume power . if the total power consumption is below a predefined threshold this part of the in - service diagnostic testing is passed . on the other hand , if the total power consumption is above the predefined threshold this part of the in - service diagnostic testing is not passed and further tests may be initiated to identify the one or more components consuming more power than expected and acceptable . in a state of no activity of the climate control system 10 the voltage and frequency of the power supply can be determined whereby the quality of the power supply can be determined and logged . b . the heater 60 is used for defrosting the evaporator while components unrelated to defrosting are deactivated and the power consumption of the heater 30 is determined and compared to its nominal power consumption value . possibly , the temperature sensitive element 108 may be used to verify that heat is actually produced as expected . here , too , the voltage and frequency of the power supply can be determined whereby the quality of the power supply can be determined and logged . c . the condenser 30 has a motor - driven fan that blows air past the condenser coil to remove heat from the coil . the condenser fan is active when the climate control system is activated , and the power consumption of the condenser fan can be determined in such periods . an air flow sensor may also be applied to determine that an air flow is actually generated by the condenser fan . alternatively , the condenser fan can be activated in a state of no activity of the climate control system or during defrost . d . temperature sensors ( not shown ) are arranged in connection with the condenser for sensing the temperature of the ambient air and the temperature of the condenser coil . in order to verify the ( relative ) accuracy of these two temperature sensors the condenser fan motor is activated while the compressor is deactivated , e . g . during defrost . this will cause the condenser coil to assume the temperature of the ambient air , and the readings of the two temperature sensors should therefore be identical or near identical . if this is not the case a corrective measure could be exchanging one or both sensors , or taking the different readings into account when determining the difference between the two temperatures . e . the compressor motor operates on a three phase electric power supply . if two phases in the power supplied to the system are interchanged the motor will rotate in the opposite direction of what is expected . in a simple test for whether this is the case the system will interchange two phases . the compressor will present different loads to its motor in the forward ( normal ) direction of rotation and in the reversed direction of rotation , and the compressor motor will have corresponding different power consumptions in the forward and the reverse directions of rotation . the different power consumptions can be used for testing and verifying that the three phases are correctly connected , and if not , taking appropriate corrective action such as interchanging two phases . f . the climate control system may have pressure sensors for sensing the pressure drop across the evaporator 50 . a supply pressure sensor senses the pressure of the refrigerant in the supply conduit between the thermostatic expansion valve 42 and the distributors 51 and 52 , and a return pressure sensor senses the pressure of the refrigerant in the return conduit 22 between the discharge point 105 and the compressor 20 . the pressure readings are used for monitoring the refrigerant pressure in the system , and the difference between the supply pressure and the return pressure in a refrigerant equalized state is an indicator of the flow of refrigerant through the evaporator and a comparison can be made to expected and acceptable values under the working conditions such as ambient temperature , the actual temperature in the container and the set - point temperature which is the target temperature . g . the climate control system should be able to avoid excessively high refrigerant pressures which may potentially damage the system . the supply pressure sensor mentioned above and other pressure sensors may be used for this purpose . during such test the compressor 20 is operated at or near its maximum capacity whereby in particular the supply pressure increases to reach a maximum threshold pressure level which should not be exceeded during normal operation . it is tested that when this threshold pressure level is reached a safety routine should be activated to deactivate the compressor whereby the pressure will decrease . it is checked that the pressure actually decreases , and that when it has decreased below a second threshold pressure level the compressor will be activated again . h . the economizer heat exchanger 40 is used for increasing the refrigeration capacity of the system if desired . for doing so a solenoid valve at the outlet side of the oil filter 35 is activated to lead refrigerant through a thermostatic expansion valve to the heat exchanger 40 . the heat exchanger being active will represent an increased load on the compressor , whereby the power consumption of the compressor will increase . the increased power consumption indicates that the solenoid valve is operating as desired and , vice versa , if the power consumption of the compressor does not increase correspondingly this indicates that the solenoid valve is not operating as desired . i . the motors of the fans 55 that circulate air through the evaporator 50 and through the interior of the container 100 are tested individually by activating the fans and determining their power consumption . the test is performed at different motor speeds and the corresponding power consumptions are determined and compared to acceptable values . a deviation from acceptable values indicate malfunction of the corresponding fan motor . an air flow sensor may also be applied to determine that an air flow is actually generated by the evaporator fans 50 . j . temperature sensors are provided for sensing the temperature of the air supplied by the evaporator fans 50 to the container , the temperature of the air that is returned from the container and the temperature of the evaporator . one way of checking the accuracy of these sensors is to activate the evaporator fans 50 in a state of no other activity of the system . hereby these three temperatures will tend to become equal , and the readings should therefore also be equal . some cargo other than frozen cargo may produce heat , and in such cases the temperature of the return air will be correspondingly higher than the temperature of the supply air . deviations from acceptable readings may indicate malfunction of one or more of the temperature sensors . k . the climate control system will normally have activated periods of time where refrigeration is provided and the temperature in the container is lowered , and deactivated periods of time where no refrigeration is provided and the temperature in the container will increase due to a higher ambient temperature ( in case heating is needed instead of refrigeration the situation is reversed ). with a given ambient temperature and a given cargo and a given set - point temperature for the cargo it is possible to calculate or at least estimate the power consumption that is needed for a normally functioning climate control system to maintain the set - point temperature with the actual ambient temperature , where the difference between the ambient temperature and the set - point temperature is the temperature difference which the climate control system must maintain . actual durations t a of activated periods of time and durations t p of the period of time between consecutive activations of the climate control system can be determined by simple measurements , and the ratio t a / t p can then be calculated . the ratio t a / t p , also known as the duty cycle , is a number expressing the fraction of the total time where the climate control system is activated , i . e . where it provides refrigeration , and is an indicator e . g . of how close the system is working to its maximum capacity . deviations , in particular when greater duty cycles than expected and acceptable are observed , indicate that the refrigeration capacity of the system is smaller than expected and possibly also below an acceptable limit . a reason for reduced refrigeration capacity can be that refrigerant is low and needs topping up . l . while the container with its cargo is being transported by rail , ship or truck the controller 110 stores information about the result of the in - service diagnostic testing in a memory for later retrieval and sends to a receiver at a central facility a wireless message with corresponding information ( i . e ., testing results ), and information identifying the container and the climate control system . the message is sent via a wireless connection such as a satellite connection or a cellular telephone network or other suitable wireless connection . the determination of whether the container including its climate control system has passed the testing and whether an approval for further service is issued can be made by the controller of the climate control system or at the central facility . if the climate control system has passed and is approved for further service , a satisfactory pti report is generated for the climate control system . in addition to a newly performed test such determination can also be based on other data such as the history of the container including previous pti reports of the system and its components , and also on experience gained from other containers or otherwise . in - service diagnostic testing can be performed including any of the above described tests individually or some or all of them in any desired combination and also further tests not described here , all carried out under the control of the controller 110 . a pre - trip inspection is traditionally performed on an empty container at a suitable time from arrival at its destination and after its cargo is unloaded . according to the method of the invention in - service diagnostic testing ( to generate a pti report ) can be initiated by an operator or automatically by the system and the in - service diagnostic testing is performed automatically at a time where there is cargo in the container . if the in - service diagnostic testing is passed the container and its climate control system are approved for further or continued use with cargo for a period until new in - service diagnostic testing must be performed , which allows the container and its climate control system to be used for one or more journeys with cargo . new in - service diagnostic testing can be scheduled to be performed in good time before the expiry of the approval period so that the approval period will not expire when the container is being transported with cargo .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.