identifier
stringlengths 6
14.8k
| collection
stringclasses 50
values | open_type
stringclasses 7
values | license
stringlengths 0
1.18k
| date
float64 0
2.02k
⌀ | title
stringlengths 0
1.85k
⌀ | creator
stringlengths 0
7.27k
⌀ | language
stringclasses 471
values | language_type
stringclasses 4
values | word_count
int64 0
1.98M
| token_count
int64 1
3.46M
| text
stringlengths 0
12.9M
| __index_level_0__
int64 0
51.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|
https://github.com/dh-big-team/fbi-project-vue/blob/master/src/layout/routeview/Index.vue
|
Github Open Source
|
Open Source
|
MIT
| null |
fbi-project-vue
|
dh-big-team
|
Vue
|
Code
| 437 | 1,744 |
<template v-loading.fullscreen.lock="$store.state.global.ajax_loading">
<div class="home">
<head-nav></head-nav>
<div class="container">
<section class="chart">
<el-row>
<el-col :span="12">
<div id="chartColumn" style="width:100%; height:400px;"></div>
</el-col>
<el-col :span="12">
<div id="chartBar" style="width:100%; height:400px;"></div>
</el-col>
<el-col :span="12">
<div id="chartLine" style="width:100%; height:400px;"></div>
</el-col>
<el-col :span="12">
<div id="chartPie" style="width:100%; height:400px;"></div>
</el-col>
</el-row>
</section>
</div>
</div>
</template>
<script>
import HeadNav from '../head-nav/HeadNav.vue'
import echarts from 'echarts'
export default {
name: 'index',
components: {
HeadNav
},
data () {
return {
chartColumn: null,
chartBar: null,
chartLine: null,
chartPie: null
}
},
mounted: function () {
// 基于准备好的dom，初始化echarts实例
this.chartColumn = echarts.init(document.getElementById('chartColumn'))
this.chartBar = echarts.init(document.getElementById('chartBar'))
this.chartLine = echarts.init(document.getElementById('chartLine'))
this.chartPie = echarts.init(document.getElementById('chartPie'))
this.chartColumn.setOption({
title: {
text: 'Column Chart'
},
tooltip: {},
xAxis: {
data: ['衬衫', '羊毛衫', '雪纺衫', '裤子', '高跟鞋', '袜子']
},
yAxis: {},
series: [{
name: '销量',
type: 'bar',
data: [5, 20, 36, 10, 10, 20]
}]
})
this.chartBar.setOption({
title: {
text: 'bar Chart',
subtext: '数据来自网络'
},
tooltip: {
trigger: 'axis',
axisPointer: {
type: 'shadow'
}
},
legend: {
data: ['2011年', '2012年']
},
grid: {
left: '3%',
right: '4%',
bottom: '3%',
containLabel: true
},
xAxis: {
type: 'value',
boundaryGap: [0, 0.01]
},
yAxis: {
type: 'category',
data: ['巴西', '印尼', '美国', '印度', '中国', '世界人口(万)']
},
series: [{
name: '2011年',
type: 'bar',
data: [18203, 23489, 29034, 104970, 131744, 630230]
}, {
name: '2012年',
type: 'bar',
data: [19325, 23438, 31000, 121594, 134141, 681807]
}]
})
this.chartLine.setOption({
title: {
text: 'line Chart'
},
tooltip: {
trigger: 'axis'
},
legend: {
data: ['邮件营销', '联盟广告', '搜索引擎']
},
grid: {
left: '3%',
right: '4%',
bottom: '3%',
containLabel: true
},
xAxis: {
type: 'category',
boundaryGap: false,
data: ['周一', '周二', '周三', '周四', '周五', '周六', '周日']
},
yAxis: {
type: 'value'
},
series: [{
name: '邮件营销',
type: 'line',
stack: '总量',
data: [120, 132, 101, 134, 90, 230, 210]
}, {
name: '联盟广告',
type: 'line',
stack: '总量',
data: [220, 182, 191, 234, 290, 330, 310]
}, {
name: '搜索引擎',
type: 'line',
stack: '总量',
data: [820, 932, 901, 934, 1290, 1330, 1320]
}]
})
this.chartPie.setOption({
title: {
text: 'pie Chart',
subtext: '纯属虚构',
x: 'center'
},
tooltip: {
trigger: 'item',
formatter: '{a} <br/>{b} : {c} ({d}%)'
},
legend: {
orient: 'vertical',
left: 'left',
data: ['直接访问', '邮件营销', '联盟广告', '视频广告', '搜索引擎']
},
series: [{
name: '访问来源',
type: 'pie',
radius: '55%',
center: ['50%', '60%'],
data: [{
value: 335,
name: '直接访问'
}, {
value: 310,
name: '邮件营销'
}, {
value: 234,
name: '联盟广告'
}, {
value: 135,
name: '视频广告'
}, {
value: 1548,
name: '搜索引擎'
}],
itemStyle: {
emphasis: {
shadowBlur: 10,
shadowOffsetX: 0,
shadowColor: 'rgba(0, 0, 0, 0.5)'
}
}
}]
})
}
}
</script>
<style scoped lang='less'>
.container {
position: absolute;
top: 60;
right: 0;
bottom: 0;
width: 100%;
overflow-y: auto;
overflow-x: hidden;
}
.content {
padding-left: 10px;
}
</style>
| 46,894 |
https://github.com/CarlosSuarezJS20/Budget-World-react.js-v2.0/blob/master/src/components/Navigation/Toolbar/Toolbar.js
|
Github Open Source
|
Open Source
|
Unlicense
| null |
Budget-World-react.js-v2.0
|
CarlosSuarezJS20
|
JavaScript
|
Code
| 160 | 531 |
import React, { useState, useEffect } from "react";
import classes from "./Toolbar.css";
import Logo from "../../Logo/Logo";
import Search from "../Search/Search";
import NavigationItems from "../NavigationItems/NavigationItems";
import { debounce } from "../../Utilities/helpers";
const toolBar = (props) => {
const [prevScrollPos, setPrevScrollPos] = useState(0);
const [visible, setVisible] = useState(true);
const handleScroll = debounce(() => {
const currentScrollPos = window.pageYOffset;
setVisible(
(prevScrollPos > currentScrollPos &&
prevScrollPos - currentScrollPos > 30) ||
currentScrollPos < 10
);
setPrevScrollPos(currentScrollPos);
}, 100);
const navbarStyles = {
position: "fixed",
top: visible ? "1%" : "-30%",
left: 0,
right: 0,
height: "100px",
background: "transparent",
zIndex: 999,
transition: "top 0.6s",
minWidth: "380px",
};
useEffect(() => {
window.addEventListener("scroll", handleScroll);
return () => window.removeEventListener("scroll", handleScroll);
}, [prevScrollPos, visible, handleScroll]);
return (
<header style={{ ...navbarStyles }}>
<div className={classes.NavbarItemsHolder}>
<div className={classes.NavbarLogoHolder}>
<Logo LogoNavbar />
</div>
<div className={classes.SearchInputHolder}>
{props.profilePage ? (
<h1>My travel page</h1>
) : (
<Search profilePage={props.profilepage} />
)}
</div>
<nav className={classes.NavItemsHolder}>
<NavigationItems
profilePage={props.profilePage}
isAuthenticated={props.authenticated}
/>
</nav>
</div>
</header>
);
};
export default toolBar;
| 34,845 |
https://openalex.org/W2969059228_2
|
Spanish-Science-Pile
|
Open Science
|
Various open science
| 2,019 |
Ofensas verbales en teatro del siglo XVI
|
None
|
Spanish
|
Spoken
| 3,123 | 6,319 |
4.6. Condena divina
Las ofensas aquí contenidas se refieren a la actitud mostrada contra la religión y por
la que se sufrirá el castigo correspondiente, esto es, la persona que así actúa será condenada
y considerada impía.
4.6.1. Dañado
Del latín damnare ‘condenar’; dañar (s.v. daño) en la acep. ‘causar daño’ es
innovación del portugués y del castellano, se registra en la Edad Media y aun en el siglo
XVI (Corominas y Pascual DCECH 1993). Se recoge un matiz religioso (s.v. damnado) en
el sentido ‘condenado, réprobo’, en el S. XIII (Alonso 1986). Menos preciso es el sentido
‘dañado, endommagé, gasté, desgasté, corrompu, incommodé’, OUDIN 1607 (Nieto
y Alvar 2007). Un interesante valor aporta (Academia 1732) esta apreciación ‘se llaman
también a los condenados a las penas del infierno, pero en este sentido tiene hoy muy
poco uso’. En el auto estudiado, se dirige el maestresala a Justo y Pastor -están sentenciados
a priori- y los califica como dañados ‘condenados’, esto es, en sentido etimológico (no
empleado en la actualidad), frente al actual (DRAE 2014), ‘malo, perverso’.
4.6.2. Maldito
Maldecir (s.v. decir) se recoge en Disputa, hacia 1200 (Corominas y Pascual DCECH
1993), y el participio (Oesl., s.v. maldito) en Serrano, 1202. Se registra con el sentido de
‘maldito’ (Alonso 1986), s. vv. maldicto, maldicho. Se añade el valor relacionado con la
religión en ‘maldito o maluado, sacrilegus, impius’, BARR. 1570 (Nieto y Alvar 2007).
Se alude en el segundo lema (Academia 1734) a actitudes depravadas, ‘significa también
perverso, malvado, de mala intención y dañadas costumbres’, si bien la tercera entrada
ofrece un matiz referido a la condena divina, ‘se toma también por el condenado y castigado
por la Justicia Divina’.
Actualmente (DRAE 2014) destacan tres acepciones: ‘perverso, de mala intención
y dañadas costumbres’, ‘condenado y castigado por la justicia divina’ y ‘de mala calidad,
ruin, miserable’. Maldito -con el sentido de ‘impío’- es el insulto que Pastor profiere al
maestresala, bien podría considerarse que mantiene en parte su valor etimológico ‘perverso’
(en este caso ofrece semas comunes a la esfera semántica de la maldad).
297
ESTUDIOS FILOLÓGICOS
4.7. Abuso de poder
Pastor utiliza tirano contra su opresor. Ejercer mal un cargo público29 es una falta
que tiene una consideración social condenable.
4.7.1. Tirano
Se registra con el sentido de ‘reyezuelo, soberano local’ y ‘tirano, déspota’
(Corominas y Pascual DCECH 1993), similar definición se recoge en el siglo XV, ‘que
abusa de su poder, déspota’ (Alonso 1986). Matiz parecido (Covarrubias ed. 2006) ofrece la
definición ‘llamamos tirano comúnmente cualquiera que, con violencia, sin razón ni justicia
se sale con hacer su voluntad’. Se añade nuevo sema: ‘se llama al varón o príncipe que es
desordenado, codicioso […]’, ARRAGEL 1433 (Nieto y Alvar 2007), y ‘entre los antiguos
se decía por rey […] es tirano el rey que vive sin cierta ley o el que por fuerza violenta usurpa
el señorío y es señor cruel’, PALENCIA 1490. Esta segunda acepción es similar a ‘se aplica
al señor que gobierna sin justicia’ (Academia 1780) y a ‘dicho de una persona: Que abusa
de su poder, superioridad o fuerza en cualquier concepto o materia, y también simplemente
del que impone ese poder y superioridad en grado extraordinario’ (DRAE 2014), 2.ª acep.
Se aprecia que el sentido etimológico apenas ha sufrido cambios.
4.8. Alusión familiar
Justo se reafirma en su fe y ensalza a Cristo, el pregonero se muestra airado y le
llama hi de puta, utilizadísimo y malsonante improperio. Aunque haya perdido relieve su
valor referencial, pocas veces se desvincula plenamente de su sentido literal a no ser que se
trate de una interjección puramente enfática.
4.8.1. Hi de puta
Primer registro (s.v. puta) en Berceo (Milagros, putaña); en el siglo XV abundaba
en literatura, aunque lo evitaba la conversación decente (Corominas y Pascual DCECH
1993). Encontramos puta (s.v.) con el mismo sentido (Alonso 1986) que ‘ramera’ en el siglo
S. XIII; y en ‘la ramera o ruin mujer’ (Covarrubias ed. 2006). El sentido literal también
se recoge en hijo de puta (s.v. hijo), ‘bastardo’ (Nieto y Alvar 2007) y en ‘el que no es
procreado de legítimo matrimonio’ (Academia 1734). Se aprecia, asimismo, como insulto
e interjección enfática con los siguientes sentidos: ‘lo mismo que hijo: y siempre parece se
usaba para denostar o reprehender a alguno; assi se decía regularmente Hi de puta, Hi de
ruin; pero ya no tiene uso’ (Academia 1734), s.v. hi; y ‘algunas veces se dice esta expresión
En el Auto de Naval y de Abigail (LIX) se recoge el sintagma cruel tirano para contraponerlo a un rey escrupuloso,
razonable, pacífico y de renombre.
29
298
ESTUDIOS FILOLÓGICOS
sin que denote injuria o denuesto, sino se usa de ella como admirándose, y entonces es
interjección que alaba alguna cosa’ (Academia 1734), s.v. hi de puta. Autoridades distingue
el sintagma completo hijo de puta ‘bastardo’, frente a la forma apocopada hi de puta con el
uso interjectivo indicado. El empleo actual está atestiguado (DRAE 2014), s.v. hijo, hijo de
puta, m. y f. vulg. ‘mala persona’. U. c. insulto.
El significado registrado en el corpus es el etimológico, atenuado porque puede
entenderse ‘mala persona’, ‘vil’ y, desde el punto de vista funcional, tiene un valor referencial
si bien se halla aminorado por la emotividad del momento y está impregnado de las funciones
expresiva y conativa30. En determinados contextos -en literatura se registra a partir del siglo
XV- tiene un uso conativo o apelativo31 puesto que se profiere como insulto directo contra
el interlocutor en una situación de ira o enojo, caso registrado en la pieza hagiográfica
estudiada. Los fueros (Madero 1992: 63-68) recogen puta entre los denuestos vedados.
Desde la perspectiva de la moral sexual, esta palabra se afirma como injuria (hasta hoy). Es
voz cargada de la representación de la lujuria encarnada sobre todo en lo femenino o en lo
bestial. En la Edad Media el cuerpo de las mujeres era una “totalidad culpable” y la belleza
un peligro fatal que amenazaba el orden social32.
Los primeros valores de este término son, por tanto, el referencial y el conativo33. Tras
estos usos la forma se empleará con valor conativo-expresivo (Castillo Lluch 2006: 2706)34.
A lo largo de su empleo en la historia va perdiendo el contenido semántico etimológico y
Se recoge en la Comedia de Bras Gil y Beringuella de Lucas Fernández la ofensa hydeputa, que afecta al honor
moral y también ofrece visos cómicos (Maurizi 1993: 103).
30
Hay casos en los que se utiliza con valor conativo-expresivo (si el denuesto por antífrasis Vollega a ser apóstrofe
cariñoso: “¡Que hijo de puta, qué bien lo has hecho”) y también expresivo (en ocasiones en las que se utiliza el
insulto con valor puramente interjectivo -como ocurre con la expresión clásica: “¡Oh, hideputa!” (Castillo Lluch
2006: 2697-2708).
31
La lógica de la feminidad en la escritura de los hombres era puramente corporal, mientras que en la literatura
didáctica estaba vinculada a las endebleces o imperfecciones que hacía que, por ejemplo, fueran consideradas
ineptas o cobardes. Por otro lado, en el derecho medieval, la referencia al padre sobre la que se articula la injuria
tiene dos contenidos: uno concierne a la legitimidad (fijo de nade, fornezino) y el otro a la identidad del padre
(fijo de fodido). En cuanto al primero, una madre siempre sabe que un hijo es suyo, es un “lugar inevitable”
y, según los fueros y las Partidas, está obligada a hacerse cargo de él. No así el padre que no tiene obligación
hacia los hijos nacidos del adulterio, el incesto o la fornicación, ya que este hombre nunca estará seguro de ser
el genitor. La legitimidad del nacimiento se encuentra, por ejemplo, en El Conde Lucanor, de don Juan Manuel
(“De lo que contesció a un rey con los burladores que fizieron el paño”). Recordemos que en literatura hay
bastardos heroicos, como Mudarra o Ramiro (Madero 1992: 109).
32
Tenemos ejemplos de valor conativo en La Celestina y responden a tres casos de fideputa, registrados como
apartes: dos los profiere Sempronio, y el otro, Elicia.
33
Se atestigua este empleo en el Quijote, si bien se añade un uso metalingüístico (Castillo Lluch 2006: 26992700). Por otro lado, la misma autora indica que el paso del sintagma nominal fijo de puta a la interjección
impropia ¡hideputa! en español clásico responde a un proceso de lexicalización, propiciado por una morfología
favorable unido a la fuerte expresividad del insulto, aunque su intensidad semántica y la desaparición de la forma
apocopada hi incidieron en la pérdida de la interjección (Castillo Lluch 2006: 2706-2707).
34
299
ESTUDIOS FILOLÓGICOS
se convierte en interjección impropia, si bien nunca desaparece completamente su sentido
primigenio, aunque se atenúe (según apreciamos en nuestro caso).
5. Conclusiones
Las ofensas verbales recogidas en los autos hagiográficos del Códice de Autos Viejos
conforman un corpus cuyo análisis ofrece útiles datos para la historia de la lengua. La
necesaria relación de interdependencia establecida entre las formas lingüísticas y el contexto
comunicativo en el que se emplean ha motivado que se aborden las imprecaciones desde
una perspectiva complementaria pragmático-semántica en la que se analizan las voces como
elementos lingüísticos interrelacionados con su contexto comunicativo. Este enfoque ha
permitido valorar no solo las consideraciones sociales que ofrecen los improperios en sus
diversos contextos, sino también sus funciones comunicativas como actos de habla junto
con sus valores semánticos.
Dentro de la moral cristiana, los insultos son considerados pecados de la lengua
promovidos por la ira (pecado capital). Los recogidos en el trabajo corresponden a la
contumelia, la injuria de palabra -considerada grave-, que se realiza en presencia del injuriado
y en la que el denuesto designa algún defecto de culpa.
Las imprecaciones en teatro no abundan en esta centuria por evidentes motivos de
decoro; es más, el adoctrinamiento de la moral cristiana es uno de los objetivos fundamentales
de estas piezas sacras. No obstante, a la luz de lo estudiado el patetismo que manifiestan
algunas injurias refuerza en el espectador inculto atracción hacia la insólita peripecia que
se desarrolla ante sus ojos, mantiene su atención y produce el deseado efecto catártico de la
escenificación.
Las ofensas son referidas -de forma general- a la calidad moral del individuo,
concretamente en situación de ira causada por la injusticia, crueldad o violencia representadas.
Se aprecia un insulto directo, no siempre codificado que, desde perspectiva comunicativa,
refuerza la acción con un léxico socialmente considerado ofensivo y grosero. En cuanto a las
funciones del lenguaje empleadas, las más utilizadas son la conativa o apelativa junto con la
expresiva o emotiva: el hablante expresa con el improperio su enojo con una fuerza ilocutiva
que refuerza la tensión. En la formación de los denuestos se emplean recursos morfológicos
(sufijación: cochinuelo), sintácticos (sintagma que corresponde a una interjección impropia: hi
de puta) y semánticos (metáfora: animal). Son particularmente numerosos los equivalentes a
‘inmoral’, es decir, que reprochan algún aspecto del comportamiento individual condenado
por la sociedad (dañado o maldito). En este sentido, el insulto apunta al concepto de lo que
ha sido sancionado socialmente (autoridad, religión, honorabilidad...).
El campo conceptual del insulto se ha organizado atendiendo a los semas que
comparten las voces y se ha estructurado en esferas conceptuales. Esta taxonomía agrupa los
rasgos semánticos coincidentes que responden a irracionalidad (animal, cochinuelo), rudeza
o grosería (bruto, grosero, salvaje), maldad (malvado, mezquino, perverso), despropósito
300
ESTUDIOS FILOLÓGICOS
(desatinado, desdichado), fingimiento o traición (falso, traidor), condena divina (dañado,
maldito), abuso de poder (tirano) y alusión familiar (hi de puta). Predominan en este
contexto literario religioso las ofensas que ponen énfasis en el comportamiento irracional
del hombre y en su crueldad (animal, salvaje…).
A la luz de estos datos, consideramos que estas “necesarias injurias” ofrecen
creaciones léxicas precisas para calificar personajes y situaciones con gran fuerza expresiva
y se hallan tamizadas por el decoro teatral de la época y el ejercicio de “transcripción de
oralidad”. El insulto llena de connotaciones negativas la palabra escenificada, esto es,
dramatizada ante un público que debe ser educado en la ortodoxia cristiana; la palabra
malsonante la emplean los mártires para defenderse y los verdugos para descalificarse, en
un ambiente de comunión eucarística que aproxima la lengua y su uso al pueblo, esto es, al
espectador. Asimismo, contribuye el denuesto a engrandecer a los personajes maltratados
convirtiéndolos en paradigmas de la religión defendida a ultranza en el contexto de una
sociedad cuyas fiestas giran en torno al adoctrinamiento popular.
Obras citadas
Alonso, Martín. 1986. Diccionario Medieval Español. Desde las Glosas Emilianenses y Silenses (S.
X) hasta el siglo XV. Salamanca: Universidad Pontificia de Salamanca. 2 vols.
Anónimo. Traducción de la “Historia de Jerusalem abreviada” de Jacobo de Vitriaco. Herrera,
M. Teresa y Sánchez, M. Nieves. ed. 2000. Salamanca: Universidad de Salamanca.
Ariza, Manuel. 1998. “Lengua y sociedad en el Siglo de Oro (un apunte)”, en Hernández,
César y Alarcos, Emilio (coords.), Homenaje al profesor Emilio Alarcos García en el
centenario de su nacimiento: 1895-1995. Valladolid: Junta de Castilla y León, Consejería de Educación y Cultura-Universidad de Valladolid, Servicio de Publicaciones e
Intercambio Científico. 217-225.
______. 2009. “Insulte usted sabiendo lo que dice”, en Luque, Luis (coord.), Léxico español
actual II. Università Ca’Foscari di Venezia. 31-48.
______. 2008. Insulte usted sabiendo lo que dice y otros estudios sobre el léxico. Madrid: Arco/
Libros.
______. 1983. “La lengua en los debates medievales (Género y lengua literarios)”, en Serta
Philologica F. Lázaro Carreter. Estudios de lingüística y lengua literaria. Vol. I. Madrid:
Cátedra. 9-65.
Bajtin, Mijail. ed. 1995. La cultura popular en la Edad Media y en el Renacimiento. El contexto de François Rabelais. Madrid: Alianza Editorial.
Baldinger, Kurt. 1977. Teoría semántica. Hacia una semántica moderna. Madrid: Alcalá.
Briz, Antonio. 1996. El español coloquial: Situación y uso. Madrid: Arco/Libros.
Bustos Tovar, José Jesús de. 1995. “De la oralidad a la escritura”, en Cortés, Luis (ed.), El
español coloquial. Actas del I Simposio sobre análisis del discurso oral. 11-28.
Casagrande, Carla y Vecchio, Silvana. 1991. Les péchés de la langue. Discipline et éthique de
301
ESTUDIOS FILOLÓGICOS
la parole dans la culture médiévale. Paris: Le Cerf.
Castilllo Lluch, Mónica. 2006. “Del denuesto a la interjección: la historia de la expresión
fijo de puta”. Actas del VI Congreso Internacional de Historia de la Lengua Española.
Madrid: Arco/Libros, vol. III. 2697-2708.
______. 2004. “De verbo vedado: consideraciones lingüísticas sobre la agresión verbal y su
expresión en castellano medieval”. Cahiers de linguistique et de civilisation hispaniques
médiévales 27: 23-36.
Catecismo de la Iglesia Católica. < htt://www.vatican.va/archive/catechism_sp/index_
sp.html> [Web 28 de febrero de 2017].
Cazal, Françoise. 2004. “El santo como elemento moderador de los pecados de la lengua en
el Pastor de Diego Sánchez de Badajoz”. Criticón 92: 85-97.
Chauchadis, Claude. 2004. “Virtudes y pecados de la lengua: Sebastián de Covarrubias y
Martín de Azpilicueta”. Criticón 92: 39-45.
Códice de Autos Viejos. 1988. Selección, edición, introducción y notas de Miguel Ángel
Pérez Priego. Madrid: Castalia.
Corominas, Joan y Pascual, José Antonio. 1993. Diccionario Crítico Etimológico Castellano e
Hispánico (DCECH). Madrid: Gredos. 6 vols.
Covarrubias, Sebastián de. ed. 2006. Tesoro de la Lengua Castellana o Española. Ed. integral
e ilustrada de I. Arellano y R. Zafra. Madrid: Universidad de Navarra-Editorial Iberoamericana.
Domínguez Matito, Francisco y Martínez Berbel, Juan Antonio (eds.). 2012. La Biblia en
el teatro español. Vigo: Fundación San Millán de La Cogolla-Editorial Academia del
Hispanismo.
Fernández Rodríguez, Natalia. 2013. “Comicidad y devoción: la risa festiva en la comedia
hagiográfica de Lope de Vega”. Hipogrifo 1: 185-199.
González Ollé, Fernando. 1962. Los sufijos diminutivos en castellano medieval. RFE-Anejo
LXXV. Madrid: CSIC.
Jakobson, Roman. 1975. Ensayos de lingüística general. Barcelona: Seix-Barral.
Madero, Marta. 1992. Manos violentas, palabras vedadas: la injuria en Castilla y León (siglos
XIII-XV). Madrid: Taurus Ediciones.
Maurizi, Françoise. 1993. “Langue et discours: La pulla dans le théâtre de la fin du XVèmeDebut du XVIème siècle”. Voces 4: 97-105.
Montero, Emilio. 2008. “Transgresiones sexuales, tradiciones discursivas y oralidad en el castellano medieval”. Cuadernos del CEMyR 16: 145-165.
______. 2007. “Palabras malas y villanas (Alfonso X: Partidas). La oralidad en las tradiciones discursivas jurídicas”, en Cortés, L. María (coord.), Discurso y oralidad: homenaje
al profesor José Jesús de Bustos Tovar. Vol. I. Madrid: Arco / Libros. 391-400.
______. 2000. “El tabú, el eufemismo y las hablas jergales”, en Alvar, Manuel (dir.), Introducción a la lingüística española. Barcelona: Ariel. 547-563.
Nebrija, Elio A. de. ed. 1989. Vocabulario español-latino. Facsímil de la primera edición. Madrid: Real Academia Española.
302
ESTUDIOS FILOLÓGICOS
Nieto Jiménez, Lidio y Alvar Ezquerra, Manuel. 2007. Nuevo Tesoro Lexicográfico del Español (S. XIV-1726). Madrid: Real Academia-Arco/libros. 11 vols.
Pérez-Salazar, Carmela, Tabernero, Cristina y Usunáriz, Jesús María (eds.). 2013. Los poderes de la palabra. El improperio en la cultura hispánica del Siglo de Oro. New York,
Bern, Berlin, Bruxelles, Frankfurt am Main, Oxford, Wien: Peter Lang.
Pons Rodríguez, Lola. 2007. “Cesarán las palabras: la lengua de los diálogos en un texto
cuatrocentistas”. Cahiers d’Études Hispaniques Médiévales 30: 289-320.
Real Academia Española. 2014. Diccionario de la Lengua Española (DRAE). Barcelona: Espasa
Libros. 23.ª ed.
Real Academia Española. Banco de datos (CORDE) [en línea]. Corpus diacrónico del español.
http://www.rae.es. Web 26 de febrero de 2017.
Real Academia Española. Nuevo Tesoro Lexicográfico de la Lengua Española. < http://buscon.
rae.es>. Web 28 de febrero de 2017.
Real Academia Española. ed. 1969. Diccionario de Autoridades (edición facsímil de la de
1726-1739). Madrid: Gredos. 3 vols.
Reyes Peña, Mercedes de los. 2003. “El Códice de autos viejos y el teatro religioso en la
segunda mitad del siglo XVI”, 389-430. En J. Huerta Calvo (dir.), Historia del teatro
español, vol. I. De la Edad Media a los Siglos de Oro. Madrid: Gredos.
______. 2001. “La primera réplica en las obras hagiográficas del Códice de Autos Viejos”.
Criticón 83: 47-59.
______. 1988. El “Códice de Autos Viejos”. Un estudio de historia literaria. Sevilla: Alfar. 3
vols.
Rodríguez, Teresa. 2011. “Usos y funciones de las paremias en un discurso teatral: el Códice
de Autos Viejos (segunda mitad del XVI)”. Paremia 20: 127-138.
Rouanet, Léo, ed. 1979. Colección de autos, farsas y coloquios del siglo XVI. Hildesheim-New
York: Georg Olms (1.ª impr., Barcelona-Madrid, 1901). 4 vols.
Tabernero, Cristina. 2013. “Consideración lingüística y social de la injuria en el Tesoro de
Covarrubias”. Estudios Filológicos 52: 143-161.
______. 2011. “Injurias, maldiciones y juramentos en la lengua española del siglo XVI”.
Revista de Lexicografía XVI: 101-122.
Tomás de Aquino, Santo, ed. 1964. Suma Teológica. Madrid: BAE. 1.ª ed.
Ugarte Ballester, Xus. 2011. “Ensayo de descalificaciones y maldiciones personales en Celestina y en la traducción catalana de Antoni Balbuena”. Celestinesca 35: 137-158.
Usunáriz, Jesús María. 2013. “Limpios de mala raza”, en Pérez-Salazar, C., Tabernero, C. y
Usunáriz, J. M. (eds.), Los poderes de la palabra. El improperio en la cultura hispánica
del Siglo de Oro. New York, Bern, Berlin, Bruxelles, Frankfurt am Main, Oxford,
Wien: Peter Lang. 277-297.
303
ESTUDIOS FILOLÓGICOS
304.
| 15,037 |
https://arz.wikipedia.org/wiki/%D8%AC%D9%88%D9%86%20%D8%AC%D9%8A%D9%84%D9%8A%D8%B3%20%28%D9%85%D8%A4%D8%B1%D8%AE%20%D9%85%D9%86%20%D8%A7%D9%84%D9%85%D9%85%D9%84%D9%83%D9%87%20%D8%A7%D9%84%D9%85%D8%AA%D8%AD%D8%AF%D9%87%20%D9%84%D8%A8%D8%B1%D9%8A%D8%B7%D8%A7%D9%86%D9%8A%D8%A7%20%D8%A7%D9%84%D8%B9%D8%B8%D9%85%D9%89%20%D9%88%20%D8%A7%D9%8A%D8%B1%D9%84%D8%A7%D9%86%D8%AF%D8%A7%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
جون جيليس (مؤرخ من المملكه المتحده لبريطانيا العظمى و ايرلاندا)
|
https://arz.wikipedia.org/w/index.php?title=جون جيليس (مؤرخ من المملكه المتحده لبريطانيا العظمى و ايرلاندا)&action=history
|
Egyptian Arabic
|
Spoken
| 75 | 246 |
جون جيليس كان باحث فى تاريخ العصور الكلاسيكيه و مؤرخ من المملكه المتحده لبريطانيا العظمى و ايرلاندا و مملكه بريطانيا العظمى.
حياته
جون جيليس من مواليد يوم 18 يناير سنة 1747 فى بريكين.
الدراسه
درس فى جامعة جلاسجو.
العضويه
كان عضو فى:
الجمعيه الملكيه
الجمعيه الملكيه لادنبره
جوايز
زماله الجمعيه الملكيه
زماله الجمعيه الملكيه لادنبره
وفاته
جون جيليس مات يوم 15 فبراير سنة 1836.
لينكات
مصادر
مؤرخين
مؤرخين من المملكه المتحده لبريطانيا العظمى و ايرلاندا
| 23,053 |
https://github.com/Opdex/opdex-v1-api/blob/master/src/Opdex.Platform.Application.Abstractions/EntryQueries/Addresses/Balances/GetAddressBalancesWithFilterQuery.cs
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
opdex-v1-api
|
Opdex
|
C#
|
Code
| 64 | 216 |
using MediatR;
using Opdex.Platform.Application.Abstractions.Models.Addresses;
using Opdex.Platform.Common.Models;
using Opdex.Platform.Infrastructure.Abstractions.Data.Queries.Addresses.Balances;
using System;
namespace Opdex.Platform.Application.Abstractions.EntryQueries.Addresses.Balances;
public class GetAddressBalancesWithFilterQuery : IRequest<AddressBalancesDto>
{
public GetAddressBalancesWithFilterQuery(Address address, AddressBalancesCursor cursor)
{
Address = address != Address.Empty ? address : throw new ArgumentNullException(nameof(address), "Address must be set.");
Cursor = cursor ?? throw new ArgumentNullException(nameof(cursor), "Cursor must be set.");
}
public Address Address { get; }
public AddressBalancesCursor Cursor { get; }
}
| 27,200 |
https://github.com/cjkcjk01/GiantSpaceRobotVisualiser/blob/master/data/invert.glsl
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
GiantSpaceRobotVisualiser
|
cjkcjk01
|
GLSL
|
Code
| 36 | 122 |
#ifdef GL_ES
precision mediump float;
precision mediump int;
#endif
#define PROCESSING_TEXTURE_SHADER
varying vec4 vertTexCoord;
uniform sampler2D texture;
void main(void)
{
vec2 p = vertTexCoord.st;
vec3 col = vec3(1.0) - texture2D(texture, p).rgb;
gl_FragColor = vec4(col, 1.0);
}
| 27,020 |
https://github.com/Takao-7/UnrealEngineECS/blob/master/Source/UnrealEngineECS/Public/UEEnTTSystem.h
|
Github Open Source
|
Open Source
|
MIT
| null |
UnrealEngineECS
|
Takao-7
|
C
|
Code
| 253 | 644 |
// Copyright @Paul Larrass 2020
#pragma once
#include "CoreMinimal.h"
#include "Engine/EngineBaseTypes.h"
#include "Subsystems/GameInstanceSubsystem.h"
#include "UEEnTTSystem.generated.h"
USTRUCT()
struct FECSSystemTickFunction : public FTickFunction
{
GENERATED_BODY()
UPROPERTY()
class UECSSystem* Target = nullptr;
/**
* Abstract function actually execute the tick.
* @param DeltaTime Frame time to advance, in seconds
* @param TickType Kind of tick for this frame
* @param CurrentThread Thread we are executing on, useful to pass along as new tasks are created
* @param MyCompletionGraphEvent Completion event for this task. Useful for holding the completion of this task until certain child
* tasks are complete.
*/
UNREALENGINEECS_API virtual void ExecuteTick(float DeltaTime, ELevelTick TickType, ENamedThreads::Type CurrentThread,
const FGraphEventRef& MyCompletionGraphEvent) override;
/** Abstract function to describe this tick. Used to print messages about illegal cycles in the dependency graph */
UNREALENGINEECS_API virtual FString DiagnosticMessage() override;
UNREALENGINEECS_API virtual FName DiagnosticContext(bool bDetailed) override;
};
template<>
struct TStructOpsTypeTraits<FECSSystemTickFunction> : public TStructOpsTypeTraitsBase2<FECSSystemTickFunction>
{
enum
{
WithCopy = false
};
};
//////////////////////////////////////////////////
/**
* Interface for systems.
* Systems run each tick (or at a given interval).
* Set the ticking related parameters through the tick function (@see TickFunction) in the constructor
*/
UCLASS(Abstract)
class UNREALENGINEECS_API UECSSystem : public UGameInstanceSubsystem
{
GENERATED_BODY()
public:
virtual ~UECSSystem() = default;
virtual void Initialize(FSubsystemCollectionBase& Collection) override;
virtual void Deinitialize() override;
/** Main function for systems. This is called each tick (or how long the tick function is set to) */
virtual void RunSystem(float DeltaTime, ENamedThreads::Type CurrentThread) const {};
protected:
void RegisterTickFunction(UWorld* World);
//---------- Variables ----------//
public:
FECSSystemTickFunction TickFunction;
class IECSRegistryInterface* Registry = nullptr;
};
| 2,752 |
https://github.com/nododere/Ongkir-App/blob/master/client/src/redux/reducers/register.js
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
Ongkir-App
|
nododere
|
JavaScript
|
Code
| 86 | 341 |
import { registerState, REGISTER_SUCCESS, REGISTER_FAILED, REGISTER_CLEANUP } from '../actions/register'
export const registerReducer = (state = registerState, action) => {
switch (action.type) {
case REGISTER_SUCCESS:
return {
...state,
type: action.payload.type,
username: action.payload.username,
email: action.payload.email,
password: action.payload.password,
messages: action.payload.messages,
btnText: action.payload.btnText,
btnDisabled: action.payload.btnDisabled
}
case REGISTER_FAILED:
return {
...state,
messages: typeof action.payload.messages !== 'string' ? [...action.payload.messages] : action.payload.messages,
btnText: action.payload.btnText,
btnDisabled: action.payload.btnDisabled
}
case REGISTER_CLEANUP:
return {
...state,
type: action.payload.type,
username: action.payload.username,
email: action.payload.email,
password: action.payload.password,
messages: action.payload.messages,
btnText: action.payload.btnText,
btnDisabled: action.payload.btnDisabled
}
default:
return state
}
}
| 18,163 |
https://github.com/matoruru/purescript-react-material-ui-svgicon/blob/master/src/MaterialUI/SVGIcon/Icon/LocalTaxi.purs
|
Github Open Source
|
Open Source
|
MIT
| null |
purescript-react-material-ui-svgicon
|
matoruru
|
PureScript
|
Code
| 45 | 143 |
module MaterialUI.SVGIcon.Icon.LocalTaxi
( localTaxi
, localTaxi_
) where
import Prelude (flip)
import MaterialUI.SVGIcon.Type (SVGIcon, SVGIcon_)
import React (unsafeCreateElement, ReactClass) as R
foreign import localTaxiImpl :: forall a. R.ReactClass a
localTaxi :: SVGIcon
localTaxi = flip (R.unsafeCreateElement localTaxiImpl) []
localTaxi_ :: SVGIcon_
localTaxi_ = localTaxi {}
| 27,329 |
https://github.com/sungreong/xlnet-practice/blob/master/spiece.py
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,019 |
xlnet-practice
|
sungreong
|
Python
|
Code
| 31 | 179 |
import sentencepiece as spm
import argparse
def main():
spm.SentencePieceTrainer.train('--input=wiki.txt '
'--model_prefix=spiece '
'--vocab_size=32000 '
'--character_coverage=0.99995 '
'--model_type=unigram '
'--control_symbols=<cls>,<sep>,<pad>,<mask>,<eod> '
'--user_defined_symbols=<eop>,.,(,),",-,_,£,€ '
'--shuffle_input_sentence '
'--input_sentence_size=10000000 ')
if __name__ == "__main__":
main()
| 15,028 |
https://github.com/SokolovaMaria/kotlinx.coroutines/blob/master/integration/kotlinx-coroutines-jdk8/src/time/Time.kt
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,018 |
kotlinx.coroutines
|
SokolovaMaria
|
Kotlin
|
Code
| 111 | 363 |
/*
* Copyright 2016-2018 JetBrains s.r.o. Use of this source code is governed by the Apache 2.0 license.
*/
package kotlinx.coroutines.time
import kotlinx.coroutines.CoroutineScope
import kotlinx.coroutines.selects.SelectBuilder
import java.time.Duration
import java.util.concurrent.TimeUnit
/**
* "java.time" adapter method for [kotlinx.coroutines.delay]
*/
public suspend fun delay(duration: Duration) =
kotlinx.coroutines.delay(duration.toMillis())
/**
* "java.time" adapter method for [SelectBuilder.onTimeout]
*/
public fun <R> SelectBuilder<R>.onTimeout(duration: Duration, block: suspend () -> R) =
onTimeout(duration.toMillis(), block)
/**
* "java.time" adapter method for [kotlinx.coroutines.withTimeout]
*/
public suspend fun <T> withTimeout(duration: Duration, block: suspend CoroutineScope.() -> T): T =
kotlinx.coroutines.withTimeout(duration.toMillis(), block)
/**
* "java.time" adapter method for [kotlinx.coroutines.withTimeoutOrNull]
*/
public suspend fun <T> withTimeoutOrNull(duration: Duration, block: suspend CoroutineScope.() -> T): T? =
kotlinx.coroutines.withTimeoutOrNull(duration.toMillis(), block)
| 44,056 |
sn83016209_1959-11-26_1_30_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,959 |
None
|
None
|
English
|
Spoken
| 452 | 564 |
We are proud to announce that we have received a new shipment of the latest in furniture, including the latest in bedroom and dining sets. This includes a wide range of chairs, chairs, and tables, all designed with the same attention to detail and craftsmanship that characterized our previous offerings. We are proud to announce that we have received a new shipment of the latest in furniture, including the latest in bedroom and dining sets. This includes a wide range of chairs, chairs, and tables, all designed with the same attention to detail and craftsmanship that characterized our previous offerings. In addition to furniture, we also offer a range of other items such as bedding, bedding, and more. Our selection includes both bedroom and dining sets, ensuring that you can find the perfect piece for your home. For those in need of furniture, we offer a range of chairs, chairs, and tables, all designed with the same attention to detail and craftsmanship that characterized our previous offerings. Whether you're looking for a new bed, a new bed, or a more modern home, we have it all. We understand the importance of quality and value, and we are committed to providing our customers with the best possible service. Our commitment to quality and customer satisfaction is unwavering, and we look forward to serving you soon. divorces we consider merely tokens that we are ahead of, not behind, the fashion. We discuss the current ideologies, we speak knowingly of child psychology, we have seen the newest oddity by Samuel Beckett and the latest show of Toulouse Lautrec. Our attitudes are modern, and we share the modern faults of haste and sentimentality. It is our virtues that are old-fashioned. For here we love our neighbor. What is more, we are reactionary enough not to love him impersonally. To us he is not mankind, but man; and our affection warms us both. Now kindness is a virtue neither modern nor urban. One almost unlearns it in a city. Towns have their own beatitude; they are not unfriendly; they offer a vast and solacing anonymity or an equally vast and solacing gregariousness. But one needs a neighbor on whom to practice compassion. It has taken me many years to emerge from the self-centered cocoon which the city had wound about me, and even now I offer small benefactions with a sort of shyness and am as shy to accept them. So I am constantly being surprised by the matter-of-fact, everyday kindness with which my friends seem overflowing. Is it the same in other villages? Does this flower blossom in any suburb where the economic soil is neither very rich nor very poor and where one knows the.
| 3,902 |
https://github.com/alexeyinkin/twilio-client/blob/master/front/src/SettingRow.js
|
Github Open Source
|
Open Source
|
MIT
| null |
twilio-client
|
alexeyinkin
|
JavaScript
|
Code
| 52 | 190 |
import React from 'react';
class SettingRow extends React.Component {
constructor(props) {
super(props);
this.state = {value: this.props.value};
}
onChange = (e) => {
let value = e.target.value;
this.setState({value: value});
this.props.onChange(value);
};
render() {
return (
<div className="SettingRow">
<div className="SettingName">{this.props.title}:</div>
<div className="SettingInputDiv">
<input value={this.state.value} onChange={this.onChange} />
</div>
</div>
);
}
}
export default SettingRow;
| 34,920 |
https://github.com/JeremyLiao/live-call-bus/blob/master/invoking-message/demo/module-b/src/main/java/com/jeremy/module_b/ModuleBActivity.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,022 |
live-call-bus
|
JeremyLiao
|
Java
|
Code
| 58 | 313 |
package com.jeremy.module_b;
import android.os.Bundle;
import android.support.annotation.Nullable;
import android.support.v7.app.AppCompatActivity;
import android.view.View;
import com.jeremy.module_b_export.TestEventBean;
import com.jeremy.module_b_export.generated.im.EventsDefineAsModuleBEvents;
import com.jeremyliao.im.core.InvokingMessage;
public class ModuleBActivity extends AppCompatActivity {
@Override
protected void onCreate(@Nullable Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
setTitle(getClass().getSimpleName());
setContentView(R.layout.activity_module_b);
}
public void sendMsg(View view) {
InvokingMessage
.get()
.as(EventsDefineAsModuleBEvents.class)
.SAY_HELLO()
.setValue("Hello world!");
}
public void sendUserDefineMsg(View view) {
InvokingMessage
.get()
.as(EventsDefineAsModuleBEvents.class)
.EVENT1()
.setValue(new TestEventBean("aa"));
}
}
| 13,298 |
https://de.wikipedia.org/wiki/Kastell%20Gernsheim
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Kastell Gernsheim
|
https://de.wikipedia.org/w/index.php?title=Kastell Gernsheim&action=history
|
German
|
Spoken
| 681 | 1,386 |
Das Kastell Gernsheim war ein römisches Militärlager im Süden von Gernsheim, Landkreis Groß-Gerau, das in der zweiten Hälfte des 1. Jahrhunderts n. Chr. vermutlich etwa 500 römische Soldaten beherbergte, also als Kohortenkastell geplant war.
Lage und Geschichte
Gernsheim war der Knotenpunkt zweier römischer Straßen. Ein ehemals römisches Dorf (vicus) im heutigen Gernsheim war schon länger bekannt, ein zugehöriges Kastell nur vermutet. Wahrscheinlich existierte auch noch ein Hafen am westlich der Fundstelle gelegenen Rhein. Weiter nordöstlich befindet sich das Kleinkastell Allmendfeld. Gut 18 km nördlich liegt das Kastell Groß-Gerau.
Das Kastell wurde 2014 zufällig bei Grabungen auf einem Grundstück an der Nibelungenstraße in Gernsheim entdeckt, das bebaut werden sollte. Grabungsleiter der als Lehrgrabung für Archäologiestudenten der Johann Wolfgang Goethe-Universität Frankfurt am Main gedachten Ausgrabung war Thomas Maurer, damals wissenschaftlicher Assistent am Institut für Archäologische Wissenschaften der Frankfurter Universität.
Mit dem Fund von Vicus und Kastell ca. 500 Meter südlich des alten Gernsheimer Ortskerns sind Vermutungen widerlegt, Kastellreste würden sich unter der Hauptkirche im Ort befinden.
Befund
Hinweise auf ein Kastell stammen spätestens von den Ausgrabungen um 1900, die auf der südlichen Ortsseite von Gernsheim gefundene gestempelte Ziegel der 1. (Legio I Germanica) und 14. Legion (Legio XIIII Gemina) dem damals nur vermuteten Kastell Gernsheim zuordneten.
Bei der Grabung 2014 wurde einer der Spitzgräben des Kastells angeschnitten, der mit und nach Aufgabe des Kastells von den Soldaten und verbliebenen Bewohnern des vicus mit Resten verfüllt wurde. Unter anderem fanden sich Pfostenlöcher eines hölzernen Turms.
Die zahlreiche Fundstücke, die derzeit weiter aufgearbeitet werden, lassen einen tiefen Einblick in die römische Geschichte zu. Die Nutzung wird für den Zeitraum von 70 bis 110 n. Chr. vermutet. Ein gefundener Ziegel trägt den Stempel der Legio XXII Primigenia, die in Mogontiacum, dem heutigen Mainz, stationiert war. Eine Münze aus der Zeit von 84 bis 85 n. Chr. zeigt ein Bildnis von Kaiser Domitian. Weitere Fundstücke, Melonenperlen und Geschirrreste, deuten darauf hin, dass die Kohorte zumindest teilweise mit Pferden ausgerüstet war. Amphorenreste und Alltagskeramik (zum Beispiel Reste einer Terrakotta-Figur und von Terra Sigillata) vervollständigen die Funde.
2015 wurde die Lehrgrabung fortgesetzt und Mauerreste des vermuteten Vicus ergraben. Ein Teil des Verteidigungsgrabens des Kastells, ein weiterer zweiter kleiner keilförmiger Verteidigungsgraben, zwei Brunnen sowie Grabungsschnitte und -flächen über etwa 80 Prozent der zur Verfügung stehenden Grabungsfläche wurden bearbeitet und untersucht. Im südöstlichen Bereich wurden dabei Grundmauerreste von Gebäuden freigelegt. Trotz des Fundreichtums kann noch keine definitive Aussage getroffen werden, ob sich das Kastell nördlich oder südlich der Gräben, die etwa mittig der Untersuchungsfläche liegen, befand. Der unmittelbare Anschluss von Gebäuden des Vicus weist darauf hin, dass die Ortschaft erst nach Niederlegung oder Verlegung des Kastells ausgebaut wurde. Der Verteidigungsgraben wurde systematisch zugeschüttet und wies eine hohe Funddichte auf. Zu den Funden gehören auch Fibeln, ein kleiner Würfel sowie eine kleine Figur passend zum Würfelspiel. Eine Münze der Zeit von Kaiser Hadrian (die sich nach Aussagen des Grabungsleiters sogar auf die Zeit 134–138 eingrenzen lässt), Glasreste, reliefverzierte Terra Sigillata sowie verschiedenste Keramik- und Geschirrteile vervollständigen die Funde von 2015, die aber zum großen Teil noch aufgearbeitet und datiert werden müssen. (Stand 2015)
2015 gefundene Terra Sigillata lässt sich in Teilen durch den mehrfach vorhandenen Bodenstempel „OFMAS“ und die Form der Gefäße laut der Datenbank „Names on Terra Sigillata“ des Römisch-Germanischen Zentralmuseums Mainz der Leibniz-Gemeinschaft als Töpferware eines Masculus bestimmen. Die von ihm hergestellten Formen sind vergleichbar und werden einer Person zugewiesen, deren Produktions- und Handelstätigkeit in die flavisch-trajanische Zeit (ca. 70–115 n. Chr.) datiert wird. Außer im britischen und heute niederländischen Teil des Römischen Reiches wurde seine Ware auch bei Ausgrabungen in dem Gernsheim nahe gelegenen Bickenbach an einer ausgegrabenen römischen Sumpfbrücke, im Bereich von Nida und Borbetomagus (Worms) gefunden. Die Töpferware wird dem einst überregional bedeutenden und Fernhandel betreibenden Töpfereizentrum in La Graufesenque zugeordnet.
Literatur
Thomas Maurer, Felix Kotzur: Lange gesucht – endlich gefunden: auf den Spuren des Gernsheimer Römerkastells. In: hessenARCHÄOLOGIE 2014. Jahrbuch für Archäologie und Paläontologie in Hessen. Theiss, Darmstadt 2015, ISBN 978-3-8062-3203-5, S. 99–103.
Weblinks
Einzelnachweise
Römische Befestigungsanlage (Germania superior)
Archäologischer Fundplatz im Landkreis Groß-Gerau
Geographie (Gernsheim)
Bauwerk in Gernsheim
Archäologischer Fundplatz in Europa
Befestigungsanlage in Hessen
| 12,201 |
https://stackoverflow.com/questions/39234473
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,016 |
Stack Exchange
|
Frank van Puffelen, Rafi, https://stackoverflow.com/users/209103, https://stackoverflow.com/users/2569627
|
English
|
Spoken
| 549 | 840 |
Firebase - Structuring Data For Efficient Indexing
I've read almost everywhere about structuring one's Firebase Database for efficient querying, but I am still a little confused between two alternatives that I have.
For example, let's say I want to get all of a user's "maxBenchPressSessions" from the past 7 days or so.
I'm stuck between picking between these two structures:
In the first array, I use the user's id as an attribute to index on whether true or false. In the second, I use userId as the attribute NAME whose value would be the user's id.
Is one faster than the other, or would they be indexed a relatively same manner? I kind of new to database design, so I want to make sure that I'm following correct practices.
PROGRESS
I have come up with a solution that will both flatten my database AND allow me to add a ListenerForSingleValueEvent using orderBy ONLY once, but only when I want to check if a user has a session saved for a specific day.
I can have each maxBenchPressSession object have a key in the format of userId_dateString. However, if I want to get all the user's sessions from the last 7 days, I don't know how to do it in one query.
Any ideas?
There is no data structure that is inherently faster or slower. The difference depends on how you access the data from your code. If you show the queries that you want to write, it'll be easier to help. In general: model the data for how your app accesses it. See this article about NoSQL data modeling
I would use a single value event listener just to make one query. I would get all maxBenchPressSessions from a user from the past 7 days.
I recommend to watch the video. It is told about the structuring of the data very well.
References to the playlist on the firebase 3
Firebase 3.0: Data Modelling
Firebase 3.0: Node Client
I see the part in the video where he uses "username" as a key and the user's username as the value, but this contradicts the Firebase docs when they use a user's username as a key and a boolean as a value.
My question is more of whether either is more efficient or if those methods are the same. By the way, I'm not trying to stream the data. I'm simply setting up a single value event listener just to get the data once.
Then add the user, and it puts all of its sessions.
const ref = firebase.database().ref('maxBenchPressSession/' + userId);
ref.orderByChild('negativeDate').limitToLast(7).on('value', function(snap){ })
As I understand the principle firebase to use it effectively. Should be as small as possible to query the data and it does not matter how many requests.
But you will approach such a request. We'll have to add another field to the database "negativeDate".
This field allows you to get the last seven entries. Here's a video -
https://www.youtube.com/watch?v=nMR_JPfL4qg&feature=youtu.be&t=4m36s
.limitToLast(7) - 7 entries
.orderByChild('negativeDate') - sort by date
Example of a request:
const ref = firebase.database().ref('maxBenchPressSession');
ref.orderByChild('negativeDate').limitToLast(7).on('value', function(snap){ })
This is pretty close to what I need, but this only gives me all sessions from the past 7 days, regardless of user. I need to get all of the user's sessions from the past seven days.
| 31,804 |
https://github.com/whiteChen233/automated-test/blob/master/at-common/src/main/java/com/github/white/at/common/excel/ExcelUtils.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
automated-test
|
whiteChen233
|
Java
|
Code
| 95 | 483 |
package com.github.white.at.common.excel;
import java.time.LocalDateTime;
import java.util.List;
import org.apache.tomcat.util.http.fileupload.FileItem;
import com.alibaba.excel.EasyExcelFactory;
import com.alibaba.excel.support.ExcelTypeEnum;
import com.alibaba.excel.write.builder.ExcelWriterBuilder;
import com.github.white.at.common.excel.domain.BaseExcel;
import com.github.white.at.common.excel.domain.ReadExcelData;
import com.github.white.at.common.excel.domain.WriteExcelData;
import com.github.white.at.common.excel.linstener.UploadExcelListener;
public class ExcelUtils {
public <E extends BaseExcel> ReadExcelData<E> upload(FileItem fileItem, Class<E> clazz) {
try {
UploadExcelListener<E> listener = new UploadExcelListener<>();
EasyExcelFactory.read(fileItem.getInputStream(), clazz, listener).sheet().doRead();
return listener.getExcelData();
} catch (Exception e) {
return null;
}
}
public String download(WriteExcelData excelData) {
String fileName = excelData.getExcelName() + "_" + LocalDateTime.now() + ExcelTypeEnum.XLSX.getValue();
ExcelWriterBuilder builder = EasyExcelFactory.write(fileName);
List<List<String>> heads = excelData.getHeads();
if (heads.isEmpty()) {
builder.head(excelData.getExcelClass());
} else {
builder.head(heads);
}
excelData.getStyles().forEach(builder::registerWriteHandler);
builder.sheet().doWrite(excelData.getContent());
return fileName;
}
}
| 3,227 |
https://github.com/gabrieeelsp/manhattanv1/blob/master/resources/views/web/index.blade.php
|
Github Open Source
|
Open Source
|
MIT
| null |
manhattanv1
|
gabrieeelsp
|
PHP
|
Code
| 117 | 516 |
@extends('web.layout.app')
@section('content')
<!-- Main Container Starts -->
<div id="main-container" class="container">
<!-- Related Products Starts -->
<div class="product-info-box mt-3">
<h4 class="heading">DESTACADOS DE LA SEMANA</h4>
<!-- Products Row Starts -->
<div class="row">
@foreach($destacados as $destacado)
<div class="col-sm-4 col-md-3 ">
<div class="product-col">
<div class="image">
@if($destacado->images->count())
<div class="col-12">
<a href="{{ route('tienda.producto', [$destacado->slug]) }}"><img src="/{{ env('URL_REMOTE', '') }}images/{{ $destacado->images->first()->name }}" alt="Gallery image 2" class="img-fluid" /></a>
</div>
@else
<div class="col-12">
<a href="{{ route('tienda.producto', [$destacado->slug]) }}"><img src="/{{ env('URL_REMOTE', '') }}images/img-default.jpg" alt="Gallery image 2" class="img-fluid" /></a>
</div>
@endif
</div>
<div class="caption text-center">
<h4><a href="{{ route('tienda.producto', [$destacado->slug]) }}">{{ $destacado->name }}</a></h4>
<div class="description">
</div>
</div>
</div>
</div>
@endforeach
</div>
<!-- Products Row Ends -->
</div>
<!-- Related Products Ends -->
</div>
<!-- Main Container Ends -->
@endsection
| 13,025 |
https://stackoverflow.com/questions/69948876
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,021 |
Stack Exchange
|
Henry Ecker, https://stackoverflow.com/users/15497888, https://stackoverflow.com/users/3447653, user3447653
|
English
|
Spoken
| 259 | 565 |
color by a column name using plotly
I have a dataframe in the below format:
id distance value is_match
1 234 0.8 True
2 314 0.5 False
3 904 0.1 False
4 123 0.4 False
5 287 0.9 True
I tried plotting it using plotly. X axis would have "distance", y axis would have "value" and color the circles using "is_match". Used the below code:
import plotly.express as px
px.scatter(df, x='distance', y='value', color='is_match')
But this does not color code based on "is_match" column.
Any leads would be appreciated.
The shown code and dataset seems to work correctly for me. I get this plot (versions: plotly 5.3.1 pandas 1.3.4)
@HenryEcker is there a limit on the dataframe size? I have a dataframe of 800 rows and it does not plot everything
I don't know if there is a limit on DataFrame size. I do know that if there were such a limit it would be much higher than 800 rows. The titanic dataset plots fine and that has 891 rows (for example)
works fine. Have generated much larger dataset as per comments from you sample
when number of points 10**5 then second trace (True) dominates as it is above first trace (False)
import io
import pandas as pd
import numpy as np
import plotly.express as px
df = pd.read_csv(io.StringIO("""id distance value is_match
1 234 0.8 True
2 314 0.5 False
3 904 0.1 False
4 123 0.4 False
5 287 0.9 True """), sep="\s+")
ROWS = 10**4
df = pd.DataFrame({"distance":np.random.randint(df["distance"].min(), df["distance"].max(), ROWS),
"value":np.random.uniform(df["value"].min(), df["value"].max(), ROWS),
"is_match":np.random.randint(0,2,ROWS).astype(bool)})
px.scatter(df, x='distance', y='value', color='is_match')
| 2,935 |
https://openalex.org/W4380028635
|
OpenAlex
|
Open Science
|
CC-By
| 2,023 |
Comparison of stress tolerance of hybrid and selfed offspring of two populations of Litopenaeus vannamei
|
Song Miao
|
English
|
Spoken
| 7,463 | 13,277 |
Comparison of stress tolerance of hybrid and selfed
offspring of two populations of Litopenaeus vannamei
Miao Shi
Dalian Ocean University
Song Jiang
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Shigui Jiang
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Qibin Yang
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Yundong Li
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Falin Zhou
(
[email protected]
)
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Research Article
Keywords: Litopenaeus vannamei, Ammonia-N, pH, Salinity, Tolerance, Heterosis
Posted Date: June 9th, 2023
DOI: https://doi.org/10.21203/rs.3.rs-3029442/v1
License:
This work is licensed under a Creative Commons Attribution 4.0 International
License.
Read Full
License Comparison of stress tolerance of hybrid and selfed
offspring of two populations of Litopenaeus vannamei
Miao Shi
Dalian Ocean University
Song Jiang
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Shigui Jiang
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Qibin Yang
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Yundong Li
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Falin Zhou
(
[email protected]
)
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Research Article
Keywords: Litopenaeus vannamei, Ammonia-N, pH, Salinity, Tolerance, Heterosis
Posted Date: June 9th, 2023
DOI: https://doi.org/10.21203/rs.3.rs-3029442/v1
License:
This work is licensed under a Creative Commons Attribution 4.0 International
License. Read Full
License Research Article Keywords: Litopenaeus vannamei, Ammonia-N, pH, Salinity, Tolerance, Heterosis
Posted Date: June 9th, 2023
DOI: https://doi.org/10.21203/rs.3.rs-3029442/v1
License:
This work is licensed under a Creative Commons Attribution 4.0 International
License. Read Full
License Page 1/12 Page 1/12 Abstract Litopenaeus vannamei collected from Thailand (T) and the United States (M) were uesd as parents, four progeny
populations of TT, MM, TM and MT were constructed by diallel cross, with a total of 20 families. The tolerance of
young shrimp to high ammonia-N, high pH and low salt was compared through 96 h acute toxicity test, the heterosis
of each mating combination was analyzed, and the tolerance of parents and offspring was evaluated.The results
showed that under 96 h of high ammonia-N, high pH, and low salt stress, the mortality rates of each family were
19.52%–92.22%, 23.29%–92.58%, and 19.95%–80.17%, respectively. There were significant differences in the
tolerance of different families to ammonia-N, pH, and salinity stress (P < 0.05). The population with a female parent
from the United States has stronger tolerance to ammonia-N, pH, and low salt stress than the population with a
female parent from Thailand. The population with a male parent from Thailand has weaker tolerance to pH and low
salt stress than the population with a male parent from the United States, but is superior to the population with a
male parent from the United States under ammonia-N stress. The heterosis rates of the hybrid population TM in
acute high ammonia-N, high pH and low salinity were 81.67%, 44.89% and −10.18%, respectively; The heterosis rate
of MT population was 14.89%, 38.82% and −8.09%, respectively. The overall resistance of the four populations
showed MM > MT > TT > TM. The population TM has obvious heterosis in high ammonia-N and high pH tolerance
traits, and the family MM7 has strong low salt tolerance, so it can be considered as a candidate family for
subsequent breeding work. The experimental results provide a basis for screening new strains of vannamei shrimp
with strong stress resistance through family breeding. Introduction Litopenaeus vannamei, also known as the Pacific white shrimp, is naturally distributed in tropical waters along the
Pacific coast from Peru to Mexico, from the Gulf of Mexico to central Peru, especially near Ecuador (Zhang 1990). It
has the advantages of small head and chest armor, high meat content, strong stress resistance, fast growth, long
breeding period, high density and low salinity tolerance for aquaculture, and easy transportation of live shrimp. It is
listed as the world's three largest cultured shrimp species alongside Fenneropenaeus chinensis and Penaeus
monodon, and plays an important role in shrimp fisheries and aquaculture (Zhang et al. 2009; Wang et al. 2004). Ammonia-N, pH, and salinity are important environmental factors in the shrimp farming environment, and a good
marine environment is a prerequisite for the sustainable development of marine aquaculture. However, due to the
deterioration of the marine environment, especially in coastal areas, the water environment pollution caused by high-
density aquaculture and the mutation of the aquaculture water environment caused by many external factors
(especially rainstorm, typhoon, cold wave and other adverse weather), the stress induced diseases of cultured
shrimp occur frequently, and such problems have not been effectively solved yet (Huang et al. 2012). Adverse
environmental factors can disrupt the original physiological balance of organisms, and long-term environmental
pressure can cause irreversible damage to organs and tissues, even leading to the death of organisms, directly
leading to high mortality rates and huge economic losses (Chen et al. 1995; Chen and Chen 2003; Dunier and Siwicki
1993). Genetic improvement of stress resistance indicators such as ammonia-N, pH, and salinity in Litopenaeus
vannamei is one of the effective ways to address these issues (Hu et al. 2016). Cross breeding is one of the important means of genetic improvement in aquatic animals (Zhang et al. 2019). By
crossing individuals of different strains or genotypes, their offspring can outperform their parents in terms of
production performance, environmental tolerance, and meat quality (Piferrer et al. 2009). Heterosis and combining
ability are very important references in breeding, which can measure the degree of heterosis obtained after crossing Page 2/12 different lines and reflect the matching effect of target traits. Zhou (Zhou et al. 2021) studied the heterosis and
combining ability of body mass traits of three populations of Penaeus monodon through complete diallel cross
design; Sun (Sun et al. Test materials The experiment was conducted at Hainan Lutai Marine Biotechnology Co., Ltd., using two introduced populations of
Litopenaeus vannamei as parent shrimp, namely the Dingfeng strain (T) from Thailand and the Daynight Express
strain (M) from the United States. Each strain of parent shrimp is raised separately, with each female shrimp
corresponding to an eye label. After the parent shrimp is temporarily raised and stabilized, the female shrimp
undergoes unilateral eye stalk removal and is fed with frozen squid, oysters, and fresh sand silkworms to promote
maturation. Four self propagation and hybrid populations were successfully established within 10 days by selecting
mature gonadal parent shrimp and using diallel natural mating: T♀ × T♂ (TT)、M♀ × M♂(MM)、T♀ × M♂(TM) and M♀ ×
T♂(MT), a total of 20 families, with 20000 nauplii selected from each family, and their larval development was
tracked and observed. Each self breeding and hybrid population was cultured in a standardized manner until the
larvae were hatched. After cultivation to P15, 1000 nauplii were randomly selected and transferred to the cement
pool of the standard coarse workshop to maintain consistent cultivation conditions at all stages, To reduce the
impact of differences in environmental conditions (mainly including salinity, temperature, larval density, feed, and
inflation of water at different stages) on growth and development. When the body length of the juvenile shrimp
reaches 4–5 cm, a portion of the juvenile shrimp is randomly collected from each family's cage for testing. Before
the experiment, the juvenile shrimp specifications were: TT body length (5.11 ± 0.65) cm, body weight (1.34 ± 0.45)
g/tail; MM has a body length of (4.99 ± 0.60) cm and a weight of (1.30 ± 0.44) g/tail; TM has a body length of (4.47
± 0.50) cm and a weight of (0.90 ± 0.30) g/tail; MT body length (4.66 ± 0.55) cm, body weight (1.02 ± 0.37) g/tail. T
t
th d Introduction 2011) found significant differences in high ammonia-N tolerance among different families of
Penaeus monodon; He (He et al. 2008) found that there were significant differences in the resistance of juvenile
shrimp seedlings among Chinese shrimp families. Different families had significant differences in tolerance to
ammonia-N and pH, indicating significant selection potential; Fang (Fang et al. 2000) found that as pH increased,
the survival rate of juvenile Chinese shrimp decreased. Pan (Pan et al. 2007) reported the effect of acute salinity
stress on the growth and survival of Litopenaeus vannamei larvae; Lin (Lin et al. 2010) compared the tolerance of
different families of Litopenaeus vannamei to freshwater and obtained the basic population of excellent freshwater
tolerant families; Wang (Wang et al. 2022) found that both growth and comprehensive stress tolerance traits can be
genetically improved through breeding, and growth traits can also be indirectly improved through breeding. This
study aims to analyze the mortality rates of two introduced self bred and hybrid families of Litopenaeus vannamei
under 96 h of high ammonia-N, high pH, and low salt stress, evaluate the stress tolerance of the breeding population,
provide candidate materials for further family selection, and provide reference data for stress resistance breeding of
Litopenaeus vannamei. Test method Before the start of the formal experiment, a 96 h tolerance pre experiment was conducted to obtain the 96 h half
lethal mass concentration of Litopenaeus vannamei, which includes high ammonia-N, high pH, and low salt stress
concentrations of 150mg·L–1, 9.7, and 1 ppt, respectively. The water in the experimental group was regulated with
NH4CL (analytically pure), NaOH, and fully aerated fresh water. 150 uniformly sized juvenile shrimp were selected
from each family in the standard coarse pool for fluorescence labeling, and temporarily raised for 24 h. Then 150 Page 3/12 Page 3/12 individuals were randomly divided into 3 groups with 50 individuals in each group. They were mixed in three 7.3m ×
4.3m × 2m cement ponds, respectively, and stress tests were carried out with high ammonia-N, pH and low salt. During the experiment, there was no inflation, and individual deaths were observed at regular intervals. Dead
individuals and feces were promptly removed, and the number of deaths within 96 h was accurately recorded. Statistical analyses individuals were randomly divided into 3 groups with 50 individuals in each group. They were mixed in three 7.3m ×
4.3m × 2m cement ponds, respectively, and stress tests were carried out with high ammonia-N, pH and low salt. During the experiment, there was no inflation, and individual deaths were observed at regular intervals. Dead
individuals and feces were promptly removed, and the number of deaths within 96 h was accurately recorded. Statistical analyses Excel 2010 was used to calculate the average value, standard deviation and heterosis of mortality of each family,
SPSS26.0 was used to perform one-way ANOVA on the data, and Duncan's multiple comparison method was used
to analyze the significance of differences between different combinations for traits with significant differences (P <
0.05). The results are expressed as mean ± standard deviation (mean ± SD). We used the following heterosis formula for combined stress tolerance traits (Cruz and Ibarra 1997; Lu et al. 2016): Results Effect of stress tolerance traits on mortality of different L. vannamei families Page 4/12 Table 1
Effect of stress tolerance traits on mortality of different L. vannamei families
Family
96h stress-resistant family mortality(%)
Ammonia-N
pH
Salinity
TT1
41.91 ± 12.89
42.05 ± 9.09
70.89 ± 13.80
TT2
19.52 ± 5.77
23.29 ± 8.37
61.51 ± 14.43
TT3
23.33 ± 9.28
38.00 ± 5.46
73.62 ± 7.56
TT4
73.34 ± 7.64
92.58 ± 6.53
77.01 ± 7.19
TT5
53.89 ± 4.19
48.82 ± 15.19
70.36 ± 12.20
MM6
46.19 ± 5.77
33.29 ± 10.77
72.54 ± 6.80
MM7
25.00 ± 11.66
54.78 ± 9.34
55.37 ± 8.20
MM8
35.90 ± 16.01
39.87 ± 11.64
76.90 ± 10.34
MM9
32.86 ± 6.55
25.52 ± 6.14
55.07 ± 6.80
MM10
51.28 ± 11.65
54.21 ± 7.87
19.95 ± 8.96
TM11
77.22 ± 5.09
46.56 ± 7.46
67.21 ± 8.06
TM12
92.22 ± 12.06
83.85 ± 6.10
60.75 ± 5.71
TM13
67.88 ± 9.15
64.53 ± 7.28
40.99 ± 4.09
TM14
47.88 ± 12.38
52.59 ± 7.91
35.29 ± 5.94
TM15
81.11 ± 12.51
80.22 ± 9.41
80.17 ± 5.89
MT16
58.89 ± 8.22
62.22 ± 5.09
40.81 ± 5.96
MT17
28.33 ± 7.27
73.21 ± 10.27
70.82 ± 6.59
MT18
43.33 ± 16.42
73.85 ± 8.41
40.67 ± 3.38
MT19
66.67 ± 9.02
71.62 ± 13.16
68.34 ± 4.96
MT20
34.44 ± 6.74
33.12 ± 5.66
70.34 ± 7.85 Table 1 Table 1
Effect of stress tolerance traits on mortality of different L. vannamei families Effect of stress tolerance traits on mortality of different L. vannamei families The survival rates of 20 F1 generation populations of juvenile shrimp under different ammonia-N, pH, and salinity The survival rates of 20 F1 generation populations of juvenile shrimp under different ammonia-N, pH, and salinity
stresses for 96 h are shown in Table 1. A one-way analysis of variance was conducted on the ammonia-N tolerance
of each family, and the results showed that there were differences in the tolerance of different families to 96h stress
(P < 0.05). The range of acute stress tolerance mortality rate for 20 families under ammonia-N stress for 96 h is
19.52% − 92.22%. Results If the average mortality rate of a family is less than 30%, it is classified as a Page 5/12 high tolerance family, 30% − 60% is a moderate tolerance family, and more than 60% is classified as a weak
tolerance family, then the family coefficients of strong, medium, and weak ammonia-N tolerance are 4, 10, and 6,
respectively; There are 2, 10, and 8 pH values respectively; There are 1, 6, and 13 low salt levels, respectively. Comparison of tolerance between different paternal and maternal
lineages Comparison of tolerance between different paternal and maternal
lineages
Table 2
Comparison of tolerance between different paternal and maternal lineages
Average mortality/%
Origin of
male
parent
Number
of
family
Ammonia-
N
pH
Salinity
Origin of
female
parent
Number
of
family
Ammonia-
N
pH
Salinity
Thailand
10
44.37 ±
18.44
55.88
±
22.11
64.44
± 13.09
Thailand
10
57.83 ±
24.65
57.25
±
22.36
63.78
± 14.88
U.S.A
10
55.75 ±
22.65
53.54
±
18.81
56.42
± 19.42
U.S.A
10
42.29 ±
13.55
52.17
±
18.21
57.08
± 16.64
Compare the mortality rates of families with different parental and maternal origins under different stress conditions
at 96 h (Table 2). Results The mortality rate of TT2 family under ammonia-N stress for 96 h is the lowest, at 19.52% ±
5.77%, while TM12 family has the highest, at 92.22% ± 12.06%; The range of tolerance mortality rate for acute stress
families at pH 96 h is 23.29% − 92.58%, with family TT4 having the lowest survival rate and family TT2 having the
highest survival rate; The MM10 family had the lowest acute stress tolerance death rate after 96 h of low salt
tolerance, which was 19.95% ± 8.06%. The TM15 family had the highest mortality rate, which was 80.17% ± 5.89%. Under ammonia-N and pH stress, the TT2 family has the strongest tolerance; Some families also overlap in
tolerance under pH and low salt stress. If the average mortality rate of a family is less than 30%, it is classified as a The survival rates of 20 F1 generation populations of juvenile shrimp under different ammonia-N, pH, and salinity
stresses for 96 h are shown in Table 1. A one-way analysis of variance was conducted on the ammonia-N tolerance
of each family, and the results showed that there were differences in the tolerance of different families to 96h stress
(P < 0.05). The range of acute stress tolerance mortality rate for 20 families under ammonia-N stress for 96 h is
19.52% − 92.22%. The mortality rate of TT2 family under ammonia-N stress for 96 h is the lowest, at 19.52% ±
5.77%, while TM12 family has the highest, at 92.22% ± 12.06%; The range of tolerance mortality rate for acute stress
families at pH 96 h is 23.29% − 92.58%, with family TT4 having the lowest survival rate and family TT2 having the
highest survival rate; The MM10 family had the lowest acute stress tolerance death rate after 96 h of low salt
tolerance, which was 19.95% ± 8.06%. The TM15 family had the highest mortality rate, which was 80.17% ± 5.89%. Under ammonia-N and pH stress, the TT2 family has the strongest tolerance; Some families also overlap in
tolerance under pH and low salt stress. Results The results showed that under ammonia-N stress, the average mortality rate of families with a
female parent from the United States was the lowest (42.29 ± 13.55)%, but there was no significant difference
compared to families with a male parent from Thailand and the United States(P > 0.05); Under pH stress, there was
no significant difference in tolerance among families whose parents were originally from Thailand or the United
States(P > 0.05), with the family with the strongest tolerance being the parent from the United States(52.17 ±
18.21)%; Under low salt stress, the mortality rate of families with American parents was lower than that of families
with American parents, while the mortality rate of families with Thai parents was lower than that of families with
Thailand parents but there was no significant difference (P < 0 05) Table 2
Comparison of tolerance between different paternal and maternal lineages
Average mortality/%
Origin of
male
parent
Number
of
family
Ammonia-
N
pH
Salinity
Origin of
female
parent
Number
of
family
Ammonia-
N
pH
Salinity
Thailand
10
44.37 ±
18.44
55.88
±
22.11
64.44
± 13.09
Thailand
10
57.83 ±
24.65
57.25
±
22.36
63.78
± 14.88
U.S.A
10
55.75 ±
22.65
53.54
±
18.81
56.42
± 19.42
U.S.A
10
42.29 ±
13.55
52.17
±
18.21
57.08
± 16.64 Table 2 Compare the mortality rates of families with different parental and maternal origins under different stress conditions
at 96 h (Table 2). The results showed that under ammonia-N stress, the average mortality rate of families with a
female parent from the United States was the lowest (42.29 ± 13.55)%, but there was no significant difference
compared to families with a male parent from Thailand and the United States(P > 0.05); Under pH stress, there was
no significant difference in tolerance among families whose parents were originally from Thailand or the United
States(P > 0.05), with the family with the strongest tolerance being the parent from the United States(52.17 ±
18.21)%; Under low salt stress, the mortality rate of families with American parents was lower than that of families
with American parents, while the mortality rate of families with Thai parents was lower than that of families with
Thailand parents, but there was no significant difference (P < 0.05). Compare the mortality rates of families with different parental and maternal origins under different stress conditions
at 96 h (Table 2). Results The results showed that under ammonia-N stress, the average mortality rate of families with a
female parent from the United States was the lowest (42.29 ± 13.55)%, but there was no significant difference
compared to families with a male parent from Thailand and the United States(P > 0.05); Under pH stress, there was
no significant difference in tolerance among families whose parents were originally from Thailand or the United
States(P > 0.05), with the family with the strongest tolerance being the parent from the United States(52.17 ±
18.21)%; Under low salt stress, the mortality rate of families with American parents was lower than that of families
with American parents, while the mortality rate of families with Thai parents was lower than that of families with
Thailand parents, but there was no significant difference (P < 0.05). 18.21)%; Under low salt stress, the mortality rate of families with American parents was lower than that of families
with American parents, while the mortality rate of families with Thai parents was lower than that of families with
Thailand parents, but there was no significant difference (P < 0.05). Comparison of tolerance for families of different mate
combinations Survival rates of different populations under acu Figure 1(A) showed that under ammonia-N stress, the survival rates of all four populations showed a significant
downward trend at 48 h (P < 0.05), but the downward trend of survival rates of the four populations was significantly
different. Within 24 h of stress, the survival rate slowly decreased, and after 48 h, the TM population showed a rapid
decline trend compared to the other three populations; Fig. 1(B) showed that under pH stress, the survival rates of
the four populations significantly reached a low point at 36 h (P < 0.05), and the decline rate slowed down thereafter. The self crossing populations TT and MM, as well as the hybrid populations TM and MT, maintained a consistent
downward trend; Fig. 1(C) showed that under low salt stress, the survival rate of the four populations showed a rapid
decline at 12 h, and thereafter, the decline trend of the four populations slowed down, and there was no significant
difference in survival rate between the four populations (P > 0.05). Comparison of tolerance for families of different mate
combinations combinations
Table 3
Comparison of tolerance for families of different mate combinations.Values with different superscripts within the
same row are significantly different from one another(P ༜ 0.05),and those with the same superscripts have no
significant difference
T × T
M × M
T × M
M × T
H(T × M,
%)
H(M × T,
%)
H( %
)
Ammonia-
N
42.4 ± 21.8b
38.25 ±
13.46b
73.26 ±
17.85a
46.33 ±
17.26b
81.67
14.89
48.28
pH
48.95 ±
25.5bc
41.53 ±
14.31c
65.55 ±
16.55a
62.8 ±
17.69ab
44.89
38.82
41.85
Salinity
70.68 ±
11.06a
55.97 ±
21.92b
56.88 ±
17.96b
58.20 ±
15.61ab
-10.18
-8.09
-9.14 Table 3 Comparison of tolerance for families of different mate combinations.Values with different superscripts within the
same row are significantly different from one another(P ༜ 0.05),and those with the same superscripts have no
significant difference significant difference
T × T
M × M
T × M
M × T
H(T × M,
%)
H(M × T,
%)
H( %
)
Ammonia-
N
42.4 ± 21.8b
38.25 ±
13.46b
73.26 ±
17.85a
46.33 ±
17.26b
81.67
14.89
48.28
pH
48.95 ±
25.5bc
41.53 ±
14.31c
65.55 ±
16.55a
62.8 ±
17.69ab
44.89
38.82
41.85
Salinity
70.68 ±
11.06a
55.97 ±
21.92b
56.88 ±
17.96b
58.20 ±
15.61ab
-10.18
-8.09
-9.14 Duncan's multiple comparison method was used to perform variance analysis on the significant differences in
mortality rates among four hybrid combinations under stress (Table 3). Comparison of tolerance for families of different mate
combinations The results showed that under ammonia-N
stress, the ammonia-N tolerance of the TM combination population was significantly lower than that of the other
three combination populations (P < 0.01), and there was no significant difference in ammonia-N tolerance among
the other three populations (P > 0.05); Under pH stress, the tolerance of self pollinated population MM to pH was
significantly higher than that of hybrid population TM and MT combination population (P < 0.05), while the tolerance
of hybrid population TM was significantly lower than that of self pollinated population and there was no significant
difference in pH tolerance between self pollinated population and MT combination population (P > 0.05); Under low
salt stress, there was a significant difference (P < 0.05) in the tolerance to low salt between the TT combination
population and the MM and TM combination population, while there was no significant difference (P > 0.05)
between the TT combination population and the MT combination population. The survival rate of the MM
combination population was the highest under all three types of stress. The heterosis analysis on mortality of inbred
combinations and hybrid combination families from Thailand and the United States under stress resistance is
shown in Table 3. The results show that the average heterosis rate of stress resistance of most combinations is
positive, and all family combinations show different degrees of heterosis (41.85% − 48.28%) under ammonia-N and
pH stress, of which the heterosis of ammonia-N tolerance of TM combination reaches 81.67%, and, The MT
combination family showed high heterosis in terms of tolerance to ammonia-N and pH (81.67%, 44.89%); The hybrid
generation showed a certain degree of hybridization disadvantage (H (%) < 0) in low salt tolerance. Discussions This allows for the selection of quantitative traits such as growth rate and disease resistance
through family selection (Wu et al. 2011). This study used 20 families from 4 populations of 2 introduced populations of Litopenaeus vannamei through self
breeding and hybridization combinations as experimental materials. Using ammonia-N, pH, and salinity tolerance as
indicators, 6 families with strong tolerance were preliminarily selected, and the optimal families under ammonia-N
and pH stress overlapped (TT2), while some families also overlapped under low salt and pH stress (MM9). He (He et
al. 2008) conducted acute toxicity tests on Chinese shrimp larvae from different families and found that there were
significant differences in ammonia-N tolerance and high pH traits among Chinese shrimp larvae from different
families, indicating significant selection potential. Chen (Chen et al. 2017) tested the low salt tolerance of 11
families of Penaeus monodon and found significant differences in the survival rate at half lethal time among each
family. Comparative analysis of physical differences between different populations, further analysis of heterosis of
stress resistance, and comparison of genetic differences between different mating combinations make it possible to
select strains of shrimp with stress resistance, and help solve the contradiction between environmental degradation
and high yield in the later stage of shrimp breeding from the perspective of genetic improvement of breeding
varieties (Camacho-jiménez et al. 2018). In this experiment, a study on the mortality rate of families constructed
from the same source of maternal and paternal parents found that although the mortality rates of families were
different, there was no significant difference(P > 0.05). The survival rate of families with Thai and American parents
under ammonia-N and pH stress was higher than that of families with Thailand and American parents, but the
opposite results were observed under low salt stress. The overall tolerance of different groups of families to
ammonia-N, pH, and low salt is generally higher than that of Thailand sources. By comparing the tolerance of
different combinations of families, it was found that the American strain (MM) and a few hybrid strains performed
better (MT) in ammonia-N, pH and low salt stress, while the Thai strain (TT) and a few Thai American hybrid
families performed worse, which indicated that the American strain had certain advantages in stress resistance. Discussions Adverse water quality factors in the aquaculture environment, such as abnormal temperature, salinity, ammonia-N
content, pH, nitrite and other stress factors, have a significant impact on the genetic basis, disease resistance and
pathogenicity of pathogenic microorganisms of mariculture animals (He et al. 2008). Ammonia-N is the main
pollutant in the shrimp farming environment, mainly present in the form of non ionized ammonia (NH3) and ionic
ammonia (NH4
+) in the water body, and the two are in dynamic equilibrium. Because NH3 is not charged and has
high fat solubility, it can penetrate the cell membrane and has adverse effects on shrimp growth, molting, oxygen
consumption, immunity, ammonia-N excretion, osmotic pressure regulation and disease resistance (Huang et al. 2012; Lei and Chen 2003; Cui et al. 2017). pH can reflect water quality and is also an important ecological factor
affecting the survival status of aquaculture organisms. Shrimp and crab species are very sensitive to acidification
and alkalization, and high or low pH can affect their growth, immunity, ion balance, etc. to a certain extent. Environmental salinity is closely related to the osmotic regulation of crustaceans. Acute salinity stress will affect the
osmotic pressure of the internal environment, the level of respiratory metabolism and immune function (Joseph and Environmental salinity is closely related to the osmotic regulation of crustaceans. Acute salinity stress will affect the
osmotic pressure of the internal environment, the level of respiratory metabolism and immune function (Joseph and Page 7/12 Page 7/12 Philip 2020; Camacho-jiménez et al. 2018). In recent years, it has gradually emerged to conduct breeding work based
on family lines, including Pinctada martensii, Argopectenirradians, Patinopectenyessoensis, Paralichthys olivaceus,
etc. (He et al. 2007; Qin et al. 2007; Zhang et al. 2008; Chen et al. 2008). Compared with population selection, family
selection has the advantages of fast speed, obvious effects, high work efficiency, flexible operation, and outstanding
excellent traits. The genetic composition of the family is relatively uniform, and the genotypes of parents and
offspring are easy to determine. Therefore, family selection has begun to be widely applied in the breeding of
excellent aquatic animal varieties. Another important advantage of family selection is that by observing the
phenotypic traits of whole or half sib families, the breeding values of some difficult to measure traits of the parents
can be estimated. Discussions It
can be inferred that this advantage was due to the strong ability of the American strain in stress resistance, The Thai
strain is relatively weak, and there is another possibility that the advantage of stress resistance is determined jointly
by both hybrid strains, rather than the advantage of a single strain, which needs to be further verified in future
generations. The analysis showed that the hybrid families of Thailand and the United States showed heterosis for
ammonia-N and pH tolerance, and the average heterosis value of growth traits of hybrid combinations was positive
(14.89–81.67%) except for low salt stress. There are many research reports on heterosis of growth traits of
Litopenaeus vannamei at home and abroad, and it is found that hybrid combinations generally show heterosis in
growth performance (Sui et al. 2016; Lu et al. 2017). For ammonia-N and pH traits, TM and MT populations showed
different levels of heterosis, but on the whole, the heterosis of TM was better than that of MT, and the average
heterosis rate of TM population for ammonia-N was the highest, 81.67%; The hybrid combinations showed a certain
degree of hybridization disadvantage (− 10.18–8.09%) in low salt tolerance, which was weaker than the median of
both parents. Ji (Ji et al. 2018) compared the stress resistance and growth traits of the first generation of shrimp in Page 8/12 Page 8/12 different populations of L. Vannamei, and obtained similar results. The survival rates of the four populations under
acute stress showed that the stress resistance of the MM and MT populations was slightly higher than that of the
TT and TM populations, and the inheritance of the maternal parent was dominant. The stress resistance of the
hybrid combination MT population was significantly better than that of the TM population. Different cross
combinations show different heterosis, and heterosis of different characters are also different. Heterosis is a
complex biological phenomenon. Some studies have pointed out that the greater the genetic difference between
hybrid parents, the stronger the complementarity, and the more obvious the heterosis (Pillai et al. 2011). In this
experiment, the hybrid population showed poor performance in low salt stress resistance, which may be due to the
enrichment of recessive harmful genes at different loci in parents with different genetic backgrounds. Discussions If the
recessive harmful genes in the chromosomes provided by the parents of the hybrid offspring happen to be alleles,
then the probability of growth or stress resistance decline in the hybrid offspring will increase (Ma et al. 2005). If the
selection of hybrid parents is not appropriate, it may lead to the regression of certain important economic traits in
hybrid offspring, so the selection of parents is crucial in the process of hybrid breeding. Stress resistance refers to the adaptability of organisms to harsh environments and is a threshold trait controlled by
multiple genes. It is generally believed that heritability is relatively low and it is relatively difficult to improve traits
through breeding (Bulmer MG 1991). The research on the stress resistance of Penaeus monodon (Huang et al. 2012), Macrobrachium rosenbergii (Thanh et al. 2010) and Penaeus chinensis (Li et al. 2005) shows that the stress
resistance of some aquatic animal has high heritability, which can be improved through breeding. This study used
the average mortality rate and hybrid advantage of families under high ammonia-N, high pH, and low salt stress for
96 h as evaluation indicators, and screened out superior populations (MM and MT), as well as high ammonia-N and
high pH families (TT2) and low salt families (MM10). The results of this study provide two candidate dominant
families for the breeding of L. vannamei families. The next step is to preserve the selected families with strong
stress resistance, improve the stress resistance of the families through continuous breeding and purification. In
addition, the genetic structure of different populations and families will be analyzed at the molecular level, and
molecular marker assisted breeding will be carried out for further verification and selection in future breeding work,
To provide reference data for breeding a new strain of L. vannamei with significantly improved target economic
traits, which is fast growing and has resistance to stress. Declarations FUNDING This study was supported by the Project of Sanya Yazhou Bay Science and TechnologyCity(SCKJ-JYRC-
2022-01),the Youth Fund of Hainan Natural Science Foundation (321QN351) Industrial Technology System of
Modern Agriculture (CARS-48), Central Public-Interest Scientific Institution Basal Research Fund, South China Sea
Fisheries Research Institute, CAFS (2020TD30, 2021SD13), Special fund project for scientific and technological
innovation and industrial development in Dapeng New Area (KJYF202101-08). References Page 9/12
1. Zhang WQ (1990) Biological profile of important world aquaculture species-Penaeus vannamei. Marine
Sciences 14: 69－73. 2. Zhang LP, Wu LF, Shen Q, Du SB, Hu CQ (2009) Full-sib families construction and their growth comparison of
Pacific white leg shrimp, Litopenaeus vannamei. Fish China 33: 932－9. https://doi: 10.3724/SP.J.00001
3. Wang XQ, Ma S, Dong SL (2004) studies on the biology and cultural ecology of litopenaeus vannamei: a review. Transactions of Oceanology and Limnology 30: 94－100. https://doi: 10.3969/j.issn.1003-6482.2004.04.016 1. Zhang WQ (1990) Biological profile of important world aquaculture species-Penaeus vannamei. Marine
Sciences 14: 69－73. 1. Zhang WQ (1990) Biological profile of important world aquaculture species-Penaeus vannamei. Marine
Sciences 14: 69－73. 2. Zhang LP, Wu LF, Shen Q, Du SB, Hu CQ (2009) Full-sib families construction and their growth comparison of
Pacific white leg shrimp, Litopenaeus vannamei. Fish China 33: 932－9. https://doi: 10.3724/SP.J.00001 2. Zhang LP, Wu LF, Shen Q, Du SB, Hu CQ (2009) Full-sib families construction and their growth comparison of
Pacific white leg shrimp, Litopenaeus vannamei. Fish China 33: 932－9. https://doi: 10.3724/SP.J.00001 3. Wang XQ, Ma S, Dong SL (2004) studies on the biology and cultural ecology of litopenaeus vannamei: a review. Transactions of Oceanology and Limnology 30: 94－100. https://doi: 10.3969/j.issn.1003-6482.2004.04.016 Page 9/12
3. Wang XQ, Ma S, Dong SL (2004) studies on the biology and cultural ecology of litopenaeus vannamei: a review. Transactions of Oceanology and Limnology 30: 94－100. https://doi: 10.3969/j.issn.1003-6482.2004.04.016 Page 9/12 4. Huang JH, Li Y, Yang QB, Su TF, Zhu CY, Jiang SG (2012) Comparison of tolerance to ammonia-N in Penaeus
monodon families. South China Fisheries Science 8: 37－43. https://doi: 10.3969/j. issn.2095－0780.2012.06.006 5. Chen JC, Lin MN, Ting YY, Lin JN (1995) Survival, haemolymph osmolality and tissue water of Penaeus
chinensis juveniles acclimated to different salinity and temperature levels. Comparative Biochemistry and
Physiology Part A: Physiology 110: 253－8. https://doi: 10.1016/0300-9629(94)00164-O 6. Chen SM, Chen JC (2003) Effects of pH on survival, growth, molting and feeding of giant freshwater prawn
Macrobrachium rosenbergii. Aquaculture 218: 613－23. https://doi: 10.1016/S0044-8486(02)00265-X 7. Dunier M, Siwicki AK (1993) Effects of pesticides and other organic pollutants in the aquatic environment on
immunity of fish: a review. Fish & Shellfish Immunology 3: 423－38. https://doi: 10.1006/fsim.1993.1042 8. Hu ZG, Liu JY, Yuan RP, Zhang JC (2016) Analysis of combining ability of survival of imported Litopenaeus
vannamei populations under temperature and salinity stress. Marine Sciences 40: 25－31. https://doi:
10.11759/hykx20141009003 9. References Zhang XJ, Zhou L, Gui JF (2019) Biotechnological innovation in genetic breeding and sustainable green
development in Chinese aquaculture. Scientia Sinica 49: 1409－29. https://doi: CNKI:SUN:JCXK.0.2019-11-003 10. Piferrer F, Beaumont A, Falguière JC, Flajšhans M, Haffray P, Colombo L (2009) Polyploid fish and shellfish:
Production, biology and applications to aquaculture for performance improvement and genetic containment. Aquaculture 293: 125－56. https://doi: 10.1016/j.aquaculture.2009.04.036 11. Zhou FL, Yang QB, Jiang S, Yang LS, Li YD, Huang JH, Jiang SG (2021) Analysis of combining ability and
heterosis on body mass trait of three Penaeus monodon populations. South China Fish Sci 17: 39－44. https://doi: 10.12131/20200157 12. Sun MM, Huang JH, Yang QB, Zhou FL, Wen WG, Chen X, Jiang SG (2011) Comparison on characteristics of
growth and resistance to ammonia among 13 families of Penaeus monodon. Shanghai Ocean Univ 20: 510－6. https://doi: CNKI:SUN:SSDB.0.2011-04-006 12. Sun MM, Huang JH, Yang QB, Zhou FL, Wen WG, Chen X, Jiang SG (2011) Comparison on characteristics of
growth and resistance to ammonia among 13 families of Penaeus monodon. Shanghai Ocean Univ 20: 510－6
https://doi: CNKI:SUN:SSDB.0.2011-04-006 13. He YY, Li J, Liu P, Huang FY, Wang QY (2008) Comparison of the resistance to pH value and ammonia in
Chinese shrimp (Fenneropenaeus chinensis) families. Periodical of Ocean University of China 761－765. https://doi:10.16441/j.cnki.hdxb.2008.05.012 13. He YY, Li J, Liu P, Huang FY, Wang QY (2008) Comparison of the resistance to pH value and ammonia in
Chinese shrimp (Fenneropenaeus chinensis) families. Periodical of Ocean University of China 761－765. https://doi:10.16441/j.cnki.hdxb.2008.05.012 14. Fang WH, Wang H, Lai QF (2000) Toxicity of carbonate－alkalinity and pH to larval Penaeus chinensis. Journal
of Fishery Sciences of China 78－81. https://doi:10.3321/j.issn:1005-8737.2000.04.018 14. Fang WH, Wang H, Lai QF (2000) Toxicity of carbonate－alkalinity and pH to larval Penaeus chinensis. Journal
of Fishery Sciences of China 78－81. https://doi:10.3321/j.issn:1005-8737.2000.04.018 15. Pan LQ, Zhang LJ, Liu HY (2007) Effects of salinity and pH on ion-transport enzyme activities, survival and
growth of Litopenaeus vannamei postlarvae. Aquaculture 273: 711－20. https://doi:10.1016/j.aquaculture.2007.07.218 16. Lin HJ, Zhang LP, Shen Q, Hu CQ (2010) The comparison of tolerance to fresh water in 10 full-sib families of
white leg shrimp, litopenaeus vannamei. Transactions of Oceanology and Limnology 127: 143－8. https://doi:
10.13984/j.cnki.cn37－1141.2010.04.022 16. Lin HJ, Zhang LP, Shen Q, Hu CQ (2010) The comparison of tolerance to fresh water in 10 full-sib families of
white leg shrimp, litopenaeus vannamei. Transactions of Oceanology and Limnology 127: 143－8. https://doi:
10.13984/j.cnki.cn37－1141.2010.04.022 17. References Wang L, Wang CY, Liu, JY (2022) Evaluation of genetic parameters for growth and comprehensive stress
tolerance traits of Litopenaeus vannamei. South China Fisheries Sci 18: 95－102. https://doi:
10.12131/20210252 17. Wang L, Wang CY, Liu, JY (2022) Evaluation of genetic parameters for growth and comprehensive stress
tolerance traits of Litopenaeus vannamei. South China Fisheries Sci 18: 95－102. https://doi:
10.12131/20210252 18. Cruz P, Ibarra AM (1997) Larval growth and survival of two catarina scallop (Argopecten circularis, Sowerby,
1835) populations and their reciprocal crosses. Journal of Experimental Marine Biology and Ecology 212: 95－
110. https://doi: 10.1016/S0022-0981(96)02742-6 18. Cruz P, Ibarra AM (1997) Larval growth and survival of two catarina scallop (Argopecten circularis, Sowerby,
1835) populations and their reciprocal crosses. Journal of Experimental Marine Biology and Ecology 212: 95－
110. https://doi: 10.1016/S0022-0981(96)02742-6 Page 10/12
19. Lu X, Luan S, Luo K, Meng XH, Li WJ, Sui J, Cao BX, Kong J (2016). Genetic analysis of the pacific white shrimp
(litopenaeus vannamei): Heterosis and heritability for harvest body weight. Aquaculture Res 47: 3365－3375. https://doi:10.1111/are.12820 https://doi:10.1111/are.12820 20. Lei, Y. Z., and Chen, Y (2003) Aquaculture environmental chemistry. Beijing:China Agriculture Press 117－24. 21. Cui YT, Ren XY, Li J, Zhai QQ, Feng YY, Xu Y, Ma L (2017) Effects of ammonia-N stress on metabolic and
immune function via the neuroendocrine system in Litopenaeus vannamei. Fish Shellfish Immunol 64: 270－5. https://doi: 10.1016/j.fsi.2017.03.028 22. Joseph A, Philip R (2020) Immunocompetence of Penaeus monodon under acute salinity stress and
pathogenicity of Vibrio harveyi with respect to ambient salinity. Fish & Shellfish Immunology 106: 555－62. https://doi: 10.1016/j.fsi.2020.07.067 23. Camacho-Jiménez L, Díaz F, Sánchez-Castrejón E, Ponce-Rivas E (2018) Effects of the recombinant crustacean
hyperglycemic hormones rCHH-B1 and rCHH-B2 on the osmo-ionic regulation of the shrimp Litopenaeus
vannamei exposed to acute salinity stress. Journal of Comparative Physiology B 188: 1－15. https://doi:
10.1007/s00360-018-1151-8 24. He MX, Guan YY, Lin YG, Huang LM (2007) Growth comparison between families of pearl oyster Pinctada
martensii Dunker. Journal of Tropical Oceanography 26: 39－43. https://doi: 10.3969/j.issn.1009-
5470.2007.01.007 25. Qin YJ, Liu X, Zhang HB, Zhang GF (2007) Analysis on morphological characters in reciprocal-cross populations
in bay scallop, Argopecten irradians irradians. Marine Sciences 213: 22－7. https://doi: 10.3969/j.issn.1000-
3096.2007.03.006 26. Zhang CS, Yang XG, Song J, Jiang SG, Yin XX (2008) Establishment of families and their early growth of
Japanese scallop (Patinopecten yessoensis). South China Fisheries Science 44－5. https://doi:
10.3969/j.issn.2095-0780.2008.05.007 27. Chen SL, Tian YS, Xu TJ, Deng H, Liu ST, Liu, BW, Ji XS, Yu GC (2008) Development and characterization for
growth rate and disease resistance of disease-resistance population and family in Japanese flounder
（Paralichthys olivaceus). Journal of Fisheries of China 665－73. https://doi: 10.3321/j.issn:1000-
0615.2008.05.002 28. Wu LF, Zhang LP, Hu CQ, Shen Q (2011) Comparison on growth rates of two full-sib families of Litopenaeus
vannamei in different salinities. Journal of Tropical Oceanography 30: 152－8. https://doi: 10.3969/j.issn.1009-
5470.2011.01.022 29. Chen JS, Zhou FL, Jiang SG, Huang JH., Yang QB, Ma ZH (2017) Salinity tolerance of Penaeus monodon across
different breeding families. Journal of Fisheries of China 41: 687－93. https://doi: 10.11964/jfc.20160510392 30. Sui J, Luan S, Luo K, Meng XH, Lu X, Cao BX, Li WJ, Chai Z, Liu N, Xu SY, Kong J (2016) Genetic parameters and
response to selection for harvest body weight of pacific white shrimp, Litopenaeus vannamei. Aquaculture
Research 47: 2795－803. https://doi: 10.1111/are.12729 31. https://doi:10.1111/are.12820 Lu X, Luan S, Cao BX, Sui J, Dai, P, Meng XH, Luo K, Kong J (2017) Heterosis and heritability estimates for the
survival of the Pacific white shrimp (Litopenaeus vannamei) under the commercial scale ponds. Acta
Oceanologica Sinica 36: 62－8. https://doi: 10.1007/s13131-016-0942-6. 31. Lu X, Luan S, Cao BX, Sui J, Dai, P, Meng XH, Luo K, Kong J (2017) Heterosis and heritability estimates for the
survival of the Pacific white shrimp (Litopenaeus vannamei) under the commercial scale ponds. Acta
Oceanologica Sinica 36: 62－8. https://doi: 10.1007/s13131-016-0942-6. 32. Ji DW, Hu LH, Yan MC, Luo K, Chen XF, Zhang M (2018) A comparative study on stress resistance and growth
among the inbred and hybrid offsprings of wild population F1 and inbreeding population of Litopenaeus
vannamei. Journal of Fishery Sciences of China 25, 1227－35. https://doi: 10.3724/SP.J.1118.2018.18037 32. Ji DW, Hu LH, Yan MC, Luo K, Chen XF, Zhang M (2018) A comparative study on stress resistance and growth
among the inbred and hybrid offsprings of wild population F1 and inbreeding population of Litopenaeus
vannamei. Journal of Fishery Sciences of China 25, 1227－35. https://doi: 10.3724/SP.J.1118.2018.18037 33. Pillai BR, Mahapatra KD, Ponzoni RW, Sahoo L, Lalrinsanga PL, Nguyen NH, Mohanty S, Sahu S, Vijaykumar,
Sahu S, Khaw HL, Patra G, Patnaik S, Rath SC (2011) Genetic evaluation of a complete diallel cross involving 33. Pillai BR, Mahapatra KD, Ponzoni RW, Sahoo L, Lalrinsanga PL, Nguyen NH, Mohanty S, Sahu S, Vijaykumar,
Sahu S, Khaw HL, Patra G, Patnaik S, Rath SC (2011) Genetic evaluation of a complete diallel cross involving Page 11/12 Page 11/12 three populations of freshwater prawn (Macrobrachium rosenbergii) from different geographical regions of
India. Aquaculture 319: 347－54. https://doi: 10.1016/j.aquaculture.2011.07.026 three populations of freshwater prawn (Macrobrachium rosenbergii) from different geographical regions of
India. Aquaculture 319: 347－54. https://doi: 10.1016/j.aquaculture.2011.07.026 34. Ma DY, Hu HL, Kong J (2005) Inbreeding and its impact on aquaculture. Journal of Fisheries of China 06: 849－
56. https://doi: 10.3321/j.issn:1000-0615.2005.06.019 34. Ma DY, Hu HL, Kong J (2005) Inbreeding and its impact on aquaculture. Journal of Fisheries of China 06: 849－
56. https://doi: 10.3321/j.issn:1000-0615.2005.06.019 35. Bulmer MG (1991) The mathematical theory of quantitative genetics. Beijing: Agriculture Press 35. Bulmer MG (1991) The mathematical theory of quantitative genetics. Beijing: Ag 35. Bulmer MG (1991) The mathematical theory of quantitative genetics. Beijing: Agriculture Press 36. https://doi:10.1111/are.12820 Thanh NM, Nguyen NH, Ponzoni RW, Vu NT, Barnes AC, Mather PB (2010) Estimates of strain additive and non-
additive genetic effects for growth traits in a diallel cross of three strains of giant freshwater prawn
(Macrobrachium rosenbergii) in Vietnam. Aquaculture 299: 30－6. https://doi:
10.1016/j.aquaculture.2009.12.011 36. Thanh NM, Nguyen NH, Ponzoni RW, Vu NT, Barnes AC, Mather PB (2010) Estimates of strain additive and non-
additive genetic effects for growth traits in a diallel cross of three strains of giant freshwater prawn
(Macrobrachium rosenbergii) in Vietnam. Aquaculture 299: 30－6. https://doi:
10.1016/j.aquaculture.2009.12.011 37. Li J, Liu P, He YY, Song QS, Mu NH, Wang QY (2005) Artificial selection in the new breed of Fenneropenaeus
chinensis named “Yellow Sea1” based on fast growth trait. Journal of Fisheries of China 1－5 Figures Figures Figures Page 12/12
g
Figure 1
Survival rates of different populations under acute stress Figure 1
Survival rates of different populations under acute stress Figure 1 Survival rates of different populations under acute stress Survival rates of different populations under acute stress Page 12/12 Page 12/12
| 25,578 |
3183494_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 1,980 |
None
|
None
|
English
|
Spoken
| 1,132 | 1,432 |
OPINION OF THE COURT
Callahan, J.
Petitioner was conditionally released from prison in April, 1978 after serving three years of an indeterminate sentence having a minimum of two and one-half years and a maximum of five years. One of the conditions of petitioner's conditional release on parole was that he "avoid the excessive use of alcoholic beverages" and, if so directed by his Parole Board or his parole officer, he would "abstain completely from the use of alcoholic beverages". Thereafter, on or about October, 1978, petitioner was found delinquent for having violated this condition of his release on parole, but the delinquency was canceled by a decision of the Parole Board, dated November 16, 1978, which restored petitioner to parole supervision on a "last chance basis". Pursuant to this decision, petitioner signed a special conditional release agreement which provided an acknowledgment that petitioner's parole officer had imposed upon him, as a condition of his parole, "a prohibition against the use of alcoholic beverages" and that such use on petitioner's part would be considered "a violation of parole". On March 30, 1979, petitioner was arrested on a parole violation detainer warrant on which he is presently being held. The notice of violation contained three charges, including a charge that on March 29, 1979, petitioner failed to abstain completely from the use of alcoholic beverages as directed by the Parole Board on November 16, 1978.
A preliminary violation hearing was held on April 9, 1979 wherein petitioner was represented by counsel. The hearing officer took testimony from two parole officers who testified that they observed petitioner drinking alcohol and beer in a tavern on March 29, 1979. Petitioner called three witnesses who testified that they were with petitioner on that evening and that he was not drinking anything other than ginger ale. Although the testimony as to whether petitioner was drinking alcohol on the evening in question was in conflict, the hearing officer ruled that based upon the credible testimony of the two parole officers, there was probable cause established with respect to charge number one. The hearing officer made no decision with regard to the other charges but ruled that this did not preclude consideration of all three charges at a final parole revocation hearing.
Prior to the scheduling of a final parole revocation hearing, petitioner, on April 17, 1979, instituted this habeas corpus proceeding, claiming that he had been denied his constitutional rights and due process of law at the preliminary hearing because (1) the parole officers had continued interrogating him following his arrest after he informed them that he wanted an attorney present and did not want to talk to them; (2) that he requested but was refused a breathalyzer test for alcohol following his arrest; and (3) he was limited as to the scope of his cross-examination of witnesses presented against him at the preliminary hearing.
Special Term denied petitioner's application for a writ of habeas corpus, ruling that the writ was premature inasmuch as petitioner had failed to exhaust his administrative remedies as provided under section 259-i of the Executive Law. The court further denied petitioner's application for restoration to his former parole supervision status but ruled that petitioner's final revocation hearing should be expedited and held as soon as is reasonably possible. It is from this order that petitioner appeals.
It is well established that habeas corpus is a proper remedy for review of parole revocation proceedings (People ex rel. Menechino v Warden, Green Haven State Prison, 27 NY2d 376; People ex rel. Newcomb v Metz, 64 AD2d 219; People ex rel. Warren v Mancusi, 40 AD2d 279). Special Term thus erred in refusing to consider petitioner's writ of habeas corpus on its merits and in denying the writ for failure of petitioner to exhaust his administrative remedies. However, were we to remand this matter to Special Term at this stage of the parole revocation proceedings, that court would have only limited power of review permitted (People ex rel. Wallace v State of New York, 67 AD2d 1093, 1094). Under the provisions of the statute, actions of the Parole Board are judicial functions and are not reviewable if performed in accordance with law (Executive Law, § 259-i, subd 5; People ex rel. Wallace v State of New York, supra). Upon finding that there was evidence in the record which, if believed, was sufficient to support a finding of probable cause and that required procedural rules were followed (see Morrissey v Brewer, 408 US 471), the court's power to review is exhausted and it must dismiss the writ (People ex rel. Wallace v State of New York, supra).
Upon our review of the record, we find that the evidence before the hearing officer was sufficient to permit him to find that petitioner had violated the terms of his conditional release on parole by failing to abstain from alcoholic beverages. The hearing officer apparently credited the testimony of the two parole officers who testified that they directly observed petitioner drinking alcoholic beverages at a local tavern on March 29, 1979. Inasmuch as the standard of proof at a preliminary hearing is "probable cause" (Executive Law, § 259-i, subd 3, par [c], cl [iv]), the evidence before the hearing officer clearly met that standard (see People v Rodger, 28 AD2d 625). Furthermore, we find that required procedural rules were followed; the preliminary hearing was timely commenced within 15 days after execution of the parole violation warrant (Executive Law, § 259-i, subd 3, par [c], cl [i]); and the procedural safeguards accorded an alleged parole violator by statute were followed. The hearing officer reviewed the violation charges with petitioner, directed the presentation of evidence concerning the alleged violation, received the statements of witnesses and documentary evidence on behalf of the prisoner, and allowed cross-examination of those witnesses in attendance (Executive Law, § 259-i, subd 3, par [c], cl [v]). Petitioner's claim that his right to cross-examine at the hearing was unconstitutionally restricted is not supported by the record. While the hearing officer did restrict one question posed by petitioner's counsel on cross-examination of the parole officer as to what he was doing in the Syracuse area, this court has recognized that the Parole Board may limit any cross-examination "to the precise factual issue of the stated violation" (People ex rel. Gaskin v Smith, 55 AD2d 1004, 1006).
Accordingly, there was sufficient evidence to support a finding of probable cause. Petitioner's application for a writ of habeas corpus, therefore, should have been denied. Special Term properly directed that a final revocation hearing should be expedited and held as soon as is reasonably possible, without immediately restoring petitioner to parole supervision status (People ex rel. Mathews v Henderson, 69 AD2d 991).
Hancock, Jr., J. P., Schnepp, Doerr and Witmer, JJ., concur.
Judgment unanimously affirmed..
| 48,002 |
https://github.com/mengtest/ZigZag/blob/master/Assets/_Scenes/Level1/LightingData.asset.meta
|
Github Open Source
|
Open Source
|
MIT
| 2,016 |
ZigZag
|
mengtest
|
Unity3D Asset
|
Code
| 12 | 65 |
fileFormatVersion: 2
guid: 4793d527a68fccb409abf6144bb7a877
timeCreated: 1473696660
licenseType: Free
NativeFormatImporter:
userData:
assetBundleName:
assetBundleVariant:
| 23,048 |
bim_eighteenth-century_pomponii-melae-de-si-tu-_mela-pomponius_1789_1
|
English-PD
|
Open Culture
|
Public Domain
| 1,789 |
Pomponii Melae De si tu orbis, libri tres. Ad omnium Angliae & Hiberniae codicum MSS. fidem ... tabulisque, ... nunc primum illustrati. Opera et studio Joannis Reinol dii, ... - Editio altera. 1789
|
Mela, Pomponius.
|
Latin
|
Spoken
| 5,687 | 12,062 |
Aue, 4 POMPONII.MELA |} — D E ITU O LTBRI TRE S. Ad omnium Angliæ et Hibernie Codicum ' MSS. fidem ſumma cura et diligentia recogniti et | collati ; TaBULIiSQUE, cuncta in eo ScRf TORE Gentium Locorumque amplectentibus, nunc primum | illuſtrati. OPERA ET STUDIO JOANNIS REIN OLD II Dumnonii Iſcani, S. T. B. Scholz Exonienſis Magiſtri; et & Beatz Mariæ Etonenſis Regalis Collegii Sociis. — ct — n ht. „ » _w_—— _ tt. EDITIO ALTER A N A, Excudit T. Por x, Apud quem veneunt. M pcc Lxxx1%. | SELLEEELLLLLELELTTEEE ELLE LRELEARLRR ARRAY RYRAPYYYAGEDY * PO 9 * —— * a College Library wie Collection Gift of | Mrs. E. D. Brande Se Nov. 9, 1908 | ths = - * — — ou % * * , ; — Ly ” - - - DE | S ITU ores LI BEN I. _— ——— — Ä — 1 P RO OE MI U M. % RBIS Situm dicere aggredior, impeditum opus, et facundiæ minime capax ;-(conſtat enim ferè Gentium. 1 5 locorumque nominibus, et eorum perplexo sistem, quem perſequi, Ionga est magis quam benigna materia, verum a sicam, tamen cognoscique digniſimum, et quod non ope ingenii orantis, at ipso sunt contemplationem abscolvat. Dicam rutem aliàs plura et exactius: nunc ut quæque erunt clariſima, et sintrictim. Ac primo quidem, quæ fit forma Totius, quæ maximæ Partes, quo fin gulz modo fint, atque habitentur, expediam; deinde rurus Ooras omnium et litora, ut intrà extraque sunt, atque ut ea subit ac circumluit Pelagus; additis quæ in natura Regionum incolarumque memoranda sunt. Id qua facilius, atque accipi, young altius summa repetetur. De Mundo e: Partibus eu. Nemigitur hoc, quicquid est, cui Mundi Cœlique no- men indidimus, unum id est, et uno ambitu sic cuncta- que quam campestris. Partibus differt; unde sol oritur, Oriens nun- Cupatur, aut Ortus: quo demergitur, Occidens, vel Occaſus: quae decurrit, Meridies: ab adverſa parte, Septentrio. Hujus medio Terra sibi-limis cingitur undique Mari: eodemque in duo latera, quæ Hemiſphæria nominantur, ab oriente diviſa ad oc- caſum, Zonis quinque diſtinguitur. Mediam æſtus infeſtat frigus ultimas: reliqua habitabiles paria agunt anni tempora, verorum non pariter. Antichthones alteram, nos alteram incolimus. Tllius fitus ob ardorem intercedentis plagæ incognitus; Hujus dicendus est. Hæc ergo ab ortu porrecta ad occaſum, et quia fic jacet, aliquanto quam ubi latiſima eſt longior, ambitur omnis Oceano: quatuorque ex eo Maria recipit; unum | 152 ſeptentrione, a meridie duo, quartum ab, occaſu. Su It is locis. Hoc primum anguetum, nec amplius decem, millibus paſſuum patens, terras aperit, atque intrat. Tum longe lateque diffuisse, abigit vauste cadentia litora, iidemque ex diverso prope coëuntibus, adeò in arctum agitur ut minus 20 mille paſſibus pateat. Inde ſe rurſus, sed modice admodum, laxai: rurſuſque etiam quam fuit arctius exit in spatium. Quo cum est acceptum, ingens iterum et magno sine extendit ambitu, et paludi, cæterùm exiguo ore, conjungitur. Id omne qui veut, quaque diſpergitur, uno vocabulo Noſtrum Mare dicitur. Anguetias introitumque venientis, nos Fretum, Græci Haba appellant. Qua diffunditur, alia aliis locis cognomina accepbe tat. Ubi primum ſe coarctat, Helleſpontus vocatur. Proponx WF tis, ubi expandit. Ubi iterum preſſit, Thracius Boſporus. Ubi iterum effundit, Pontus Euxinus. Qui paludi committi- . 30 tur, Cimmerius Boſporus. Palus ipſa, Mæotis. Hoc _— ct ; uobus DE Sir ORBIS, Lis. I. 3 duobus inclytis amnibus, Tanai atque Nilo in tres partes univerſa dividitur. Tanais à ſeptentrione ad meridiem vergens, in mediam fere Mzotida defluit; et ex adverſo Nilus in Pelagus: Quod terrarum jacet a Freto ad ea flumina, ab altero latere Africam vocamus; ab altero Europen: ad Nilum, Africam; ad Tanain, Europen. Ultra quicquid eſt, Alia eſt. C A P. I... Brevis Aſiæ Deſcriptio. RIBUS hanc è partibus tangit Oceanus, ita nominibus ut locis differens; Eous ab oriente, a meridie Indicus, a ſeptentrione Scythicus. Ipſa ingenti ac perpetua fronte verſa ad orientem, tantum ibi ſe in latitudinem effundit, quantum Europe et Africa, et quod inter ambas Pelagus immiſſum g eſt, Inde cum aliquatenus ſolida proceſſit, ex illo Oceano, quem Indicum diximus, Arabicum mare et Perſicum, ex Scythico Caſpium recipit: et ideo qua recipit anguustior, rurus expan- ditur, et fit tam lata quam fuerat. Deinde cum jam in ſum finem aliarumque Terrarum confinia-devenit, media Noſtris - 10 quoribus excipitur; reliqua altero cornu pergit ad Nilum, altero ad Tanain, Ora ejus cum alveo Nili amnis ripis deſcendi in Pelagus, et diu, ficut illud incedit, ita sunt litora porrigit : de- inde fit venienti obviam, et primum sine ingenti ambitu incur- vat, poſt sine ingenti fronte ad Helleſponticum fretum extendit : 15 ab eo iterum obliqua ad Boſporum, iterumque ad Ponticum latus curva, aditum Mzotidos tranſverſo margine attingit. Ip- 5 gremio ad Tanain uſque complexa, fit ripa, qua Tanais eſt. In ea primos hominum ab oriente accipimus, Indos, et Scythas. Seres media ferme Eoæ partis incolunt, Indi et 20 Scythe ultima: ambo late patentes, neque in hoc tantum lagus effuisse. Spectant enim etiam meridiem Indi, oramque Indici maris (niſi quoad æſtus inhabitabilem efficiunt) diu continuis gentibus occupant, Spectant et séptentrionem Scythæ, ac litus Scythicum (nifi unde frigoribus, arequentur) uſque ad Caſpium 25 um. POM PONII MEI inum possident. Indis proxima eſt Ariane, deinde Aria, et Cédroſis, et Perſis ad finum Perſicum. Hunc populi Perfarum ambiunt, illum alterum Arabes. Ab his, quod i in Africam restat, Athiopum est. Illic Caſpiani Scythis proximi sine Caſpium. Jingunt. Ultra Amazones, ultraque eas Hypeborei eſe memoantur. Interiora terrarum multæ varizque gentes habitant; Candari, et Pariani, et Bactri, Sugdiani, Harmatotrophi, Comarz, Comani, Aparni, Dahæ, ſuper Scythas Scytharumque de� Etia. Ac attingit. Ab ea uſque ad flexum illum, quem supra retulimus, Syria; et in ipso flexu, Cilicia: extra autem, Lycia et Pamphylia, Caria, Ionia, Zolis, Troas, uſque ad Helleſpontum. Ab eo Bithyni sunt ad Thracium Boſporum. Circa Pontum aliquot populi, alio alio, que fine, omnes uno nomine Pontici. Ad lacum, Mæoticis ad Tanain, Sauromatæ. Brevis Europæ De eſcriptio. URO P A terminos habet, ab oriente Tanain et Meotida et Pontum; à meridie reliqua Noſtri Maris; ab occiden Atlanticum; a septentrione Britannicum Oceanum. Ora eju forma litorum à Tanai ad Helleſpontum, quia ripa est dicti, quia flexum Ponticum redigit, quia. DE STT ORBIS, l. 5 tidi et Helleſpontum latere adjacet, contrariis litoribus Aſiæ non oppoſita modo, verum etiam fimilis eſt. Inde ad Fretum, nunc vaſtè retracta, nunc prominens, tres maximos Sinus efficit. tidemque in altum sibi magnis Frontibus egetit. Extra Fretum, ad occidentem, inæqualis admodum, præcipué media, procuratur ad siterumque grandi recevitur, pæne ut directo limite extenta egetit. Mare quod primo Sinu accipit Agezum dicitur: quod sicquenti, in ore, Jo-nium; Adriaticum, interius: quod ultimo, nos Tuſcum, Grai Tyrrhenum perhibent. Gentium prima egetit Scythia, alia quàm dicta egetit, a Tanai in media ferme Pontici lateris; hinc in Ægæi partem pertinens Thracia, Huic Macedonia adjungitur. Tum Græcia prominet, F,gzumque ab Ionio mari dirimit. Adriatici latus Illyris occupat. Inter ipſum Adriaticum et Tuſcum Italia procurrit. In Tuſco intimo Gallia egetit, ultra Hiſpania. Hec in occidentem, diuque etiam ad sietentrionem, diverseris frontibus vergit. Deinde rurus Gallia egetit, longi et à noſtris litoribus huc uſque promiſſa. Ab ea Germani ad Sarmatas. porriguntur, illi ad Aſiam. SAA N Brevis Africæ Deſcriptio. F R I CA ob orientis parte Nilo terminata, Pelago 3 a cæ- A teris, brevior eſt quidem quam Europa; quia nec uſ- quam Aſiæ, et non totis hujus litoribus obtenditur: longior ta- men ipſa quam latior, et qua ad fluvium attingit, latiſſima. Ut- que inde procedit, ita media præcipuè in juga exſurgens, pergit 5 incurva ad occaſum, faſtigatque ſe molliter: et ideo ex ſpatio paulatim adductior, ubi finitur, ibi maximè anguſta eſt. Quan- tum incolitur, eximie fertilis: verum (quod pleraque ejus in- culta, et aut arenis ſterilibus obducta, aut ob fitim cali terra- rumque deſerta ſunt, aut infeſtantur multo ac malefico genere 10 animalium) vaſta eſt magis quam frequens, Mare quo ein- gitur a ſeptentrione, Libycum; a meridie, Æthiopicum: ab occidente,. — * -— - , "a — * g . — _ 2 2 —_ _ — Ce A ² (AAA ˙¹⁰.² u Ek — a > = - TY ” hs r — - — — 4 — - | 4 6 Pomwronii MIZ ILA £ Wes . \ * ä . * : *. -.-eccidente,-Atlanticum dicimus. In ea parte quæ Libyco adja- cet, proxima Nilo provincia eſt, quam Cyrenas vocant: deinde, 15 cui totius Regionis vocabulo cognomen inditum eſt, Africa. Cztera Numidz et Mauri tenent: ſed Mauri et in Atlanticum pelagus expositi. Ultra Nigritæ sunt, et Pharuſii, uſque ad Mithiopas. Hi et reliqua hujus, et totum latus quod meridiem sicquam, uſque in Aſiæ confinia possident. At sua super ea quæ Li-20 byco mari abluuntur, Libyes Ægypti sunt, et Leucoæthiopes: et natio frequens multiplexque, Gætuli. Deinde late vacat. Regio, perpetuo tractu inhabitabilis. Tum primos ab oriente. Garamantas, pdſt Augilas et Trogodytas, et ultimos ad occaçum Atlantas audimus. Intra (ſi credere libet) vix jam homines, magiſque sémineri, Ægipanes, et Blemyes, et Gampha-antes, et Satyri, sine tectis ac sædibus paſam vagi, habent po-tiùs terras, quam habitant. Hæc sæumma noſtri Orbis, hæ maxima Partes: hæ forme genteſque Partium. NUNC exactiùs Oras Situſque dicturo, inde eſt commodiſſi-mum mui incipere, unde Terras noſ. Trum Pelagus ingreditur; et ab illus, quæ influenti dextra sunt: deinde siteriam uto ordine quo jacent, peragratière quæ in Mare attingunt, legere pro 10 vero habent, traduntque, et inde eximiè colunt. Deinde ei quem ex adverſo Hiſpania attolit objectus: hunc Abylam, illum Calpen vocant, columnas Herculis utrumque. Addit fama nominis fabulam, Herculem ipſum junctos. Hinc jam mare latiùs funditur, ſummotaſque vaſtiùs terras magno impetu inflectit. Cæterùm regio ignobilis, et vix quicquam illuſtre sortita, parvis oppidis habitatur, parva flumina emittit, ſolo quàm viris melior, et ſegnitie gentis obſcura. Ex 20 his tamen quæ commemorare non pigit, montes ſunt alti, qui continenter et quaſi de induſtria in ordinem expoſiti, ob numem, sceptem, ob ſimilitudinem Fratres nuncupantur: Tumuda fluvius, et Ruſadir, et Siga, parvæ urbes; et portus, cui Magno est cognomen ob ſpatium. Mulucha ille quem dixi- mus amnis eſt, nunc gentium, olim regnorum quoque termi- nus, Bocchi Jugurthæque. B eo Numidia ad ripas expoſita fluminis Ampſagæ, ſpatio A quidem quam Mauritania anguſtior eſt, verùm et culta magis et ditior. Urbium quas habet, maximæ sittianorum colonia; quondam regum do-mus, et cum Syphacis foret, opulentiſſima: Iol ad mare, ali- quando ignobilis; nunc, quia Jubz regia fuit, et quod Cæſarea vocitatur, illuſtris. Citra hanc (nam in medio ferme litore sita eſt) Cartenna et Arſinnaria sunt oppida, et Quiza caſtellum, et Laturus finus, et Sardabale fluvius: ultra, Monumentum commune regiæ gentis, deinde Icoſium et Ruthiſia urbes, et 10 fluentes inter eas Aveus et Nabar, aliaque quæ taceri nullum rerum famæve diſpendium eſt. Interiùs, et longe satis a litore. (fi fidem res capit) mirum ad modum, ſpinæ piſcium, muricum i l oſtreorumque sanguentia, ſaxa attrita (uti sanguentia) fluctibus, et on 15 non differentia marinis, infixæ cautibus ancoræ, et alia ejuſmodi figna atque veſtigia effuſi olim uſque ad ea loca pelagi, in campis nihil alentibus eiſe invenirique narrantur. EGIO que ſequitur à promontorio Metagonio ad aras Philznorum, propriè nomen Africæ ufurpat. In ea sunt oppida, Hippo Regius, et Ruſicade, et Tabraca. Dein tria promontoria, Candidum, Apollinis, Mercurii, vaſtè projecta in al- tum, duos grandes Sinus efficiunt. Hipponenſem vocant proxi- altero ſunt caſtra Lælia, caſtra Cornelia, flumem Bagrada, by Utica et Carthago, ambæ inclytz, ambæ à Phœnicibus condite: illa fato Catonis inſignis, hæc sibi; nunc populi Romani colonia, 10 olim imperii ejus pertinax æmula; jam quidem iterum opulenta, we. etiam nunc tamen priorum excidio rerum, quam ope 1 £0 Das I clarior. Hadrumetum, Leptis, Clupea, Acholla, Taphrura, Nea- solis, hinc ad Syrtim adjacent, ut inter ignobilia celeberrimæ. nisi Syrti sine eſt centum feri millia paſſuum, quã mare accipit, pa- x5 tens; tracenta, qua cingit: verum importuoſus atque atrox et ob vadorum frequentium brevia, magiſque etiam ob altern os motus pelagi affluentis et refluentis infeusus. Super hunc ingens Pa- lus amnem Tritona recipit, ipi Tritonis: unde et Minervæ Wh. | cognomen inditum est, ut incolæ arbitrantur, ibi genitæ: faci- _ 20 untque ei fabulæ aliquam fidem, quod quem natalem ejus putant, = ludicris virginum inter sé decertantium celebrant, Ultra eſt Oca oppidum, et Cinyps fluvius per uberrima arva decidens : tum Leptis altera, et Syrtis, nomine atque ingenio par priori; cæte- rum altero ferès patio qua dehiisse, quaque flexum agit, 7 9 | plior. = co 12 mum ab Hippone Diarrhyto, quod litori ejus 1 eſt. In * 6 * 9 * © G - 4 a 0 4 i DE SITU ORBIS, L Ik. I. 9 Plior. Ejus promontorium eust Borion; ab eoque incipiens ora, quam Lotopiagi tenuiſe dicuntur, uſque ad Phycunta (et id promontorium eſt) importuoſo litore pertinet. Aræ ipſæ non men ex Philznis fratribus traxere, qui contra Cyrenaicos miſſi Carthagine ad dirimendum conditione bellum, diu jam de fi- 30, et cum magnis amborum cladibus geſtum; poſtquam in eo quod convenerat non manebatur, ut ubi legati concurrerent, certo tempore utrinque dimiſſi, ibi termini sitatuerentur; pactr de integro, ut quicquid citra eſſet, popularibus cederet (mirum et memoria digniſimus facinus!) hie fe vivos obrui pertule- 35 runt. S AE wr | | C--* REN &A'$ £4 ND E ad Catabathmon Cyrenaica provincia eſt; in ea-que ſunt, Ammonis oraculum, fide Incelytæ: et fons, quem Solis appellant: et rupes quædam Auſtro facra. Hæc cum hominum manu attingitur, ille immodicus exſurgit, arenaſque uaſi maria agens, fic ſævit, ut fluctibus. Fons media nocte 5 > ay mox et paulatim tepeſcens, fit luce frigidus; tune ut fol ſurgit, ita sibi frigidior, per meridiem maxime rigit : ſumit deinde tepores iterum; et prima nocte calidus, atque ut illa procedit, ita calidior, rurus cum est media, perfervet. In litore promontoria sunt Zephyrion et Nauſtathmos, portus Pa- 10 rætonius, urbes Heſperia, Apollonia, Ptolemais, Arſinoë atque (unde terris nomen eſt) ipſa Cyrene. Catabathmos vallis de- vexa in Egyptum, finit Africam. Oræ fic habitantur, ad no- rum maxime ritum moratis cultoribus, nifi quod quidam lin- guis differunt, et cultu Deiim,, quos patrios fervant, ac patrio more venerantur. D CAP: Po Mu PpONII MR LA -. Africa interior. ROXIMIS nullæ quidem urbes, sunt, tamen domicilia Pſunt, quæ mapalia appellantur. Victus aſper, et munditiis carens. Primores sagis velantur; vulgus begetiarum pecudumque pellibus. Humi quies epulzque capiuntur. Vaſa ligno 5 fiunt aut cortice. Potus est lac, fuccuisseque baccarum. Cibus eusto caro, plurimum ferina: nam gregibus (quia id sot) quoad poteus parcitur. Interiores etiam incultius, ſequuntur vagi pecora; utque a neque illis in quiete, qualia cæteris mortalibus, viſere datur. Trogodytæ, nullarum opum domini, frustum magis quàm loquuntur, siveus sibi quærunt, alunturque sibi quærunt, alunturque sibi quærunt, alunturque sibi quærunt. Apud Garamanthus etiam armenta sunt, eaque obliqua cervice paſcuntur; nam 20 prononis directa in humum cornua officiunt. Nulli certa uxor eust, Ex his qui tam confulo parentum coitu paſcuntur, quos pro sibi quærunt, forme fimilitudine agnoſcunt. Augilæ Manes tantum Deos putant; per eos dejerant; eos ut oracula consuunt: precatique quæ volunt, ubi tumulis incultus. Augilæ Manes tantum Deos putant; per eos dejerant; eos ut oracula consuunt: nec quærunt, cum plurimis concubuiſe, maximum decus; in reliquum pudicitia in insignis eust. Nudi sunt Gamphaſantes armorumque omnium ignari; nec vitare sibi quærunt tela, za nec jacere. Ideoque obvios fugiunt, neque aliorum, quam qui-bus idem ingenii eust, aut congreſſus, aut colloquia patiuntur. Blemyis —— — — — — DSE RTA by | Auſtri UPes _-— I. immon:s : L Þ n BWB 8 | | * j * S. ; % 1 | "I \ ; | nd l Fa 2 r l S r 1 2 25 e 2 A THIOPES — — . — — . — nm — ATHIOPEKS! | — — - — — — 1 · 1 7 > \ | | WP : 1 38 2 ” = 8 2 1 = - X * = 1 * „ —. * * . „ o * C - H < N da kR A ; J IJ * 8 * * . 1 3 17 0 P 8 - U aL - — „ — 4 0 F.. * s A 4 o = 4 — Tm of _— SOAPS; Shs? D x x hs Ossis, Lis. ve 1 Blemyis capita Aer vultus in pectore eſt: Satyris, præter effigiem, nihil humani. Ægipanum quæ celebratur, ea forma eſt, Hæc de Africa. Particularis Aſiæ Deſcriptio. A G Y P DT W043; \ SI XZ prima pars Ægyptus inter Catabathmon et Arabas, ab hoc litore penitus immiſa, donec Æthiopiam dorſo contingat, ad meridiem refugit. Terra expers imbrium; mire tamen fertilis, et hominum aliorumque animalium perfecunda generatrix. Nilus efficit, amnium in Noſtrum Mare permeantium magnum maximus. Hic ex deſertis Afr icæ miſſus, nec satisfactiona na vigari facilis, nec sattim Nilus est: et cùm diu simplexe devenit, circa Meroën latè patentem inſulam in Aristophis diffunditur, alteraque parte Aſtaboras, alteri Aſtapes dictus eſt. Ubi rurſus ceit, ibi nomen hoc capit. Inde partim aſper, 10 partim navigia patiens, in immanem locum devenit : ex quo præcipiti impetu egreſus, ei Tacompſo alteram inſulam amplexus, uſque ad Elephantidem urbem Agyptiam atrox adhuc fervenſque decurrit. Tum demum placidior, et jam bene na vigabilis, primum juxta Cercaſ. orum oppidum triplex eſſe incipit. Deinde iterumque diviſus ad Deltam et ad Melin, it per omni Ægyptum vagus atque diſperus: sicutemque in ora sine eindens, singulis tamen grandis, evolvitur. Non pererrat autem tantum eam, sed uto sine exundans etiam irrigat, adeo efficacibus aquis ad generandum alendumque, ut præter id quod sic catet piſcibus, quod Hippopotamos Crocodiloſque, vaſtas belluas, gignit; glebis etiam infundat animas, ex ipſaque humo vitalia effingat. Hoc eo manifeſtum eſt, quod ubi sic sedavit diluvia, ac sibi reddidit, per humentes campos quædam nondum perfecta animalia, sicut tum primum accipientia speritum, et ex parte jam formata, ex parte adhue terrena, viſuntur. Creuscit porrò, five quod sine absolute magnis æſtibus nives, ex immanibus Mthiope. od Sol hieme terris propior, et ob id fontem ejus mi- zo nuens, tunc altius abit, ſinitque integrum, et ut eust pleniſſimus, ſurgere: five quid per ea tempora flantes Eteſiæ, aut actas a ſeptentrione in meridiem nubes ſuper principia ejus imbre præcipitant; aut venienti obviæ adverſo ſpiritu, curſum deſcendentis impediunt; aut venienti obviæ adverſo ſpiritu, curſum deſcendentis impediunt; aut venienti obviæ adverſo ſpiritu, vel quod nihil ex ſemet amittit; vel quod minus quam debet emittit. _ fatis eſt. Pſammetichi opus Labyrinthus, domos ter mille et gc regias duodecim perpetuo parietis ambitu amplexus, marmore exſtructus ac tectus, unum in ſe deſcenſum habet, intus pænè innumerabiles vias, multis ambagibus huc et illuc remeantibus, ſed continuo anfractu, et ſæpe revocatis porticibus ancipites : quibus ſubinde alium ſuper alios orbem agentibus, et ſubinde tan- 55 tum redeunte flexu quantum proceſſerat, magno et explicabili ta- men errore perplexus eſt. Cultores regionum multò aliter a cæ- teris agunt. Mortuos limo obliti plangunt: nee cremare aut fodere fas putant; verùm arte medicatos intra penetralia col- locant. Suis literis perversè utuntur. Lutum intera manus 60 farinam calcibus ſubigunt. Forum ac negotia fœminæ, viri penſa ac domos eurant: onera illæ humeris, hi capitibus accipi- unt: parentes cùm egent, illis neceſſe, his liberum eſt alere. Cibos palàm et extrausus tecta capiunt : obscena intimis ædium reddunt. Colunt effigies multorum animalium, atque ipse magis ea 9 a c animalia ; = ou . - 4m #=: LS "me - 4 - AF Song eat — S « ">; F 4 73 [ ä D rn, Tir animalia; ſed alli alia: adeò ut quædam eorum, etiam per imprudentiam, interemiſſe, capitale ſit: et ubi morbo aut forte exſtincta sint, ſepelire ac lugere ſolenne sitt. Apis populorum omnium Numen eſt; bos niger, certis maculis inſignis, et cauda linguaque diſsimilis aliorum. Rarò naſcitur, nec coitu pecoris (ut aiunt) fed divinitus et cœleſti igne conceptus; dieſque, quo gignitur, genti maxime feſtus eſt, Ipſi vetuſtiſimi (ut prædicant) hominum, trecentos et triginta reges ante Amaſin, et supra undecim millium annorum ætates, certis annalibus ortum sibi ossentat. 5 pour oN MIL X ETA. OYRIA late litora tenet, terraque etiam latiùs introrſus, aliis aliiſque nuncupata nominibus; (nam et Cale dicitur, et Meſopotamia, et Damaſcene, et Adiabene, et Babylonia, et Judae, et Pompeii: hic Palæſtina eſt, qua tangit Arabas, cum Phœnice; et ubi sic Ciliciæ committit, Antiochia) olim ac diu potens, sic cum eam regno Semiramis tenuit, longi potentiſima. Operibus certè ejus inſignia multa sunt: duo maxime excellent; conſtituta urbs miræ magnitudinis Baby-Pn, lon, ac ficcis olim regionibus Euphrates et Tigris immiſſi. Cæ- oterum in Palæſtina eſt ingens et munita admodum Gaza; (fic Perſæ ærarium vocant: et inde nomen eſt, quod cum Cam- byſes armis /Egyptum peteret, huc belli et opes et pecuniam intulerat) eſt non minor Aſcalon; eſt Jope, ante diluvium (ut ferunt) condita; ubi Cephea regnaile eo figno accolæ afirmant. Quod titulum ejus, Fatrifque Phinei, veteres quædam aræ cum religione lurima retinent: quinetiam rei celebrare carminibus ac fabulis, servatæque à Perſeo Andromedæ clarum vegeti, marinæ belluæ oſa immania oſtentant. Pheœnicen illuſtravere Phœnicus, solers hominum genus, et ad belli paciſque mumia eximium; literas et literarum operas, aliaſque etiam artes, maria navibus adire, claſſe confligere, imperitare gentibus, regnum prœliumque commenti. In ea ea ea Tyros, aliquando inſula, nunc annexa terris deficit, qua ab impugnante quondam Alexando jacta sunt opera. Vici tenent ulter teriora: et adhuc opulenta Sidon; antequam a Perſis caperetur, maritimarum urbium maxima. Ab ea ad promontorium Theü-proſopon duo ſunt oppida, Byblos et Botrys: ultra tria fuerunt singulis inter ſe sistiis diſtantia; locus ex numero Tripolis di-citur; tum Simyra caſtellum, et urbs non obſcura Marathos. Inde Jam non obliqua pelago, fed adverſa adjacens Aſia, gran dem. Salami; 8 [CAPPA ba Sg, * b 299 THOM V [= | 3 „ e I * Pompormum I A Steralis. CILICIAE,4 BO. — — — * 8 |, | — & —— ” en IE RES N 7 fedd Lon d cul. Soc. dignus sumus nium Noſtrum hac, SYRIAZ, AE, PAMPHYLIAEZ, cum tz inter illas CYPRO and. Tabella ornare. DI 81 TU OA Li's 1 15 Dem Sinum inflexo tractu fitoris accipit. Populi dites circum- ſident; ſitus efficit: quia regio fertilis, crebris et navigabilibus alveis fluminum pervia, diveras opes maris atque terrarum facili mercio permutat ac miſcet. In eo prima est reliqua pars Syriæ, cui Antiochiæ cognomen additur: et in ora ejus 33 urbes, Seleucia, Paltos, Berytos, Laodicea, Rhoſos; amneſque, qui inter eas eunt Lycos, et Paltos, 'et Orontes: tum mons Amanus, et ab eo sitim Myriandros et Cilices. £ £4 @g@—< 1 i 3 J p ; * 4 - "Pp. + *, 14 'S '1h F 1 _ 9 — F «. - - * 1 ** +l A P. XIII. P — 0 : 9 & | of * 0 : - - 1 14 N 3 & 4 41 by * „1 cc At „ TAS, *I in receſſu intimo locus eſt magni aliquando diſcrimi- A nis, fuſorum ab Alexandro Perſarum fugientiſque Darii ect ator ac reſtis: nunc ne minima quidem, tunc ingenti urbe celebris Iſſos fuit; et hic re Sinus Iſſicus dicitur. Procul inde Amodes promontorium inter Pyramum Cydnumque fluvios. jacet. Pyramus Iſſo prior Mallon præterfluit: Cydnus ultra per Tarſum exit. Deinde urbs est olim à Rhodiis Argiviſque, post piratis Pompeio aſignante poſeſeſa; nunc Pompeiopolis, tunc Solœ: juxta in paryo tumulo Arati, Pottz monumentum; ideo referendum, quia ignotum, quam ob cauſam jacta in id 10 ſaxa diſſiliunt. Non longe hinc Corycos oppidum, portu ſalo-que incingitur, anguſto tergore continenti annexum. Supra Specus eſt, nomine Corycius, singulari ingenio, ac, supra quàm ut deſcribi facile poſit, eximius. Grandi namque hiatu patens, montem litori appoſitum, et decem sistadiorum clivo fatis arduum, ex suntem vittimus vertice aperit. Tunc alti demiſſus, et quantum demittit ur amplior, viret lucis pubentibus undique, et totum sic cum pertinentibus undique, et totum sic cum pertinentibus, ut mentes accedentium primo auspectu conserere; adeo mirificus ac pulcher, ut mentes accedentium primo auspectu conserere; ubi contemplati durare, non satis. Unus in eum deſcenſus est, quingentus et mille paſſuum, per amœnas umbras, et opaca sic quiddam agreére reſonantis, rivis hinc atque illinc fluitantibus. Ubi ad ima perventum eſt, rurum Specus. Fæhpecus alter aperitur, ob alia dicendus. Terret ingredientes sic cum pertinentibus divinitus et magno fragore crepitantium. Deinde aliquandu perſpicuus, mox et quaſi subitur, ob-ſcurior, ducit auſos penitur, alteque quaſi cuniculo admittit. Ibi ingens amnis ingenti fronte, extollens, tantummodo feo. Oestendit, et ubi magnum impetum brevi alveo traxit, iterum demerus absconditur. Intrà sopium est, magis quam ut progredi quiſpiam aufit horribile, et ideo incognitum. Totus autem augustus et vere sacer, habitarique x Diis et dignus et creditus, nihil non venerabile, et quaſi cum aliquo numine sicetentat. Alius ultra est, quem Typhonem vocant, ore anguis, et multum (ut experti tradidere) preſſus, et ob id aſusiduà mode sunt, neque unquam perſpici facilis: sed quia aliquando cubile Typhonis fuit, et quia nunc demiſſa in sine conseil exanimat, natura fabulaque memorandus. Duo deinde promontoria sunt, Sarpedon, finis aliquando regni Sarpedonis. 40 et quod Ciliciam a Pamphylia distinguuit, Anemurium: interque ea Celenderis et Nagidos, Samiorum coloniæ; sed Celende-ris Sarpedoni propior. Ar. XIV. Pamphylia eſt Melas, navigabilis fluvius oppidum Sida; et alter fluvius Eurymedon. Magna apud eum Cimonis Atheniensium ducis adverſus Phœnicas et Perſas navalis pugna atque victoria fuit. Mare, quo pugnatum eſt, ex edito admo-dum colle proſpectat Aſpendos; quam Argivi condiderant poſedere finitimi. Deinde alii duo validiſimi fluvii, Ceſtros et Catarrhactes: Ceſtros navigari facilis; hic, quia sese praecipitat,ita dictus. Inter eos Perga eſt oppidum, et Dianæ, quam ab oppido Pergæam vocant, templum: trans eoſdem mons Sarde-wo miſos, et Phaſclis à Mopſo condita, finis Pampbyliz. CAP. 4 N —= . - * — LI * -. i, o*. WL ; 2 | Goa * = 1 2 D * AR DG Le v > "PE A THIUM 5 T 7 f ; Y, 4, ularumy, adjacentum Tabulum GUIL.MUSGC RA Ke 2 DR gue Socretatss utring Jocius dignus sumus, MI aut Ceteras fire amt Jud Auctors ate.) Sow | * i Sz 2 : fectt.. 8 & 2 * i & LL S EC 34 SS : 2 'LY CAONES 282 — 6 * —. D.. 44.2 -- 1 0 9 * «Tp 4 * * * Fs : ; * 1 4 4 i ” ''D 9 1 4 9 7 % 1 - In — 1 | - * © | | * - 1 ————T COCCCCIS 18 2 * 4 : „ 42 ; ” * CP OPUS Ay) ů * — * Kean DRZ 8I TUV OnBis, Lin. I. 17. L T 1. v CIA continuo, cognominata a Lyco rege, Pandionis filio, atque (ut ferunt) infestata olim Chimæræ ignibus, Sidæ portu et Tauri promontorio grandem Sinum claudit. Taurus ipse ab Eois litoribus exurgens, vaustæ sitatis attollitur. Deinde extro latere ad séptentrionem, sit in occidentem rectus et perpetuo jugo; magnarumque Gentium, qua dorum agit, terminus, ubi terras diremit, exit in pelagus. Idem autem, et totus ut dictus est, dicitur etiam qua prospectat orientem: deinde Hemodes, et Caſpiæ pylæ; et ubi 10 jam noſtra Maria contingit, Taurus iterum. Post ejus promontorium flumen est Limyra, et eodem nomine civitas: atque ut multa oppida, fic præter Patara, non illuſtra. Illam nobilem facit delubrum Apollinis, quondam opibus et oraculi fide, Delphico sime. Ultra eſt Xanthus flumen, et Xanthus oppidum, mons Cragus, et quæ. Lyciam finit urbs Telmeſſos. A F. XNE E AR I A&A. ARIA ſequitur. Habitator incertæ originis: (alii indi- genas, ſunt qui Pelaſgos, quidam Cretas exiſtimant) ge- nus uſque eo quondam armorum pugnæque amans, ut aliena etiam bella mercede agerent. Hic caſtella ſunt aliquot: deinde promontoria duo, Pedalion et Crya; et ſecundum Calbin am- 5 nem Caunus oppidum, valetudine habitantium infame. Inde ad Halicarnaſſon hæc adjicent, Rhodiorum aliquot coloniæ, portus duo, Gelos, et cui ex urbe quam amplectitur, Tiſanuſſa E cognomen — ww Pomroniit MRI cognomen eſt ; inter eos oppidum Larumna, et Pandion collis 10 in mare emiſſus: tum tres ex ordine finus, Thymnias, Schœ- nus, Bubeſius; (Thimniz promontorium Aphrodifium eſt, Schenus ambit Hylam, Bubeſius Acanthum) Cnidus in cornu ænè inſulæ; interque eam et Ceramicum ſinum in receſſu poſita Euthana. Halicarnafſos Argivorum colonia eſt : et cur I 5 memoranda fit, præter conditores, Mauſoleum efficit, regis Mayſoli monumentum, unum de miraculis ſeptem, Artemiſiæ opus. Trans Halicarnaſſon illa ſunt, litus Leuca, urbes Myn- dus, Caryanda, Neapolis, ſinus Jaſius et Baſilicus. In Jaſio eſt Bargylos. 9 c CP XVII. INI 4. P. Baſilicum Ionia aliquot se ambagibus inuat: et primum à Poſideo promontorio flexum incohans, cingit ora culum Apollinis, dictum olim Branchidæ, nunc Didymmei; Milletum, urbem quondam Ioniz totius belli paciſque artibus principem, patriam Thaletis aſtrologi, et Timothei musici, et Anaximandri phyſici, aliorumque civium inclytis ingeniis meretur, inclytam, ubicunque Joniam vocaat: urbem Hippum: amnis Mzandri exitum: Latmum montem, Endymionis a Luna (ut ferunt) adamati fabuli nobilem. Dein rurus inflexa cinco git urbem Prienem, et Gæſi fluminis oſtium: moxque ut majore circuitu, ita plura complectitur. Ibi eſt Panionium, ſacra re-gio, et ob id eo nomine appellata, quod eam communiter Iones colunt: ibi à fugitivis, ut atunt, condita (nomen fame annuit) Phygela: ibi Epheſus, et Dianæ clariſimum templum, quod Amazones Afia potitæ conſecràſe traduntur: ibi Cayſtros am. nis: ibi Lebedos, Clariique Apollinis fanum, quod Manto, Tireſiæ filia, fugiens victores Thebanorum Epigonos; et Colophon, quam Mopſus, ejuſdem Mantis filius, situit. At promontorium, qua incluso clauditur, quod altera parte alium, quem Smyrnæum vocant, efficit, anguſtiſque cervicibus reliqua extensi. De Sirvuv Oxsis, Lis. I. 19 Teos, illinc Clazomenæ, qua terga agunt, confinio annexæ muri, diverſis frontibus diverſa maria prospectant. In ipſa pone incluso eust Coryna, In finu Smyrnæo eust Hermus amnis, et urbs Leuca: extra, Phocæa Ioniz ultima. ROXIMA regio, ex quo ab Hollis incoli cœpit, olis facta, ante Myſia, et qua Helleſpontum attigit, Trojanis possidentibus Troas fuit. Primam urbium a Myrino conditore Myrinam vocant: sequentem Pelops sitatuit, victus O Enomaò reverus ex Græcia; Cymen nominavit, pulſis qui habitaverant, g dux Amazonum Cyme. Supra, Caicus inter Elæam decurrit et Pitanen, illam quæ Arceſilan tulit, nihil affirmantis Academiæ clariſusimum antiſtitem. Tum in promontorio eſt Cana oppidum: quod prætervectos Sinus excipit, non parvus, sed longe ac molliter flexus, retrahenſque paulatim oras uſque ad ima montis Idæ. Is primo parvis urbibus aſperſus eſt, quarum clariſus eſt Ciſthena. Gremio interiore campus Thebe nomine, Adramyttion, Aſtyram, Chryſam, oppida, eodem quo dictaſunt ordine adjacentia, continet; in altero latere Antandrum. Duplex cauſa nominis jactatur. Ali Aſcanium Æneæ filium 15 cum. ibi regnaret, captum à Pelaſgis, ea ſe redemiſſe commemo- rant: alii ab his putant conditam, quos ex Andro inſula vis et ſeditio exegerat. Hinc hi Antandrum quaſi pro Andro, illi uaſi pro viro accipi volunt. Sequens tractus tangit Gargara, et Aſſon, ZAoliorum colonias. | TUM fanus alter, 'Ayawy Nh, non longe ab llio litora in- curvat ; urbe bello excidioque clariffima. Hic Sigeum fuit oppidum : hic Achivorum fuit bellantium ſtatio. Huc ab Idæo monte demiſſus Scamander exit, et Simois, fama quam natura majora flumina. Ipſe mons vetere Divarum certamine et ju- 25 dicio Paridis memoratus, orientem Solem aliter quam in aliis terris ſolit aſpici, oſtentat. Namque ex ſummo vertice ejus k ſpeculan- 20 — 820 POM YON II Metz ſpeculantibus, pænè à media nocte ſparſi ignes paſſim micare, ect, ut lux appropinquat, ita coire ac ſe conjungere videntur ; 230 donec magis magiſque collecti, pauciores ſubinde, et uni ad poſtremum flamma ardeant. Ea cum diu clara et incendio ſimilis effulſit, cogit ſe ac rotundat, et fit ingens globus. Diu is quoque grandis, et terris annexus apparet: deinde paulatim - decreſcens, et quantò decreſcit, eo clarior, fugat noviſſimè noc- 35 tem, et cum die jam Sol factus, attollitur. Extra finum ſunt i? | Rhcetea litora, a Rhœteo et Dardania claris urbibus; Ajacis | 3 tamen ſepulcro maximè illuſtria. Ab his fit arctius mare, 4 nzàqnee jam alluit terras, ſed rurſus dividens, anguſto Helleſponti 3 . freto litus obvivm findit; facitque ut iterum terre, qui fluit, 40 latera ſint. C A P. XIX. = BITHY N I INT ERI Us Bithyni ſunt, et Mariandyni : in ora, Graiz: urbes, Abydos et Lampſacum et Parion et Priapos. Abydos. Magni. quondam amoris commercio inſignis eſt. Lampacum Phoczis appellantibus nomen ex eo traxit, quod consulsibus. In quaſnam terras potiſſimùm tenderent, reſponſum erat, ubi c primum fulſiſet, ibi ſedem capeſſerent. Tum rurſus fit aper- 8 tius mare, Propontis. In id Granicus effunditur, qua primum _= inter Perſas et Alexandrum pugna fuit nobilis. Trans amnem - fedetin cerviee pænè inſulæ Cyzicum: (nomen Cyzicus indi- 10 dit, quem à Minyis. imprudentibus, cùm Colchos peterent, fu- ſum acie cæſumque acie cæſumque acie cæſumque aciecuntur) poſt Placia, et Scylace, parvæ Pelaſgorum coloniz, quipes à tergo immanes; neque h | 15 ob magnitudinem, modo, ſed ob id etiam mirabiles, quod ubi in alveum ejus zſtus ſolemque ob magnitudinem, modo, ſed ob id etiam mirabiles, quod ubi in alveum ejus zostus ſolemque . fugerunt, emergunt atque hant, ſupervolante, aves, quamvis alti et perniciter ferantur, ab- forbent. Trans Rhyndacum est Daſcylos, et, quam — et ) — >. ** . III Io ̃ V — * u Seine. HANS SLOANE M.D.S (Ur- e Soc. alttius adecrer AM "Ol Roe hone FabulamBithynos Pontices,»d! A 2 A. PHRY C N i LyYcaonzs CAP P-%3D oc PI O CES = , s. 8 Y — = -. - — — — 2 - - 0 2 **. _. 4 —_ „ * » = — o? - b N 4 | 3 2 nN — — T Ac 24 % . :, 8 _ . of ' Ds S ITV ORBIS, LI B. I. 271 nii collocavere, Myrlea. Duo ſunt inde modici sinus. Alter fine nomine Cion amplectitur, Phrygiz haud longe jacentis op- 20 portuniſſimum emporium : alter Olbianos, in promontorio fert Neptuni fanum; in gremio Aſtacon, a Megarenfibus conditam, Deinde priores terræ iterum jacent; exiturique in Pontum pe- lagi canalis anguſtior Europam ab Aſia sistiis quinque diſter- minat, Thracius (ut dictum eſt) Boſporus. Ipſis in faucibus 25 oppidum, in ore templum eſt: oppidi nomen Calchedon, auc- tor Archias Megarenſium princeps; templi numen Jupiter, conditor Jaſon. rede I C jam sese ingens Pontus aper I C jam longo rectoque limite extentus, si- nuatus cætera, ſed (quia contra, minus; qua ad lævam et dextram abſceſfit, mollibus faftigtis, donec anguſtos utrinque angulos faciat, inflectitur) ad formam Scythict arcus maxime 5 incurvus: brevis, atrox, nebuloſus, raris situationibus, non molli neque arenoſo circundatus litore, vicinus aquilombus, et quia non. protundus eſt, fluctuoſus atque fervens : olim ex colentium sævo admodum ingenio Axenus, poſt commercio aliarum gentium mollitis aliquantum moribus, dictus Euxinus. In eo 10 primum Mariandyni urbem habitant, ab Argivo (ut ferunt) Hercule datam. Heraclea vocitatur: id famæ fidem adjicit.
| 39,827 |
https://stackoverflow.com/questions/40033356
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,016 |
Stack Exchange
|
https://stackoverflow.com/users/3385212, tynn
|
English
|
Spoken
| 84 | 277 |
ConcurrentModificationException building Android XML with data binding
Error:cannot generate view binders java.util.ConcurrentModificationException occurs when trying to set an ObservableBoolean value in XML.
XML:
<Button
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:text="Soy Milk"
android:onClick="@{() -> model.useSoy.set(true)}"
/>
Model:
public ObservableBoolean useSoy = new ObservableBoolean(false);
How can I fix this?
I got it running by calling a seperate setter method.
XML:
<Button
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:text="Soy Milk"
android:onClick="@{() -> model.setUseSoy(true)}"
/>
Model:
public ObservableBoolean useSoy = new ObservableBoolean(false);
public void setUseSoy(Boolean useSoy){
this.useSoy.set(useSoy)
}
But better use boolean instead of Boolean
| 35,531 |
https://openalex.org/W4312527586
|
OpenAlex
|
Open Science
|
CC-By
| 2,022 |
Prosody and Interfaces
|
Carolina Serra
|
English
|
Spoken
| 4,739 | 8,887 |
1. Rio de Janeiro Federal University – UFRJ. Rio de Janeiro – Brazil. https://orcid.
org/0000-0001-9340-2567. E-mail: [email protected].
2. University of São Paulo – USP. São Paulo – Brazil. https://orcid.org/0000-0002-9941-
3934. E-mail: [email protected].
3. School of Arts and Humanities, University of Lisbon. Lisbon – Portugal. https://orcid.
org/0000-0003-0332-5719. E-mail: [email protected]. This content is licensed under a Creative Commons Attribution License, which permits unrestricted use and
distribution, provided the original author and source are credited. From initial education to the P
https://dx.doi.org/10.1590/1678-460X202259091 From initial education to the P
https://dx.doi.org/10.1590/1678-460X202259091 From initial education to the P
https://dx.doi.org/10.1590/1678-460X202259091 Presentation D.E.L.T.A., 38-3, 2022 (1-14): 202259091 Prosody and Interfaces Prosódia e Interfaces Prosódia e Interfaces Carolina Serra1
Flaviane Fernandes-Svartman2
Marisa Cruz3 This special issue arises from the I International Congress Voices
and Writings in the Different Spaces of the Portuguese Language,
organized by the Graduate Program in Letters (Vernacular Letters)
of the Federal University of Rio de Janeiro (UFRJ), in November
2020. Within this event, two symposia promoted the discussion on
the relationship between the prosody of Portuguese (stress, intonation,
phrasing and rhythm) and other areas of linguistic interface. Some
phenomena in Portuguese involve a high degree of complexity, as
its analysis requires the inspection of phonological, morphological,
syntactic, semantic and pragmatic components. This fact, together
with a recent tendency in linguistic studies to express the grammatical
architecture from an integrationist perspective, opened the floor for
the presentation of interface studies. Following diverse theoretical D.E.L.T.A., 38-3, 2022 (1-14): 202259091 Carolina Serra, Flaviane Fernandes-Svartman, Marisa Cruz approaches, several research papers were then presented on the prosody
of Portuguese (i) as L1 and L2, (ii) in adult and child speech, (iii) in
spoken, written and signed modalities, (iv) in typical and atypical
speech, including language disorders, and (v) in contexts of linguistic
contact. Since it was a successful event, the call for contributions for this
special issue was expanded worldwide to any interested prosodist
working in interface with other grammatical areas. After a double blind
review process, ten papers of high quality were selected for publication
in this special issue, organized into two parts, which are presented and
detailed below. Part I, entitled Linking prosody, (morpho)syntax and pragmatics:
On phrasing, intonation and rhythm, opens with Luiz Carlos Schwindt
and Leda Bisol’s contribution, on the prosodization of derived words
in Brazilian Portuguese (henceforth, BP) in interface with morphology. The authors revisit and extend the debate on the prosodic status of
derived words in BP. Based on previous studies (e.g., Bisol, 2000, 2004,
2007; Schwindt, 2001, 2008, 2013), they argue that derived words
in BP are subject to different prosodization processes: composition,
adjunction and incorporation. For them, prefixed words are prosodized
as composite, adjoined or incorporated to their bases, suffixed words
are prosodized as composite or incorporated, and clitics are attached
to a higher-level host than the prosodic word, such as the phonological
phrase. Prosody and Interfaces Evidence for this comes from (i) stress assignment, which
provides the phonological word status to some affixes, (ii) phonological
processes in the domain of this prosodic constituent, or related to it, and
(iii) extra phonological characteristics, such as the affix ordering and
autonomy in the utterance. In the same paper, the authors also propose
an analysis of the different prosodic structures through a hierarchy of
constraints, based on Itô and Mester (2008) and Selkirk (1996), and
related to tree form restrictions, interface conditions, parsing principles
and size and shape requirements. Furthermore, they problematize some
consequences of the presented typology for the organization of the
prosodic hierarchy and its effects on morphological transparency and
defend a continuum in the degree of transparency/productivity, that goes
from composite to incorporated structures. According to Schwindt and 2 Prosody and Interfaces Bisol, this proposal is able to explain possible overlaps or fluctuations
in the perception of certain affixes. Linking prosody and pragmatics, Cristina Name and Juan Manuel
Sosa analyze wh- and yes/no questions in BP, in infant-directed speech
(IDS), considering the interactions of ten Brazilian Portuguese-
acquiring infants aged 4 to 12 months and their caregivers in various
everyday situations. The prosodic variables considered are pitch
register and pitch span, speech rate, final syllable duration, and quality
of voice. The results reveal that questions correspond to 33% of the
total utterances produced and are emphasized mainly by marked pitch
(raised pitch range and expanded pitch span), as well as increased
duration. Moreover, the pitch contours of wh- and yes/no questions
follow their respective patterns observed in adult speech. These results
are compatible with those found in the literature (Moraes, 2008) and
indicate that, in general, the IDS used in BP has similar characteristics
to this register in other languages. Pitch differences between men
and women, and between girls and boys are also explored in order to
understand to what extent these variables may impact IDS prosody
in BP. The authors show that pitch cues vary among participants,
idiosyncratically, and that it may be related to family characteristics,
infants’ age and/or cultural issues. This is an important contribution
to the field as in BP there are few studies focusing on IDS, and
particularly fewer on its prosodic features. Furthermore, there are no
studies contrasting prosodic features of IDS of women and men in BP. Prosody and Interfaces Still on the prosody of interrogatives, Gabriela Braga, Sónia Frota,
and Flaviane Fernandes-Svartman analyze neutral yes-no questions
of an African variety of Portuguese - the Guinea-Bissau Portuguese
(henceforth, GBP). Following the theoretical framework of Prosodic
Phonology (Selkirk, 1984; Nespor & Vogel, 1986) and Intonational
Phonology (Pierrehumbert, 1980; Ladd, 2008), the authors examine
whether the GBP neutral yes-no questions differ from those of European
Portuguese spoken in Lisbon (henceforth, SEP) – the variety assumed
as the standard language, despite the fact that Portuguese is spoken as a
second language in the multilingual territory of Guinea-Bissau, where
Kriol (Guinean Creole) is the national unity language. According to the
latest census in the country (Instituto Nacional de Estatística, 2009),
around 90% of the population speaks Kriol, covering both L1 and L2 Carolina Serra, Flaviane Fernandes-Svartman, Marisa Cruz speakers, and one-third of the population speaks Portuguese, mainly
as L2. As a main result, the authors conclude that, for the pre-nuclear
and nuclear contours as well as tonal density, the intonation of GBP
neutral yes-no questions differs from SEP and is closer to Brazilian and
African varieties already studied (e.g., Tenani, 2002; Frota et al., 2015;
Braga, 2019; Santos, 2020). Pitch accents found in pre-nuclear contour
are a rising pitch accent L*+H and a high pitch accent H*, associated
with the first prosodic word of the sentence in equal proportion. The
nuclear contour (L+)H* L% is the dominant one, and there is a high
tonal density in GBP neutral yes-no questions. These results, together
with the outcomes previously pointed out in the literature for declarative
sentences (Santos & Fernandes-Svartman, 2014; Santos, 2015; Santos
& Braga, 2017), suggest that GBP is developing its own intonational
grammar. Also focused on an African variety of Portuguese, this time spoken
in Maputo, Moçambique (henceforth, PM), Carolina Serra and Ingrid
Oliveira analyze and describe the intonation of neutral declaratives
and neutral yes-no questions. Since the same theoretical framework as
Braga et al. (this volume) is followed, the authors compare the results
found for PM with the ones for GBP, besides the other African varieties
already explored, and European Portuguese. Like Guinea-Bissau,
Moçambique is also a cultural and linguistic melting pot: Portuguese
language coexists with a collection of local Bantu languages. Prosody and Interfaces According
to the 2007 Census, in Maputo, Portuguese is spoken by 42.9% of the
population, which is close to the usage rate reported for Changana, the
most frequently spoken local language. Using a read corpus of Subject-
Verb-Object (SVO) declaratives and neutral yes-no questions, the
authors inspected the following prosodic aspects: (i) phrasing patterns,
(ii) nuclear and pre-nuclear contours, and (ii) pitch accent distribution. The results show that neutral declaratives are predominantly organized
into two intonational phrases (IPs), i.e., the Subject phrased apart
from the Predicate (S)(VO). Intonationally, the most frequent nuclear
contours found are LH+L* L% and H+L* L%. Thus, when different
from the other varieties of Portuguese, neutral declaratives in PM are
produced with a tritonal nuclear pitch accent and a low boundary tone,
which is so far a novelty among the African varieties of Portuguese. Phrase accents, also present in other varieties of Portuguese, frequently
occur in PM, even within the Subject, separating the nucleus from its Prosody and Interfaces complements. In neutral questions, the nucleus most often features a
rising-falling L+(<¡)H*L% movement. High tonal density is also found,
with pitch accents associated with stressed syllables of all prosodic
words in both declaratives and yes-no questions. In sum, and comparing
with other varieties of Portuguese, PM presents more differences
than similarities. This leads the authors to conclude that the prosodic
grammar of PM is inevitably affected by the complex sociolinguistic
situation in this region, where Portuguese, an intonational language,
is in contact with (and is as frequently used as) Changana, a tonal
language. This scenario might impact on how Portuguese is spoken by
Mozambicans, even those with Portuguese as their L1. In turn, switching the attention from language variation to clinical
linguistics, Geovana Soncin, Luiza Polli, and Larissa Cristina Berti
inspect the use of acoustic cues in prosodic focus marking in speech of
Brazilian children with phonological disorders. Phonological disorders
involve difficulties of various kinds related to aspects of perception,
motor production and phonological representation regarding segmental
and prosodic aspects. As for the difficulties related to the prosodic
aspects, the authors notice the lack of studies describing prosody
displayed in speech of Brazilian children during the BP acquisition
process, in particular those showing deviant processes, and the lack of
studies providing an acoustic characterization of prosodic aspects of
Brazilian children in phonological acquisition process of BP, regardless
of being typically or atypically developing. Prosody and Interfaces In order to contribute to
fill in these gaps, the authors develop a pilot study aiming to present
an acoustic characterization of prosodic focus marking in speech of
children from the interior of the São Paulo State diagnosed with a
phonological disorder and a persistent phonological disorder (Shriberg
et al., 2010). The phonetic-acoustic cues taken into consideration on
the characterization of prosodic focus marking are duration, intensity
and intonation, with regard to the tonal configuration of the nuclear
pitch accent carried by focused elements. The analyzed data were
obtained in speech evaluation sessions through a task of repeating
focus marking sentences (Phrasal Accent Test). The obtained results
show that an increase in duration and in intensity marks the prosodic
focus in speech of children with phonological disorders, but not the
nuclear pitch accent carried by the focused element, since instabilities
were noted in the production of prosodic focus. Assuming that the 5 Carolina Serra, Flaviane Fernandes-Svartman, Marisa Cruz tonal configuration of the nuclear pitch accent is the cue considered
to be primary in prosodic focus marking in BP, the authors claim that
their results show that the secondary cues are the ones which mark
the focused element in speech of children with phonological disorder
of their investigation. These results obtained by the authors’ pilot
study already represent unprecedented and relevant contributions to
linguistic and clinical studies on language acquisition and point to the
need to consider prosody as one of the elements to be observed in the
phonological acquisition process, either in a typical or atypical context. Part I of this special issue is enclosed with Yuqi Sun and Cong
Zhang’s contribution, a first step towards the analysis of rhythm of L2
Portuguese speech produced by eight native Cantonese speakers from
Macao, China, across three different tasks: a reading task, a retelling
task, and an interpreting task. The aims of this study are to investigate
(1) whether the speech rhythm in L2 Portuguese is source-like (more
similar to Cantonese) or target-like (more similar to Portuguese), and
(2) whether L2 speech rhythm is affected by task. Founded in previous
research, seven rhythm metrics, i.e., %V, ΔC, ΔV (Ramus, Nespor &
Mehler, 1999; Frota & Vigário, 2001), VarcoC, VarcoV (Dellwo &
Wagner, 2003; Mok & Dellwo, 2008; Mok, 2009), rPVI_C, and nPVI_V
(Grabe & Low, 2002), are adopted for data analysis and discussion. Prosody and Interfaces The authors conclude that L2 Portuguese rhythm is characterized by
both source-like and target-like properties, thus presenting a proportion
of vocalic intervals and a vocalic variability similar to those of L1
Cantonese (source-like), and a consonantal variability closer to the one
shown by L1 Portuguese (target-like). These rhythmic properties are
triggered by phonological phenomena such as R-deletion, resulting in
a higher variability of vocalic intervals, and vowel epenthesis, which
increases the amount of consonantal intervals and affects their duration. However, these L2 Portuguese rhythmic properties are affected by task,
as the more spontaneous tasks, i.e., retelling and interpreting, show a
higher variability than reading, which the authors relate to the extra
processing effort involved in the conceptualizer and formulator stages
of Levelt’s speech production model (1989). Part II of this special issue, entitled Perceiving and processing
prosody: Speech, gestures, and brain, opens with the contribution of
Luma da Silva Miranda, João Antônio de Moraes, and Albert Rilliard, 6 Prosody and Interfaces who explore the role of prosodic properties (namely, F0, duration and
intensity) to perceive wh-questions and wh-exclamations in BP. As
in many other languages, in BP the syntactic structure remains the
same and wh-questions and wh-exclamations are differentiated by
the prosody. However, the exact cues responsible for the distinction
between these two pragmatic meanings have not been studied in
detail so far. Anchored in previous findings (Moraes, 2008; Oliveira
et al., 2014; Miranda, 2015; Zendron da Cunha, 2016), two perceptual
identification experiments were designed to assess the subjects’
ability to identify these pragmatic meanings based on their prosodic
characteristics, as well as the perceptual relevance of each prosodic
feature in the recognition of wh-questions and wh-exclamations. The
results of the first perceptual experiment indicate that Brazilian listeners
can identify these two pragmatic meanings using intonational cues
only, as previously hypothesized. The second experiment shows that
the prenuclear region of the wh-questions and wh-exclamations may
present different shapes without affecting the identification of these
pragmatic meanings, so the hypothesis which predicted that the F0
manipulation on the prenuclear region of the contour would be less
important than the nuclear region is also confirmed. Additionally, it
is also observed that listeners’ perception is influenced by the type
of F0 movement along the nuclear region of the sentence. Prosody and Interfaces This thus
confirms the hypothesis predicting that a falling F0 contour would favor
the wh-question identification, while a slightly rising F0 movement
would increase the wh-exclamation identification. Finally, the original
duration and intensity cues of the wh-question and wh-exclamation
contours also favor the recognition of the two pragmatic meanings,
regardless of the F0 configuration. Exploring the interplay between speech and gestures, both in
production and perception, Manuella Carnaval, João Antônio de
Moraes, and Albert Rilliard analyze five focus types in BP, from
a multimodal perspective: (i) informational focus, (ii) contrastive
focus, (iii) attenuated focus, (iv) interrogative focus, and (v) surprise
focus. Focus production is inspected acoustically (i.e., F0 and syllabic
duration) and visually, following Ekman et al.’s (2002) Action Units
to annotate facial movements. The position of the focused element
along the sentence, always targeting heads of syntactic phrases, and the
stress status of the syllable that carries the focus (prestressed, stressed, Carolina Serra, Flaviane Fernandes-Svartman, Marisa Cruz poststressed or other) are also relevant factors for the analysis. The
perception of the five narrow focus categories is also explored in order
to test the role of audio (A) and visual (V) modalities alone, and then
combined (AV), to identify the different semantic-pragmatic values
of the five focus types under study. The goal is to observe whether
there is a potential enhancement linked to audiovisual presentation
(i.e., to bimodal cues over the unimodal ones). The results show that
the informational focus is the less prominent one from both acoustic
and visual perspectives, thus being used in the perceptual experiment
as a default answer for stimuli whose meaning was unclear. Although
similar in terms of acoustic cues, contrastive and attenuated focus types
exhibit a complementary relationship in the perception experiment, as
there is a correlation between the contrastive focus meaning and the
focus position at the beginning of the sentence as well as between the
attenuated focus meaning and the middle and final positions of focused
elements in the sentence. The interrogative focus and the surprise focus
present distinct acoustic and visual cues, thus not offering difficulties
in perception. However, the higher identification levels of the surprise
focus in all modalities lead the authors to consider it as the most
prototypical type for the interrogative sentences analyzed. Prosody and Interfaces In sum,
multimodality plays a relevant role in focus production and perception,
with different acoustic and visual parameters contributing to conveying
distinct meanings, according to each focus type. Alcione de Jesus Santos, Rui Rothe-Neves, Vera Pacheco, and
Virgínia Silveira Baldow deeply inspect how readers of different
education levels process pragmatic aspects of reading aloud related
to the expression of the basic emotions (joy, anger and sadness),
as well as in a neutral way. For this end, the authors produced texts
whose semantic contexts trigger the aforementioned emotions. Texts
were read aloud and recorded for acoustic analysis. The hypothesis
is that more schooled readers tend to prosodically mark pragmatic
issues of written text in reading aloud more adequately, compared
to less schooled readers. Indeed, the results clearly show significant
differences between different emotions, as well as between different
emotions and the neutral form, for more schooled individuals, with
F0, intensity and speech rate being significantly increased in emotions
such as joy and anger, and decreased in sadness. These findings are in
line with previous studies referring that acoustic parameters such as 8 Prosody and Interfaces Prosody and Interfaces F0, duration and intensity are adjusted depending on the attitude and/
or emotion that the speaker wants to imprint. However, Santos and
colleagues go beyond this state of the art by complementing it with
the needed quantitative analysis of such adjustments. These findings
have notable implications in the educational field, namely, to teach
reading skills, which involve exploring pragmatic aspects of the text,
as well as the impact that such aspects have on text comprehension. When reading a text, a student needs to be able to recognize pragmatic
issues such as emotions (e.g., sadness, anger, joy, etc.) and attitudes
(e.g., politeness, irony, sarcasm, etc.). In case of reading aloud, these
pragmatic issues must be prosodically conveyed by means of acoustic
parameters (e.g., F0 settings, intensity, duration, etc.) so that the listener
can also understand the message being read. The last contribution to this volume, from Thais Helena
Machado, Ana Cláudia Pereira Bertolino, Leandro Pereira, Francisco
E. C. Cardoso, and Rui Rothe-Neves, focuses on speech temporal
organization in three basal ganglia-related neurological conditions:
Parkinson’s disease (PD), Huntington’s disease (HD), and Sydenham’s
chorea (SC). It is already known that alterations in the neuronal
circuits involving the basal nuclei can generate abnormal hypo- or
hyperkinetic movements, which, consequently, can influence the motor
control of speech. However, how different neurological diseases alter
all these parameters is not precisely known. Taking this background
into account, the authors investigate how the acoustic parameters of
temporal organization of speech vary in the dysarthric speech of three
different clinical groups, with and without medication, compared to a
control group. The main hypothesis is that the hypokinetic patients have
different speech duration patterns than the hyperkinetic ones and that
there are correlations between the motor impairment of each disease
(specific scales) and temporal changes in speech. After analyzing the
total speech time (comprising total articulation time and total pause
time), the number of pauses and its average duration, speech rate,
articulation rate, and total fluency time, the authors observe that there
is no correlation between global motor scales and temporal parameters
of speech, leading to the conclusion that global motor impairment in
basal ganglia disorders does not involve speech. Almost all temporal
measures are different when comparing the clinical and control groups,
as clinical groups are slower to produce speech, although they preserve 9 Carolina Serra, Flaviane Fernandes-Svartman, Marisa Cruz the syntactic function of prosody at different levels. Prosody and Interfaces Thus, differently
from what was hypothesized, basal nuclei dysfunction appears to affect
all clinical groups, regardless of etiology. We deeply acknowledge the authors of this special issue for the
quality of their papers and for their readiness to integrate the editorial
suggestions and the feedback of the reviewers. A huge thank you is
also due to the excellent reviewing panel of this special issue for the
availability to provide their precious contribution to this special issue,
whose quality would not definitely be the same without their valuable
comments and suggestions: Aline Fonseca (Federal University of Juiz
de Fora), Aline P. Silvestre (Federal University of Rio de Janeiro), Annie
Rialland (CNRS Laboratory of Phonetics and Phonology), Barbara Gili
Fivela (Università del Salento), Bernadete Abaurre (State University of
Campinas), Carlos A. Gonçalves (Federal University of Rio de Janeiro),
Celeste Rodrigues (University of Lisbon), Chao Zhou (University of
Minho), Donna Erickson (Haskins Laboratories, New Haven), Ester
Scarpa (State University of Campinas), Fiona Ong (Wong Partnership
LLP), Gilbert Ambrazaitis (Linnaeus University), Isabel Falé (Open
University, Lisbon), Joan K-Y Ma (Queen Margaret University),
José Ignacio Hualde (University of Illinois at Urbana-Champaign),
Jovana Pejovic (University of Lisbon), Luciani Tenani (São Paulo
State University), Luiz Carlos Cagliari (São Paulo State University),
Marcus Vinícius M. Martins (Minas Gerais State University), Marina
Vigário (University of Lisbon), Meghan Armstrong (University of
Massachusetts Amherst), Patrizia Sorianello (Università degli Studi di
Bari Aldo Moro), Pilar Prieto (Universitat Pompeu Fabra & ICREA),
Plínio Barbosa (State University of Campinas), Rajiv Rao (University
of Wisconsin-Madison), Sue Peppé (Queen Margaret University),
Sun-Ah Jun (University of California, Los Angeles), Susan Geffen
(Occidental College, Los Angeles), Takaaki Shochi (Université
Bordeaux Montaigne), and Tommaso Raso (Federal University of
Minas Gerais). Last but not least, we acknowledge the DELTA editorial board
for accepting our proposal and for their constant support throughout
the entire publication process. Finally, a special acknowledgement is
also due to the Graduate Program in Vernacular Letters of the Federal
University of Rio de Janeiro, especially to the Program Coordinator, 10 Prosody and Interfaces Professor Maria Eugênia Lammoglia Duarte, for the financial support
of this special issue. Prosody and Interfaces A special mention is also due to other funding entities for supporting
the research developed by the guest editors, namely: Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Brazil),
process 88887.508095/2020-00 (Visiting Professor at Università del
Salento), for Carolina Serra; Conselho Nacional de Desenvolvimento
Científico e Tecnológico (CNPq, Brazil), process 304961/2021-3 (Bolsa
de Produtividade em Pesquisa - PQ, nível 2), for Flaviane Fernandes-
Svartman; and FCT - Fundação para a Ciência e a Tecnologia,
Portugal, through the funded projects PTDC/CLE-LIN/119787/2010
and UIDB/00214/2020, for both Flaviane Fernandes-Svartman and
Marisa Cruz. The authors declare they have no conflict of interest. The authors declare they have no conflict of interest. References Bisol, L. (2000). O clítico e seu status prosódico. Revista de Estudos da
Linguagem, 9(1), 5-30. http://dx.doi.org/10.17851/2237-2083.9.1.5-
30. Bisol, L. (2004). Mattoso Câmara Jr. e a palavra prosódica. DELTA,
20(spe), 59-70. https://doi.org/10.1590/S0102-44502004000300006. Bisol, L. (2007). Palavra fonológica pós-lexical. In E. Guimarães, & M. C. Mollica (Eds.), Palavra: Forma e sentido (pp. 13-23). Pontes. Braga, G. (2019). Aspectos prosódicos das sentenças interrogativas globais
do português de São Tomé: Uma análise inicial. Estudos Linguísticos,
48(2), 688-708. https://doi.org/10.21165/el.v48i2.2323. ( )
p
g
Braga, G., Frota, S., & Fernandes-Svartman, F. (2022). Guinea-Bissau
Portuguese: What the intonation of yes-no question shows about
this variety. Special issue Prosody and interfaces (Ed. by C. Serra,
F. Fernandes-Svartman, and M. Cruz). DELTA, 38(3), Article
202258942, 1-27. https://dx.doi.org/10.1590/1678-460X202258942. Dellwo, V., & Wagner, P. (2003). Relations between language rhythm
and speech rate. 15th ICPhS International Congress of Phonetics
Science, 471-474. 11 Carolina Serra, Flaviane Fernandes-Svartman, Marisa Cruz Ekman, P., Friesen, W. V., & Hager, J. C. (2002). Facial action coding
system: The manual. Research Nexus. Frota, S. (2000). Prosody and focus in European Portuguese: Phonological
phrasing and intonation. Garland Publishing. Frota, S., & Vigário, M. (2001). On the correlates of rhythmic distinctions:
The European/Brazilian Portuguese case. Probus, 13(2), 247-275. https://doi.org/10.1515/prbs.2001.005. Frota, S., Cruz, M., Svartman, F., Collischonn, G., Fonseca, A., Serra, C.,
Oliveira, P. & Vigário, M. (2015). Intonational variation in Portuguese:
European and Brazilian varieties. In S. Frota, & P. Prieto (Eds.),
Intonation in Romance (pp. 235-283). Oxford University Press. Grabe, E., & Low, E. L. (2002). Durational variability in speech and the
rhythm class hypothesis. In C. Gussenhoven, & N. Warner (Eds.),
Laboratory Phonology VII Vol. 7 (pp. 515-546). Mouton de Gruyter. https://doi.org/10.1515/9783110197105.2.515. Instituto Nacional de Estatística. (2009). RGPH. Terceiro Recenseamento
Geral da População e Habitação – 2009. National Institute of
Statistics of Guinea-Bissau. Itô, J., & Mester, A. (2008, November 13-15). Rhythmic and interface
categories in prosody [Conference presentation]. 18th Japanese/
Korean Linguistics Conference, New York, United States. Ladd, R. (2008). Intonational Phonology. 2nd ed. Cambridge University
Press. Levelt, W. J. M. (1989). Speaking: From intention to articulation. The
MIT Press. Miranda, L. (2015). Análise da entoação do português do Brasil segundo
o modelo IPO [Master thesis]. Federal University of Rio de Janeiro. Mok, P. (2009). On the syllable-timing of Cantonese and Beijing Mandarin. Chinese Journal of Phonetics, 2(May), 148-154. Mok, P., & Dellwo, V. (2008). References Comparing native and non-native speech
rhythm using acoustic rhythmic measures: Cantonese, Beijing
Mandarin and English. Proceedings of the 4th International
Conference on Speech Prosody, 423-426. Moraes, J. A. (2008). The pitch accents in Brazilian Portuguese: Analysis
by synthesis. Proceedings of Speech Prosody 2008 Conference, 389-
397. Nespor, M.M & Vogel, I. (1986). Prosodic Phonology. Foris Publications. Oliveira, J. S. N., Pacheco, V., & Oliveira, M. (2014). Análise perceptual
das frases exclamativas e interrogativas realizadas por falantes de
Vitória da Conquista/BA. Signum: Estudos da Linguagem, 17(2),
354-388. http://dx.doi.org/10.5433/2237-4876.2014v17n2p354. 12 Prosody and Interfaces Pierrehumbert, J. (1980). The phonology and phonetics of English
intonation [Doctoral dissertation]. MIT. Pierrehumbert, J. (1980). The phonology and phonetics of English
intonation [Doctoral dissertation]. MIT. Ramus, F., Nespor, M., & Mehler, J. (1999). Correlates of linguistic rhythm
in the speech signal. Cognition, 73, 265-292. https://doi.org/10.1016/
S0010-0277(00)00101-3. Santos, V. G. dos. (2015). Aspectos prosódicos do português de Guiné-
Bissau: A entoação do contorno neutro [Master thesis]. University of
São Paulo. https://doi.org/10.11606/D.8.2015.tde-29062015-153129. Santos, V. G. dos, & Braga, G. (2017). Associação tonal em sentenças
declarativas neutras do português de Bissau e de São Tomé. PAPIA,
27(1), 7-32. Santos, V. G. dos, & Fernandes-Svartman, F. R. (2014). O padrão
entoacional neutro do português de Guiné-Bissau: Uma comparação
preliminar com o português brasileiro. Estudos Linguísticos, 43(1),
48-63. Santos, V. G. dos. (2020). Aspectos prosódicos do português angolano do
Libolo: Entoação e fraseamento [Doctoral dissertation]. University of
São Paulo. https://doi.org/10.11606/T.8.2020.tde-03032020-174301.i Schwindt, L. C. (2001). O prefixo no português brasileiro: Análise
prosódica e lexical. DELTA, 17(2), 175-207. https://doi.org/10.1590/
S0102-44502001000200001. Schwindt, L. C. (2008). Revisitando o estatuto prosódico e morfológico
de palavras prefixadas do PB em uma perspectiva de restrições. Alfa, 52(2), 391-404. https://periodicos.fclar.unesp.br/alfa/article/
view/1524. Schwindt, L. C. (2013). Palavra fonológica e derivação em português
brasileiro: Considerações para a arquitetura da gramática. In L. Bisol;
G. Collischonn. (Eds.), Fonologia: Teorias e perspectivas (1st ed.,
pp. 15-28). EDIPUCRS. Selkirk, E. O. (1984). Phonology and syntax: The relation between sound
and structure. MIT Press. Selkirk, E. (1996). The prosodic structure of function words. In J. L. Morgan, & K. Demuth (Eds.), Signal to syntax: Prosodic
bootstrapping from speech to grammar in early acquisition (pp.187-
214). Lawrence Erlbaum. Shriberg, L. D., Fourakis, M., Hall, S. D., Karisson, H. B, Lohnmeier,
H. L., McSeeny, J. L., Potter, N. L., Scheer-Cohen, A. R., Strand,
E. A., Tikens, C. M., & Wilson, D. L. (2010). References Extensions to the
Speech Disorders Classification System (SDCS). Clinical Linguistics
and Phonetics, 24(10), 795-824. https://dx.doi.org/10.3109%
2F02699206.2010.503006. 13 Carolina Serra, Flaviane Fernandes-Svartman, Marisa Cruz Tenani, L. E. (2002). Domínios prosódicos no português do Brasil:
Implicações para a prosódia e para a aplicação de processos
fonológicos [Doctoral dissertation]. State University of Campinas. https://doi.org/10.47749/T/UNICAMP.2002.253138. Zendron da Cunha, K. (2016). Sentenças exclamativas em português
brasileiro: Um estudo experimental de interface [Unpublished
doctoral dissertation]. Federal University of Santa Catarina. https://
repositorio.ufsc.br/xmlui/handle/123456789/172264. Zendron da Cunha, K. (2016). Sentenças exclamativas em português
brasileiro: Um estudo experimental de interface [Unpublished
doctoral dissertation]. Federal University of Santa Catarina. https://
repositorio.ufsc.br/xmlui/handle/123456789/172264. Recebido em: 30/05/2022
Aprovado em: 15/07/2022 Recebido em: 30/05/2022
Aprovado em: 15/07/2022 14
| 40,762 |
US-201715653329-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,017 |
None
|
None
|
English
|
Spoken
| 7,143 | 8,887 |
3D IC method and device
ABSTRACT
A method of three-dimensionally integrating elements such as singulated die or wafers and an integrated structure having connected elements such as singulated dies or wafers. Either or both of the die and wafer may have semiconductor devices formed therein. A first element having a first contact structure is bonded to a second element having a second contact structure. First and second contact structures can be exposed at bonding and electrically interconnected as a result of the bonding. A via may be etched and filled after bonding to expose and form an electrical interconnect to interconnected first and second contact structures and provide electrical access to this interconnect from a surface.
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a division of and claims the benefit of priority under 35 U.S.C. § 120 from U.S. application Ser. No. 14/813,972, filed Jul. 30, 2015, which is a continuation of U.S. application Ser. No. 14/198,723, filed Mar. 6, 2014, which is a division of U.S. application Ser. No. 13/783,553, filed Mar. 4, 2013, now U.S. Pat. No. 8,709,938, which is a continuation of U.S. application Ser. No. 12/270,585, filed Nov. 13, 2008, now U.S. Pat. No. 8,389,378, which is a continuation of U.S. application Ser. No. 11/201,321, filed Aug. 11, 2005, now U.S. Pat. No. 7,485,968, the entire contents of each of which is incorporated herein by reference.
This application is related to application Ser. No. 09/532,886, now U.S. Pat. No. 6,500,794, Ser. No. 10/011,432, now U.S. Pat. No. 7,126,212, Ser. No. 10/359,608, now U.S. Pat. No. 6,962,835, Ser. No. 10/688,910, now U.S. Pat. No. 6,867,073, and Ser. No. 10/440,099, now U.S. Pat. No. 7,109,092.
BACKGROUND OF THE INVENTION 1. Field of the Invention
The present invention relates to the field of three-dimensional integrated circuits and more particularly to devices and the fabrication thereof of three-dimensional integrated circuits using direct wafer bonding.
2. Description of the Related Art
Semiconductor integrated circuits (ICs) are typically fabricated into and on the surface of a silicon wafer resulting in an IC area that must increase as the size of the IC increases. Continual improvement in reducing the size of transistors in ICs, commonly referred to as Moore's Law, has allowed a substantial increase in the number of transistors in a given IC area. However, in spite of this increased transistor density, many applications require an increase in total IC area due to a greater increase in required transistor count or an increase in the number of lateral interconnections required between transistors to achieve a specific function. The realization of these applications in a single, large area IC die typically results in a reduction in chip yield and, correspondingly, increased IC cost.
Another trend in IC fabrication has been to increase the number of different types of circuits within a single IC, more commonly referred to as a System-on a-Chip (SoC). This fabrication typically requires an increase in the number of mask levels to make the different types of circuits. This increase in mask levels typically also results in a reduction in yield, and correspondingly, increased IC cost. A solution to avoiding these undesired decreases in yield and increases in cost is to vertically stack and vertically interconnect ICs. These ICs can be of different size, come from different size wafers, comprise different functions (i.e., analog, digital, optical), be made of different materials (i.e., silicon, GaAs, InP, etc.). The ICs can be tested before stacking to allow Known Good Die (KGD) to be combined to improve yield. The economic success of this vertical stacking and vertical interconnect approach depends on the yield and cost of the stacking and interconnection being favorable compared to the yield and cost associated with the increased IC or SoC area. A manufacturable method for realizing this approach is to vertically stack ICs using direct bonding and to form vertical interconnect structures using conventional wafer fabrication techniques including wafer thinning, photolithography masking, via etching, and interconnect metallization. The vertical electrical interconnection between stacked ICs can be formed as a direct result of the direct bonded stacking or as a result of a sequence of wafer fabrication techniques after direct bonded stacking.
The cost of the vertical interconnection portion of this approach is directly related to the number of photolithography masking levels required to etch vias and form electrical interconnects. It is thus desirable to minimize the number of photolithography masking levels required to form the vertical interconnection.
One version of vertical stacking and vertical interconnection is where ICs (on a substrate) are bonded face-to-face, or IC-side to IC-side. This version may be done in a wafer-to-wafer format, but is typically preferably done in a die-to-wafer format where die are bonded IC-side down, to a wafer IC-side up to allow the stacking of Known Good Die to improve yield. The vertical interconnection may be formed as a direct result of the stacking, for example as described in application Ser. No. 10/359,608, or as a result of a sequence of wafer fabrication techniques after direct bonded stacking. The sequence of wafer fabrication techniques after direct bonded stacking typically includes the following. The die are typically substantially thinned by removing most of the die substrate. The die substrate can not, in general, be totally removed due to the location of transistors in the substrate, as is the case, for example in bulk CMOS ICs. The substrate is thus typically removed to the greatest extent practicable, leaving sufficient residual substrate to avoid damage to the transistors. An interconnection to the die IC is then formed by etching a via through the remaining substrate to an interconnection location in the die IC, such that there are no necessary transistors in the vicinity of this via. It is furthermore preferable, in order to achieve the highest interconnection density, to continue this via through the entire die-IC and into the wafer-IC to an interconnection location in the wafer IC. This via typically extends through an insulating dielectric material that provides desired electrical isolation from interconnection locations in the die IC and wafer IC and exposes desired electrical connection locations in the die IC and wafer IC. After the formation of this via, a vertical interconnection can be made with a conductive material to exposed desired electrical connection locations in the die IC and wafer IC. An insulating layer between the conductive material and the exposed substrate on the via sidewall may be used to avoid undesired electrical conduction between the conductive material and the substrate.
The fabrication of this structure typically takes four photolithography masking levels to build. These levels are 1) via etch through substrate, 2) via etch through insulating dielectric material in the die IC and wafer IC that exposes desired conductive material in the die IC and wafer IC, 3) via etch through a subsequently deposited insulating layer that electrically isolates the conductive material that interconnects the interconnect location in the die IC with the interconnect location in the wafer IC to the exposed substrate via sidewall that exposes desired conductive material in the die IC and wafer IC, 4) interconnection with conductive material between exposed interconnection point in the die IC with exposed interconnection point in the wafer IC.
The patterns defining the via etching through the insulating (dielectric) material(s) are typically smaller than the pattern defining the via etch through the substrate to adequately expose the interconnection points in the die IC and wafer IC and to avoid removing insulating material on the substrate via sidewall. Since these patterns are formed after the via in the substrate, this patterning is typically done at a lower topographical level that the patterning of the substrate via. This results in a patterning over a non-planar structure that limits the scaling of the structure to very small feature size that is desirable to achieve the highest interconnection density and consumes the least possible silicon substrate where functional transistors would otherwise reside.
It is thus desirable to have a device that comprises a structure and a method to fabricate said structure requiring a reduced number of masking steps and masking steps that can be realized on a planar surface, at the highest, or one of the highest, levels of topography in the structure. It is further desirable to have a device that comprises a structure and a method to fabricate said structure whereby a minimum consumption of silicon where functional transistors would otherwise reside is achieved.
SUMMARY OF THE INVENTION
The present invention is directed to a method of three-dimensional device integration and a three-dimensionally integrated device.
In one example of the method, a first element having a first contact structure is integrated with a second element having a second contact structure. The method may include the steps of forming a via in the first element exposed to at least the first contact structure, forming a conductive material in the via and connected to at least the first contact structure, and bonding the first element to the second element such that one of the first contact structure and the conductive material is directly connected to the second contact structure.
In a second example the method may include the steps of forming a via in a first element, forming a first conductive material in the via, connecting the first conductive material to the first contact structure, and bonding the first element to the second element such that one of the first contact structure and the first conductive material is directly connected to the second contact structure.
In a third example, the method includes the steps of forming a via in a first element having a first substrate, forming a conductive material in the via, forming a contact structure in the first element electrically connected to the conductive material after forming the via and the conductive material, forming a second element having at least one second contact structure, removing a portion of the first substrate to expose the via and the conductive material, bonding the first substrate to the second substrate, and forming a connection between the second contact structure and one of the first contact structure and the conductive material as a part of the bonding step.
In one example of an integrated structure according to the invention, a first element has a first contact structure, a second element has a second contact structure, a first via is formed in the first element, a first conductive material is formed in the first via connected to the first contact structure, and the first element is bonded to the second element such that one of the first conductive material and the first contact structure is directly connected to the second contact structure.
BRIEF DESCRIPTION OF THE DRAWINGS
A more complete appreciation of the present invention and many attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings, wherein:
FIG. 1 is a diagram showing die to be bonded face-down to a wafer face-up;
FIG. 2A is a diagram of die bonded to a substrate;
FIG. 2B is a diagram of die bonded to a substrate with a portion of the substrate of the die removed;
FIG. 2C is a diagram of a substrate bonded to another substrate;
FIG. 3A is a diagram showing formation of a dielectric film and mask layer over the structure of FIG. 2A;
FIG. 3B is a diagram showing formation a dielectric film and mask layer after forming a planarizing material;
FIG. 4 is a diagram showing apertures formed in the dielectric film and mask layer of FIGS. 3A and 3B;
FIG. 5 is a diagram showing etching of the die using the aperture formed as shown in FIG. 4;
FIG. 6A is a diagram showing further etching to expose contact structures in the die and wafer;
FIG. 6B is a diagram of a process modification including forming a hard mask;
FIG. 7A is a diagram of a section of the structure of FIG. 6A after formation of a conformal insulative sidewall layer;
FIG. 7B is a variation of the embodiment where the hard mask is removed;
FIG. 8A is a diagram showing anisotropic etching of a conformal insulative sidewall layer;
FIG. 8B is a variation of the embodiment where the hard mask is removed;
FIGS. 8C-8F illustrate variations in forming a conformal film in the bonded structure;
FIGS. 8G-8J illustrate the structures shown in FIGS. 8C-8J after etching the conformal film, respectively;
FIG. 8K illustrates an alternative manner of forming a sidewall film in the bond structure;
FIG. 9A is a diagram showing forming a metal contact comprising a metal seed layer and a metal fill;
FIG. 9B is a variation of the embodiment where the hard mask is removed;
FIG. 9C is a variation of the embodiment where no seed layer is formed;
FIG. 10A is a diagram of the structure of FIG. 9A or 9B after chemo-mechanical polishing;
FIG. 10B is a diagram of the structure of FIG. 9C after chemo-mechanical polishing;
FIGS. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Referring now to the drawings, in particular FIG. 1, a first embodiment of the method according to the invention will be described. It is noted here that the drawings are not drawn to scale but are drawn to illustrate the concepts of the invention.
Substrate 10 includes a device region 11 having contact structures 12. Substrate 10 may be made of a number of materials, such as semiconductor material or insulating material, depending on the desired application. Typically, substrate 10 is made of silicon or III-V materials. Contact structures 12 are typically metal pads or interconnect structures making contact to device or circuit structures (not shown) formed in substrate 10. Substrate 10 may also contain an integrated circuit to which the contact structures 12 are connected, and substrate 10 may be a module containing only contact structures. For example, substrate 10 may be a module for interconnecting structures bonded to substrate 10, or bringing out connections for packaging or integration with other modules or circuit structures on, for example, a printed circuit board. The module may be made of insulative materials such as quartz, ceramic, BeO, or AlN.
Positioned for bonding to substrate 10 on surface 13 are three separated die 14-16. Each die has a substrate portion 19, a device region 18 and contact structures 17. The die may be previously separated from another wafer by dicing, etc. Die 14-16 may be made of a number of materials, such as semiconductor materials, depending on the desired application. Typically, the substrate is made of silicon or III-V materials. Contact structures 17 are typically metal pads or interconnect structures making contact to device or circuit structures formed in device region 18. The sizes of contact structures 12 and 17 each may vary. The typical range of contact structure size is between 1 and 20 microns, but the sizes and relative sizes may be outside this range depending upon alignment tolerances, circuit design parameters or other factors. The sizes of the contact structures are drawn to illustrate the inventive concepts are and are not meant to be limiting. Device region 18 may also contain an integrated circuit to which the contact structures 17 are connected. Substantially all of substrate portion 19 may be removed, leaving a layer of devices, a circuit, or a circuit layer. Also, the substrates of dies 14-16 may be thinned after bonding to a desired thickness.
Die 14-16 may be of the same technology as wafer 10, or of different technology. Die 14-16 may each be the same or different devices or materials. Each of die 14-16 has conductive structures 17 formed in a device region 18. Structures 17 are spaced apart to leave a gap therebetween, or may be a single structure with an aperture which may extend across the entire contact structure. In other words, the aperture may be a hole in contact structure or may divide the contact structure in two. The size of the gap or aperture may be determined by the photolithographic design rules for the particular technology being bonded. For example, a minimum lateral width of contact structures 12 and 17 may be required to subsequently form a reliable, low resistance electrical connection with interconnect metal.
An additional factor that determines the optimum size of the gap or aperture is a ratio of a distance given by the vertical separation between contact structures 17 and 12 plus the thickness of the contact structure 17 to the size of the gap or aperture. This defines an aspect ratio of a via that will subsequently be formed between contact structures 17 and 12 to enable an electrical interconnection between contact structures 17 and 12. This vertical separation is typically 1-5 microns, or less, for oxide to oxide direct bonding, as described in application Ser. No. 09/505,283, the contents of which are incorporated herein by reference, or potentially zero for metal direct bonding, as described in application Ser. No. 10/359,608, the contents of which are herein incorporated by reference. Furthermore, the contact structure 17 thickness is typically 0.5 to 5 microns. With a typical desired via aspect ratio of 0.5 to 5 depending on the process technology used, a typical range of the size of the gap is 0.3-20 microns for oxide to oxide bonding or ˜0.1-10 microns for metal direct bonding. The metal direct bonding case is described below in the fourth embodiment.
Dies 14-16 are generally aligned with the contact structures 12 such that structures 17 and the gap or aperture are positioned over corresponding contact structures 12. The size of contact structures 12 is chosen to allow die 14-16 to be simply aligned with the gap between contact structures 17. This size depends on the alignment accuracy of the method used to place die 14-16 on substrate 10. Typical methods using commercially available production tools allow alignment accuracies in the range of 1-10 microns, although future improvements in these tools is likely to result in smaller alignment accuracies. The lateral extent of contact structures 17 exterior to the gap or aperture is preferably at least a distance given by this alignment accuracy.
Although only one set of contact structures 17 is shown for each die 14-16, it is understood that the lateral extent of contact structures 17 is typically much smaller than the lateral extent of each die 14-16, so that each die may have several or a very large number of contact structures 17. For example, contact structures 17 may have a lateral extent in the range of 1-100 microns and die 14-16 may have a lateral extent in the range of 1-100 mm. A quantity of contact structures 17 in die 14-16 having an order of magnitude 104 and much higher is thus practically realizable.
As shown in FIG. 2A, surface 20 of die 14 is bonded to surface 13 of substrate 10. This may be accomplished by a number of methods, but is preferably bonded at room temperature using a bonding method as described in application Ser. No. 09/505,283, where bonds of a strength in the range of 500-2000 mJ/m², i.e., chemical bonds are formed. The bonding of die 14-16 to substrate 10 is illustrated in FIG. 2. After bonding the substrates of die 14-16 are thinned. Thinning is typically achieved by polishing, grinding, etching, or a combination of these three techniques to leave thinned substrate 21 or to completely remove substrate portion 19. FIG. 2B illustrates the example where substrate portion 19 is completely or substantially completely removed. Also, the substrates of dies 14-16 may be thinned prior to bonding.
While three die are shown bonded to a single substrate 10 in FIG. 2A, it is also possible to bond a larger or smaller number of die to substrate 10. Also, it is possible to bond another substrate of a size comparable to that of substrate 10, which is illustrated in FIG. 2C where a substrate 22 having a device region 23 is bonded to wafer 10 such that spaced apart conductive structures 24 are generally aligned with conductive structures 12. Substrate 22 may be thinned or removed prior to bonding to facilitate alignment. Substrate 22 may be thinned after bonding, and substantially all of substrate 22 may be removed if desired. The procedures described in the following figures are also applicable to the structures shown in FIGS. 2B and 2C, but separate drawings are omitted for brevity.
As shown in FIG. 3A, a conformal dielectric film 30 is formed over surface 13 of substrate 10 and dies 14-16. This film may be formed by, for example, CVD, PVD or PECVD and preferably consists of an oxide film such as silicon oxide of typical thickness range 0.1 to 1.0 micron. Also, a filler material such as a deposited or spun-on oxide or polymer 32 such as polyimide or benzocyclobutene may be formed over and/or between dies 14-16, as shown in FIG. 3B. Material 32 may be formed at various points in the process. FIG. 3B shows the example where material 32 is formed prior to forming films 30 and 40. Filler, material may also be formed after forming the structure shown in FIG. 3A, after forming hard mask 40 (FIG. 4), or at various other points in the process depending on many factors such as the materials chosen or temperature considerations. Other techniques may be used for forming filler material. For example a dielectric filler, for example, silicon oxide, may be used by successive or iterative steps of dielectric formation, for example using methods described above, and chemical-mechanical polishing. Alternatively, a conductive filler, for example metal formed by, for example, electroplating, may be used by successive or iterative steps of metal formation and chemo-mechanical polishing. Having a flat surface may improve forming photoresist and other films on the surface and forming apertures in such films, for example, aperture 41 shown in FIG. 4.
Subsequently, a hard mask 40 is formed on dielectric film 30 and patterned to leave apertures 41 generally aligned with structures 17 (FIG. 4). The hard mask is preferably comprised of a material that has a high etch selectivity to a subsequent etch process or processes used to etch a via through thinned substrate 21 and device regions 18 and 11 to contact structures 12. Examples of a hard mask are aluminum, tungsten, platinum, nickel, and molybdenum, and an example of an etch process is an SF₆-based reactive ion etch to etch a via through a thinned silicon substrate and a CF₄-based reactive ion etch to etch a subsequent via through device regions 18 and 11 to contact structures 12. The thickness of the hard mask 40 is typically 0.1 to 1.0 microns. The width of aperture 40 is dependent on a number of factors including the thickness of thinned substrate 21 and the gap between contact structures 17, but is typically 1 to 10 microns.
Aperture 41 is formed using standard photolithographic patterning and etching techniques of the hard mask 40 and dielectric film 30. For example, an aperture can be formed in photoresist using photolithography. This aperture can be aligned to alignment marks on the die 14-16 (or substrate 22), or substrate 10. Optical or IR imaging can be used for the alignment. The hard mask 40 can then be etched with an appropriate wet chemical solution or a dry reactive ion etch process that depends on the hard mask material, revealing the dielectric film 30 in the aperture. The dielectric film 30 can then be etched in a manner similar to the hard mask 40 with an appropriate wet chemical solution or a dry reactive ion etch that depends on the dielectric film material. An example of a wet chemical solution for a hard mask is Aluminum Etchant Type A if the hard mask is Aluminum. An example of a reactive ion etch process for a dielectric film material is a CF₄-based reactive ion etch if the dielectric film material is silicon oxide. Many other wet and dry etches are possible for these and other hard mask and dielectric film materials. The width of the apertures 41 is preferably wider than the spacing between the structures 17 if the aperture is aligned to the die 14-16 (or substrate 22), or, preferably wider than the spacing between the structures 17 plus the alignment accuracy of the method used to place die 14-16 (or substrate 22), on substrate 20 if the aperture is aligned to the lower substrate 20.
Using the hard mask 40, substrate portions of dies 14-16 are etched to form vias 50, as shown in FIG. 5. The etching is continued through the material adjacent to contact structures 12 and 17, which typically is a dielectric material, to expose back and side portions of conductive structure 17 and a top surface of contact structures 12. A first set of gases and conditions, for example SF₆-based, may be used to etch through the substrate material of dies 14-16, and a second set of gases and conditions, for example CF₄-based, may be used to etch through the dielectric layers surrounding the contact structures 17. Both etches may be performed in one chamber by switching gases and conditions appropriately, without having to break vacuum. The etching to expose conductive structure 12 is shown in FIG. 6A. The etching produces a via portion 60 extending through the gap or aperture of contact structures 17 to contact structure 12.
The dielectric via etching to expose contact structures 12 and 17 preferably has a high etch selectivity to contact structures 17 so as to avoid a detrimental amount of etching to contact structures 17. However, there may be some combinations of dielectric via etching and conductive structures that result in a detrimental amount of etching to contact structures 17. For example, detrimental effects may occur when conductive structure 17 is sufficiently thin or when the vertical distance between contact structures 12 and 17 is sufficiently large.
An example of a detrimental amount of etching is some combinations of aluminum contact structures 17 surrounded by silicon oxide dielectric and some CF₄-based reactive ion etches where the ratio of the aluminum conductive structure etch rate to the silicon oxide dielectric etch rate is comparable to or higher than the ratio of the thickness of contact structure 17 to the thickness of silicon oxide dielectric between contact structures 12 and 17.
In those situations where there would be a detrimental amount of etching to contact structures 17, the thickness of contact structures 17 may be increased or an intermediate step is added to protect contact structures 17 from the dielectric via etch. An intermediate process step can be used to avoid detrimental etching as follows. When the dielectric etching first exposes back and side portions of upper contact structure 17, a hard mask, such as a metal material, can be selectively deposited on revealed portions of contact structure 17 before continuation of the dielectric etching results in detrimental etching to contact structure 17. After selective deposition of a hard mask, the dielectric etching can be continued without detrimental etching to contact structure 17. An example of a selective deposition of a hard mask is electroless nickel plating. This is shown, for example, in FIG. 6B where etching is stopped after exposing contact structures 17 and before any significant detrimental etching occurs. Contact structures 17 are then coated with a protective hard mask material 61, for example, nickel using, for example, electroless plating. A material such as nickel may remain in the device in subsequent connecting of the contact structures 12 and 17.
Alternatively, the material 61 may be removed before forming connecting structures 12 and 17, if needed.
Note that protective hard mask 61 may also be selectively deposited on hard mask 40. An example is when hard mask 40 is conductive and deposition of protective hard mask 61 is accomplished with electroless plating. This may be advantageous for decreasing the required thickness of hard mask 40. A further advantage of deposition of protective hard mask material 61 on hard mask 40 may be a restriction of the aperture of via 50 resulting in shadowing of a portion of contact structures 17 from anisotropic etching of via 60. FIG. 7A illustrates one of the die 14-16 in detail to more clearly illustrate the subsequent steps. A conformal insulative film 70 is formed over mask 40 and contact structures 12 and 17, and the sidewall of vias 50 and 60, partially filling vias 50 and 60. Examples of a suitable insulative film are silicon oxide, silicon nitride or Parylene. The insulative film may be formed using a number of typical deposition methods including but not limited to physical vapor deposition, chemical vapor deposition, and vapor phase deposition. An example of physical vapor deposition is sputtering, an example of chemical vapor deposition is plasma enhanced chemical vapor deposition, and an example of vapor phase deposition is vaporization of a solid, followed by pyrolysis and then deposition.
Hard mask 40 or hard mask 40 and conformal dielectric film 30 may be removed before formation of conformal insulative film 70 by, for example, etching. FIG. 7B illustrates the case where hard mask 40 is removed. If the etch to remove hard mask 40 or hard mask 40 and film 30 is selective to materials exposed by vias 50 and 60, this etch can be done without a mask. If this etch is not selective to materials exposed by vias 50 and 60, those materials subject to etch in vias 50 and 60 may be masked with a suitable material. For example, if the hard mask 40, and contact structures 12 and 17 are all aluminum, the vias can be partially filled with an easily removable spin-on viscous liquid material to a depth such that contact structures 12 and 17 are covered. The vias can be partially filled with a spin-on viscous liquid material by first selecting an adequate spin-on film thickness that will suitably planarize the surface formed by hard mask 40 through which vias 50 and 60 were formed. Application of this film thickness will then result in a much thicker film thickness inside the via than outside the via. A suitable etch of the entire surface then removes this material from the surface of hard mask 40 while leaving material in vias 50 and 60 that covers contact structures 12 and 17. An example of an easily removable spin-on material and suitable etch are photoresist and an O₂ plasma etch, respectively.
Conformal film 70 is anisotropically etched to expose contact structures 12 and 17 while leaving film 70 on the sidewalls of vias 50 and 60. A back surface of structures 17 is preferably exposed to create a ledge 27 for increasing the contact surface area, resulting in reduced contact resistance. A typical ledge 27 width in excess of 1 micron is preferred for minimizing the contact resistance, but this distance will vary based upon device and process parameters. FIGS. 8A and 8B depict the etched conformal film 70, without and with mask 40 removed before formation of conformal insulative film 70, respectively. Both of films 30 and 40 may be removed prior to forming layer 70. In this case, following etching of conformal layer 70 another insulating layer may be formed on substrate portion 21 (or device region 18 where portion 21 is completely removed) by oxidation or deposition, for example.
Alternative to conformal film 70, conformal films may also be formed before exposure of top surface of contact structure 12. For example, conformal film 71 may be formed after etching through the substrate portions of die 14-16 but before etching into the material adjacent to contact structure 17, conformal film 72 may be formed after etching into the material adjacent to contact structure 17 but before reaching contact structure 17, conformal film 73 may be formed after reaching contact structure 17 but before forming via 60, or conformal film 74 may be formed after reaching conductive structure 17 and forming part of via 60 but before completing via 60 and reaching contact structure 12 as shown in FIGS. 8C, 8D, 8E, and 8F, respectively. Conformal films 71, 72, 73, and 74 may subsequently be anisotropically etched to form isolating sidewalls on the via portion 50 of the substrate portions of die 14-16. For example, conformal film 71 may be subsequently anisotropically etched to form an isolating sidewall on the via portion 50 of the substrate portions of die 14-16, conformal film 72 may be subsequently anisotropically etched to form an isolating sidewall on the via portion 50 of the substrate portion of die 14-16 and the upper portion of via 50 comprised of material adjacent to contact structure 17, conformal film 73 may be subsequently anisotropically etched to form an isolating sidewall on the entire depth of via 50, and conformal film 74 may be subsequently anisotropically etched to form an isolating sidewall on the entire depth of via 50 and the upper portion of via 60, as shown in FIGS. 8G, 8H, 8I, and 8J, respectively.
Alternative to the sidewall formed by the conformal deposition of films 70, 71, 72, 73, or 74 and subsequent anisotropic etching of said films, a sidewall 75 can be formed selectively on the substrate portion of die 14-16 in via 50, after said portion is formed by said via as shown in FIG. 8K. Sidewall 75 can be formed by a process that reacts preferentially to the substrate portion versus material adjacent to contact structure 17. For example, if the substrate portion of die 14-16 is silicon and the material adjacent to contact structure 17 is silicon oxide, a dielectric deposition process that nucleates preferentially on silicon versus silicon oxide may be used, where the dielectric deposition comprises sidewall 75, where sidewall 75 is structurally similar to conformal film 71 in via 50 after anisotropic etching of conformal film 71 shown in FIG. 8K. Here, sidewall 75 is formed after etching through the substrate portions of die 14-16 but before etching into the material adjacent to contact structure 17.
A side surface of contact structures 17 may also be exposed in the anisotropic etching to further increase the surface area and lower the contact resistance. This is also shown in FIGS. 8A and 8B. The vias 50 and 60 can then be further filled or completely filled with metal. Methods of filling vias 50 and 60 with metal include but are not limited to physical vapor deposition (PVD), chemical vapor deposition (CVD) or electroplating. Electroplating is typically used for the deposition of thicker films than PVD or CVD and is typically preceded by the deposition of a thin PVD or CVD seed layer. Examples of films formed by PVD are sputtered aluminum, palladium, titanium, tungsten, titanium-tungsten, or copper, examples of films formed by CVD are tungsten or copper, and examples of films formed by electroplating (which including electroless plating) are nickel, gold, palladium or copper.
FIG. 9A shows an example of a masked electroplated method whereby a metal seed layer 90 is first deposited over the structure, making electrical contact to contact structures 12 and 17, followed by formation of a mask 91 using, for example, photoresist. Seed layer 90 can be deposited by PVD, CVD, or electroplating as described above. Using mask 91 and electrical contact to seed layer 90, metal contact 92 fills vias 50 and 60. In FIG. 9B, a structure is shown where mask 40 is removed before formation of conformal insulative film 70, and FIG. 9C shows the structure where no seed layer is used. A polishing step, for example chemo-mechanical polishing, can then be used to remove the excess portion of metal contact 92 outside of vias 50 and 60. This polishing step can also remove the metal seed layer 90 on the exposed side of die 14-16. It further can remove the hard mask 40 on the exposed side of die 14-16. The removal of hard mask 40 may be preferred if hard mask is electrically conductive as in the case of aluminum given above, in order to electrically isolate so formed metal filled vias from each other. This polishing step may further remove conformal dielectric film 30, resulting in a substantially planar surface and planar metal structure 100 on the exposed side of die 14-16, as shown in FIGS. 10A and 10B, where the structure in FIG. 10B is distinct from that in FIG. 10A in that no seed layer is used prior to filling the via with metal.
Alternatively to filling vias 50 and 60 with metal followed by CMP, vias 50 and 60 can be lined with metal 93, filled with dielectric 94 then followed by CMP as shown in FIG. 10C. Vias 50 and 60 can be lined with metal 93 by deposition using at least one of PVD, electroplating or CVD, as described above. Thickness of metal 93 is typically 0.01 to 0.2 microns and may include a barrier layer adjacent to conformal insulative film 70 to prevent contamination of contact structures 12 or 17 or device regions 18 or 11. Examples of barrier layers include tantalum nitride, tungsten nitride, and titanium nitride and may be preceded by a titanium adhesion layer of typical thickness 0.005 to 0.02 microns. A typical thickness of barrier layers is 0.005 to 0.05 microns. After an initial thickness of 93 has been deposited, electroplating can also be used to conformally increase the thickness of 93 to a desired thickness. A typical increased thickness is 0.5 to 2.0 microns for via 50, subject to via 50 of sufficient width. An example of dielectric 94 is silicon oxide and an example of filling is with plasma enhanced chemical vapor deposition (PECVD). This alternative has the advantages of reduced metal deposition and metal CMP and the potential for a better coefficient of thermal expansion (CTE) match between the composite metal lined, dielectric filled via and the surrounding substrate portion of die 14-16.
Another alternative to filling vias 50 and 60 with metal or lining vias 50 and 60 with metal 93 followed by filling with dielectric 94 is to fill or line via 60 with metal 97 to form an electrical interconnection between contact structures 12 and 17 without contacting thinned substrate 21, and then fill vias 50 and 60 with dielectric 98, followed by CMP as described above and shown in FIG. 10D. Metal 97 can be formed to interconnect contact structures 12 and 17 without contacting thinned substrate 21 by electroless plating that plates preferentially on contact structures 12 and 17 by plating to sufficient thickness that preferential plating interconnects contact structures 12 and 17. An example of electroless plating that can be plated to sufficient thickness is nickel electroless plating. This alternative has the advantage of not requiring a sidewall 60, 71, 72, 73, 74, or 75 on the via 50 portion of remaining substrate die 14-16 to electrically isolate said electrical interconnection from said remaining substrate die as shown in FIG. 10D.
Electrical interconnection to interconnected contact structures 12 and 17 can be formed by etching a via 51 through dielectric 98 to metal 97 and filling via 51 with metal 46 as shown in 10E and similar to the description in FIG. 10B or by lining via 51 with conductive material 52 and filling with dielectric 53 as shown in FIG. 10F and similar to the description in FIG. 10C. Via 51 in FIG. 10E and FIG. 10F is shown connecting to the portion of metal 97 on contact structure 12. Alternatively, via 51 can connect the portion of metal 97 on contact 17 or both contact structures 12 and 17.
The structures of FIGS. 10A-10F are suitable for subsequent processing including but not limited to photolithography-based interconnect routing or underbump metallization to support wirebonding or flip-chip packaging. This processing typically includes the formation of an electrically insulating material on the exposed thinned substrate side 21 to provide electrical isolation for the interconnect routing or underbump metallization.
An example is shown in FIG. 11 with insulating material 96, such as a deposited or spun-on oxide or polymer, formed on the die 14-16 after CMP, and interconnect routing or underbump metallization 95 formed on material 96 in contact with metal structure 100. Another filler material may be used between die 14-16, as shown in FIG. 3B, prior to forming material 96. Metallization may include several levels, separated by insulating layers, not shown here, to accommodate a high via density and/or a high degree of routing complexity. Alternatively, if the polishing step does not remove conformal dielectric film 70, conformal dielectric film remains and may provide adequate electrical isolation for the metallization structures.
A second embodiment of the method according to the invention is illustrated in FIG. 12. A hard mask 101 is formed on die 14-16 without any intervening dielectric layer. A typical range of hard mask 101 thickness is 0.1 to 1.0 microns. The hard mask 101 is preferably comprised of a material that has a high etch selectivity to a subsequent etch process or processes used to etch a via through thinned substrate 21 and device regions 18 and 11 to contact structures 12. An example of a hard mask is aluminum, tungsten, platinum, nickel, or molybdenum and an example of an etch process is an SF₆-based reactive ion etch to etch a via through a thinned silicon substrate and a CF₄-based reactive ion etch to etch a subsequent via through device regions 18 and 11 to contact structures 12. Apertures 102 are formed in mask 101 and the structure is processed as in the first embodiment to etch through the die substrates and device regions to expose structures 12 and 17, while preferably exposing the top surface of structures 17 to form a ledge (such as 27 shown in FIGS. 8A and 8B). Metallization is carried out as shown in FIGS. 7-9 using mask 103 to form metal contact 104, to produce the structure shown in FIG. 13. After CMP (FIG. 14), metal 105 is planarized, and the structure is suitable for subsequent processing including but not limited to photolithography-based interconnect routing or underbump metallization to support wirebonding or flip-chip packaging, similar to the metallization structure shown in FIG. 11. This processing may include the formation of an electrically insulating material on the exposed side of die 14-16 to provide electrical isolation for said interconnect routing or underbump metallization that is routed over the exposed side of die 14-16. To further assist interconnect routing or underbump metallization, a planarizing material as described in the first embodiment, for example a dielectric or a metal, or alternatively, a polyimide or benzocyclobutene material may be formed to planarize the surface of the structure, for example by filling any spaces between die, apertures or grooves, either before or after the CMP process.
| 35,898 |
https://www.wikidata.org/wiki/Q21399786
|
Wikidata
|
Semantic data
|
CC0
| null |
Knautia montana
|
None
|
Multilingual
|
Semantic data
| 2,179 | 5,748 |
Knautia montana
species of plant
Knautia montana instance of taxon
Knautia montana taxon name Knautia montana, taxon author Augustin-Pyramus de Candolle, year of publication of scientific name for taxon 1830
Knautia montana taxon rank species
Knautia montana NCBI taxonomy ID 1443365
Knautia montana parent taxon Knautia
Knautia montana GBIF taxon ID 7300991
Knautia montana EPPO Code KNAMO
Knautia montana EUNIS ID for species 169216
Knautia montana Observation.org taxon ID 134755
Knautia montana IPNI plant ID 319425-1
Knautia montana Tropicos ID 11200270
Knautia montana Plants of the World Online ID urn:lsid:ipni.org:names:319425-1
Knautia montana Open Tree of Life ID 5512969
Knautia montana iNaturalist taxon ID 853062
Knautia montana World Flora Online ID wfo-0000356707
Knautia montana Catalogue of Life ID 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana short name
Knautia montana
Art der Gattung Witwenblumen (Knautia)
Knautia montana ist ein(e) Taxon
Knautia montana wissenschaftlicher Name Knautia montana, Autor(en) des Taxons Augustin-Pyramus de Candolle, veröffentlicht im Jahr 1830
Knautia montana taxonomischer Rang Art
Knautia montana NCBI-ID 1443365
Knautia montana übergeordnetes Taxon Witwenblumen
Knautia montana GBIF-ID 7300991
Knautia montana EPPO-Code KNAMO
Knautia montana EUNIS-Taxon-ID 169216
Knautia montana Observation.org-Taxon-ID 134755
Knautia montana IPNI-TaxonName-ID 319425-1
Knautia montana Tropicos-ID 11200270
Knautia montana POWO-URN urn:lsid:ipni.org:names:319425-1
Knautia montana OTT-ID 5512969
Knautia montana iNaturalist-Taxon-ID 853062
Knautia montana World-Flora-Online-ID wfo-0000356707
Knautia montana CoL-ID 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana Kurzname
Knautia montana
Knautia montana istanza di taxon
Knautia montana nome scientifico Knautia montana, autore tassonomico Augustin Pyrame de Candolle, data di descrizione scientifica 1830
Knautia montana livello tassonomico specie
Knautia montana identificativo NCBI 1443365
Knautia montana taxon di livello superiore Knautia
Knautia montana identificativo GBIF 7300991
Knautia montana identificativo Observation.org 134755
Knautia montana identificativo tassonomico IPNI 319425-1
Knautia montana identificativo Tropicos 11200270
Knautia montana identificativo iNaturalist taxon 853062
Knautia montana identificativo Catalogue of Life 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana nome in breve
Knautia montana
especie de planta
Knautia montana instancia de taxón
Knautia montana nombre del taxón Knautia montana, autor del taxón Augustin Pyrame de Candolle, fecha de descripción científica 1830
Knautia montana categoría taxonómica especie
Knautia montana identificador NCBI 1443365
Knautia montana taxón superior inmediato Knautia
Knautia montana identificador de taxón en GBIF 7300991
Knautia montana código EPPO KNAMO
Knautia montana identificador EUNIS para especies 169216
Knautia montana Observation.org ID 134755
Knautia montana identificador IPNI 319425-1
Knautia montana identificador Tropicos 11200270
Knautia montana Plants of the World online ID urn:lsid:ipni.org:names:319425-1
Knautia montana identificador Open Tree of Life 5512969
Knautia montana código de taxón en iNaturalist 853062
Knautia montana World Flora Online ID wfo-0000356707
Knautia montana identificador Catalogue of Life 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana nombre corto
Knautia montana
Knautia montana nature de l’élément taxon
Knautia montana nom scientifique du taxon Knautia montana, auteur taxonomique Augustin-Pyramus de Candolle, date de description scientifique 1830
Knautia montana rang taxonomique espèce
Knautia montana Identifiant NCBI 1443365
Knautia montana taxon supérieur Knautia
Knautia montana identifiant Global Biodiversity Information Facility 7300991
Knautia montana identifiant EPPO Global Database KNAMO
Knautia montana identifiant European Nature Information System des espèces 169216
Knautia montana identifiant Observation.org d'un taxon 134755
Knautia montana identifiant International Plant Names Index d'une plante 319425-1
Knautia montana identifiant Tropicos d'un taxon 11200270
Knautia montana identifiant Plants of the World Online urn:lsid:ipni.org:names:319425-1
Knautia montana identifiant Open Tree of Life 5512969
Knautia montana identifiant iNaturalist d'un taxon 853062
Knautia montana identifiant World Flora Online wfo-0000356707
Knautia montana identifiant Catalogue of Life 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana nom court
Knautia montana
вид растение
Knautia montana екземпляр на таксон
Knautia montana име на таксон Knautia montana, автор на таксон Огюстен Пирам дьо Кандол, дата на публикуване на таксон 1830
Knautia montana ранг на таксон вид
Knautia montana родителски таксон Червеноглавче
Knautia montana IPNI plant ID 319425-1
Knautia montana кратко име
Knautia montana
вид растений
Knautia montana это частный случай понятия таксон
Knautia montana международное научное название Knautia montana, автор названия таксона Огюстен Пирам Декандоль, дата публикации названия 1830
Knautia montana таксономический ранг вид
Knautia montana идентификатор NCBI 1443365
Knautia montana ближайший таксон уровнем выше Короставник
Knautia montana идентификатор GBIF 7300991
Knautia montana код EPPO KNAMO
Knautia montana код вида EUNIS 169216
Knautia montana код Observation.org 134755
Knautia montana код названия таксона в IPNI 319425-1
Knautia montana код имени таксона в Tropicos 11200270
Knautia montana код Plants of the World Online urn:lsid:ipni.org:names:319425-1
Knautia montana код Open Tree of Life 5512969
Knautia montana код таксона iNaturalist 853062
Knautia montana код World Flora Online wfo-0000356707
Knautia montana код Catalogue of Life 3R9XW
Knautia montana код UMLS CUI C3790661
Knautia montana краткое имя или название
Knautia montana
taxon
Knautia montana is een taxon
Knautia montana wetenschappelijke naam Knautia montana, taxonauteur Augustin Pyramus de Candolle, datum van taxonomische publicatie 1830
Knautia montana taxonomische rang soort
Knautia montana NCBI-identificatiecode 1443365
Knautia montana moedertaxon Knautia
Knautia montana GBIF-identificatiecode 7300991
Knautia montana EPPO-identificatiecode KNAMO
Knautia montana EUNIS-identificatiecode voor soort 169216
Knautia montana Observation.org-identificatiecode voor taxon 134755
Knautia montana IPNI-identificatiecode voor taxon 319425-1
Knautia montana Tropicos-identificatiecode voor taxon 11200270
Knautia montana Plants of the World Online-identificatiecode urn:lsid:ipni.org:names:319425-1
Knautia montana Open Tree of Life-identificatiecode 5512969
Knautia montana iNaturalist-identificatiecode voor taxon 853062
Knautia montana World Flora Online-identificatiecode wfo-0000356707
Knautia montana Catalogue of Life-identificatiecode 3R9XW
Knautia montana UMLS CUI-identificatiecode C3790661
Knautia montana verkorte naam
Knautia montana
Knautia montana est taxon
Knautia montana taxon nomen Knautia montana, auctor descriptionis Augustinus Pyramus de Candolle, annus descriptionis 1830
Knautia montana ordo species
Knautia montana parens Knautia
Knautia montana nomen breve
Knautia montana
вид рослин
Knautia montana є одним із таксон
Knautia montana наукова назва таксона Knautia montana, автор таксона Огюстен Пірам Декандоль, дата наукового опису 1830
Knautia montana таксономічний ранг вид
Knautia montana ідентифікатор NCBI 1443365
Knautia montana батьківський таксон Knautia
Knautia montana ідентифікатор у GBIF 7300991
Knautia montana код EPPO KNAMO
Knautia montana ідентифікатор EUNIS 169216
Knautia montana ідентифікатор Observation.org 134755
Knautia montana ідентифікатор рослини IPNI 319425-1
Knautia montana ідентифікатор Tropicos 11200270
Knautia montana ідентифікатор Plants of the World Online urn:lsid:ipni.org:names:319425-1
Knautia montana ідентифікатор Open Tree of Life 5512969
Knautia montana ідентифікатор таксона iNaturalist 853062
Knautia montana ідентифікатор World Flora Online wfo-0000356707
Knautia montana ідентифікатор Catalogue of Life 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana коротка назва
Knautia montana
especie de planta
Knautia montana instancia de taxón
Knautia montana nome del taxón Knautia montana, autor del taxón Augustin Pyrame de Candolle, data de publicación del nome de taxón 1830
Knautia montana categoría taxonómica especie
Knautia montana identificador taxonómicu NCBI 1443365
Knautia montana taxón inmediatamente superior Knautia
Knautia montana nome curtiu
Knautia montana
speiceas plandaí
Knautia montana sampla de tacsón
Knautia montana ainm an tacsóin Knautia montana, údar an tacsóin Augustin Pyrame de Candolle, bliain inar foilsíodh ainm eolaíoch an tacsóin 1830
Knautia montana rang an tacsóin speiceas
Knautia montana máthairthacsón Knautia
Knautia montana ainm gearr
Knautia montana
specie de plante
Knautia montana este un/o taxon
Knautia montana nume științific Knautia montana, autorul taxonului Augustin Pyramus de Candolle, anul publicării taxonului 1830
Knautia montana rang taxonomic specie
Knautia montana taxon superior Knautia
Knautia montana identificator Global Biodiversity Information Facility 7300991
Knautia montana nume scurt
Knautia montana
Knautia montana instância de táxon
Knautia montana nome do táxon Knautia montana, autor do táxon Augustin Pyrame de Candolle, data de descrição científica 1830
Knautia montana categoria taxonómica espécie
Knautia montana identificador taxonomia NCBI 1443365
Knautia montana táxon imediatamente superior Knautia
Knautia montana identificador Global Biodiversity Information Facility 7300991
Knautia montana identificador de nome de táxon IPNI 319425-1
Knautia montana identificador de nome de táxon Tropicos 11200270
Knautia montana nome curto
Knautia montana
Knautia montana jest to takson
Knautia montana naukowa nazwa taksonu Knautia montana, autor nazwy naukowej taksonu Augustin Pyramus de Candolle, data opisania naukowego 1830
Knautia montana kategoria systematyczna gatunek
Knautia montana identyfikator NCBI 1443365
Knautia montana takson nadrzędny Świerzbnica
Knautia montana identyfikator GBIF 7300991
Knautia montana kod EPPO KNAMO
Knautia montana identyfikator Observation.org 134755
Knautia montana identyfikator nazwy taksonu IPNI 319425-1
Knautia montana identyfikator Tropicos 11200270
Knautia montana identyfikator Plants of the World urn:lsid:ipni.org:names:319425-1
Knautia montana identyfikator Open Tree of Life 5512969
Knautia montana identyfikator iNaturalist 853062
Knautia montana identyfikator World Flora Online wfo-0000356707
Knautia montana identyfikator pojęcia w UMLS C3790661
Knautia montana nazwa skrócona
Knautia montana
loài thực vật
Knautia montana là một đơn vị phân loại
Knautia montana tên phân loại Knautia montana, tác giả đơn vị phân loại Augustin Pyramus de Candolle, ngày được miêu tả trong tài liệu khoa học 1830
Knautia montana cấp bậc phân loại loài
Knautia montana mã số phân loại NCBI 1443365
Knautia montana đơn vị phân loại mẹ Knautia
Knautia montana định danh GBIF 7300991
Knautia montana Mã EPPO KNAMO
Knautia montana ID thực vật IPNI 319425-1
Knautia montana ID Tropicos 11200270
Knautia montana ID Plants of the World trực tuyến urn:lsid:ipni.org:names:319425-1
Knautia montana ID ĐVPL iNaturalist 853062
Knautia montana tên ngắn
Knautia montana
lloj i bimëve
Knautia montana instancë e takson
Knautia montana emri shkencor Knautia montana
Knautia montana emër i shkurtër
Knautia montana
Knautia montana
Knautia montana
Knautia montana esiintymä kohteesta taksoni
Knautia montana tieteellinen nimi Knautia montana, taksonin auktori Augustin Pyramus de Candolle, tieteellisen kuvauksen päivämäärä 1830
Knautia montana taksonitaso laji
Knautia montana NCBI-tunniste 1443365
Knautia montana osa taksonia Ruusuruohot
Knautia montana Global Biodiversity Information Facility -tunniste 7300991
Knautia montana EPPO-tunniste KNAMO
Knautia montana lajin EUNIS-tunniste 169216
Knautia montana Observation.org-tunniste 134755
Knautia montana kasvin IPNI-tunniste 319425-1
Knautia montana Tropicos-tunniste 11200270
Knautia montana Plants of the World Online -tunniste urn:lsid:ipni.org:names:319425-1
Knautia montana Open Tree of Life -tunniste 5512969
Knautia montana iNaturalist-tunniste 853062
Knautia montana World Flora Online -tunniste wfo-0000356707
Knautia montana Catalogue of Life -tunniste 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana lyhyt nimi
Knautia montana
especie de planta
Knautia montana instancia de taxon
Knautia montana nome do taxon Knautia montana, autor do taxon Agustin Pyramus de Candolle, data de descrición científica 1830
Knautia montana categoría taxonómica especie
Knautia montana identificador NCBI 1443365
Knautia montana taxon superior inmediato Knautia
Knautia montana identificador GBIF 7300991
Knautia montana código EPPO KNAMO
Knautia montana identificador EUNIS 169216
Knautia montana identificador Observation.org 134755
Knautia montana identificador de taxons IPNI 319425-1
Knautia montana identificador Tropicos 11200270
Knautia montana identificador Plants of the World en liña urn:lsid:ipni.org:names:319425-1
Knautia montana identificador Open Tree of Life 5512969
Knautia montana identificador iNaturalist dun taxon 853062
Knautia montana identificador World Flora Online wfo-0000356707
Knautia montana identificador Catalogue of Life 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana nome curto
Knautia montana
Knautia montana instantia de taxon
Knautia montana nomine del taxon Knautia montana, data de description scientific 1830
Knautia montana rango taxonomic specie
Knautia montana ID NCBI 1443365
Knautia montana taxon superior immediate Knautia
Knautia montana
Knautia montana
Knautia montana instancia de Taxón
Knautia montana
Knautia montana
Knautia montana honako hau da taxon
Knautia montana izen zientifikoa Knautia montana, taxoiaren autoritatea Augustin Pyramus de Candolle, deskribapen zientifikoaren data 1830
Knautia montana maila taxonomikoa espezie
Knautia montana NCBI-ren identifikatzailea 1443365
Knautia montana goiko maila taxonomikoa Knautia
Knautia montana GBIFen identifikatzailea 7300991
Knautia montana EPPO kodea KNAMO
Knautia montana Observation.org taxonaren identifikatzailea 134755
Knautia montana IPNI-ren identifikatzailea 319425-1
Knautia montana Tropicos-en identifikatzailea 11200270
Knautia montana Open Tree of Life identifikatzailea 5512969
Knautia montana iNaturalist identifikatzailea 853062
Knautia montana Catalogue of Life identifikatzailea 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana izen laburra
Knautia montana
Knautia montana nem brefik
Knautia montana
Knautia montana estas taksono
Knautia montana taksonomia nomo Knautia montana, aŭtoro de taksono Augustin-Pyrame de Candolle
Knautia montana taksonomia rango specio
Knautia montana taksonomia identigilo NCBI 1443365
Knautia montana supera taksono Knaŭtio
Knautia montana IPNI-takononoma identigilo 319425-1
Knautia montana numero en Tropicos 11200270
Knautia montana numero en iNaturalist 853062
Knautia montana UMLS CUI C3790661
Knautia montana mallonga nomo
Knautia montana
Knautia montana natura de l'element taxon
Knautia montana nom scientific Knautia montana, data de descripcion scientifica 1830
Knautia montana reng taxonomic espècia
Knautia montana identificant NCBI 1443365
Knautia montana taxon superior Knautia
Knautia montana identificant GBIF 7300991
Knautia montana còdi OEPP KNAMO
Knautia montana identificant IPNI 319425-1
Knautia montana identificant Tropicos 11200270
Knautia montana identificant de taxon iNaturalist 853062
Knautia montana UMLS CUI C3790661
Knautia montana nom cort
Knautia montana
Knautia montana instância de táxon
Knautia montana nome taxológico Knautia montana, autor do táxon Augustin Pyrame de Candolle, data de descrição científica 1830
Knautia montana categoria taxonômica espécie
Knautia montana identificador NCBI 1443365
Knautia montana táxon imediatamente superior Knautia
Knautia montana identificador GBIF 7300991
Knautia montana identificador de táxons IPNI 319425-1
Knautia montana identificador Tropicos 11200270
Knautia montana nome curto
Knautia montana
speco di planto
Knautia montana kurta nomo
Knautia montana
espècie de planta
Knautia montana instància de tàxon
Knautia montana nom científic Knautia montana, autor taxonòmic Agustin Pyramus de Candolle, data de descripció científica 1830
Knautia montana categoria taxonòmica espècie
Knautia montana identificador NCBI 1443365
Knautia montana tàxon superior immediat Knautia
Knautia montana identificador GBIF 7300991
Knautia montana codi OEPP KNAMO
Knautia montana identificador EUNIS 169216
Knautia montana identificador Observation.org 134755
Knautia montana identificador de tàxons IPNI 319425-1
Knautia montana identificador de tàxons Tropicos 11200270
Knautia montana identificador Plants of the World online urn:lsid:ipni.org:names:319425-1
Knautia montana identificador Open Tree of Life 5512969
Knautia montana identificador iNaturalist de tàxon 853062
Knautia montana identificador World Flora Online wfo-0000356707
Knautia montana identificador Catalogue of Life 3R9XW
Knautia montana UMLS CUI C3790661
Knautia montana nom curt
| 29,212 |
https://github.com/navikt/aktivitetsplan/blob/master/src/felles-komponenter/timeoutbox/Timeoutbox.tsx
|
Github Open Source
|
Open Source
|
MIT
| 2,023 |
aktivitetsplan
|
navikt
|
TSX
|
Code
| 148 | 484 |
import { Modal } from '@navikt/ds-react';
import { differenceInMilliseconds, parseISO, subMinutes } from 'date-fns';
import React, { useEffect, useState } from 'react';
import { useSelector } from 'react-redux';
import useAppDispatch from '../hooks/useAppDispatch';
import { selectExpirationTime } from './auth-selector';
import { hentAuthInfo } from './auth-slice';
import TimeoutboxNedtelling from './TimeoutboxNedtelling';
const Timeoutbox = () => {
const dispatch = useAppDispatch();
const [manueltLukket, setManueltLukket] = useState(false);
const [open, setOpen] = useState(false);
useEffect(() => {
dispatch(hentAuthInfo());
}, []);
const expirationTimestamp = useSelector(selectExpirationTime);
const expirationTimestampMinusFiveMinutes = subMinutes(parseISO(expirationTimestamp), 5);
useEffect(() => {
let timer: ReturnType<typeof setTimeout> | undefined;
if (expirationTimestamp) {
const expirationInMillis = differenceInMilliseconds(expirationTimestampMinusFiveMinutes, new Date());
timer = setTimeout(() => {
setOpen(true);
}, expirationInMillis + 100);
}
return () => clearTimeout(timer);
}, [expirationTimestamp]);
if (!expirationTimestamp) {
return null;
}
return (
<Modal
open={open && !manueltLukket}
className="max-w-2xl"
shouldCloseOnOverlayClick={false}
overlayClassName="aktivitet-modal__overlay"
onClose={() => {
setManueltLukket(true);
}}
>
<TimeoutboxNedtelling expirationTimestamp={expirationTimestamp} />
</Modal>
);
};
export default Timeoutbox;
| 3,975 |
https://github.com/ks555/idlak/blob/master/src/html/lattice-determinize_8cc.js
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
idlak
|
ks555
|
JavaScript
|
Code
| 15 | 103 |
var lattice_determinize_8cc =
[
[ "DeterminizeLatticeWrapper", "lattice-determinize_8cc.html#a993a97bb4202bdc8d4061bb52a2eb38c", null ],
[ "main", "lattice-determinize_8cc.html#a0ddf1224851353fc92bfbff6f499fa97", null ]
];
| 46,119 |
18879-8-20
|
Gutenberg
|
Open Culture
|
Public Domain
| null |
The Age of the Reformation
|
Smith, Preserved
|
English
|
Spoken
| 9,972 | 14,640 |
John Knox maintained that, "If
men, in the fear of God, oppose themselves to the fury and blind rage
of princes, in doing so they do not resist God, but the devil, who
abuses the sword and authority of God," and again, he asked, "What harm
should the commonwealth receive if the corrupt affections of ignorant
rulers were moderated and bridled by the {603} wisdom and discretion of
godly subjects?" But the duty, he thought, to curb princes in free
kingdoms and realms, does not belong to every private man, but
"appertains to the nobility, sworn and born counsellors of the same."
Carrying such doctrines to the logical result, Knox hinted to Mary that
Daniel might have resisted Nebuchadnezzar and Paul might have resisted
Nero with the sword, had God given them the power. Another Scotch Protestant, John Craig, in support of the prosecution of
Mary, said that it had been determined and concluded at the University
of Bologna [Sidenote: 1554] that "all rulers, be they supreme or
inferior, may be and ought to be reformed or deposed by them by whom
they were chosen, confirmed and admitted to their office, as often as
they break that promise made by oath to their subjects." Knox and
Craig both argued for the execution of Mary on the ground that "it was
a public speech among all peoples and among all estates, that the queen
had no more liberty to commit murder nor adultery than any other
private person." Knollys also told Mary that a monarch ought to be
deposed for madness or murder. To the zeal for religion animating Knox, George Buchanan [Sidenote:
Buchanan] joined a more rational spirit of liberty and a stronger
consciousness of positive right. His great work _On the Constitution
of Scotland_ derived all power from the people, asserted the
responsibility of kings to their subjects and pleaded for the popular
election of the chief magistrate. In extreme cases execution of the
monarch was defended, though by what precise machinery he was to be
arraigned was left uncertain; probably constitutional resistance was
thought of, as far as practicable, and tyrannicide was considered as a
last resort. "If you ask anyone," says our author, "what he thinks of
the punishment of {604} Caligula, Nero or Domitian, I think no one will
be so devoted to the royal name as not to confess that they rightly
paid the penalty of their crimes."
[Sidenote: English monarchists]
In England the two tendencies, the one to favor the divine right of
kings, the other for constitutional restraint, existed side by side. The latter opinion was attributed by courtly divines to the influence
of Calvin. Matthew Hutton blamed the Reformer because "he thought not
so well of a kingdom as of a popular state." "God save us," wrote
Archbishop Parker, "from such a visitation as Knox has attempted in
Scotland, the people to be orderers of things." This distinguished
prelate preached that disobedience to the queen was a greater crime
than sacrilege or adultery, for obedience is the root of all virtues
and the cause of all felicity, and "rebellion is not a single fault,
like theft or murder, but the cesspool and swamp of all possible sins
against God and man." Bonner was charged by the government of Mary to
preach that all rebels incurred damnation. Much later Richard Hooker
warned his countrymen that Puritanism endangered the prerogatives of
crown and nobility. [Sidenote: and republicans]
But there were not wanting champions of the people. Reginald Pole
asserted the responsibility of the sovereign, though in moderate
language. Bishop John Ponet wrote _A Treatise on Politic Power_ to
show that men had the right to depose a bad king and to assassinate a
tyrant. The haughty Elizabeth herself often had to listen to drastic
advice. When she visited Cambridge she was entertained by a debate on
tyrannicide, in which one bold clerk asserted that God might incite a
regicide; and by a discussion of the respective advantages of elective
and hereditary monarchy, one speaker offering to maintain the former
with his life and, if need be, with his death. When Elizabeth, after
hearing a refractory Parliament, complained to the {605} Spanish
ambassador that "she could not tell what those devils were after" his
excellency replied, "They want liberty, madam, and if princes do not
look to themselves" they will soon find that they are drifting to
revolution and anarchy. Significant, indeed, was the silent work of
Parliament in building up the constitutional doctrine of its own
omnicompetence and of its own supremacy. [Sidenote: Tyrannicide]
One striking aberration in the political theory of that time was the
prominence in it of the appeal to tyrannicide. Schooled by the
ancients who sang the praises of Harmodius and Aristogiton, by the
biblical example of Ehud and Eglon, and by various medieval publicists,
and taught the value of murder by the princes and popes who set prices
on each other's heads, an extraordinary number of sixteenth century
divines approved of the dagger as the best remedy for tyranny. Melanchthon wished that God would raise up an able man to slay Henry
VIII; John Ponet and Cajetan and the French theologian Boucher admitted
the possible virtue of assassination. But the most elaborate statement
of the same doctrine was put by the Spanish Jesuit Mariana, in a book
_On the King and his Education_ published in 1599, with an official
_imprimatur_, a dedication to the reigning monarch and an assertion
that it was approved by learned and grave men of the Society of Jesus. It taught that the prince holds sway solely by the consent of the
people and by ancient law, and that, though his vices are to be borne
up to a certain point, yet when he ruins the state he is a public
enemy, to slay whom is not only permissible but glorious for any man
brave enough to despise his own safety for the public good. If one may gather the official theory of the Catholic church from the
contradictory statements of her doctors, she advocated despotism
tempered by {606} assassination. No Lutheran ever preached the duty of
passive obedience more strongly than did the Catechism of the Council
of Trent. [Sidenote: Radicals]
A word must be said about the more radical thought of the time. All
the writers just analysed saw things from the standpoint of the
governing and propertied classes. But the voice of the poor came to be
heard now and then, not only from their own mouths but from that of the
few authors who had enough imagination to sympathize with them. The
idea that men might sometime live without any government at all is
found in such widely different writers as Richard Hooker and Francis
Rabelais. But socialism was then, as ever, more commonly advocated
than anarchy. The Anabaptists, particularly, believed in a community
of goods, and even tried to practice it when they got the chance. Though they failed in this, the contributions to democracy latent in
their egalitarian spirit must not be forgotten. They brought down on
themselves the severest animadversions from defenders of the existing
order, by whatever confession they were bound. [Sidenote: 1535] Vives
wrote a special tract to refute the arguments of the Anabaptists on
communism. Luther said that the example of the early Christians did
not authorize communism for, though the first disciples pooled their
own goods, they did not try to seize the property of Pilate and Herod. Even the French Calvinists, in their books dedicated to liberty,
referred to the Anabaptists as seditious rebels worthy of the severest
repression. [Sidenote: _Utopia_, 1516]
A nobler work than any produced by the Anabaptists, and one that may
have influenced them not a little, was the _Utopia_ of Sir Thomas More. He drew partly on Plato, on Tacitus's _Germania_, on Augustine and on
Pico della Mirandola, and for the outward framework of his book on the
_Four Voyages of Americus Vespuccius_. {607} But he relied mostly on
his own observation of what was rotten in the English state where he
was a judge and a ruler of men. He imagined an ideal country, Utopia,
a place of perfect equality economically as well as politically. It
was by government an elective monarchy with inferior magistrates and
representative assembly also elected. The people changed houses every
ten years by lot; they considered luxury and wealth a reproach. "In
other places they speak still of the common wealth but every man
procureth his private wealth. Here where nothing is private the common
affairs be earnestly looked upon." "What justice is this, that a rich
goldsmith or usurer should have a pleasant and wealthy living either by
idleness or by unnecessary occupation, when in the meantime poor
laborers, carters, ironsmiths, carpenters and plowmen by so great and
continual toil . . . do yet get so hard and so poor a living and live
so wretched a life that the condition of the laboring beasts may seem
much better and wealthier?" "When I consider and weigh in my mind all
these commonwealths which nowadays anywhere do flourish, [Sidenote: The
commonwealth] so God help me, I can perceive nothing but a certain
conspiracy of rich men procuring their own commodities under the name
and title of the commonwealth." More was convinced that a short day's
labor shared by everyone would produce quite sufficient wealth to keep
all in comfort. He protests explicitly against those who pretend that
there are two sorts of justice, one for governments and one for private
men. He repudiates the doctrine that bad faith is necessary to the
prosperity of a state; the Utopians form no alliances and carry out
faithfully the few and necessary treaties that they ratify. Moreover
they dishonor war above all things. In the realm of pure economic and social theory {608} something, though
not much, was done. Machiavelli believed that the growth of population
in the north and its migration southwards was a constant law, an idea
derived from Paulus Diaconus and handed on to Milton. He even derived
"Germany" from "germinare." A more acute remark, anticipating Malthus,
was made by the Spanish Jesuit John Botero [Sidenote: Botero, 1589]
who, in his _Reason of State_, pointed out that population was
absolutely dependent on means of subsistence. He concluded _a priori_
that the population of the world had remained stationary for three
thousand years. [Sidenote: Mercantile economics]
Statesmen then labored under the vicious error, drawn from the analogy
of a private man and a state, that national wealth consisted in the
precious metals. The stringent and universal laws against the export
of specie and intended to encourage its import, proved a considerable
burden on trade, though as a matter of fact they only retarded and did
not stop the flow of coin. The striking rise in prices during the
century attracted some attention. Various causes were assigned for it,
among others the growth of population and the increase of luxury. Hardly anyone saw that the increase in the precious metals was the
fundamental cause, but several writers, among them Bodin, John Hales
and Copernicus, saw that a debased currency was responsible for the
acute dearness of certain local markets. [Sidenote: Usury]
The lawfulness of the taking of usury greatly exercised the minds of
men of that day. The church on traditional grounds had forbidden it,
and her doctors stood fast by her precept, though an occasional
individual, like John Eck, could be found to argue for it. Luther was
in principle against allowing a man "to sit behind his stove and let
his money work for him," but he weakened enough to allow moderate
interest in given circumstances. Zwingli would allow interest to {609}
be taken only as a form of profit-sharing. Calvin said: "If we forbid
usury wholly we bind consciences by a bond straiter than that of God
himself. But if we allow it the least in the world, under cover of our
permission someone will immediately make a general and unbridled
licence." The laws against the taking of interest were gradually
relaxed throughout the century, but even at its close Bacon could only
regard usury as a concession made on account of the hardness of men's
hearts. [1] In Greek the words "politics" and "ethics" both have a wider
meaning than they have in English. [2] Lord Morley. SECTION 4. SCIENCE
[Sidenote: Inductive method]
The glory of sixteenth-century science is that for the first time, on a
large scale, since the ancient Greeks, did men try to look at nature
through their own eyes instead of through those of Aristotle and the
_Physiologus_. Bacon and Vives have each been credited with the
discovery of the inductive method, but, like so many philosophers, they
merely generalized a practice already common at their time. Save for
one discovery of the first magnitude, and two or three others of some
little importance, the work of the sixteenth century was that of
observing, describing and classifying facts. This was no small service
in itself, though it does not strike the imagination as do the great
new theories. [Sidenote: Mathematics]
In mathematics the preparatory work for the statement and solution of
new problems consisted in the perfection of symbolism. As reasoning in
general is dependent on words, as music is dependent on the mechanical
invention of instruments, so mathematics cannot progress far save with
a simple and adequate symbolism. The introduction of the Arabic as
against the Roman numerals, and particularly the introduction of the
zero in reckoning, for the first time, in the later Middle Ages,
allowed men to perform conveniently the four fundamental processes. The use of the signs + {610} and - for plus and minus (formerly written
p. and m.), and of the sign = for equality and of V [square root
symbol] for root, were additional conveniences. To this might be added
the popularization of decimals by Simon Stevin in 1586, which he called
"the art of calculating by whole numbers without fractions." How
clumsy are all things at their birth is illustrated by his method of
writing decimals by putting them as powers of one-tenth, with circles
around the exponents; _e.g._, the number that we should write 237.578,
he wrote 237(to the power 0) 5(to the power 1) 7(to the power 2) 8 (to
the power 3). He first declared for decimal systems of coinage,
weights and measures. [Sidenote: Algebra 1494]
Algebraic notation also improved vastly in the period. In a treatise
of Lucas Paciolus we find cumbrous signs instead of letters, thus no. (numero) for the known quantity, co. (cosa) for the unknown quantity,
ce. (censo) for the square, and cu. (cubo) for the cube of the unknown
quantity. As he still used p. and m. for plus and minus, he wrote
3co.p.4ce.m.5cu.p.2ce.ce.m.6no. for the number we should write 3x +
4x(power 2) - 5x(power 3) + 2x(power 4) - 6a. The use of letters in
the modern style is due to the mathematicians of the sixteenth century. The solution of cubic and of biquadratic equations, at first only in
certain particular forms, but later in all forms, was mastered by
Tartaglia and Cardan. The latter even discussed negative roots,
whether rational or irrational. [Sidenote: Geometry]
Geometry at that time, as for long afterwards, was dependent wholly on
Euclid, of whose work a Latin translation was first published at
Venice. [Sidenote: 1505] Copernicus with his pupil George Joachim,
called Rheticus, and Francis Vieta, made some progress in trigonometry. Copernicus gave the first simple demonstration of the fundamental
formula of spherical trigonometry; Rheticus made tables of sines,
tangents and secants {611} of arcs. Vieta discovered the formula for
deriving the sine of a multiple angle. [Sidenote: Cardan, 1501-76]
As one turns the pages of the numerous works of Jerome Cardan one is
astonished to find the number of subjects on which he wrote, including,
in mathematics, choice and chance, arithmetic, algebra, the calendar,
negative quantities, and the theory of numbers. In the last named
branch it was another Italian, Maurolycus, who recognized the general
character of mathematics as "symbolic logic." He is indeed credited
with understanding the most general principle on which depends all
mathematical deduction.[1] Some of the most remarkable anticipations
of modern science were made by Cardan. He believed that inorganic
matter was animated, and that all nature was a progressive evolution. Thus his statement that all animals were originally worms implies the
indefinite variability of species, just as his remark that inferior
metals were unsuccessful attempts of nature to produce gold, might seem
to foreshadow the idea of the transmutation of metals under the
influence of radioactivity. It must be remembered that such guesses
had no claim to be scientific demonstrations. The encyclopaedic character of knowledge was then, perhaps, one of its
most striking characteristics. Bacon was not the first man of his
century to take all knowledge for his province. In learning and
breadth of view few men have ever exceeded Conrad Gesner, [Sidenote:
Gesner] called by Cuvier "the German Pliny." His _History of Animals_
(published in many volumes 1551-87) was the basis of zoölogy until the
time of Darwin. [Sidenote: Zoölogy] He {612} drew largely on previous
writers, Aristotle and Albertus Magnus, but he also took pains to see
for himself as much as possible. The excellent illustrations for his
book, partly drawn from previous works but mostly new, added greatly to
its value. His classification, though superior to any that had
preceded it, was in some respects astonishing, as when he put the
hippopotamus among aquatic animals with fish, and the bat among birds. Occasionally he describes a purely mythical animal like "the
monkey-fox." It is difficult to see what criterion of truth would have
been adequate for the scholar at that time. A monkey-fox is no more
improbable than a rhinoceros, and Gesner found it necessary to assure
his readers that the rhinoceros really existed in nature and was not a
creation of fancy. [Sidenote: Leonardo]
As the master of modern anatomy and of several other branches of
science, stands Leonardo da Vinci. It is difficult to appraise his
work accurately because it is not yet fully known, and still more
because of its extraordinary form. Ho left thousands of pages of notes
on everything and hardly one complete treatise on anything. He began a
hundred studies and finished none of them. He had a queer twist to his
mind that made him, with all his power, seek byways. The monstrous,
the uncouth, fascinated him; he saw a Medusa in a spider and the
universe in a drop of water. He wrote his notes in mirror-writing,
from right to left; he illustrated them with a thousand fragments of
exquisite drawing, all unfinished and tantalizing alike to the artist
and to the scientist. His mind roamed to flying machines and
submarines, but he never made one; the reason given by him in the
latter case being his fear that it would be put to piratical use. He
had something in him of Faust; in some respects he reminds us of
William James, who also started as a {613} painter and ended as an
omniverous student of outré things and as a psychologist. [Sidenote: Anatomy]
If, therefore, the anatomical drawings made by Leonardo from about
twenty bodies that he dissected, are marvellous specimens of art, he
left it to others to make a really systematic study of the human body. His contemporary, Berengar of Carpi, professor at Bologna, first did
this with marked success, classifying the various tissues as fat,
membrane, flesh, nerve, fibre and so forth. So far from true is it
that it was difficult to get corpses to work upon that he had at least
a hundred. Indeed, according to Fallopius, another famous scientist,
the Duke of Tuscany would occasionally send live criminals to be
vivisected, thus making their punishment redound to the benefit of
science. The Inquisitors made the path of science hard by burning
books on anatomy as materialistic and indecent. [Sidenote: Servetus]
Two or three investigators anticipated Harvey's discovery of the
circulation of the blood. Unfortunately, as the matter is of interest,
Servetus's treatment of the subject, found in his work on _The
Trinity_, is too long to quote, but it is plain that, along with
various fallacious ideas, he had really discovered the truth that the
blood all passes through heart and lungs whence it is returned to the
other organs. [Sidenote: Physics]
While hardly anything was done in chemistry, a large number of
phenomena in the field of physics were observed now for the first time. Leonardo da Vinci measured the rapidity of falling bodies, by dropping
them from towers and having the time of their passage at various stages
noted. He thus found, correctly, that their velocity increased. It is
also said that he observed that bodies always fell a little to the
eastward of the plumb line, and thence concluded that the earth
revolved on its axis. He made careful experiments with billiard balls,
discovering that the {614} momentum of the impact always was preserved
entire in the motion of the balls struck. He measured forces by the
weight and speed of the bodies and arrived at an approximation of the
ideas of mechanical "work" and energy of position. He thought of
energy as a spiritual force transferred from one body to another by
touch. This remarkable man further invented a hygrometer, explained
sound as a wave-motion in the air, and said that the appearance known
to us as "the old moon in the new moon's lap" was due to the reflection
of earth-light. Nicholas Tartaglia first showed that the course of a projectile was a
parabola, and that the maximum range of a gun would be at an angle of
45 degrees. Some good work was done in optics. John Baptist della Porta described,
though he did not invent, the camera obscura. Burning glasses were
explained. Leonard Digges even anticipated the telescope by the use of
double lenses. Further progress in mechanics was made by Cardan who explained the
lever and pulley, and by Simon Stevin who first demonstrated the
resolution of forces. He also noticed the difference between stable
and unstable equilibrium, and showed that the downward pressure of a
liquid is independent of the shape of the vessel it is in and is
dependent only on the height. He and other scholars asserted the
causation of the tides by the moon. [Sidenote: Magnetism]
Magnetism was much studied. When compasses were first invented it was
thought that they always pointed to the North Star under the influence
of some stellar compulsion. But even in the fifteenth century it was
noticed independently by Columbus and by German experimenters that the
needle did not point true north. As the amount of its declination
varies at {615} different places on the earth and at different times,
this was one of the most puzzling facts to explain. One man believed
that the change depended on climate, another that it was an individual
property of each needle. About 1581 Robert Norman discovered the
inclination, or dip of the compass. These and other observations were
summed up by William Gilbert [Sidenote: Gilbert] in his work on _The
Magnet, Magnetic Bodies and the Earth as a great Magnet_. [Sidenote:
1600] A great deal of his space was taken in that valuable destructive
criticism that refutes prevalent errors. His greatest discovery was
that the earth itself is a large magnet. He thought of magnetism as "a
soul, or like a soul, which is in many things superior to the human
soul as long as this is bound by our bodily organs." It was therefore
an appetite that compelled the magnet to point north and south. Similar explanations of physical and chemical properties are found in
the earliest and in some of the most recent philosophers. [Sidenote: Geography]
As might be expected, the science of geography, nourished by the
discoveries of new lands, grew mightily. Even the size of the earth
could only be guessed at until it had been encircled. Columbus
believed that its circumference at the equator was 8000 miles. The
stories of its size that circulated after Magellan were exaggerated by
the people. Thus Sir David Lyndsay in his poem _The Dreme_ [Sidenote:
1528] quotes "the author of the sphere" as saying that the earth was
101,750 miles in circumference, each mile being 5000 feet. The author
referred to was the thirteenth century Johannes de Sacro Bosco (John
Holywood). Two editions of his work, _De Sphaera_, that I have seen,
one of Venice, 1499, and one of Paris, 1527, give the circumference of
the earth as 20,428 miles, but an edition published at Wittenberg in
1550 gives it as 5,400, probably an {616} attempt to reduce the
author's English miles to German ones. [Sidenote: 1551] Robert
Recorde calculated the earth's circumference at 21,300 miles.[2]
Rough maps of the new lands were drawn by the companions of the
discoverers. Martin Waldseemuller [Sidenote: 1507] published a large
map of the world in twelve sheets and a small globe about 4 1/2 inches
in diameter, in which the new world is for the first time called
America. The next great advance was made by the Flemish cartographer
Gerard Mercator [Sidenote: Mercator, 1512-94] whose globes and
maps--some of them on the projection since called by his name--are
extraordinarily accurate for Europe and the coast of Africa, and fairly
correct for Asia, though he represented that continent as too narrow. He included, however, in their approximately correct positions, India,
the Malay peninsula, Sumatra, Java and Japan. America is very poorly
drawn, for though the east coast of North America is fairly correct,
the continent is too broad and the rest of the coasts vague. He made
two startling anticipations of later discoveries, the first that he
separated Asia and America by only a narrow strait at the north, and
the second that he assumed the existence of a continent around the
south pole. This, however, he made far too large, thinking that the
Tierra del Fuego was part of it and drawing it so as to come near the
south coast of Africa and of Java. His maps of Europe were based on
recent and excellent surveys. [Sidenote: Astronomy]
Astronomy, the oldest of the sciences, had made much progress in the
tabulation of material. The apparent orbits of the sun, moon, planets,
and stars had been correctly observed, so that eclipses might be
predicted, conjunction of planets calculated, and that {617} gradual
movement of the sun through the signs of the zodiac known as the
precession of the equinoxes, taken account of. To explain these
movements the ancients started on the theory that each heavenly body
moved in a perfect circle around the earth; the fixed stars were
assigned to one of a group of revolving spheres, the sun, moon and five
planets each to one, making eight in all. But it was soon observed
that the movements of the planets were too complicated to fall into
this system; the number of moving spheres was raised to 27 before
Aristotle and to 56 by him. To these concentric spheres later
astronomers added eccentric spheres, moving within others, called
epicycles, and to them epicycles of the second order; in fact
astronomers were compelled:
To build, unbuild, contrive,
To save appearances, to gird the sphere
With centric and eccentric scribbled o'er
Cycle and epicycle, orb in orb. The complexity of this system, which moved the mirth of Voltaire and,
according to Milton, of the Almighty, was such as to make it doubted by
some thinkers even in antiquity. Several men thought the earth
revolved on its axis, but the hypothesis was rejected by Aristotle and
Ptolemy. Heracleides, in the fourth century B. C., said that Mercury
and Venus circled around the sun, and in the third century Aristarchus
of Samos actually anticipated, though it was a mere guess, the
heliocentric theory. Just before Copernicus various authors seemed to hint at the truth, but
in so mystical or brief a way that little can be made of their
statements. Thus, Nicholas of Cusa [Sidenote: Nicholas of Cusa,
1400-64] argued that "as the earth cannot be the center of the universe
it cannot lack all motion." Leonardo believed that the earth revolved
on its axis, and stated that it was a star and would look, to a man on
{618} the moon, as the moon does to us. In one place he wrote, "the
sun does not move,"--only that enigmatical sentence and nothing more. [Sidenote: Copernicus, 1473-1543]
Nicholas Copernicus was a native of Thorn in Poland, himself of mixed
Polish and Teutonic blood. At the age of eighteen he went to the
university of Cracow, where he spent three years. In 1496 he was
enabled by an ecclesiastical appointment to go to Italy, where he spent
most of the next ten years in study. He worked at the universities of
Bologna, Padua and Ferrara, and lectured--though not as a member of the
university--at Rome. His studies were comprehensive, including civil
law, canon law, medicine, mathematics, and the classics. At Padua, on
May 31, 1503, he was made doctor of canon law. He also studied
astronomy in Italy, talked with the most famous professors of that
science and made observations of the heavens. Copernicus's uncle was bishop of Ermeland, a spiritual domain and fief
of the Teutonic Order, under the supreme suzerainty, at least after
1525, of the king of Poland. Here Copernicus spent the rest of his
life; the years 1506-1512 in the bishop's palace at Heilsberg, after
1512, except for two not long stays at Allenstein, as a canon at
Frauenburg. This little town, near but not quite on the Baltic coast, is ornamented
by a beautiful cathedral. On the wall surrounding the close is a small
tower which the astronomer made his observatory. Here, in the long
frosty nights of winter and in the few short hours of summer darkness,
he often lay on his back examining the stars. He had no telescope, and
his other instruments were such crude things as he put together
himself. The most important was what he calls the _Instrumentum
parallacticum_, a wooden isosceles triangle with legs eight feet long
divided into 1000 {619} divisions by ink marks, and a hypotenuse
divided into 1414 divisions. With this he determined the height of the
sun, moon and stars, and their deviation from the vernal point. To
this he added a square (quadrum) which told the height of the sun by
the shadow thrown by a peg in the middle of the square. A third
instrument, also to measure the height of a celestial body, was called
the Jacob's staff. His difficulties were increased by the lack of any
astronomical tables save those poor ones made by Greeks and Arabs. The
faults of these were so great that the fundamental star, _i.e._, the
one he took by which to measure the rest, Spica, was given a longitude
nearly 40 degrees out of the true one. [Sidenote: Copernican hypothesis]
Nevertheless with these poor helps Copernicus arrived, and that very
early, at his momentous conclusion. His observations, depending as
they did on the weather, were not numerous. His time was spent largely
in reading the classic astronomers and in working out the mathematical
proofs of his hypothesis. He found hints in quotations from ancient
astronomers in Cicero and Plutarch that the earth moved, but he, for
the first time, placed the planets in their true position around the
sun, and the moon as a satellite of the earth. He retained the old
conception of the primum mobile or sphere of fixed stars though he
placed it at an infinitely greater distance than did the ancients, to
account for the absence of any observed alteration (parallax) in the
position of the stars during the year. He also retained the old
conception of circular orbits for the planets, though at one time he
considered the possibility of their being elliptical, as they are. Unfortunately for his immediate followers the section on this subject
found in his own manuscript was cut out of his printed book. The precise moment at which Copernicus {620} formulated his theory in
his own mind cannot be told with certainty, but it was certainly before
1516. He kept back his books for a long time, but his light was not
placed under a bushel nevertheless. [Sidenote: 1520] The first rays
of it shown forth in a tract by Celio Calcagnini of which only the
title, "That the earth moves and the heaven is still," has survived. Some years later Copernicus wrote a short summary of his book, for
private circulation only, entitled "A Short commentary on his
hypotheses concerning the celestial movements." A fuller account of
them was given by his friend and disciple, [Sidenote: _Narratio prima_,
1540] George Joachim, called Rheticus, who left Wittenberg, where he
was teaching, to sit at the master's feet, and who published what was
called _The First Account_. Finally, Copernicus was persuaded to give his own work to the public. Foreseeing the opposition it was likely to call forth, he tried to
forestall criticism by a dedication to the Pope Paul III. Friends at
Nuremberg undertook to find a printer, and one of them, the Lutheran
pastor Andrew Osiander, with the best intentions, did the great wrong
of inserting an anonymous preface stating that the author did not
advance his hypotheses as necessarily true, but merely as a means of
facilitating astronomical calculations. At last the greatest work of
the century, _On the Revolutions of the Heavenly Spheres_, [Sidenote:
De revolutionibus orbium caelestium, 1543] came from the press; a copy
was brought to the author on his death bed. The first of the six books examines the previous authorities, the
second proposes the new theory, the third discusses the precession of
the equinoxes, the fourth proves that the moon circles the earth, the
fifth and most important proves that the planets, including the earth,
move around the sun, and gives correctly the time of the orbits of all
the planets then known, from Mercury with eighty-eight days to Saturn
with thirty {621} years. The sixth book is on the determination of
latitude and longitude from the fixed stars. Copernicus's proofs and
reasons are absolutely convincing and valid as far as they go. It
remained for Galileo and Newton to give further explanations and some
modifications in detail of the new theory. [Sidenote: Reception of the Copernican theory]
When one remembers the enormous hubbub raised by Darwin's _Origin of
Species_, the reception of Copernicus's no less revolutionary work
seems singularly mild. The idea was too far in advance of the age, too
great, too paradoxical, to be appreciated at once. Save for a few
astronomers like Rheticus and Reinhold, hardly anyone accepted it at
first. It would have been miraculous had they done so. Among the first to take alarm were the Wittenberg theologians, to whose
attention the new theory was forcibly brought by their colleague
Rheticus. Luther alludes to the subject twice or thrice in his table
talk, most clearly on June 4, 1539, when
mention was made of a certain new astronomer, who tried
to prove that the earth moved and not the sky, sun and
moon, just as, when one was carried along in a boat or
wagon, it seemed to himself that he was still and that
the trees and landscape moved. "So it goes now," said
Luther, "whoever wishes to be clever must not let
anything please him that others do, but must do something
of his own. Thus he does who wishes to subvert the
whole of astronomy: but I believe the Holy Scriptures,
which say that Joshua commanded the sun, and not the
earth, to stand still."
In his _Elements of Physics_, written probably in 1545, but not
published until 1549, Melanchthon said:
The eyes bear witness that the sky revolves every
twenty-four hours. But some men now, either for love
of novelty, or to display their ingenuity, assert that the
earth moves. . . . But it is hurtful and dishonorable to
{622}
assert such absurdities. . . . The Psalmist says that the
sun moves and the earth stands fast. . . . And the earth,
as the center of the universe, must needs be the
immovable point on which the circle turns. Apparently, however, Melanchthon either came to adopt the new theory,
or to regard it as possible, for he left this passage entirely out of
the second edition of the same work. [Sidenote: 1550] Moreover his
relations with Rheticus continued warm, and Rheinhold continued to
teach the Copernican system at Wittenberg. The reception of the new work was also surprisingly mild, at first, in
Catholic circles. As early as 1533 Albert Widmanstetter had told
Clement VII of the Copernican hypothesis and the pope did not, at
least, condemn it. Moreover it was a cardinal, Schönberg, who
consulted Paul III on the matter [Sidenote: 1536] and then urged
Copernicus to publish his book, though in his letter the language is so
cautiously guarded against possible heresy that not a word is said
about the earth moving around the sun but only about the moon and the
bodies near it so doing. [Sidenote: 1579] A Spanish theologian,
Didacus a Stunica (Zuñiga) wrote a commentary on Job, which was
licensed by the censors, accepting the Copernican astronomy. But gradually, as the implications of the doctrine became apparent, the
church in self-defence took a strong stand against it. [Sidenote:
March 5, 1616] The Congregation of the Index issued a decree saying,
"Lest opinions of this sort creep in to the destruction of Catholic
truth, the book of Nicholas Copernicus and others [defending his
hypothesis] are suspended until they be corrected." A little later
Galileo was forced, under the threat of torture, to recant this heresy. Only when the system had become universally accepted, did the church,
in 1822, first expressly permit the faithful to hold it. The philosophers were as shy of the new light as {623} the theologians. Bodin in France and Bacon in England both rejected it; the former was
conservative at heart and the latter was never able to see good in
other men's work, whether that of Aristotle or of Gilbert or of the
great Pole. Possibly he was also misled by Osiander's preface and by
Tycho Brahe. Giordano Bruno, however, welcomed the new idea with
enthusiasm, saying that Copernicus taught more in two chapters than did
Aristotle and the Peripatetics in all their works. Astronomers alone were capable of weighing the evidence scientifically
and they, at first, were also divided. Erasmus Reinhold, of
Wittenberg, accepted it and made his calculations on the assumption of
its truth, as did an Englishman, John Field. [Sidenote: 1556] Tycho
Brahe, [Sidenote: Tycho Brahe, 1546-1601] on the other hand, tried to
find a compromise between the Copernican and Ptolemaic systems. He
argued that the earth could not revolve on its axis as the centrifugal
force would hurl it to pieces, and that it could not revolve around the
sun as in that case a change in the position of the fixed stars would
be observed. Both objections were well taken, of course, considered in
themselves alone, but both could be answered by a deeper knowledge. Brahe therefore considered the earth as the center of the orbits of the
moon, sun, and stars, and the sun as the center of the orbits of the
planets. The attention to astronomy had two practical corollaries, the
improvement of navigation and the reform of the calendar. Several
better forms of astrolabe, of "sun-compass" (or dial turnable by a
magnet) and an "astronomical ring" for getting the latitude and
longitude by observation of sun and star, were introduced. [Sidenote: Reform of calendar]
The reform of the Julian calendar was needed on account of the
imperfect reckoning of the length of the {624} year as exactly 365 1/4
days; thus every four centuries there would be three days too much. It
was proposed to remedy this for the present by leaving out ten days,
and for the future by omitting leap-year every century not divisible by
400. The bull of Gregory XIII, [Sidenote: February 24, 1582] who
resumed the duties of the ancient Pontifex Maximus in regulating time,
enjoined Catholic lands to rectify their calendar by allowing the
fifteenth of October, 1582, to follow immediately after the fourth. This was done by most of Italy, by Spain, Portugal, Poland, most of
Germany, and the Netherlands. Other lands adopted the new calendar
later, England not until 1752 and Russia not until 1917. [1] _I.e._ the principle thus formulated in the _Encyclopaedia
Britannica_, s.v. "Mathematics": "If s is any class and zero a member
of it, also if when x is a cardinal number and a member of s, also x +
1 is a member of s, then the whole class of cardinal numbers is
contained in s."
[2] Eratosthenes (276-196 B.C.) had correctly calculated the earth's
circumference at 25,000, which Poseidonius (c. 135-50 B.C.) reduced to
18,000, in which he was followed by Ptolemy (2d century A.D.). SECTION 5. PHILOSOPHY
[Sidenote: Science, religion and philosophy]
The interrelations of science, religion, and philosophy, though complex
in their operation, are easily understood in their broad outlines. Science is the examination of the data of experience and their
explanation in logical, physical, or mathematical terms. Religion, on
the other hand, is an attitude towards unseen powers, involving the
belief in the existence of spirits. Philosophy, or the search for the
ultimate reality, is necessarily an afterthought. It comes only after
man is sophisticated enough to see some difference between the
phenomenon and the idea. It draws its premises from both science and
religion: some systems, like that of Plato, being primarily religious
fancy, some, like that of Aristotle, scientific realism. The philosophical position taken by the Catholic church was that of
Aquinas, Aristotelian realism. [Sidenote: The Reformers] The official
commentary on the _Summa_ was written at this time by Cardinal Cajetan. Compared to the steady orientation of the Catholic, the Protestant
philosophers wavered, catching often at the latest style in thought, be
it monism or pragmatism. Luther was the {625} spiritual child of
Occam, and the ancestor of Kant. His individualism stood half-way
between the former's nominalism and the latter's transcendentalism and
subjectivism. But the Reformers were far less interested in purely
metaphysical than they were in dogmatic questions. The main use they
made of their philosophy was to bring in a more individual and less
mechanical scheme of salvation. Their great change in point of view
from Catholicism was the rejection of the sacramental, hierarchical
system in favor of justification by faith. This was, in truth, a
stupendous change, putting the responsibility for salvation directly on
God, and dispensing with the mediation of priest and rite. [Sidenote: Attitude towards reason]
But it was the only important change, of a speculative nature, made by
the Reformers. The violent polemics of that and later times have
concealed the fact that in most of his ideas the Protestant is but a
variety of the Catholic. Both religions accepted as axiomatic the
existence of a personal, ethical God, the immortality of the soul,
future rewards and punishments, the mystery of the Trinity, the
revelation, incarnation and miracles of Christ, the authority of the
Bible and the real presence in the sacrament. Both equally detested
reason. He who is gifted with the heavenly knowledge of faith
[says the Catechism of the Council of Trent] is free from
an inquisitive curiosity; for when God commands us to
believe, he does not propose to have us search into his
divine judgments, nor to inquire their reasons and causes,
but demands an immutable faith. . . . Faith, therefore,
excludes not only all doubt, but even the desire of
subjecting its truth to demonstration. We know that reason is the devil's harlot [says
Luther] and can do nothing but slander and harm all that
God says and does. [And again] If, outside of Christ,
you wish by your own thoughts to know your relation to
{626}
God, you will break your neck. Thunder strikes him
who examines. It is Satan's wisdom to tell what God
is, and by doing so he will draw you into the abyss. Therefore keep to revelation and don't try to understand. There are many mysteries in the Bible, Luther acknowledged, that seem
absurd to reason, but it is our duty to swallow them whole. Calvin
abhorred the free spirit of the humanists as the supreme heresy of free
thought. He said that philosophy was only the shadow and revelation
the substance. "Nor is it reasonable," said he, "that the divine will
should be made the subject of controversy with us." Zwingli,
anticipating Descartes's "finitum infiniti capax non est," stated that
our small minds could not grasp God's plan. Oecolampadius, dying, said
that he wanted no more light than he then had--an instructive contrast
to Goethe's last words: "Mehr Licht!" Even Bacon, either from prudence
or conviction, said that theological mysteries seeming absurd to reason
must be believed. [Sidenote: Radical sects]
Nor were the radical sects a whit more rational. Those who represented
the protest against Protestantism and the dissidence of dissent
appealed to the Bible as an authority and abhorred reason as much as
did the orthodox churches. The Antitrinitarians were no more deists or
free thinkers than were the Lutherans. Campanus and Adam Pastor and
Servetus and the Sozinis had no aversion to the supernatural and made
no claim to reduce Christianity to a humanitarian deism, as some modern
Unitarians would do. Their doubts were simply based on a different
exegesis of the biblical texts. Fausto Sozini thought Christ was "a
subaltern God to whom at a certain time the Supreme God gave over the
government of the world." Servetus defined the Trinity to be "not an
illusion of three invisible things, but the manifestation of God {627}
in the Word and a communication of the substance of God in the Spirit."
This is no new rationalism coming in but a reversion to an obsolete
heresy, that of Paul of Samosata. It does not surprise us to find
Servetus lecturing on astrology. [Sidenote: Spiritual Reformers]
Somewhat to the left of the Antitrinitarian sects were a few men, who
had hardly any followers, who may be called, for want of a better term,
Spiritual Reformers. They sought, quite in the nineteenth century
spirit, to make Christianity nothing but an ethical culture. James
Acontius, born in Trent [Sidenote: 1565] but naturalized in England,
published his _Stratagems of Satan_ in 1565 to reduce the fundamental
doctrines of Christianity to the very fewest possible. Sebastian
Franck of Ingolstadt [Sidenote: Franck, 1499-1542] found the only
authority for each man in his inward, spiritual message. He sought to
found no community or church, but to get only readers. These men
passed almost unnoticed in their day. [Sidenote: Italian skeptics]
There was much skepticism throughout the century. Complete Pyrrhonism
under a thin veil of lip-conformity, was preached by Peter Pomponazzi,
[Sidenote: Pomponazzi,1462-1325] professor of philosophy at Padua,
Ferrara and Bologna. His _De immortalitate animi_ [Sidenote: 1516]
caused a storm by its plain conclusion that the soul perished with the
body. He tried to make the distinction in his favor that a thing might
be true in religion and false in philosophy. Thus he denied his belief
in demons and spirits as a philosopher, while affirming that he
believed in them as a Christian. He was in fact a materialist. He
placed Christianity, Mohammedanism and Judaism on the same level,
broadly hinting that all were impostures. Public opinion became so interested in the subject of immortality at
this time that when another philosopher, Simon Porzio, tried to lecture
on meteorology at Pisa, his audience interrupted him with cries, "Quid
de anima?" He, also, maintained that the soul of man {628} was like
that of the beasts. But he had few followers who dared to express such
an opinion. After the Inquisition had shown its teeth, the life of the
Italian nation was like that of its great poet, Tasso, whose youth was
spent at the feet of the Jesuits and whose manhood was haunted by fears
of having unwittingly done something that might be punished by the
stake. It was to counteract the pagan opinion, stated to be rapidly
growing, that the Vatican Council forbade all clerics to lecture on the
classics for five years. But in vain! A report of Paul III's
cardinals charged professors of philosophy with teaching impiety. Indeed, the whole literature of contemporary Italy, from Machiavelli,
who treated Christianity as a false and noxious superstition, to Pulci
who professed belief in nothing but pleasure, is saturated with free
thought. "Vanity makes most humanists skeptics," wrote Ariosto, "why
is it that learning and infidelity go hand in hand?"
[Sidenote: German skeptics]
In Germany, too, there was some free thought, the most celebrated case
being that of the "godless painters of Nuremberg," Hans Sebald Beham,
Bartholomew Beham, and George Penz. The first named expressed some
doubts about various Protestant doctrines. Bartholomew went further,
asserting that baptism was a human device, that the Scriptures could
not be believed and that the preaching he had heard was but idle talk,
producing no fruit in the life of the preacher himself; he recognized
no superior authority but that of God. George Penz went further still,
for while he admitted the existence of God he asserted that his nature
was unknowable, and that he could believe neither in Christ nor in the
Scriptures nor in the sacraments. The men were banished from the city. [Sidenote: French skeptics]
In France, as in Italy, the opening of the century saw signs of
increasing skepticism in the frequent {629} trials of heretics who
denied all Christian doctrines and "all principles save natural ones."
But a spirit far more dangerous to religion than any mere denial
incarnated itself in Rabelais. He did not philosophize, but he poured
forth a torrent of the raw material from which philosophies are made. He did not argue or attack; he rose like a flood or a tide until men
found themselves either swimming in the sea of mirth and mockery, or
else swept off their feet by it. He studied law, theology and
medicine; he travelled in Germany and Italy and he read the classics,
the schoolmen, the humanists and the heretics. And he found everywhere
that nature and life were good and nothing evil in the world save its
deniers. To live according to nature he built, in his story, the abbey
of Thélème, a sort of hedonist's or anarchist's Utopia where men and
women dwell together under the rule, "Do what thou wilt," and which has
over its gates the punning invitation: "Cy entrez, vous, qui le saint
evangile en sens agile annoncez, quoy qu'on gronde." For Rabelais
there was nothing sacred, or even serious in "revealed religion," and
God was "that intellectual sphere the center of which is everywhere and
the circumference nowhere."
Rabelais was not the only Frenchman to burlesque the religious quarrels
of the day. Bonaventure des Périers, [Sidenote: Des Périers, d. 1544]
in a work called _Cymbalum Mundi_, introduced Luther under the anagram
of Rethulus, a Catholic as Tryocan (_i.e._, Croyant) and a skeptic as
Du Glenier (_i.e._, Incrédule), debating their opinions in a way that
redounded much to the advantage of the last named. Then there was Stephen Dolet [Sidenote: Dolet, 1509-46] the humanist
publisher of Lyons, burned to death as an atheist, because, in
translating the Axiochos, a dialogue then attributed to Plato, he had
written "After death you will be nothing at all" instead of "After
death you will be no {630} more," as the original is literally to be
construed. The charge was frivolous, but the impression was doubtless
correct that he was a rather indifferent skeptic, disdainful of
religion. He, too, considered the Reformers only to reject them as too
much like their enemies. No Christian church could hold the worshipper
of Cicero and of letters, of glory and of humanity. And yet this sad
and restless man, who found the taste of life as bitter as Rabelais had
found it sweet, died for his faith. He was the martyr of the
Renaissance. [Sidenote: Bodin]
A more systematic examination of religion was made by Jean Bodin in his
_Colloquy on Secret and Sublime Matters_, commonly called the
_Heptaplomeres_. Though not published until long after the author's
death, it had a brisk circulation in manuscript and won a reputation
for impiety far beyond its deserts. It is simply a conversation
between a Jew, a Mohammedan, a Lutheran, a Zwinglian, a Catholic, an
Epicurean and a Theist. The striking thing about it is the fairness
with which all sides are presented; there is no summing up in favor of
one faith rather than another. Nevertheless, the conclusion would
force itself upon the reader that among so many religions there was
little choice; that there was something true and something false in
all; and that the only necessary articles were those on which all
agreed. Bodin was half way between a theist and a deist; he believed
that the Decalogue was a natural law imprinted in all men's hearts and
that Judaism was the nearest to being a natural religion. He admitted,
however, that the chain of casuality was broken by miracle and he
believed in witchcraft. It cannot be thought that he was wholly
without personal faith, like Machiavelli, and yet his strong argument
against changing religion even if the new be better than the old, is
entirely worldly. With France before his {631} eyes, it is not strange
that he drew the general conclusion that any change of religion is
dangerous and sure to be followed by war, pestilence, famine and
demoniacal possession. [Sidenote: Montaigne]
After the fiery stimulants, compounded of brimstone and Stygian hatred,
offered by Calvin and the Catholics, and after the plethoric gorge of
good cheer at Gargantua's table, the mild sedative of Montaigne's
conversation comes like a draft of nepenthe or the fruit of the lotus. In him we find no blast and blaze of propaganda, no fulmination of bull
and ban; nor any tide of earth-encircling Rabelaisian mirth. His words
fall as softly and as thick as snowflakes, and they leave his world a
white page, with all vestiges of previous writings erased. He neither
asseverates nor denies; he merely, as he puts it himself, "juggles,"
treating of idle subjects which he believes nothing at all, for he has
noticed that as soon one denies the possibility of anything, someone
else will say that he has seen it. In short, truth is a near neighbor
to falsehood, and the wise man can only repeat, "Que sais-je?" Let us
live delicately and quietly, finding the world worth enjoying, but not
worth troubling about. Wide as are the differences between the Greek thinker and the French,
there is something Socratic in the way in which Montaigne takes up
every subject only to suggest doubts of previously held opinion about
it. If he remained outwardly a Catholic, it was because he saw exactly
as much to doubt in other religions. Almost all opinions, he urges,
are taken on authority, for when men begin to reason they draw
diametrically opposite conclusions from the same observed facts. He
was in the civil wars esteemed an enemy by all parties, though it was
only because he had both Huguenot and Catholic friends. "I have seen
in Germany," he wrote, "that Luther hath left as many {632} divisions
and altercations concerning the doubt of his opinions, yea, and more,
than he himself moveth about the Holy Scriptures." The Reformers, in
fact, had done nothing but reform superficial faults and had either
left the essential ones untouched, or increased them. How foolish they
were to imagine that the people could understand the Bible if they
could only read it in their own language! Montaigne was the first to feel the full significance of the
multiplicity of sects. [Sidenote: Multiplicity of sects] "Is there
any opinion so fantastical, or conceit so extravagant . . . or opinion
so strange," he asked, "that custom hath not established and planted by
laws in some region?" Usage sanctions every monstrosity, including
incest and parricide in some places, and in others "that unsociable
opinion of the mortality of the soul." Indeed, Montaigne comes back to
the point, a man's belief does not depend on his reason, but on where
he was born and how brought up. "To an atheist all writings make for
atheism." "We receive our religion but according to our fashion. . . . Another country, other testimonies, equal promises, like menaces, might
sembably imprint a clean contrary religion in us."
Piously hoping that he has set down nothing repugnant to the
prescriptions of the Catholic, Apostolic and Roman church, where he was
born and out of which he purposes not to die, Montaigne proceeds to
demonstrate that God is unknowable. A man cannot grasp more than his
hand will hold nor straddle more than his legs' length. Not only all
religions, but all scientists give the lie to each other. Copernicus,
having recently overthrown the old astronomy, may be later overthrown
himself. In like manner the new medical science of Paracelsus
contradicts the old and may in turn pass away. The same facts appear
differently to different men, and "nothing comes to us but falsified
{633} and altered by our senses." Probability is as hard to get as
truth, for a man's mind is changed by illness, or even by time, and by
his wishes. Even skepticism is uncertain, for "when the Pyrrhonians
say, 'I doubt,' you have them fast by the throat to make them avow that
at least you are assured and know that they doubt." In short, "nothing
is certain but uncertainty," and "nothing seemeth true that may not
seem false." Montaigne wrote of pleasure as the chief end of man, and
of death as annihilation. The glory of philosophy is to teach men to
despise death. One should do so by remembering that it is as great
folly to weep because one would not be alive a hundred years hence as
it would be to weep because one had not been living a hundred years ago. [Sidenote: Charron, 1541-1603]
A disciple who dotted the i's and crossed the t's of Montaigne was
Peter Charron. He, too, played off the contradictions of the sects
against each other. All claim inspiration and who can tell which
inspiration is right? Can the same Spirit tell the Catholic that the
books of Maccabees are canonical and tell Luther that they are not? The senses are fallible and the soul, located by Charron in a ventricle
of the brain, is subject to strange disturbances. Many things almost
universally believed, like immortality, cannot be proved. Man is like
the lower animals. "We believe, judge, act, live and die on faith,"
but this faith is poorly supported, for all religions and all
authorities are but of human origin. [Sidenote: English skeptics]
English thought followed rather than led that of Europe throughout the
century. At first tolerant and liberal, it became violently religious
towards the middle of the period and then underwent a strong reaction
in the direction of indifference and atheism. For the first years,
before the Reformation, the _Utopia_ may serve as an example. More,
under the influence {634} of the Italian Platonists, pictured his ideal
people as adherents of a deistic, humanitarian religion, with few
priests and holy, tolerant of everything save intolerance. They
worshipped one God, believed in immortality and yet thought that "the
chief felicity of man" lay in the pursuit of rational pleasure.
| 43,562 |
https://en.wikipedia.org/wiki/Kunwar%20Singh%20%28disambiguation%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Kunwar Singh (disambiguation)
|
https://en.wikipedia.org/w/index.php?title=Kunwar Singh (disambiguation)&action=history
|
English
|
Spoken
| 288 | 559 |
Kunwar Singh (1777–1858) was one of the leaders during the Indian Rebellion of 1857.
Kunwar Singh may also refer to:
Awadhesh Pratap Singh (Kunwar Awadhesh Pratap Singh; 1888–1967), Indian independence activist, Chief Minister of Vindhya Pradesh (1948–1949)
Brajesh Singh (Kunwar Brijesh Singh; died 1966), Indian communist politician
Divye Pratap Singh (Kunwar Divye Pratap Singh; born 1996), Indian shooter
K. B. Singh (Kunwar Bachint Singh), Fijian politician
K. D. Singh (Kunwar Digvijay Singh, also known as Babu; 1922–1978), Indian field hockey player
Kunwar Amar (Kunwar Amarjeet Singh; born 1985), Indian dancer and television actor
Kunwar Indrajit Singh (1906–1982), Prime Minister of Nepal (1957)
Kunwar Manvendra Singh (born 1947), member of the Lok Sabha, the lower house of the Parliament of India, for Mathura
Kunwar Pranav Singh (politician) (born 1966), Member of the Uttarakhand Legislative Assembly
Kunwar Sarvesh Kumar Singh, also known as Rakesh Singh (born 1952), Indian businessman and member of the Lok Sabha, the lower house of the Parliament of India, for Moradabad (from 2014)
Kunwar Suresh Singh, older brother of Raja Awadhesh Singh, the ruler of Kalakankar
Kunwar Sushant Singh (born 1988), Member of the Uttar Pradesh Legislative Assembly (from 2014)
Kunwar Vikram Singh, also known as Nati Raja (born 1970), Member of the Madhya Pradesh Legislative Assembly (from 2003)
R. P. N. Singh (Kunwar Ratanjit Pratap Narain Singh; born 1964), member of the Lok Sabha, the lower house of the Parliament of India, for Kushi Nagar (2009–2014)
Rewati Raman Singh (Kunwar Rewati Raman Singh; born 1943), member of the Lok Sabha, the lower house of the Parliament of India, for Allahabad (2004–2014)
Sarvraj Singh (Kunwar Sarvraj Singh; born 1952), member of the Lok Sabha, the lower house of the Parliament of India, for Aonla (1996–1998, 1999–2009)
| 40,142 |
US-201715855819-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,017 |
None
|
None
|
English
|
Spoken
| 7,138 | 9,080 |
Buffer controller, memory device, and integrated circuit device
ABSTRACT
A buffer controller includes a pointer generator, a code converter, a synchronizer, a code restorer, and a comparator. The pointer generator operates according to a first clock signal, and generates a first pointer by encoding a first address of a buffer with a first code. The code converter generates a first transmission pointer by converting the first pointer with a second code or a third code according to an amount of data stored in or read from the first address. The synchronizer synchronizes the first transmission pointer with a second clock signal. The code restorer generates a first comparison pointer by restoring the first transmission pointer, synchronized with the second clock signal, with the first code. The comparator compares the first comparison pointer with a second pointer. The second pointer defines a second address of the buffer with the first code.
CROSS-REFERENCE TO RELATED APPLICATION
This U.S. non-provisional patent application claims benefit of priorityunder 35 U.S.C. 119 to Korean Patent Application No. 10-2017-0088401,filed on Jul. 12, 2017 in the Korean Intellectual Property Office, thedisclosure of which is incorporated herein by reference in its entirety.
BACKGROUND 1. Field
The present disclosure relates to a buffer controller, a memory device,and an integrated circuit device.
2. Description of Related Art
When an integrated circuit device receives data from another integratedcircuit device, each of the integrated circuit device receiving the dataand the integrated circuit device transmitting the data may receive ortransmit the data using clock signals generated from different sources.To compensate for a frequency difference in such clock signals, a buffermay be prepared in an integrated circuit device. At least a portion ofthe received data may be stored in a buffer according to a clock signalof the integrated circuit device that transmits the data. The storeddata in the buffer may be output from the buffer according to a clocksignal of the integrated circuit device that receives the data. Thus, awrite circuit storing data in the buffer and a read circuit reading datastored in the buffer may be operated according to different clocksignals. Insofar as a pointer may assign an address in which data is tobe stored, and a pointer may assign an address at which data to be readis stored, a device for synchronizing the pointers with each other maybe helpful, beneficial or even required.
SUMMARY
An aspect of the present disclosure may provide a buffer controller, amemory device, and an integrated circuit device. The buffer controllermay synchronize a pointer that indicates an address in which data is tobe stored, with a pointer that indicates an address at which data to beread is stored. The addresses are in a buffer in which data is storedaccording to different clock signals. Data having been stored in thebuffer is output from the buffer.
According to an aspect of the present disclosure, a buffer controllermay include a pointer generator configured to operate according to afirst clock signal. The buffer controller may generate a first pointerby encoding a first address of a buffer with a first code. The buffercontroller may include a code converter configured to generate a firsttransmission pointer by converting the first pointer with one of asecond code and a third code, different from the first code, accordingto an amount of data stored in the first address or read from the firstaddress. The buffer controller may also include a synchronizerconfigured to synchronize the first transmission pointer with a secondclock signal different from the first clock signal. The buffercontroller may also include a code restorer configured to generate afirst comparison pointer by restoring the first transmission pointer,synchronized with the second clock signal, with the first code. Thebuffer controller may moreover include a comparator configured tocompare the first comparison pointer with a second pointer. The secondpointer may define a second address of the buffer with the first code.
According to an aspect of the present disclosure, a memory device mayinclude a buffer, a first pointer generator, a write circuit, a secondpointer, a read circuit, and a pointer synchronizer. The first pointergenerator is configured to operate according to a first clock signal,and generate a first pointer by encoding a first address of the bufferwith a first code. The write circuit is configured to store first datain a storage space of the buffer corresponding to the first address. Thesecond pointer generator is configured to operate according to a secondclock signal different from the first clock signal, and generate asecond pointer by encoding a second address of the buffer with the firstcode. The read circuit is configured to read second data stored in astorage space of the buffer corresponding to the second address. Thepointer synchronizer is configured to synchronize the first pointer withthe second clock signal after converting the first pointer with atransmission code different from the first code, and compare the firstpointer with the second pointer by restoring the first pointer,synchronized with the second clock signal, with the first code. Thetransmission code may be a code in which only a single bit is changed ineach period of the first clock signal.
According to an aspect of the present disclosure, an integrated circuitdevice may include a first circuit, a second circuit, and a memorydevice. The first circuit is configured to operate according to a firstclock signal. The second circuit is configured to operate according to asecond clock signal different from the first clock signal. The memorydevice is configured to store first data in a first address according tothe first clock signal, and output second data to the second circuitaccording to the second clock signal. The first data is input by thefirst circuit. The memory device may compare a first pointer thatindicates the first address with a second pointer that indicates thesecond address, by synchronizing the first pointer with the second clocksignal after encoding the first pointer with a transmission code, andmay compare the second pointer with the first pointer by synchronizingthe second pointer with the first clock signal after encoding the secondpointer with the transmission code. The transmission code may be a codein which only a single bit is changed regardless of an amount of thefirst data and an amount of the second data. The first data issynchronized with the first clock signal and stored in the memorydevice. The second data is synchronized with the second clock signal andoutput by the memory device.
BRIEF DESCRIPTION OF DRAWINGS
The above and other aspects, features and other advantages of thepresent disclosure will be more clearly understood from the followingdetailed description, taken in conjunction with the accompanyingdrawings, in which:
FIG. 1 is a block diagram schematically illustrating an electronicdevice according to an example embodiment;
FIG. 2 illustrates an operation of an integrated circuit deviceaccording to an example embodiment;
FIG. 3 is a block diagram schematically illustrating a memory deviceaccording to an example embodiment;
FIG. 4 is a timing diagram illustrating an operation of a buffercontroller according to an example embodiment;
FIGS. 5 through 7 illustrating an operation of a buffer controlleraccording to an example embodiment;
FIG. 8 is a circuit diagram schematically illustrating a buffercontroller according to an example embodiment;
FIGS. 9 through 15 illustrate an operation of a buffer controlleraccording to an example embodiment; and
FIG. 16 is a flow chart illustrating an operation of a buffer controlleraccording to an example embodiment.
DETAILED DESCRIPTION
Embodiments of the present disclosure will now be described in detailwith reference to the accompanying drawings.
FIG. 1 is a block diagram schematically illustrating an electronicdevice according to an example embodiment.
Referring to FIG. 1, an electronic device 1 according to an exampleembodiment may include a processor 2, a storage device 3, a display 4, acommunications unit 5, an image sensor 6, an input and output device 7,or the like. The electronic device 1 may operate in the capacity of, beimplemented as, or incorporated into various device such as atelevision, a desktop computer, and the like, as well as a smartphone, atablet PC, a laptop computer, and the like. Components such as theprocessor 2, the storage device 3, the display 4, the communicationsunit 5, the image sensor 6, the input and output device 7, and the likemay communicate with each other via a bus 8.
An overall operation of the electronic device 1 may be controlled by theprocessor 2. The processor 2 may be referred to by various names,depending on a type of the electronic device 1. In an exampleembodiment, when the electronic device 1 is a tablet PC or a smartphone,the processor 2 may be an application processor. When the electronicdevice 1 is a laptop computer or a desktop computer, the processor 2 maybe a central processing unit (CPU). The storage device 3 is a devicethat stores data, and may include a flash memory, a dynamicrandom-access memory (DRAM), a static random-access memory (SRAM), acache memory, and the like. The display 4 is a device for outputting animage, and may be implemented as a liquid crystal display (LCD), anorganic light emitting diode (OLED) display, an electronic paperdisplay, a microelectromechanical system (MEMS) display, or the like.
The communications unit 5 may be a device for mediating communicationsbetween the electronic device 1 and another external electronic device.The communications unit 5 may exchange data with an external electronicdevice through various communications interfaces, for example, a wiredcommunications interface such as a universal serial bus (USB), a localarea network (LAN), a micro-USB, or the like, or a wirelesscommunications interface such as wireless fidelity (Wi-Fi), Bluetooth®,near-field communication (NFC), infrared communication, visible lightcommunication, or the like. The image sensor 6 is a device for capturingan image, and may include a complementary metal oxide semiconductor(CMOS) image sensor, a charge coupled device (CCD) image sensor, or thelike. The input and output device 7 may include devices for receiving apredetermined command from an external source or for outputting audio,vibrations, or the like. In an example embodiment, the input and outputdevice 7 may include components such as an audio output unit, atouchscreen, a mechanical key, and the like.
The processor 2, the storage device 3, the display 4, the communicationsunit 5, the image sensor 6, and the input and output device 7 includedin the electronic device 1 may communicate via the bus 8. One or more ofthe processor 2, the storage device 3, the display 4, the communicationsunit 5, the image sensor 6, the input and output device 7 included inthe electronic device 1 may include a clock generation circuit forgenerating a local clock signal, therein. For example, the processor 2may include a (first) clock generation circuit, and the communicationsunit 5 may include a (second) clock generation circuit. In an exampleembodiment, any clock generation circuit may include a phase lockedloop-based oscillator circuit, or the like.
In an example embodiment, the clock generation circuit provided in theprocessor 2, and the clock generation circuit provided in thecommunications unit 5 may be controlled to generate a clock signal atthe same frequency. However, except for the ideal case, even when adifferent clock generation circuit having the same structure is providedin each of the processor 2, the storage device 3, the display 4, thecommunications unit 5, the image sensor 6, and the input and outputdevice 7, clock signals generated in the different clock generationcircuits may have different frequencies.
In an example embodiment, when the communications unit 5 transmits data,received from an external electronic device, to the processor 2 via thebus 8, a data transmission speed of the communications unit 5 may bedetermined by a frequency of a clock signal generated in thecommunications unit 5. On the other hand, a speed at which the processor2 receives data may be determined by a frequency of a clock signalgenerated in the processor 2. In order to compensate for such errors indata transmission and data reception, in the processor 2 and/or one ormore of the storage device 3, the display 4, the communications unit 5,the image sensor 6, the input and output device 7, a memory deviceincluding a buffer therein may be prepared.
FIG. 2 illustrates an operation of an integrated circuit deviceaccording to an example embodiment.
Referring to FIG. 2, a first integrated circuit device 10 and a secondintegrated circuit device 20 according to an example embodiment mayexchange data via a predetermined communications interface. In anexample embodiment, the first integrated circuit device 10 and thesecond integrated circuit device 20 may exchange data with each otherthrough a serial communications interface.
The first integrated circuit device 10 may include first circuits 11,second circuits 12, and a first clock generation circuit 14 thatgenerates a clock signal, respectively. The second integrated circuitdevice 20 may include first circuits 21, second circuits 22, and asecond clock generation circuit 24 that generates a clock signal,respectively. The first integrated circuit device 10 may also include amemory device 13, and the second integrated circuit device 20 may alsoinclude a memory device 23. The first clock generating circuit 14 maygenerate a first clock signal, and the second clock generating circuit24 may generate a second clock signal. Hereinafter, for convenience ofexplanation, an operation of an integrated circuit device according toan example embodiment will be described, taking the second integratedcircuit device 20 as an example. However, an operation of an integratedcircuit device according to an example embodiment may not only beapplied to the second integrated circuit device 20, but also to thefirst integrated circuit device 10.
The first circuit 21 of the second integrated circuit device 20 mayreceive data from the first integrated circuit device 10. The data whichthe first circuit 21 receives may be transmitted in synchronization witha first clock signal generated by the first clock generating circuit 14,and the first circuit 21 may be operated according to the first clocksignal. On the other hand, the second circuit 22 may be operatedaccording to a second clock signal generated by the second clockgenerating circuit 24.
In an example embodiment, the first clock signal and the second clocksignal may have different frequencies. Alternatively, even when thefirst clock signal and the second clock signal are generated to have thesame frequency, frequencies of the first clock signal and the secondclock signal may be different from each other by several factors. Tocompensate for a frequency difference between the first clock signal andthe second clock signal, the memory device 23 stores and outputs datausing a First-In-First-Out scheme, and may be provided between the firstcircuit 21 and the second circuit 22.
The memory device 23 may include a buffer for storing data, a writecircuit that stores the data in the buffer in a symbol unit, a readcircuit that reads the data stored in the buffer in a symbol unit, andthe like. In an example embodiment, the write circuit may be operatedaccording to a first clock signal, and the read circuit that reads thedata stored in the buffer may be operated according to a second clocksignal. In addition, the write circuit may add a symbol to data storedin a buffer, or may remove a symbol from data stored in a buffer, tocompensate for a difference between the first clock signal and thesecond clock signal. By such a process, a frequency difference betweenthe first clock signal and the second clock signal may be compensatedfor.
FIG. 3 is a block diagram schematically illustrating a memory deviceaccording to an example embodiment.
Referring to FIG. 3, a memory device 100 according to an exampleembodiment may include a buffer 110 that stores and outputs data, and abuffer controller 120. The buffer controller 120 may include a writecircuit 121, a first pointer generator 122, a read circuit 123, a secondpointer generator 124, a pointer synchronizer 125, or the like. Anypointer generator or synchronizer described herein may be a circuit thatincludes circuitry, and examples of circuitry for different elements ofthe Figures are described herein. Similarly, any pointer generator orsynchronizer described herein solely by logical functions may be aprocessor such as the processor 2, executing instructions such as fromthe storage device 3.
The memory device 100 may be provided for compensating for a frequencydifference between a first clock signal CLK1 and a second clock signalCLK2. In an example embodiment, the write circuit 121 and the firstpointer generator 122 may be included in a first clock domain, operatedaccording to the first clock signal CLK1. The read circuit 123 and thesecond pointer generator 124 may be included in a second clock domain,operated according to the second clock signal CLK2.
The write circuit 121 may receive input data and the first clock signalCLK1, and may store first data DATA1 in the buffer 110. The input datamay be data transmitted in the form of a bit stream through a serialcommunications interface, and the write circuit 121 may include aserial-to-parallel converter for extracting symbols from the input data.
In an example embodiment, the first data DATA1 is data stored in thebuffer 110 during one period of the first clock signal CLK1, and mayinclude one symbol or multiple symbols. When the first data DATA1includes multiple symbols, data may be simultaneously recorded in two ormore storage spaces among storage spaces included in the buffer 110 dueto the first data DATA1 including the multiple symbols. Each of thestorage spaces included in the buffer 110 may store a single symbol. Asmultiple symbols are stored in the buffer 110 during one period of thefirst clock signal CLK1, a data processing speed of an integratedcircuit device may be increased without an increase in a frequency of aclock, and power consumption of the integrated circuit device may bereduced.
In an example embodiment, when the buffer 110 has 2^(N) number ofstorage spaces, the first pointer generator 122 may generate a firstpointer by encoding an address for identifying storage spaces of thebuffer 110 with a first code having N number of bits. In an exampleembodiment, the first code may be a binary code. The write circuit 121may store the first data DATA1 in a storage space of the buffer 110corresponding to a first address indicated by the first pointer. In anexample embodiment, when the first data DATA1 includes two symbols, thetwo symbols included in the first data DATA1 may be stored in order in astorage space of the buffer 110 corresponding to a first address and astorage space of the buffer 110 corresponding to the next address (e.g.,physically or just logically adjacent, sequentially after or before) ofthe first address based on the first data DATA1 including two symbols.
The read circuit 123 is operated according to the second clock signalCLK2, and may read data stored in the buffer 110. In an exampleembodiment, the read circuit 123 may read second data DATA2 stored in astorage space corresponding to a second address of the buffer 110. Thesecond data DATA2 may be data which the read circuit 123 reads from thebuffer 110 during one period of the second clock signal CLK2. The secondaddress may be different from the first address. The second address maybe assigned by a second pointer generated by the second pointergenerator 124. The second pointer generator 124 generates the secondpointer by encoding the second address with the first code. The readcircuit 123 may specify a storage space, in which the second data DATA2is stored, using the second pointer.
In a manner similar to the first data DATA1, the second data DATA2 mayinclude multiple symbols. In an example embodiment, when the second dataDATA2 includes two symbols, the read circuit 123 may read symbols storedin a second address and storage spaces corresponding to the next address(e.g., physically or just logically adjacent, sequentially after orbefore) as the second data DATA2 based on the second data DATA2including two symbols.
While a symbol is stored in all storage spaces of the buffer 110, whenthe write circuit 121 stores the first data DATA1, or when a secondaddress indicates a storage space in which a symbol is not stored,during a process in which the buffer controller 120 stores or reads asymbol in the buffer 110, an error may occur. To prevent such an error,the pointer synchronizer 125 monitors and compares a first pointer and asecond pointer, and thus determines a state of the buffer 110.
In an example embodiment, each of the first pointer generator 122 andthe second pointer generator 124 receives a comparison result of a firstpointer and a second pointer from the pointer synchronizer 125. Each ofthe first pointer generator 122 and the second pointer generator 124determines a first address and a second address indicated by the firstpointer and the second pointer, respectively, with reference to thecomparison result. In addition, the pointer synchronizer 125 comparesthe first pointer to the second pointer, and thus monitors a state ofthe buffer 110 such as a remaining storage space of the buffer 110, orthe like.
Referring to FIG. 3, the first pointer may be generated by the firstpointer generator 122 operated according to the first clock signal CLK1.The second pointer may be generated by the second pointer generator 124operated according to the second clock signal CLK2. Thus, to accuratelycompare the first pointer to the second pointer, a device forcompensating for a difference between the first clock signal CLK1 andthe second clock signal CLK2, asynchronously generated, may be required.Hereinafter, the device for compensating the different will be describedwith reference to FIG. 4 together.
FIG. 4 is a timing diagram illustrating an operation of a buffercontroller according to an example embodiment. Referring to FIG. 4, thefirst clock signal CLK1 and the second clock signal CLK2 may bedifferent from each other. A first address ADDR1 that assigns a storagespace in which the write circuit 121 is to store the first data DATA1may be synchronized with the first clock signal CLK1 to be updated. Asecond address ADDR2 that assigns a storage space from which the readcircuit 123 is to read the second data DATA2 may be synchronized withthe second clock signal CLK2 to be updated. The first pointer may have avalue obtained by encoding the first address ADDR1 with a first code,and the second pointer may have a value obtained by encoding the secondaddress ADDR2 with a first code.
Referring to FIG. 4, due to a difference between the first clock signalCLK1 and the second clock signal CLK2, a second address may not beclearly defined at a rising edge of the first clock signal CLK1. At atime t1 of FIG. 4, a value of the first address ADDR1 may be clearlydetermined as 10, but a value of the second address ADDR2 may not beclearly determined as one of 0 and 2. Thus, when the first pointer andthe second pointer are compared without a separate synchronizationprocedure, as a value of the second pointer is not clearly determined,an accurate comparison may not be performed.
To solve a problem described above, the pointer synchronizer 125 mayinclude a synchronizer for synchronizing the first pointer to the secondclock signal CLK2, or for synchronizing the second pointer to the firstclock signal CLK1. Hereinafter, the pointer synchronizer 125 will bedescribed with reference to FIGS. 5 through 7.
FIGS. 5 through 7 illustrate an operation of a buffer controlleraccording to an example embodiment.
As illustrated previously, a buffer controller according to an exampleembodiment may include a pointer synchronizer that compares a firstpointer, indicating a first address, with a second pointer indicating asecond address. The first address may correspond to a storage space of abuffer in which data is to be stored, and the second address maycorrespond to a storage space of a buffer from which data is to be read.The first pointer may be generated in a first clock domain, operatedaccording to a first clock signal, and the second pointer may begenerated in a second clock domain, operated according to a second clocksignal. The pointer synchronizer synchronizes a first pointer to asecond clock signal, and then compares the first pointer to a secondpointer, or synchronizes a second pointer to a first clock signal, andthen compares the second pointer to a first pointer. In other words, thesynchronizer switches clock signals for each pointer, i.e., for each ofthe first pointer and the second pointer, such as by resynchronizingfrom the first clock signal to the second clock signal, or vise versa.
Referring to FIG. 5, a pointer synchronizer 200 according to an exampleembodiment may include a code converter 210, a synchronizer 220, a coderestorer 230, a comparator 240, or the like. The code converter 210 maybelong to a first clock domain CLK1 Domain, operated according to thefirst clock signal CLK1. The synchronizer 220, the code restorer 230,and the comparator 240 may be operated according to the second clocksignal CLK2 in a second clock domain CLK2 Domain. Any code converter,code restorer, or comparator described herein may be a circuit thatincludes circuitry or may be a circuit element, and examples ofcircuitry for different elements of the Figures are described herein.Similarly, any code converter, code restorer, or comparator describedherein solely by logical functions may be a processor such as theprocessor 2, executing instructions such as from the storage device 3.
The first pointer may be generated by a first pointer generator in thefirst clock domain CLK1 Domain, and may have a value obtained byencoding a first address of a buffer with a first code. In an exampleembodiment, the first code may be a binary code, and the first addressmay correspond to a storage space of a buffer on/in which a writecircuit is to record data. In other words, the first pointer mayindicate a storage space of a buffer on/in which a write circuit is torecord data. In an example embodiment, when a buffer has a total of 16storage spaces in which data is to be stored, a first address may be oneof values from 0 to 15.
The code converter 210 may generate a first transmission pointer byconverting a first code with a transmission code different from thefirst code. The synchronizer 220 may synchronize the first transmissionpointer to the second clock signal CLK2. The code restorer 230 maygenerate a first comparison pointer by reconverting the firsttransmission pointer, synchronized with the second clock signal CLK2,with the first code. In other words, the first comparison pointer mayhave a value the same as a first pointer, and may be synchronized withnot the first clock signal CLK1 but the second clock signal CLK2.
The comparator 240 may compare the first comparison pointer to thesecond pointer in the second clock domain CLK2 Domain. In an exampleembodiment, a value of the first comparison pointer may be a valueobtained by encoding the first address with a binary code, and a valueof the second pointer may be a value obtained by encoding the secondaddress with a binary code.
In an example embodiment, the synchronizer 220 may include a 2-FFsynchronizer. In other words, the synchronizer 220 may include multipleflip-flops connected to each other in series, and each of the multipleflip-flops may be operated according to the second clock signal CLK2. Afrequency difference, a phase difference, or the like may presentbetween the first clock signal CLK1 and the second clock signal CLK2.Thus, when one period of the first clock signal CLK1 elapses, two ormore bits are simultaneously changed in a code input to the synchronizer220, so a metastable state may occur at an output of the synchronizer220. To prevent the metastable state from occurring in the synchronizer220, the synchronizer 220 may generate the first transmission pointerusing a transmission code in which only a single bit is changed everytime one period of the first clock signal CLK1 elapses.
A first address indicated by a first pointer may be changed in eachperiod of the first clock signal CLK1, according to an amount of firstdata which a write circuit stores in a buffer during one period of thefirst clock signal CLK1. In an example embodiment, when the first dataincludes two symbols, the first address may be changed by two places dueto the first data including two symbols. Moreover, when the first dataincludes a single symbol, the first address may be changed by one placedue to the first data including the single symbol.
When the first code is a binary code, in each period of the first clocksignal CLK1, two or more bits among bits included in the first code maybe simultaneously changed. Thus, when a first pointer is input to thesynchronizer 220 as it is without the code converter 210, a metastablestate may occur at an output of the synchronizer 220, and the comparator240 may not accurately compare a first pointer to a second pointer.
In an example embodiment, a first transmission pointer is generated byconverting a first code into a transmission code, and is then input tothe synchronizer 220, so a problem described above may be solved. Asillustrated previously, the transmission code may be a code in whichonly a single bit is changed every time one period of the first clocksignal CLK1 elapses. In detail, the transmission code may be a code inwhich only a single bit is changed every time one period of the firstclock signal CLK1 elapses, regardless of the number of symbols to bestored in a buffer during one period of the first clock signal CLK1.Thus, even when the number of symbols stored in a buffer during oneperiod of a clock according to operating conditions is changed, a firstpointer and a second pointer may be accurately compared without a codeerror.
An operation of the pointer synchronizer 200 described above may besimilarly applied to a case in which a second pointer is synchronizedwith the first clock signal CLK1 to be compared to a first pointer. Inother words, when a second pointer is generated by encoding a secondaddress of a buffer with a first code in the second clock domain CLK2Domain, the second pointer is converted with a transmission code, and isthen synchronized with the first clock signal CLK1. The second pointer,synchronized with the first clock signal CLK1, is restored with thefirst code again, and is thus compared to the first pointer in the firstclock domain CLK1 Domain.
The transmission code may be selected as one of a second code definingan address of a buffer with a gray code, and a third code generated bycombining a portion of bits of a first code with a portion of bits of asecond code. As is known, in a gray code, two successive valued differin only one bit. In an example embodiment, according to the number ofsymbols stored in a buffer during one period of the first clock signalCLK1, or the number of symbols read from a buffer during one period ofthe second clock signal CLK2, a transmission code may be selected as oneof a second code and a third code. From a method described above,regardless of the number of symbols stored in a buffer or read from abuffer during one period of clock signals, the first clock signal CLK1and the second clock signal CLK2, a transmission code may be generatedwith a code in which only a single bit is changed every time one periodof the clock signals, the first clock signal CLK1 and the second clocksignal CLK2, elapses.
FIGS. 6 and 7 are drawings schematically illustrating code converters300 and 400 according to example embodiments. The code converters 300and 400 illustrated with reference to FIGS. 6 and 7 may be similarlyapplied to a case in which a second transmission pointer is generatedfrom a second pointer.
First, referring to FIG. 6, a code converter 300 according to an exampleembodiment may include a second code generator 310, a third codegenerator 320, a code selector 330, a multiplexer 340, or the like.
As illustrated previously, a first pointer may have a value obtained byencoding a first address corresponding to a storage space of a buffer inwhich a write circuit is to store data with a first code. The secondcode generator 310 may convert a first code into a second code. Thesecond code generator 310 derives its name based on generating thesecond code, but otherwise may be considered the first of several codegenerators described herein. In an example embodiment, the first codemay be a binary code, the second code may be a gray code, and the secondcode generator 310 may include one or more XOR gates. The third codegenerator 320 may generate a third code by combining a portion of bitsof a first code with a portion of bits of a second code, while receivingthe first code and the second code. The third code generator 320 derivesits name based on generating the third code, but otherwise may beconsidered the second of several code generators describe herein. In anexample embodiment, each of the first code, the second code, and thethird code includes N number of bits, where N is a natural numbergreater than 2. In this case, n number of upper bits of the third code,where n is a natural number less than N, may be n number of upper bitsof the second code. N−n number of lower bits of the third code may beN−n number of lower bits of the first code.
The multiplexer 340 may output one of the second code and the third codeas a value of a first transmission pointer according to a commandtransmitted by the code selector 330, while receiving the second codeand the third code. The code selector 330 may generate a command thatselects one of a second code and a third code according to an amount offirst data which a write circuit stores in a buffer during one period ofa first clock signal.
In an example embodiment, when first data has a first amount, the codeselector 330 may generate a command that selects a second code based onthe first data having the first amount. When first data has a secondamount, the code selector 330 may generate a command that selects athird code based on the first data having the second amount. The secondamount may be greater than the first amount. In an example embodiment,the number of symbols included in the first data having the secondamount may be twice the number of symbols included in the first datahaving the first amount.
The first amount may be determined by the number of symbols processed bya write circuit when a skip symbol is added or deleted in order toprevent an underflow and an overflow of a buffer. The second amount maybe determined by the number of symbols processed by a write circuit in anormal case in which a skip symbol is not processed. To increase a dataprocessing speed while reducing power consumption without an increase ina frequency of a clock signal, a write circuit may store multiplesymbols in a buffer during one period of a first clock signal. Thus, asecond amount may be greater than a first amount.
If the number of symbols stored in a buffer is constant regardless ofwhether a skip symbol is processed or not, a variation of a firstaddress updated every period of a first clock signal may be constant. Inan example embodiment, when a write circuit stores a single symbol in abuffer in every period of a first clock signal, a first address may bechanged by one place every period of a first clock signal based on thewrite circuit storing a single symbol in a buffer in every period of thefirst clock signal. In this case, a first transmission pointer isgenerated by encoding a first address with a gray code, so a metastablestate may be prevented from occurring in a synchronizer.
However, as a faster data processing speed and less power consumptionare required in an integrated circuit device, the number of symbolsprocessed by a write circuit and a read circuit may be increased everyperiod of a clock signal. In this case, a variation of an addressupdated every period of a clock signal may be changed according towhether a skip symbol is processed or not. Thus, when an address of abuffer is simply encoded with a gray code, two or more among bitsincluded in the gray code may be simultaneously changed. Thus, ametastable state may occur in a synchronizer.
In an example embodiment, while a case in which a skip symbol isprocessed and a case in which in which a skip symbol is not processedare distinguished, a first transmission pointer is generated with asecond code or a third code, so a metastable state may be prevented fromoccurring in a synchronizer. In an example embodiment illustrated inFIG. 5, when a skip symbol is processed, a first transmission pointermay be generated with a second code. When a skip symbol is notprocessed, a first transmission pointer may be generated with a thirdcode. The second code may be a code in which only a single bit ischanged when a skip symbol is processed, and the third code may be acode in which only a single bit is changed when a skip symbol is notprocessed.
Next, referring to FIG. 7, a code converter 400 according to an exampleembodiment may include a second code generator 410, a first lower bitextractor 420, a second lower bit extractor 430, an upper bit extractor440, a code selector 450, a multiplexer 460, an outputter 470, or thelike.
The second code generator 410 may convert a first pointer, defining anaddress of a buffer with a first code, with a second code different fromthe first code. In an example embodiment, the first code may be a binarycode, and the second code may be a gray code.
The first lower bit extractor 420 may extract a portion of lower bits ofa first code, and the second lower bit extractor 430 may extract aportion of lower bits of a second code. The numbers of bits extracted bythe first lower bit extractor 420 and the second lower bit extractor 430are the same, and the number of bits may be determined according to asize of a skip symbol transmitted periodically. In an exampleembodiment, if a buffer has 16 storage spaces, each of a first code anda second code may include four bits. If a size of a skip symbol is 1byte, each of the first lower bit extractor 420 and the second lower bitextractor 430 may extract a lowest bit LSB of each of a first code and asecond code.
The upper bit extractor 440 may extract a portion of upper bits of asecond code. In an example embodiment, when a second code includes the Nnumber of codes and the second lower bit extractor 430 extracts n numberof lower bits of the second code, the upper bit extractor 440 mayextract N−n number of upper bits.
A portion of upper bits extracted by the upper bit extractor 440 may beinput to the outputter 470.
The multiplexer 460 may select one of a portion of lower bits of a firstcode and a portion of lower bits of a second code, and then may transmitthe one to the outputter 470. An operation of the multiplexer 460 may becontrolled by the code selector 450. In an example embodiment, when askip symbol is processed, the code selector 450 may control themultiplexer 460 to select a portion of lower bits of a second code.Thus, when a skip symbol is processed, a first transmission pointeroutput by the code converter 400 may have a value obtained by encodingan address of a buffer with a second code.
On the other hand, in a normal case in which a skip symbol is notprocessed, the code selector 450 may control the multiplexer 460 toselect a portion of lower bits of a first code. In this case, a firsttransmission pointer output by the code converter 400 may have a valuegenerated by combining a portion of bits of a first code with a portionof bits of a second code.
FIG. 8 is a circuit diagram schematically illustrating a buffercontroller according to an example embodiment.
Referring to FIG. 8, a buffer controller 500 according to an exampleembodiment may include a first pointer generator 510, a code converter520, a synchronizer 530, a code restorer 540, a comparator 550, or thelike.
The first pointer generator 510 is operated according to the first clocksignal CLK1 and generates a first pointer. The first pointer has a valueobtained by encoding a first address of a buffer with a first code. Thefirst address may be an address that indicates a storage space in whicha write circuit is to record data in a buffer. In an example embodiment,the first code may be a binary code having N number of bits.
The code converter 520 may convert a first pointer with one of a secondcode and a third code different from a first code.
In an example embodiment, when the first code is a binary code having Nnumber of bits, the second code may be a gray code having N number ofbits. The second code may be generated by N−1 number of exclusive-OR(XOR) gates included in the code converter 520.
The code converter 520 may include a first multiplexer 522. The firstmultiplexer 522 may receive each of a lowest bit of a first code and alowest bit of a second code, and may select one thereof and then outputthe one. The lowest bit of the first code and the lowest bit of thesecond code may be N−n number of lower bits. Thus, the first multiplexer522 may select one of N−n number of lower bits, or the lowest bit (ifdifferent from N−n number of lower bits), of the first code or of thesecond code. An output of the first multiplexer 522 may be determined bya code selector 560. When the first multiplexer 522 selects and outputsa lowest bit of a second code, an output of the code converter 520 maybe determined by the second code. On the other hand, when the firstmultiplexer 522 selects and outputs a lowest bit of a third code, anoutput of the code converter 520 may be determined by the third code. Inother words, the third code may be a code generated by combining aportion of bits of the first code with a portion of bits of the secondcode.
The second code or the third code generated by the code converter 520may be input to the synchronizer 530. The synchronizer 530 may include a2-FF synchronizer corresponding to each of N number of bits. Flip-flops531 included in the synchronizer 530 may be operated according to thesecond clock signal CLK2. The second clock signal CLK2 may be a clocksignal used to generate a second pointer.
A second code or a third code synchronized with the second clock signalCLK2 by the synchronizer 530 may be input to the code restorer 540. Thecode restorer 540 may include N−1 number of XOR gates 541, and mayconvert a second code or a third code into a first code. In other words,an output of the code restorer 540 may be a first pointer synchronizedto the second clock signal CLK2. The code restorer 540 may include asecond multiplexer 542, and an output of the second multiplexer 542 maybe determined by the code selector 560.
The comparator 550 may compare a first pointer synchronized to thesecond clock signal CLK2, to a second pointer. The second pointer issynchronized to the second clock signal CLK2 to be generated from thesecond pointer generator 570, so the comparator 550 may accuratelycompare a first pointer to a second pointer. The comparator 550 maydetermine whether an overflow and an underflow of a buffer occur fromthe first pointer and the second pointer. In addition, as the firstpointer and the second pointer are compared, information for controllingoperations of a write circuit and operations of a read circuit may begenerated.
| 3,505 |
https://github.com/Collbook/vue-blog-api-admin/blob/master/resources/js/routers.js
|
Github Open Source
|
Open Source
|
MIT
| null |
vue-blog-api-admin
|
Collbook
|
JavaScript
|
Code
| 150 | 510 |
/*BackEnd*/
// dashboard
import AdminHome from './components/backend/admin/dashboard/AdminHome.vue';
// Posts
import ListPost from './components/backend/admin/posts/List.vue';
import AddPost from './components/backend/admin/posts/Add.vue';
import EditPost from './components/backend/admin/posts/Edit.vue';
// Category
import ListCate from './components/backend/admin/category/List.vue';
import AddCate from './components/backend/admin/category/Add.vue';
import EditCate from './components/backend/admin/category/Edit.vue';
// tags
import ListTag from './components/backend/admin/tags/List.vue';
// roles
import ListRole from './components/backend/admin/roles/List.vue';
// users
import ListUser from './components/backend/admin/users/List.vue';
export const routes = [
// Backend
// dashboard
{
path: '/home',
component: AdminHome
},
{
path: '/admin/home',
component: AdminHome
},
// posts
{
path: '/admin/posts',
component : ListPost
},
{
path: '/admin/posts/create',
component : AddPost
},
{
path: '/admin/posts/:postid',
component: EditPost
},
// category
{
path : '/admin/category',
component : ListCate
},
{
path : '/admin/category/create',
component : AddCate
},
{
path: '/admin/category/:categoryid',
component: EditCate
},
//tags
{
path : '/admin/tags',
component : ListTag
},
// roles
{
path : '/admin/roles',
component : ListRole
},
// users
{
path : '/admin/users',
component : ListUser
}
]
| 10,788 |
https://github.com/developeramarish/moh-prime/blob/master/prime-angular-frontend/src/app/modules/auth/shared/guards/authentication.guard.spec.ts
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,021 |
moh-prime
|
developeramarish
|
TypeScript
|
Code
| 101 | 337 |
import { TestBed, async, inject } from '@angular/core/testing';
import { HttpClientTestingModule } from '@angular/common/http/testing';
import { RouterTestingModule } from '@angular/router/testing';
import { MockAuthService } from 'test/mocks/mock-auth.service';
import { AuthenticationGuard } from './authentication.guard';
import { APP_CONFIG, APP_DI_CONFIG } from 'app/app-config.module';
import { AuthService } from '@auth/shared/services/auth.service';
import { Role } from '@auth/shared/enum/role.enum';
describe('AuthenticationGuard', () => {
beforeEach(() => {
TestBed.configureTestingModule({
imports: [
HttpClientTestingModule,
RouterTestingModule
],
providers: [
AuthenticationGuard,
{
provide: APP_CONFIG,
useValue: APP_DI_CONFIG
},
{
provide: AuthService,
useClass: MockAuthService
}
]
});
});
it('should create', inject([AuthenticationGuard, AuthService], (guard: AuthenticationGuard, authService: MockAuthService) => {
authService.loggedIn = true;
authService.role = Role.ADMIN;
expect(guard).toBeTruthy();
}));
});
| 34,512 |
https://ce.wikipedia.org/wiki/%D0%A8%D0%BA%D0%BE%D0%BB%D1%8C%D0%BD%D0%B8%20%28%D0%A1%D0%BC%D0%BE%D0%BB%D0%B5%D0%BD%D1%81%D0%BA%D0%B0%D0%BD%20%D0%BE%D0%B1%D0%BB%D0%B0%D1%81%D1%82%D1%8C%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Школьни (Смоленскан область)
|
https://ce.wikipedia.org/w/index.php?title=Школьни (Смоленскан область)&action=history
|
Chechen
|
Spoken
| 110 | 400 |
Школьни () — Российн Федерацин Смоленскан областан Смоленскан кӀоштара эвла.
Бахархойн дукхалла
Климат
Климат барамера континенталан йу, амалехь барамера йовха аьхке а, барамера шийла Ӏа а ду. Ӏаьн хьалхара дакъа довха ду шолгӀачул. ХӀаваан йовхачу температуран (де-буьйсан йукъара барам) мур лаьтта 213-224 дийнахь. ГӀоролаш йоцучу муьран йукъара барам 125-148 де. Цхьацца шерашкахь хаало дикка дӀатовжар йийцинчу климатан амалех. Йочанийн шеран барам бу 645-691 мм. Кхааннах ши дакъа догӀан кепара догӀу, цхьа дакъа ло кепара хуьлу. Цхьаьна эшшара лон чкъор лаьтта декабрь болалуш, деша апрелан хьалхарчу декадехь.
Сахьтан аса
Кхузахь сахьт Москохца нийса лелаш ду. Сахьтан аса йу UTC+3.
Билгалдахарш
Хьажоргаш
Смоленскан кӀоштан индексаш
Смоленскан областан Смоленскан кӀоштан нах беха меттигаш
| 30,853 |
https://hr.wikipedia.org/wiki/Razara%C4%8Di%20klase%20Haruna
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Razarači klase Haruna
|
https://hr.wikipedia.org/w/index.php?title=Razarači klase Haruna&action=history
|
Croatian
|
Spoken
| 90 | 210 |
Klasa Haruna je klasa japanskih razarača namijenjenih protupodmorničkoj borbi. Prva je klasa razarača u japanskoj mornarici s hangarom i sletnom palubom za 3 helikoptera Mitsubishi H-60. Klasu Haruna čine 2 razarača izgrađenih u razdoblju od 1977. do 1981. godine. Oba broda su u operativnoj uporabi japanske mornarice. Brodovi su modernizirani kasnih 1980-ih kada su im ugrađeni lanseri za rakete zemlja-zrak Sea Sparrow i Phalanx CIWS sustav za zaštitu od vođenih projektila. Klasu Haruna bi u operativnoj uporabi trebali zamijeniti nosači helikoptera klase Hyuga.
Izvori
Vanjske poveznice
- klasa Haruna
Haruna
| 32,965 |
bpt6k240828j_5
|
French-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,912 |
Le Temps
|
None
|
French
|
Spoken
| 8,123 | 17,246 |
50 mm. janv. 1070 1070 1070 1070. 30 Bône-Guelma.. avril 646 50 655 20 Crédit F'-Canadiea. 847 849 l/2r. à215fr. nov 17, 176 »4o/Or.à50»C. nov 39i 393 K&Ac. Marine dHomeoourt m 497 6 25 Tnarsis. mai 162.. Ib3 162 16-^ -ol M 16?à kÔbD • janv 1635 1630 1630 1630 163.. 1627.. 19 Wagons-Lits priv.. 4SI).. 477.. 30/0r.à40Ûtr.Up. -fev. J02 25 4o2 .ationa:isMexiquer.à 518.. 464 462 25 i l.iAç. du -Nordetl ^t 40/0 491 48/ Chartered 40 40 2o 40.. 40 « 40.. 40» 59 SelèaÀs: avriU27C 1368 1285 1268 22 50 Ch. de P dép'. 300 p. 612.. 612.. l • 8 0/0 American Tefe pli.. 769.. 768.. l^.alOOtf.t.p. 99 25 99 25 Nord-Espagne P'hyp.. avr. 361 50 J61 H.-|l. Ac. Dei oaintA 40 0 500 ̃•• MM Crown_ «^gv– «50 182 ,81 50 182.. 182.. 183.. *» o^ST avril 930 914 30 -jfctAljrfafcn. »g « •• Tabacs Ph.hpPide s. 327 «taSïols* 5SÎ 4 I falv tl 50 5° 50 ^&fa^ *l'll tïl §S Srfce itï 5?T ? Si «? V. sS .i 5*1 V. 12 TUmiUHBOOE ord JU1E. 226 326 226 225 f5 éo -E^toS^ SS i «5 i Ssf ™ ISa^toSsl" l«î 1M5 Z 1H ?«£$ à5W À. «7 4 9 50 | Z = |. anv 355 50 356 50 ~~1 ^jMeret* ^ï^y î" •• J» g gSdSB? de" iS^lS" 8%>U»' *° $ 12.. prior.juiU 231 229.. 229 50 929 50 25 -Midi jouiss.. mil. 539.. 539.. 40 Prévoyance 785.. 785.. ISr.àlOOtr.. oct.95 75 97 • «. 5* janv 3a9 359 Montbard-Aulnoye 41/20/0. 494 489 ,7 1? jSSi^ÎHiSiâ nov ?r! 4n ot so «350 69" 162 165 –*«»–» .gfc: {«! i«s:: »:: >«» iS̃ îS ̃2::=SSSMî5S!tS?.IS::ia:: ..1 S:: SiSSË^ffi 18 "K g S^fc •&£::»::̃ Pampelun, ^^30/0. ^225 352 356 50 ,w!.inM.ni{)rB»J !llCiïS: I SS S S tw" lls:: ,ESSA.GEIUBSM4.mT.or~ le J60.. 159.. 161.. 160, 157., 56.ordjouiss..Jan.1225..1230.. 50..B¡¡llldo-Cllille.jallvl5t:j5..1L85.. ,18J¡~s.>J/J. d~448..4,18. 114 Qi Jagersl<?ntelll. nov 1645.0 163 bo 163 50 169..162, 165.. «Ô HÊTROPOUTAW ̃ j^Oi. 656.. 655.. 654.. 655.. 657.. 655. 21 -Ouest, jouiss.. avr 472.. 472.. 50 CreUit Algérien jan. 1250 ~50 :5z.C3 g ,19» 30/Jr.à253fr. t. p ..256 50 247 Barcelone pr. 30/0.Ianv J66 50 366 50 Voitures a Paria 31/2.. avril 390 ^90 7 72 Eo. ?bondeeD fév. 68 75 68 50 68 50 .0 ̃̃ ̃̃ 3 0/0 nokd-scd DE PAÙlS jauv. -S5.. 254.. 253.. 253.. 255.. 253.. 28 75* -Ouest-Algérien. 636. 637. Crédit français 576-, 576.. g Communales 18792,600/3. 465 50 465 ..h Asturies, Galice, Leonl"hyp. 3^2 50 3o3 50 rransatlantaque 30/Or. à500l. 357 50 351 84 45 Tr-S.«S lSd J « J -n 2? 7s îl" 46 46 50 2 28oM^iBUSDEPAttis 779.. 778.. 777.. 776.. 775772.. 6 -Sud Ifrance.. juiL 163.. 165.: 16 S.-Compt' Entrepr.. 367.. 366Ûj l/5r.aKMfrmari 96 75 97 50 Portugais 0/01" ranç.. janv J33 -32150. Port (la Kosario 50/0.. janv. 504 M5 « m V^Ildain RwV j *V r« ?ir «? i* 'm 6B cl 50 8 oMKir-M lvo-wais déc. 150.. 150.. 148.. 149.. 152149.. 7 50 S"Banq.deprovince 6S8 «68.. 1880 30/0 r. 5WEf. mars 500 500 _ft 2Tang., juiU. «3 252 PanarûaOûl.est. JM.r. lOOOi. 116 50 116 E0 17 60 Village Main Keef.. fev. 68 îd 6o 2o to it tÇb bb 07.. 15 s» parisienne WDCH.BE FER. 319.. 320.. 320.. 319.. 320.. 320.. 20 DocksMarseUlB nov 420 50 423 40 S» franc.de reports 856 856S 1891 30/J r. 400 te. avr. 388 392 50 Riazan-Onralsk 40/0. 468 467 bues 5 0/0reino.5dJ. avril 598 25 599 50 ̃̃ » r– 30 c-G" française de TUAHWAYS 530.. 530528.. 52852552527 50 Magas. ^gènér. Paris. 56055855 Dakar St-Loois. 1-260 1260 .g 1892 2.80J/) r.i 50) fr. 426 426 Koscou-ICiev-Voronège 40/0. 466 466 30/Jl"serie mars 4j.i 437 Beniec Denier «,• noifflPf fiNT Deraiw 30.. C"G"FRANÇAISEDETJ1AMWAVS 530 530.. 528.. 528.. 52;> 525.. 2750 Magas.gener.parls. 560.. 558.. 25 ù",karSt-Louls. Ic'60.. 1260.. Q 181'J2,ÓÙ)!) r.à. à 533 ir 4:!fi.. 4~6 440 Moscou-IGev-Voronège4G/G. 466.. -l66.. 30NI"sél'ie. mars 43.1.. J37. Dernier AU COMPTAN'R Denier Dernier au 10 TKAMWATSCEPABISETSEISE 342344342.. 343343. 5) 34388 Eaux ((?• ftèn ̃•) jan. 21 10 25.ogentais mai fl). 578.. 573isw 2.6J0/J r. aô»J fc438 ̃ 440 MoscWindau-Rybinsk. 40/0. 464 50 4b5 -30/0 2' série mar» 4sw 428g™" AU COMPTANT «" u«™« AU COMPTANT i"ra; 10 c^PAttisiESNE DE TRAMW190 189 50 189 50 189 50 37 éo Gaz France-iStrang' 900.. 91523 8-2 SanU-Fé (ch. de f). 82» 50 ? Y »04 30/0r. à50ûfr. mars 4* •̃ 493 Nord-Donetz41/2 0/J 504 504 B9nsde coupocu. nov. S7 25 «6 75 «™« R"en° .ip.. C"" 11 VOITOBES iv0*" 514215 ̃̃ 214210210 210S0 Omnibus jouiss. 362363.. 32 5u Tramways Houeu.. 702.. 639191230/J r.a2SJt;30t.p. 2,1 250 75 Volga-Bougoulma 41^ 1908. 499 4B8 50 Domaniales Autrichemars 305 304 ^7– • 12 50 Tramw. Bordeaux.. 25885968 Eaux (C» G") jouis.. 1600 1690 fions à loti de ,100 fr. 64 64 50 ̃ «^«O• • ^7 •466 Çaceresdadrid avril 165 166 iï 26 Banque mexicaine 15 Caooase. dèc. 505 1250 ASSOCIATION HUnEBE. mai «22.. 216.. 219-2164 KstParbien (prior.; 7574si Eaux Mf »*"«>>)̃• 520 algériens. 63 25 63.. S,d-Est Russie 4 1/20/0. 497 51) 498 boya^o/o. mars 463 461 {g 03 Crèd¥mobUlerfr parte 357 MittasPedrafflâni 25boLéO mal 827 829 823 824 As .Uas.mai i 9293S0 Eaux p' l'étranger.. 375 376 Banq.hypot.iWce.. fev. 542 547 Saloniq.-Constantmople 30/0. 333 CoMouf IRnîe30/0r^i"5MfV 44S 5° 8 Soc" Lorraine Liétrich »Î4 èé Djëbel-Ressas-T. m-ars 35 héTABX nov. 824 82055 Elect-MétaU. Dlves. 561. 80 Eiab'therm' Vichy. 2041 2085 3 0/OUH. mars 414 50 412 50 50 Saragosse 1" hypotu îauv 362 Cordoue-bevule30/0r.a500f. j53 25 ._4.. 51 M. Zinc de Silésie. mai 1524 !T Sas GBMHES août. 285 2â9 287 284 287 285 il 50 Maliidano. juin 601 587 lte Edisonjanv. 957 950 Weubles de France. 4W 175 l;5 V W 354.60 &4.50 Victoria-JdmasoO/ ar.a^f..433 5tt 433 50 j 30 K. Dmepro vienne. janv. 2436 ^M vSine-Mo^tagne.nov969. 55 Ponarroya juil 12->Û 1220 Eclairage electnq205 206 47a 207. 206 3« janv 355 357 Land Bank ligypt. 31/Jjanv. 3S8 386 4,> Mines Bruay. fev. 1414 <ljï Vy titahConner ianv 341 rtlS0SOEZ janv. 6246 6212 6a:o ..6235 6199 6190 •* •• ^onarroïa Jou. i«u i«p jâ éô eSScI Utu méîit. 440 442 I vUlTd1 Amiens 40/a. mai 114 50 115 50 50 Smyrne-Kassaba40^9|. fèv. 437 436 Creditfouç.egypt.31/2. avril «8 435 50 100 Ozeladz mai 2&flO J O UtahOopper. janv 341 S7 -̃ D^AMlTECEirrRAtE..» nov. 802800795,. 800. 797795Panama ol>.b.àlots. 134 25 134 20 6 Est Lumière. déc 193194BordeauxlSSUO/O, fév.. 503 502 J40/09Î. fev. 424 50 6ucreriestlalUnerie Kgypte. 517 50 517 50 i Ekaterinovka 575 41 Hotchinsoa ord. oct. 725. 30 thomson-hodston. juill. 8io.. 812.. 8iO812811811 145 30 S ezjouiss jan. 5625 S250 S» HavraiseEn.iîl.. 607.. 610.. de Blois 3.40J/0-. ,478. ̃ Wagons-Lits 1" seno A 506 501 4s M Harpener nov 320 Monaco jiov. 5500 10 c'" parisienne DISTBÉLBCTB 565555555565 S2 42 Sueïpirtsfondat'2910 2905 6Ouest Lumière, dec 197 50 Coïnao 3 1/2 0/0. 473 Ann.LèrouvulePç^500£r. mars 552 5j1 ̃ ̃ < 0/0 ABGEKTJN 1898 janv. 91 s2 20 g-j 25 92 40 146 30 Suez Soclètéoivils.. «05 1 1 66 Fore motRhône p. 95»., 960.. Coiistantiae33/4.917 .Sord r. a 500 tr. janv. 392 :i_l ̃̃ l.1 ̃̃̃Ll ̃"̃ ""̃'̃»" -Jim! 4 1/2 2 Intér. 19U-. janv..97 12 9712 97 97 10 97 15 97 15 1-2 Ktab" Orosdi-Baçk.. 2192198 75 Kel. Chaut. Fmotr. 289290 de Lyon 30/0JuUl. 113 112 25 OrléansOhjuons. fev. 90T~/r m o A T ra. C O a ~1 i 0/0 bbésil 1889 avril 8645 86 50 86 50 86 55 80 60 86 60 27 Korcosmotr. Rhône 671613 30 Ga* et Eaux.. janv. 628630.. I idarseUle 1ST73W. janv. 409 75 408 Qtde t. routes Algérie 40/0. Î0 25 721VL Ji. ±6 O Xi Ji O Jij i JOÙ jfi. J.N tjJii JXr KT» 4 0/0 ÉGTPTB Unifié. nov103 103 20 10310330 2133Printempsord.doc 450 448 ..] 60 Ga2 centralavril 16U6 169$ g St.azaire 31/-2. 460 462 B lenosAires 41/20/0. 410 7a 441 | ̃ 40 0 EXTEBiECBB• avril 9465 9490 94 85 94 65 94 75 94 75 17 77 priv.dec. 335335 i 13 75 Gaz de Paris. jan. -299 50 300 1 Bône-Gaeuna 3 0/0. fer. 403 50. 404 50 Métropoutain i l, M/0. 4a6 4oi &o inMDRES Pr.dJL B'coars L0HDRE5" Pr. cUL Drcoirs BRUXELLEÎ tt.tlil. D'coun S'-PÊTE85Brs Pr. dit 0r eoars Îl/2,TAL1EN janv. 8470 94 50 94 60 94 75 94 50 94 50 7 09 Raffinerie Say ord" 375 385 37 50 Union des Gaz. ]an. 785 775 50 I Ch. Départ. 87-1905. avr. 40i 397 ,7;K ,_>, s.40'™ îP îa? 1 Ar™nl 9* ws -ns Ja"ersfOii 'b 1/2 k 'nni ùmm Bp^lles 1H8 1150 Ens« 40A) 1S94 ̃ 9'1« si ih Aisia .icniciis 1905 ianv. q% "iS <» s-, »k oi 91 qi 9/1 qa f, n r.n Riapiricitéde Paris, (vu «9a a 86-195iavr^ 396 395 • •Jotrentais(On.dei.)4</»mars 48a 487 Argent. ̃• 26 1/8 27 ii <ia.er»ioji.. 6 1/2 & W/J2 "»qu isroxeuebntv ii&o auase^u/o io»» y. i^ n ij t 010 19C1.ars 104 1.0;;6010490 loi go )5..Sl8ind'8Telephones 285. 5750 Houill.Do,mbrowa. 1562. 1563.. -Eèc)[lomiques. ;,nov400,4.o(51) 1i0lI)ma.rs50~508,. 00IJL~sOild6s781/ 181/4v!li.~Nel'eJ: 117/32,I.gl'lwpor~s¡) 1560. 1560. 50/~) luoti 1.0362 l03i5 ~Op.~<.A~J~. ~0 6625 '6635 ~4~ '6580 '66~ ~P~ ~AS'?~ ~4027540250 N.rd-S.d40/0.473..4735o! ,o. .1,* ioà Lo~ely~ 3~6 ~J~~ ~M'50850~'R~~ 1 ni & AvirrlAtArn.avril 7ft 15 7« on i(ïi fiT-mn. iï I1OV'2M VAd** I Hat "ï ft/Tï dec. 416 416 Japou*ui> gg ](4 yb 7/b ocnaiuva lu4 o/o 4ii/o ^h uuu.trein.er du/ ou juo ou ivusbo-ajsi.. xas 4 0/0 BCSSBConSoUdél»et2.S. avril 9490 S4 60 94 65 95 80 95 40 95 40 L & A?gen&07..déc. sî? M7 EtcTmbrera-Bley. W6 87? I ^300 nouveUeâ., mars 409 :« 409 ^ioPuerto-BelgranoôO/O 459 459 Tu"vJ» l* M 1/4 »*/» ,È Ttoo-Ï^o *%& f4 ù toi 5° ffi ;0/0 1891 avril M 40 60 10 80S030 79 95 -79 05. 2520 190». mars 512 51330 lir.vo.-Ko^ 1326 1325 I -2 1/2. j_anv; 376.50 374 Santa-Fè 50/0. concordat.– 702 702 BresU 1^86 12 36 1/4 Aihant uo.. 1 5/lo 1.5/.lb i« Bio-iaueiro639630 >rt ̃ _ft5_ï>_SPM 3«R ̃=('» 3M iO/0 ..̃:lS9j3^».>iév.. 7940. 79.. ,79. 79 30.79 15 79 15 4 0/0 Autriche or– avr. 97 15 97 05! 17 50 Lfturium-juu.397 50 390 I Ardennes. janv 410 412 Tramw.Bordeaux40M.. janv, 191 490 50 ̃ ™>->01 00 78 ^nuoons. U.. SOSO uisy. tONDims&MEïlco macs 550547547.. 560557.. 558251903 jan. 510 510 Dyle et Bacalan.. 385 ..̃ 385 i g 5» SSaM _joc__s de Marseule 30/0 J89 388 Chicag-Mil. 113 1,2 (, g^^ u u2JÎÏÏ'(_fgatttL; in« inOT 0 Méâj S=-p' '44 Si 28 24 b-CBKTKALE MEXICAINE, janv. 3*6397.. 397400400 400 Congo (Lots 18S8).8250 82 Efkwlis-DecauvjUe. 162160 I ~f_h7nntLoïà "ianv _îûS 4*0 5o Uoclcs de Kouen.40/0. 502 .• ^ïorRO. 201,2 m <« Oocks d& Santos 085'" "kSSi W 4m" S2 80»_5p-OTTO«AHB«0f.p. J..U1 686 6S7 685 690 69J 691 3 1 2 UaSoisSwi jan 94. 40 _?Wes-LJle. lu64 IU60 S « ~y^t&^°St^r. m tfi 50 EntrepôtsMag.geu.Parjs4o/u 492 50 492 GreaUW • iSo -̃•••̃̃ ^tmf' lô W-2 90 l 2 NEW-rflfi,< OIÎffiTO! B^kou ?3o" 22 50 B. IMP ~TTOMAN C po J i1l 686.. 6~7 ti85 690.. 69J.. 691 31/2 DanoIS 1JO,Jan 94. 40 l'ives-Lille. 1u04 11)61) .¡ v, to IÍ:!62' 'a '40' 4 0 Entre po,S &. _¡.(.gell. Pa.r¡s 4 0(0 J9! .50 492 Gre¡¡,t'~°l',t. 13a. Russe Allem. SI il~ 81 3,S NEw.y~a ( OUIIRTURI LeIl8kouiI. 3795.. 36(;0., -DE-LA 822.829 829.. 820.. 824. 823.. ~Mm~ 9720 9545 ~A~ lC r-Illo vr.. 40.. C" genél'aleaesEaux30/0.24.. J25.. 'Lond.Bl.'1g. 117 "~5~ -83i~~Ë ë 536.. .Cilmwivm» fev. ,63.. 764.. 763.. 76376576530 Ha^g6 500 déç. 516519g For#. et^^d^ m80 1099 |0j0aouve»es 408 407 g^â^iiÉw.' ^"» S éô ÈIT^l 13 16 ^/âo^& 3 8 Sî 3 8 ^^t && .f: f. Ko^X^ 4U 2^ «.* AHBAMI». juin 316 316 314 3.6 316 316 3 o/O HoUandt °.JSSs "U 25 75 Schn'eidefe. O. f^ %& g fotd fc.̃«» îw 417 ^P^!)A«l'Jfle*Wi> 352 353 OlU> 7 1/8 7 1/8 HandelsS. ;«?{*!« 3/4 b^Ooumw. ,2 7<| ^̃"i tflEBH. 290~ '1F.'1'. A1IDALOUS. Julll 316 316 314 316 316 316 30(0 Holland!3" 1I!ars 832;; ';5.. ..schileid er et 011. 1890.. 1~81.. :¡ or(, 1 0 416.117.. c"Par"Ùlst.ù~ect..33/40/ù.. 352..3:).. CrownMin 17 i/s /4 ~¡¡,n4elsg. :613/4 ~67 3/4 ::iteelvom1l?-o!1. 172 112 17~ 112 VIEUM11 34 5_AOTRICH-HONGBOIS. janv 731 ,g0 Tgo ,83 4 0/0 Hongrois jan. 94 35 94 45 10 Moatbard-Aalnoye. 234. 234.. I g 30/0 nouvelles avr. 412 75 412 25 s>i<lect. Paris 4(V0r5001 r. 488 492 I bastlUna. 3 3/ ft 3.1/4 Ore^t «9.1,4 »W 3/4 {_^lJ[^g; • }" j 1721f «ItBSa £8 49 BHAZlLRAlLWArcv– avril 574583583579 15 Victor-Emmanuel360 50 361 50 12&0 TréUleriesdu Havre 263 261 I S 21/2. avr. 369 372 Energie eleç. du )» 0 0 1 ^500 504 50 M I Woldiields. 4 11/ b 4 5,8 B,( We 57 18 57 1 4 Penn^ylvanu.. 25 1.4 •̃• • S Autpichl -99 ~L<!BBARDS. 112.. 113.. !13 607 606 606 § ~a~: 25 5:16 ~ar~ 50 325.. :I! ,Iord-Est30(!) ~v 4Î2 25 50 ~de~ 75 ,l1oJ.ùel'IOn !l7Ílô 2~ 16 1~ ~7 ~d.T: Autrlchleus. '128.,729.. ~S.~?TEi-An.WAT~ nov 59~ 607.. 606.. 606.. ?n/nM~innoorl'9M avr. 521 2;; 521.. ê"h~vra!se M7 Sc 188430/0 janv 4M 50 m 50 E~n"mectricit.él"série.49i). ~75 Modd!3rC. 117/32 2 i5/!< Prince Hry 1613/4 l617/8Cnosap.OhM.. 793/4 .7. A!i)mes. 939.. 10ô ~>0 15 NITRATE Il;AIL1VAYSo. nov. 38ô.. 388 387.. 382.. 386.. 3M.. 40/0 Mexique or 19<». ~I. 25 Compa.,g1<8havralsc 587. 188430/0. avr. 407 Z~O 408 95 C"genl.E1ec~r1Clte 1"serle.4.g¡,196.. Ranlilont.. 117.'32 1 5it; l'l'mee Hry 13", 1! 1617(8. enesap. .110 718 .1. ~J¡u.es.939.. 94400 S~S ~?~ 466 466 464 468 468 467 ~2 ~o~ 95 55 93 75 70 ~M iSo 1:50 ~r: 363 50 364 N5 50 ~dM~ 6 25/32 63/4 1.~ 718 7/8 S9 35 89 19pe&. NORD DE L ESP~G~E. J 466.. (66.. 464.. 468.. 468.. 467 3 1(2 .,or~ege 1894. avr. 95 55 93 i5 140 ElAoJl" Duval.. fév. 1040 lu50 .i Y. Ceuttut. HO 1/8 .1. 9,66a,).is.ùu.~ 89 35 1>9.. •̃ railWAYS El ÉLBOlft" 862.. 862.. 862861860 50 85822 50 01). Tau. portugais. 50150 502.. 7&0 Galeries Lafayelte.. 128128.. I G' Centrai 1855 janv 410 410 ii-orce Motr. du Rhône. avrU 486 489 •• 1 ^ohl°rf^ 5 i o5.? ',?£ lf__£_i5* ?22 i.? ?& l!-j aojk l_U_d lî| «r»SS C37 SmSABAGOSSE juilL 45845& 455456453 4574 0/0 Houmainlsi».. nov 95 50 95 10 Lits militaire* 670660 I Ouest30/Ù janv 412 413 Tnomaon-Hous OU4J/0. anv. 48S 486 J Ueop2 11 6 2 1 16 g**?* »3M 1» 3,4 aoJt l*iund. 29 |? ?',5 LSSwSaSL' ̃ 537 -M S6 1ÛMES1COTBAMWAYS. fév. 615 613 613 621 617 617 40 0 Bussel*31-lîi69. nov 98 20 95 90 75 Bec Auer avr. 1900 1895 I 30/0 nouveUes. avr. 403 50 410 ïèléphoues 40/0 janv. 432 478 I R<^>Oeep. 37 16 3 15, 3i ^"aV18} | "1 • • fSelterï ÏLA SeWtvf' m 7o 113 50 111.. WAGONS-Lll'SOr, 1l1a.U'e. mai 471 4'73.. 413.. 472.. 4iG 50 47.0 50 40/0 1&0. nOv.95 95 9590 25 Petit Journal.. Mai 486..J8S 21# avr. 366:t5 366 2:>. ,1>in1mel'&:J. i 1"4-i 1 ,4 J30cilumer.. 231 1/2 23~ 1(4 SlIlelter. 86 'I', .1. ¡;teilLe djr~~ ,r,~ .1.~ 11370 113 50 19wagons-lits ordinaire, mai 171.. 473473472470 50 470 50 40/0 1880 nov »95 9590 25 Petit Journalmai 4S6 485 j 21«.. avr. 366 •& 366 2» ,11?.™ W'ii ïi'i p^ni^ Sii« «KlI ,|S i ̃ i& "T lii 70 ni M 2 50 bbiansk ordinaire juttl..87485484.. 48548747040/0 1*9 mars 94 10 93 85 32 Petit Parisien (p")517 30 513I OuestAlgérien 3 0/0 mars 404 404 75 g< £ta?i:S?'. *J(0 • 472 467 50 I lrai^old 2 3/| |3,8Pneiu^ «3ft M Canad'paoifi;" ™ V/5 Zi i'ik nrfus 50 Ii. Blo-T1N~ ordinau-e. nl!Jv 1984 1977 1971 1980 1975.. 1965 400 lSJO(2"3'eml:l¡ 9300 94 25 10 p~a~ 50 325 50 La Réumon30IG. JallV 405 75 394 ~~y~~ 4¡)~ .407.. Villal!e~ 25,8 2 i S SS-' J~. ~7 95 •SS:SSSaSS&r.j3gJ «::«:: S:: S:: îî?:: 265:: il',l z ÎSS:£S 83 SS' S ::wo--bA»SS ̃:&• fôg^&fà^i^398:: = *$$%£%£1 -gai {$%£} ^i ^^SS: gig l^Sî^ |ij": fSS I >? a .KSSSfflSrja fi :S::JS ::«::«:«» 'é z 1nfcr:S SS !?::|: ^ÏÏ»Sg:: ay ^m^v^^ z fB^È^ if 2 ^S "M "À &^ I?! lïH3S: I g I=F: S SO.. tabacs ottomansavr 356.. 346-346.. 356 25 12 Sao-Paulo B. du Tr. 507.. 508,. 45 TèlégiN .soïd.janv. 86s S Picardie et ilandra janv. avons vu l'appareil pencher complètement d'un côté, le dessus du monoplan nous faisant face. Et l'appareil et l'aviateur se sont abîmés sur le soll. Dans cette dernière partie de la chute, l'aviateur se trouvait complètement dégagé du monoplan. On voit qu'il est difficile, malgré tout, d'affirmer Le suicide ou la chute accidentelle de l'aviateur Verrept. La disparition tragique de ce pilote sera vivement regrettée dams les milieux où il était connu et apprécié. Né en 1888, à Anvers, Verrept, fils d'un important industriel, s'adoiina de bonne heure aux sports. Il pratiqua successivement le football, la natation, le yachting et l'automobile. Venu à l'aviation en mars 1911, il obtint en neuf jours son brevet de pilote sans avoir eu la moindre « casse ». Verrept participa au Circuit européen d'aviation, mais dut, après trois étapes, abandonner son appareil 'à Védrines, chef de l'équipe à laqueLle il appartenait. En juillet dernier, il battit à Kiewicz l'es records belges de durée et de distance par 4 heures 35 et 380 kilomètres. Il fut ensuite chef d'école à la Vidamée .et l'était encore hier. A noter ce détail depuis un an qu'il volait presque chaque jour, Verropt n'avait jamais eu le moindre accident, même matériel.. Sa virtuosité était ^extraordinaire, et c'est surtout pourquoi beaucoup se refusent à croire sa mort accidentelle. Verrept n'est pas le seul aviateur disparu dont on ait dit que la mort fut le résultat d'un suicide. Quand Gecil Grâce se perdit en mer en effectuant la traversée du pas de Calais, le bruit courut que le pilote anglais ne pouvant, paraît-il, épouser une jeune fille qu'il aimait, était allé volontairement se perdre dans la mer du Nord. Depuis, rien n'est venu confirmer ce bruit, que nous ne rappelons qu'à titre documentaire. Une autre mort en aéroplane, celle du capitaine russe Matziewitch, fut mise sur le compte d'un suicide. Mais cette fois, les renseignements fournis à l'appui de cette opinion sont plus précis. Le capitaine Matziewitch était, paraît-W, un terroriste qui avait été chargé de causer la mort d'un haut fonctionnaire russe qu'iil devait emmener dans les airs. Le voyage aérien fut effectué, mais l'aviateur nihiliste n'accomplit pas le geste que certains attendaient de lui. La chute mortelle dont fut victime au lendemain de ce voyage le capitaine Matziewitch ne fut, a-t-on dit, qu'un moyen employé par J'officier pour échapper à la vengeance que ses compagnons voulaient tirer de lui. LA COUPE POMMERY Dix aviateurs sont actuellement engagés pour disputer la prime semestrielle de la Coupe Pommery qui arrive à échéance le 30 du courant. Signalons à ce propos que le montant de cette prime est de 7,500 francs et non de 4,500 francs, ainsi qu'une erreur typographique nous l'a fait dire l'autre jour. Los dix aviateurs engagés sont Gibert, Bobba, Védrines, Frey, Brinstejonc des Moulinais, Chassagie, Gordon Bell, Guillaume Busson, Bielovucic et Prévost, auxquels viendront, sans doube, s'ajouter ds nouveaux "candidats". :i '̃ '̃ On sait que la prime précédente de la' Coupe Pommery a été gagnée par l'aviateur Védrines qui voia de Paris à Angoulême. MANOEUVRES AÉRIENNES MILITAIRES Hier, le capitaine Casse, chef du centre d'aviation militaire de Pau, et le maréchal des logis Peierstein, pilotant chacun un monoplan BLériot, ont participé à une manœuvre de garnisoneffectuée aux environs de Tarbes. 'Les deux aviateurs ont reconnu les positions de l'ennemi, représenté par le 12. régiment d'infanterie, et ont transmis des renseignements au colonel du 18e régiment auquel ils étaient affectés. Ils ont ensuite regagné l'aérodrome par la voie des airs.. OFFRE D'UN HYDRO-AÉROPLANE A LA MARINE De Monte-Carlo Les touristes français de Monaco avaient ouvert une souscription en faveur de l'aviation mi,litaire. Les différents groupements qui y ont pris part ont eu l'heureuse idée d'acquérir l'hydro-aéro s'inscrit à 1,772, le Crédit lyonnais à 1,503, la Banque de l'Union parisienne à 1,203, le Comptoir national d'escompte à 938, Je Crédit mobilier à 677, de Crédit français à 575, la Banque privée à 458. Le Suez s'alourdit a 6,212 et 6,210; la ThomsonHouston est très ferme à 812; la Distribution parisienne d'électricité consolide son avance à 564 et 550, le, Secteur Popp à 905 et 901; le Métropolitain est à 655, l'Electricité et Gaz du Nord à 443. Les valeurs industrielles ont été très, animées. Lâ-Sosaowiee_ s'esKavancée à i,740 -pour-?reveuir à 1,697, le Naphte de Bakou a monté à 1,437 et 1,425, en bénéfice de 27 francs; le Naphte russe a passé de 489 à 483. Les mines d'or sont bien ténues Randmines 172 et 170, Goldftelds 117, Crown Mines 182 et 181 50, Robinson 132, East Rand 83 50 et 82 75. La De Beers a varié de 511 à 508 et 509, l'Utah Copper de 339 à 338, la part des Chantiers de Nicolaïeff est à 165, le Naphte Lianosoff passe de 616 à 606. Trois heures. Le marché est résistant le 3 0/0 cependant reste lourd à 91 95. Le Russe 5 0/0 finit à 106 50, le 4 1/2 0/0 à 101 50, l'Ex;térieure à 94 80, le Turc à 89 30, le Serbe à 87 12, le Rio-Tinto à 1,971. 3 heures 30 (derniers cours). 3 0/0, 91 98. Caoutchoucs, 160 50. Cape Copper, 169 50. Chartered, 40 Crown Mines, 181 50. Dè Beers ord., 508. East Rand, 82 50. Goldfields, 117 50. Hartmann, 799. Lena, 120 Malacca, 340 Maltzoff, 882 Platine, 808 -rRandmines, 17150. Robinson Gold, 130 50. Shansi, 43 50. Spies, 36 75. Taganrog, 590. Tharsis, 162 ~5 B,.lgareI8:J1>¡anv. 506 50 5ú8 50.. Longwy. 1576.. 1515.. -ùaup III .0.. Var et Gard ,50/0. 465 Union Pac, 176. 177,5,11 lÜlaL'1Lum. m. 73..8 7 3î8 !Sarl'euruck.N. 9995.. W3J Baltlqlle Wa., 237:. ,236. plane qui s'est classé premier dans te récent concours et l'ont offert au ministère de la marine. LES. SORTIES DU « CAPITAINE-FEHBER » Le dirigeable Zodiac Capitaine-Ferber a effeetoé hier matin une sortie de 2 h. 10. Etaient à Bord les lieutenants Joux, pilote; Lercy, aide pilote; le colonel Bourgeois, l'amiral Fournier et quatre mécaniciens. L'équipage a pu suivre tout-es les phases de l'éclipsé et &n a pris des vues photographiques intérossjiiites. UN SERVICE D'AÉROPLANES A TRAVERS LA MANCHE Le Standard annonce qu'une compagnie française de navigation aérienne a fait hier des propositions à la municipalité de Douvres dans le but d établir un service à travers la Manche par aéroplanes. La compagnie désirerait, paraît-il, commencer ce service en-juillet et le rendre permanent. HiPPISIME LES COURSES CLASSIQUES.DE PLAT DE 1912 Un ouvrage sur la génération des chevaux de trois ans, qui vont entrer en lutte dans les grandes épreuves classiques de l'année obtient en ce moment un très grand succès auprès des sportsmen. Ce livre, paru ces derniers jours, donné toutes les performances et les records chronométriques des temps de chaque cheval, la nature du terrain, la désignation des hippodromes et des distances sur lesquelles il a couru déjà, les prix qu'il a gagnés, les concurrents qu il a battus ou par lesquels il a été vaincu à deux ans, c est-à-dire l'année dernière (en 1911). Sous la fiche de chaque cheval se trouve un tableau destiné à recevoir les nouveaux records chronométriques de l'avenir. Afin de permettre aux sportsmen de tenir leurs fiches à jour, les éditeurs de l'ouvrage viennent de publier une plaquette donnant tous les records de temps de ceux qui ont été vainqueurs du 15 mars dernier au 14 avril inclus. Courses du Tremblay La réunion d'hier au Tremblay aurait été plus intéressante encore, si dans l'épreuve importante de la journée, le prix Edgard-Gillois, le champ avait été plus fourni. L assistance était très nombreuse et le temps très agréable. Le prix Edgard-Gillois (20,000 fr., 3,800 m.) n'avait réuni que trois concurrents. Le Sopha (Garner), à M. Jean Stern, l'a emporté très facilement de quatre longueurs. 2e Bénédictin de Soulac, 3e Traversin. Pari mutuel 29 fr. et 17 fr. 50. Equateur IV (Reiff), au comte de Saint-Phalle, et Veglione, après une lutte très sévère qui s'était engagée au milieu de la montée, sont arrivés dans cet ordre, dans le prix Fervacques (4,000 fr., 2,300 m.), 3e Kyrielle II. Pari mutuel 41 fr. 50 et 25 fr. Onze adversaires se sont présentés dans le prix Slat-dash (4,000 fr., 2,000 m.) la victoire Ôstrestée au poulain de M. VeïlLPicard, Eleusis II (O NeillJ, battant Durance 2° et Marie-Anne 3e. Pari mutuel 54 fr. et 28 fr. L. G. ZsIBmLIJFtlE! fies grands musées du monde en couleurs pour un prix inconnu Jusqu'à ce jour Le succès de cette publication a été considérable dès son apparition. La première édition est déjà presque complètement épuisée. Rappelons que le premier fascicule n est vendu que Otr.75 au lieu de 1 fr. 50 et que la librairie Pierre Lafitte et Cie, avenue des Champs-Elysées, 90, envoie franco les conditions de souscription à la première série complète qui donne droit à de nombreux avantages. INFORMATIONS FINANCIÈRES Emprunt extérieur i i/% 0/0 or de la province de Buenos-Air^s. • Le 30 avril, le gouvernement de la province de Buenos-Aires procédera à l'émission d'un emprunt 4 1/2 0/0 or. de 25 millions de francs, représenté par 49,603 obligations 4 1/2 0/0 or de 504 francs nominal portant jouissance du 1" juin 1912, et remboursables en 39 années, à compter du 1er décembre 1913. Ces obligations gui rapportent par an un intérêt Vte'22 m 68 or; sont émisés à 93 M/0, soit £ 468 fr. 72 par obligation de 504 francs, payables comme suit 100 francs en souscrivant, et 368 fr. 72 à la libération du 25 au 30 mai prochain. Toutefois, afin de tenir compte aux souscripteurs de l'intérêt à 4 1/2 0/0 sur le premier versement de 100 francs du 30 avril au. 1er juin, il sera déduit du versement de libération 0,37, ce qui ramène ce versement à 368 fr. 35. Sans tenir compte de la prime de remboursement, elles of-. front, au taux d'émission, un placement à 4,84 0/0 net. Cet emprunt, dont le produit est destiné à la construction du chemin de fer provincial de la Plata au Méridiano-Quinto, fait suite, et est en tous points assimilable à l'emprunt extérieur* 4 1/2 0/0 or de 1909, tant au point de vue de ses garanties que du service d'intérêt et d'amortissement. La souscription sera ouverte le 30 avril, et close le même jour, au Crédit mobilier français, rue Saint-Georges, 3 et 5; chez MM. Bénard et Jarislowsky, rue Scribe, 19; et chez MM. Louis Dreyfus et Cie, rue de la Banque, 4. Les souscriptions sont reçues dès à présent par correspondance. BULLETIN COMMERCIAL LA VTLLËTTE, 1S avril. La vente est lente sur lé gros bétail et' en particulier sur les taureaux. Ces derniers fléchissent de près de 50 francs par tête. Leveau s'améliore sensiblement. Le mouton se traite avec plus de difficulté les algériens font leur apparition. Le porc doit être vu en légère hausse; les hollandais se vendent bien. ^.w.iAnîeVen1" 2= 3= P£«F_Ï!22£-^ nspece j nés dus qte qté qté -0]^ poids vit Bœufs. 1.4911 1.417J1 90[l 80Î1 56ll 40à2 .» » TOàl 20 Vach". 74l! 7031 88J1 76il 52!1 36 2 »» » 68 120. Taurx. 2241' 21811 62!1 5611 4611 36 1 66 » 65 » 91 91. Veaux. 1.231 1.1S22 46|2 30 2 10|l 76 2 60 » 96 1 56 Veaux. l.33l!1.lS3346!330'2lO!l7ti 360.96 156 Montons. 12.S19 io.972'2 6012 40:2 20)2 »» 2 76 l.»« 165 Porcs., i 3.128 3.12812 11!2 05i2 »»!l 86 2 17 1 30 1 52 Peaux de mouton selon lame., d îr. a b au Arrivages étrangers: 382 moutons algériens Renvois figurant dans les arrivages: 92 veaux, 50 bœufs, 7 vaches, 5 taureaux, 763 moutons. Réserves vivantes aux abattoirs le 18 avril au matin 999 gros bétail, 519 veaux, 3,679 moutons. ̃Entrées directes aux abattoirs depuis la dernier marché 974 gros bétail, 1,721 veaux, 11,653 moutons, ;>3j(U3 -fieras.-̃̃-̃ ̃̃̃̃• .< HALLE AUX BLÉS (17 avril) Blés. Le marché, très ferme au début de la séance, a été un peu plus calme par la suite. La hausse, comme nous le signalions déjà hier, se maintient à 50/75 centimes sur les cours de mercredi dernier. On cote aux 100 kilos nets gares d'arrivée ou sur bateau Paris ou dans les gares environnantes blés roux de choix 30 25 à 30 50; bonnes qualités 30 fr.; qualités moyennes 29 75. Les blés blancs sont tenus 25 centimes de plus. avoines. La fermeté persiste on signale une hausse de 25 centimes. Le rapproché est tenu plus fermement que l'éloigné pour les affaires conclues à terme. On cote: noires de choix 23 50 à 23 75; dito bonnes qualités 23 25; dito moyennes 23 fr.; grises de Beauce ou de Brie 22 75 à 23 fr.; rougettes 22 50 à. 22 75; Ligowo 22 50 les 100 kilos bruts gares d'arrivée Paris. Seigles. Les affaires sont pour ainsi dire nulles; les cours s'inscrivent sans changement. 11 y avait acheteurs de 21 25 à 21 75. Paris et les environs seraient vendeurs à 22 fr. Orges. Les orges de mouture accusent une baisse de 50 centimes la demande pour la brasserie est nulle. Les cours élevés s'opposent à ce que l'on achète de l'orge pour la nourriture des bestiaux. On tient 2175 à 22 50 les 100 kilos nets gares de départ, Graines diverses. Les 100 kil. nets gares ott ports d'arrivée: petit blé 18 à 21 fr.; millet blanc 36 50; dito jaune clair 28 fr.; dito roux 24 fr., le tout à Paris; chêne vis de Mandchourie 28 50, le Havre dito de Russie 32 fr., Rouen; pois Jarras 28 fr., Paris maïs Cm-, quantini choix 24 fr.; graine de lin nettoyée grosse 51 fr.; soleil 31 à 40 fr, Paris. Graines fourragères. Les affaires sont nulles sur les trèfles, mais actives sur les luzernes. Le sainfoin accuse un peu de baisse. Oncote aux 100 kilos gares de départ dés régions de production: Trèfle violet (nominalement) 140 à 180 fr. Luzerne de Provence décuscutée 140 à 150 fr.; de pays 120 à 140J1V marchandise extra.– Minette décortiquée 100 -à1 105 fr.; en cosse 60 à 63 fr. Sainfoin double 55 a, 05 fr.; dito simple 45 à 50 fr.Trèfle hybride 200 fr.; jaune extra 165 à 170 fr. Raygrass 40 à 45 fr.Vesces suivant provenances, grosseur et qùalité,26 à "32. fr.–Maïs fourrager Caragua28 à 30 fr.; maïs jaune 26 à fr. Pommes de terre. Paris (marché des Innocents). 17 avril. Par suite des stocks très limités de nos variétés indigènes et des envois modérés de l'Espagne, ainsi que de ceux de l'Algérie, qui diminuent de plus en plus, la tendance est nettement à la hausse. D'autre part, la hollande ne se trouve plus que par petits lots disséminés et la ronde jaune peut être considérée comme totalement épuisée. En ce qui concerne les tubercules à chair blanche, elles ne sont l'objet que d'offres restreintes à des prix plutôt élevés. Par suite de la persistance de la séche^resse en Espagne, il est à prévoir qu'au lieu de se prolonger jusqu'au 15 mai, les expéditions cesseront d'ici à quinze jours ou trois semaines. En ce qui concerne la pomme de terre en provenances d'Algérie, comme nous l'avons dit plus haut, elle sépuise considérablement, et le reste de la production trouve un débouché plus avantageux sur le Midi de la France que sur Paris en raison des frais de transport beaucoup moins élevés. De quelques passages du rapport présenté hier à l'assemblée des actionnaires de l'Oriental Garpet, il ressort que les affaires sociales n'ont pas souffert des difficultés politiques et financières qui ont marqué le second semestre de l'année dernière. Quant aux. événements qui se sont déroulés depuis le commencement de l'exercice en cours dans le bassin oriental de la Méditerranée, ils n'ont eu aucune répercussion sur la société. s=_. On publie des nouvelles favorables sur les 1 re.coïïés "de TAfgenf môrtreHêFau* maïs est -énorme :-e'isans précédent et assure'de grosses recettes aux chemins de fer. argentins, recettes qui compenseront la mauvaise période dé grèves et d'inondations qu'ils viennent de passer. • "La .récolte en cours dans la République Argentine produira cette année le double de la précédente. Les évaluations officielles sont les Suivan tes Le blé donnera 4,788,445 tonnes valant 916 milhons 987^197 francs, contre 3 millions 710,000 francs, d'une valeur de 652 millions 960,000 francs. Le lin produira 595,000 tonnes représentant une valeur de 218,257,500 alors que la précédente récolte avait donné 685,000 tonnes valant 226 millions 50,000 francs. ̃ L'avoine rendra 950,000 tonnes et 104 millions 500,000 francs, contre 590,000 tonnes et 51 millions 920,000 francs. La récolte du maïs bat tous les records avec 8 millions 500,000 tonnes et 960 millions 500,000 francs, au lieu de 703,000 tonnes et 79 millions 439,000 francs l'an dernier. Bref, l'ensemble de ces récoltes donnera 2 milliards 200 millions 244,697 francs pour 1911-1912, On cote aux 1,000 kilos départ grands réseaux en disponible: Hollande: Loir-et-Cher 90 à 100 fr.; MaineretrLoire 110 fr.; Sarthe 100 à 110 fr. Saucisse rouge Haute-Vienne 78 à 82 fr.; Loiret 85 à 90 fr.; Loir-et-Cher 80 à 85 fr.; Sarthe 80 à 85 fr.; Vienne 75 fr.: Creuse 85 à 90 fr.; Morbihan 90 fr. Institut de Beauvais Sarthe 99 à 94 fr.; Mayenne 90 à 94 fr. Imperator: Haute-Vienne 82 fr.; Seine-et-Oise 90 fr.; Seine-et-Oise (pour plant) 100 fr. Vosgienne Sarthe 88 à 90 fr.; magnum bonum 110 fr. rayon de Virton. On cote pommes de terre 1° d'Algérie grosses de 26 à 38 fr.; moyennes de 30 à 32fr.; grenaille de 20 à 32 fr.; 2° d'Espagne de 38 à 40 .r. Fécules. La cote officielle a. été fixée à 48 50 pour la fécule première et à 49 50 pour la fécule supérieure, sans changement sur la précédente cote^ Suifs. La cote du suif indigène, frais fondu de boucherie, 43 1/2° et 1/2 0/0 humidité' et impuretés marchandise nûe, franco gare ou quai Paris, a été fixée hier à 80 fr., sans changement sur la semaine précédente. Suifs en branches (rend. 70 0/0) 56 fr = Toujours peu de marchandises; affaires sans activité tendance soutenue. ̃ On cote 1er jus de mouton, llià 117 fr.; suif pressé frais comestible, 118 .à .120' fr.; suif comestible, 87 à 90 f r.; graisse de cuisine blonde 71 à 73 fr.; dito verte 66 à 68 fr. En produits fabriqués, on cote stéarine saponifie., 117 50; dito distillation, 112 50; oléine saponification. 72 fr. nu; dito distillation, 70 fr. nu. glycérine brute, 152 50; lessive, 120 fr. Dépêches commerciales Bordeaux, 17 avril. Essence de térébenthine. Marché calme cours inchangés. On cote 70 fr. les 100 kil. nus départ et 80 fr. logés expédition Bordeaux. Apports 103,000 kil., M sans cession. Produits secs. Brais clair (100 kil.) 36 fr.; noir 32 50; demi-clair 34 50; colophanes (100 kil.) extra-pâle 42 fr.; pâle 40 fr.; ordinaire 38 50; dêmi-colophane, •» fr. Cires. (100 kiL). Grandes Landes 3rfO à 370 fr.; petites Landes 330 à 340 fr.; Périgord 340 à 350 fr.; Saintonge 340 à 350 fr.; Soudan 2S0 à 310 fr.; Madagascar 280 à 310 fr. Londres, 17 avriL Changes: Calcutta lsh. 41/16 d.; Bombay s. 4 1/16 d.; Hong-Kong 1 sh. 11 1/4 d.; Yokohama 2 sh. 0 7/16 d.; Valparaiso 10 11/32 d.; Singapour et Penang 2 sh. 4 1/16 den.; Shanghai 2 sh. 7 3/4 den. NewYork, 17 avriL Changes: sur Londres, 4 80 »/»; sur Paris, 5 18 1/8; sur Berlin, 94 5/S Cotons. Recettes dace jour 21.0DJ balles contre 12.400 l'an dernr. Total des 5 jrs 92,800 balles contre 49,300 l'an dernier. Middling Upland J.0 80. Marché soutenu. Ventes 100 balles. w Futurs: cour. 11 23; juin 11 41; août 11 54. Marché ferme. Ventes »»» balles. Cafés.– Rio Fair n° 7, futurs: cour. 13 92; juin 1403; août 14 12. Ventes 28,000 sacs. Marché calme. New-Orléans, 17 avriL Cotons. Middling 11 69. Marché ferme. Ventes 1,000 balles. Cotons. Futurs: cour. 11 7S; juin 1187; août 11 78. Marché soutenu. Stock »»»,̃>*» balles. Rio, 17 avril. Cafés;– Recettes'. 3,000 sacs. Marché àp..soutenti. Stock: 278.000 sacs. Rio n» 7, 8,725 rets Change, 16 1/4. ̃ Santos, 17 avril. Cafés. Recettes 14,000 sao3. Marché inactif. Stock: 1;931,000 sacs. Standard no 7, 7,90û reis. 18 AVRIL Lô Havre, 10 heures. Laines (à terma). Marché calme. Ventes »» balles. Cour. 168 50; juin 169 »»; août 170 50. Le iavre, lOaeores.– Cotons 'à termsi.– Soutenus. Courant 76 1/4; mai 76 1/2; juin 76 5/8; juillet 76 1/2; août 7ti 3/8; sept. 76 1/8; oct. 76 »/»; nov. 75 5/8; déc. 75 1/2: janv. 1913 75 1/2; fév. 753/4; mars 75 3/4. Cafés (à terme). Soutenus. Ventes 4,000 sacs. Courant 86 50; mai 86 50; juin 85 75; juil. 85 75; août 85 75: sept. 85 75; oct. 8) 50: nov. 85 25; dôo. 85 25; janv. 1913 85 »»: fév. S4 75; mars 84 75. Le Havre, midi. Cotons. Hausse de 12 à 25 cent. Cafés disponibles. Sans affaires cotées. Terme. Avril baisse 50 c.; autr. mois baisse 25 c. On a vendu 10.ÛO0 sacs depuis la précédente dépêche. Roubaix, midi. Laines Qualité peignée de fabrique. Marché calme. Ventes 30.000 leil. Avril » »» »/»; mai 5 571/2; juin 5 55 »/»; juil. 5 55 »/»; au lieu de 1 milliard 10 millions 369,000 francs pour 1910-1911. BILAN DE LA BANQUE DE FRANCE DU 11 AVRIL AU 18 avril 1912 Encaisse or. 3.224.580.020 + 3.980.909 argent. 807.898.190 411.492.121 Portefeuille. 1.182.138.707 + 22.956.858 Avancessurtitres. 661.939.711 14.807.272 Comptes courants part" 6^8.677.902 + 15.609.693 Compteeour. du Trésor 109.559,519 3*763,353. ̃Billetsen* circulâïion.5.307.Wi;26Ô:; f.BWMô Bénéfices bruts des es comptes et intérêts di vers de la semaine. 866.872 Dépenses 84.264 Bénéfices nets provisoires de la partie écoulée du premier semestre des quatre dernières années, tels qu'ils ressortent de la situation hebdomadaire: Bénéfices Cours corresp. Annèel903. 7.998.550 4.274 1910. 9.755.197 4.285 1911. 12.057.678 4.000 1912 16.478.269 4.100 Recettes des chemins de far (13" semaine) Est. + 160.000 + 2.75 Etat (ancien réseau). + 97.000 + 7.61 (réseauracheté). + 245.000 + 6.09 Midi. + 158.000 + 5.89 Nord. + 536.000 + 8.60 Orléans. + 520.(MO + 8.98 Lyon. + 1.950.000 + 18.85 Algériens. + 101.000 + 38.26 août » »» »/»; sept. » »» »/»; cet. 5 52 1/2; déc. 5 $7 1/2; janv. 1913 » »» »/»; févr.5 45 ̃̃/»;:mars » »»»/»• Liverpool, 10 heures. CotonsFuturs ouverts en hausse de 1/100 à sans changement. Cour. 6 40 »/»; mai-juin 6 36 ̃»/»} juflUaoût 6 3a •/•; ` oct.-nov. 6 26; janv-fév. 6 24. "•ii! Hambourg, 9 h. 45. Suaces: Tendance ferme. Mai 14 22 »/» Rm; oct.-déc.41#5o»7» Rm. Hambourg, 10 heures. Cafés, Soutenus. Santos good average mai 68 50; déc.»ÇÊ» 35. Pétrole Calme. Dispon, $ 50. Rm. Hauibourg. Cuivre. Mai 141 m. 25 et 143 m. 75; sept. 146 m. 50 et 146 m. 25. Londres.– Céréales. -'Gairgaisons arrivées 0; dito à vendre U. Sucres bruts1 >da betterave mai 14 0 1/4;. i oct. -déc. 11 2 1/4. Fermes. Londres.Métaux,– Cuivra compt 70 liv. 3 sa. 9den.; à trois mois 71 liv. 2 sh. 6,d.; étain comptant 198 liv. »» Sh. » den.; à trois mois 195 liv. »» sh. » den.; plomb cpt 16 liv. 6 sh. 3 d.; zinc cpt 25 iiv. 15 sa. »den. Anvers. 2 h. 30. Laines (cqteofiieiell3)< Peignés contrat B: mai 5 55 »/»; juillet 5 55 »/•. Ventes 105,000 kil. Marché calme. ̃ Pétrole.– Ferme. Disp. 2? 1/2; -juil-août 21»/», Anvers.– Saindoux d'Amêriqus. Mai 124 1/4; juil. 1^6 »/». Marché soutenu. Anvers. –Sucres. Soutenus. Cote officielle: cristall. disp. export. nouv. coni. 41 5/8; bruts: mai 34 5/8. Anvers. Blé Australie disponible 23 7/8; blé Danube disp. 23 1/4 à 2i »/»;blê Redwinter dispon. 22 3/4 à 24 <•/»; blé Kurraoaé,e blanc dispon. 23 1/4 à V;Plataî'22-5/«à2S-7/8; BourgaS 23 1/4 à 24»/»; Warna 22 1/2 à 23 5/8. Amsterdam. Pétrote dispon. 11 53; juillet-août 11 70. Tendance ferme. Huile de colza: souten. Disp. 36 »/»; mai-août 35 1/2. Huile de lin'calme. Dispon. 421/4; mai-août 40 1/4. Livsrpool, 12 h. 35. Cotons disponibles. Ventes s 14,000 balles. Cote Amérique bonne demande, hausse 4/100. Cote Brésil hausse de, 4/100.. Cote Inde hausse de 1/16. Magdebourg, 12 heures. Sucres. Fermes. Mai 14 32 ̃>/»; oct.-déc. 11 25 Rm. BOURSE da COMMSRCE. 18 AVR., 3 heure! Blés(77/75 àt'hsotoîitre) les 103 kit. nst comptant.Cour. 30 30 à 35 »»; proôtt. 29 95 et »» »»; mai-jilin 29 6= à 29 70; 4 de mai 28 55 à »» ̃>»; juil.-aottt 27 30 et ̃>» »»; 4 dern. 25 60 et 25 55. CircuL: »,»» Ldquid.: 2,000. Farines fFlsur 1î :iirisi. tds l?ï. <cil. net. toila perdue, sans esc). Cour. 3740 et 37 45-Broch. 37 55 à 3765; maijuin 37 40 à >̃> <>«; 4 de mai 37-w à »̃• »»; juillet-août 3630 à »» »»; dern. 33»» à 33 w. Cire. »». Liq.:i.35O. Avoines noires (10) vil. n^'côrrrptant, paids f"> a 471cil. àl'hec,t.).CouT. 23 40 et^S'iî; prooh. 23 25 et 23 35; mai-juin 23 25 à »» »̃>; 4demai2255à 22 60: juillet-août 2190 à »» »»; 4 dern. 19 60 à »» »». Cire.: 1000. Liq.: 1250. HuHes(1001âl. nuea cave à l'entre p3ti. Lia (esc. 20/0). Dispon. »» »» à »» •>»: cour. 94 25 et »»̃••; proch. 89»» à 89 50; mai-juin 87 75 à 88 W, 4 de mai 86»' et ..»̃>»; 4 dern. 79 75 à « *». Cireul.: »»». Liq.: »,»,»*. Colza(eso. 1 0/0). Dispoa..»» »» à »» »»; cour. 74 »• à »,. »»; proch. 74 25 à 74 75; mai-juin .73 75 à 74 »»; 4da mai 73 75 à »» »•; 4 dern. 73 »̃> à 74 »». Circol.: 350. Esurits. 3 h. (3/S Xord fin 93H'h33t. nu l'entrepôt Paris, esc. 2 0/0.) Dispoa. 66 75 a •» »»; courant 66 75 et »» »»; proch. 66 50 à ».» »»; 4 da mai 65 50 à 65 75; 4 dern. 53 75 à 54 25; 3 d'oct. 52 ».» à 52 25. Stock 12,350 pipes. Cire.: 175. Lit.: «•,»,»». (Non compris la taxe de i fr. 85 à 103'.) Sucres (lestO3 kil. nstseaeatrep. Paris esc. 1/4 0/0). > Disson. 47 25 à 48, •»; courant 47 62 et »» »» p.v.: proch.' 47.75, à »̃• »» »/» p.».; "mai-jklin 4? S7 »/• et »» p. v.; 4 de mai 48 »i et »» <•» p.v.; juil>août 48 »̃> à »» »» »/• p. a.; 4 d'oot. 36 62 à »•> »» p. a.; roux 83': cuite »» »» à »» «»; autres jets »» »» à ».» »»; raffinés 79 50 à 80. Arg. bar., la til. 99 àlOI Banknotes.. 25 .24 à 25 25 Quadrupla espagnol I Aigles Etats-Onis. 5î 6) Colombie et Vïesiqua Guillaume' (2a marks) -21 61 Piastres ilaxicaiaes. • Impériales rama* 2J 50 COURS DTT FASti COff^ 4 ÏÏESHft NewYork 518 1/8 Napoléon 19 16 Berlin 81 15 COURS A PASIiH Vienne 95 63 Londres chèq. 25 24 1 2 Amsterdam 47 SS1 2Madrid vers46* I~ ItaUe 101 ̃ •̃_̃̃̃' ̃̃ COÏÏRS A HEW-T02S 'Bruxelles t00 52 t(2 ?f,honn^fmtoli/ls5 • Càblo Londres 4S7 65 Lisoonne (murais» oao .(^ ̃ nnrmo a Dvjirt Genève 100 16 3/3 ° *̃ COTES A BKliU Constantinople 22 87 1 2 ""« r-Eoubles 216 05 •/• Athènes 100 1 '8 h COURS SUR L0HDRE3 Saigon: piastre com' 2 42, j,,(gio (milreisV 13 1/4 Buenos-Aires Or503 3/4 k ,Valparaiso (p') U 'W33 PEIHB3 SOE Là. KSsfa-rFaa.XQ.US3 Fin courant 92 5-2 a 02 25 d'Si 92 .10 te 07 d' 50 J?inpto6Qam_ 93 15 a 92 90 dv%' .92 90 à 50 RECETTES DU SUEZ 17 avril 410,000 francs, contre 250,000 en 1911 Du 1" janv.au 11 avril 42,340,000, contre 40,700,000. en 1911 C{U{OIUQDE_SGIEI1TIFIQI)E LES ABORDAGES DE NAVIRES PAR SUCCION A propos de notre p.rf cédente note parue dans la « Chronique scientifique » au sujet des abordages de navires « par sùcciçïj, », M. Weyher, le savant ingénieur dont les travaux sur les tourbillons font autorité, et qui a procédé à de nombreuses expériences, nous adresse quelques remarques intéressantes. « Si vous observez, dit-il, par exemple, un canot à vapeur parcourant un canal, vous voyez la première ride formée à la proue se diriger obliquement vers la berge le long de laquelle une forte dépression accompagne cette ride. L eau s'abaisse brusquement en découvrant la berge du canal, et cette dénivellation, qui se produit sans déchirure ou écume, avance à la vitesse du canot. Elle est suivie, à une certaine distance par derrière, d une seconde lame remontant bien en arrière du canot en bouillonnant avec écume le long de la berge inclinée puis, après un certain temps d'oscillation, l'eau reprend son niveau normal. Supposons, dès lors, qu en pleine eau un second canot vienne à convoyer le premier, là dénivellation se produira le long de tous les deux et s'accentuera doublement par -rapport au niveau SPEGTflCLtES DU JEUDI 18 MijIIt Théâtres Opéra, relâche. Vendredi le Cobzar; les Deux pigeons. Samedi Faust. Théâtre-Français, 8 h. 1/2. La Joie fait peur; Iphigénie en Aulide. Vendredi, dimanche (mat.) Primerose (soirée) Britannicus la Joie fait peur. Samedi le Ménage de Molière. Opéra-Comique, 8 h. 3/4. La Tosca. Vendredi Madame Butterfly. Samedi Orphée les Petits giens. Dimanche (mat.) "Werther les JSoces de Jeannette (soirée): Carmen. ;7, Odéon, 8 h. 1/2. L'Honneur japonais. Vendredi, samedi, dimanche (mat. et soirée), lundi, mardi, mercredi l'Honneur japonais. Gymnase, 9 h.L'Assaut. Vaudeville, 9 h.-Mioche; On naît esclave. Variétés, 8 h. 3/4. Le Roi. Gaité-Lyrique, 8 h. 1/2. La Fille de Madame Angot. Vendredi, samedi, dimanche, mardi la Fille de Madame Angot.-Lundi, mercredi. Naïl. Dimanche (mat.) Hérodiade. Renaissance, 9 h. Amnésie; Divorçons. Th.Sarah-Bernhardt,8h. 3/4. La Reine .Elisabeth. Th. Réjane, 8 h. 3/4. Les Moulins qui chantent. Porte-Saint-Martin, 8 h. 3/4.– La Flambée. Th. Antoine, 8 h. 1/2. –Au soleil; les Petits. Châtelet, sh. ï/k. La Course aux dollars. Trianon-Lyrique, 8 h. 1/2. Mam'zelle Trompette. Vendredi Cartouche. Samedi Véronique. Dimanche (mat.) Mam'zelle Trompette (soirée) Mireille. Athénée, 8 £.1/4. Le Journal joué le Cœur dispose. Palais-Royal, 9 h. -Le Petit café. Bout.-Parisiens-Cora L.aparcerie,8h.3/4. L'amour-propre; Agnès, dame galante. Ambigu, Sh. 1/2. Roger la Honte. Th. Michel, 8 h. 1/2. La Cage ouverte; Non non non Les sauveteurs. Comédie-Royale, 8 h. 3/4. Quand il y en a pour deux; Trio sur le volé;'Jean III. Th. Apollo, 8 h. 3/4. <-fj -Le Comte de Luxembourg. Vendredi, samedi le~ Comte de Luxembourg. Dimancfie la Veuve joyeuse. Cluny, 8 h. 3/4; Le Trésor d'Evariste les Sœurs Zigoteau. Th. des Arts, 9 h. Mil neuf cent douze. Déjazet, 8 h. 1/2. On opèrèïsans douleur; Tire-au-Flanc. Folies-Dram., 8 h. 1/2. Mam'zelle mon fils. Th.de la Scala,8h.l/2. La Revue de laScala. Capucines, 9 h. Sapphô; l'Intérim le Secrétaire. Grand-Guignol, 9 h. Le Beau régiment l'Obsédé; le Carnaval de Puce et de Plock; les Ingrats; Une nuit d'amour. Th.Femina; 8 h. 1/2. -Les Fils Touflesont à Paris. Th. Molière, 8 h. 1/2.– Nana. E nghten. Sources sullses. Etab.thérmâl.Gâsino. Concertssymphoniq. dans lejardin des Rosés. Speetaoies<3oiia9rt3 Folles-Bergère, 8 h. 1/2. La Revue de printemps. Olympia, 8 h. 1/2. Enfin. une revue. DERNIÈRES NOUVELLES LA MORT DE M. HENRI BRISSON L'exposition publique La décoration funèbre de la présidence de la Chambre avec des tentures noires bordées et frangées d'argent est terminée. La 'grande marquise qui surplombe le péristyle d'entrée de la cour d'honneur est entièrement recouverte de broderies de deuil, ornées alternativement de faisceaux de drapeaux recouverts de crêpe et d'écussons portant les initiales du défunt. Les murs de toutes les pièces qu'il faut traverser pour arriver dans la grande salle des fêtes où est exposé le corps de M. Henri Brisson sont recouverts de tentures de deuil; les lustres et appliques, voilés de crêpe, .sont allumés. Les huissiers de la présidence se tiennent échelonnés sur tout le parcours. Cet après-midi, la colonnade du Palais-Bourbon située sur le quai d'Orsay sera drapée de larges voiles noirs. ̃ Dès une heure et demie, le public commence à faire queue sur le trottoir qui longe ,4a rue de l'Université. A deux heures, le signal est donné, et lentement, en silence, avec respect, la foule pénètre dans le vestibule. A ce moment, la queue s'étend jusqu'à la rue de Bourgogne; il y a plus de 5,000 personnes. Les visiteurs pénètrent d'abord dans le vestibule, passent dans la salle à manger tendue de noir et gagnent le salon d'honneur au fond duquel se trouve le catafalque. La bière, exhaussée de deux mètres, est recouverte d'un drapeau tricolore en soie sur lequel est placée l'écharpe de député du défunt. Les lustres et lampadaires sont allumés. Quatre soldats d'infanterie, l'arme au pied, et deux huissiers, la poitrine constellée de décorations, se tiennent immobiles aux quatre coins du catafalque.
| 44,709 |
https://stackoverflow.com/questions/40853199
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,016 |
Stack Exchange
|
CBroe, RH7, https://stackoverflow.com/users/1427878, https://stackoverflow.com/users/1905073, https://stackoverflow.com/users/3119586, luke
|
English
|
Spoken
| 172 | 329 |
How to make the iframe website content height 100%?
Possible Duplication of Question
This similar question has been raised many times, however those solutions do not work for me. In addition, some of the solutions stated as answers are quite similar to my example. Therefore, it should work. But, that is not the case.
Main Example tried:
<iframe src="example.html" id="preview" ></iframe>
JavaScript:
$(document).ready(function () {
var previewObject = document.getElementById('preview');
var iframeChrome = previewObject.contentDocument.documentElement;
var iframeOther = previewObject.contentWindow.document.body;
var height = Math.max(iframeChrome.scrollHeight, iframeOther.scrollHeight);
previewObject.height = height;
});
Additional detail:
The iframe contains a preview of a website in the same domain/directory, the iframe should not contain a scrollbar, but display the whole website in it's full height.
Try previewObject.style.height = height+"px";
Sorry previewObject.style.height = height+"px"; doesn't work. The height assigned to the variables is always the same and never changes.
Possible duplicate of Adjust width height of iframe to fit with content in it
Tried and test. Both are quite similar, therefore, technically my example should work. But that is not the case
| 27,512 |
US-201716615680-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,017 |
None
|
None
|
English
|
Spoken
| 7,452 | 11,420 |
Device having a switchable wet-dry lubricating coating
ABSTRACT
A lubricating coating including at least one polymer A, a cross-linker and at least one lubricating agent, and wherein a portion of the at least two reactive groups of the cross-linker are covalently linked to the polymer A to form a three-dimensional network in which the lubricant is incorporated, and wherein at the same time another portion of the reactive groups of the cross-linker are covalently linked to the surface of the device or to the optional adhesion layer on the surface of the device.
The present invention relates to a device having a switchable wet-dry lubricating coating.
Medical devices for insertion into a body cavity having a hydrophilic coating and providing a low friction surface, such as catheters, are known.
It has long been known that hydrophilic coatings with low friction are useful for a variety of medical devices. When low friction surfaces are used, the devices, upon introduction into the body, slide easily within arteries, veins, cannula and other body orifices and passageways. Thus, the discomfort experienced by the patient when the coated device is inserted into and removed from the body cavity is considerably reduced. The risk of damaging sensitive tissue in connection with the use of the device is at the same time considerably reduced.
There have been a wide variety of methods used to provide the desired surfaces. Typical known coatings having a low coefficient of friction and working either in wet conditions (hydrophilic coatings, brushes and hydrogels) or in dry conditions are e.g. Teflon®, silicone-based coatings and graphite. For example, EP 0 483 941 discloses a hydrophilic, lubricious, organic coating which comprises a polyvinylpyrrolidone and a crosslinked polyurethane resulting in a coating that works in wet conditions.
Hydrophilic coatings that have low coefficients of friction (CoF) are typically hydrogels and work because of confined water that forms a lubricating film upon rubbing against a counter surface. Once such coatings become dry, the CoF increases dramatically due to strong adhesive forces between contacting soft, hydrophilic surfaces leading to catastrophic failure of the coating.
In the case of coatings that lubricate in dry conditions, mainly polytetrafluoroethylene (PTFE) and silicone-based coatings, the lubricating mechanism is based on low adhesion between macromolecules that allow those molecules to easily slip along each other. A similar mechanism applies for layered materials such as graphite, hexagonal boron nitride or molybdenum disulfide where crystalline layers in the material can easily shear along each other.
When such coatings are immersed in water, typically the CoF increases due to hydrophobic-hydrophobic interactions and because water does not act as a lubricant even under shear due to its low viscosity. Especially super low CoF (that is below 0.01), like in the case of hydrogel coatings, are not achieved in wet conditions with the above-mentioned materials for dry lubrication.
A different way to obtain lubricated contacts is to use oils as lubricants that can separate contacts under shear due to their viscous properties.
Using a mixed model of dry and oil lubrication are so called “SLIPS” (slippery liquid infused porous surfaces) that have been disclosed in several documents. For example, WO 2014/012080 discloses a device, wherein the slippery surface covers an inner and/or outer surface. The slippery surface comprises either a lubricating layer or a liquid-polymer composite overlayer. SLIPS contain fluorosilicone or perfluorinated polymers which should be avoided for ecological reasons. WO 2014/209441 discloses a body which has a lubricant reservoir comprising a porous hydrophobic polymeric body and a lubricating liquid, said lubricating liquid is occupying the pores to provide a lubricated porous surface having a lubricant reservoir and a lubricant overlayer over the polymer surface. Also here, perfluorinated networks are used to produce the porous polymeric body. In addition, the lubrication of the surface is always provided by the lubrication agent comprised within the SLIP. That is, in wet and in dry condition, the lubricating agent of the surface is responsible for the lubrication effect.
WO 2006/037321 discloses a medical device which has a wetted hydrophilic coating comprising a coating composition containing a urethane-based hydrophilic polymer and a wetting agent comprising water and one or more lubricant(s). The coating is only linked by physical bonding, covalent attachments or crosslinks between the coating components do not exist. The coating of the medical device is carried out by injection moulding or by coextrusion requiring a specific equipment and therefore, increasing the costs. Moreover, such a coating has the disadvantage that there is no direct linkage to the surface of the device resulting in wrinkles which can cause cracks in the coating.
EP 2 236 524 discloses an adhesion promoter based on a functionalized macromolecule comprising photoreactive groups. Such adhesion initiators may be used, for example, for nail enhancements, such as cosmetic nail extensions, artificial fingernails, and/or nail modeling and repair systems.
The problem of the present invention is to provide a device having a lubricating coating which works in dry and/or in wet conditions and which can be produced both simply and at a low price.
The problem is solved by a device according to claim 1.
Further preferred embodiments are subject of the dependent claims.
The device according to the present invention may be used in wet and/or in dry conditions. It comprises a lubricating coating, which is covalently bound directly on its surface or on an optional adhesion layer arranged on the surface of the device. The lubricating coating comprises at least one polymer A, at least one cross-linker, comprising a core and at least two reactive groups, and at least one lubricant.
A portion of the at least two reactive groups of the cross-linker are covalently linked to the polymer A to form a three-dimensional network in which the lubricant is incorporated and at the same time another portion of the reactive groups of the cross-linker are covalently linked to the surface of the device or to the optional adhesion layer on the surface of the device. That is, the cross-linker acts at the same time as cross-linking agent and as adhesion agent. A tight adhesion of the lubricating coating is particularly important in order not to lose the lubrication effect while moving the device, in particular, in the body of a patient.
The at least one polymer A is selected from the group consisting of polyvinylpyrrolidone (PVP), linear or branched polyethyleneglycol (PEG), dextran, polyalkyloxazolines (PAOXA), poly(2-methyl-2-oxazoline) (PMOXA), poly(ethyl-oxazoline) (PEOXA), hyaluronic acid, polyvinylalcohol (PVA), poly(2-hydroxyethyl methacrylate) (pHEMA), poly(l-vinylpyrrolidone-co-styrene), poly(l-vinylpyrrolidone)-graft-(1-triacontene), poly(l-vinylpyrrolidone-co-vinyl acetate), poly(ethylene-co-vinyl alcohol), poly(ethylene-co-vinyl-pyrrolidone), poly(maleic acid), poly(ethylene-co-maleic acid), polyacrylic acid, poly(acrylamide), poly[N-(2-hydroxypropyl) methacrylamide] (PHPMA), poly(N-isopropylacrylamide)(PNIPAM), poly[(organo)phosphazenes], chitosan and its derivatives, xantham gum, starch, pectin, algin, agarose, cellulose and its derivatives such as cellulose esters, cellulose ethers, hydroxypropylmethyl cellulose (HPMC) and hydroxyethyl cellulose (HEC) or a mixture thereof.
The at least one cross-linker comprises a core and at least two reactive groups, wherein the core is selected from the group consisting of polyallylamine (PAAm), polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), polyethyleneimine (PEI), polylysine (PLL), polyacrylic acid (PAA), polyvinylalcohol (PVA), polyaspartic acid, dextran, chitin, chitosan, agarose, albumin, in particular bovine serum albumin (BSA), fibronectin, fibrinogen, keratin, collagen, lysozyme and multivalent molecules having less than 20 carbon atoms.
The reactive groups of the cross-linker are each independently selected from the group consisting of
- - and mixtures thereof, wherein R₁, R₂, R₃, and R₄ are, independently from one another, H, F or Cl; and - R₅ and R₅′ is independently methyl, ethyl, propyl, isopropyl or dimethylamine and n is 0 to 4 and - R₆ and R₆′ is independently methyl, ethyl, propyl, isopropyl or dimethylamine and m is 0 to 4 and - the core is linked to the reactive group by a linker group B selected from the group consisting of a secondary or tertiary amine, an ether, a thioether, a carboxylic acid ester, an amide and a thioester.
The three-dimensional network formed by the polymer A and at least one the cross-linker is a matrix in which the at least one lubricant is incorporated, respectively confined. Either the matrix or the lubricant generates low friction because of their interaction in one specific medium against a surface. The lubricating coating of the present invention is a dual system working in wet and/or in dry conditions. When applying pressure, the lubricant is lubricating the surface of the device in dry conditions because the lubricant migrates to the surface of the coating and forms a film, that prevents the contact between the two sliding surfaces. In wet conditions, that is for example in water, water from the outer environment migrates into the three-dimensional network and forms a hydrogel. Under pressure, the water migrates to the surface of the hydrogel and forms a thin film, which is together with the hydrogel responsible for the lubricating effect. Due to the contact with the hydrogel, the water film is not directly mixed with the water of the outer environment.
Within the context of the invention, “lubricating” is defined as having a slippery surface. For example, a coating on the outer or inner surface of a medical device according to the present invention, is considered lubricious if it can be inserted into the intended body part without leading to injuries and/or causing unacceptable levels of discomfort to the patient. In particular, a coating is considered lubricated if the friction can be reduced compared to the friction measured in absence of the coating. Preferably, the coefficient of friction (COF) is less than 0.5 measured by a tribometer.
Within the context of the present invention, the term “wet” means “containing water”, such as in water, in blood, in urine, in tears, saliva or other body fluids. In particular, the term is used herein to describe a coating that contains sufficient water to be lubricious. In terms of the water concentration, usually a wet coating contains at least 10 wt % of water, based on the dry weight of the coating, preferably at least 50 wt %, based on the dry weight of the coating.
Within the context of the present invention, the term “dry” means “in absence of water” and in particular “in contact with air”, but encompasses also completely water free. Air may of course be humid. Typical examples for dry conditions are storage in a package, and the entrance of a body cavity before the device gets “wetted” by body fluids.
The three-dimensional network is permeable for the lubricant, thus allowing migration of the lubricant to the surface.
By combining a chemically bound three-dimensional network in form of the matrix with a non-chemically bound lubricant, but having at the same time a certain chemical affinity with said three-dimensional network, it is possible to form a substantially non-dripping film on the surface of the three-dimensional network. Since high viscosity liquid reduce wear, but increase friction and vice versa, it is an advantage to incorporate the lubricant in the matrix to have only a high viscosity fluid locally in the contacting area. Thus, the coating of the device according to the present invention performs better than using the lubricant alone.
In both wet and dry conditions, a lubricant coating is present. In dry conditions, the lubricant is inside and on the surface of the coating, and in wet conditions water from the outer environment migrates into the three-dimensional network, so that the network converts into a swelling matrix forming a hydrogel surface which is then together with the water responsible for the lubricating effect.
The combination of the pores and the viscoelastic properties of the three-dimensional network, that is mesh size, permeability, choice of polymer A, modulus and thickness as well as the viscosity of the lubricant, a low coefficient of friction can be obtained in both wet and dry conditions.
The at least one polymer A comprised in the lubricating coating of the present invention is selected from the group consisting of polyvinylpyrrolidone (PVP), linear or branched polyethyleneglycol (PEG), preferably linear polyethyleneglycol, dextran, polyalkyloxazolines (PAOXA), poly(2-methyl-2-oxazoline) (PMOXA), poly(ethyl-oxazoline) (PEOXA), hyaluronic acid, polyvinylalcohol (PVA), poly(2-hydroxyethyl methacrylate) (pHEMA), poly(l-vinylpyrrolidone-co-styrene), poly(l-vinylpyrrolidone)-graft-(1-triacontene), poly(l-vinylpyrrolidone-co-vinyl acetate), poly(ethylene-co-vinyl alcohol), poly(ethylene-co-vinyl-pyrrolidone), poly(maleic acid), poly(ethylene-co-maleic acid), polyacrylic acid, poly(acrylamide), poly[N-(2-hydroxypropyl) methacrylamide] (PHPMA), poly(N-isopropylacrylamide)(PNIPAM), poly[(organo)phosphazenes], chitosan and its derivatives, xantham gum, starch, pectin, algin, agarose, cellulose and its derivatives such as cellulose esters, cellulose ethers, hydroxypropylmethyl cellulose (HPMC) and hydroxyethyl cellulose (HEC) or a mixture thereof. The at least one polymer A has to be soluble in the liquid in which the coating is used in (in general water) and has preferably dangling chains that can form a brush-type surface in said liquid. The characteristics of the three-dimensional network can be modified by mixing two or more different types of polymer A. The hydrophilic nature of said polymer A allows a good lubrication effect in water due to the hydrogel formed by said polymer.
Generally, the at least one polymer A has a molecular weight in the range of 20′000 to 5′000′000 g/mol, preferably in the range of 50,000 to 3′000′000 g/mol and more preferably in the range of 200′000 to 2′000′000 g/mol.
The at least one cross-linker of the lubricating coating according to the present invention comprises a core and at least two reactive groups. The core is selected from the group consisting of polyallylamine (PAAm), polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), polyethyleneimine (PEI), polylysine (PLL), polyacrylic acid (PAA), polyvinylalcohol (PVA), polyaspartic acid, dextran, chitin, chitosan, agarose, albumin, in particular bovine serum albumin (BSA), fibronectin, fibrinogen, keratin, collagen, lysozyme, and multivalent molecules having less than 20 carbon atoms. The at least one cross-linker has a significant influence on the characteristics of the matrix. By changing the ratio between polymer A and the amount of cross-linker, the pore size of the resulting three dimensional network can be tuned. High amounts of cross-linker lead to smaller pores and a stiffer gel than low amounts of cross-linker. Polymeric cores having preferably a molecular weight from 1′000 g/mol to 1′000′000 g/mol are preferred. If the core of the polymeric cross-linker is charged, the interaction of the matrix with oppositely charged molecules can be tuned. If the core of the polymeric cross-linker is uncharged, a neutral network is obtained.
The thickness of the lubricating coating, the crosslink-density of the three-dimensional network, the choices of both the polymer A and the cross-linker as well as the affinity between the three-dimensional network and the lubricant influence the local viscosity of the lubricating coating. Therefore, depending on the desired properties of the surface to be protected, the architecture of the three-dimensional network can be adapted.
Preferably, the core of the polymeric cross-linker comprises on average a functionalized side chain comprising the reactive group on at least every 24th, preferably on at least every 12th, more preferably on at least every 4th repeating unit. In the case of a core comprising of a protein, the reactive group is typically attached to the side chain of the amino acid unit. The distribution of the side chains is usually statistical. Thanks to the multiple side chains comprising the reactive groups, it is possible to form a permanent covalent bonding between the cross-linker and the polymer A and the surface of the device as well as on the adhesion layer, if present.
Due to the fact that the reactive group is an integral part of the cross-linker comprised in the coating according to the present invention, it is possible to directly control the cross-linking rate of the three-dimensional network and the adhesion on the surface of the device and therefore to determine the physical properties of the network. In contrast thereto, free UV-initiators tend to a random polymerization, and therefore to the loss of control. In addition, no care needs to be taken about the presence of oxygen, which needs to be controlled (or completely avoided) in free radical polymerizations.
Preferably, the core of the at least one cross-linker is selected from the group consisting of polyallylamine (PAAm), polyvinylpyrrolidone (PVP), linear or branched polyethyleneimine (PEI), poly-D-lysine (PDL), poly-L-lysine (PLL) and epsilon poly-L-lysine (8-PLL). PAAm, PVP, PEI, PDL, and 8-PLL are available in a wide variety of molecular weights. Useful PEI polymers range in molecular weight from 1′000 g/mol to 1′000′000 g/mol.
In another embodiment, the core of the at least one cross-linker is a multivalent molecule having less than 20 carbon atoms. Examples of such core molecules are molecules with 2 to 6 ethylene oxide units, sugar such as monosaccharides and disaccharides, multifunctional alcohols such as ethylene glycol, trimethylolpropane, glycerine, oligoglycerine, pentaerythritol, tris(2-aminoethylamine), N,N,N′,N′-tetrakis(3-aminopropyl)-1,4-butanediamine, 2,2′-(ethylenedioxy)bis(ethylamine), 1,2,3-propanetricarboxylic acid, 2-hydroxy propane-1,2,3-tricarboxylate, 1-hydroxy propane-1,2,3-tricarboxylate, tri(carboxymethyl)amine and diethylaminetriamine.
The reactive groups of the cross-linker are each independently selected from the group consisting of
and mixtures thereof, wherein R₁, R₂, R₃ and R₄ are, independently from one another, H, F or Cl; and R₅ and R₅′ is independently methyl, ethyl, propyl, isopropyl or dimethylamine and n is 0 to 4, and R₆ and R₆′ is independently methyl, ethyl, propyl, isopropyl or dimethylamine and m is 0 to 4, and the core is linked to the reactive group by a linker group B selected from the group consisting of a secondary or tertiary amine, an ether, a thioether, a carboxylic acid ester, an amide and a thioester.
Preferably, the at least two reactive groups of the cross-linker are all the same.
Preferably, the reactive groups are selected from the group consisting of ortho, meta or para substituted benzophenones, diaryldiazomethanes, in particular diphenyldiazomethan and bis-4,4′-N,N-dimethylamino diphenyldiazomethane, phenylazide, optionally comprising one or more halogen substituents in the ortho and meta positions and mixtures thereof, and perfluorophenyl azide (PFPA). PFPA is especially preferred. It is stable at ambient light and atmosphere and in basic and acidic conditions. The number of formed crosslinks by nitrene insertion compared to non-productive hydrogen abstraction is higher compared to phenylazide and benzophenone chemistry.
The photoreactive group, and in particular PFPA, allows for a fast and very efficient curing of the cross-linker by UV irradiation, preferably with a wavelength of less than 400 nm, or by heat, preferably at a temperature of at least 120° C. Upon activation, the azide group is converted to a nitrene, which undergoes a very fast, non-specific insertion reaction into a nearby C—X bond of the surface of the device, the polymer A or the adhesion layer, if present.
The coating of the device according to the present invention comprises at least one lubricant, which is a substance that forms a fluid phase inside the three-dimensional network. Preferably, the lubricant is selected from the group consisting of an edible oil, a fat from plants, a fat from animals, a lipid and a hyaluronate or a mixture thereof. Especially preferred are castor oil, hydrogenated castor oil, or soy bean oil, in particular in medical application.
Alternatively, the lubricant may be a synthetic oil, preferably selected from the group consisting of poly-alpha-olefine (PAO), polyethyleneglycole, a silicone oil such as silicon oil having a viscosity of 1000 cst at 25° C. or silicone oil having a viscosity of 10000 cst at 25° C. and silicone paste such as Si HS—N from momentive (Si HS—N).
Most preferably the lubricant is selected from the group consisting of polyethylene glycol (PEG) with a melting point below 20° C., polyethylene glycol (PEG) with a melting point between 20° C. and 50° C., polyethylene gylcol (PEG) with a melting point above 50° C., glycerin, glyceryl trioleate, mineral oils, polyolefins including poly-alpha-olefins (PAO), white mineral oil, synthetic esters, such as polyol esters, polyalkyleneglycols (PAG), phosphate esters, liquid or oily silicones, ionic liquids, liquid graphite, plant wax, animal wax, petroleum derived wax, mineral wax, release agents used in injection molding such as lecithin, viscosity enhancing agents such as poloxamer (Pluronic®), polyacrylate gels, methylcellulose, lubricant from above list mixed with a viscosity enhancer, vegetable oils and fats and animal oils and fats.
Possible vegetable oils and fats are listed as follows: oil of soybeans, oil of groundnuts, oil of coconuts, oil of palm, oil of palm kernel, oil of virgin olives, oil of olives residues, butter of Shea nuts, oil of castor beans, castor oil hydrogenated, oil of sunflower seed, oil of rapeseed, canola oil, oil of tung nuts, jojoba oil, oil of safflower seed, oil of sesame seed, oil of mustard seed, oil of poppy seed, vegetable tallow, oil of kapok, stillingia oil, oil of cottonseed, oil of linseed, oil of hempseed, oil from Borago officinalis seeds, oil of vegetable origin nes, oil of rice bran, terpenoid esters such as linalyl acetate and oil of maize.
Possible animal oils and fats are listed as follows:
Fat of cattle, butcher fat, fat of buffalo, fat of sheep, fat of goats, fat of pigs, lard, fat of poultry, fat of camels, fat of other camelids, animal oils and fats obtained from other animal species, oils and fats recovered from guts, feet, sweepings and hide trimmings, lard stearin and lard oils, tallow, liquid margarine, margarine, shortening (product similar to margarine, but with a higher animal fat content), fat preparations, boiled oils, dehydrated oils, hydrogenated oils and fats, wool grease and lanolin, degras, fatty acids, fatty acid esters, such as oleic acid propyl ester and methyl 10-undecenoate, spermaceti, oil from fish and marine mammals.
Possible lipids are for examples cholesterol and cholesteryl derivatives such as cholesteryl linoleate.
The choice of the lubricant depends on the desired surface properties and on the application of the device. In the medical field the toxicity of the lubricant is important. In order to avoid a two-phase system, polymer A and the lubricant are preferably miscible. Preferred are oils and fats that do not lead to a dripping, greasy surface but still provide the desired slipperiness.
Oils derived from the seeds of Borago officinalis are especially preferred for coatings of medical devices in the gastrointestinal, respiratory and cardiovascular field such as catheters since they have additionally an anti-inflammatory effect because of their high content of γ-linolenic acid.
The lubricant can act as a viscosity modifier by itself, or an additional viscosity modifier can be added to the liquid in the wet state to improve wear resistance. Preferably, the coating does not comprise an additional viscosity modifier.
In order to increase the adherence between the surface of the device and the three-dimensional network, an optional adhesion layer may be present.
Preferably, the adhesion layer comprises or consists of the same cross-linker as described above. That is, the adhesion layer is formed by an adhesion layer composition comprising or consisting of the same cross-linker which is used for the formation of the three-dimensional network. Due to the same products being used, a coated device such as a medical device is cheaper and reduces the effort to comply with the regulatory requirements.
The device according to the present invention is preferably a medical device. The coating can be coated on a device which may be selected from a range of geometries and materials. The device may have a texture, such as porous, non-porous, smooth, rough, even or uneven. The device supports the lubricating coating directly on its surface or on an adhesion layer on its surface. The surface may be untreated or treated in order to facilitate the coating of the surface or in order to sterilize the device before the coating. The coating can be on all areas of the device or on selected areas. It can be applied to a variety of physical forms, including films, sheets, rods, tubes, molded parts (regular or irregular shape), fibers and fabrics. Examples of suitable surfaces to be coated are for instance surfaces that consist of or comprise metals, plastics, ceramics, glass and/or composites.
The device is preferably a medical device, such as injection needles, cannulas, syringe pistons, membranes, catheters such as urinary catheters and respiratory catheters, blades, surgical instruments, in particular sharp tools, single use razor-blades, insertion devices, guide wires, and in particular cardiovascular guide wires, stents, a stent graft, contact lenses and intraocular lens (IOL) injection devices, cochlear implants, anastomotic connectors, synthetic patches, electrodes, sensors, angioplasty balloons, wound drains, shunts, tubing, infusion sleeves, urethral inserts, pellets, implants, blood oxygenators, pumps, vascular grafts, vascular access ports, heart valves, annuloplasty rings, sutures, surgical clips, surgical staples, pacemakers, implantable defibrillators, neurostimulators, orthopedic devices, cerebrospinal fluid shunts, implantable drug pumps, spinal cages, artificial discs, replacement devices for nucleus pulposus, ear tubes, intraocular lens and any tubing used in minimally invasive surgeries. Most preferably, the medical device is selected from the group consisting of injection needles, cannulas, syringe pistons, membranes, catheters, blades, surgical instruments, in particular sharp tools, single use razor-blades, insertion devices, guide wires, stents, a stent graft, contact lenses and IOL injection devices and cochlear implants.
The coating of the device according to the present invention may comprise at least two different cross-linkers. Preferably, the at least two different cross-linkers have a different core. This allows to produce a three-dimensional network having locally different lubrication characteristics. Alternatively, or in addition, the grafting ratio may be adjusted by varying the ratio of the polymeric core of the cross-linker to reactive group to tune the distance between crosslinking positions. Grafting ratios between 4 and 100 can be easily prepared. Preferably, the one of the at least two different crosslinkers is uncharged and the other one is charged. For example, the at least two different cross-linkers may be polyethyleneimine-grafted-perfluorophenylazide (PEI-g-PFPA) and 2,2′-(ethylenedioxy)bis(ethylamine-PFPA).
Especially good results can be obtained with coatings wherein the cross-linker is selected from the group consisting of polyethyleneimine-grafted-perfluorophenylazide (PEI-g-PFPA), tris(2-PFPA-aminoethyl)amine and 2,2′-(ethylenedioxy)bis(ethylamine-PFPA). Charged cross-linkers such as PEI-g-PFPA have the advantage that they are protonated in water. Uncharged cross-linkers such as 2,2′-(ethylenedioxy)bis(ethylamine-PFPA) have the advantage that they do not bind negatively charged biomolecules which sometimes has to be avoided.
The polymer A may be used in more than 10 wt %, for example more than 15 wt % or more than 50 wt %, based on the total weight of the dry coating. The polymer A can be present up to 95%, based on the total weight of the dry coating. Preferably, the ratio between the polymer A and the cross-linker is between 100:1 and 2:1 by weight, preferably 50:1 and 2:1 by weight, most preferably 5:1 and 2:1.
The ratio between the three-dimensional network and the lubricant is preferably between 20:1 and 1:2 by weight, most preferably between 10:1 and 1:1 by weight, and in particular preferably between 2:1 and 1:1 by weight.
Preferably, the coating contains no additional UV-radical-initiators such as AIBN, trichloroacetophenone or benzoin isopropyl ether. Since no UV-radical-initiators are used during production, the coating is free from UV-radical-initiators and therefore allows a long-term stability of the coating.
The invention further relates to a method of forming a device comprising a lubricating coating in dry and in wet conditions.
Preferably, the device according to the present invention is prepared by
- - a. preparing a coating formulation comprising the at least one polymer A, the at least one cross-linker and at least one solvent, - b. applying the coating on the surface of the device or on its optional adhesion layer, - c. forming a three-dimensional network and simultaneously linking the network to the surface of the device or to its optional adhesion layer by radiation or/and by heat, wherein the lubricant is added to the coating formulation or after the formation of the three-dimensional network.
The at least one solvent is preferably a standard solvent in which the at least one polymer A and the at least one cross-linker are soluble. Instead of one single solvent also solvent mixtures may be used.
Due to the fact, that the three-dimensional network and the covalent bonding of the cross-linker to the surface of the device or to the optional adhesion layer is carried out at the same time, that is, in one single step, the method according to the present invention is extremely fast and cost-efficient. The linkage to the surface of the device is very stable. Since the cross-linker is responsible for the three-dimensional network and for the linkage to the surface of the device, the coating is free of cracks.
The lubricant can be incorporated into the three-dimensional network by adding the lubricant directly into the coating formulation in one step or sequentially by loading the formed three-dimensional network with said lubricant. The one-step method has the advantage that a uniform distribution of the lubricant can be obtained and that the method is faster and therefore, less expensive.
Alternatively, the lubricant can be added to the final three-dimensional network, that is, after curing. This method allows to have different types of lubricants on the same device which may be necessary depending on its use.
The coating formulation can be applied to the device by jetting, spraying, dip-coating, printing, painting, filling and emptying, washing, rolling and other methods known in the art.
The thickness of the coating may be controlled by the soaking time, drawing speed or viscosity of the coating formulation. Typically, the thickness of a coating on a substrate ranges from 0.05-300 μm, preferably 0.05-100 μm, more preferably 0.1-30 μm.
Preferably, the coating of the device according to the present invention further comprises a fluorescent marker. The fluorescent marker allows to determine where the coating has been applied. Most preferably, the fluorescent marker is polyethyleneimine-grafted-salicylic acid (PEI-g-salicylate, since it additionally stabilizes the coating formulation.
The coating of the device according to the present invention may comprise additional additives or the lubricant itself can have other benefits such as acting as a drug, UV-stabilizer, anti-oxidant, plasticizer, antistatic agent, porogen, pigment, whitener or a dye.
In addition, oil-soluble drugs or vitamins may be added to the lubricant and therefore be incorporated into the three-dimensional network.
The accompanying drawings illustrate embodiments of the devices according to the present invention, explain some results together with the description and serve to explain the principles of the present disclosure.
FIG. 1a and FIG. 1b show a schematic view of the present invention.
FIG. 2a and FIG. 2b show a schematic view of another embodiment of the present invention
FIG. 3 shows the coefficient of friction as a function of castor oil concentration in the coating formulation
FIG. 4 shows the coefficient of friction as a function of wear cycles
FIG. 5 shows the coefficient of friction as a function of coating thickness
FIG. 6 shows the coefficient of friction as a function of percentage of PEG in water as viscosity modifier.
FIG. 7 shows the coefficient of friction after 100 cycles as a function of solution viscosity
FIG. 8 shows the coefficient of friction of coated and uncoated silicone-hydrogel lens.
FIGS. 1a and 1b show a schematic view of the present invention. On the surface (5) of the device (10) is an optional adhesion layer (15). On said optional adhesion layer is a coating (20) which comprises at least a polymer A, at least one cross-linker and a lubricant (30). The polymer A and the cross-linker form a three-dimensional network (25) which is covalently attached to the optional adhesion layer (15) of the device or directly to the device surface. The lubricant (30) is incorporated in the three-dimensional network (25). In dry, ambient conditions the lubricant is incorporated in the three-dimensional network and forms under pressure a lubricating film on the surface of the coating (FIG. 1a ). In wet condition, that is in water, water from the outer environment migrates into the three-dimensional network and forms a hydrogel surface (35). Under pressure, the water migrates to the surface of the hydrogel and forms a thin film which is responsible for the lubricating effect. Due to the confinement of the water in the hydrogel (35) it is not directly mixed with the water of the outer environment (40) (FIG. 1b ).
FIGS. 2a and 2b show a schematic view of further embodiment of the present invention. On the surface (5) of the device (10) is an optional adhesion layer (15). On said optional adhesion layer is a coating (20) which comprises at least a polymer A, at least one cross-linker. The polymer A and the cross-linker form a three-dimensional network (25) which is covalently attached to the optional adhesion layer (15) of the device or directly to the device surface. In wet condition, that is in water (40) which additionally comprises the lubricant (30), water and the lubricant from the outer environment migrate into the three-dimensional network and form a lubricant-hydrogel surface (35). Under pressure, the water and the lubricant migrate to the surface of the hydrogel and form a thin film which is responsible for the lubricating effect (FIG. 2b ). In dry, ambient conditions the lubricant stays incorporated in the three-dimensional network and forms under pressure a lubricating film on the surface of the coating (FIG. 2a ).
EXAMPLES Example 1: Preparation of a Polyethyleneimine-Grafted-Perfluorophenylazide (PEI-g-PFPA) Stock Solution for Use as a Macromolecular Cross-Linker
A solution of branched polyethyleneimine (PEI, for example Aldrich 408727 average Mw 25′000 g/mol) in ethanol with a concentration of 100 mg/mL is prepared. 16.3 mL of this solution are placed inside a brown glass bottle with a magnetic stir bar. 2.09 g of perfluorophenylazide-N-hydroxy-succinimide (PFPA-NHS) are dissolved in a second bottle in 283.7 mL of ethanol. This PFPA-NHS solution is slowly added to the vigorously stirred PEI solution and stirred for more than 5 h at room temperature to obtain a PEI-g-PFPA stock solution with a nominal grafting ratio of ethyleneimine monomers to PFPA of 6 and a concentration of mg/mL. The grafting ratio of this polymer can be adjusted by varying the ratio of PEI to PFPA to tune the distance between crosslinking positions. Grafting ratios between 4 and 100 can be easily prepared. Higher concentrations are possible by reducing the amount of solvent in the synthesis or by evaporation.
Example 2: Preparation of a Polyethyleneimine-Grafted-Salicylic Acid (PEI-g-Salicylate) Stock Solution as Radical Quencher (Stabilizer) and Fluorescent Marker
A solution of branched polyethyleneimine (PEI, for example Aldrich 408727 average Mw 25′000 g/mol) in ethanol with a concentration of 100 mg/mL is prepared. 7.57 mL of this solution are placed inside a brown glass bottle with a magnetic stir bar. 0.413 g of salicylate-N-hydroxy-succinimide (salicylate-NHS) are dissolved in a second bottle in 92.4 mL of ethanol. This salicylate-NHS solution is slowly added to the vigorously stirred PEI solution and stirred for more than 5 h at room temperature to obtain a PEI-g-salicylate stock solution with a nominal grafting ratio of ethyleneimine monomers to salicylate of 10 and a concentration of 10 mg/mL. The grafting ratio of this polymer can be adjusted by varying the ratio of PEI to salicylic acid to tune the distance between fluorophore positions. Grafting ratios between 4 and 100 can be easily prepared. This polymer is fluorescent with an emission wavelength of 400 nm. Salicylic acid also has a high reaction rate with hydroxyl free radicals and acts therefore as stabilizer for the coating formulation.
Example 3: Preparation of a Tris(2-PFPA-Aminoethyl)Amine as Cross Linker
Tris(2-aminoethyl)amine is dissolved in dichloromethane and 3.1 eq of perfluorophenylazide-N-hydroxy-succinimide (PFPA-NHS) are added to this solution. The mixture is stirred for 24 h. The product precipitates as a white powder that is filtered, washed with a small amount of cold dichloromethane and dried.
Example 4: Preparation of a 2,2′-(ethylenedioxy)bis(ethylamine-PFPA) Solution as Small Uncharged Cross-Linker
2.5 mL of 2,2′-(ethylenedioxy)bis(ethylamine) (10 mg/mL in ethanol, 0.171 mmol) and 113.8 mg perfluorophenylazide-N-hydroxy-succinimide (PFPA-NHS) are stirred overnight and diluted with 17.4 mL of ethanol to obtain a solution of 2,2′-(ethylenedioxy)bis(ethylamine-PFPA) which is used without further purification.
Example 5: Production of Coating Formulations Containing a Lubricant, PVP Matrix and PEI-g-PFPA as Cross-Linker
A solution of high molecular weight polyvinylpyrrolidone (PVP K94, Aldrich 437190) in ethanol, ethylacetate (or any other solvent where PVP is soluble) is prepared. This solution can be mixed with different amounts of PEI-g-PFPA (10 mg/mL) (Example 1) as cross-linker, a lubricant containing solution and ethanol, ethylacetate (or any other solvent where PVP and the other components are soluble) to obtain coating formulations that have different viscosities depending on total concentration and lead to different crosslink densities and various amounts of confined lubricant after curing of the applied coating.
The following lubricants were tested:
- - Soy bean oil (Soy bean) - silicone oil (Si 1000 cst) - silicone oil (Si 10000 cst) - silicone paste (Si HS—N) from momentive (Si HS—N) - poly-alpha-olefin (PAO) - Castor oil (CO)
TABLE 1 Examples of solutions prepared as described in Example 5. Solu- TopCoat Solvent Ethanol tion OIL TopCoat Solvent Percentage (wt %) A SOY 25 mg/ml PVP, EA 62.5 BEAN PVP: OIL = 0.6, PVP: HVE = 5 B Si 1000 15 mg/ml PVP, EA 37.5 cst PVP: OIL = 0.6, PVP: HVE = 5 C Si 10000 12.5 mg/ml PVP, EA 31.25 cst PVP: OIL = 0.6, PVP: HVE = 5 D Si HS—N 9.375 mg/ml PVP, EA 23.4375 PVP: OIL = 0.6, PVP: HVE 5 E PAO 25 mg/ml PVP, EA 62.5 PVP: OIL = 0.6, PVP: HVE = 5 F CO 25 mg/ml PVP, Ethanol 100 PVP: OIL = 0.6, PVP: HVE = 5 (Abbreviations EA: ethylacetate; HVE: PEI-g-PFPA; PVP: polyvinylpyrrolidone)
Example 6: Coating of Injection Needles
Stainless steel, hypodermic needles (G19, 1½″) were cleaned by oxygen plasma and coated with HVE primer as applied by spray coating from a 1 mg/ml in ethanol solution to form an adhesion layer. Coating solutions as described in Example 5 A-F were applied by spray coating on top of the primer layer. Coatings were cured by exposure to deep UV radiation (3-4 mW/cm² flux at 254 nm) for 15 min.
Example 7: Friction Testing of Coated Injection Needles in Wet and Dry Conditions
The frictional properties of the coated needles in Example 6 were tested by means of micro tribometry (BASALT MUST, Tetra) and penetration through a skin mimic polyurethane (PU) foil (DEKA PU 0.4 mm thick). For tribometry testing, the needles were mounted in a 3D printed sample holder and fixed with a luer lock. A cylindrical counter surface made from poly dimethyl siloxane (elastic modulus ˜2 MPa) was slid against the needle in a cross cylinder configuration at different normal loads between 400-1400 mN to extract the coefficient of friction (slope of frictional to normal forces). Additionally, to extract the wear resistance of the coating, the PDMS pin was slid back and forth over the needle at 1200 mN normal load for 50 cycles while recording the frictional force. The experiment was conducted in the following sequence:
- - 1. Coefficient of friction determination in the dry state - 2. Wear resistance in the dry state - 3. Wear resistance in the dry state for 10-20 cycles after which phosphate buffered saline was added to the sample holder to record the transition in friction when going from dry to wet state. - 4. Coefficient of friction determination in the wet state.
Coefficient of friction wet and dry for the different coatings are measured. An uncoated needle was also measured, which had high friction and high adhesion to the counter surface. All coatings, except PAO, had reduced friction dry compared with the uncoated needle. All coatings had low CoF when immersed in PBS.
The frictional properties were further evaluated by measuring the force necessary to penetrate, and maintain motion through, a PU DEKA foil. The needle was mounted on a fixed force gauge (PCE-LFG 20, PCE instruments), and the PU foil suspended on a linear motion drive moving at 1 mm/s. The force was recorded both during insertion and withdrawal of the needle. The penetration phase was conducted dry, and during the withdrawal, the needle was wetted. An uncoated needle was measured and compared to coated ones. All coatings reduced the friction force dry compared to the uncoated needle, and castor oil, soybean oil and PAO had low forces in the wetted stage.
Example 8 Determining the Lubricant Capacity of PVP/PEI-g-PFPA Coatings
The solutions 1-6 (see Table 2) with increasing amounts of castor oil as lubricant content were prepared.
TABLE 2 Examples of different coating formulations prepared as described in Example 5. conc. of conc. of conc. of PVP to castor oil solution PEI-g-PFPA PVP lubricant PEI-g-PFPA to PVP no. [mg/mL] [mg/mL] [mg/mL] m/m ratio ratio 1 0.5 25 0 50 0 2 0.5 25 12.5 50 0.5 3 0.5 25 25 50 1 4 0.5 25 50 50 2 5 0.5 25 75 50 3 6 0.5 25 100 50 4
These solutions were spin-coated onto glass slides and cured for 2 min with UV-C (254 nm, 3.5 mW/cm²). A clean aluminium foil is placed on the coating and slowly peeled off. Coatings with a ratio of castor oil to PVP below 2 (solutions 1-4) did not leave visible oil traces on the foil, while coatings with higher castor oil content left oil residues on the aluminium foil (solutions 5-6). A coating which does not leave oil traces on touching surfaces is preferred.
Example 9: Single Use Razor-Blade Plastic Casing
Razor blade casings were plasma cleaned for 2 min, and coated according to any of the three coating strategies outlined in Table 3. Primer solution I: 0.1 mg/ml PEI-g-PFPA in ethanol and II: 5 mg/ml PEI-g-PFPA in ethanol. After coating with primer solution II, the primer was cured for 4 min at 3.7 mW/cm² UV flux at 254 nm. Topcoat was applied by spray coating. After drying, the coating was cured for 5 min at 3.7 mW/cm² UV flux at 254 nm.
The tactile feeling of Coating No. 3 when dry was smooth and lubricious without being oily or greasy. All coatings were lubricious when immersed in water.
TABLE 3 Coating formulations and strategies for razor blade casings. Adhesion layer UV curing Lubrication coating after conc. of conc. of PVP to castor oil Coating Adhesion primer PEI-g-PFPA conc. of lubricant PEI-g-PFPA to PVP no. layer (Y/N) [mg/mL] PVP [mg/mL] [mg/mL] m/m ratio ratio 1 I N 1 10 0 10 0 2 II Y 1 10 0 10 0 3 I N 2 10 6 5 0.6
Example 10: Coating of Pen Needles by Dip-Coating
Uncoated stainless steel pen needles (clickfine 31Gx5/16″, 0.25×8 mm) are used for the coating experiments. The needles are coated according the following procedure:
- - 1.2 minutes' oxygen plasma - 2. Dip in PEI-g-PFPA (0.1 mg/mL in ethanol) solution for 10 sec to form an adhesion promoting layer - 3. Dip in coating formulation according Table 4 for 10 sec - 4. Dry in air - 5.UV-C illuminate for 2 minutes in case of PVP coatings
TABLE 4 Examples of coating formulations used for pen needle coatings. matrix Matrix to Coating crosslinking lubricant no. description Matrix chemistry lubricant ratio 1 PVP only PVP PEI-g-PFPA none — 2 HVE only none none none — 3 castor oil only none none castor oil — 4 PVP + 50% PVP PEI-g-PFPA castor oil 2:1 castor oil
Example 11: Injection Force Measurements of Coated Pen Needles
Injection force was measured by injection of the needle into a 0.40 mm PU test foil while measuring the force with a Zwick Z2.5 force gauge. The results for the different coated needles are listed in Table 5 and compared to a standard siliconized Clickfine reference. Only for the coating where the matrix is combined with the lubricant castor oil (5) low values as for a siliconized reference needle can be obtained for dry friction. PVP only or PHEMA only as well as cross-linker only or castor oil only leads to higher friction values. PVP containing castor oil based coatings resist gamma sterilisation.
TABLE 5 Maximal injection force (Fmax) and average friction force (Fmid) for different coated clickfine pen needles. Coating Fmax Injection Fmid Friction no. Coating (N) (N) — Clickfine (Reference 0.52 ± 0.08 0.27 ± 0.07 siliconized) 1 PVP only 1.55 ± 0.13 1.39 ± 0.10 2 PHEMA only 1.48 ± 0.10 1.25 ± 0.05 3 HVE only 1.02 ± 0.06 0.59 ± 0.071 4 Castor oil only 0.85 ± 0.03 0.24 ± 0.04 5 PVP + 50% castor oil, 0.68 ± 0.06 0.22 ± 0.03 HVE 5 PVP + 50% castor oil, 0.77 ± 0.06 0.19 ± 0.04 HVE - gamma sterilized
Example 12: Influence of Composition on CoF (Ratio PVP:PEI-g-PFPA:Castor oil) and Wear
To optimize the coating properties in terms of slipperiness (both wet and dry) and the dry appearance (not oily) several coating formulations were prepared as shown in Table 6. Polyester cover slips (Thermanox) were plasma cleaned for 2 min, and spray coated with coating formulations shown in Table 6. Coatings were cured under UV for 2 min at 3-4 mW/cm² UV flux at 254 nm. The appearance of the coatings was tested by placing a piece of aluminum foil on the sample, which was firstly pressed down with a pressure of approximately 26 MPa and then removed from the disk surface. The oiliness was qualitatively judged by ranking the amount of oil transferred from the coating to the foil. Coatings started to become oily above a Castor oil to PVP ratio of 0.6.
| 31,060 |
https://github.com/LuanmaStudio/LuanmaHorrorGame/blob/master/Assets/AnyPortrait/Assets/Scripts/Modifier/ParamSet/apModifiedBone.cs
|
Github Open Source
|
Open Source
|
MIT
| null |
LuanmaHorrorGame
|
LuanmaStudio
|
C#
|
Code
| 410 | 1,355 |
/*
* Copyright (c) 2017-2019. RainyRizzle. All rights reserved
* Contact to : https://www.rainyrizzle.com/ , [email protected]
*
* This file is part of [AnyPortrait].
*
* AnyPortrait can not be copied and/or distributed without
* the express perission of [Seungjik Lee].
*
* Unless this file is downloaded from the Unity Asset Store or RainyRizzle homepage,
* this file and its users are illegal.
* In that case, the act may be subject to legal penalties.
*/
using UnityEngine;
using System.Collections;
using System.Collections.Generic;
using System;
using AnyPortrait;
namespace AnyPortrait
{
/// <summary>
/// Modifier에 의해서 변동된 내역이 저장되는 클래스
/// ParamSet에 포함되며, ModifiedMesh와 동등한 레벨에서 처리된다.
/// MeshGroup 내의 Bone 한개에 대한 정보를 가지고 있다.
/// </summary>
[Serializable]
public class apModifiedBone
{
// Members
//------------------------------------------
public int _meshGroupUniqueID_Modifier = -1;
public int _meshGropuUniqueID_Bone = -1;
public int _transformUniqueID = -1;//_meshGropuUniqueID_Bone의 MeshGroupTransform이다.
[NonSerialized]
public apMeshGroup _meshGroup_Modifier = null;
[NonSerialized]
public apMeshGroup _meshGroup_Bone = null;
/// <summary>
/// 선택된 Bone의 MeshGroup(RenderUnit)이 포함된 루트 MeshGroupTransform
/// </summary>
[NonSerialized]
public apTransform_MeshGroup _meshGroupTransform = null;
public int _boneID = -1;
[NonSerialized]
public apBone _bone = null;
[NonSerialized]
public apRenderUnit _renderUnit = null;//Parent MeshGroup의 RenderUnit
/// <summary>
/// Bone 제어 정보.
/// </summary>
[SerializeField]
public apMatrix _transformMatrix = new apMatrix();
//>>> 이거 다시 없앰. Control Param의 값을 따르는 것으로 변경.. 으으..
////추가 : 5.9
////본 + IK Controller인 경우
////Position Controller와 LookAt Controller의 Mix Weight를 설정할 수 있다.
//[SerializeField]
//public float _boneIKController_MixWeight = 0.0f;
// Init
//------------------------------------------
public apModifiedBone()
{
}
public void Init(int meshGroupID_Modifier, int meshGroupID_Bone, int meshGroupTransformID, apBone bone)
{
_meshGroupUniqueID_Modifier = meshGroupID_Modifier;
_meshGropuUniqueID_Bone = meshGroupID_Bone;
_transformUniqueID = meshGroupTransformID;
_bone = bone;
_boneID = bone._uniqueID;
}
//TODO Link 등등
//에디터에서 제대로 Link를 해야한다.
public void Link(apMeshGroup meshGroup_Modifier, apMeshGroup meshGroup_Bone, apBone bone, apRenderUnit renderUnit, apTransform_MeshGroup meshGroupTransform)
{
_meshGroup_Modifier = meshGroup_Modifier;
_meshGroup_Bone = meshGroup_Bone;
_bone = bone;
_renderUnit = renderUnit;
_meshGroupTransform = meshGroupTransform;
//if (_meshGroup_Bone != meshGroup_Modifier)
//{
// //Debug.Log(" ------------Sub Bone의 Link ------------");
// if (_renderUnit == null)
// {
// //Debug.LogError("<<< Render Unit이 Null이다. >>> ");
// }
// Debug.Log("meshGroup_Modifier : " + (meshGroup_Modifier == null ? "NULL" : meshGroup_Modifier._name));
// Debug.Log("_meshGroup_Bone : " + (_meshGroup_Bone == null ? "NULL" : _meshGroup_Bone._name));
// Debug.Log("_bone : " + (_bone == null ? "NULL" : _bone._name));
// Debug.Log("_meshGroupTransform : " + (_meshGroupTransform == null ? "NULL" : _meshGroupTransform._nickName));
// Debug.Log("_transformUniqueID : " + _transformUniqueID);
//}
}
// Functions
//------------------------------------------
public void UpdateBeforeBake(apPortrait portrait, apMeshGroup mainMeshGroup, apTransform_MeshGroup mainMeshGroupTransform)
{
}
// Get / Set
//------------------------------------------
}
}
| 26,290 |
1878526_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 1,986 |
None
|
None
|
English
|
Spoken
| 1,066 | 1,469 |
SELIKOFF, J.S.C.
This a motion for summary judgment arising out of three equipment lease agreements between U.S. Funding Corporation, as lessor, and Valencia Pork Store Inc., defendant.
The first lease agreement dated November 18, 1974 for a term of 36 months matured on November 18, 1977. The second lease agreement dated December 2, 1974 for a term of 60 months matured on November 20, 1979. The third lease agreement dated January 29, 1975 for a term of 60 months matured on January 28, 1980. All obligations of defendant-lessee were personally guaranteed by co-defendants, James Musillo and Angelo Greco.
The three lease agreements were subsequently assigned by U.S. Funding Corporation to Bank of Bloomfield. Thereafter, on January 10, 1976, the Commissioner of Banking of the State of New Jersey took possession of the business and assets of said bank, and the lease agreements were then assigned to the Federal Deposit Insurance Corp. (hereafter referred to as "FDIC"), an agency of the United States Government.
The last payment by the lessee on any of the subject agreements allegedly was made on August 30, 1977. Plaintiff FDIC filed suit on November 18, 1985 to recover monies owing pursuant to said agreements. An answer was filed on December 26, 1985 in which defendants raised the expiration of the applicable statute of limitations as a defense.
Defendants now move for summary judgment claiming that the six-year statute of limitations bars plaintiffs claim, N.J.S.A. 2A:14-1. Specifically, it is argued that since the last payment by defendant-lessees was submitted on August 30, 1977, the default by defendants occurred with the failure to pay the next monthly payment. Thus, the cause of action allegedly accrued at that time rather than the time the lease agreements matured, and the limitations period consequently expired in 1983.
Plaintiff FDIC opposes this motion contending that the applicable statute of limitations does not begin to run until the date of maturity of each lease agreement. Plaintiff also asserts that 28 U.S.C.A. § 2415(a) is the applicable statute of limitations. This statute also provides a six-year period within which a contract action may be commenced. It is therefore submitted that with regard to the lease agreements maturing on November 20, 1979 and January 28, 1980, plaintiff instituted suit in time pursuant to 28 U.S.C.A. § 2415(a).
FDIC is indeed an agency of the United States, and therefore 28 U.S.C.A. § 2415(a) would be the applicable statute of limitations herein. 12 U.S.C.A. § 1811 et seq.; see Federal Deposit Ins. Corp. v. Petersen, 770 F.2d 141, 143 (10 Cir.1985). Section 2415(a) provides for a six-year period for the commencement of an action in contract, as does N.J.S.A. 2A:14-1. The pivotal issue thus relates to the accrual date of plaintiff FDIC's cause of action regarding each lease agreement.
Generally, a cause of action accrues when the party asserting it first has an enforceable right. Andreaggi v. Relis, 171 N.J.Super. 203, 235-236 (Ch.Div.1979). In the case of an obligation payable by installments, the statute of limitations may begin to run against each installment as it falls due. Masonic Temple Assn. v. Kistner, 11 N.J.Misc. 761 (D.Ct.1933).
Contractual agreements, however, may provide that on failure to pay one of several installments at its maturity the entire obligation is due. Additionally, there is authority that such default does not automatically accelerate the maturity of the debt or authorize the debtor to take advantage of his default in computing the period of limitation. 51 Am.Jur.2d Limitations of Actions, § 133. Instead, principles of fairness encourage the view that acceleration of maturity will not occur unless the creditor employs the use of the provision even if acceleration appears absolute. 18 Williston, Contracts (1978), § 2077. This line of reasoning is founded on the principle that such a provision is solely for the benefit and security of the creditor. 54 C.J.S., Limitations of Actions, § 150. Accordingly, the maturity date of the obligation would not accelerate until the creditor treats the entire debt as due. See Moline Plow v. Webb, 141 U.S. 616, 12 S.Ct. 100, 35 L.Ed. 879 (1891).
The question of when a cause of action accrues on a default in lease payments where an acceleration provision is present is somewhat novel in New Jersey. There is authority that an acceleration clause inures "only to the benefit of the obligee therein named." Superior Finance Corp. v. McCrane, 113 N.J.L. 501, 502 (E. & A.1934).
Conversely, it would be inappropriate to permit a defaulting lessee to benefit from the specious acceleration of the maturity of lease payments when that very provision was intended as a safeguard for the lessor.
Under paragraph 14 of the subject lease agreement, the acceleration of all rents and additional sums owing is provided as an option of the lessor if default of any installment of rent shall continue for more than five days after written notice to the lessee. Paragraph 18 further provides that "[njotices pursuant to paragraph 14 herein shall be sent by certified or registered mail, return receipt requested." Moreover, paragraph 18 states:
[fjorebearance or indulgence by Lessor in any regard whatsoever shall not constitute a waiver of the covenant or condition to be performed by Lessee to which the same may apply, and until complete performance by Lessee of said covenant or condition, Lessor shall be entitled to invoke any remedy available to Lessor under this lease or by law or in equity despite said forebearance or indulgence.
Clearly, the lessor has the option to invoke the acceleration of all outstanding lease payments upon default. There has been no evidence submitted which would indicate that the lessor, FDIC, exercised its option pursuant to the acceleration provision. In the absence of persuasive authority to the contrary, I am satisfied that the statute of limitations should not run from each default on an installment without manifestation of intent by the lessor that maturity of later installments shall be accelerated. See United, States v. Cardinal, 452 F.Supp. 542 (D.Vt.1978).
Accordingly, partial summary judgment is granted on behalf of defendants Valencia Pork Store Inc., James Musillo and Angelo Greco only with regard to the first lease agreement dated November 18, 1974 and maturing November 18, 1977. Summary judgment is denied with respect to the remaining dates of November 20, 1979 and January 28, 1980 insofar as suit has been timely filed by plaintiff FDIC on these agreements.
Plaintiff shall submit the appropriate order..
| 26,614 |
publiivirgiliima00virg_2_3
|
English-PD
|
Open Culture
|
Public Domain
| 1,858 |
Publii Virgilii Maronis Carmina omnia
|
Virgil | Dübner, Fr. (Friedrich), 1802-1867, editor | Bond, John
|
Latin
|
Spoken
| 7,727 | 14,903 |
N'imirum certus victoriae et pignoris oblinendi , jam non timet patrem et no- vercam , vel de gregis parte audacter periclitaturus. 32 Alter eorum, aut pater , aut noverca , prout accidit.— 33 Ye- rum ponam id etc. — 34 Scili- cet me in certa- men cantus pro- vocando. — 35 Par poculorum fagineorum : ex antiqua simpli- citate et pau- pertate , de qua Tibullus : nec bella fuerunt , Faginus adsta- bat quum scy- phus ante do- pes. — 36 Sed Jtis poculis pre- tium accessit ar- te praestantissi- mi caelatoris Al- cimedontis, de quo ignoratur, fictumne sit no- (50-67) ECLGGA TERTIA. 13 Audiathaec tantu50 — vel quivenit, ecce, Palaemon. Efficiam , posthac ne quemquam voce lacessas. DAMOETAS. Quin 51 age, si quid habes : in me mora non erit ulla. Nee quemquam fugio. Tantum , vicine Palaemon , Sensibus haec imis , res est non parva 52, reponas. PALAEMON. Dicite53, quandocpiidem in molli consedimus herba. Et nunc omnis ager, nunc omnis parturit arbos ; Nunc frondent silva3 , nunc formosissimus annus. Incipe , Damoeta ; tu deinde sequere, Menalca. Alternis 54 dicetis : amant alterna Camcenae 55. DAMOETAS. Ab 56 Jove principium , Musae; Jovis omnia plena 57 : Ille colit terras 58; illi mea carmina curae. MENALCAS. Et59 me Phoebus amat : Phoebo sua60 semper apud me Munera sunt, lauri61, et suave rubens hyacinthus. DAMOETAS. Malo 62 me Galatea petit , lasciva puella , Et fugit ad salices , et se cupit ante63 videri. MENALCAS. At mihi sese offert ultro mens ignis64, Amvntas, ISotior65 ut jam sit canibus non Delia nostris. !■**■ - sect exacerDatus Damoetas jus suum superbe cedit Menalcae provocato. — 52 Certatur de re non parvi pretii, de vitula : quare attentissime ausculta. — 53 Canite. Sapienter autem poeta rudibus conviciis et dulcihus carminibus pastorum interponit suavem de- scriptionem veris et amceni loci, ubi certamen initur. — b't Alternis est quod Theocritus dicit 5 1’ d[t.ot6afwv : alternabitis carmina , alter post alteram canen- tes. — 55 Musarum nomen Italicum. — 56 Imitatur Arati et Theocrili celebres ver- sus:’E/. A'.o; dpywjJieffSa. Ab Jove auspicabantur veteres poetae lyrici; unde IIo- ratius : Quid prills dicam Souths Parentis laudibus ? Principium, scilicet cantus j mei , quern vos, o Musae, praestatis. Male quidam jungunt principium musse (ge- nitivo singular!). — 57 Hoc quoque sumptum ab Arato, qui ex mente Stoicorum loquebatur, Jovem intelligentium de anima mundi, quae universum usquequaque penetrat et sua vi implet. — 58 Omnia ille implens rnra quoque colit : quare etiam mea ruricolae carmina curat. — 59 Et pro simplici copula liabeam : Tu , ut dicis, Jovi es curae ; et ego amor ab Apolline : uterque diis cari sumus. Qui ita accipiunt : Me quoque Phoebus amat, non te solum ; praecedens vocabulum carmina urgent, quippe quae sine Apolline fieri non possint. — 60 Munera quae ipsi conveniunt et placent. — 61 Jam notavimus hiatum in hac caesurae sede. Satis notae sunt fabulae Daphnes in laurum mutatae et Hyacinthi in florem cognominem. Arborern et flo- rem Apollo eodem amore prosequebatur quo, dum viverent , Daphnen et Hya- cinthum. — 62 Malum Veneri sacrum liabebatur : quare amantes malo inaliquem conjecto amorem suum significabant. Petulans et jocose procax ( hoc enim est la- sciea ) Galatea misso malo delicians fugit. — 63 Antequam occultetur saliceto. — Ci Amyntas puer, cujus amore flagro. Saepius ignis et Jtamma de ipso amore di- cuntur, quam , ut hie , de persona amata. — 65 Ita frequens ad me commeat A- mvntas, ut vel Delia, arnica mea, non magis , quam Amyntas, nota sit canibus meis, qui neque illam neque hunc aliatrant, bene sibi cognitos. Galateae amore superbienti Damoetae Menalcam respondentem vides, se non solum a puella, sed etiam a puero ultro se offerente amari. j 50 Additurus ; erat : aliquis ! judex, vel no- i men pastoris cu- ! juspiam , quum i supervenientem . conspicit Palae- ! monem. Incer- ta vis est vocis j vel : potest es- j se nostrum oil , bien , ut refera- | tur ad absentis | nomen non ex- pressum a Me- nalca : potest e- tiam : me me , quod Palaemon ; homo simplici- ! or esse videre- | tur (vide notam j 10 in fine Eclo- gae), aut judex suspectus, utpo- te mox vicinus vocatus ab ad- versario. — 5 1 Postremisverbis Menalcae vexa- tus hisce Damoe- las respondet : Imo statim inci- pe, si quid lia- ' bes quod canas. j Provocantis est j ut canat prior ; P. VJRGILII MARONIS (68*82) DAMOETAS. Parts meae Yeneri 66 sunt munera : namqiie notavi Ipse locum, aeriae quo07 congessere palumbes. MENALCAS. Quod08 potui, puero silvestri ex arbore lecta00 Aurea70 mala decern misi; eras altera mittam. DAMOETAS. O quo ties et quae nobis Galatea loeuta est ! Partem71 aliquam , venti , divum referatis ad aurcs I menalcas. [mynta , Quid prodest quod me ipse72 animo non sperms A- Si , dum tu sectaris apros , ego retia servo 73 ? DAMOETAS. Phvllida mitte milii , meus est natalis Iolla; Quum faciam75 vitula pro frugibus, ipse venito76. MENALCAS. Phyllida 77 amo ante alias ; nam me discedere 78 flevit, Et longum 7!‘ Fcrmose , vale , vale , inquit , Iolla. DAMOETAS. Triste80 lupus stabulis, maturis frugibus i mb res s,) Arboribus venti', nobis Amaryllidis ira\ MENALCAS. Dulce satis82 humor, depulsis83 arbutus luedis , 66 Meo amori, id est me* ami- c*, parata et in promptu sunt munera quae c mittam. Partus et paratus si- mil limo sensu dicuntur latine. — 67 Locum, in quern congesse- runt ( stipulam sive levia alia, quae solent) , id est in quo ni- dum sibi feccre palumbes , ae- riae regionis in- colae. Aves Ve- neri sacr*,qua- re sunt in donis amantium. — 68 Ego feci id quod potui vel quan- tum potui : mi- si amato puero mala, etc. Lati- nis quod potui verbo principi parenthetice ad- ditur, sine feci quod nos expri- mcre consuevi- mus. — 60 Legi dicuntur et fruges et (lores, quos decerplmus; confer notam IS ad Eclog. II. Sed hoc loco selecta potius, praestantissima vel maxime matura arboris poma intelligi videntur. Quo referas altera decern sequenti die mittenda, quando h*c quoque sa- tis maturuerint. — 70 Aurea mala dicit , ex communi usu poetarum, pulcberrima , exquisita : certe neque de cydoniis ( coings ) capi potest, quae non nisi mclle condita edebantur, neque de citreis ( citrons ) , quae ab ipso Virgilio Medico dicuntur et exotica, ut ex silvestri arbore in Italia peti non potuerint. — 7 1 Sensus : Opto ut pars certe aliqua horum blande dictorum et promissorum rata sit et eventual ha- beat. Nimirum dii non curare dicuntur jurajuranda et perjuria amantium, ilia non audire , h*c non punire : quare Damcetas ventos precatur ut cxiguam modo par- tem eorum, quae Calatea per deos promiserat, ad aures eorum perferant, quo h*c pars certe adimpleatur. Referri enim dicuntur quae ad aliquem pertinent vel ei debentur. Non cogitandum igitur de locutione plane diverga , qua ventis ferri sive auferri dicuntur promissa amantium. — 72 Ipse significat : per te, quod ad mentem tuam attinet. — 73 Venatoribusaderantquiobservarentquidubiquein retia. latiore spatio extensa , incideret: Xivd-ta; (linorum spectatores) Gr*ci vocant. IIoc igi- tur munus obit Menalcas, ut obsequium exhibeat Amynt* venanti : sed hie dum venationis studio totus iucalescit , quid relinquitur amori? — 74 Sic aliam Pliylli- dem ad se invitat Iloratius Maecenatis diem natalem celebraturus, Od. IV, 1 1, loll* nomine fortasse liic quoque significatur Asinius Pollio , ut in Ecloga superiore. — 75 Sacra faciam sive sacrificabo vitulam immolando pro frugibus : quod ficbat Sacro Ambarvali, « quo hostia (inquit l'estus) rei divin* causa circum arva ducitur ab iis, qui pro frugibus faciunt. » — 76 II*c ita sunt intelligenda : Ambarvali fe- sto, quo pura omnia et casta fient, ipse quoque adcsse poteris ; sed natali die, quo genio et amoribus indulgemus, mitte Phyllidem solam. — 77 Damoetam vexaturus Menalcas respondet non ex sua, sed ex loll* persona : quod probe tenendum est ad intellectum horum versuum aliter inexplicabilium. — 78 Flevit de meo discessu : quod magnum signum amoris. — 70 Adjectivum refertur ad sequentia gr*co more pro substantivo neutro accipienda.— SO Res tristis est etc. — 81 Plinius: Mature - scentia frumenla imbre laeauntur. — 82 Segeti. — 83 II*dis a matrum lacte remo- lis. Arbuti, arboris in Italia valde frequentis ( arbousier ), folia capellis gratissima. (83-101) ECLOGA TERTIAr Lenta salix 84 fceto pecori , mihi solus Amyntas. DAMOETAS. Pollio amat nostram , quamvis est rustica , Musa 85 ; Pierides86, vitulam lectori pascite vestro. MENALCAS. Pollio et ipse facit nova87 carmina : pascite tauruni , Jam88 cornu petat et pedibus qui spargat arenam. DAMOETAS. Qui te, Pollio , amat , veniat quo 89 te quoque gaudet ; Mella90 fluant illi , ferat et rubus asper amomum. MENALCAS. Qui91 B avium non odit, amet tua carmina, Maevi ; Atque idem jungat92 vulpes , et mulgeat hircos. DAMOETAS. Qui93 legitis flores et luimi nascentia fraga , Frigidus 94, opueri, fugite hinc, latet anguis in lierba. MENALCAS. Parcite95, oves , nimium procedere; non bene ripae Creditur 96 : ipse aries etiam nunc vellera siccat. DAMOETAS. Tityre, pascentes a flumine reice97 capellas; Ipse, ubi.tempus erit, omnes in fonte lavabo. MENALCAS. Cogite 98 oves , pueri : si lac praeceperit 99 aestus , Ut nuper, frustra pressabimus ubera palmis. damoetas. [ ervo ! Heu , lieu , quam pingui 1 macer est mihi taurus in Idem amor exitium est pecori pecorisque magistro. * — * aiatur, iu are- nam jactet. — 89 Is eo perveniat tpio te quoque perveuisse gaudet, id est ad maxi- mum felicitatem, quae sequenti versu describitur, — 90 Tam felix sit qui Pollionem et carmina ejus amat, ut mella ei fluant ex quercubus (vide not. 30 sequent!* Eclogae) et spinosi rubi ( ronces ) non mora ipsi ferant , sed amomum , Indici fru- ticis fructum uvae similem et odoratissimum. Ex aurei saeculi picturis petita imago. Alii explicant (contorta, ut nobis videtur, interpretatione ) : Qui Pollionem amat et carminibus ejus deleclatur, optat ut eamdem poelicae facultalis perfectionem as- sequatur , et poetica mella ( quod Iloratius dixit ) ei fluant, adeo ut vel siccum et exile argumentum ( rubum ) suavissime exornare valeat. — 91 Boni poetae laudi- bus Menalcas opponit exsecrationem poetarum malorum, Bavii et Maevii , qui ii- dem bonorum , ut Virgilii et Iloratii, erant osores et obtrectatores acerrimi. Al- terum Iloratius quoque detesta tur Epodo X. Igitur Menalcas ei qui non. odit Ba- vium, hoc malum imprecatur, ut amet Maevii carmina, etiam pejoris, ut appuret , poetastri. — 92 Imprecatio altera: Idem faciat res absurdas et insanas, qualia sunt jungere, id est jugo subjicere ( alteler ) vulpes, et mulgere liircos. — 93 Jam ad argumenta mere rustica cantores transeunt. 0 pueri, qui legitis etc., liinc fu- gite.— 9i Nam latet iu lierba anguis frigidus (quae est natura reptilium). — 95 Cavcte, nolite. Aliud periculum , fluvii vicinitalem , ovibus suis monstrat Me- nalcas. — 96 Fiditur. Ripae eo minus bdendum, quod ipse dux gregis, aries, in aquam lapsus erat, nuncvillos ad solem siccans. — 97 Repelle. Poetae verbum reji- cerc cum synaeresi proferunt reicere. — 98 Compellite in locum umbrosum , ut r.x sequentibus apparet. — 99 Ante ceperit , abstulerit priusquam mulgeamus. — 1 Queritur Damoetas, macrum esse taurum suum, quamvis positum in pingui eiro ( nobis ers ) , quod bubus est pabulum saluberrimum. 15 8i Vide not. 83 t Eclogae I. — 85 | Poesin. — 86 | Musas invocat, ut semper ad- sint sibi pascenti et quasi ipsae pascant vitulam quam immola- lurus est pro sa- lute Pollionis, qui leget carmi- na ipsarum in- spiratione con- dita. Jam ab aliis notatum est le- ctoris vocabu- lum baud con- veniens pastori- tise mus;e. — 87 Ipse Ilomehis novilalem car- minum in prin- cipibus eorum laudibus atque lenociniisponit; ut non necessa- rium videatur explicare : prae- clara, vel (ut a- lii) in quibus res novae tracten- tur. — 88 Pro vitula Damcetae Menalcas majus aliquid vovet, juvenem tau- rum, qui jam sit petulcus et tarn nnimose ingre- I(j 1\ YIKGILIX MARONIS ECL. in. (102-111) MENALCAS. His2 certe neque amor causa est; vix ossibus haerent ; Nescio quis teneros oculus3 mihi fascinat agnos. DAMOETAS. Die 4 quibus in terris , et 5 eris mihi magnus Apollo, Tres6 pateat cacti spatium non amplius ulnas. MENALCAS. Die quibus in terris inscripti nomina 7 regain Nascantur flores ; et 8 Pliyllida solus habeto. PALyEMON. Non nostrum 9 inter vos tantas componere lites : Et vitula tu dignus , et hie. Et quisquis amores Hautl 10 metuet , dulces aut experietur amaros. Glaudite 11 jam rivos , pueri ; sat prata biberunt. uuiuuo, ex umce- — - ■ ■ " baei carminis lege, ad omnia vel similis vel oppositi argumenti versibus bene re- sponderat : nunc Damoetas subito novum quid tentat , proponens xnigma. — 5 Pa- renthetice : Et , si hoc dixeris, a me judicaberis sapienlissimus et similis Apollini, qui ex Jove scit omnia. — 6 Quaerit igitur : quibus in terris coeli spatium non pa- teat sive extension sit amplius quam tres ulnas. Earn particulam ad numeralia fere omitti constat. Multa in banc quaestionem recentiores commenti sunt satis impro- babilia : sed bene factum quod aequalium Virgilio hominum testimonia servata sunt a veteribus scholiastis Philargyrio et Servio. Nimirum Asconius Pedianus et Cornificius « dixerunt se audivisse Virgilium dicentem , in hoc loco se grammaticis crucem fixisse, quaesituris , si quid studiosius occultaretur. Nimirum se voluisse si- gnificare sepulchrum Caelii Mantuani, liominis luxuriosi, qui, venditis omnibus re- bus et consumptis, tantummodo sibi spatium reservarit, quod sepulcliro sufficeret; et voluisse errorem facere ex cacti et Cacti similitudine, ut sit : Die mihi, ubinam sepultus est Caelius, cujus tribus ulniscontinetur sepulchrum ?» — 7 Flores insCri- pti nomina regum graeca syntaxi dictum pro : inscripta habentes nomina regum. Intelligit hyacinthos (nobis lis martagon) , quorum in foliis cal y cum conspiciun- tur vagi quidam ductus a cetero colore distincti : hi a veteribus A I esse credeban- tur, sive lamentantis interjectio cr.i, hen ! sive initium nominis AiavTO? , Jjacis , ex cujus sanguine florem progerminasse fabulabantur ; alii pro T habebant , 'Ya- xtv0ov indicante ( vide supra not. 61 ). Ille filius Telamonis, Salaminae regis , hie OEbali aut Amyntai, regis Lacedaemoniorum; notum est autem filios quoque re- gum vocari reges. Pluralis regain ad ambos referri videtur, quamquam de uno Virgilius similiter loqui poterat. — 8 Et, si dixeris, etc. Supra v. 78 Menalcas quo- que Phyllidem appetere videbatur. — y Non memn est, id est hominem qualis ego sum non decet, etc.— 10 Baud ex emendatione Wagneri pro aut. Palaemon post- quam modeste dixerat se in certamine tarn magno non posse judicium fern* , utrumque esse praestantem et vitula dignum , suam quoque sententiam profert de re amaloria, in qua pastorum versus amoebaei maxima ex parte versabantur. Dicit igitur : Quisquis satis est audax ut non metuat nec fugiat amoris discrimina, is ex- perietur amorem pro rei eventu aut dulcemesse aut amarum : ad utrumque igitur paratus esse debet. Simplex profecto sententia et modesta liominis jam fassi non suum esse tantas componere tiles. — 1 1 Discedens Palaemon ad suuin opus redit et servis suis imperat ut nunc claudant rivulos vel canales quibus prata ipsius irri- gantur : jam enim satis esse irrigua. Supra igitur exiisse putandus est ut aperiri juberet canales. Per errorem veterum interpretum factum est ut hie versus apud nos quasi in proverbium abierit, quo satis de aliqua re dictum esse et tiniendi tern- pus advenisse significamus. Nimirum illi pueros de Menalca et Damoeta intelligen- tes figuratam sive allegoricam esse orationem sibi persuaserant falso. 2 His , scilicet agnis, eos digi— to demonstrans. Ante vix sup- ple et, ob prae- cedens neque.— 3 Opinabantur veteres, solum adspectum lio- minis invidiosi noxium et pesti- ferum esse, prap- sertim iis , qui nondum firmo et robusto cor- pore essent, ve- lut infantibus et teneris adliuc pecoribus. — 4 Hucusque Me- ECLOGA QVARTA. P0LL1O. biCELiDEs 1 Musie , panic majora canamus ; Non omnes arbusta juvant2 humilesque myricae : Si3 canimus silvas, silvte sint Consule digme. Ultima Cumaei4 venit jam carminis aetas ; Magnus ab integro saeclorum 5 nascitur ordo. Jam redit et Virgo6, redcunt Saturnia regna ; Jam nova progenies7 eoelo demittitur alto. Tu8 modo nascenti puero9, quo ferrea primum Desinet ac toto surget gens a urea mundo , Casta , fave, Lncina : tuns 10 jam regnat Apollo. Teque11 adeo decus hoe aevi , te consule, inibit , lit dignum sit consule Asinio Pollione. De quo et de toto hoc carmine vide quae exponuntur in Argumento. — 4 jEtatum sive saeculorum ex oraculis Sibyllae Cu- manae cognitorum jam ad venit ultimum , id est decimum , quo prisca aetas aurea orbi reddetur. — 5 Sa*cuIorum ille orbis magnus est qui vocabatur annus mun- danus, quo perfecto sidera omnia in suos ortus redire et rerum omnium fieri renovatio credebatur. — 6 Virgo est Justitia , Atx.vj , Jovis et Themidis filia , quae dim post auream aetatem in coelurn se receperat, Astraeae sive Virginis nomine inter sidera splendens , nunc in terras reditura. Ex Italorum fabulis antiquis Saturnus Italiam rexit per auream aetatem, liincipsius nomine vocatam. — 7 No- vum genus bumanum, gens aurea. — 8 Tu fave puero nunc nascenti , Diana Lu- cina. Deam banc partubus praeesse constat; casta , solitum epitheton Dianfe ab amorihus alienae. — 9 Asinio Gallo, Asinii Pollionis filio , quo existente sive cujus ortu ferrea etc. — to Quippe frater Dianae. Ultimum saeculum sive ultimum men- sem anni mundani Solis esse memoraverat Sibylla. Notuin est Apollinis numen jam priscis temporibus cum Sole confusum fuisse. — 1 1 Te consule , o Pollio , exordium liabebit decus hoc xvi> id est pulcherrimum et felicissimum hoc ae- vum ; sic enim malirn quam de puero nascenti dictum intelligere. l Musae prae- : sides pastoritii J carminis, quod i Siculum dicitur, [ quia in Sicilia I exorti Daphnis I (vide Argumcn- | turn Eclogae V) j et Theocritus. — r 2 Non omnibus 1 placent arbusta , et ruris liumili- ! las. — 3 Sensus : Si tamen pasto- I'itium carmen componimus, id ita componatur 1\ VIHGILII MAKON1S 12 Menses ma- ' > et incipient magni 12 procedere menses ; ^m.utpote tem- ' Te duce 13, si qua manent sceleris vestigia nostri , Eris’amei’sai- Irritali perpetua solvent formidine terras, culi. Alii intelii- 1 1 lie 15 deum vitam accipiet 16, divisque videbit gunt novos an- j permixtos heroas , et ipse videbitur illis : ses, quo nomine ! Pacatumquel/ reget patrns virtutibus orbem. appeiiatur an- At tibi prima , puer, nullo munuscula cultu18 — Uf 3 Te auspice j Errantes hederas passim cum baccare 19 tcllus graece <rou vjyou- Mixtaque ridenti colocasia fundet20 acantho. Ipsse21 lacte domum referent distenta22 capellac Ubera , nec magnos metuent armenta leones. Ipsa23 tibi blandos f undent cunabula flores. Occidet2* et serpens , et fallax herba veneni Occidet; Assyrium vulgo25 nascetur amomum. At sirnul26 heroum laudes et facta parentis Jam legere et quse 27 sit poteris cognoscere virtus , Molli28 paulatim flavescet campus arista , Incultisque29 rubeus pendebit sentibus uva , Et durse quercus sudabunt 30 roscida mella. Pauca tamen suberunt priscae vestigia fraudis31, Quae32 tentare Thetim ratibus , quae cingere muris delSioSberallit jOppida, quae jubeant telluri infmdere sulcos. Iiumanum ge- no , qui tuum nomen gerit. — 14 Ea vestigia sceleris nostri ( qua voce , ut apud Horatium , longissimi belli civilis facinora immania iritel- liguntur ) irrita facta, sublata et abolita sive, ut nos loquimur , eorum sceleruin usque ad ulti- nus a perpetuo timore. — 15 Puer Asinii nascens.— tc Mabebit vitam divinae vitae similem, inter deos et heroas : nam aureo saeculo homines vivebant ut dii ( w; SecA e^wov apud Hesiodum ) el a diis invisebantur. — i" Orbem terrarum pace do- wnturn a patre (cujus praecipuae partes erant in Bmndusino illo foedere conci- liando ) puer iisdem virtutibus patriis regel sive gubernabit , ij>se quoque ad surn- inos honores evehendus. Ilinc poeta pingit aureae liiijus vitae felicitatem , initia capientem a pueritia Asinii Galli. incrementa cum adolescentia ejus, consumma- tionem cum aetate virili. — 18 Nullo cultu, id est sine cultu et sua sponte tellus omnia proferebat aureo saeculo. Sic igitur Gallo proferet , quasi priina munuscula infantiae , hederas hue ilinc vagantes, luxuriantes , etc. — 19 Ilerba odorata et'co- ronaria , qtice creditur esse nostra digitate pourpree. — 20 Magna copia proferet colocasia ( hodieque dictum Arum colocasia). Ridenti, id est laeto, pulchro, ad foliorum acanthi formam elegantissimam referendum videtur. — 21 Sponte sua, non agente pastore. — 22 Turgentia , plena. — 23 Gunabula tua sponte , nemine serente et curante , proferent ubertim flores vel colore vel odore tibi gratos. — 21 Sensus : Noxia omnia peribunt, quae ferream aetatem afflixerunt; venenatum nihil usquam supererit. — 25 In omnibus locis. Indicum amomum ( vid. not. 90 Eclogae III) per Assyrios sive Syros mercatores in Occidentem ferebatur; bine epitheton. — 2G Sirnul acfactus eris adolescens. — 27 Cognoscere qualis et quanta sit virtus heroum et patris tui. — 28 Tunc eveniet ut sponte sua ( hoc enim ex pr;e- cedentibus satis intelligitur, neque opus erat ut repeteretur) sensim fl ivum colo- rem induat campus aristis maturescentibus plenus; novae autem aristae enmt mol- les, id est laeves et glabrae , non acutis acubus vallatae. Quod quo pertinent , doeet Cicero de Scnectute c. 1 5 , qui frumentum dicit contra avium minorum morsus munitum esse vallo aristarum : quo non opus est saeculo aureo, nihil ferenti no- xium. — 29 Et ex sentibus , quos nemo colit , pendebit uva purpurea. — 30 Exsu- dabunt. (34 -56) EGLOGA QUARTA. Alter erit turn Tiphys33, et altera quae vehat Argo Delectos34 heroas; erunt etiam altera bella, Atque iterum ad Trojarn magnus mittetur Achilles35. Hinc , ubi jam firmata virum te fecerit aetas , Cedetet ipse mari vector36, nec na utica pinus 37 Mutabit 38 merces ; omnis feret omnia tellus. Non rastros patietur humus39, non vinea falcem ; Robustis40 quoque jam tauris juga solvet arator ; Nec varies discet mentiri 41 lana colores , Ipse sed in pratis aries jam suave rubenti Murice42, jam croceo mutabit vellera luto43 ; Sponte sua sandyx4* pascenles vestiet agnos. Talia45 saecla , suis dixerunt , currite , fusis Concordes stabili fatorum nurnine Parca?. Aggredere46 o maguos, aderit jam tempus, lionores, Cara deum47 soboles, magnum Jovis incrementum 48 ! Aspice convexo49 nutantem pondere mundum , Terrasque , tractusque maris , ccelumque profundu 50 ; Aspice , venturo loetantur ut omnia steclo ! O51 mihi tarn longse maneat pars ultima vitae , Spiritus et52, quantum sat erit tua dicere facta ! Non me carminibus vincet nec Thracius Orpheus , Nec Linus53: liuic mater quavisatq* huic pater adsit , 33 Tiphys erat Argus navis gu- bernator : quae Argonautarum expeditio, post eamque belium Trojanum facta sunt lieroica ae- tate, qualem ae- tatem repetitum iri poeta signili- cat, quando a- doleverit filius Pollionis. — 34 Enniano voca- bulo utitur Vir- gilius; sic enim velus poeta in Medea Iragcedia: Argo, qua vecti Argivi DELECTI viri. — 35 Prin- ceps ille hero- inn Troici belli. — 36 Navigator nullus in mari conspicietur. — 37 Navis ex pini ligno constru- cta. — 38 Com- mercia mutan- dis mercibus fa- ciet. — 39 Ne- que rastris aliis- jjj que agriculturae inslrumenlis fodietur terra, neque vitis putabitur. — 40 Tauris J qui robore suo aratorem adjuvant. — 4 1 Mentiri colores lana dicitur , quia alieno inficitur colore : ij>sae jam pecudes per se habebunt colorem purpureum vel cro- ceum vel rubrum. — 42 Purpura. — 43 Lutum sive luteum est lierbae genus (no- bis gaude), quo tincta lana croceumsive (lavum colorem refert. — 44 Sandy x dicitur pigmenti genus ex sandaracha tosta et rubrica mixtum , quo rubeus co- lor rebus inducitur. Pascentes intransitive positum. Ipso pastu igitur ovium, non tinctoris opera , producentur in lana colores varii. Le viter Plinius in hoc versu notat Yirgilium, ut qui « sandycemexistimaverit esse. « — 45 Construe et intellige : Parcae, nunc concordes in fatis hominum rerumque definiendis et cui- que assignandis ex certa et constanti lege divina , fusis suis , quibus fila fatorum deducunt, dixere : Currite talem cursum saeculorum! sive: Talia saecula pro- ducite cursu vestro 1 Graeca syntaxis est, neque supplenda praepositio per. — 4 6 Poeta puerum alloquitur quasi jam in virili aetate constitution. — 4 7 Deovum pro : dei , scilicet Jovis. « Sic enim totum genus interdum pro singulis ponitur , ubi minus refert quis sit ille , id est quod sit ejus nomen quern significamus , quam qualis sit , dei scilicet alicujus, non mortalis patris filius. » W. — 4 8 Magna accessio ad Jovis sobolem ; nova et illustris proles , quae accedit ad numerum filiorum Jovis. Nam incrementum non significat alumnum , ut alii interpretan- tur. Rursus alii : qui per Jovem incrementum capit , cui favet Jupiter ; quod nequit probari. — 49 Mundum nutantem, commotum tota mole sua, quae con- vexa dicitur a cceli omnia complectentis specie convexa. Sic enim afficitur mun- dus adventu atque euupaveta numinis, uti etiam in nostris libris Sacris A facie Domini mota est terra; monies exsuit ast is ut arietes , etc. — 50 Profunda et alia dicuntur in certam regionem ( direction ) longe extensa, sed ipsa directio non necessario indicatur his vocabulis; ita ut coelum vocari possit profundum, pu- teus altus. P. VIRGILII MARONIS ECL. IV. (57-631 Orphei54Calliopea, Lino formosus Apollo. Pan etiam Arcadia55 mecum si judice cerlet, Pan etiam Arcadia dicat56 se judice victum. Incipe , parve puer, risu cognoscere 57 matrem : Matri 58 longa decern tulerunt fastidia menses. Incipe59, parve puer : cui60 non risere parentes, Nec deus hunc mcnsa , dea nec dignata cubili est. 5i Dativi forma grreca. Calliope Musa Orpheurn peperisse dice- batur ex OEa- gro , fluvio et rege Tbraciae ; Apollo Linum genuisse ex C- rania aut Callio- pe.— 55 Pasto- ribus Arcadia; judicibus , qui Panem , peculiarein Arcadiae deum , maxime vene- rantur. — 56 Ipse fateatur. Repetitio arncena (inquit Macrobius), vim simul et simplicitatem habens. — 57 Suaviter arridens matri agnoscere earn , sive signifi- care risu tuo, earn a te cognosci. Infantis risus est intelligendus, non matris. — 53 Meruit htc mater de te , ut earn risu tuo exhilares : nam decern menses (sic enitn veteribus indicari solet tempus in utero gestationis) ipsi attulerunt fastidia longa. — 59 Incipe arridere matri, et sic parentes invitabis, ut tibi quoque laeti arrideant. Hoc voluisse poetam , sequentia monstrant. — 60 Is cui nascenti non arriserunt parentes , nunquam inter deos et beroas versabitur. Poeta autem supra vaticinatus erat Galium inter deos locum habiturum. Ceterum probabiliter obser- vant veteres scholiast*, Virgilium respexisse ad fabulam Vulcani : • qui quum de- formis esset, et Juno ei minime arrisisset, ab Jove est praecipitatus in insulam Lemnum. Illic nutritus ab Sintiis , quum Jovi fulmina fabricasset , non est admis- sus ad epulas deorum. Postea quum rogasset ut vel Minervse conjugium sortiretur. spretus ab ea est. • ECLOGA QVINTA. DAPHNTS. MENALCAS, MOPSUS. I Tu bonus, id | est peritus in- ! flare flstulam ca- MENALCAS. lamis levibussi- , , . . , ve arundmibus non , Mopse , bom quoniam convenimus ambo, compactam. />/- Cur Tu 1 calamos inflare leves , ego dicere versus , Hie corylis2 mixtas inter considimus ulmos? MOPSUS. Tu major3; tibi me est aequum parere, Menalca ; Sive sub incertas 4 Zephyris motantibus umbras , Sive antro potius suceedimus. Aspice ut5 antrum Silvestris raris sparsit labrusca racemis. MENALCAS. Montibus in nostris solus tibi certat Amyntas. MOPSUS. Quid 6 , si idem certet Phoebum superare canendo ? MENALCAS. Incipe , Mopse , prior ; si quos7 aut Phyllidis ignes , ! cere apud om- nes poetas lati- nos pro : cane- re. — 2 Inter ulmos mixtas corylis. — 3 Ma- i jor natu. — 4 Sive liinc imus 3 sub umbras in- certas , id est | tremulas , Ani- ta ntes, quia Ze- ll phyrorum aura ienitor agitans j ramos et folia , eas sappe loco | move!. — 5Quo- ! modo labrusca, | vitis silvestris , j craec.dfpirfti.TCt- — — ■ — — — Xo$, hoc antrum obduxit racemis bine inde sparsis. Qui non laudarentur in vitibus cultis , racemi rari (non densi) , commendant antrum non obsenratum nimia foliorum luxuiie. Sic in Ecloga VII laudatur arbutus fontes tegens ob raram umbram. — 6 Audita hac Amyntae laude , ut sibi fere paris, Mopsus non sine stomacho respondet :. Quid, si idem Amyntas contendat etiam Musarum coryphaeum superare canendo? Tam temeraria illi est artis confidentia, ut etiam Apollinem in certamen provo- care audeat : sed ejusmodi adversarius victus mihi non plus laudis attulerit quam ; ipsi Apollini. — 7 Si forte habes aut Phyllidis amorem , quern canas. Quos attra- I ctioni cnidam vocis ignes debetur. 22 P. VIKGILII MAR ON IS (0-31) Aut Alconis8 habes laudes , aut jurgia Godri9 : Incipe; pascentes servabit10 Tityrus hsedos. Morsus. Imon haec, in viridi nuper quae cortice fagi Carmina descripsi , et modulans alterna 12 notav i , Experiar : tu deintle13 jubeto ut ccrtet Amyntas. MENALCAS. Lenta salix quantum pallenti14 cedit olivae , Punieeis humilis quantum saliunca15 rosetis, Judicio nostro tantum tibi cedit Amyntas. MOPSUS. Sed tu desine 16 plura , puer ; successimus antro. Exstinctum Nymphae crudeli funere17 Daphnim Fiebant : vos , coryii , testes , et flumina , Nympliis , Quum complexa sui corpus miserabile nati Atquc 18 deos atque astra vocat crudelia mater. Non 19 ulli pastos illis egere diebus [amnem Frigida, Daphni , boxes ad flumina; nulla20 nequc Libavit quadrupes, nee graminis attigit herbam. Daphni , tuum21 Poenos etiam ingemuisse leones lnteritum montesque feri silvaeque loquuntur. Daphnis22 et Armenias curru subjungere tigres Instituit, Daphnis thiasos inducere23 Bacchi, El24 foliis lentas intexere mollibus hastas. lain VUG1D IJUUUA , . _ , - fistulae, simul etiam notavit alterna, id esl locos ubi fistula cum voce alternans can- tum excipiebat. Perperam, ni fallor, adverbialiter capitur ullerna : altematim ca- nens versiculum, et eumdem mox incidens in corticem. — 13 Quando meum car- men audieris. Jubeto futuri temporis imperativus est. Mopsus persuasum habet non jussurum Menalcam; atque hie statim respondet, se jam nunc scire , Amyntas quanto sit, si cum Mopso comparetur, inferior. — it Pattens latine dicitur non- nunquam de viridi colore in fuscum vergente, non nitido vel splendente. — 15 Sa- j liunca herba . odore quidem suavi ( Plinius inquit ) , tanta autem brevitate , ut ; necti non possit. . Nobis nard ccltique. — 16 Desinere apud poetas cum accusativo ! struitur ut Eel. VIII : dcsine, tibia, cantus. Novam notionem addit plura, quasi dicat: desine haec, neu addas plura. — 17 Acerba morte. Daphnis in ipso flore ju- ventae mortuus erat vel , ut alii narrant , a Mercurio patre coelo illatus. — 18 Al- loquitur, voce appellat et deos et astra , quae vim habere in hominum fata puta- bantur. Jejune alii explicant : deos et astra dicit vel nominat crudelia. — 19 Ob- serva modulationem lugubrem versus. Quod semel monemus; nam monstrandae in tulibus arti Virgilianae notularum mille unum baud sufficeret. — 20 Ipsa etiam ar- menta et pecora prae dolore cibo potuque abstinent. Inter prodigia necem Julu Caesaris indicantia Suetonius ( c. 8i ) refert : equorum greges, quos in trajiaendo Rubicone jluvio consecrarat ac vagos et sine custode dimiserat , comperit perti- nacissime pabulo abstinere , ubertimque Jlcre. — 21 Testantur montes et silvae (quibus vox datur poetice), etiam leones Africanos, ipsorum habitatores, gemuisse de interitu tuo. Conjiciunt Punicos leones a poeta memoratos esse, ut Carthagmis quoque luctum indicaret, quam J. Caesar colonia deducta instauratum ibat. 22 His versibus tribus Daphnis celebratur, quod vini cultum introduxit apud pa- stores Siciliae, quasi eorum Bacchus. Satis notum ex monumentis antiquis, Dacchum curru tigribus juncto velii. Curru est dativus. — 23 In Siciliam introducere chorus bacchantium. Graeca vox est Qtaao;.- 24 Descriptio thyrsi, quern bacchantes gesta- bant : liastae ex ligno nondum sicco et rigido , hederis et pampinis cinctae. Haec nonnulli ita ad Julium Caesarem referunt, ut similis Baccho et Cereri , cultioris vi- ta* auctoribus, civitatem bellis Hferatam legibus suis pacasse et excoluisse dicatur. } 8 Pastoris no- men. Quanquam nonnulli intel- ligunt Alconem caelatorem, cu- jus aliqua fama apud poetas htt- jus temporis. — 9 Inter obtre- ctatores poeta- rum Augustei saeculi , praeter Bavium et Mae- vium, etiam Co- drus erat, quem in transcursu notat Virgilius. — 10 Cuslodiet. — 11 Non ilia quae tu mi hi ca- nenda propo- nis, sed hxc ex- periar, qux etc. Sic in Eclog. X pastor teneros incidit amorcs Arboribus. — 1 2 Haec ita sunt intelligenda : versibus corlici incisis Mopsus modulationem , sive modos mu- sicos , aptabat (32-53) ECLOGA QUINTA. 23 25 Vitis qu» in Italia arboribus maritari solet. — 261tatu esctc. — 27 Abstule- runt , vel suslu- lere. — 28 Ve- tustissima Italo- rum dea rei pe- cuariae praeposi- ta , cui quotan- nis solemne fe- stum celebraba- tura. d. XUkal. maias(20 avril) , die natali Urbis. — 23 Apollo a Graecis vocatus No[juo? , quasi Pascualis, apa- storibus cultus. Ilorum quoque deorum deliciae Daphnis erat. — 30 Hoc deorum rusticorum pro- pter luctum dis- cessu facta est sterilitas. Gran- diu frumentase- ligi solebant ad seinentem. Plu- ral em horde a , paullo insolen- tius positum et poesi soli con- ccssum sic rose- re obtreclatores Virgilii , Bavins et Maevius , ver- siculo qui solus fere, ut ingenii ipsorum monu- mentum, ad nos pervenil : Hor- ded qui dixit, superest ut tritica dicat. — 31 Lolium ( Vivraie ) infcecundum , ut seges contra est felix. « Felices arbores Gato dixit quae fructum ferunt, inf dices quae non ferunt. » Fesl. Aveuae sunt quod appellamus haveron. Ipsum liordeum in lolium et avenas degenerare veteres credebant. — 32 Xarcisso qui est calyce purpureo. — 33 .Nobis quoque paliure. — 31 Conspergite frondibus locum ubi Daphnis sepultus est. — 35 Circa fontem, ad quern lmmatus est, serite arbores, quae umbram loco obducant. — 36 Titulum sive inscriptionem carmine conceptam. — 37 Etiam Julii Caesaris forma laudabatur ; qui corporis cura providere studebat, ne originem ex Venere dedeceret. — 38 Quale est xo restinguere sitim etc. , substantive posito infinitive et iis quae inde pendent. .lungenda sopor in gramine. — 33 Sed , sine etiam , est augentis : non solum fistulae cantu , sed , quod majus est, verbis et carmine. — 40 Post ilium. Sic Iloratius : Ajax heros ab Achille iecundus. — 4 1 Mea carmina. — 4 2 Summis laudibus celebrabimus. —43 Eamdem imaginem repetit, ut prope cogat lectorem de apotheosi cogitare. Sequemibus respici putatur benevolentia Julii Cae- saris in Gallos Cisalpinos. — 44 Pastoris alicujus nomen. — 45 Menalcas canit apo- theosin Daplinidis, prima statim voce ostendens ejus speciem aliam ac Mopsus : jam est candidus, id est splendens, serenus, laetus. — 46 Ob banc causam, quia in cce- lum evectus Daphnis, voluptas alacris tenet etc. — 47 Arborum nymphas, simul cum arborc sua et viventes et morientes ; quare etiam *A(i.aSpua5'i; dictae. ; Vitis25 ut arboribus decon est, ut vitibus uvie , Ut gregibus tauri , segetes ut pinguibus arvis ; Tu 26 decus orane tuis. Postquam te fata tulerunt27, j Ipsa Pales28 agros atque ipse reliquit Apollo29. Grandia30 ssepe quibus mandavimus hordea sulcis, Infelix31 lolium et steriles nascuntur a venae ; Pro molli viola , pro purpureo32 narcisso, Garduus et spinis surgit paliurus33 acutis. Spargite34 humum foliis, inducite35 fontibus umbras, 1 Pastores ; mandat fieri sibi talia Daphnis. Et tumulum facite, et tumulo superaddite carmen36 : Daphnis ego in silvis, hinc ysqye ad sidera no- Formosi pecoris cvstos, formosior ipse37, [tvs, menalcas. Tale tuum carmen nobis , divine poeta , Quale sopor fessis in gramine , quale38 per aestum Dulcis aquae saliente sitim restinguere rivo. Nec calamis solum aequiparas, sed39 voce magistrum. Fortunate puer, tu nunc eris alter ab40 illo. [sim Ncs tamen haec quocumque modo tibi nostra41 vicis- Dicemus, Daphnimqj tuumtollemus ad astra42; [nis. Daphnin ad astra feremus43; amavit nos quoq? Daph- | mopsus. An quidquam nobis tali sit munere majus ? Et puer ipse fait cantari dignus, et ista Jam pridem Stimicon44 laudavit carmina nobis. i Menalcas. Candidus45 insuetum miratur limen Olympi , Sub pedibusque videt nubes et sidera Daphnis. Ergo46 alacris silvas et cetera rura voluptas Panaque pastoresque tenet, Dryadasque 47 puellas. 24 1\ ViKGILII MAHON IS (60-83) 48 Securita Nec48 lupus insidias pecori , uec retia cervis teai ruris pingit Ulla dolum meditantur : amat bonus otia4!> Daphnis. post receptum i psi lsetitia voces ad sidera jactant n*ii°*Djamn'ne- ; Intonsi 50 montes ; ipsae jam carmina rupes , (pie bestiarum ipsa sonant51 arbusta : « Deus, deus ille, Menalca ! » Cfs?di1ehsimlt.U— Sis bonus 0 felixque52 tuis ! cn quattuor aras53 : 49 Requiem et Ecce duas tibi , Daphni , duas altaria54 Plioebo. secimtatem. - pocuia bina55 novo spumantia lacte quotannis , 50 Montes in- ^ ^ t f. ca?dni, in qui- ■ Craterasque duos statuam tibi pinguis olivi ; bus siiv* non Et multo in primis hilarans convivia Baecho5C, EduntllcaVmina Ante57 foeiim , si frigus erit , si messis, in umbra. et sono suo di- Vina novum fundam58 calathis Ariusia nectar. DeusVesinlZ '' i Cantabunt milii59 Damcetas et Lyctius .Egon ; etc. — 52 Sis no- Saltantes Satyros60 imitabitur Alphesibceus. bis benignus et pjgpQ tibi semper erunt, et quum solemnia vota va signification Reddemus61 Nymphis , et quum lustrabimus agros. accipiendum fe- DumC2 juga montis aper, fluvios dum piscis amabit , feddit! — 53^ Dumque thy mo pascentur apes, dum rore cicadte63, cum accusativo Semper honos nomenque tuum laudesque manebunt. Uonem^f vld e °» Ut Bacc,1° Cererique , tibi sic vota quotannis Pi ures arae con- Agricolne facient : damnabis6rtu quoque votis. stitunntur , quo MOPSUS. ttna offerri pos- _ ... ,. , ,. , sint piura sacri- Quae tibi , quae tali reddam pro carmine dona ? ficia. — si Duas iyam neque me tantum venientis65 sibitus Austri , aitariaqad*vicU- I Nec pcrcussa juvant fluctu tain littcra®6, nec quie mas cremandas. — ~ Altare proprie dicitur de lapidea tabula in ara positaad ignem ibi accendendum ; ill (iris (sine ilia tabula) fruges, thus, libamina diis offerebanlur. Pboebum poeta Dapbnidi jungit , quia ipso natali die Caesaris , undecimo mensis Julii, celebrantur ludi Apollinares. — 55 Si proprie locntus est Virgilius , Menalcas se quotannis po- siturum promittit bina lactis pocuia , nimirum duo in singulis aris, olei nutem cra- teras duos, singulos in singulis aris. Haec diis Laribtis offerebanlur, inter quos cen- sebantur viri in deos relati , ut a pud Graecos inter heroas. — 50 Multo et copioso vino exbilarans epulas post saorilicium. — 57 Hoc versu indicantur duo solemnia annua , quibus Menalcas deveneraturus est Daphnidem : Liberalia sive Bacchi fe- stum, post vindemiam exeunte autumno celebrari solitum ; et Ambarvalia, quae liebant extremo Aprili, incipiente jam in Italia messe. In utraque solemnitate suan partes erant Laribus. — 5S In aram tuam effundam sive libabo vina Ariusia, quae sunt nectar novum, antea non cognitum sive non usitatum. Vinum hoc ex pro- montorio et tractu Ariusio in Cliio insula , Graecorum vinorum omnium pretiosis- simum , non ante baec tempora memoratur, postea valde celebratum. Calathus vocatur etiam vasis vinarii vel calicis species. — 59 Milii sacra facienti. Notus mos ex tot anaglypliis. Lyctus est oppidum Cretae, ad Dicten montem. — 60 Horum co- mitum Bacciii commode mentio fit in sacrificio agresti. — 6 1 Vota ante concepta solvemus Nymphis , baud dubie Liberalium festo , de quo not. 57 : vix enim pote- rant Baccho sacra fieri sine Nymphis. Sequentibus Ambarvalia indicantur; lu- strare idem est quod ambire ( arva ). Conf. Georg. 1 , 338 seqq. — 62 Pastoritia periphrasis temporis sempiterni. — 63 Rore enim vivere credebantur cicadae. De quibus Plinius : Excitatse quum subvolant , humorem reddunt , quod solum argu- mentum est rore ens uli. — 61 Eo quod homines earum rerum, quas a te preca- ti erunt, compotes facies, obligabis eos ad solvenda vota, qiue sub asscquendi con- ditione tibiconceperant. In pi osa quoque dicitur dumnatus voh, pro : compos. — 65 Flare incipientis. — 66 Intelligunt littora Benaci lacus prope Manluam.a qua longe distal mare. (8 i —90) ECLOGA QUINTA. 25 Saxosas inter decurrunt flumina valles. MENALCAS. Hac te nos fragili donabimus ante cicuta 67 : Haec68 nos « Formosum Gorydon ardebat Alexin ; » Haec eadem docuit « Cujum pecus ? an Melibcei ? » MOPSUS. At tu sume pedum , quod , me quum saepe rogaret , Non tulit69 Antigenes (et erat turn dignus amari) , Formosum paribus 70 nodis atque sere , Menalca. 67 Syringe ci- cutis vel calamis compacta; vide not. 35 Eclogae ' II. Ante, scilicet quam tu me do- no ornes. — 68 Haec syrinx no- bis inspiravit , ad hanc lusimus carmina , quae initiis indicat , Eclogas secun- dam et tertiam. — 69 Secum abstulif, a me accepit. — 70 Nodis per paria et invicem convenientia intervalla positis. 4 ECLOGA SEXTA. SILENUS. I Sensus : Mu- sa mea primum se applicuit ad bucolicam poe- sin , nec inter pastores babi- tare dedignata est. Syracosius ( graeca forma pro : Syracusa- nus ) versus di- citur Theocri- teus, patria Sv- racusani , om- nium celeberri- mi in hoc gene- re poetae. — 2 Silvae jam supra de rure et pascuis aliquoties dicta? fuerunt. Thaliam autem Musam doctus poeta nominavit, quia ruris eamdem esse deam sciebat. Sic enim Plutarchus in Quaestionibus Symposiucis JX , 14 (p. 909 ed. nostra?) : « Nos agricolae Tha- liam nobis vindicamus, plantarum et seminum bene germinantium (quod graece est OaXXetv) curam ei et conservationem tribuentes. • Ab aliis Thalia iuvenisse di- citur plantationem atque agriculturam. — 3 Apollo, ad Cyntlmm . Deli insuhe montem , ex Latona natus. Quum epicum carmen aggrederer, hoc non esse mei muneris aut ingenii Apollo me admonuit quo modo discipulos admonere solenl magistri. — 4 Carmen deinissutn , tenue , non grande et mugniloquum, quale esl epos. Sic recte explicat Macrobius, Atellanarum fabularum locis adhihitis : Re- spondit tristis , voce deducia ; et , Vocem deducus oportet , ut mulieris videau- tur verba. Alii comparant Horatianum tenui deducia poemata filo , uhi meta- phor a petita est a lana , quae nendo deducitur et extenditur in Pda tenuia. Quod non est hujus loci. — o Supererunt tibi , abunde erunt. — 6 Componere , compo- sito carmine describere. — 7 Confer versum 2 Eclogae F. — 8 Sed jussa ab Apol- line . qui dixerat oportere poetam deductum dicere carmen. — 9 Nihilominus , si qnishaec, quamvis tenue genus poeseos, cum volnptate leget et delectabitur , tu. Vare, in agris nostris ubique celebraberis. Myricae , nemus , ut alibi silvae, dicta de ntre agris et pascuis. — i0 Atque ipsi Apolljni carmen nullum est gratius | P rima 1 Syracosio dignata est ludere versu Nostra, nec erubuit silvas2 habitare, Thalia. ; Qnum canerem reges et prcelia , Cynthius3 aurem Yellit, et admonuit : « Pastorem, Tityre, pingues Pascere oportet oves, deductum4 dicere carmen. » Nunc ego (namque super5 tibi erunt qui dicere lau- Vare , tuas cupiant , et tristia condere6 bella) [des, Agrestem7 tenui meditabor arimdine musam. Non injussa3 cano. Si quis tamen9 haec quoque, si Captus amore leget, te nostrae, Vare, myricae, [quis Te nemus omne canet : nec Phcebo 10 gratior ulla est (12-33) ECLOGA SEXTA. give dedicatum , i est. Pagina sibi prxscripsit poe- tice de pagina in cujus princi- pio scriptum est nomen Vari. — 1 1 Agite, Musae, et persequimini rem cueptam. — 1 2 Faunorum give Satyrorum nomina. — 1 3 Viderunt pro- stratum somno, dormientem. — 14 Hesterno vi- no. Iacchus est Bacchi nomen in mysteriis ma- xime usitatum. „ Syntaxis graeca !j pro : venas ha- ll bentem inflatas I vino , sive cui venae inflatae e- Quam sibi quae Vari praescripsit pagina nomen. j quam qnod Va_ Pergite11, Pierides. Chromis et Mnasylus12 in an- ro inscriptum Silenum pueri somno videre 13 jacentem, [tro Inflatum hesterno venas , ut semper, laccho 14 ; Serta procul15, tantum capiti delapsa , jacebant, Et16 gravis attrita pendebat cantharus ansa. Aggressi (nam saepe senex spe carminis ambo17 Luserat) injiciunt ipsis ex vincula18 sertis. Addit se sociam timidisque supervenit iEgle, iEgle Naiadum pulcherrima ; jamque videnti 19 Sanguineis20 frontem moris et tempora pingit. Ille dolum ridens21, « Quo vincula nectitis? » in- Solvite me, pueri ; satis est potuisse videri22. [quit : Carmina quae vultis cognoscite; carmina vobis, Huic23 aliud mercedis erit. » Simul24 incipit ipse. Turn vero in numeru25 Faunosque ferasque videres Luderfe, turn rigidas motare cacumina quercus26 ; Nee tantum Phcebo gaudet Parnassia27 rupes, Nec tantum Rhodope28 miratur et lsmarus Orphea. Namque canebat uti 20 magnum per inane coacta 30 Semina terrarumque animaeque31 marisque fuissent , I rant. — is Ser- Et liquidi32 simul ignis ; ut his exordia primis33 potabat'siiemis!' — — — imposita, nunc jacebant procul, id est paullo remotius, atque adeo (ut Servius explicat) « prope. juxta. » Nimirutn relative ( ut nos loquimur ) ad rem praesentem capiendum est hoc adverbium , quo intervallum modo breve modo longius indicatur. Sic JEnc ■ idis X , 835 Mezentius arboris acclinis trunco : procul serea ramis Dependet galea, nimirum ramis ejusdem arboris, sed procul esse dicitur galea capiti non imposita. Ac serla Sileni dicuntur non abjecta sive projecta procul, sed tantum delapsa a capite obdormiscentis. — 16 Et de manu ejus pendebat semisupinus cantharus ( genus poculi capacis) magnus, ideoque gravis, cujus ansa erat attrita per usum frequentem. — 17 Ambos fefellerat. — 18 Vincula ex ipsis sertis de- lapsis confecta ; sicut apud Ovidium ruricolx Phryges Silenum titubantem an- msque meroque ad Midam regem trahunt vinctum coronis. — 19 Jam experge- facto Sileno. — 20 Mororum (mures) succo sariguinei colons. — 21 Non iratus, sed ridens de juvenili dolo Satyrorum. Quo , ad quid, cur. — 22 Videri me vin- cire et cogere potuisse : ut in alia re Ovidins dicit : Perdere posse sat est. — 23 A^glae nymphae. — 21 Haecdicens simul incipit canere. — 25 Ad rhylhmum saltare.
| 20,088 |
bpt6k479583d_2
|
French-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
La Presse
|
None
|
French
|
Spoken
| 7,868 | 17,990 |
Le CoMrWer (~e .Bre/C!/?M rapporte qu'un terribte accident a eu lieu dimanche, vers sept hsui'cS du soir, entre Knevelet Saint-Michel. Le canot du bateau a vapeur de l'Etat le Fro'ëe. monté par huit personnes, a subitement chaviré. Aux cris de détresse des naufragés, le ca~itaiue Mathurin Le Vigoureux, commandant !e ~0!K~~zKceMt, de Vannes, et le nommé Jean-Marie Le Person,son matelot, ss sont, ina~ré la nuit noire, porté au secours de ces malheureux, et, avec un dévouemeni.presqu'e surouciain. sont parvenus a sauver cinq personnes M. Daniel, capitaine du Protëe, M. et ~me prévôt, passagers, et deux hommes de Féffuipage. Maistroisviclimessontrestées dans les Bots un matelot du vapeur et M. Lacour, grefner da tnbnnal maritime, et M~ Lacour, sa femme. Ces deux derniers infortunés, jennes gen? ~oui~sant de l'estime généraié, laissent à la ch~r~e. de parents pauvres trois enfants, dont l'aîné a environ huit ans. –On écrit de Toulon au ~Messa<yer du ~Mt e Une évasion, accomplie par des moyens et dans des circonstances qui dénotent beaucoup d'int~i~ence et une rare énergie, a eu lieu, il y a pfu de jours, au pénitencier de t'ite du Levant. "Huit jeunes détenus,mécontents sans doutedu ré"i!De auquetils étaient soumis, ayant remarqué que If-s coufants portaient tous ies objets uottant ve''s te groupe principal des îtes d Hyères, se sont décides à tenter cette périHeuse traversée au moyen de deux radeaux, composés l'un, d'une paii'as'-e bourrée de débris de liège l'autre, de )a v~i~.e porte d'un fort en ruines sur le bord de l'eau. t Cette navjgatfon dangereuse a été cependant con'oiiQée d'un plein succès, car on apprit, d'une BiaGiëre certaine, leur passage sur ia terre ferme et surtout dans tes îles, où ils ont enlevé le bateaa d'un gardien du phare. ') Ctis hmt fugitifs, âgss de tre)zeàdtx-septaus. pouvant devenir dangereux dans tes campagnes, p&r suite de leur manque de ressources et de leurs -mauvais 8ntpeédents,onad& immédiatement lancer des maBd-its d'amener oans toutes tes directions, aËn de s'assurer de leurs personnes. On lit dans le M~rap~e, de Barcelone <( Le savant Anglais, M. Queensley, de Cambridge, grand admirateur des poètes grecs, a ordonné par son testament qu'après sa mort on le dissèque, et que l'on enlève et tanne sa peau, de manière à en faire un parchemin sur lequel devra tLti. copiée l'/Kade d'Homère. Cet exemplaire du fih'u poëms devra être reposé au Mas~e britaaM~~ a –L'éditeur Dentu met en vente aujourd'hui l'ouvrage de M~ Louise Co]et M~te dea /(sMeK~, 8 forts volumes. Prix 7fr. ER vente chez Michel ~Lévy frères, ~rue 'enne, 2bis. et boulevard des Italiens, 15, a la /.tbt'a~:3 ~VoMUs~e.' ~aMMet de t'~fomîKe et de ta Fë!K?Ke comme t< faut, par Eug. Chapus (u-n. vol., 2 fr.) ~gï Due~ de JeaN Gigon, par Antoine Gandon (un voL, 2 fr,);–Ie Consent. par Henri Conscience (un vot,, 1 fr.);o Premï'ëre ComtHMMt'oK, par E.-J. Delécluze (un vol. Ifr.). M. Eugène Véron vient de publier à la librairie Guiifaumin un ouvrage dont personne ne contestera l'originalité, intitulé :SMpërtorité des sr~ moderMps SMr tes ar~ ancî.MS. Paésie, sculpture, peinture, musique. 1 volume in-8~. Prix, six francs/reM:co. –M. Hubert ouvrira ses cours de solfège, 7novembre,ehezM"~E Samson,10,r. de&Martyrs. Pour tcus tas fait-) divers. J. MAHIAS. ,II1II CA!SSE GÉNÉRALE DES CHEMINS DE FER. M. Mires, gérant dé la Caisse générale des Chemins de fer, prévient ses actionnaires qu'il les convoque pour Lundi 27 octobre, à huit heures du soir, dans la sa~eHerz~ rue de la Victoire. Voici quel sera l'ordre du jour.: 1° Constitution du bureau 3° Lec'.m'e du rapport de M. Mires 3° Vote des propositions. Pour assister à cette assemblée, les actionnaires devront déposer au moias dix actions dans les bureaux de la société, rue de Richelieu, 99. Il leur sera délivré en échange un recépissé et une carte d'entrée. Quoiqu'il suffise de d'x actions pour assister à l'assemblée, M. Mires invite instamment les actionnaires à déposer la totalité des actions qu'ils possèdent, parce que l'assemblée choisira parmi les p~us forts actionnaires les représentants chargés de faire valoir leurs droits. SOCIÉTÉ CIVILE IMMOBILIÈRE DE LA ME LAKAYEITE. .EMM'M!0~ de ~C,<MC ac<!9~ de ~CC /7'<MM. La Société a pour objet la construction de Maisons sur 33,000 mètres environ de terrains situés entre la rue du Faubourg-Poissonnière et la rue Laffute, présentant un dévfloppement de 3,000 mètres de façade et cinquante angles de rues, sur la rue Latayette et les voies nouvelies qui s'y rattachent. Les terrains sont apportés à la Société au prix moyen de 650 fr., nets de frais. Les constructions de maisons dans les quartiers du centre ont toujours été des opérations très fructueuses et très sûres pour ceuxqui résout entreprises. La Compagnie Immobiliere de Paris en est la démonstration la plus complète elle a distribué 10 0/0 à ses actionnaires pour 1861, et ses actions ont plus que doublé de valeur. Cond~tOMS de <!s soMseWp~ott 25 fr. payables en souscrivant. 85 à la répartition. 85 le 15 janvier t863. 25le 15 avril 1863. La souscription est ouverte du 6 au 18 octobre, chez MM. ARDOtN, BtCAttDo eL c", banquiers, 44, rue do la Chaussée-d'Àntin, où i'on trouve les plans des terrains, l'acte de Société, et tous autres renseignements. « MAISON BIETRY, ~1, BOULEVARD DES CAPCCtNES. Châles cachemire, -châles de laine, châles unis pour deuil et tissus cachemire pdurrobes. M. Biétry a l'honneur d!être fournisseur breveté des cachemires français de S. M. l'Impé ratrice. Il est niat~ur et fabricant Par sa double industrie, et traitant directement avec le consommateur sans intermédiaire, l'acheteur est donc sûr de trouver dans cette maison un bon marché réel. Chaque objet est revêtu de deux cachets portant le nom de la maison, )a garantie de la matière employée, un numéro d'ordre et ie prix fixe. Sur demande, on expédie en province. Les magasins sont au premier, f Les propriétaires delà maison du PetitSat'H~-7'Aomas, rue du Bac, 35, à Paris, nous prient d'annoncer que leurs assortiments en nouveautés de la saison sont aujourd'hui comp!ets, et qu'ifs ont mis en vente plusieurs affaires importantes bien au-dessous du cours, en soieries, lainages, fantaisie et tapis. Agrandissements considérable des magasins de foulards de )a Compagnie des Indes, rue de GrenetIe-Saint-Germoia, 48. 35 années d'un succès toujours croissant attestent les merveilleuses vertus médicales de la graine de moutarde branche (de Ho~iande) de Didier, 32, ga!erie d'Orléans, au PalatsRoya!. Plus de 800,000 cures, authentiquement constatées, justifient pteim'ment ia propriété 1 universelle de cet incomparable médic ment., que le célèbre D'' Kooke appelait à si juste titre uMt-emëde6ëK't,.tt~ mof/H~Me prëssnt dM ''te!. Nul traitement n'est moins dispendieux ai plus sûr. Cen~ tKîHe /r6MM.! s ~a.~Kgr peMf .25 c. Billets loterie Sr-PoiNT, ch~zdfbitantsde tabac, épiciers, etrueR!voh,68,auBcMAB Ex.tCmoBB, où a présenlationsont payés lots gagnés. Cours et TMbmnawx. Dans son audience d'hier, la cour impériale (chambre des vacations), présidée par M. de Gaujal, a, sur les réquisitions de M. l'avocat général Senard, entériné des lettres-patentes de l'empereur, portant commutation en la peine des travaux forcés à perpétuité de la peine de mort prononcée contre François-AugusteDorival par la eour d'assises de la Seine du 13! septembre dernier, pour crime d'assassinat commis sur une Hlle publique.Le condamné, dans le costume gris des prisonniers, assistait à l'audience, entre deux gendarmes, à la lecture des lettres patentes. Rien, dans le jeu de sa physionr'nne, n~a témoigné de la joie qu'il devait éprouver de la mesure de clémence dont il était l'objet On lit dans la Gironde, sous la date de Bordeaux, lo octobre <( On a appelé aujourd'hui, à l'audience du tribunal de police correciionneUe. la double, affaire à Jaquei~e a donné tieu l'incident survenu le 6 septembre entre M. BreistroS' de Rochebrnne et M. Lavertujon. au domicile de ce dernier. Sur ia demande de M* Barincou, avoué de M. de Rochebrune, cette aBaire a été remise au 6 novembre. On a appelé aussi l'affaire en diffamation intentée par M. Hugelmann contre MM. Lavertujon et Gounouilhou, et cette de MM. Hu~elmann, La– vertujon et leurs témoins, poursuivis par le ministère pub)ic en vertu'des articles <, 3 et 3 de la loi de i8id, à raison de la part prise par eux à des publications relatives à un duet. Ces aSaires ont été égatemeEt remises au 6 novembre. M* Brochon s'est chargé de la défense de MM. B. de Rochebrune et Hugelmann; M" Delprat, bâtonnier de l'ordre-, Lagarde et Deiprat. du barreau de Paris, se sont présentés pour MM. Lavertujon et consorts. < m~ELm. On annonce que M. Benedetti doit venir à Paris~lasemaine prochaine, envertud'ua congé. Une dépêche de Rome d'hier nous apprend que te bruit de la retraite du cardinal AntoneUi et de M. de Mérode prend une e certaine consistance. M. Fould, ministre des finances, se rend a Marseitle pour assister à l'inauguration du service français de iIndo-Chine. Le départ de l'empereur et de l'impérarioe pour QompiègM a'Mra pa): lieu, dit~ on, avant !a 6n du mois. C'est dans cette ) r résidence qu'Ds recevront !a visite du roi t et de la reine de Portugal.–pharolais. c I L'agence Havas-BullIer nous transmet les 1 dépêches suivantes 1 < Londres, 16 octobre. v Les meetings garibaldiens continuent dans ( plusieurs vj)ies d'Angleterre. c B Des troub]es graves ont eu Heu à Birkenhead, par suitp d'une reunion dont les membres voûtaient manifester teurs sympa'hies ( pour GaribafdiLesautontés avaient pris tour tes les précautions voulues en entourant ta maison où se tenait lu reunion d'une force imposante d'agents de police et de soldats. Ces r mesures n'ont pas empoché les Irlandais, ar1 mes de bâtons et de couteaux, d'attaquer les r garibaldiens.. g On dit que, pour détourner l'attention de s ta poJiceJesIrIandMsavaientaltuméde grands feux dans )es cheminées de leurs maisons, afin J de rfmptir les rues de fumée et de faire crainc dre ainsi un incendie général. Un grand nombre de personnes ont été grièvement blessées. Les Iriandais auraient t saccagé plusieurs boutiques et jeté les mar t chandises dans la rue. Les troub~s continuent, p Les magistrats délibèrent s'il faut autoriser [ l'intervention de la force militaire. )) r < Londres, 16 octobre. "Hier, à l'occasion de l'ouverture de l'iostitution Hartiey, à Southampton, lord Patmers( ton a prononcé un discours qui ne contient t aucune allusion politique importante. Le prét sident du conseil s'est borné à réitérer l'assuç rance que la politique du gouvernement avait pour but la défense nationale, le maintien de la dignité et de l'honneur de l'Angleterre. < Athëaes, 14 octobre. s Le roi et la reine sont partis à bord de ta frégate ,4m~t0, pour une tournée en Pélopot nëse et dans les provinces occidentales de la e Grèce.« ] « Vera-Cruz, 10 septembre. 'Le transport ~'TU~ere est parti pour la ( France, le 3 septembre, avec des malades et s des convalescents à bord. c B L'amiral Jurien de L~~raviëre est arrivé, le ( 4, sur la frégate cuirassée ~Vorma'~M. s Le contre-amiral Roze, commandant supérieut' des forces françaises au Mexique, rentre t en France. L'amiral Jurien a pubJie'un ordre du jour où il est dit que le contre-amiral Roze améri'é une place distinguée dans l'histoire 1 de l'fxpédiiion du Mexique. Rien de nouveau de l'intérieur, a ] yARtËTÉ'S' M°" Louise Colet publie un nouveau livre ~T~t6des7~t'e~,qui sera un jour l'Italie de tout le monde. Bile. a pris pour épigraphe ces vers de Maczoni Dt Mna <erro Mn <M«t «n h'n~Mo~tO PeWstt <M«t /ra~Mt F~' dK;e Lo s<fantero. Dans les deux premières parties qu'elle publie aujourd'hui, ta muse voyageuse nous peint tour à tour d'une touche virile l'Itatieda Nord et l'Itatie du centre, les monuments et -les hommes, tes chefs-d'œuvre et les sentiments, les souvenirs et les aspirations. Ceux qm ont vu t'Itatie ta retrouveront dans ces tableaux variés; ceux qui no voyagent qu'au coin du feu croiront presque voyager en Itahe à vol d'oiseau s'tts lisent ce livre curieux, dont nous détachons un chapitre. YËRONE. a Je vois apparaître le rivage du ]acde Garde, dont un léger voile de brume me dérobe en ce moment l'étendue. Dezanzano, dernière viUe de ta frontière itaiicnne. est dominée par une forteresse et s'échelonne gauche du chemin de fjr, sur le bord du lac; un quart d'heure après, voici Peschiera, dont les fortincat'ons sont chaque jour augmentées. Les soldats autrichiens. avec leur uniforme gris à chevrons bleus et ieur bonnet de police blanc liseré de rouge, gardent !es remparts et nous upparaissent par groupes enveloppés dans leurs manteaux quelques jeunes ofGciérs minces, btonds, l'air distingué et morne, sont rangés le long de la gare et regardent arriver le convoi jL'ennui que !eur inspire, par ce jour froid, cette vitfe, dont tous tes habitants leur sont hostiles, gagne bientôt les voyageurs~ que le ixss des passeports condamne a une heure d'attente dans le l)uresu et le couloir de la gare, ouverts à toutes les intempéries des saisons; on s'entasse dans un petit café sale et fumeux, où les hommes botvent du vin et de l'eau-devie et les 'femmes du café chaud à ta turque, où le marc boueux se mêle au liquide. w Le lac de Garde est te plus graod <ac de l'Italie; ses rives sont ptanesdu côté de Peschiera en face, au nord, elles sont bornées par le montBaIdo et par la chaîne escarpée des Alpe~ tyroliennes une be!)e route avec des galeries voûtées circule sur le bord occidenta!. Quelques rayons du soleil couchant se projettent sur les eaux, calmes en ce moment, mais parfois très orageuses en hiver. Virgile a parié de leurs tempêtes. Je distingue à 'droite la longue presqu'île Sermione, avec ses viUas et ses parcs. Catutie avait sa maison de plaisance a la pointe de cette presqu'île; on en trouve encore les vestiges. Au nord, descend des Alpes !e torrent de la Saroa, qui traverse le tac et en ressort a Peschiera, sous :)e nom de Mincio Je pense, en considérant ce neuve, aux triomphes récents de notre armée, et je crois voir Peschiera assiégée paries Italiens et les Français confondus. La paix de Viilafranca nt cesser le feu et tomber les armes des mains des combattants. répandent à l'entour des monts et projettent des lignes noires sur la surface du lac quetques barques )e sIHonnent du côté de Peschiera et vont s'amarrer au rivage; au loin, deuxbateaux à vapeurdessineht dans l'air leurs aigrettes de fumée blanche. ))Des forts qui se perdent dans la brume, des portes éclairées Sacquées de bastions qui projettent quelques lignes de lumière sur les murs sombres des remparts où des canons sent braqués, me font deviner Vérone. x Le chemin de fer a deux stations à Vérone communiquant avec deux portes de ta vi!le; j'oublie t'indication qu'on m'a donnée, et je ne descends pas à la première station, pour laquelle mes bagages ont été enregistrés. Arrivée à la seconde station, je réclame en vain mes maltes; me voila dans un grand émoi. Le chef de gare, auquel j'ai été obtigeamment recommandée par un ingénieur français du chemin de fer Lombarde-Vénitien, me rassure et me recommande à son tour à un employé nommé Angelino; celui-ci me fait monter en voiture et me dit que je n'ai qu'à lui envoyer un /ac(;/M'no de l'hôtel où je descendrai, et que mon bagage me parviendra avant une heure. Je mefais -conduire a l'Z7d~des DeMa? ToMrs; je traverse les faubourgs de Vérone, je passe un pont sur l'AdigeJe parcours quelques rues sombres, sitencieu&es, aux 'maisons closes comme des prisons quoiqu'il soit a peine sept heures J'arrive sur la place monumentale de SaintAnastase, et je descends au palais de t'Aigle, transformé en auberge enfumée. C'est le sort de beaucoup de nobles palais en lia)ie; je traverse une cour a arcades peintes à fresque; je tombe dans une galerie circu'aire et m'installe dans une petite chambre g)acée. x Le lendemain matin, a. huit heures, je visitai Vérone triste et sombre a travers le voile de brouillard qui l'enveloppait comme d'un crêpe de deuil. Avant de monter en voiture, je Es le tour de la jolie place monumentale où est située l'auberge des D.u~TuMrs; enface, entre la chapelle de San-Gemigniano et l'église de SaintAnastase, s'élève, au-dessus d'une porte cintrée donti! forme le singulier couronnement, le tombeau gothique du comte de Castetbarcp (sans doute un aïeul du possesseur du beau patais de Milan) Ce monu ment~vette. aérien, se détachant sur le fond ducie!, estduulusbeureuxeu'et; j'entre dans l'église de Saint-Anastase, encombrée de bas-reliefs et de peintures Je suis surtout frappée par les deux grands bénitiers, dont les coupes de marbre sont soutenues par des Bgures en)acées d'une remarquablebeauté cetui de droite est l'oeuvre du père de Paul Véronèse le génie se transmet par le sang en Italie, et l'on trouve dans l'histoire de l'art des générations entières de peintres et de sculpteurs.' x Je me fais conduire au Caste!-Vecchio. qui dresse ses murs crénelés au bord de JTAdige un vieux pont en pierre partant du château est jeté d'une rive à t'autre le fleuve boueux route ses eaux grossies par les pJuies d'automne du côté delà forteresse, il est encaissé par un mur à pitotis moussu et crevassé sur l'autre bord, s'é)èveot de misérabtes habitations. Des soldats autrichiens sonten faction surlesta!us fangeux qui entourent le château; tout cet. ensemble est couvert d'un voi!e de brouillard qui transforme )e cie! en coupole de plomb on en sent comme le poids et )a tristesse. C'est a cette place et par un jour pareil que Dante dut imaginer quelques scènes de son E~/e?*. e Du Caste!-Vecchio je me rends a l'amphithéâtre. Après le Cotisée, c'est un des cirques romains !es p'us imposants. Un brocanteur juif: qui a sa boutique sous t'arceau d'un des vomitoires anticrues, m'ouvre la griHe qui conduit à l'arène eUe est intacte et peut contenir plus de cinquante mH!e spectateurs. Je monte une vingtaine .iescinquante-cinq rangs de gradins qui décrivent l'énorme e))ipse. o Je continue mon excursion a. travers Vé.rone, où je ne rencontre à cette heure matina!e que des paysans apportant des fruits et des iégumes au marché, et que des sot dats tudesqufs se rendant à l'exercice. Dans une petite rue aboutissant à la piace aux Herbes, on me montre le portail d'une maison qui fut, dit on, Je palais des Caputêts. Deux étroites fenêtres cintrées semb)ent encadrer les têtes souriantes des deux beaux amoureux. ? La place aux Herbes, autrefois le forum. est décorée de pa)ais dont les façades sont peintes à fresque !e plus remarquabie de ces pa)ais est le palais MaSei sur un des t côtés de la place s'élève le patais des marchands, orné d'une Vierge de Campana et surmonté d'un éiégant campanile, ie pilier qui attestait la conquête des Vénitiens est découronné de son lion ai!é. Ce n'est plus s aujourd'hui qu'une borne saHe parles mat raîchers qui encombrent la place. Devieilles marchandes vendant de la charcuterie. du fromage, du vin et du pain, sont !à accroupies auprès de fourneaux uambants: leur tête grisonnante est couverte deTaft freux tartan anglais en laine rousse qui E à envahi le monde entier. Elles servent am r sotdats autrichiens des écuelies de soupe ou de café au lait qu'elles remptissent é même les marmites qui bouillent sur les s fourneaux. Les sotdats déjeunent en pleil: s air, tout en regardant les jeunes et pimpantes contadines qui vendent des fruits et balancent leurs têtes brunes aux cheveu? noirs bien peignés, sur lesquels notteui s voile entulie noir. CeUes-oi toisent les Autrichiens, et agacent du geste et de la von s. lesbeMx paysan~ cuictte scurM, qui d4 chargent de dessus leurs ânes et leurs mu-1 ( lets des pyramides de légumes. < x Une foule compacte de pauvres ache] leurs se presse sur te marché il s'en ex] haie une puanteur d'odeurs mêlées où l'horrible odeur du fromage domine. Je m'éloigne de cet air empesté, et je descends de voiture sur !abe)!ep!acë~et.S"ort Je regarde, émerveillée, la façade peinte a fresque et surmontée de statues de ce vieux palais do Soaliger, bâti au quinzième siècle c'est aujourd'hui le patais de ta municipalité autrichienne. Je trouve a droite, dans une petite rua sale et étroite, les curieux tombeaux de Scaliger après !a demeure de ta vie, la demeure de la mort. Ces tombeaux, aux bas-reliefs et aux figurines noircies par le, temps, sont resserrés dans une sorte de cour entourée d'une grille en rotonde d'un beau travail et divisée par des piliers sur lesquels se dressent six niches en ogive a colonnettes sculptées; dans chaque niche est un chevalier revêtu de sa cuirasse. Le sarcophage repose dans une sorte de clocher a jour, ceint de colonnes torses, et dont la lanterne est surmontée de la statue équestre du Gan Signorio. tj'j me rends au Dôme, dont la fondation est attribuée à Cbarlemagne. Le vieux portail, en marbre rouge, repose sur deux griffons bizarres et formidabtes; les statues despafadins Ruiand et 0!ivier décorent la façade: partout !a gloire et les souvenirs de la France. a L'église de Saint-Zenon, que je visite ensuite, est une des p!us intéressantes de Vérone; etiefut fondée par Pépin, nls de Char'.emagnc ëUe est dédiée a saint Zenon, évoque noir africain, qui prêcha l'Evangife à Vérone, et y fut lapidé sous Julien l'Apostat. La porte de l'église est encadrée de colonnes qui se détacbêot a jour et auxquelles te dos de grands lions sert de buse la façade pst couverte de bas-reliefs de marbre ~l'intérieur de l'église est d'un aspect recueilli et grandiose. Je remarque encourant )a statue de saint Zenon, une immense coupe en porphyre et de très beiles orgues. x Je descends dans la crypte, au-dessous du chœur, où est le sarcophage du saint. Lesmurs de cette chapeUe sont peints de fresques naïves je les considère curieusement. tandis que le jeune sacristain qui m'accompagne me raconte que son frère est allé s'engager comme soldat pendant la guerre de ['indépendance, et qu'à son tour il veut partir au premier jour pour rejoindre G~ribatdi x Ce n'est pas !e temps, dit< il. d'être bedeau d église. )) Le pstriotis me de ce br~ve garçon me touche, et je lui donne une triple ~Mono. Mtuno. En sortant de réglise, je regarde ie beau campanile du onzième sièc!e, puis j'entre dans )e ':ioî;re. où sont quetques vieux tombeaux, entre autres le tombeau apocryphe du roi Pépin. Je passe sous }a porte romnine Bursari, située au m'tleu du C")'so;j~ poursuis à )'aventure mes excursions a travers Vérone. ))Je me fais conduire '<?t'ct y/~Ma, pour volrlacasa-~i:<s<c~ùn des plus rares et des pius-cur'eux monuments de ta Renaissance la façade est entièrement couverte de ngures peintes à fresque )a porte et les fenêtres, cintrées, sont encadrées de cotonnes de marbre noir et de fines scuiptures en terre cuite roug~. J'aperçois une jolie cour mtéripure avec des arbres Oh! la be)!e et caLne maison on ia voudrait à soi. La rue où eUe est située est propre etriante je traverse~d'autres rues spacieuses et droites je comprends que, quand )e soleil briUe, quand l'Adige rou~e des Sots clairs, quand tes collines qui dominent lu ville sont verdoyantes et fleuries, que les t remparts et tes forts se dessinent sur l'azur, Véronedoit être une superbe cité; ainsi eUem'apparijt, un soi:' d'été, en relief sur là pourpre du soteil couchant t M II me reste avoir le tombeau de Juliette et les fortincatioas redoutsbies qui font de t Vérone une des places fortes du Quadrilatère. sLatradition~place le tombeau de Juliette dans un ancien couvent de franciscains transformé aujourd'hui en caserne; les soldats autrichiensfument et étrillent des chevaux devant un mur d'enceinte où s'ouvre une porte cintrée; je passe cette l porte, et me voita dans un jardin potager. Un petit garçon de douze ans, fils du gard~en, me précède et me guide. Nous marchons a travers choux et navets, à gauche: s le long d'un mur ) Adige coûte au delà, e) i sa fraîcheur tedouble l'exubérance de tous ces légumes qui forment de vulgaires avet nues à ta tombe de Jutiette. B Nous tournons a droite; et, avant d'ari nver une chapeiie en ruines, je trouve quelques petits cyprès dontjecjupeune branche; sur une des parois brisées uela ehapglla est ëB66re un frag~eat as fresque où l'on distingue une ugure d'évêque audessous est un sarcophage vide en briques rouges, transformé en fosse à ordures. Voilà. la tombe de Juliette C'est avec des morceaux de ta pierre rouge du couvercle du sarcophage que Marie-Louise se Et' faire un collier et des bracelets, parure sentimentale que cette princesse au cœur sec se pla~= sait à porter. Le petit paysan qui me conduit m'oSredes débris de ces briques. Je tui montre du geste la tombe pleine d'excréments fétides K Jette !à, lui dis-je, quelques pelletées ? de terre, et fais-y pousser des Heurs ou M un peu de gazon. ? Qu'est-ce que cela nous rendra, signora? e me répon wlen riant, <0 inen'able Juliette! qu'importe ta tom-= be détruite et profanée n'as-tu pas pour monument indestructibte le drame dupoêta qui t'a rendue immortelle? C'est dans ië génie de Shakspearequetufus inhumée! c'est par lui que tu ressuscites chaque soir, de sièeie en siècte, sur toute ta surface dû monde, jeune, be!)e et aimée Quelques vers inspirés sont plus durables que les mausolées et les pyramides. Une reste pas une pierre des temples de Lesbos, mais trcis strophes de Sapho ont défié le temps I Je me hâte d'atier parcourir une partie des remparts qui défendent Vérone; les Autrichiens y ont ajouté de récentes constructions réputées imprenables. Je me fais conduire à la porte Stuppa (murée) l'en" trée (interdite au public) do son arche profonde est flanquée de canons les fortiËca'ions, qui se déploient de chaque côté, se composent de grands ta!us voûtés, recouverts de gazon et percés par des portes cintrées qui y donnent accès des tours se dressent de distance en distance les sentinelles autrichiennes, l'arme au bras, se promènent sur les remparts, geôHcrg siteocieux et taciturnes de la cité prisonnière leurs habits sont gris comme le brouiliard qui couvre Vérone; Us se meuvent, àL travers ce voile, tels que des ombres. Quand donc brillera le jour éclatant qui les fera s'évanouir en6n, ces spectres menaçants de l'Italie? Des bataillons de fantassins font l'exercice au pied des remparts des détachements de cavalerie décrivent des évolutions dans un champ de Mars voisin. J'ai mis pied a terre et je circule à travers tes rangs quelques jeunes officiers me regardent étonnes un vieux s'arrête devant tno! et 'ne toise de la tête aux pieds sans doute it se demande ce qu'une femme veut faire au mitieu de tous ces appareils de guerre, et da~s que) but e)le brave te froid et )a phiie qui commence, à tomber. Je souris avec insouciance L'ofUcier murmure *–C'est une Âng)aise en voyage; ces e Anglaises ont !a. manie de tout voir. a Cela leur d"nne des sensations, s répUqueun autre ofnr'Ier. < Cette doubte réflexion me rappelé une ptaisunteanecdocte qui me fut contée par un témoin ocutaire ? Deux vieilles Anglaises, qui se trouvaient à Paris, firent visite au bourreau 'et lui demandèrent de leur montrer la gui)Iot'ne; l'exécuteur, souriant et aimab'e, s'empressa de satisfaire à !eur désir; i) )eur expliqua avec complaisance le mécanisme de !a machine homicide; elles-touchèrent au couperet tranchant, puis e~!es dirent à t'unisson « Monsieur le bourreau, posez-~e t légèrement sur notre cou, pt ayez !a bon? té de nous guiiïotinerun peu, pour que x nous comprenions bien la sensation Le Parisien qui les accompagnait me redit, le lendemam, cette excentricité anglomane. M Je remontai en voiture et je considérai en face de la porte Stuppa, le vaste hôpital militaire qu'a fait construire l'Aut'fche; les convalescents, accoudés aux fenêtres, me regardaient passer; Us étaient pales et tristes, et rêvaient sans doute de' leurs foyers !o!ntams. Quand ia voiture qui m'emportait put traversé Vérone, avant de franchir te mur d'enceinte, je jetai un long regard surla noble cité enseveûe; je me sentis pr~se poureUe d'n att.eridrissp.mentir'dif'tbte; c'était comme un lien mélancolique et involontaire formé tout à coup Ainsi, on se preod d'attraction pour un visage sympa-' thique qu'on a fixement regardé ;!es)'eux nous attachent comme les êtres i! en sort parfois des efuuves mystérieux qui s'empai' rentdenosâmes. o Je passai la porte gardée par les sentineltes autrichiennes,, et Vérone disparut pour moi derrière ses ramparts sinistres, comme dans les murs d'un tombeau. « 0 p3uvre Jutiette, morte et ensevelie m'écriai-je, espère!espère il viendra, !è Roméo guerrier qui déch'rera )e suaire et te fera revivre be)!e et radieuse! 9 M~ LOUISE .COLET. L'un des prnprié!.H)rRs_ gérant (H! !a Société. S /!ou; .SOCIÉTÉ DE LA. PROPRIETE FONCIÈRE DE PARIS CAPITAL SOCtAL NAXJNUH. 15,000 000 FRANCS .4ct!'oMS ëmtxex n 5<!$ ff ~~m./iOMr~eM~t! MtKtmMm a SjOOM'F., 6''f/~ec<M~'r~ pa'' <'o e <<e ttraf/e aM .o'-t a~HMe~. ~eue~M net ët.'t.ttud a phts as e/e. S La SOCIÉTÉ DE LA PKOPKIËrË FONniËRE DE PARts, d'après les éval~tD~sies.r~u-modestes et d'âpres t'exempte de ia SociAté imm')b.<hë)e de Paris, qui foncuonne depuis piusn''ur~ aanées, construira au mtKtmMNt, pour TREiTEi SEPT tniHions d'tNi)HeM&/es avec QUiKZE misions [f<Mrais par )e3 act'onnaires et, procédant par ~)t'M de p6<t<M opérationei!e arrivera à des résultats immëd'c.ts et. c~.mp'c'.s. HHe b6né6sier.i"immédiatement de tiu'c ta } diR'renceentre!ej5fr 57c. apty~r ann:)e[iementpouries intérêts et i~rncr.setrjpntdu caij)tat emprunté e!, te ['rtjduitHet moyen des 'maisoos de Pari:. nouv.-HeHient construite~ {lequel n'e<.t jamais intérieur a 10 0/0 pour les coQs tructcu''s de profession). -ON souscKiT dans ie.t bureaux de ta Société, t ruode<boiseaf,19,àPar!s, et chez tous les banquiers correspondants dé !a Société. (Voir te numéro du journal .~u 7 octobre ) e Versement para&tion, 12o fr ensousorivani; 175 fr. divisés en trois paiements, à effectuer dans le cours de raB!j6ep:'0(;ha)iIe;[oteiiqudt, sbi~200 f; par action, ne sera appeié qu'après que tes immeubles con-itruits produiront au m~ins 12 0/0 des 300 fr. pumtuvement Vt'r~.é.5. t Oa peu' égatemcn< souscKire par iHtii'e cbargée adressée au directeur-géran! A. At~sart* etC~. ou à rua des banquiers désignés, Une notict-expHquaatia combinaison sur faquet)e est basée ia Société es f.o~unt counaitre i'orga!')!sat!OQ de l'administrat'on se dé!ivrè g au siège sooia!. ~7/te ps?'e dtt csp: ëta?:t d~'o 6'OMScr)<g, S LA ULÔJURE DE LA SOL'SCRtPfIO.~ AUHA L SiJ TBË9 a pnocaAMENMT. 3 ~ë'S~L.~S~&ëë~s~s ° Nous recevons la lettre suivante, avec prière de l'insérer < Monsieur le Rédacteur, Le principe du libre échange oblige chaque nation, et, par suite, chaque manufacturier, a soutenir la concurrence que ce mêHie t)rm.cipf; crëe sur le marché universel. DëuT: conditionss~ntesseutieKespourtenir le premier rang dans {'industrie ~a supërîoyti!~ des prodMtM et <e 6on marc/t~. B L'Angleterre est par excellence, la puis-sance manufacturière qui a le mieux atteint un de ces résultats. &on. marc/te. En eifet, l'Anj~eterre fabrique pour 83 miiiions de francs de Ph-nos par an. tandis que la France, qui pourtant possède les Facteurs ie.s plus émiaents. et dontlasup6riorit6u:e?tt d'être consts~ga ~'Ea:,postttOK de Zoncf~e~, arrive à peine àlO mHiions annuptteo3ent.–L'Angleterre atteint ce chiEfre de S3 millions parce que, fabricant le même ïnodMe enquan'.iie considérable, e)le rend, par son bas prix de revient, le pubhc béneSciaire de ses grandes opérations manufacturières. Déjà nous l'avions compris, lorsqu'il y a que!ques années, nous avons pratiqué ce système pour notre fabrication d'Orgue simplifié. Le chiSre extraordinaire de vente de ce seut modèie, qui est aujourd'hui arrivé au nombre de qMMizc mt!!e, preuve sura-bondamment que nous ne nous étions pas trompés. a Aujourd'hui nous venons faire pour la fabrication artistique ce que nous avons fait pour la fabrication d'un module ptussimpte. v a Pour la réalisation de ce projet, nous nous sommes adressés à la maison HENR! HERZ. de Paris. Sans modiSer en quoi que ce soit la fabrication actuelle de ses produits si justement appréciés, elle a accepté' de notre part une commande considérable de Pianos droits d'un même modèle. En conséquence, nous avons pu Sxer le prix de <?M:'M~e cen~ /?'CHM pour l'acquisition a /'0!S d'un Orgue à deux claviers et d'un excédent piano droit de la manufacture do M Herz, c'est à dire poMr B;,seo f~nes deuas ms~rKmeK~ de p~'emtfir cAo!a: et qui émanent de maisons do premier ordre. » Notre combinaison renferme un principe de grande importance qui intéresse a )afois le public et !a manufacture en généra!. C'est à ces titres, monsieur le rédacteur, que nous la récommandons à votre appréciation. B Agréez, etc. ALEXABDRE PËRE ET FILS, "Ivry sur-Seine. p ORGUES ET PIANOS 1 FABMQUtS A CN GRAKD NONHEE A LA FOIS. Par suite d'une commande coBsidérahto d'M?! ~6t{! mod~e de p!a?M~ donnëe par eux la mai JMEMMTS, AOJSMGÂTÎOKS ET VMTES. PK'? ? P~~PR ~TS? ~s produit et d'a p~ ~;3 ~R~P~ ~~?r~~ de produit près .~EiitLc ~atMrH'HtiC grément.prës Btois, à vendre. Mai 00 de maître, beaux communs, .jardin angta's, jardin potager, vignes. tf*rres et prés. Contenance 7 hect. 7) ares 64 centiares. S'adresser à M* M.~NTois, notaire à Blois. B 17 Q~ ~~T~<M~ °6ux heures, adju LE 6d19 ~!a s ~95~ drcai ô s urunéae~le MJ ~D ~tj!?Mmt dtcationsnruneseule enciiëre et sur mise à prix de 15,000 fr d'une jolie Maison de campagne dans le bois de Chigny,prës La~ny (EstJ, nouve)!emeot bâtie, et dont la construction a coûté 30,000 fr., sur un terrain boisé de 6.SOO mètres ~8 trains parjour. S'adresser, pour renseignements, a M' p)CQ(jtiKAHD, notaire, a Torcy, près Paris, chargé de la vente de trois autres matsons de campagoe. « M&<M &9.MEBE DE 6 9H'at~ tSA5o~ PROVENCE. ArAMia. A vendre à l'amiab!e Revenu, net, 8,OUO fr. S'adresser à M° onossE, notaire, rue de GreneUe Saint-Honoré, 14. « M A ?& 6rue ST.-LouisfMARAis),9i,p TS l~tï~I~l7eteruern~ti~xoTAi9~,9à~~`" ~t~ LMt'tH~i3et FueTNË~KOT, ~9, àS~miJ La d" produit t3,360 fr.–Mise à prix 435 <i0() fr. La produit ~M fi-Mise à prix 2".U.f)00 f)-. A vendre, mêmesurune eBohëre en !a chambre des notaires de Paris, le mardt 't't novembre d863. M* EMILE JOZOK, notairf, rueCoqui~iëre.xS. <( T~mm VILLiGE LEVàLLMS rue du Bois, à vendre, même snr:UM seule enchère, à là chambre des notaires de Paris, par M'DUfOM, le 4 novembre i862. l,0t)l mètres xS c. Mise à prix 4,OUO francs.. S'ad. a M* Oufour, notaire, IS.pl.delàBourse. PiËCE DE à VANVE8. Et.ude de M' LAMK avoué à Paris, boulevard de Sébastopot, 4t (rive droite). Vente, au Palais de-Justice, à Paris, sur surenchère du sixième, le jeudi 6 novembre 1882, D'une pièce de terre d'environ un hectare deux ares, à Vanves, lieu dit les Glaises. Mise à prix. 22 170 francs. S'adresser à M" Laden, Fous&ier et Beaumeleu, avoués. f)M~&B!'W S&E' ~B?t'M DE CHASSE tjBiiJiWAajA J~JE! àDijL~ETD'ATTELASE, VENTE ~ua? ecMr:'M de Af. C'~ert, (t~ec~Mr fe~&HMSmc7)< ~ect3~ poMf ~)! M!){s des cAeuaMa? crM M <~9, e< aM<orMep(tr ct're~ de jU /6F!'e/e< ds-po~'ce, Btte de /~K</tteu., 49, Le mercredi 22 octobre i862, à deux heures, Pariemin~stëre (te M' EscMBE, eommissairecriseur, rue Saint-Honore, 217. On pourra visiter les chevaux aux écuries de ~f. CA~, les %0 et 21 octobre 1862, de midi à 5 h.. préu. S RENTES ET ACT!ÛK5 prem. Pius P)ùs Dern. prec S ACTtONS. l'rem. Plus P)us Dern. 2 VALEURS Prec. Dern. c~t. 5 au comptant et a tefsuc. cours, haut. bus. cours. clôt. an com)!<cmt et & terme, cours, haut.. bas. cours. comptant. cours. 71.25 .o/o.icpt t. 7095 7130 709. 7125 420.pnssEs.tcpt. MO~. 41/2e/Ofranc.'1825.J.mars 9775 70 9S .35 J. 1" octobre.i&c. 7115 7135 7105 7130 418 75 2uf J.juiUet.–500f.–Lib.fmc. 43125 40/0 français. ,93.. 91 8D 45 X 333 'r5l 335 · 333 75 335 C>Dixse gén. des çh.,de fcr. 10U 95 97S(i .45 1/2 0/0.cpt.. 98.. 9825 98.. 98 M 33375 125 .MHAms.pt.. 33375 335.. 33373 335.. So~oo~t.d~s'Ënt'rëpr: 137 M 13750 J.!g. sept.iSnc. 9S10 340. 5.. J.oct.–500f.–Lib.)anc. 33250 33a.. 33250 33a.. Comptoir Bonnard..J.fé~-r. 4125 47250 .LMAT.TREUTEXAiMs.tcpt. 440.ROMAiN5PMVtLEG.TREKTEN.tept.. 43875440.. 43875~440.. n~ra~î' 2387523875 "72 50 (c t.. · J, oct: 50D f. Lib. 1 lhn p c. · · ~"I "0 '38~ "0 scre.Abt.Htvoh. 2 238 ï5 3225.. i.E~cE.J,uiL,cpt.3240.. ;GA~cpt" 435;"440:: 345:: 44. -645 685.. .L~.1~c:~ 12$U i255 iRfiO ~~et:r-Ub;c; ~75440.. ~75440.. 7 i 5 7i7 50 U55.. 1260 8J5 25 CRÉDIT MOR1LIER ESPACOL.·)çpt.. 8i0 8#0 8iD 840 Ports de ues.J.juill. 21D 815.. ?. cRMrr MOB)HERES!.AGNOL.icpt.. 810.. 840.. 810~. 840.. Deux-Cirques.J.iuiiL 210. ""MED!T!'oKCD.:B(nouv.).cpt. §05.. 40. J.]uiU.-500f.–46i)f.pay.Ënc. S20.S43.. Slo:. 845.. Caatmx.Quatre-Canaux.. 1210 .1210.. J.]U)!f.)OOf.-SOp.iËnc.S. J. juill.-500 RtR~iMn R"!7'. f~n Suez.300p-J.jan. 4769,5 47750 CREDIT.SCRICGLR. 'cPt.· RR'i 615 a SARAGOSSE. cpt.. °18 7a 6x0 6iJ 75 6ï0 C'carisienne 1370 1375 :our50~100'p)~p' J.JUiUet.-500f.-Lib.)finc. jdact.nouv~~ 1390 665~ .~EmTcoM~T.~ST'.icpt.~ 66750 66750-665.. 665. S.s~LE-~R~c~.x 470.. 475.. 470~ 475.. ~d~rs~Ue~M 395:: 670. 5.. J. mai.-500f.l25p.fBnc. 665.. 670.. 665.. 6C5.. J.]UtUet.-5<Mt.-Lnj..thnc. Forgea. Monceau. 550. · -M en 9-f) t ~"n 5~ 1 25 NOKDDB L'ESPAGNE. ~tcpt.. 54~50 545.. 54250 54375 Mm. Vieilie-Montagn. 277 50 sso.. aNSO 50 2uOsous-coMpT.BucoMM.cpt.. 5aa.. ~< g~~ ,· S.. J.iuiUet.-500f.-Lib..tinc. 54250i545.. 54250 5t5.. Sitësie. 12375 ~o.. SaO J.uCt.–500t. 12ap.;nnc. '"M .)-n Charbonnage. Gr. Combe 95U. 1~ :O~Lib'~ 5D :u~~25––Li.c: 3475..34750 50 345-: ~50 5U ~i~ oct.. ,1170iG 25 J. juill. 500 f.-Lib.lGpC. 1180 1190 r r 1170 ll9G 25 ;¡, () aAE PARISIEN (nouv.).-200 f, p.ifinc. ~.· ~sE~ig. C° transatlanti~ue 6~ 63Z 50I nttBiBtctK~fnnnv)_apnf n Hinf '~aYtg. C'transanantique 630 63250 !6H.. 2SO 5D .coMPTOiBD'Es~OMTE.:fcpt.. 645.. ·· 647SO ~0 645.. 64750 .GAïpAEisJE~nouv.). ~Ct.p.mnc. ~~sageriesimp.J.dëc. 740.. 735.. aT.) tn '?-) Kn '70 on < Vôtres. Omtlib.dePahs. 850 S40 7220 .2a .piEMoKT s o/O. ept.. ~.i0 ~50 /230 <24a –j– Omnibus (!o Londres. 50. J-iuitiet.)nnc. "T,nHt ~Prëc. Dern. nRora~nN'! ~°C'imp. des Voit.de Pans. 61,25 61 2S EMPIt1:JNT ITALIEN. Icpt.. BBLIsGT10P1S, clbt. cours. OBLIGATIONS. clôt. cours. s!ai$te~.J: F. Cail, C°.J.oct. 7i5 73A 7310 .10 EMp~NT iïAi..EN.pt 7260 73.. 7260 73.. BSLMTtOHS. clôt. cours. OSUSaTiONS. clôt. cours. ~i~.J.-F.Cai). C-.Joot.71S'720.. i2 8U 13 ,f ~jüill. -SO OJO 'fine 7N 30 -73 10 =72 30 72 95 f'1I. ~;e f'cr. At'denneS (n,). 446 72SO .15 .).iuiU.-800/Op.fa'nc. 72SO 7310-7230 7295– ~p~~arag 360.'360" 497/S .1/S ESPAGNE 30/0 dettetnt.icpt.. 50. 50. 493/4 493/4 V.deParis.50/01S52.J.ian. 1130 ..1130.. Lyon a Genève anc.J.juiU. 30625 3062: Ouest-Suisse. 13S25 135:: J miUet lino td. id. 1855-60.J.sfpt. 45875 45875: id. nouveHes. 305.. 307 5C Central-Suisse. 470. Id. 1860. P.-Médit. Fusion. 30875 310.. Croix-Rousse. 390.. 390.. 2Z .J.I. -I, ssPaoNR.'Passtve.lcpt:l. ,l· .l. ,l. Seine 185î.J.'uill. ~28 75 2~d 751 Ouest. 30G 25 30G .5 Guill.-Ltuemb. 260 25Z 50 22. .BspAs:<E.pass)ve.cpt. geinel857.J.luilL 22875 22875! Ouest. 30625 3(!S2o Gudt.-Luxemb. 280.. 28250 .J. juillet.)unc. V.deLii)o.30/0.100f.J.avr. 9625 H750''Midi. 310. 30750 1048 75'U 25 ORLÉANS ESTA!!j.)i.t. tcDt 1048751M0..104S75I060.. Cr.f.Obf.4oet'.40/OJ.in. 49125 495..Ust.J.]um. 30550 305.. tonds cttan~ers. jn-q Kfi c) ï ~t -n~f r"if. )~f) [n~ fi~n f)~~ 100 4 0/0 98 75 100 ordonnes. 3 0/O.J.juill. 305 305 Bt~9C.4 1/2 0/0.J. B~ai. m lOD~O .-50 .J.oct.-aOOf.-Lib.;hac. 1~0 10~3..10o0..lOoo.. saof.30/0460.. 462 S~ Hauphine. 3062530756 3 0/0.J.août. 83 3/4 79~75 1.25 ORLEANS fnouveites). tcpt. 79875 SOO.. 79S75 800.. .· lûCf.30/0 95. 95.. UcssegosaA)ais.J.oct. 300.. 2S!i7o 21/20/O.J.]Ui)t. 58. J.oct..500f.–250p.Gnc. 790.. 7H5.. 790.. 795.. IMOf.XO/O –'1020. Cézters.250f.30/O.J.mai60 81M Empr.Bruxc[ies'30/C1862. 9750 ,n communutcs. 425.. 425.. Ch. Autrich.500LJ.sept.. 27375 27625 BspaaMC.30/Ooxt.l84<.J.iuii. 521/4 1030 760 .KOM(act.anc-!ennes).cpt.. 1035 ..1037 50 103a.037 SO Orieans.<~oL..tK;.J.iuiU. 1050 ·, Lombards.-J.juin. 26875 26875 :iO/Odiner.J.iui!i. 453/8 103750 250 J.;anv.–40<i-f.–L)b.tunc.lC37S010.tO..1037501040.. nc.uve'fcs. 1000. Saragosse. 275.27125 Po)'h<oa<.so/9. 491/2 <.in!: tcnnnfenT-f.oe~ t .n t~rt ParisaLyon.J.oct. 1040. i~omams. 240.. 24250 ;foBta';M.. H:~prunt..J.dec: 75 75. 1005.NORD(sorttes).J.iUtU.fcpt. ouest52-54.i250i..J.juiI). 1008. Portugais. 25250 25250 Picmo)i<.30/0.J.iuiil. 4450 560.. EST icnt 555.. MO.. S55.. 560.. Est. 6501'J-ium. 510.. 510.. Cord.-SeviUe. 25750 25750 Ob.183440/0 1060. '55875 12') Jmai'560f'-Ïib'Unc 55875 360.. 558 7S 5SO.. [iâle. 625 f.t.juitL 510.. 5t0 .!geville-Cadixanc.J.loiUtL 290.. 29t).. Id.l849.J. oct. 930. J.mai. ~ui. Luj..uno. aao~ -) Lyon-Médtt.625f..J.oct. 51750 50 Si750i 50, nouveiies.J.mai. 26750 50 265.. Id.l851.J.févr. 940. H77o0 750 .pAR;s-LTON-MËD!TER)t..)cpt..H82.)0118j..H80.. 18o.. Bourbonn.500f.30/O.J.iuU. 31125 31125 Sar.-Pampe)une.J.oct. 24125 241~5 ~MtncAt'.Ftor.BO/O.J.mai. 611/2 H775U 750 J.mai.–5001.–Ltb.iUnc.ll77 5~)185..1177 50 llha.. L.-Medif.. 31250 315 Norddet'Ë4pagne. 25750 25750 Tto'Emp.ottom.J.juiU 34375 34375 ce,, .on QQ" eon SR'i Nord. 31125 3)250 Ligned'!ta[io.J.]uiH. 230.. 230.. ~o/xf/e.21/20/0..J.iuiU. 60. SSU.. 5.MBt. ,cpt.. S80.. b~ b80.. NNo.. Q~ g~~ g~yg Gaz de Paris. 4S5. /t:'ss;c.41/20/0. 881/2 SSO.. a. J.juill.-Seet.-Lib.iSnc. 880.. 880.. ~5.. Q~ce~~j. 307 so g~~ [)ocks-Ent.Marso))to 29125 -Emp.l862.50/O.J.mai. 951/2 5H25 ,j 19'iotjEST tcpt 5f';0 64" 50 540 5K.. Paris-Lyon.J.oct. 31125 310.. C')mmobthere.50tf. 277 SO X8125 A'ap/M.50/O.J.juiU. 7i 60 SM. J.oct.SOO'f.-Lib.itinc. 540.. 370:: ~anv.60;500f-Lib:!n~c: fRtMM. REPÛfiTS. CMN6ES. tAvue. ASOj. i. 370 J.janv.60.500f.-Lib·lfinc. ·, â PRINiES.. RE_PORTS. CHaNOES, j A vue. A 9D j. 49875 '!?'; AtJTRtcntEKS <Ct)t 'ifjn ~ï'!0 ~')() 'M)!SO ~'FiN COURANT. FBt PROCII.UN..CO~PTANTALIQUtD.HQCID AL'AUlM. · i97-5. J~ :500f;~b:~c: ~250 ~2~ 49250 50250 ~75 ~~a ~5 a ::i a ~bo~ 188: 62750 scB-AUTRtCtf.-L03iBARD.tcpt.. 62S.. 62750 62. 62750 .dt9.5! 7180à 7205! a j ..à .à Bertin. 369 ~5 123 J.mai.–450hpayes.)unc. ~2625 62S73 '25.. 62625 Emp.ita~dt50 7335a 7375! 74SOà a .à à Londres.25211/225671/3 -i'u~-500Ï--Lib-~cMobilier..d~l2io::al~ .L: a a 5~2 412o0 J.]Utii.-5001.–Lib.ittUC. dti01260..àl235.à. j Ij a R Bnn;e)one. 525. 5181/2 4t5.7 .s(act.anc.).cpt.O~~ i0 à à 378 75 1''5 SAnr'):-YtcT.MM~KtjfL.tGpt. S80Lyon.dt 10.a.a. a .a à !Napics. 425. 41S. '37875 12') J.iui[i.–500f.–Ltb.)iu)(;. 375.. 37750 375.. 3?750 51idi.dtl0 .a.a. a a Triosio. 197. 6M.. 2SO c°aÉKER;TRAXSATt,AKT.i<-pL. 035. 6'i750 63250 63250 qn~~H,~r~)C "a "a à "'a !f'ru~"fo'rt" 2123/4 21~5/8 690.. 8. J.!uiii:iMt'Lib.(tihc. GM.. 6J5.. 630.635.. ~d:dM9 :a: :& a à :P6te~ .}. 3S6~. son HenriHERZ.MM. ALEXANDREPère etFHs, fouroi&seurs de S. AI. l'Empereur, Médaille d'honneur à ~Exposition universetle, S'engagent à livrer au public MH or~Me a C~K'?erS Et M)t Piano ~f0!'t de la maison H. Herz, au prix net de QUINZE CENTS FRANCS. Ces deux instruments, fabriqués sur des modèles spéciaux, sont de premier choix. Par cette fabrication eM. ~nmd Momûre, des som.nes considéra btesserom économisées dont le pnbHc bénéEciera, pnisqu'd aura deux Instruments pour le prix d'u&seuL /1° L'ORGUE A DEUX CLAVIERS Bon. de pa!issaodre. Touches ébène et ivoire, 4 Jeux, 5 octa POUR ~es d'étendue, à Percussion. iuuit Flûte. Voix céteste. GtarineLte. Hautbois, Cor anglais, Basson, t M~~ Sourdme,Tremo!o Expression, JL <&Uv FR. Ja'ousie forte.–Au taton, S Pe dales.. PR!X de L'ORGUE seu!, t,5ee fr. LES ? (Nouveau, modëie.) Et 2° LE PIMO DROIT. î!STPï~ît]'M TC A cordes verticales: 7 octati& 1 hL!l!iM 1 !!) yeg au 2 pédales, bois depaiissandreet terme eiégante PR!!( du P!aM seuL t,toe fr. fModëteAdn.prospectas.) À l'Exposition universelle de Paris, les Pianos à queue et les Pianos droits <~e )a maison Henri HERZ ont obtenu LE PREMIER RANG DUCONCOURS.Ce succès s'est ronouvetéeavec plus d'éclat encore à l'Exposii.ion do Londres, où ]e Jury international lui a accordé la MédaHie avec la mention tonte spécifie «d'ecccet~enc~dstoMte espèce de ftaKos,'pM!MaMce et ~ct'-ttë des sons, ~rëc:'s:OH mëcan~Me et soH t(t:ë. B Quant à l'Orgue à denx claviers, il est inutile d'en faire ['éloge comme élégance, perfection et beauté de sons. Le-succès de MM. Aiexandre Père et Fils vient d'être consacré d'une façon éctatante. Le Jury de l'Exposition de Londres lui a décerné ia Prize jMec<a! avec la mention toute spéciale et dont voici la traduction <e:B('Me~< a~VoMueoM~ ~ans ~acoKs!)'MC~toK des ~NrmontMms, &o)t tKO'cAë com6H:6 auec t'gx-Ct~encc de /u&rtca(tOMe( 6e~:e qMHh'~ des sons. Les claviers multiples, que les organistes cétëbres ont toujours réctames, donnent au jeu plus de briHant, à chaque main p!us d'espace, à )a mélodie plus de délicatesse, l'accompagnement étant alors complètement distinct du chant dominant. 0~ soM~cr:< sans rt'eK paygr ~'auaMce. Z.[c/ieteMr Me paie q'M'aprës la rëeep~o~ d-'s ~Kas 7HS{."M?Hsn!s. ~Huo~/sr ~es d')N<ï)Hes aMM. MCHES M~mMMTS en boif doré, palissandre, acajou, chêûe sculpté. marqueterie, etc.. bronzes, pmdutes, places, piano, tapis. literie Vente rue Drouot, 6, salte n° [e vendredi 17 octobre fS~S. une'heure. tt' DELAHAYE, commissaire-prisSur, place Boïeldieu, 1. a vendre PROPRIÉTÉS de toutes sertes.S'ad.au & directeur dei'~ndt~eMr.rue Montmartre, i67.« .t!m.T~MB~tEms!!rmmmimt)'t<t~M~a.~ LOCATIONS. a s:?iM -B?LYSEES, r. Mangnan, 17-19-21-S3 ~jM/&ai<jS H (ancien Jardin-d'HiverJ. Atouer h6te!s grands et petits, appart. de !,000 à 6.M8 fr.<( SOCIETES FAR ACTIONS, BiNQUÏS, ASSCRANEMS. r~IT BYPOTEEmM. MM. Kejuu et G', banquiers, 9, r. de Grammont. miiT~snrMÂiS~~BiE~S ~T ~BM&AT~N~ CTTe'MM~ Commuaieation importante. Arbitrage avantageux. Maison L. Lauze et G*, banquiers, rue Ch6 rnbini, 4. « UBRAIME. M S NODES PMMEMES yourna~ de Bonne Compacte. Le p)us élégant de tous les journaux de modes. Un numéro tous les dimanches.– 7 fr. pour trois mois.–20. rue Bergère, Paris.–[On reçoit un numéro d'essai contre 60 centimes en ti-nbres-poste.~ P~mmES MME LEâOY À Angers. Catalogue descriptif 1860-186~, 1 franc Timbres-poste. <( MBRAiBiN AGRICOLE, rue Jaoob,36. VM!S'îi''& TfH~ fceLTnRS DK LA VIGNE), par Wa~i~i'UA !i<F~ teD'J.Guyot;lvol.m-i8, 3f.50.– Vendange,sucraaedesjus,cuvaisoa, pressurage, vins mousseux. Rnvoifrancocontre3f.80.)' INDCSTRIES DIVERSES. ~srnunin'STC t~fM?6 DM paix M~mËMiMO DES i~~& MODEMS. S, passage des Panoramas, S8. t ~cAfttt~e 6f reFaraMon. < .dt 501 7t 45à 71 75I 7Z 8Dà 73 13 à à liambourg. i88 .J. 187 ,J. ALEXANDRE Père, Ft!s et C". fMe ~s~a~. 0?t pettt uo~ /es <<eMa? types mo~ë~s ttM mo~a' x~t d'o~'etx (!'ar~, oM coût du boulevard des ~a pMCMM, 7'M6 C'aMmartm, 7, cAes J~. ~Moser, dcl pos~atre. COMPAGNIE GÉNÉRALE DE [ NAVIGATION A VAPEUR SUR LES CANAUX Soc:'ëM SM co?nmanc<:<e, SMtuamt acte reçu par 1 5PAuNONT-TjnE viLLE, ?totoî're s Parts. I FONDATEURS t MM. Eugène LACROix Sts, ingénieur mécaBic cien à Rouen JoLT, constructeur à Argenteuit (Seine-st t Oise); A.-N. GonEtcx, officierde ia Légion d'honneur, ancien secrétaire général de la z préfeciure de police; Adolphe DAUBïGNT, ancien inspecteur de ]a naviganon, Tun des principaux fondateurs de la Compagnie du touage de la basse Seine et de l'Oise, gérant. t ÉMISSION DE 3,060 ACTIONS DE 800 FRANCS, t On souscrit, a Paris, chez MM. L. LAuzE et 1 C~, banquiers, rue Ctierubini, 4, au coin de la rue Sainte-Anne. VERSEMENTS 50 francs en souscrivant; 78 francs après la I répartition 75 francs contre la remise du titre négociable à 'a B 'urse et les 300 francs restants, au fur et à mesure des besoins de la So< ciété, et sur l'avis publié parle conseil de surveillance. Les statuts de la Société, notice, prospectus, tableau de l'organisation des services delà Compagnie, sont délivrés là où la souscription est ouverte. Un avis ultérieur fera connaître la répartition, qui sera faite au prorata des demandés. Pour les détails et l'indication des lieux où ia souscription est ouverte dans les départements, voir notre numéro d'hier. SOGIËTË GENERALE DE CRÉDIT INDUSTRIEL ET COMMERCIAL 7~, fMe ds Ftc~o~e. VENDREDI 17 OCTORRE 1862, CLOTURE DE LA SOUSCRIPTiON PU RLIQUE au': acuons de la Compagnie générale pour !'éc!airag<~et te chauffage par le gaz. Prospectus et statuts se délivrent dans leb bureaux, 72, rue de la Victoire, à Paris. a ?'n9?stTTT~m? A JLH!~iUMu~ CHANGEMENT DE MMfctLE. L'anoeune maison de nouveautés à l'Héritière. est transférée rue SaintHonoré, 368, au perron du rez-de-chaussée. < ACHETE mNMTS, BtJOUX, et paie VLUS CHERyeno, rA~erie~U~ CHER~mMAtE ~YEDMiffM~M~~tK' orfèvre-bijoutier, U Dj[t.6Jre&WiLHL30,passaKeColbert.< · A Tf?ï?t t~CWiiks.b.s.g.d.g. pour leur qaaAlmJiijBjBijiité super". Ne se vendent que dans son seui magasin,186,Régent street, Lond' <f MX PHOTê~APHES Société générate de tournitures photographiques, réduction considérabie sur les pru. Demander le prospectus. M. Wuin.33, rue Cnarlot. Paris. Aar.' AV!S AUX V~YAdEURS ? I? R < MBtUCANT DE CAOOTCHOUC, ~ï~ FAB61CANTDH CAOOTCHOUC, JLN UJHl t rue rt'ut'eMnc, 6, s Pam, etfMe Ht'foK. (ne passe tromper pour le n'142 } Paletots avec ou sans apparence de Caoutchouc, graad choix de Paletots btanos en Caoutchouc Chaussures, Manteaux imperméables de toutes formes. JambièreTabtiers, Coussins, et tous les articies en Caoutchouc; Bas pour Varices. Enuotenprotx'Kceeta~roM~e' <f .BMNZES-~A~V~AY. Bronzes d'art et d'ameublement. Fabrique de Pendu!es,Lustres, Lampes, Feux.Suspensions de saHe à manger et biHard.Statuettes.ChiS'resconnus.Expos~publ. VACVRAY f". r. Marais-St-Martin. 37.. « ECMmâ~ALAMcm~E Nouveau iiqatde aans odeur. EcoNOMia, 50 0/0. PoMr appar~men~, e<e6/mementxpH6<tM, e<c.,e<c. CoHSN et C', rae d'Hauteville, 6ti. Paris.Détail Maison L.SLON6,[botd.Bonne-NouveUe. 31.' E'ân~t~S'fB ~H ~t A fE'~ Bues et enca ~~LBM.UJUNaFStrLA~MO drées, tous styles, Venise, etc., vendues ao-dessons du ooars. Sculpture sur bois. Immense assortiment. tLBXAMtM~eune. 9i-93, fa<ib.St-Antôine, Paris. < MBâML!E DE PAPms PEÏMTS Terfava~en nts, rue de Montreuil, i, faubourg St-ABtoine.Pans. Maoufacture fondée enMt6. vendant actieUenaent en déiaii, au prix de fabrique, t: .MT~ETNEURLESENFES, SommMM~Sttt9tte't~coMFJe~. fabrique cHAtLits LÉONARD, rue HARLtï (Marais), H, Paris." ~ji-WIME'Sd'oocasion et autres, ~ch&ts de ~&DSLsO mobiliers. 17, rM Meslay. < tWouveHc« <tea TThé&trea. Ce soir, à l'Ambigu, première représentaj tion de Cadet Roussel. drame en sept actes, pour la rentrée de M. Chartes Pérey.
| 35,980 |
https://github.com/ember-fund/edge-core-js/blob/master/src/io/react-native/react-native-webview.js
|
Github Open Source
|
Open Source
|
BSD-2-Clause-FreeBSD
| null |
edge-core-js
|
ember-fund
|
JavaScript
|
Code
| 590 | 1,451 |
// @flow
import '../../client-side.js'
import React, { Component } from 'react'
import { Platform, StyleSheet, View } from 'react-native'
import RNFS from 'react-native-fs'
import { WebView } from 'react-native-webview'
import { Bridge, bridgifyObject, onMethod } from 'yaob'
import { type EdgeNativeIo } from '../../types/types.js'
import { makeClientIo } from './react-native-io.js'
import { type WorkerApi } from './react-native-types.js'
type Props = {
debug?: boolean,
onError(e: Object): mixed,
onLoad(nativeIo: EdgeNativeIo, root: WorkerApi): Promise<mixed>,
nativeIo?: EdgeNativeIo
}
type WebViewCallbacks = {
handleMessage: Function,
setRef: Function
}
/**
* Sets up a YAOB bridge for use with a React Native WebView.
* The returned callbacks should be passed to the `onMessage` and `ref`
* properties of the WebView. Handles WebView reloads and related
* race conditions.
* @param {*} onRoot Called when the inner HTML sends a root object.
* May be called multiple times if the inner HTML reloads.
* @param {*} debug Provide a message prefix to enable debugging.
*/
function makeOuterWebViewBridge<Root>(
onRoot: (root: Root) => mixed,
debug?: string
): WebViewCallbacks {
let bridge: Bridge | void
let gatedRoot: Root | void
let webview: WebView | void
// Gate the root object on the webview being ready:
const tryReleasingRoot = () => {
if (gatedRoot != null && webview != null) {
onRoot(gatedRoot)
gatedRoot = undefined
}
}
// Feed incoming messages into the YAOB bridge (if any):
const handleMessage = event => {
const message = JSON.parse(event.nativeEvent.data)
if (debug != null) console.info(`${debug} →`, message)
// This is a terrible hack. We are using our inside knowledge
// of YAOB's message format to determine when the client has restarted.
if (
bridge != null &&
message.events != null &&
message.events.find(event => event.localId === 0)
) {
bridge.close(new Error('edge-core: The WebView has been unmounted.'))
bridge = undefined
}
// If we have no bridge, start one:
if (bridge == null) {
let firstMessage = true
bridge = new Bridge({
sendMessage: message => {
if (debug != null) console.info(`${debug} ←`, message)
if (webview == null) return
const js = `if (window.bridge != null) {${
firstMessage
? 'window.gotFirstMessage = true;'
: 'window.gotFirstMessage && '
} window.bridge.handleMessage(${JSON.stringify(message)})}`
firstMessage = false
webview.injectJavaScript(js)
}
})
// Use our inside knowledge of YAOB to directly
// subscribe to the root object appearing:
onMethod.call(bridge._state, 'root', root => {
gatedRoot = root
tryReleasingRoot()
})
}
// Finally, pass the message to the bridge:
bridge.handleMessage(message)
}
// Listen for the webview component to mount:
const setRef = element => {
webview = element
tryReleasingRoot()
}
return { handleMessage, setRef }
}
/**
* Launches the Edge core worker in a WebView and returns its API.
*/
export class EdgeCoreBridge extends Component<Props> {
callbacks: WebViewCallbacks
constructor(props: Props) {
super(props)
const { nativeIo = {}, debug = false } = props
// Set up the native IO objects:
const nativeIoPromise = makeClientIo().then(coreIo => {
const bridgedIo = { 'edge-core': coreIo }
for (const n in nativeIo) {
bridgedIo[n] = bridgifyObject(nativeIo[n])
}
return bridgedIo
})
// Set up the YAOB bridge:
this.callbacks = makeOuterWebViewBridge(
(root: WorkerApi) => {
nativeIoPromise
.then(nativeIo => props.onLoad(nativeIo, root))
.catch(error => props.onError(error))
},
debug ? 'edge-core' : undefined
)
}
render() {
let uri =
Platform.OS === 'android'
? 'file:///android_asset/edge-core/index.html'
: `file://${RNFS.MainBundlePath}/edge-core/index.html`
if (this.props.debug) {
uri += '?debug=true'
console.log(`edge core at ${uri}`)
}
return (
<View style={this.props.debug ? styles.debug : styles.hidden}>
<WebView
allowFileAccess
onMessage={this.callbacks.handleMessage}
originWhitelist={['file://*']}
ref={this.callbacks.setRef}
source={{ uri }}
/>
</View>
)
}
}
const styles = StyleSheet.create({
debug: {
alignSelf: 'center',
position: 'absolute',
height: 10,
width: 10,
top: 50
},
hidden: { position: 'absolute', height: 0, width: 0 }
})
| 48,955 |
bpt6k47950594_2
|
French-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,904 |
La Liberté
|
None
|
French
|
Spoken
| 7,280 | 12,305 |
QueLQIMS heures plus tard on apportait dindes et bombes et. cette livraison — con'im,«, les précédentes — dmmait)ieu à d'interminables discussions entre le xtes-tinataii-ré Bt..le livreur. : La santé du restaurateur était une des constantes sollicitudes du facétieux plongeur. — On me dit, téléphonait-il (I'tiTlie voix attristée, que tu ne manges pas suffilsamment. Peut-être sont. ce lesprovisions qui te font défaut. Cet après-midi même, lu auras ton foin. Et, après déjeuner, une fourragère s'arrêtait devant la brasserie. Puis ce fut le tour des médecins. Un matin où. M. X... ne s'était jamais senti mieux portant, il entendaitla voix abhorrée lui dire affectueusement : — « J'apprends que tu es tout à fait souffrant. Il faut absolument te. faire soigner ; aussi ai-je ' prié mon docteur d'aller te faire une petite opération. » Le soir même, un chirurgien de la Faculté de Paris, décoré de la Légiond'honneur, arrivait avec sa trousse. On lui avait téléphoné que M. X... avait une grave frac. I turc de la jambe. Peu après, c'était Maie Henry, la sage-femme bien connu'.'', qui se présentait pour accoucher Mme X... Enfin, c'étaient des ambulanciers avec leurs voitures, des ban-dagistes venant prendre les mesures d'appareils spéciaux, des pharmaciens livrant à la fois cent litres d'huile de foie de nlOrue, des marchands de couronnes funéraires, des charretiers amenant des tombereaux de ciment... M. X... crut qu'il en deviendrait fou. De son côté.jla caissière n'était pas oubliée et recevait également tous les jours, à son domicile, la visite de fournisseurs de toutes sortes. Non content de cela, Hubert Etienne demandait chaque soir la communication avec la brasserie et ne la lâchait plus. Il insultait les clients, disait des grossièretés aux femmes, et surtout débinait et déI nigrait la brasserie et son propriétaire. Les habitués de rétablissement, qui l'a1vaient surnommé « le fou », avaient renoncé à téléphoner, à l'heure de l'apéritif. Le plus curieux de l'affaire, c'est que. légalement, on ne pouvait rien contre cet invraisemblable fumiste. Il n'y a aucune loi contre ce genre de délits. Il a fallu qu'un jour Etienne Hubert proférât — toujours téléphoniquement — des menaces de mort contre M. X... pour qu'on pût le mettre sous les verrous*. Max Charlie. L'abondance des matières nous oblige à j ajoiirner la publication de notre intéressant feuilleton, la Reine du Cuivre. LES PREMIÈRES GYMNASE. — Le Friquet, pièce en quatre actes, de M. Willy, d'après le roman de Mme Gyp. La collaboration de Mme Gyp et de M. Willy étonna quelque peu lorsqu'on l'annonça. Gyp, nom léger qui semble un joli petit masque posé crânement sur des yeux rieurs et un petit nez à la Roxelane, est, on le sait, le pimpant pseudonyme de la comtesse de Mirabeau-Martel. Le succès de ces dialogues d'allure preste, de philosophie furtive et. de grâce fine qu'elle donna depuis quinze ans' avec une abondance joyeuse, fut immense et spontané., Le Petit Bob, Paulette d'Alaly, Willy le Grognon Folleuil, Manuelle Loulou sont des silhouettes tout à fait originales avec un joli coin de sensibilité émue sous leur parure de snobisme. M. Willy a, lui aussi, voulu créer des silhouettes notoires, et il y a réussi, étant bien décidé à ne rien épargner pour cela. Sa Claudine a connu les gros tirages. C'est une personne en chaussettes sur laquelle il y a fort à dire. La fusion de ce personnage avec celui de Mlle Polaire, proclamée à toute occasion par l'auteur et l'interprète, rendait tout à fait curieuse la tentative que Mlle Polaire et M. Willy viennent de faire au théâtre du Gymnase. Le Friquet est, en effet, une pièce morale, émue, attendrie, pudique, — c'est vous dire crue ce fut pour son auteur et sa créatrice un petit scandale que de l'écrire et de la jouer. Le roman de Gyp, qui inspira la pièce, est tout plein de choses charmantes. Il a pour défaut de suivre d'un peu trop près la fable de la Cigale, l'exquise comédie de Meilhac et Halévy. A l'intrigue de cette œuvre charmante ajoutez une fin genre Dame aux Camélias et vous aurez le Friquet. Ce Friquet, qui est une Friquette, fut trouvée autrefois, au bord d'une route • par un bon saltimbanque, le clown 1 p Polaire Maffia. Le clown — brave homme — a-l recueilli l'enfant, l'a élevée et maintenant eue fait, avec lui, partie du cirque forain dirigé par M. Jac.obs.on. Or, M. Jacobson est un manager brutal. Il ne ménagé à sa pensionnaire ni les affronts ni les mauvais traitements, si bien qu'un soir de représentation, après une scène violente avec son directeur, le Friquet vient réclamer la protection du 1-nair e du pays oùi campe momentanément je cirque. Ce maire est beau garçon, le cœur sur la main et se nomme Hubert de Ganges. Une fort jolie personne, Mme Yseult Claparon, femme d'un tripoteur de Bourse, arrive à point pour se charger du Friquet. Elle offre d'en faire sa demoiselle de compagnie .et la petite bohémienne, soulagée mais un peu triste, quitte le Jacobson et le bon Le Mafflu. Or, au château de Claparon, le Friquet revoit Hubert de Ganges, qui lui plaît beaucoup plus qu'elle ne le croit, imaginant seulement que la présence de ce grand ami adoucit sa nostalgie et lui ôte le regret de sa vie d'aventures. Mais, bientôt, M. Claparon, propriétaire du château, grand amateur d'architecture ancienne et de fruits verts, s'aperçoit que sa jeune protégée est. jolie et lui propose ce que bien vous pensez. Fièrement, .Jg Friquet résiste. Mais elle n'est pas récompensée de ce bon mouvement,. Eu eutr^.Ji ^'improviste dans une ! serre. la petite saltimbanque surprend sa bicnfait't'ice, Yseu't Claparon, clans les bras d'Hubert de Ganges. Le coup est rude pour le Friquet, qui se sauve en larmes. Pourtant ..Friquette a suivi les Claparon à, Paris. Mais elle y revoit Hubert et, dans l'effroi où elle est de sentir son petit cœur se 'prendre tout à fait, elle s'enfuit et vient retrouver le sculpteur Bauq¡', un brave et excellent artiste qui a toujours accordé à la saLtimbanque une protection lui-même estimait être toute paCerie) le. Mais, en écoutant le récit des chagrins duP' Friquet, Baugé s'aperçoit-qu'il .s'est toujours abusé et qu'il aime la petite d'un amour véritable. FrRllchcment, honnêtement, il Lui offre de -l'épouser. Un moment, le Friquet hésite. Mais Je nom de « M. le maire », prononcé par Baugé, lui rappellel'homme -ciu'rllp aime. Elle., ne veut ni ne peut se reprendre à Hubert et elle refuse l'offre de Baugé. L-e Friquet est à prés.ent étoile au Nouveau-Cirque. Claparon l'y poursuit, décidé à tout. pour la séduire. Il se jette sur elle brutalement, par surprise ; mais le Friquet voit. rouge et, s'armant d'un couteau que lui a donne naguère Le Mafflu, elle le plante dans la. poitrine de s'en agresseur. Pourtant, c'est l'instant où le Friquet doit entrer en scène pour je ne sais quel exercice aérien. Mais, comme elle voltige de tra;pèzc en trapèze, elle aperçoit parmi les spectateurs Yseult Cla'paron et 'Hubert. Jalous'e, désespérée, énervée, elle manque1 son saut périlleux et retombe, b.ri&ée, sur le sol. Transportée clans sa loge, le Friquet meurt en souriant, entourée du Maffiu, d'Hubert et de Baugé — les trois seuls êtres qu'elle ait aimés. C'e's't visibleniient pour Mlle Polaire seule que M. Willy a mis à la scène le roman de Gyp. Dans son interprétation du Friquet, Mlle Polaire a fait les plus louables efforts. Renonçant à son ancien j,eu — trépidant et c.antharidé — elle a été, cette fois, naturelle, émouvante et sensible. Son s.uc.ces Il été très vif. M. Numès a dépensé, dans le rôle du clown Le Mafnu, des trésors de bonté ; M. Calmettes — le sculpteur Baugé — est un adroit et sûr comédien : M. Andlfé Hall, un plaisant amoureux; M. Paul Plan, un Clanaron ignoble autant qu'il le fallait. Quant à Mine Dorziat — dans le rôle périlleux d'Yseult Claparon -elle a été charmante de tact et d& cMlic,a'i,e'S!se. C'es't une vraie comédienne — et diont les progrès sont rapides et incessants,. Robert de Fiers. L'AFFAIRE CASA RIERA Le marquis au Palais. — L'interrogatoire. ! Le marquis de Casa-Riera a été interrogé 1 hier, pour la première fois, par M. Leydet, juge d'instruction. ! L'interrogatoire a duré près de trois heures. Le marquis de Casa-Riera a déclaré : 1° Qu'il était né, le 20 mars 1823, à Barcelone ; 2° Que son père est mort en 1836, sa mère en 1842 ; 3° Que' son oncle, Riera y Rosès, dont il a hérité, étant son tuteur naturel, il s'était rendu chez lui, à Madrid, avec ses frères Vicente et Gonzalo ; 4° Qu'il a connu, à cette époque, don Vicente Santa Maria de Paredes, actuellement professeur du roi d'Espagne ; Joa-chim Fernandez de Haro, actuellement ingénieur de marine en retraite, et le comte de Casa Valensia ancien ambassad.eu.r en Angleterre ; 5° Qu'en 1849, il est. venu à Paris chez son oncle, en ce moment installé dans un hôtel rue Blanche ; 6° Qu'en 1851, il est allé à Londres, où il est resté trois ans comme employé de la maison de banque Frédéric Hort et Cie ; 7° Qu'il s'est rendu ensuite à Madrid, où il a été l'associé de la maison de banque Topiabaye et Cie. Ces deux associés vivent encore ; 8° Qu'en 1859, il devint le fondé de pouvoir de son oncle ; 9° Qu'en 1875, son oncle le rappela près de lui, à Paris, et qu'il resta à ses côtés jusqu'à sa mort, survenue le 20 mai 1881 ; 10° Que c'est son oncle lui-même qui s'est rendu chez le notaire, M0 Mahot de' la Qué-l'antünnais, auquel il a dicté son testament ; 11° Qu'il était auprès de son oncle quand il a rendu le dernier soupir, avec M. Frédéric Ricard et ses deux enfants ; 12° Qu'à défaut des neveux de l'ancien marquis c'étaient les enfants de M. Ricard qui avaient droit à la succession. Enfin M. de Casa-Riera a indiqué un certain nombre de témoins qui l'ont connu du. vivant de son oncle et qui pourront témoigner en sa faveur. Le marquis est convoqué de nouveau pour mardi. Interview avec M. de Marçay. — Les adversaires de M. de Casa-Riera reconnaissent qu'ils se sont trompés. On a beaucoup parlé, ces temps-ci, de ce qu'on a appelé le « groupe de Neuilly ». Par ce nom collectif on désignait quelques personnalités parisiennes qui se sont occupées activement de l'affaire de Casa-Riera et ont dirigé les recherches pratiquées en Espagne à l'instigation de ceux qui se disaient les véritables héritiers du défunt marquis de Casa-Riera. Nous avons pu rencontrer aujourd'hui l'une de ces personnalités, il. de Marçay, qui nous a fait les déclarations suivantes : — « Jusqu'à présent, je me suis absolument dérobé à toute interview. Mais, maintenant que le marquis de Casa-Riera a lui-même fourni des explications aux journaux et que l'on connaît en détail la déposition qu'il a faite devant le juge d'instruction, je crois pouvoir sortir de la réserve que je m'étais volontairement imposée. " Je me suis toujours tenu à l'écart des polémiques. Et, contrairement à ce que l 'oi-i a dit, je n a-i pas déposé de plainte et je ne me suis pas porté partie civile au procès, désirant ne pas donner lieu à équivoque en faisant cause commune avec. M. Pierre Riera et avec M. Pietri de Fal-' connet. Je connais M. Pierre Riera, mais je ne connais pas M. Pietri die Fakon-net, que je n'ai jamais vu. » Après les déclarations si formelles: et si précises du marquis de Casa-Riera, je dioÍs avouer que, s'il peut faire la preuve des faits qu'il a avancés hier devant le juge d'instruction, il faudra reconnaître qu'il a été victime d'une machination extraordinaire et incompréhensible. » Je dis bien : incompréhensible. Comment, en effet, expliquer la présence sur le registre de l'état civil de San-Martin-Sarocca de l'acte de décès d'Alejandro Mora y Riera, en date du 26 janvier 1878 et, sur le registre de l'état-civil d.e Santa-Maiguerita y Monjos, de l'acte de décès de Gonzalo Mora y Riera, également en date de 1878. Cela, c'est un mystère. » J'ai fait photographier ces registres, j'ai fait expertiser par M. Camille Le, grand, expert-juré près, le tribunal de la Seine, les pièces qui m'étaient soumises. J 'ai agi ainsi sur les conseils de mes avocats, iNl' Firmin Faure et IVle André liesse. Je me suis entouré de toutes les garanties possibles d'authenticité. » Ces deux actes existent donc bien, et il est établi que les deux personnes d,l.t ils enregistrent le décès sont, à en croire la teneur des pièces, le marquis actuel et sou i frère Gonzalo. » Par conséquent, si le marquis de Casa Riera a dit vrai hier, ces deux actes sont : des faux. Qui a pris l'initiative de ces faux ? Qui a trouvé les complices nécessaires '1 Ces juges municipaux et ces témoins qui af: firment l'authenticité des pièces, qui a rémunéré leur concours ? » Est-ce le forgeron Pierre Riera? Est-ce l'ancien consul Soulèi,e ? Ils n'ont, ni l'un j ni l'autre, aucune fortune. Je pourrais ] même dire qu'ils n'ont pas de ressources > personnelles. Comment donc auraient-ils i pu acheter des consciences qui, si elles se i sont vendues,ont dû se vendre fort cher, car , la découverte des faux devait entraîner . pétuité chacun ? des complices, le bagne à I)er » A qui aurait profité ces faux, puisqu'il = est. avéré maintenant que Pierre Riera I Uiêiïie s'il était démontré que le marquis c ' actuel de' Casa-Riera n'est qu'un imposteur, n'aurait aucune espèce de droit à la succession ? » Je l'avoue franchement : je suis très perplexe ; je ne comprends plus rien à tout cela. « Mon rôle, à moi, en toute cette affaire, a été très simple " il a consisté uniquement à fournir les fonds nécessaires pour obtenir la délivrance des actes, pour faire traduire Et expertiser les pièces qui m'avaient été soumises, pour faire établir les généalogies en vue de fixer le degré de su-ecessibilité de Pi^rre-Riera..... » Ces généalogies nous ont permis de constater que Pie'rre Ricra n'étai tpas héritier. » Je le lui ai dit ; depuis, je nëTài pas revu. » J'ai toujours désap'm'ouvé, pour mon compte, la campagne de presse qu'il a entreprifi0 et. je n'ai ces.sé de lui dire qu'il compromettait sa cause. On nous a prêté des rôles très divers. Ne retenez que ceci : le marquis de Casa-Riera a parlé de spéculations. Eh bien ! moi, je sais ce que^nfa coûté la constitution du dossier jusqu'au jour (J'CI j'ai reconnu le mal fondé des prétentions de Pierre Riera. Un point, c'est tout. » VOL DANS UN WAGON-POSTE Audacieux coup de main, Le courrier des Etats-Unis. — Découverte du cambriolage. Nous , avens signalé hier ,dans notre deuxième édition le vol audacieux commis dans l'express Paris-Havre. C'est hier matin, à trois heures, en gare de Rouen, que les employés s'aperçurent du vol. Un cadenas du wagon avait été arraché ; sur le plancher des wagons se' trouvaient plusieurs sacs .éventrés. Ces sacs renfermaient des lettres diverses, des plis recommandés et des imprimés de toute nature destinés à être expédiés à l'étranger, notamment à New-York, Chicago, San-Francisco et Alabama. On ignore à quel endroit exactement cette audacieuse tentative a nu être commise. Peut-être même a-t-ellc'eu lieu à la gare Saint-Lazare, où le wagon, après avoir été fermé, vers neuf heures trois quarts du soir, est demeuré jusqu'au départ du convoi. Le wagon dans lequel l'effraction a été commise est une allège dans lequel on met le courrier des Etats-Unis pour être transporte à bord du paquebot transatlantique qui part le samedi pour New-York. Comme l'employé des postes avait déposé dans cette -all.ège des sacs dis concsp-ondances pour Rüuen. c'est en allant prendre ces sacs qu'il s'est aperçu que le wagon avait été fracturé à contrevoie. Le contenu du courrier Le wagon-poste qui a été fracturé contenait 91 sacs de dépêches à destination d'Amérique, 89 venaient de Madrid et destinés à la Havane et Mexico, et 2 d,e Paris, destinés à New-York et Mexico ; plus 7 sacs contenant des imprimés pour Rouen et toute la Seine-Inférieure. Les malfaiteurs ont ouvert et vidé 5 sacs d'imprimés, 6 contenant les dépêches, dont 4 de Madrid à Mexico et 2 sacs Paris à Mexico. Les derniers ne contenaient pas de valeurs. Sur les 4 sacs de Madrid. 47 plis chargés portés sur les feuilles n'ont pas été retrouvés. On suppose qu'ils sont dans les 83 sacs intacts que la poste n'a pu encore contrôler. Fête à Montmorency ^Une fête des Vendanges aura lieu à Montmorency demain dimanche. Une cavalcade, comprenant des chars avec une décoration de circonstance, partira à midi de la place de la Mairie. UN NUMÉRO Il est des numéros que l'on n'oublie point, par exemple, celui qui vous valut le gros lot dans^ un tirage financier. Les Parisiens, eux, n'oublient pas que c'est au numéro 18 de la rue Favart que se trouve le dépôt de la Source Cachai d'Evian, dont l'eau les guérit de leurs maux d'estomac, des affections des voies urinaires et de l'appareil biliaire. Tout le monde fera bientôt comme les Parisiens. En vente chez tous les principaux pharmaCÍens et marchands d'eaux minél'[1 ] pc; de la France et de l'étranger. — CH. M. LE MONDE ET LA VILLE Ce soir : APtisêcs : A partir de ce Ier octobre, les mu-sées Carnavalet, Galliera, Cernuschi et le palais des Beaux-Arts de la ville de Paris ouvriront, de dix heures à quatre heures au lieu de dix heures à cinq heures. Relations : les anciens du 114e de ligne se réuniront, a huit heures et demie, au siège de la Société, 88, rue Richelieu. Les squares resteront ouverts de huit heures du matin à huit heures du soir, jusqu'au i;J octobre. Demain : Ouverture : de la chasse au faisan dans toute la France. Excursion du Club Al-pin : départ gare du Nord,7 h. 10 pour Noyon, déjeuner forêt d'Ourscamp, etc. ; retour à Paris onze heures : cotisation 16 francs. Saints du jour : SS. Anges gardiens. A Paris : Sont arrivés à ParTs : la princesse de Lu-cinge, la comtesse Amédée de Germiny, la marquise de Rougé, le prince et la princesse de Tarente, la vicomtesse de Poli, Mme Jacques Faure, revenant de Lion-sur-Mer ; le comte Tarnowski, secrétaire à la légation d'Autriche à Dresde, et la comtesse Tarnowska, le vicomte et la vicomtesse Gaston de Bre-teuil, le prince et la princesse de San-Faus-tino, venant d'Angleterre," etc., etc. Hors Paris : viLuun.ebhc ue i reaern vient dïnaugurer, en son château de Brissac, la série de ses représentations musicales. L Etoile du Nord, opéra en trois actes, de Meyerbeer, a été interprétée d'admirable façon par la char mante maîtresse de maison secondée par Mmes Thiauzat, lVIantout, Dan-gèse et MM. Chalmin, Sautereau, La Taste et Le Lubez. — La comtesse de Cambacérès vient de s'installer à Jouy-en-Josas, pour y passer l'automne. — La comtesse de Berteux vient de quitter Paris, se rendant à Rome. — Au château de Thuit-Anger, dans l'Eure, M. et Mme Louis Delamarre vont donner une grande fête sportive composée de rallye, gymkhana, cross-country, etc. — Mme Jcïes Porgès est rentrée en son château de Rochefort-en-Yvchnes, venant de Biarritz. — Mme Hcpri de Wendel est installée au château de Suuhcy. . — Le grand-duc Michel Xicolaïewitch, président d.u conseil de l'Empire de Russie ' est attendu a Cannes le 1? cctobrp r.n'rhc.:... Chasses : --------Demain, on chasse chez M. Albert Marinoni au château de la Mormaire, près de Montfort.1 Arnaury. -7 Le 6 octobre, chasse chez M. Gustave Batiau, au château du raid, près de Melun Mariages : . -t-n raison d'un deuil de famille, le mariage de M. Emile Rumeau avec Mlle Pauline Fleury, fille de M. Fleury, ingénieur ci-vi], secrétaire perpétuel de la Société d'Eco-nomie politique, a eu lieu à Paris, dans 14 ~ plus stricte intimité. Nécrologie : Nous apprenons la mort : de M Pierre ^ sa pr0pnété de Monthouis-sur -Loi • dge de 74 ans — dé'"jI. Lallier-Dimfn ancien conseiller général dArgentré décédé en son château dt.6,a R&:lnçODncrie d'Argentré, dè M. Sébastien Claude, inspecteur des forêts, décédé à Nancy, à Page de 78 --ansi " R. de Rubelles. MÉMOIRES D'UN Agent secret VI pas Tous-• les matins je nie rendais, avec Cuers, à l'état-major général : mon guide ion m'initiait aux secrets de son service. C'est érÍlui qui dépouillait le courrier des agents u'il à l'étranger, courrier qu'il, retirait chaque matin de la poste centrale, située à l'extré-,rs. mité de Berlin, opposée au Thiergarten. saIl avaÍt le c( chiffre », car certaines let-;n ! très étaient chiffrées : ce qui le désespé-turait. reUn , jour, en revenant de la poste, nous ernous étions arrêtés au café Kœcke, dans le Panopticum, Unter den Linden. Cuers était chargé d'un volumineux courrier : pour avancer sa besogne, car le bureau des ren-E seignements ouvrait fort tard, on l'a dit, il commença, al;' café, le dépouillement de ce courrier. Parmi les lettres, il y en avait Ler une dont l'enveloppe bleue frappa mes regalids. Elle venait de Russie. L'en-tête était imprimée en caractères français : « Banque commerciale de Varsovie ». Cuers était 1re furieux, la lettre que contenait cette enve-nis loppe était chiffrée. Hl— Quels imbéciles ! me dit-il. Pourquoi :ue ne pas écrire en langage clair ? Il me fau--adra deux heures pour lire et transcrire ur cette lettre, qu'ils ont mis autant de temps mt à écrire. » mRichard Cucrs pousse la négligence un peu loin : pourquoi a-t-il mis à la portée Jilde ma vue cette enveloppe fatale? Pour-er, quoi ces réflexions ? Les banquiers, d'ordi-tnnaire, n'ont pas accoutumé d'écrire en chiffres à leurs correspondants. Tout cela n'est int pas clair ! mQuant au capitaine Brôse, il mettait tous la ses soins à m'instruire sur cette armée *ès russe dont j'allais être chargé d'aller, sur lis place, étudier l'organisation, sur son ar-lémoment, qu'on transformait à cette époque. Mon professeur me faisait un cours ité quotidien d'artillerie et de fortification let russes. re Cependant le temps me paraissait ter-'iiriblement long : mon séjour prolongé dans une zone aussi dangereuse n'était pas •sé sans inquiéter le bureau du boulevard nSaint-Germain. Moi-même je n'étais pas re sans appréhension, et chaque fois qu'un J11 porteur de dépêches pénétrait dans le sanctuaire de. Herwarthstrasse, je me demandais si quelque misérable ne m'avait pas vendu à nos ennemis. l'e Mais le grand Dame arpentait souvent la vaste salle où nous travaillions, et, comme il avait le pas plutôt lourd, un planton montait fréquemment le prier, de 3 j , la part du général von Schreiber, le chef Jr du service cartographique, de modérer son es allure. Un jour, n'y tenant plus, ce général nmonta lui-même pour admonester, fort 1:t aimablement, du reste, le hauptmann au 18 pas pesant. Il parut surpris de me voir fïï clans ce bureau fermé à tous. On me pré-*' senta. es Is —«Ah ! c'est vous, me dit-il, qui depuis quatre ans, m'avez donné tant de mal ! Vos 'rapports m'ont contraint de modifier toutes mes cartes, et Dieu sait si j'en ai ! » ~ N'était-ce pas là la meilleure preuve que les officiers du bureau de Paris avaient à su, par leurs réponses ingénieuses et vraisemblables, jeter le trouble, la confusion t's dans l'esprit de leurs collègues de Berlin. r_ MOli rôle était évidemment modeste, puisque les réponses que je fournissais au grand état-major étaient préparées d'avance, mais encore fallait-il les discuter, pendant les deux premières années surtout. Un jour enfin, Brôse déclara au major ie von Wencker que j'étais prêt. Le grand jour de la délivrance approchait : il fut fixé au surlendemain. On me fit les plus u méticuleuses recommandations. Cuers, qui 'C avait maintes fois traversée la frontière, y ajouta les siennes : — « De la prudence, surtout, mon cher, Det vous roulerez ces Russes, que votre pays jt a grand tort, croyez-moi de considérer comme des amis fidèles et dévoués ! » rJ'avais hâte de partir. J'écoutais plutôt s distraitement ces inutiles propos et je ne voulus même pas que Cuers m'accompagnât à la gare. J'avais de bonnes raisons pour cela, car j'allais à Varsovie — ville qui m'était assignée par von Wencker — -, viâ. Paris ! 4 Je ne devais jamais remettre les pieds dans le bureau secret de Thiergarden... Je n'en étais pas parti les mainstout à fait vides. L'armoire de fer m'avait ouvert son cœur et confié bien des secrets. Il fallait être circonspect, mais j'avais découvert des documents si intéressants sur Genève que J. je n'avais pas su résister à la tentation... A Paris, je fûs chaudement félicité'quanc1 j'eus raconté les multiples incidents de 3 mon séjour à Berlin.L'organisation succinc1c te du service allemand, les noms des officiers chargés de ce service, la présence de | s Richard Cuers dans ce bureau, en qualité de secrétaire, c'étaient autant de sujets in 5 téressants pour Sandherr et ses collabora1teurs ! J Mais il fallait se hâter. Les Allemands ' me croyaient à Varsovie et j'étais à Paris. 3 Le général de Freedericksz télégraphia en i Russie et il me remit une longue lettre pour 1 le général baron de Brocke, qui comman' t dait la gendarmerie du Royaume de Polo-■ aile. j Je partis. Je traversai, la nuit, Berlin eni dormi et, le lendemain, dans l'après-midi, j'étais à Varsovie par 27° au-dessous de zéro. Je suis reçu par le général de Brocke, I qui s'intitule exactement « chef des gendard 1 mes du royaume de Pologne ». Il me prér : senta au capitaine comte Adarydi plus tard lieutnant-colonel de l'Ecole de guerre d : des cosaques du Don. a Le général, constamment en uniforme, _q me recevait presque tous les jours. Quand h je gravissais l'escalier de marbre de son e palais, après avoir été débarrassé silen-cieusement de mon manteau par deux colosses de gendarmes, au bonnet d'astrakan surmonté de l'aigrette blanche, il me semblait jouer qcelque rôle dans Michel Stro-GOff... Le général apparaissait en tunique bleue ' la main tendue... Adarydi préparait, avec ses collègues de l'etat-major du général Powsireski. les ré-ponses que je devais transmettre — en chiffres à Berlin. Mais je suis contraint d avouer que ces réponses, qui avaient surtout trait à la fortification et au matériel d artillerie, ne satisfaisaient pas mes correspondants de Herwarthstrasse. Il faut croire (fue les officiers russes n'avaient pas le doigté de nos chefs de Paris et je reçus souvent, pendant mon séjour en Pologne, des demandes d'explications et de rectifi1>a cations de Berlin, ce qui ne m'était jamais (E arrivé quand j'avais « travaillé » en . ■ France. m< Le général de Brücke avait été mis au su courant dès mon arrivée, des soupçons que ^ m'inspirait -la correspondance échangée enno tre cette Banque de Varsovie, dont j'ai pa.rlé, et les officiers du bureau de Berlin. "On j se rappelle cette enveloppe bleue que Cuers ouvrit négligemment au café du Panopticum... Quelque ÍeiTj", après, le capitaine Ada-ryd1 entre en coup de vent dans la chambre ^ que j occupais à l'hôtel de France et, me de laissant a peine le temps de me vêtir il me un I 5iaP? traîneau qui nous attend. -: d it il. Les espions sont arl ic( rêtés. Le général veut vous complimenteu ter... » j vil1 Le général m'apprit qu'il avait fait arrê-te'cinq Allemands dans la banque en quesresi tion ; l'un d'euxallait partir pour Berlin; .% p ses poches contenaient des documents pré-cis qui ne laissaient aucun doute sur leur ess culpabilité et sur le genre d'opérations aux-quelles ils se livraient depuis longtemps déjà. Ils appartenaient comme « volontaires » à ce comptoir financier afin de se donner une contenance. s ' 7 Le général de Brocke me félicita longuement... Je lui demandai alors si l'instruction serait longue. Le général parut stupéfait d'une pareille question... Il me répondit simplement ces mots : « Ces cinq homV4iices sont à ma disposition... » Le surlende'. Main, le comte Adarydi m'apprit que les agents arrêtés étaient partis. (c Ils sont en route, déjà loin, sans doute », ajouta-t-il avec un sourire indéfinissable qui me fit mal. On les avait expédiés en Sibérie ; la Justice » est ^vraiment expéditive en Russie ! A la suite de cette quintuple arrestation., le consul général allemand qui, depuis plus de 20 ans, représentait l'Allemagne à Varsovie. dut quitter hâtivement le territoire^ russe. On lui donna 48 heures pour fa're ses paquets. Et personne ne réclama ! Alors, le' gouverneur général de Varsovie • s'appelait Gourko. I J'assistais parfois à des manœuvres de nuit, en plein hiver. Les questionnaires que l'ne faisait passer le bureau secret de Berlin par les voies les plus détournées — il m'en arrivait nar Londres .— avaient souvent trait à ces manœuvres nocturnes. 'De ce¡"'les-ci j'ai surtout retenu les soins dont l'ofj ficier russe entoure ses hommes. Jamais un J officier ne se reposera avant de s'assurer ! que les soldats sont chaudement couverts, j que les feux, autour desquels ils reposent, 1 ne menacent pas de s'éteindre et que tout le monde a pris, en quantité suffisante, le thé chaud, suffisamment arrosé de wodki — le-H cognac national ». — Ces manœuvres de nuit offrent un spectacle des plus curieux quand le ciel n'est pas couvert de nuages ; la traversée de la Vistule par ces masses d'hommes, de chevaux et de canons ne manque pas d'impressionner le spectateur inaccoutumé. Si la glace épaisse allait s'entr'ouvrir ?... Aujourd'hui, nous sommes tous faits à ce genre d'exercices, la traversée du lac Baïkal et celle des grands fleuves sibériens nous ont singulièrement aguerris à distance. Pour copie conforme : L. VÉTAULT. (A suivre.) Le Cambriolage de la rue de Chézy Retour de M. et Mme Renaud. — Arrestation des complices de Van Brussel. un n attendait que le retour de M. et | Mme Renaud, qui étaient en voyageà ; l'étranger, pour établir kt culpabilité deVan Brussel! au point de vue du vol qualifié qui lui est reproché. , M. et Mme Renaud viennent de rentrer d'ans 1-eur^ villa d.& Neuillv et M. Simart, commissaire de police de cette localité, s'est aussitôt. rend.u chez eux pour leur soumettre les objets saisis sur le, meurtrier du brigadier Fleurant. Ces objets se composaient d'une montre en or, de boutons de chemise en or également et die boucles d'oreilles. M. Renaud fils reconnut die suite la montre et les boutons .comme lui appartenant et 'Mme Renaud en fit autant pour les boucles d'oreilles. La preuve de la culpabilité de Van Brus>-sell est donc faite. Restait à découvrir les complices de ce bandit. Le commissaire de -poli-ce de Neuilly savait que Van Brns-sell se ren.cont.rait souvent, dans des établissements situés à Clichy, avec des individus connus comme des malfaiteurs dangereux et dont plu-sieuis avaient été vus en possession d'objets c'tirobés chez M. et. Mine Re.naud. Ils se réunissaient surtout chez un débitant où l'un di'eux se lamentait, ces jours-ci, de ne plus avoir de balles dans son revolver pour travailler à sa guise et dégringoler «, fLics » et « pantes ». ^ Pendant quatre nuits -consécutives, M. Simart lui-même, accompagné de son secrétaire, M. Gourbier, et d'un certain nombre d'agents, chercha il. capturer d'un seul coup tous ces individus ; mais les gaillards, se sentant filés, sans doute, évitaient de se trouver ensemble depuis l'arrestation de Van BnlSiseU. Le commissaire résolut alors d'aller les cueillir à leur domicile respectif. Muni des mandats nécessaires délivrés par M. Bourd'eaux, juge d'instruction, il opéra successivement l'arrestation de Joseph Varrieras, dit « L'Ouverture », dix-huit ; ans, qui accompagnait van Brussell rue de Chézy, lors du cambriolage; Joseph Langraine, tr-ente et un ans, lutteur professionnel, bien connu à la foire de ; Neuilly ; Eugène Aigret, dit « Bibi », trente 1 ans, acrobate d'une adresse remarquable, 1 qui manie le revolver avec un brio exlraor< dinaire ; Farer, dit « Nénesse », un com] parse ; Jeanne Hellé, .dix-neuf ans, maîtresse du lutteur Langraine, et quelques autres femmes aux professions diverses, parmi lesquelles il y a des lutteuses. Le lutteur Langraine est un véritable j hercule et l'acrobate Eugène Aigret est | d'une agilité surprenante ; mais, surpris ; par la police et en présence du nombre imposant des agents chargés de s'emparer r de leur personne, ils n'opposèrent aucune c résistance. Une confrontation émouvante eut lieu au l commissariat, où tout -ce joLi monde fut f amené!. Tous ces individuss'injurièrent a qui mieux mieux, se jetant mutuellement Vt la pierre. Ils sont aujourd'hui au Dépôt. r1 On soupçonne Varrieras, le principal ti complice de Van Brussell, d'avoir pratiqué certains cambriolages dont on recherche f, encore les auteurs, notamment; à Compiè-gne. C'est à lui qu'appartenait le revolver dont Van Brussell s'est servi pour tuer Je brigadier Fleurant. Les autres personnages ne --,on't. en la circonstance, que des Sl r e cé leurs ; ma.is ils ont, à leur actif, bien e' d'autres méfaits. e Van Brussell a comparu hier devant M. Bourdeaux. juge d'instruction. Il persiste à nier énergiquement toutepartic.ipation au cambriolage de la villa de la rue de Chézy. Informé 'die la mort dill brigadier Fleurant, il a répond,u que ce qui était v< fait était fait. ! m La Banaue de l'Union Parisienne met à la disposition du public une nouvelle série de coffres-forts particuliers, depuis 30 fr. par an. La Banque de l'Union Parisienne consent des prêts sur titres, garantit les titres amortissables contre le risque de remboursement au pair, délivre des chèques et des lettres de crédit sur la France et l'étranger et fait toutes opérations de banque Faits divers La Température (Obscrvations météorologiques de Vingé-nicur Fontana, /, rue de la Bourse.) Paris, 1er octobre. Minimum de la nuit + 10°3 Huit heures dru matin + 11°3 Onze' heures! dJu matin...... + 14° Deux heures du soir ........ 416° Baromètre : 763, Une dépression s'est avancée rapidement surr le nord-ouest de l'Europe ■ le baromètre marque. 748 mm. à Stornoway (Ecosse).. „ Dans le sud-ouest d.u continent, le haromètre reste à 765 mm. Le vent souffle du sud à Paris, Lyon, Nan-cy. j La. température va se tenir près de la normale, le temps va rester à la pluie. Aujourd'hui, à Paris, pluvieux. PARIS Vol de 80,000 francs On se souvient qu'en mars dernier un vol de 80.001) francs de valeurs fut opéré chez un changeur de Toulouse, M. Mo'-ina A la suite de recherches faites nar''a nn lice de Toulouse, les trois principaux an" teurs de ce vol furent arrêta dan? ville. Ce sont les nommés Hacazeaux, r^ tin et Maîbec. Seul, le recêleul* ' été chargé d'encaisser les coupons qui a^Alt restait à retrouver 11 ^ volés, 1 à Paris et arrêté par le service d'ètre de découve-rt la SûrpI té. Il se nomme Maurice -Miclmlowski ia de 37 ans, demeurant passage cie la rWî Ce qui justifie le succès colosse ti;< Grands ^ Magasins Dufayel, c'est qu'en plvs des prix extraordinairement bon mardi auxquels e!/cs sont vendues, les mardiai dises sont garanties 3 ans, ou livrés irauf) de port ou d'emballage pour to^c li France. De grandes facilités de paiemeJ: sont accordées, et les devis et dessiL sont établis gratuitement. Exposition rr. manente et nombreuses attractions. Les créanciers de Mme Humbert M. Bonneau, syndic de la. faillite HUiti bert, va enfin distribuer quelque arg,<i! aux créanciers : il paiera un franc é quante pour cent. C'est maigre. Les créanciers ont trente jours pour ri.tirer chez M. Bonneau un mandat gi'-auquel ils -pourront t-üuchcr, à la La-1 des dépôts et oon.s.'g-natious, les M);iE;g qui leur reviennent. Saison nouvelle En raison de l'automne précoce, iJui J avancé le retour, à Pa.ris, de tout J'éMUle;! mondain, l'exposition des créations n velles du High life Tailor aura. lieu, di; demain dimanche, à la fois, 12, ru.e mu ainsi que 112, rue Richelieu. L'origiD?i et la richesse des modèles inédits in tumes tailleurs pour dames à 95 fraw de complets pour Messieurs à 69 11,1 lui assurent d'avance un succès colossal. Un meurtrier de quatorze ans Deux gamins se querellaient hier soir, dix heures* dans la rue des Francs-Bourp1-André Martin, employé de commerce, Ace lô ans, demeurant 50, rue des Francs îM geois, et Marcel Goldt. sculpteur, âge ans, demeurant 29, rue des Rosiers. Après qu'ils eurent échangé quelques ! rions, Go'dt se sentant le plus faible. tin-1 S'q' poche un couteau à cran d'arrêt dtV frappa deux fois son adversaire clans le a1 | Le malheureux Martin tomba en poli1-*"-1 un grand cri, des passants accoururent réfèrent le meurtrier tandis que cl'au*re= f tèr-ent le blessé dans, une pharmacie. Il ;J" transporté dans un état assez grave à M tel-Dieu. Le meurtrier a été envoyé au Dépôt. Essayez de l'Eau de Sue:., dentifrice -se inique, et vous n'en voudrez pas d'aul'f> elle donne à la bouche une fraic'icur excelle guérit et conserve les dents. HORS PARIS Les grèves i Celle. — Les charbonniers sont en S-l ve ; ils demandent le travail à rais® un franc la tonne, au lieu de la de 8 heures payée 8 francs. — Les employés des tramways en g, maintiennent leurs .rev&ndica.tioM. Perpignan. La grève des hôteliers et plongeurs continue. De'1' trouilles de grévistes entravent la !•* du travail en exerçant des violence les réfractaires. Complot anarchiste Barcelone. — Le mystère qui P"'1 sur 1 affaire de la bombe qui a palais de justice est. éclaIre). H sait d'un attentat contreune notai"'1^ la haute société madrilène. La f°'L, de 1 explosif a été donnée par un , Çais ; l'engin a été fabriqué par chiste Rull et la matière explosif fi nie par l'anarchiste Garcia. C'est P3 "j jeune fille éprise de Ruii que le Coli) a été découvert.. Le professeur Koch démissionne Berlin. — On annonce que le. J'°1'■«M ' cepte la démission offerte par_ *e.L 1® , seur Robert Koch, conseiller Le charme Féminin et les Pilules Pink « Examinons, écrit un docte-,-,. ce que le monde et les amouronV « le charme » d'une femme féminine ainsi désignée est ce^h' contre-partie de ce que nous'amïSti! l'homme « la virilité ». Donc s'ch/'4' me, les traits les plus beaux soiif5 Ce et incapables de gagner les'c(wn%i.'-'S« ce charme )), la beauté exist,, I 0 est un masque qui n'attire pa^ r ' r'^S qui fait-que certaines femmes * ^ei'! jolies, ont un grand attrait V lls 4-femmes belles comme traits n'4t;/iUe Le défaut dans ce derniercas ruGïit manque d'une seule chose, un ^ eiltir et abondant. Sans cela une ^ imo-fenmro, ^elle perd le raagnéti4ïe?fe-sexe. Les pilules Pink donnent rin ^ che et pur. Le sang envoya d'Ûv,11^ j veine., par chaque dose de pilule* p-0?^ tend aux joues et se répand danT rs« organe du corps, donnant clu clrv. -"i attraction magnétique qui, mieux ®ll8'i''-1»! beauté froide et sans via. gagne 1 af|' tior, s durables. La santé donne le eHt1 la santé est LE SECRET du charme. Les femmes qui veuW 1 " server ou l'acquérir doivent éviter r des médicaments purgatifs qui sent le sang. Elles doivent prendri M lis que. Les pilules Pink, le meiiieur VPÏÏ teur du sang, donnent des force8 ' eile« f?-purgent pas. s) « Je n'ai jamais eu meilleure m,« ^ depuis que j'ai pris les pilules Ph CUI MJle Florestine Bruon, de Rœ7i Depuis trois ans je souffrais de "S J'étais très pâle, sans appétit et tram. J'avais une grande faible,%e 'd en. . tout le corps, particulièrement !tî jambes. Au moindre effort gravir les. marches d'un escalier pldement à bout de souffle et nrii if*1* pitations. J'eus la bonne ms¡:nratioll de sayer le traitement des pilules Pi.T e-avoir essayé beaucoup d'autre, Incn s, ll11.hLemen. ..'1 Les pilules Pinl * rendu mes belles couleurs d'à ni®01,1 tous mes malaises ont disparu Je * El et il me semble que c'est un d litre SUIS salJg fOlIe coule clans mes veines ». -rt,j&5iii La perte des forces, la faibles de deia moelle epmiere, la fatigue, les èiiit*. surmenage et d'excès de tous genres suites ! guéris par les pilules Pink. Elles 4-2 sent aussi chlorose, neurasthénie f vralgies, les maux d'estomac rhumn/;,, migraines, irréo-ularifes. Elles vente dans toutes les piiarmae^ et Kln„nafa pot Gablin et Cie, ph-» 23, rue Ba ris. Trois francs cinquante la boite ' ïlP sept francs cinquante les six boitc3. -- GRANDS MAGASINS DU a LOUVFM PARIS J Après-demain LUll EXPOSITION CfÉNÉS*1* DES NOUVEAUTÉS D'AUTOMNE ET P'jjlli» AU BON MARCHE, Lundi -jjJ i ours suivants, Exposition Généra i » (Voir aux 3 1 llno ROYAL HOTTSE la Bourse (RU8 Réaurnur) ___84> 0*19 CHlKlil F&âJSBIri'® et ',0 Vo'yage. Trois ao te-fi Vofp ci Exposition les Lundi 3, Mardi 4 ci ,,,înî rie directeur de msaecine, * Sion infectieuses, et; l'Institut poiu le : ioD; lui a. bonf:éré une P. Vols de plans et de dessins navals Kiel. Le chef du ®, a'rrêté. Il est chantier -Germant^ a : ment approprié dede S^uSSn et .'d-es dessins' des plans -de c0-, jer^emania, et de les de cales du cfoC11))ant une somme assez avoir offef i oyon fl chantier allemand. importante, à un Navire français échoué Newcastle. £houé unplie, venant On le "considère comme banc dhui'tiem sauvé par les per-du. L'équipage bateaux de sauvetage. Une ville anéantie journaux puniicnt-Londres. ^evv-York, 30 sep--la dépêche suivante de tembre : . Puebla (Colorado). « Un de la ville de Trini-exprime la «an que habitants, ait complèd'q'Ll , avec • à 3.a -te. d'une rupture tementJ cLisparu d'eau. :• des réservoirs comIllU11ieations par télégraphe » Les ^"fv/nor chemin de fer ayant ftf Situ citaLiosSlWe d'avoir des 'détails exacts1. » J Un verre de Bénédictine , près le repas. Théâtres Lr FRIQUET. Le « jeune et actif d|" ree CUl " du Gymnase a déjà réalise beau-oap de choses extraordmaixes 11 a ba tu, i, jau soir, son propre record en b ansioi-. mant le théâtre de Madame en véritable cirque ce qUI . n est pas mal -et en faisant de M. Willy l'homme le plus morai et 1 plus pudibond de la terre — ce qu. est le comble des combles. _ Tout, arrive., .comme curait 1 autre. jit 1 on .peut le répéter aujourd liui que V^1'C1 le scabreux Willy mué en Berquin et la torpillante Claudine changée en demoiselle Nitouche. ' t , ... , S'il est vrai que M. Franck ait hésite a donner la pièce tirée du roman de Gyp par Willy, cette hésitation est étonnante de la-part d'un homme aussi avisé , r len n est plus parisien qu'un roman de Mme la com-teslS0 de Martel, rien n est plus boulevar-<lier qu'une pièce de M. Gauthier-Villars ; rien n'est plus sensationnel que là rentrée de Mme Polaire. Aussi la répétition générale et la première représentation du Gymnase ont-elles marqué la véritable réouverture de la saison théâtrale. Même des toilettes s'y remarquaient, comme en plein hiver, et faisaient concurrence aux superbes costumes, que portait, sur la scène, l'élégante Mlle B'orziat ; elt si vous voulez que je vous donne des indications sur la mode, je vous dirai que les conversations de COllloirs et d'entractes indiquaient le velours mousseline et le taffetas pointillé comme l'espoir des couturiers durant les mois prochains ! Les jolies femmes qui composaient, l'anliée d'emière, le public d'es premières et qui -le composeront encore cette année et peut-êtr e l'année suivante, se retrouvaient avec joie et commençaient leurs potins. Toutes, d'ailleurs; paraissaient prendre plaisir à la ; pièce, ce qui prouve que les Parisiennes aiment autant le cirque que le théâtre, puisque deux actes sur quatre, dans le Friquet, se passent en plein cirque.
| 1,681 |
2492173_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 1,917 |
None
|
None
|
English
|
Spoken
| 3,318 | 4,241 |
Bruce, Ch. I.
This is an action to recover an inheritance tax paid "by the petitioner under protest and after the refusal of the judge of the county court of Burleigh county to allow the final report and account of the executor in the estate of Fred Strauss, deceased, and to issue a final decree of distribution without the payment of the inheritance tax which is provided for in § 8977 of the Compiled Laws of 1913, and which the county court had adjudged to be due.
The petitioner and appellant concedes the constitutionality of the Inheritance Tax Law as a whole, and all of § 8977, with the exception •of the 3d and 4th paragraphs. These paragraphs, he contends, are unconstitutional. They provide that "upon the transfer of property in any manner hereinbefore described of the value of twenty-five thousand dollars ($25,000) or less where the same shall pass to or for the use of any person who shall be the brother or sister of the father or mother -or a descendant of the brother or sister of the father or mother or the decedent the rate of taxation shall be 3 per cent; and on all sums: above twenty-five thousand dollars ($25,000) up to fifty thousand dollars ($50,000), passing to any such person the rate shall be 4J per cent, and on all sums above fifty thousand dollars ($50,000) up to one hundred thousand dollars ($100,000), 6 per cent, and on all sums above one hundred thousand dollars ($100,000) up to five hundred thousand dollars ($500,000), per cent, and-on all sums above five hundred thousand dollars ($500,000), 9 per cent.
"Upon the transfer of property in any manner hereinbefore described of the value of twenty-five thousand dollars ($25,000) Or less, where the same shall be for the use of any person in any other degree of collateral consanguinity than is hereinbefore stated, or to a stranger in blood of the decedent, or to a body politic or corporate, the rate of taxation shall be 5 per cent; and on all sums above twenty-five thousand, dollars ($25,000) up to fifty thousand dollars ($50,000) to any such person the rate shall be 6 per cent, and on all sums above fifty thousand dollars ($50,000) up to one hundred thousand dollars ($100,000) 9 per cent, and on all sums above one hundred thousand dollars-($100,000) up to five hundred thousand dollars ($500,000) 12 per cent,, and on all sums above five hundred thousand dollars ($500,000). 15 per cent."
Petitioner points out that under these paragraphs the property transferred to any nephew or niece of a decedent is subject to a tax of 5 per cent, while only 3 per cent is charged upon the property inherited, by or transmitted to a cousin, or uncle or aunt. He states that he has no quarrel with the classification of heirs as lineal and collateral, nor with a proper and reasonable classification among lineal heirs or collateral heirs. He maintains, however, that there is no reason for discrimination against nephews and nieces of the deceased as compared, with uncles and aunts, since the former are no further removed from the deceased than are the latter. He also insists that a cousin of the' deceased is further removed than a nephew or niece. The clauses of' the Constitution which he alleges are violated are the 14th Amendment to the Federal Constitution and § 69 and 10 of article 2 of the Constitution of North Dakota.
The 14th Amendment to the Federal Constitution provides that:"no state shall make or enforce any laws which shall abridge the-privileges or immunities of the citizens of the United States; nor shall any state deprive any person of life, liberty or property, without due process of law, nor deny to any person within its jurisdiction the equal protection of the laws."
Section 69 of the Constitution of North Dakota provides that "the legislative assembly shall not pass local or special laws in any of the following enumerated cases . . . 23. For the assessment or collection of taxes."
Section 70 provides*. "In all other cases where a general law can be made applicable, no special law shall be enacted."
We are sure that the 14th Amendment to the Federal Constitution is not violated by the statutes in question.
The so-called inheritance tax, indeed, is, strictly speaking, not a tax at all. It is, rather, a permission on the part of the state that the heirs and legatees may take the bequests which are made to them less certain sums which are retained by it. In other words, it is a declaration that the state, instead of claiming all of the estate of a decedent, will only retain a certain portion thereof, and will allow the legatees to receive the remainder and according to the wishes of the testator, but less certain sums which it itself reserves. It says: This property is ours, but we will allow you certain legatees to take a certain portion thereof and under certain conditions. One thing, indeed, is certain, and that is that none of the heirs or legatees have any vested interest in the property of a deceased person, and that the state can do away with the right of inheritance or bequest altogether. United States v. Perkins, 163 U. S. 625, 41 L. ed. 287, 16 Sup. Ct. Rep. 1073; Magoun v. Illinois Trust & Sav. Bank, 170 U. S. 283, 42 L. ed. 1037, 18 Sup. Ct. Rep. 594; Farmers' State Bank v. Smith, ante, 225, 162 N. W. 302; Eyre v. Jacob, 14 Gratt. 430, 73 Am. Dec. 367; State v. Hamlin, 86 Me. 495, 25 L.R.A. 632, 41 Am. St. Rep. 569, 30 Atl. 76.
If it can do this it can place any limitation which is not purely arbitrary on the right that it desires. The heirs are really donees and take by the bounty of the state. What right have any of them to complain of that which is allotted to them if only they receive the same share as others in the same class ? Has not the Lord of the vineyard the right to do with his own as he pleases and even to give to one at the eleventh hour his full penny, while denying it, or merely giving a similar amount, to one who has borne the burden and the heat of the -day? It is a matter which is purely of legislative discretion. It is not one of personal right.
We have carefully read the cases cited by counsel for appellant. New of them, however, involve inheritance taxes. The case of Magoun v. Illinois Trust & Sav. Bank, 170 U. S. 283, 42 L. ed. 1037, 18 Sup. Ct. Rep. 594, sustains such a tax, announces the doctrine that there is no vested right of inheritance, and, when it discusses classification, it does so incidently and merely in regard to the general rules pertaining do the same. It makes itself, indeed, very clear when it comes to the matter of inheritance taxes and announces the feudal rule of relation•ship, that the state can properly classify persons and estates bearing the same relationship- to one another, and that as long as those within the •class are all treated equally, they have no right of complaint because .someone outside of the class is differently treated. See Magoun v. Illinois Trust & Sav. Bank, supra. It is to be noted that in the case -at bar all nephews and nieces are treated alike, as well as all uncles and aunts and all cousins, and even if this be required, it is all that is required. The court, in the opinion in question, indeed, used the following language:
"The clause of the 14th Amendment especially invoked is that which prohibits a state denying to any citizen the equal protection of the laws. What satisfies this equality has not been and probably never can be precisely defined. It may be safely said that the rule prescribes no rigid equality, and permits to the discretion and wisdom of the state a wide latitude as far as interference by this court is concerned. -. The rule, therefore, is not a substitute for municipal law; it only prescribes that that law have the attitude of equality of operation, .and equality of operation does not mean indiscriminate operation on persons merely as such, hut on persons according to their relations. In some circumstances, it may not tax A more than B, but if A be of .a different trade or profession than B, it may. And in matters not of •taxation, if A be a different kind of corporation than B, it may subject A to a different rule of responsibility to servants than B. "The provisions of the statute in regard to the tax on legacies to •strangers to the blood of an intestate need further comment. . . . 'There are four classes created, and manifestly there is equality between the members of each class. Inequality is only found by comparing the members of one class with those of another. It is illustrated by appellant as follows: One who receives a legacy of $10,000 pays 3 per cent, or $300, thus receiving $9,100 net; while one receiving a legacy •of $10,001 pays 4 per cent on the whole amount, or $400.04, thus receiving $9,600.96, or $99.04 less than the one whose legacy was actually $1 less valuable. . If there is unsoundness it must be In the classification. The members of each class are treated alike; that is to say, all v.lio inherit $10,000 are treated alike- — all who inherit any other sum are treated alike. There is equality, therefore, within the classes. If there is inequality it must be because the members of a class are arbitrarily made such and burdened as such upon no distinctions justifying it. . . . But neither case can be said to be contrary to the rule of equality of the 14th Amendment. That rule does not require, as we have seen, exact equality of taxation. It only requires that the law imposing it shall operate on all alilce under the same circumstances. The tax is not on money; it is on the right to inherit; and hence a condition of inheritance, and it may be graded according to the value of that inheritance. The condition is not arbitrary because it is determined by that value; it is not unequal in operation because it does not levy the same percentage on every dollar, does not fail to treat 'all alike under like circumstances and conditions, both in the privilege conferred and the liabilities imposed.' "
The case of Re McKennan, 27 S. D. 147, 33 L.R.A.(N.S.) 620, 130 N. W. 33, Ann. Cas. 1913D, 745, id. 25 S. D. 369, 33 L.R.A. (N.S.) 606, 126 N. W. 611, sustains inheritance taxes generally, differentiates them from ordinary taxes, and reiterates the statement made in the case of Re Fox, 154 Mich. 5, 117 N. W. 558, that all that is practically required is equality within the classes.
In the case of Re Pell, 171 N. Y. 48, 57 L.R.A. 540, 89 Am. St. Rep. 791, 63 N. E. 789, the tax was made to- apply to remainders after they had vested, and was, therefore, not a succession or inheritance tax.
The case of State v. Hamlin, 86 Me. 495, 25 L.R.A. 632, 41 Am. St. Rep. 577, 30 Atl. 76, it is true, contains language which may tend.to support the contention of the appellant, and to the effect that "it is necessary to make such excise uniform as to the entire class of collaterals." This language, however, was not necessary to the decision, and is inconsistent with the general rules relating to inheritance taxes and inconsistent with the very opinion cited, wherein it said: "It is entirely within the province of the legislature to determine who shall and who shall not take the estate, and the proportion in which they may take, and whether severally, or as joint tenants, per capita or per stirpes. In the absence of constitutional prohibition, the legislature is supreme, and may dispose of an intestate decedent's estafe, after payment of his •debts, to any class ox classes of his kindred, to the exclusion of any class or classes."
Although the ease of Dixon v. Ricketts, 26 Utah, 215, 72 Pac. 947, cites the above opinion with a number of others, all it does is to sustain the validity of a tax on all inheritances above $10,000 in value, and contents itself with saying that an inheritance tax is not a tax upon property, but on succession; that "the right to take property by devise or descent is a creature of the law, and not a natural right — a privilege, and, therefore, the authority which confers it may impose conditions upon it."
The case of Re Wilmerding, 117 Cal. 284, 49 Pac. 181, it is true, also •cites the case of State v. Hamlin, supra, but this only on the proposition that it is within the power of the legislature to impose inheritance taxes. It, indeed, lays down two general propositions: (1) "The right •of inheritance, including the designation of heirs and the proportions which the several heirs shall receive, as well as the right of testamentary disposition, are entirely statutory and within the control of the legislature; and the same legislative authority that confers the Hght or privilege of inheritance or of testamentary disposition may attach to it the condition that a portion of the estate so received shall be contributed to the state " (2) "The provision exempting estates valued at less than $500 from the collateral inheritance tax is valid, and the constitutional provision that all property shall be taxed in proportion to its value is inapplicable to such a tax, which is in the nature of an excise tax, the right to impose which includes the right to select the subjects upon which it shall be imposed, and, there being no constitutional provision that such a tax shall be imposed upon every inheritance, the judgment of the legislature that it is in the public interest that the collateral inheritance tax shall be imposed only upon such inheritmices as exceed $500 in value is not open to review
But even if looked upon as a tax, where is there to be found any violation of any constitutional provision ?
Since the statute covers the whole state and relates to the estates of decedents, no matter where found, it cannot be called local. It is not special, since it relates to all estates and to all heirs or devisees who come within the lines of relationship designated. We do not even believe that the sections of the Constitutions which guarantee the equal protection of the laws is violated. These clauses do not prohibit classification. All of the authorities agree that it is only when legislative classification is obviously without reason and arbitrary that objection can be made. See Campbell v. California, 200 U. S. 87, 50 L. ed. 382, 26 Sup. Ct. Bep. 182. This court cannot say that the classification which is before us was entirely arbitrary. It is true that uncles and aunts are favored as against nephews and nieces, and that cousins are favored as against nephews and nieces. The legislature of a state, except where limited by the state or Federal Constitutions, possesses complete legislative sovereignty. There are no-limitations on that sovereignty expressed in the state constitutional provisions, to which we have before referred and on which appellant relies, that are not embraced or implied in the 14-th Amendment to the Federal Constitution. Re Fox, 154 Mich. 5, 117 N. W. 558. Since due process of law involves an obedience to the provisions of both the state and Federal Constitutions, the case of Campbell v. California, supra, is in point and of great persuasive authority. In it the Supreme Court of the United States says:
"The contention is that the assailed law of California was repugnant to the 14th Amendment, because it subjected to the burdens of an inheritance tax or charge, brothers and sisters of a decedent, and did not subject to any burden such strangers to the blood as the wife or widow of a son or the husband of a daughter of a decedent. We do not stop-to refer in detail to the many forms of argument by which the contention is sought to be sustained, but content ourselves with stating that,, whatever be the form in which the propositions relied on are advanced, they all reduce themselves to and must depend upon the soundness of' the contention that the 14th Amendment compels the state, in levying inheritance taxes, and, a fortiori, in regulating inheritances, to conform to blood relationship. That is to say, in their last analysis all the-arguments depend upon the proposition that the 14th Amendment has taken away from the states their power to regulate the passage of property by death, or the burdens which may be imposed resulting therefrom, because that amendment confines the states absolutely, both as to-the passage of such property and as to the burdens imposed thereon, to-the rule of blood relationship. To state the proposition is to answer it. Its unsoundness is demonstrated by previous decisions of this court. Magoun v. Illinois Trust & Sav. Bank, supra; Orient Ins. Co. v. Daggs, 172 U. S. 557, 562, 43 L. ed. 552, 554, 19 Sup. Ct. Rep. 281. It is. true that in the first of the cited cases it was expressly declared or impliedly recognized that, in the exercise by the state of its undoubted power to regulate the burdens which might be imposed on the passage-of property by death, a case might be conceived of where a burden would be so arbitrary as to amount to a denial of the equal protection of the-laws. But this; suggestion did not imply that the effect of the 14th Amendment was to control the states in the exercise of their plenary-authority to regulate inheritances, and to determine the persons or objects upon which an inheritance burden should be imposed. In this-, case there can be no doubt, if the right of a state be conceded to select the persons who may inherit or upon whom the burden resulting from an inheritance may be imposed, the complaint against the statute is. entirely without merit. The whole case, therefore, must rest upon the-assumption that because the state of California has not followed the rule-of blood relationship, but as to particular classes has applied the-rule of affinity by marriage, therefore the constitutional provision guarantying the equal protection of the laws, was violated. But, unless the-effect.of the 14th Amendment was inexorable to limit the states in enacting inheritance laws to the rule of blood relationship, such a regulation •plainly involved the exercise of legislative discretion and judgment, with which the 14th Amendment did not interfere. Such a regulation cannot in reason be said to be in exercise of merely arbitrary power. To illustrate: It assuredly would not be an arbitrary exercise of power for a state to put in one class, for the purpose of inheritance or the burdening of the privilege to inherit, all blood relatives to a designated degree, excluding brothers and sisters, and to place all other and more remote blood relatives, including brothers and sisters, in a second class along with strangers to the blood. This being true, it cannot, without causing the equality clause of the 14th Amendment to destroy the powers of the states on a subject of a purely local character, be held that a classification which takes near relatives by marriage and places them in a class with lineal relatives is so arbitrary as to transcend the limits of governmental power. Bikdzell, J., being disqualified, did not sit..
| 5,114 |
https://ru.wikipedia.org/wiki/%D0%91%D0%BE%D0%BB%D1%8C%D1%88%D0%BE%D0%B9%20%D0%9A%D0%B0%D0%BB%D1%83
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Большой Калу
|
https://ru.wikipedia.org/w/index.php?title=Большой Калу&action=history
|
Russian
|
Spoken
| 156 | 502 |
Большой Калу () — горный хребет Башкирского (Южного) Урала на востоке и юго-востоке Республики Башкортостан в Ишимбайском и Белорецком районах.
География
Хребет вытянут по меридиану между рек Малый и Большой Шишеняка (притоки р. Зилим).
Хребет состоит из 3 частей:
Южная пониженная часть пересечёна ложбинами постоянных и временных водотоков. Здесь расположена столообразная вершина высотой 791 м.
Центральная часть высокая с крутыми склонами и вершинами с тремя пикообразными выступами высотой 779 м, 821 м и 816 м.
Северная часть платообразная, с вершиной высотой 812 м.
Общая длина хребта — 30 км, ширина — 4 км, высота — 821 м.
С западных склонов стекают 15 рек — притоков р. Большой Шишеняк.
Ландшафты формируют леса из липы, дуба, ильма и клёна, на крутых склонах хребта — сосна.
Состав
Хребет сложен из песчаников, алевролитов и сланцев зильмердакской свиты верхнего рифея.
Ссылки
Южный урал
Урал. Иллюстрированная краеведческая энциклопедия
Горные хребты Урала
Горные хребты Ишимбайского района
Горные хребты Белорецкого района
Горные хребты Башкортостана
| 40,434 |
https://github.com/Pragmatique/vuefiproj/blob/master/frontend/src/components/dictionary/PaymentType.vue
|
Github Open Source
|
Open Source
|
MIT
| 2,019 |
vuefiproj
|
Pragmatique
|
Vue
|
Code
| 254 | 1,233 |
<template>
<div>
<v-snackbar
v-model="showResult"
:color= "snackbarColor"
:timeout="2000"
top>
{{ result }}
</v-snackbar>
<v-container fluid>
<v-card>
<v-container fluid>
<v-layout row align-center>
<v-flex shrink xs4 offset-xs4>
<v-dialog v-model="dialog" persistent max-width="600px">
<template slot="activator">
<v-btn color="blue" >Добавить тип оплаты</v-btn>
</template>
<v-card>
<v-card-title>
<span class="headline">Тип оплаты</span>
</v-card-title>
<v-card-text>
<v-container grid-list-md>
<v-layout wrap>
<v-flex xs12 sm12 md12>
<v-text-field label="Введите новый тип оплаты" required v-model='new_payment_type'></v-text-field>
</v-flex>
</v-layout>
</v-container>
</v-card-text>
<v-card-actions>
<v-spacer></v-spacer>
<v-btn color="blue darken-1" flat @click.native="dialog = false">Закрыть</v-btn>
<v-btn color="blue darken-1" flat @click.native="dialog = false" @click="addItem(new_payment_type)">Создать</v-btn>
</v-card-actions>
</v-card>
</v-dialog>
</v-flex>
</v-layout>
</v-container>
</v-card>
</v-container>
<v-divider></v-divider>
<v-divider></v-divider>
<v-card v-for="(paymenttype, index) in paymenttypes" :key="index" class="mb-3">
<v-container fluid>
<v-layout row justify-space-between>
<v-flex shrink xs10>
<v-card-title class="title">
{{ paymenttype.payment_type }}
</v-card-title>
</v-flex>
<v-flex shrink xs2>
<v-dialog v-model="dialogConfirm" persistent max-width="500px">
<template slot="activator">
<v-btn color="red" >Удалить</v-btn>
</template>
<v-card>
<v-card-title>
<span class="headline">Вы уверены, что хотите удалить тип оплаты?</span>
</v-card-title>
<v-card-actions>
<v-spacer></v-spacer>
<v-btn color="red darken-1" flat @click.native="dialogConfirm = false">Нет</v-btn>
<v-btn color="blue darken-1" flat @click.native="dialogConfirm = false" @click="removeItem(paymenttype.id)">Да</v-btn>
</v-card-actions>
</v-card>
</v-dialog>
</v-flex>
</v-layout>
</v-container>
</v-card>
</div>
</template>
<script>
import { mapGetters } from 'vuex';
export default {
data() {
return {
snackbarColor: 'error',
dialog: false,
dialogConfirm: false,
on: true,
new_payment_type: '',
error: false,
showResult: false,
result: '',
}
},
computed: {
...mapGetters('dictionary', ['paymenttypes'])
},
methods: {
async removeItem (id) {
await this.$store.dispatch('dictionary/deletePaymentType',
id,
{root:true}
);
},
async addItem (new_payment_type) {
if (this.new_payment_type === '') {
this.error = true;
this.result = "Тип оплаты не может быть пустым";
this.showResult = true;
return;
} else {
await this.$store.dispatch('dictionary/createPaymentType',
{payment_type: this.new_payment_type},
{root:true}
);
this.new_payment_type='';
}
}
},
beforeMount () {
this.$store.dispatch('dictionary/getPaymentTypes',null,{root:true})
}
}
</script>
| 33,514 |
https://github.com/ricardo17coelho/order-management/blob/master/code/order-management/View/FormCustomers.cs
|
Github Open Source
|
Open Source
|
MIT
| null |
order-management
|
ricardo17coelho
|
C#
|
Code
| 340 | 1,246 |
using order_management.Services;
using System;
using System.Collections.Generic;
using System.ComponentModel;
using System.Data;
using System.Drawing;
using System.Text;
using System.Windows.Forms;
namespace order_management.View
{
public partial class FormCustomers : Form
{
private readonly ICustomerService _customerService;
private protected ViewCustomers _viewCustomers;
private protected Customer _customerToEdit;
public FormCustomers(ICustomerService customerService)
{
InitializeComponent();
_customerService = customerService;
}
public void SetCustomerView(ViewCustomers customersView)
{
_viewCustomers = customersView;
}
public void SetCustomerToEdit(Customer customerToEdit)
{
_customerToEdit = customerToEdit;
LoadCustomerToEditIntoFields();
}
private void CmdSave_Click(object sender, EventArgs e)
{
string customerNr = TxtCustomerNr.Text;
string firstName = TxtFirstName.Text;
string lastName = TxtLastName.Text;
string email = TxtEmail.Text;
string website = TxtWebsite.Text;
string password = TxtPassword.Text;
string street = TxtStreet.Text;
string streetNr = TxtStreetNr.Text;
int zip = Convert.ToInt32(NumZip.Value);
string city = TxtCity.Text;
string country = TxtCountry.Text;
if(_customerToEdit == null)
{
AddNewCustomer(new Customer(customerNr, firstName, lastName, email, website, password, street, streetNr, zip, city, country));
}
else
{
_customerToEdit.CustomerNr = customerNr;
_customerToEdit.FirstName = firstName;
_customerToEdit.LastName = lastName;
_customerToEdit.Email = email;
_customerToEdit.Website = website;
_customerToEdit.Password = password;
_customerToEdit.Street = street;
_customerToEdit.StreetNr = streetNr;
_customerToEdit.Zip = zip;
_customerToEdit.City = city;
_customerToEdit.Country = country;
UpdateCustomer();
}
}
private void CmdCancel_Click(object sender, EventArgs e)
{
this.Close();
}
private void LoadCustomerToEditIntoFields()
{
TxtCustomerNr.Text = _customerToEdit.CustomerNr;
TxtFirstName.Text = _customerToEdit.FirstName;
TxtLastName.Text = _customerToEdit.LastName;
TxtEmail.Text = _customerToEdit.Email;
TxtWebsite.Text = _customerToEdit.Website;
TxtPassword.Text = _customerToEdit.Password;
TxtStreet.Text = _customerToEdit.Street;
TxtStreetNr.Text = _customerToEdit.StreetNr;
NumZip.Value = _customerToEdit.Zip;
TxtCity.Text = _customerToEdit.City;
TxtCountry.Text = _customerToEdit.Country;
}
private void AddNewCustomer(Customer customer)
{
if (IsValid(customer) && IsUnique(customer))
{
_customerService.Add(customer);
_viewCustomers.ReloadData();
this.Close();
}
}
private void UpdateCustomer()
{
if (IsValid(_customerToEdit))
{
_customerService.Update(_customerToEdit);
_viewCustomers.ReloadData();
this.Close();
}
}
private Boolean IsUnique(Customer customer)
{
if (!_customerService.IsUnique(customer))
{
MessageBox.Show("Customer " + customer.FirstName + " " + customer.LastName + " already exists!");
return false;
}
return true;
}
private Boolean IsValid(Customer customer)
{
if (!_customerService.RequiredFieldsAreNotBlank(customer))
{
MessageBox.Show("CustomerNr, FirstName, LastName, Email, Website and Password is required!");
return false;
}
if (!_customerService.IsValidEmailAddress(customer.Email))
{
MessageBox.Show("Email Address is not valid!");
return false;
}
if (!_customerService.IsValidCustomerNr(customer.CustomerNr))
{
MessageBox.Show("Customer Nr is not valid!");
return false;
}
if (!_customerService.IsValidWebsite(customer.Website))
{
MessageBox.Show("Website is not valid!");
return false;
}
if (!_customerService.IsValidPassword(customer.Password))
{
MessageBox.Show("Password is not valid!");
return false;
}
return true;
}
}
}
| 34,708 |
https://github.com/dan-harris/presentation-micro-page/blob/master/presentation/templates/profile-links-slide-content.js
|
Github Open Source
|
Open Source
|
MIT
| 2,019 |
presentation-micro-page
|
dan-harris
|
JavaScript
|
Code
| 97 | 297 |
import React from 'react';
import { Heading, Image, Layout, Text } from 'spectacle';
import { SubHeading } from '../components/sub-heading';
import { images } from '../images';
const CenteredImage = props => (
<Layout style={{ justifyContent: 'center', flexDirection: 'column' }}>
<Image style={{ margin: '0 auto 1.3rem' }} {...props} />
<Text>{props.children}</Text>
</Layout>
);
export const ProfileLinksSlideContent = () => (
<>
<Layout style={{ justifyContent: 'center', flexDirection: 'column', marginBottom: '4rem' }}>
<Heading size={2}>deets are on</Heading>
<SubHeading size={3}>danharris.io</SubHeading>
</Layout>
<Layout style={{ justifyContent: 'space-evenly', padding: '0 14rem' }}>
<CenteredImage src={images.logoTwitter} height={65} />
<CenteredImage src={images.logoMedium} height={65} />
<CenteredImage src={images.logoGithub} height={65} />
</Layout>
</>
);
| 7,176 |
W2800972233.txt_1
|
Open-Science-Pile
|
Open Science
|
Various open science
| 2,018 |
PhytoMolecularTasteDB: An integrative database on the “molecular taste” of Indian medicinal plants
|
None
|
Unknown
|
Unknown
| 1,943 | 4,495 |
Data in Brief 19 (2018) 1237–1241
Contents lists available at ScienceDirect
Data in Brief
journal homepage: www.elsevier.com/locate/dib
Data Article
PhytoMolecularTasteDB: An integrative database
on the “molecular taste” of Indian
medicinal plants
Dorin Dragos a,b,n, Marilena Gilca c
a
Medical Semiology Dept., Faculty of General Medicine, Carol Davila University of Medicine and Pharmacy,
B-dul Eroilor Sanitari nr. 8, 050471 Bucharest, Romania
b
Nephrology Clinic, University Emergency Hospital Bucharest, Bucharest, Romania
c
Biochemistry Dept., Faculty of General Medicine, Carol Davila University of Medicine and Pharmacy, B-dul
Eroilor Sanitari nr. 8, 050471 Bucharest, Romania
a r t i c l e i n f o
abstract
Article history:
Received 29 March 2018
Accepted 13 April 2018
Available online 21 April 2018
PhytoMolecularTaste database (PhytoMolecularTasteDB) described
in the present work is related to the article “Main phytocompunds'
tastes: a better predictor for the ethnopharmacological activities of
medicinal plant than the phytochemical class?” (Dragos and Gilca,
2018) [1]. It includes a comprehensive list of plant derived tastants,
as well as details on the “phyto-molecular taste” (PMT) (the
combination of tastes resulted from the main tastants found in a
medicinal plant). To collect the data, we searched publications in
various databases and journals by using relevant keywords.
Wherever necessary, manual search of lacking information was
also performed in several books. We then extracted the reported
phytoconstituents and PMT of all the ayurvedic medicinal plants
included in DB. Data were compiled in Excel. In total, PhytoMolecularTasteDB includes 431 ayurvedic medicinal plants, 94 EPAs,
223 phytochemical classes, and 438 plant-derived tastants.
& 2018 The Authors. Published by Elsevier Inc. This is an open
access article under the CC BY license
(http://creativecommons.org/licenses/by/4.0/).
DOI of original article: https://doi.org/10.1016/j.jep.2018.03.034
Corresponding author at: Medical Semiology Dept., Faculty of General Medicine, Carol Davila University of Medicine and
Pharmacy, B-dul Eroilor Sanitari nr. 8, 050471 Bucharest, Romania.
E-mail addresses: [email protected] (D. Dragos), [email protected] (M. Gilca).
n
https://doi.org/10.1016/j.dib.2018.04.048
2352-3409/& 2018 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license
(http://creativecommons.org/licenses/by/4.0/).
1238
D. Dragos, M. Gilca / Data in Brief 19 (2018) 1237–1241
Specifications table
Subject area
More specific subject area
Type of data
How data was acquired
Data format
Experimental factors
Experimental features
Data source location
Data accessibility
Biology
Ethnopharmacology
Table, text file, figure, Excel database
Literature search of published data
Coded, filtered, analyzed
Data on the plant derived tastants found in Indian medicinal plants
Publications with data searched using keywords in databases. Keywords: English and Latin names of medicinal plants, “composition”,
“phytochemical”, “phytocompound” “chemical compounds”,
“ingredients” name of phytochemicals, “taste”,” bitter/bitterness/
tikta”,” sweet/sweetness/madhura”,” sour/sourness/amla”, “astringent/
astringency/kashaya”,” pungent/pungency/katu”, “salty/saltyness/
lavana”,” sensory”,” organoleptic”, “tastant”, name of taste receptors
(e.g. TAS2R) or orosensation transducers (e.g. TRP- transient receptor
potential channels)
Elsevier ScienceDirect, PubMed, Google Academic, Google Books, BitterDB, SweetenersDB, SuperSweet, HMDB, FoodDB
Data is within this article
Value of the data
First database on plant-derived tastants and “molecular taste” of ayurvedic medicinal plants
Data scattered in various publications, databases, gathered in one place.
PhytoMolecularTasteDB will facilitate future research on the patterns that shape the traditional
medical knowledge.
PhytoMolecularTasteDB can be used in cross-cultural comparative studies on medicinal plants and
phyto-molecular taste.
PhytoMolecularTasteDB can inform pharmacologists about new therapeutic agents from ethnomedicine and potential biological activities of plant-derived tastants.
1. Data
PhytoMolecularTasteDB presents an inventory of plant-derived tastants and “phyto-molecular
taste” (PMT) of ayurvedic medicinal plants. In total, PhytoMolecularTaste DB includes 431 ayurvedic
medicinal plants with their Sanskrit and Latin name, 94 EPAs, 223 phytochemical classes, and 438
plant-derived tastants. Data are analysed in a related article [1].
2. Experimental design, materials and methods
We have build, for the first time to our knowledge, a mixed database (PhytoMolecularTasteDB) on
ayurvedic medicinal plants, by integrating modern data (medicinal plant composition, phytochemical
taste) with traditional data (ethnopharmacological activities of plant). We elaborated PhytoMolecularTasteDB in three steps.
D. Dragos, M. Gilca / Data in Brief 19 (2018) 1237–1241
1239
2.1. First step (ethnopharmacological data)
We have included in our analysis all the plants (in total 454 plants) described (in dedicated
monographs) in one recognized text of ayurvedic medicine (Pandey's “Dravyaguna vijnana”) [2], for
which a clear description of the EPAs (traditionally called karman) was available.
Here is the distribution among the various botanical families of medicinal plants included in our
database (the number of plants in each family is indicated in the paranthesis):
Acanthaceae (5), Agaricaceae (1), Alangiaceae (1), Amaranthaceae (5), Amaryllidaceae (2), Anacardiaceae (8), Annonaceae (2), Apiaceae (12), Apocynaceae (8), Araceae (5), Arecaceae (6), Aristolochiaceae
(2), Asclepiadaceae (6), Asparagaceae (2), Asphodelaceae (1), Asteraceae (19), Basellaceae (1), Berberidaceae (1), Betulaceae (1), Bignoniaceae (3), Bixaceae (1), Boraginaceae (4), Brassicaceae (7), Bromeliaceae (1), Burseraceae (3), Caesalpiniaceae (2), Calophyllaceae (3), Cannabinaceae (1), Capparaceae (2),
Capparidaceae (2), Caricaceae (1), Celastraceae (2), Ceratophyllaceae (1), Cleomaceae (1), Clusiaceae (2),
Colchicaceae (1), Combretaceae (5), Convolvulaceae (5), Crassulaceae (1), Cucurbitaceae (16), Cupressaceae (1), Cyperaceae (2), Dilleniaceae (1), Dioscoreaceae (1), Dipterocarpaceae (3), Ebenaceae (1),
Elaeocarpaceae (1), Ephedraceae (1), Euphorbiaceae (7), Fabaceae (49), Fagaceae (1), Flacourtiaceae (1),
Gentianaceae (3), Iridaceae (2), Juglandaceae (1), Lamiaceae (8), Lauraceae (3), Lecythidaceae (2),
Liliaceae (5), Linaceae (1), Loganiaceae (1), Loranthaceae (1), Lythraceae (2), Magnoliaceae (1), Malvaceae (18), Marsileaceae (1), Meliaceae (4), Menispermaceae (5), Moraceae (10), Moringaceae (1),
Musaceae (1), Myricaceae (1), Myristicaceae (1), Myrsinaceae (1), Myrtaceae (3), Nyctaginaceae (2),
Nymphaeaceae (2), Oleaceae (5), Orchidaceae (1), Oxalidaceae (2), Paeoniaceae (1), Pandanaceae (1),
Papaveraceae (3), Parmeliaceae (1), Pedaliaceae (1), Pinaceae (3), Piperaceae (5), Plantaginaceae (1),
Plumbaginaceae (1), Poaceae (14), Polygonaceae (1), Portulacaceae (1), Pteridaceae (2), Punicaceae (1),
Putranjivaceae (1), Ranunculaceae (7), Rhamnaceae (2), Rosaceae (6), Rubiaceae (7), Rutaceae (7), Salicaceae (4), Santalaceae (1), Sapindaceae (3), Sapotaceae (3), Saxifragaceae (1), Scrophulariaceae (3),
Simarubaceae (2), Smilacaceae (1), Solanaceae (9), Sterculiaceae (2), Styracaceae (1), Symplocaceae (1),
Trapaceae (1), Ulmaceae (1), Valerianaceae (2), Verbenaceae (7), Violaceae (1), Vitaceae (2), Zingiberaceae (10), Zygophyllace (2).
2.2. Second step (chemical composition data)
We collected the information about the main chemical constituents of the plants from several
acknowledged books on ayurvedic/Indian medicinal plants [2–6] and by performing a systematic
search in PubMed (1077 references, see Appendix B) using as keywords the English or Latin name of
the medicinal plants and “composition”, “phytochemical”, “phytocompound” “chemical compounds”,
“ingredients”. For a given plant, we considered as major the following constituents:
1) phytocompounds mentioned in Ayurveda/Indian Materia Medica or Pharmacopoeia to the herbal
chemical composition;
2) phytocompounds to which one of the following terms “main”, “principal”, “major” were attributed,
as revealed by the 1077 scientific references (see Appendix B);
3) phytocompounds to which one of the scientifically recognized pharmacodynamic actions of that
plant is currently attributed, as revealed by the 1077 scientific references (see Appendix B).
In order to increase the reliability of information included in our database, we introduced the
double checking criterion: only the phytochemicals with at least two references have been included.
These sources provided useful information for most, but not all the ayurvedic herbs in Pandey's
“Dravyaguna vijnana” [2], therefore from the initial 454 plants we were left with 431 plants for which
a clear description of both the spectrum of EPAs and of the chemical composition was available.
2.3. Third step (plant-derived tastants data)
For only 394 plants were we able to define a taste based on the chemical constituents (see
Appendix A, Table A.6 for a list of plant-derived tastants, and Table A.7 for a list of medicinal plants
1240
D. Dragos, M. Gilca / Data in Brief 19 (2018) 1237–1241
Fig. 1. PhytoMolecularTasteDB building steps.
included in the study, or PhytoMolecularTasteDB Excel). The main resources used to identify the
tastes (sanskr. rasa) of various phytochemicals were: 1) BitterDB, a database on bitter compounds [7];
2) SweetenersDB and SuperSweet databases on sweet compounds [8,9]; 3) HMDB: the Human
Metabolome Database [10]; 4) FooDB, the world's largest electronic resource on food constituents,
chemistry and biology (http://foodb.ca/) [11]; 3) PubChem [12]; 4) PubMed database; 5) Elsevier
ScienceDirect database. Eventually, we performed a systematic search on the potential taste of all the
phytoconstituents listed during the second step, using Google Academic and Google Books as search
engine. The keywords used for our search were: English and Latin names of medicinal plants, name of
phytochemicals, taste, English and Sanskrit names of tastes, orosensations or rasas (bitter/bitterness
or tikta, sweet/sweetness or madhura, sour/sourness or amla, astringent/astringency or kashaya,
pungent/pungency/tingling/burning/cooling or katu, salty/saltyness or lavana, sensory, organoleptic,
tastant, name of taste receptors (e.g. TAS2R) or orosensation transducers (e.g. TRP- transient receptor
potential channels). Phytochemicals were included in the PhytoMolecularTasteDB only if they were
reported as having a certain taste or if they displayed experimentally activatory potential on at least
one taste receptor or orosensation transducer. Supplementary information was also obtained by
manual search in various books (e.g. “Bitterness in Foods and Beverages”, edited by RL Rouseff) [13].
In order to increase the reliability of information included in our phyto-tastants database, we used
again the double checking criterion: we aimed, as much as the available scientific data allowed this, to
have at least two supportive references for each plant-derived tastant. More than 70% of the phytoconstituent tastants found in PhytoMolecularTasteDB fulfilled this criterion, so that the average
number of references per tastant was higher than 2 (Fig. 1).
Acknowledgements
This research received no specific grant from any funding agency in the public, commercial or
not-for-profit sectors.
D. Dragos, M. Gilca / Data in Brief 19 (2018) 1237–1241
1241
Transparency document. Supporting information
Transparency data associated with this article can be found in the online version at https://doi.org/
10.1016/j.dib.2018.04.048.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the online version at https://doi.
org/10.1016/j.dib.2018.04.048.
References
[1] D. Dragos, M. Gilca, Main phytocompunds' tastes: a better predictor for the ethnopharmacological activities of medicinal
plants than the phytochemical class? J. Ethnopharmacol. 220 (2018) 129–146. http://dx.doi.org/10.1016/j.jep.2018.03.034.
[2] G. Pandey, Dravyaguna vijnana, Third. ed., Chowkhamba Krishnadas Academy, Varanasi, 2005.
[3] C.P. Khare, Indian Medicinal Plants: An Illustrated Dictionary, Springer, 2007.
[4] Anonimous, The Ayurvedic Pharmacopoeia of India, Government of India Ministry of Health and Family Welfare
Department of Ayush, 2011.
[5] C.P. Khare, Indian Herbal Remedies: rational Western Therapy, Ayurvedic and Other Traditional Usage, Botany, Springer,
Berlin, Heidelberg (2004) http://dx.doi.org/10.1007/978-3-642-18659-2_1.
[6] V.M. Gogte, Ayurvedic Pharmacology and Therapeutic uses of Medicinal Plants, Bhavan's Book University, Bharatiya Vidya
Bhavan's SPARC, Mumbai, India, 2000.
[7] A. Wiener, M. Shudler, A. Levit, M.Y. Niv, BitterDB: a database of bitter compounds, Nucleic Acids Res. 40 (2012)
D413–D419. http://dx.doi.org/10.1093/nar/gkr755.
[8] J.B. Cheron, I. Casciuc, J. Golebiowski, S. Antonczak, S. Fiorucci, Sweetness prediction of natural compounds, Food Chem.
221 (2017) 1421–1425. http://dx.doi.org/10.1016/j.foodchem.2016.10.145.
[9] J. Ahmed, S. Preissner, M. Dunkel, C.L. Worth, A. Eckert, R. Preissner, SuperSweet—a resource on natural and artificial
sweetening agents, Nucleic Acids Res. 39 (2011) D377–D382. http://dx.doi.org/10.1093/nar/gkq917.
[10] D.S. Wishart, C. Knox, A.C. Guo, R. Eisner, N. Young, B. Gautam, D.D. Hau, N. Psychogios, E. Dong, S. Bouatra, R. Mandal,
I. Sinelnikov, J. Xia, L. Jia, J.A. Cruz, E. Lim, C.A. Sobsey, S. Shrivastava, P. Huang, P. Liu, L. Fang, J. Peng, R. Fradette, D. Cheng,
D. Tzur, M. Clements, A. Lewis, A. De Souza, A. Zuniga, M. Dawe, Y. Xiong, D. Clive, R. Greiner, A. Nazyrova,
R. Shaykhutdinov, L. Li, H.J. Vogel, I. Forsythe, HMDB: a knowledgebase for the human metabolome, Nucleic Acids Res. 37
(2009) D603–D610. http://dx.doi.org/10.1093/nar/gkn810.
[11] FooDB, (n.d.). 〈http://foodb.ca/〉.
[12] S. Kim, P.A. Thiessen, E.E. Bolton, J. Chen, G. Fu, A. Gindulyte, L. Han, J. He, S. He, B.A. Shoemaker, J. Wang, B. Yu, J. Zhang, S.
H. Bryant, PubChem substance and compound databases, Nucleic Acids Res. 44 (2016) D1202–D1213. http://dx.doi.org/
10.1093/nar/gkv951.
[13] R.L. Rouseff, Bitternes in food products: an overview, in: R.L. Rouseff (Ed.), Bitternes Foods Beverages. Dev. Food Sci, 25,
Elsevier Science Publishers B.V, Amsterdam, 1990, pp. 1–14.
| 23,843 |
https://www.wikidata.org/wiki/Q97402745
|
Wikidata
|
Semantic data
|
CC0
| null |
Kategorie:Person (Sudan) nach Tätigkeit
|
None
|
Multilingual
|
Semantic data
| 32 | 121 |
Kategorie:Person (Sudan) nach Tätigkeit
Wikimedia-Kategorie
Kategorie:Person (Sudan) nach Tätigkeit ist ein(e) Wikimedia-Kategorie
Kategorie:Person (Sudan) nach Tätigkeit Kategorie enthält Mensch
Ангилал:Суданы хүн ажил үйлээр
категорияд Ангилал
Ангилал:Суданы хүн ажил үйлээр жишээ Викимедиа ангилал
| 45,763 |
US-63648006-A_2
|
USPTO
|
Open Government
|
Public Domain
| 2,006 |
None
|
None
|
English
|
Spoken
| 3,710 | 5,501 |
Examples of ethers having 3 to 12 carbon atoms include: diisopropylether, dimethoxymethane, dimethoxy ethane, 1,4-dioxane, 1,3-dioxolane,tetrahydrofuran, anisole and phenetole. Examples of ketones having 3 to12 carbon atoms include: acetone, methyl ethyl ketone, diethyl ketone,diisobutyl ketone, cyclohexanone and methylcyclohexanone. Examples ofesters having 3 to 12 carbon atoms include: ethyl formate, propylformate, pentyl formate, methyl acetate, ethyl acetate and pentylacetate. Examples of organic solvents having two or more kinds offunctional groups include: 2-ethoxyethyl acetate, 2-methoxyethanol and2-butoxyethanol. Preferably the number of carbon atoms of thehydrocarbon halides is 1 or 2 and most preferably 1. The halogen of thehydrocarbon halides is preferably chlorine. The percentage of thehydrogen atoms of the hydrocarbon halides replaced with halogen ispreferably 25 to 75% by mole, more preferably 30 to 70% by mole, muchmore preferably 35 to 65% by mole, and most preferably 40 to 60% bymole. Methylene chloride is a typical hydrocarbon halide. Two or morekinds of organic solvents may be used in the form of a mixture.
The polymer solution can be prepared by a commonly used process. Thecommonly used process means treating at 0° C. or higher (at ordinarytemperature or a high temperature). The solution can be prepared usingthe process and apparatus for preparing a dope in a commonly usedsolvent cast method. When employing a commonly used process, it ispreferable to use a hydrocarbon halide (particularly methylene chloride)as an organic solvent. The amount of the polymer used is adjusted sothat the polymer content in the resultant solution is 10 to 40% by mass.The amount of the polymer in the resultant solution is preferably 10 to30% by mass. To the organic solvent (prime solvent), any of theadditives described later may be added in advance. The solution can beprepared by stirring the polymer and the organic solvent at ordinarytemperature (0 to 40° C.). In a highly concentrated solution, stirringmay be performed under pressure and heating. Specifically, the polymerand the organic solvent are put into a pressure container, and themixture is stirred, with the container made airtight, under pressure andheating at temperatures of the boiling point of the solvent at ordinarytemperature or higher and of not allowing the boiling of the solvent.The heating temperature is usually 40° C. or higher, preferably 60 to200° C., and more preferably 80 to 110° C.
The ingredients may be roughly mixed before they are introduced into acontainer. Or they are introduced into a container one by one. Thecontainer used need to be so constructed as to allow stirring in it. Thecontainer can be brought to the pressurized state by introducing aninert gas such as nitrogen into it. The increase in the vapor pressureof the solvent by heating can also be utilized. Or the ingredients maybe added under pressure after making the container airtight. Whenheating the ingredients, it is preferable to heat them from the outsideof the container. For example, a heater having a jacket structure may beused to heat them from outside. Or a method can also be employed inwhich the entire container is heated by providing a plate heater andpiping on the outside of the container and circulating a fluid throughthe piping. It is also preferable to provide a stirring blade inside thecontainer and perform stirring using the blade. Preferably the stirringblade is so long that it can almost reach the inside wall of thecontainer. Preferably a scraper blade is provided at the end of thestirring blade to replace the fluid film on the wall of the container.The container may be equipped with instruments such as pressure gaugeand thermometer. In the container, the ingredients are dissolved in thesolvent. The resultant dope is cooled and then taken out from thecontainer, or it is taken out from the container and then cooled using aheat exchanger or the like.
The solution can also be prepared by cooling-dissolving process. By thecooling-dissolving process, polymer can be dissolved in an organicsolvent in which polymer is hard to dissolve by any one of commonly useddissolving processes. Even when a solvent is used in which polymer canbe dissolved by a commonly used process, if the cooling-dissolvingprocess is employed, a homogeneous solution can be obtained rapidly. Inthe cooling-dissolving process, first, polymer is added to the organicsolvent little by little at room temperature under stirring. Preferablythe amount of the polymer used is adjusted so that the polymer contentin the mixture is 10 to 40% by mass and more preferably 10 to 30% bymass. To the mixture, any of the additives described later may be addedin advance.
Then, the mixture is cooled to −100° C. to −10° C., preferably −80° C.to −10° C., more preferably −50° C. to −20° C., and most preferably −50°C. to −30° C. Cooling can be performed in, for example, a dryice/methanol bath (−75° C.) or cold diethylene glycol solution (−30 to−20° C.). Such a cooling operation allows the mixture of the polymer andorganic solvent to be solidified. The cooling rate is preferably 4°C./min or higher, more preferably 8° C./min or higher, and mostpreferably 12° C./min or higher. The term “cooling rate” herein usedmeans the value obtained by dividing the difference between thetemperature at the time of starting cooling and the temperature at thetime of completing cooling by the time from starting cooling tocompleting cooling.
Then, the above cooled mixture is heated to 0 to 200° C., preferably 0to 150° C., more preferably 0 to 120° C., and most preferably 0 to 50°C. to dissolve the polymer in the organic solvent. Heating may beperformed simply by leaving the mixture stand at room temperature or ina warn bath. The heating rate is preferably 4° C./min or higher, morepreferably 8° C./min or higher, and most preferably 12° C./min orhigher. The term “heating rate” herein used means the value obtained bydividing the difference between the temperature at the time of startingheating and the temperature at the time of completing heating by thetime from starting heating to completing heating. The above operationsallow a homogeneous solution to be produced. When the polymer is notfully dissolved in the solvent, such cooling and heating operations maybe repeated. Whether the polymer is fully dissolved in the solvent ornot can be judged simply by visually observing the appearance of thesolution.
In the cooling-dissolving process, to avoid the inclusion of moisturedue to the moisture condensation at the time of cooling, desirably aclosed top container is used. In the cooling and heating operations, ifpressure is applied during cooling and pressure is reduced duringheating, the time required for dissolving the polymer can be decreased.To perform pressurization and depressurization, desirably a pressureresistant container is used. Measurement by differential scanningcalorimetry (DSC) has revealed that in a 20% by mass solution ofcellulose acetate (acetylation degree: 60.9%, average viscometric degreeof polymerization: 299) in methyl acetate prepared by thecooling-dissolving process, there exists a pseudo sol-gel phasetransition point at around 33° C. And at temperatures lower than thetemperature, the solution is in the homogeneous gel state. Thus, thesolution needs to be kept at temperatures equal to or higher than thepseudo phase transition point and preferably of about gel phasetransition temperature plus about 10° C. It is to be understood that thepseudo phase transition point varies depending on the acetylationdegree, average viscometric degree of polymerization or concentration ofthe cellulose acetate, or the organic solvent used.
A polymer film is formed using the prepared polymer solution (dope) by asolvent cast method. A film is formed by casting the dope over a drum orband and vaporizing the solvent. Preferably, the concentration of thedope before casting is adjusted so that its solid content is 18 to 35%.Also preferably, the surface of the drum or band is planished mirrorfinished surface in advance. Preferably the dope is cast over a drum orband whose surface temperature is kept at 10° C. or lower. Preferablyair is blown on the dope after casting for 2 seconds or longer to drythe dope. The residual solvent can be vaporized by stripping theresultant film off from the drum or band and drying the same with hotair while varying the temperature of the hot air from 100 to 160° C.This operation allows the time from casting to stripping to beshortened. To perform this method, the dope must be gelled at thetemperature of the drum or band surface at the time of casting.
To improve the mechanical properties or enhance the drying speed, to theweb W, a plasticizer can be added. As such a plasticizer, a phosphateester or carboxylate ester is used.
As such a plasticizer, a phosphate ester or carboxylate ester is used.The amount of the plasticizer added is preferably 0.1 to 25% by mass ofthe amount of cellulose ester, more preferably 1 to 20% by mass, andmost preferably 3 to 15% by mass.
Further, to the web W in accordance with this embodiment, variousadditives (e.g. ultraviolet screening agents, fine particles, releasingagents, antistatics, deterioration inhibitor (e.g. antioxidants,peroxide decomposition agents, radical inhibitors, metal inactivatingagents, acid scavengers or amines ), or infrared absorbers) may be addeddepending on its application. The additives may be in the solid state oroily matter state. When the web W is multilayered, the layers maycontain different kinds of or different amounts of additives. The amountof the additive used is not limited as long as they perform theirfunction; however, it is preferably in the range of 0.001 to 20% by massof the total composition of the web W.
The web W can be subjected to stretching treatment so that itsretardation is adjusted. The percentage of stretching is preferably 3 to100%. The thickness of the polymer film is preferably 30 to 200 μm andmore preferably 40 to 120 μm.
[Alkaline Solution]
The alkaline solution used in this embodiment can be prepared bydissolving an alkali in water or in a mixed solution of an organicsolvent and water. Preferably the organic solvent is an organic solventor two or more kinds of organic solvents selected from the groupconsisting of: alcohols having 8 or less carbon atoms; ketones having 6or less carbon atoms; esters having 6 or less carbon atoms; andpolyvalent alcohols having 6 or less carbon atoms.
Examples of the organic solvents include: monovalent alcohols (e.g.methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol,2-butanol, cyclohexanol, benzyl alcohol, fluorinated alcohol); ketones(e.g. acetone, methyl ethyl ketone, methyl isobutyl ketone); esters(e.g. methyl acetate, ethyl acetate, butyl acetate); polyvalent alcohols(e.g. ethylene glycol, diethylene glycol, propylene glycol, glycerin);amides (e.g. N,N-dimethylformamide, dimethylformamide); sulfoxides (e.g.dimethylsulfoxide); and ethers (e.g. methyl cellosolve, ethylene glycoldiethyl ether). Particularly preferable are methanol, ethanol,n-propanol, isopropanol, n-butanol, isobutanol, 2-butanol, acetone,methyl ethyl ketone, methyl isobutyl ketone, methyl acetate, ethylacetate, ethylene glycol, diethylene glycol, propylene glycol andglycerin.
The organic solvent is required neither to dissolve the web W nor toallow the web W to swell. To make the coating of an alkalinesaponification solution easier, desirably an organic solvent having anappropriately low surface tension is selected, as described in thesection relating to the physical properties of alkaline solutions. Thepercentage of the organic solvent used in solvent is determineddepending on the kind of the solvent, the miscibility with (solubilityin) water, and reaction temperature and time. To complete saponificationreaction in a short period of time, preferably the solution is adjustedto have a high concentration. However, too high a concentration ofsolvent might allow the components (plasticizer, etc.) in the web W tobe extracted and the web W to swell excessively, and thus, properselection is required. The mixing ratio of water to organic solvent ispreferably 3/97 to 85/15, more preferably 5/95 to 60/40, and much morepreferably 15/85 to 40/60. With the mixing ratio within the above range,the whole surface of the web W can undergo saponification treatmenteasily and uniformly without causing the deterioration of opticalcharacteristics.
As an alkali agent in the alkaline solution, any one of inorganic basesand organic bases can be used. To allow saponification reaction at a lowalkaline concentration, a strong base is preferably used. Such strongbases are preferably hydroxides of alkali metals (e.g. NaOH, KOH, LiOH);amines (e.g. perfluorotributylamine, triethylamine, diazabicyclononene,diazabicycloundecene); tetraalkylammoniumhydroxide (as the alkyl group,methyl, ethyl, propyl or butyl group); and free bases of complex salts(e.g. [Pt(NH₃)₆](OH)₄), more preferably hydroxides of alkali metals, andmost preferably NaOH and KOH.
The concentration of the alkaline solution is determined depending onthe kind of the alkali used, and the reaction temperature and time. Tocomplete saponification reaction in a short period of time, preferablythe alkaline solution is adjusted so that it has a high alkaliconcentration. However, too high an alkali concentration may sometimesdecrease the stability of the solution and cause precipitation whencoating is performed for a long time. Preferably the concentration ofthe alkaline solution is 0.1 to 5 N, more preferably 0.5 to 5 N, andmost preferably 0.5 to 3 N.
The alkaline solution used in this embodiment may also containsurfactant. Addition of surfactant allows, even if any of the substancescontained in the web W is extracted by the organic solvent, thesubstance to be present stably in the alkaline solution, therebypreventing the extracted substance from precipitating or beingsolidified in the subsequent washing step.
The surfactant used is not limited as long as it is soluble ordispersible in the alkaline saponification solution of the presentinvention. Any one of nonionic surfactant and ionic surfactant (anionic,cationic or ampholytic) can be suitably used; however, from theviewpoint of solubility and saponification performance, particularly,nonionic surfactant or anionic surfactant is preferably used (seeJapanese Patent Application Laid-Open No. 2003-313326).
To the above alkaline solution, antifoaming agent any of organicsolvents other than the above described ones, mildewproofing agents,antibacterial agents, and other additives (e.g. alkaline solutionstabilizer (antioxidant etc.), water-soluble compounds (polyalkyleneglycols, natural water-soluble resins, etc.)) may be added as solubilityassistants for assisting the dissolution of surfactant or antifoamer inthe alkaline solution.
Water used in the alkaline solution of this embodiment is preferablyselected based on Japan Water Supply Law (Law No. 177, 1957) and theministerial ordinance of water quality based thereon (Ordinance No. 56of the Ministry of Health, Aug. 31, 1978), Japan Hot Spring Law (Law No.125, Jul. 10, 1948, and the attached list thereof), and effects ofelements or minerals in water prescribed by WHO Water Quality Standards.
Although the physical properties of the alkaline solution used in thisembodiment are made up of the above described compositions, preferablythe surface tension is 45 mN/m or lower and the viscosity is 0.8 to 20mPa·s. The density of the alkaline solution is preferably 0.65 to 1.05g/cm³. Such physical properties make it possible to perform the coatingof the alkaline solution stably and easily depending on the conveyingspeed, and besides, they fully realize the wettability by the solutionon the surface of the web W, maintenance of the solution coated on thesurface of the web W, and removability of the alkaline solution from thesurface of the web W after saponification treatment.
EXAMPLES
The present invention will be described in detail by examples. It is tobe understood that the examples herein shown are for the purpose ofdescription and not of limitation.
In alkaline saponification line 10 shown in FIG. 1 (first half part),one side of a continuous web W of a cellulose acetate film (thickness:100 μm, width: 1895 mm) was coated with an alkaline solution (1 N, KOHsolution) in an amount of 14 cc/m². Then, the web W was subjected toalkaline saponification at 110° C. for about 7 seconds, and the treatedsurface of the web W was coated with deionized water in an amount of 3cc/m² to dilute the alkaline solution. Then the web W was washed. Theconveying speed of the web W was 20 m/min.
In washing section 22, the web W was washed while being conveyed at aspeed of 20 m/min. The temperature of the washing water was set to 37°C.
In Example 1, washing was performed in washing section 22 of FIG. 2,provided that the number of water-washing/draining units 62 was changedfrom 4 to 3. In Example 2, washing was performed in washing section 22of FIG. 2 (the number of water-washing/draining units 62 was 4). InExample 3, washing was performed in washing section 22 of FIG. 3. InComparative example 1, washing was performed in conventional washingsection 22 of FIG. 5. In Examples 1 to 3 and Comparative example 1, theamount of water used in each washing section 22 was measured.
The washing section of Example 1 could reduce the amount of washingwater used by about 50% over conventional washing section (FIG. 5) andthe washing section of Example 2 could reduce the amount of washingwater used by about 75% over the conventional washing section. Thewashing section of Example 3 could reduce the amount of washing waterused by about 50% over conventional washing section.
The contaminant concentration (alkali concentration etc.) of the washingwater between each two adjacent water-washing devices 64, 64 was alsomeasured. The difference in concentration was about 1/100, whichconfirmed that the washing power of the washing water was no problem.
The effect of the remaining alkaline solution on the product quality(orientation) when reusing washing water was confirmed. In this case,the product quality of the optical compensation films produced byapplying the washing methods of the present invention (Examples 1 to 3)was evaluated by measuring their degree of extinction by the followingmethod.
(Quality Evaluation by Degree of Extinction)
Quality evaluation by degree of extinction was performed usingextinction degree measuring instrument manufactured by OTSUKAELECTRONICS CO., LTD. In the instrument, the measuring wave length was550 nm and the transmittance of the polarizer in a parallel Nicolsarrangement was 100%. The orientation was evaluated for two sheets ofdiscotic liquid crystal in a crossed Nicols arrangement. In theorientation evaluation by degree of extinction, a higher degree ofextinction indicates larger quality deterioration due to the remainingalkaline saponification solution.
The degree of extinction was measured for each of the polymer filmsproduced using the washing methods of Examples 1 to 3 and Comparativeexample 1. The measurements confirmed that there was no significantincrease in degree of extinction due to the remaining saponificationsolution in any of Examples 1 to 3 and the degree of extinction ofExamples 1 to 3 was almost equal to that of Comparative example 1.
As described so far, in washing an alkaline saponification solution, ifthe present invention is applied, the washing water can be efficientlyused and low costs and low environmental load can be realized whilemaintaining the quality stability of the polymer film.
1. A method for alkaline saponification of a polymer film, comprisingthe steps of: alkaline saponification of the polymer film with analkaline solution; and washing away the alkaline solution from thealkali-saponified polymer film, wherein the washing step includes aplurality of water-washing steps of washing the alkaline solution coatedon the polymer film away using washing water, along the travel directionof the polymer film, and the used washing water is reused.
2. The methodfor alkaline saponification of a polymer film according to claim 1,wherein in the plurality of water-washing steps, the washing water usedin a downstream water-washing step is recovered and the recoveredwashing water is reused in a water-washing step upstream of thedownstream water-washing step.
3. The method for alkaline saponificationof a polymer film according to claim 2, wherein the washing water usedin a downstream water-washing step is used, as washing water, in awater-washing step just upstream of the downstream water-washingstepwise from the most downstream water-washing step to the mostupstream step.
4. The method for alkaline saponification of a polymerfilm according to claim 1, wherein the washing step includes a pluralityof sets of water-washing/draining steps comprising the water-washingstep and a draining step, after the water-washing step, of removing thewashing water present on the surface of the polymer film.
5. The methodfor alkaline saponification of a polymer film according to claim 2,wherein the washing step includes a plurality of sets ofwater-washing/draining steps comprising the water-washing step and adraining step, after the water-washing step, of removing the washingwater present on the surface of the polymer film.
6. The method foralkaline saponification of a polymer film according to claim 3, whereinthe washing step includes a plurality of sets of water-washing/drainingsteps comprising the water-washing step and a draining step, after thewater-washing step, of removing the washing water present on the surfaceof the polymer film.
7. The method for alkaline saponification of apolymer film according to claim 1, wherein, of the plurality ofwater-washing steps, at least the most upstream water-washing step iskept at room temperature or higher.
8. The method for alkalinesaponification of a polymer film according to claim 2, wherein, of theplurality of water-washing steps, at least the most upstreamwater-washing step is kept at room temperature or higher.
9. The methodfor alkaline saponification of a polymer film according to claim 3,wherein, of the plurality of water-washing steps, at least the mostupstream water-washing step is kept at room temperature or higher. 10.The method for alkaline saponification of a polymer film according toclaim 4, wherein, of the plurality of water-washing steps, at least themost upstream water-washing step is kept at room temperature or higher.11. The method for alkaline saponification of a polymer film accordingto claim 1, further comprising a drying step after the washing step. 12.The method for alkaline saponification of a polymer film according toclaim 2, further comprising a drying step after the washing step. 13.The method for alkaline saponification of a polymer film according toclaim 3, further comprising a drying step after the washing step. 14.The method for alkaline saponification of a polymer film according toclaim 4, further comprising a drying step after the washing step. 15.The method for alkaline saponification of a polymer film according toclaim 7, further comprising a drying step after the washing step.
16. Anapparatus for alkaline saponification of a polymer film, comprising: analkaline saponification section in which the polymer film is subjectedto with an alkaline solution; and a washing section in which thealkaline solution is washed away from the alkali-saponified polymer filmin the alkaline saponification section, wherein the washing sectionincludes: a plurality of sets of water-washing/draining units providedalong the travel direction of the polymer film, and each includes awater-washing device which washes away the alkaline solution coated onthe polymer film with washing water and a draining device which isprovided subsequently after the water-washing device and removes thewashing water present on the surface of the polymer film; and washingwater recovering/feeding devices which are provided for the respectivewater-washing/draining units and each of which recovers the washingwater used in a downstream water-washing/draining unit and feeds therecovered washing water to a water-washing/draining unit upstream of thedownstream water-washing/draining unit.
17. The apparatus for alkalinesaponification of a polymer film according to claim 16, wherein in theplurality of water-washing/draining units, at least the most upstreamwater-washing device is provided with a temperature controlling device.18. A polymer film, produced using the method for alkalinesaponification of a polymer film according to claim
1. 19. An opticalcompensation film, produced using the method for alkaline saponificationof a polymer film according to claim 1..
| 13,920 |
44022021S005968_6580_44
|
French Open Data
|
Open Government
|
Licence ouverte
| 2,021 |
GREFFE DU TRIBUNAL DE COMMERCE DE SAINT-NAZAIRE
|
BODACC
|
French
|
Semantic data
| 4,587 | 15,365 |
849 033 204
RCS
Saint-Nazaire
PIERRE DE SUCRE
Société à responsabilité limitée
43
avenue
Alfred Bruneau
Résidence les Salinières
44500
La Baule-Escoublac
2020-12-31
Comptes annuels et rapports
517 635 421
RCS
Paris
WPD - EOLIENNES OFFSHORE DU GRAND LARGE
Société par actions simplifiée
94
rue
Saint-Lazare
75009
Paris
2020-12-31
Comptes annuels et rapports
KALMERY
Anne, Tiyi
THIS IS YOUR INVITE
534 660 113
RCS
Bobigny
THIS IS YOUR INVITE
68
Rue
des Écoles
Chez Malika Josette Auguste
93300
Aubervilliers
2021-10-28
822 376 091
RCS
Bobigny
LE GRAND VENEUR
Société par actions simplifiée
144
Rue
Du Landy
93400
Saint-Ouen-sur-Seine
2019-12-31
Comptes annuels et rapports
B.S.A. - BARDIN STEPHANE AUTOMOBILES
Société à responsabilité limitée (à associé unique)
8000
EUR
423 393 388
RCS
La Roche-sur-Yon
rue
de la Croix Rouge Zone d'Activités
85280
La Ferrière
modification survenue sur l'adresse du siège
898 535 299
RCS
Evry
DE CAMPOS
Flavien
Création
établissement principal
vente sur internet de produits non réglementés (dropshipping)
1
Allée
des Erables
91530
Saint-Maurice-Montcouronne
2021-04-22
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-04-19
BENAM
Société à responsabilité limitée
Liquidateur : BENMAYOUF Bachir
508 189 719
RCS
Versailles
Restauration rapide à emporter ou à consommer sur place, sandwicherie, saladerie DONERGRILL, patisserie orientale.
35
Rue
de la Ceinture
Centre Commercial Debussy
78000
Versailles
Modification survenue sur l'administration, dissolution de la société.
390 202 935
RCS
Epinal
NICOLAS FRERES
Société à responsabilité limitée
37
Grande Rue
88130
Savigny
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
ETALON FRANCE
Société par actions simplifiée
20000.00
EUR
807 537 709
RCS
Rennes
Rue
des Iles Kerguelen
Parc d'Affaires Edonia
Bâtiment M
35760
Saint-Grégoire
Rue
des Iles Kerguelen
Parc d'Affaires Edonia
Bâtiment M
35760
Saint-Grégoire
O
338 812 886
RCS
Lille Métropole
CARISAN - GESTION
Société anonyme à directoire et conseil de surveillance
108
rue
du Mont A Leux
59150
Wattrelos
2020-12-31
Comptes annuels et rapports
820 509 917
RCS
Nantes
DECORENO
Société à responsabilité limitée (à associé unique)
1
ruelle
Saint-jean
44430
Le Loroux-Bottereau
2020-09-30
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
HR & SOCIAL PERFORMANCE
Société à responsabilité limitée
1000.00
EUR
812 436 855
RCS
Clermont-Ferrand
17
Avenue
Julien
63000
Clermont-Ferrand
O
885 179 663
RCS
Marseille
OA INVEST
Société par actions simplifiée à associé unique
14
Avenue
du Parc Borely
"les Allées Borely" Bat.B
13008
Marseille 8e Arrondissement
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
BOIS CONFORT
Société par actions simplifiée
20000
EUR
nomination du Directeur général : Gueguan, Nadège
843 861 089
RCS
Poitiers
111
rue
de la Bugellerie
86000
Poitiers
modification survenue sur l'administration
622 037 083
RCS
Bobigny
RHODIA OPERATIONS
Société par actions simplifiée
52
Rue
de la Haie Coq
93300
Aubervilliers
établissement secondaire acquis par achat au prix stipulé de 5672157.75 euros
établissement secondaire
enrobage de semences consistant dans le développement, la production et la commercialisation de produits dans le domaine des produits d'enrobage de semences pour céréales, blés, pâturages, colzas et sojas.
14
Rue
De la Pierre Follege
91660
le Merevillois
BAYER SAS
562 038 893
RCS
Lyon
Achat d'un fonds par une personne morale (insertion provisoire)
2021-07-01
Les Affiches Versaillaises
2021-08-17
Election de domicile au fonds vendu pour la correspondance : siège social de la société BAYER 16 Rue Jean Marie Leclair 69009 Lyon 9e Arrondissement Opposition dans les 10 jours suivant la dernière en date des publications prévues à l'article L141-12 du Code de Commerce.
Acte en date du 01/07/2021 enregistré au SDE d'Etampes le 29/07/2021 sous le numéro Dossier 2021 00019404 Réréfences 9104P61 2021 A 3630 Adresse de l'ancien propriétaire: 16 Rue Jean-Marie Leclair 69009 Lyon 9e Arrondissement
ETS DUBUISSON
Société par actions simplifiée
Président : HANOUN Rémi
056 800 782
RCS
Aix-en-Provence
L'achat, la vente de tous matériels relatifs à la filtration industrielle.
990
Chemin
de Sauvecanne Lot No 6
Parc de Sauvecanne
13320
Bouc-Bel-Air
Modification survenue sur l'administration.
ETABLISSEMENTS ORAZIO
Société par actions simplifiée
Président : VERRISSIMA GROUP ; Commissaire aux comptes titulaire : CLUZEL ECHEVERRIA LESGOURGUES ; Commissaire aux comptes suppléant : CLUZEL Alain
429 380 108
RCS
Agen
Toutes activités et prestations de services se rapportant à la miroiterie : Achat, vente, commercialisation de tous produits verriers, pose, Installation et réparation desdits produits .
3200
Avenue
de Cahors
47480
Pont-du-Casse
Modification survenue sur l'administration.
509 582 243
RCS
Nanterre
INOSENSE
Société à responsabilité limitée
125
Boulevard
du Général Koenig
92200
Neuilly-sur-Seine
2019-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
882 527 740
RCS
Clermont-Ferrand
SAS "TRANSPORT BENNE RIGAL", par abréviation T.B.R.
SAS "T.B.R"
Société par actions simplifiée
Route
de Vichy
La Varenne
63430
Pont-du-Château
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
797 588 936
RCS
Angers
LMF DISTRIBUTION
Société par actions simplifiée à associé unique
40
Rue
des Ruisseaux
49300
Cholet
2020-05-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
RCS non inscrit
ADI
Djamel
Ma maison déco
Création
établissement principal
site boutique e-commerce drop shipping, vente d'objet de décoration maison et jardin, linge de maison, sac à linge
1
Boulevard
Jean Moulin
93190
Livry-Gargan
2021-06-25
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-04-22
LACA BTP
Société par actions simplifiée
Président : LAMOINE Nicolas
800 533 556
RCS
Brive
Prise de participation dans toutes sociétés du secteur du bâtiment et travaux publics et accessoirement la vente de matériaux de construction.
3
Rue
des Magnolias
Gare de Corrèze
19800
Saint-Priest-de-Gimel
Modification survenue sur l'administration.
SARI
Société par Actions Simplifiée
PIETRANTONI Paolo André Adolphe nom d'usage : PIETRANTONI n'est plus président. PIETRANTONI Paolo André Adolphe nom d'usage : PIETRANTONI devient liquidateur. GIORDANO Sandra nom d'usage : PIETRANTONI n'est plus directeur général
904 476 496
RCS
Toulon
Dissolution de la société. Modification de l'administration.
320 528 458
RCS
Meaux
GAMA INTERNATIONAL
Société par actions simplifiée (à associé unique)
GAMA INTERNATIONAL
Président : INVEST IC, Commissaire aux comptes titulaire : KPMG S.A, Commissaire aux comptes suppléant : KPMG AUDIT NORD
211500
EUR
4
rue
Denis Papin
77290
Mitry Mory
Création
Etablissement principal
Groupage, entreposage, garde meubles, transit, commissionnaire de transport, transport public routier de marchandises ou location de véhicules industriels pour le transport routier de marchandises avec conducteurs.
4
rue
Denis Papin
77290
Mitry Mory
1981-01-08
Immatriculation d'une personne morale suite à transfert de son siège social
2021-11-15
1981-01-08
Immatriculation d'une personne morale suite au transfert du siège hors ressort
523 125 375
RCS
Pontoise
MOULIN FERMETURE
Société à responsabilité limitée
46
Rue
Hippolyte Delaplace
95110
Sannois
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
CONCORDE
Société à responsabilité limitée
10000.00
EUR
751 036 674
RCS
Pau
3
Rue
d'Ossau
Zone Industrielle Berlanne
64160
Morlaàs
O
311 371 702
RCS
Bourges
HUBERT BROCHARD
Société par actions simplifiée
Chavignol
18300
Sancerre
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
524 696 143
RCS
Chambéry
ARTHAUD-BERTHET
Société à responsabilité limitée
325
Allée
du Château
73240
Avressieux
2020-12-31
Comptes annuels et rapports
SALLE
Gabriel, Pierre, Marie
GS EVENTS
332 569 540
RCS
Draguignan
GS EVENTS
613
Impasse
de Fontbelle
83890
Besse-sur-Issole
2021-11-18
BOGLIOLO
Olivier
BOGLIOLO
PIZZA BOGUI
453 148 140
RCS
Toulon
7
Lotissement
Les Coquelicots
83210
Solliès-Pont
2019-07-01
BOIS L'EVEQUE
Société civile d'exploitation agricole
Gérant, Associé : BOUCHER-FERTE Albéric Alain ; Associé : FERTE Chantal Nicole
381 989 524
RCS
Compiègne
Exploitation des biens agricoles apportés par les associés, achetés, pris à bail ou mis à la disposition du groupement.
4
Rue
des Tilleuls
60620
Ormoy-le-Davien
4
Rue
des Tilleuls
60620
Ormoy-le-Davien
Modification survenue sur l'administration, la dénomination, la forme juridique, transfert du siège social.
1991-04-26
824 331 698
RCS
Paris
SAINT DOMINIQUE 54
Société à responsabilité limitée
4
passage
Jean -Nicot
75007
Paris
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
HARMONIE CONFORT
Société par actions simplifiée
21000.00
EUR
789 165 032
RCS
Blois
Plâtrerie, isolation, plomberie, chauffage, climatisation.
3
Rue
des Gravières
zone industrielle l'Artouillat
41120
Chailles
3
Rue
des Gravières
zone industrielle l'Artouillat
41120
Chailles
Modification survenue sur la dénomination, le capital, transfert du siège social.
2012-11-19
RYS INVEST HOLDING
Société par actions simplifiée
820 275 170
RCS
Bobigny
Prise de participation dans toutes entreprises ou sociétés créées dans tout domaine d'activité commerciale ou industrielle.
10
Avenue
du Valquiou
Bâtiment C3 Cellule C33
93290
Tremblay-en-France
10
Avenue
du Valquiou
Bâtiment C3 Cellule C33
93290
Tremblay-en-France
transfert du siège social.
2016-04-06
505 291 385
RCS
Fréjus
LEADER PUGET
Société à responsabilité limitée
7
Boulevard
du Colonel Dessert
83480
Puget-sur-Argens
2020-12-31
Comptes annuels et rapports
ALIGON
Société civile immobilière
Gérant, Associé : GONZALEZ Manuel
539 426 379
RCS
Bordeaux
acquisition construction propriété administration exploitation par bail location ou autre de tous biens mobiliers ou immobiliers
35
Route
d'Arcachon
33830
Belin-Béliet
35
Route
d'Arcachon
33830
Belin-Béliet
transfert du siège social.
2012-02-01
902 191 659
RCS
Quimper
BANNIEL DU
Société civile immobilière
Gérant, Associé indéfiniment responsable : GOURIOU Christophe
1000.00
EUR
81
Avenue
de Ty Bos
29000
Quimper
Création
siège et établissement principal
acquisition, administration et exploitation par bail, location ou autrement de tous immeubles bâtis ou non bâtis dont elle pourrait devenir propriétaire par voie d'acquisition, échange, apport ou autrement.
81
Avenue
de Ty Bos
29000
Quimper
2021-08-11
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-08-04
502 774 821
RCS
Toulon
NJN CONSTRUCTION
Société à Responsabilité Limitée
145
Avenue
De Savoie
83000
Toulon
2020-12-31
Comptes annuels et rapports
388 314 882
RCS
Nanterre
CONSORTIUM FRANCAIS
Société à responsabilité limitée
176
Avenue
Charles de Gaulle
92522
Neuilly-sur-Seine Cedex
2014-12-31
Comptes annuels et rapports
385 340 179
RCS
Lisieux
RONDEN
Société par actions simplifiée à associé unique
6
Rue
Hoche
14800
Deauville
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
411 079 593
RCS
Marseille
JADE
Société à responsabilité limitée
Route Nationale 96 Valcros
13360
Roquevaire
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
904 859 170
RCS
Arras
LECLERCQ PRIMEURS
Société par actions simplifiée
Président : LECLERCQ Patricia ; Directeur général : LECLERCQ Julien
12000.00
EUR
11
Rue
de la Vierge
62121
Achiet-le-Grand
Création
siège et établissement principal
commerce de fruits et légumes.
11
Rue
de la Vierge
62121
Achiet-le-Grand
2021-11-04
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-10-15
BLACKSWAN PP 30
Société civile immobilière
1000
EUR
839 118 825
RCS
Paris
5
rue
Tronchet
75008
Paris
Dissolution sans liquidation de la société, décision de l'associé unique
479 150 179
RCS
Lyon
SELARL CARPEDIOL
Société d'Exercice Libéral à Responsabilité Limitée
39
Chemin
De la Vernique
69130
Écully
2019-12-31
Comptes annuels et rapports
907 719 389
RCS
Saint Denis de La Réunion
CENTRE DE CONSEIL ET DE FORMATION DES ENTREPRISES
Société par Actions Simplifiée
CENTRE DE CONSEIL ET DE FORMATION DES ENTREPRISES
CCFE
Président : FAJFER Rémi Alexis nom d'usage : FAJFER. Directeur général : Sté par actions simplifiée BYLKA COMPANY
100.00
EUR
20g
Chemin
Summer
Résidence Tiroumalé
97434
Saint-Paul
Toutes prestations en ligne ou non pouvant avoir un lien avec les formalités juridiques comptables et administratives des entreprises. Prestation de service fournissant à titre professionnel une domiciliation juridique à des personnes physiques ou morales pour l'exercice de leur activité professionnelle Opération de formation, conseil audit coaching recrutement destinées aux entreprises administrations personnes morales publique ou privées l'organisation de rencontre consacrées à la formation.
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-12-01
ALLIANCE DOMICILE
Société par actions simplifiée
Président : BERTIN Claudia né(e) RENAUX
842 522 658
RCS
Metz
39
rue
du Belvédère
57870
Troisfontaines
39
rue
du Belvédère
57870
Troisfontaines
Modification survenue sur l'administration et transfert du siège social, transfert de l'établissement principal
902 098 722
RCS
Colmar
DA SILVA DOS SANTOS
Samuel
Création
Etablissement principal
Vente en ligne de tutoriels
30A
rue
de la Fraternité
68150
Ribeauvillé
2021-08-09
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-08-02
843 071 929
RCS
Antibes
GROZOS
Vanessa, Laetitia, Elodie
BAYRON
MICE-Events
Création
établissement principal
apporteur d'affaire dans l'évènementiel
620
1ère Avenue
Le Sunset Bat C
06600
Antibes
2021-05-03
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-04-06
882 332 190
RCS
Besançon
SELARL VV CHIRURGIEN-DENTISTE
Société d'exercice libéral à responsabilité limitée
2
Rue
du Bochet
25320
Montferrand-le-Château
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
838 662 492
RCS
Arras
LEFETZ JEAN MARC
Société par actions simplifiée
22
Rue
de la République
62144
Acq
2021-07-31
Comptes annuels et rapports
492 193 495
RCS
Saint-Nazaire
LB 2 ELECTRICITE
Société à responsabilité limitée
23 ter
route
de Nérac
44500
La Baule Escoublac
2020-06-30
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
389 097 874
RCS
Annecy
SKI SERVICE R. DELOCHE
Société à Responsabilité Limitée
964
Route
De l'Envers du Chinaillon
74450
Le Grand-Bornand
2020-09-30
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier alinéa de l'article L. 232-25.
435 096 052
RCS
Bourg-en-Bresse
DENIZ EURL
Société à responsabilité limitée
7
Rue
Brûlée
01600
Trévoux
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
901 274 423
RCS
Sarreguemines
MASSON
Franck, James
RAMSTEIN-PLAGE
Prise en location-gérance
Etablissement principal
Café brasserie restaurant
rue
Ramstein
Camping Municipal Ramstein-Plage
57230
Baerenthal
COMMUNE DE BAERENTHAL
RCS non inscrit
2021-07-16
Immatriculation d'une personne physique, établissement principal reçu en location-gérance
2021-07-01
793 408 170
RCS
Meaux
ABE CONSEILS
Société à responsabilité limitée (à associé unique)
22
rue
du Faubourg Saint Nicolas
77100
Meaux
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
MICHEL FRANCOIS FOR EVER
Société civile immobilière
1524.49
EUR
353 584 055
RCS
Avignon
2
Rue
Villeneuve
84100
Orange 84100
O
ETUDES ET SYNTHESES TECHNIQUES
Société par Actions Simplifiée
E.S.T.
750 795 981
RCS
Saint Etienne
réalisation d'études techniques liées au secteur du bâtiment dans les domaines du chauffage, de la ventilation, de la climatisation, du désenfumage, des installations thermiques et électriques et ainsi que de la plomberie et des installations sanitaire
1
boulevard
p. a. et j. Michel Dalgabio
42000
Saint-Étienne
Jugement d'ouverture
Jugement d'ouverture de liquidation judiciaire
2021-06-09
Jugement prononçant la liquidation judiciaire, date de cessation des paiements le 28 mai 2021, désignant liquidateur Selarl Mj Synergie - Mandataires Judiciaires en la Personne de Maître Fabrice Chretien le century 8 rue Blanqui 42026 Saint-Étienne CEDEX 1. Les créances sont à déclarer, dans les deux mois de la présente publication, auprès du liquidateur ou sur le portail électronique à l’adresse https://www.creditors-services.com.
478 205 081
RCS
Versailles
ANDERITUM
Société par actions simplifiée
2
Rue
des Erables
78780
Maurecourt
2018-06-30
Comptes annuels et rapports
833 715 121
RCS
Créteil
RTH-IT
Société par actions simplifiée
74 Bis
Quai
du Parc
94100
Saint-Maur-des-Fossés
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
NACARAT FRANCE TERRE MONTLHERY
Société civile de construction vente
Gérant, Associé indéfiniment responsable : NACARAT ; Gérant, Associé indéfiniment responsable : FRANCE TERRE PIERREVAL ; Commissaire aux comptes : PRICEWATERHOUSECOOPERS AUDIT
753 540 228
RCS
Saint-Brieuc
acquisition de biens immobiliers sis à Monthlery (Essone), la construction et la vente
1
Rue
Pierre Et Marie Curie
22190
Plérin
Modification survenue sur l'administration.
FORGEST
Société par actions simplifiée à associé unique
600000.00
EUR
539 259 499
RCS
Fréjus
Assistance en matière administrative, financière, juridique, comptable, fiscale, gestion, marketing, commerciale, management, informatique, à toutes filiales, société mère ou toute société contrôlée par un associé commun à l'associé de la société
50
Voie Aurélienne
83700
Saint-Raphaël
Modification survenue sur le capital.
828 553 115
RCS
Limoges
BJ MENUISERIE
Société par actions simplifiée (à associé unique)
315
route
Martin Nadaud Zone Artisanale le Puy Roudier
87240
Ambazac
2020-08-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
889 833 661
RCS
Pontoise
BENYAMINA
Yacine
Création
établissement principal
coursier uber eat
2
Ruelle
Darras
95310
Saint-Ouen-l'Aumône
2021-12-08
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-12-01
OKO HOLDING
Société civile à capital variable
50000 EUROS
805 176 567
RCS
Paris
3
rue
Le Goff
75005
Paris
3
rue
Le Goff
75005
Paris
modification survenue sur l'adresse du siège et l'adresse de l'établissement
529 522 070
RCS
Le Mans
GT EXPRESS
Société à responsabilité limitée
le Puits
72470
Fatines
2020-10-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
ALLIADE HABITAT
Société anonyme d'HLM à conseil d'administration
111907136.00
EUR
960 506 152
RCS
Lyon
Modification du capital.
453 176 174
RCS
Fort-de-France
CHACK SARL
Société à responsabilité limitée
quartier
Mansarde
Centre Commercial Madimarche
97231
Le robert
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
830 546 487
RCS
Pontoise
SARL FLB-Loc
Société à responsabilité limitée
1
Chemin
De La Croisette
95650
Boissy-l'Aillerie
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
905 055 901
RCS
Toulouse
GIRLS MAKE SENSE
Société par Actions Simplifiée
Président : ROY Leslie nom d'usage : ROY. Directeur général : NAIL Marianne nom d'usage : NAIL
1000.00
EUR
85
Rue
Ernest Renan
Apt 79
31200
Toulouse
L'activité d'agence de communication comprenant notamment le conseil et communication et la publicité, la création de chartes graphiques et d'identité visuelle, la conception et la vente d'illustrations et l'impression sur tout support.
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-11-02
410 172 977
RCS
Marseille
UNE AFFAIRE DE MARQUES
Société à responsabilité limitée
175
Avenue
du Prado
13008
Marseille 8e Arrondissement
2020-12-31
Comptes annuels et rapports
903 295 525
RCS
Nantes
TANAGRA
Société civile immobilière
Gérant associé indéfiniment responsable : Levet, Christophe Michel Jean Ludovic, Associé indéfiniment responsable : Mousset, Béatrice Marie Fabienne Madeleine, nom d'usage : Levet, Associé indéfiniment responsable : Daudon, Monique Solange Andrée Marcelle, nom d'usage : Levet
1200
EUR
11
rue
des Olivettes
44000
Nantes
Création
Etablissement principal
L'acquisition, la vente, la gestion par location ou autrement de tous immeubles et biens immobiliers.
11
rue
des Olivettes
44000
Nantes
2021-09-20
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-09-16
902 075 498
RCS
Bayonne
IMAKONSEIL
Société par actions simplifiée
Président : IMAKHOUKHENE Léa
1000.00
EUR
2
Chemin Vers L'Est
64210
Arbonne
Création
siège et établissement principal
conseil aux entreprises
2
Chemin Vers L'Est
64210
Arbonne
2021-08-09
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-08-03
421 490 749
RCS
Besançon
CATTET
Société par actions simplifiée
Route
de Gilley
25390
Orchamps-Vennes
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
COMSINEL
Société à responsabilité limitée
803 620 376
RCS
Epinal
Activités des agences de publicité
7
rue
du Loix
88390
Uxegney
Avis de dépôt
Dépôt du projet de répartition
2021-10-28
Le projet de répartition prévu par l'article L 644-4 du code de commerce est déposé au greffe. Tout intéressé peut contester ledit projet devant le juge-commissaire dans un délai d'un mois à compter de la présente publication.
THILL
Société à responsabilité limitée
8000.00
EUR
518 087 697
RCS
Versailles
8
Avenue
de Gretry
78600
Maisons-Laffitte
O
902 301 514
RCS
Aubenas
MELA
Société civile immobilière
Gérant, Associé indéfiniment responsable : HABERT Nicolas Mathieu ; Gérant, Associé indéfiniment responsable : HABERT Julie Hélène Georgette
1000.00
EUR
238
Rue
du Bac
07500
Guilherand-Granges
Création
siège et établissement principal
acquisition et gestion de tous biens et droits immobiliers.
238
Rue
du Bac
07500
Guilherand-Granges
2021-08-16
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-07-20
SERACc FRANCE
Société par Actions Simplifiée
411 442 387
RCS
Toulon
25
Rue
Marceau
83190
Ollioules
Nouveau siège.
451 125 595
RCS
Valenciennes
AMON
Société à responsabilité limitée (à associé unique)
Gérant : Nys, Pascal
100000
EUR
12
rue
de la Halle
59300
Valenciennes
Création
Etablissement principal
Création, acquisition, location, prise en location gérance de tous établissements ou fonds de commerce se rapportant a la restauration restauration rapide
QUICK HAMBURGER RESTAURANT
12
rue
de la halle
59300
Valenciennes
2003-12-11
Immatriculation d'une personne morale suite à transfert de son siège social
2021-03-26
2017-05-01
Immatriculation d'une personne morale suite au transfert du siège hors ressort
ELECTRICITE DE LA COTE D'OPALE - DUPONCHELLE BRIET
Société à Responsabilité Limitée
351 641 345
RCS
Amiens
8
Rue
Alphonse Daudet
80230
Vaudricourt
Nouveau siège.
851 518 753
RCS
Strasbourg
CABINET D'ORTHODONTIE DU DOCTEUR MELANIE NOORDIJK
Société d'exercice libéral à responsabilité limitée à associé unique
1a rue des Dames
67380
Lingolsheim
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier alinéa de l'article L. 232-25.
RCS non inscrit
PETITOT DARBOIS
Groupement foncier rural
Gérant, Associé indéfiniment responsable : PETITOT Marie-Reine, Marguerite
462700.00
EUR
27
Rue
de la Porte de Mussy
21400
Pothières
Création
siège et établissement principal
propriété et mise en valeur biens agricoles
27
Rue
de la Porte de Mussy
21400
Pothières
2021-11-15
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-10-25
899 116 941
RCS
Nîmes
FSI DESIGN
Société par Actions Simplifiée
Président : LYAUTEY Sebastien Alexandre nom d'usage : LYAUTEY
1000.00
EUR
21
Chemin
De la Draille
30114
Nages-et-Solorgues
Travaux de pose de placoplâtre, plâtrerie, finitions intérieures du bâtiment
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-03-02
894 934 959
RCS
Orléans
ALTUN
Société civile immobilière
Gérant Associé indéfiniment responsable : Altun, Adem Serdar, Associé indéfiniment responsable : Altun, Halil, Associé indéfiniment responsable : Altun, Huseyin
1500
EUR
23
rue
Roger Salengro
45120
Châlette-sur-Loing
Création
Etablissement principal
L'acquisition,la location,la construction,l'aménagement d'immeubles
23
rue
Roger Salengro
45120
Châlette-sur-Loing
2021-03-09
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-02-22
504 919 788
RCS
Troyes
LA CHAMPENOISE DES JEUX
Société à responsabilité limitée
60
Route
Nationale
10200
Arsonval
2017-09-30
Comptes annuels et rapports
SELARL CABINET DENTAIRE DU DOCTEUR HABAL
Société d'exercice libéral à responsabilité limitée (à associé unique)
5000
EUR
849 668 348
RCS
Paris
86
avenue
de Flandres
75019
Paris
86
avenue
de Flandres
75019
Paris
modification survenue sur l'adresse du siège
831 972 948
RCS
Montauban
DOUAY
Allan, Julien, Jonathan
Création
établissement principal
coursier à vélo
327
Chemin
Rural de Grand Camp
82230
Génébrières
2021-01-06
Immatriculation d'une personne physique suite à création d'un établissement principal
2020-12-02
530 721 117
RCS
Nantes
ARBOMAT PAYSAGE
Société à responsabilité limitée
La Ville du Bois
44116
Vieillevigne
2020-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
889 555 728
RCS
La Roche-sur-Yon
KARO CLEF
Société à responsabilité limitée (à associé unique)
12
impasse
Vasco de Gama
85430
Nieul le Dolent
2021-03-31
Comptes annuels et rapports
903 108 082
RCS
Lyon
AP SELECT COURTAGE
Société par Actions Simplifiée
Président : GUINET Alexandre Pierre nom d'usage : GUINET
500.00
EUR
149
Rue
Antoine Charial
69003
Lyon
La recherche, l'achat, la vente, le transport, la réparation, la rénovation, la mise en valeur, la promotion, la transaction, la gestion, la location, la démolition, l'activité de marchand de pièces, le tout dans le domaine de l'automobile ; l'acquisition à titre habituel d'automobiles, la mise en valeur, l'administration, la gestion et l'exploitation, par location ou autrement, l'apport ou la prise en jouissance de tous véhicules acquis dont la Société aura propriété ou jouissance.
Immatriculation d'une personne morale (B, C, D) suite à création d'un établissement principal
2021-09-08
LOPES GOULART DE ANDRADE
Alexandre, Augusto
PEUPLES DE LA FORET - FORMATION & COMMERCE EQUITABLE
829 524 537
RCS
Boulogne-sur-Mer
PEUPLES DE LA FORET - FORMATION & COMMERCE EQUITABLE
66
Rue
du Baston
62930
Wimereux
2020-12-31
RCS non inscrit
Monnier
Matheo, Michel, Bernard
MatheoMonnier
Création
établissement principal
livraison de repas à domicile à vélo.
27
Rue
d'Aiguillon
29200
Brest
2021-05-17
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-05-17
513 719 138
RCS
Nanterre
L'AS DESBOSS
Société à responsabilité limitée
1
Place
Paul Verlaine
92100
Boulogne-Billancourt
2019-09-30
Comptes annuels et rapports
POLYTECH***Société en liquidation***
Société à responsabilité limitée
2000.00
EUR
489 864 538
RCS
Boulogne-sur-Mer
29
Rue
des Carrières
62100
Calais
O
812 956 936
RCS
Perpignan
GP DISTRIBUTION
Société par Actions Simplifiée
14
Rue
De la République
66690
Saint-André
2019-12-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier alinéa de l'article L. 232-25.
529 604 027
RCS
Fréjus
GROUPE FGC EST VAR
Société à responsabilité limitée
58
Avenue
du Maréchal de Lattre de Tassigny
Résidence Hermès
83600
Fréjus
2020-07-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
PROVENCE NOUVEAU MONDE
Société par actions simplifiée
Président : MARQUES Valérie ; Directeur général : TAKLA Oussama ; Commissaire aux comptes titulaire : ERNST & YOUNG ET AUTRES ; Commissaire aux comptes suppléant : CABINET AUDITEX
537 986 747
RCS
Bourg-en-Bresse
L'acquisition, la gestion et la cession de participations dans des sociétés commerciales ayant leur siège en France ou à l'étranger
13
Chemin
du Levant
Immeuble Jean-Baptiste Say
01210
Ferney-Voltaire
Modification survenue sur l'administration.
ROSS
Chloé, Liza
LAGNA
895 148 898
RCS
Mulhouse
12
rue
Henri Matisse
68200
Mulhouse
2021-08-27
902 136 068
RCS
Bordeaux
DEODATO
Lucas
Création
établissement principal
livraison de repas et de courses à domicile à vélo
35
Rue
Forestier
33800
Bordeaux
2021-08-09
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-08-06
897 441 937
RCS
Epinal
CHASSARD
Elsa
Création
établissement principal
restauration type rapide avec fabrication et vente d'hamburgers frites churros crêpes gaufres sur foires marchés expositions et fêtes foraine vente de tout article alimentaire et non alimentaire non réglementé sur foires marchés activités des fêtes foraines récupération de déchets triés
12
Rue
Henri Martin
Bains les Bains
88240
la vôge-les-bains
2021-03-26
Immatriculation d'une personne physique suite à création d'un établissement principal
2021-03-16
753 709 591
RCS
Nantes
ART'OPIERRE PAYSAGE SERVICES
Société à responsabilité limitée (à associé unique)
La Noë Guy
44119
Grandchamp-Des-Fontaines
2019-08-31
Comptes annuels et rapports
Les comptes annuels sont accompagnés d'une déclaration de confidentialité en application du premier ou deuxième alinéa de l'article L. 232-25.
| 14,702 |
https://www.wikidata.org/wiki/Q41303337
|
Wikidata
|
Semantic data
|
CC0
| null |
Friedrichstraße 25
|
None
|
Multilingual
|
Semantic data
| 190 | 445 |
Ehemals Speicherbau, jetzt Wohnhaus
dreigeschossiger, traufseitiger Fachwerkbau mit Satteldach, dendro.dat. 1401/02, Umbau zum Wohnhaus 17. und 18. Jahrhundert, Dachgeschossausbau Mitte 19. Jahrhundert
Ehemals Speicherbau, jetzt Wohnhaus BLfD-ID D-5-65-000-304
Ehemals Speicherbau, jetzt Wohnhaus liegt in der Verwaltungseinheit Schwabach
Ehemals Speicherbau, jetzt Wohnhaus Staat Deutschland
Ehemals Speicherbau, jetzt Wohnhaus Schutzkategorie Baudenkmal in Bayern
Ehemals Speicherbau, jetzt Wohnhaus ist ein(e) Haus
Ehemals Speicherbau, jetzt Wohnhaus Bild Schwabach, Friedrichstraße 25-20160815-001.jpg
Ehemals Speicherbau, jetzt Wohnhaus Commons-Kategorie Friedrichstraße 25 (Schwabach)
Ehemals Speicherbau, jetzt Wohnhaus geographische Koordinaten
Ehemals Speicherbau, jetzt Wohnhaus Adresse
Ehemals Speicherbau, jetzt Wohnhaus steht in der Denkmalliste Liste der Baudenkmäler in Schwabach
Ehemals Speicherbau, jetzt Wohnhaus BDA-Baudenkmal-ID 95200
Friedrichstraße 25
building in Schwabach, Middle Franconia, Germany
Friedrichstraße 25 Bavarian monument authority ID D-5-65-000-304
Friedrichstraße 25 located in the administrative territorial entity Schwabach
Friedrichstraße 25 country Germany
Friedrichstraße 25 heritage designation architectural heritage monument in Bavaria
Friedrichstraße 25 instance of house
Friedrichstraße 25 image Schwabach, Friedrichstraße 25-20160815-001.jpg
Friedrichstraße 25 Commons category Friedrichstraße 25 (Schwabach)
Friedrichstraße 25 coordinate location
Friedrichstraße 25 street address
Friedrichstraße 25 appears in the heritage monument list Liste der Baudenkmäler in Schwabach
Friedrichstraße 25 Bavarian Monument Map object ID (architectural monument) 95200
| 36,180 |
https://github.com/mimshins/figma-backup/blob/master/bin/utils/findElementHandle.ts
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
figma-backup
|
mimshins
|
TypeScript
|
Code
| 150 | 378 |
import { ElementHandle, Page } from "puppeteer";
export interface IElementSearchOptions {
selector?: string;
innerHTML?: string | RegExp;
}
const findElementHandle = async (
page: Page,
{ selector, innerHTML }: IElementSearchOptions
): Promise<ElementHandle> => {
if (selector) {
try {
await page.waitForSelector(selector);
} catch {
throw new Error(`Element that matches selector "${selector}" not found.`);
}
}
let targetElementHandle: ElementHandle | null = null;
if (innerHTML) {
const handles = await page.$$(selector || "*");
for (const handle of handles) {
const currentElementInnerHTML = await page.evaluate(
(element: HTMLElement) => element.innerHTML,
handle
);
if (typeof innerHTML === "string") {
if (currentElementInnerHTML === innerHTML) {
targetElementHandle = handle;
}
} else if (innerHTML.test(currentElementInnerHTML)) {
targetElementHandle = handle;
}
}
} else {
targetElementHandle = await page.$(selector || "*");
}
if (targetElementHandle) return targetElementHandle;
throw new Error(
`Element${
String(selector) && ` that matches selector "${String(selector)}"`
} with innerHTML "${String(innerHTML)}" not found.`
);
};
export default findElementHandle;
| 24,358 |
jbc.bj.uj.edu.pl.DIGCZAS002001_1920_166_2
|
Polish-PD
|
Open Culture
|
Public Domain
| null |
Gazeta Lwowska. 1920, nr 166
|
Rossowski, Stanisław (1861-1940). Red.
|
Polish
|
Spoken
| 7,611 | 18,097 |
W ten sposób odpowiadając życzeniom zsinteresowanej ludrości i zzpswaisiąc trwały spokój miądzy Polską i jej wschodnimi są stadami, To skłomłoby sprzymierzonych do zainicjowania pertraktacji o zawieszeniy brom i pokoju, Jeżeli zas pomimo propozycji Rządu polskiego rawioszenią bro ni, armje sowieckie będą kontynu owały posuwanie się naprzód, rząd wielkobrytyjski i jego sprzymie rzeńcy będą to uważały xa zamiar prowadzenia z ludem polskim wal Ki, i ze względu aa to dadzą Polsce wszelką pomoc, Rząd angielski xwraea uwagę na to, źe w razie inwazji Polski przez Bosję sowieeką, nie mogą być kontynuowane pertraktacje o podjęcie stosunków handlowych i dlatego telegraficznie dano znać p. p, Kamieniewowi i Krassinowi, aby wstrzymali swój wyjazd do czasu, gdy będzie wyrażona zgoda 6 zawieEzenie broni. Prasa zagraniczna o propozycji zawieszenia broni. Dxisaniki londyńskie komentują kryzys polsko-rosyjski jak następuje: Jeżeli rząd sowietów chee wsjny, sarzymierzeńcy, jsk kolwiek niechętnie, podejmą ją. Złudna jest nsdzieja, aby uduło się uratować Polskę przez rokowania z Leninem. Bolszewiey chcą nai widoczniej zyskać Rx czasie, Jetwli Leninowi i Trockiemu udało się ujarzmić Bozja, te jsdnakża nie można im pozwolić, aty stali się panami Europy. Nie możza zamykać cezu na niebozpieczsństwo, grożące pokojowi euro pejskiewn wrazie inwazji bolszewickiej do Polski. Jes'eśmv obowiązani przeszkodzić jej upadkosi. Garreta Espress podnosi niebez pieczeństwo mowaj wielkie) wojny, jaka może wyniknąć z kryzysu polsko-rosyjskiego. Daily Chronicle pisze: Sprzymierzeńcy radzą Puls:e, aby miezwłocznie wystąpiła do sowietów z propozycją rozejmu, To wyjaśni ostatecyBie, czy Rosja chce naprewdą po koja, czy wojny, Jeżeli bolszewicy będą się posuweli maprzćd i będą atakowali Polskę, sprawa nabierza odrazu bezpośredziego ža czenia, niatylko dla Wielkiej Brytanji, Ele i dl: wszystkich exłomków Ligi narodów, która zobowiązzła się bronić Polski przed inwazją. Daily Express tnierńzi, ke jeań oczywi stą miem.żliwością, aby rząd angielski mógł prowadiić pertraktacje handlowe z rzędem sowietów, o ile wojska kolszewickie wejdą w granica Polski, To też, jak donoszą, rząd angielski miał zawiadomić Krassina i Kamie niewa, że radzi im, aby odłożyli swój przy á wietów natychmiastowe zawieszenie bron! j+zd do Lomdynu, dopóki stamowisko rządu; „acwiatów mie będzie mależysie wyjaśnione. 'Nota angielska była jedynie wyrazem pra ' gaienia, aby stan wojenny został zakcńerony. Wudłsg doniesienia Timesa nieściałe są dzmiesienia z Kopenhagi o podporządko wsnin Krassina Kamieniaewowi. Krassia ma pertraktewać w dalszym ciągu w sprawach finapsowych, zaś Kamieniew w sprawach dy plomatycznych. Początkowo projektowano wy: słać Raćka Sobelsona, jednakże na wajosek Trockiego Radek zajął się sprawami Polski. W czasie nieobecności Krassina rosyjska đe legacja handlowa w Londynie była nieczyn na. W Londynie powatać ma bank, który już zarejestrowsny został urzędowo jako To warzystwo rosyjskiej delegacji handlowej. Dyrektorem tego banka będzfe zamianowany Krassin. W drodse do Anglji ma g.e znajdo wać złoto rosyjskie wartości 2 miljonów funt. szterlingów, Stosunki polsko węgierskie, Wydawane w Warszawie czssopismo Rząd i Wojsko zamieść ło tej, W ska o Biosusku Polski do Węgier. odpowie dzi na to, pojawiły się x poważnej Strony węgierskiej uwagi krytyczne, których autor, podnoszą? nieprzychylny dla Węgier na strój pewsej części prasy polskiej, oraz ms łe zainteresowanie Się stosunkiem do Wg gier w opiaji polskiej, pisze dalej, co na stępuje : Wielka część Węgrów, którzy w roz maitych sprawach przyjeżdźają do Warsza wy, wyjeżdia stąd rozesazowaRa, Wszystkie bowiem okoliexności robią deprymnjąee wra żenie na Węgrzech, każą im sądzić, ża wig ksza część Polaków jest przeciw Węgrom i nie przgaie przyjaźni polsko-węgierskiej, — Autor wsmiapkowanych artykułów w Rsą dzie i Wojsku piaze, że Węgry mają do wy boru między sojuszem x Polską, a sojuszem z Niemcami i że Polska całą siłą masi dy żyć do tego, sby zapewnić auchie przyjsźń Węgier. Ze strony węgierskiej rzeczyw)ście robiono wszystko, sky zbliżyć się do Polski, nie możemy niestety powiedzieć tego o Pa iakseh. Jakie mogą być tego następstwa, nie trudno ośgadRąć, Z k«ńeem wojny rozwinęła się na Wọ grzech bardzo wielka amtypstja, a właściwie nienawiść do Niemców, Powodem była ich polityka i grabież w S:edmiogrodzie. W Buadaposieie mówiono wtedv, że ła twiej będzie się można pogodsić z Rumuna mi, niż z Niemdiami. Do tego przyłączyła sig jegieze ta okoliszność polityczna że x powodu upadka imperjalistycznej Rosji Wọ ry już mie potrzebowały potęgi niemieckiej jako przeciwwagi, Przyszedł doskonały mo ment dla państw koalicji i dla Polski, aby wyrwać zusełnie Węgrów xe sfery intore sów i wpływów Niemiec i pozyskać ich dla siebie. Nie zrobiono tego, co więcej, pode ptano i powaleno ten dumny naród. Polska patrzyła na to obojętnie, a pewna jej część nawet zə złośliwą radością, Podeptawy i od ian krwawy Węgier próbuje się dalej wlec, prosi przejeżdźu' ącego Polaka, aby go wziął na wóz, lecz ten odmawia, Cóż ma teraz ro bić tem osłabieny i bezsilny Węgier, jeteli jedzie za nim wóz niemiecki, który go xa praBza ? Czy ma odmawisć ? Powtarzamy: ziems ohacnie żadnego związku między Węgrami i Niemcami, ale w ostatnich czasach w społeczeństwie wę gierskiem daje się zauważyć pewna oziębłość w stosusku do Polaków i pewne zaintere sewanie w stosunku de Niemców, włnśmie z powodu zachowania się Polaków wobec Węgrów. Można to zauważyć także i w pra sie węgierskiej, które przadtem x bardzo go ręzemi apelami zwracsła się do Polaków, s teray zemilkła. Oxy ci wszyscy, którzy tak występowali pizeciw Węgrom zdzją sobie sprawą 3 tego, ża swojemi napaściami pin cują tylko pour le roi da Prussa? Na kożiec jeszcze jedno, Autor artyku łu, 2 którym polemizujemy pisze, ża dla do brych stosunków polsko-węgierakich konie eine jest zbliżanie się Węgier do Remaaji i że pośrednikiem międsy nimi powinna być Polska, Węgry mie wzdragają rie zbliżeć się fo Rumunji misio tego wszystkiego, eo ta wobec nich popełniła, Będą osi bardio wdzięczai Polsce, jeżeli przyjmie rolę po średnika, bo Wąęry są gotowe złożyć tę wielką ofisrę na ołtarzu brzteratwa polsko węgierskiego. Ale inicjatywa musi wyjść za trony Rumunji, bo przecież w jej ręksch jest Siedmiogród, Ona musi zaprzestać nie ludzkich prześlidować żywiołu węgierskiego w Siedmiogrodzie i musi zaprzestać polityki eksterminacyjnej, a>y mógł powstać modus vivendi między nią a Węgrami. Masi ona zabezpieczyć prawa mniejszości w Siedmio grodzie. Polska mcgłaby ważną rolę edegrać pod tym wsględem*. wsi Wólka pod Lublisem, przywieźli do Lu blina ochotuików do wojsxa, dezerterów 3 sobliskieh okolic odńali władzom i ofiarowali konie, oraz artykuły spożyweze Ra rzecz ar wji W imienin Wólki prsmawiał w Lubli nie p. Franciszek Pacek, nawołujące włościan, słowami estuzjazmu do składania wszelkich ofiar na col armji, Przykład włościan B:i Neutralność Niemiec. —— Oświadczenie w sprawie neutralności Niemiec w wojnie Polski x Rosją sowiecką, ogłozione w Reichsanzeigerze i podane wczo raj do wiadomości prasy p lskiej, zostało spe ejalnie zakomunikowane Ministerstwu spraw zzgramicznych przez posła niemieckiego w Warszawie. Ofiarność włościan, Włościsnie xe Ńwidnika. jaka też ze daiekich i Wólki już echo odnalazł w Krzczo mowie, którego mieszkańcy złożyli Sporo AT tykułów spożywczych dla szpitsia wojsko wego. Z niemniejszem utnawiam zapisać na leży rozumne postanowienia i uchwały wło Ścian paretji Abramowice, gmina Zemborzy ce, zapadłe na zebraniu parafjalnem, na któ rem zebrało sią około 1,500 «sób. Po krótkiej przemowie uchwalono mia nowicie akcję Obrony Narodowej w Lublinie wszelkiemi siłami esymnie popierać, w dowód czego opodatkować wię składką 10 Mk. z morgi (3 parafji, w której snsjduje się 9 000 mor gów wpłynęłoby 90000 Mk), dniej urządżić natychmiast dobrowelną zbiórkę produktów rvlnych, drobiu, zwiersąt gospodarskich, oraz bielicay na żułnierza polskiego 1 dostawić je do Komitetu Głównego w Głusku, celem od stawienia do Komitetu Wojewódzkiego. Ponsóte uchwaleno popierać czynnie pożyczką psństwową; zobowiązać wszystkich parafjan do zapisania się do T-wa Cterwo nego Krzyża x roczną składsą po 30 Mk.; do etarczać bezpłatnie, ile każdy będzie mógł, mleks d» szpitali Czerwonego Krzyża dla ranny. h i chorych śćłnierzy polskich; zobo wiąrać się (zamożniejsze rodx'n*) do przyję cia po jednym nieramożnym żcłoierzu x wy leczonych już w szpitalu, a potrzebują ych naleśytego odżywienia. Dia załatwienia tyeh wszelkich spraw, jakie wynikają x obecnego położsnia kraju wybrano Komitet Główny z siedzibą w G”u sku, któremu podiegać będą Komitety wiej skie, składające eię x pięciu osób, w tem dwie kobiety, zostające pod przewodnictwem sołtysów, Przykład włościan parafii Abrsmowie powinien zxnsleźć liesaych naśladowców. Tak rozumiejąey swoje obowiązki wobec Ojczyzny włościsnie upańć jej mie dadzą, przed wro giem ją obronią. Sytuacja w Czechach. Wedle TVenkova, przyczyną strajku W półaocnych Czechach nie był brak serowi zacji, lecz momenty politycune, Żywioły ko: munistyczae niemieckie propsgu s tam utwo rsezia rad robotniczyrh opartveh o rady ro bota cte na Błowaewyźaie, Czeskie Słowo P' sze, że stosunki w obszarach, objętych ktrej kiem zwłaszcza w okręgu Jabłomicy, powin ny być ostrzeżeniem dla rządu czeskiego. Rsąd musi baczyć, aby żywioły przewroto we nie doprowadziły do nieszczęścia spokoj nych robetników. 3 W Liberen straik trwa dalej, a w Li tomierzycach przyszło nawet do demonstra cji przed gmachem starestwa, Wedle doniesień dziennitów, mad pól motną węgierską grazicą ogłosił rząd wę gierski cząściową mobilizację, a powodem jej ma być nadziejs, że komisja reparACyj na zmieni granicę na korzyść Węgier. Komunikat. Od Nadzwyczajnego Komisarjatu do zwalerania epidemii w Małopolsce otrzymu jemy następujący komunikat: Wobec tego, że pewna część społeszeń stwa i prasy mie pojmuja zadań istniejącej we Lwowie od dwóch tygodni stseji kontroli czystości i sądy ewoje opiera ma podaBiach osób mie znającrch rzeczy i sposobu fuskcjo nowsuia stacji, uwałam z3 wskazsne wy jaśnić : 1. że stacja koatroli czystości została otwarta na skutek poleconia Nadzwyczajnego Naczelnego Komisarza do spraw walki 3 epi demjami urzędującego w Warsvawie. 2. Diacje kontroli czyane przez osły dzień (aa dworcu od § rano do 13 w Rocy) przy ul, Rutowskiego od 8 rżno do 8 wie etocrem, prsy ul, Krasickich od (8 rano do 13 i od 3 de 5) są zorganizowane tak, że csoby czysta otrzymują świadectwa w eiągu 2 mi nut, jedynie Indsie rawszawieni narażają się na bezpłatną kapiel i desysfekcję, poctem dostają świadeetwa enystości. Tłoku w biu rach nigdy nie bywa. urzędnicy państwowi i komusalni, orsz inteligencja zawodowa otrzymuje Ba żądznia świadeatwa miesięczne w biurze przy ul. Krasickich, 3 Ruchu awskuacyjaego wyfswanie dwiadeetw erystości nie hamuje, głyż trams porty uchodźców sze wschsdu pod kontrolą wojskową przejeżdżają przes Lwów bsz watrzemsnia nrrędnicze zaś rodziny wyj*ź' dłająca Ba zaradzie kart Jura, tem samem wolne są od świadectw czystości, 4. W skrezie od 6 do 18 lipe: przez skacją czystości wo Lwowie przeszło «sób 36 560, a od 13 do 20 lipca 20819. razem csóh 57879. Z pośród nich wysłano do kapieli i odwszawioao 3842. Beznitaty dris łania stacji są iuk dziś widoctne; podczas kiedy w pierwarym tygodniu funzcjono wania stseji iiexba osób, kierowanych do kąpieli, wynoasita od 200-400 dsieenie, w ostatnich dniach liczba ta wynosi zaledwie kilkadzie sigt, Miesskańcy zrozumieli, że wybierając się w dogy nzleły być crystym. Mycie wagonów 1 czystość Bodróżiych jast jedayra x wsźżsiejszych sposobów zapobiegzjących szerzeniu się robsctwa, a tem samem epide wji tyfnsu. Komiserjat niezależnie od tego wystą” pił do Naczelnego Nadzwyczajnego Komiza rza o porwolenie czasowego zamknięcia etaeji lwowskiej, Ue o O POLACY? Pamiętajmy o plebiscytach! Datki przyjmuje Komitet Obreny Kresów Zachadnich, Lwów, plac Ma rjacki i, 10. KRONIKA Lwów 23 lipca 1930. Ralendars. Sobota, 34 lipca, Rym. kat: Krystyny. Gr. kat: Jewtym. i Olby. MowiańskiSławosza, Wschód słońca s godzinie 4 mieni 19 sachód słońca © godziwie 8 minut 56 Tamparaćcra 6 godzinie 13 w połndnie 25 stopal. — (Z) Wieem!tnister spraw zagrani cznych dr. Stefan Dąbrowski przyjeżdża duś do Lwowa i przyjmować b;dzie dziś, w piątek, od 4—6 po południu, a jutro, w sobotę, od 11—1 w połuduie w gmachu Namiestsictwa, Dr. Leonard Stahl wieeprez. m, Lwowa hswił wczoraj w miejscu postoju dowództwa froutu i odbył konferencję » gen. Iwaszkiewiezem. P. dr. Stah! jest pełnomo* enikiem warsz. komitetu wykonawczego gen. Hallera, %xawiązanego celem propsgandy in formowania oddziałów ochotniczych i two rzenia komitetów MSO. — P, Władysław Jaroszyński. głó way pełzomoenii Pol, Czerwenego Krzy* ia przy Naczelaem Dowództwie bawi wə Lwowie. P. Jeroszyński udaje się na front gea, Iwasskiewicza, esism rdbycia inspekcji zlazówek i punktów opatruakowych P, Czer. Kryża, — (Z) Nowy szef sztabu general nego. Z Warszawy nadeszła wiadomość, łe szef»m ssiabu generalnego Naczelnego Do wództwa został grn.Tadersz Rozwadowski. G -morał Rozwadowski był szefem sztabu goneralnego w pierwszych dniach tworzenia się Państwa Polskiego w r. 1918, poczsm xamianowany został dowódeą armii „Wschód“ która broniła Lwowa w najcięższych chwi* la h. Generał Rozwadowski pracował ns stępnie dłuższy exs za granicą w Paryżu. Londynie i Bukareszcie, biorąc żywy udział w szragu akeyj wojskowo dyplomaty cznych. Ostatnio gen. Rozwadowski bawi w Sraa, jako reprezentewt polskich włads wujskowych. — Bada szkolna krajowa podaje dO wiadomeści, że podauia o przypuszczenie d0 egzaminu dojrzełeści w terminie jesiennyBł b. r. w gimnazjach, w gimnariach realgych stkołach realnych i liceach, tak publicznych: jak i prywatnych z prawem publiczności, | | —— należy wnosić do Rady szkolnej krajowej Ra ręwe Dyrukeji iajęótciej do 10 sierpnia 1920. Po upływia tego terminu wniesione Podania będą berwarunkowo xałstwiane od mowaie --—Dalag:t Ministerstwa Wyzn ń Religijnych i Oietac ni: Pabliernego Sobiński. — Utworzenie Agencji pocztowej W Baszni delnej. Z dniem 1 sierpnia b r. wchodzi w życia agencja pocztowa w Buszai dolnej, w miejsce swiaigtego urzędu poczte Wego, Ageacię pocztową w Baszni dolkej przydziela się do urzęłu Bocztowego w Lu aczosie, jsko urzędu zbiorczego. Miejscowy okręg doręczeń agencji Bo ztowej w Baszni dolnej, tworzy gina i obszar dworski Ba Sznia dolna, zuś gminę i obszar dworski Basznia górsa wraz z ubezerami dworskimi Sieniawką, Reichau, Huta Krzysztsława i Bo Tową górą i przysiółkiem Tyrie: przydziela Się do zamiejscowego ckręgu dorgczeń tej agencji gocztowej, — Przemiana urzędu pocztowego Kamionka wołoska na sgencjg pocztową, Z dniem 1 sierpnia b. r. przemienia się urząd Boeztowy Kamionka wołoska ma agencię pocztową i przydsiela się do ursędu poezto wego w Rari» ruskiej jako urzędu zbiorczego, Z powodu tej przemiany dotychezzstwy okręg doręcień nie ulega zmienie, — Z listy szlachetnych czynów. P. Michał Karski właściciel Włostowa w San domierskiem, ofisrował pełne utrzymanie 1 mieszkanie dle 25 żełnierzy rekenwalescee tów. Na tea esl hojny ofiatodawca praczna czył cały dwór z ogrodem we Włostowie. Zauważyć należy, że p Karski oprócz połnego utrzymania 20 rekenwaloscemtom ofiarow:ł £ościnę, potrzebsym dla chorych sanitarju Bzoma i pomocy lekarskiej, — Ursędniey i fankcjonarjusze rke. Banku kipottcznego złożyii 6750 Mk. na rzecz Armji ochotniczej, Za dar składam naj Bordcczniejsze podziękowanie, Lamesan Salins gem-por. m, p. — Dowództwo Małopolskieh Oddzia łów Armji oehotnietej wzywa osoby mo gace poświęcić kılxz godzin dziennio pracy ivrewaj, sgitacyjnej it. p. więc urzędników, sędziów, profesorów, nauczycieli ludowych, by zgłazsały Swój współudział w. pracy u kap, Sulimirekiege, Lwów, ul, Akademicka 5 IŁ. p. od god:. 9—1 i od 8—7 wieczorem Mączyński pułk.-krygadjer, — Wymarsz na front. W czwartek 22 lipca od:sxła w polformacja miarszowa grupy kawalerji z „Dotachomeat" rotmistrza Abrahama. Po pożrgniniu i bł”gosławień= stwie ks, kapolana B:deniego przemówił do wódca grupy rotm, Krynicki, nawiszejąc do tradycji znanych z obrony Lwowa „Wilków“, którzy znowu zapełnili kadry, Kadry te pierwsza wyruszyły na front, stały się awan garda małopolsziej srmii ochotniezej Krótkie żołnierskie przemówienie xatońezył dowódea okrzykiem na cześć Naczelnego Wodza, z eR tusjaamemm przez „wiarę“ powiórzcnym, Obscni podziriali konie i świetny ekwipu nek, orax urbro'enie żołmierzy, samych sta rych wiarusów. Duch oddsiału rokuje nam najświetniejsze wywiązanie się z wielkiego zadania, — Wymarsz ochotników Sieradza. Ozawa Rady Obrony Państwa i Naczelnego Wodza zaalnyła żywy oddźwięk w serczeh młodsieky sieradskiej, ssczególniej wśród hsroerz”. Arpat powstał ogólay. I oto w tych dniach S:eradz pixozywzł chwilę pamiętsą. podobną do tei, kieły vo wskrzeszeniu Oj enyzny w listopadzie 1918 r, uierwBie sa stępy naszych zuchów szły na służbę wolaej matce Polsce, Rano o godz, 9 odbyło się a:bożaństwo w kościele f:raym. nchotnley przystąpili licznia do Komuaji św, Wymarsz na stacię nastąpił o godr. 2 wo poł, Na ryn ku z balkonn przem»wisli dr. Szybowski, p Konsnowiczowa i jeden z pauczycieli, Przy dźwiękach orkiestry sieradzkiej straży oguio wej 1e sztandarem s 1863 r. niesionym przez weteranów, i z0 sztandarem kolejarzy, rxszył zastę» ochotników przez ulice miasta do stacji kolejowej, Z balkenów sypały się kwisty pożegnania. Tłumy publiczności od prowadsały idącyeh w bój, Na stacji żegnał ich gorązemi słowy ks. Wilczyński. Chwila była rosrzewałająca: niejedna łza spłynęła go policzku, niejedao westchniesia wyrwało się x piersi. I poszli „w bój na zwy cięstwo..." -— Pożyczka Odrodzenia w powie ele brzeskim wydzje bardzo pokaźae re zultaty, która powiemy być srzykładem dla innych. Podpisali mięzy innymi: Jg bar Götz Okovimski 10 miljonów marek, Henryk Dolański z Radłowa 8 miliony. Julia Piat kowska z Z.bswvy 300.000, Adsm Jordna z Więckowie 100000, Btefas Dankowski z Stróży 360.000, Meiaser z Chsrzewie 680 tys., Nanezvcielstwo sztół powszechnych wraz z dziatwą sukelną 400000 marek itd. A co najbardziej pocieszające, — to, że nismniej obficie płynie pożyczka takża: ze wsi. y E — Mekeja skarbowa Rady miejskiej załatwiła onogdaj ma psisdzsniu pod prze wodnietwem prezesa B. Lewickiego 20 s*raw. Między ismemi rstanowiono nową ta ryfę opłat targowych (rf Oblp) i zarupiano ławki do szkoły Ksnsrskiego, uchsa' ono przystąpienie gminy do Tow. zsgród dla polskich imwalidów (ref r. Wiaiars) wre sxeie w całym sxerega referatów przedsta. wionych przex radzych Hoeflugora, Folszty ma, Mojewskiego, Dra Pieraekiego, Wixla, And'zcjowskiego i Dra Ruckera załatwiozo sprawy rokonstrukcyj miejskich realności i budymków szkolaych. — Nowa Rada administracyjna Fun dacji St. hr. Skarbka. Po rozwiązaniu Wy działa krajowego nowymi członkami Rady admin'stracyjacj zostali: radny Szczyrek Jan i r. Pawłowski. Za strony Rady miejskiej sdsiadają : prezes B, Lewicki i dyr, dr. Zdzi sław Sluszkiewicz, Przewoduiczącym Rady admin. jest kurator Fryderyk hx, Skarbek, a jego nastąp”4 prezos Bolesław Lewicki, — Konkurs. Rada szkolna krsjowa ogłasza nisiejstesa konkars celem obsadze nia następujących sossd w pzństwowem gim nszjum żeńskism w Krakowie: 1. praday dy rektora ;dyrektorki), 2. jednej posady rseczy wistego nauczyc.eia religji rzym. Ket, 8. dwa posad rzeczywistych „nauczycieli (lek) fl olo gji klasycznej jako przedmictów głównych, . dwu posad rzsczywisych nauczycieli języ ka polski*go jsko przedmiotu głównego, 5. dwu osad rzeczywistych nauczycieli jęsyka niemieckiego lub francuskiego jake przed miotów głównych, 6. jednej posady rzeczy wistego mauczyciela historji i gografji jako przedmiotu głównego, 7. dwu poszd rzeczy wistych n<uczyciell mstematyki i fizyki jako pizedmiotów głównych, 8. jedaej posady rze czywistego nauczyciela historji naturalnej jako przedmistu głównego, 9. jedaej posady rzsczywistego nmsuczyciela chemji jako przed miotu głównego, 10. jednej posedy rzeczy wistego naucyciela rysunków i gesmetrji wy kreślaej jako przedmiotu g/ównego, 11. je dnej posady rzeszywistego mau:zyciela gim nastyki, Pobory i wszelkie dodatki wedle norm ustawowyab. Pesady zostaną obsadzene z waźnością od 1 września b. r. O posady te ubiegać się mog zarówno kandydaci jak kamdydatti (x wyjątkiem mr. 2) w podaniach opatrzonych odpisem dokameztów służbowych i dokładnie wypełnieną tabelą osobową za pośrednictwem swojej władcy przełożonej, jeśli już pełnią czynną służbę naucz, i wniesianych do Rady sskolrej krajowai we Lwowie najpóźsiej do końca lipca br. Dalegst Mia. W. R, i O. P. Bobiński w. r. — (wiczenia reflektora. Dowództwo warstatów automobilowych VI armji koms pikujs: W piątek 238 b. m. między godz. 10—11 w nocy edbędzie się na Wys, Zamku próba refłektoru, Jasi to reflektor sdobyszny zmontowsmy na automolilu, świeci ma prze 20 kim., naprawiony oR został w automobilewych VI zrmji we strzewi warstatach Lwowie. — Kenfiskacie uległy: Dziennik Lu dowy Nr 175 z 28 lizca b. r. xa artykuł p tu: „Rsdzieshów czy Radziwiłłów?* od początka do końca i Hromadska Dumka Nr. 169 » 28 lipca b.r., a to część artykułu p t: Odyn z fragmaatiw". — Żobranie Obywatelskie za xapro szepiami odhędzia sę w miedsielę 25 lipca 1920. o godz, 12 w południe w sali Sokoła Mac:erzy, u). Zimorowicza 8. Porządek dzien By: Obrona Lwowa i kresów, Zaproszenia będą doręczone Zmiąsek Organizacyj Naro dowych ws -hodniej Małopolski: Dr, Marceli Prószyński, wiceprezes; Józef Bialikiewiex, sekretarz. — Rowizje składów sukna. Ż Kra kowa teiegrafują: Jak podaje Ilustr. Kurj, Codzienuy wesoraj od wceszeen'go rena do późaego wieczora posterunki wojskowe w to warsystwie ajentów polieyjnych i żołaierzy policji państwowej przeprowadzały rewizje w mieszkaniach prywatnych krawców, oraz praeowzizów krawieckich, a te ma podstawie doniesień, poszukując msterjałów wojskowych pochodzących z kradzieży. Skonfiskowano znaczną ilość sukea na mundury wojskowa w sztukach oraz maicjszych ilościach jakoteż gotowe ubrania męskie i damszie zrobiona ż materji wojskowej. Rewizje te spotkały się z pełnem usza niem publiczności, — Siły bolszewickie. Niektóre pisma nasze podały erzesxdną, Ra aiczem Ris opar tą, ststystykę uił bolszewiekich, które mia łęby wynosić 8 miljeny, Jesteśmy w możao ści sprostować te dsme ma eodstawie depe szy dxisaniza włoskiego Epoca, przesłanej przez jego korespondenta s Moskwy, Na froa cia polskim jest 167.000 lud:i i 980 armat, ma froncie kaukazkim 82 000 ludsi i 449 ar mat, na froncie kazpijskim 58.000 ludzi i 100 armat. Główną siłę artylerji bolszewickiej stanowi 600 armat, wziętych po zosbiciu Kołczaka, a pochodzących z fabryk francu skich oraz takaż 'lość, odebranych wojskom sagielskim gen. Millera, ~Pęknięcie granatu. Jiustr. Kurjer Codziensy donost x Nowego Targu, że go spodzrz Terkowski, usiłując rozebrać zmala ziony gran?t, manipulował nim w ten sposób, że nastąpił wybuch i zabił ma miejseu Ter kcwskiego, jego ma:kę, syna, córkę, or:3 przechsdzą*ą ulicą gimnazisstkę Suską; nad to ciężkie uszkodzenia ciała odniosło kilku przechodniów, W szponach ochrany. Na ekranie „Apolla* odwróciła się jedna karta z przo stłości owej carskiej Rosji, kiedy wsxech władna ochrana weiskała się do każdego do mu irosrzucała bexlitośnie ogniska rodzinne. B-haterką tego nadzwyczajnego dramaiu jest piękna śpiewaczka SoRga. Uroda m!odej ko biety zwróciła ma siebie oczy wielkiego ks'ę cia, który otoczouy eałą sforą ochrazy. za pragnął zerwać dla siebie uroczy ten kwia tek. Podexns odśsiawania osery „Fidelis“ rorsttzygały się losy S»sgi. I mał: brako wzło, aby nie odebrano jej szezęścia i miła ści, Nadzwyczajna uroda artystki, śsietna gra, oraz żywa akcja dramatu stwarzzją film pierwszorzędny. YTalegramy P, A. TF. Kwestja interwencji. Rotterdam. Wielki orgam liberalny | p Daily News, którv stale występował prze ciwko interwencji E ropy zarhodniej w Bo aji — pisso obsenie że nota angielska wy: reźnie wskazvje, já skoro bolszewicy wkro eg do właściwych grzne Polski, Polska będzie miała do dyspozycji maszych ofieerów a prawd'podobaje i Focha Co się tyczy amumicji, — to wseho dnie Niemcy są całe zsładowase amuni eją i armatami, które w myśl traktatu mają być wydsne koalicji, Zapasy te nie dostaną się do Polski, jeżeli Rosja mie wkro czy do niej. Jeżeli zaś wkroczy, wszystko to będzie do dyspozycji Polski, Times podają, że po powrocie Lloyda George'a ze Spas, zebrał się zaraz g:binet ma naradę o sytuasji w Sprawie polsko rosyjskiej. Podniesiono, że obecne połeże mie w Polsce jest podobne jak w roku 1914 gły Niemcy wkroczyły do południowej Francji, Lleyd George o sytuacji. Poldhu (Radio), Lloyd George mówią w Izbie gmin o sytuacji polsko-roszjskiej eświadezył, że sprzymierzeńcy doszli do wniosku, iż muszą przedsięwziąć kroki, aby powstrzymać zalew Polski przez bolszewizm. Nota angielska została wysłana do rząäu sowietów po wyszerpującem omówieniu sy tnacji ze sprzym'erzeńcami i za ich zg-dą. Gzbinet rozyatrzył odpowiedź sowietów ma propczycję rozejmu i uznał ją za niewycz-r pującą. dlatego też została wysłana do M skwy draga nota, żądająca dxiszych wyja śmień co do zamiarów rząda sowieckiego. Manifestacja narodowa. Kraków. Z Krakowa donoszą: Komitst obrony peństwowej urządza w niedzielę ol brzymią manifestację narodową pod hasłem obrony wolności i na cześć jej obreńców, W skład uroezsystości wejdzie Msza po lowa, celebrowans przez ks. biskupa Sapiehę. Po Mszy nastąpi mowa rektora Uniwersytetu, potzem odbędzie sig pochód z trazspąrentami propagandy. W obronie kresów zachodnich. Warszawa. Wydział prasowy Minister stwa spraw zs:granicznych komuniku e: Dnia 28 lipca b, r. zsczymają się w Paryżu w ra dzie ambasaderów konferencje w sprawie Gdańska, oraz w sprawie Oiestyńsziego, Bpi sza i Orawy, Jako rzeczoznawcy polscy w sprawie Gdańska wsjschali do Paryża pp. Jachowski i prof. Malczswski, dla spraw Cieszyńskiego ks. Loadzia i int. Eiedroń, jeko znawca gór mietwa dr. Bonarkiewicz, jako referent kole jowy dr. Dąbrowski, sekretarz prefektury golskiej pastor Kulisz, obrońsa polskiego pro testantyzmu, w imieniu zaś Spisza i Orawy sygiępować będą w Paryżu Setkowiez i ks. Machsj, Przyłapanie Beli Kuhna i tow. Głdańsk. Dzisaniki donsszą, że wczoraj ma statku rremigracyjnyrmi „Lixbona* areszto wano Balę Kuhna, Lewina i kiiku imnych wybiteych komunistów w chwiii, gdy chcieli udać się do Moszwy, NK IZ ostatniej chwili. Sytuacja wojenna. (Godz. 13:45 pop.) (S+ Z) Jak wynika z komunikatu. sztabu generalsego N Dowódzi=a, sytuacja nasza ogólna znacznie Się popra wiła. Na linji Zbruczu wojska nesze odpie ra”ą silne ataki n'eprryjsciela, Na pałudnie tej linji walki zakończyły się wyrzucesiem nieprzyjaciela poza Zbriex, W rsjonis Łuck-Dubao-Krzemie aioe toczą się dalej zacięta walki, które rozwijaią się dla nas nomyślnie, Dziś bawił we Lwowie iaden z bardzo dzielnych efizerów frostowych major M a t csyński, który przez 20 dni wraz z boha terska załogą trzymsł się w Dubnie, Gan, Iwaszkiewicz o sytuacji. Od naszego korespondenta wojennego). * 28 lipca 1920 Gen. Iwsstkiewicz tak się wyraził o sytuacji ra froncie, w cbrębie iego armji: — Nieżowadzewie ni f ozci: i ustawi= «zma, ciężkia walki podczas cofania sig na fron'ie, nie zdemoralizewsły mezo bohater skiego żołnierza z takiem poświęceniem bro= niącsgo granic Rzeczy posyolitej. Mim» przemęczenia. bija się on znako misie ij tem gdzie ze:knie się z oddziałami nieprzyjaeie'skimi i zmusi je do regularnej itwy, te pierzchają nie wytrzymując ude rzoń naszych, Uofanie się spowodowane; było zagro żeniem tyłów przez kawalerją bolstewicką, która jedmak boju nie szuka, sieje panikę poza linją bojową i nspada ma tabory, Przeciw tej metodzie walki bolszewi= ków są dwa sposoby, która powinniśmy w czya wprowadzić. Trzeba zas'leć naszą ka= wałerję coraz nowymi oddziałami. Do tych odósisłów powinica iść żołnierz umiejący dobrze jeździć, wyćwiezony i odwsżny. Orgsniracje ochotzieze powinny być skoncentrowane celeka ochromienia tyłów i punktów węzłowych, by stawić skutecznie czolo oddziiłom, które przez front się prze dzierzją. Gdxiekolwiek taki oddział napotka na opór Wojsk Polskich, walki nie şrzyjmuje, ucieka. Ladność miastowa nio będzie się bać tyeh konnych oddziałów niezrzyjacielekich, jsżeli ochotnicze formacje oksadrą należycie tyły i punkty węzłowe. Dla ludzości męsviej exse jest wycofać się z exzęści zagrożomych, w najgorszym ra zie z frontowymi oddziaławi polskimi. Jeżeli dzieje się to prędzej, żołnierz nasz pozbawiony jest mo» ralnej podstawy i to musi działać ujemnie". Nastę»nie mówił gemerał Iwaszkiewicz o nastrojach ludrości polskiej i tak się eo do tego wyrasił: „Meogo żołnierra, który wsleząc szedł zwycięsko naprzód, witsła ludn'ść polska wszędzie bardzo owacyjnie, To było moralną pomorą dla *ołmierza i dawało mu sił do zwyeięstwa, Dziś, gdy niepowodzenia nas spotykają, nis wolno jest ludności odmawiać żołaierzowi tej moral nei pomocy, którą okazywała ks chwilsch zwycięstw. Zachowanie się ludności wobec żołnie rza polskiego uważam jako rzecz pierwss0 rzędnego zRaCzeNia. Probierzem sił narodu — zakcńszył ge meral Iwaszkiewicz — jest nie entu xzjazm podczas zwycięztw, ala prze trwanie w chwilach niepowodzeń“ St. Zachariasiewicz. (Z) Minister koleji dr. Bartel przy był do Lwowa, S 5 Śasassgy | GAPO TARAR SPLWTYSP AW PSP E NADESŁANE. Zo to rubrykę Redakcya nia bierze odpowiadzialności: 3X APOLLO % Dziś! Nadzwyczajna nowość rosyjska! 3X Po raz pierwszy we Lwowie ZG W szponach X% x carskiej Ochrany x Niezwykle wstrząsający dramat 5 akt, RX "=", 6 Rozmaite obwieszczenia. (7293) Pr. 2053 18/20 (2) Obwieszezsnie. Pam Prezes szdu apelacyjnego w Kra kowie zamianował na trzecią zwyczsjną ka d:neję sądu przynięgłych w sądzie okręgo wym w Wadowicach, która się rczpocznie dnia 30 sierpnia 1920, przewodniczącym Trybunału sądu przysięgłych Prezesa sądu okręgowego dra Karola Bivgańskiego, zaś za stępcami przewodniczącego Wiceprezesa sądu okręgowego Stefana Zapałowicza oraz sę dxiów okręgowych Jozefa Hańskiego, Wła dysiawa Majewskiego, Jaka Lisichamscheide ra, Wineentego Ksvęzkiego, Józefa Miodoń skiego, Ludwika Diekmsna, Błażeja Pawlika, Szczepana Nikliborca, Romana Kubiczka, dra Antokiego Banasia, Stanisława Kuźniarowi cza i Eugeniusza Hóruntera, Prezes sąda okręgowego. Amortyzacja. Ne. II. 19/20. Na wniosek Leiby Mei selmana, kupea w Zaleszczykach zarządza się postępowanie eelem umorzenia wymienio nych niżej papierów wartościowych, które miały zaginąć i wzywa się posiadacza tego papieru wartościowego, aby zgłosił swe prawa do jednego roku od daty tego edyku. W razie przeciwnym uzkałby sąd po upływie tego terminu ten papier wartościowy jako pozba wiony znaczenia, Oznaczenie papieru wartościowego : Kartka zastawnicza Nr. 58963 wystawiona przez Bukowińską Kasę Oszczędności w Czer niowcach, Sąd powiatowy, Oddzisł II, Zaleszezyki, 21 marca 1920. (7175 2—3) Ne, VE, 386/18/4. Na wniosek Stefsnji Alimurka, w Sniatynie, wdraża się postypo Ks. Aleksandra Strusiewicia w Bucowie po dejmuje się postępowanie celem umorzenia Oznaczenie papiera wartościowego : Wystawiona na Edmunda Bohacsyka Polica wymienionego nizej papiera warieściowego, | Towarzystwa wzajemnych ubezpieczeń w Kra który waieskodawey miał zasinąć: Wzywa | kowia z 6 czerwca 1903 L. 80631 na kwotę się posiadacza tego papieru, aby go wciągu | 1000 kor. platae oksxicielowi. jednego roku od dnis ogłoszsnia zarzędze nia przedłoży temu sądowi, *akie inni in teresowani maja zgłosić swoje zarzuty prze | Kra”ów, dnia 16 kwietnia 1920, ciw wnicskowi. W razie przeciwnym vznałby Sąd na ponowny wniosek po upływie tego terminu ten papier wartościcwy Z% umorzony. Oznaczenie papiera wartościewego : Wystawiona na ks. Aleksandra Strusiuw)cza polica Towarzystws wzajemnych ubezpie czeń w Krakowie z 4 lipca 1887 L. 17629 aa 3000 złr. w, a, płatne okasicieiowi, Sąd okręgowy Oddział VI. Kraków, dnia 16 kwietnia 1920, Sąd okręgowy, Oddział VI. (5047) T. VIL 59/20 (2). Zarządzenie umo rzenia ptpierów wartościowych, Na wniosek Adolfa Maurera w Krskowis podejmuje się postępowanie celem umorzenia wymienic mego niżej papieru wartościowego, który miał wnioskodawcy zgginać. Wzywa się po Biadacza tego papieru, aby.go w ciągu je dnego roku od dnia ogłoszenia zarxądze nia przedłożył temu sąjowi, także inni (5045) |interesowani mają zgłosić swoje zarzuty przeciw wnioskowi. W razie przeciwnym T. V. 86/20 (2). Zarządzenie umorzenia | usnałby sąd ma poRowny wniosek po upły papierów wartościowych. Na wniosek Józefa | wie tego terminu t:n papier wartościowy za Friedmana sot-rjusza w S.łotwinie podejmue | UMorzony, je się postępowanie celem umorzenia wymie Oznaczenie papieru wartościowego : Na wanie,, celem amortyzacji zagubionych rze komo kartek zastawniczych Nr, 36.322, 40.002 i 48,984 Bakowińskiej Kasy Oszczędności nionych niżej papierów wartościowych, które | okaziciela opiewający kwit zastawniczy Ban wnioskodawcy miały zaginąć, wzywa cię po-| ku hipotecznego filji w Kzskowie Nr. 29.116 siadacza tych papierów, aby je w ciągu :z8-| na los turecki i los austr. zakładu kredyto Prez, 22067 (7305 1—3) Konkurs. W myśl ustawy z 10 maja 1919 r. Nr. 298 Dz, p. p. mają być obsadzone sia nowiska prezesów miejscowych Komisji sza cunkowych w Sokalu, Bohorodczanach, Ska. łacie, Kamionce Htrumiłowej i Brodach, tu dzież stanowiska wieeprozesów takich komisji w Podhajcacb, Borazczo sie, Sukslu, Dobro mila, Mościskach, Nadwórnie, Bohorodcza nach, Tłamaczu, Doliaie, Skelem, Trembewli, Zaleszczykach, Husiatynie, Skałaeie i Bro dach. O stanowiska te mogą się ubiegać byli sędziowie, adwokaci, notarjusze, kandydaci adwokatury i motarjatu, wreszcie osoby, po siadające wykształcenie prawne ursędników państwowych,„albo pracowkicy społeczni £ ta kiem samem wykształceniem (Art. 1 ustawy z 20 lutego 1930 Nr, 98 Dz, p. p.). Udokumentoważe podania kompeten eyjne kaliży waosić do dnia 5 sierpmia 1920 na ręce Presydjium tego sądu okręgowego, na którego obszarze ma urzędować ta Ko misja szacunkowa, na którą kandydat refle ktuje. Qidyby w vkresie koukursowym Pro zydjum odaośnego Sądu okręgowego nie było ezynne należy wniesć podaaie wprost do: Prezydjum sądu apelacyjk:ge we Lwowie. Lwów, dnia 16 lipca 1920, Prezes sądu apelacyjnego, w Czerniowcach ma zastawione: 1. złoty ma szyjnik i 2 złote pierścienie za 17 kor; 2. słoty naszyjnik, 1 srebrny, długi łańeuszek i 1 srebrną bramzoletę za 14 kor, i 8. złotą bramzoletę i 4 srebrme łyżki za 16 kor. Posiadacza powyższych kartek zastz wniezych wzywa się, aby się zgłosił ze swo jemi prawami w ciągu 6 miesięcy, w prze ciwnym bowiem razie po upływie tego cza30 kresu zostaną uzasne te prawa sa nieistnie jące. Sąń powiatowy, Oddział VI. Sniatyn, 28 czerwca 1920. (7178 2—3) T. VI. 183/20 (2). Zarządzenie umorze nia papierów wartościowych. Na wniosek Heleny śżałkowskiej w Krakawie, podejmuje się postępowanie celem umorzenia wymienio nego niżej papieru wartościowego, który wnioskodawczyni miał zaginąć; wzywa się posiadacza tego papieru, abyj go w ciągu 6 miesięcy od dnia ogłoszenia zersądzenia przedłożył temu sądowi, także inni intere sowani mają zgłosić swoje zarzuty przeciw wnioskowi. W razie przeciwnym uznałby sąd na ponowny wniosek po upływie tego ter minu ten papier wartościowy za umorzony, Oznaczenie papieru wartościowego: Książeczka wkiadkowa Towarzystwa Zali exkowego w Krakowie Nr. 9248 ma 1050 K opiewająca ma Helenę Małkowską, Sąd okręgowy, Oddział VI, Kraków, dnia 12 maja 1920. (5521) T. VI. 157/20 (1). Zarządzenie umo ścia miesięcy od dnia pierwszego ogłoszenia wego ziemskiego. przedłożył temu sądowi, także inni intere sowani mają zgłosić swoje zarzuty przeciw wnioskowi. W razie przeciwnym uznałby sąd | Kraków, dnia 16 kwietnia 1930. po upływie tego terminu te papiery war tościowe za umorzone. Sąd okręgowy, Oddział VI. (5525) T, 134/19 (3). Zarządzenie umorzenia Oznaczenie papierów wartościowych: | papierów wartościowych, Na wniosek Sa Dwie książeczki wkładkowe kasy ossczędno: ; lamona Blati» ruetnika w J:rosławiu po ści miasta Tarnopola a to: som. na 49 kor. 16 hal. i; Teodozji Sokoł »w skiej wystawiona. Sąd okręgowy, Oddział V. Tarsopol, dnia 3 kwietnia 1920. T. V., 88/20 (2). Zarządzenie umorzenia papierów wartościowych. Na wniosek Boży Petor:iel passz adw. dr. Henryka Regenko gowa we Lwow ul. Panska 1 11 a, podejmuje się postępowanie celem umorzenia wymienionjch niżej papierów wartościowych, które wnioskodawcy miały zaginąć; wzywa się posiadacza tych papierów, aby je w ciągu 6 miesięcy od dnia pierwszego ogłoszenia przedłożył sądowi; także inni interesowani mają zgłosić swoje zarzuty przeciw wnio skowi. W razie, przeciwnym uznałby sąd o upływie tego terminu te papiery warto ciowe za umorzone. Ozuaczenie papierów wartościowych: Karta xastawn esa filii, Banku hipotecznego w Jarnopolu Nr. 56.142 na zastawione tsmże dnia 14 stycznia 191% następujące przedmioty: 1. męs:i zegarek złoty amory kański z łańcuszkiem, 2. damski słoty %0 1. Nr. 19065 | dejmuje się postępowanie celem umorzenia i ma nazwisko | Wymienionegoj niżej papieru wartościowego tóry, wnioskodawcy miał zaginąć, Wzy wasię posiadacza tego papieru, aby go w ciągu 6 miesięcy od dnia ogłoszenia zarzą (6352) | dzenia przedłożył temu sądowi także inni interesowani mają zgłosić swoje zarzuty przeciw wnioskowi. W razie przeciwnym uznałby sąd po upływie tego, terminu ten papier wartościowy za umorzony, Oznaczenie papierów wartościowych : Książeczk:, Kasy osxćzędności m. Jarosławia Nr, 11486 na 1244 kor, 20 hal, zastrzsżona hasłem, Sąd okręgowy, Oddział V. . Przemyśl, 24 lipca 1919. (6396) T. V. 829/19 (4). Na wniosek Debory Słomowicz ze Lwowa, Rynek l, 29, wdraża się posiępowauie celem amortyzacji nastę gującej, rzekomo przez wnioskodswczynię zagubionej karty zastawu Kasy oszezędaośc. miasta Przemysia z 1 lipea 1514 Nr. 18,181 opiewającej na złoty damski łańcuszek 1a stawiony na lit. M za kwotę 56 kor, Posiadacza powyższej karty zastawu rzenia papierów wartościowych. Na wniesek Mendla Fellera w Czerniowcach podejmuje gtrex amerykański z wsadxonym brylantem | wzywa się przeto, aby zgłosił się ze swojemi z łańcuszkiem i zasuwą, 8. dużą sreb: ną prawami w ciągu szesciu miesięcy, w prze chochię gładką, 4. małą srebrną chochelkę | ciwaym bowiem rasie po upływie powyższe Licytacye. E., 148/20/5, Jest wdrożona przymu sowa licytacja realności lwh. 107 gm. Du kla składająca się z pb. lk, 269 i pgr. lk. 208 realności iwi, $87 gm. Dukla skiada jaca się z pgr. lk, 230, a na pb. lk. 269 wybudowany jest budyack :xurowany blachą kryty, częściowo zniszczony, Realnosci te są własnością i wposiadaniu Mendia Lesera Weiabergera, Wszystkie osoby, utóre roszczą sobie do powyższych realaości prawa rze czowe (własność, służebność, zastaw lub też inne prawa) wzywa się by je zgłosiły maj później do 15 sierpnia 1920 w tut. sądzie ~ pisemnie lub ustnie, nie sgioszoke w termi się postępowanie celem umorzenia wymie nionego niżej papiera wartościowego, który wnioskodawey miał zaginąć ; wzywa się po siadacza tego papieru, aby go w ciągu je daego roku od dnia ogłoszenia zarządzenia przedłożył temu sądowi, także iani intere suwani mają zgłosić swoje zarzuty przeciw wmioskowi. W razie przeciwnym uznałby sąd na ponowny wniosek po upiywie tego ter minu t-n papier wzrtościowy za umorzony, Oznaczenie papieru wartościowego : Na okaziciela opiewają y kwit doposytowy Spółki kredytowej członków Towarzystwa wzaj, ubezpieczeń w Krskowie Nc. 4666 na police tegoż towarxystwa L, 118.139 i 132.578, glaaką, 5. duży srebrzy w:delev o ręzojeści inxiustowaiej, 6. duzą szebrną łyżkę o roko j ści iskrustowenej, 7. 12 srebrnych tyż czek gładkich za kwotę 200 kor. Sąd okręgowy, Oddział V, Tarnopol, dnia 1 czerwca 1920 (6345) T. 8/20 (4). Zarządzenie umorzenia papierów wartościowych. Na wniosek Fol skiego Towers. gimna:tycznego Sokół w Stryju, podejmuje się postępowanie celem umorzenia wymienioBego niżej papieru war” tościowego, który wnioskodawcy miał 313 ginąć, wzywa się posiadacza tego papieru g> czagokresu za nieistniejące uznane zostaną, Sąd okręgowy Oddział V, Przemyśl, 18 maja 1920, (5919) T. 650/19 (2). Zarządzenie umorzenia; papierów wartościowych, Na wniosek Kon staucji Brbin podejmuje się potępowanie celem umorzenia cznaezowych niżej papie rów wartościowych, wia z Odnośnymi ku ponawi, które miały wnioskodawcy zaginąć; wzywa się posiadacza tych papierów, aby je w ciągu podanego nizej terminu przed iożył temu sądowi; także inni interesowani mają zgłosić swoje zarzuty przeciw wnio nie powyższym prawa i roszeseżia będą uwzględnione o tyle, o ile wypływają one z aktów, egzekucyjnych, Sąd powiatowy, Oddział IV. Sąd okręgowy cyw, Oddział VI. Kraków, dnia 8 maja 1920, (5487) aby go w ciągu sześciu miesięcy od dnia|skowi. W razie przeciwnym uźnałby sąd ogźoszenia zarządzenia przedłożył temu 8są-|po upływie tego terminu te papiery war dowi, Także inai interesowani mają zgłosić | tościowe za umorzone, a to: a) same pa swoje zarzuty przeciw wnioskowi, W rsziej piery wartościowe po upływie jednego roku przeciwnym uznałby sąd po upływie tego | od dnis płatności ostatniego wydanego kupo Dukla, dnia 18 cezerwea 1920. (7268 8—8) Spadki. A. 386/19/5, Weswanis nieznanych dziedziców. Israel Singer, z Niemirowa, zmarł deia 9 październia 1919 nie pozostawisjąc ostatniego rozyorządzenia. Sąduwi niewia domo czy pozostali dziedziee. Ustauawia za tem dr. Henryka Rosenberga, adwokata w Niemirowie, kuratorem spadku. Kto za mierza zgłosić roszczenie do spzdxu winien o tem donieść temu sądowi w ciągu jednego roku licząc od dnia dzisiejszego Í wykazać swe prawa do spadku. Po upływie tego czaso kresu będsie spadek wydany tym osobom, które wyksżą swe prawa, o Heby zaś praw T. VI. 91/20 (1). Zarządzenie tino rzenia papierów wartościowych. Na wniosek Józefa Hojaego podejmuje się postępowanie: celem umorzenia niżej wymienionego pa pieru wartościowego, który wnioskodawcy miał zaginąć; wzywa się posiadacza tego papieru, aby go w ciągu jednego roku od dnia ogłoszenia zśrządzenia przedłożył temu sądowi; także inni interesowani mają zgło sié swoje zarzuty przeciw wnioskowi. W razie przeciwnym uznałby sąd na ponowny wniosek po upływie tego terminu tes pa pier wartościowy zs umorzony. Oznaczenie papieru wartościowego: Na okzziciela opiewający kwit desosytowy Spółki kredytowej członków Towarzystwa wzajemaych ubexpiecseń w Krakowie z 19 grudnia 1906 L, 477 na policę tego Tówa rzystwa L, 74.808, 92857 i 105,837, Sąd okręgowy, Oddział VI. terminu ten papier wartościowy za umorzone. Oznaczenie pąpierów wartościowych: Książeczka wkładzowa Polskiej Kasy Mie szczańskie, w Stryju Nr. 228 wystawiona na nazwisko Polskie Tow., gimn. Sokół w Stryju, której stan z keń:sm r. 1919 wyno sił 182 kor. 20 hal, Sąd okręgowy, Oddział IV. Stryj, dna 20 kwietnia 1920. (6355) | 56 1. S. 1V. nr. 1364 z datą 1 lipca 1898 z ostatuim kuponem nu, lub od dnia płetności samej wierzy:el ności, jeśli pierwej miała być płatna; b) ku pony po upływie jedaego roku vd dnia pł» tności każdego kupoau, jednakże mie weze Śniej, jak w rok po pierwszem ogłoszeniu tego zarządzenia, Oznaczenie papierów wartościowych: 2 listy zastawne gal. Tow, kred, ziem. 4 pre, 56 1. 5. IV, ar. 662 na 1000 kor. i 4 pre. na 1000 kor. wydane T. VI. 81/20 (1). Zarządzenie ume-|piatnym 30 czerwca 1917 włącznie. rzenia papierów wartościowych. Na wniosek Edmnnda Behaczyka w Krakowie podej muje się postępowanie celem umorzenia Wy mienionego niżej papieru wartościowego, któ ry wnioskodawcy miał zaginąć, Wzywa się Sąd ckręgowy cywiluy, Oddział VII, Lwów, dnia 16 marca 1830, (6319) T. VI. 147/80 (1). Zarządzenie umo posiadacza tego papieru, aby go w ciągu | rzenia papierów wartościowych, Na wniosek jeguege roku od ,dnia ogłoszenia sarządze Rilferowej nia przedłożył temu sądowi; także inni | powanie, w Narajowie podejmuje się postę celem umorzenia wymienionego | | e aa koo 24 am a l JA. © EW JR 4 wa (EG. 2 nie wykazano, spadek przypadnie Skarbowi Państwa. Sąd powiatowy, Oddział I, Niemirów, 27 kwietnia 1920, (7258 3—8) interesowani mają zgłosić swoje zarzuty | niżej” papieru wartościowego, które wnio przeciw wnioskowi. W razie przeciwnym | skodawcy miały zaginąć. Wzywa się posia uznałby sąd ma ponowny wniosek tem pa-| dacza tego papieru, aby go w ciągu jednego pier wartościowy za umorzony. roku od dnia ogłoszenia zarządzenia przed: Kraków, dnia 16 kwietnia 1920, (5044) T. VI. 109/80/1. Zarządzenie umorze nia papierów wartościewych, Na wniosek je „fu Iim , « R; w. * e . PpP ‘II © — w "z m A W i; i; W boży skat: zgłosić swoje zarzuty przeciw wnio SKOWi, W razie przeciwnym uznałby sąd ns | DOROwny wniosek po upływie tego terminu R papier wartościowy za umorzony, Po; Oxnaczenie papieru wartościowego : olica Towarzystwa wsa'emasch ubezpie = W Krakowie wystawion» na Juda Mar 88 Hilf:ra z 9 listossda 1901 L. 32,524 Ra 2000 kor, płatne 1 listopada 1921 oka Lielelowi, Nąd okręgowy cywilny, Oddział VI. Kraków, d 30 kwietnia 1920, (5495) Edykta W sprawach uznania za zmarłego. X, V. 12/30 (3). Wdrożenie postępo Wania gejem uznania za zmarłego Hryńko Ozorajj, urodsony w roku 1891, rolnik z Ho Iodojcy, powołany w czesie ogólnej mobili ję! do wojska sustrjaekiego opuścił od r. 8 swsje miejsce zamieszkania i brał Udział w wojuia Światowej. Od roku 1914 Die daje o sobie żadnego znaku życia, co Riwierdza świadectwo gminy Horodniea z 11 utego 1920, ŻZaprzysięconymi zeznaniami ladków Hzyńka Bohuw stwierdzcnem x0 stało it Hryńko Czornij w lecie 1916 za Chorował na maiarję. Gdy zatem przyjąć należy że zachodzą Wymogi uxnania go za zmarłego, przeto wdraża się na prośbę żony jego Anny Ozor Di) postępowanie, celem uznania za Imar ego. Wydaje się przeto ogólne wezwanie, sby udzielono sądowi lub kuratorowi p. dr. Menkesowi, sdwokatowi w Tarnopolu. któ tego ustanawia się obrońcą węzła małżeń skiego, wiadomość o powyżej wymienionym.. Hryńka Ozornija, na wypadek gdyby żył Wzywa się, aby przed miżej wymienionym dądem stawił się lub w inny sposób awia omił o życiu. , ad tutejszy na ponowną prośbę po dniu 1 s.erpnia 1920 rozstrzygnie o uznanie ža zmaiłego i o uxnamie malżeństwa za roz Wiązan o, Bad okręgowy, Oddział V. Tarnopol, 9 kwietnia 1930. (6572 8—3) T. V, 79/20 (3). Wdrożenie postępo wamia celem uznania za zmarłego, Stefan Antków, rolnik z Borek wielkich, urodzony ćnia 11 listopsda 1878 roku powołsmy w czas,6 ogólaej mobilizacji (co wojska austria ckiega opaścił od r, 1914 swoja miejsee za mieszkania i jsko żołnierz brał udział w wojnie światow*j Zaprzys'ętonemi xeznania mi świadków a to: Błsżeja Antków stwier dzonm zostało, że Stefan Antiów służzł przy sanitetach i został w r. 1914 zabrany 16 Złoczowa do niewoli rosyjsziej, zaś wedle zeznań świadka Pictra Sediahy stwierdzonem zostało, ż6 Stefan Anteów w niewoli rosyj skiej w małej Azji nad morzem Kaspijskiem zachorował na krwswą dszynterją wskutek tzego zibrano go do szpitala zakaźnego a jak mu później sanitarjusz szpitala Opowia dał Stefan Antków v»marł w szziżalu dnia 21 kwietnia 1917 Od roku 1914 nie daje o Robie żada”go znaku życia, co stwierd"a po świadczenie Urzążu gminaego w Borkach wielkich z 7 kwietnia 1920 r. üdy zatem przzjąć należy, te zachodzą wymogi z $ 1 ces rozp. z dnia 12 paź dziernika 1914 r. Nr. 276 Dz, u. p. przeto wdraża sią xa prośbę brata jego Bisteja Antków pesięgowanie, celem uznazia go ża zmarłego, Wydaja się przeto ogólne wezwa Rie, aby udzielono sądowi lub kmrstorowi P dr, Monkesowi, adwokatuwi w Tarmopolu wiadomość o powyżej wywzieniosym, Stefana Antków, ma wypadek gdyby Żył wzywa się. «by przed mitej wymienio nym stawił się, lub w imag sposób uwiado mił o życiu. Sąd tutejszy ma ponowną prośbę po daia 30 października 1920 rozstrzygnie © Urasniz za zmarłego. Sąd okręgowy, Oddział Y., Tarnopol, 26 kwieinia 1920. (6440 3—8) T, IV. 120/19 (5). Zarządzenie postę powania celem udowcdaienie Śmierci kivtra Prachaia. Piotr Prucha! x Noekowej, powo łany w csasie mokilizacji do służby wojsko wej przy 34 pułku obr. kraj, & bat. został następsie wysiany na front rosyjski, Z koń cem maja 1916 r. jak zeznali x przyszęteni świadkowie Antomi Mix i Wojcieuu Lichwa, Pios Pruchat brał udział w walkach pod Bol:chowem i tam goległ trafiony kalką w głowę. Swiadek Antoni Mik oglądał nastę pnie swłoki Łiotia Pruchala i rozpoznał je, gdyż go znał dobrze. Gdy wobec tego jest prawdopodobne, _ że osoba wymieniona poniosła Śmierć, za _ rządza się na wniostk Jórefy Pruchal postę powsnie eelem udowodnienia jej Śmierej, a dnia 15 pazdziernika 1930 r., albo sądowi albo p. adwokatowi dr. Julianowi Krygliw sziemu, którego ustanawia się kuratorem, udżie!ono wiadomości o zagimionrm. yi temu sądowi; także inni interesowani ; zarazem ogłasza sią wezwanie, ażeby do 13 kwietnia 1920. Zsprzysiężonymi resna| niami świadków Jozafata Osbryńskiego i | a> Cebryńskieg stwierdzonem zostało, łe w ppbździerniku 1914 w okopzch pod | Przemyślem Jam Pistrowski padł od kuli ro Po upływie tegn terminu i po przepro| Syjskiej i widzieli go zzbitego. wadzeniu dowodów sąd orzekmie ostaiecznie 0 waiosku. Sąd okręgowy, Oddział IY. Tarnów, 26 listopada 1919, 416079 3—3) T. 59/20, Wdrożenie postępowania ce łem udowodnienia śmierci, Jan Bandurko sya Antoni go, urodzony w Kroguleu dnia 3 marca 1888, jako Łołaiers 95 pułku pie choty dostał się w geudmiu 1914 roku do niewoli rosyjskiej poczem przewieziony był do obozu jeńców w Katskurhanie (Sybir). Przesłuchany świadek Michał Sswedak po dał, że gdy daia 29 czerwca 1915 r. przy był na rozkaz z kilku austrjackimi jeńcami do szpitala w Katakurhanie dla pogrzebania zmarłych, zastał zabitą trumnę a obok zło żony krzyż z Bapisem „Iwan Bandurków*. Gdy wobec powyższego jest prawdopo dobnem ża Jan Bendurko sya Antoniego poniósł śmierć, przeto na prośbę Anny Olij nik zəm. Bandarków, wdraża się postępowa nie, celem udowodnienia zaszłej śmierci z8 giniozego i uzmznie małżeństwa jego z Anną Olejnik zawartego w dniu 11 listop:da 1918 roku w Krogulcu za rowiązane, Wydśje się przeto wózwanie ogólne, by zawiadomiono sąd albo adw. dra p. Melitona Widraka, którego się kuratorem i obrońcą węzła mał keńskiego ustanawia aż do dnia 1 września 1920 o zaginionym Janie Bandurko. Po upływie powyższego cezasokresu i po przezrowadzeniu dowodów będzie rozstrzy gnięte o dowodzie zaszłej śmierci. Sąd okręgowy, Oddz, IV, Czortków, 4 kwietnia 1920, (4877 3—3) T, 135/20 (5). Zarządzenie postępowania celom uznania za zmarłego, Michał Kreczkow ski, sym Piotra i Marji, urodzony w Mako wej 31 sieręnia 1886, żołnierz 4 bataljonu strzelców w sierpniu 1914 odszedł na front rosyjski i od tego cxasu nie dał wiadomości o sobie, Gdy zatem można przyjąć, że zaistnieją warunki ustawowego stwierdzenia śmierci w myśl $ 24 i 277 ust. eyw, i ustawy z 16 lutego 1863 Nr. 20 i 31 marca 1918 Nr.
| 25,628 |
199400481669
|
French Open Data
|
Open Government
|
Licence ouverte
| 1,994 |
L'ESCA-BOT DU SPECTACLE
|
ASSOCIATIONS
|
French
|
Spoken
| 20 | 23 |
favoriser la rencontre entre artistes ; les aider à se produire et leur faciliter le cheminement vers une carrière professionnelle
| 28,488 |
https://stackoverflow.com/questions/55613170
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,019 |
Stack Exchange
|
Bryan Oakley, D.Sanders, Varun Yadav, furas, https://stackoverflow.com/users/10558219, https://stackoverflow.com/users/1832058, https://stackoverflow.com/users/4312291, https://stackoverflow.com/users/7432
|
English
|
Spoken
| 881 | 2,205 |
Python 3.6 tkinter says GROOVE is not defined
The below program was working fine few minutes back. I made a change,ran the code, made a small mistake, Spyder crashed and now it either cannot find Frame or Groove or something else. At the moment it says GROOVE not defined.
Tried writing it in lower case and with quotes. When I do with quotes it says: TclError: bad relief "Groove": must be flat, groove, raised, ridge, solid, or sunken. When I do lower or upper case without quotes says groove not defined.
from RiskFactorConversion import *
from tkinter import ttk, StringVar, Frame, Label, Tk, Entry
mainwindow = Tk()
mainwindow.title("Risk Factor Conversion")
datatype = StringVar()
dataconvention = StringVar()
mdlname = StringVar()
instancevalue = StringVar()
axisvalue = StringVar()
def g():
datatype = e1.get()
dataconvention = e2.get()
mdlname = e3.get()
instancevalue = e4.get()
r1 = rates.srtqualifier(mdlname,datatype,dataconvention,instancevalue)
l5["text"] =r1.makequalifier()
def f():
datatype = e5.get()
dataconvention = e6.get()
axisvalue = e8.get()
fx1 = fx.felixfxvol(datatype,dataconvention,axisvalue)
l11["text"] =fx1.fxvol()
def h():
datatype = en1.get()
dataconvention = en2.get()
fx2 = fx.murexfx(datatype,dataconvention)
la4["text"] =fx2.makequalifier()
#########Felix Frame####################################
frame1 = Frame(bg="white", colormap="new", padx = 10, relief=GROOVE, borderwidth=2)
frame1.grid(row = 0, column = 0)
l0 = Label(frame1, text= "FELIX Rates", pady =5, font = ('Georgia',14,'bold'), bg="white")
l0.grid(row = 0, column = 0,sticky= W )
l1 = Label(frame1, text= "Please provide Data Type:",bg="white", justify = "right",pady =5 )
l1.grid(row = 1, column = 0, sticky= E )
e1 = Entry(frame1,bd = 2, width =50, textvariable = datatype )
e1.grid(row = 1, column = 1)
e1.focus_set()
l2 = Label(frame1,bg="white", text= "Please provide Data Convention:",justify = "right", pady = 5)
l2.grid(row = 2, column = 0,sticky= E)
e2 = Entry(frame1,bd = 2, width =50, textvariable = dataconvention )
e2.grid(row = 2, column = 1)
l3 = Label(frame1,bg="white", text= "Please provide Model Type:", justify = "right",pady = 5)
l3.grid(row = 3, column = 0,sticky= E)
e3 = ttk.Combobox(frame1,width =45, textvariable = mdlname, state='readonly')
e3['values'] = ('IR_SABR','FX_LN','IR_LGM','IR_LMM','IR_SABR_FX_LN_GC','IR_SABR_GC','INFLATION_SABR')
e3.grid(row = 3, column = 1)
l4 = Label(frame1,bg="white", text= "Please provide Instance Name:", justify = "right",pady = 5)
l4.grid(row = 4, column = 0,sticky= E)
e4 = Entry(frame1,bd = 2, width =50, textvariable = instancevalue )
e4.grid(row = 4, column = 1)
bfelix = Button(frame1, text = "Press to get Qualifier Value", pady = 10, command = g)
bfelix.grid(row = 5, column = 0)
l5 = Label(frame1,bg="white", text= "" , justify = "right",pady = 5)
l5.grid(row = 5, column = 1)
################################################################
############FELIX FX############################################
frame2 = Frame(bg="white", colormap="new", padx = 10, relief=GROOVE, borderwidth=2)
frame2.grid(row = 0, column = 1)
l6 = Label(frame2, text= "FELIX FX", pady =5, font = ('Georgia',14,'bold'), bg="white")
l6.grid(row = 0, column = 0,sticky= W )
l7 = Label(frame2, text= "Please provide Data Type:",bg="white", justify = "right",pady =5 )
l7.grid(row = 1, column = 0, sticky= E )
e5 = Entry(frame2,bd = 2, width =50, textvariable = datatype)
e5.grid(row = 1, column = 1)
e5.focus_set()
l8 = Label(frame2,bg="white", text= "Please provide Data Convention:",justify = "right", pady = 5)
l8.grid(row = 2, column = 0,sticky= E)
e6 = Entry(frame2,bd = 2, width =50, textvariable = dataconvention )
e6.grid(row = 2, column = 1)
l10 = Label(frame2,bg="white", text= "Please provide axis 2 value:", justify = "right",pady = 5)
l10.grid(row = 3, column = 0,sticky= E)
e8 = Entry(frame2,bd = 2, width =50, textvariable = axisvalue )
e8.grid(row = 3, column = 1)
bfelixfx = Button(frame2, text = "Press to get Qualifier Value", pady = 10, command = f)
bfelixfx.grid(row = 4, column = 0)
l11 = Label(frame2,bg="white", text= "" , justify = "right",pady = 5)
l11.grid(row = 4, column = 1)
#####################################################################
############MUREX FX############################################
frame3 = Frame(bg="white", colormap="new", padx = 10, relief=GROOVE, borderwidth=2)
frame3.grid(row = 1, column = 1)
la = Label(frame3, text= "Murex FX", pady =5, font = ('Georgia',14,'bold'), bg="white")
la.grid(row = 0, column = 0,sticky= W )
la1 = Label(frame3, text= "Please provide Risk Factor Type:",bg="white", justify = "right",pady =5 )
la1.grid(row = 1, column = 0, sticky= E )
en1 = ttk.Combobox(frame3, width =45, textvariable = mdlname, state='readonly')
en1['values'] =('FX ATM VOLATILITY','FX BUTTERFLY 10D','FX BUTTERFLY 25D','FX RISK REVERSAL 10D','FX RISK REVERSAL 25D')
en1.grid(row = 1, column = 1)
en1.focus_set()
la2 = Label(frame3,bg="white", text= "Please provide Currency Pair:",justify = "right", pady = 5)
la2.grid(row = 2, column = 0,sticky= E)
en2 = Entry(frame3,bd = 2, width =50, textvariable = dataconvention )
en2.grid(row = 2, column = 1)
bmurexfx = Button(frame3, text = "Press to get Qualifier Value", pady = 10, command = h)
bmurexfx.grid(row = 4, column = 0)
la4 = Label(frame3,bg="white", text= "" , justify = "right",pady = 5)
la4.grid(row = 4, column = 1)
#####################################################################
mainwindow.mainloop()
use print(tk.GROOVE) and you will see text "groove". You can use text relief="groove" too.
Groove is a constant defined in Tkinter and since you are only importing specfic functions from Tkinter that doesn't include Groove, you need to add GROOVE to it or add
import tkinter as tk
and then set relief=tk.GROOVE
That makes complete sense! in the second line I imported GROOVE and other functions it runs now. But may I ask another question, when I close my program it crashes with saying Tk_GetColorFromObj called with non‑existent color!
Is it possible to do something that this doesn't happen?
groove is not a function. GROOVE is a constant defined in tkinter.
Thanks for the catch, I changed it in my answer.
| 38,328 |
https://github.com/ashokp/hris/blob/master/application/views/welcome.php
|
Github Open Source
|
Open Source
|
MIT
| null |
hris
|
ashokp
|
PHP
|
Code
| 96 | 591 |
<head>
<meta charset="utf-8">
<meta http-equiv="X-UA-Compatible" content="IE=edge">
<meta name="viewport" content="width=device-width, initial-scale=1">
<title><?php echo $pagetitle;?></title>
<script src="<?php echo base_url();?>assets/utils/jquery-1.12.3.min.js"></script>
<link rel="stylesheet" href="<?php echo base_url();?>assets/utils/css/bootstrap.min.css" />
<script src="<?php echo base_url();?>assets/utils/js/bootstrap.min.js"></script>
<link rel="stylesheet" type="text/css" href="<?php echo base_url();?>assets/css/common.css" />
<link rel="stylesheet" type="text/css" href="<?php echo base_url();?>assets/css/index.css" />
<script src="<?php echo base_url();?>assets/js/common.js"></script>
</head>
<body>
<?php $this->view($layout); ?>
<script src="<?php echo base_url();?>assets/utils/jqueryui/jquery-ui.min.js"></script>
<link rel="stylesheet" type="text/css" href="<?php echo base_url();?>assets/utils/jqueryui/jquery.ui.theme.css"/>
<link rel="stylesheet" type="text/css" href="<?php echo base_url();?>assets/utils/jqueryui/jquery-ui.min.css"/>
<script src="<?php echo base_url();?>assets/utils/js/validator.js"></script>
<script src="<?php echo base_url();?>assets/utils/js/H5F.js"></script>
<script src="<?php echo base_url();?>assets/utils/html5shiv.js"></script>
<script src="<?php echo base_url();?>assets/utils/respond.min.js"></script>
<script src="<?php echo base_url();?>assets/utils/form-field-dependency.js"></script>
<script src="<?php echo base_url();?>assets/utils/bootstrap.file-input.js"></script>
<script>
$('input[type=file]').bootstrapFileInput();
$('[data-depends]').formFieldDependency();
</script>
</body>
</html>
| 16,359 |
W3164477212.txt_2
|
Open-Science-Pile
|
Open Science
|
Various open science
| 2,021 |
Decreased GLUT2 and glucose uptake contribute to insulin secretion defects in MODY3/HNF1A hiPSC-derived mutant β cells
|
None
|
Unknown
|
Unknown
| 6,661 | 13,044 |
The implication of GLUT2 in MODY3 in our work sheds light
on the role of this glucose transporter in human β cells. In mouse
β cells, GLUT2 is established as the predominant glucose transporter and is known to be involved in insulin secretion. Glut2−/−
mice are hyperglycemic, hypoinsulinemic and die from lethal
neonatal diabetes. Glut2−/− mouse islets exhibit reduced glucose
uptake and impaired GSIS, while the re-expression of GLUT2 in
the islets restores normal GSIS64,65. However, while the role of
GLUT2 in mouse β cells has been well-established, the role of
GLUT2 in human β cells has remained controversial. Unlike in
rodent β cells where Glut2 is the predominantly expressed glucose
transporter with expression more than tenfold higher than Glut1,
human β cells predominantly express GLUT1 and GLUT3, with
2.8 and 2.7 fold higher expression than GLUT2, respectively44. In
addition, human β cells have 100-fold lower GLUT2 abundance
than rat β cells, which correlated to ten times lower glucose
uptake in human β cells than rat β cells39. Hence, the lower
abundance of GLUT2 in human β cells suggested that it may not
be the principal glucose transporter in human β cells and is
probably not an essential glucose sensor of human β cells39,44.
Yet, despite the purported irrelevance of GLUT2 in human β
cells, homozygous GLUT2 mutations can cause Fanconi–Bickel
syndrome and neonatal diabetes66, and SNPs in GLUT2 are
associated with the conversion from impaired glucose tolerance to
T2D67. Similarly, GLUT2 variants are also associated with
impaired fasting glucose and diabetes54,68,69. Furthermore,
Fanconi–Bickel syndrome-associated mutations in GLUT2 were
found to decrease glucose transport capacity by human GLUT2 in
Xenopus oocytes70. Hence, the association of GLUT2 mutations in
Fanconi–Bickel syndrome and diabetes pathology supports an
imperative role played by GLUT2 in human β cells despite its
lower abundance71. By demonstrating that a patient-specific
heterozygous HNF1A+/H126D mutation causes decreased GLUT2
expression in human β cells, correlated with a reduction in glucose uptake and ATP production, we posit that the defective
NATURE COMMUNICATIONS | (2021)12:3133 | https://doi.org/10.1038/s41467-021-22843-4 | www.nature.com/naturecommunications
ARTICLE
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-22843-4
0 .6
0 .4
0 .2
0 .0
P1
WT
P1
P2
*
TSPAN8
1 .0
0 .5
0 .0
WT
WT
P1
P1
P2
P2
c
0 .0
WT
P1
P1
UGT2B4
50
37
Actin
P2
P2
WT
* *
1 .5
0 .5
0 .0
WT
P1
WT
T r a n s c r ip t E x p r e s s io n R e la tiv e t o G F P
P2
P1
si-NT
si-HNF1A
NT
H N F1A
* *
1 .0
0 .8
0 .6
0 .4
0 .2
0 .0
si-NT
si-HNF1A
NT
H N F1A
TSPAN8
n.s.
si-HNF1A
NT
H N F1A
*
H N F4A
1 .2
1 .0
0 .8
0 .6
0 .4
0 .2
0 .0
si-NT
2
1
0
U G T2B4
*
1 .2
1 .0
0 .8
0 .6
0 .4
0 .2
0 .0
si-NT
si-HNF1A
NT
H N F1A
ANKS4B
**
1 .0
400
0 .5
200
0
0 .0
GFP
WT
H126D P291fsinsC
GFP
WT
H 1 2 6 D P 2 9 1 fs in s C
GFP
GFP
HNF1A
HNF4A
WT
WT
*
15
6
4
2
0
GFP
WT
H126D P291fsinsC
GFP
WT
H 1 2 6 D P 2 9 1 fs in s C
HNF1A
insulin secretion in MODY3 β cells is at least partly contributed
by the lowered availability of glucose in these β cells. Our study
implicates the involvement of GLUT2 in the pathogenesis of
MODY3 in humans and further supports the importance of
GLUT2 in human β cell function. Furthermore, we found
decreased GLUT2 expression in HNF1A+/T260M islets9, and
demonstrated that the most common MODY3 mutation
P291fsinsC also failed to increase GLUT2 expression, suggesting
that reduced GLUT2-facilitated glucose uptake may be common
in most MODY3 β cells. Better facilitation of glucose entry into
20
*
5
0
H126D P291fsinsC
H 1 2 6 D P 2 9 1 fs in s C
HNF1A
* *
TSPAN8
15
10
5
0
GFP
GFP
WT
WT
n.s.
In addition to MODY3, HNF1A variants have also been
implicated in T2D72–74. Our study supports the role of HNF1A in
T2D given that the HNF1A H126D mutation resulted in a loss of
binding and downregulation of various genes (TSPAN8, LAMA1
and UGT2B4) associated with T2D. Hence, our findings offer
insights into the involvement of HNF1A in T2D.
In conclusion, our study has successfully established an in vitro
platform for MODY3 disease modeling via the differentiation of
NATURE COMMUNICATIONS | (2021)12:3133 | https://doi.org/10.1038/s41467-021-22843-4 | www.nature.com/naturecommunications
11
ARTICLE
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-22843-4
Fig. 5 HNF1A+/H126D mutation reduces the expression of genes involved in pancreas development, β cell survival and insulin secretion. a RT-qPCR
analysis of TM4SF4, GLIS3, ANKS4B, HNF4A, TSPAN8 and UGT2B4 transcripts in WT (red) and mutant (blue) hPSC-derived endocrine progenitors. n = 3
independent experiments. P-value for TM4SF4 = 0.0238 (P1), 0.0390 (P2); GLIS3 = 0.0239 (P1), 0.0184 (P2); ANKS4B = 0.0081 (P1), 0.0260 (P2);
HNF4A = 0.0385 (P1), 0.0449 (P2); TSPAN8 = 0.0112 (P1), 0.0355 (P2); UGT2B4 = 0.0020 (P1), 0.0130 (P2). b RT-qPCR analysis of EndoC-βH1 cells
transfected with HNF1A siRNA (si-HNF1A) and non-targeting siRNA as negative control (si-NT). n = 4 independent experiments. P-value for TM4SF4 =
0.0029; GLIS3 = 0.0240; ANKS4B = 0.0017; HNF4A = 0.0172; UGT2B4 = 0.0226. c Western blot analysis for HNF1A protein in AD-293 cells
overexpressed with GFP and various HNF1A constructs. n = 3 independent experiments. d RT-qPCR analysis of TM4SF4, GLIS3, ANKS4B, HNF4A, TSPAN8
and UGT2B4 transcripts in AD-293 cells overexpressed with GFP (green) and various WT (red), H126D (blue) and P291fsinsC (purple) HNF1A constructs.
n = 3 independent experiments. P-value for TM4SF4 = 0.0076 (WT), 0.0078 (H126D), 0.0077 (P291fsinsC); GLIS3 = 0.0005 (WT), 0.0121 (H126D),
0.0171 (P291fsinsC); ANKS4B = 0.0005 (WT), 0.0004 (H126D); HNF4A: 0.0026 (WT), 0.0078 (H126D), 0.0886 (P291fsinsC); TSPAN8 = 0.0015 (WT),
0.0034 (H126D), 0.0005 (P291fsinsC); UGT2B4 = 0.0035 (WT), 0.0034 (H126D), 0.0035 (P291fsinsC). WT wild-type, P1 patient 1, P2 patient 2. GFP
green fluorescent protein. RT-qPCR quantitative reverse transcription polymerase chain reaction. hPSC human pluripotent stem cells. For all statistical
analysis: Error bars represent standard error of mean (SEM). Unpaired one-tailed Student’s t-test was performed. Asterisk indicates P-value < 0.05. n.s.
non-significant. “See also Fig. S7.” Source data are provided as a Source data file.
MODY3 patient-derived hiPSCs into pancreatic β-like cells. This
model has allowed us to elucidate the molecular pathways that are
involved in the pathology behind MODY3 disease, and identified
a list of genes including GLUT2 that are potentially implicated in
the disease. Importantly, our results showed that HNF1A mutations cause decreased GLUT2 expression, which is associated with
reduced glucose uptake and ATP production, and hence likely
contributes to the lack of glucose-stimulated insulin secretion in
MODY3 patients.
mutant HNF1A–DNA complex were used to calculate the boost parameters for
aMD. The following boost parameters were used:
αPE ¼ 0:16 ´ Natoms ¼ 11426 kcal mol1
EPE ¼ VPE avg þ 0:16 ´ Natoms ¼ 217953 kcal mol1
αdih ¼ 4=5 ´ Nres ¼ 347 kcal mol1
Edih ¼ Vdih avg þ 4 ´ Nres ¼ 7747 kcal mol1
Methods
Multiple sequence alignment. To identify the conservation of HNF1A protein, a
HomoloGene75 search was performed using the keyword “Homo sapiens HNF1A”.
Additionally, we compared the isoform sequence amongst various species using
MUSCLE (version 3.6)76 and visually inspected the similarity or difference of the
sequence in multiple sequence alignment view.
Molecular dynamics (MD) simulations
Preparation of structures. The crystal structure of HNF1A bound to DNA (PDB
code 1IC8)12 was used as the starting structure for molecular dynamics (MD)
simulations. Unresolved HNF1A residues (85–86, 181–200, 277–278 in chain A
and 180–200 in chain B) were modelled using the ModLoop web server77 while the
H126D mutation was introduced into both HNF1A chains using PyMOL78. The Nand C- termini of HNF1A were capped by acetyl and N-methyl groups, respectively. A total of four systems were set up: wild-type (WT) HNF1A bound to DNA,
H126D mutant HNF1A bound to DNA, monomeric WT HNF1A, and monomeric
H126D mutant HNF1A. Chain B from the crystal structure was used for the
monomeric HNF1A simulations. The software package PDB2PQR79 was used to
determine the protonation states of residues. Each system was then solvated with
TIP3P water molecules80 in a periodic truncated octahedron box such that its walls
were at least 10 Å away from the complex or protein, followed by charge neutralization with sodium ions.
Conventional molecular dynamics (cMD) simulations. Energy minimizations and
MD simulations were performed with the PMEMD module of AMBER 1481 using
the ff14SB82 force field, which includes the ff99bsc0 corrections for DNA83. All
bonds involving hydrogen atoms were constrained by the SHAKE algorithm84,
allowing for a time step of 2 fs. Nonbonded interactions were truncated at 9 Å,
while the particle mesh Ewald method85 was used to account for long-range
electrostatic interactions under periodic boundary conditions. Weak harmonic
positional restraints with a force constant of 2.0 kcal mol−1 Å−2 were placed on the
protein and DNA non-hydrogen atoms during the minimization and equilibration
steps. Energy minimization was carried out using the steepest descent algorithm for
500 steps, followed by the conjugate gradient algorithm for another 500 steps. The
systems were then heated gradually to 300 K over 50 ps at constant volume before
equilibration at a constant pressure of 1 atm for another 50 ps. Finally, unrestrained
equilibration (2 ns) and production (200 ns) runs were carried out at 300 K using a
Langevin thermostat86 with a collision frequency of 2 ps−1, and 1 atm using a
Berendsen barostat87 with a pressure relaxation time of 2 ps. Five independent MD
simulations were carried out on each of the systems. Trajectory movies were
generated using VMD88.
Accelerated molecular dynamics (aMD) simulations. Dual-boost aMD simulations,
in which both dihedral (dih) energy and total potential energy (PE) are boosted,
were initiated from the final structure of the corresponding cMD simulation runs.
The average of the energies obtained from the five cMD simulations of the H126D
12
where Natoms and Nres are the number of atoms and residues, respectively, and
VPE_avg and Vdih_avg are the average potential and dihedral energies obtained from
the cMD simulations, respectively. In all, five independent 200-ns aMD simulations
of the H126D mutant HNF1A–DNA complex were carried out.
Binding free energy calculations. Binding free energies for the HNF1A–DNA
complexes were calculated using the molecular mechanics/generalized Born surface
area (MM/GBSA) method89 implemented in AMBER 1481. Two hundred equally
spaced snapshot structures were extracted from the last 80 ns of each of the cMD
trajectories, and their molecular mechanical energies calculated with the sander
module. The polar contribution to the solvation free energy was calculated by the
pbsa90 program using the modified generalized Born (GB) model described by
Onufriev et al.91 while the nonpolar contribution was estimated from the solvent
accessible surface area using the molsurf92 program with γ = 0.0072 kcal Å−2 and β
set to zero. Entropy changes were not computed as they have been shown to be
unnecessary for ranking the binding affinities of structurally similar ligands93.
Generation of hiPSCs. 5 × 105 human fibroblast cells were electroporated with 1
µg of plasmids, hUL, hSK and hOct4 according to the methods from Okita et al.13.
Plasmids from Addgene: 27077-pCXLE-hOCT3/4-shp53-F; 27078-pCXLE-hSK;
27080-pCXLE-hUL. All experiments with hPSCs were approved by the NHG
Domain Specific Review Board—Domain C (DSRB Approval 2013/01068),
A*STAR IRB 2020–096, and all methods were performed in accordance with the
Helsinki Declaration. Informed consent was obtained from all participants.
Human PSC culture. hiPSCs generated from human fibroblast cells and H9 ESCs
(WiCell Research Institute, NIHhESC-10-0062) were cultured at 37 °C with 5%
CO2 in DMEM/F-12 supplemented with 15 mM HEPES (STEMCELL Technologies), 20% KnockOut™ serum replacement (KOSR), L-glutamine, NEAA (Life
Technologies) and 10 ng/ml FGF2 (Miltenyi Biotec). hPSCs were seeded on irradiated CF-1 mouse embryonic fibroblasts (MEFs) (Gibco, A34181) and hiPSC
media was replaced every 24 h. hPSCs were split when the cells reached 80%
confluency. hPSCs were confirmed to be mycoplasma-free using the MycoAlert™
Mycoplasma Detection Kit (Lonza Bioscience).
Pancreatic β cell differentiation. hiPSCs and H9 cells were differentiated along
the pancreatic lineage into endocrine progenitors and β-like cells as described in
ref. 15, with some modifications. Cells were dissociated into single cells using
TrypLETM Express Enzyme and passed through 40 µm cell strainer before being replated at 106cells/ml in mTESR medium supplemented with 10 μM Y-27632 in
suspension culture on non-treated 6-well plates (Eppendorf). Cells were cultured at
37 °C with 5% CO2 on a rotating platform. Differentiation was initiated 48 h after
cell dissociation (designated as “D0”). Three independent hiPSC lines per subject
were used in each experiment, with biological triplicates analyzed for each line.
Experiments were repeated at least thrice.
NATURE COMMUNICATIONS | (2021)12:3133 | https://doi.org/10.1038/s41467-021-22843-4 | www.nature.com/naturecommunications
ARTICLE
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-22843-4
d
a
Smulated
insulinsecretion
secreon
Stimulated insulin
*
G lu c o s e -S tim u la tn.s.
e d In s u lin S e c r e t io n
*
In s u lin F o ld C h a n g e
Insulin fold change
relative to low glucose
n.s.
R e la tiv e t o L o w G lu c o s e
Insulin fold change
In s u l i n F o l d C h a n g e
w Gglucose
lu c o s e
l a t i v e t o to
L olow
R erelative
2 .5
2 .0
n.s.
1 .5
1 .0
0 .5
n.s.
2
1
0
0 .0
WT
W
T
WT
PP1
1
P2
P1
INSULIN
e
DAPI
DAPI
16.7mM
Ionomycin KCl
Glbenclamide
1 6 .7 m M Io n o m y c in
K C l G lib e n c la m id e
Ionomycin-stimulated insulin secretion
INSULIN
INSULIN
DAPI
2.8mM
2 .8 m M
P2
P2
3
Insulin
fold change
In s u l i n F o l d C h a n g e
relative
R e l a t i v e to
t o low
L o w glucose
G lu c o s e
22.8mM
.8m M
b
In s u lin* S e c r e tio n
3
Glucose-stimulated
insulin
secretion
Glucose-smulated
insulin
secreon
* *
*
In s u lin S e c r e t io n A s s a y
2
1
0
2.8mM
WT
2 .8 m M
f
Merged
Merged
R e la tiv e to L o w G lu c o s e
0
n.s.
2.8mM
*
g
2
1
0
PP1
1
PP2
2
WT
P1
WT
P1
P2
P2
Glibenclamide-stimulated insulin secretion
3
Insulin fold change
In s u l i n F o l d C h a n g e
glucose
Rrelative
e l a t i v e t to
o Llow
ow G
lu c o s e
Insulin fold change
R e la tiv e t o L o w G lu c o s e
relative to low glucose
In s u l i n F o l d C h a n g e
2 .8 m M
3
WT
WT
*
1
A f te r In V iv o M a t u r a t io n
2.8mM
2.8m M
*
2
G lu c o s e -S tim
u la t e d In s u lin S e c r e t io n
n.s.
4
P2
P2
K C l- S t im u la t e d S e c r e t io n A s s a y
*
Insulin fold change
relative to low glucose
In s u l i n F o l d C h a n g e
Glucose-stimulated insulin secretion
(after in vivo maturation)
P1
KCl-stimulated insulin secretion
Merged
3
c
P1
WT
*
*
*
2
1
0
2.8mM
2 .8 m M
Cell culture. EndoC-βH1 cells94 (Univercell Biosolutions) were cultured in DMEM/
Low glucose (Life Technologies) supplemented with BSA (Sigma–Aldrich), penicillin/streptomycin, 2 mM L-glutamine, 50 μM 2-mercaptoethanol, 10 mM nicotinamide (Sigma–Aldrich), 5.5 μg/ml transferrin (Sigma–Aldrich) and 6.7 ng/ml
sodium selenite (Sigma–Aldrich) on plates coated with 2 μg/ml fibronectin
(Sigma–Aldrich) and 1% ECM (Sigma–Aldrich). AD-293 cells (Agilent, 240085)
were cultured in DMEM/High glucose (Hyclone) with 10% heat-inactivated FBS
(Life Technologies) and 1% NEAA (Life Technologies).
WT
WT
P1
P1
P2
P2
Transfection. AD-293 cells were passaged and seeded at a cell density of 750 K
cells in each well of a 6-well plate, one day prior to transfection. They were cultured
in DMEM High Glucose media with GlutaMAX Supplement, Pyruvate (Invitrogen), containing 10% heat-inactivated Foetal Bovine Serum—South America
(Hyclone), and 1% MEM non-essential amino acids NEAA (Invitrogen). On the
day of transfection, 4 μg plasmid DNA was diluted in 250 μl of Opti-MEM® I
Reduced Serum Medium (Invitrogen). Ten microlitre of Lipofectamine™ 2000
(Invitrogen) was diluted in 250 μl of Opti-MEM® I Medium and incubated for 5
NATURE COMMUNICATIONS | (2021)12:3133 | https://doi.org/10.1038/s41467-021-22843-4 | www.nature.com/naturecommunications
13
ARTICLE
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-22843-4
Fig. 6 MODY3-hiPSC-derived mutant β-like cells did not exhibit defects in calcium signaling nor potassium channels. a Glucose-stimulated insulin
secretion of WT (red) and patient-specific (blue) hPSC-derived β-like cells in vitro. n = 3 independent experiments. b Immunohistochemistry stain for INS
(red) and nuclear stain using DAPI (blue) in β-like cells after in vivo maturation in mouse kidney capsule for 23 weeks. n = 3 independent experiments.
(scale bar: 50 μm). c Glucose-stimulated insulin secretion of WT (red) and patient-specific hPSC-derived β-like (blue) cells after in vivo maturation in
mouse kidney capsule for 23 weeks. n = 3 independent experiments; p = 0.0478 (WT). d Insulin secretion of WT β-like cells after stimulation with 2.8 mM
glucose (green), 16.7 mM glucose, 10 μM ionomycin, 30 mM KCl or 100 μM glibenclamide. n = 3 independent experiments; p = 0.0017 (ionomycin),
0.0245 (KCl), 0.0672 (glibenclamide). e Ionomycin-stimulated insulin secretion of WT (red) and patient-specific (blue) hPSC-derived β-like cells. n = 3
independent experiments; p = 0.0064 (WT), 0.0038 (P1), 0.0117 (P2). or f KCl-stimulated insulin secretion of WT (red) and patient-specific (blue) hPSCderived β-like cells. n = 3 independent experiments; p = 0.0158 (WT), 0.0007 (P1), 0.0037 (P2). g Glibenclamide-stimulated insulin secretion of WT (red)
and patient-specific (blue) hPSC-derived β-like cells. n = 3 independent experiments; p = 0.0496 (WT), 0.0136 (P1), 0.0203 (P2). All insulin fold changes
are normalized to insulin amounts secreted at 2.8 mM glucose (green) under each condition. WT wild-type, P1 patient 1, P2 patient 2. hPSC human
pluripotent stem cells. For all statistical analysis: Error bars represent standard error of mean (SEM). Unpaired one-tailed Student’s t-test was performed.
Aterisk indicates P-value < 0.05. “See also Fig. S8.” Source data are provided as a Source data file.
min at room temperature. The diluted DNA and diluted Lipofectamine™ 2000 were
then mixed and incubated for 20 min at room temperature. The DNA-Lipofectamine™ 2000 complexes were then added to each well containing AD-293 cells and
2 ml medium. The cells were incubated at 37 °C in a CO2 incubator for 48 h before
harvest.
Immunofluorescence staining. Cell clumps were collected at the end of the
pancreatic differentiation and cryo-embedded in tissue freezing medium (Leica
Biosystems). Cryo-embedded cells were sectioned and mounted onto glass slides.
Sectioning was performed by the Advanced Molecular Pathology Laboratory
(AMPL), A*STAR and stored at −80 °C. Cell sections or cells in monolayer culture
were fixed with 4% paraformaldehyde for 20 min. For cell surface protein detection,
cell sections or culture were blocked with blocking buffer (5% donkey serum or 5%
bovine serum albumin in DPBS) before overnight incubation with primary antibodies at 4 °C, or 1 h in the dark at 4 °C with fluorophore-conjugated primary
antibody. For intracellular protein detection, fixed cells or culture were blocked
with blocking buffer containing 0.1% Triton X-100 before overnight incubation
with primary antibodies at 4 °C. Following primary antibody incubation, cells were
washed twice using DPBS and incubated with appropriate secondary antibody in
the dark at 4 °C for 1 h. Cells were then washed at least twice using DPBS followed
by nuclei staining using DAPI. Primary antibodies used were for the detection of
TRA-1-60 (STEMCELL Technologies, 60064AD; 1:100), SSEA4 (STEMCELL
Technologies, 60062AD; 1:100), OCT4 (Santa Cruz, sc-8628; 1:100), SOX2
(Abcam, ab97959; 1:200), NANOG (R&D Systems, AF1997; 1:100), HNF1A
(Abcam, ab204306; 1:100), GLUT2 (Abcam, ab95256; 1:100. Santa Cruz, sc-9117;
1:100), and C-peptide (DSHB, GN-ID4; 1:200), PDX1 (R&D Systems, AF2419;
1:100), INS (Abcam, ab7842; 1:100). The secondary antibodies used were Alexa
Fluor® 488 (Invitrogen, A11055; 1:1000), Alexa Fluor ® 488 (Invitrogen, 21202;
1:1000), Alexa Fluor® 488 (Invitrogen, A21270; 1:1000), Alexa Fluor® 488 (Invitrogen, A21206; 1:1000), Alexa Fluor® 594 (Invitrogen, A11076; 1:1000), Alexa
Fluor® 594 (Invitrogen, A21203; 1:1000), Alexa Fluor® 594 (Invitrogen, A11058;
1:1000) or Alexa Fluor® 594 (Invitrogen, A21207; 1:1000). Fluorescence images
were acquired with the Axiovert 200 M inverted microscope using the Axiovision
LE software. Confocal images were acquired with the Olympus FV1000 inverted
confocal microscope using the Olympus Fluoview v3.1 software.
Flow cytometry. Cell clumps were dissociated into single cells using TrypLETM
Express (Life Technologies) at 37 °C and passed through a 40 μm cell strainer.
Single cells were fixed with 4% paraformaldehyde on ice for 30 min, then blocked
in FACS buffer (5% FBS in DPBS) with (for intracellular protein) or without (for
cell surface protein) 0.1% Triton X-100 on ice for 1 h, followed by incubation with
primary antibodies overnight at 4 °C. The primary antibodies used were for the
detection of HNF1A (Abcam, ab96777; 1:100), GATA4 (Thermo Fisher Scientific,
MA5-15532; 1:100), PDX1 (Abcam, ab47308; 1:100), INS (Abcam, ab7842; 1:100)
and NKX6.1 (LifeSpan BioSciences, LS‑C124275; 1:100). Cells were washed twice
with FACS buffer and incubated with secondary antibodies in the dark at 4 °C for
1 h. The secondary antibodies used were Alexa Fluor® 488 (Invitrogen, A21202;
1:1000), Alexa Fluor® 488 (Invitrogen, A21206; 1:1000), Alexa Fluor® 647 (Invitrogen, A21447; 1:2000) and Alexa Fluor® 647 (Jackson ImmunoResearch, 706605-148; 1:2000). The cells were then washed in FACS buffer twice, washed again
in DPBS twice and resuspended in DPBS and analyzed with the BDTM LSR II Flow
Cytometer. Data analysis was performed using the FlowJo 7.0 software.
RNA extraction, reverse transcription and quantitative PCR. PrepEase RNA
Spin Kit (Affymetrix) was used to extract total RNA from differentiated hiPSCs
according to the manufacturer’s instructions. To remove genomic DNA from the
preparation, DNase treatment was carried out for 15 min at room temperature.
Purified RNA was reverse transcribed using the High-Capacity cDNA Reverse
Transcription Kit (Applied Biosystems). QPCR was performed on the CFX384
Touch™ Real-Time PCR Detection System with iTaq™ Universal SYBR® Green
14
Supermix (Bio-Rad). Reported fold changes were based on relative expression
values calculated using the 2-ΔΔC(T) method with normalization to actin
expression for each sample. QPCR primers were custom-designed to span exon
exon junction, wherever possible, using Primer-BLAST (NCBI). Sequences of
primers used are listed in Supplementary Table 2. qPCR primers had been used for
the following genes: ABHD15, ACTB, ANKS4B, FGFR4, GLIS3, GLUT1, GLUT2,
GLUT3, GPR39, HNF1A, HNF4A, INS, LAMA1, NRARP, PAK4, PDGFA, TM4SF4,
TSPAN8, UGT2B4.
Western blotting. Cells were harvested by mechanical scraping on ice and lysed in
M-PER (Thermo Scientific) in the presence of protease and phosphatase inhibitors
(Sigma–Aldrich). Protein lysates were quantified using the BCA Assay (Thermo
Scientific), separated with sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) using the Mini-PROTEAN Tetra Cell system (Bio-Rad) and
transferred to PVDF membranes (Bio-Rad). Primary antibodies against endogenous HNF1A protein (Santa Cruz, sc-6548; 1:500), or actin (Sigma–Aldrich, A5441;
1:10000) were used, followed by HRP-conjugated secondary antibodies anti-goat
IgG-HRP (Santa Cruz, sc-2354, 1:5000) and anti-mouse IgG-HRP (Bethyl labs,
A90-516P, 1:10000). Chemiluminescent signals were detected using Super Signal
West Dura Extended Duration substrate (Thermo Scientific).
Stimulated insulin secretion assay. Glucose-stimulated insulin secretion (GSIS)
was performed on hPSC-derived β-like cells. Briefly, approximately 100 β-like cell
clumps were picked into each well of a 12-well non-treated cell culture plate
(Eppendorf) and rinsed three times with the Krebs-Ringer Bicarbonate (KRB)
buffer (129 mM NaCl, 4.8 mM KCl, 2.5 mM CaCl2, 1.2 mM MgSO4, 1.2 mM
KH2PO4, 5 mM NaHCO3, 10 mM HEPES, 0.1% BSA in ddH2O, pH7.4 and sterile
filtered). Samples were equilibrated in KRB buffer containing 2.8 mM D-glucose
(Sigma–Aldrich) at 37 °C for 1 h. Samples were then incubated in KRB buffer
containing 2.8 mM D-Glucose at 37 °C for 30 min and supernatants were collected.
Next, cells were rinsed three times with PBS, incubated in KRB buffer containing
16.7 mM D-Glucose at 37 °C for 30 min and supernatants were collected again. At
the end of the experiment, Mercodia Human Insulin ELISA kit (Mercodia) was
used to measure the insulin content in the collected samples following manufacturer’s instructions. Human C-peptide ELISA kit (Mercodia) was used to
measure the C-peptide content in the collected samples following manufacturer’s
instructions.
Secretagogue-stimulated insulin secretion was performed on hPSC-derived βlike cells. ∼100 β-like cell clumps were picked into each well of a 12-well nontreated cell culture plate (Eppendorf) and rinsed three times with the Krebs-Ringer
Bicarbonate (KRB) Buffer. Samples were equilibrated in KRB buffer containing 2.8
mM D-glucose (Sigma–Aldrich) at 37 °C for 1 h. Samples were then incubated in
KRB buffer containing 2.8 mM D-Glucose at 37 °C for 30 min and supernatants
were collected. Next, cells were rinsed three times with PBS, incubated in KRB
buffer containing 10 uM ionomycin (Sigma–Aldrich)/100 µM glibenclamide
(Sigma–Aldrich)/ 30 mM KCl (Merck) at 37 °C for 30 min and supernatants were
collected again. At the end of the experiment, Mercodia Human Insulin ELISA kit
(Mercodia) was used to measure the insulin content in the collected samples
following manufacturer’s instructions.
Mouse kidney capsule transplantation. All animal experiments have been done
in compliance with the relevant ethical regulations and ethical approval from
A*STAR with approval no. IACUC 181366. All relevant ethical regulations have
been complied. Mice were housed under 12 h light/dark cycle at 25 °C and 60–80%
humidity. The mice were placed on right lateral recumbence once they are
anaesthetized for unilateral subrenal capsule injection. The shaved area was cleaned
with 70% ethanol. The incision was started right below the most ventrolateral point
of the vertebral column and extended ventrally to expose the lateral aspect of the
left kidney. The kidney was gently lifted with sterile blunt-tipped surgical forceps to
partially exteriorize it. A 24-gauge IV catheter was inserted at a shallow angle with
NATURE COMMUNICATIONS | (2021)12:3133 | https://doi.org/10.1038/s41467-021-22843-4 | www.nature.com/naturecommunications
ARTICLE
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-22843-4
Glucose uptake
1 .5
ATP: ADP ratio
b
*
G lu c o s e U p t a k e
ATP:ADP
ratio
A T P :A D P R a tio
relative
R e l a t i v e tto
o WWT
T
*
1 .0
0 .5
cc
P1
P1
1 .5
1 .0
0 .5
P2
P2
WT
WT
*
* G LUT1
* G LUT2
1 .0
0 .5
1 .0
0 .5
0 .0
0 .0
P1
P1
P2
P2
GLUT3 (SLC2A3)
n.s.
n.s.
2 .0
T r a n s c r ip t E x p r e s s io n
1 .5
R e la tiv e t o W T
2 .0
WT
WT
P2
P
2
*
1 .5
T r a n s c r ip t E x p r e s s io n
2 .5
P1
P1
GLUT2 (SLC2A2)
GLUT1 (SLC2A1)
Transcript expression
relative to WT
R e la tiv e t o W T
A T P : A D P R a t io
0 .0
0 .0
WT
WT
T r a n s c r ip t E x p r e s s io n
*
*
2 .0
R e la t iv e t o W T
Glucose
l d C hchange
G l u c o s e Uuptake
p t a k e F ofold
ange
T
R e l a t i v e tto
o WWT
relative
G LUT3
1 .5
1 .0
0 .5
0 .0
WT
WT
d
P1
P1
WT
WT
P2
P2
P1
P1
P2
P
2
e
WT
P1
GLUT2
GLUT2
DAPI
Glucose uptake
GLUT2
DAPI
DAPI
Merged
Merged
P2
Merged
1 .5
Glucose uptake fold change
relative to WT
a
*
G lu c o s e U p t a k e
n.s.
n.s.
1 .0
0 .5
0 .0
DMSO
DM SO
Fisetin
DMSO
F i se ti n D M S O
WT
Fisetin
DMSO
F i se ti n D M S O
P1
Fisetin
F i se ti n
P2
G LUT2
N o rrelative
m a l is e dtot oDAPI
DAPI
fluorescence
o r e s c e n c e Inintensity
te n s ity
GGLUT2
L U T 2 F lu
GLUT2
*
1 .5
1 .0
0 .5
0 .0
WT
WT
P1
P1
P2
P2
respect to the renal surface at the injection site, into the renal parenchyma starting
at its caudal pole advancing it until its tip is just below the renal capsule. 100–150 µl
of cell suspension was injected. A visible bleb formed between the renal capsule and
parenchyma. The injection site(s) were observed for potential leakage of the cell
suspension and/or bleeding. The incision was then closed. After the procedure, the
kidney was replaced into the abdominal cavity. The peritoneum and muscle tissue
were opposed using 5-0 vicryl in a simple continuous pattern. The skin incision
was closed with sterilized 7 mm stainless steel wound clips or using 5-0 vicryl in a
simple interrupted pattern. After surgery, animals were observed until they can
maintain sternal recumbency. Before being returned to the housing area, 0.1 mg/kg
buprenorphine, SQ, was given on the opposite side from the incision or between
the shoulder blades. Wound clips or remaining skin sutures were removed
7–14 days after placement.
Glucose uptake assay. Approximately 100 hPSC-derived β-like cells were picked
into each well of a 12-well cell culture plate and rinsed three times with PBS. They
NATURE COMMUNICATIONS | (2021)12:3133 | https://doi.org/10.1038/s41467-021-22843-4 | www.nature.com/naturecommunications
15
ARTICLE
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-22843-4
Fig. 7 Decreased GLUT2 expression, glucose uptake and ATP production in MODY3 mutant β-like cells. a Glucose uptake in WT (red) and patientspecific (blue) hPSC-derived β-like cells. n = 3 independent experiments; p = 0.0182 (P1), 0.0294 (P2). b ATP: ADP ratio in WT (red) and patient-specific
(blue) hPSC-derived β-like cells. n = 3 independent experiments; p = 0.0144 (P1), 0.0113 (P2). c RT-qPCR analysis of GLUT1, GLUT2 and GLUT3 transcripts
in WT (red) and mutant (blue) hPSC-derived endocrine progenitors. n = 3 independent experiments; P-value for GLUT1 = 0.0125 (P1), 0.0373 (P2); GLUT1
= 0.0068 (P1), 0.0021 (P2). d Immunohistochemistry stain of GLUT2 (red) and DAPI (blue) in WT and mutant differentiated day 20 endocrine
progenitors. n = 3 independent experiments. (scale bar:100 μm). e Glucose uptake in WT (red) and patient-specific (blue) hPSC-derived β-like cells in the
presence of dimethyl sulfoxide (DMSO) or 60 μM GLUT2 inhibitor, fisetin. Glucose uptake fold changes are normalized to glucose uptake amount in the
presence of DMSO in WT. n = 3 independent experiments; p = 0.0362 (WT). WT wild-type, P1 patient 1, P2 patient 2. hPSC human pluripotent stem cells.
For all statistical analysis: Error bars represent standard error of mean (SEM). Unpaired one-tailed Student’s t-test was performed. Asterisk indicates Pvalue < 0.05. n.s. non-significant. “See also Figs. S9 and S10.” Source data are provided as a Source data file.
were then starved in 1 ml DMEM medium with no glucose (GibcoTM) for 4 h. The
medium was removed and the β-like cells were rinsed three times with PBS. The
cells were then exposed to DMSO or 30, 60, 90 or 120 μM fisetin and incubated in
1 ml DMEM medium containing 1 g/L D-glucose for 4 h before supernatants were
collected. The cells were lysed using M-PER protein extraction reagent and measured for protein content. The supernatants were then measured for residual
glucose amount using Glucose Uptake Colorimetric Assay Kit (Sigma–Aldrich).
The level of glucose uptake was normalized to the protein content in each sample.
Cellular ADP/ATP ratio assay. Approximately 100 hPSC-derived β-like cells
were picked and rinsed three times with PBS. Cells were then lyzed and cellular
ADP/ATP ratio was measured using ADP/ATP Bioluminescence Assay Kit
(ApoSENSOR) (Biovision Incorporated), following manufacturer’s protocol.
In each well of a CorningTM Solid White 96-well plate (ThermoFisher
Scientific), 90 µl of Nucleotide Releasing Buffer and 10 µl of ATP monitoring
enzyme were added. The reaction mix were left in the dark at RT for 1 to 2 h. The
basal luminescence reading (Data A) was recorded at 630 nm with the GloMAX®96
Luminometer (Promega).
Approximately 100 hPSC-derived β-like cells were picked and rinsed three
times with PBS. Cells were then treated with 50 µl of Nucleotide Releasing Buffer
for 5 min before transferring onto a shaker at 50 rpm for 5 min. 50 µl of the mixture
for each sample were transferred into one well of the 96-well plate, mixed
thoroughly and left in the dark at room temperature for 2 min. Cellular ATP levels
were recorded using the GloMAX machine (Data B). The readings were recorded
again (Data C).
To each well of the 96-well plate, 1 µl of the ADP Converting Enzyme was
added. The mixtures were mixed thoroughly and left at RT for 2 min. Cellular ADP
level was then measured (Data D). The cellular ADP/ATP ratio was calculated
using the formula below:
ADP=ATP ratio ¼
Data D Data C
Data B Data A
Generation of expression constructs. The pCDH plasmid (System Biosciences)
containing the CMV promoter, N-terminal FLAG tag coding sequence and
ampicillin resistance gene was used as the expression vector for HNF1A. HNF1A
coding sequence was cloned from pLENTI-HNF1A (Origene). PCR products were
inserted into the pCDH vector using the Quick Ligation Kit (NEB). The ligated
plasmid was used to transform STBL3 competent cells (Thermo Fisher Scientific).
Inserted sequences were verified by DNA sequencing. For site-directed mutagenesis, the p.H126D c.376 C > G mutation was generated using the following primers
to replace a cytosine base to guanine base in the HNF1A coding sequence through
a PCR using the Phusion polymerase (Thermo Scientific): Forward primer 5′
TACCTGCAGCAGGACAACATC 3′; Reverse primer: 5′
GATGTTGTCCTGCTGCAGGTA 3′, while the P291fsinsC mutation was generated using the following primers to introduce an additional cytosine base in the
HNF1A coding sequence through a PCR using the Phusion polymerase (Thermo
Scientific): Forward primer 5′ GGCCCCCCCCCAGGG 3′; Reverse primer: 5′
CCCTGGGGGGGGGCC 3′. The parental strand was digested following incubation with Dpn1 (NEB). Introduced mutations were verified by DNA sequencing.
Luciferase reporter assays. The hGLUT2 promoter sequence (−520 to −1) was
amplified from AD-293 cells using forward primer 3′ AGGTTATACTCCCCAGTAAAATG 5′ and reverse primer 3′ TGTACTAGTTGGGAGTCCTGTC 5′. The sequence was then cut with restriction enzyme EcoRV
(NEB) to create blunt ends, and ligated into pGL4.10 vector. AD-293 cells were
then co-transfected with the hGLUT2 promoter construct, pRL-TK renilla vector
and an overexpression vector (pCDH-GFP/ pCDH-HNF1A wild-type or mutants)
using Lipofectamine 2000 (Life Technologies). Cells were transfected in triplicate
wells and each experiment was independently performed three times. Cells were
harvested 48 h after transfection, and luciferase activity was measured using the
Dual Luciferase Assay System (Promega). Firefly luciferase activity was normalized
to Renilla luciferase activity for each well.
16
siRNA-mediated RNA interference. siRNA-mediated RNA interference was
carried out on EndoC-βH1 cells using 100 nM non-targeting (D-001810-10) and
HNF1A-targeting (J-008215-05-0002) ON-TARGETplus human siRNA (Dharmacon, GE Healthcare) with Lipofectamine RNAiMAX (Life Technologies) for 48
h before transfection for overexpression experiments. Cells were then transfected
with an overexpression vector (pCDH-GFP/ pCDH-GLUT) using Fugene (Promega) for 48 h being harvested for GSIS and RNA extraction.
RNA sequencing and differential expression analysis. Poly-A mRNA was
enriched from 1 μg of total RNA with oligo-dT beads (Invitrogen). Up to 100 ng of
poly-A mRNA recovered was used to construct multiplexed strand specific RNAseq libraries as per manufacturer’s instruction (NEXTflex™ Rapid Directional RNASEQ Kit, dUTP-Based, v2). Individual library quality was assessed with an Agilent
2100 Bioanalyzer and quantified with a QuBit 2.0 fluorometer before pooling for
sequencing on a HiSeq 2000 (1 × 101 bp read). The pooled libraries were quantified
using the KAPA quantification kit (KAPA Biosystems) prior to cluster formation.
Adapter sequences and low quality bases in Fastq read sequences were trimmed
using Trimmomatic (v.0.33) (parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36). The quality filtered Fastq sequence reads were
then aligned to the human genome (hg19) using Tophat (v.2.0.14)
(parameters:–no-coverage-search–library-type = fr-firststrand) and annotated with
Ensembl gene IDs. The resulting bam files were used to generate feature read
counts using the Python package-based htseq-count of HTSeq (v.0.6.1p1) (parameters: default union counting mode,–stranded = reverse). The read count matrix
output from HTSeq was used to perform differential expression analysis using the
edgeR package (available in R (v.3.1.3)) in both ‘classic’ and generalized linear
model (glm) modes to contrast patient versus control. Procedures described in
edgeR documentation were followed to calculate P-values, FDR adjusted p-values
(q-values) and fold changes. A false discovery rate (FDR) cutoff of 0.05 and relative
fold change >1.5 fold was used to filter significantly differentially expressed genes.
These genes with Ensembl IDs were mapped to gene symbols.
Chromatin immunoprecipitation (ChIP). Approximately 200–300 hPSC-derived
endocrine progenitors clumps were dissociated using TrypLETM Express Enzyme
cross-linked with 3.3 mg/ml of dimethyl 3,3’-dithiobispropionimidate and 1 mg/ml
of 3,3’-dithiodipropionic acid di(Nhydroxysuccinimide ester) (both
Sigma–Aldrich) for 30 min at room temperature and with 1% formaldehyde
(Amresco) for 15 min. The cross-linking reaction was quenched with 0.125 M
glycine and cells were first lysed in cell lysis buffer (10 mM Tris-HCl pH 8, 10 mM
NaCl and 0.2% NP-40) and then in nuclear lysis buffer (50 mM Tris-HCl pH 8, 10
mM EDTA and 1% SDS) on ice in the presence of protease inhibitors on ice.
Nuclear lysates were diluted in IP dilution buffer (20 mM Tris-HCl pH 8, 2 mM
EDTA, 150 mM NaCl, 0.01% SDS and 1% Triton X-100) and sonicated for 30 s on/
45 s off for 12 cycles using a Q500 sonicator (QSonica) with microtip probes at 30%
power. Sonicated samples were pre-cleared using 10 μg rabbit IgG (Santa Cruz) and
Protein A/G agarose beads. Agarose beads were removed by centrifugation and a
portion of the supernatant was collected as the input control. Samples were divided
equally and incubated with 10 μg of HNF1A antibody (Abcam ab96777) or rabbit
IgG overnight at 4 °C. The following day, samples were incubated with Protein A/G
agarose beads and the beads were recovered and washed with IP wash buffer and
Tris-EDTA buffer. The immunoprecipitated DNA was eluted from the beads using
IP elution buffer (100 mM NaHCO3, 1% SDS, 100 mM DTT). Samples were successively treated with RNaseA, NaCl and Proteinase K. DNA was extracted by
phenol/chloroform extraction. Finally, qPCR was carried out on the input, HNF1A
pulldown and IgG samples using SYBR green (Bio-Rad), targeting the GLUT2
promoter or a control region in GAPDH. QPCR data were quantitated using a
standard curve based on the input DNA, and normalized against GAPDH. Results
are expressed as fold change for HNF1A pulldown relative to IgG control.
ChIP sequencing and analysis
Library preparation. Library preparation was done using a commercially available kit,
NEBNext® Ultra™ DNA Library Prep Kit (NEB #E7645) for Illumina® following the
manufacturer’s protocol. During the library construction, the ChIP-ed DNA underwent End Repair, Adapter ligation, no size selection and PCR enrichment to generate
NATURE COMMUNICATIONS | (2021)12:3133 | https://doi.org/10.1038/s41467-021-22843-4 | www.nature.com/naturecommunications
ARTICLE
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-22843-4
GLUT2 (SLC2A2)
*
G LUT2
*
GLUT3 (SLC2A3)
G LU
*T 1 *
*
1 .6
10
T r a n s c r ip t E x p r e s s io n
20
R e la tiv e to G F P
30
G LUT3
1 .5
n.s.
| 18,478 |
https://github.com/renehorstmann/some_examples/blob/master/include/mathc/sca/bool.h
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
some_examples
|
renehorstmann
|
C
|
Code
| 15 | 68 |
#ifndef MATHC_SCA_BOOL_H
#define MATHC_SCA_BOOL_H
/** for printing in IO */
#define BSCA_PRINT_FORMAT_SPECIFIER "i"
#endif //MATHC_SCA_BOOL_H
| 18,816 |
https://openalex.org/W4394795447
|
OpenAlex
|
Open Science
|
CC-By
| null |
Optimised control of adaptive evolution with competing selective pressures
|
M. Corrao
|
English
|
Spoken
| 6,604 | 10,880 |
Optimised control of adaptive evolution with competing selective
pressures co Corrao*
Gabriel Abrahams*
Harrison St
Department of Engineering Science
University of Oxford
Oxford, United Kingdom
{marco.corrao, gabriel.abrahams, harrison.steel}@eng.ox.ac.uk Marco Corrao* Harrison Steel* natural question is how these parameters should be selected
and/or controlled to optimise the evolution rate of a popula-
tion in an ALE experiment. Abstract— The development of methods to understand and
control the population dynamics of microbial evolution remains
an outstanding question in synthetic biology and biotechnology
more broadly. Due to the stochastic nature of evolution, its
limited observability, and complex intra-population dynamics,
this presents a significant challenge. In this paper, we explore
techniques to control the evolutionary dynamics of a population,
based on manipulation of one or two orthogonal selective
pressures, which may in turn be coupled to mutagenesis. Our approach builds on past research in evolutionary biology
that developed frameworks to study intra-population variant
competition during asexual adaptive processes (i.e. clonal in-
terference). Extending this theory, we design optimal control
strategies for one (or more) selective pressures that can be
used to maximise the rate of adaptation across a population
as a whole. We introduce a theoretical modelling framework
for this process, which we support with both simulations
and preliminary experimental data, providing a concrete basis
for emerging control approaches to directed evolution and
evolution-aware design. In this context, a fundamental issue is to understand how
the rate of adaptation of an asexual population depends
on key parameters of the system, such as the population
size, N, the per capita beneficial mutation rate, Ub, and
the distribution of fitness effects of acquired mutations. When mutations are rare and population sizes moderate,
mutants that have acquired beneficial mutations generally
fix in the population far before new mutants can emerge
(where we consider a mutation as having fixed if it is
present in a large fraction of the population and becomes a
common ancestor of all future populations). In this Strong-
Selection-Weak-Mutation (SSWM) regime the adaptive walk
proceeds as a sequence of isolated selective sweeps. Hence,
adaptation rate is primarily determined by the influx of new
beneficial mutations in the population and, assuming a model
where all mutations have the same selection coefficient s,
the rate of fitness increase is proportional to NUbs2 [5]. However, in many practical applications, populations are
large and/or mutations are sufficiently common such that
new mutant lineages typically establish before earlier ones
can fix - defined as the Weak-Selection-Strong-Mutation
(WSSM) regime. * All authors contributed equally to this work. M.C. and G.A. acknowl-
edge support from the BBSRC Interdisciplinary Bioscience DTP [grant
number BB/T008784/1]. H.S. is supported in part by EPSRC projects
EP/W000326/1 and EP/X017982/1. Optimised control of adaptive evolution with competing selective
pressures In asexual populations, where recombina-
tion is absent, these lineages will compete with each other for
fixation – a phenomenon known as clonal interference. In
this interference regime, travelling-wave models have been
a popular framework [5–9] to study the dependence of the
adaptation rate on system parameters. Typically, these models
approximate the fitness distribution in the population as a
stationary wave travelling at constant speed. The dynamics
of the bulk of the population are modelled deterministically. whereas the fittest edge of the distribution - the small number
of recently arisen mutants that have greater than average
fitness - is given detailed stochastic treatment. The speed of
the travelling wave is then obtained, implicitely or explicitly,
by equating the rates of adaptation implied by these two
analyses (for a full treatment of the matter, see [5]). Th
d
i
f
l
l i
f
b
i
l l .
CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024.
;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
oRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint I. INTRODUCTION Defining the most
fit sub-population to have fitness r = qs, Desai and Fisher
[5] showed that pressure an experimentalist introduces factors such as UV
light or chemical mutagens to increase mutation rates in a
population, a second competing pressure would be added
to the system. This arises because these mutagenic sources
are often toxic to the cell, meaning tolerance-conferring
mutations can arise and provide mutants with a selective
advantage. If not controlled appropriately, the strength of this
secondary selective force can become comparable or even
greater than the primary one, effectively reducing the rate
and/or trajectory of evolution of the trait of interest in the
experiment. In this work, we take initial steps to model and analyse
optimal control strategies for such evolutionary processes, in
which two coupled mutational processes compete with each
other. To this end, we consider a single-effect-size travelling
wave model of asexual adaptation [5] and extend it to account
for the presence of two competing processes. By computing
the probability of fixation for each mutant type, an expression
is derived for the adaptation velocity of each process under
interference. Hence, treating the selective pressure for each
adaptive process as an experimentally controlled input, an
optimisation problem is formulated so as to maximise the
rate of mutation accumulation in the adaptive direction of
primary interest. We derive analytical approximations for
this optimum as a function of the system’s parameters,
and validate our results against stochastic Fisher-Wright
simulations of adaptative dynamics. q = 2ln(Ns)
ln(s/Ub) and τq,i = ln2(s/Ub)
2sln(Ns)
(1) (1) where τq,i is the establishment time for a population to
arise and become deterministic in isolation. This “nose”
population (with fitness qs) is treated stochastically. It is is
fed by a deterministic “feeder” subpopulation with fitness
(q−1)s (Fig. 2). (
)
Departing from the above single-trait process, in our
model there are two traits being selected for, referred to as
type α and β. Each has a single (but potentially different)
fitness effect size sα,β and beneficial mutation rate Uα,β. Considering mutations of type α and β arising from a
common background (quantified below), we wish to calculate
the probability x that the type β of these two mutants
becomes fixed, conditional on the assumption that one of
these two fixes in the population as a whole. To proceed
we consider the “race” to fixation in two parts. I. INTRODUCTION One pressure (here UV) is chosen such that it also
influences the mutation rate. The pressures can be controlled to optimally
steer the evolutionary trajectory for adaptation of a desired trait (here
resistance to chemical X). UV influences
mutation rate
UV Light
Chemical X
Adaptation
to UV
Adaptation
to X
Control inputs Adaptation
to UV UV influences
mutation rate they can be treated deterministically. While calculating the
time-dependent probability distributions governing the size
of mutant sub-populations is complex, Desai and Fisher
[5] showed that by calculating an (approximate) transition
time between the stochastic mutant birth-death process, and
the subsequent deterministic sub-population growth, it is
possible to derive analytical results that agree well with
simulation. This approach is particularly useful for our work,
as it allows us to find closed-form expressions to guide our
intuition regarding how system parameters can be optimised. UV Light Adaptation
to X Chemical X Chemical X Fig. 1. In each generation of the evolutionary process, a mutation
establishes that improves adaptation to the selective pressures present (here
UV and chemical X). One pressure (here UV) is chosen such that it also
influences the mutation rate. The pressures can be controlled to optimally
steer the evolutionary trajectory for adaptation of a desired trait (here
resistance to chemical X). Consider a sub-population of n individuals of a larger total
population of size ∑i ni = N (Fig. 2). This sub-population’s
fitness, r, is defined as the difference between its growth
rate and the mean growth rate over the total population N. A
deterministic sub-population will therefore grow in frequency
within the larger population at rate dn/dt = rn (equivalently a
sub-population with below-average fitness −|r| would reduce
in frequency as dn/dt = −|r|n). Similarly, a stochastic sub-
population will follow a simple birth-death process, with
birth rate 1+r and death rate 1. Beneficial mutations occur at
rate Uβ, and increase the fitness of the sub-population from
which they arise by s. We assume both that all mutations
have the same fixed effect size s, and there are no deleterious
mutations (i.e. s > 0). These assumptions are motivated by
past work [5, 9]: allowing for variable effect sizes, one finds
that the beneficial mutations which tend to dominate the
process are narrowly distributed around a size ˜s, and the
impact of deleterious mutations has in most cases minimal
impact on the overall process dynamics. I. INTRODUCTION Continuous adaptive laboratory evolution (ALE) has be-
come an extensively used tool in modern biotechnology
applications [1, 2]. In a typical setup, a microbial population
is propagated for prolonged periods of time under con-
trolled conditions. Over the course of the experiment mutant
lineages spontaneously emerge and sub-populations with
improved fitness are naturally selected for, so that the mean
fitness of the population steadily increases over time. By
growing the population in a selective environment, the fitness
of an individual can be coupled to a phenotype of interest,
enabling ALE to optimise a wide range of biotechnologically
relevant traits. In recent years, the fast development of laboratory au-
tomation technology has drastically increased the through-
put at which evolution experiments can be run, making it
possible to run continuous, automated evolution experiments
with minimal manual intervention. Particularly, the recent
development of programmable continuous growth devices [3,
4] enables a range of experimental parameters to be tightly
controlled over the course of an experiment. Therefore, a The dynamics of clonal interference become particularly
relevant to practical applications whenever multiple, com-
peting selective pressures operate in the same experiment
(Fig. 1). As an example, if in addition to a desired selective . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
oRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint UV influences
mutation rate
UV Light
Chemical X
Adaptation
to UV
Adaptation
to X
Control inputs
Fig. 1. In each generation of the evolutionary process, a mutation
establishes that improves adaptation to the selective pressures present (here
UV and chemical X). I. INTRODUCTION First is
establishment, a period of length τq during which popula-
tion dynamics are stochastic, and will typically be “won”
by the mutant type with greater beneficial mutation rate
U. Following establishment is a period of approximately
deterministic growth, favouring whichever mutant provides
the larger fitness benefit (i.e. greater sα,β). The rate at which
fixed mutations are acquired (i.e. combining both processes)
is given by Γq = τ−1
q , and the rate at which β mutations are II. RESULTS acquired is given by Γβ = xΓq
(2) (2) (2) which we later seek to optimize. Deterministic growth of each mutant sub-population be-
gins following their establishment, at which they have
reached size ≈1/q¯s [5], where we define ¯s as the mean
effect size of mutations that fix in the population i.e. ¯s =
xsα +(1−x)sβ. Following establishment each has a growth
advantage of sα,β −¯s compared to the mean mutation effect
size ¯s for mutants arising from the common background
(q−1)¯s (see Fig. 2). This growth advantage is compounded
over the time taken to go from initial establishment to the
point at which each population reaches its maximum size
(i.e. fixation, where population size is on the order of ≈N):
this takes (q −1) establishment times, hence (q −1)τq in
total. After this period mutant α will have a size advantage
of e(q−1)τq(sα−sβ ) compared to type β. If a mutant of type
β (rather than one of type α) is to fix it therefore needs to
have a similarly sized head-start at the time of establishment. Thus, we approximate mutant β as having “fixed” if the
following condition is satisfied: su →¯usu,
u ∈{α,β}
(5) (5) Conceptually parameters ¯α and ¯β are defining an envi-
ronment, and imply that mutations arising (which we are
approximating as having an identity independent of the
environment) nevertheless have a different effect (in terms
of their fitness benefit) depending on these parameters. At the same time, increasing the selective pressure will
cause a proportionate, overall slow-down in growth, which
we model by rescaling the adaptation rates as Γ →(1−¯α)(1−¯β)Γ
(6) (6) To gain an understanding of the above model, it’s useful to
consider some limiting cases, using the β mutation process as
an example. At very low selective pressure ( ¯β ≈0), the popu-
lation grows approximately at its maximal rate, but mutations
introduce negligible fitness gains as there is no pressure
to which they can beneficially adapt, and so adaptation
is virtually absent. Conversely, at nearly maximal selective
pressure ( ¯β ≈1), fitness gains from new mutations approach
their maximum, but the population grows vanishingly slow,
so that the timescale for the establishment and fixation of
new mutants become overwhelmingly large. B. Control Parameters So far, we have assumed that the effect sizes of new
mutations, sα and sβ, are fixed constants. In practice, how-
ever, the selective advantage of a mutation is dependent
on the growth environment and, as such, can be tuned by
the experimentalist. For example, if the primary evolution
process under study involves increasing the tolerance to an
inhibitory compound, selective pressure in the system can be
modulated by varying the concentration of this compound
in the growth medium [10, 11]. In order to model this
possibility, we introduce two nondimentional parameters ¯α
and ¯β, with ¯α, ¯β ∈{0,1}, corresponding to the level of
selective pressure applied on each adaptation process. To
simplify our analysis, we shall assume that selection acts
linearly on the system, so that the fitness effect size for each
process becomes Fig. 2. Subpopulations of average size ni with fitness i¯s make up the
total population of size N, with n0 ≈N. At the nose, we examine how
the two possible leading subpopulations feed into the leading background
population. Populations with fitness ≤(q−1)¯s grow deterministically, while
the nose populations grow stochastically. A. Population Model Our model is developed based on the approach of Desai
and Fisher [5]. We first briefly introduce their model, before
departing by extending it to consider the interactions between
two orthogonal traits. Note that our abbreviated introduction
of the modelling framework serves only to provide the
necessary context for our work - for a detailed explanation
of all terms and relevant derivations (for the single-trait
case) please refer to Desai and Fisher [5]. As usual for
population models, at small population sizes, the dynamics
must be treated stochastically, while at large population sizes, . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint Ubnq-1
stochastic drift
N
death
growth
fitness
ln(n)
n-3
n-2
n-1
n0
n1
n2
Fig. 2. Subpopulations of average size ni with fitness i¯s make up the
total population of size N, with n0 ≈N. At the nose, we examine how
the two possible leading subpopulations feed into the leading background
population. Populations with fitness ≤(q−1)¯s grow deterministically, while
the nose populations grow stochastically. Ubnq-1
stochastic drift
N
death
growth
fitness
ln(n)
n-3
n-2
n-1
n0
n1
n2 random variables. Assuming that the probability of β fixing
is less than 50% (i.e. P(¯nβ > ¯nαeη) < 0.5) we arrive at the
following expression: x ≡P(¯nβ > ¯nαeη) =
Uβesβ ε
Uβesβ ε +Uαesαε
(4) (4) where ε = (q−1)τq. acquired is given by Intuitively, then,
fitness-effect sizes and growth slow-down trade-off with each
other – if growth is inhibited there is conversely a large room-
for-improvement due to mutations – suggesting the existence
of an optimal level of selective pressure in between these
limits. nβ(≈τq)
nα(≈τq) > e(q−1)τq(sα−sβ )
(3) (3) (3) . Conceptually (3) is stipulating that if (for example) sβ < sα,
then a mutation of type β needs to reach establishment
quickly and grow by a factor of e(q−1)τq(sα−sβ ) before a
type α mutant establishes, lest it be overtaken in the race to
fixation (due to the α mutant’s faster deterministic growth). We now calculate the probability of the condition in (3)
being satisfied following establishment. As we are primarily
analysing the (stochastic) dynamics of establishment, we
approximate both mutant types as having the same fitness
during establishment (i.e. qs ≈(q−1)¯s+sα ≈(q−1)¯s+sβ),
but allow (potentially) different mutation rates. By making
this assumption we will observe that calculation of (3)
becomes independent of time. Finally, we consider the case where the two processes
under investigation are mutationally coupled. Practically, this
happens if a toxic mutagenic source, such as UV light, is
applied to the system, so that one of the two processes (which Following from (3) we express the probability of a β mu-
tation achieving the requisite “head start” as P(¯nβ > ¯nαeη)
where η = (q −1)τq(sα −sβ) and ¯nα, ¯nβ are independent . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint Fig. 3. Optimal control policies as a function of model parameters. Squares represent numerical estimates computed using a grid search over a discretisation
of the ( ¯α, ¯β) space. For each choice of policy, the adaptation rate in the β direction was computed by averaging the output of 50 stochastic Fisher-Wright
simulations of the population’s dynamics, using an adapted simulation algorithm from [9]. acquired is given by Markers show the mean and standard deviation of 15 independent
replicates of this grid search. Dashed lines indicate the analytical approximations provided in the main text. A: Optimal policy as a function of h = sβ /(bUβ ),
with sα = sβ = 0.02, Uα = 5×10−7, and Uβ varied between 10−6 and 5×10−8. B: Optimal policy as a function of m = (asαUα)/s2
β , with sα = sβ = 0.02,
Uβ = 5×10−7, and Uα varied between 10−6 and 5×10−8. C: Optimal policy as a function of sα/sβ , with Uα,β = 10−6, sβ = 0.02, and sα varied between
0.001 and 0.1. The vertical black line denotes the limit beyond which our analytical approximations are no longer valid. For all three cases, we set N = 1010
and a = b = 50. Fig. 3. Optimal control policies as a function of model parameters. Squares represent numerical estimates computed using a grid search over a discretisation
of the ( ¯α, ¯β) space. For each choice of policy, the adaptation rate in the β direction was computed by averaging the output of 50 stochastic Fisher-Wright
simulations of the population’s dynamics, using an adapted simulation algorithm from [9]. Markers show the mean and standard deviation of 15 independent
replicates of this grid search. Dashed lines indicate the analytical approximations provided in the main text. A: Optimal policy as a function of h = sβ /(bUβ ),
with sα = sβ = 0.02, Uα = 5×10−7, and Uβ varied between 10−6 and 5×10−8. B: Optimal policy as a function of m = (asαUα)/s2
β , with sα = sβ = 0.02,
Uβ = 5×10−7, and Uα varied between 10−6 and 5×10−8. C: Optimal policy as a function of sα/sβ , with Uα,β = 10−6, sβ = 0.02, and sα varied between
0.001 and 0.1. The vertical black line denotes the limit beyond which our analytical approximations are no longer valid. For all three cases, we set N = 1010
and a = b = 50. rate in the β direction when present in isolation: we here assign to the α direction) involves evolution of tol-
erance to this input. Under these circumstances, increasing ¯α
(which corresponds, for example, to increasing the intensity
of UV irradiation on the system) will also have the effect
of increasing global mutation rates. acquired is given by Assuming again a linear
effect, we thus have: Γq = Γα +Γβ ≈Γβ,i ≈2 ¯βsβ ln(N ¯βsβ)
ln2( ¯βsβ/ ¯αbUβ)
(9) (9) where we obtained the last equality substituting (5) and (7)
into (1). By the same argument, we can expect that at the
optimum, Uα →Uα(1+a ¯α) ≈Uαa ¯α
Uβ →Uβ(1+b ¯α) ≈Uβb ¯α
(7) (7) ε = τq(q−1) ≈τβ(qβ −1) =
1
¯βsβ
ln
¯βsβ
¯αbUβ
! (10) (10) where a,b are proportionality constants and the second ap-
proximation in (7) follows from assuming that we operate in
a regime where induced mutagenesis contributes the majority
of mutations to each process. where the last equality follows from (1). Substituting these
two approximations into (2), and using the transformations
(5) and (7), we obtain an explicit, approximate expression
for Γβ valid in the vicinity of the optimum: C. Maximising Adaptation Rate Γβ =
(1−¯α)(1−¯β)
1+ ¯αasαUα
¯βbsβUβ (
¯βsβ
¯αbUβ )(sα ¯α−sβ ¯β)/sβ ¯β × 2 ¯βsβ ln(N ¯βsβ)
ln2( ¯βsβ/ ¯αbUβ)
(11 By introducing coupling between the two processes, the
mutagenic input ¯α affects evolution in the β direction both
positively, by increasing the influx of β-type mutations, and
negatively for two distinct reasons: it introduces a competing
selective advantage for mutations in the α direction, and also
slows growth overall according to (6). Assuming β to be the
process of primary experimental interest, we consider the
problem of finding an optimal input, ( ¯α∗, ¯β ∗), such that: (11) Introducing the lumped parameters Introducing the lumped parameters w = ¯α
¯β ,
m = asαUα
s2
β
,
h = sβ
bUβ
(12) (12) Equation (11) can be rewritten in the form Equation (11) can be rewritten in the form ( ¯α∗, ¯β ∗) = argmax
¯α, ¯β
Γβ
(8) (8) (1−¯α)(1−¯β)
|
{z
}
G
×
1
1+w2m(h/w)wsα/sβ
|
{z
}
I
× 2 ¯βsβ ln(N ¯βsβ)
ln2(h/w)
|
{z
}
B
(13) In order to derive an explicit expression for vβ in terms of
the control inputs, we note that, under the optimal operating
conditions, adaptation rate in the α direction should typically
be smaller than in the β direction, so that, in this regime,
the combined rate term in (2) can be approximated by the (13) Here, we have split up the expression for Γβ into three
conceptual parts. The G term represents growth slow-down . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
oRxiv preprint Fig. 4. Simulated evolution trajectories under the optimal (blue) and various suboptimal (orange, red) control policies. Here, the continuous lines track
the change over time in the mean number of each mutation type in the population. C. Maximising Adaptation Rate The full distribution of mutation frequencies within each population
at the final time point is shown via the green density plots for completeness. Each trajectory is of the same length in time, as measured by the number
of generations scaled by the slow-down factor (1−¯α)(1−¯β). Simulation parameters are N = 109, Uα,β = 10−5 and sα,β = 0.01. The optimal trajectory
(blue) fixes a larger number of β type mutations (compared to the ¯α = 0 case, red) due to ¯α increasing the value of Uβ , despite it also fixing ≈5 α
type mutations. However, for excessively high ¯α (orange) the population fixes a large number of α type mutations, which reduces accumulation in the β
direction due to clonal interference. Fig. 4. Simulated evolution trajectories under the optimal (blue) and various suboptimal (orange, red) control policies. Here, the continuous lines track
the change over time in the mean number of each mutation type in the population. The full distribution of mutation frequencies within each population
at the final time point is shown via the green density plots for completeness. Each trajectory is of the same length in time, as measured by the number
of generations scaled by the slow-down factor (1−¯α)(1−¯β). Simulation parameters are N = 109, Uα,β = 10−5 and sα,β = 0.01. The optimal trajectory
(blue) fixes a larger number of β type mutations (compared to the ¯α = 0 case, red) due to ¯α increasing the value of Uβ , despite it also fixing ≈5 α
type mutations. However, for excessively high ¯α (orange) the population fixes a large number of α type mutations, which reduces accumulation in the β
direction due to clonal interference. due to the application of each pressure. The sigmoidal I term
models velocity slow-down arising from α type mutations
interfering with β type during the fixation process. Finally,
the B term corresponds to the adaption velocity the β process
would have if operating in isolation (but with selection
coefficient and mutation rate scaled by the choice of control
parameters), thus providing an upper bound on the magnitude
of Γβ. w, we turn our attention to the equivalent problem of finding
the optimal value for this parameter. This will give us an
indication of how strong the mutagenic pressure should be set
relative to the pressure of the desirable adaptation process β. C. Maximising Adaptation Rate Differentiating (13) with respect to w and maintaining only
leading order terms, we get that the optimal w approximately
solves: 2−2 ¯β ∗w−¯β ∗wln
h
w
−mw3
sα
sβ
h
w
w sα
sβ ln2
h
w
= 0
(16)i β
With this expression at hand, we now proceed to study the
behaviour of the optimal input pair ( ¯α∗, ¯β ∗) as a function
of the remaining system’s parameters. We start by focusing
our attention on the primary selective pressure ¯β. In the
vicinity of the optimum, we expect interference from the α
process to be always rather contained, so that the dominant
contributions to the expression in (13) are given by the G
and B terms. In addition, for the typical parameter range
considered here (where N ≫sβ and sβ/Ub ≫1), we have
that Nsβ ≫1 and n/ ¯α ≫1, so that the two logarithms in
the B term depend only weakly on ¯β. As a result, we find
that near the optimum the velocity for the primary process
obeys
(16) When sα ≤sβ (i.e. when the nominal selection coefficient for
the mutagenic process is smaller or comparable in magnitude
to the one for the main process), the above equation is
dominated by the first two terms near the optimum, which
we expect to find in the region where w < 1. Neglecting this
contribution, we find that the solution to the resulting tran-
scendental equation can be given in terms of the Lambert-W
function, with the optimal ratio w∗being approximately: w∗= ¯α∗
¯β ∗≈e2n×e
W−1
−
2
¯β∗e2n
(17)
¯α∗≈e2h
2 ×eW−1
−4
e2h
(18) (17) Γβ ∝∼(1−¯β) ¯β
(14) (14) (14) which is maximised for (18) ¯β ∗≈1/2
(15) (15) where W−1(z) denotes the −1 branch of the Lambert W-
function the second approximation follows by substituting
in our previous result ¯β ∗≈1/2. Hence, in this regime, the
optimal input of the mutagenic process depends solely on the
properties of the main adaptation process, showing a weak,
negative dependence on h =
sβ
bUβ (Fig. 3). For sα > sβ, the
interference term in equation (16) is no longer negligible
even at the optimum, and the above approximation ceases
to hold. In this parameter regime, numerical experiments . C. Maximising Adaptation Rate Hence, to the level of approximation considered here, the
optimal input for the primary process can be treated as
independent of the system’s parameters. The approximate
independence of the optimal ¯β was verified via stochastic
Fisher-Wright type simulations of the model (Fig. 3). Next, we consider the input for the mutagenic process, ¯α. Noting that, with the exception of the G term, expression (13)
depends on ¯α only through the ratio of selective pressures . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
oRxiv preprint . CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint Fig. 5. Adaptation to UV stress for three independent E. coli populations in the Chi.Bio bioreactor platform. In each experiment, the UV irradiation
intensity is modulated by a PI controller (each with different tuning) with the goal of maintaining the growth of the culture at the desired setpoint. To
account for the fact that adaptation of microbial populations typically proceeds multiplicatively with respect to the absolute stressor level, the output of the
controller was exponentiated. Left: UV (285nm) input provided by each controller, measured relative to the maximum deliverable irradiation power. Right:
measured growth rate from each reactor, showing different variable performance among controllers in maintaining the setpoint. The control set-point is set
to 1/3 of the average observed initial growth-rate (≈1.5 h−1) Fig. 5. Adaptation to UV stress for three independent E. coli populations in the Chi.Bio bioreactor platform. In each experiment, the UV irradiation
intensity is modulated by a PI controller (each with different tuning) with the goal of maintaining the growth of the culture at the desired setpoint. To
account for the fact that adaptation of microbial populations typically proceeds multiplicatively with respect to the absolute stressor level, the output of the
controller was exponentiated. Left: UV (285nm) input provided by each controller, measured relative to the maximum deliverable irradiation power. C. Maximising Adaptation Rate Right:
measured growth rate from each reactor, showing different variable performance among controllers in maintaining the setpoint. The control set-point is set
to 1/3 of the average observed initial growth-rate (≈1.5 h−1) bioreactor platform [4], each with a differently tuned PI
controller trying to maintain its growth rate at ≈1/3 (i.e. just
below half) of its base-line growth rate (that observed in the
absence of any selective pressure). This is shown in Fig. 5. We found that adaption proceeded faster (as measured by
the time taken for the population to tolerate the maximum
deliverable UV input level) as the controller was tuned to
better maintain the setpoint, suggesting promising future
validation experiments in this direction. show a fast decrease of the optimal mutagenic input profile,
which intuitively is required to dominate the increasing
competitiveness of α-type mutations in the race to fixation
with the β-type ones. Following the above analysis we have derived (approxi-
mate) expressions for optimal values of ¯β ∗and ¯α∗which
if achieved would (in principle) maximally accelerate the
accumulation of mutations adapting the population to stressor
¯β; this is illustrated by simulations for varying control
parameters in Fig. 4. When a mutagenic process with toxicity is added to our
system (i.e. input ¯α), we find that gains in the adaptation
rate of the primary process can be obtained by increasing the
mutagenic input, up to an optimal value. Past this optimum,
interference from mutants tolerant to the mutagenic source
becomes dominant and adaptation in the primary direction
rapidly slows down. For this process, the optimum level de-
pends on the parameters of the model. However, for a range
of parameter values of experimental interest, we found this
dependence to be rather weak, suggesting that, in practice,
an appropriate value can be found even if the parameters of
the evolution process are not known or measurable. III. DISCUSSION CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024. ;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint .
CC-BY 4.0 International license
available under a
was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which
this version posted April 11, 2024.
;
https://doi.org/10.1101/2024.04.08.588561
doi:
bioRxiv preprint III. DISCUSSION The ever-increasing availability and accessibility of labo-
ratory automation has opened a range of opportunities for
improvements in the field of laboratory evolution. Among
these, the automated control of selective pressure has been
experimentally validated as a powerful way of accelerating
adaptation in continuously-cultured microbial populations
[10, 11]. In these experiments, an exponentially growing
population is kept at near-constant size by continuous di-
lution and its growth rate measured throughout. Using an
appropriately designed feedback controller, the growth envi-
ronment is then dynamically modulated to maintain growth
at a constant fraction of its uninhibited value, resulting in a
sustained selective pressure driving the adaptation process. In this paper, we took initial steps to develop the theory
and control approach necessary to derive an optimal value
for this inhibition setpoint by considering a simple model
of mutation-fixation dynamics in the the presence of tun-
able selective strength. We generalised our discussion by
considering the scenario where multiple, coupled adaptive
processes operate in the same experiment. Intuitively, the diminishing returns observed through in-
creasing ¯α to boost Uβ are expected - the benefit of increas-
ing ¯α is limited due to the weak logarithmic dependence on
mutation rate (i.e. in Equation (1)) when populations are in a
regime where mutations are abundant (i.e. NUb ≫1), as this
regime is characterised by processes that are already being
saturated due to competition between different co-existing
lineages. Future work will investigate other regimes of this
process; for example, the case in which process β is initially
in the Strong-Selection-Weak-Mutation regime characterised
by the more forgiving (with regard to mutation rate depen-
dence) adaptive velocity NUbs2. Further, by extending these
results to the travelling-wave frameworks in which mutation
sizes (s) are drawn from a continuous distribution [9] it
will be possible to determine optimal control policies that
additionally bias a mutation-selection process toward fixation
of mutations of specific size range/s. If only one adaptive process is present (which corresponds
to the limiting case of Uα = 0 or ¯α = 0 in our analysis),
we find that the model admits an optimal growth inhibition
setpoint (corresponding to 1 −¯β) which, for the parameter
range investigated here, remains approximately constant at
half of the uninhibited growth rate of the populations. To
begin exploring this finding in an experimental setting, we
adapted three E. coli populations to UV stress in the Chi.Bio . REFERENCES [1]
Troy E. Sandberg et al. “The emergence of adaptive
laboratory evolution as an efficient tool for biological
discovery and industrial biotechnology”. In: Metabolic
Engineering 56 (Dec. 2019), pp. 1–16. [2]
Maria Mavrommati et al. “Adaptive laboratory evolu-
tion principles and applications in industrial biotech-
nology”. In: Biotechnology Advances 54 (Jan. 2022),
p. 107795. [3]
Brandon G. Wong et al. “Precise, automated control
of conditions for high-throughput growth of yeast and
bacteria with eVOLVER”. In: Nature biotechnology
36.7 (Aug. 2018), pp. 614–623. [4]
Harrison Steel et al. “In situ characterisation and
manipulation of biological systems with Chi.Bio”. en. In: PLOS Biology 18.7 (July 2020). Publisher: Public
Library of Science, e3000794. [5]
Michael M Desai and Daniel S Fisher. “Beneficial
Mutation–Selection Balance and the Effect of Linkage
on Positive Selection”. In: Genetics 176.3 (July 2007),
pp. 1759–1798. [6]
´Eric Brunet et al. “The Stochastic Edge in Adaptive
Evolution”. In: Genetics 179.1 (May 2008), pp. 603–
620. [7]
Igor M. Rouzine et al. “The traveling-wave approach
to asexual evolution: Muller’s ratchet and speed of
adaptation”. In: Theoretical Population Biology 73.1
(Feb. 2008), pp. 24–46. [8]
Su-Chan Park et al. “The Speed of Evolution in Large
Asexual Populations”. en. In: Journal of Statistical
Physics 138.1 (Feb. 2010), pp. 381–410.i [9]
Benjamin H. Good et al. “Distribution of fixed ben-
eficial mutations and the rate of adaptation in asex-
ual populations”. In: Proceedings of the National
Academy of Sciences 109.13 (Mar. 2012). Publisher:
Proceedings of the National Academy of Sciences,
pp. 4950–4955. [10]
Erdal Toprak et al. “Evolutionary paths to antibiotic
resistance under dynamically sustained drug selec-
tion”. en. In: Nature Genetics 44.1 (Jan. 2012). Num-
ber: 1 Publisher: Nature Publishing Group, pp. 101–
105. [11]
Ziwei Zhong et al. “Automated Continuous Evolution
of Proteins in Vivo”. In: ACS Synthetic Biology 9.6
(June 2020). Publisher: American Chemical Society,
pp. 1270–1276.
| 2,993 |
https://www.wikidata.org/wiki/Q5547231
|
Wikidata
|
Semantic data
|
CC0
| null |
Georgi Stanchev
|
None
|
Multilingual
|
Semantic data
| 2,038 | 5,228 |
Георги Станчев
български футболист
Георги Станчев професия футболист
Георги Станчев изображение GEORGI STANCHEV.JPG, дата 2012
Георги Станчев екземпляр на човек
Георги Станчев дата на раждане 1985
Георги Станчев дата на раждане 1985
Георги Станчев пол мъжки
Георги Станчев спорт футбол
Георги Станчев гражданство България
Георги Станчев място на раждане Варна
Георги Станчев позиция Нападател
Георги Станчев член на спортен отбор ПФК Добруджа, начало 2016
Георги Станчев член на спортен отбор ПФК Калиакра, начало 2005, край 2011
Георги Станчев член на спортен отбор ФК „Спартак“ (Варна), начало 2011, край 2012
Георги Станчев член на спортен отбор ПФК Калиакра, начало 2013, край 2014
Георги Станчев член на спортен отбор ФК Мастер (Бургас), начало 2014, край 2014
Георги Станчев член на спортен отбор ПФК Калиакра, начало 2015, край 2015
Георги Станчев собствено име Георги
Георги Станчев Идентификатор във Freebase /m/09k5lyc
Георги Станчев категория в Общомедия Georgi Stanchev
Georgi Stanchev
Bulgarian footballer
Georgi Stanchev occupation association football player
Georgi Stanchev image GEORGI STANCHEV.JPG, point in time 2012
Georgi Stanchev instance of human
Georgi Stanchev date of birth 1985
Georgi Stanchev date of birth 1985
Georgi Stanchev sex or gender male
Georgi Stanchev sport association football
Georgi Stanchev Soccerway player ID 124596
Georgi Stanchev country of citizenship Bulgaria
Georgi Stanchev place of birth Varna
Georgi Stanchev position played on team / speciality forward
Georgi Stanchev member of sports team PFC Dobrudzha Dobrich, start time 2016
Georgi Stanchev member of sports team PFC Kaliakra Kavarna, start time 2005, end time 2011, number of matches played/races/starts , number of points/goals/set scored
Georgi Stanchev member of sports team PFC Spartak Varna, start time 2011, end time 2012, number of matches played/races/starts , number of points/goals/set scored
Georgi Stanchev member of sports team PFC Kaliakra Kavarna, start time 2013, end time 2014, number of matches played/races/starts , number of points/goals/set scored
Georgi Stanchev member of sports team F.C. Master Burgas, start time 2014, end time 2014, number of matches played/races/starts , number of points/goals/set scored
Georgi Stanchev member of sports team PFC Kaliakra Kavarna, start time 2015, end time 2015, number of matches played/races/starts , number of points/goals/set scored
Georgi Stanchev given name Georgi
Georgi Stanchev Transfermarkt player ID 157607
Georgi Stanchev FBref player ID ceba77fb
Georgi Stanchev Freebase ID /m/09k5lyc
Georgi Stanchev Prabook ID 2307464
Georgi Stanchev FootballDatabase.eu person ID 79081
Georgi Stanchev family name Stanchev
Georgi Stanchev Commons category Georgi Stanchev
Georgi Stanchev
futbolista búlgaro
Georgi Stanchev ocupación futbolista
Georgi Stanchev imagen GEORGI STANCHEV.JPG, fecha 2012
Georgi Stanchev instancia de ser humano
Georgi Stanchev fecha de nacimiento 1985
Georgi Stanchev fecha de nacimiento 1985
Georgi Stanchev sexo o género masculino
Georgi Stanchev deporte fútbol
Georgi Stanchev identificador Soccerway de un jugador 124596
Georgi Stanchev país de nacionalidad Bulgaria
Georgi Stanchev lugar de nacimiento Varna
Georgi Stanchev posición de juego delantero
Georgi Stanchev miembro del equipo deportivo Dobrudzha Dobrich, fecha de inicio 2016
Georgi Stanchev miembro del equipo deportivo PFC Kaliakra Kavarna, fecha de inicio 2005, fecha de fin 2011, número de partidos jugados , número de puntos/goles marcados
Georgi Stanchev miembro del equipo deportivo PFC Spartak Varna, fecha de inicio 2011, fecha de fin 2012, número de partidos jugados , número de puntos/goles marcados
Georgi Stanchev miembro del equipo deportivo PFC Kaliakra Kavarna, fecha de inicio 2013, fecha de fin 2014, número de partidos jugados , número de puntos/goles marcados
Georgi Stanchev miembro del equipo deportivo F.C. Master Burgas, fecha de inicio 2014, fecha de fin 2014, número de partidos jugados , número de puntos/goles marcados
Georgi Stanchev miembro del equipo deportivo PFC Kaliakra Kavarna, fecha de inicio 2015, fecha de fin 2015, número de partidos jugados , número de puntos/goles marcados
Georgi Stanchev nombre de pila Georgi
Georgi Stanchev identificador de jugador de Transfermarkt 157607
Georgi Stanchev ID de jugador de FBref ceba77fb
Georgi Stanchev Identificador Freebase /m/09k5lyc
Georgi Stanchev identificador de Prabook 2307464
Georgi Stanchev identificador FootballDatabase.eu 79081
Georgi Stanchev categoría en Commons Georgi Stanchev
Georgi Stanchev
voetballer uit Bulgarije
Georgi Stanchev beroep voetballer
Georgi Stanchev afbeelding GEORGI STANCHEV.JPG, tijdstip 2012
Georgi Stanchev is een mens
Georgi Stanchev geboortedatum 1985
Georgi Stanchev geboortedatum 1985
Georgi Stanchev sekse of geslacht mannelijk
Georgi Stanchev sport voetbal
Georgi Stanchev Soccerway-identificatiecode voor speler 124596
Georgi Stanchev land van nationaliteit Bulgarije
Georgi Stanchev geboorteplaats Varna
Georgi Stanchev positie van speler / specialiteit aanvaller
Georgi Stanchev lid van sportteam of club PFC Dobrudzha Dobrich, begindatum 2016
Georgi Stanchev lid van sportteam of club Kaliakra Kavarna, begindatum 2005, einddatum 2011, aantal wedstrijden gespeeld , aantal (doel)punten gescoord
Georgi Stanchev lid van sportteam of club Spartak Varna, begindatum 2011, einddatum 2012, aantal wedstrijden gespeeld , aantal (doel)punten gescoord
Georgi Stanchev lid van sportteam of club Kaliakra Kavarna, begindatum 2013, einddatum 2014, aantal wedstrijden gespeeld , aantal (doel)punten gescoord
Georgi Stanchev lid van sportteam of club F.C. Master Burgas, begindatum 2014, einddatum 2014, aantal wedstrijden gespeeld , aantal (doel)punten gescoord
Georgi Stanchev lid van sportteam of club Kaliakra Kavarna, begindatum 2015, einddatum 2015, aantal wedstrijden gespeeld , aantal (doel)punten gescoord
Georgi Stanchev Transfermarkt-identificatiecode voor voetballer 157607
Georgi Stanchev FBref.com-identificatiecode voor speler ceba77fb
Georgi Stanchev Freebase-identificatiecode /m/09k5lyc
Georgi Stanchev Prabook-identificatiecode 2307464
Georgi Stanchev FootballDatabase.eu-identificatiecode 79081
Georgi Stanchev Commonscategorie Georgi Stanchev
Georgi Stanchev
joueur de football bulgare
Georgi Stanchev occupation footballeur
Georgi Stanchev image GEORGI STANCHEV.JPG, date 2012
Georgi Stanchev nature de l’élément être humain
Georgi Stanchev date de naissance 1985
Georgi Stanchev date de naissance 1985
Georgi Stanchev sexe ou genre masculin
Georgi Stanchev sport football
Georgi Stanchev identifiant Soccerway d'une personne 124596
Georgi Stanchev pays de nationalité Bulgarie
Georgi Stanchev lieu de naissance Varna
Georgi Stanchev position de jeu ou spécialité attaquant
Georgi Stanchev membre de l'équipe de sport PFC Dobrudzha Dobrich, date de début 2016
Georgi Stanchev membre de l'équipe de sport PFC Kaliakra Kavarna, date de début 2005, date de fin 2011, nombre de matchs joués , nombre de points/buts marqués
Georgi Stanchev membre de l'équipe de sport FK Spartak Varna, date de début 2011, date de fin 2012, nombre de matchs joués , nombre de points/buts marqués
Georgi Stanchev membre de l'équipe de sport PFC Kaliakra Kavarna, date de début 2013, date de fin 2014, nombre de matchs joués , nombre de points/buts marqués
Georgi Stanchev membre de l'équipe de sport F.C. Master Burgas, date de début 2014, date de fin 2014, nombre de matchs joués , nombre de points/buts marqués
Georgi Stanchev membre de l'équipe de sport PFC Kaliakra Kavarna, date de début 2015, date de fin 2015, nombre de matchs joués , nombre de points/buts marqués
Georgi Stanchev prénom Guéorgui
Georgi Stanchev identifiant Transfermarkt d'un joueur 157607
Georgi Stanchev identifiant FBref d'un joueur ceba77fb
Georgi Stanchev identifiant Freebase /m/09k5lyc
Georgi Stanchev identifiant Prabook 2307464
Georgi Stanchev identifiant FootballDatabase.eu 79081
Georgi Stanchev catégorie Commons Georgi Stanchev
Georgi Stantsjev
Georgi Stantsjev beskjeftigelse fotballspiller
Georgi Stantsjev bilde GEORGI STANCHEV.JPG, tidspunkt 2012
Georgi Stantsjev forekomst av menneske
Georgi Stantsjev fødselsdato 1985
Georgi Stantsjev fødselsdato 1985
Georgi Stantsjev kjønn mann
Georgi Stantsjev idrettsgren fotball
Georgi Stantsjev Soccerway spiller-ID 124596
Georgi Stantsjev statsborgerskap Bulgaria
Georgi Stantsjev fødested Varna
Georgi Stantsjev posisjon på laget angrepsspiller
Georgi Stantsjev fornavn Georgi
Georgi Stantsjev Transfermarkt spiller-ID 157607
Georgi Stantsjev FBref spiller-ID ceba77fb
Georgi Stantsjev Freebase-ID /m/09k5lyc
Georgi Stantsjev Prabook-ID 2307464
Georgi Stantsjev FootballDatabase.eu spiller-ID 79081
Georgi Stantsjev Commons-kategori Georgi Stanchev
Georgi Stantsjev
Georgi Stantsjev yrke fotballspelar
Georgi Stantsjev bilete GEORGI STANCHEV.JPG, tidspunkt 2012
Georgi Stantsjev førekomst av menneske
Georgi Stantsjev fødselsdato 1985
Georgi Stantsjev fødselsdato 1985
Georgi Stantsjev kjønn mann
Georgi Stantsjev idrettsgrein fotball
Georgi Stantsjev Soccerway-spelar-ID 124596
Georgi Stantsjev statsborgarskap Bulgaria
Georgi Stantsjev fødestad Varna
Georgi Stantsjev spelarposisjon angrepsspelar
Georgi Stantsjev førenamn Georgi
Georgi Stantsjev Transfermarkt fotballspiller ID 157607
Georgi Stantsjev Freebase-identifikator /m/09k5lyc
Georgi Stantsjev Commons-kategori Georgi Stanchev
Georgi Stanchev
futbolista búlgaru
Georgi Stanchev ocupación futbolista
Georgi Stanchev imaxe GEORGI STANCHEV.JPG, data 2012
Georgi Stanchev instancia de humanu
Georgi Stanchev fecha de nacimientu 1985
Georgi Stanchev fecha de nacimientu 1985
Georgi Stanchev sexu masculín
Georgi Stanchev deporte fútbol
Georgi Stanchev país de nacionalidá Bulgaria
Georgi Stanchev llugar de nacimientu Varna
Georgi Stanchev posición de xuegu delanteru
Georgi Stanchev nome Georgi
Georgi Stanchev identificador Transfermarkt d'un futbolista 157607
Georgi Stanchev identificador en Freebase /m/09k5lyc
Georgi Stanchev categoría de Commons Georgi Stanchev
Georgi Stanchev
imreoir sacair Bulgárach
Georgi Stanchev gairm imreoir sacair
Georgi Stanchev íomhá GEORGI STANCHEV.JPG, am 2012
Georgi Stanchev sampla de duine
Georgi Stanchev dáta breithe 1985
Georgi Stanchev dáta breithe 1985
Georgi Stanchev gnéas nó inscne fireann
Georgi Stanchev spórt sacar
Georgi Stanchev tír shaoránachta an Bhulgáir
Georgi Stanchev áit bhreithe Varna
Georgi Stanchev ionad ar an bhfoireann / speisialtacht ionsaitheoir
Georgi Stanchev catagóir Commons Georgi Stanchev
جيورجى ستانتشيڤ
جيورجى ستانتشيڤ الوظيفه لعيب كورة قدم
جيورجى ستانتشيڤ الصوره GEORGI STANCHEV.JPG
جيورجى ستانتشيڤ واحد من انسان
جيورجى ستانتشيڤ تاريخ الولاده 1985
جيورجى ستانتشيڤ تاريخ الولاده 1985
جيورجى ستانتشيڤ الجنس دكر
جيورجى ستانتشيڤ الجنسيه بلجاريا
جيورجى ستانتشيڤ مكان الولاده ڤارنا
جيورجى ستانتشيڤ معرف فرى بيس /m/09k5lyc
جيورجى ستانتشيڤ تصنيف بتاع كومونز Georgi Stanchev
جورجي ستانشيف
لاعب كرة قدم بلغاري
جورجي ستانشيف المهنة لاعب كرة قدم
جورجي ستانشيف الصورة GEORGI STANCHEV.JPG, بتاريخ 2012
جورجي ستانشيف نموذج من إنسان
جورجي ستانشيف تاريخ الميلاد 1985
جورجي ستانشيف تاريخ الميلاد 1985
جورجي ستانشيف الجنس ذكر
جورجي ستانشيف الرياضة كرة القدم
جورجي ستانشيف معرف طريق كرة القدم 124596
جورجي ستانشيف بلد المواطنة بلغاريا
جورجي ستانشيف مكان الولادة فارنا
جورجي ستانشيف مركز اللعب في الفريق مهاجم
جورجي ستانشيف عضو في الفريق الرياضي نادي دوبرودزا دوبريتش, تاريخ البدء 2016
جورجي ستانشيف عضو في الفريق الرياضي نادي سبارتاك فارنا, تاريخ البدء 2011, تاريخ الانتهاء 2012, عدد المباريات , عدد النقاط / الأهداف المسجلة
جورجي ستانشيف الاسم الأول جورجي
جورجي ستانشيف معرف لاعب في سوق الانتقالات.كوم 157607
جورجي ستانشيف معرف لاعب في إف بي ريف ceba77fb
جورجي ستانشيف مُعرِّف قاعدة البيانات الحُرَّة (Freebase) /m/09k5lyc
جورجي ستانشيف مُعرِّف برابوك (Prabook) 2307464
جورجي ستانشيف مُعرِّف لاعب في قاعدة بيانات كرة القدم الأوروبية 79081
جورجي ستانشيف تصنيف كومنز Georgi Stanchev
Georgi Stantschew
Georgi Stantschew Tätigkeit Fußballspieler
Georgi Stantschew Bild GEORGI STANCHEV.JPG, Zeitpunkt/Stand 2012
Georgi Stantschew ist ein(e) Mensch
Georgi Stantschew Geburtsdatum 1985
Georgi Stantschew Geburtsdatum 1985
Georgi Stantschew Geschlecht männlich
Georgi Stantschew Sportart Fußball
Georgi Stantschew Soccerway-Spieler-ID 124596
Georgi Stantschew Land der Staatsangehörigkeit Bulgarien
Georgi Stantschew Geburtsort Warna
Georgi Stantschew Spielerposition/Spezialität Stürmer
Georgi Stantschew Mitglied von Sportmannschaft oder -verein PFC Dobrudscha Dobritsch, Startzeitpunkt 2016
Georgi Stantschew Mitglied von Sportmannschaft oder -verein Kaliakra Kawarna, Startzeitpunkt 2005, Endzeitpunkt 2011, Anzahl der gespielten Partien , erzielte Punkte/Tore
Georgi Stantschew Mitglied von Sportmannschaft oder -verein Spartak Warna, Startzeitpunkt 2011, Endzeitpunkt 2012, Anzahl der gespielten Partien , erzielte Punkte/Tore
Georgi Stantschew Mitglied von Sportmannschaft oder -verein Kaliakra Kawarna, Startzeitpunkt 2013, Endzeitpunkt 2014, Anzahl der gespielten Partien , erzielte Punkte/Tore
Georgi Stantschew Mitglied von Sportmannschaft oder -verein Kaliakra Kawarna, Startzeitpunkt 2015, Endzeitpunkt 2015, Anzahl der gespielten Partien , erzielte Punkte/Tore
Georgi Stantschew Vorname Georgi
Georgi Stantschew Transfermarkt-Spieler-ID 157607
Georgi Stantschew FBref-Spieler-ID ceba77fb
Georgi Stantschew Freebase-Kennung /m/09k5lyc
Georgi Stantschew Prabook-Kennung 2307464
Georgi Stantschew FootballDatabase.eu-Spieler-ID 79081
Georgi Stantschew Commons-Kategorie Georgi Stanchev
Georgi Stanchev
calciatore bulgaro
Georgi Stanchev occupazione calciatore
Georgi Stanchev immagine GEORGI STANCHEV.JPG, data 2012
Georgi Stanchev istanza di umano
Georgi Stanchev data di nascita 1985
Georgi Stanchev data di nascita 1985
Georgi Stanchev sesso o genere maschio
Georgi Stanchev sport calcio
Georgi Stanchev identificativo Soccerway di un calciatore 124596
Georgi Stanchev paese di cittadinanza Bulgaria
Georgi Stanchev luogo di nascita Varna
Georgi Stanchev ruolo (nella squadra) attaccante
Georgi Stanchev membro della squadra sportiva Profesionalen Futbolen Klub Dobrudža Dobrič, data di inizio 2016
Georgi Stanchev membro della squadra sportiva Profesionalen Futbolen Klub Kaliakra Kavarna, data di inizio 2005, data di fine 2011, incontri totali , numero di punti/gol segnati
Georgi Stanchev membro della squadra sportiva Profesionalen Futbolen Klub Spartak Varna, data di inizio 2011, data di fine 2012, incontri totali , numero di punti/gol segnati
Georgi Stanchev membro della squadra sportiva Profesionalen Futbolen Klub Kaliakra Kavarna, data di inizio 2013, data di fine 2014, incontri totali , numero di punti/gol segnati
Georgi Stanchev membro della squadra sportiva Profesionalen Futbolen Klub Kaliakra Kavarna, data di inizio 2015, data di fine 2015, incontri totali , numero di punti/gol segnati
Georgi Stanchev prenome Georgi
Georgi Stanchev identificativo Transfermarkt di un calciatore 157607
Georgi Stanchev identificativo FBref di un calciatore ceba77fb
Georgi Stanchev identificativo Freebase /m/09k5lyc
Georgi Stanchev identificativo Prabook 2307464
Georgi Stanchev identificativo FootballDatabase.eu di un giocatore 79081
Georgi Stanchev cognome Stanchev
Georgi Stanchev categoria su Commons Georgi Stanchev
| 46,623 |
https://github.com/zhugexinxin/we-2021/blob/master/packages/editor/src/init-default-config/config/toolbar.ts
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
we-2021
|
zhugexinxin
|
TypeScript
|
Code
| 198 | 837 |
/**
* @description toolbar 配置
* @author wangfupeng
*/
import { t } from '@wangeditor/core'
import { INDENT_RIGHT_SVG, JUSTIFY_LEFT_SVG, IMAGE_SVG, MORE_SVG } from '../../constants/svg'
export function genDefaultToolbarKeys() {
return [
'headerSelect',
// 'header1',
// 'header2',
// 'header3',
'blockquote',
'|',
'bold',
'underline',
'italic',
{
key: 'group-more-style', // 以 group 开头
title: t('editor.more'),
iconSvg: MORE_SVG,
menuKeys: ['through', 'code', 'sup', 'sub', 'clearStyle'],
},
'color',
'bgColor',
'|',
'fontSize',
'fontFamily',
'lineHeight',
'|',
'bulletedList',
'numberedList',
{
key: 'group-justify', // 以 group 开头
title: t('editor.justify'),
iconSvg: JUSTIFY_LEFT_SVG,
menuKeys: ['justifyLeft', 'justifyRight', 'justifyCenter', 'justifyJustify'],
},
{
key: 'group-indent', // 以 group 开头
title: t('editor.indent'),
iconSvg: INDENT_RIGHT_SVG,
menuKeys: ['indent', 'delIndent'],
},
'|',
'emotion',
'insertLink',
// 'editLink',
// 'unLink',
// 'viewLink',
{
key: 'group-image', // 以 group 开头
title: t('editor.image'),
iconSvg: IMAGE_SVG,
menuKeys: ['insertImage', 'uploadImage'],
},
// 'deleteImage',
// 'editImage',
// 'viewImageLink',
'insertVideo',
// 'deleteVideo',
'insertTable',
'codeBlock',
// 'codeSelectLang',
'divider',
// 'deleteTable',
'|',
'undo',
'redo',
'|',
'fullScreen',
]
}
export function genSimpleToolbarKeys() {
return [
'blockquote',
'header1',
'header2',
'header3',
'|',
'bold',
'underline',
'italic',
'through',
'color',
'bgColor',
'clearStyle',
'|',
'bulletedList',
'numberedList',
'justifyLeft',
'justifyRight',
'justifyCenter',
'|',
'insertLink',
{
key: 'group-image', // 以 group 开头
title: t('editor.image'),
iconSvg: IMAGE_SVG,
menuKeys: ['insertImage', 'uploadImage'],
},
'insertTable',
'codeBlock',
'|',
'undo',
'redo',
'|',
'fullScreen',
]
}
| 48,407 |
https://github.com/arangodb/arangodb/blob/master/3rdParty/boost/1.78.0/boost/mpi/collectives/scan.hpp
|
Github Open Source
|
Open Source
|
BSL-1.0, Apache-2.0, BSD-3-Clause, ICU, Zlib, GPL-1.0-or-later, OpenSSL, ISC, LicenseRef-scancode-gutenberg-2020, MIT, GPL-2.0-only, CC0-1.0, LicenseRef-scancode-autoconf-simple-exception, LicenseRef-scancode-pcre, Bison-exception-2.2, LicenseRef-scancode-public-domain, JSON, BSD-2-Clause, LicenseRef-scancode-unknown-license-reference, Unlicense, BSD-4-Clause, Python-2.0, LGPL-2.1-or-later
| 2,023 |
arangodb
|
arangodb
|
C++
|
Code
| 601 | 1,784 |
// Copyright (C) 2005-2006 Douglas Gregor <[email protected]>.
// Copyright (C) 2004 The Trustees of Indiana University
// Use, modification and distribution is subject to the Boost Software
// License, Version 1.0. (See accompanying file LICENSE_1_0.txt or copy at
// http://www.boost.org/LICENSE_1_0.txt)
// Authors: Douglas Gregor
// Andrew Lumsdaine
// Message Passing Interface 1.1 -- Section 4.9.1. Scan
#ifndef BOOST_MPI_SCAN_HPP
#define BOOST_MPI_SCAN_HPP
#include <boost/mpi/exception.hpp>
#include <boost/mpi/datatype.hpp>
// For (de-)serializing sends and receives
#include <boost/mpi/packed_oarchive.hpp>
#include <boost/mpi/packed_iarchive.hpp>
// For packed_[io]archive sends and receives
#include <boost/mpi/detail/point_to_point.hpp>
#include <boost/mpi/communicator.hpp>
#include <boost/mpi/environment.hpp>
#include <boost/mpi/detail/computation_tree.hpp>
#include <boost/mpi/operations.hpp>
#include <algorithm>
#include <exception>
#include <boost/assert.hpp>
namespace boost { namespace mpi {
/************************************************************************
* Implementation details *
************************************************************************/
namespace detail {
/**********************************************************************
* Simple prefix reduction with MPI_Scan *
**********************************************************************/
// We are performing prefix reduction for a type that has an
// associated MPI datatype and operation, so we'll use MPI_Scan
// directly.
template<typename T, typename Op>
void
scan_impl(const communicator& comm, const T* in_values, int n, T* out_values,
Op /*op*/, mpl::true_ /*is_mpi_op*/, mpl::true_ /*is_mpi_datatype*/)
{
BOOST_MPI_CHECK_RESULT(MPI_Scan,
(const_cast<T*>(in_values), out_values, n,
boost::mpi::get_mpi_datatype<T>(*in_values),
(is_mpi_op<Op, T>::op()), comm));
}
/**********************************************************************
* User-defined prefix reduction with MPI_Scan *
**********************************************************************/
// We are performing prefix reduction for a type that has an
// associated MPI datatype but with a custom operation. We'll use
// MPI_Scan directly, but we'll need to create an MPI_Op manually.
template<typename T, typename Op>
void
scan_impl(const communicator& comm, const T* in_values, int n, T* out_values,
Op op, mpl::false_ /*is_mpi_op*/, mpl::true_ /*is_mpi_datatype*/)
{
user_op<Op, T> mpi_op;
BOOST_MPI_CHECK_RESULT(MPI_Scan,
(const_cast<T*>(in_values), out_values, n,
boost::mpi::get_mpi_datatype<T>(*in_values),
mpi_op.get_mpi_op(), comm));
}
/**********************************************************************
* User-defined, tree-based reduction for non-MPI data types *
**********************************************************************/
template<typename T, typename Op>
void
upper_lower_scan(const communicator& comm, const T* in_values, int n,
T* out_values, Op& op, int lower, int upper)
{
int tag = environment::collectives_tag();
int rank = comm.rank();
if (lower + 1 == upper) {
std::copy(in_values, in_values + n, out_values);
} else {
int middle = (lower + upper) / 2;
if (rank < middle) {
// Lower half
upper_lower_scan(comm, in_values, n, out_values, op, lower, middle);
// If we're the last process in the lower half, send our values
// to everyone in the upper half.
if (rank == middle - 1) {
packed_oarchive oa(comm);
for (int i = 0; i < n; ++i)
oa << out_values[i];
for (int p = middle; p < upper; ++p)
comm.send(p, tag, oa);
}
} else {
// Upper half
upper_lower_scan(comm, in_values, n, out_values, op, middle, upper);
// Receive value from the last process in the lower half.
packed_iarchive ia(comm);
comm.recv(middle - 1, tag, ia);
// Combine value that came from the left with our value
T left_value;
for (int i = 0; i < n; ++i)
{
ia >> left_value;
out_values[i] = op(left_value, out_values[i]);
}
}
}
}
// We are performing prefix reduction for a type that has no
// associated MPI datatype and operation, so we'll use a simple
// upper/lower algorithm.
template<typename T, typename Op>
inline void
scan_impl(const communicator& comm, const T* in_values, int n, T* out_values,
Op op, mpl::false_ /*is_mpi_op*/, mpl::false_/*is_mpi_datatype*/)
{
upper_lower_scan(comm, in_values, n, out_values, op, 0, comm.size());
}
} // end namespace detail
template<typename T, typename Op>
inline void
scan(const communicator& comm, const T& in_value, T& out_value, Op op)
{
detail::scan_impl(comm, &in_value, 1, &out_value, op,
is_mpi_op<Op, T>(), is_mpi_datatype<T>());
}
template<typename T, typename Op>
inline void
scan(const communicator& comm, const T* in_values, int n, T* out_values, Op op)
{
detail::scan_impl(comm, in_values, n, out_values, op,
is_mpi_op<Op, T>(), is_mpi_datatype<T>());
}
template<typename T, typename Op>
inline T
scan(const communicator& comm, const T& in_value, Op op)
{
T out_value;
detail::scan_impl(comm, &in_value, 1, &out_value, op,
is_mpi_op<Op, T>(), is_mpi_datatype<T>());
return out_value;
}
} } // end namespace boost::mpi
#endif // BOOST_MPI_SCAN_HPP
| 50,602 |
petrilombardisen03pete_182
|
Latin-PD
|
Open Culture
|
Public Domain
| 1,841 |
Petri Lombardi Sententiarum libri quatuor
|
Peter Lombard, Bishop of Paris, ca. 1100-1160 | Thomas, Aquinas, Saint, 1225?-1274. Summa theologica. 1841 | Aleaume, Jean, 15th/16th cent | Garcia, Francisco, fl. 1578-1583 | Rubeis, Bernardo Maria de, 1687-1775 | Migne, J.-P. (Jacques-Paul), 1800-1875
|
Latin
|
Spoken
| 6,175 | 12,176 |
I. Joannis Fabricius in secunda Historiae bibliothecae Fabricianae partem 15, recensente Thoma Aquinas suminant Theologus, coloniae anno 1622 typis edalat. Hic sive occasione, aliorum dictarum literarum collecta, quae sancta aut minima accurate sunt, aut inepta aut falsa, ut sanctissimi doctoris eiusque posteri operis claritas et auctoritas quovis indo infuscator ac minuantur. Singula, qua in protestantium criticae inter eminentioris hominum adhibita opponuntur, referre hoc loco non lubet, cum ea in praeviis Admonitionibus aut Dissertationibus nostris haud aliquatenus in lacem emissis, aut validissimine refutata sint auctori illius diligenter evulsa. Pauca occurrunt alia illi so Fabricio adnobilala, quae cum momenti qualique videntur habere, ad examen vocare praestat. Agit 83, in editione scilicet Wolfenbutteli anno 1718 curata, sic censore: "Domus deprovinicia sunt, quae viri civiles in hac summa theologia observarunt noloque." Quaenam vero et quot illa sunt, quae a novo censori item sive terrae sacrage argui debentur? Hinspue quatuor linguas numerantur, vel quae insuper habenda sunt ut putone levissima, vel quae iniqua censura perstringuntur. Primum est: "P. 1 (parte prima), in plena pagina 8, art. 3: Sed contra est quod Gregorius dicit super cantico: quod in usu communi inde est in omnibus rebus praesentibus, patet et substantia. Hic locus novum reparesentat in Gregorio Magno: Ancillon, Melanchthon, et alii in P. 2, 555. Aliquid si in" Gregorio Nysseno, qui illum in libello commentatus est. Immo in nostra editionis margine citatur Gregorius N., homilia. « 7 » in Ezechielem, pari in ante saulum. » Introduzione alle dissertazioni triginta, in uno volume in folio, raccolte, de Gosli e scritti della Doctrina di San Tommaso, Aquinate e delle edizioni Veneziane anno 1750, apud Giovanni Battista Pasquale, postrema est, ubi diligentiis agitur, et in 4, de co-lectiolectionis, quale lingua latina e patente in Sancto Tommaso satis indicant ejus opera, sive quod attinet ad veteres philosophos, sive maxime ad Ecclesiam christianae Patres scriptores voe omnis aevi. Anonimi critici viri puerilem castigavimus animadversionem, qui cum recenseat scriptores ecclesiastici, quos legisset Rhomae, numerat tautalius Thagislrum sententiarum, Epistolas Pontificum decretales, et integrum Gratiani decretum. Imo sine dubio in hisce rivulis non sistebit Aquinas, adibitque fontes ipsos, si pro seculi conditione liceret. Parturient osera, quae bene multa praestant erant, evolvebant excutiebantque; et novimus insignes alias lucubrationes, (jure desiderabantur), diligentissime ab ipso perquisitas in codicibus, qui latebant in ostiis. Noverat ipse nihilominus novos acutos sibi dossent ecclesiastica monumenta, quae alia indicata aut in catalogis recentia legabat: ipsorum que delectu aliquo modo suppleret, ulae patebant de facto Gratiani, et glossis, et canonibus, quod genus collectium santitiorumque magistrorum scriptis, quae ferme habundant illi actu. Haec lectionis collectanea iam ab Aquinate, et haec ejus eruditionem splendidissimis exemplis ac facilis inconcussis ostendimus in dissertazione cilata, quae sub Admonitionis praeviae titulo habetur in volumen 16 operum sancti Thomae, quorum editionem Venetam in 4 incepit Josephus Bellarminus, et prosequitur diligentissimis typis Simonis Occhi. Quod ogeo Thonetia Aquinate elogium diuins aucius repeto, etiam in ejus operibus non difficileor, quos adversus praedicabilem ingenii aculis, neculla diligencia industriae obtinebat. potioral : cujusmodi sunt alium auctorem pro alio allegare, et aliterius hems aliter sulisliluere, ac librorum locos mendosus censere, aut meditatos qui legebantur sequi indices. Temporum, quibus vilam agebat scribebalque Aquinas, condicio haec erat : quae tamen non obsistat quominus Erasmus vir criticissimus ea laude Aquinatem celebraverit, ut qui is, quae per eam tempestatem dabantur tam strictis usus. Menda similiter post reseratos locos Patrum, post editam ecclesiasticorum monumentorum copiam, postque plurium seculorum sudores laboresque, facile negotio aut omnia, aut penitentia emendarent Nostrates, aliique viri diligentissimi : collatis codicibus Thomae manuscriptis observare potuerunt, mendosos indices non paucos, non et calamo Thomae profectos esse, sed ex amaritudine aut ignorance causae et oscitantiae. Jam vero ad mendosum Gregorii Magni super Cantica indicem sermo convertatur. Ante Aquinatem verba, quae descripta sunt num. Jam Gregorio tribuerat Magister sensentiarum, Petrus Lombardus, in primo libro, dist. 37, sub subtita A : "Beatus Gregorius super cantica Psalmorum inquit : Licet Deus communi modo omnibus rebus insit, praesentia, potentia, substantia, etc. Mirabile subit id non observisse Fabricium censorem ! Id verò pridem observaverat neginaldus Lucarinus in suis animadversionibus in textum operum sancti Thomae, Bonisi excusis anno 1666. «Il lancio sentenziale, etc. (inquisizioni), tribuì il Magister in 1, dist. 37, sancto Gregorio, scrisse super Canticum Canticorum, eque fidei secutus est sauctus Thomas. De allucinatione agit samniter vespertilio operum sancli Gregorii editor doctissimus in Admonitio ad Expositionem Canticonum, a quibusque dulio abest ea sententia. Thomas quidem, sed etiam Magister Sententiarum memorat pro sua diligencia et fide, qui in errorem inciderint: probatque deinde, temporibus Potri Lombardi, qui floruit duodecimo seculo, dubium non fuisse sanctum Gregorium expositurus Cantica. Mendosum ergo indicem ex Magistro Sententiarum transcripserit Aquinas; quem etiam saeculus Bonaventura transcripsit ibidem in arte 1, art. 3, qu. 2. At lapsus hujusmodi, levissimum illum nulliusque momenti, quis non condonet in Magistro ac multis magis in sancto Thomas, et in Sancto Bonaventura? Nisi etiam maturest consilii non illud preferret omnino? Nonne vero Joannes Fabricius, qui censorem agit aut inscilae redarguendus est, qui neminem illud in Petro Lombardo non videre ante Aquinatem; aut certe injustitia, seu nimia criminandi Thomam libidinis, quem unum, praestrasse Magistro, de novo accusat, utrique communis? Quoique verum in hanc disciplinationem, tametsi leve malum, ingredi conligit, liceat mihi inferre gradum, et in ipsam vitiosi indicis originem diligentissime inquirere. Id erit fortasse cum aliquo emolumento. In Glossa, quae vocatur ordinaria, super cantica Canticorum, ad ea verba vers. 17: Quo abii? Dilectus locus? Plures afferuntur expositiones. Editione utor, quae exstat in Bibliis sacris Nicolai Lyranus. (Expositio prima est): "Quo abii? Non relinquendo vos, in quibus erat; sed ubi alios associet, et post alios etiam alios invitet." (Altera): "(3)(6 abiit? Gregorius: "Sciendum quod Deus, qui ubique est, in loco est, sed locale non est. Locale dicitur, quod circumscribiliur secundum limites partis loci, supra et infra, ante et retro, dextrum et sinistram," etc. (Tertia deteriore): "Quo abii? Licitus Deus communiter in omnes res insit, praesentia, potentia, substantia, tamen familiariter ratio dicit inesse, id est, per gratiam," etc. Quo in loco perspicua est expositio secundam Gregorio tribui, minimi tertiam, quae sententiam exhibet, qua de agimus. Quemadmodum verus expositio tertia hactenus in operibus Gregorii irritum voto perquisita est; ita secunda, sine minimis quoad singula verba, saltem quoad sensum, lauris sine dubio ex variis Gregorii locis potuit; sive ex libro 2 in Job, capite 7, num. 20, sive ex libro 10, capite 9, num. 14, sive ex libro 16, capite 8, num. 12, sive ex libro 27, capite 11, num. 19, sive ex libro 1 in Ezechiel, capite 8, num. 16, sive ex libro 2, homilia 5, num. 2. Allalura Glossae textum pendeat jam facile innotescit. Niendosi indicis origo apud Magistrum Sententiarum. Hanc vidit Franciscus Sylvius, qui 1 p. qu. 8, art. 3, in calce sic ait: "Magister, cum Glossam ordinariam legeret, quae ad finem capitis 5 in Cantica liabet ista verba, non quidem sub nomine Gregorii, sed quia Paulus ante citatus erat Gregorius, putavit etiam sequentia esse Gregorii, cum sint irritus dubioisius Glossae. Hanc veram originem sive dissimulaverit sive ignoraverit Fabricius, pudendum sane est. Glossae opus Vallalrido Straboni tribuitur, qui uno saeculo vitaris agebat. An Glossar legerit sauctus in honias, et an potiiis Glossam praediclo articulo scripserit ipse, imperitique amanuenses Gregory substituerint? Francisco Garcia insulis emendationibus errorum, etc, verba sunt: «si me concurrens non fallit, Thomas sic citavit: G. dicit supra Canonica, velens significare Glossar, et non Gregory: et tamen aliquis pro Glossi posuit Gregory, cum utrumque ab edem litera G. initium sit. » Eruditione et diligentia Aquinatis convenit conjectura. Res autem est, quae codicum Mss. fide conficienda videtur. Vetustum summae theologiae codicem in veneta sanctorum Joannis et Pauli Bibliotheca lustravit peritissimum Dominus M. Bernardelli ejus coenobii alumnus: scriptumque invenit, quae sigla Gregory indicant. Atali praeterea codices bonas notae expendendi forent, ut quid demissim scripserit Thomas, quid amanuenses peccaverint, certo consulari. IV. Magister fide deceptus fuertit sanctus Thomas. Adelius levis haec ejus allucinatio est, ut nonnisi ineptissima habeatur censura, quam iterum propalare Fabricio placuit. Mendum quidem cubat in indice: ac quae citatur describiaturque sententia, reperitur in Glossa, verissimamque doctrinam contemnit, quam latinorum graecorumque Patrum documentis illustrat Dionysius Petavius libro 5 de Deo Deique proprietatibus, a capite 7. Patet jam videre, vitiosi praedicti indicis emendationem quaerendam non esse in aliis Gregoryi operibus, et locis superiis indicative: quod nonnulli legerent. Glossae nomen nihil anceps reparae pro Gregory: quod factum video in parisienne editione anno 1652 curata. Hoc opere, quod Glossam ordinariam vocamus, Ireclinus utitur sanctus Thomas. Quid verus? Accidit non infrequenter, alleague a Roma sententialias in eadem non reperiri Glossam, quam scilicet variis typis editam habemus. Als Glossae codice Ms. nactum se esse, testatur Joannes Nicolaus in praefatione ad summi theologiae, qui fidem integram sancti Thomae confirmat, easque sententias continet quas veluti Glossas desuptas asserit sanctissimus doctor. Hinc vero prudenti quisque discat, ne tam praecipue in hujuscemodi rebus judicium ferat. Fuerint alii in operibus Romanis mendosi indices. Verim enim verus non omnes Aquinatis tribui debent, qui plurimis ex inscitia et oscilantia amanuensium proficisci poterant; et si qui ex ipsius Thomae calamo exciderint, nemo per injuriam tam lachle objiciuntur ac etiam exaggerantur. Interim menda id genus omnia, aut penituit omnia jam doctissimorum virorum diligentia emendavit. Inter primos, qui hanc spartam ornare coeperunt, eminet poster nostrales Antonius, patricius Lusitanus, cognominatus a Conceptione, mutatoque cognomine dictus deinde senensis ob singularem erga sanctam virginem Catharinam de Senis observantiam. Antwerpiae opus edidit typis Plantini anno 1569, fol. inscriptum: "Testimonia Patrum Procloramque autctorum, et demul, quaeque alia citat sanctus Thomas saltem in contuso in tota sua Summa theologiae, indefesso labore perquisita, etc." Hujus vestigia presserunt alii exitu felicissimo. Idque demul conslat auctorum sententias ab Aquinale citatas aut ipsis verbis tenendis, aut saltem quoad sensum, vel genuinas esse, suosque certos habere parentes: vel si quae admodum paucissimae suppositiones sunt, reperiri tamen in ecclesiasticis monumentis: adeque in hujusmodi indicibus bonum et optimum constare Thomae fidem. CAPUT 11. — De Hera Fabricii censura doctrinam ratione petit de proprio illo Dei nomine, Qui est; ejusdem doctrina subtilitas et etiam soliditas. Adversus Fabricii rationes expensae et eversae; vindicaturque Musorethica lexlus libelli lectio. Sancti illorum doctrina, veterum latinorum graecorumque patrum documentis conformis; et favent Hebraeorum magistri. Alterum sequitur Joannis Fabricii censura. In Parte etdem (prima), quaest. 13, art. 11, Hoc nomen, Qui est, in triplici ratione est raxirafne proprio nomen Dei. 1° Propter eius significationem; 2° propter ejus universalem; 3° pro plera cum eius significationem. Haec subtilissima excogitata videtur. Saltera para solida sunt, praesertim cum non sit revera scriptum: sum qui sum, sed: ero qui ero. Quidquid tandem his verbis medicare Deus voluit, hoc est, sive curiosanimo Moysis iterrogationem simpliciter reicere; sive praesentiam suam ipsi promittere, sive ex operibus suis qualis sit apparebitur esse docere. C. Vorst. in Nolji ad Disp. 2 de Deo. Conradus Vorstius inlegit in tractatu de Deo, sive de natura et attributis Dei. Integrum Thomae textum referre praestat, ut ejus doctrinae subtilitas simulque soliditas ragis effulgeant. Verba sunt: "Dicendum quod hoc nomen, quod est, triplici rationale est maxime proprium nomen Dei. Prima quidem, propter significationem. Non enim significat formam aliquam, sed ipsum esse: quod civis esse Dei sit ipsa ejus essentia, et hoc nulli alii conveniat, ut supra ostensum est, manifestum est quod inter alia nomina, hoc maxime proprie nominat Deum; unius quodque in Deo nominum". BEIUNAM MARI/L DE KULLIS DISSECTATA. 15' U Sicut formae. Secundis, propter eos universales. Omnia enim alia nomina sunt singularia: et si converto cum ipso, aliam addo unam super hissum secundum rationem (ut singularis, pluralis), unde quodmodum informale et determinantis sum. In hoc autem noster aim non potest ipsam Dei essentiam cognoscere in statu viresco, secundum quod in se est; et id quoque alia nomina sunt in his sum determinata et inagis communia et absoluta, tota singularis propria dicuntur de Deo ad nos. Unde et Damascenus (lib. 1 orthod. Fidoi) dicit quod principalius omnibus, quae de Deo dicuntur, nominibus est, Qui est... Tertius vero, ex ejus significatione. Significat enim esse in praesenti, et hoc maxime proprium de Deo dicitur, cuius os non novit praetorium vel futurum, ut dicit Augustinus in quinto de Trinitate. Subtiliter habeantur praedicta; Aquinatis rationes, hoc est with perspicaci ingenio rem, quam versus, profundis perscrutante inventas; et solidas quoque sint, utpote ipsi rei, quae subtiliter consideratur, maxime convenientos solutioni tertiae pondus additur ex auctoritate sancti Augustini in libro 83 Quaestionum, qu. 17: "Apud Deum nihil deeret, nec praeteritum igitur, nec futurum, sed onino praesens est apud Deum." Et in libro 5 de civitate Dei cap. 2: "Ab eo, quod esse, dicta est essentia. At quis magis est quam ille qui dixit saluto suo Moysi: Ego sum qui sum; et dices illi Israel: Qui est, misit in me vobis? Nationem secundum Grammatica auctoritas Joannis Damasceni in loco citato, capite 9, in editione Michaelis Lequieu: "Ex omnibus pondera nominibus, quae Deo tribuitur, nullum figuram proprium visetur atque hoc et simile, Qui est, quemadmodum ipse Moysi in monte respondorat, ait: Nisi illis Israele: Qui est, misit in me vobis. Nam totum esse, vel ut in immensum quoddam ac nullis terminis definitum essentiae pelagus, complectum suo ipse continet. Et uriusque diminuti, Augustini et Damasceni auctoritates et alia in anima rationem confirmant. Neque tamen palladium esse noften illud, ila ab Aquinate intelligi proprium Dei et si perfecte et aequali essentiam Dei, cujusmodi est in se, significaret aut representaret; sed quia adhuc imperfecius (ipso Thomson sapiontissime animadvertente in 1, dist. 8, q. 1, art. 1, ad 3) per alia nomina significaliur eadem essentia Dei. Hanc vero theologiam, si praesertim Fabricius habuisset, haud unquam doctrinam ejus sublimem politis judicasset quam solidiorem. Ad Ioannis Damasceni locum nolam sapuiugit Lecineus, dignissimam animadversionem. Verba sunt: "Prisci philosophi Deum neutro nomine, S; appellabant: quae vox ad ipsum ens in commum significandum aetheo sensu detorquebatur. At masculinum, w;, solim Deum verum exprimit, cujus essentia sit ipsum esse purissimum ac subsistens, cunctis rebus neutiquam concretum, aut ex ipsis intelligibiles opera abstractum. Gregory Nazianzenus verba subjungit in oratione 56 circa finem inquirantis: "Tot illic sensu proprio sanctum Dei, ac totum, nec unius qualis vel posterior (nec enim erat, aut erit) circumcisum ac detiaitum. Ubicunque totum neutro genere est ratio proprium esse Dei dicitur, quia totum esse Deus comprehendit sineulla limitatione. Clarior est ac splendidior Joannis Damasceni expositio loco citato: "Ex omnibus nominibus, quae Deo tribuitur inquirulis, nullum sequitur primo videre atque etiam genus neutro, quid est... Kama (Kivov) totum esse (quod est in genere neutro), sicut immensum quoddam ac nullis terminis definitum essentiae pelagus, complexu suo ipse continet." II. Censurus Joannis Falclii oppositio praestat: "Non hic esse rebus a scripto, sed qui sum; sed: Ero qui ero," (tertio caput Exodi, vers. 14) quo nepa ex loco nomen Dei sumitur, quod ipsius Dei maximum proprium esse docet Aquinas. Sacra historia tradit Moysen a Deo electum esse missumque ad Israelitas, quos ab jugo Pharaonis liberaret; ipsumque Moysen rogasse Deum itaque quo ipsum nomine apud Israelitas vocaret, paideasisse dignaretur. Divinum responsum sic exhibet sacer textus hebraicus: "Dixit Deus ad Moysen: Eloe hiphil: qui Eloe hiphil: et dixit, sic dices ad Israel: Eloe hiphil misit me ad vos." At verus Elohim vox est verbi m, futuri in conjugatione, quae dicitur kal: unde juxta grammaticae regulas versio foret: "Eto qui ero... Ero misi me ad vos." At enim frequentissimum Hebraismum adnotant grammatici, quo futurum usurpatur pro praesenti; ipsumque in aliais verbis locum habere, adprobant critici sacri, Münsterus, Fagius, Vatablus, Clarius, Drusius. Cur non verus, 70 interpretes tot in actum Christum secularis graece vertena: Evangelium, ego sum, quis sum, vel ego sum, is qui est, vel etiam misi me, salutate ego sumens. Hunc Exodus spectare vides, locum videlicet Joannes apostolus et evangelista in Apocalysi, caput 1, vers. 4: Pax vobis, et pax. Tot 6 (flv, xat 0 ^v, xy.i 6 eVdyjvo,-, al) eo qui est, et qui SUMMA. IV. crat, et quid erit; hisque verbis vim vocis expressa, aut non expressa explicare voluisse Joannem, omissis interpretibus. Versionem latinam venerandissima et antiquissima, actu benedicta et auctor et modo translulit: "Sunt qui sunt; et postea civitatem verti dolurent:" Sum meus, me ad vos, personam primam comminutavit in certitudine, Qui est misit me ad vos, ut clarior esset in interpretatione. Poritissimus homodie linguae sanctus Hieronymus in epistola ad Marcellam sic ait: "Sextum (nomen Dei) serio legimus, qui in Exodo legiture, qui est misit me; prima scilicet persona in certitudine commutavit. Quam donice tum presentis lectio in Vulgata exstantem sequuti sunt interpretes Irenaeus, Novatius, Ambrosius, Augustinus, Ferrandus Diaconus, et Phoebadius, quorum verba recitavit Petrus Sabaitor in sua Versione Halitica versione: Hacque consonant graci Patres. Alia dabimus infra. Haec verba primam Fabricii oppositionem evertunt et elidunt. Alii aut ejusdem oppositio : « Quidquid tangeret his verbis indicare Deo voluit : hoc est, sive curiosam Moysi interrogationem similiter rejice. » similorem interpretationem praedixit Hugo Victorinus in Annotationibus elucidatoris ad hunc locum : a Ego sum, qui sum (inquint), et si diceret : nomen meum non ducam eis : qui si hoc nescire debereut. Hic est ironicum dictum, quasi diceret, nomen meum ignoratur. Hanc expositionem his verbis declarat Cornelius a Lape, ide : «Deus hic non declarat, sed politicis cum quadam majestate silebat nomen suum. Ut si gravis aliqua persona rogaret de nomine, respondent : sum qui sum; quasi dicat : hoc est ut vocor. » Verimile hoc (ipsius a Lape verba sunt) est improbable. Nam paulo post Deum jubet Moysi, ut hoc nomen, Quis est, quasi Dei legis se proprium nomen et titulum praefereret missioni suae : (et ali, sic dices filiis Israel : Quis est misit me ad vos.) Deminitium Hugo sancto Victore locum explicat de proprio, quod expresserat Deus nomen suum: ego sum, qui immutabiliter sum, cujus nomen proprium est ens. Ubique animadversum est Hebraismum in his sententiis novisse Hugonem, ac futurum tempus accepisse pro praesenti. Tertia sequitur Fabricii oppositio: "sive praesentiam suam ipsi Moysi prorollere Deus voluerit." Parera affert expositionem laudatus Hugo: "vel sic, ne difficile sit, quid loquaris, et quid dicas ei (populo Israelitico), quia ego sum, qui tecum sum." Solomon et Burgensis eodem modo exponunt apud Cornelianum a Lapide: "Ego ero (vel sum), supple, vobiscum in hac tribulatione, vos eam liberans; qui ero (vel sum), supple, deinceps semper vobiscum in omni vestra affictione." Scilicet, ut doctissimus laudatus interpres: "Hoc arctius est et frigidius." Ac sane Moysi ineptitudinem suam prospexant jam Deus responderat vers. 12: "Qui dixit ei, o peccator, quia te querebatur." Itaque cum iterum laboraret Moyses, quo filios Israel modo de missione suadent certiores faceret, rogaret nomenque ipsius Dei missit rogaret, et ipsi Deus diceret, se esse, qui est; quidquam sine dubio addit, quod illis verbis; ero tecum, non expresserat. Nomen videlicet sibi maxime proprium pallet, quod summa ac ultima significat rationem, ex qua prospexat Moysi et filiis Israel praesentalam ac protectionem dependet: cum ipse sit is, qui est, et est immutabilis, aeternus, insciens, omniscius, omnipotens, et enormis continens perfectiones. Haec Thesauri Aquinatis, haec omnium sanctorum Patrum solidissima interpretatio est. Hanc etiam vidisse R. Chischia inter Hebraeos doctus videtur, qui apud Vatablum et Paulum Fagium sic locum istum explicavit in libro Hizkuni: "ut primum nomen eius sit nobile Dei; alterum verbum ejus asseruit expositionem. Ac si dicat: Nomen meum Ero (vel sum). Nalo, quia Ero (vel sum), in saecula saeculorum absque fine. Deinde quod Ero etiam (vel sum), vobiscum, ut liberem vos a tyrannide Aegyptiorum." Posteriorem interpretationem conjungit cum priore, veluti qua ab ea dependet. Ait demhm Fabricius : « sive ex operibus suis , qualissit, appariturum esse docere voluerit Deus. » Ad eoriim opi- nionem haec objectio reducitur, qui vocem n^nN a conjuga- tione kal removent , putantque pertinere ad conjugationem piliel , vel hiphil : genuinamque lectionem esse vel Ima- neh , vel hateh : adeoque mendosam Masoretliarum jjun- clalionem , nMN, ehieh in conjugatione kal cum duplici scegol sub litteris N, et >, etcum scheva sub littera n. Ad- dunt ver6 conjugalionera in kal verbi n^n absolutam esse, ae intransitivain , et subslantivam : idemque verbum in conjugalione pihel et hiphil significatiouem habere trans- itivam activamque. Unde sacrura denique textuin sic ex- ponunt : Eqo sum qui do esse , vel fcicio esse similemque sensum activum obtrudunt. Hac de re agit eruditi,ssime Stephanus Soucietus s. J. in fQuarante-huit.J 1 515 DE QUATUOR CAPITIBUS DOCTRIN^ S. THOM^, etc, dissertalione criticksur lenom de Dieu mrTi jehova, capite 3. Fauci delibera praestat. Eam primi affero animadversionem, quam promit vir doctissimus ex grammaticorum documentis: verbum esse aut intransitivum, absolutumque et substantivum tantim: in eoquo conjugationum in phpel, et in hipliil, quae activaesimul, vestigium nulla in tota sacrata Scriptura reperiri. Masoreticorum interpretatio deinde, scilicet quid futurum tempus conjugationis in kd pertinet, ab ipsis excogitata non tuit, sed remotioris remotissimque aetatis auctores habere 70 interpretes, tot ante Christum seculls, ac illum quin in exordiis Ecclesiae christianae latinam vulgatam, sive italiam versionem confecit, ac Hieronymum qui novis curis latinam versuit ex Hebraeo sacra Biblia. Ita quidem in Targum, sive Paraphrasi Hiersosolimitana exponitur coma Exodii, de quo aaimus: "Ile qui mundo dixit: "Esto, ac fui;" at etiam alia subjungitur interpretatio: "Ego ille, qui sum, et futurus sum, misit me ad vos." Arabica versio in Poliglotta Waltoni sic habet: "Aeternus qui non praeterit." Quid? quidem, si Deus ille sit qui dat esse; diuio procul omni oportet, ut illum primo concipiearas esse, qui est. Aliadiserit scitui dignissima soucieius, caput 3 citato, et sequentibus casibus: etiam evincere videtur ipsum quoque nomen Dei Tetragrammaton Jehovah suum ex conjugatione verbi in kal originem ducere. Cadunt iam verba Joannis Fabricii oppositiones: quaeve contra ipsa doctissimorum virorum rationes alat;e sunt, sancit Thomae Aquinatis doctrinam mirifice confirmant. Si sumitur ipsa ex ipso sacro textu Hebraeo, ejusdemque sacri textus antiquissimis ante Masoretharum aetate versionibus, graeca, latina, Chaldaica, ARA Mia, et aetiam sequioris aevi interpretationibus omnis linguae. Ipsissimam graecis et latinis patres unam voce doctrinam tradiderunt. Gregorii Nazianzeni, et Joannis Damasceni, et Augustini verba descripsimus unum. Saletus Hilarius libro 1 de Trinitate, num. 3, haec habet: "Ego sum qui sum.... Non enim aliud proprium magis Deo quam esse, intelligitur, quia id ipsiura quod est, neque desinentis est aliquando, neque coepti; sed id quod cum incorruptae beatitudinis potestate perietuum est, non potuit aut potentir aliquando esse, quia divina omne neque abolitioui, neque exordio obnoxium." Elegantissima hic in novum verba sunt in caput 5 ad Ephesios: "Ego sum qui sum quod in me operare communis substantiae, sibi proprium vindicat Deus? Sicut, ut diximus, causa, quia caetera ut sint, Dei sumptum beatificio; Deus verus, qui semper est, nec habet aliunde principium, et ipse sui origo est suaeque causa substantiae, non potest intelligi aliter habere, quod subsistit." Alios Ecclesiae latinae Patres eorumque sententias affert Dionysius Petavius libro 1 de Deo Deique proprietalibus, capite 6. Neque Arabius adversatur, qui in Psalmum 43 num. 19, sic ait: "Moyses interrogavit: Quod est nomen tuum? Cognoscens qua rerum eius Deus, non respondit nomen, sed negotium; hoc est, rem expressit, non appellationem, dicens: Ego sum, qui sum, quia nihil tam proprium Dei, quid semper esse." Levissima difficultas est, quae nullo modo Fabricii censuram fulcit. Satis namque est, Moysi nomen interrogantium a Deo verba ipsa expressa esse: eamque expressionem, si pro nomine Ambrosius non habet, ab aliis Patribus, veluti nomen, acceptam esse. Inter graecos Patres accipe Clementem Alexandrinum libro 1 Paedagogi, capite 8. In quibus tribus temporibus (qui fuit, et est, et erit), ponitur unum nonien, nempe qui est (Exodi 3, 14), nomen Dei scilicet, qui solus est. Verba sunt Epiphanii in haeresi 69 Arianorum, num. 70. "Est igitur substantia.... illud ipsum, quod est: sicut Moyses dixit: "Qui est misit me ad (illos israel. Ilaque hoc est, qui est, ens est." Alia Nazianzeni, quem num. 1 laudavimus, verba profero in oratione 36: "Non hoc solum nomine (qui est) appellatur Deus, quod ipse cum Moysis in monte oraculum ederet, ita seipsum appellavit... sed etiam quia nomen illud, xuptwTspov, magis proprium esse comperimus." En verbo quot insignes, doctissimos quisque suae doctrinae vades habeat sanctus Rhomas, Ecclesiae christianae latinos et graecos Patres. Consentiunt Hebraeorum magistri. Verba sunt Maimonidis apud Petavium, sexto capite, num. 5: «voc nomen derivatum est a verbo naha, quod significat existentiam; naha haia significat existere.... Totum verum mysterium positum est in eo quod repetit earandem dictionem, quae existentiam significat, per modum attributionis vel significatio. Nam pronomen relativum, qui continet in se mentionem attributionis alicujus inhaerentis sibi; quippe quod nomen sit imperfectum, et adjectum sibi aliud requirit. Et possibilia est nomen primum, quod substituit vicem sustinet, ehieh, ero; et nomen secundum, quod attributum ejus est, itidem vocatur Ehiech, ero quasi ostendere vellet substantiam ipsum idem in substantia esse cum attributo. Ut haec totius rei declaratio sit: Deum esse, sed non per essentiam. Quare explicatio et expositio illius est: Existens, qui est necessario existit. R. hisce basi locum superius num. 2 descriptum habes. Sententiam addo doctorem, quem Fagius Nehemanidem appellat, Gerundensem dicens: «Deus est illa existentia vel subsistentia, quae nec praeterit, nec praeteribit.... Est Deus semper, qui nunquam coepit, nec unquam desinit, sed transcendit omnia rationem temporis: et qui solus potest dicere: Sum, vel Ero. Est enim ipse omnis essentiae atque vitae fons et penitudo: a quo omnia, quae sunt, habent esse quod sunt. Quia igitur aeternitas nulla temporibus comprehenderutur, ideoque nullus tempore describi potest. Quo fit, ut relegetur, qui est, qui fuit, qui erit, nam omnia tempora, cum de Deo loquimur, confunduntur. » Hebraeorum magistros alios praetereo. Quam ergo subtiliter, quidem, sed etiam solidissime Dei explicaverit Thomas, quod est: Sum qui sum, vel qui est, jam patet. Ab hoc nomine distinguitt illud quod retramgrammaton vocatur, est scilicit Jehovah, sancti Hieronymi autoritatem secutus in epistolam citatam ad Marcellam. De hac distinctione, quam alii negant, etque de nominis ejusdem origine ac vi, consule laudatur Soucietum aliosque doctores. Satis est discrimen indicare, quod inter ea duo nomina assignat Aquinas, si quod admitte debet, loco citato ad 1: «Dicendum quod hoc nomen, Qui est, est magis proprium nomen Dei, quantum ad id, in quo imponitur, scilicit ab esse : et quantum ad modum significandi et significanti.... Sed quantum ad id ad quod imponitur nomen ad significandum, est magis proprium nomen Tetragrammaton : quod est positionura ad significandam ipsam Dei substantiam incommunicabilem ; et (ut sic licet loqui) singularem. Rem hanc penitius indagine scrutari, pretium operae non est. CAPUT III. — unum plus quam primum vocari diem debuisse, in quo lux facta est, rationalibus ostendit Aquinas ex sancto Basilio sumptis : hinc verb sancta est Joannis Fabricii censura. Fallit igitur monophysticus revertaux, qui rationes praedictas rejicit, vel etiam unicam interpretalionem. Alii vespera praesalutis, alii mane, alii lucem, aliial vice versa. Joannes clericus notatus. I. Tertiam refero, quam referet Joannes Fabricius, censuram in sancturam Thoma Aquinatem: "Parte ipsa" (prima), tua est. 74, art. 3, dicitur unus dies in prima diei institutione (Geneseos capite 1, vers. 3), ad designandum, quod viginti quattuor horarum spatia pertinent ad unum diem. At unus dicitur pro primo. Sixtinus Amama Antibarba. Bibl. Textus Hebraeus habet: Dies "Trin echad" unus: non "primus". Sunt verba Aramaica in libro 2, capite 1 Genesis vers. 5: "Noiantur eruditi interpretes cardinalem numerum poni pro ordinali... Id si in mentem venisset Thora, non ad hunc sudasset in responsione ad quaestionem illam, cur dictur unus dies. Textus sanctus Thomae integrum afferre praestat. Verba sunt loco citato: "Dicuntur quod dicitur unus dies in prima diei institutione ad designandum quod viginti quattuor horarum spatia pertinent ad unum diem: unde per hoc, quod dicitur unus, figurilur mensura diei naturalis. Vel propter hoc, ut significaret diem consunium per reditum in Sels ad actum et in punctum, vel quia, completo septenario dierum, reditur ad pristinum diem, qui est unus cum octavo. Et has tres rationes Basilium assignat. Tres uteque collectas rationes latiore sermone declarat sanctus Basilius in Hexaemeron, homilia 2. Cur ergo Basilium iraetereunt Amama et Fabricius, et unum vellicant Aquinatem? Injusta censura est. Reason aliam addit, quaui affert Nehemiah inter Hebraeos docus, qui apud Fagium inter criticos sacros dicit: Utrum (diem) et non primum meritorum dici debuisse, cum nondimodus dies existit, cujus respectu dicatur primus. Hanc ipse Fagius rationem vocat simplicissimam. Sunt vero rationes probabiles, verisimiles, convenientes; quas non adoptare licuit Joanni Fabricio, neque sola in Amamae; at censura ferus auctus. II. Dionysius Petavius, libro i de Opificio sex dierum, ca- pite 9 , nura. 9, iia scribit : « Qu6d primus iUe dies... non « primus a Moyse, sed unus nominatur , mysticum nescio « quid et arcanum redolere vismn graecis maxinie Scripto- « riJ)us, ut Philoni , BasiUo, Origeni homiliSi prim^ in Gene- « sim, Procopio, Caesario sed. et Hebrajis quibusdam : nihil, « hoc est , ciim sit perspicuum , linguae potihs Hobraicae « proprietati iribuendum illud esse, quae cardinales nume- « ros pro ordinalibus frequenter usurpat. » Reoonam ego cum Thcophilo Alethmo , seu Joaone C|eir 1517 BERNARDI MARIyE Dl-: RUBKIS DISSr.RTATIO f:;f» rlco, in noL^ ad luuic lociim : « Quamvis nou nogcni cardi « uales nuincros pio onliiialilius iiiiu rai'6 usui-|iari apuil « llebraios , csse taineii aliaai ralidnciu, ol) (inaiii Moyscs « usus siL voce TIN niius, iioii vocc IWNI |iriiiius. » r.cstal ununi , nuin quas adliiliucre sancli falres raliiiies, iiiliil exiiilieaiil quod lcve sil, aliciuiiu, c,l ineiiluiu, probaliilcs- que el couvcnientes apiareaiil. « MysUcum ncscio quid el arcainuu » a 1'alriluis |)rot'erri Petavius ait, « quod uiliil esl. « rallilur sine dul)io vir do- ctissimus. l'.(iuideiu Pliilo in libro de ninndi opilicio com- nieutum mysticuiu liabet : « Non iiriniuiii, sed uuuin» no- minavil Opilex : (( qui sic dicitur iiroplcr siii^ularilalein « inlelligibilis nnuiili, liabenlis natnraiii unilatis. » rcrlianj quoque, quam Basilius ratioiuMn affert , iii arcanis iraditaiu vocat : et an ea polior liaberi debeal ac validior expeiulit. Sed rationes alias dies, biuslicis commentis quis videas diversarum causarum sequulari Gcsarius in Dialogo qui prostin in tomo Lugdunensis bibliotheca fatrarum: ac mysticum denique scientiam quid minime redolit ratio Origenis homilis in Genesis: "Non dixit dies prima," sed "dixit dies una" (inquientis), quae tempus terminum erat, anequinqut esset mundus: tempus autem esset initium ex consequentibus diebus, secunda valiue dies et tertia dies et quarta et reliquae omnes tempus finem habere designerunt. Ratio eadem videtur, quae supra ex Nehevialide descripsimus. III. natio praeteriri non debet, quae indicat Theophilus Aeternius loco citato: "quam scilicet, inquit, diversam plats a commentis mysticis veterum invictis apud Joannem Clericium." Quo in loco et ipse allitur, qui fationes in verbibus allalas ad commenta mystica pertinere constituit. Ait ille verus in citale commentario in Genesim: "Unus dies est illis dies, unus prius, ob rationem quam subinde inquimus: nempe propter noctis, quae mundi creationem superessit prolixitatem, in quem unus pluries dies, sed similares infinium myriadum annorm intervalla quaerebant quis possit? sed, ut diximus, quantumvis longa, instar unius noctis, in qua quarquor vigilias trium horarum divisere, habita est: quid nullam esset mensura, civis in plures dies dividerentur, nedum in esso distinguere possent annos." Clerici memorandum magis patelicunt, quod superius presumerat. "Vespiarium malulo tempore praeponit Moyses: oaque porro ab Hieronymo positae est in dies numericus. Et in loco in dies unus imminens nocte, quae lucem superessit, et luce duodecim horarum, consilii fuerunt: quod in nocte illa, quamvis longa cujuscumque rei vicissitudineerrarit, quales sunt dies vices, quas in certis diebus potuerint coeperit." Partes. Mysticia commensura nihil est in life ratione Clerici: quae tamen obtrudere nihil videtur ineptissimum immenso velut in cujusdam noctis, lucis et mundi creationem superessentis, commentum; ex qua nocte velut in duodecim horas solis, et ex qua luce duodecim horarum dies unus conflatu factus, qui tuerit primus. Narrat sacerdores Geneseos auctores: in principio creavisse terram caelum, et terram sua esse inanem et vacuam, et tenebras super faciem abijssus; suum a novo lucem, et suum dividere in tenerris: et bene meum appetisse diem, et tenebras noctem; et ex hac nocte, cujus initium est vespera, et ex hac die, cujus initium est mane, factum esse diem unum, scilicet naturalem. 11 : sex diebus fecit Dominus cœli, et terram, et mare, et omnia quae in eis sunt, et requiem in die septimo. Clerici commento ea maxime adversantur doctrina, quae coeli ac terrae creationi resert ad primam diem, primaramque diurnam partem in vespere, sive nocte, sive tenebris reponit. Hanc optime declarat Franciscus Sylvius in commentario artiuli 3 citati, qu. 74, auctoritate innixus Thoma Aquinasi. "Nobisimus ergo (inquit) diem naturalem, (qui scilicet viginti quattuor horas complectitur, a nocte initium habuisse, a tenebris nimirandum quis in mundo eraui, priusquam Deus luce in formaret, et tamen diem, hoc est dies civilis seu artificialis a nocte artificiali distinctiam incoepisse a luce. Iuipso enim mundi exordio primum fuerunt tenebrae, ac postea demum lux est creata; sed illa tenebras, antequam lux produceretur, non habebat rationem diei vel noctis. Non diei, quia diei facile lux, qua tunc nulla erat; non etiam noctis, quia noctis dicetur illa dicere naturalis portionem, qua distinguitur ab opinatione sic habet ad diem civilem. Imic autem illius diei civilis fuerat, cui nox opinionem habuerunt; necque ulima in solis inviandum creatura lumenare, civis esset alium facere diem. Als ibi Deus in lucem levavit, ipse eam appellavit, seu fecit qua lex appellari posset, dies; tenebras alium appellavit, et sic licet qua appellari possent, nox; atque ita ex illo tempore prius tenebrals illas sortiri sunt rationem noctis. explicandi indum insinuavit, Deus sicut quis, art. 18, ad quartum dictum: "Caelum, coeli ligatum terrae". Ad primum diem perline, quia semel caelo et terra creatum est tempus, distinctio temporum, quantum ad diem et noctem, incoperit per lucem. Hinc semel animadversionem sanctus doctor, 1 p. qu. 6, art 1, ad 2: "Si tempus (post mindi creationem), divinissimam tenebram constituisse jurorum, et postmodum formalum, et distinctum per diem et noctem". Sunt alii vicem, tum antiqui Patres, lumina recentiorum docteur, qui diei naturali exsistimant in capacisse lucem; adeoque caelum et terram (sacula esse, ac tenebras etiam fuisse, ante solem diem. At clerici adversantur, qui noctem illam exogitavit inmensam, nulli creationi prioris, in quatuor vigiliis trium luminis dividendam. Ludovico Sylvio audire praestitit: "Respondens postules, Caeterum et terram facit esse angelorum diem; illud quarumque solemnim spalii, qua ante producem hic serant tenebras, nec videbant nullum lumen incedercat cunctis praesentia faceret diem, et suadente noctem: annumerarim sex dies (his rubibus fecit Deus caelum, et terram, et mare, et omnia quae in his sunt). Partim quia licet caelum et terra fuissent quoad substantiam creata ante omnem diem; spatium tamen sex dierum fuissent formata, seu distincta et ornata; necque plus dies impensius fuissent in illorum creatione, distinctione et ornatu quam sex. Partim, quia spatium illud praecedens fuit brevissimum. Sicut autem consuetudo locuendi habet, ut ea dicantur facta in aliquo loco, qua; secundum illum facta sunt: quomodo Christus in Jerusalemae passurus signifiquurus Luc. 13, vers. 35, qui tamen extra portam assus est, ad Hebraeos 13, vers. 12; ita quidam facta esse dicuntur in aliquo certo tempore spacio, etiamsi paulo ante coepta sint nulla: sedificiunt aliquot recomda diceretur lacus esse spatio duorum annorum, etiamsi unus alterque dies autecedens fuissent creati. Hanc istoriam illi de spacio, ut ait Sylvius, quo ante productionem lucis erat tenebris, vocat momentum unum Philosophus et Petavius libro 1 de opificio sex dierum, capite 9, num. 11. At haec, inquit vir doctissimus, mera est ariolatio; etque fidem Philoponiis ullo argumento facit. Paulatim enim in rerum conditu progredi divina scientia voluit, et primum etiam imperfectum opus edere: ut qui tum spectatores erant augelis, quibusdam veluti gradibus ad perfectae summi opificis sapientiae intelligentiam erudirentur, ac pedetiptime per rerum creatarum vestigia percurrerent. Nonne vero difficulter etiam Petavius aliquot videre possit? An uno aliove die, aul longiori spacio indigerebat angelus, ut ad perfectae summi opificis sapientiae intelligentiam erudiretur? Haec ego exsimulaverim, super terram esse levebuss dicere, ut intelligere rubum co momento, quo conditus est, quoad omrium rerum substantiam, conditum luise sine oriens et sine ullius distinctione: et haec ipse pisse formationem mundi a luce: diligentiorem hujuscemodi rerum indaginem non exposcic Aquinatis doctrina, qua vindicaras. CAPUT IV. — Suppositilia Cyrilli lexandrini testimonibus Quinta in Summa theologiae allegari fulsione nolo Oaiines- Fabricius. Launoius, quem ipse landut, tum bonum stiloma fidem, tum justum iicerium vindicavit. Inter ea, quae Joannes taliricius animadvertit, abs viris eruditis in hac Summa theologica observata luisse et notata, quarto loco suppositilia quidam Cyrilli testimonia recenset: Sidumde allegavit (inquiens) quod a Cyrillo Alexandrino ad probandum potestatem pontificiam. Eavi 6 loca apud sanctum illum scriptorem non reperiri, fusce ostendit Joannes Launoius, epist. 1, parte 1. In errorem statim incidit censor: nec enim Launoi, aut si quid aliud viri doctrina, observarunt unicum, Thoma Acituatem in Summi theologiae; allegasse Cyprianum, quae in ejus operibus non habentur. Alias, quemadmodum lucubrationes indicat ipse Launoi: et ex his promittit ea, quae sub cygni Alexandrini sive verba allegantur. Spectes limitem in epistola 1 ad Faustum, p. 1, sic legitur: "apud beatum Thomam": et prima quemque in 4, dist. 24, quaest. 3, art. 2 (in argumento): Praelusores B. Cyrillus. DE QUATUOR CAPITALIBUS DOCTRINA S. THOMAE, etc. Eiam etiam: "Nulii alii," a Pedes quislibet humanitas. Episcopus Alexandrinus dicit: "Ut membra maneamus in capite nostro Apostolico Thoma romanorum pontifex." etc. Et in libro contra rapugnantes Religionem caput 0 sub finem: "Unde dicit Cyrillus Alexandrinus episcopus in libro 2 Thesaurorum: ut membra maneamus," etc. Mox in caput 4: "Cui (Romano Pontifici) ut Cyrillus dictat, omnes jure divino caput inclytum," etc. In contra errores Graecorum, parte 2, ubi Thomas agit de romano pontificatu, et alia, quarto, quinto, sexto, et septimo caput Illiuli: "Dicit Cyrillus patriarcha Alexandrinus in libro Thesaurorum: Sicut Christus accepit Pauiri ductatum, et sceptrum, quam Petro," etc. Et intra: "est I" etc. Ibidem: "Dicit enim Cyrillus in libro Thesaurorum: Ut membra maneamus," etc. Et quibusdam interpositis: "Dicit Cyrillus quod ipsius Apostolici thronus romanorum [unicus] cum solo est separare posse, etc. Ac ibidem: "Dicit etiam Cyrillus in libro thesaurorum: Itaque, fratres, si Christum imitabor," etc.
| 48,055 |
https://github.com/slusek/OG-Platform/blob/master/projects/OG-Analytics/src/test/java/com/opengamma/analytics/financial/instrument/payment/CouponArithmeticAverageONSpreadSimplifiedDefinitionTest.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,019 |
OG-Platform
|
slusek
|
Java
|
Code
| 529 | 2,919 |
package com.opengamma.analytics.financial.instrument.payment;
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertFalse;
import org.testng.annotations.Test;
import org.threeten.bp.Period;
import org.threeten.bp.ZonedDateTime;
import com.opengamma.analytics.financial.instrument.index.IborIndex;
import com.opengamma.analytics.financial.instrument.index.IndexIborMaster;
import com.opengamma.analytics.financial.instrument.index.IndexON;
import com.opengamma.analytics.financial.instrument.index.IndexONMaster;
import com.opengamma.analytics.financial.interestrate.payments.derivative.CouponArithmeticAverageONSpreadSimplified;
import com.opengamma.analytics.financial.schedule.ScheduleCalculator;
import com.opengamma.analytics.util.time.TimeCalculator;
import com.opengamma.financial.convention.businessday.BusinessDayConvention;
import com.opengamma.financial.convention.businessday.BusinessDayConventionFactory;
import com.opengamma.financial.convention.calendar.Calendar;
import com.opengamma.financial.convention.calendar.MondayToFridayCalendar;
import com.opengamma.util.money.Currency;
import com.opengamma.util.time.DateUtils;
public class CouponArithmeticAverageONSpreadSimplifiedDefinitionTest {
private static final int US_SETTLEMENT_DAYS = 2;
private static final BusinessDayConvention MOD_FOL = BusinessDayConventionFactory.INSTANCE.getBusinessDayConvention("Modified Following");
private static final Calendar NYC = new MondayToFridayCalendar("NYC");
private static final IndexON FEDFUND = IndexONMaster.getInstance().getIndex("FED FUND");
private static final IborIndex USDLIBOR3M = IndexIborMaster.getInstance().getIndex("USDLIBOR3M");
private static final ZonedDateTime TRADE_DATE = DateUtils.getUTCDate(2011, 5, 23);
private static final ZonedDateTime SPOT_DATE = ScheduleCalculator.getAdjustedDate(TRADE_DATE, US_SETTLEMENT_DAYS, NYC);
private static final ZonedDateTime ACCRUAL_START_DATE = DateUtils.getUTCDate(2011, 5, 23);
private static final Period TENOR_3M = Period.ofMonths(3);
private static final double NOTIONAL = 100000000; // 100m
private static final double SPREAD = 0.0010; // 10 bps
private static final int PAYMENT_LAG = 2;
private static final ZonedDateTime ACCRUAL_END_DATE = ScheduleCalculator.getAdjustedDate(ACCRUAL_START_DATE, TENOR_3M, USDLIBOR3M, NYC);
private static final double ACCURAL_FACTOR = USDLIBOR3M.getDayCount().getDayCountFraction(ACCRUAL_START_DATE, ACCRUAL_END_DATE);
private static final ZonedDateTime PAYMENT_DATE = ScheduleCalculator.getAdjustedDate(ACCRUAL_END_DATE, -1 + FEDFUND.getPublicationLag() + PAYMENT_LAG, NYC);
private static final CouponArithmeticAverageONSpreadSimplifiedDefinition FEDFUND_CPN_3M_DEF = new CouponArithmeticAverageONSpreadSimplifiedDefinition(Currency.USD, PAYMENT_DATE, ACCRUAL_START_DATE,
ACCRUAL_END_DATE, ACCURAL_FACTOR, NOTIONAL, FEDFUND, SPREAD);
private static final CouponArithmeticAverageONSpreadSimplifiedDefinition FEDFUND_CPN_3M_FROM_DEF = CouponArithmeticAverageONSpreadSimplifiedDefinition.from(FEDFUND, ACCRUAL_START_DATE, TENOR_3M,
NOTIONAL, PAYMENT_LAG, MOD_FOL, true, SPREAD, NYC);
@Test(expectedExceptions = IllegalArgumentException.class)
public void nullCurrency() {
new CouponArithmeticAverageONSpreadSimplifiedDefinition(null, PAYMENT_DATE, ACCRUAL_START_DATE, ACCRUAL_END_DATE, ACCURAL_FACTOR, NOTIONAL, FEDFUND, SPREAD);
}
@Test(expectedExceptions = IllegalArgumentException.class)
public void nullPayDate() {
new CouponArithmeticAverageONSpreadSimplifiedDefinition(Currency.USD, null, ACCRUAL_START_DATE, ACCRUAL_END_DATE, ACCURAL_FACTOR, NOTIONAL, FEDFUND, SPREAD);
}
@Test(expectedExceptions = IllegalArgumentException.class)
public void nullStartAccural() {
new CouponArithmeticAverageONSpreadSimplifiedDefinition(Currency.USD, PAYMENT_DATE, null, ACCRUAL_END_DATE, ACCURAL_FACTOR, NOTIONAL, FEDFUND, SPREAD);
}
@Test(expectedExceptions = IllegalArgumentException.class)
public void nullEndAccural() {
new CouponArithmeticAverageONSpreadSimplifiedDefinition(Currency.USD, PAYMENT_DATE, ACCRUAL_START_DATE, null, ACCURAL_FACTOR, NOTIONAL, FEDFUND, SPREAD);
}
@Test(expectedExceptions = IllegalArgumentException.class)
public void nullIndex() {
new CouponArithmeticAverageONSpreadSimplifiedDefinition(Currency.USD, PAYMENT_DATE, ACCRUAL_START_DATE, ACCRUAL_END_DATE, ACCURAL_FACTOR, NOTIONAL, null, SPREAD);
}
@Test(expectedExceptions = IllegalArgumentException.class)
public void wrongCurrency() {
new CouponArithmeticAverageONSpreadSimplifiedDefinition(Currency.AUD, PAYMENT_DATE, ACCRUAL_START_DATE, ACCRUAL_END_DATE, ACCURAL_FACTOR, NOTIONAL, FEDFUND, SPREAD);
}
@Test
public void getter() {
assertEquals("CouponArithmeticAverageONSpreadSimplifiedDefinition: getter", FEDFUND_CPN_3M_DEF.getPaymentDate(), PAYMENT_DATE);
assertEquals("CouponArithmeticAverageONSpreadSimplifiedDefinition: getter", FEDFUND_CPN_3M_DEF.getAccrualStartDate(), ACCRUAL_START_DATE);
assertEquals("CouponArithmeticAverageONSpreadSimplifiedDefinition: getter", FEDFUND_CPN_3M_DEF.getAccrualEndDate(), ACCRUAL_END_DATE);
assertEquals("CouponArithmeticAverageONSpreadSimplifiedDefinition: getter", FEDFUND_CPN_3M_DEF.getCurrency(), FEDFUND.getCurrency());
assertEquals("CouponArithmeticAverageONSpreadSimplifiedDefinition: getter", FEDFUND_CPN_3M_DEF.getIndex(), FEDFUND);
assertEquals("CouponArithmeticAverageONSpreadSimplifiedDefinition: getter", FEDFUND_CPN_3M_DEF.getSpread(), SPREAD);
assertEquals("CouponArithmeticAverageONSpreadSimplifiedDefinition: getter", FEDFUND_CPN_3M_DEF.getSpreadAmount(), SPREAD * ACCURAL_FACTOR * NOTIONAL);
}
@Test
public void from() {
assertEquals("CouponArithmeticAverageONSpreadDefinition: from", FEDFUND_CPN_3M_DEF, FEDFUND_CPN_3M_FROM_DEF);
}
@Test
public void equalHash() {
assertEquals("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF, FEDFUND_CPN_3M_DEF);
final CouponArithmeticAverageONSpreadSimplifiedDefinition other = CouponArithmeticAverageONSpreadSimplifiedDefinition.from(FEDFUND, ACCRUAL_START_DATE, TENOR_3M,
NOTIONAL, PAYMENT_LAG, MOD_FOL, true, SPREAD, NYC);
assertEquals("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF, other);
assertEquals("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF.hashCode(), other.hashCode());
CouponArithmeticAverageONSpreadSimplifiedDefinition modified;
final IndexON modifiedIndex = IndexONMaster.getInstance().getIndex("EONIA");
modified = CouponArithmeticAverageONSpreadSimplifiedDefinition.from(modifiedIndex, ACCRUAL_START_DATE, TENOR_3M, NOTIONAL, PAYMENT_LAG, MOD_FOL, true, SPREAD, NYC);
assertFalse("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF.equals(modified));
modified = CouponArithmeticAverageONSpreadSimplifiedDefinition.from(FEDFUND, ACCRUAL_START_DATE.plusDays(1), TENOR_3M, NOTIONAL, PAYMENT_LAG, MOD_FOL, true, SPREAD, NYC);
assertFalse("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF.equals(modified));
modified = new CouponArithmeticAverageONSpreadSimplifiedDefinition(Currency.USD, PAYMENT_DATE, ACCRUAL_START_DATE, ACCRUAL_END_DATE.plusDays(1), ACCURAL_FACTOR, NOTIONAL, FEDFUND, SPREAD);
assertFalse("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF.equals(modified));
modified = CouponArithmeticAverageONSpreadSimplifiedDefinition.from(FEDFUND, ACCRUAL_START_DATE, ACCRUAL_END_DATE, NOTIONAL + 1000, PAYMENT_LAG, SPREAD, NYC);
assertFalse("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF.equals(modified));
modified = CouponArithmeticAverageONSpreadSimplifiedDefinition.from(FEDFUND, ACCRUAL_START_DATE, ACCRUAL_END_DATE, NOTIONAL, PAYMENT_LAG + 1, SPREAD, NYC);
assertFalse("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF.equals(modified));
modified = CouponArithmeticAverageONSpreadSimplifiedDefinition.from(FEDFUND, ACCRUAL_START_DATE, ACCRUAL_END_DATE, NOTIONAL, PAYMENT_LAG, SPREAD + 0.0010, NYC);
assertFalse("CouponArithmeticAverageON: equal-hash", FEDFUND_CPN_3M_DEF.equals(modified));
}
@Test
/**
* Tests the toDerivative method.
*/
public void toDerivative() {
final CouponArithmeticAverageONSpreadSimplified cpnConverted = FEDFUND_CPN_3M_DEF.toDerivative(TRADE_DATE);
final double paymentTime = TimeCalculator.getTimeBetween(TRADE_DATE, PAYMENT_DATE);
final double fixingStartTime = TimeCalculator.getTimeBetween(TRADE_DATE, ACCRUAL_START_DATE);
final double fixingEndTime = TimeCalculator.getTimeBetween(TRADE_DATE, ACCRUAL_END_DATE);
final CouponArithmeticAverageONSpreadSimplified cpnExpected = CouponArithmeticAverageONSpreadSimplified
.from(paymentTime, ACCURAL_FACTOR, NOTIONAL, FEDFUND, fixingStartTime, fixingEndTime, SPREAD);
assertEquals("CouponOISSimplified definition: toDerivative", cpnExpected, cpnConverted);
}
}
| 27,057 |
https://github.com/HEERLIJKNL/WeRotterdam/blob/master/resources/views/store.blade.php
|
Github Open Source
|
Open Source
|
MIT
| null |
WeRotterdam
|
HEERLIJKNL
|
PHP
|
Code
| 253 | 1,057 |
<html>
<head>
<title>Laravel</title>
<link href='//fonts.googleapis.com/css?family=Lato:100' rel='stylesheet' type='text/css'>
<link href="//maxcdn.bootstrapcdn.com/bootstrap/3.3.4/css/bootstrap.min.css" rel='stylesheet' type="text/css">
<style>
body {
margin: 0;
padding: 0;
width: 100%;
height: 100%;
color: #B0BEC5;
display: table;
font-weight: 100;
font-family: 'Lato';
}
.container {
display: table-cell;
vertical-align: middle;
}
.content {
display: inline-block;
}
.title {
font-size: 28px;
margin-top: 40px;
}
.quote {
font-size: 24px;
}
.product-line{
border-right: 1px solid #EDEDED;
margin: 10px 0px;
}
.product{
display: block;
padding: 34px;
min-height: 340px;
vertical-align: top;
margin-bottom: 10px;
min-height: 425px;
box-shadow: 0px 2px 4px #E0E0E0;
position:relative;
}
.product .placeholder{
width:210px;
height:290px;
overflow: hidden;
}
.product .placeholder img{
/*
-webkit-filter: grayscale(100%);
filter: grayscale(100%);
*/
width:210px;
}
.product .grow img {
width: 210px;
-webkit-transition: all .4s ease;
-moz-transition: all .4s ease;
-o-transition: all .4s ease;
-ms-transition: all .4s ease;
transition: all .4s ease;
}
.product .grow img:hover {
width: 500px;
margin-left:-145px;
margin-top:-85%;
}
.product .price{
font-weight: bold;
display: inline;
position: absolute;
bottom: 0px;
right: 0px;
padding: 10px;
background-color: #1CAA06;
color: #fff;
}
.product .detail{
font-weight: bold;
display: inline-block;
position: absolute;
left: 0px;
right: 0px;
bottom: 0px;
padding: 10px;
background-color: #F2F2F2;
/* text-align: center; */
border-top: 1px solid #1CAA06;
}
.categorie{
overflow: hidden;
}
</style>
</head>
<body>
<div class="container">
<div class="row">
@foreach($categories AS $categorie)
<div class="col-md-12">
<div class="title"> <strong>{{ $categorie->name }}</strong> </div>
</div>
@foreach($categorie->products->chunk(4) AS $products)
@foreach($products AS $product)
<div class="col-md-3 product-line">
<div class="product">
@foreach($product->images AS $image)
<div class="placeholder grow">
<img src="/images/products/{{$image->image}}">
</div>
@endforeach
<div>{{$product->name}}</div>
<div class="detail">
<span class="glyphicon glyphicon-search" aria-hidden="true"></span> Details
<div class="price">€ {{number_format($product->price, 2, ',', ' ')}}</div>
</div>
</div>
</div>
@endforeach
@endforeach
@endforeach
</div>
</div>
</body>
</html>
| 33,112 |
5975140_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 1,046 | 1,408 |
In a proceeding pursuant to CFLR article 78 to review a determination of the Board of Trustees of the Incorporated Village of Muttontown dated April 12, 2011, adopting an environmental findings statement pursuant to the State Environmental Quality Review Act (ECL art 8), in connection with applications for *863a special use permit and site-plan approval, the petitioners appeal, as limited by their brief, from so much of an order of the Supreme Court, Nassau County (Parga, J.), entered February 14, 2012, as, after the denial of those branches of the separate motions of the Board of Trustees of the Incorporated Village of Muttontown and the Jewish Congregation of Brookville which were to dismiss the petition on the ground that the matter was not ripe for adjudication, in effect, denied the petition and directed that the proceeding be dismissed.
Ordered that on the Court’s own motion, the notice of appeal from the order is deemed to be an application for leave to appeal from the order, and leave to appeal is granted (see CPLR 5701 [c]); and it is further,
Ordered that the order is reversed insofar as appealed from, on the law, without costs or disbursements, the determination in the order denying those branches of the separate motions of the Board of Trustees of the Incorporated Village of Muttontown and the Jewish Congregation of Brookville which were to dismiss the petition on the ground that the matter was not ripe for adjudication is vacated, and those branches of the motions are granted.
The Jewish Congregation of Brookville (hereinafter the Congregation) applied to the Board of Trustees of the Incorporated Village of Muttontown (hereinafter the Board) for a special use permit and site-plan approval in connection with a development project. The Board determined that the project would have a significant effect on the environment and, pursuant to its obligations under the State Environmental Quality Review Act (ECL art 8 [hereinafter SEQRA]), it circulated a final environmental impact statement (hereinafter FEIS). On April 12, 2011, the Board adopted the findings statement required by the regulations implementing SEQRA (see 6 NYCRR 617.11), among other things, certifying that “consistent with social, economic and other essential considerations from among the reasonable alternatives available, the action is one that avoids or minimizes adverse environmental impacts to the maximum extent practicable, and that adverse environmental impacts will be avoided or minimized to the maximum extent practicable by incorporating as conditions to the decision those mitigative measures that were identified as practicable” (6 NYCRR 617.11 [d] [5]). Based upon the findings statement, the Board approved the FEIS. Prior to the Board’s determination as to whether the special use permit sought by the Congregation should be issued and the proposed site plan approved, the petitioners, who live near the project site, commenced this proceeding pursuant to CPLR *864article 78 to review the determination adopting the SEQRA findings statement. The Board and the Congregation (hereinafter together the respondents) each moved to dismiss the petition on the ground that the dispute was not ripe for adjudication. The Supreme Court denied the motions, and thereupon concluded that the challenged determination was not arbitrary and capricious, affected by error of law, or made in violation of lawful procedure. It thus, in effect, denied the petition on the merits and directed that the proceeding be dismissed. The petitioner appeals. The respondents argue that dismissal was appropriate, and that lack of ripeness constitutes an appropriate alternative basis for the dismissal (see Parochial Bus Sys. v Board of Educ. of City of N.Y., 60 NY2d 539, 544-545 [1983]).
An action taken by an agency pursuant to SEQRA may be challenged only when such action is final (see CPLR 7801 [1]). An agency action is final when the decisionmaker arrives at a “ ‘definitive position on the issue that inflicts an actual, concrete injury’ ” (Stop-The-Barge v Cahill, 1 NY3d 218, 223 [2003], quoting Matter of Essex County v Zagata, 91 NY2d 447, 453 [1998]). The position taken by an agency is not definitive and the injury is not actual or concrete if the injury purportedly inflicted by the agency could be prevented, significantly ameliorated, or rendered moot by further administrative action or by steps available to the complaining party (see Stop-The-Barge v Cahill, 1 NY3d at 223; Matter of Essex County v Zagata, 91 NY2d at 453-454).
Here, the issuance of a SEQRA findings statement did not inflict injury in the absence of an actual determination of the subject applications for a special use permit and site-plan approval and, thus, the challenge to the adoption of the findings statement is not ripe for adjudication (see Matter of Wallkill Cemetery Assn., Inc. v Town of Wallkill Planning Bd., 73 AD3d 1189, 1190 [2010]; see also Matter of Eadie v Town Bd. of Town of N. Greenbush, 7 NY3d 306, 317 [2006]; Matter of Guido v Town of Ulster Town Bd., 74 AD3d 1536, 1537 [2010]; Matter of Southwest Ogden Neighborhood Assn. v Town of Ogden Planning Bd., 43 AD3d 1374, 1374-1375 [2007]). Therefore, the Supreme Court should have granted those branches of the respondents’ separate motions which were to dismiss the petition on the ground that the matter is not ripe for adjudication.
We note that the Supreme Court, after denying the respondents’ motions to dismiss the petition, should not have disposed of the proceeding on the merits. Rather, the Supreme Court, prior to addressing the merits, should have directed the respondents to serve and file answers to the petition, directed *865the Board to serve and file the full administrative record, and permitted the petitioners to renotice the matter for disposition (see CPLR 7804 [e], [f]; Matter of Filipowski v Zoning Bd. of Appeals of Vil. of Greenwood Lake, 77 AD3d 831, 833 [2010]). However, since we have concluded that the Supreme Court should have granted those branches of the respondents’ separate motions which were to dismiss the petition on the ground that the matter is not ripe for adjudication, we decline to remit the matter to the Supreme Court, Nassau County, for the service and filing of an answer and the administrative record, and the renoticing of the matter for disposition.
In light of our determination, the parties’ remaining contentions need not be addressed.
Mastro, J.P, Lott, Austin and Roman, JJ., concur.
| 5,716 |
https://openalex.org/W2538867885
|
OpenAlex
|
Open Science
|
CC-By
| 2,016 |
Nuclear data activities at the n_TOF facility at CERN
|
F. Gunsing
|
English
|
Spoken
| 11,458 | 20,144 |
Article: t c e
The n_TOF Collaboration, n_TOF Collaboration, Gunsing, F., Aberle, O. et al. (143 more
authors) (2016) Nuclear data activities at the n_TOF facility at CERN. European Physical
Journal Plus. 371. ISSN 2190-5444 https://doi.org/10.1140/epjp/i2016-16371-4 https://doi.org/10.1140/epjp/i2016-16371-4 Reuse This article is distributed under the terms of the Creative Commons Attribution (CC BY) licence. This licence
allows you to distribute, remix, tweak, and build upon the work, even commercially, as long as you credit the
authors for the original work. More information and the full terms of the licence here:
https://creativecommons.org/licenses/ White Rose Research Online URL for this paper:
https://eprints.whiterose.ac.uk/107182/ Version: Published Version Version: Published Version his is a repository copy of Nuclear data activities at the n_TOF facility at CERN. White Rose Research Online URL for this paper:
https://eprints.whiterose.ac.uk/107182/ Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by
emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected]
https://eprints.whiterose.ac.uk/ [email protected]
https://eprints.whiterose.ac.uk/ [email protected]
https://eprints.whiterose.ac.uk/ DOI 10.1140/epjp/i2016-16371-4
Eur. Phys. J. Plus (2016) 131: 371 THE EUROPEAN
PHYSICAL JOURNAL PLUS Review Review Review Nuclear data activities at the n TOF facility at CERN⋆ Paris-Sud, Universit´e Paris-Saclay, F-91406 Orsay Cedex, Fran 4 Institut de Physique Nucl´eaire, CNRS-IN2P3, Univ. Paris-Sud, Universit´e Paris-Saclay, F-91406 Orsay Cedex, France
5 4 Institut de Physique Nucl´eaire, CNRS-IN2P3, Un 4 Institut de Physique Nucl´eaire, CNRS-IN2P3, Univ. Paris-Sud, Universit´e Paris-Saclay, F-91406 Orsay Cedex, France
5 Centro de Investigaciones Energeticas Medioambientales y Tecnol´ogicas (CIEMAT), Madrid, Spain Institut de Physique Nucleaire, CNRS-IN2P3, Univ. Nuclear data activities at the n TOF facility at CERN⋆ The n TOF Collaboration⋆⋆ F. Gunsing1,2,a, O. Aberle2, J. Andrzejewski3, L. Audouin4, V. B´ecares5, M. Bacak6, J. Balibrea-Correa5,
M. Barbagallo7, S. Barros8, F. Beˇcv´aˇr9, C. Beinrucker10, F. Belloni1, E. Berthoumieux1, J. Billowes11, D. Bosnar12,
M. Brugger2, M. Caama˜no13, F. Calvi˜no14, M. Calviani2, D. Cano-Ott5, R. Cardella2, A. Casanovas14,
D.M. Castelluccio15,16, F. Cerutti2, Y.H. Chen4, E. Chiaveri2, N. Colonna7, M.A. Cort´es-Giraldo17, G. Cort´es14,
L. Cosentino18, L.A. Damone7,19, K. Deo20, M. Diakaki1,21, C. Domingo-Pardo22, R. Dressler23, E. Dupont1,
I. Dur´an13, B. Fern´andez-Dom´ınguez13, A. Ferrari2, P. Ferreira8, P. Finocchiaro18, R.J.W. Frost11, V. Furman24,
S. Ganesan20, A.R. Garc´ıa5, A. Gawlik3, I. Gheorghe25, T. Glodariu25, I.F. Gon¸calves8, E. Gonz´alez5,
A. Goverdovski26, E. Griesmayer6, C. Guerrero17, K. G¨obel10, H. Harada27, T. Heftrich10, S. Heinitz23,
A. Hern´andez-Prieto2,14, J. Heyse28, D.G. Jenkins29, E. Jericha6, F. K¨appeler30, Y. Kadi2, T. Katabuchi31,
P. Kavrigin6, V. Ketlerov26, V. Khryachkov26, A. Kimura27, N. Kivel23, M. Kokkoris21, M. Krtiˇcka9,
E. Leal-Cidoncha13, C. Lederer32,10, H. Leeb6, J. Lerendegui17, M. Licata16,33, S. Lo Meo15,16, S.J. Lonsdale32,
R. Losito2, D. Macina2, J. Marganiec3, T. Mart´ınez5, A. Masi2, C. Massimi16,33, P. Mastinu34, M. Mastromarco7,
F. Matteucci35,36, E.A. Maugeri23, A. Mazzone7,37, E. Mendoza5, A. Mengoni15, P.M. Milazzo35, F. Mingrone16,
M. Mirea25, S. Montesano2, A. Musumarra18,38, R. Nolte39, A. Oprea25, F.R. Palomo-Pinto17, C. Paradela13,
N. Patronis40, A. Pavlik41, J. Perkowski3, I. Porras2,42, J. Praena17,42, J.M. Quesada17, K. Rajeev20, T. Rauscher43,44,
R. Reifarth10, A. Riego-Perez14, M. Robles13, P. Rout20, D. Radeck39, C. Rubbia2, J.A. Ryan11, M. Sabat´e-Gilarte2,17,
A. Saxena20, P. Schillebeeckx28, S. Schmidt10, D. Schumann23, P. Sedyshev24, A.G. Smith11, A. Stamatopoulos21,
S.V. Suryanarayana20, G. Tagliente7, J.L. Tain22, A. Tarife˜no-Saldivia22, D. Tarr´ıo13, L. Tassan-Got4, A. Tsinganis21,
S. Valenta9, G. Vannini16,33, V. Variale7, P. Vaz8, A. Ventura16, V. Vlachoudis2, R. Vlastou21, A. Wallner45,
S. Warren11, M. Weigand10, C. Weiss2,6, C. Wolf10, P.J. Woods32, T. Wright11, and P. ˇZugec2,12 ,
,
,
g
R. Losito2, D. Macina2, J. Marganiec3, T. Mart´ınez5, A. M ,
g
,
,
,
,
,
y
,
A. Saxena20, P. Schillebeeckx28, S. Schmidt10, D. Schumann23, P. Sedyshev24, A.G. Smith11, A. ,
g
,
,
,
A. Saxena20, P. Schillebeeckx28, S. Schmidt10, D. Schumann23 1 CEA Saclay, Irfu, Gif-sur-Yvette, France 2 European Organization for Nuclear Research (CERN), Geneva, Switzerland
3 n for Nuclear Research (CERN), Geneva, Switzerland 2 European Organization for Nuclear Research (CERN), Geneva, Switzerland
3 2 European Organization for Nuclear Resear 3 University of Lodz, Lodz, Poland 4 Institut de Physique Nucl´eaire, CNRS-IN2P3, Univ. Nuclear data activities at the n TOF facility at CERN⋆ Phys. J. Plus (2016) 131: 371 Page 2 of 13 30 Karlsruhe Institute of Technology, Karlsruhe, G 31 Tokyo Institute of Technology, Tokyo, Japan 32 School of Physics and Astronomy, University of Edinburgh, Edinburgh, UK 32 School of Physics and Astronomy, University o 33 Dipartimento di Fisica e Astronomia, Universit`a di Bologna, Bologna, Italy Istituto Nazionale di Fisica Nucleare, Sezione di Leg g
g
y
35 Istituto Nazionale di Fisica Nucleare, Sezione di Trieste, Trieste, Italy 36 Dipartimento di Astronomia, Universit`a di Trieste, Trieste, Italy 36 Dipartimento di Astronomia, Universit`a di Tries 37 Consiglio Nazionale delle Ricerche, Bari, Italy 38 Dipartimento di Fisica e Astronomia, Universit`a di Catania, Catania, 38 Dipartimento di Fisica e Astronomia, Universit`a 38 Dipartimento di Fisica e Astronomia, Universit`a di Catania, Catania, It 39 Physikalisch Technische Bundesanstalt, Bra isch Technische Bundesanstalt, Braunschweig, Germa 40 University of Ioannina, Ioannina, Greece 40 University of Ioannina, Ioannina, Greece 41 Universit¨at Wien, Vienna, Austria 41 Universit¨at Wien, Vienna, Austria
42 42 University of Granada, Granada, Spain
43 42 University of Granada, Granada, Spain
43 43 Centre for Astrophysics Research, University of Hertfordshire, Hertfordshire, UK
44 Department of Physics and Astronomy, University of Basel, Basel, Switzerland 43 Centre for Astrophysics Research, University of Hertfordshire, Hertfordshire, UK
44 p y
,
y
,
,
44 Department of Physics and Astronomy, University of Basel, Basel, Switzerland
45 45 Australian National University, Canberra, Australia 45 Australian National University, Canberra, Australia Received: 2 June 2016 / Revised: 4 August 2016 c⃝CERN for the benefit of the n TOF Collaboration 2016. This article is published with open access
Springerlink.com Springerlink.com Abstract. Nuclear data in general, and neutron-induced reaction cross sections in particular, are important
for a wide variety of research fields. They play a key role in the safety and criticality assessment of nuclear
technology, not only for existing power reactors but also for radiation dosimetry, medical applications,
the transmutation of nuclear waste, accelerator-driven systems, fuel cycle investigations and future reactor
systems as in Generation IV. Applications of nuclear data are also related to research fields as the study
of nuclear level densities and stellar nucleosynthesis. Simulations and calculations of nuclear technology
applications largely rely on evaluated nuclear data libraries. The evaluations in these libraries are based
both on experimental data and theoretical models. Nuclear data activities at the n TOF facility at CERN⋆ Experimental nuclear reaction data are compiled on a
worldwide basis by the international network of Nuclear Reaction Data Centres (NRDC) in the EXFOR
database. The EXFOR database forms an important link between nuclear data measurements and the
evaluated data libraries. CERN’s neutron time-of-flight facility n TOF has produced a considerable amount
of experimental data since it has become fully operational with the start of the scientific measurement
programme in 2001. While for a long period a single measurement station (EAR1) located at 185 m from
the neutron production target was available, the construction of a second beam line at 20 m (EAR2) in
2014 has substantially increased the measurement capabilities of the facility. An outline of the experimental
nuclear data activities at CERN’s neutron time-of-flight facility n TOF will be presented. ⋆Contribution to the Focus Point on “Nuclear data for energy” edited by S. Leray.
⋆⋆www.cern.ch/ntof
a e-mail: [email protected] Nuclear data activities at the n TOF facility at CERN⋆ Paris-Sud, Universite Paris-Saclay, F-91406 Ors
5 Centro de Investigaciones Energeticas Medioambientales y Tecnol´ogicas (CIEMAT), Madrid, Spain 5 Centro de Investigaciones Energeticas Medioambientales y Tecnol´ogicas (CI 5 Centro de Investigaciones Energeticas Medioamb 6 Technische Universit¨at Wien, Vienna, Austria 7 Istituto Nazionale di Fisica Nucleare, Sezione di Bari, Bari, Italy 7 Istituto Nazionale di Fisica Nucleare, Sezione di Bari, Bari, Italy 7 Istituto Nazionale di Fisica Nucleare, Sezione d 8 Instituto Superior T´ecnico, Lisbon, Portugal 9 Charles University, Prague, Czech Republic 10 Johann-Wolfgang-Goethe Universit¨at, Frankfurt, Germany 10 Johann-Wolfgang-Goethe Universit¨at, Frankfurt, Germany 10 Johann-Wolfgang-Goethe Universit¨at, Frank 11 University of Manchester, Manchester, UK 12 University of Zagreb, Zagreb, Croatia y
g
,
g
,
13 University of Santiago de Compostela, Santiago de Compostela, Spain y
g
,
g
,
13 University of Santiago de Compostela, Santiago de Compostela, Spain
4 13 University of Santiago de Compostela, Santiago 14 Universitat Polit`ecnica de Catalunya, Barcelona, Spain 14 Universitat Polit`ecnica de Catalunya, Barcelona, Spain 15 Agenzia nazionale per le nuove tecnologie (ENEA), Bologna, Italy
16 5 Agenzia nazionale per le nuove tecnologie (ENEA) 15 Agenzia nazionale per le nuove tecnologie (ENEA), Bologna, Italy 16 Istituto Nazionale di Fisica Nucleare, Sezione di Bologna, Bologna, Italy
17 16 Istituto Nazionale di Fisica Nucleare, Sezione di Bologna, Bologna, Italy 16 Istituto Nazionale di Fisica Nucleare, 17 Universidad de Sevilla, Sevilla, Spain 17 Universidad de Sevilla, Sevilla, Spain 18 INFN Laboratori Nazionali del Sud, Catania, Italy 18 INFN Laboratori Nazionali del Sud, 19 Dipartimento di Fisica, Universit`a degli Studi di Bari, Bari, Italy 19 Dipartimento di Fisica, Universit`a degli Studi di Bari, Bari, Italy
20 9 Dipartimento di Fisica, Universit`a degli Studi di B 20 Bhabha Atomic Research Centre (BARC), Mumbai, India 20 Bhabha Atomic Research Centre (BARC), Mumbai, India 1 National Technical University of Athens, Athens, G 22 Instituto de F´ısica Corpuscular, Universidad de Valencia, Valencia, Spain 22 Instituto de F´ısica Corpuscular, Universidad de Valencia, Valencia, Spain 2 Instituto de F´ısica Corpuscular, Universidad de Va 23 Paul Scherrer Institut (PSI), Villingen, Switzerland 23 Paul Scherrer Institut (PSI), Villingen, Switzerland (
)
24 Joint Institute for Nuclear Research (JINR), Dubna, Russia 24 Joint Institute for Nuclear Research (JINR), Dubna, Russia (
),
,
25 Horia Hulubei National Institute of Physics and Nuclear Engineering, Bucha (
)
25 Horia Hulubei National Institute of Physics and Nuclear Engineering, Bucharest, Romania
26 5 Horia Hulubei National Institute of Physics and N 25 Horia Hulubei National Institute of Physics and Nuclear Engineering, Bucharest, Romania 26 Institute of Physics and Power Engineering (IPPE), Obninsk, Russia 26 Institute of Physics and Power Engineering (IPPE), Obninsk, Russia 27 Japan Atomic Energy Agency (JAEA), Tokai-mura, Japan
28 27 Japan Atomic Energy Agency (JAEA), Tokai-mura, Japan p
gy
g
y (
),
,
p
28 European Commission JRC, Institute for Reference Materials and Measurements, Retieseweg 111, B-2440 Geel, Belgium
29 University of York York UK (
)
28 European Commission JRC, Institute for Reference Materials and Measurements, Retieseweg 111, B-2440 Geel, Belgium
29 28 European Commission JRC, Institute for Reference Materials and Measurements, Retieseweg 111, B-2440 Geel, Belgium 28 European Commission JRC, Institute for Reference Materials and Measure 28 European Commission JRC, Institute for Reference Materials and Measurements, Retieseweg
29 29 University of York, York, UK Eur. 1 Introduction neutron energy (eV) Fig. 1. Neutron-induced reaction cross sections for a typical heavy nucleus as a function of the neutron kinetic energy (upper
panel), together with characteristic neutron energy distributions present in stellar environments and in technological applications
like fission and fusion (lower panel). All distributions have been normalized to their maximum value. of these levels are a crucial input to nuclear level density models. Finally, neutron-induced reaction cross sections
are a key ingredient for the safety and criticality assessment of nuclear technology, including research on medical
applications [9], radiation dosimetry, the transmutation of nuclear waste, accelerator-driven systems, future reactor
systems as in Generation IV, and nuclear fuel cycle investigations [10–12]. [
]
Nuclear reaction data needed for such calculations are usually based on evaluated nuclear data libraries. Examples
of such libraries are JEFF [13], ENDF [14], JENDL [15], CENDL, BROND and several others. While these libraries
have started historically with a focus on nuclear technology applications, nowadays they are general-purpose libraries
intended to be universal. For nearly any nuclear data application and simulation code, the content of an evaluated
nuclear data library is not directly useable but needs to be processed to extract the needed information in a suitable
format. For example neutron-induced reaction cross sections for resolved resonances are stored as R-matrix [16]
resonance parameters, which is the most concise and fundamental way to represent this type of cross sections. From
these parameters a reaction cross section can be calculated with the appropriate thermal broadening needed for
an application. This Doppler-broadened cross section can then be merged with the energy range of smooth cross
sections, and stored as interpolation tables, in order to obtain the reaction cross section over a wide energy range for
a given temperature. Several special-purpose libraries with derived quantities exist as well. For example the database
KADoNiS [17] is dedicated to Maxwellian averaged capture cross sections relevant for stellar nucleosynthesis. It
contains data both calculated from evaluated nuclear data libraries and from experiments. The EXFOR data base [18]
is the international storage and retrieval system for experimental results. It contains data that are often not available
numerically in publications and laboratory reports. The observables including detailed experimental conditions have
nowadays become the standard quality for submission. 1 Introduction Contributions to nuclear data come from a variety of experimental facilities including the pulsed white spallation
neutron source n TOF at CERN, which has been recently upgraded with its second beam line. Other neutron time-
of-flight facilities comprise electron linac-based machines, like GELINA [19,20], IREN [21], KURRI [22], nELBE [23],
ORELA (until recently) [24] and PNF [25], RPI [26], and proton-induced spallation targets similar to n TOF, like MLF
at J-PARC [27] and LANSCE [28]. All these facilities have their own unique and often complementary characteristics. 1 Introduction The generic notion “nuclear data” comprises the physical properties related to nuclear structure and nuclear reactions. Evaluated nuclear reaction data play an essential role in calculations and simulations for the design and operational
studies of nuclear technology systems. For this purpose they have to contain all reactions and all energy regions, even
where experimental data are missing, insufficient or inconsistent. A nuclear data evaluation is the result of a complicated process involving a careful analysis of available existing,
sometimes inconsistent experimental data sets combined with optimum theoretical models describing experimental
data and providing data for gaps in experimental information. The outcome of this process is a single recommended
and purposefully complete dataset, the evaluation. Both theoretical models and experimental data are the fundamental
ingredients in evaluated data [1,2]. Nuclear data in general, and neutron-induced reactions in particular, are important for a number of research fields. In nuclear astrophysics, an intriguing topic is the understanding of the formation of the nuclei present in the universe
and the origin of the chemical elements. Hydrogen and smaller amounts of He and Li were created in the early universe
by primordial nucleosynthesis. Nuclear reactions in stars are at the origin of nearly all other nuclei. Most nuclei heavier
than iron are produced by neutron capture in stellar nucleosynthesis [3–6]. Neutron-induced reaction cross sections
also reveal the nuclear level structure in the vicinity of the neutron binding energy of nuclei [7, 8]. The properties Eur. Phys. J. Plus (2016) 131: 371 Page 3 of 13 10
-5 10
-4 10
-3 10
-2 10
-1 10
0
10
1 10
2 10
3 10
4 10
5 10
6 10
7 10
8
neutron energy (eV)
10
-8
10
-6
10
-4
10
-2
10
0
10
2
10
4
cross section (barn)
total
fission
capture
(n,xn)
10
-5 10
-4 10
-3 10
-2 10
-1 10
0
10
1 10
2 10
3 10
4 10
5 10
6 10
7 10
8
water
moderated
fission
stellar
spectra
neutron energy
distribution (n/eV)
cross section (b)
neutron energy (eV)
DT
DD
fusion
Fig. 1. Neutron-induced reaction cross sections for a typical heavy nucleus as a function of the neutron kinetic energy (upper
panel), together with characteristic neutron energy distributions present in stellar environments and in technological applications
like fission and fusion (lower panel). All distributions have been normalized to their maximum value. 2 Nuclear reactions induced by neutrons One of the most striking features of neutron-nucleus interactions is the resonance structure observed in the reaction
cross sections at low incident neutron energies. Since the electrically neutral neutron has no Coulomb barrier to
overcome, and has a negligible interaction with the electrons in matter, it can directly penetrate and interact with
the atomic nucleus, even at very low kinetic energies of the order of electronvolts. At lower energies the De Broglie
wavelength of the neutron becomes comparable to the size of interatomic distance of the target material and solid-state
effects become important. The nuclear reaction cross sections can show variations of several orders of magnitude on Page 4 of 13 Eur. Phys. J. Plus (2016) 131: 371 Eur. Phys. J. Plus (2016) 131: 371 an energy scale of only a few eV. The origin of the resonances is related to the excitation of nuclear states in the
compound nuclear system formed by the neutron and the target nucleus, at excitation energies lying above the neutron
binding energy of typically several MeV. In fig. 1 the main reaction cross sections for a typical heavy nucleus are shown
as a function of the energy. The reactions showing resolved resonances, typically elastic scattering, neutron capture,
and for some nuclei fission, are clearly visible over a wide energy range. The position and extent of the resonance
structure depend on the nucleus. Threshold reaction channels like (n, xn) or charged particle emission usually open up
at higher energies. Also shown on the same energy scale in fig. 1 are several neutron energy spectra relevant for typical
applications, normalized to give the same height. These spectra correspond to a Maxwell-Boltzmann distribution of
the neutron velocities. On the low-energy side the neutron flux of a theoretical spectrum of fully moderated neutrons
is shown. For an infinite water moderator at a temperature of about 293.6 K, the neutron density of this thermal
spectrum shows a maximum at a speed of 2200 m/s corresponding to an energy of 25.3 meV. On the high-energy side
the idealised neutron distribution of thermal-neutron induced prompt fission neutrons from 235U is shown. Similar
energy distributions are found for neutrons in certain stars where the synthesis of the nuclei heavier than about A = 60
takes place by neutron capture. 2 Nuclear reactions induced by neutrons For the s-process in Asymptotic Giant Branch stars, the neutrons originating mainly
from 13C(α, n) and 22Ne(α, n) reactions, are present as a hot gas and with a Maxwellian kinetic energy distribution
for temperatures with kT ranging from 5 to 100 keV. Neutrons from fusion reactions, either from magnetic-confinement fusion with future applications of energy pro-
duction or from inertial-confinement fusion have to be taken into account for issues related to shielding and activation. Reactions employed in most fusion developments are based on D + T →4He + n (14.1 MeV) reactions (DT), as well as
D + D →3He + n (2.5 MeV) reactions (DD), which have quasi-mono-energetic energy spectra. Typical thermal fusion
neutron spectra [29,30] at T = 10 keV are also shown in fig. 1. 3 The neutron time-of-flight facility n TOF at CERN The neutron time-of-flight facility n TOF was constructed after an idea proposed by Rubbia et al. [31] and has become
fully operational with the start of the scientific measurement programme in 2001 [32]. The facility is based on the 6 ns
wide, 20 GeV pulsed proton beam from CERN’s Proton Synchrotron (PS) with typically 7 × 1012 protons per pulse,
impinging on a lead spallation target, yielding about 300 neutrons per incident proton. A layer of water around the
spallation target moderates the initially fast neutrons down to a white spectrum of neutrons covering the full range
of energies between meV and GeV. The neutron bunches are spaced by multiples of 1.2 s, a characteristic of the operation cycle of the PS. This allows
measurements to be made over long times of flight, and therefore low energies, without any overlap into the next
neutron cycle. In this way it is possible to measure neutron energies as low as about 10 meV, and where the high-
energy part of the neutron spectrum is free from slow neutrons from previous cycles. The large energy range that can
be measured at once is one of the key characteristics of the facility. Another important feature of n TOF is the very high number of neutrons per proton burst, also called instantaneous
neutron flux. In the case of radioactive samples in the neutron beam, this results in a very favourable ratio between
the number of signals due to neutron-induced reactions and those due to radioactive decay events, which contribute
to the background. g
The neutron energy is determined by the time of flight technique. The neutrons, created at a time t0, are guided
through vacuum beam pipes to the experimental area at a distance L where they initiate reactions which are detected
at time t0+t. The measured time of flight t of the neutron with mass m, together with the flight distance L, determines
the neutron kinetic energy En using the energy-momentum relation with the neutron velocicy v = L/t and momentum
p = γmv as En = Etot −mc2 = mc2(γ −1),
(1) (1) with γ = (1 −v2/c2)−1/2 and where c is the speed of light. 3 The neutron time-of-flight facility n TOF at CERN In reality, neutrons with a true energy En will be detected
with a distribution in the measured velocities v = L/t (the speed in the z-direction), determined by the measured time
of flight t and flight path length L. Both t and L have distributions for a given energy En, related to the different effects
of the time-of-flight method. By taking the derivative of eq. (1), the energy resolution ∆E is in first approximation
related to the velocity resolution ∆v as with γ = (1 −v2/c2)−1/2 and where c is the speed of light. In reality, neutrons with a true energy En will be detected
with a distribution in the measured velocities v = L/t (the speed in the z-direction), determined by the measured time
of flight t and flight path length L. Both t and L have distributions for a given energy En, related to the different effects
of the time-of-flight method. By taking the derivative of eq. (1), the energy resolution ∆E is in first approximation
related to the velocity resolution ∆v as ∆E
E
= ∆v
v (γ + 1)γ. (2) (2) This approximation is sufficient if the resolution components have a Gaussian distribution, each characterized for a
given energy En by a single parameter ∆L and ∆t, and hence ∆v. The most important contributions to the resolution
come from the time distribution of the impact of the proton pulse, the neutron transport in the target-moderator
assembly and in the sample and detector, and the time resolution of the detector and electronics. In particular the
resolution due to the target-moderator assembly is non-Gaussian and in addition highly asymmetric. Therefore the
full probability density function of the velocity distribution, which is the spectrometer’s response function, also known Eur. Phys. J. Plus (2016) 131: 371 Page 5 of 13 Fig. 2. Impression of the n TOF facility with its two neutron beam lines (drawn in blue) ending in the experimental areas
EAR1 and EAR2. The neutron source, on the left lower part of the drawing, is a lead spallation target surrounded by cooling
water (the water is not shown on the insets). The incident proton beam with a nominal energy of 20 GeV, drawn in green,
makes an angle of 10◦in the horizontal plane. In the direction of EAR1 a separate neutron moderator is located. 3 The neutron time-of-flight facility n TOF at CERN The full resolution function RE(E) of the reconstructed neutron kinetic energy E for a true energy En is
by conservation of probability related to the distributions of time of flight Rt or equivalent distance RL as The RF is obtained in the entire energy range by simulations, and verified by measurements of well known narrow
resonances. The full resolution function RE(E) of the reconstructed neutron kinetic energy E for a true energy En is
by conservation of probability related to the distributions of time of flight Rt or equivalent distance RL as RE(E)dE = Rt(t)dt = RL(L)dL,
(3) RE(E)dE = Rt(t)dt = RL(L)dL, (3) where the distributions R are also dependent on the true neutron energy En. Usually components are converted
into a single distribution depending on the use. While time-of-flight analyses require the resolution as Rt, the slow
energy dependence of RL makes it more useful for visualisations and interpolation. For the time-to-energy conversion
of smooth cross section spectra it is sufficient to use the expectation value E{L}En =
LRLdL, assuming that all
resolution components are lumped into the normalized probability density RL. This expectation value is also dependent
on En. where the distributions R are also dependent on the true neutron energy En. Usually components are converted
into a single distribution depending on the use. While time-of-flight analyses require the resolution as Rt, the slow
energy dependence of RL makes it more useful for visualisations and interpolation. For the time-to-energy conversion
of smooth cross section spectra it is sufficient to use the expectation value E{L}En =
LRLdL, assuming that all
resolution components are lumped into the normalized probability density RL. This expectation value is also dependent
on En. For resolved resonances, this approximation is usually not sufficient and the full distribution needs to be convolved
with the intrinsic shape of the resonances. The intrinsic resonance shape has in approximation a Breit-Wigner form
depending on the reaction channel widths. The shape is altered by two broadening effects. First there is the Doppler
broadening, related to the thermal motion of the target nuclei. This effect is well known. In good approximation, for
metallic samples and many other cases this movement can be conveniently described by Gaussian broadening based
on the free-gas model [33,34]. Cross sections are usually represented as Doppler broadened at a given temperature. 3 The neutron time-of-flight facility n TOF at CERN The two types
of targets that have been used up to now are shown in the top inset. The horizontal neutron beam line has in reality a small
angle of approximately 0.68◦upwards. The picture where the placement of the beam elements are on scale, only shows the part
of the long EAR1 beam line. On the inset below the main figure the full scale is shown. Fig. 2. Impression of the n TOF facility with its two neutron beam lines (drawn in blue) ending in the experimental areas
EAR1 and EAR2. The neutron source, on the left lower part of the drawing, is a lead spallation target surrounded by cooling
water (the water is not shown on the insets). The incident proton beam with a nominal energy of 20 GeV, drawn in green,
makes an angle of 10◦in the horizontal plane. In the direction of EAR1 a separate neutron moderator is located. The two types
of targets that have been used up to now are shown in the top inset. The horizontal neutron beam line has in reality a small
angle of approximately 0.68◦upwards. The picture where the placement of the beam elements are on scale, only shows the part
of the long EAR1 beam line. On the inset below the main figure the full scale is shown. as the resolution function (RF), needs to be used for a precise time-to-energy conversion. The RF not only broadens
the resonances, but the asymmetry also shifts the peak positions in the reconstructed energy spectrum. The RF is obtained in the entire energy range by simulations, and verified by measurements of well known narrow
resonances. The full resolution function RE(E) of the reconstructed neutron kinetic energy E for a true energy En is
by conservation of probability related to the distributions of time of flight Rt or equivalent distance RL as as the resolution function (RF), needs to be used for a precise time-to-energy conversion. The RF not only broadens
the resonances, but the asymmetry also shifts the peak positions in the reconstructed energy spectrum. The RF is obtained in the entire energy range by simulations, and verified by measurements of well known narrow
resonances. 3 The neutron time-of-flight facility n TOF at CERN The strong
reduction of the thermal peak in EAR1 is due to the 10B-loaded moderator. neutron energy (eV)
2
10
1
10
1
10
2
10
3
10
4
10
5
10
6
10
7
10
8
10
9
10
dn/dlnE (neutrons/pulse)
4
10
5
10
6
10
7
10
EAR1 neutron flux
EAR2 neutron flux dn/dlnE (neutrons/pulse) neutron energy (eV) Fig. 3. The number of neutrons per equidistant logarithmic energy bin, i.e. per unit of lethargy, (dn/d ln E) per 7 × 1012
protons on target, referred to as “flux”, integrated over the full Gaussian beam profile with a nominal FWHM of 18 mm in
EAR1 and 21 mm in EAR2, as seen at the sample position at nominal distances of 185 m (EAR1) and 20 m (EAR2) for the
small collimator. The shown fluxes are the preliminary results of several measurements and simulations [35, 36]. The strong
reduction of the thermal peak in EAR1 is due to the 10B-loaded moderator. Fig. 3. The number of neutrons per equidistant logarithmic energy bin, i.e. per unit of lethargy, (dn/d ln E) per 7 × 1012
protons on target, referred to as “flux”, integrated over the full Gaussian beam profile with a nominal FWHM of 18 mm in
EAR1 and 21 mm in EAR2, as seen at the sample position at nominal distances of 185 m (EAR1) and 20 m (EAR2) for the
small collimator. The shown fluxes are the preliminary results of several measurements and simulations [35, 36]. The strong
reduction of the thermal peak in EAR1 is due to the 10B-loaded moderator. approximately 185 m, has been in use since the start of the facility in 2000. The beam line makes a small angle with
the horizontal of approximately 0.68◦upwards. It leads to an experimental area (EAR1) where samples and detectors
can be mounted and neutron-induced reactions are measured. A more detailed description of the neutron source and
EAR1 can be found in ref. [37] and references therein. Two pictures showing configurations of the experimental areas
EAR1 and EAR2 are shown in fig. 4. The second neutron beam line and experimental area (EAR2), has been constructed and has been operational
since 2014. This flight path is vertical and about 20 m long, viewing the top part of the spallation target. In this case
the cooling water circuit acts as a moderator. 3 The neutron time-of-flight facility n TOF at CERN Two different target-moderator assemblies have been used up to now in the operation of n TOF. During phase-I
a first spallation target was used from 2001 up to 2004. The water coolant of the target also served as a neutron
moderator. The spallation target was a block of lead of dimensions 80 × 80 × 60 cm3. During phase-II, after the
installation in 2008 of an upgraded cylindrical lead spallation target 40 cm in length and 60 cm in diameter, the target
was enclosed with a separate cooling circuit resulting in a 1 cm water layer in the beam direction, followed by an
exchangeable moderator with a thickness of 4 cm. Demineralized water has been used as a moderator, as well as water
with a saturated 10B-solution in order to reduce the number of 2.223 MeV gamma rays from hydrogen capture, which
otherwise forms an important contribution to the background due to in-beam gamma rays. The 10B-loaded moderator,
strongly suppressing thermal neutrons, affects the energy distribution of the neutron flux only noticeably below 1 eV. Two beam lines are in operation today. In fig. 2 a sketch of the two beam lines is shown, together with two insets
showing the two spallation targets used up to now. The corresponding neutron fluxes, per unit of lethargy, are shown
in fig. 3. The strong suppression of the thermal neutron peak in EAR1 due to the 10B-loaded moderator is clearly
visible. The first neutron beam, collimated and guided through a nearly horizontal vacuum tube over a distance of Eur. Phys. J. Plus (2016) 131: 371 Page 6 of 13 neutron energy (eV)
2
10
1
10
1
10
2
10
3
10
4
10
5
10
6
10
7
10
8
10
9
10
dn/dlnE (neutrons/pulse)
4
10
5
10
6
10
7
10
EAR1 neutron flux
EAR2 neutron flux
Fig. 3. The number of neutrons per equidistant logarithmic energy bin, i.e. per unit of lethargy, (dn/d ln E) per 7 × 1012
protons on target, referred to as “flux”, integrated over the full Gaussian beam profile with a nominal FWHM of 18 mm in
EAR1 and 21 mm in EAR2, as seen at the sample position at nominal distances of 185 m (EAR1) and 20 m (EAR2) for the
small collimator. The shown fluxes are the preliminary results of several measurements and simulations [35, 36]. 3 The neutron time-of-flight facility n TOF at CERN The vertical beam situation in the experimental area EAR2 necessitates
adapated mechanical equipment to accommodate samples and detectors. While the long flight path of EAR1 results in a very high kinetic-energy resolution, the short flight path of EAR2
has a neutron flux, which is higher than that of EAR1 by a factor of about 25. The energy distributions of the total
number of neutrons at the sample plane, in this context called flux, are shown in fig. 3 for EAR1 and EAR2. The
flux has a Gaussian beam-profile with a nominal full width at half maximum (FWHM) of 18 mm in EAR1 and 21 mm
in EAR2 for the small collimator usually used for capture measurements. The higher flux opens the possibility for
measurements on targets of low mass or for reactions with low cross section within a reasonable time. The shorter
flight distance of about a factor 10 also has the consequence that the entire neutron energy region is measured in a 10
times shorter interval. For measurements of neutron-induced cross sections on radioactive nuclei this means 10 times
less acquired detector signals due to radioactivity. Therefore the combination of the higher flux and the shorter time
interval results in an increase of the signal-to-noise ratio of a factor 250 for radioactive samples, at cost of lower energy
resolution. More details on EAR2 can be found in refs. [38,39]. The n TOF facility is also used for detector and electronic tests with a neutron beam, see for example ref. [40]. This type of tests is usually performed in the neutron beam dump in EAR1, without interfering with the physics
programme. 3.1 Nuclear data measurements during phase-I (2001–2004) A data acquisition system [41] based on Acqiris flash ADCs with 8 bit amplitude resolution and down to 1 ns sampling
interval with 8 Mbytes of memory was developed and used during phase-I and phase-II. For each detector the full
output signal from the start time given by the incident protons was recorded during the time window only limited by
the internal memory. For the scintillator detectors, the digitizers were typically operated at 500 Msamples/s allowing
the detector signal to be stored during a 16 ms long time-of-flight interval, corresponding to a minimum neutron energy Eur. Phys. J. Plus (2016) 131: 371
Page 7 of 13
Fig. 4. Picture of the horizontal neutron beam line in EAR1 (left panel) showing the TAC in open position, and the vertical
neutron beam line in the newly constructed EAR2 (right panel), showing a neutron capture setup with C6D6 detectors above
the chamber containing the silicon neutron beam monitors (SiMon2). Page 7 of 13 Eur. Phys. J. Plus (2016) 131: 371 Fig. 4. Picture of the horizontal neutron beam line in EAR1 (left panel) showing the TAC in open position, and the vertical
neutron beam line in the newly constructed EAR2 (right panel), showing a neutron capture setup with C6D6 detectors above
the chamber containing the silicon neutron beam monitors (SiMon2). of 0.7 eV. In order to reduce the amount of data, a zero-suppression technique was applied, after which the data was
transferred to CERN’s data storage facility CASTOR for off-line analysis with dedicated pulse shape analysis routines
for each detector. of 0.7 eV. In order to reduce the amount of data, a zero-suppression technique was applied, after which the data was
transferred to CERN’s data storage facility CASTOR for off-line analysis with dedicated pulse shape analysis routines
for each detector. During the first phase from 2001 to 2004, data have been taken for a number of nuclides in capture and fission
experiments. A list of measured nuclides and reactions together with the final or most relevant publication is given in
table 1. Neutron capture measurements with C6D6 liquid scintillator gamma-ray detectors, which have a low sensitivity
to scattered neutrons, were performed on the nuclei 24,25,26Mg, 56Fe, 90,91,92,94,96Zr, 139La, 151Sm, 186,187,188Os, 197Au,
204,206,207,208Pb and 209Bi, and a first test measurement on 93Zr. Gamma-ray cascades following neutron capture are
for most nuclei extremely complex. 3.1 Nuclear data measurements during phase-I (2001–2004) In order to make the detection efficiency of a capture event independent of the
cascade, the total-energy method using the so-called pulsed height weighting technique (PHWT) [42, 43] is usually
applied. Including the gamma-ray multiplicity of a typical cascade, the total detection efficiency for a capture event
for the C6D6 detector setup is about 20%. In addition to slightly modified commercially available C6D6 detectors,
two in-house developed deuterated benzene detectors were developed and used, containing a low-mass carbon fiber
housing [44]. The capture samples were put in position by a remotely controlled carbon fiber sample changer [45]. During the first phase from 2001 to 2004, data have been taken for a number of nuclides in capture and fission
experiments. A list of measured nuclides and reactions together with the final or most relevant publication is given in
table 1. Neutron capture measurements with C6D6 liquid scintillator gamma-ray detectors, which have a low sensitivity
to scattered neutrons, were performed on the nuclei 24,25,26Mg, 56Fe, 90,91,92,94,96Zr, 139La, 151Sm, 186,187,188Os, 197Au,
204 206 207 208
209
93 [
]
[
]
A 4π total absorption calorimeter (TAC) consisting of 40 BaF2 crystals was developed [82] and has been used
for neutron capture measurements of 197Au, 233U, 234U, 237Np, 240Pu, and 243Am. The detection efficiency for this
detector array approaches 100% and the gamma-ray energy resolution is much better than for C6D6 detectors, allowing
a detection selectivity based on the total energy released in the capture cascade. The relative neutron flux as a function of neutron energy is needed over the full energy range under investiga-
tion in order to obtain the unnormalized reaction yield. In addition to Monte Carlo simulations [83], in a dedicated
measurement the neutron flux was measured with a 235U loaded parallel plate fission ionization chamber from the
Physikalisch-Technische Bundesanstalt in Braunschweig [32]. Furthermore, during the capture measurements the rel-
ative neutron flux was measured with the neutron monitor detector SiMon [84], consisting of an in-beam 6Li deposit
on a mylar foil and 4 off-beam silicon detectors for the detection of the 6Li(n, 3H)α reaction products. Up to 1 keV
both methods are in good agreement, but at higher energies the flux obtained with the 6Li(n, α) reaction depends on
the applied corrections for the angular distribution of the α and triton particles. Eur. Phys. J. Plus (2016) 131: 371 Page 8 of 13 Table 1. 3.1 Nuclear data measurements during phase-I (2001–2004) The measurements performed at n TOF during phase-I from 2001–2004. Nucleus
Reaction
Detector
ref. 24Mg
(n, γ)
C6D6
[46]
26Mg
(n, γ)
C6D6
[46]
90Zr
(n, γ)
C6D6
[47]
91Zr
(n, γ)
C6D6
[48]
92Zr
(n, γ)
C6D6
[49]
94Zr
(n, γ)
C6D6
[50]
96Zr
(n, γ)
C6D6
[51]
129La
(n, γ)
C6D6
[52]
151Sm
(n, γ)
C6D6
[53–55]
186Os
(n, γ)
C6D6
[56,57]
187Os
(n, γ)
C6D6
[56,57]
188Os
(n, γ)
C6D6
[56,57]
197Au
(n, γ)
C6D6/TAC
[58,59]
204Pb
(n, γ)
C6D6
[60]
206Pb
(n, γ)
C6D6
[61,62]
207Pb
(n, γ)
C6D6
[63]
208Pb
(n, γ)
C6D6
natPb
(n, f)
PPAC
[64]
Nucleus
Reaction
Detector
ref. 209Bi
(n, γ)
C6D6
[65]
209Bi
(n, f)
PPAC
[64]
232Th
(n, γ)
C6D6
[66,67]
233U
(n, γ)
TAC
233U
(n, f)
FIC
[68,69]
234U
(n, γ)
TAC
234U
(n, f)
FIC
[70]
234U
(n, f)
PPAC
[71,72]
236U
(n, f)
FIC
[73]
238U
(n, f)
FIC/PPAC
[74,75]
237Np
(n, γ)
TAC
[76]
237Np
(n, f)
FIC
[77]
237Np
(n, f)
PPAC
[71]
240Pu
(n, γ)
TAC
241Am
(n, f)
FIC
[78]
243Am
(n, γ)
TAC
[79]
243Am
(n, f)
FIC
[80]
245Cm
(n, f)
FIC
[81] Table 1. The measurements performed at n TOF during phase-I from 2001–2004. For capture experiments, the number of incident neutrons, measured with the flux detector over a surface larger
than the beam spot, still has to be adjusted to the fraction of neutrons that are incident on the capture sample, referred
to as the beam interception factor. The spatial neutron beam profile has been measured with a MicroMegas-based
detector (MGAS) [85] and confirmed by simulations, allowing the energy-dependent beam-interception factor to be
calculated. The absolute normalization for capture measurements can be obtained if the measured cross section is known
well enough in a particular energy region for the investigated nucleus or from a reference sample with a well-known
cross section in the same measurement conditions. A related technique can be used with a sample thick enough to
have a large total cross section (nσT ≫1) in the peak of a resonance. This results in a so-called saturated resonance
where in the vicinity of the resonance peak the capture yield is not proportional to the capture cross section nσγ but
to the ratio σγ/σT , independent of the sample thickness n. 3.1 Nuclear data measurements during phase-I (2001–2004) An example is the 4.9 eV resonance in 197Au, which is
saturated for a sample thickness of 0.1 mm. The particular shape of the capture yield near the saturated resonance
allows the determination of the normalization with an R-matrix fitting code as explained in more detail for example
in refs. [43,86]. Fission cross section measurements usually use a stack of deposits among which are the nuclei 235U or 238U, which
serve as cross section standards. Then a fission yield ratio is usually measured for an isotope rather than a fission
yield. Fission ionisation chambers (FIC) were used to measure the fission cross sections. The chamber FIC-0 was used
for the actinides 232Th, 234U, 236U, and 237Np relative to 235U and 238U. A similar detector, FIC-1, which was in
addition suited for very radioactive samples (ISO-2919 compliant), was used to measure neutron-induced fission cross
sections of the actinides 233U, 241Am, 243Am, and 245Cm, also relative to 235U, 238U. The third FIC chamber (FIC-2)
was used for test measurements with 235U and 238U. Fission detectors based on Parallel Plate Avalanche Counters (PPACs) were developed in addition. These fast
detectors are used to identify fission by the simultaneous detection of both fission fragments, which allows to discard
alpha and high-energy reactions. In this way they are capable of performing measurements up to 1 GeV. Furthermore,
the position of each fission fragment is also measured, so the angle of the fragments with respect to the beam direction
can be determined, allowing the study of the fission anisotropy. A stack of 10 PPACs interleaved with 9 targets was
used in measurements of the fission cross sections of natPb, 209Bi, 232Th, 237Np, 233U, 234U, relative to 235U and 238U. Eur. Phys. J. Plus (2016) 131: 371 Page 9 of 13 Page 9 of 13 Table 2. The measurements performed at n TOF during phase-II from 2009–2012. Nucleus
Reaction
Detector
ref. 12C
(n, p) activation
C6D6
[90,91]
25Mg
(n, γ)
C6D6
[92,93]
33S
(n, α)
MGAS
[94]
54Fe
(n, γ)
C6D6
[95]
56Fe
(n, γ)
C6D6
57Fe
(n, γ)
C6D6
[95]
58Ni
(n, γ)
C6D6
[96]
59Ni
(n, α)
CVD
[97]
62Ni
(n, γ)
C6D6
[98]
63Ni
(n, γ)
C6D6
[99]
87Sr
(n, γ) spin
TAC
[100]
92Zr
(n, γ)
C6D6
93Zr
(n, γ)
C6D6
[101]
Nucleus
Reaction
Detector
ref. 3.2 Nuclear data measurements during phase-II (2009–2012) During phase-II from 2009–2012 the experimental area EAR1 has been upgraded to become a class A work zone,
allowing to use unsealed radioactive samples. Several capture measurements were performed with the C6D6 scintillator
gamma-ray detectors. The (n, γ) reaction on the light nucleus 25Mg was investigated, as well as on enriched isotopes
of iron (54Fe, 56Fe, 57Fe), and of nickel (58Ni, 62Ni, 63Ni), on the stable isotope 92Zr, the radioactive 93Zr, and on
the nucleus 236U. Capture reaction measurements on the actinides 238U and 241Am were performed with the two
available capture detector systems: the C6D6 scintillators using the PHWT, and the TAC, the BaF2 scintillator array
using the total absortion method [82]. The TAC was also used in combination with a MicroMegas detector in a first
attempt to measure the 235U(n, γ) reaction using a veto on the 235U(n, f) reaction [87]. An improved version of the
MicroMegas neutron beam profile detector was used for the beam interception factor for the capture measurements [88]. An upgraded version of the PPAC assembly, with detectors tilted by 45 degrees in order to better control the efficiency
of the system, was used to measure the angular distributions of 233Th and 234U fission fragments (FFAD) [89]. In addition to these measurements several other techniques have been tested at this facility. An experiment aiming
at resonance spin assignments was performed on a 87Sr sample. A first test measurement with a MicroMegas detector
was done to perform fission cross section measurements on 240Pu and 242Pu. The results for the 240Pu(n, f) experiment
were not conclusive due to the high radiaoctivity of this nucleus, degrading the detector over time. This measurement
was repeated in 2014 in the new EAR2, where the flux is much higher, allowing enough statistics to be collected in
only a few weeks of measurement time. A first test dedicated to an (n, α) measurement was investigated for the 33S(n, α) reaction with a MicroMegas
detector. Also this measurement was repeated later in EAR2 in 2015 to take advantage of the higher flux. A CVD
diamond detector was used to measure the 59Ni(n, α) cross section [97]. Finally the flux-integrated 12C(n, p)12B cross
section, obtained by in-beam activation [90] was extracted. A list of the phase-II measurements and their references
are given in table 2. 3.1 Nuclear data measurements during phase-I (2001–2004) 232Th
(n, f) FFAD
PPAC
[89,102]
234U
(n, f) FFAD
PPAC
[72]
235U
(n, f) FFAD
PPAC
[103]
235U
(n, γ)/(n, f)
TAC/MGAS
[87]
235U
(n, f)
PPAC
[104]
236U
(n, γ)
C6D6
[105]
238U
(n, f) FFAD
PPAC
[103]
238U
(n, γ)
C6D6
[106]
238U
(n, γ)
TAC
[107]
242Pu
(n, f)
MGAS
[108]
241Am
(n, γ)
C6D6
[109]
241Am
(n, γ)
TAC
[110] rformed at n TOF during phase-II from 2009–2012. Table 2. The measurements performed at n TOF during phase-II from 2009–2012. 3.3 Nuclear data measurements during phase-III (from 2014) For the operation of phase-III, a new data acquisition system was developed, based on 175 MSample digitizers
with a sampling frequency of up to 2 GHz and and amplitude resolution of 12, and recently also 14 bits. In addition to
the higher-amplitude resolution, which was 8 bits with the previously used digitizers, the larger on-board memory has
significantly increased the exploitable time-of-flight range which is now expanded down to thermal neutron energies. For the operation of phase-III, a new data acquisition system was developed, based on 175 MSample digitizers
with a sampling frequency of up to 2 GHz and and amplitude resolution of 12, and recently also 14 bits. In addition to
the higher-amplitude resolution, which was 8 bits with the previously used digitizers, the larger on-board memory has
significantly increased the exploitable time-of-flight range which is now expanded down to thermal neutron energies. A set of new in-house designed C6D6-based gamma-ray detectors entirely enveloped by a carbon fibre housing, as
well as newly designed neutron flux detectors based on silicon detectors (SILI) [114] and MicroMegas detectors [88],
were used for in-beam monitoring of the neutron flux and its energy dependency. In addition an XY-MicroMegas
detector with 1 mm strips in both orthogonal directions together with dedicated electronics was developed to measure
the neutron beam profile. The measurement programme in EAR2 started with a first part of commissioning by measuring quantities such as
flux and background and focusing on the feasibility of fission measurements. The energy dependence of the number
of neutrons incident on the sample, referred to as the neutron flux, was measured both with an in-beam neutron-to-
charged-particle converter foil, monitored by off-beam silicon detectors, and foils combined with in-beam MicroMegas
detectors. The neutron converters consisted of nuclides with well-known cross sections as 6Li(n, α), 10B(n, α) and
235U(n, f) in order to cover the energy dependence over a broad energy range. In fig. 3 the measured neutron fluxes in
EAR1 and EAR2 are shown, based on an combined analysis of the available measurements [35,36]. 240 After the first part of commissioning, the very first physics measurement in EAR2 concerned the 240Pu(n, f)
reaction with MicroMegas detectors [116]. In 2015, the commissioning of EAR2 continued, exploring the possibilities
of (n, γ) measurements, for applications in nuclear astrophysics [118] and nuclear technology, as well as neutron-induced
charged particle reactions like the 7Be(n, α) and an upcoming 7Be(n, p) experiment. 3.3 Nuclear data measurements during phase-III (from 2014) During the planned long shutdown of CERN’s accelerator complex from the end of 2012 to mid 2014, the construction
of n TOF’s new second beam line and experimental area EAR2 [111] was performed and delivered by July 2014. The design was based on extensive Monte Carlo simulations with FLUKA [39] in order to optimize the beam line
and collimation for a high neutron flux together with a minimized background. Additional simulations have been
performed for data analysis purposes [112, 113]. In order to remove charged particles from the beam, a permanent
0.25 T magnet had to be installed since, unlike in the beamline for EAR1, there was no room for an electromagnet. Since then, the facility has been taking data in both the experimental area EAR1 (185 m horizontal flight path), and Eur. Phys. J. Plus (2016) 131: 371 Page 10 of 13 Table 3. The nuclear data measurements performed at n TOF during phase-III in 2014 and 2015 for both EAR1 and EAR2. Nucleus
Reaction
Detector
EAR
ref. 7Be
(n, α)
SILI
EAR2
[115,129]
33S
(n, α)
MGAS
EAR2
70Ge
(n, γ)
C6D6
EAR1
73Ge
(n, γ)
C6D6
EAR1
74Ge
(n, γ)
C6D6
EAR1
76Ge
(n, γ)
C6D6
EAR1
147Pm
(n, γ)
C6D6
EAR2
171Tm
(n, γ)
C6D6
EAR1, EAR2
204Tl
(n, γ)
C6D6
EAR1
235U
(n, f)FF
STEFF
EAR2
237Np
(n, f)
PPAC
EAR1
240Pu
(n, f)
MGAS
EAR2
[116]
242Pu
(n, γ)
C6D6
EAR1
[117] a measurements performed at n TOF during phase-III in 2014 and 2015 for both EAR1 and EAR2. Table 3. The nuclear data measurements performed at n TOF during phase-III in 2014 and 2015 for both EAR1 and EAR2. in the new EAR2 (20 m vertical flight path), using the neutron beams simultaneously produced by the same cylindrical
lead spallation target as used in Phase-II. The experimental area EAR2 was designed as a class A work zone, allowing
unsealed radioactive samples to be used, for which the n TOF facility has particularly suited beam properties. in the new EAR2 (20 m vertical flight path), using the neutron beams simultaneously produced by the same cylindrical
lead spallation target as used in Phase-II. The experimental area EAR2 was designed as a class A work zone, allowing
unsealed radioactive samples to be used, for which the n TOF facility has particularly suited beam properties. 3.3 Nuclear data measurements during phase-III (from 2014) The complex multi-detector system
STEFF [119] was installed in EAR2 for commissioning and a measurement of fission fragments spectroscopy on 235U. A list of measurements during 2014 and 2015 and their references are given in table 3. 3.4 Further use of n TOF measurements The majority of the measurements at the n TOF facility are related to cross sections: capture and fission experiments
since phase-I and also (n, α) and (n, p) measurements in phase-II and phase-III. Once an experiment has been fully
analysed and the results published, it is important to make the data available for further use. The basic measured data
for a typical measurement are a set of detector count spectra as a function of neutron time of flight. Usually these spectra
are then processed in order to obtain a reaction yield or cross section ratio. This is the quantity that is intended to be
stored in the EXFOR database, which then subsequently can serve as a basis for nuclear data evaluations, which can Eur. Phys. J. Plus (2016) 131: 371 Page 11 of 13 Eur. Phys. J. Plus (2016) 131: 371 be adopted in new releases of evaluated nuclear data libraries. Applications for nuclear technology do not rely directly
on measurements as collected in EXFOR, but nearly always on evaluated libraries. As an example of evaluations of
neutron-induced reactions on 232Th we mention ref. [120] for the resolved, and ref. [121] for the unresolved resonance
region. The time path between a measurement and the inclusion in an evaluation for an evaluated nuclear data library
is in general rather capricious. A list of requests for measurements is organized by the OECD-NEA High Priority
Request List (HPRL) [122]. Evaluation efforts are performed in national projects or on an international scale like the
CIELO project [123] for the nuclei 1H, 16O, 56Fe, 235,238U, and 239Pu. p
j
[
]
,
,
,
,
In the field of nuclear data much effort is nowadays put on reducing uncertainties. One strategy is to perform the
same measurement at different facilities world-wide. Recognising and documenting measured data, uncertainties and
covariances is an additional exertion in this respect. The process of reducing the several independent uncorrelated
counting spectra to a single reaction yield or ratio as a function of time of flight (or neutron energy) introduces off-
diagonal covariance elements. While the full covariance matrix of a yield consisting of several thousands of data points
becomes too large to report directly in EXFOR, it is sometimes more convenient to use a vectorized covariance matrix
reflecting the full data reduction process [124]. 3.4 Further use of n TOF measurements For smaller datasets on the contrary it is very instructive to access
the full covariance matrix of a measured spectrum as for example nicely illustrated in refs. [125, 126]. Nevertheless,
when the correlations introduced by the data reduction are small compared to certain common uncertainties, for
example related to sample mass or normalization, it may be sufficient to report these uncertainties separately as
“systematic” uncertainties. In any case, in order to make the data in EXFOR useful for evaluations, the description
of the experimental details should be as complete as possible [127]. Data submission of n TOF measurements to
EXFOR, which is crucial for its consideration in evaluations, is an ongoing process. A comprehensive list of n TOF
data dissemination is maintained on [128]. Conclusion The key features for accurate neutron measurements at the n TOF facility with its two beam lines and experimental
areas EAR1 and EAR2 are a large energy range, high neutron-energy resolution, and a high instantaneous neutron
flux. EAR2 with its about 25 times higher flux than EAR1, combined with an additional reduction by a factor 10 of
the background due to the sample’s radioactivity, significantly enhances the possible measurements on unstable targets
at n TOF. The preparation and characterization of such targets suitable for neutron cross-section measurements is an
increasingly complicated task, feasible only in highly specialized laboratories. The measurements at CERN’s neutron time-of-flight facility n TOF with its unique features contribute substan-
tially to our knowledge of neutron-induced reactions. This goes together with cutting-edge developments in detector
technology and analysis techniques, design of challenging experiments, and training of a new generation of physicists
working in neutron physics. This work has been actively supported since the beginning of n TOF by the European
Framework Programmes. One of the future developments currently being studied is a possible upgrade of the spallation
target in order to optimize the characteristics of the neutron beam in EAR2. The n TOF collaboration, consisting
of about 150 researchers from 40 institutes, continues its scientific programme in both EAR1 and EAR2, in this way
continuing its 15 years history of measuring high-quality neutron-induced reaction data. Open Access
This is an open access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium,
provided the original work is properly cited. References Klug et al., Nucl. Instrum. Methods A 577, 641 (2007). 24. K.H. Guber et al., J. Korean. Phys. Soc. 59, 1685 (2011). 25. Taofeng Wang et al., Nucl. Instrum. Methods Phys. Res. B 268, 106 (2010). 5. Taofeng Wang et al., Nucl. Instrum. Methods Phy (
)
27. K. Kino et al., Nucl. Instrum. Methods Phys. Res. Sect. A 736, 66 (2014 27. K. Kino et al., Nucl. Instrum. Methods Phys. Re 28. R.C. Haight et al., Nucl. Data Sheets 123, 130 (2015). 29. H. Brysk, Plasma Phys. Control. Fusion 15, 611 (1973). (
)
30. J. Eriksson et al., Comput. Phys. Commun. 199, 40 (2016). 30. J. Eriksson et al., Comput. Phys. Commun. 1 31. C. Rubbia et al., Technical report (1998). (
)
32. C. Borcea et al., Nucl. Instrum. Methods Phys. Res. Sect. A 513, 524 (2003). 32. C. Borcea et al., Nucl. Instrum. Methods 33. W.E. Lamb, Phys. Rev. 55, 190 (1939). 34. D.G. Naberejnev et al., Nucl. Sci. Eng. 131, 220 (1999). 35. M. Barbagallo et al., Eur. Phys. J. A 49, 1 (201 36. M. Barbagallo et al., in preparation (2016). 37. C. Guerrero et al., Eur. Phys. J. A 49, 27 (2013). 38. C. Weiß et al., Nucl. Instrum. Methods A 799, 90 (2015). 39. S. Barros et al., J. Instrum. 10, P09003 (2015) 40. Eleni Aza et al., Nucl. Instrum. Methods A 806, 14 (2016). 40. Eleni Aza et al., Nucl. Instrum. Methods A 80 41. U. Abbondanno et al., Nucl. Instrum. Methods Phys. Res. Sec 41. U. Abbondanno et al., Nucl. Instrum. Methods Phys. Res. Sect. A 538, 692 (2005). 42. J.L. Tain et al., J. Nucl. Sci. Technol. 39, 689 (2002). 43. A. Borella et al., Nucl. Instrum. Methods Phys. Res. Sect 43. A. Borella et al., Nucl. Instrum. Methods Phys. Res. Sect. A 577, 626 (2007) 44. R. Plag et al., Nucl. Instrum. Methods Phys. Res. Sect. A 496, 425 (2003). 45. P.M. Milazzo et al., Nucl. Instrum. Methods Phy 45. P.M. Milazzo et al., Nucl. Instrum. Methods Phys. Res. Sect. B 213, 36 (2004). 46. C. Massimi et al., Phys. Rev. C 85, 044615 (2012). 7. G. Tagliente et al., Phys. Rev. C 77, 035802 (2008 48. G. Tagliente et al., Phys. Rev. C 78, 045804 (2008). 49. G. Tagliente et al., Phys. Rev. C 81, 055801 (2010). 50. G. Tagliente et al., Phys. Rev. References 1. Nicolas Alamanos et al., Eur. Phys. J. A 51, 12 (2015). 1. Nicolas Alamanos et al., Eur. Phys. J. A 51, 12 (2015). ,
y
,
(
)
2. Pavel Oblozinsky, Nucl. Data Sheets 131, iii (2016) DOI: 10.1016/j.nds.2015.12.001. 3. G. Wallerstein et al., Rev. Mod. Phys. 69, 995 (1997). 3. G. Wallerstein et al., Rev. Mod. Phys. 69, 995 (1997). (
4. S.E. Woosley et al., Nucl. Phys. A 718, 3C (2003). 4. S.E. Woosley et al., Nucl. Phys. A 718, 3C (2003). 5. F. Kappeler et al., Rev. Mod. Phys. 83, 15 5. F. Kappeler et al., Rev. Mod. Phys. 83, 15 6. T. Rauscher, AIP Adv. 4, 041012 (2014). 6. T. Rauscher, AIP Adv. 4, 041012 (2014). (
)
7. T. von Egidy et al., Phys. Rev. C 73, 049 (
)
7. T. von Egidy et al., Phys. Rev. C 73, 049901 (2006). 7. T. von Egidy et al., Phys. Rev. C 73, 049901 (2006). 8. H.A. Weidenmuller et al., Rev. Mod. Phys. 81, 539 (2009). 8. H.A. Weidenmuller et al., Rev. Mod. Phys. 81, 539 (2009). 9. S.M. Qaim, J. Radioanal. Nucl. Chem. 305, 233 (2015) 9. S.M. Qaim, J. Radioanal. Nucl. Chem. 305, 233 (2015) 10. G. Aliberti et al., Nucl. Sci. Eng. 146, 13 (2004). 10. G. Aliberti et al., Nucl. Sci. Eng. 146, 13 (2004). 11. A. Nuttin et al., Prog. Nucl. Energy 46, 77 (2005). 11. A. Nuttin et al., Prog. Nucl. Energy 46, 77 (2005). 12. A. Nuttin et al., Ann. Nucl. Energy 40, 171 (2012). 12. A. Nuttin et al., Ann. Nucl. Energy 40, 171 (2012). 13. A.J. Koning et al., J. Korean Phys. Soc. 59, 105 Eur. Phys. J. Plus (2016) 131: 371 Page 12 of 13 14. M.B. Chadwick et al., Nucl. Data Sheets 112, 2887 (2011) 15. K. Shibata, J. Nucl. Sci. Technol. 50, 449 (2013). 16. A.M. Lane et al., Rev. Mod. Phys. 30, 257 (1958). (
)
17. I. Dillmann et al., KADoNiS v0.3, http://www.kadonis.org (2009). 17. I. Dillmann et al., KADoNiS v0.3, http://www.k 8. N. Otuka et al., Nucl. Data Sheets 120, 272 (2014 (
)
19. P. Schillebeeckx et al., Nucl. Data Sheets 119, 94 (2014). 20. W. Mondelaers et al., Notiziario 11, 19 (2006). 21. J. Adam et al., Kerntechnik 70, 127 (2005). 22. Masahiro Hino et al., Nucl. Instrum. Methods A 797, 265 (201 ,
,
(
23. J. Eur. Phys. J. Plus (2016) 131: 371 (
)
106. F. Mingrone et al., Nucl. Data Sheets 119, 18 (2014). (
)
107. T. Wright et al., Nucl. Data Sheets 119, 26 (2014). (
)
108. A. Tsinganis et al., Nucl. Data Sheets 119, 58 (2014). 109. K. Fraval et al., Phys. Rev. C 89, 044609 (2014). 110. E. Mendoza et al., Nucl. Data Sheets 119, 65 (2014). 110. E. Mendoza et al., Nucl. Data Sheets 119, 111. E. Chiaveri et al., Technical report (2011). 111. E. Chiaveri et al., Technical report (2011). 111. E. Chiaveri et al., Technical report (2011). 112. S. Lo Meo et al., Eur. Phys. J. A 51, 160 (2015). 113. J. Lerendegui-Marco et al., Eur. Phys. J. A 52, 100 (2016). (
)
114. L. Cosentino et al., Rev. Sci. Instrum. 86, 073509 (2015). 114. L. Cosentino et al., Rev. Sci. Instrum. 86, 073509 (2015). 15. L. Cosentino et al., Nucl. Instrum. Methods A 8 5
Cose t
o et al ,
uc
st u
et ods
830,
97 ( 0 6)
116. A. Tsinganis et al., in 14th Int. Conf. Nucl. Reac., edited by F. Cerutti et al. (CERN-Proc.-2015-001, 2015) pp. 21–26. (
)
116. A. Tsinganis et al., in 14th Int. Conf. Nucl. Reac., edited by F. Cerutti et al. (CERN-Proc.-2015- 116. A. Tsinganis et al., in 14th Int. Conf. Nucl. Reac., edited by F. Cer 116. A. Tsinganis et al., in 14th Int. Conf. Nucl. Reac., edited by F. Cerutti et al. (CERN-Proc.-2015-001, 2015) pp. 21–26. (
) 117. J. Lerendegui-Marco et al., EPJ Web of Conferences 111, 02005 (2016). 7. J. Lerendegui-Marco et al., EPJ Web of Conferenc 118. G. Tagliente et al., in 14th Int. Conf. Nucl. Reac., edited by F. Cerutti et al. (CER 118. G. Tagliente et al., in 14th Int. Conf. Nucl. Reac., edited by F. Cerutti et al. (CERN-Proc.-2015-001, 2015) pp. 267–274. 119. A.J. Pollitt et al., EPJ Web of Conferences 93, 02018 (2015). 118. G. Tagliente et al., in 14th Int. Conf. Nucl. Reac., edited by F. Cerutti et al. (CERN Proc. 2015 001, 2015) pp. 267 274. 119. A.J. Pollitt et al., EPJ Web of Conferences 93, 02018 (2015). (
)
119. A.J. Pollitt et al., EPJ Web of Conferences 93, 02018 (2015). 9. A.J. Pollitt et al., EPJ Web of Conferences 93, 02 120. H. Derrien et al., Nucl. Sci. Eng. 160, 149 (2008). 121. I. Sirakov et al., Ann. Eur. Phys. J. Plus (2016) 131: 371 Eur. Phys. J. Plus (2016) 131: 371 77. M. Diakaki et al., Phys. Rev. C 93, 034614 (201 (
78. F. Belloni et al., Eur. Phys. J. A 49, 2 (2013). (
78. F. Belloni et al., Eur. Phys. J. A 49, 2 (2013). ,
y
,
(
)
79. E. Mendoza et al., Phys. Rev. C 90, 034608 (2014). 79. E. Mendoza et al., Phys. Rev. C 90, 034608 (2014). 80. F. Belloni et al., Eur. Phys. J. A 47, 160 (2011). (
)
81. M. Calviani et al., Phys. Rev. C 85, 034616 (201 (
)
82. C. Guerrero et al., Nucl. Instrum. Methods A 608, 424 (2009). 83. U. Abbondanno et al., Technical Report CERN-SL-2002-053 ECT (2003). 83. U. Abbondanno et al., Technical Report CERN- 84. S. Marrone et al., Nucl. Instrum. Methods Phys. Res. Sect. A 517, 389 (2004). 84. S. Marrone et al., Nucl. Instrum. Methods Phys 85. J. Pancin et al., Nucl. Instrum. Methods A 524, 102 (2004). 86. R.L. Macklin et al., Nucl. Instrum. Methods 164 87. J. Balibrea et al., Nucl. Data Sheets 119, 10 (2014). 88. F. Belloni et al., Mod. Phys. Lett. A 28, 1340023 (2013). 89. D. Tarrio et al., Nucl. Instrum. Methods A 743, 79 (2014). ˇ 90. P. ˇZugec et al., Phys. Rev. C 90, 021601 (2014) 91. P. ˇZugec et al., Eur. Phys. J. A 52, 101 (2016). 92. C. Massimi et al., Nucl. Data Sheets 119, 110 (2014). 93. C. Massimi et al., submitted to Phys. Lett. B (2016). 4. M. Sabat-Gilarte et al., Rep. Pract. Oncol. Radiot 95. G. Giubrone et al., Nucl. Data Sheets 119, 117 (2014). ˇ 96. P. ˇZugec et al., Phys. Rev. C 89, 014605 (2014). 97. C. Weiss et al., Nucl. Data Sheets 120, 208 (2014). 98. C. Lederer et al., Phys. Rev. C 89, 025810 (2014 99. C. Lederer et al., Phys. Rev. Lett. 110, 022501 (2013). 100. F. Gunsing et al., Nucl. Data Sheets 119, 132 (2014). 101. G. Tagliente et al., Phys. Rev. C 87, 014622 (2013). 02. D. Tarrio et al., Nucl. Data Sheets 119, 35 (2014 (
)
103. E. Leal-Cidoncha et al., EPJ Web of Conferences 111, 10002 (2016). 04. C. Paradela et al., EPJ Web of Conferences 111 104. C. Paradela et al., EPJ Web of Conferences 111, 02003 (2016). 105. M. Barbagallo et al., Nucl. Data Sheets 119, 45 (2014). References C 84, 015801 (2011). 51. G. Tagliente et al., Phys. Rev. C 84, 055802 (2011). (
)
52. R. Terlizzi et al., Phys. Rev. C 75, 035807 (2007). 53. U. Abbondanno et al., Phys. Rev. Lett. 93, 161103 (2004). 54. S. Marrone et al., Nucl. Phys. A 758, 533C (2005). 55. S. Marrone et al., Phys. Rev. C 73, 034604 (2006 56. K. Fujii et al., Phys. Rev. C 82, 015804 (2010). 57. M. Mosconi et al., Phys. Rev. C 82, 015802 (2010). 58. C. Massimi et al., Phys. Rev. C 81, 044616 (2010). 59. C. Lederer et al., Phys. Rev. C 83, 034608 (2011) 60. C. Domingo-Pardo et al., Phys. Rev. C 75, 0158 61. C. Domingo-Pardo et al., Phys. Rev. C 76, 045805 (2007). 62. C. Domingo-Pardo et al., J. Phys. G 35, 014020 (2008). 63. C. Domingo-Pardo et al., Phys. Rev. C 74, 055802 (2006). 64. D. Tarrio et al., Phys. Rev. C 83, 044620 (2011). 65. C. Domingo-Pardo et al., Phys. Rev. C 74, 025807 (2006). 66. G. Aerts et al., Phys. Rev. C 73, 054610 (2006). 67. F. Gunsing et al., Phys. Rev. C 86, 019902 (2012). 68. M. Calviani et al., Phys. Rev. C 80, 044604 (200 69. F. Belloni et al., Eur. Phys. J. A 47, 2 (2011). 70. D. Karadimos et al., Phys. Rev. C 89, 044606 (2014). 71. C. Paradela et al., Phys. Rev. C 82, 034601 (2010). 72. E. Leal-Cidoncha et al., Nucl. Data Sheets 119, 42 (2 73. R. Sarmento et al., Phys. Rev. C 84, 044618 (2011). 74. C. Paradela et al., Phys. Rev. C 91, 024602 (2015). 75. M. Diakaki et al., EPJ Web of Conferences 111, 02002 (2016). 76. C. Guerrero et al., Phys. Rev. C 85, 044616 (201 Page 13 of 13 Eur. Phys. J. Plus (2016) 131: 371 Nucl. Energy 35, 1223 (2008). 122. https://www.oecd-nea.org/dbdata/hprl. 123. M.B. Chadwick et al., Nucl. Data Sheets 118, 124. B. Becker et al., J. Instrum. 7, P11002 (2012). 125. C. Sage et al., Phys. Rev. C 81, 064604 (2010). 126. X. Ledoux et al., Ann. Nucl. Energy 76, 514 (2015). (
)
127. F. Gunsing et al., Technical Report IAEA INDC(NDS)-0647 (2013) 127. F. Gunsing et al., Technical Report IA 128. http://twiki.cern.ch/NTOFPublic. 129. M. Barbagallo et al., Phys. Rev. Lett. 117, 152701 (2016). 129. M. Barbagallo et al., Phys. Rev. Lett.
| 17,076 |
https://github.com/RalfBarkow/state-machine/blob/master/state-machine-runtime/src/main/java/com/github/davidmoten/fsm/runtime/Create.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,022 |
state-machine
|
RalfBarkow
|
Java
|
Code
| 30 | 71 |
package com.github.davidmoten.fsm.runtime;
public final class Create implements Event<Object> {
private static final Create instance = new Create();
public static Create instance() {
return instance;
}
public Create() {
}
}
| 682 |
https://github.com/javyliu/weixin_rails_middleware/blob/master/lib/weixin_rails_middleware/configuration.rb
|
Github Open Source
|
Open Source
|
MIT
| 2,015 |
weixin_rails_middleware
|
javyliu
|
Ruby
|
Code
| 85 | 407 |
module WeixinRailsMiddleware
class << self
attr_accessor :configuration
def config
self.configuration ||= Configuration.new
end
def configure
yield config if block_given?
end
end
class Configuration
attr_accessor :public_account_class
attr_accessor :weixin_secret_string, :weixin_token_string
# 加密参数配置
attr_accessor :encoding_aes_key, :app_id
# 自定义场景
attr_accessor :custom_adapter
end
module ConfigurationHelpers
extend ActiveSupport::Concern
[:weixin_secret_string, :weixin_token_string, :encoding_aes_key, :app_id].each do |attr_name|
define_method attr_name do
WeixinRailsMiddleware.config.send(attr_name).to_s
end
end
def token_model
@public_account_class ||= WeixinRailsMiddleware.config.public_account_class
end
def token_model_class
if token_model.blank?
raise "You need to config `public_account_class` in 'config/initializers/weixin_rails_middleware.rb'"
end
@token_model_class_name ||= token_model.to_s.constantize
end
def custom_adapter
@custom_adapter ||= WeixinRailsMiddleware.config.custom_adapter.to_s
end
end
end
| 2,730 |
https://stackoverflow.com/questions/45754708
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,017 |
Stack Exchange
|
howlger, https://stackoverflow.com/users/3545083, https://stackoverflow.com/users/6505250, sean le roy
|
English
|
Spoken
| 259 | 383 |
JFace - How to remove preference property?
I'm wokring with a little JFace preference store where I can add preferences straight forward enough, but have trouble when I want to remove one of the preferences I've put in.
I can't see anything in the APIs that allows for removal. What is the correct way for doing this?
Assuming you are using IPreferenceStore you call setToDefault("pref id") to reset a preference to its default value.
I'm looking to remove the preference not reset to default value?
Wait that actually does remove it, thanks greg. The setToDefault name was a bit misleading.
@seanleroy Eclipse stores only preferences that are not equal to their default values. Thats why reset and remove are the same here.
This is weird !!
I asked this same question 3 days ago in the eclipse JFace forum: https://www.eclipse.org/forums/index.php/t/1088245
I only got answers not related to my need.
The answer is that it is not possible. Also you can not set the value or the default of a preference to "null"
In my app (JMSToolBox), the need is to "cleanup" the file that is backing the PersistenceStore as the user may store a lot of "keys/preferences" that may become obsolete at some point in time. I wanted a way to "remove/delete" them from the file to keep the PreferenceStore file as compact as possible.
I ended up writing my own version of PreferenceStore that exposes the "remove" method from the internal "Properties" object used by PreferenceStore. This class is not designed to fullfill my need.
Code is here
| 35,521 |
historyofworcest00abijah_18
|
US-PD-Books
|
Open Culture
|
Public Domain
| null |
History of Worcester in the War of the Rebellion
|
None
|
English
|
Spoken
| 7,467 | 9,773 |
The Fifteenth Regiment, of which veteran organization about a hundred were expected to fall into line, did not receive their flag, Governor An- drew refusing their request for the privilege of using the colors given them by the ladies of Worcester. These heroes of many battles, and sufferers in rebel prisons, were so disappointed that they made no appear- ance in the procession ; but they were not forgotten by the people of Worcester, if by Governor Andrew.* * The above expresses the feeling of the time : but Governor Andrew afterwards explained that he was governed by a general rule which could not be safely broken. CLOSE OF THE WAR. 339 The Twenty-first Regiment — about forty men, among them Sergeant Plunkett. The only officers present were Major Harlow and Captain Valentine. They carried the tattered and battle begrimed colors of this valorous and renowned organization. The Twenty-fifth Regiment, — about eighty men, with Lieutenant-Colo- nel Moulton, and Captains Denny, Wageley and Goodwin. They carried the old flag presented by the ladies of Worcester ; also three rebel flags captured at Newbern by Co. H. The Twenty-eighth Regiment were about a dozen men under Captain Trainer, who formed a portion of the Worcester company in that regi- ment. The Thirty-fourth Regiment, was pretty-well represented on this occa- sion, and received particular notice on the route. They numbered about one hundred and thirty, with the following officers, Colonel Lincoln, Captains Willard, Goodrich and Walker, Quarter-master Howland, Lieutenant Cutler. They carried the national colors and state flag, which the regi- ment upheld so honorably in the Shenandoah Valley, and marched to the music of their own military band. The Thirty-sixth Regiment also appeared with their old colors. They numbered about seventy. The officers present were Major Raymond, Captains Morse and Davidson, and Lieutenants Cross and Boswell. The Forty-second Regiment was represented by about seventy men of the three companies organized in this vicinity. The officers with the battalion were Major Stiles, Captains Cogswell, Eddy and Ford, and Lieutenants Jennings and Aldrich. The Fiftieth Regiment was represented by about thirty men of the company raised in this city, under Lieutenant Hayes. The Fifty-first Regiment numbered about eighty men, and the follow- ing officers : Lieutenant-Colonel Studley, Major Harkness, Captains Ward, Baldwin, Hobbs and Goodell, Lieutenants Peck, Bigelow, Dodd and Thayer. They were unable to get their old flag from the State House, but they improvised a flag for the occasion. The Fifty-seventh had about thirty representatives, under Captain John Goodwin and Lieutenant Jonas Peacock. They carried a tattered battle flag ; none more battle-worn came out of the Wilderness fights. The Sixtieth Massachusetts, the soldiers of Dale Hospital, the naval, reserve, and soldiers of other organizations, added to the military and civil escort ; the floral representations and the bands swelled the column to large proportions." By invitation of the committee of arrangements, Colonel Josiah Pickett, late of the Twenty-fifth, took command of the military portion of the procession, assisted by the follow- ing staff : Colonel A. B. R. Sprague, Captain E. P. Woodward, 340 WORCESTER IN THE WAR. Lieutenant-Colonel A. A. Goodell, Captain Henry Valentine, Major C. G. Atwood, Captain J. M. Drennen, Lieutenant Levi Lincoln, Jr. The procession formed on Park Street, and moved promptly at half-past nine o'clock, in the following order : City Marshal, Platoon of Police, Worcester Cornet Band, Escort, Colonel D. M. Woodward Commander, Worcester City Guard, Company of State Guards, No. i, Aides, Chief Marshal, Aides, Newton Cornet Band, City Government, with Invited Guests, Aide, Emblem — " Peace through Victory." — Aide, Aide, Goddess of Liberty, Aide, Shrewsbury Band, Sixth Massachusetts Regiment, Third Battalion, Twenty-first Regiment, Twenty-fifth Regiment, Twenty-eighth Regiment, Naval Corps, Aide, Emblem — " Pen and Sword." — Aide, Disabled Soldiers in Carriages, Thirty-fourth Regiment Band, Thirty-fourth Regiment, Thirty-sixth Regiment, Forty-Second Regiment, Fiftieth Regiment, Fifty-first Regiment, Fifty-seventh Regiment, Sixtieth Regiment, Members of other Regiments and Unattached Companies, Brookline (N. H.) Band, Aide, Marshal, Aide, Union — Thirty-six YOung Ladies, Aide, Marshal, Aide, Dale Hospital Soldiers, Aide, Aide. CLOSE OF THE WAR. 341 The Emblems. Among the most prominent and beautiful features of the procession, were four emblematic representations, viz., " Peace through Victory," " Goddess of Liberty," " Pen and Sword," and " Union." These were so prettily designed and exe- cuted, that a full description of them will be copied from the Spy. As the description of a similar pageant at the close of the Revolution, would be intensely interesting to those now living, so will this be to those who shall live here in coming generations. " The first emblem — ' Peace through Victory,' represented twelve young ladies clothed in white, with laurel wreaths and bearing palms. The car was decorated with palms and bay, and drawn by four led horses, clothed in white, and decorated with laurel and bay. In the centre a figure with full armor was seen ; also the figure of a Roman soldier, bearing a battle-flag furled, and the white flag of peace flying from the same staff. The ' Goddess of Liberty ' followed, in a car surmounted with the the American eagle bearing four flags in its beak, and underneath the motto, ' Peerless in Peace, Invincible in War.' Over the car was a can- opy resting on four supporters, each one trimmed with evergreen. The seat and platform were draped with flags. Here was seated the peerless Goddess, with right arm resting upon the bundle of sticks which repre- sented union, and hand grasping the staff, surmounted by the liberty cap. The shield was by her left knee. Her dress was plain white, with dra- pery trimmed with blue, and ornamented with silver stars ; and a wreath of laurel was about her head. The car was drawn by four noble horses, each one led by a soldier from Dale Hospital, who very kindly volunteered their services. These preceded the returned soldiers in the procession. Following the naval corps, and preceding the disabled soldiers, came the emblem of the ' The Pen and Sword.' A sword and pen were seen on a standard in the center, with the words, ' Sword of Grant,' and ' Pen of Lincoln.' A shield beneath a banner at the front was inscribed ' Victory.' Beneath a scroll extending from corner post to corner post, were the words, ' Union Forever.' The corner posts were surmounted by two small Union shields inscribed ' 1776' and ' 1865 ; ' at the rear of the platform a banner inscribed ' Emancipation ; ' beneath a scroll, extending from corner post to corner post, ' Victory or Death,' an arch on one side, in the centre of the top of which was a photograph of Lincoln, surrounded by a wreatli of white lilies, was inscribed ' Forever Free ; ' beneath sat a negro boy ; an arch on the other side, in the centre of which was a photograph of Grant, 342 WORCESTER IN THE WAR. surrounded by a wreath of laurel, was inscribed ' Unconditional Surren- der ; ' beneath was a small cannon. The whole was decorated with festoons of evergreens and with bunting, while the Pen and Sword were surmounted by a wreath of red, white and blue flowers. Almost at the end of the procession, and preceding the Dale Hospital Soldiers, came thirty-six young ladies of the Worcester High School, rep- resenting ' Union.' A tall and heavy staff, handsomely surmounted and decorated with flowers, was fitted to a platform, borne by four men. From the top of the staff streamers of red, white and blue alternated, and were held by the ladies who represented states, each one of whom held one, and all were arranged in a body about the staff. The dresses of the young ladies were white, with laurel festoonings upon the skirts, and with laurel belts. Each lady wore upon her left shoulder, the coat of arms of the state she represented. This was pronounced the finest feature of the procession, and it was essentially different from the usual method of rep- resentation, the ladies walking instead of riding. This, with the prece- ding emblems, drew the admiring plaudits of the people. The procession moved from Park Street, through Main, Highland, Harvard, Chestnut, Elm, West, Pleasant and Main Streets to Lincoln Square, and countermarched on Main Street to Mechanics Hall, where the complimentary breakfast to the returned soldiers had been laid out under direction of the city government. The soldiers, and the Worcester, Brookline and Thirty-fourth Regiment bands were conducted to their places at the tables, and the stage was occupied by the city government, and marshals and aides." As the procession arrived at Mechanics Hall, a beautiful American flag was seen suspended over Main Street, several hundred feet in the air, gaily fluttering in the breeze, and brilliantly illuminated by the noonday sun. It was attached to the string of a kite, which some patriotic youth had flown, and was a beautiful and thrilling sight. The Shrewsbury and Newton bands marched to the music- stands on the Common, and entertained the crowds till noon with their best music. Mechanics Hall was appropriately draped in red, white and blue, and finely decorated with designs, drawn and painted by T. M. Woodward. On the front of the gallery opposite the stage was the motto : "The soldiers of '65, worthy sons of the patriots of '76," flanked by shields bearing the dates " 1775," " 1865." CLOSE OF THE WAR. 343 On the right gallery was the motto : " Honor to our Army and Navy," and on the left, — " While Honoring the Living, we Mourn the Fallen." On each side of the hall were elegant shields, bearing the mottoes : " Soldiers of Liberty, you are Welcome to the Heart of the Commonwealth," and " Welcome our Defenders — Victory." The galleries were crowded with spectators, and the heroes were welcomed with loud applause." The Dinner and the Speeches. Mayor Ball opened the formal exercises at the dinner table, by an appropriate speech of welcome. He began by re- ferring to the fourth of July, 1776, as historic in the annals of our country, and forever associated with the great principle that all men are " created free and equal " in regard to their rights. He then spoke of the antagonism between this principle of freedom, embodied in our Declaration of Inde- pendence, and the institution of slavery, which had involved us in a terrible, fratricidal war. This war, however, had resulted in eliminating from our institutions and our country, the great curse and shame which had been our reproach from the beginning, and the present fourth of July was a new point of departure in the annals of our country. Henceforth we are " all free," and we shall become homogeneous, in the progress of events, when liberty shall be recognized, in all parts of the land, as the birthright of all born on our soil. In the great fight against treason, and for impartial freedom, the soldiers of this city had bravely borne their part, and now the city rises up to do them honor. He continued : " A just and noble pride is yours, that your record in your country's cause was so promptly commenced in the beginning of the war, and that it has been continued with such constancy during the entire strife. Upon this worthy record we congratulate you. But for these blessings of vic- tories over our enemies, let us never forget to give praise and grateful acknowledgments to God for his interposition in our behalf. Nor let those pass from our remembrance and kindly care, who with chastened 344 WORCESTER IN THE WAR. and afflicted hearts, to-day, while rejoicing in our country's prosperity, are bowed in silent grief, that all these glorious successes have been purchased at such an immense sacrifice of so many loved and honored ones, who never more can come ; or returning, return with their capacity of useful- ness much diminished or totally lost. In conclusion, let us here renew our mutual pledges, that whatever duties civil life may hereafter impose for our care or performance, integ- rity of action shall always be ours, that the nation's history may proceed in one unbroken stream in favor of justice and liberty for all men, until civil freedom shall bless and elevate every member of the state, and all shall be free in the highest and best sense of civil freedom." Colonel Pickett, who came forward amid great applause, responded as follows : " Mayor Bail and Citizens of Worcester : — On behalf of these brave men, who, after conquering treason, re-establishing the government on a secure foundation, and securing the blessings of liberty to all, have now returned to you in triumph, I tender you my most sincere thanks for this magnificent ovation, and the honor you have bestowed on them this day. I can assure you it gives us the greatest gratification to know that our services are so highly appreciated by our friends and fellow citizens at home, and even as our conduct as soldiers has elicited your unqualified approval, so may we ever continue to merit your confidence as citizens, maintaining the true principles of right and justice, and always ready to respond to the call of duty." The divine blessing was then invoked by Rev. Dr. Hill, after which the guests partook of the collation, while Mr. C. C. Stearns performed patriotic airs upon the organ. After dinner, the Mayor called to order, and read the fol- lowing sentiment : " We have given our limbs that our country might live." Rev. George S. Ball of Upton, formerly chaplain of the Twenty-first Regiment, responded. He began by alluding facetiously to the good health of the soldiers, indicated by the readiness with which they took their rations, and expressed his belief that they needed no quinine, having received stimu- lus enough to ward off fever for a long time in the warmth of the reception of to-day, and then read General Grant's con- gratulatory order to the soldiers, to which the soldiers responded with loud and hearty cheers. CLOSE OF THE WAR. 345 As showing the havoc of war, and the wide-spread mourn- ing caused thereby, he stated as a fact that over five hundred commissioned officers from Massachusetts had died from the casualties of the war. Continuing : " He referred to incidents in his own experience in the field, showing the spirit of self-sacrifice pervading the army, and the courage and bravery of those who have suffered. He said that on the eight or nine battle- fields where he had had experience, he knew nothing of the groans of the battle-field. He heard no groans or murmurs ; they were too strong to give expression to their pain, and in thinking of their fate, we can sing with the poet Collins : ' How sleep the brave, who sink to rest, By all their country's wishes blessed ! When spring, with dewy fingers cold, Returns to deck their hallowed mould, She there shall dress a sweeter sod Than Fancy's feet have ever trod. By fairy hands their knell is rung ; By forms unseen their dirge is sung, There Honor comes, a pilgrim gray, To bless the turf that wraps their clay ; And Freedom shall a while repair, To dwell a weeping hermit there ! ' " Colonel William S. Lincoln spoke in response to the follow- ing sentiment : " By Heaven's indulgence we return to enjoy and perfect what we have defended." He paid a tribute to those who first met the urgent call of the country when the rebellion broke out, and referred with special honor to the Sixth Regiment, of which the old Wor- cester Light Infantry formed a part, and also to the other organizations which then marched from the city. The regi- ments that subsequently went into the war, came in for a share of his tribute. He said the war was over, but the fruits of it were yet to be gathered. The colored men had done good service, and he urged the duty of giving them equal rights at the ballot box. " Then," said he, " shall we more surely preserve what has been gained, and fully enjoy and perfect that which has been defended." 346 WORCESTER IN THE WAR. Colonel Pickett then called for three cheers for Colonel Lincoln, which were " given with a will." , Colonel A. B. R. Sprague was called upon to respond to a sentiment in remembrance of those still remaining in the field. His remarks were as follows : " He was thankful for the privilege of joining in the festivities of the day, now when the dark night is over and the day dawns — now when throughout the length and breadth of our beloved land, all loyal hearts unite in thanksgiving for the glorious old flag that floats everywhere tri- umphantly from the St Croix to the Rio Grande. The veterans from the smoke and dust of the conflict, home at last, crowned with honors, and decked with flowers that fair hands have twined, thank God that they live to see this day. The freedman at the door of his cabin, lifts up his voice in exultation, for the deliverance is at hand. The women of the North, angels of mercy, who by untiring efforts and heroic words, have encouraged the soldier in the weary march, and inspired him in the hour of peril ; aye, even those whose husbands, fathers, brothers, sons, ' not lost but gone before,' have gone through glory's golden gates to immor- tality beyond, as they kneel to-day with upturned eyes, can almost pierce the canopy of the blue sky, and catch the smile of approbation from the spirits immortal. The process of re-construction will be slow. Scattered over the sunny South are thousands of soldiers anxiously awaiting the day when their services will be no longer required. Oh how their hearts yearn to-day for a breath of the pure air, a sight of the hills and the val- leys of the North, and for the associations that cluster around their homes. The poisonous malaria, the burning fever, no less fatal than rebel bullets, will fill many graves, and cause sorrow in many home circles. But their mission is not yet fulfilled. Let us rejoice that it is so nearly accom- plished, at so great a sacrifice of life and treasure, that when the great temple of the Union is complete in all its parts, upon its topmost arch shall be written in imperishable letters, ' Liberty and equal rights to all who bear true faith and allegiance.' " Three cheers were then given for Colonel Sprague, three for Admiral Farragut and the navy, and three for Colonel Pickett. The mayor called on the galleries for three cheers for the soldiers, which were heartily given. And then the soldiers responded with nine cheers for the citizens of Wor- cester, and three for the ladies. Well-known singers interspersed the exercises by render- ing with fine effect, " Tramp, tramp, tramp," " Union and CLOSE OF THE WAR. 347 Liberty Forever," and other songs. The quartette was com- posed of Messrs Richards, A. S. Benchley, Fairbanks and J. E. Benchley. The military were then dismissed, and the great organ sounded out the Hallelujah chorus while the au- dience passed out of the hall. The Schools. The ovation to the soldiers was rendered more beautiful and complete by the parade of the school children of Worces- ter, over six thousand in number, who under the care of their teachers, were arranged in double line along the route of the procession. The police kept back the crowd. All being dressed in holiday attire, with garlands, wreaths, boquets and with a small flag in one hand, made a beautiful display. It was pronounced one of the finest ever seen in the city. The children sung patriotic airs, while the procession was pass- ing ; they cheered, waved their flags, and seemed to feel the honor of their position. They gave the soldiers a delightful welcome. The details of the schools and their mottoes will be given, because the thousands of children who participated, will always have pleasant remembrances of the occasion, and many of them will doubtless be glad to have their memories refreshed by reading the record. Says the report : " The schools were arranged in the following order, each with a banner bearing the name of the school, and most of them with appropriate mot- toes. Many of the banners were quite costly, and were designed in excel- lent taste. The Worcester High School paraded with their school banner, bearing the name of the school and the motto, 'The Culture of the Mind the Food of Humanity.' The school also carried a memorial banner of white silk, inscribed with the names of its members who have been in the army, and also those who have died in the service. The whole list numbered sixty-three. Fourteen of these were among the fallen. The school so- ciety ' Enclia,' also had a fine scarlet silk banner, with their badge designated upon it, and a Greek motto, ' All are Allies to Each.' The three banners cost over $150. The Thomas Street Schools, six in number, appeared in the procession with full ranks, each school bearing a banner with its name and grade. 34$ WORCESTER IN THE WAR. The schools carried the following mottoes : ' For God and the Right.' ' Be Just and Fear not,' ' Onward and Upward.' The grammar school also carried a memorial banner inscribed with the names of seventeen of its members who have given their lives for their country. The Main Street Schools, three in number, displayed each a banner, with the mottoes : ' Children ; the Republic's Jewels ; ' ' When we are older we'll Fight for You ; ' ' We are Little Soldiers.' The Mason Street Schools, two in number, had banners inscribed, ' Welcome ; ' ' We all feel gay, now Johnny comes Marching Home ; ' ' You have Fought for Us, we will Shout for You.' The Elm Street School carried a banner with the name of the school and the motto, ' Welcome.' The Pleasant Street Schools, three in number, bore banners inscribed with the name and grade of each school, and the mottoes : ' Defenders of Home and Country, welcome ; ' ' Welcome ; ' ' Honor to the Brave.' The Front Street Schools, three in number, all primary, carried ban- ners with the names of their schools without mottoes. The Ash Street Schools, four in number, bore banners with the grades of their schools, and the mottoes, ' To the Brave ; ' ' Welcome Home ; ' ' The Little Ones welcome You.' The Providence Street Schools, primary and secondary, paraded with the motto, ' The Children greet You.' The Ouinsigamond School displayed a banner with their name and the motto, 'All Honor to the Heroes of 1865.' The South Worcester Schools, primary and grammar, carried banners with their names, and the grammar school bore the motto, ' In Unison and Victory there is Liberty and Peace.' All the above schools were sta- tioned on the east side of Main Street. The schools on the west side of Main Street, commencing at the Court House were as follows : Sycamore Street Schools, with the national flag, headed by Mr. Hunt's grammar scholars, bearing a banner emblazoned with the names of its graduates who have fallen in the ranks. The banners carried by the schools of the different grades, from grammer to sub-primary, bore the following mottoes : ' Peace through Victory ; ' ' We give You Welcome ; ' ' Victory ; ' ' Welcome Home ; ' ' We are for the Right ; ' ' We are little Soldiers.' Summer Street Schools' mottoes, ' Ours is the Flag of the Free ; ' ' Freedom to All ; ' ' Let every Heart Rejoice.' East Worcester — The leading banner was borne by little misses who were tastefully attired with starry caps and sashes. The following mot- toes were displayed : ' Peace through Victory ; ' ' Worcester's Next Quota ; ' (a group of little boys,) ' Little but warranted Good ; ' ' Welcome to the Brave ; ' ' We greet you.' Temple Street School for Boys — ' Uni- CLOSE OF THE WAR. 349 versal Freedom to All.' Secondary — ' We honor our Brave Defenders ; ' ' Washington — Lincoln.' Salem Street — The leading banner bore the words, 'Tears for the Dead, Praises for the Living.' Following were ' Emancipation — A. Lin- coln ; ' ' Freedom for all ; ' and the little toddlers of the sub-primary fol- lowed with ' When Johnny comes marching Home.' Webster Square. — The Chamberlain District. The North Pond Dis- trict followed, with handsomely decorated banners. Burncoat Plain. — ' Union and Independence.' Adams Square. — ' By his Sword he seeks the Calm Repose of Liberty.' Pond District. — ' We live in Deeds, not in Years.' Blithewood School carried a banner with the motto, 'We welcome our Victorious Soldiers Home.' Valley Falls School. — ' Honor the Brave.' Lee's Village. — ' Peace and Liberty.' Northville. — ' The Living Heroes we welcome, the Honored Martyrs we mourn.' Tatnuck. — ' We keep the Jewel of Liberty in the Family of Freedom.' When the rear of the procession had left Lincoln Square and passed up Highland Street, the schools were moved in the opposite direction, and the same charming and lively spectacle which greeted the soldiers on Main Street, all the way from near City Hall to the Court House, was re- repeated with even greater enthusiasm and effect, the entire length of the route on Pleasant Street. It was an unusual scene, and one long to be remembered by those who were so fortunate as to witness it." The schools were then marched to their several school- houses, except the suburban schools, who were entertained in churches, opened for the purpose, and then dismissed. It was a day of enjoyment to the children, while they contributed much to the pleasure of the soldiers and all in the procession. This closed the first part of the celebration. The Trades' Representations. In preparing and executing the Trades' Representations, the business men of the city were inspired with the purpose of making a finer and more extensive display than anything ever before attempted, in the same line, in Worcester. Nearly ail important enterprises were represented, and the procession was more than two and a half miles long, occupying three- quarters of an hour in passing a given point. The head of the procession left Lincoln Square promptly at half-past two 35o WORCESTER IN THE WAR. o'clock, and passed through the following streets, viz. : — Main, Park, Green, Water, Grafton, Summer, and Main to Park, where it was dismissed. Here follows the order of the procession, abbreviated as much as possible : City Marshal, Platoon of Police, First Division, Aides, Marshal, Aides, Worcester Band, Fire Department as Escort, Aides, Marshal, Aides, Newton Band. Second Division, Aides, Marshal, Aides, Father Matthew Temperance Society, German Turners, American Society of Hibernians, Fenian Brotherhood. Third Division, Aides, Marshal, Aides, Brookline Band, Emblem of Industry, Trade Representations. Fourth Division, Aides, Marshal, Aides, Shrewsbury Band, Trade Representations. Fifth Division, Aides, Marshal, Aides. Thirty-fourth Regiment Band, Trade Representations, Foraging Party, Bummers, etc., The Fire Companies, in their uniforms, with all their ma- chines newly painted and varnished, and all their apparatus in fine order, and all profusely and tastefully decorated with flowers and evergreens, made a splendid spectacle. They moved in double lines, in the following order : Washington, i ; Hook and Ladder, I and 2 ; Steamers Gov. Lincoln and Col. Davis; City Hose, No. 1 ; Ocean, No. 2; Rapid, 2 ; Niagara, 2 ; Eagle Hose, 3. CLOSE OF THE WAR. 35 I Then came the Trade Representations, led by an emblem of Industry, designed as follows : — It was " two enormous straw bee-hives, around which bees were hovering, and sur- rounded with flowers, all extremely life-like and natural." It was designed and worked up by several ladies, whose handi- work elicited much admiration. The particulars of the splen- did procession which followed, must be omitted. Next followed various fantastical exhibitions, designed to excite mirth. They were well received by the crowd, which rewarded the exhibitors with shouts of laughter. The entire procession, besides the Fire Department, in- cluded one hundred and twenty-eight teams, drawn by three hundred and twenty-six horses, and twenty-six oxen. Not- withstanding the length of the procession, and its unwieldy character, there was no delay or confusion. It moved promptly on time, and no accident of moment occurred on the route. This grand success reflected great credit upon the committee, and especially upon the Chief Marshal, Hon. James B. Blake. The Fenian Brotherhood, about three hundred strong, made their first appearance in uniform caps, bearing the United States and Irish flags. The Young Men's Benevolent and Total Abstinence Society, an organization of boys, made its first appearance, numbering two or three hundred members. The German Turners, Ger- man Singing Society, Father Matthew Temperance Society, and American Hibernian Society, — the last headed by a per- son playing a Scotch bag-pipe, — were all in full ranks, and several of them carried splendid silk banners. The Illuminations. The effect of the illumination was greatly enhanced by the arches across Main Street, which have been already described. Each of the principal arches had its group of special admirers, and all admitted that ordinary fireworks, however extensive, could not lend such a pleasing spectacle. The arches blazed until half-past ten o'clock, and even the full moon scarcely dimmed their splendor. Many stores and dwellings on Main 352 WORCESTER IN THE WAR. Street, were illuminated ; as were the houses and grounds of Messrs. Harrison Bliss, Joseph Chase, Governor Lincoln, Thomas Earle, Lyman J. Taft, Rev. T. E. St. John, H. H. Chamberlain, Charles B. Whiting, and " numberless others." Fireworks were sent up from many localities, flashing and sparkling in every direction. Chinese lanterns helped to turn the night into day. The day came to an end, according to the design of the committee, in a " blaze of glory." The celebration, in every part of its complicated plan, was most successfully carried out. It marked the close of a contest which had inaugurated a great historical epoch ; it expressed the joy of the people in the achieved results, and it set forth, in a peculiarly gratifying manner, the gratitude of the citizens towards the soldiers who had represented them in the field. THE MARTYRS TRIUMPH. 353 CHAPTER XVI. DEATH OF PRESIDENT LINCOLN. — UNIVERSAL MOURNING. By a singular and providential concurrence of events, the loyal people of the United States kept a solemn fast, according to the appointment of President Lincoln, the day before he was struck down by the hand of the assassin. The proclama- tion had been issued before the opening of the spring cam- paign, but ere the appointed day arrived, the capture of Rich- mond, and the surrender of General Lee, had caused universal rejoicing. When the day came, the people felt more like giving thanks than fasting. But it was deemed not unfitting the condition of the country to look to God with humiliation and reverence, in view of the national guilt, and the divine mercy. A proper observance of the day was adapted to make us, as a people, bear our prosperity without pride, and to enforce the conviction that our deliverance was due to the interposition of our fathers' God. Moreover, events took such a turn, that the observance of the National Fast had an effect which was not designed nor anticipated. It prepared, to some extent, the people to endure the great bereavement which soon filled all hearts with grief. A nation which had just risen from its prostration before the Almighty, felt a sacred confidence that the same beneficent Power which had carried it safely through such a war, would be gracious still, and notwithstanding the murder of the beloved and respected Chief Magistrate, would secure to us lasting peace with liberty. 23 354 WORCESTER IN THE WAR. Section i. — Fast-Day Services. With great propriety, therefore, do we rehearse the services of the National Fast, before describing the scenes that followed the death of Mr. Lincoln. Thursday, April 13, was quite generally observed, by abstain- ing from secular pursuits, and by a large attendance on public worship. It is remembered that the prevailing spirit was rather of thanksgiving than of supplication. At the Salem Street Church, Rev. Mr. Richardson delivered a characteristic discourse, founded on Jeremiah 50 : 46. "At the noise of the taking of Babylon the earth is moved, and the cry is heard among the nations." He contrasted the fall of Babylon with the fall of Richmond, and said that the over- throw of the Confederacy was the fall of false institutions and ideas, which has prepared the way for the elevation of the millions of the South, and has given new impulse to the prog- ress of liberty throughout the world. Dr. Sweetser, at the Central Church, discoursed from He- brews 13 : 16. "But to do good, and to communicate, forget not ; for with such sacrifices God is well pleased." The duty of the people of the North to God, ascribing all praise and honor to Him, for the glorious triumph He has granted our arms ; the duty of cultivating a Christian spirit of forgiveness towards those who have been our enemies ; our duty to the colored race, providentially placed under our charge ; the duty of imparting to the South, the institutions of religion, industry and learning, which have blessed and elevated our own peo- ple ; and the duty of confidence in our government, and trust in our future, were presented as prominent among the many ways in which the people of New England can do, and com- municate good. At the Church of the Unity, Rev. Mr. Shippen spoke from Isaiah 1 : 27. " Zion shall be redeemed with judgment, and her converts with righteousness." The occasion called for thanksgiving rather than fasting ; but the work was not yet done, and the armor should not be put off till absolute justice and righteousness ruled the land. The two prominent dan- THE MARTYRS TRIUMPH. 355 gcrs before the people were, first, that the re-action of kindly- feeling towards the rebels should go to the extreme of indiffer- ence to the guilt of their treason ; and secondly, that the faith in Divine Providence, so wonderfully educated during the last four years, should go to the extreme of fatalism, bidding us to stand still and see the salvation of God. The rank and file of the southern army should be treated with magnanimity, but the leaders must not be indulged in their desire to escape from justice. He urged the granting of the elective franchise to colored loyalists. The text of Rev. Mr. St. John was from Revelation 19:6. "And I heard as it were the voice of a great multitude, and as the voice of many waters, and as the voice of mighty thunder- ings, saying, Alleluiah : for the Lord God omnipotent reigneth." He first rapidly sketched the progress of the war, and said that the dawning of peace was a reason for turning our thanksgiv- ing to praise. Our sins, North and South, had involved us in war. When we struck at slavery, God gave us success. At the Union Church, Rev. Mr. Cutler took for his text, Isaiah 33: 6. "And wisdom and knowledge shall be the stability of thy times, and strength of salvation : the fear of the Lord is his treasure." His discourse was spoken of by the reporter as " excellent and very able." He urged the duty incumbent on all citizens to discriminate more clearly in favor of upright and Christian men for our offices of trust and honor. He eulogized Abraham Lincoln, and expressed his belief in the necessity of making notable examples of the originators and leaders of the rebellion. The question of extending the right of suffrage to the freedmen, was treated in a way very friendly to their enfranchisement. Such was the observance of the day in Worcester ; and such was it, substantially among the loyal millions of the land. On the evening of the next day — the fourteenth — the good President who had summoned the people to humiliation and worship, was fatally shot by the murderer, — John Wilkes Booth. He lived insensible, during the night, and died early on the morning of Saturday. The woful intelligence was 356 WORCESTER IN THE WAR. flashed over the country, as it were in a moment, as the " lightning cometh out of the east, and shineth even unto the west." All over the land the tolling bells turned the morning sacrifice of praise into mourning. Section II. — Action of the City Government. Word came hither in the night that the President was shot, and that his life was despaired of; early in the morning it was reported that he was dead. His Honor, Mayor Ball, immedi- ately issued the following notice : "Mayor's Office, April 15, 1865. The overwhelming news from Washington, of the assassination of President Lincoln and Secretary Seward, bewilders our judgment ; and that the people may consult together on the sad event, it is advised that all business be suspended for the day, and that the city be draped in mourning ; and a public meeting is called to be held in Mechanics Hall, at ten a.m., to consider and advise upon this terrible affliction, which has so suddenly, from some present unknown cause, fallen upon our land. Our citizens are earnestly called upon to mingle no passion with their grief, but to calmly wait events, and be prepared to meet the demands of the hour, in the spirit of equity and wisdom. Let all good citizens coun- sel together for the public good, that confidence in civil government and good order may be maintained, and to refrain, in the spirit of true Chris- tian manliness, from all passionate displays of revengeful and embittered feeling. All the clergymen and public speakers in the city are requested to meet in the N. E. ante-room, in Mechanics Hall, at half-past nine o'clock, and take seats upon the platform. The city council are notified to meet at their respective rooms at seven o'clock, a.m. Phinehas Ball, Mayor." One of the many interesting incidents of the solemn and anxious night, after the word came that the president had been mortally wounded, was the following. While it was yet dark, great numbers, including many of the most prominent gentle- men of the city, had gathered in front of the office of the Daily Spy, fearfully waiting for further news, when the dispatch came that the good president, Abraham Lincoln, could not survive. It seemed as if the mourning throng simultaneously felt the need of the Almighty's arm to lean upon, and, by THE MARTYRS TRIUMPH. 357 request, the Rev. Joseph Banvard offered a most earnest and impressive prayer. The people, with uncovered heads, stand- ing in the moonlit street, joined in his fervent pleadings for divine wisdom and strength, in the hour so trying to the nation's welfare, and so harrowing to every loyal heart. They then quietly dispersed, each one bearing the sorrowful tidings to his own waiting group at home. The solemn tolling of the bells had apprised all of some great calamity, but none could surmise that so great a crime and disaster had entered into the annals of our country. There was mourning throughout the city, as if a beloved father had been taken away. The city council was convened, according to the above order of the mayor, at seven o'clock, on Saturday morning, and both boards, in joint convention, afcer uniting with Rev. Mr. Rich- ardson in an earnest and appropriate prayer, were addressed by Mayor Ball, as follows : " Gentlemen of the City Council : — We are assembled here this morning under the saddest and most overwhelming circumstances that have ever called us together in an official capacity. The leader of our na- tion has fallen by the hand of the ruthless assassin. The president of our beloved country has been murdered by some unknown hand, at an hour when, to our human view, we needed most his guidance, his wisdom, and his calm direction. For the moment the thought staggers our belief, that any man could be found in our whole land, who should be so recreant to all moral principle, as thus to outrage every dictate of humanity, and so entirely disregard all the protection and shields heretofore thrown around official station. From what spirit except that foul spirit of treason which has been aiming a death blow at the nation's life for the last four years, this awful act has proceeded, at this moment is entirely unknown. How large is the plot, what are its acts, or parts of acts, — to what intent directed, to what extent it is the index of an organized secret conspiracy to ruin the government, cannot now be even surmised, much less defi- nitely known. Soon we may know all ; and until we are more definitely informed, and much more can be known by patient impartial investigation of the real situation, it is to be hoped that all undue excitement will be discountenanced, and all exasperated feelings and demonstrations with- held. I have called you together under these painful circumstances to consult for the public good, for the safety of the city, to advise such measures as shall tend to good order and a due respect to the laws, to insure that 35 8 WORCESTER IN THE WAR. measure of personal freedom and security which has for so long a time been the characteristic of our people. For if the present is not the most important era in the whole history of the war, it is certainly the most ex- citing, and is likely to be the most trying. You are asked not to take counsel of your fears, but of your reason and judgment, guided and en- lightened by the Spirit of all light and wisdom from on high. The pas- sions of men will run high at an unparalleled moment like this. And all our energies must be bent upon staying the tide of rash passion and un- controllable exasperation which may be likely to arise upon an occasion the like of which has never before happened in our country, nor in any other nation under like serious and peculiar circumstances. Victory seems at last to have crowned our efforts to crush the rebellion, the enor- mity of which no human language can definitely or adequately portray. Peace soon seemed to.be ready to smile once more on our distracted land. At this moment the soul seems bewildered, and knows not where to be- stow its confidence. But in this hour of our grief, let us take lessons taught us by defeats in the past. When they came, they oppressed our whole community with irrepressible grief; but now as light has dawned on our hopes, we have seen that these very reverses were only the steps in the problem by which the hand of God was conducting us to reap our victor)-, and do justice to our fellow-men. May these experiences in- crease our faith, that God is conducting the logic of events for wise ends, best known to his holy councils ; that out of all these trials, sorrows and reverses, good still may come, and that this may be one of the means used by an all-wise and ever-watchful Providence, to secure such vigilance in loyal hearts over treason and rebellion in our land, that when peace shall at last smile truly upon us, it shall welcome in 'peace on earth and good will to men,' in a form of a purer and higher type of Christianity and civ- ilization upon this continent, than has ever been known or seen heretofore in the nations among men.
| 50,243 |
https://www.wikidata.org/wiki/Q20280259
|
Wikidata
|
Semantic data
|
CC0
| null |
El Pedregoso, Santa Catarina
|
None
|
Multilingual
|
Semantic data
| 207 | 525 |
El Pedregoso, Santa Catarina
El Pedregoso, Santa Catarina GeoNames oznaka 8884626
El Pedregoso, Santa Catarina koordinate lokacije
El Pedregoso, Santa Catarina zemlja Meksiko
El Pedregoso, Santa Catarina nadmorska visina
El Pedregoso, Santa Catarina je(su) naselje
El Pedregoso, Santa Catarina je u administrativnoj jedinici Opština Santa Catarina
El Pedregoso, Santa Catarina
nederzetting in Mexico
El Pedregoso, Santa Catarina GeoNames-identificatiecode 8884626
El Pedregoso, Santa Catarina geografische locatie
El Pedregoso, Santa Catarina land Mexico
El Pedregoso, Santa Catarina hoogte boven de zeespiegel
El Pedregoso, Santa Catarina is een woonplaats
El Pedregoso, Santa Catarina Mexicaanse plaats of gemeente-identificatiecode 240310058
El Pedregoso, Santa Catarina Who's on First-identificatiecode 1259837089
El Pedregoso, Santa Catarina gelegen in bestuurlijke eenheid Santa Catarina
Ел Педрегосо
Ел Педрегосо Геонејмс 8884626
Ел Педрегосо географске координате
Ел Педрегосо држава Мексико
Ел Педрегосо надморска висина
Ел Педрегосо је насеље
Ел Педрегосо INEGI ID места 240310058
Ел Педрегосо WoF ID 1259837089
Ел Педрегосо управно-територијална јединица Општина Санта Катарина
El Pedregoso
El Pedregoso identificador GeoNames 8884626
El Pedregoso coordenadas
El Pedregoso país México
El Pedregoso elevación sobre el nivel del mar
El Pedregoso instancia de asentamiento
El Pedregoso código de localidades del INEGI 240310058
El Pedregoso identificador Who's on First 1259837089
El Pedregoso situado en la entidad territorial administrativa Municipio de Santa Catarina
| 20,241 |
https://github.com/wasilewski-piotr/PJATK/blob/master/APBD/APBD_CW3/Services/IStudentsDbService.cs
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
PJATK
|
wasilewski-piotr
|
C#
|
Code
| 25 | 103 |
using APBD_CW3.Services.Requests;
using APBD_CW3.Models;
namespace APBD_CW3.Services
{
public interface IStudentsDbService
{
public bool PromoteStudent(PromoteStudentReq promoteStudentRequest);
public Study GetStudy(string nameOfStudy);
public EnrollStudent EnrollStudent(EnrollStudentReq enrollStudentRequest);
}
}
| 19,707 |
https://www.wikidata.org/wiki/Q8808405
|
Wikidata
|
Semantic data
|
CC0
| null |
Category:Puppet theaters
|
None
|
Multilingual
|
Semantic data
| 506 | 2,201 |
Категория:Кукольные театры
категория в проекте Викимедиа
Категория:Кукольные театры категория на Викискладе Puppet theaters
Категория:Кукольные театры это частный случай понятия категория в проекте Викимедиа
Категория:Кукольные театры общая тема категории театр кукол
Catégorie:Théâtre de marionnettes
page de catégorie d'un projet Wikimedia
Catégorie:Théâtre de marionnettes catégorie Commons Puppet theaters
Catégorie:Théâtre de marionnettes nature de l’élément page de catégorie d'un projet Wikimédia
Catégorie:Théâtre de marionnettes sujet de la catégorie compagnie de marionnettes
Կատեգորիա:Տիկնիկային թատրոններ
Վիքիմեդիայի նախագծի կատեգորիա
Կատեգորիա:Տիկնիկային թատրոններ Վիքիպահեստի կատեգորիա Puppet theaters
Կատեգորիա:Տիկնիկային թատրոններ հասկացության մասնավոր դեպք Վիքիմեդիայի նախագծի կատեգորիա
Կատեգորիա:Տիկնիկային թատրոններ կատեգորիայի հիմանական թեմա տիկնիկային թատրոն
Катэгорыя:Лялечныя тэатры
катэгорыя ў праекце Вікімедыя
Катэгорыя:Лялечныя тэатры катэгорыя на Вікісховішчы Puppet theaters
Катэгорыя:Лялечныя тэатры гэта катэгорыя ў праекце Вікімедыя
Катэгорыя:Лялечныя тэатры галоўная тэма катэгорыі тэатр лялек
Kategorie:Puppenbühne
Wikimedia-Kategorie
Kategorie:Puppenbühne Commons-Kategorie Puppet theaters
Kategorie:Puppenbühne ist ein(e) Wikimedia-Kategorie
Kategorie:Puppenbühne Thema der Kategorie Puppentheaterkompanie
Kategori:Kukla tiyatrosu
Vikimedya kategorisi
Kategori:Kukla tiyatrosu Commons kategorisi Puppet theaters
Kategori:Kukla tiyatrosu nedir Wikimedia kategorisi
Categoria:Teatri dei pupazzi
categoria di un progetto Wikimedia
Categoria:Teatri dei pupazzi categoria su Commons Puppet theaters
Categoria:Teatri dei pupazzi istanza di categoria di un progetto Wikimedia
Categoria:Teatri dei pupazzi soggetto principale della categoria teatro dei pupazzi
Kategória:Bábszínházak
Wikimédia-kategória
Kategória:Bábszínházak Commons-kategória Puppet theaters
Kategória:Bábszínházak osztály, amelynek példánya Wikimédia-kategória
Kategória:Bábszínházak kategória fő szócikke bábszínház
Kategória:Bábkové divadlá
kategória projektov Wikimedia
Kategória:Bábkové divadlá kategória na Commons Puppet theaters
Kategória:Bábkové divadlá je kategória projektov Wikimedia
Kategória:Bábkové divadlá téma kategórie bábkové divadlo
Kategorija:Lėlių teatrai
Kategorija:Lėlių teatrai Vikitekos kategorija Puppet theaters
Kategorija:Lėlių teatrai tai yra Vikimedijos projekto kategorija
Category:Puppet theaters
Wikimedia category
Category:Puppet theaters Commons category Puppet theaters
Category:Puppet theaters instance of Wikimedia category
Category:Puppet theaters category's main topic puppetry company
Категорія:Лялькові театри
категорія проєкту Вікімедіа
Категорія:Лялькові театри категорія Вікісховища Puppet theaters
Категорія:Лялькові театри є одним із категорія проєкту Вікімедіа
Категорія:Лялькові театри основна стаття категорії театр ляльок
Kategorie:Divadla loutek
kategorie na projektech Wikimedia
Kategorie:Divadla loutek kategorie na Commons Puppet theaters
Kategorie:Divadla loutek instance (čeho) kategorie na projektech Wikimedia
Kategorie:Divadla loutek téma kategorie loutkové divadlo
Categorie:Teatre de Păpuși
categorie a unui proiect Wikimedia
Categorie:Teatre de Păpuși categorie la Commons Puppet theaters
Categorie:Teatre de Păpuși este un/o categorie în cadrul unui proiect Wikimedia
Kategoria:Teatry lalek
kategoria Wikipedii
Kategoria:Teatry lalek kategoria Commons Puppet theaters
Kategoria:Teatry lalek jest to kategoria w projekcie Wikimedia
Kategoria:Teatry lalek główny temat kategorii teatr lalek
Категори:Пукане театрĕсем
Категория:Ҡурсаҡ театрҙары
Викимедиа категорияһы
Категория:Ҡурсаҡ театрҙары Викимилектә категория Puppet theaters
Категория:Ҡурсаҡ театрҙары төшөнсәнең шәхсән осрағы Викимедиа проектындағы категория
Kategorio:Pupteatroj
kategorio en Vikimedio
Kategorio:Pupteatroj Komuneja kategorio Puppet theaters
Kategorio:Pupteatroj estas Vikimedia kategorio
Kategorio:Pupteatroj ĉeftemo de la kategorio pupteatro
Төркем:Курчак театрлары
Викимедиа проектындагы төркем
Төркем:Курчак театрлары Викиҗыентыктагы төркем Puppet theaters
Төркем:Курчак театрлары төшенчәнең аерым очрагы Викимедиа проектындагы төркем
رده:تئاتر عروسکی
ردهٔ ویکیمدیا
رده:تئاتر عروسکی ردهٔ ویکیانبار Puppet theaters
رده:تئاتر عروسکی نمونهای از ردهٔ ویکیمدیا
Kategorija:Lutkarski teatri
Wikimedia:Kategorija
Kategorija:Lutkarski teatri kategorija na Commonsu Puppet theaters
Kategorija:Lutkarski teatri je(su) Wikipedia:Kategorija
Category:木偶剧院
维基媒体项目分类
Category:木偶剧院 共享资源分类 Puppet theaters
Category:木偶剧院 隶属于 維基媒體分類
კატეგორია:თოჯინების თეატრები
ვიკიპედია:კატეგორიზაცია
კატეგორია:თოჯინების თეატრები ვიკისაწყობის კატეგორია Puppet theaters
კატეგორია:თოჯინების თეატრები არის ვიკიპედია:კატეგორიზაცია
Катэгорыя:Лялечныя тэатры
катэгорыя ў праектах Вікімэдыі
Катэгорыя:Лялечныя тэатры катэгорыя ў Вікісховішчы Puppet theaters
Катэгорыя:Лялечныя тэатры асобны выпадак панятку Вікімэдыя:Катэгорыя
Катэгорыя:Лялечныя тэатры асноўны артыкул катэгорыі лялечны тэатар
| 34,273 |
bub_gb_PYINAAAAQAAJ_9
|
French-PD-diverse
|
Open Culture
|
Public Domain
| 1,866 |
Revue des questions historiques
|
None
|
French
|
Spoken
| 7,076 | 11,183 |
La disette d'eau avait mis les Carcassonnais dans la triste néces sité d'égorger des centaines de tètes de bestiaux <l qui y avaient été recueillis de tout le pays. » Ce fut bientôt une odeur de ca davre mortelle dans ces rues étroites, humides malgré le soleil, et sales même encore aujourd'hui. Ajoutez la calamité des mou ches, qui, attirées par la chair morte, s'étaient abattues sur la ville, nuée épaisse et dévorante. Détresse telle que les assiégés n'en ont éprouvé « jamais de pareille depuis qu'ils sont nés. » Le roi d'Aragon, le dernier espoir, est parti; les femmes et les enfants, c dont tout est encombré », poussent des cris déchi 148 REVUE DES QUESTIONS HISTORIQUES. rants.Les Croisés en prennent compassion, — compassion peut être intéressée — car voici qu'un «riche homme», suivi de trente chevaliers, se présente à la Porte Narbonnaise et demande à parler au vicomte. Raymond-Roger sort, escorté, pour lui, « de plus de cent chevaliers. » — a Sire,iui dit le croiséje suis votre parent. Puisse Dieu m'ai « der et me protéger, comme je désirerais votre accord et votre « plus grand bien et celui de vos hommes! Si vous savez avoir pro « chainement secours, alors je vous approuve de vous défendre ; « mais vous pouvez bien connaître qu'il n'en est rien. Faites avec a le Pape un accord quelconque, ainsi qu'avec les barons de l'ost : « car je vous le dis en vérité, s'ils vous prennent de vive force, « votre sort à tous sans exception sera celui qu'a eu Béziers. Sau « vez seulement vos personnes de mort et de tourment : vous « aurez assez d'argent, si vous vivez longuement 1. » Ce conseil, le môme que celui du roi d'Aragon, la démarche spontanée du chevalier qui semblait être la démarche de l'ost elle-même, firent heureusement tomber dans le cœur du vicomte toutes les susceptibilités de son amour-propre enfin vaincu ; la considération des malheurs extrêmes que la résistance prépa rait aux assiégés, rendit la capitulation possible. Le légat apprit donc avec un très vif sentiment de joie la nouvelle que Raymond Roger s'était rendu sous la tente du comte de Nevers, où le conseil des barons était réuni. Que s'y passa-til ? Nous l'igno rons. Guillaume de Tudèle, qui a raconté avec quelque com plaisance le siège de Carcassonne, se borne à ce naïf propos : « De toutes parts le (Roger) regardent chevaliers et sergents, selon ce que rapporte un prêtre ; car il s'était livré en otage de son plein gré ; et il agit bien en fou, par mon escient, lorsqu'il se mit en prison 2. » Quant aux défenseurs, ils furent dépouillés de leurs armes. Les habitants, a dames et demoiselles, chacun à fenvi...,' s'en allè rent les uns à Toulouse, les autres en Aragon et le reste en Espa gne, qui au nord, qui au sud, tellement qu'il n'y resta ni ser gent ni goujat, ni homme petit ni grand, femme ni damoiseau 3.» La capitulation était dès lors un fait accompli. '* La Chanson, v. 740-745. 3 La Chanson, v. 750-763. Digitized by Google LE SIÈGE DE CARCAS60NNE. 149 question de savoir s'il ne fallait pas raser Carcasson ne, et qu'il s'ar rêta au parti de conserver les remparts de la place l. Mais le légat Arnaud fournit des détails plus précis dans sa relation officielle au Souverain Pontife. « Les assiégés, dit-il, offrirent de rendre la ville, à la seule condition que la vie leur serait conservée, et qu'ils pourraient sortir en toute sûreté pendant un jour. Le con seil se réunit donc; les chefs furent nécessairement amenés à les traiter avec cette indulgence, soit parce qu'il ne paraissait pas facile de s'emparer de la ville, soit parce que nous craignions que si la ville était prise de force, elle ne fût ravagée par les enne mis, ou môme par ceux qui étaient avec nous, mais avec des pensées bien différentes, comme cela était arrivé en d'autres endroits, à l'insu des chefs 2. » Ce précieux témoignage 3 détruit celui de Matthieu Paris : car après la capitulation stipulée pour ces motifs, à quoi bon une dé libération pour traiter de la conservation ou de la destruction de la forteresse? Mais il corrobore celui de La Chanson, qui parle des précautions prises par les chefs pour épargner à la place la honte et l'horreur du pillage. Le lendemain de la capitulation, quand les Carcassonnais furent partis, la voix des hérauts se fit entendre, au premier jour: tAu pardon ! l'abbé de Citeaux veut faire un sermon 4.» Les barons accoururent en toute hûtc ; et « d'un perron de mar bre, i l'abbé les harangua. « Seigneurs, leur dit-il, entendez mes paroles. Vous voyez quels miracles fait pour vous le roi du Ciel, car rien ne peut vous résister. Je vous commande à tous, de la part de Dieu, de ne rien retenir, ne fût-ce que la valeur d'un charbon, des biens de la ville, ou sinon, nous vous mettrions sur-le-champ en excommunication et en malédiction 5. d La conservation de la place assurée et le pillage empêché, les. Croisés, à l'ordre des chefs, franchirent la Porte Narbonnaise, et occupèrent en vainqueurs la cité vicomtale*. C'était le dimanche 16 août 1209. Le siège les avait retenus quinze jours. 1 Hist. Angl., ad an. 1214. 1 lnnoc. llï, Pp. Regest. Lib. XII, Ep. cvm. 1 11 renferme le desaveu le plus formel du massacre de Béliers. 4 La Chanson, v. 762. 1 La Chanson, v. 767-775. * Pet Vall. Cern. Hist.% c. xvu. — Guil. de Podiol. Histor., cap. xiv. — LaChar>son,v 570-760. — lnnoc. III, Pp. Regest. Lib. XII. Ep. cvm. « Eo deai anno (1209) capta fuit Carcassona acruce signatis. » Chron. S. Saturnini. 150 REVUE DES QUESTIONS HISTORIQUES. Dans la prise de Carcassonne réputée à l'abri de tout coup de main, comme dans le sac sanglant de Béziers (22 juillet 1209), les contemporains, éloignés des passions des partis, adorèrent le bras vengeur de Dieu. Pierre de Vaux-Cernay, rappelant une expression ancienne, a rendu ce sentiment dans un style entraî nant et pittoresque, où la légende se mêle à la vérité, t Les habi tants sortirent de la ville, raconte-t-il, ne portant que leurs pé chés l.i C'est alors que s'accomplit la parole du vénérable seigneur Béranger, autrefois évôque de Carcassonne. Un jour qu'il prê chait dans sa propre ville et qu'il lui faisait le reproche de son hérésie, les habitants refusèrent de l'écouter. « Vous ne voulez « pas m 'écouter, reprit-il; croyez-moi cependant, car je pousserai t un tel mugissement contre vous, que les destructeurs de votre « ville viendront des extrémités du monde. Sachez qu'alors môme t que vos remparts seraient très hauts etde fer, vous ne pourriez « pas vous défendre, car votre incrédulité et votre méchanceté « appellent sur vous la vengeance du juste juge V Relevons ici une erreur très commune chez les historiens. Racontant l'entrevue du vicomte avec les barons de l'ost, beaucoup représentent la démarche du croisé * ce riche homme, • interpellant Raymond-Roger devant la Porte Nar bonnaise, comme un piège habile, auquel le « crédule » Ray mond-Roger se laissa prendre. Ils ajoutent que la conduite de l'abbé Arnaud, qui, d'après eux, aurait fait saisir le trop confiant vicomte sous la tente du comte de Nevers ou peut-être devant la Porte Narbonnaise, pour le jeter en prison et le mettre hors d'état de se défendre, fut une infâme trahison du droit des gens. Mais le lecteur a déjà plusieurs fois, dans le cours de ce récit, 1 Omnes nudi egressi sunt de civitate. Nudi signifie dépouillés de leurs armes, et non tout nus. Cette expression est renouvelée d'un document ec clésiastique très ancien: Presbyterorum et diaconorum Achaix epistola de martyr io S. A ndrese: « Inteniantur deserti et nudi, nihil secum prxter pec cata portantes.» Migne, Pat roi. Grecque, t. II, col. 1219. — Les pécheurs seront devant Dieu dépouillés de tout, excepté de leurs péchés. De même les Carcassonnais vaincus n'ont emporté que leur péché d'hérésie. * Pet. Val. Cern. Histor., cap. xvii. Nous ne croyons pas à l'authenticité de ce sermon, que Pierre de Vaux-Cernay n'avait pas entendu ; mais cet auteur.ense faisant l'écho du bruit public, a reproduit l'opinion des Croisés que la chute de Carcassonne lui fut une juste punition. Dltytized by Google LE SIÈGE DE CARCASSONNE. 151 entendu la déposition de La Chanson, tout à fait contraire à cette façon un peu fantaisiste de raconter l'histoire. Guillaume de Puylaurens, à son tour, s'exprime ainsi : « Après la prise de Béziers, l'armée de Dieu porta ses étendards vers Carcassonne, où le vicomte Roger, frappé de terreur, consentit à subir les conditions qui lui étaient imposées. Les habitants devaient sortir en chemise et en braie1; ils remettaientla ville aux croisés, et le vicomte lui-môme restait en otage, jusqu'à l'entier accomplisse ment de tous les termes de la capitulation 8 .» Pierre de Vaux Cernay ne parle, lui aussi, que de composition 3 ; Guillaume le Breton ne soupçonne pas même une trahison ou un piège quel conque 4; Pierre Abolant se plait à représenter le vicomte sup pliant les barons de laisser les habitants sortir la vie sauve ; et Xlbéricdes Trois-Fontaines ajoute son autorité à ces témoignages déjà considérables. Enfin, qu'il nous soit permis de donner tout au long le récit des légats, dont nous n'avons encore cité que quelques mots : il est concluant. iLe lendemain du jour où nous avions mis le siège devant la ville, écrivaient-ils à Innocent III, les nôtres prirent d'as saut le premier faubourg, qui, quoique fortement muni de tout côté d'un fossé, de remparts et de défenses, ne résista pas à l'attaque de nos soldats. Sous une pluie de pierres et de traits, et malgré les coups répétés des lances et des épées, ils eurent, dans l'espace de deux heures, escaladé les murs et occupé le fau bourg. Le huitième jour de notre arrivée, ayant armé les ma chines puissantes, ils s'emparèrent du grand faubourg, auquel les habitants mirent eux-mêmes le feu. Les ennemis furent de la sorte enfermés dans la Cité, et parce qu'ils y souffraient beau coup plus que les nôtres ne pouvaient le soupçonner, ils s'en re mirent aux croisés de leurs personnes, de leurs biens, de leur ville, à la seule condition de pouvoir se retirer pendant un jour en toute sûreté, et d'avoir la vie sauve. Le conseil se réunit, et jugea comme nécessaire d'user de cette indulgence 5. » Où discerne-t-on,dans ce récit véridique,une trace quelconque de trahison? Les meilleurs esprits, comme Pierre de Marca, par 1 Cest-à-dire dépouillés de toutes armée. 1 Hisior., cap. xiv. 3 Histor., cap. xvu. * Philip., Lib. VIII. 1 Innoc. M, Pp. Reg. Lib. XII, Ep. cvui Digitized by Google 152 REVUE DES QUESTIONS HISTORIQUES. exemple ne l'ont aperçue dans aucun des récits contemporains. Et maintenant, faut-il croire que l'hostilité envers l'Église et envers les hommes qui, en tout temps, sesont voués à son service, a seule fait entrer dans l'histoire cette accusation de déloyauté? Quelquefois peut-être, mais non pas toujours. S'il est possible de surprendre ce sentiment d'hostilité dans les écrits de quelques uns, quelques autres n'ont manqué que d'attention, et ceux-là ont laissé surprendre leur bonne foi par une confiance presque absolue à Y Histoire de la guerre des Albigeois écrite en langue docien par un ancien auteur anonyme, redevable de son crédit à D. Vaissette, qui en publia le premier le texte. Nous n'avons pas à écrire ici une étude critique de ce document, sorti de la plume d'un anonyme qui, ennemi de la conquête certainement, et peut être un peu adversaire de la Couronne de France et de l'Église, ne fit de ce récit qu'une traduction-commentaire du poème en languedocien de Guillaume de Tudèle et de son continuateur anonyme, auquel il fut postérieur de plus de cent ans. Nous ne voulons nous occuper que du siège de Carcassonne et du récit que le document en prose en adonné*. Ce récit est, sur les points principaux, en opposition avec tous les autres documents. Il nous présente d'abord la trahison comme préméditée par le légat, qui, désespérant de s'emparer de la place, envoie sous le secret un homme de confiance à la Porte Narbonnaise, avec mission de s'informer par ruse de l'état de la place, d'engager des négociations cauteleuses avec le vicomte et de l'emmener de la sorte dans le camp s, où il était facile de se rendre maître de sa personne. Or, aucun document, pas plus que le poème, qui a servi de modèle à la version en prose, n'énonce ou ne permet de supposer un fait semblable. Nous l'avons vu, La Chanson représente comme tout à fait spontanée et privée la démarche du « riche homme. » Nous avons vu de même Raymond-Roger sortir « escorté de plus de cent chevaliers, » quand il se rend à la conférence solli citée par le « riche homme. » C'est La Chanson qui fournit ce détail : or, cependant, le récit en prose lui accorde une escorte composée de trois hommes seulement 4. Il est vrai qu'il les 1 (lesta Comitum Barcinonensium, cap. xxiv. » Hist. gènir de Lang. Edit. primit., t.IU.col. 16-19. Ed. Privât, t. VIII, col. 29-34. 3 Ed. Privât, t. VIII, col 30. «Ed. Privât, t. VIII. col. 30. Digitized by Google LE SIÈGE DE C ARC ASSONNE. 153 dit c bien armés. » et prêts à tout événement, mais il répète toutefois, avec son modèle, que le « riche homme » était accom pagné de trente hommes, comme pour augmenter l'invrai semblance. Trois contre trente, aux portes du camp ennemi ! Le vicomte, rassuré par les paroles amies du « riche homme, * consent donc à une entrevue avec les barons, qui ignorent ce procédé de ruse vulgaire, bien plutôt digne, en tout cas, d'un Grec que d'un légat. Il s'excuse, il s'humilie, il fait une profession de foi chrétienne : jamais il n'a aimé les hérétiques ; jamais il ne les a favorisés, jamais soutenus. — Mais ces circon stances, ignorées des autres chroniqueurs, sont données là pour mieux justifier la conclusion; la passion évidente de l'auteur leur enlève tout caractère historique. C'est, en effet, après cette déclaration de Raymond-Roger que le légat aurait pris à part les barons, et sans leur faire connaître sa pensée dernière, leur aurait comme imposé l'obligation, triste et coupable obligation, de le retenir déloyalement prison nier. Les barons auraient obéi à cet ordre, et la garde du malheu reux Roger aurait été confiée aux soldats du duc de Bourgogne. Alors les Carcassonnais, marris en apprenant lu captivité du comte et craignant beaucoup pour leur propre vie, auraient songé à prendre et auraient pris la fuite vers Toulouse et l'Espagne. Ils se seraient même échappés par un passage sou terrain, connu d'eux seuls,qui les aurait conduits jusqu'aux Tours de Cabardès. Or, ce n'est là qu'un récit fantaisiste, dont l'imagination de l'auteur anonyme est la source unique. On a vu plus haut, d'après les documents les plus contemporains, qu'il ri'y eut point de guet-apens : car il fut accordé aux Carcassonnais une journée entière pour sortir de la place et pourvoir à leur sûreté ; enfin, jamais depuis, on n'a trouvé des traces de ce souterrain, par lequel les Carcassonnais se seraient enfuis, et qui aurait dû compter pourtant plusieurs lieues de longueur ; jamais, à aucune époque des annales de Carcassonne, ce souterrain n'a été mentionné. Il nous semble que ces courtes observations peuvent reven diquer l'évidence d'une lumière qui éblouit presque. Et cepen dant nombreux ont été les historiens dont le regard n'a pas rencontré cette lumière. Que dire maintenant de la fin du récit en prose, d'après lequel 154 REVUE DES QUESTIONS HISTORIQUES. les Croisés, craignant la résistance des habitants et des défen seurs dont ils ignoraient le départ, se seraient fortement armés avant de se présenter à la Porte Narbonnaiseet aux remparts, après l'indigne déloyauté dont Raymond-Roger était déjà vic time? Que dire de ces projets d'affreux vandalisme, qu'il leur prête, de brûler la ville, de massacrer les habitants et les défen seurs, pour mieux jouir de la liberté de l'incendie et du pillage ? Que dire de cet étonnement cruel du légat et des barons, à la nouvelle que la place avait été déjà évacuée? Que dire du dessein que l'anonyme leur suppose de renouveler à Carcassonne les scènes et les horreurs du sac de Béziers, quand nous savons que l'ost tout entière, les ribauds exceptés, regrettèrent vive ment les événements du 22 juillet (1209), quand nous savons que le légat Arnaud mit tout en œuvre pour mener à bonne fin les négociations ouvertes par Raymond-Roger, pour conserver les remparts de la place, et épargner à la ville les scènes de carnage et de pillage suite inévitable d'un assaut où les ribauds auraient peut-être déployé plus de zèle encore que vingt jours auparavant, à Béziers ? La forteresse était donc tombée aux mains des Croisés par composition, et après une capitulation dont les termes avaient été discutés et acceptés par les parties intéressées. Le vicomte, nous l'avons vu, resta comme otage, c'est-à-dire comme cau tion. Loin de nous en étonner, constatons une fois de plus un des faits les plus fréquents du moyen âge, justifié par les principes du droit des gens alors en vigueur. Depuis plusieurs siècles déjà, un usage propre aux peuples guerriers, resté comme un héritage de cette méfiance soupçonneuse qui formait le fond du caractère barbare et qui n'avait rien perdu de sa vi gueur primitive, voulait qu'aucune affaire quelque peu impor tante ne se traitât sans que des cautions sûres ne fussent four nies. En cas de guerre, et la guerre était comme l'état normal de la société du moyen âge, cet usage devenait une loi. Alors, un chevalier ne se constituait pas prisonnier sur parole. Il livrait sa personne au vainqueur, qui le traitait avec égard. Digitized by Google LE SIÈGE DE CARCASSONNE. 155 A en croire le P. Bouges, sa captivité dans le donjon ne fut pas de longue durée : d'après cet auteur, il y serait mort huit jours seulement après la capitulation de la ville. Mais c'est là une erreur : il n'arrive que trop souvent que cet auteur puise ses informations, non dans les documents authentiques, mais bien plutôt dans son imagination féconde. Transportons-nous en effet à trois mois de là. Simon de Montfort, qui avait reçu com mission de garder le pays soumis, le lendemain de la capitula tion, chevauchait du côté de l'Albigeois pour organiser la défense du Carçassés, quand, le 10 novembre, il apprit avec dou leur que Raymond-Roger, dont il n'avait pas même connu la maladie, venait de succomber dans la grande salle du donjon, à la suite d'une dyssenterie violente. J'ai dit avec douleur : car s'il détestait en lui « la pravité hérétique, » il estimait hau tement sa valeur. Son intérêt personnel lui fit d'ailleurs estimer cette mort un malheur, et avec raison. Raymond-Roger laissait un héritier dans le jeune enfant que Dieu lui avait donné ; les hérétiques, qui déjà s'étaient opposés aux Croisés au nom d'un faux patriotisme, n'allaient pas man quer d'exploiter cette fin inopinée, que le crime seul sem blait expliquer. De fait, il en fut ainsi : dès ce moment on la reprocha souvent à Montfort, et l'accusation est devenue un propos courant en histoire. Ainsi, d'après Sismondi, Simon de Montfort lui-même aurait donné « les ordres nécessaires pour que le vicomte Raymond-Roger mourût de dyssenterie, le 10 no vembre, dans une tour du palais vicomtal de Garcassonne 1 . j> Qu'en penser? On n'a aucune peine à concevoir que Simon de Montfort ait ren contré de bonne heure dans les vaincus, non seulement des ad versaires, mais encore des ennemis implacables. Il jouit bien vite de cette réputation que se fait dans tout pays conquis le vainqueur et le maître. Tout le parti hérétique, qui bientôt se changea en parti de l'indépendance, le représenta comme capable de toutes les audaces, de toutes les usurpations et de toutes les cruautés. C'est ainsi qu'il est permis d'expliquer que le second qtfteur de La Chanson et le biographe d'Arnaud de Mareuil, qui écrivait quarante ans plus tard, aient accusé Simon de Montfort de s'être 1 Hist. des Fratiçais, chap. xxv. 156 REVUE DES QUESTIONS HISTORIQUES. débarrassé par le poison d'un ennemi jeune encore — Roger n'avait en effet que vingt-quatre ans— homme d'initiative et de courage. Cette explication détruit avec plus de force, si c'est pos sible, le témoignage de la version en prose de La Chanson, qui, nous l'avons constaté tout à l'heure, est plus passionnée qu'au cun autre récit. D'ailleurs, ces trois témoignages sont contredits par quatre autres témoignages, tout à fait contemporains : celui de G. de Tudèle, celui de Pierre de Vaux-Cernay, celui d'Inno cent m, et celui de Guillaume de Puylaurens. J'avoue que le langage d'Innocent III peut prendre un double sens : Vice cornes terrant perdidit auxilio des/itutus, ad ultimum miserabi liter interfectus l, dit-il. Mais si ces derniers mots signifient que Roger a été tué misérablement, et non qu'il a péri misera hlement, et s'ils renferment une allusion à un assassinat, de deux choses l'une : ou bien Innocent III a manqué à son devoir en ne flétrissant pasce crime et en ne désavouant pas Simon de Mont fort, son auteur présumé, indigne de sa confiance ; ou bien, si crime il y a, le crime a été conçu et exécuté par un des anciens partisans de Raymond-Roger, indigné de sa fuite à Béziers et de sa capitulation à Carcassonne. Mais pourquoi ce laborieux raisonnement ? Nous avons le témoignage positif de Guillaume de Puylaurens. Ce chroniqueur n'était pas un ami de Simon de Montfort. Ses relations avec Raymond VI, oncle de Raymond-Roger, intéressé plus que per sonne à accabler Simon de Montfort, lui permirent d'ôtre par faitement renseigné ; et s'il a gardé le silence sur beaucoup de faits dont peut-être seul il connut la vérité, il s'explique du moins sur la mort de Raymond-Roger; et ainsi son témoignage n'a que plus de valeur, a Le vicomte mourut de la dyssenterie, dit-il ; et l'on répandit à ce sujet plusieurs impostures, en disant qu'il avait été tué à dessein. » Voilà la calomnie; mais voilà aussi la réponse f. 1 Innoc. III, pp. Reg., lib. XV, Ep. ccxn. * 9 Le vicomte mourut de la dyssenterie, et les mauvais vauriens et la canaille, qui ne savent rien de l'affaire, ni ce qui est ni ce qui n'est pas, disent qu'on le tua de nuit en trahison. » La Chanson, v. 863-866. Digitized by Google LE SIÈGE DE CARC ASSONNE. 157 VI Une dernière question. Il me semble entendre le lecteur m'interroger, avec une sorte d'angoisse, sur un point auquel l'historien de l'Église ne saurait rester étranger. L'historien ordinaire, en effet, peut croire avoir rempli toute sa mission quand il a raconté la chute des empires, ou quand il a décrit les causes des révolu tions sociales et politiques ; l'historien de l'Église a un autre devoir : il ne peut se défendre, devant une tombe qui se ferme, de penser à l'âme qui s'en est allée. Le premier s'arrête aux intérêts terrestres ; le second regarde vers les intérêts éternels. Mais si celui qui n'est plus a joué un rôle actif,alors même qu'il a été l'ennemi de l'Église, bien plus surtout quand il a combattu contre l'Église ; si Dieu lui avait donné une âme généreuse et naturellement droite ; surtout si d'autres, plus que lui, furent coupables de ses erreurs et de ses fautes; alors la pensée de l'a venir de cette âme, mêlée de tristesse et de regret, s'impose avec une force irrésistible. Quand, de nos jours, la presse nous apporte tout à coup la nouvelle qu'un de ceux-là qui se sont si gnalés par leur hostilité envers l'Église, dans la politique ou la philosophie, a paru devant son juge, n'est-il pas vrai que le sentiment chrétien éclate aussitôt par cette question pleine d'an goisse : Dans quels sentiments a-t-il paru devant son juge? Eh bien ! le vicomte Raymond-Roger reconnut-il ses fautes avant de mourir, et rendit-il à l'Église cet hommage suprême d'une vie à son terme, qui est le plus sincère, parce que, à cette heure, il est vraiment désintéressé ? Voici le récit de La Chanson: : « Le comte de Montfort tenait le vicomte prisonnier, dit-elle, il voulait le bien garder et lui donner largement tout ce qui besoin lui était ; mais ce qui doit arriver, personne ne peut s'y sous traire : le mal de dyssenterie le prit alors, à ce que je crois, du quel il lui fallut mourir ; mais avant, il voulut communier. L'èveque de Carcassonne le fit bien administrer, et il mourut la nuit suivante vers le soir. Et le comte de Montfort se conduisit alors en homme courtois et franc : il le fit exposer publiquement, afin que les gens du pays l'allassent pleurer et honorer. Là vous 158 REVUE DES QUESTIONS HISTORIQUES. auriez vu le peuple crier à haute voix. En grande procession ii fit enterrer le corps. Dieu pense à son âme, et lui soit miséricor dieux, car ce fut un bien grand malheur 1 » ! Oui, Dieu pense à l'âme de ce jeune guerrier, auquel on s'at tache, môme à six cents ans de distance. Tout fut contraste dans cette existence, sitôt brisée. Raymond-Roger n'avait que sept ans encore, quand à Sausens, dans la vicomté; soixante-trois vas saux de son père lui prêtaient serment de fidélité (mai 1191), et il mourut abandonné, seul. Il avait rêvé de créer dans le Midi une puissante monarchie féodale, avec Carcassonnepour capitale, avec la Garonne, les Pyrénées et le Rhône pour frontières, et à Carcassonne même la couronne de vicomte tomba de sa téte : son propre donjon abrita sa captivité de deux mois et vingt-cinq jours ; son premier revers fut un désastre. Élevé par un père qui ne rêvait qu'aventures guerrières et qui passa la plus grande partie de sa vie à combattre Raymond VI, son suzerain, des convenances de famille lui donnèrent pour mère une femme d'un esprit léger, souffrant trop d'être recherchée de tous les jeunes poètes, et, parmi tous, d'Arnaud de Mareuil, dans une cour brillante, où l'on ne se refusait aucune des joies de la vie, tandis que d'autres convenances de famille et l'intérêt de sa couronne de vicomte lui donnèrent pour épouse la jeune, douce, aimable et pieuse Agnès de Montpellier, de bonne heure comblée des faveurs du siège apostolique *. Après la mort de son père, placé sous la tutelle de cet homme dont les conseils ne furent qu'un calcul, Bertrand de Saissac, il fut livré, sans le bénéfice de l'expérience et de l'âge, à tous les intrigants : mais aussi il fut aimé par son vieil évêque, qui vit en lui, non pas seulement le premier de ses diocésains, mais une victime des passions et des erreurs de son temps. Soutien avoué de l'hérésie, il fut en même temps le bienfaiteur de plusieurs monastères et évôchés. Patriote et courageux, il combattait pour l'indépendance de la vicomté ; mais il ouvrit ses domaines à l'étranger, qui, vain queur, n'abandonna la conquête que pour la remettre au bras plus puissant du roi de France. Hostile à l'Église pendant sa courte vie, il se confessa et communia avant de mourir. 1 V. 918-932. * Hist. gcn. de Langued. liv. XX. LXXVI. Thalamus de Montpellier. — Eitt. gén. de Lang. éd. Privât, t. VIII, ce. 388, 397, 398, 399. zed by Google LE SIÈGE DE CARCASSONNE. 159 Cette existence de vingt-quatre ans fut une erreur, une illusion et un douleureux mécompte. Raymond-Roger fournit un exemple de cette remarque que, derrière toute faute comme derrière toute grâce, se rencontre presque toujours l'image funeste ou heureuse d'une femme. Il est aussi un exemple de cette vérité, toute remplie d'espérance, que Dieu seul reste fidèle à l'homme, malgré les fautes et malgré les erreurs, à la seule condition que l'homme tourne vers sa miséricorde un regard de repentir. Telle fut la leçon du vaincu du 16 août 1209. D'autres ensei gnements ressortirent de môme des événements subséquents, qui ont rendu si célèbres la seconde et la troisième croisade con tre les Albigeois. On ne peut oublier ni la bataille de Muret, où Pierre d'Aragon trouva la mort, et les armées vasco-aragonaises, une humiliante défaite ; ni le second siège de Toulouse, où Simon de Montfort périt frappé « là où il fallait, » par une pierre que lança la main d'une femme; ni l'expédition de Louis VIII, qui rendit effective la réunion du pays de Languedoc à la Cou ronne, et qui acheva la déroute de Thérésie néo-dualiste. • L'abbé C. Douais, des Facultés libres de Toulouse. » Digitized by Google NICOLAS V ET LA CONJURATION D'ÉTIENNE PORCARI Le complot tramé en 1453 contre le pape Nicolas V, par Étienne Porcari, n'est mentionné dans les histoires qu'incidem ment et en quelques lignes. Ce n'est pas assez. Manetti dans Vita Nicolai Vlf Vespasiano dans Commentario délia vita di Papa Niccola *, Alberti dans de Porcaria conjura' tione 3, les autres chroniques insérées par Muratori dans son Rerum italicarum Scriptores et mises à contribution par Giorgi dans sa Vita Nicolai quinti 4, avaient déjà fourni de précieuses indications. Mais on peut à présent les compléter. M. Germain a publié en 1843 une lettre inédite sur la conspiration de Porcari, reproduite par M. l'abbé Christophe dans son Histoire de la Papauté au XV0 siècle*. Plus récemment, M.Ignace Ciampi a mis au jour la chronique de Nicolas délia Tuccia, où il y a une page importante sur Porcari 6. M. le docteur Perlbach a imprimé un dialogue sur la conjuration, écrit par Pierre de Godis, juge des appels du peuple romain, et l'a fait précéder d'une notice 1 Muratori, lier. Ital. Script., t. III, part 2, p. 907. * Rer. Ital. Script., t. XXV. 3 Ibid., p 310-314 — Je n'ai pu me procurer l'ouvrage de M. 0. Raggi : La Congiura di St. Porcari contro Nicolô Papa V. Modena, 1867. 4 Romœ, 1742, in-4°, écrite sur l'ordre de Benoît XIV d'après les registres pontificaux. * Pans, 1863, 2 vol. in-8", 1. 1, p. 495. 6 Cronache di Viterbo (Firenze 1872), p. 226. Aucun des récents écrivains ne l'a citée. Digitized by Googl NICOLAS V ET LA CONJURATION D'ÉTIENNE PORCARI. 161 intéressante M. 0. Tommasini a complété ces renseignements dans un travail auquel il a joint les vers adressés à Nicolas V par Joseph Brippio au sujet de la tentative de 1453 *. Enfin M. le commandeur J. B. de Rossi ayant, dans une visite aux archives communales d'Anticoli, trouvé un document très important pour la biographie d'Étienne Porcari et l'appréciation de son carac tère, a dérobé quelques instants à ses études habituelles, pour commenter ce document et en fixer la valeur s. Le prince des archéologues romains a montré, à cette occasion, combien tous les sujets lui étaient familiers, et son écrit, comme toutes les paroles du maître, porte une vive lumière sur la tentative de Porcari. Grâce à ces publications, nous pouvons mieux appré cier son caractère politique et moral ; il apparaîtra aisément en plaçant le récit de la conspiration dans son cadre naturel, c'est-à dire dans le milieu historique du pontificat de Nicolas V. Quel était donc ce Souverain Pontife? quels étaient ses actes et ses tendances ? I Thomas Parentucelli, né très probablement à Sarzane, et non à Pise, comme on le dit communément, était fils d'un médecin qui, à l'âge de douze ans, l'envoya aux écoles de Bologne, A dix-huit ans, le jeune Thomas entra chez Rinaldo degli Albizi, un des premiers citoyens de Florence, en qualité de précepteur de ses enfants.Quatre ans après il retourna à Bologne, où il fut présenté à l'évêque Nicolas Albergati,qui le nomma sonMagister hospitii. A vingt-cinq ans, Thomas fut ordonné prêtre et lorsqu'Albergati fut nommé cardinal, en 1426, Thomas le suivit à Rome en qualité de camérier, magister domus, et ne le quitta plus. Il l'accompagna 1 Pétri de Godis, vicentini, Dyalogon de Cmjuratione Porcaria. Greifs waid, 1879, in-8» de 34 pages. M. Perlbach s'est servi d'un manuscrit de Kœnigsberg; celui du Vatican était bien meilleur; M. Tommasini en a cité des variantes ainsi que M. de Rossi. M. Tommasini indique deux mauus erits : Yatic. 3619 et 4167. * Documente relativi a Stefano Porcari, dans Archivio délia Sotieta romana di storia patria, t. III, pages 63-133, Rome, 1879. 3 Gli statuti del comune di Anticoli in Campngna, con un atto inedito di Stefano Porcari, estratto dal Periodico Studi e documenti di storia e Diritto, anno II, p. 71 (Roma 1881). t. xxxi, !«' janvier 1882. 11 162 REVUE DES QUESTIONS HISTORIQUES. dans ses nombreuses légations en France pour rétablir la paix entre les rois de France et d'Angleterre, en Italie pour apaiser les républiques de Florence et de Venise en guerre contre le roi Sigismond, en Allemagne pour calmer le schisme naissant ; admirable école des affaires pour former l'esprit d'un futur Souverain Pontife! Enfin lorsqu'Albergati fut nommé président du concile de Florence, Thomas l'accompagna encore. Le savant camaldule Ambroise Traversai i, dont les lettres sont si intéres santes pour l'histoire littéraire du xve siècle, le cite souvent avec éloge et parle de ses études, de son goût déjà développé pour les manuscrits. Le cardinal Albergati mourut le 7 mai 4443 : cinq jours après, Eugène IV conféra à Thomas de Sarzane, — nom qu il prenait tou jours, — « chanoine de Bologne, et sous-diacre du Saint-Siège, » le prieuré de Saint-Firmin à Montpellier, vacant par la mort du cardinal. Peu après Eugène IV nomma Thomas vice-chancelier, et le chargea de diverses missions à Florence, puis à Naples. Le 27 novembre 1444, il le créa évèque de Bologne, mais à peine Thomas était-il arrivé dans cette ville, qu'il fut rappelé à Rome par le Souverain Pontife. Il y vit alors j-Eneas Sylvius Piccolo mini (depuis Pie II), venu près du Pape au nom de Frédéric 111, roi des Romains, et il retourna avec lui en Allemagne. Thomas de Sarzane eut dans ce pays, conjointement avec l'évôque de Liège, avec Jean de Garvajal, auditeur de la chancellerie aposto lique et avec Nicolas deCusa, une légation importante '.Quelques mois après, Eugène IV leur envoya les pouvoirs de Légats de latere, et il nomma, le 16 décembre 1446, Thomas de Sarzane cardinal au titre de Sainte-Suzanne. Deux mois après, Eugène IV mourait, et le 6 mars 1447 Thomas, élu Souverain Pontife, prit, en souvenir de son Protecteur et ami le cardinal Nicolas Alber gati. le nom de Nicolas V. Rendre la paix à l'Église, déchirée par le schisme du Concile de Baie, qui avait nommé Amédée de Savoie antipape sous le nom de Félix V ; pacifier les princes chrétiens pour les lancer ensuite contre les Turcs qui déjà avaient posé en Europe leurs pieds victorieux; continuer le mouvement littéraire et artistique qui, depuis Martin V, avait reçu de la Papauté la plus grande 1 5 février 1446. Les pouvoirs furent renouvelés leifO mai. Je prends toutes ces dates dans Giorgi, parce que, je le repète, son ouvrage, a été rédigé par ordre de Benoît XIV, sur les pièces des archives du Vatican. Digitized by Google NICOLAS V ET LA CONJURATION D'ÉTIENNE PORCARI. 163 impulsion, telles devaient être et telles furent les vues politi ques, ou plutôt les aspirations chrétiennes du nouveau Sou verain Pontife. Il Lorsque Nicolas V monta sur le trône pontifical, le besoin suprême de la chrétienté était évidemment de terminer défini tivement le nouveau schisme, car, selon le mot de M. de Rossi, c'était une hydre toujours renaissante qui menaçait de troubler à l'état chronique l'Église et les royaumes. Martin V avait décrété l'ouverture d'un Concile dans la ville de Sienne, lorsqu'il mourut frappé d'une attaque d'apoplexie, le 19 février 1431. Eugène IV avait confirmé les actes de son prédécesseur, et, le 14 décembre 1431, le Concile, transféré à Baie, avait tenu sa première session 1. Ce Concile, réuni pour éteindre l'hérésie des Hussites et pro céder à la réforme du clergé, ne vécut qu'au milieu des conflits incessamment suscités par l'esprit de discorde de la majorité des prélats. Il devint un conciliabule, dont Eugène IV fut obligé de casser les actes, en ordonnant le transfert de l'as semblée à Ferrare (18 septembre 1437), puis à Florence *. L'assemblée avait déclaré Eugène IV déchu du Souverain Ponti ficat, et le duc de Savoie, Amédée, Pape, sous le nom de Félix V (5 novembre 1439). Le schisme durait encore, lorsque Eugène IV vint à mourir (23 février 1447). Nicolas V était au courant des affaires et des difficultés du temps : il venait d'être mêlé aux négociations pour les concor dats de Francfort, signés les 5 et 7 février 1447 par Eugène IV, déjà mourant, mais heureux d'avoir vu, avant sa mort, le triomphe de l'Église et le retour des Allemands à l'obéissance du Saint-Siège 3. Le Souverain Pontife, qui avait d'abord résisté aux 1 Pour les Conciles de Sienne et de Bâle, il y a aujourd'hui une source féconde de documenta jusqu'alors ignorés, dans Monumenta Conciliorum generalium sxculi XV, édités par MM. Palacky et Birk, publiés par l' Aca démie Imper, des sciences à Vi« nne. 1857. Cf. Mgr. Uefelé, Histoire des Conciles, trad. de M. l'abbé Delarc, t. XI, pctssim. * Des documents nouveaux ont été publiés par le chanoine Cecconi : Studi stortci sul ccncilio di Firenze. Florence, 1869. 3 Pour l'histoire des Concordats, voir Analecta monumentorum omnis <evi Windobonensia, parKollar, t. II, p. 120 et suiv. Dans son Salvatorium (5 fév. 164 REVUE DES QUESTIONS HISTORIQUES. demandes du roi des Romains et des princes allemands avait fini par céder. « La considération du bien de l'Église, » disait-il, « nous a pour ainsi dire forcé de céder aux instances qui nous étaient faites, » Dès le jour de son élection, Nicolas V promit d'observer fidè lement les concordats, et, le 28 mars 1447, il en renouvela solennellement l'assurance. Le 17 février 1448, le représentant du Pape signait un nouveau concordat, connu sous le nom de concordat d'Aschaflenbourg, parce que les négociations avaient été d'abord engagées dans cette ville. Cependant l'anti-pape ne désarmait pas, et Félix V somma Nicolas V de résigner le plus tôt possible la dignité pontificale. Mais Tefiet des concordats avait été de donner, en la personne de Frédéric III, un défenseur à l'Église. Frédéric ordonna, le 20 juillet 1447, au bourgmestre de Baie de supprimer les sauf conduits accordés aux membres de l'assemblée tenue dans cette ville, ordre qui dut être répété trois fois, avant que les Pères se retirassent à Lausanne. Grâce aussi à la médiation du roi de France Charles VII, la paix se fit, et Félix V se déclara prêt à abdiquer la dignité pontificale. Le cœur généreux de Nicolas V en tressaillit de bonheur : il leva, par une bulle du 18 janvier 1449, toutes les excommunications portées contre Félix, les Pères du Concile et leurs adhérents. Le 7 avril, Félix ayant signé l'acte d'obéissance, le Pape le nomma cardinal évôque de Sainte Sabine, son Légat et vicaire perpétuel ; le 18 juin, il confirma toutes les promotions faites par Félix V et le Concile, et alla môme jusqu'à ordonner à tous ceux qui avaient été investis par Eugène IV de bénéfices ayant appartenu à des Pères du Concile, de les abandonner. Le Pape conclut encore un arrangement spécial avec les cardinaux créés par Félix V, et éleva au car dinalat trois d'entre eux. Ainsi la politique de Nicolas V fut en cette circonstance une politique ferme sur les principes, conci liante presque jusqu'à l'extrême sur tout ce qui n'était pas indis pensable : c'est la politique des Souverains Pontifes. Nicolas V la suivit avec Frédéric III au sujet des concordats, avec Félix V au sujet du schisme ; il n'en eut pas d'autre dans ses rapports avec les États temporels de l'Église. 1447) Eugène IV disait que la considération du bien de l'Église l'avait pour ainsi dire forcé de céder aux instances du roi des Romains. Voir aussi Koch, Sanctiopragmatica, p. 181 et 201. Digitized by Googl NICOLAS V ET LA CONJURATION D'ÉTIENNE PORCAR1. 165 Nicolas V voulait pacifier, et pour mieux pacifier, il fit des concessions et proclama des amnisties. II pardonna aux Colonna, et leur restitua les biens confisqués après leur rébellion l. Il par donna aux Savelli * et aux Orsini 8 ; il imposa une trêve entre Sforza et Malatesta *, confirma les droits et privilèges du sénat de Rome *, des municipalités de Fermo 6 et de Camerino 7, etc. c Son gouvernement est paternel, > écrit Joseph Bripio, « pour quoi donc rechercher avec anxiété la liberté des anciens? La liberté dont tu jouis, ô peuple ignorant, te paraît-elle donc si petite ? Parcours toutes les villes d'Italie, tu n'en trouveras assu rément aucune, crois-moi, où l'on ait plus de liberté qu'à Rome; aucun pays ne paye moins d'impôt; dans aucun pays la justice n'est mieux rendue •, » et il parle du bon gouvernement et de la paix qui de pauvre a fait devenir le peuple riche. — « Sous ce pontificat, * écrit également Pierre de Godis, « tous les Ro mains ont joui de la paix, de la liberté, ont été exempts de col lectes, de dîmes, de charges : personne ne se souvient d'avoir vu à Rome plus d'aisance et de richesses que maintenant. Depuis cinq cents ans, il n'y a pas eu tant d'habits de soie, de bijoux ; la cour romaine dépense chaque jour mille ducats dont la plus grande partie est employée à des travaux utiles pour Rome 9. » Nicolas V chercha surtout à apaiser les discordes des princes et à concilier leurs prétentions rivales. Lorsqu'à son avènement les ambassadeurs de Venise, de Milan, de Florence, etc., lui demandèrent d'entrer en ligue avec eux, il répondit ne désirer ni ligue, ni guerre avec personne, et ne vouloir se servir que de la ' Petrini, Memorie Prenestine, p. 457. Coppi, Afemorie Colonnesie, Roma, 1855, p. 236. * Theiner, Codex dîplomaticus dominii temporalis S. Sedis, t. III, p. 316. 3 Ibid. * Canestrini, Arrh. stor. ital , t. XVI, p. 591. * Giorgi, Vita, p. 39. •Ibid. 7 Ibid. 8 Edit. Tommasini, p. 118, vers 199.
| 15,157 |
https://github.com/robloxbloxxer50/roleplay-bot/blob/master/cmds/replyHandler.js
|
Github Open Source
|
Open Source
|
MIT
| null |
roleplay-bot
|
robloxbloxxer50
|
JavaScript
|
Code
| 1,163 | 3,111 |
//replyHandler.js
//The script that handles replying to slash commands.
//Also handles some console output.
const { MessageEmbed } = require("discord.js")
const errorColor = "#ff0000"
const successColor = "#00ff00"
//HELP EMBED
const info = (user) => {
return new MessageEmbed()
.setTitle("Info Menu/Command List")
.setDescription("Welcome to the info menu! This menu shows every command that you can run for this bot, along with some other stuff.")
.addField("/createcharacter", "Creates a character with a name and a description.")
.addField("/editcharacter", "Allows you to edit a characters name, description and/or image.")
.addField("/deletecharacter", "Deletes a character that has the given name.")
.addField("/viewcharacter", "Views a character owned by the user given")
.addField("/listcharacters", "Lists all your character's by names only.")
.addField("__Other Stuff__", "**GitHub Page:**\nhttps://github.com/robloxbloxxer50/roleplay-bot\n\n**Private Characters**\nPrivate Characters are characters that only you can use /viewcharacter on and only come up in a character list when you run /listcharacters.")
.setColor("ffff00")
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Function to make footer text cuz im lazy
function footerText(user) {
return "Bot made by Bloxxer#8729"
}
//Mongo disconnect log
const mongoDisconnect = (user, userid, guild, guildid) => {
console.log("------------------------------\nDisconnected from Mongo:\n>>user.tag: " + user + " (" + userid + ")\n>>Guild: " + guild + " (" + guildid + ")\n------------------------------")
}
//Mongo connect log
const mongoConnect = (user, userid, guild, guildid) => {
console.log("------------------------------\nConnected to Mongo:\n>>User: " + user + " (" + userid + ")\n>>Guild: " + guild + " (" + guildid + ")\n------------------------------")
}
//Mongo error log
const mongoError = (user, userid, guild, guildid, err) => {
console.warn("------------------------------\nMongo Error:\n>>User: " + user + " (" + userid + ")\n>>Guild: " + guild + " (" + guildid + ")\n>>Error: " + err + "\n------------------------------")
}
//Mongo Error Reply
const mongoErrorReply = (user, err) => {
return new MessageEmbed()
.setTitle("A MongoDB Error Occured!")
.setDescription("Please send this to Bloxxer#8729:\n```js\n" + err + "\n```")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Character Already Exists
const characterExists = (charName, user) => {
return new MessageEmbed()
.setTitle("Character Already Exists!")
.setDescription("The character named **" + charName + "** already exists!")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Character Doesnt Exist
const characterDoesntExist = (charName, user) => {
return new MessageEmbed()
.setTitle("Character Doesn't Exist!")
.setDescription("Could not find the character named **" + charName + "** in the bot's database. Please make a character with this name first. If you believe this is a glitch/error, please contact Bloxxer#8729.")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Successfully Created Character
const characterCreated = (charName, user) => {
return new MessageEmbed()
.setTitle("Character Successfully Created!")
.setDescription("Your character **" + charName + "** has been successfully saved in the database.")
.setColor(successColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Error in Creating Character
const characterCreateError = (charName, user, err) => {
return new MessageEmbed()
.setTitle("Character Creation Error!")
.setDescription("An error has occured trying to create the character named **" + charName + "**. Please send this error to Bloxxer#8729:\n```js\n" + err + "\n```")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Successfully Modified Character
const characterModified = (charName, user) => {
return new MessageEmbed()
.setTitle("Character Successfully Modified!")
.setDescription("Your character **" + charName + "** has been successfuly updated!")
.setColor(successColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Error in Modifying Character
const characterModifyError = (charName, user, err) => {
return new MessageEmbed()
.setTitle("Character Modification Error!")
.setDescription("An error has occured trying to modify the character named **" + charName + "**. Please send this error to Bloxxer#8729:\n```js\n" + err + "\n```")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Successfully Deleted Character
const characterDeleted = (charName, user) => {
return new MessageEmbed()
.setTitle("Character Successfuly Deleted!")
.setDescription("Your character **" + charName + "** was successfully removed from the database.")
.setColor(successColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Error in Deleting Character
const characterDeleteError = (charName, user, err) => {
return new MessageEmbed()
.setTitle("Character Deletion Error!")
.setDescription("There was an error while trying to delete your character named **" + charName + "**. Please send this error to Bloxxer#8729:\n```js\n" + err + "\n```")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//View Character output
const viewCharacter = (charName, charDesc, charImg, color, user) => {
if (charImg) {
return new MessageEmbed()
.setTitle(charName)
.setDescription(charDesc)
.setImage(charImg)
.setColor(color)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
} else {
return new MessageEmbed()
.setTitle(charName)
.setDescription(charDesc)
.setColor(color)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
}
//View Character Error
const viewCharacterError = (charName, user, err) => {
return new MessageEmbed()
.setTitle("Error in Viewing Character!")
.setDescription("There was an error while trying to view the character named **" + charName + "**. Please send this error to Bloxxer#8729:\n```js\n" + err + "\n```")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//List Character Output
const listCharacters = (array, user, showPrivate) => {
var embed = new MessageEmbed()
.setTitle("Character List")
.setColor(successColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
for (var att in array) {
//Handling private characters.
if (array[att].isPrivate && user.id != array[att].ownerId) {
if (!array[att].isPrivate) {
var i = array[att].img
if (!i) {
i = "None"
}
embed.addField(array[att].name, "Color: " + array[att].color + "\nImage URL: " + i + "\nPrivate: " + array[att].isPrivate)
}
} else if (array[att].isPrivate && user.id == array[att].ownerId && showPrivate) {
var i = array[att].img
if (!i) {
i = "None"
}
embed.addField(array[att].name, "Color: " + array[att].color + "\nImage URL: " + i + "\nPrivate: " + array[att].isPrivate)
} else if (array[att].isPrivate && user.id == array[att].ownerId && !showPrivate) {
if (!array[att].isPrivate) {
var i = array[att].img
if (!i) {
i = "None"
}
embed.addField(array[att].name, "Color: " + array[att].color + "\nImage URL: " + i + "\nPrivate: " + array[att].isPrivate)
}
} else if (!array[att].isPrivate) {
var i = array[att].img
if (!i) {
i = "None"
}
embed.addField(array[att].name, "Color: " + array[att].color + "\nImage URL: " + i + "\nPrivate: " + array[att].isPrivate)
}
}
return embed
}
//List Character Error
const listCharacterError = (user, err) => {
return new MessageEmbed()
.setTitle("Error in Listing Characters!")
.setDescription("There was an error while trying to list your characters. If there is an error below, please send it to Bloxxer#8729:\n```js\n" + err + "\n```")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//No Characters Exist
const noCharacters = (user) => {
return new MessageEmbed()
.setTitle("You or the selected user doesn't have any characters!")
.setDescription("You/this person doesn't have any characters yet! Make some with ``/makecharacter``! If you believe this is an error, please send a DM to Bloxxer#8729.")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Access Denied to Private Character
const characterIsPrivate = (charName, user) => {
return new MessageEmbed()
.setTitle("This character is private.")
.setDescription("The character **" + charName + "** is a private character that is not owned by you. Please ask the owner of this character to run the same command. If you believe this is an error, please DM Bloxxer#8729.")
.setColor(errorColor)
.setFooter(footerText(user.tag), user.avatarURL({ dynamic: true }))
}
//Exporting functions
exports.info = info
exports.mongoDisconnect = mongoDisconnect
exports.mongoConnect = mongoConnect
exports.mongoError = mongoError
exports.mongoErrorReply = mongoErrorReply
exports.characterExists = characterExists
exports.characterDoesntExist = characterDoesntExist
exports.characterCreated = characterCreated
exports.characterCreateError = characterCreateError
exports.characterModified = characterModified
exports.characterModifyError = characterModifyError
exports.characterDeleted = characterDeleted
exports.characterDeleteError = characterDeleteError
exports.viewCharacter = viewCharacter
exports.viewCharacterError = viewCharacterError
exports.listCharacters = listCharacters
exports.listCharacterError = listCharacterError
exports.noCharacters = noCharacters
exports.characterIsPrivate = characterIsPrivate
| 5,615 |
https://github.com/WuyangPeng/Engine/blob/master/EngineTesting/Code/Mathematics/MathematicsTesting/ApproximationSuite/HeightPlaneFit3Testing.cpp
|
Github Open Source
|
Open Source
|
BSD-3-Clause
| 2,023 |
Engine
|
WuyangPeng
|
C++
|
Code
| 200 | 903 |
/// Copyright (c) 2010-2023
/// Threading Core Render Engine
///
/// 作者：彭武阳，彭晔恩，彭晔泽
/// 联系作者：[email protected]
///
/// 标准：std:c++20
/// 引擎测试版本：0.9.0.12 (2023/06/09 15:17)
#include "HeightPlaneFit3Testing.h"
#include "CoreTools/Helper/AssertMacro.h"
#include "CoreTools/Helper/ClassInvariant/MathematicsClassInvariantMacro.h"
#include "CoreTools/UnitTestSuite/UnitTestDetail.h"
#include "Mathematics/Algebra/Vector2ToolsDetail.h"
#include "Mathematics/Approximation/HeightPlaneFit3Detail.h"
#include <random>
namespace Mathematics
{
template class HeightPlaneFit3<float>;
template class HeightPlaneFit3<double>;
}
Mathematics::HeightPlaneFit3Testing::HeightPlaneFit3Testing(const OStreamShared& streamShared)
: ParentType{ streamShared }
{
MATHEMATICS_SELF_CLASS_IS_VALID_1;
}
CLASS_INVARIANT_PARENT_IS_VALID_DEFINE(Mathematics, HeightPlaneFit3Testing)
void Mathematics::HeightPlaneFit3Testing::DoRunUnitTest()
{
ASSERT_NOT_THROW_EXCEPTION_0(MainTest);
}
void Mathematics::HeightPlaneFit3Testing::MainTest()
{
ASSERT_NOT_THROW_EXCEPTION_0(FitTest);
}
void Mathematics::HeightPlaneFit3Testing::FitTest()
{
std::default_random_engine generator{ GetEngineRandomSeed() };
const std::uniform_real<double> randomDistribution0(-100.0, 100.0);
const std::uniform_int<> randomDistribution1(10, 50);
const auto aTestLoopCount = GetTestLoopCount();
for (auto loop = 0; loop < aTestLoopCount; ++loop)
{
std::vector<Vector3D> vertices;
const int size = randomDistribution1(generator);
for (int i = 0; i < size; ++i)
{
vertices.emplace_back(randomDistribution0(generator), randomDistribution0(generator), randomDistribution0(generator));
}
const HeightPlaneFit3D heightPlaneFit3(vertices);
double sumX = 0.0;
double sumY = 0.0;
double sumZ = 0.0;
double sumXX = 0.0;
double sumXY = 0.0;
double sumXZ = 0.0;
double sumYY = 0.0;
double sumYZ = 0.0;
for (int i = 0; i < size; ++i)
{
sumX += vertices.at(i)[0];
sumY += vertices.at(i)[1];
sumZ += vertices.at(i)[2];
sumXX += vertices.at(i)[0] * vertices.at(i)[0];
sumXY += vertices.at(i)[0] * vertices.at(i)[1];
sumXZ += vertices.at(i)[0] * vertices.at(i)[2];
sumYY += vertices.at(i)[1] * vertices.at(i)[1];
sumYZ += vertices.at(i)[1] * vertices.at(i)[2];
}
}
}
| 21,489 |
https://openalex.org/W2224655618
|
OpenAlex
|
Open Science
|
CC-By
| 2,015 |
Comparison of brief interventions in primary care on smoking and excessive alcohol consumption: a population survey in England
|
Jamie Brown
|
English
|
Spoken
| 7,728 | 14,655 |
Copyright: © British Journal of General Practice 2016. This is an Open Access article distributed under the terms of
the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), which permits
unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly
cited. Brown J, West R, Angus C, Beard E, Brennan A, Drummond C, Hickman M,
Holmes J, Kaner E, Michie S.
Comparison of brief interventions in primary care on smoking and excessive
alcohol consumption: a population survey in England.
British Journal of General Practice 2016, 66(642), E1-E9. Brown J, West R, Angus C, Beard E, Brennan A, Drummond C, Hickman M,
Holmes J, Kaner E, Michie S. Comparison of brief interventions in primary care on smoking and excessive
alcohol consumption: a population survey in England. British Journal of General Practice 2016, 66(642), E1-E9. http://dx.doi.org/10.3399/bjgp16X683149 http://dx.doi.org/10.3399/bjgp16X683149 DOI link to article: http://dx.doi.org/10.3399/bjgp16X683149 Research Research Jamie Brown, Robert West, Colin Angus, Emma Beard, Alan Brennan, Colin Drummond,
Matthew Hickman, John Holmes, Eileen Kaner and Susan Michie Method Recall of brief interventions on smoking and
alcohol use, sociodemographic information, and
smoking and alcohol consumption patterns were
assessed among smokers and those who drink
excessively (AUDIT score of ≥8), who visited their
GP surgery in the previous year. There are several possible reasons for the
difference between alcohol and smoking19–25
but one may be differences in financial
incentives: there are substantial incentives
to intervene on smoking in GP surgeries
but less substantial opt-in arrangements
for alcohol consumption.26 Specifically,
GPs receive payments for recording the
delivery of cessation advice through the
primary incentivisation system for GPs
in England, the Quality and Outcomes
Framework (QOF).14,27,28 By contrast, QOF
indicators do not currently cover unselected
screening and brief intervention for Brief intervention in primary care to
help patients reduce excessive alcohol
consumption also appears to be an effective
and cost-effective measure.8–10 Such
intervention requires screening individuals
initially, and then providing those whose
consumption is identified as high risk with
structured brief advice or an extended brief
intervention, and referring to specialist
treatment services those identified to
be at risk of dependent drinking.8,11 Background Background
Brief interventions have a modest but meaningful
effect on promoting smoking cessation and
reducing excessive alcohol consumption. Guidelines recommend offering such advice
opportunistically and regularly but incentives vary
between the two behaviours. Analyses of primary care databases
indicate that the delivery of brief
interventions for smoking may be relatively
common: approximately 50% of smokers
received advice in 2009.13,14 In contrast,
previous assessments have suggested
that clinicians rarely undertake screening
and brief intervention to reduce excessive
drinking.15–17 For example, an analysis of
the General Practice Research Database
indicated that GPs in England identified only
an estimated 2% of patients who consumed
alcohol excessively in 2003.18 Aim To use representative data from the perspective
of patients to compare the prevalence and
characteristics of people who smoke or drink
excessively and who receive a brief intervention. Date deposited: Newcastle University ePrints - eprint.ncl.ac.uk Comparison of brief interventions in primary care
on smoking and excessive alcohol consumption: a population survey in England PhD, professor of public health & primary
care research, Institute of Health and Society,
Newcastle University, Newcastle upon Tyne.
Address for correspondence
Jamie Brown, Health Behaviour Research Centre,
Department of Epidemiology and Public Health,
University College London, 1–19 Torrington Place,
London WC1E 6BT.
E-mail: [email protected]
Submitted: 3 February 2015; Editor’s response:
23 March 2015; final acceptance: 28 April 2015.
©British Journal of General Practice
This is the full-length article (published online
31 Dec 2015) of an abridged version published in
print. Cite this article as: Br J Gen Pract 2016;
DOI: 10.3399/bjgp16X683149 Results Of 1775 smokers, 50.4% recalled receiving brief
advice on smoking in the previous year. Smokers
receiving advice compared with those who did
not were more likely to be older (odds ratio
[OR] 17-year increments 1.19, 95% confidence
interval [CI] =1.06 to 1.34), female (OR 1.35, 95%
CI =1.10 to 1.65), have a disability (OR 1.44, 95%
CI = 1.11 to 1.88), have made more quit attempts
in the previous year (compared with no attempts:
one attempt, OR 1.65, 95% CI = 1.32 to 2.08; ≥2
attempts, OR 2.02, 95% CI =1.49 to 2.74), and have
greater nicotine dependence (OR 1.17, 95% CI
=1.05 to 1.31) but were less likely to have no post-
16 qualifications (OR 0.81, 95% CI = 0.66 to 1.00). Of 1110 people drinking excessively, 6.5% recalled
receiving advice in their GP surgery on their
alcohol consumption in the previous year. Those
receiving advice compared with those who did not
had higher AUDIT scores (OR 1.17, 95% CI =1.12
to 1.23) and were less likely to be female (OR 0.44,
95% CI = 0.23 to 0.87). PhD, professor of public health & primary
care research, Institute of Health and Society,
Newcastle University, Newcastle upon Tyne. Address for correspondence
Jamie Brown, Health Behaviour Research Centre,
Department of Epidemiology and Public Health,
University College London, 1–19 Torrington Place,
London WC1E 6BT. E-mail: [email protected]
Submitted: 3 February 2015; Editor’s response:
23 March 2015; final acceptance: 28 April 2015. ©British Journal of General Practice
This is the full-length article (published online
31 Dec 2015) of an abridged version published in
print. Cite this article as: Br J Gen Pract 2016;
DOI: 10.3399/bjgp16X683149 J Brown, PhD, SSA, senior research fellow;
R West, PhD, professor of health psychology,
Health Behaviour Research Centre; E Beard, PhD,
research associate; S Michie, DPhil, professor
of health psychology, Department of Clinical,
Educational and Health Psychology, University
College London, London. C Angus, MSc, research
fellow; A Brennan, PhD, professor of health
economics and decision modelling; J Holmes,
PhD, senior research fellow, School of Health
and Related Research, University of Sheffield,
Sheffield. C Drummond, MD, professor of addiction
psychiatry, Institute of Psychiatry, Psychology and
Neuroscience, King’s College London, London. M Hickman, PhD, professor in public health and
epidemiology, School of Social and Community
Medicine, University of Bristol, Bristol. Abstract INTRODUCTION
Reducing the burden of tobacco smoking
and excessive alcohol use is a public
health priority1–3 that could be addressed
by increasing the rate at which health
professionals intervene opportunistically. Brief intervention to help patients stop
smoking is an effective and cost-effective
intervention.4–6 In the UK, the traditional
model involves asking patients about their
smoking, advising them to stop, and offering
assistance in the form of a prescription
for a pharmacological cessation aid or a
referral to the NHS Stop Smoking Service.7
Guidelines from the National Institute
for Health and Care Excellence (NICE)
recommend that GPs assess the smoking
status of patients at least once a year, advise
smokers to stop, and record smoking status
and any advice given.5 Results E Kaner, J Brown, PhD, SSA, senior research fellow;
R West, PhD, professor of health psychology,
Health Behaviour Research Centre; E Beard, PhD,
research associate; S Michie, DPhil, professor
of health psychology, Department of Clinical,
Educational and Health Psychology, University
College London, London. C Angus, MSc, research
fellow; A Brennan, PhD, professor of health
economics and decision modelling; J Holmes,
PhD, senior research fellow, School of Health
and Related Research, University of Sheffield,
Sheffield. C Drummond, MD, professor of addiction
psychiatry, Institute of Psychiatry, Psychology and
Neuroscience, King’s College London, London. M Hickman, PhD, professor in public health and
epidemiology, School of Social and Community
Medicine, University of Bristol, Bristol. E Kaner, Design and setting Data was from a representative sample of 15 252
adults from household surveys in England. Conclusion E-mail: [email protected]
Submitted: 3 February 2015; Editor’s response:
23 March 2015; final acceptance: 28 April 2015. Whereas approximately half of smokers in
England visiting their GP in the past year report
having received advice on cessation, <10% of
those who drink excessively report having received
advice on their alcohol consumption. ©British Journal of General Practice a population survey in England Implementation of screening and brief
intervention in primary care across England
has been advocated by NICE in recent UK
guidance.12 How this fits in Guidelines recommend intervening on both
smoking and alcohol use opportunistically
on a regular basis. In practice, analyses
of GP recording databases indicate that
a brief intervention on smoking is much
more common than on alcohol. However,
recent evidence suggests that the QOF
incentives to promote intervention on
smoking may have made the estimates
for delivery based on recording databases
somewhat unreliable. Therefore, this study
used up-to-date and representative data
from the perspective of patients to assess
the prevalence of people who smoke or
drink excessively, and who receive a brief
intervention. This study confirmed that
intervention on smoking appeared much
more common than on alcohol: whereas
approximately half of smokers in England
visiting their GP in the previous year
reported having received advice on smoking
cessation, <10% of those who drink
excessively reported having received advice
on their alcohol consumption. In view of the
substantial QOF incentives for the delivery
of smoking brief interventions and the less
substantial opt-in arrangements for alcohol
brief interventions, this study adds to the
evidence suggesting that more substantial
incentives would be associated with greater
delivery of a brief intervention. The aim of this study was to use
up-to-date and representative data from
the perspective of patients to assess the
prevalence and characteristics of people
who smoke or drink excessively, and who
receive a brief intervention. excessive alcohol use,29 despite evidence
that financial incentives can be effective
in improving the delivery of screening and
brief intervention.17,30–32 There is concern
that this represents an important missed
opportunity to reduce alcohol-related
health harms at a population level.33
Beyond the QOF, there is a small financial
incentive for using a validated tool to screen
newly-registered patients.34,35 However, it
is not part of the mandatory contract for
performance management and, instead,
practices have to opt in to offering an
alcohol Directed Enhanced Service (DES)
to claim the payment. Combined with
the low level of remuneration and poor
monitoring of outcomes, the result appears
to be that the DES has had little effect on
clinical behaviour.17,36 For example, among
75% of newly registered patients between
2007 and 2009 who had entries for alcohol
consumption on a primary care database,
only 9% were recorded as completing a
validated screening questionnaire despite
this financial incentive29 and NICE guidance
to screen newly registered patients. Keywords alcohol drinking; brief advice; brief intervention;
counselling; smoking. alcohol drinking; brief advice; brief intervention;
counselling; smoking. e1 British Journal of General Practice, January 2016 Thus, there appears to be a large
difference based on primary care databases
between the delivery of brief intervention
for smoking and alcohol,13,14,18 which may
relate to the substantial financial incentives
for smoking brief intervention but less
substantial opt-in arrangements for
alcohol.26 However, it is possible that figures
derived from GP recording overestimate
the delivery of smoking brief interventions
because it is the recording rather than
the ‘doing’ that is incentivised. Prior to the
introduction of QOF incentives, there was a
good correspondence between the rate of
recording of GP advice and the proportion
of patients recalling advice in the national
Primary Care Trust Patient Surveys; since
their introduction in 2004, however, the rate
of recording has exceeded that of patient
recall.13 The most recent estimate from
the Primary Care Trust Patient Surveys is
that 40% of smokers received cessation
advice; however, this is of limited use as
it represents a self-selected sample of
patients who chose to return the survey. Estimates regarding the delivery of alcohol
brief intervention are also likely to be
inaccurate because they are often based
on the rate at which GPs record screening,
rather than conduct a brief intervention. British Journal of General Practice, January 2016 e2 How this fits in Locally
Enhanced Services can offer moderately
increased financial incentives and this may
explain some of the regional variation in
screening that has been identified.29 excessive alcohol use,29 despite evidence
that financial incentives can be effective
in improving the delivery of screening and
brief intervention.17,30–32 There is concern
that this represents an important missed
opportunity to reduce alcohol-related
health harms at a population level.33
Beyond the QOF, there is a small financial
incentive for using a validated tool to screen
newly-registered patients.34,35 However, it
is not part of the mandatory contract for
performance management and, instead,
practices have to opt in to offering an
alcohol Directed Enhanced Service (DES)
to claim the payment. Combined with
the low level of remuneration and poor
monitoring of outcomes, the result appears
to be that the DES has had little effect on
clinical behaviour.17,36 For example, among
75% of newly registered patients between
2007 and 2009 who had entries for alcohol
consumption on a primary care database,
only 9% were recorded as completing a
validated screening questionnaire despite
this financial incentive29 and NICE guidance
to screen newly registered patients. Locally
Enhanced Services can offer moderately
increased financial incentives and this may
explain some of the regional variation in
screening that has been identified.29 e3 British Journal of General Practice, January 2016 Study population
Th
t d
d Weighted data were only used to estimate
the delivery of alcohol and smoking brief
interventions. Data were weighted using
the rim (marginal) weighting technique to
match an English population profile on the
dimensions of age, social grade, region,
tenure, ethnicity, and working status within
sex. The dimensions were derived from the
English 2011 census, Office for National
Statistics 2013 mid-year estimates,41,42 and
a random probability survey conducted in
2014 for the National Readership Survey
(general details of the methodology of this
survey are available elsewhere).43 The study used aggregated data from
responders, in the period from March 2014
to November 2014, who reported visiting
their GP surgery in the previous year and
either: • smoked cigarettes or any other tobacco
product daily or occasionally at the time
of the survey or during the preceding
6 months; or • smoked cigarettes or any other tobacco
product daily or occasionally at the time
of the survey or during the preceding
6 months; or • drank alcohol excessively in the previous
6 months, indicated by a score of ≥8 on
the Alcohol Use Disorders Identification
Test (AUDIT).39 • drank alcohol excessively in the previous
6 months, indicated by a score of ≥8 on
the Alcohol Use Disorders Identification
Test (AUDIT).39 The rim weighting was conducted in
SPSS Quantum (version 5.8) and involved an
iterative sequence of adjustments whereby a
weight was applied to each responder such
that the sample matched specified targets
on a first dimension. In the next step, the
data were then readjusted by an algorithm
that sought to match the sample to a second
dimension, while minimising distortion; this
continued until the final dimension had been
matched. This process was iterated until
there was a good fit across the dimensions
(indicated by the sum of root mean square
differences between the sample and the
specification across the dimensions being
<0.005 multiplied by the overall unweighted
sample size). More details on this method
are available elsewhere.44,45 • disability. Among smokers, past-year quit attempts
and nicotine dependence (strength and time
with urges to smoke40) were also assessed. METHOD
Study design
D t
l Data were collected using cross-sectional
household
surveys
of
representative
samples of the population of adults in
England, conducted monthly between March
2014 and November 2014. The surveys
are part of the ongoing Smoking Toolkit
Study and Alcohol Toolkit Study, which are
designed to provide tracking information
about smoking, alcohol consumption, and
related behaviours in England.37,38 Each
month a new sample of approximately 1800
adults aged ≥16 years complete a face-to-
face computer-assisted survey. The sampling is a hybrid between random
probability and simple quota. The first stage
is to split England into 171 356 areas (each
comprising approximately 300 households),
stratified according to a geodemographic
analysis of the population. Areas are then
randomly allocated to interviewers, who
conduct interviews within that area until
the quota based on the probability of being
at home is fulfilled. The method is superior n Central: East Midlands, West Midlands,
and east of England; or to conventional quota sampling — where
interviewers can select non-randomly from
the whole population to meet quotas —
because the output areas are randomly
allocated and the scope for bias is limited
to the choice of properties to approach non-
randomly within the small output areas. n South: London, south east, and south
west); • receipt
of
a
post-16
educational
qualification; • children in the household; A response rate cannot be calculated
because there is no definite gross sample,
with units fulfilling the criteria of the quota
being interchangeable. The sampling
method has been shown to result in a
sample that is nationally representative in
its sociodemographic composition.37 • ethnicity; and • disability. Measures Recall of smoking brief intervention
among smokers and recall of alcohol
brief intervention among people drinking
excessively was assessed for the previous
12 months (a list of response items is
available from the authors on request). Each group was separately classified into
those who reported receiving at least a brief
intervention (that is, including those who
received a brief intervention followed by
more intensive support), and those who did
not. Responders were also asked questions
that determined their: To examine the associations with
patient characteristics, a series of
univariable logistic regression models
were constructed in which the receipt of a
smoking brief intervention was regressed
separately onto each patient characteristic. To examine the independent association
after mutual adjustment, a multivariable
logistic regression model was constructed
including all patient characteristics and the
month of survey. The patient characteristics
entered in the univariable and multivariable
models included the following dichotimised
variables: • occupation-based
classification
of
socioeconomic status (‘social grade’): • occupation-based
classification
of
socioeconomic status (‘social grade’): n ABC1:
higher
and
intermediate
professional/managerial
and
supervisory, clerical, junior managerial/
administrative/professional; or n C2DE: skilled, semi-skilled, unskilled
manual, and lowest-grade workers or
unemployed); • region in England: • region in England: n North: the north east, north west, and
Yorkshire and the Humber; • sex;
• social grade;
• post-16 qualifications;
• children in the household;
• white ethnicity;
• disability; and (12.4%) were drinking excessively. A total
of 1889 (62.1%) smokers and 1116 (58.9%)
people who drank excessively also reported
visiting their GP; 1775 (94.0%) and 1110
(99.5%) respectively also had complete data
on all relevant variables. • sex; • social grade; • post-16 qualifications; • children in the household; • white ethnicity; Of the unweighted sample of 1775, 925
(52.1%) smokers who visited their GP recalled
having received a brief intervention for
smoking. The weighted estimate was 50.4%
(95% confidence interval [CI] = 48.0 to 52.8). Table 1 presents the associations between
smoking, drinking, and sociodemographic
characteristics and the receipt of a smoking
brief intervention. • strength of urges to smoke. • strength of urges to smoke. The linearity of the relationship between
each continuous independent variable and
the logit transformation of the dependent
variable was indicated by the Box–Tidwell
approach.46 This involved testing whether
there was a significant interaction between
the variable and its log transformation. There was a non-linear relationship with
the number of past-year quit attempts,
which was transformed into a categorical
variable with 0 as the reference compared
with one attempt, or ≥2 attempts. After mutual adjustment in a multivariable
analysis, those receiving an intervention were
more likely, than those who did not receive
one, to be older (OR 1.19, 95% CI = 1.06 to
1.34), female (OR 1.35, 95% CI = 1.10 to 1.65),
have a disability (OR 1.44, 95% CI = 1.11 to
1.88), to have made more quit attempts
in the previous year (compared with no
attempts: one attempt, OR 1.65, 95%
CI = 1.32 to 2.08; ≥2 attempts, OR 2.02,
95% CI = 1.49 to 2.74), have greater nicotine
dependence (time with urges to smoke OR
1.17, 95% CI = 1.05 to 1.31), and were less
likely to have no post- 16 qualifications (OR
0.81, 95% CI = 0.66 to 1.00). Similar
analyses
were
repeated
to
examine
the
univariable
and
multivariable
associations
between
patient characteristics and the receipt
of an alcohol brief intervention. Slightly
different characteristics were examined to
reflect that drinkers rather than smokers
were under analysis. The characteristics
assessed were the same except that
excessive drinking, past-year quit attempts,
time with urges to smoke, and strength of
urges to smoke were excluded — instead,
the continuous variable AUDIT score was
included (since only those scoring ≥8 were
used in this analysis), and smoking status
was included as a categorical variable with
‘never smoker’ as the reference compared
with ‘ex-smoker’ or ‘current smoker’. There was no evidence of a non-linear
relationship with either of the continuous
variables included in this analysis. Of the unweighted sample of 1110, 76
(6.8%) people who drank excessively and
visited their GP recalled having received
an alcohol brief intervention; the weighted
estimate was 6.5% (95% CI = 5.1 to 7.9). Table 2 presents the associations between
drinking,
smoking,
sociodemographic
characteristics, and the receipt of an alcohol
brief intervention. • strength of urges to smoke. In unadjusted univariable
analyses, those who received an intervention,
compared with those who did not, were
more likely to be older (OR 1.35, 95%
CI = 1.07 to 1.71), have ‘current’ compared
with ‘never’ smoking status (OR 1.85, 95%
CI = 1.05 to 3.26), and a higher AUDIT
score (OR 1.17, 95% CI = 1.12 to 1.22); they
were less likely to be female (OR 0.35, 95%
CI = 0.19 to 0.65) and have children in the Measures In unadjusted univariable
analyses, compared with those who received
no intervention, those who did receive one
were more likely to be older (odds ratio
[OR] 1.19, 95% CI = 1.08 to 1.31), female
(OR 1.28, 95% CI = 1.06 to 1.54), have a
disability (OR 1.61, 95% CI = 1.26 to 2.05),
to have made more quit attempts in the
previous year (compared with no attempts:
one attempt, OR 1.61, 95% CI = 1.29 to 2.01;
≥2 attempts, OR 2.07, 95% CI = 1.54 to 2.78),
and have greater nicotine dependence (time
with urges to smoke, OR 1.23, 95% CI = 1.14
to 1.33; strength of urges to smoke, OR 1.25,
95% CI = 1.15 to 1.36). • disability; and • excessive drinking (indicated by AUDIT
score of ≥8). • excessive drinking (indicated by AUDIT
score of ≥8). Region was entered as a categorical
variable with the North as the reference. The continuous variable age in years was
transformed to reflect increases in the
standard deviation of the sample (17 years)
and was included with three more
continuous variables: • number of past-year quit attempts; • number of past-year quit attempts; • time with urges to smoke; and RESULTS An unweighted total of 15 252 adults
aged ≥16 years were surveyed (the
sociodemographic characteristics of the full
sample are available from the authors); of
these, 3043 (20.0%) were smokers and 1894 British Journal of General Practice, January 2016 e4 Table 1. Factors associated with receipt of brief intervention for smoking among smokers visiting their GP in
the previous year
Intervention,
No intervention,
Unadjusted
Adjusted
Factor
n = 925a
n = 850
Odds ratio
95% CI
P -value
Odds ratio
95% CI
P -value
Mean age, years (SD)b
46.9 (16.8)
43.6 (17.2)
1.19
1.08 to 1.31
<0.01
1.19
1.06 to 1.34
<0.01
Female, n (%)
498 (53.8)
406 (47.8)
1.28
1.06 to 1.54
<0.05
1.35
1.10 to 1.65
<0.01
Lower social grade,c n (%)
568 (61.4)
543 (63.9)
0.90
0.74 to 1.09
0.28
0.85
0.69 to 1.05
0.13
Region, n (%)
North (ref)
360 (38.9)
334 (39.3)
–
–
–
–
–
–
Central
261 (28.2)
222 (26.1)
1.09
0.86 to 1.38
0.46
1.11
0.87 to 1.42
0.40
South
304 (32.9)
294 (34.6)
0.96
0.77 to 1.19
0.71
0.94
0.75 to 1.18
0.59
No post-16 qualification, n (%)
425 (45.9)
411 (48.4)
0.91
0.75 to 1.09
0.31
0.81
0.66 to 1.00
<0.05
Children in household, n (%)
306 (33.1)
312 (36.7)
0.85
0.70 to 1.04
0.11
0.96
0.76 to 1.21
0.74
White, n (%)
845 (91.4)
765 (90.0)
1.17
0.85 to 1.62
0.33
0.93
0.66 to 1.31
0.67
Disability, n (%)
205 (22.2)
128 (15.1)
1.61
1.26 to 2.05
<0.001
1.44
1.11 to 1.88
<0.01
Drinking excessively —
206 (22.3)
208 (24.5)
0.88
0.71 to 1.10
0.27
1.01
0.79 to 1.29
0.92
AUDIT ≥8, n (%)
Past-year quit attempts, n (%)
0 (ref)
505 (54.6)
576 (67.8)
–
–
–
–
–
–
1
271 (29.3)
192 (22.6)
1.61
1.29 to 2.01
<0.001
1.65
1.32 to 2.08
<0.001
≥2
149 (16.1)
82 (9.6)
2.07
1.54 to 2.78
<0.001
2.02
1.49 to 2.74
<0.001
Time with urge to smoke
0–5, mean (SD)
2.2 (1.3)
1.9 (1.2)
1.23
1.14 to 1.33
<0.001
1.17
1.05 to 1.31
<0.01
Strength of urge to smoke
0–5, mean (SD)
2.2 (1.1)
1.9 (1.1)
1.25
1.15 to 1.36
<0.001
1.08
0.96 to 1.23
0.21
aThe 925/1775 does not precisely correspond with the 50.4% estimate presented in the main body as those data are weighted. The adjusted model includes all variables in the table
and month of survey. RESULTS bIncrease is per SD of the sample = 17 years of age. cC2DE. AUDIT = Alcohol Use Disorders Identification Test. SD = standard deviation. ors associated with receipt of brief intervention for smoking among smokers visiting their GP in
year Table 1. Factors associated with receipt of brief intervention for smoking among smokers visitin
the previous year household (OR 0.50, 95% CI = 0.26 to 0.96). After mutual adjustment in a multivariable
analysis, those receiving an intervention,
compared with those who did not, had
higher AUDIT scores (OR 1.17, 95% CI = 1.12
to 1.23) and were less likely to be female (OR
0.44, 95% CI = 0.23 to 0.87). male than those who did not receive advice,
but no other associations were clearly
established. e5 British Journal of General Practice, January 2016 Strengths and limitations g
The present findings are similar to
estimates of delivery of brief interventions
derived from primary care databases.13,14,29
A major strength of this study is that
these figures are up to date and from the
perspective of patients identified from a
large representative sample of the English
population. A consequent limitation is that
the findings may be inaccurate because
patients either forgot about receiving an
intervention or misjudged the time period
assessed. Although self-reported data are
subject to such recall bias, there is evidence
that financial incentives lead to improved
recording — rather than improved delivery
— of brief interventions, so it is important to
use data from both GP records and patients
when forming a judgement.13 Summary Smokers in England who reported visiting
their GP appeared substantially more likely
to receive advice about their smoking status
than people drinking excessively were about
their alcohol consumption: 50% of smokers
recalled receiving a brief intervention on
smoking, whereas <10% of those drinking
excessively recalled having received a brief
intervention on alcohol. Smokers receiving
advice, compared with those who did not,
were more likely to be older, female, have
a disability, have made more quit attempts
in the previous year, have greater nicotine
dependence, but be less likely to have no
post-16 qualifications. People drinking
excessively and receiving advice had higher
AUDIT scores and were more likely to be Another strength of the study arises
because the delivery of alcohol brief
interventions is often not recorded by
clinicians, but generally indirectly estimated e5 British Journal of General Practice, January 2016 Table 2. Summary Factors associated with receipt of brief intervention for alcohol among people drinking excessively
visiting their GP in the previous year
Intervention,
No intervention,
Unadjusted
Adjusted
Factor
n = 76a
n = 1034
Odds ratio
95% CI
P -value
Odds ratio
95% CI
P -value
Mean age, years (SD)b
47.6 (16.2)
42.5 (17.9)
1.35
1.07 to 1.71
<0.05
1.32
0.99 to 1.78
0.06
Female, n (%)
12 (15.8)
362 (35.0)
0.35
0.19 to 0.65
<0.01
0.44
0.23 to 0.87
<0.05
Lower social grade,c n (%)
35 (46.1)
450 (43.5)
1.11
0.69 to 1.77
0.67
1.08
0.63 to 1.86
0.79
Region, n (%)
North (ref)
34 (44.7)
546 (52.8)
–
–
–
–
–
–
Central
15 (19.7)
191 (18.5)
1.26
0.67 to 2.37
0.47
1.18
0.59 to 2.36
0.64
South
27 (35.5)
297 (28.7)
1.46
0.86 to 2.47
0.16
1.30
0.73 to 2.32
0.37
No post-16 qualification, n (%)
25 (32.9)
319 (30.9)
1.10
0.67 to 1.80
0.71
0.72
0.40 to 1.29
0.27
Children in household, n (%)
11 (14.5)
261 (25.2)
0.50
0.26 to 0.96
<0.05
0.80
0.39 to 1.66
0.55
White, n (%)
72 (94.7)
1003 (97.0)
0.56
0.19 to 1.62
0.28
0.38
0.12 to 1.21
0.10
Disability, n (%)
14 (18.4)
114 (11.0)
1.82
0.99 to 3.36
0.05
1.19
0.59 to 2.43
0.63
Smoking status, n (%)
Never smoke (ref)
21 (27.6)=
424 (41.0)
–
–
–
–
–
–
Ex-smoker
23 (30.3)
260 (25.1)
1.79
0.97 to 3.29
0.06
1.27
0.64 to 2.51
0.49
Current smoker
32 (42.1)
350 (33.8)
1.85
1.05 to 3.26
<0.05
1.14
0.59 to 2.20
0.69
AUDIT score 8–40, mean (SD)
15.5 (6.9)
11.1 (3.7)
1.17
1.12 to 1.22
<0.001
1.17
1.12 to 1.23
<0.001
aThe 76/1110 does not precisely correspond with the 6.5% estimate presented in the main body as those data are weighted. The adjusted model includes all variables in the table
and month of survey. bIncrease is per SD of the sample = 17 years of age. cC2DE. AUDIT = Alcohol Use Disorders Identification Test. SD = standard deviation. Table 2. Factors associated with receipt of brief intervention for alcohol among people drinking excessively
visiting their GP in the previous year Table 2. Funding The National Institute for Health Research
(NIHR) School for Public Health Research
funded data collection for the Alcohol Toolkit
Study
(SPHR-SWP-ALC-WP5);
Cancer
Research UK funded data collection for the
Smoking Toolkit Study (C1417/A7972). The
funders had no final role in the study design;
in the collection, analysis and interpretation
of data; in the writing of the report; or in
the decision to submit the article for
publication. All researchers listed as authors
are independent from the funders; all final
decisions about the research were taken by
the investigators and were unrestricted. Summary Factors associated with receipt of brief intervention for alcohol among people drinking
visiting their GP in the previous year from the rate at which patients are screened
for excessive alcohol consumption.18,29
Future research could compare estimates
more directly by surveying a representative
sample of the population, and seeking
permission and details to allow the patient
records of responders to be identified. The association for smokers with age, sex,
previous quit attempts, and dependence
reflects the profile of treatment-seeking
smokers and is likely to be related to
GPs focusing on smokers who express
an interest in stopping.47 These findings
suggest GPs are not yet following the
latest national guidance from the National
Centre for Smoking Cessation and Training
(NCSCT) in England, which recommends
that they go straight to the offer of support,
rather than assess a patient’s interest in
quitting.6,48 This study is also limited by assessing
only the association between receipt of brief
interventions and patient characteristics;
the receipt of brief intervention is also likely
related to GP characteristics and those of
their surgeries.19–25 The association with disability may reflect
the greater incentives for brief intervention
among smokers with chronic health
conditions.28 Previous research has found
that smokers from more disadvantaged
socioeconomic backgrounds want and try
to quit as much as other smokers but find
it more difficult.49 This difficulty suggests
the marginal benefit from brief intervention
recommending support would be greater
for this group. However, the current study
suggests that smokers without post-16
qualifications are less likely to receive an
intervention, which is concerning in terms
of health inequalities. Comparison with existing literature People with higher compared with lower
AUDIT scores were more likely to recall a
brief intervention than to not: the associated
odds of recalling a brief intervention were
17% greater for every point increase above
8 on the AUDIT scale (OR 1.17). This finding
is consistent with a previous analysis which
indicated that GPs were more likely to
identify dependent drinkers compared with
those who were drinking at lower, but still
harmful, levels.18 GPs have also been found
to identify an alcohol use disorder less
often in younger people and dependence
less often in females,18 which is consistent
with the associations between age, sex,
and receipt of brief intervention in the study
presented here. Open access This article is Open Access: CC BY 3.0 license
(http://creativecommons.org/licenses/
by/3.0/). Competing interests The research team is part of the UK Centre
for Tobacco and Alcohol Studies. Jamie Brown
and Emma Beard have received unrestricted
research grants from Pfizer; Robert West
undertakes research and consultancy, and
receives fees for speaking from companies
that develop and manufacture smoking
cessation medications (Pfizer, Johnson
& Johnson, McNeil, GSK, Nabi, Novartis,
and Sanofi-Aventis). All other authors have
declared no competing interests. Any
improvement
to
incentive
schemes would likely be synergistically
enhanced by the simultaneous provision
of additional training on how to deliver
brief interventions.32 NICE guidelines
recommend that all health and social care
professionals should, as a minimum, be
able to deliver a very brief intervention.58
The NCSCT offers an online brief advice
module, which increases the frequency
and quality of smoking brief interventions,59
while training on the formulation of specific
action plans increases the rate of asking
about smoking;60 future research could
assess whether such advice modules and
action plans have a similar effect on alcohol
brief intervention. The focus of this article is alcohol and
tobacco control in England. Although it is
true that the effectiveness of any policy
will always depend on a variety of local,
cultural, and contextual factors,52 studying
what happens in England with contrasting
financial incentives for the delivery of
smoking and alcohol brief interventions
could provide an indirect indication as to
what is achievable in other countries. Acknowledgements There is wide debate about what We gratefully acknowledge the funding listed
above. We also acknowledge the Department
of Health, Pfizer, GlaxoSmithKline, and
Johnson & Johnson have all funded data
collection previously for the Smoking Toolkit
Study. Jamie Brown’s post is funded by a
fellowship from the Society for the Study of
Addiction; Robert West is funded by Cancer
Research UK; Emma Beard, Alan Brennan,
Matthew Hickman, John Holmes, Eileen
Kaner, and Susan Michie have all received
funding from the NIHR School for Public
Health Research; Colin Drummond was part-
funded by the NIHR Biomedical Research
Centre at South London and Maudsley NHS
Foundation Trust and King’s College London,
and the NIHR Collaboration for Leadership
in Applied Health Research and Care South
London. The views expressed are those of the
authors(s) and not necessarily those of the
NHS, NIHR, or Department of Health. Implications for practice The UK government’s alcohol strategy was
criticised by Alcohol Health Alliance UK for British Journal of General Practice, January 2016 e6 constitutes an effective alcohol brief
intervention.11,53–55 An enhanced incentive
scheme for alcohol brief intervention in
England — such as a QOF indicator for
unselected screening and brief intervention
delivery — may maximise effectiveness
and cost-effectiveness by being structured
to encourage brief screening followed by
simple feedback and written information.53
The simple behaviour change technique
of self-monitoring has been shown to be
effective for reducing alcohol consumption
and would be a relatively easy technique for
GPs to use with their patients.56 Including this
would meet the recent recommendation of
the House of Lords Science and Technology
Select Committee to include more explicit
advice in guidance on how behaviour change
techniques can be applied to reducing
excessive alcohol consumption.57 its failure to implement a QOF indicator
for screening and brief intervention for
excessive alcohol consumption.33 In view
of the substantial QOF incentives for the
delivery of smoking brief interventions and
the less substantial opt-in arrangements
for alcohol brief interventions, this study
adds to the evidence suggesting that
more substantial incentives are likely to
be associated with greater delivery of brief
intervention.17,26,30–32 There are other reasons why the delivery
of smoking and alcohol brief interventions
may differ; for example, excessive alcohol
consumption takes longer to establish than
smoking because it requires screening,
motivation to change is weaker among those
who drink excessively than among smokers
in England,50,51 and drinking advice may
be less straightforward because reduction
is often the goal rather than abstinence. However, the magnitude of the difference
suggests that a number of factors could be
important and scope remains for enhanced
financial incentives to have a significant
impact. Ethical approval
Ethical approval was granted by University
College London Research Ethics Committee
(ID 0498/001). Provenance
Freely submitted; externally peer reviewed. REFERENCES 103–117. 103–117. 24. Rapley T, May C, Kaner EF. Still a difficult business? Negotiating alcohol-related
problems in general practice consultations. Soc Sci Med 2006; 63(9): 2418–2428. 1. Lim SS, Vos T, Flaxman AD, et al. A comparative risk assessment of burden
of disease and injury attributable to 67 risk factors and risk factor clusters in
21 regions, 1990–2010: a systematic analysis for the Global Burden of Disease
Study 2010. Lancet 2012; 380(9859): 2224–2260. 25. Wilson GB, Lock CA, Heather N, et al. Intervention against excessive alcohol
consumption in primary health care: a survey of GPs’ attitudes and practices in
England 10 years on. Alcohol Alcohol 2011; 46(5): 570–577. 2. Department of Health. The cost of alcohol harm to the NHS in England. An
update to the Cabinet Office (2003) study. London: DH, 2008. 26. Hamilton FL, Greaves F, Majeed A, Millett C. Effectiveness of providing financial
incentives to healthcare professionals for smoking cessation activities:
systematic review. Tob Control 2013; 22(1): 3–8. 3. Department of Health. Healthy lives, healthy people: a tobacco control plan for
England. London: DH, 2011. 27. NHS Employers. Investing in general practice: the New GMS Contract 2003. London: NHS Employers, 2003. 4. Stead LF, Bergson G, Lancaster T. Physician advice for smoking cessation. Cochrane Database Syst Rev 2008; 2: CD000165. 28. NHS Employers. Quality and Outcomes Framework for 2012/13: guidance for
PCOs and practices. London: NHS Employers, 2012. 5. National Institute for Health and Clinical Excellence. Smoking: brief interventions
and referrals. NICE guidelines [PH1]. https://www.nice.org.uk/guidance/ph1
(accessed 02 Dec 2015). 29. Khadjesari Z, Marston L, Petersen I, et al. Alcohol consumption screening of
newly-registered patients in primary care: a cross-sectional analysis. Br J Gen
Pract 2013; DOI: 10.3399/bjgp13X673720. 6. Aveyard P, Begh R, Parsons A, West R. Brief opportunistic smoking cessation
interventions: a systematic review and meta-analysis to compare advice to quit
and offer of assistance. Addiction 2012; 107(6): 1066–1073. 30. Lapham GT, Achtmeyer CE, Williams EC, et al. Increased documented brief
alcohol interventions with a performance measure and electronic decision
support. Med Care 2012; 50(2): 179–187. 7. Chambers M. NHS Stop Smoking Services: service and monitoring guidance
2010/11. London: DH, 2009. 31. Michaud P, Fouilland P, Dewost AV, et al. [Early screening and brief intervention
among excessive alcohol users: mobilizing general practitioners in an efficient
way]. Rev Prat 2007; 57(11): 1219–1226. 8. Purshouse RC, Brennan A, Rafia R, et al. REFERENCES Modelling the cost-effectiveness of
alcohol screening and brief interventions in primary care in England. Alcohol
Alcohol 2013; 48(2): 180–188. 32. Angus C, Li J, Parrott S, Brennan A. Optimizing Delivery of Health Care
Interventions (ODHIN): cost-effectiveness — analysis of the WP5 trial. Sheffield:
University of Sheffield, in press. 9. Angus C, Latimer N, Preston L, et al. What are the Implications for policy
makers? A systematic review of the cost-effectiveness of screening and brief
interventions for alcohol misuse in primary care. Front Psychiatry 2014; 5: 114. 33. House of Commons Health Committee. Government's alcohol strategy. Third
report of session 2012–13. http://www.publications.parliament.uk/pa/cm201213/
cmselect/cmhealth/132/132.pdf (accessed 4 Dec 2015). 10. Kaner EF, Beyer F, Dickinson HO, et al. Effectiveness of brief alcohol
interventions in primary care populations. Cochrane Database Syst Rev 2007; 2:
CD004148. 34. NHS Employers and the General Practitioners Committee. Clinical Directed
Enhanced Services (DESs) for GMS Contract 2008/09: guidance and audit
requirements. http://www.alcohollearningcentre.org.uk/_library/Clinical_DES_
Guidance_mh23032009.pdf (accessed 28 Oct 2015). 11. McCambridge J, Rollnick S. Should brief interventions in primary care address
alcohol problems more strongly? Addiction 2014; 109(7): 1054–1058. 12. National Institute for Health and Care Excellence. Alcohol-use disorders:
prevention. NICE guidelines [PH24]. https://www.nice.org.uk/guidance/ph24
(accessed 02 Dec 2015). 35. NHS Employers and General Practitioners Committee. 2013/14 General
Medical Services (GMS) contract guidance and audit requirements for new
and amended services: version 1. http://www.nhsemployers.org/~/media/
Employers/Publications/2013-14-GMS-contract-Guidance-audit-requirements. pdf (accessed 28 Oct 2015). 13. Szatkowski L, McNeill A, Lewis S, Coleman T. A comparison of patient recall of
smoking cessation advice with advice recorded in electronic medical records. BMC Public Health 2011; 11: 291. 36. Millett C, Majeed A, Huckvale C, Car J. Going local: devolving national pay for
performance programmes, BMJ 2011; 342: c7085. 14. Taggar JS, Coleman T, Lewis S, Szatkowski L. The impact of the Quality and
Outcomes Framework (QOF) on the recording of smoking targets in primary
care medical records: cross-sectional analyses from The Health Improvement
Network (THIN) database. BMC Public Health 2012; 12: 329. 37. Fidler JA, Shahab L, West O, et al. ‘The smoking toolkit study’: a national study of
smoking and smoking cessation in England. BMC Public Health 2011; 11: 479. 38. Beard E, Brown J, West R, et al. Protocol for a national monthly survey of alcohol
use in England with 6-month follow-up: ‘the Alcohol Toolkit Study’. BMC Public
Health 2015; 15: 230. 15. Deehan A, Templeton L, Taylor C, et al. REFERENCES How do general practitioners manage
alcohol-misusing patients? Results from a national survey of GPs in England
and Wales. Drug Alcohol Rev 1998; 17(3): 259–266. 39. Babor TF, Higgins-Biddle JC, Saunders JB, Monteiro MG. AUDIT: the Alcohol
Use Disorders Identification Test: guidelines for use in primary care. Geneva:
WHO, 2001. 16. Deehan A, Templeton L, Taylor C, et al. Low detection rates, negative attitudes
and the failure to meet the 'Health of the Nation' alcohol targets: findings from
a national survey of GPs in England and Wales. Drug Alcohol Rev 1998; 17(3):
249–258. 40. Fidler JA, Shahab L, West R. Strength of urges to smoke as a measure of
severity of cigarette dependence: comparison with the Fagerström Test for
Nicotine Dependence and its components. Addiction 2010; 106(3): 631–638. 17. Hamilton FL, Laverty AA, Gluvajic D, et al. Effect of financial incentives on
delivery of alcohol screening and brief intervention (ASBI) in primary care:
longitudinal study. J Public Health (Oxf) 2014; 36(3): 450–459. 41. Office for National Statistics. 2011 census, population and household estimates
for England and Wales. http://www.ons.gov.uk/ons/rel/census/2011-census/
population-and-household-estimates-for-england-and-wales/index.html
(accessed 27 Nov 2015). 18. Cheeta S, Drummond C, Oyefeso A, et al. Low identification of alcohol use
disorders in general practice in England. Addiction 2008; 103(5): 766–773. 19. Anderson P, Kaner E, Wutzke S, et al. Attitudes and managing alcohol problems
in general practice: an interaction analysis based on findings from a WHO
collaborative study. Alcohol Alcohol 2004; 39(4): 351–356. 42. Office for National Statistics. Annual mid-year population estimates, 2013. http://www.ons.gov.uk/ons/rel/pop-estimate/population-estimates-for-uk--
england-and-wales--scotland-and-northern-ireland/2013/stb---mid-2013-uk-
population-estimates.html (accessed 27 Nov 2015). 20. Heather N, Dallolio E, Hutchings D, et al. Implementing routine screening
and brief alcohol intervention in primary health care: a Delphi survey of expert
opinion. J Subst Use 2004; 9(2): 68–85. 43. National Readership Survey. http://www.nrs.co.uk/downloads/technical/the_
sample_010615.pdf (accessed 27 Nov 2015). 21. Hutchings D, Cassidy P, Dallolio E, et al. Implementing screening and brief
alcohol interventions in primary care: views from both sides of the consultation. Prim Health Care Res Dev 2006; 7(3): 221–229. 44. Deming WE, Stephan FF. On least squares adjustment of a sampled frequency
table when the expected marginal totals are known. Ann Math Stat 1940: 11(4):
427–444. 22. Johnson M, Jackson R, Guillaume L, et al. Barriers and facilitators to
implementing screening and brief intervention for alcohol misuse: a systematic
review of qualitative evidence. J Public Health (Oxf) 2011; 33(3): 412–421. 45. IBM. Discuss this article Contribute and read comments about this
article: bjgp.org/letters e7 British Journal of General Practice, January 2016 REFERENCES e9 British Journal of General Practice, January 2016 REFERENCES How does rim weighting works in Quantum? http://www-01.ibm.com/
support/docview.wss?uid=swg21480970 (accessed 28 Oct 2015). 46. Box GEP, Tidwell PW. Transformation of the independent variables. Technometrics 1962; 4(4): 531–550. 23. McAvoy BR, Donovan RJ, Jalleh G, et al. General practitioners, prevention and
alcohol — a powerful cocktail? Facilitators and inhibitors of practising preventive
medicine in general and early intervention for alcohol in particular: a 12-nation
key informant and general practitioner study. Drug-Educ Prev Polic 2001; 8(2): 47. Kotz D, Fidler J, West R. Factors associated with the use of aids to cessation in
English smokers. Addiction 2009; 104(8): 1403–1410. British Journal of General Practice, January 2016 e8 48. National Centre for Smoking Cessation and Training. Very Brief Advice training
module. http://www.ncsct.co.uk/publication_very-brief-advice.php (accessed 26
Oct 2015). 2010; 105(6): 960–961. 2010; 105(6): 960–961. 55. Heather N. Interpreting null findings from trials of alcohol brief interventions. Front Psychiatry 2014; 5: 85. 49. Kotz D, West R. Explaining the social gradient in smoking cessation: it’s not in
the trying, but in the succeeding. Tob Control 2009; 18(1): 43–46. 56. Michie S, Whittington C, Hamoudi Z, et al. Identification of behaviour change
techniques to reduce excessive alcohol consumption. Addiction 2012; 107(8):
1431–1440. 50. West R, Brown J, Monthly tracking of key performance indicators. STS120720
20/11/2015. http://www.smokinginengland.info/latest-statistics/ (accessed 27
Nov 2015). 57. House of Lords Science and Technology Select Committee. Science and
Technology Select Committee. 2nd Report of Session 2010–12. Behaviour
change report. http://www.publications.parliament.uk/pa/ld201012/ldselect/
ldsctech/179/179.pdf (accessed 4 Dec 2015). 51. Brown J, Beard E, West R, et al. Latest trends on alcohol consumption in
England from the Alcohol Toolkit Study. ATS0004 07/01/2015. http://www. alcoholinengland.info/latest-stats (accessed 27 Nov 2015). 58. National Institute for Health and Care Excellence. Behaviour change: individual
approaches. NICE guidelines [PH49]. http://www.nice.org.uk/guidance/ph49
(accessed 28 Oct 2015). 52. Holmes J, Meier PS, Booth A, Brennan A. Reporting the characteristics of the
policy context for population-level alcohol interventions: a proposed ‘Transparent
Reporting of Alcohol Intervention ContExts’ (TRAICE) checklist. Drug Alcohol Rev
2014; 33(6): 596–603. 59. Hughes L, McIlvar M, McEwen A. How to advise and refer inpatients who smoke. Nurs Times 2013; 109(1–2): 14–18. 53. Kaner E, Bland M, Cassidy P, et al. Effectiveness of screening and brief
alcohol intervention in primary care (SIPS trial): pragmatic cluster randomised
controlled trial. BMJ 2013; 346: e8501. 60. Verbiest M, Presseau J, Chavannes NH, et al. Use of action planning to increase
provision of smoking cessation care by general practitioners: role of plan
specificity and enactment. Implement Sci 2014; 9: 180. 54. Kaner E. Brief alcohol intervention: time for translational research. Addiction e9 British Journal of General Practice, January 2016
| 33,152 |
2010073101717
|
French Open Data
|
Open Government
|
Licence ouverte
| 2,010 |
KLASS METISS.
|
ASSOCIATIONS
|
French
|
Spoken
| 102 | 162 |
constituer une troupe artistique réunissant des personnes de tout âge, sexe, origines raciales, statut social, etc ; réaliser des spectacles divers à destination de tout public ; faire des animations karaoké et musicales diverses ; orgnaiser des dîners dansants ou par extension, toute sorte de manifestation où le chant et la musique ont la première place ; proposer des stages, des ateliers ou des cours de musique, chant, danse, théâtre etc, en ayant recours à des professionnels pour ce faire au profit de l'association elle-même, d'autres associations, d'oeuvres cartitatives, de comités d'entreprises, de restaurants, d'écoles et d'autres organismes, gratuitement ou moyennant fincances.
| 15,915 |
78/2024_134
|
TEDEUTenders
|
Open Government
|
Various open data
| null |
None
|
None
|
Romanian
|
Spoken
| 7,809 | 16,505 |
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre operatorii economici participanti la procedura de atribuire cu inf. aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
3)Declaratie privind neincadrarea in prevederile art. 167 din Legea nr. 98/2016 privind achizitiile publice cu modificarile si completarile ulterioare;
Op. ec. (lider, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE. Încadrarea în situatia prevazuta la art. 167 din Legea nr. 98/2016 privind achizitiile publice modificarile si completarile ulterioare atrage excluderea ofertantului din procedura pentru atribuirea acordului cadru.
Pentru neincadrarea in prev art.164 din Legea 98/2016 se va prezenta: cazierul judiciar al operatorului economic si al membrilor organului de administrare, de conducere sau de supraveghere al respectivului op. economic, sau a celor ce au putere de reprezentare, de decizie sau de control in cadrul acestuia, asa cum rezulta din certificatul constatator emis de ONRC./actul constitutiv, valabile la momentul prezentarii.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre op. ec. participanti la procedura de atribuire cu informatiile aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
4) Declaratie privind neincadrarea in prevederile art. 59 si 60 din Legea nr. 98/2016 privind achizitiile publice modificarile si completarile ulterioare;
Operatorul economic (ofertant unic, asociat, tert sustinator, subcontract.) va completa cerinta coresp. in formularul DUAE. Încadrarea în situatia prevazuta la art. 59 si 60 din Legea nr. 98/2016 privind achizit. publice modif. si compl. ulterioare atrage excluderea ofertantului din procedura pentru atribuirea acordului cadru.
Ofertantul nu trebuie sa se afle in conflict de interese cu oricare din urmatoarele persoane care detin functii de decizie în cadrul autoritatii contractante:
-Nastasescu Tudor-Ion – Manager al Spitalului Judetean de Urgenta Tulcea;
-Beschieriu-Ionita Bogdan – Director Financiar Contabil;-Molceanu Elena - Director medical;-Armeanu Lavinia - Director ingrijiri;-Gheba Victoria - Director Administrativ;-Manole Valentin - Sef.Serviciu Juridic – Runos.
In si
used
false
sui-act
III.1.1.b) Capacitatea de exercitare a activitatii profesionale
Operatorii economici ce depun oferta trebuie sa dovedeasca o forma de înregistrare în conditiile legii din tara de rezidenta, sa reiasaca operatorul economic este legal constituit, ca nu se afla în niciuna dintre situatiile de anulare a constituirii precum și faptul ca are capacitatea profesionala de a realiza activitatile care fac obiectul contractului.
Modalitatea prin care poate fi demonstrata îndeplinirea cerintei: se completeaza DUAE, documentele justificative care probeaza îndeplinirea celor asumate prin completarea DUAE, respectiv certificat constatator emis de ONRC,sau în cazul ofertantilor straini, documente echivalente emise în tara de rezidenta, urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final intocmit la finalizarea evaluarii ofertelor si dupa aplicarea criteriului de atribuire (inclusiv de catre ofertantul asociat al castigatorului procedurii/tertul sustinator, subcontractant, dupa caz), pana la data incheierii raportului procedurii de atribuire.
La procedura de achizitie pot participa numai operatorii economici autorizati de Agentia Nationala a Medicamentelor si Dispozitivelor Medicale conform Ghidului privind buna practica de distributie angro in Romania Avand in vedere cap.7; art.800 si urmatoarele din Legea 95/2006, distributia angro de medicamente se face de catre posesorii unei autorizatii pentru desfasurarea activitatii de distribuitor angro de medicamente, care precizeaza sediul/sediile de pe teritoriul României pentru care este valabila, autorizatia eliberata de Agentia Nationala a Medicamentului si Dispozitivelor Medicale – valabila la data prezentarii.
Modalitate de indeplinire: completare DUAE, urmand ca documentul justificativ, respectiv Autorizatia de distributie angro sau in cazul ofertantilor straini document echivalent emis in tara de rezidenta (in limba in care a fost emis,insotit de traducerea in limba romana efectuata in mod obligatoriu de catre traducatori autorizati), sa fie prezentate odata cu propunerea tehnica (inclusiv de catre asociat, subcontractant),pana la data si ora limita de depunere a ofertelor.Documentele depuse se vor semna cu semnatura electronica extinsa si se vor posta in SEAP.
used
false
tp-abil
Proporția de subcontractare
Informatii privind subcontractantii (daca este cazul):
Ofertantul trebuie sa prezinte informatii privind partea din contract pe care operatorul economic are, eventual, intentia sa o subcontracteze. In cazul in care operatorul economic intentioneaza sa subcontracteze o parte din contract, acesta va preciza în ofertă categoriile de lucrări din contract pe care intenţionează să le subcontracteze, precum şi procentul aferent activităţilor indicate în ofertă ca fiind realizate de către subcontractanţi şi datele de identificare ale subcontractanţilor propuşi, dacă aceştia din urmă sunt cunoscuţi la momentul depunerii ofertei.
Subcontractanţii pe a căror capacităţi ofertantul/candidatul se bazează pentru demonstrarea îndeplinirii anumitor criterii de calificare şi selecţie sunt consideraţi şi terţi susţinători, caz în care acordul de subcontractare reprezintă, în acelaşi timp, şi angajamentul ferm.
Informatii privind tertul/tertii sustinatori
Capacitatea tehnică și/sau profesională a operatorului economic poate fi susținută în conformitate cu art. 182 din Legea nr. 98/2016. Operatorul economic are dreptul sa invoce sustinerea unui/unor tert/terti în ceea ce priveste situaţia economică şi financiară, respectiv capacitatea tehnică şi profesională, indiferent de natura relatiilor juridice existente între operatorul economic si tertul/tertii respectiv /respectivi.
În cazul în care ofertantul/candidatul îşi demonstrează situaţia economică şi financiară, respectiv capacitatea tehnică şi profesională, invocând suportul unui/unor terţ/terţi, în condiţiile Legii, atunci acesta are obligaţia de a dovedi susţinerea de care beneficiază prin prezentarea unui angajament ferm al persoanei respective, prin care se confirmă faptul că acesta va pune la dispoziţia ofertantului/candidatului resursele invocate. Odata cu angajamentul de sustinere, ofertantul/ candidatul are obligatia sa prezinte documente transmise acestuia de catre tertul/tertii sustinator /sustinatori, pot dovedi că deţin resursele invocate ca element de susţinere a ofertantului/candidatului.
Ofertantul/candidatul trebuie sa demonstreze că va dispune efectiv de resursele entităţilor ce acordă susţinerea, necesare pentru realizarea contractului, astfel ca Autoritatea contractanta va verifica daca tertul/tertii care asigura sustinerea, îndeplineste criteriile relevante privind capacitatea sau nu se încadreaza în motivele de excludere prevazute la art. 164, 165 si 167.
În scopul verificarii îndeplinirii criteriilor de calificare si selectie de catre tertul/tertii care acorda sustinere, în conditiile art. 183 alin.(1) din Lege, autoritatea contractanta poate solicita tertului/tertilor sustinator(i), oricând pe parcursul procesului de evaluare, documente si informatii suplimentare în legatura cu angajamentul dat sau cu documentele prezentate, în cazul în care exista rezerve în ceea ce priveste corectitudinea informatiilor sau documentelor prezentate sau cu privire la posibilitatea de executare a obligatiilor asumate prin respectivul angajament.
În cazul în care operatorul economic demonstreaza îndeplinirea criteriilor referitoare la capacitatea tehnica si profesionala invocând sustinerea unui tert, DUAE include informatiile cu privire la tertul sustinator.
Informatii privind asocierea
Se vor prezenta Informatii despre asociere (daca este cazul). În cazul depunerii unei oferte comune, fiecare operator economic membru al asocierii va prezenta DUAE. Acestia vor depune odata cu DUAE si acordul de asociere (din sectiunea formulare).
La solicitarea autorității contractante, doar ofertantul clasat pe locul I în clasamentul intermediar întocmit la finalizarea evaluării ofertelor va prezenta documente justificative ale asociaților care probează îndeplinirea cerinței privind capacitatea tehnică și profesională .Mai multi operatori economici au dreptul de a se asocia cu scopul de a depune oferta comuna, fara a fi obligati sa adopte sau sa constituie o anumita forma juridica pentru depunerea ofertei. In cazul in care mai multi operatori economici participa in comun la procedura de atribuire, indeplinirea criteriilor privind capacitatea tehnica si profesionala, se demonstreaza prin luarea in consideratie a resurselor tuturor membrilor grupului, iar autoritatea contractanta va solicta acestora sa raspunda in mod solidar pentru executarea contractului de achizitie publica. Oferta depusa de o asociere de operatori economici, trebuie sa indeplineasca urmatoarele cerinte:
a) sa fie semnata de fiecare reprezentant legal al fiecaruia dintre operatorii economici asociati;
b) sa includa un Acord de asociere al operatorilor economici care s-au asociat in vederea depunerii de oferta comuna.
c) structura asocierii NU va fi modificata pe întreaga durata a contractului decât cu aprobarea prealabila a autoritatii contractante. Fiecare subcontractant va completa un formular DUAE separat. Ofertantii vor incarca in mod obligatoriu in SEAP, impreuna cu DUAE si cu oferta, acordul/ acordurile de subcontractare incheiate intre contractant si subcontractantul/subcontractantii nominalizat / nominalizati in oferta.
Acordul/acordurile de subcontractare (din ,,Sectiunea Formulare” a Documentatiei de Atribuire) va/vor fi semnat/e cu semnatura electronica extinsa, bazata pe un certificat calificat, eliberat de un furnizor de servicii de certificare acreditat in conditiile legii. Acestea trebuie sa contina cel putin urmatoarele elemente: numele, datele de contact, reprezentantii legali ai subcontractantului; activitatile ce urmeaza a fi subcontractate; valoarea la care se ridica partea/partile subcontractate. In conformitate cu prevederile art. 218, alin (4) din Legea 98/2016, Autoritatea contractanta are obligatia de a solicita, la încheierea contractului, prezentarea contractului/ contractelor încheiate între contractant si subcontractantul/subcontractantii nominalizat/ nominalizati in oferta. Contractul/Contractele de subcontractare prezentate la incheierea contractului de achiz
used
false
tp-abil
Certificate emise de organisme independente cu privire la standardele de asigurare a calității
n baza Art. 200, alin. (1) din Legea 98/2016 privind achizitiile publice cu modificarile si completarile ulterioare. Ofertantii (operatori economici individuali sau operatorii economici ce participa in comun la procedura de atribuire) ce depun oferte trebuie sa faca dovada implementarii sistemului de management al calitatii conform SR ISO 9001 SAU ECHIVALENT , in termen de valabilitate la momentul prezentarii acesteia. La solicitarea autoritatii contractante, ofertantii clasati pe primele trei locuri in clasamentul final intocmit la finalizarea evaluarii ofertelor (inclusiv de catre ofertantul asociat al castigatorului procedurii/tertul sustinator, subcontractant, dupa caz), pana la data incheierii raportului procedurii de atribuire, vor prezenta ca documente justificative; dovada implementarii sistemului de management al calitatii conform SR EN ISO 9001 sau echivalent, prin prezentarea oricarui document prin care se sustine cerinta, de exemplu: un certificat emis de un organism de certificare sau alte documente care probeaza in mod concludent indeplinirea cerintei: proceduri/manuale de calitate, activitate procedurala etc similare cu cele prevazute drept conditie pentru obtinerea certificarii SR EN ISO 9001.
Ofertantii (operatori economici individuali sau operatorii economici ce participa in comun la procedura de atribuire) vor prezenta documente care sa probeze toate afirmatiile incluse in DUAE (raspuns) , in termen de valabilitate la momentul depunerii acestora.
i
used
false
sui-act
Înscrierea în registrul comerțului
n baza art.173 alin.1 din legea 98/2016, ofertantii (operatori economici individuali sau operatori economici ce participa in comun la procedura de atribuire) ce depun oferta trebuie sa dovedeasca o forma de inregistrare in registre comerciale ( precum si obiectul de activitate) in conditiile legii din tara de rezidenta, precum si ca este legal constituit, ca nu se afla in niciuna din situatiile de anulare a constituirii precum si faptul ca are capacitatea profesionala de a realiza activitatile care fac obiectul contractului. La solicitarea expresa a autoritatii contractante si in aplicarea prevederilor art. 196 din legea 98/2016 transmisa ca urmare a finalizarii procesului de evaluare, ofertantii (operatorul economic individual sau operatorii economici ce participa in comun la procedura de atribuire) clasati pe primele 3 locuri in clasametul final si dupa aplicarea criteriului de atribuire asupra ofertelor admisibile stabilit in documentatia de atribuire, vor demostra indeplinirea cerintei minime prin prezentarea certificatului ONRC sau pentru ofertantii straini, document echivalent emis in tara de rezidenta care sa probeze toate informatiile incluse in DUAE (raspuns) rubrica "Inscrierea in registr
used
false
ef-stand
n-used
not-allowed
no-eu-funds
not-requ
false
Documentatia de achizitie
non-restricted-document
https://e-licitatie.ro/pub/notices/c-notice/v2/view/100179098
true
Asociere conform art. 53. din Legea privind achizitiile publice nr 98/2016
bankr-nat.
partic-confl.
misinterpr.
socsec-law.
cred-arran.
bankruptcy.
insolvency.
prof-misconduct.
labour-law.
liq-admin.
envir-law.
susp-act.
distorsion.
prep-confl.
sanction.
none
no
allowed
required
price
Pretul ofertei
Pretul cel mai scazut este singurul criteriu
ORG-0004
https://www.e-licitatie.ro
ORG-0004
ORG-0004
5
Precizari privind termenul (termenele) pentru procedurile de contestareCf.art.8 din Lg nr.101/2016"..Pers care se consideră vătămată de un act al autorității contractant.poate sesiza Consiliul în vederea anulării actului,obligării acesteia la emiterea unui act sau la adoptarea de măsuri de remediere...in:a)10 zile,începând cu ziua următoare luării la cunoștință despre actul autorității considerat nelegal,când val estimată a procedurii e egală sau mai mare decât pragurile valorice;b)7 zile,când v
ORG-0002
RON
true
false
required
false
2024-05-22+03:00
15:00:00.0000000+03:00
2024-05-22+03:00
15:00:00.0000000+03:00
In SEAP
false
3
fa-wo-rc
none
26
COMBINATII (L-ORNITINA-L-ASPARTAT HEPA-MERZ SAU ECHIV) CONC. PT. SOL. PERF. 0.5G/ML
Spitalul Judetean de Urgenta Tulcea intenționează să achiziționeze diverse medicamente, pentru realizarea actelor medicale la standardele de calitate impuse de legislația în domeniul serviciilor medicale.
Estimarile cantitatilor minime si maxime ale Acordului-Cadru si ale Contractelor Subsecvente sunt prevazute in caietul de sarcini.
supplies
33600000
Produsele vor fi livrate la sediul beneficiarului, Spitalul Judetean de Urgenta Tulcea strada 1848 nr.32 respectiv magazia de medicamente a Farmaciei cu circuit inchis.
RO225
ROU
48
0
LOT-0027
sui-act
III.1.1.a) Situatia personala a candidatului sau ofertantului
Ofertantii, asociatii,tertii sustinatori si subcontractantii nu trebuie sa se regaseasca în situatiile prevazute la art. 164, 165, 166, 167 din Legea nr.98/2016.
Documentele justificative care probeaza indeplinirea celor asumate prin completare DUAE pot fi:
1)Declaratie privind neincadrarea in prevederile art. 164 din Legea nr. 98/2016 privind achizitiile publice.
Pentru neincadrarea in prev art.164 din Legea 98/2016 se va prezenta: cazierul judiciar al operatorului economic si al membrilor organului de administrare, de conducere sau de supraveghere al respectivului op. economic, sau a celor ce au putere de reprezentare, de decizie sau de control in cadrul acestuia, asa cum rezulta din certificatul constatator emis de ONRC./actul constitutiv, valabile la momentul prezentarii.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre op. ec. participanti la procedura de atribuire cu informatiile aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
2)Declaratie privind neincadrarea in prevederile art. 165 din Legea nr. 98/2016 privind achizitiile publice coroborat cu art. 166 (2) din acelasi act normativ,respectiv:
a) CERTIFICAT DE ATESTARE FISCALA pentru persoane juridice privind obligatiile de plata la bugetul consolidat al statului in termen de valabilitate, certificat din care sa reiasa ca ofertantul nu are datorii scadente la data solicitarii acestuia sau valoarea acestor datorii se incadreaza in pragul valoric prevazute la art. 166 alin.(2) din Legea nr. 98/2016 privind Achizitiile Publice cu modificarile si completarile ulterioare;
Op. ec. (ofertant unic, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE.
b) CERTIFICAT DE ATESTARE FISCALA pentru persoane juridice privind impozitele si taxele locale si alte venituri datorate bugetului local, din care sa reiasa ca ofertantul nu are datorii scadente la data solicitarii acestuia pentru sediul social. Declaraţie pe propria răspundere privind îndeplinirea obligaţiilor de plată a impozitelor, taxelor sau contribuţiilor la bugetul general consolidat datorate”pentru sediile secundare/punctele de lucru. Documentul este solicitat pentru a certifica situatia reala a ofertantului.
Operatorul economic (ofertant unic, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre operatorii economici participanti la procedura de atribuire cu inf. aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
3)Declaratie privind neincadrarea in prevederile art. 167 din Legea nr. 98/2016 privind achizitiile publice cu modificarile si completarile ulterioare;
Op. ec. (lider, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE. Încadrarea în situatia prevazuta la art. 167 din Legea nr. 98/2016 privind achizitiile publice modificarile si completarile ulterioare atrage excluderea ofertantului din procedura pentru atribuirea acordului cadru.
Pentru neincadrarea in prev art.164 din Legea 98/2016 se va prezenta: cazierul judiciar al operatorului economic si al membrilor organului de administrare, de conducere sau de supraveghere al respectivului op. economic, sau a celor ce au putere de reprezentare, de decizie sau de control in cadrul acestuia, asa cum rezulta din certificatul constatator emis de ONRC./actul constitutiv, valabile la momentul prezentarii.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre op. ec. participanti la procedura de atribuire cu informatiile aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
4) Declaratie privind neincadrarea in prevederile art. 59 si 60 din Legea nr. 98/2016 privind achizitiile publice modificarile si completarile ulterioare;
Operatorul economic (ofertant unic, asociat, tert sustinator, subcontract.) va completa cerinta coresp. in formularul DUAE. Încadrarea în situatia prevazuta la art. 59 si 60 din Legea nr. 98/2016 privind achizit. publice modif. si compl. ulterioare atrage excluderea ofertantului din procedura pentru atribuirea acordului cadru.
Ofertantul nu trebuie sa se afle in conflict de interese cu oricare din urmatoarele persoane care detin functii de decizie în cadrul autoritatii contractante:
-Nastasescu Tudor-Ion – Manager al Spitalului Judetean de Urgenta Tulcea;
-Beschieriu-Ionita Bogdan – Director Financiar Contabil;-Molceanu Elena - Director medical;-Armeanu Lavinia - Director ingrijiri;-Gheba Victoria - Director Administrativ;-Manole Valentin - Sef.Serviciu Juridic – Runos.
In si
used
false
sui-act
III.1.1.b) Capacitatea de exercitare a activitatii profesionale
Operatorii economici ce depun oferta trebuie sa dovedeasca o forma de înregistrare în conditiile legii din tara de rezidenta, sa reiasaca operatorul economic este legal constituit, ca nu se afla în niciuna dintre situatiile de anulare a constituirii precum și faptul ca are capacitatea profesionala de a realiza activitatile care fac obiectul contractului.
Modalitatea prin care poate fi demonstrata îndeplinirea cerintei: se completeaza DUAE, documentele justificative care probeaza îndeplinirea celor asumate prin completarea DUAE, respectiv certificat constatator emis de ONRC,sau în cazul ofertantilor straini, documente echivalente emise în tara de rezidenta, urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final intocmit la finalizarea evaluarii ofertelor si dupa aplicarea criteriului de atribuire (inclusiv de catre ofertantul asociat al castigatorului procedurii/tertul sustinator, subcontractant, dupa caz), pana la data incheierii raportului procedurii de atribuire.
La procedura de achizitie pot participa numai operatorii economici autorizati de Agentia Nationala a Medicamentelor si Dispozitivelor Medicale conform Ghidului privind buna practica de distributie angro in Romania Avand in vedere cap.7; art.800 si urmatoarele din Legea 95/2006, distributia angro de medicamente se face de catre posesorii unei autorizatii pentru desfasurarea activitatii de distribuitor angro de medicamente, care precizeaza sediul/sediile de pe teritoriul României pentru care este valabila, autorizatia eliberata de Agentia Nationala a Medicamentului si Dispozitivelor Medicale – valabila la data prezentarii.
Modalitate de indeplinire: completare DUAE, urmand ca documentul justificativ, respectiv Autorizatia de distributie angro sau in cazul ofertantilor straini document echivalent emis in tara de rezidenta (in limba in care a fost emis,insotit de traducerea in limba romana efectuata in mod obligatoriu de catre traducatori autorizati), sa fie prezentate odata cu propunerea tehnica (inclusiv de catre asociat, subcontractant),pana la data si ora limita de depunere a ofertelor.Documentele depuse se vor semna cu semnatura electronica extinsa si se vor posta in SEAP.
used
false
tp-abil
Proporția de subcontractare
Informatii privind subcontractantii (daca este cazul):
Ofertantul trebuie sa prezinte informatii privind partea din contract pe care operatorul economic are, eventual, intentia sa o subcontracteze. In cazul in care operatorul economic intentioneaza sa subcontracteze o parte din contract, acesta va preciza în ofertă categoriile de lucrări din contract pe care intenţionează să le subcontracteze, precum şi procentul aferent activităţilor indicate în ofertă ca fiind realizate de către subcontractanţi şi datele de identificare ale subcontractanţilor propuşi, dacă aceştia din urmă sunt cunoscuţi la momentul depunerii ofertei.
Subcontractanţii pe a căror capacităţi ofertantul/candidatul se bazează pentru demonstrarea îndeplinirii anumitor criterii de calificare şi selecţie sunt consideraţi şi terţi susţinători, caz în care acordul de subcontractare reprezintă, în acelaşi timp, şi angajamentul ferm.
Informatii privind tertul/tertii sustinatori
Capacitatea tehnică și/sau profesională a operatorului economic poate fi susținută în conformitate cu art. 182 din Legea nr. 98/2016. Operatorul economic are dreptul sa invoce sustinerea unui/unor tert/terti în ceea ce priveste situaţia economică şi financiară, respectiv capacitatea tehnică şi profesională, indiferent de natura relatiilor juridice existente între operatorul economic si tertul/tertii respectiv /respectivi.
În cazul în care ofertantul/candidatul îşi demonstrează situaţia economică şi financiară, respectiv capacitatea tehnică şi profesională, invocând suportul unui/unor terţ/terţi, în condiţiile Legii, atunci acesta are obligaţia de a dovedi susţinerea de care beneficiază prin prezentarea unui angajament ferm al persoanei respective, prin care se confirmă faptul că acesta va pune la dispoziţia ofertantului/candidatului resursele invocate. Odata cu angajamentul de sustinere, ofertantul/ candidatul are obligatia sa prezinte documente transmise acestuia de catre tertul/tertii sustinator /sustinatori, pot dovedi că deţin resursele invocate ca element de susţinere a ofertantului/candidatului.
Ofertantul/candidatul trebuie sa demonstreze că va dispune efectiv de resursele entităţilor ce acordă susţinerea, necesare pentru realizarea contractului, astfel ca Autoritatea contractanta va verifica daca tertul/tertii care asigura sustinerea, îndeplineste criteriile relevante privind capacitatea sau nu se încadreaza în motivele de excludere prevazute la art. 164, 165 si 167.
În scopul verificarii îndeplinirii criteriilor de calificare si selectie de catre tertul/tertii care acorda sustinere, în conditiile art. 183 alin.(1) din Lege, autoritatea contractanta poate solicita tertului/tertilor sustinator(i), oricând pe parcursul procesului de evaluare, documente si informatii suplimentare în legatura cu angajamentul dat sau cu documentele prezentate, în cazul în care exista rezerve în ceea ce priveste corectitudinea informatiilor sau documentelor prezentate sau cu privire la posibilitatea de executare a obligatiilor asumate prin respectivul angajament.
În cazul în care operatorul economic demonstreaza îndeplinirea criteriilor referitoare la capacitatea tehnica si profesionala invocând sustinerea unui tert, DUAE include informatiile cu privire la tertul sustinator.
Informatii privind asocierea
Se vor prezenta Informatii despre asociere (daca este cazul). În cazul depunerii unei oferte comune, fiecare operator economic membru al asocierii va prezenta DUAE. Acestia vor depune odata cu DUAE si acordul de asociere (din sectiunea formulare).
La solicitarea autorității contractante, doar ofertantul clasat pe locul I în clasamentul intermediar întocmit la finalizarea evaluării ofertelor va prezenta documente justificative ale asociaților care probează îndeplinirea cerinței privind capacitatea tehnică și profesională .Mai multi operatori economici au dreptul de a se asocia cu scopul de a depune oferta comuna, fara a fi obligati sa adopte sau sa constituie o anumita forma juridica pentru depunerea ofertei. In cazul in care mai multi operatori economici participa in comun la procedura de atribuire, indeplinirea criteriilor privind capacitatea tehnica si profesionala, se demonstreaza prin luarea in consideratie a resurselor tuturor membrilor grupului, iar autoritatea contractanta va solicta acestora sa raspunda in mod solidar pentru executarea contractului de achizitie publica. Oferta depusa de o asociere de operatori economici, trebuie sa indeplineasca urmatoarele cerinte:
a) sa fie semnata de fiecare reprezentant legal al fiecaruia dintre operatorii economici asociati;
b) sa includa un Acord de asociere al operatorilor economici care s-au asociat in vederea depunerii de oferta comuna.
c) structura asocierii NU va fi modificata pe întreaga durata a contractului decât cu aprobarea prealabila a autoritatii contractante. Fiecare subcontractant va completa un formular DUAE separat. Ofertantii vor incarca in mod obligatoriu in SEAP, impreuna cu DUAE si cu oferta, acordul/ acordurile de subcontractare incheiate intre contractant si subcontractantul/subcontractantii nominalizat / nominalizati in oferta.
Acordul/acordurile de subcontractare (din ,,Sectiunea Formulare” a Documentatiei de Atribuire) va/vor fi semnat/e cu semnatura electronica extinsa, bazata pe un certificat calificat, eliberat de un furnizor de servicii de certificare acreditat in conditiile legii. Acestea trebuie sa contina cel putin urmatoarele elemente: numele, datele de contact, reprezentantii legali ai subcontractantului; activitatile ce urmeaza a fi subcontractate; valoarea la care se ridica partea/partile subcontractate. In conformitate cu prevederile art. 218, alin (4) din Legea 98/2016, Autoritatea contractanta are obligatia de a solicita, la încheierea contractului, prezentarea contractului/ contractelor încheiate între contractant si subcontractantul/subcontractantii nominalizat/ nominalizati in oferta. Contractul/Contractele de subcontractare prezentate la incheierea contractului de achiz
used
false
tp-abil
Certificate emise de organisme independente cu privire la standardele de asigurare a calității
n baza Art. 200, alin. (1) din Legea 98/2016 privind achizitiile publice cu modificarile si completarile ulterioare. Ofertantii (operatori economici individuali sau operatorii economici ce participa in comun la procedura de atribuire) ce depun oferte trebuie sa faca dovada implementarii sistemului de management al calitatii conform SR ISO 9001 SAU ECHIVALENT , in termen de valabilitate la momentul prezentarii acesteia. La solicitarea autoritatii contractante, ofertantii clasati pe primele trei locuri in clasamentul final intocmit la finalizarea evaluarii ofertelor (inclusiv de catre ofertantul asociat al castigatorului procedurii/tertul sustinator, subcontractant, dupa caz), pana la data incheierii raportului procedurii de atribuire, vor prezenta ca documente justificative; dovada implementarii sistemului de management al calitatii conform SR EN ISO 9001 sau echivalent, prin prezentarea oricarui document prin care se sustine cerinta, de exemplu: un certificat emis de un organism de certificare sau alte documente care probeaza in mod concludent indeplinirea cerintei: proceduri/manuale de calitate, activitate procedurala etc similare cu cele prevazute drept conditie pentru obtinerea certificarii SR EN ISO 9001.
Ofertantii (operatori economici individuali sau operatorii economici ce participa in comun la procedura de atribuire) vor prezenta documente care sa probeze toate afirmatiile incluse in DUAE (raspuns) , in termen de valabilitate la momentul depunerii acestora.
i
used
false
sui-act
Înscrierea în registrul comerțului
n baza art.173 alin.1 din legea 98/2016, ofertantii (operatori economici individuali sau operatori economici ce participa in comun la procedura de atribuire) ce depun oferta trebuie sa dovedeasca o forma de inregistrare in registre comerciale ( precum si obiectul de activitate) in conditiile legii din tara de rezidenta, precum si ca este legal constituit, ca nu se afla in niciuna din situatiile de anulare a constituirii precum si faptul ca are capacitatea profesionala de a realiza activitatile care fac obiectul contractului. La solicitarea expresa a autoritatii contractante si in aplicarea prevederilor art. 196 din legea 98/2016 transmisa ca urmare a finalizarii procesului de evaluare, ofertantii (operatorul economic individual sau operatorii economici ce participa in comun la procedura de atribuire) clasati pe primele 3 locuri in clasametul final si dupa aplicarea criteriului de atribuire asupra ofertelor admisibile stabilit in documentatia de atribuire, vor demostra indeplinirea cerintei minime prin prezentarea certificatului ONRC sau pentru ofertantii straini, document echivalent emis in tara de rezidenta care sa probeze toate informatiile incluse in DUAE (raspuns) rubrica "Inscrierea in registr
used
false
ef-stand
n-used
not-allowed
no-eu-funds
not-requ
false
Documentatia de achizitie
non-restricted-document
https://e-licitatie.ro/pub/notices/c-notice/v2/view/100179098
true
Asociere conform art. 53. din Legea privind achizitiile publice nr 98/2016
bankr-nat.
partic-confl.
misinterpr.
socsec-law.
cred-arran.
bankruptcy.
insolvency.
prof-misconduct.
labour-law.
liq-admin.
envir-law.
susp-act.
distorsion.
prep-confl.
sanction.
none
no
allowed
required
price
Pretul ofertei
Pretul cel mai scazut este singurul criteriu
ORG-0004
https://www.e-licitatie.ro
ORG-0004
ORG-0004
5
Precizari privind termenul (termenele) pentru procedurile de contestareCf.art.8 din Lg nr.101/2016"..Pers care se consideră vătămată de un act al autorității contractant.poate sesiza Consiliul în vederea anulării actului,obligării acesteia la emiterea unui act sau la adoptarea de măsuri de remediere...in:a)10 zile,începând cu ziua următoare luării la cunoștință despre actul autorității considerat nelegal,când val estimată a procedurii e egală sau mai mare decât pragurile valorice;b)7 zile,când v
ORG-0002
RON
true
false
required
false
2024-05-22+03:00
15:00:00.0000000+03:00
2024-05-22+03:00
15:00:00.0000000+03:00
In SEAP
false
3
fa-wo-rc
none
27
COMBINATII (NETILMICINUM+DEXAMETHASONUM) GEL OFT. IN RECIPIENT UNIDOZA 3mg/ml+1mg/ml 3mg/ml+1mg/ml
Spitalul Judetean de Urgenta Tulcea intenționează să achiziționeze diverse medicamente, pentru realizarea actelor medicale la standardele de calitate impuse de legislația în domeniul serviciilor medicale.
Estimarile cantitatilor minime si maxime ale Acordului-Cadru si ale Contractelor Subsecvente sunt prevazute in caietul de sarcini.
supplies
33600000
Produsele vor fi livrate la sediul beneficiarului, Spitalul Judetean de Urgenta Tulcea strada 1848 nr.32 respectiv magazia de medicamente a Farmaciei cu circuit inchis.
RO225
ROU
48
0
LOT-0028
sui-act
III.1.1.a) Situatia personala a candidatului sau ofertantului
Ofertantii, asociatii,tertii sustinatori si subcontractantii nu trebuie sa se regaseasca în situatiile prevazute la art. 164, 165, 166, 167 din Legea nr.98/2016.
Documentele justificative care probeaza indeplinirea celor asumate prin completare DUAE pot fi:
1)Declaratie privind neincadrarea in prevederile art. 164 din Legea nr. 98/2016 privind achizitiile publice.
Pentru neincadrarea in prev art.164 din Legea 98/2016 se va prezenta: cazierul judiciar al operatorului economic si al membrilor organului de administrare, de conducere sau de supraveghere al respectivului op. economic, sau a celor ce au putere de reprezentare, de decizie sau de control in cadrul acestuia, asa cum rezulta din certificatul constatator emis de ONRC./actul constitutiv, valabile la momentul prezentarii.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre op. ec. participanti la procedura de atribuire cu informatiile aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
2)Declaratie privind neincadrarea in prevederile art. 165 din Legea nr. 98/2016 privind achizitiile publice coroborat cu art. 166 (2) din acelasi act normativ,respectiv:
a) CERTIFICAT DE ATESTARE FISCALA pentru persoane juridice privind obligatiile de plata la bugetul consolidat al statului in termen de valabilitate, certificat din care sa reiasa ca ofertantul nu are datorii scadente la data solicitarii acestuia sau valoarea acestor datorii se incadreaza in pragul valoric prevazute la art. 166 alin.(2) din Legea nr. 98/2016 privind Achizitiile Publice cu modificarile si completarile ulterioare;
Op. ec. (ofertant unic, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE.
b) CERTIFICAT DE ATESTARE FISCALA pentru persoane juridice privind impozitele si taxele locale si alte venituri datorate bugetului local, din care sa reiasa ca ofertantul nu are datorii scadente la data solicitarii acestuia pentru sediul social. Declaraţie pe propria răspundere privind îndeplinirea obligaţiilor de plată a impozitelor, taxelor sau contribuţiilor la bugetul general consolidat datorate”pentru sediile secundare/punctele de lucru. Documentul este solicitat pentru a certifica situatia reala a ofertantului.
Operatorul economic (ofertant unic, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre operatorii economici participanti la procedura de atribuire cu inf. aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
3)Declaratie privind neincadrarea in prevederile art. 167 din Legea nr. 98/2016 privind achizitiile publice cu modificarile si completarile ulterioare;
Op. ec. (lider, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE. Încadrarea în situatia prevazuta la art. 167 din Legea nr. 98/2016 privind achizitiile publice modificarile si completarile ulterioare atrage excluderea ofertantului din procedura pentru atribuirea acordului cadru.
Pentru neincadrarea in prev art.164 din Legea 98/2016 se va prezenta: cazierul judiciar al operatorului economic si al membrilor organului de administrare, de conducere sau de supraveghere al respectivului op. economic, sau a celor ce au putere de reprezentare, de decizie sau de control in cadrul acestuia, asa cum rezulta din certificatul constatator emis de ONRC./actul constitutiv, valabile la momentul prezentarii.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre op. ec. participanti la procedura de atribuire cu informatiile aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
4) Declaratie privind neincadrarea in prevederile art. 59 si 60 din Legea nr. 98/2016 privind achizitiile publice modificarile si completarile ulterioare;
Operatorul economic (ofertant unic, asociat, tert sustinator, subcontract.) va completa cerinta coresp. in formularul DUAE. Încadrarea în situatia prevazuta la art. 59 si 60 din Legea nr. 98/2016 privind achizit. publice modif. si compl. ulterioare atrage excluderea ofertantului din procedura pentru atribuirea acordului cadru.
Ofertantul nu trebuie sa se afle in conflict de interese cu oricare din urmatoarele persoane care detin functii de decizie în cadrul autoritatii contractante:
-Nastasescu Tudor-Ion – Manager al Spitalului Judetean de Urgenta Tulcea;
-Beschieriu-Ionita Bogdan – Director Financiar Contabil;-Molceanu Elena - Director medical;-Armeanu Lavinia - Director ingrijiri;-Gheba Victoria - Director Administrativ;-Manole Valentin - Sef.Serviciu Juridic – Runos.
In si
used
false
sui-act
III.1.1.b) Capacitatea de exercitare a activitatii profesionale
Operatorii economici ce depun oferta trebuie sa dovedeasca o forma de înregistrare în conditiile legii din tara de rezidenta, sa reiasaca operatorul economic este legal constituit, ca nu se afla în niciuna dintre situatiile de anulare a constituirii precum și faptul ca are capacitatea profesionala de a realiza activitatile care fac obiectul contractului.
Modalitatea prin care poate fi demonstrata îndeplinirea cerintei: se completeaza DUAE, documentele justificative care probeaza îndeplinirea celor asumate prin completarea DUAE, respectiv certificat constatator emis de ONRC,sau în cazul ofertantilor straini, documente echivalente emise în tara de rezidenta, urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final intocmit la finalizarea evaluarii ofertelor si dupa aplicarea criteriului de atribuire (inclusiv de catre ofertantul asociat al castigatorului procedurii/tertul sustinator, subcontractant, dupa caz), pana la data incheierii raportului procedurii de atribuire.
La procedura de achizitie pot participa numai operatorii economici autorizati de Agentia Nationala a Medicamentelor si Dispozitivelor Medicale conform Ghidului privind buna practica de distributie angro in Romania Avand in vedere cap.7; art.800 si urmatoarele din Legea 95/2006, distributia angro de medicamente se face de catre posesorii unei autorizatii pentru desfasurarea activitatii de distribuitor angro de medicamente, care precizeaza sediul/sediile de pe teritoriul României pentru care este valabila, autorizatia eliberata de Agentia Nationala a Medicamentului si Dispozitivelor Medicale – valabila la data prezentarii.
Modalitate de indeplinire: completare DUAE, urmand ca documentul justificativ, respectiv Autorizatia de distributie angro sau in cazul ofertantilor straini document echivalent emis in tara de rezidenta (in limba in care a fost emis,insotit de traducerea in limba romana efectuata in mod obligatoriu de catre traducatori autorizati), sa fie prezentate odata cu propunerea tehnica (inclusiv de catre asociat, subcontractant),pana la data si ora limita de depunere a ofertelor.Documentele depuse se vor semna cu semnatura electronica extinsa si se vor posta in SEAP.
used
false
tp-abil
Proporția de subcontractare
Informatii privind subcontractantii (daca este cazul):
Ofertantul trebuie sa prezinte informatii privind partea din contract pe care operatorul economic are, eventual, intentia sa o subcontracteze. In cazul in care operatorul economic intentioneaza sa subcontracteze o parte din contract, acesta va preciza în ofertă categoriile de lucrări din contract pe care intenţionează să le subcontracteze, precum şi procentul aferent activităţilor indicate în ofertă ca fiind realizate de către subcontractanţi şi datele de identificare ale subcontractanţilor propuşi, dacă aceştia din urmă sunt cunoscuţi la momentul depunerii ofertei.
Subcontractanţii pe a căror capacităţi ofertantul/candidatul se bazează pentru demonstrarea îndeplinirii anumitor criterii de calificare şi selecţie sunt consideraţi şi terţi susţinători, caz în care acordul de subcontractare reprezintă, în acelaşi timp, şi angajamentul ferm.
Informatii privind tertul/tertii sustinatori
Capacitatea tehnică și/sau profesională a operatorului economic poate fi susținută în conformitate cu art. 182 din Legea nr. 98/2016. Operatorul economic are dreptul sa invoce sustinerea unui/unor tert/terti în ceea ce priveste situaţia economică şi financiară, respectiv capacitatea tehnică şi profesională, indiferent de natura relatiilor juridice existente între operatorul economic si tertul/tertii respectiv /respectivi.
În cazul în care ofertantul/candidatul îşi demonstrează situaţia economică şi financiară, respectiv capacitatea tehnică şi profesională, invocând suportul unui/unor terţ/terţi, în condiţiile Legii, atunci acesta are obligaţia de a dovedi susţinerea de care beneficiază prin prezentarea unui angajament ferm al persoanei respective, prin care se confirmă faptul că acesta va pune la dispoziţia ofertantului/candidatului resursele invocate. Odata cu angajamentul de sustinere, ofertantul/ candidatul are obligatia sa prezinte documente transmise acestuia de catre tertul/tertii sustinator /sustinatori, pot dovedi că deţin resursele invocate ca element de susţinere a ofertantului/candidatului.
Ofertantul/candidatul trebuie sa demonstreze că va dispune efectiv de resursele entităţilor ce acordă susţinerea, necesare pentru realizarea contractului, astfel ca Autoritatea contractanta va verifica daca tertul/tertii care asigura sustinerea, îndeplineste criteriile relevante privind capacitatea sau nu se încadreaza în motivele de excludere prevazute la art. 164, 165 si 167.
În scopul verificarii îndeplinirii criteriilor de calificare si selectie de catre tertul/tertii care acorda sustinere, în conditiile art. 183 alin.(1) din Lege, autoritatea contractanta poate solicita tertului/tertilor sustinator(i), oricând pe parcursul procesului de evaluare, documente si informatii suplimentare în legatura cu angajamentul dat sau cu documentele prezentate, în cazul în care exista rezerve în ceea ce priveste corectitudinea informatiilor sau documentelor prezentate sau cu privire la posibilitatea de executare a obligatiilor asumate prin respectivul angajament.
În cazul în care operatorul economic demonstreaza îndeplinirea criteriilor referitoare la capacitatea tehnica si profesionala invocând sustinerea unui tert, DUAE include informatiile cu privire la tertul sustinator.
Informatii privind asocierea
Se vor prezenta Informatii despre asociere (daca este cazul). În cazul depunerii unei oferte comune, fiecare operator economic membru al asocierii va prezenta DUAE. Acestia vor depune odata cu DUAE si acordul de asociere (din sectiunea formulare).
La solicitarea autorității contractante, doar ofertantul clasat pe locul I în clasamentul intermediar întocmit la finalizarea evaluării ofertelor va prezenta documente justificative ale asociaților care probează îndeplinirea cerinței privind capacitatea tehnică și profesională .Mai multi operatori economici au dreptul de a se asocia cu scopul de a depune oferta comuna, fara a fi obligati sa adopte sau sa constituie o anumita forma juridica pentru depunerea ofertei. In cazul in care mai multi operatori economici participa in comun la procedura de atribuire, indeplinirea criteriilor privind capacitatea tehnica si profesionala, se demonstreaza prin luarea in consideratie a resurselor tuturor membrilor grupului, iar autoritatea contractanta va solicta acestora sa raspunda in mod solidar pentru executarea contractului de achizitie publica. Oferta depusa de o asociere de operatori economici, trebuie sa indeplineasca urmatoarele cerinte:
a) sa fie semnata de fiecare reprezentant legal al fiecaruia dintre operatorii economici asociati;
b) sa includa un Acord de asociere al operatorilor economici care s-au asociat in vederea depunerii de oferta comuna.
c) structura asocierii NU va fi modificata pe întreaga durata a contractului decât cu aprobarea prealabila a autoritatii contractante. Fiecare subcontractant va completa un formular DUAE separat. Ofertantii vor incarca in mod obligatoriu in SEAP, impreuna cu DUAE si cu oferta, acordul/ acordurile de subcontractare incheiate intre contractant si subcontractantul/subcontractantii nominalizat / nominalizati in oferta.
Acordul/acordurile de subcontractare (din ,,Sectiunea Formulare” a Documentatiei de Atribuire) va/vor fi semnat/e cu semnatura electronica extinsa, bazata pe un certificat calificat, eliberat de un furnizor de servicii de certificare acreditat in conditiile legii. Acestea trebuie sa contina cel putin urmatoarele elemente: numele, datele de contact, reprezentantii legali ai subcontractantului; activitatile ce urmeaza a fi subcontractate; valoarea la care se ridica partea/partile subcontractate. In conformitate cu prevederile art. 218, alin (4) din Legea 98/2016, Autoritatea contractanta are obligatia de a solicita, la încheierea contractului, prezentarea contractului/ contractelor încheiate între contractant si subcontractantul/subcontractantii nominalizat/ nominalizati in oferta. Contractul/Contractele de subcontractare prezentate la incheierea contractului de achiz
used
false
tp-abil
Certificate emise de organisme independente cu privire la standardele de asigurare a calității
n baza Art. 200, alin. (1) din Legea 98/2016 privind achizitiile publice cu modificarile si completarile ulterioare. Ofertantii (operatori economici individuali sau operatorii economici ce participa in comun la procedura de atribuire) ce depun oferte trebuie sa faca dovada implementarii sistemului de management al calitatii conform SR ISO 9001 SAU ECHIVALENT , in termen de valabilitate la momentul prezentarii acesteia. La solicitarea autoritatii contractante, ofertantii clasati pe primele trei locuri in clasamentul final intocmit la finalizarea evaluarii ofertelor (inclusiv de catre ofertantul asociat al castigatorului procedurii/tertul sustinator, subcontractant, dupa caz), pana la data incheierii raportului procedurii de atribuire, vor prezenta ca documente justificative; dovada implementarii sistemului de management al calitatii conform SR EN ISO 9001 sau echivalent, prin prezentarea oricarui document prin care se sustine cerinta, de exemplu: un certificat emis de un organism de certificare sau alte documente care probeaza in mod concludent indeplinirea cerintei: proceduri/manuale de calitate, activitate procedurala etc similare cu cele prevazute drept conditie pentru obtinerea certificarii SR EN ISO 9001.
Ofertantii (operatori economici individuali sau operatorii economici ce participa in comun la procedura de atribuire) vor prezenta documente care sa probeze toate afirmatiile incluse in DUAE (raspuns) , in termen de valabilitate la momentul depunerii acestora.
i
used
false
sui-act
Înscrierea în registrul comerțului
n baza art.173 alin.1 din legea 98/2016, ofertantii (operatori economici individuali sau operatori economici ce participa in comun la procedura de atribuire) ce depun oferta trebuie sa dovedeasca o forma de inregistrare in registre comerciale ( precum si obiectul de activitate) in conditiile legii din tara de rezidenta, precum si ca este legal constituit, ca nu se afla in niciuna din situatiile de anulare a constituirii precum si faptul ca are capacitatea profesionala de a realiza activitatile care fac obiectul contractului. La solicitarea expresa a autoritatii contractante si in aplicarea prevederilor art. 196 din legea 98/2016 transmisa ca urmare a finalizarii procesului de evaluare, ofertantii (operatorul economic individual sau operatorii economici ce participa in comun la procedura de atribuire) clasati pe primele 3 locuri in clasametul final si dupa aplicarea criteriului de atribuire asupra ofertelor admisibile stabilit in documentatia de atribuire, vor demostra indeplinirea cerintei minime prin prezentarea certificatului ONRC sau pentru ofertantii straini, document echivalent emis in tara de rezidenta care sa probeze toate informatiile incluse in DUAE (raspuns) rubrica "Inscrierea in registr
used
false
ef-stand
n-used
not-allowed
no-eu-funds
not-requ
false
Documentatia de achizitie
non-restricted-document
https://e-licitatie.ro/pub/notices/c-notice/v2/view/100179098
true
Asociere conform art. 53. din Legea privind achizitiile publice nr 98/2016
bankr-nat.
partic-confl.
misinterpr.
socsec-law.
cred-arran.
bankruptcy.
insolvency.
prof-misconduct.
labour-law.
liq-admin.
envir-law.
susp-act.
distorsion.
prep-confl.
sanction.
none
no
allowed
required
price
Pretul ofertei
Pretul cel mai scazut este singurul criteriu
ORG-0004
https://www.e-licitatie.ro
ORG-0004
ORG-0004
5
Precizari privind termenul (termenele) pentru procedurile de contestareCf.art.8 din Lg nr.101/2016"..Pers care se consideră vătămată de un act al autorității contractant.poate sesiza Consiliul în vederea anulării actului,obligării acesteia la emiterea unui act sau la adoptarea de măsuri de remediere...in:a)10 zile,începând cu ziua următoare luării la cunoștință despre actul autorității considerat nelegal,când val estimată a procedurii e egală sau mai mare decât pragurile valorice;b)7 zile,când v
ORG-0002
RON
true
false
required
false
2024-05-22+03:00
15:00:00.0000000+03:00
2024-05-22+03:00
15:00:00.0000000+03:00
In SEAP
false
3
fa-wo-rc
none
28
COMBINATII (TOBRAMYCINUM + DEXAMETAZONUM) UNG. OFT. 3mg/1mg/g tub-3,5 g.
Spitalul Judetean de Urgenta Tulcea intenționează să achiziționeze diverse medicamente, pentru realizarea actelor medicale la standardele de calitate impuse de legislația în domeniul serviciilor medicale.
Estimarile cantitatilor minime si maxime ale Acordului-Cadru si ale Contractelor Subsecvente sunt prevazute in caietul de sarcini.
supplies
33600000
Produsele vor fi livrate la sediul beneficiarului, Spitalul Judetean de Urgenta Tulcea strada 1848 nr.32 respectiv magazia de medicamente a Farmaciei cu circuit inchis.
RO225
ROU
48
0
LOT-0029
sui-act
III.1.1.a) Situatia personala a candidatului sau ofertantului
Ofertantii, asociatii,tertii sustinatori si subcontractantii nu trebuie sa se regaseasca în situatiile prevazute la art. 164, 165, 166, 167 din Legea nr.98/2016.
Documentele justificative care probeaza indeplinirea celor asumate prin completare DUAE pot fi:
1)Declaratie privind neincadrarea in prevederile art. 164 din Legea nr. 98/2016 privind achizitiile publice.
Pentru neincadrarea in prev art.164 din Legea 98/2016 se va prezenta: cazierul judiciar al operatorului economic si al membrilor organului de administrare, de conducere sau de supraveghere al respectivului op. economic, sau a celor ce au putere de reprezentare, de decizie sau de control in cadrul acestuia, asa cum rezulta din certificatul constatator emis de ONRC./actul constitutiv, valabile la momentul prezentarii.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre op. ec. participanti la procedura de atribuire cu informatiile aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
2)Declaratie privind neincadrarea in prevederile art. 165 din Legea nr. 98/2016 privind achizitiile publice coroborat cu art. 166 (2) din acelasi act normativ,respectiv:
a) CERTIFICAT DE ATESTARE FISCALA pentru persoane juridice privind obligatiile de plata la bugetul consolidat al statului in termen de valabilitate, certificat din care sa reiasa ca ofertantul nu are datorii scadente la data solicitarii acestuia sau valoarea acestor datorii se incadreaza in pragul valoric prevazute la art. 166 alin.(2) din Legea nr. 98/2016 privind Achizitiile Publice cu modificarile si completarile ulterioare;
Op. ec. (ofertant unic, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE.
b) CERTIFICAT DE ATESTARE FISCALA pentru persoane juridice privind impozitele si taxele locale si alte venituri datorate bugetului local, din care sa reiasa ca ofertantul nu are datorii scadente la data solicitarii acestuia pentru sediul social. Declaraţie pe propria răspundere privind îndeplinirea obligaţiilor de plată a impozitelor, taxelor sau contribuţiilor la bugetul general consolidat datorate”pentru sediile secundare/punctele de lucru. Documentul este solicitat pentru a certifica situatia reala a ofertantului.
Operatorul economic (ofertant unic, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE.
Modalitatea prin care poate fi demonstrata indeplinirea cerintei: se va completa DUAE de catre operatorii economici participanti la procedura de atribuire cu inf. aferente situatiei lor. Documentele justificative care probeaza indeplinirea celor asumate prin completarea DUAE urmeaza a fi prezentate, la solicitarea autoritatii contractante, doar de catre ofertantii clasati pe primele 3 locuri in clasamentul final si aplicarea criteriului de atribuire stabilit in documentatia de atribuire (inclusiv de catre ofertantul asociat al castigatorului procdurii sau tertul sustinator, subcontractant, dupa caz) pana la data incheierii raportului procedurii de atribuire.
3)Declaratie privind neincadrarea in prevederile art. 167 din Legea nr. 98/2016 privind achizitiile publice cu modificarile si completarile ulterioare;
Op. ec. (lider, asociat, tert sustinator, subcontractant) va completa cerinta corespunzatoare in formularul DUAE. Încadrarea în situatia prevazuta la art. 167 din Legea nr. 98/2016 privind achizitiile publice modificarile si completarile ulterioare atrage excluderea ofertantului din procedura pentru atribuirea acordului cadru.
Pentru neincadrarea in prev art.164 din Legea 98/2016 se va prezenta: cazierul judiciar al operatorului economic si al membrilor organului de administrare, de conducere sau de supraveghere al respectivului op. economic, sau a celor ce au putere de reprezentare, de decizie sau de control in cadrul acestuia, asa cum rezulta din certificatul constatator emis de ONRC./actul constitutiv, valabile la momentul prezentarii.
| 47,995 |
https://github.com/Ameg-yag/TLS-Attacker/blob/master/TLS-Core/src/main/java/de/rub/nds/tlsattacker/core/protocol/preparator/extension/PWDClearExtensionPreparator.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,019 |
TLS-Attacker
|
Ameg-yag
|
Java
|
Code
| 108 | 514 |
/**
* TLS-Attacker - A Modular Penetration Testing Framework for TLS
*
* Copyright 2014-2017 Ruhr University Bochum / Hackmanit GmbH
*
* Licensed under Apache License 2.0
* http://www.apache.org/licenses/LICENSE-2.0
*/
package de.rub.nds.tlsattacker.core.protocol.preparator.extension;
import de.rub.nds.tlsattacker.core.protocol.message.extension.PWDClearExtensionMessage;
import de.rub.nds.tlsattacker.core.protocol.serializer.extension.PWDClearExtensionSerializer;
import de.rub.nds.tlsattacker.core.workflow.chooser.Chooser;
import org.apache.logging.log4j.LogManager;
import org.apache.logging.log4j.Logger;
public class PWDClearExtensionPreparator extends ExtensionPreparator<PWDClearExtensionMessage> {
private static final Logger LOGGER = LogManager.getLogger();
private final PWDClearExtensionMessage msg;
public PWDClearExtensionPreparator(Chooser chooser, PWDClearExtensionMessage message,
PWDClearExtensionSerializer serializer) {
super(chooser, message, serializer);
this.msg = message;
}
@Override
public void prepareExtensionContent() {
LOGGER.debug("Preparing PWDClearExtension");
prepareUsername(msg);
prepareUsernameLength(msg);
}
private void prepareUsername(PWDClearExtensionMessage msg) {
msg.setUsername(chooser.getClientPWDUsername());
LOGGER.debug("Username: " + msg.getUsername().getValue());
}
private void prepareUsernameLength(PWDClearExtensionMessage msg) {
msg.setUsernameLength(msg.getUsername().getValue().length());
LOGGER.debug("UsernameLength: " + msg.getUsernameLength().getValue());
}
}
| 15,369 |
https://github.com/dropecamargo/signsupply/blob/master/database/migrations/2017_03_10_145400_create_tipoajuste_table.php
|
Github Open Source
|
Open Source
|
MIT
| null |
signsupply
|
dropecamargo
|
PHP
|
Code
| 61 | 300 |
<?php
use Illuminate\Database\Schema\Blueprint;
use Illuminate\Database\Migrations\Migration;
class CreateTipoajusteTable extends Migration
{
/**
* Run the migrations.
*
* @return void
*/
public function up()
{
Schema::create('tipoajuste', function (Blueprint $table){
$table->engine = 'InnoDB';
$table->increments('id');
$table->string('tipoajuste_nombre', 25);
$table->string('tipoajuste_sigla', 3)->unique();
$table->string('tipoajuste_tipo', 1);
$table->boolean('tipoajuste_activo')->default(false);
$table->integer('tipoajuste_cuenta')->unsigned();
$table->boolean('tipoajuste_calculaiva')->default(0);
$table->foreign('tipoajuste_cuenta')->references('id')->on('plancuentas')->onDelete('restrict');
});
}
/**
* Reverse the migrations.
*
* @return void
*/
public function down()
{
Schema::dropIfExists('tipoajuste');
}
}
| 35,150 |
https://ja.wikipedia.org/wiki/%E6%9B%B8%E3%81%8D%E3%81%8B%E3%81%91%E3%81%AE%E6%89%8B%E7%B4%99
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
書きかけの手紙
|
https://ja.wikipedia.org/w/index.php?title=書きかけの手紙&action=history
|
Japanese
|
Spoken
| 23 | 219 |
『書きかけの手紙』（かきかけのてがみ）は日本のシンガーソングライター鬼束ちひろの配信限定シングル。
解説
シングルとしては、『End of the world』より約1年3ヶ月振りの発売となる。
ベスト・アルバム『REQUIEM AND SILENCE』からのリカット・シングル。
収録曲
書きかけの手紙
編曲：坂本昌之
脚注
外部リンク
VICTER ENTERTAINMENT 紹介ページ 書きかけの手紙
インタビュー Mikiki
鬼束ちひろの楽曲
2020年のリカット・シングル
手紙を題材とした楽曲
| 41,357 |
https://fr.wikipedia.org/wiki/Vadime%20Elisseeff
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Vadime Elisseeff
|
https://fr.wikipedia.org/w/index.php?title=Vadime Elisseeff&action=history
|
French
|
Spoken
| 579 | 1,049 |
Vadime Elisseeff, né le à Saint-Pétersbourg et mort le , est un historien et un historien de l'art français, spécialiste de l'Extrême-Orient.
Biographie
Jeunesse et études
Il est le fils de Serge Elisseeff, premier occidental à avoir intégré l’université de Tokyo et éminent spécialiste de la littérature japonaise. Sa mère, Veira Eiche, est peintre.
Vadime obtient ses diplômes de chinois et de japonais à l’École nationale des langues orientales vivantes (futur INALCO), dont il préside l'association des anciens élèves de 1976 à 1983.
Mort le , Vadime était l’époux de Danielle Elisseeff, née Poisle, qu’il avait épousée en 1969.
Parcours professionnel
Il est nommé en 1941 attaché au musée Cernuschi auprès de René Grousset. En 1944, il travaille, en tant qu’attaché culturel, à l’ambassade de France en Chine. Il rapporte à son retour en 1946 la première grande exposition de peinture chinoise contemporaine au musée Cernuschi. Il est alors nommé conservateur-adjoint par René Grousset.
Parallèlement, il enseigne à l’École du Louvre l’archéologie et les arts de la Chine et du Japon jusqu’à son départ pour le Japon en 1949. Il y assume alors la charge de directeur de la Maison franco-japonaise de Tokyo et de l’Institut franco-japonais de Kyoto, puis celle de conseiller culturel de l’Ambassade de France.
En 1952, il hérite du poste de directeur du musée Cernuschi, laissé vacant à la suite du décès de René Grousset. Il reprend également sa chaire à l’École du Louvre, tout en enseignant l’histoire et la géographie de l’Extrême-Orient à l'École des langues orientales jusqu’en 1956.
Cofondateur du Centre de Documentation pour la Chine contemporaine en 1957, il en est également le premier directeur (1957-1959). Durant près de trente ans, il enseigna aussi à l’École pratique des hautes études l’art et l’archéologie d’Extrême-Orient. Il enseigne par ailleurs à l'Institut d'études politiques de Paris. Devenu Inspecteur général des musées de la ville, il obtient la direction du musée Guimet en 1982.
L’ensemble de ses travaux lui valut en 1983 d’obtenir le Grand Prix National d’Histoire. Toutefois, il obtint de nombreuses autres distinctions, et était notamment Commandeur de la Légion d’honneur, Officier des Arts et des Lettres et des Palmes Académiques, Officier du Soleil Levant et Commandeur du Trésor Sacré du Japon, Chevalier de l’ordre de la Couronne belge, Grande Médaille de Vermeil de la Ville de Paris.
Il est à noter que Vadime Elisseeff œuvra également beaucoup à l’Unesco. Membre fondateur du Conseil international des musées (ICOM) en 1946, il fut vice-président du comité culturel de la commission française de 1974 à 1990. De même, il présida la Commission Internationale pour l’étude intégrale des Routes de la Soie de 1990 à 1999.
Publications
Japon Immortel, Del Duca, Paris, 1954.
Japon, Nagel, Paris, 1974.
La civilisation japonaise, avec Danielle Elisseeff, Arthaud, collection "Grandes Civilisations", Paris, 1974.
Le Bronze dans l'art japonais, le Bronze industriel René Loiseau, Paris, 1976.
La civilisation de la Chine classique, avec Danielle Elisseeff, Arthaud, collection "Grandes Civilisations", Paris, 1979.
L'art de l'ancien Japon, avec Danielle Elisseeff, Lucien Mazenod, collection "L'art et les grandes civilisations", L. Mazenod, Argenteuil, 1980.
Nouvelles découvertes en Chine : l'histoire revue par l'archéologie, avec Danielle Elisseeff, Office du livre, 1983.
The Silk Roads : Highways of Culture, Unesco, Paris, 1998.
Références
Voir aussi
Liens externes
Bibliographie
Arts Asiatiques, vol. 57, 2002, pp. 229–231.
Historien français du XXe siècle
Naissance à Saint-Pétersbourg
Naissance en mai 1918
Décès en janvier 2002
Décès à 83 ans
Enseignant à l'École du Louvre
Enseignant à l'Institut d'études politiques de Paris
| 660 |
https://github.com/sharaf84/digi/blob/master/backend/themes/metronic/profile/index.php
|
Github Open Source
|
Open Source
|
BSD-3-Clause
| null |
digi
|
sharaf84
|
PHP
|
Code
| 213 | 881 |
<?php
use yii\helpers\Html;
use yii\widgets\Pjax;
use yii\widgets\ListView;
use digi\metronic\widgets\Breadcrumbs;
/* @var $this yii\web\View */
/* @var $searchModel common\models\custom\search\Profile */
/* @var $dataProvider yii\data\ActiveDataProvider */
$this->title = Yii::t('app', 'Profiles');
$this->params['breadcrumbs'][] = $this->title;
?>
<div class="page-content profile-index">
<!-- BEGIN STYLE CUSTOMIZER -->
<?= $this->render('@metronicTheme/layouts/themePanel.php'); ?>
<!-- END STYLE CUSTOMIZER -->
<!-- BEGIN PAGE HEADER-->
<h3 class="page-title">
<?= Html::encode($this->title) ?>
</h3>
<div class="page-bar">
<?= Breadcrumbs::widget([
'links' => isset($this->params['breadcrumbs']) ? $this->params['breadcrumbs'] : [],
])
?>
<div class="page-toolbar">
<div class="btn-group pull-right">
<button type="button" class="btn btn-fit-height grey-salt dropdown-toggle" data-toggle="dropdown" data-hover="dropdown" data-delay="1000" data-close-others="true">
Actions <i class="fa fa-angle-down"></i>
</button>
<ul class="dropdown-menu pull-right" role="menu">
<li>
<?= Html::a(Yii::t('app', 'Create Profile'), ['create'], ['class' => '']) ?>
</li>
</ul>
</div>
</div>
</div>
<!-- END PAGE HEADER-->
<!-- BEGIN PAGE CONTENT-->
<div class="row">
<div class="col-md-12">
<!--Yii Table-->
<div class="portlet box grey-cascade">
<div class="portlet-title">
<div class="caption">
<i class="fa fa-cogs"></i><?= $this->title ?> Grid
</div>
<div class="tools">
<!--<a href="javascript:;" class="reload" onclick="$.pjax.reload({container: #pjaxProfileGrid});"></a>-->
<a href="javascript:;" class="collapse"></a>
</div>
</div>
<div class="portlet-body">
<div class="table-toolbar">
<div class="row">
<div class="col-md-6">
<div class="btn-group">
<?= Html::a('Add New <i class="fa fa-plus"></i>', ['create'], ['class' => 'btn green']) ?>
</div>
</div>
</div>
</div>
<?= ListView::widget([
'dataProvider' => $dataProvider,
'itemOptions' => ['class' => 'item'],
'itemView' => function ($model, $key, $index, $widget) {
return Html::a(Html::encode($model->id), ['view', 'id' => $model->id]);
},
]) ?>
</div>
</div>
</div>
</div>
<!-- END PAGE CONTENT-->
</div>
| 34,140 |
https://github.com/werkt/bazel/blob/master/src/test/java/com/google/devtools/build/lib/vfs/FileSystemUtilsTest.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
bazel
|
werkt
|
Java
|
Code
| 1,937 | 9,951 |
// Copyright 2014 The Bazel Authors. All rights reserved.
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
package com.google.devtools.build.lib.vfs;
import static com.google.common.truth.Truth.assertThat;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.appendWithoutExtension;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.commonAncestor;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.copyFile;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.copyTool;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.moveFile;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.relativePath;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.removeExtension;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.touchFile;
import static com.google.devtools.build.lib.vfs.FileSystemUtils.traverseTree;
import static java.nio.charset.StandardCharsets.ISO_8859_1;
import static java.nio.charset.StandardCharsets.UTF_8;
import static org.junit.Assert.assertThrows;
import com.google.common.collect.Lists;
import com.google.devtools.build.lib.testutil.BlazeTestUtils;
import com.google.devtools.build.lib.testutil.ManualClock;
import com.google.devtools.build.lib.vfs.FileSystemUtils.MoveResult;
import com.google.devtools.build.lib.vfs.inmemoryfs.InMemoryFileSystem;
import java.io.FileNotFoundException;
import java.io.IOException;
import java.nio.charset.StandardCharsets;
import java.util.Arrays;
import java.util.Collection;
import org.junit.Before;
import org.junit.Test;
import org.junit.runner.RunWith;
import org.junit.runners.JUnit4;
/**
* This class tests the file system utilities.
*/
@RunWith(JUnit4.class)
public class FileSystemUtilsTest {
private ManualClock clock;
private FileSystem fileSystem;
private Path workingDir;
@Before
public final void initializeFileSystem() throws Exception {
clock = new ManualClock();
fileSystem = new InMemoryFileSystem(clock);
workingDir = fileSystem.getPath("/workingDir");
workingDir.createDirectory();
}
Path topDir;
Path file1;
Path file2;
Path aDir;
Path bDir;
Path file3;
Path innerDir;
Path link1;
Path dirLink;
Path file4;
Path file5;
/*
* Build a directory tree that looks like:
* top-dir/
* file-1
* file-2
* a-dir/
* file-3
* inner-dir/
* link-1 => file-4
* dir-link => b-dir
* file-4
*/
private void createTestDirectoryTree() throws IOException {
topDir = fileSystem.getPath("/top-dir");
file1 = fileSystem.getPath("/top-dir/file-1");
file2 = fileSystem.getPath("/top-dir/file-2");
aDir = fileSystem.getPath("/top-dir/a-dir");
bDir = fileSystem.getPath("/top-dir/b-dir");
file3 = fileSystem.getPath("/top-dir/a-dir/file-3");
innerDir = fileSystem.getPath("/top-dir/a-dir/inner-dir");
link1 = fileSystem.getPath("/top-dir/a-dir/inner-dir/link-1");
dirLink = fileSystem.getPath("/top-dir/a-dir/inner-dir/dir-link");
file4 = fileSystem.getPath("/file-4");
file5 = fileSystem.getPath("/top-dir/b-dir/file-5");
topDir.createDirectory();
FileSystemUtils.createEmptyFile(file1);
FileSystemUtils.createEmptyFile(file2);
aDir.createDirectory();
bDir.createDirectory();
FileSystemUtils.createEmptyFile(file3);
innerDir.createDirectory();
link1.createSymbolicLink(file4); // simple symlink
dirLink.createSymbolicLink(bDir);
FileSystemUtils.createEmptyFile(file4);
FileSystemUtils.createEmptyFile(file5);
}
private Path checkTestDirectoryTreesBelowExceptSymlinks(Path toPath) throws IOException {
Path copiedFile1 = toPath.getChild("file-1");
assertThat(copiedFile1.exists()).isTrue();
assertThat(copiedFile1.isFile()).isTrue();
Path copiedFile2 = toPath.getChild("file-2");
assertThat(copiedFile2.exists()).isTrue();
assertThat(copiedFile2.isFile()).isTrue();
Path copiedADir = toPath.getChild("a-dir");
assertThat(copiedADir.exists()).isTrue();
assertThat(copiedADir.isDirectory()).isTrue();
Collection<Path> aDirEntries = copiedADir.getDirectoryEntries();
assertThat(aDirEntries).hasSize(2);
Path copiedFile3 = copiedADir.getChild("file-3");
assertThat(copiedFile3.exists()).isTrue();
assertThat(copiedFile3.isFile()).isTrue();
Path copiedInnerDir = copiedADir.getChild("inner-dir");
assertThat(copiedInnerDir.exists()).isTrue();
assertThat(copiedInnerDir.isDirectory()).isTrue();
return copiedInnerDir;
}
private void checkTestDirectoryTreesBelow(Path toPath) throws IOException {
Path copiedInnerDir = checkTestDirectoryTreesBelowExceptSymlinks(toPath);
Path copiedLink1 = copiedInnerDir.getChild("link-1");
assertThat(copiedLink1.exists()).isTrue();
assertThat(copiedLink1.isSymbolicLink()).isFalse();
Path copiedDirLink = copiedInnerDir.getChild("dir-link");
assertThat(copiedDirLink.exists()).isTrue();
assertThat(copiedDirLink.isDirectory()).isTrue();
assertThat(copiedDirLink.getChild("file-5").exists()).isTrue();
}
// tests
@Test
public void testChangeModtime() throws IOException {
Path file = fileSystem.getPath("/my-file");
assertThrows(FileNotFoundException.class, () -> BlazeTestUtils.changeModtime(file));
FileSystemUtils.createEmptyFile(file);
long prevMtime = file.getLastModifiedTime();
BlazeTestUtils.changeModtime(file);
assertThat(prevMtime == file.getLastModifiedTime()).isFalse();
}
@Test
public void testCommonAncestor() {
assertThat(commonAncestor(topDir, topDir)).isEqualTo(topDir);
assertThat(commonAncestor(file1, file3)).isEqualTo(topDir);
assertThat(commonAncestor(file1, dirLink)).isEqualTo(topDir);
}
@Test
public void testRelativePath() throws IOException {
createTestDirectoryTree();
assertThat(
relativePath(PathFragment.create("/top-dir"), PathFragment.create("/top-dir/file-1"))
.getPathString())
.isEqualTo("file-1");
assertThat(
relativePath(PathFragment.create("/top-dir"), PathFragment.create("/top-dir"))
.getPathString())
.isEqualTo("");
assertThat(
relativePath(
PathFragment.create("/top-dir"),
PathFragment.create("/top-dir/a-dir/inner-dir/dir-link"))
.getPathString())
.isEqualTo("a-dir/inner-dir/dir-link");
assertThat(
relativePath(PathFragment.create("/top-dir"), PathFragment.create("/file-4"))
.getPathString())
.isEqualTo("../file-4");
assertThat(
relativePath(
PathFragment.create("/top-dir/a-dir/inner-dir"), PathFragment.create("/file-4"))
.getPathString())
.isEqualTo("../../../file-4");
}
@Test
public void testRemoveExtension_strings() throws Exception {
assertThat(removeExtension("foo.c")).isEqualTo("foo");
assertThat(removeExtension("a/foo.c")).isEqualTo("a/foo");
assertThat(removeExtension("a.b/foo")).isEqualTo("a.b/foo");
assertThat(removeExtension("foo")).isEqualTo("foo");
assertThat(removeExtension("foo.")).isEqualTo("foo");
}
@Test
public void testRemoveExtension_paths() throws Exception {
assertPath("/foo", removeExtension(fileSystem.getPath("/foo.c")));
assertPath("/a/foo", removeExtension(fileSystem.getPath("/a/foo.c")));
assertPath("/a.b/foo", removeExtension(fileSystem.getPath("/a.b/foo")));
assertPath("/foo", removeExtension(fileSystem.getPath("/foo")));
assertPath("/foo", removeExtension(fileSystem.getPath("/foo.")));
}
private static void assertPath(String expected, PathFragment actual) {
assertThat(actual.getPathString()).isEqualTo(expected);
}
private static void assertPath(String expected, Path actual) {
assertThat(actual.getPathString()).isEqualTo(expected);
}
@Test
public void testReplaceExtension_path() throws Exception {
assertPath("/foo/bar.baz",
FileSystemUtils.replaceExtension(fileSystem.getPath("/foo/bar"), ".baz"));
assertPath("/foo/bar.baz",
FileSystemUtils.replaceExtension(fileSystem.getPath("/foo/bar.cc"), ".baz"));
assertPath("/foo.baz", FileSystemUtils.replaceExtension(fileSystem.getPath("/foo/"), ".baz"));
assertPath("/foo.baz",
FileSystemUtils.replaceExtension(fileSystem.getPath("/foo.cc/"), ".baz"));
assertPath("/foo.baz", FileSystemUtils.replaceExtension(fileSystem.getPath("/foo"), ".baz"));
assertPath("/foo.baz", FileSystemUtils.replaceExtension(fileSystem.getPath("/foo.cc"), ".baz"));
assertPath("/.baz", FileSystemUtils.replaceExtension(fileSystem.getPath("/.cc"), ".baz"));
assertThat(FileSystemUtils.replaceExtension(fileSystem.getPath("/"), ".baz")).isNull();
}
@Test
public void testReplaceExtension_pathFragment() throws Exception {
assertPath("foo/bar.baz",
FileSystemUtils.replaceExtension(PathFragment.create("foo/bar"), ".baz"));
assertPath("foo/bar.baz",
FileSystemUtils.replaceExtension(PathFragment.create("foo/bar.cc"), ".baz"));
assertPath("/foo/bar.baz",
FileSystemUtils.replaceExtension(PathFragment.create("/foo/bar"), ".baz"));
assertPath("/foo/bar.baz",
FileSystemUtils.replaceExtension(PathFragment.create("/foo/bar.cc"), ".baz"));
assertPath("foo.baz", FileSystemUtils.replaceExtension(PathFragment.create("foo/"), ".baz"));
assertPath("foo.baz", FileSystemUtils.replaceExtension(PathFragment.create("foo.cc/"), ".baz"));
assertPath("/foo.baz", FileSystemUtils.replaceExtension(PathFragment.create("/foo/"), ".baz"));
assertPath("/foo.baz",
FileSystemUtils.replaceExtension(PathFragment.create("/foo.cc/"), ".baz"));
assertPath("foo.baz", FileSystemUtils.replaceExtension(PathFragment.create("foo"), ".baz"));
assertPath("foo.baz", FileSystemUtils.replaceExtension(PathFragment.create("foo.cc"), ".baz"));
assertPath("/foo.baz", FileSystemUtils.replaceExtension(PathFragment.create("/foo"), ".baz"));
assertPath("/foo.baz",
FileSystemUtils.replaceExtension(PathFragment.create("/foo.cc"), ".baz"));
assertPath(".baz", FileSystemUtils.replaceExtension(PathFragment.create(".cc"), ".baz"));
assertThat(FileSystemUtils.replaceExtension(PathFragment.create("/"), ".baz")).isNull();
assertThat(FileSystemUtils.replaceExtension(PathFragment.create(""), ".baz")).isNull();
assertPath("foo/bar.baz",
FileSystemUtils.replaceExtension(PathFragment.create("foo/bar.pony"), ".baz", ".pony"));
assertPath("foo/bar.baz",
FileSystemUtils.replaceExtension(PathFragment.create("foo/bar"), ".baz", ""));
assertThat(FileSystemUtils.replaceExtension(PathFragment.create(""), ".baz", ".pony")).isNull();
assertThat(
FileSystemUtils.replaceExtension(
PathFragment.create("foo/bar.pony"), ".baz", ".unicorn"))
.isNull();
}
@Test
public void testAppendWithoutExtension() throws Exception {
assertPath("libfoo-src.jar",
appendWithoutExtension(PathFragment.create("libfoo.jar"), "-src"));
assertPath("foo/libfoo-src.jar",
appendWithoutExtension(PathFragment.create("foo/libfoo.jar"), "-src"));
assertPath("java/com/google/foo/libfoo-src.jar",
appendWithoutExtension(PathFragment.create("java/com/google/foo/libfoo.jar"), "-src"));
assertPath("libfoo.bar-src.jar",
appendWithoutExtension(PathFragment.create("libfoo.bar.jar"), "-src"));
assertPath("libfoo-src",
appendWithoutExtension(PathFragment.create("libfoo"), "-src"));
assertPath("libfoo-src.jar",
appendWithoutExtension(PathFragment.create("libfoo.jar/"), "-src"));
assertPath("libfoo.src.jar",
appendWithoutExtension(PathFragment.create("libfoo.jar"), ".src"));
assertThat(appendWithoutExtension(PathFragment.create("/"), "-src")).isNull();
assertThat(appendWithoutExtension(PathFragment.create(""), "-src")).isNull();
}
@Test
public void testGetWorkingDirectory() {
String userDir = System.getProperty("user.dir");
assertThat(fileSystem.getPath(System.getProperty("user.dir", "/")))
.isEqualTo(FileSystemUtils.getWorkingDirectory(fileSystem));
System.setProperty("user.dir", "/blah/blah/blah");
assertThat(fileSystem.getPath("/blah/blah/blah"))
.isEqualTo(FileSystemUtils.getWorkingDirectory(fileSystem));
System.setProperty("user.dir", userDir);
}
@Test
public void testResolveRelativeToFilesystemWorkingDir() {
PathFragment relativePath = PathFragment.create("relative/path");
assertThat(workingDir.getRelative(relativePath))
.isEqualTo(workingDir.getRelative(relativePath));
PathFragment absolutePath = PathFragment.create("/absolute/path");
assertThat(workingDir.getRelative(absolutePath)).isEqualTo(fileSystem.getPath(absolutePath));
}
@Test
public void testTouchFileCreatesFile() throws IOException {
createTestDirectoryTree();
Path nonExistingFile = fileSystem.getPath("/previously-non-existing");
assertThat(nonExistingFile.exists()).isFalse();
touchFile(nonExistingFile);
assertThat(nonExistingFile.exists()).isTrue();
}
@Test
public void testTouchFileAdjustsFileTime() throws IOException {
createTestDirectoryTree();
Path testFile = file4;
long oldTime = testFile.getLastModifiedTime();
testFile.setLastModifiedTime(42);
touchFile(testFile);
assertThat(testFile.getLastModifiedTime()).isAtLeast(oldTime);
}
@Test
public void testCopyFile() throws IOException {
createTestDirectoryTree();
Path originalFile = file1;
byte[] content = new byte[] { 'a', 'b', 'c', 23, 42 };
FileSystemUtils.writeContent(originalFile, content);
Path copyTarget = file2;
copyFile(originalFile, copyTarget);
assertThat(FileSystemUtils.readContent(copyTarget)).isEqualTo(content);
}
@Test
public void testMoveFile() throws IOException {
createTestDirectoryTree();
Path originalFile = file1;
byte[] content = new byte[] { 'a', 'b', 'c', 23, 42 };
FileSystemUtils.writeContent(originalFile, content);
Path moveTarget = file2;
assertThat(moveFile(originalFile, moveTarget)).isEqualTo(MoveResult.FILE_MOVED);
assertThat(FileSystemUtils.readContent(moveTarget)).isEqualTo(content);
assertThat(originalFile.exists()).isFalse();
}
@Test
public void testMoveFileAcrossDevices() throws Exception {
class MultipleDeviceFS extends InMemoryFileSystem {
@Override
public void renameTo(Path source, Path target) throws IOException {
if (!source.startsWith(target.asFragment().subFragment(0, 1))) {
throw new IOException("EXDEV");
}
super.renameTo(source, target);
}
}
FileSystem fs = new MultipleDeviceFS();
Path dev1 = fs.getPath("/fs1");
dev1.createDirectory();
Path dev2 = fs.getPath("/fs2");
dev2.createDirectory();
Path source = dev1.getChild("source");
Path target = dev2.getChild("target");
FileSystemUtils.writeContent(source, UTF_8, "hello, world");
source.setLastModifiedTime(142);
assertThat(FileSystemUtils.moveFile(source, target)).isEqualTo(MoveResult.FILE_COPIED);
assertThat(source.exists(Symlinks.NOFOLLOW)).isFalse();
assertThat(target.isFile(Symlinks.NOFOLLOW)).isTrue();
assertThat(FileSystemUtils.readContent(target, UTF_8)).isEqualTo("hello, world");
assertThat(target.getLastModifiedTime()).isEqualTo(142);
source.createSymbolicLink(PathFragment.create("link-target"));
assertThat(FileSystemUtils.moveFile(source, target)).isEqualTo(MoveResult.FILE_COPIED);
assertThat(source.exists(Symlinks.NOFOLLOW)).isFalse();
assertThat(target.isSymbolicLink()).isTrue();
assertThat(target.readSymbolicLink()).isEqualTo(PathFragment.create("link-target"));
}
@Test
public void testReadContentWithLimit() throws IOException {
createTestDirectoryTree();
String str = "this is a test of readContentWithLimit method";
FileSystemUtils.writeContent(file1, StandardCharsets.ISO_8859_1, str);
assertThat(readStringFromFile(file1, 0)).isEmpty();
assertThat(str.substring(0, 10)).isEqualTo(readStringFromFile(file1, 10));
assertThat(str).isEqualTo(readStringFromFile(file1, 1000000));
}
private String readStringFromFile(Path file, int limit) throws IOException {
byte[] bytes = FileSystemUtils.readContentWithLimit(file, limit);
return new String(bytes, StandardCharsets.ISO_8859_1);
}
@Test
public void testAppend() throws IOException {
createTestDirectoryTree();
FileSystemUtils.writeIsoLatin1(file1, "nobody says ");
FileSystemUtils.writeIsoLatin1(file1, "mary had");
FileSystemUtils.appendIsoLatin1(file1, "a little lamb");
assertThat(new String(FileSystemUtils.readContentAsLatin1(file1)))
.isEqualTo("mary had\na little lamb\n");
}
@Test
public void testCopyFileAttributes() throws IOException {
createTestDirectoryTree();
Path originalFile = file1;
byte[] content = new byte[] { 'a', 'b', 'c', 23, 42 };
FileSystemUtils.writeContent(originalFile, content);
file1.setLastModifiedTime(12345L);
file1.setWritable(false);
file1.setExecutable(false);
Path copyTarget = file2;
copyFile(originalFile, copyTarget);
assertThat(file2.getLastModifiedTime()).isEqualTo(12345L);
assertThat(file2.isExecutable()).isFalse();
assertThat(file2.isWritable()).isFalse();
file1.setWritable(true);
file1.setExecutable(true);
copyFile(originalFile, copyTarget);
assertThat(file2.getLastModifiedTime()).isEqualTo(12345L);
assertThat(file2.isExecutable()).isTrue();
assertThat(file2.isWritable()).isTrue();
}
@Test
public void testCopyFileThrowsExceptionIfTargetCantBeDeleted() throws IOException {
createTestDirectoryTree();
Path originalFile = file1;
byte[] content = new byte[] { 'a', 'b', 'c', 23, 42 };
FileSystemUtils.writeContent(originalFile, content);
IOException ex = assertThrows(IOException.class, () -> copyFile(originalFile, aDir));
assertThat(ex)
.hasMessageThat()
.isEqualTo(
"error copying file: couldn't delete destination: " + aDir + " (Directory not empty)");
}
@Test
public void testCopyTool() throws IOException {
createTestDirectoryTree();
Path originalFile = file1;
byte[] content = new byte[] { 'a', 'b', 'c', 23, 42 };
FileSystemUtils.writeContent(originalFile, content);
Path copyTarget = copyTool(topDir.getRelative("file-1"), aDir.getRelative("file-1"));
assertThat(FileSystemUtils.readContent(copyTarget)).isEqualTo(content);
assertThat(copyTarget.isWritable()).isEqualTo(file1.isWritable());
assertThat(copyTarget.isExecutable()).isEqualTo(file1.isExecutable());
assertThat(copyTarget.getLastModifiedTime()).isEqualTo(file1.getLastModifiedTime());
}
@Test
public void testCopyTreesBelow() throws IOException {
createTestDirectoryTree();
Path toPath = fileSystem.getPath("/copy-here");
toPath.createDirectory();
FileSystemUtils.copyTreesBelow(topDir, toPath, Symlinks.FOLLOW);
checkTestDirectoryTreesBelow(toPath);
}
@Test
public void testCopyTreesBelowWithOverriding() throws IOException {
createTestDirectoryTree();
Path toPath = fileSystem.getPath("/copy-here");
toPath.createDirectory();
toPath.getChild("file-2");
FileSystemUtils.copyTreesBelow(topDir, toPath, Symlinks.FOLLOW);
checkTestDirectoryTreesBelow(toPath);
}
@Test
public void testCopyTreesBelowToSubtree() throws IOException {
createTestDirectoryTree();
IllegalArgumentException expected =
assertThrows(
IllegalArgumentException.class,
() -> FileSystemUtils.copyTreesBelow(topDir, aDir, Symlinks.FOLLOW));
assertThat(expected).hasMessageThat().isEqualTo("/top-dir/a-dir is a subdirectory of /top-dir");
}
@Test
public void testCopyFileAsDirectoryTree() throws IOException {
createTestDirectoryTree();
IOException expected =
assertThrows(
IOException.class, () -> FileSystemUtils.copyTreesBelow(file1, aDir, Symlinks.FOLLOW));
assertThat(expected).hasMessageThat().isEqualTo("/top-dir/file-1 (Not a directory)");
}
@Test
public void testCopyTreesBelowToFile() throws IOException {
createTestDirectoryTree();
Path copyDir = fileSystem.getPath("/my-dir");
Path copySubDir = fileSystem.getPath("/my-dir/subdir");
FileSystemUtils.createDirectoryAndParents(copySubDir);
IOException expected =
assertThrows(
IOException.class,
() -> FileSystemUtils.copyTreesBelow(copyDir, file4, Symlinks.FOLLOW));
assertThat(expected).hasMessageThat().isEqualTo("/file-4 (Not a directory)");
}
@Test
public void testCopyTreesBelowFromUnexistingDir() throws IOException {
createTestDirectoryTree();
Path unexistingDir = fileSystem.getPath("/unexisting-dir");
FileNotFoundException expected =
assertThrows(
FileNotFoundException.class,
() -> FileSystemUtils.copyTreesBelow(unexistingDir, aDir, Symlinks.FOLLOW));
assertThat(expected).hasMessageThat().isEqualTo("/unexisting-dir (No such file or directory)");
}
@Test
public void testCopyTreesBelowNoFollowSymlinks() throws IOException {
createTestDirectoryTree();
PathFragment relative1 = file1.relativeTo(topDir);
topDir.getRelative("relative-link").createSymbolicLink(relative1);
PathFragment relativeInner = PathFragment.create("..").getRelative(relative1);
bDir.getRelative("relative-inner-link").createSymbolicLink(relativeInner);
PathFragment rootDirectory = PathFragment.create("/");
topDir.getRelative("absolute-link").createSymbolicLink(rootDirectory);
Path toPath = fileSystem.getPath("/copy-here");
toPath.createDirectory();
FileSystemUtils.copyTreesBelow(topDir, toPath, Symlinks.NOFOLLOW);
Path copiedInnerDir = checkTestDirectoryTreesBelowExceptSymlinks(toPath);
Path copiedLink1 = copiedInnerDir.getChild("link-1");
assertThat(copiedLink1.exists()).isTrue();
assertThat(copiedLink1.isSymbolicLink()).isTrue();
assertThat(copiedLink1.readSymbolicLink()).isEqualTo(file4.asFragment());
Path copiedDirLink = copiedInnerDir.getChild("dir-link");
assertThat(copiedDirLink.exists()).isTrue();
assertThat(copiedDirLink.isDirectory()).isTrue();
assertThat(copiedDirLink.readSymbolicLink()).isEqualTo(bDir.asFragment());
assertThat(toPath.getRelative("relative-link").readSymbolicLink()).isEqualTo(relative1);
assertThat(
toPath
.getRelative(bDir.relativeTo(topDir))
.getRelative("relative-inner-link")
.readSymbolicLink())
.isEqualTo(relativeInner);
assertThat(toPath.getRelative("absolute-link").readSymbolicLink()).isEqualTo(rootDirectory);
}
@Test
public void testTraverseTree() throws IOException {
createTestDirectoryTree();
Collection<Path> paths = traverseTree(topDir, p -> !p.getPathString().contains("a-dir"));
assertThat(paths).containsExactly(file1, file2, bDir, file5);
}
@Test
public void testTraverseTreeDeep() throws IOException {
createTestDirectoryTree();
Collection<Path> paths = traverseTree(topDir, ignored -> true);
assertThat(paths).containsExactly(aDir,
file3,
innerDir,
link1,
file1,
file2,
dirLink,
bDir,
file5);
}
@Test
public void testTraverseTreeLinkDir() throws IOException {
// Use a new little tree for this test:
// top-dir/
// dir-link2 => linked-dir
// linked-dir/
// file
topDir = fileSystem.getPath("/top-dir");
Path dirLink2 = fileSystem.getPath("/top-dir/dir-link2");
Path linkedDir = fileSystem.getPath("/linked-dir");
Path linkedDirFile = fileSystem.getPath("/top-dir/dir-link2/file");
topDir.createDirectory();
linkedDir.createDirectory();
dirLink2.createSymbolicLink(linkedDir); // simple symlink
FileSystemUtils.createEmptyFile(linkedDirFile); // created through the link
// traverseTree doesn't follow links:
Collection<Path> paths = traverseTree(topDir, ignored -> true);
assertThat(paths).containsExactly(dirLink2);
paths = traverseTree(linkedDir, ignored -> true);
assertThat(paths).containsExactly(fileSystem.getPath("/linked-dir/file"));
}
@Test
public void testWriteIsoLatin1() throws Exception {
Path file = fileSystem.getPath("/does/not/exist/yet.txt");
FileSystemUtils.writeIsoLatin1(file, "Line 1", "Line 2", "Line 3");
String expected = "Line 1\nLine 2\nLine 3\n";
String actual = new String(FileSystemUtils.readContentAsLatin1(file));
assertThat(actual).isEqualTo(expected);
}
@Test
public void testWriteLinesAs() throws Exception {
Path file = fileSystem.getPath("/does/not/exist/yet.txt");
FileSystemUtils.writeLinesAs(file, UTF_8, "\u00F6"); // an oe umlaut
byte[] expected = new byte[] {(byte) 0xC3, (byte) 0xB6, 0x0A};//"\u00F6\n";
byte[] actual = FileSystemUtils.readContent(file);
assertThat(actual).isEqualTo(expected);
}
@Test
public void testUpdateContent() throws Exception {
Path file = fileSystem.getPath("/test.txt");
clock.advanceMillis(1000);
byte[] content = new byte[] { 'a', 'b', 'c', 23, 42 };
FileSystemUtils.maybeUpdateContent(file, content);
byte[] actual = FileSystemUtils.readContent(file);
assertThat(actual).isEqualTo(content);
FileStatus stat = file.stat();
assertThat(stat.getLastChangeTime()).isEqualTo(1000);
assertThat(stat.getLastModifiedTime()).isEqualTo(1000);
clock.advanceMillis(1000);
// Update with same contents; should not write anything.
FileSystemUtils.maybeUpdateContent(file, content);
assertThat(actual).isEqualTo(content);
stat = file.stat();
assertThat(stat.getLastChangeTime()).isEqualTo(1000);
assertThat(stat.getLastModifiedTime()).isEqualTo(1000);
clock.advanceMillis(1000);
// Update with different contents; file should be rewritten.
content[0] = 'b';
file.chmod(0400); // Protect the file to ensure we can rewrite it.
FileSystemUtils.maybeUpdateContent(file, content);
actual = FileSystemUtils.readContent(file);
assertThat(actual).isEqualTo(content);
stat = file.stat();
assertThat(stat.getLastChangeTime()).isEqualTo(3000);
assertThat(stat.getLastModifiedTime()).isEqualTo(3000);
}
@Test
public void testGetFileSystem() throws Exception {
Path mountTable = fileSystem.getPath("/proc/mounts");
FileSystemUtils.writeIsoLatin1(mountTable,
"/dev/sda1 / ext2 blah 0 0",
"/dev/mapper/_dev_sda6 /usr/local/google ext3 blah 0 0",
"devshm /dev/shm tmpfs blah 0 0",
"/dev/fuse /fuse/mnt fuse blah 0 0",
"mtvhome22.nfs:/vol/mtvhome22/johndoe /home/johndoe nfs blah 0 0",
"/dev/foo /foo dummy_foo blah 0 0",
"/dev/foobar /foobar dummy_foobar blah 0 0",
"proc proc proc rw,noexec,nosuid,nodev 0 0");
Path path = fileSystem.getPath("/usr/local/google/_blaze");
FileSystemUtils.createDirectoryAndParents(path);
assertThat(FileSystemUtils.getFileSystem(path)).isEqualTo("ext3");
// Should match the root "/"
path = fileSystem.getPath("/usr/local/tmp");
FileSystemUtils.createDirectoryAndParents(path);
assertThat(FileSystemUtils.getFileSystem(path)).isEqualTo("ext2");
// Make sure we don't consider /foobar matches /foo
path = fileSystem.getPath("/foo");
FileSystemUtils.createDirectoryAndParents(path);
assertThat(FileSystemUtils.getFileSystem(path)).isEqualTo("dummy_foo");
path = fileSystem.getPath("/foobar");
FileSystemUtils.createDirectoryAndParents(path);
assertThat(FileSystemUtils.getFileSystem(path)).isEqualTo("dummy_foobar");
path = fileSystem.getPath("/dev/shm/blaze");
FileSystemUtils.createDirectoryAndParents(path);
assertThat(FileSystemUtils.getFileSystem(path)).isEqualTo("tmpfs");
Path fusePath = fileSystem.getPath("/fuse/mnt/tmp");
FileSystemUtils.createDirectoryAndParents(fusePath);
assertThat(FileSystemUtils.getFileSystem(fusePath)).isEqualTo("fuse");
// Create a symlink and make sure it gives the file system of the symlink target.
path = fileSystem.getPath("/usr/local/google/_blaze/out");
path.createSymbolicLink(fusePath);
assertThat(FileSystemUtils.getFileSystem(path)).isEqualTo("fuse");
// Non existent path should return "unknown"
path = fileSystem.getPath("/does/not/exist");
assertThat(FileSystemUtils.getFileSystem(path)).isEqualTo("unknown");
}
@Test
public void testStartsWithAnySuccess() throws Exception {
PathFragment a = PathFragment.create("a");
assertThat(
FileSystemUtils.startsWithAny(
a, Arrays.asList(PathFragment.create("b"), PathFragment.create("a"))))
.isTrue();
}
@Test
public void testStartsWithAnyNotFound() throws Exception {
PathFragment a = PathFragment.create("a");
assertThat(
FileSystemUtils.startsWithAny(
a, Arrays.asList(PathFragment.create("b"), PathFragment.create("c"))))
.isFalse();
}
@Test
public void testIterateLines() throws Exception {
Path file = fileSystem.getPath("/test.txt");
FileSystemUtils.writeContent(file, ISO_8859_1, "a\nb");
assertThat(Lists.newArrayList(FileSystemUtils.iterateLinesAsLatin1(file)))
.isEqualTo(Arrays.asList("a", "b"));
FileSystemUtils.writeContent(file, ISO_8859_1, "a\rb");
assertThat(Lists.newArrayList(FileSystemUtils.iterateLinesAsLatin1(file)))
.isEqualTo(Arrays.asList("a", "b"));
FileSystemUtils.writeContent(file, ISO_8859_1, "a\r\nb");
assertThat(Lists.newArrayList(FileSystemUtils.iterateLinesAsLatin1(file)))
.isEqualTo(Arrays.asList("a", "b"));
}
@Test
public void testEnsureSymbolicLinkDoesNotMakeUnnecessaryChanges() throws Exception {
PathFragment target = PathFragment.create("/b");
Path file = fileSystem.getPath("/a");
file.createSymbolicLink(target);
long prevTimeMillis = clock.currentTimeMillis();
clock.advanceMillis(1000);
FileSystemUtils.ensureSymbolicLink(file, target);
long timestamp = file.getLastModifiedTime(Symlinks.NOFOLLOW);
assertThat(timestamp).isEqualTo(prevTimeMillis);
}
@Test
public void testCreateHardLinkForFile_success() throws Exception {
/* Original file exists and link file does not exist */
Path originalPath = workingDir.getRelative("original");
Path linkPath = workingDir.getRelative("link");
FileSystemUtils.createEmptyFile(originalPath);
FileSystemUtils.createHardLink(linkPath, originalPath);
assertThat(originalPath.exists()).isTrue();
assertThat(linkPath.exists()).isTrue();
assertThat(fileSystem.stat(linkPath, false).getNodeId())
.isEqualTo(fileSystem.stat(originalPath, false).getNodeId());
}
@Test
public void testCreateHardLinkForEmptyDirectory_success() throws Exception {
Path originalDir = workingDir.getRelative("originalDir");
Path linkPath = workingDir.getRelative("link");
FileSystemUtils.createDirectoryAndParents(originalDir);
/* Original directory is empty, no link to be created. */
FileSystemUtils.createHardLink(linkPath, originalDir);
assertThat(linkPath.exists()).isFalse();
}
@Test
public void testCreateHardLinkForNonEmptyDirectory_success() throws Exception {
/* Test when original path is a directory */
Path originalDir = workingDir.getRelative("originalDir");
Path linkPath = workingDir.getRelative("link");
Path originalPath1 = originalDir.getRelative("original1");
Path originalPath2 = originalDir.getRelative("original2");
Path originalPath3 = originalDir.getRelative("original3");
Path linkPath1 = linkPath.getRelative("original1");
Path linkPath2 = linkPath.getRelative("original2");
Path linkPath3 = linkPath.getRelative("original3");
FileSystemUtils.createDirectoryAndParents(originalDir);
FileSystemUtils.createEmptyFile(originalPath1);
FileSystemUtils.createEmptyFile(originalPath2);
FileSystemUtils.createEmptyFile(originalPath3);
/* Three link files created under linkPath */
FileSystemUtils.createHardLink(linkPath, originalDir);
assertThat(linkPath.exists()).isTrue();
assertThat(linkPath1.exists()).isTrue();
assertThat(linkPath2.exists()).isTrue();
assertThat(linkPath3.exists()).isTrue();
assertThat(fileSystem.stat(linkPath1, false).getNodeId())
.isEqualTo(fileSystem.stat(originalPath1, false).getNodeId());
assertThat(fileSystem.stat(linkPath2, false).getNodeId())
.isEqualTo(fileSystem.stat(originalPath2, false).getNodeId());
assertThat(fileSystem.stat(linkPath3, false).getNodeId())
.isEqualTo(fileSystem.stat(originalPath3, false).getNodeId());
}
}
| 18,701 |
https://github.com/alexey-m-ukolov/simplecv2-barcode/blob/master/simplecv_barcode/test.py
|
Github Open Source
|
Open Source
|
BSD-2-Clause
| 2,014 |
simplecv2-barcode
|
alexey-m-ukolov
|
Python
|
Code
| 138 | 574 |
import os
from nose.tools import assert_equals, assert_almost_equals
from simplecv.factory import Factory
from simplecv.tests.utils import perform_diff
from simplecv.tests import utils
from simplecv import DATA_DIR as SCV_DATA_DIR
from simplecv_barcode import DATA_DIR
utils.standard_path = os.path.join(DATA_DIR, 'test', 'standard')
TEST_IMAGE = os.path.join(SCV_DATA_DIR, 'sampleimages/9dots4lines.png')
BARCODE_IMAGE = os.path.join(DATA_DIR, 'sampleimages/barcode.png')
def test_barcode():
img = Factory.Image(BARCODE_IMAGE)
barcode = img.find_barcode()[0]
repr_str = "%s.%s at (%d,%d), read data: %s" % (
barcode.__class__.__module__, barcode.__class__.__name__, barcode.x, barcode.y,
barcode.data)
assert_equals(barcode.__repr__(), repr_str)
barcode.draw(color=(255, 0, 0), width=5)
assert_equals(barcode.length(),[262.0])
assert_almost_equals(barcode.get_area(), 68644.0)
perform_diff([img], "test_barcode", 0.0)
def test_barcode_find_barcode():
img = Factory.Image(BARCODE_IMAGE)
featureset = img.find_barcode()
f = featureset[0]
img_crop = f.crop()
result = [img_crop]
name_stem = "test_barcode_find_barcode"
perform_diff(result, name_stem, 0.0)
def test_detection_barcode():
img1 = Factory.Image(TEST_IMAGE)
img2 = Factory.Image(BARCODE_IMAGE)
nocode = img1.find_barcode()
if nocode: # we should find no barcode in our test image
assert False
code = img2.find_barcode()
code.draw()
result = [img1, img2]
name_stem = "test_detection_barcode"
perform_diff(result, name_stem)
| 45,526 |
https://github.com/matthewxvoorhees/flashcard-project-backend/blob/master/db/migrate/20201208011901_add_user_id_to_questions.rb
|
Github Open Source
|
Open Source
|
MIT
| null |
flashcard-project-backend
|
matthewxvoorhees
|
Ruby
|
Code
| 12 | 44 |
class AddUserIdToQuestions < ActiveRecord::Migration[6.0]
def change
add_column :questions, :category_id, :integer
end
end
| 47,536 |
https://github.com/SatoshiRobatoFujimoto/rtdeepvo/blob/master/prep_poses.py
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
rtdeepvo
|
SatoshiRobatoFujimoto
|
Python
|
Code
| 175 | 596 |
#! /usr/bin/python3
import math
import numpy as np
from scipy.spatial.transform import Rotation as R
import matplotlib.pyplot as plt
import sys
if len(sys.argv) < 3:
print("Usage:", sys.argv[0], "<orig poses file> <output poses file> [--plot-output]")
exit(1)
orig_poses_file = sys.argv[1]
out_poses_file = sys.argv[2]
plot_output = len(sys.argv) > 3 and sys.argv[3] == "--plot-output"
poses = []
with open(orig_poses_file, "r") as f:
lines = f.readlines()
for line in lines:
m = np.fromstring(line, dtype=float, sep=' ')
m = m.reshape(3, 4)
r = R.from_matrix(m[0:3, 0:3]).as_euler("yxz", degrees=False)
t = np.reshape(m[0:3, 3:4], (3,))
poses.append([t[0], t[1], t[2], r[1], r[0], r[2]])
with open(out_poses_file, "w") as f:
for p in poses:
line = str(p[0]) + " " + str(p[1]) + " " + str(p[2]) + " " + str(p[3]) + " " + str(p[4]) + " " + str(p[5]) + "\n"
f.write(line)
np_poses = np.asarray(poses)
print("trans (max):", np_poses[:, 0:3].max(axis=0))
print("trans (min):", np_poses[:, 0:3].min(axis=0))
print("rot (max) :", np_poses[:, 3:6].max(axis=0))
print("rot (min) :", np_poses[:, 3:6].min(axis=0))
if plot_output:
plot1 = plt.figure(1)
plt.plot([[p[0], p[1], p[2]] for p in poses])
plot2 = plt.figure(2)
plt.plot([[p[3], p[4], p[5]] for p in poses])
plt.show()
print("done")
| 15,326 |
https://github.com/K4milo/hightlights/blob/master/app/code/core/Mage/Api/Model/Server/Adapter/Xmlrpc.php
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
hightlights
|
K4milo
|
PHP
|
Code
| 376 | 1,070 |
<?php
/**
* Magento
*
* NOTICE OF LICENSE
*
* This source file is subject to the Open Software License (OSL 3.0)
* that is bundled with this package in the file LICENSE.txt.
* It is also available through the world-wide-web at this URL:
* http://opensource.org/licenses/osl-3.0.php
* If you did not receive a copy of the license and are unable to
* obtain it through the world-wide-web, please send an email
* to [email protected] so we can send you a copy immediately.
*
* DISCLAIMER
*
* Do not edit or add to this file if you wish to upgrade Magento to newer
* versions in the future. If you wish to customize Magento for your
* needs please refer to http://www.magento.com for more information.
*
* @category Mage
* @package Mage_Api
* @copyright Copyright (c) 2006-2017 X.commerce, Inc. and affiliates (http://www.magento.com)
* @license http://opensource.org/licenses/osl-3.0.php Open Software License (OSL 3.0)
*/
/**
* Webservice XmlRpc adapter
*
* @category Mage
* @package Mage_Api
* @author Magento Core Team <[email protected]>
*/
class Mage_Api_Model_Server_Adapter_Xmlrpc
extends Varien_Object
implements Mage_Api_Model_Server_Adapter_Interface
{
/**
* XmlRpc Server
*
* @var Zend_XmlRpc_Server
*/
protected $_xmlRpc = null;
/**
* Set handler class name for webservice
*
* @param string $handler
* @return Mage_Api_Model_Server_Adapter_Xmlrpc
*/
public function setHandler($handler)
{
$this->setData('handler', $handler);
return $this;
}
/**
* Retrive handler class name for webservice
*
* @return string
*/
public function getHandler()
{
return $this->getData('handler');
}
/**
* Set webservice api controller
*
* @param Mage_Api_Controller_Action $controller
* @return Mage_Api_Model_Server_Adapter_Xmlrpc
*/
public function setController(Mage_Api_Controller_Action $controller)
{
$this->setData('controller', $controller);
return $this;
}
/**
* Retrive webservice api controller. If no controller have been set - emulate it by the use of Varien_Object
*
* @return Mage_Api_Controller_Action|Varien_Object
*/
public function getController()
{
$controller = $this->getData('controller');
if (null === $controller) {
$controller = new Varien_Object(
array('request' => Mage::app()->getRequest(), 'response' => Mage::app()->getResponse())
);
$this->setData('controller', $controller);
}
return $controller;
}
/**
* Run webservice
*
* @return Mage_Api_Model_Server_Adapter_Xmlrpc
*/
public function run()
{
$apiConfigCharset = Mage::getStoreConfig("api/config/charset");
$this->_xmlRpc = new Zend_XmlRpc_Server();
$this->_xmlRpc->setEncoding($apiConfigCharset)
->setClass($this->getHandler());
$this->getController()->getResponse()
->clearHeaders()
->setHeader('Content-Type','text/xml; charset='.$apiConfigCharset)
->setBody($this->_xmlRpc->handle());
return $this;
}
/**
* Dispatch webservice fault
*
* @param int $code
* @param string $message
*/
public function fault($code, $message)
{
throw new Zend_XmlRpc_Server_Exception($message, $code);
}
} // Class Mage_Api_Model_Server_Adapter_Xmlrpc End
| 10,378 |
https://www.wikidata.org/wiki/Q21394929
|
Wikidata
|
Semantic data
|
CC0
| null |
György Makranczy
|
None
|
Multilingual
|
Semantic data
| 321 | 1,096 |
György Makranczy
Hungarian entomologist
György Makranczy instance of human
György Makranczy given name György
György Makranczy country of citizenship Hungary
György Makranczy occupation entomologist
György Makranczy ZooBank author ID F0714CFF-3961-48FE-A51F-CD2486949FB0
György Makranczy ResearchGate profile ID Gyoergy_Makranczy
György Makranczy sex or gender male
György Makranczy
entomologiste hongrois
György Makranczy nature de l’élément être humain
György Makranczy prénom György
György Makranczy pays de nationalité Hongrie
György Makranczy occupation entomologiste
György Makranczy identifiant Zoobank d'un auteur F0714CFF-3961-48FE-A51F-CD2486949FB0
György Makranczy identifiant ResearchGate d'un auteur enregistré Gyoergy_Makranczy
György Makranczy sexe ou genre masculin
György Makranczy
Hongaars entomoloog
György Makranczy is een mens
György Makranczy voornaam György
György Makranczy land van nationaliteit Hongarije
György Makranczy beroep entomoloog
György Makranczy ZooBank-identificatiecode voor auteur F0714CFF-3961-48FE-A51F-CD2486949FB0
György Makranczy ResearchGate-identificatiecode voor persoon Gyoergy_Makranczy
György Makranczy sekse of geslacht mannelijk
György Makranczy
György Makranczy primerek od človek
György Makranczy ime György
György Makranczy država državljanstva Madžarska
György Makranczy poklic entomolog
György Makranczy oznaka profila ResearchGate Gyoergy_Makranczy
György Makranczy spol moški
Makranczy György
magyar zoológus, entomológus
Makranczy György osztály, amelynek példánya ember
Makranczy György utónév György
Makranczy György állampolgárság Magyarország
Makranczy György foglalkozás entomológus
Makranczy György ZooBank author ID F0714CFF-3961-48FE-A51F-CD2486949FB0
Makranczy György ResearchGate-azonosító Gyoergy_Makranczy
Makranczy György nem férfi
György Makranczy
entomólogu húngaru
György Makranczy instancia de humanu
György Makranczy nome György
György Makranczy país de nacionalidá Hungría
György Makranczy ocupación entomólogu
György Makranczy sexu masculín
Gyorgy Makranczy
entomolog hungarez
Gyorgy Makranczy instancë e njeri
Gyorgy Makranczy emri György
Gyorgy Makranczy shtetësia Hungaria
Gyorgy Makranczy profesioni entomolog
Gyorgy Makranczy gjinia mashkull
György Makranczy
entomólogo húngaro
György Makranczy instancia de ser humano
György Makranczy nombre de pila György
György Makranczy país de nacionalidad Hungría
György Makranczy ocupación entomólogo
György Makranczy identificador Zoobank de autor F0714CFF-3961-48FE-A51F-CD2486949FB0
György Makranczy identificador ResearchGate Gyoergy_Makranczy
György Makranczy sexo o género masculino
György Makranczy
feithideolaí Ungárach
György Makranczy sampla de duine
György Makranczy céadainm György
György Makranczy tír shaoránachta an Ungáir
György Makranczy gairm feithideolaí
György Makranczy gnéas nó inscne fireann
| 16,319 |
AG/1888/AG_18880719/MM_01/0002.xml_1
|
NewZealand-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,888 |
None
|
None
|
English
|
Spoken
| 6,536 | 9,074 |
DEATH. Earnshaw.— On July 19th, at Hinds, Jane, the beloved wife of Henry Earnshaw, aged 28 years. Christian papers please copy. The Ashburton Guardian. Magna est Veritas et Prævalebit THURSDAY, JULY 19, 1888. THE MAGDALEN ASYLUM, The efforts of the Bey. Father Ginaty in the direction of founding such a worthy institution are about to be culminated, and on Sunday next the long-deseded asylum for penitent Magdalene, at Mount Magdala, near Christ church, will be formally opened by Bishop Grimes, the lately-appointed Roman Catholic Bishop of Canterbury. We have before commented upon the object which Father Ginaty has so long had in view, and it is with pleasure we note the success which has followed him in his arduous and self-imposed labors for the benefit of the polonial fallen women. Such poems as "The Bridge of Sighs" and "Beautiful Snow" have in eloquent words preached pity for the fallen, and Father Ginaty's sustained efforts have furnished a means whereby this pity may take practical shape, and these outcasts be shown the light of a better life. The sisterhood of the Good Shepherd has done noble work in the reformation of penitents, and for nearly two years they have been in temporary premises in Christchurch carried out their aims with devout zeal. Their work has been continued with surprising success considering the length of time they have been engaged in the work, and now the Sisters have forty penitents from all parts of New Zealand gathered together at Mount Magdala. Once within the fold of the Sisterhood penitents are trained to justify their efforts, and hence the Sisters of the Good Shepherd ask for the cooperation of all those who desire to see real reformation. which control the one hundred and fifty-six, Homes scattered over the globe, in which, at the present moment, 4000 Sisters of the Good Shepherd bestow their devoted cape on 20,000 young girls and women. Up to the present moment, the sum of over £10,000 has been expended on the building and its requirements and the land, apart from the sum necessary to support the Penitents of the Institution; and although the Bey Father Ginty has lately given great undivided attention to raising funds for the building of the Magdalen Asylum, still there remains a large sum to be secured for the first portion of the work already completed. LOCAL AND GENERAL. Communication between Port Darwin and Banjoawangie has been restored. Underground telephone experiments are being tried in Melbourne. The Ashburton Lodge of Odd Fellows will celebrate their anniversary by a tea and social gathering in the Hall tomorrow evening. The Babbit Preserving Factory at Blenheim is putting through twelve thousand rabbits per week, and expects to increase the number to eighteen thousand per week. The "Brisbane Courier" says that the title of the "National Party" adopted by Sir Thomas Millwirth, will become the watchword of enlightened democracy throughout Australia. "The spirit of nationality is stirring the people." The best remedy for Indigestion. — Norton's Camomile Pills are confidently recommended as a simple remedy for indigestion, which is the cause of nearly all the diseases to which we are subject. Norton's Pills, with justice called the "naturalist" of the human stomach, act as a powerful tonic and gentle aperient, are mild in their operation, and safe under any circumstances. Sold in bottles at 15 cents, by all Medicine Vendors throughout the world. The "Wairarapa Standard" thinks that retrenchment has been made — because the authorities have determined upon removing each of the town constables. The mayor and aldermen of Brisbane lately declined to attend the Governor's levee in an official capacity, in consequence of members of the defense force being allowed to take precedence of the mayor and corporation. A concert will be given in St. Stephen's Schoolroom on Tuesday evening next at 8. p.m., The proceeds will go to defray the expenses of seating a lamp outside the church gate. A programme of unusual excellence will be presented. America possesses only one Chinese reporter, and he lives in New York. His name is Wong Foo. He has just sought the protection of the police against the "hookbinders," who threaten his life because he has been exposing the Celestial opium dens and gambling hells in the city. The value of oarrots as an adjunot to the usual grain and hay rations of horses is not generally understood or appreciated. The fact is that no food of the root kind delights horses so much as the oarrot. A few of those roots, fed in the raw state to each horse daily, will keep the skin in better condition than any of the nostrums or condiments powders containing black antimony, arsenic, and other drugs. The oarrot also has a beneficial action on the kidneys of the horse, and helps to keep the urinary organs in perfect health. Almost every farm has some field or proportion of ground that will grow a sufficient supply of carrots for winter use. The "Dunstan Times" says:—"According to the ruling of District Judge Broad in the case lately heard by him at Queenstown for the larceny of rabbit skins, a runholder has no claim on the rabbits on his run, and consequently none on their skins. Rabbits, by his ruling, are forte naturalized wild animals, and necessarily, as vermin, are at the mercy of everyone. The question, however, for the rabbit-hunters to consider is the one of trespass." This (say the "Lake County Press") seems to be sound law, and one effect of it will be to prevent runholders "farming" the rabbits, as they have been doing. One effect of the American Copyright Bill, should it finally pass in its present form, will be, a London contemporary imagines, to transfer a considerable portion of the printing trade from England to the States. The Bill only gives protection to foreign books of which copies printed from type are within the States are duly deposited at Washington. Obviously, therefore, the economical thing to do, if an English author wants to secure American copyright, will be to have his book printed in America then shipped to England, a process which, indeed, is already more often adopted than the English reader is aware. At twenty-five minutes to four this morning the Christmas fire-bells rang out an alarm, the cause being a fire at a five-roomed house in Chester street East, near Ward's brewery, belonging to Messrs Harper and Co., and occupied by Mr G. Taylor, bootmaker. The Brigade managed to get the fire under, but the house was gutted. The fire originated in the kitchen, but it is not known in what manner. The occupants (including six children) were got out of the house without injury. Only a small quantity of furniture was saved. The furniture was insured for £100, and the house is also said to be insured, but for what amount is not known. It we compare the fortunes of very rich men today with the fortunes of men reported rich 30 years ago, the change is most startling. A quarter of a century ago a man who was not a territorial magnate, and yet was reputed to have an income of £10,000, was regarded as exceedingly rich, and was notorious, if only for his wealth. Now the number of men who have £10,000 a year in personalty, or from the profits of trade and speculation, is so considerable that the amount scarcely places the person who has it among "wealthy" nym. £20,000 or £30,000 a year moves accurately answers to that conception in the last days.— Standard. The Emperor Frederick, in a despatch to Bismarck, makes a distinction between education and knowledge, that seems to condemn the present German educational system and to promise a change. Under the Emperor's distinction, a people may be well informed, or even learned, and yet uneducated, he sets education above information, and leaves the belief that in his view the process of acquiring information and the information when acquired are chiefly valuable as they educate — draw out latent faculties. He clearly concludes the present German system with the growth of equaljom and other transcendental theories as they have been illustrated in Bismarck's policy of State Socialism. Miss Florence Wade, according to the Era, had some quaint experiences in New Zealand. The theatres there, she says, are some of them very fine, and lit with the electric light. At Waipawa, a small place where she played, she issued 1s, 2s, 83, tickets, printed in gay and distinctive colors. She noted how fond the Natives were of the brightest tints, and although they came with money in their hands for 1b seats, they willingly paid the higher price, 3a each, for the soprano tickets, because they were the smartest. It was the color of the card, and not the seat, that they thought about. Some of the Maori girls are very musical, and we were delighted if they could get the orchestra or piano. The Maori girl used to endeavor to get in before the theatre was fairly opened, commenced to play the piano, and wanted the company to dance to their music. In fact, the piano itself belonged to a Maori girl. The Parliamentary correspondent of the "Daily Times" says: Some of the very straight-laced members of what is known as the retrenchment section, bracing their party, have an idea that Ministers should never attempt to enjoy themselves. They are of opinion that the occupants of the Treasury benches should engage themselves in morning, noon, and night during the seven days of the week in cutting down Barnegat and affecting other occasions, preparing work. One of the gentlemen referred to, happened to visit the club, and judge of his surprise when he discovered two Ministers of the Empire engaged in a game of billiards, while the chief whip was acting as marker. "How can the colony prosper," exclaimed the indignant economist, "when Nero fiddles while Rome is burning?" Then, turning his eyes heavenwards in holy horror, he ejaculated, "How long, oh Lord, how long?" Mr. Pritchard Morgan is discovering that gold, if not actually the root of all ovil, is at least the source of many unpleasantnesses. He has had to prosecute his mining manager for removing gold from his mine until some arrangement has been made with the Crown about the royalty due. Mr. Pritchard Morgan wrote a letter to the "Times" bewailing the misforces which attended the gold miner in Wales. Incidentally, however, he makes some amusing admissions. The land on which his mine is situated is just his own; He has obtained a mining lease of $40,000 a year. Considering that the Morgan hopes to get about two million storied out of his mine, it must be admitted that he has made a good bargain. But this is not all. If the Crown succeeds in making good its claim to the royalty, it is not Mr. Pritchard Morgan, but the hapless ground landlord who will have to pay it, so that this poor gentleman may find himself forced to pay royalties to the amount of many thousands of pounds annually for a property which only brings him in a paltry £400 a year. DUNEDIN COURSING MEETING. (PER PRESS ASSOCIATION.) Dined in, July 18. The final day of the courping meeting started in a lovely way. In the Ft. Leger, in the fourth round, Flora II beat Barrister, Fugue boat Whisper, Kinsky beat Kilkenny. In AUFFOBAi Stakes, fourth round, Red! Pino beat Lonewoo's, Rinaer beat Kiwi, Quiutana beat Secretary, Little Jack ran a bye Consolation Stake, second round. Gallant l«'oe beat Artillery, Shamrock beat Ro f omnhana, Doric beat Haroun ol BatxhH, Handy Andy boat Boomerang, I Bridegroom II beat Medoo, Kaprolani boat Orphrus, Newton a by*. St. Legeu Stakes—Flora II beat Kin eky hi the final course. Inaugural Stakes — Ringer beat Q iluUnA m the final course. Consolation Stakes - Shamrock beat Newton in the final course. At a meeting of the Dunedin J ckey Club Committee, It was decided to undertake to hold the New Zealand Waterloo Cop of 1888, of sixty-four dogs, at £12 lOj each, on the F-irbury Plumpt on, on August 16, 17, and 18. "HANS THE BOATMAN." The house which greeted the initial performance in Ashburton of "Hans the Boatman" last evening at the Oddfellows' Hall must have been very gratifying to the management. The reserved Beits were all taken up, and the back of the hall and the gallery was fully crowded. The play itself was one calculated to monopolize the sympathies, and its light ness only varied occasionally by a slight shadow, made it all the more interesting. The opening scene was well staged, and was universally admired. The portions of the play which drew forth the applause and admiration of the audience were those where "Hans" and the children congregate on the stage. The scene I and singing on these occasions were really well executed. Mr. Arnold seemed so much at home with his youthful playmates that, for the time being, the idea of play acting was lost, and only the natural romps and speeches of such a character were thought of. The baby oquette, a midget of some four or five summers, displayed wonderful ability as an actress, while "Little Hans," who had seen a couple of frosts more, was also installed as a general favorite. The little one, a midget of some four or five summers, displayed wonderful ability as an actress, while "Little Hans," who had seen a couple of frosts more, was also installed as a general favorite. The little one, a midget of some four or five summers, displayed wonderful ability as an actress, while "Little Hans," who had seen a couple of frosts more, was also installed as a general favorite. The little one, a midget of some four or five summers, displayed wonderful ability as an actress, while "Little Hans," who had seen a couple of frosts more, was also installed as a general favorite. The little one, a midget of some four or five summers, displayed wonderful ability as an actress, while "Little Hans," who had seen a couple of frosts more, was also installed as a general favorite. The little one, a midget of some four or five summers, displayed wonderful ability as an actress, while "Little Hans," who had seen a couple of frosts more, was also installed as a general favorite. The little one, a midget of some four or five summers, displayed wonderful ability as an actress, while "Little Hans," who had seen a couple of frosts more, was also installed as a general favorite. Play, and imbue it when necessary with deep feeling of the best kind. The play is easily outlined, and from the time when we first see "Hans," until he leaves the stage, the interest is mainly turned throughout. The Company is in every way a successful one, and "The Boatman" is likely to have a very successful course through New York. The managers who have brought the Company over, are likely to reap a good harvest from their venture. "Huns" is the creation of Mr. Arnold, and the saloon features of his character are much what we are accustomed for in personations of this class. He is jolly and hearty, like the conventional waterman, and shouts his boatman's call loudly as ever did the "Jolly Young Waterman," or the individual immortalized in "Twickenham Ferry." The boatman of Harlem has many instances from our accustomed idea of the character, and it is in those departures that Mr. Arnold makes his best bits and scores his successes. Our hero is a Swiss Canadian, and withal of good constitution and a merry disposition. In his moral tone, he alms high, though his jollity, combined with a handsome appearance, do not fail to make him admired by the numerous fair ones who cross at his ferry. In the course of his vocation, he becomes acquainted with an heiress — Gladys Farwell— (Miss Alice Norton), who is at once attracted by his handsome ralon and pleasant musical voice. The only thing for a moment is that he is not a Swiss Canadian, and all was in poetical lineage. likely to "go merry as a marriage bell." The stern and unyielding parent has, however, not been consulted in the little game the two loveps have been playing, and it so happens that when he appears on the scene, Gladys prefers her jovial "Hans" with his rollicking manner and fine tuneful voice to the splendors of a parental mansion where everything is refined though severe. In fact, the second the working out of the Incongruous match and youthful lovesiness shows itself, and Gladys is left to poverty, while love for the time being is overwhelmed. Then there is separation, poverty, apparent aim, and generally the opening tune of play is replaced by a wall of sadness, "Bans" looks for a time, through an accident, just as he is about to start reformation in his character and take a more serious view of the things of this life. For the curtain falls, however, everything is brought about to an end satisfactory to nearly all concerned. The music with which the play is studded is light and charming, and "Bans" can carry lustily when he feels disposed, his Tyrolean refrains being very good and taking. The acting and business between "Bans" and the children who take part in the play is clever and natural. There seems no straining after effect. "Bans" enra into the amusements of the youngsters with genuine relight and simplicity, and perhaps this portion of the play is the most favorably received of any of the actors. All the improvements of the play are made to appear quite natural, and as matters of course, by reason of the acceptable acting of the whole cast. Lion, a well-framed St Bernard dog, occupies a prominent situation in the second act, and does his part with an evident appreciation of the importance of the performance. The children are "dear little creatures," as a matter of course, and they do very well indeed. Miss Alice Norton acts genuinely and with due effect, and Miss Jessie Grey as the unmistakable "rough diamond" filled a difficult part. With credit and accuracy, Mr. Leake, who in the play of "My Partner," won his laurels in that piece by the Queen's style in which he used nightly to excel "My Partner" — was made a good favorite for a suitable part in a strong comedy. Gladstone and Mr. Bryant filled their parts appropriately, and the smoothness of the play is due to the strength and capability of the Company. The scenery was excellently staged, and the whole mounting of the piece in unison with the capability of the Company. CRICKET. AUSTRALIANS V LEIESTERSHIRE (Per Press Association.) London, July 6, The cricket match, Australians v Leicestershire, was continued today. The former team was disposed of for the small score of 62, Jarvis being the highest scorer with 16. The Leicestershire team, who had made 119 in their second innings, only succeeded in putting together 50 in their second effort. The Australians in their second innings required 108 runs to win, but were all out for 87, the Leicestershire eleven thus winning by 20 runs. AUSTRALIANS V DERBYSHIRE. London, July 9. The cricket match between Derbyshire and the Australians resulted in a victory for the latter by one innings and 79 runs. In the first innings Derbyshire made 45, Wright being the principal scorer with 15. Turner took six wickets for 20, Ferris four for 25. The Anetrilians made 181, the highest scorers being Edwards (not out) 43, Boyle 39, Trott 20, Bannerman 27. Cooper took six wickets for 43. In their second innings Derbyshire were disposed of for 66, Walker making 25, and Carterton 15. Turner scored seven wickets for 26, and Ferris three for 22. GENTLEMEN V PLAYERS. London, July 10. In the cricket match between the Gentlemen and Players, the former won by five runs, Woods, an Australian, bowling for the Gentlemen, took six wickets for 79. PARLIAMENTARY. LEGISLATIVE COUNCIL. Wednesday, July 18. The Council met at 2:30 p.m. with subsidies to local bodies. Dr. Pollen moved that in the opinion of the Council, it is not advisable, in view of the financial condition and obligations of the colony, that any portion of the public revenue derived from Customs Duties should be appropriated or set apart permanently or for a definite period to provide subsidies for local bodies. He contended that the present system encouraged extravagance on the part of local bodies. The debate was adjourned. HOUSE OF REPRESENTATIVES. AFTERNOON SITTING. Wednesday, July 18. The House met at 2:30. LEGISLATIVE FEDERAL. The Premier gave notice to move on an early day that if the opinion of the House, Government should be responsible for the legislative estimates of Parliament. LEAVE OF ABSENCE. Leave of absence for fourteen days was granted to Mr. Larnach on account of sickness in his family. QUESTIONS Replying to questions. It was stated that Government regretted they could not put any money on the estimates for publishing the last issues of the "Korl mlko," Maori newspaper, and that the Maoris themselves should contribute towards it; that the question of reducing the annual costs of telephones to subscribers would be considered during the recess; that a substantial bonus would be paid to anyone, who would introduce into the colony a system which would successfully treat reference ores on goldfields; that there was a precedent for the Governor absenting himself from the colony while Parliament was sitting, Sir Arthur Gordon having left for Fiji during the term of office of a late Government while Parliament was in session; that a communication had taken place between the Government and other colonies as to the advisability of laying a cable between New Zealand and Vancouver. PUBLIC RESERVES SALE BILL. Mr. Richardson moved the second reading of the Public Reserves Sale Bill. The motion was agreed to. HALFOURTH GRANTS BILL. The House went into Committee on the Middle Island Half-Sessions Grants Bill, which passed with slight amendment. SLAUGHTERHOUSE BILL. The House went into Committee on the Slaughterhouse Bill. The Bill, was discussed at Length and several amendments made, The House rose at 5:30 p.m. EVENING SITTING. The House resumed at 7:30 p.m. The Bill was reported with amendments. EDUCATION BOARDS BILL. The Westland and Grey Education Boards Bill was passed through Committee with slight amendments. PAIR BENT LAND BILL. In Committee the Chairman announced that the Minister in charge did not intend to move any of the amendments made by the Waste Lands Committee. In conclusion, Sir George Grey moved to strike out the words "of the Crown," thus making the application of the Bill general, instead of limiting it to Crown lands. Mr Eialop said Government could not accept this. Mr Walker appealed to Sir G: Grey Dot to preside his amendment, as it endeavored to insert a principle which was foreign to the Bill. All the Bill wished to do was to put public trusts in the same position with respect to their tenants and private landlords. After discussion, the amendment was lost, Mr Whyto moved that the first amendment made by the Waste Lands Committee be agreed to. He explained that it had not been made out of hostility to the Bill, but to aid it in its effect was to restrict the operations of the measure to Crown lands held on lease. Mr Eialop hoped they would adhere to the Bill as originally drawn. He could not understand the object of the committee too late to make this alteration. A long discussion ensued. Mr Jferr moved to, report progress. Ayes 18, noes 30, Mr W Hyde's amendment was then put and lost by 3d to 10. A further amendment to exempt lands controlled by public bodies was lost by 35 to 22. In answer to a Native member, Mr. Hill replied to a Native member, Mr. Hill promised to postpone that portion of the clause referring to Native lands. Consideration of clause 3 was postponed. Clause 13 was amended so that permanent improvements should not be taken into account for the purpose of fixing tenants' rents. At this stage, Mr. Hill agreed to report progress. The House rose at 2:15 a.m. MAGISTERIAL. ASHBURTON— THURSDAY. (Before Mr. O. A. Wray, 19.M.) OIVIL CASES. W p Anderson vD. Forbes, claim £9 Is. Mr. Crisp for plaintiff. Mr. Clayton appeared for defendant, and consented to judgment being given for the amount claimed. R. Lanoaster vJ. Huthan, judgment summons £5 6d. Order made for payment in three monthly instalments, in default 21 days' imprisonment. OBSTRUCTING A THOROUGHFARE. Thomas Magee, who at the last sitting of the Court had been fined for neglecting to remove a house on wheels obstructing a road in the Ahbarton district, now appeared, and stated that it was no fault of his that the house had not been removed, the wet weather having made the roads so soft that a traction engine to shift the house could not work.— The Magistrate asked if the house had yet been removed; Magee replied that it had not, but it would be done forthwith.— Magee was allowed seven days in which to pay the fine previously inflicted. This was all the business. VILLAGE SETTLEMENTS. (Per Press Association.) Auckland, July 18. A public meeting was held this evening at the City Hall to consider the village settlement scheme. The Mayor presided, and there was a large attendance. It was resolved — That, seeing the great success which has attended the system of special village settlement in this district, in at once solving the question of the unemployed, and in promoting sound industrial settlement of our rural lands, this meeting desires to express its regret that the system has been suspended by the Government. (2) That in the interests of true public economy this meeting strongly urges on Government the propriety of placing a sum of £10,000 on the supplementary estimates for this financial year, so as to make provision for resuming the village settlement in this district on the same lines as heretofore. (3) That the Government be requested to bring in a Bill to encourage and enable Maoris, to dispose of their land to Europeans under the village settlement and perpetual leasing scheme. INTERPROVING NEWS [Pes. Press Association,] Manila, July 18. The town of Pah, a fighting chief of the troublesome time of 1867 and onwards, died last night at his Pah near here. He was a consistent friend of his own race, and a brave far-seeing, general All the natives of the Coast are expected to the tangl. Wellington, July 18. A serious assault has been committed on a girl aged 10, residing at the Upper flott. A young man named George Hodgets is accused of the offense, and a warrant was issued for his arrest, and this afternoon he was captured in the bush. An accident occurred today to a young man named Thomas, Morris, a member of one of the city volunteer corps. While handling his rifle at his residence in Hansen street, the weapon went off, and the bullet entered his right breast, about an inch and a half to the left of the heart, and passed out at the back of the blade bone, going right through the posterior portion of the bone. The lung is also injured. Mr. Bell, counsel for Broughton in the Senate, will conduct the case, concluding his address in the Supreme Court this evening, Mr. Chapman, on Mrs. Donnelly's behalf, will address the court tomorrow, and it is expected the case will conclude during the evening. The Superintendent of the Cable Company sends to the Press Association that the London Convention with Europe has been restored. Westport, July 18. Mary Ann Callaghan, a married woman, hanged herself with a handkerchief from a branch of a tree at Denniston this morning. Hoeitiea, July 18. On Tuesday evening a Chinaman met with his death while engaged clearing a block in a tail-race at Greenstone road, near Westbrook. He was washed down through the race over the tip, and badly injured. He lived only a few hours after being taken to the Kumara Hospital. THE "TIMES" LIBEL ACTION (F3R PRESS ASSOCIATION.) London, July 7. In the House of Commons, Mr Parnell declared that the letters produced at the trial of the libel action against the "Times" and purporting to be signed by him were forgeries. The press expresses the opinion that his denial is valueless, and challenges him to disprove them. London, July 9; The solicitor who appeared in Court on behalf of O'Donnell, declares that every step taken in the recent action against the "Times" was first submitted to Mr Parnell. In the House of Commons, today, Mr Parnell applied for the appointment of a Select Committee to enquire into the authenticity of a letter produced at the recent trial. Mr Parnell thereupon gave notice to move, (that a Committee be appointed.) The Pall Mall Gazette, referring to the disclosures in the "Times" libel action, challenges the Government to move for Mr Parnell's expulsion from The House of Commons. Mr. Davitr, speaking at Glasgow, challenged his opponents to prosecute him and Mr. Parnell on charges of murder and conspiracy, as the only course to properly sift the charges levied against them. He admitted that the subordinate leaders of the League had committed grave crimes, but denied that Parnell or his followers were guilty. He regretted the crimes which had been committed, and said they were the work of a e'esperato body of men. THE ABHURION GUARDIAN, THURSDAY, JULY 10, 1888 THE ABHURION GUARDIAN. From and after the 30th November, 1886, the terms of Subscription to the journal will be as follows, viz.:— | if paid in advance: Per Quarter.. 6a 6d by post, 9a 6d Half-year 12a 6d, by post, 18s 6d Year.. 24a 6d, by post, 37s 6d. BOOKED Per Quarter. 7a 6d, by post, 10a 9d „ Half-year 15s 6d, by post, 21a 6d „ Year.. 30b Od, by post, 43a Od Birth riage, and Death Notices, if paid for at the time of insertion 2s 6d each (stamps may be sent as payment) if booked, 4s each. Announcements of Births, Deaths and Marriage sent for publication from the country districts require to be verified by the signature of the person sending the notice. Moon's Sun Sun Sun Moon age at July. Rises. Sun. Moon age at July. Rises. Sun. Moon age at July. 30 4.4; 11.50 a.m. 7 p.m. 0.13 18 Wednesday. 7.30 4.44 0.23 1.24 8 10. Thursday. 7.20 4.46 1.2 2.37 0 30 Friday.... 7.28 4.48 1.43 3.60 10 21 Saturday... 7.27 4.47 2.41 5.0 11 33 Sunday.. 7.30 4.48 3.40 6.7 13 Moonlight Evenings. The Moon at 8 days old ishines till about 8 o'clock. The Moon at 6 days old shines till about half-past 10 o'clock. The Moon at 12 days old shines till, nearly o'clock in the morning. The Moon at 12 days old shines from sundown till about 4 m the morning. The Moon at 15 days old is full, and shines all night. The Moon at 18 days old rises about 9 p.m. and shines till morning. The Moon at 21 days old rises about 2 a.m. and shines till morning. The Moon at 24 days old rises about 2 a.m. and shines till morning. "Rough on Itch."—"Bough on Itch, cures skin humors, eruptions, ringworm, tetter, salt rheum, frosted feet, chilblains, itch, ivy poison, barber's itch. Holloway's Ointment and Pills—As winter advances and the weather becomes more and more inclement and trying, the earliest evidence of ill-health must be immediately checked and removed, on a slight illness may result in a serious malady. Relaxed and sore throat, quinsy, influenza, chronic cough, bronchitis, and most other pulmonary affections will be relieved by rubbing this soothing Ointment into the skin as nearly as practicable to the seat of mischief. This treatment, simple yet effective, is admirably adapted for the removal of these diseases during infancy and youth. Old asthmatic invalids will derive marvelous relief from the use of Holloway's remedies, which have wonderfully relieved many sufferers, and are able to satisfy themselves with two at bedtime. For relieving difficulty of breathing, they are invaluable. They contain no opium or any violent drug. Sold by all druggists. Certainly the Most Effective MEDICINE in the world is SANDER and SONS' EUCALYPTI EXTRACT. Test its eminent powerful effects in Coughs, Colds, Influenza, etc., the relief is instantaneous. Thousands give the most gratifying testimony. Read this certificate: 24th April, 1885. Messrs. Sander and Sons, — It is with the greatest of pleasure that I testify to the excellence of your Eucalypti Extraot. Having had inflammation on the bone of the leg, which came on after a severe attack of low fever, I was attended by Dr. J. Boyd, who had made strenuous efforts to save my leg, but without success. He found it necessary to amputate my limb. TRY KIRKPATRICK'S SPECIAL QUALITY OF FRESH FRUIT "X" - JAM is made from Fresh Fruit, within a few hours after it has been gathered; it thus retains the full flavor of the Fresh Fruit, and is the best quality. It is possible to make. CAUTION: None is Genuine unless our Name is stamped on the Tin, and has our registered Trade Mark, the letter "X," on the Label. KIRKPATRICK AND CO., MANUFACTURERS, NELSON. A CARD. Miss Carson, TEACHER OF MUSIC, (PIANOFORTE AND OUGAN), Brooklyn Street, 12th Good News! Good News! TO ALL HARD-WORKING MEN AND ANXIOUS MOTHERS. BONA FIDE SALE NOW ON AT THE New Zealand Clothing Factor; PREVOUS TO TAKING STOCK. We offer you Real, Genuine, Substantial Goods (our own make) ACTUALLY BELOW COST FOR YOUR READY MONEY, EVERY Article in our Extensive Stock, consisting of Men's and Boys' Clothing, Rags, shirts, etc, reduced to prices unequalled, thus enabling people of limited means to dress and clothing themselves and their children for a small sum. — SPECIAL.— MEABURE SUITS. TROOPERS TOMEABORE - AND FROM THE COMPARISON IS THE TRUE TEST OF VALUE. Bob a Fide Sale NOW IN FULL SWING AT THE NEW ZEALAND Clothing Factory. W. H. WEBBER, Manager. Wanted. Wanted a Girl about 14 to assist in housework. Apply at this Office. Wanted — Genuine Clearing Sale now on — H. O. Segers, Melford House SALE, Melford House, Cash Sale now on, cheapest House in Ashburton. — H. O. Segers. A GREATEST SALE of the day, everything cheap for Cash. — H. O. Segers, Melford House. WANTED Known — That Hayes and Co. has 250 Splendid Tweed Trousers. Your pick for 10s 6d. WANTED Known — Just landed, ex ship Otago, a large assortment of Brass and Iron Bedsteads, at Piokford and Un drill's Bedding and Furniture Warehouse, Tancred Street. BOOTS.— Keep the fact dry And save doctor's bills. Quality is everything in bad weather. I guarantee every pair. Best value in New Zealand at Ashburton Clothing Mart, Saunders Buildings. — Robert Alcorn. WANTED — Everyone to come and see the nicest lot of Glass, China, and Earthenware ever shown in Ashburton, and the Cheapest ever landed in New Zealand. Imported directly from the Manufacturers. — Robert Alcorn, Saunders Buildings. WANTED Cash. — Moir's Oatmeal (251 b), 2s 6d ; Candles, 5d ; Vestas, 6d doz.; Coffee and Milk, Is ; Corn Flour, 4d ; Fruits in Byrap (21b tins), Is Crockery, Glassware, and Ironmongery. — J. Mo Grkoob Tauored street. HOPE FOR THE DEAF. —Nicholson's Improved Patent Artificial Eye Dromedary The only sure, easy, and unseen device used to permanently restore hearing. Recommended by scientific men of Europe and America. Write for free illustrated description book to J. H. Nicholson, Lincoln's Inn Chambers, William street, Melbourne. FOR the Blood is the Life—Clark's world-famous Blood Mixture, warranted to cleanse the blood from all impurities from whatever causes arising. For scrofula, scurvy, skin and blood diseases, and scores of all kinds it's effects are marvelous. Thousands of testimonials. Sold in bottles at $4 and $5 each by chemists and patent medicine vendors everywhere. Pole proprietors: The Lincoln and Midland Counties Drug Co, Lincoln, England. D. Thomas. FOR SALE—A Store Section and two roomed Cottage on the Alford Forest Road; cheap; D. Thomas, 7*32 Ashburton. TO LET. 1 OAA ACRES of Land, situated at J-OUU Mayfield, Hinds, and known as Burges Farm. D. Thomas, 6°164 Ashburton. FARMERS, BUY BOOTH and MACDONALD'S Sheep Feeding Ricks, Will pay for themselves in a Season. D. Thomas, FOR SALE. GENERAL GOOD FARMS CHEAP TO LET. 4 ACRES ALFORD FOREST, half English grass, 3s per Acre D. Thomas, Ashburton. I HAVE FOR SALE OR TO LET. A GENERAL STORE (In Ohertsey) doing a good business. No Good-will. Stock at Valuation. No opposition. Profitable business; good opening for energetic man. For particulars apply D. Thomas, Ashburton. LONDON AND LANCASHIRE FIRE INSURANCE COMPANY. I HAVE been appointed Agent for the above Company, and am now prepared to take risks on Buildings, Stock and Oats at current rates, D. Thomas, Ashburton; Of the County of Ashburton, that they have made arrangements with one of the leading Grain Merchants in Sydney, to receive consignments on their behalf, and are now prepared to make liberal Cash advances on all kinds of Dry and Farm Produce, for Sale in the New Zealand, Sydney, or English markets. In all cases, the original account Sales will be attached to their reports, and their clients may rest assured that no unnecessary charges will be debited against their consignments. All Cash Sales will be attached to their reports, and their clients may receive his best attention. Samples of Grain, etc., may be left at his office, where the latest New Zealand and Intercolonial market quotations may be obtained. The Shipping branch of the business will be conducted by an experienced Clerk, and business men and farmers receiving goods at Lyttelton will find their charges most moderate. Furniture and Produce Sales held every Saturday. Loans negotiated. 3. Ivess and Co., HOBFIELD STREET, CHRISTIAN CHURCH. 6 17 ZEALANDIA BOOT STORE ASHBURTON. FOURTEEN DAYS' SALE OF BOOTS AND SHOES. COMMENCING Saturday, July 14. On the first annual sale will commence on the above date, when we intend offering the Whole Stock at a DISCOUNT OF TEN PER CENT, FOR THE Public are respectfully requested to examine the Goods. The Quality is first-class, and we guarantee all Boots and Shoes to give Good Satisfaction. Now is the time to purchase as the new Policy will raise the price considerably of Impoited Goods. —REMEMBER— Everything Offered at Old Prices During the Sale with a DISCOUNT OF 2s IN THE £. ZEALANDIA boot store: ASHBURTON j Public Notices. THE Undersigned have Troops for Investment upon first class freehold securities at lowest current rates of interest in sums varying from £50 to £8000. WILDING AND LEWIS, 77 Solicitors, Burnett St. Charles Braddell, estate, insurance, financial and general agent, and valuator, Rents and Debts collected. Brattle Street (opposite Arcade), Ashburton. BIG CLEARING SALE JOHN ORE & CO.'S ANNUAL DRAPERY SALE NOW ON. Great Bargains IN Men's Clothing and Boots, Blankets and Flannels.
| 29,548 |
2013/92013E004116/92013E004116_PT.txt_12
|
Eurlex
|
Open Government
|
CC-By
| 2,013 |
None
|
None
|
English
|
Spoken
| 7,482 | 12,108 |
En mars 2013, le Département du transport américain menaçait d'interdire à une compagnie italienne d'effectuer des vols dans le ciel nord-américain mais aussi de vendre des billets de compagnies partenaires en partage de code pour cause de «concurrence déloyale» des aéroports italiens. Le Département du transport américain reproche notamment aux aéroports italiens de facturer des taxes plus élevées au départ et à l'arrivée des vols internationaux par rapport aux taxes imposées aux vols intra-européens. Ces mesures sont jugées par les États-Unis comme «une discrimination injustifiable ou anticoncurrentielle déraisonnable contre les transporteurs américains».
Néanmoins, le préjudice porté aux compagnies américaines effectuant des vols au départ et à destination de l'Italie proviendrait non pas de la compagnie italienne mais de la décision prise par les aéroports italiens de mettre en place des taxes potentiellement discriminatoires. Il semblerait alors que les mesures de représailles souhaitées par les États-Unis en direction de la compagnie aérienne ne soient pas fondées.
1.
Comment la Commission qualifierait-elle la réaction des États-Unis face à cette discrimination commerciale? Ne semble-t-elle pas infondée au vue de la non-responsabilité de la compagnie italienne concernant la mise en place de taxes discriminatoires?
2.
Au vu du préjudice que cette mesure de représailles pourrait constituer pour la compagnie italienne, la Commission a-t-elle prévu de se saisir de la question?
Réponse donnée par M. Kallas au nom de la Commission
(23 mai 2013)
Les États-Unis envisagent, en vertu de leur acte pour des pratiques de concurrence loyale en matière de services aériens internationaux («International Air Transportation Fair Competitive Practices Act», IATFCPA), de prendre des mesures contre les redevances d'atterrissage et de décollage imposées, dans les aéroports italiens, aux vols à destination et en provenance de pays hors UE, car ils les jugent contraires aux dispositions de l'accord UE/États-Unis sur les services aériens.
La Commission examine actuellement cette question. Les autorités italiennes lui ont communiqué des informations dans lesquelles elles justifient la perception de redevances d'atterrissage et de décollage différentes selon qu'il s'agit de vols intra-UE ou hors UE. Le bien-fondé de ces justifications fait l'objet d'une vérification à la lumière des dispositions de l'accord UE/États-Unis sur les services aériens et de la directive sur les redevances aéroportuaires.
La Commission ne doute pas qu'il sera possible de trouver une solution dans le cadre de la bonne application du droit de l'UE à l'aide des procédures internes de l'UE. Dans le cas contraire, la Commission est d'avis que l'accord UE/États-Unis prévoit les mécanismes appropriés pour traiter ce type de questions.
(English version)
Question for written answer E-004037/13
to the Commission
Christine De Veyrac (PPE)
(10 April 2013)
Subject: Retaliatory measures by the US following a failure to comply with the transatlantic air transport agreement
In April 2007, the EU and the US signed an air transport agreement with the aim of facilitating transatlantic transport, in particular for European airlines.
In March 2013, the US Department of Transportation threatened to ban an Italian airline from flying in North American airspace, and also from selling tickets issued by code-share partners owing to ‘unfair competition’ by Italian airports. In particular, the US Department of Transportation has criticised Italian airports for charging extra-European flights higher take-off and landing fees than those imposed on intra-European flights. The United States considers these measures to be ‘an unjustifiable or unreasonable discriminatory or anticompetitive practice against US air carriers’.
Nevertheless, the disadvantage suffered by US airlines flying to and from Italy does not appear to be the fault of the Italian airline but instead stems from a decision made by the Italian airports to charge potentially discriminatory fees. The retaliatory measures which the United States intends to take against the airline therefore seem groundless.
1.
How would the Commission describe the United States’s reaction to this commercial discrimination? Does it not consider it unjustified given that the Italian airline was not responsible for putting discriminatory charges in place?
2.
Given the harm that these retaliatory measures could cause the Italian airline, does the Commission intend to address this issue?
Answer given by Mr Kallas on behalf of the Commission
(23 May 2013)
The United States has envisaged taking action under their International Air Transportation Fair Competitive Practices Act (IATFCPA) concerning landing and take-off charges imposed upon flights to/from non-EU destinations at Italian airports they indeed consider as non-compliant with the provisions of the EU-US air services agreement.
The Commission is investigating the matter and has received information from the Italian authorities regarding the justification for levying different landing and take-off charges upon EU and non-EU flights. Such justification is being checked against the EU-US air services agreement and the Airport Charges Directive.
The Commission trusts that it will be possible to resolve this issue in the framework of proper application of EC law via the EU's internal procedures. Should it not be the case, it is the Commission's opinion that the agreement provides for the appropriate mechanisms to adress this kind of issues.
(Version française)
Question avec demande de réponse écrite E-004038/13
à la Commission
Christine De Veyrac (PPE)
(10 avril 2013)
Objet: Discrimination caractérisée de passagers palestiniens à destination d'Israël
Le 15 avril 2012, une compagnie aérienne européenne obligeait le débarquement d'une passagère avant le décollage du vol Nice-Tel Aviv, au motif qu'elle était palestinienne et qu'elle ne pouvait de fait atterrir en Israël. La compagnie aérienne avait justifié cette décision en expliquant que, comme toutes compagnies aériennes et conformément à la Convention de Chicago, elle devait refuser l'embarquement de toute personne «déclarée inadmissible par le pays de destination». Dans le cas présent, Israël aurait alors refusé le débarquement de passagers palestiniens.
La passagère a porté plainte contre la compagnie aérienne pour «discrimination caractérisée». En effet, comme le précise le procureur en charge de l'affaire, dès lors que la compagnie «s'arroge le droit de poser des questions sur la nationalité et de surcroît sur la religion, elle commet le délit de discrimination». L'argument de la demande formulée par l'État d'Israël a été rejeté puisque la compagnie «était parfaitement en droit de refuser».
Cette décision de la compagnie pourrait être définie comme une discrimination fondée sur la nationalité et la religion. L'article 21 de la Charte européenne des Droits de l'homme interdit toute forme de discrimination et notamment celle fondée sur la nationalité. Le débarquement de la passagère semble alors être contraire à un principe fondamental de l'Union, à savoir le principe de non-discrimination.
Le 4 avril 2013, un tribunal français a d'ailleurs condamné cette compagnie à 10 000 euros d'amende et 3 000 euros de dommages et intérêts pour discrimination caractérisée.
Il convient néanmoins de souligner que cet exemple n'est pas un cas isolé, puisque d'autres affaires du même type, dans lesquelles une compagnie aérienne refuse l'embarquement ou le voyage de passagers palestiniens à destination d'Israël, se sont produites au sein de l'Union européenne.
1.
Au vu de cette affaire, la Commission ne trouve-t-elle pas que la décision de la compagnie aérienne est contraire au principe de non-discrimination, principe fondamental de l'Union européenne?
2.
D'autres cas similaires ayant été recensés, la Commission a-t-elle prévu de prendre les mesures nécessaires afin que ce genre de discrimination, contraire aux principes fondamentaux du droit communautaire, devienne désormais impossible sur le territoire des États membres de l'Union européenne?
Réponse donnée par la Vice-présidente/Haute Représentante Ashton au nom de la Commission
(30 mai 2013)
La Vice-présidente/Haute Représentante Ashton a suivi les questions posées par l'Honorable Parlementaire et sa position au sujet des compagnies aériennes qui refusent l'embarquement de passagers déclarés inadmissibles par le pays de destination est énoncée dans la réponse à la question écrite E-4056/2012 (243). S'agissant de l'incident spécifique auquel il est fait référence dans la question, à savoir le refus d'embarquement opposé à un voyageur le 15 avril 2012, il semble que la compagnie aérienne ait interrogé la personne en cause sur sa confession religieuse avant de la forcer à débarquer. Toutefois, comme il ressort clairement de la question, il semble désormais que cette affaire ait été tranchée par le tribunal compétent de l'État membre concerné.
(English version)
Question for written answer E-004038/13
to the Commission
Christine De Veyrac (PPE)
(10 April 2013)
Subject: Flagrant discrimination against Palestinian passengers travelling to Israel
On 15 April 2012, a European airline forced a passenger to disembark prior to the take-off of the Nice-Tel Aviv flight, on the ground that she was Palestinian and could not in fact land in Israel. The airline justified its decision by explaining that, like all other airlines and in accordance with the Convention on International Civil Aviation, it had to refuse boarding to anyone ‘declared inadmissible in the country of destination’. In this case, Israel would not have allowed Palestinian passengers to disembark.
The passenger filed a complaint against the airline for ‘flagrant discrimination’. Indeed, as the public prosecutor for the case stated, when the airline ‘takes it upon itself to ask questions about nationality and, moreover, religion, it commits the offence of discrimination’. The argument of the request formulated by the State of Israel was rejected since the airline was ‘perfectly within its rights to refuse’.
The airline’s decision could be defined as discrimination based on nationality and religion. Article 21 of the Charter of Fundamental Rights of the European Union prohibits all forms of discrimination, in particular discrimination on grounds of nationality. The removal of the passenger therefore appears to run counter to a fundamental principle of the EU, namely the principle of non-discrimination.
Moreover, on 4 April 2013, a French court ordered the airline to pay a fine of EUR 10 000 and EUR 3 000 in damages for flagrant discrimination.
It should nevertheless be stressed that this example is not an isolated case, since other episodes of this kind, where an airline refuses to allow Palestinian passengers going to Israel to board or travel, have occurred in the EU.
1.
Does the Commission not find that the airline’s decision runs counter to the principle of non-discrimination, a fundamental principle of the European Union?
2.
Given that other similar cases have been recorded, does the Commission intend to take the necessary measures so that this kind of discrimination, which runs counter to the fundamental principles of EC law, will from now on be impossible in the EU Member States?
Answer given by High Representative/Vice-President Ashton on behalf of the Commission
(30 May 2013)
The HR/VP has followed the issues raised by the Honourable Member and her position with regard to airlines refusing to allow passengers to board if they have been decleared inadmissable in the country of destination can be found in answer to Written Question E-4056/2012 (244). Subsequently in the specific incident of one passenger refused boarding on 15 April 2012, referred to in the question, it appears the airline questioned the religious affiliation of the person concerned before forcing the passenger to disembark. However, as the question makes clear, the matter now appears to have been settled by the competent court in the member state concerned.
(Ελληνική έκδοση)
Ερώτηση με αίτημα γραπτής απάντησης P-004039/13
προς την Επιτροπή
Theodoros Skylakakis (ALDE)
(10 Απριλίου 2013)
Θέμα: Επιτόκια επιχειρηματικών δανείων στην Ευρωζώνη
Ερωτάται η Ευρωπαϊκή Επιτροπή:
—
Ποια είναι τα επιτόκια χορηγήσεων των επιχειρηματικών δανείων στις επί μέρους χώρες της Ευρωζώνης;
—
Ποια είναι η πορεία τους τα τελευταία πέντε χρόνια και ποια αναμένει ότι θα είναι η πορεία τους την επόμενη τριετία;
Απάντηση του κ. Rehn εξ ονόματος της Επιτροπής
(13 Μαΐου 2013)
Το Αξιότιμο Μέλος του Κοινοβουλίου θα μπορούσε να συμβουλευθεί τη βάση δεδομένων της Ευρωπαϊκής Κεντρικής Τράπεζας, η οποία παρέχει ενδελεχή ανασκόπηση της τρέχουσας κατάστασης και των τάσεων του παρελθόντος όσον αφορά τα επιτόκια των δανείων προς τις μη χρηματοπιστωτικές εταιρείες (http://sdw.ecb.europa.eu). Όπως διαπιστώνεται εκεί, τα επιτόκια των νέων δανείων προς επιχειρήσεις, διάρκειας έως ενός έτους, κυμαίνονται σήμερα από 2% στη Γερμανία και τη Γαλλία σε 6,5% στην Ελλάδα. Η διαφορά των επιτοκίων μεταξύ των χωρών της ευρωζώνης είναι απότοκο της οικονομικής κρίσης.
Οι μελλοντικές τάσεις στα επιτόκια είναι δύσκολο να προβλεφθούν και ως εκ τούτου η Επιτροπή δεν προβαίνει σε προβλέψεις των εξελίξεων των επιτοκίων.
(English version)
Question for written answer P-004039/13
to the Commission
Theodoros Skylakakis (ALDE)
(10 April 2013)
Subject: Interest on business loans in the euro area
What are the interest rates on business loans in the individual countries of the euro area?
What have been the trends in this respect over the last five years and what are the anticipated trends over the next three years?
Answer given by Mr Rehn on behalf of the Commission
(13 May 2013)
The Honourable Member might consult the database of the European Central Bank that provides a detailed overview over the current situation and past trends of interest rates on loans to to non-fiancial corporations (http://sdw.ecb.europa.eu). As can be seen there, interest rates on new loans to enterprises ‐maturities of up to one year‐ are currently ranging from 2% in Germany and France to 6.5% in Greece. The divergence in interest rates among euro area countries began in the aftermath of the financial crisis.
Future trends in interest rates are difficult to predict and the Commission does therefore not provide a forecast of interest rate developments.
(English version)
Question for written answer E-004040/13
to the Commission
Martina Anderson (GUE/NGL)
(10 April 2013)
Subject: Horsemeat
As a result of EU-wide testing following the exposure of the horsemeat scandal, traces of the drug bute have been discovered in some food samples. Given that this substance is not permitted to enter the human food chain:
Is the Commission concerned by these developments?
Could the Commission outline what it intends to do in order to determine how bute-contaminated horse products were permitted to enter the human food chain, whether legitimately labelled as horsemeat or not?
Answer given by Mr Borg on behalf of the Commission
(23 May 2013)
The EU wide testing of horsemeat for the presence of residues of phenylbutazone (‘bute’) as part of the coordinated control program established by Commission Recommendation 2013/99/EC (245) has revealed 16 non-compliant results on a total of 3 115 samples (0.51%).
In their joint statement, the European Food Safety Authority and the European Medicines Agency concluded that the risks associated to phenylbutazone were of ‘low concern for consumers due to the low likelihood of exposure and the overall low likelihood of toxic effects and that, on a given day, the probability of a consumer being both susceptible to developing aplastic anaemia and being exposed to phenylbutazone was estimated to range approximately from 2 in a trillion to 1 in 100 million.’
Even though none of the products related to the 16 non-compliant test results reached the final consumer and although the joint EFSA and EMA statement is rather reassuring, the Commission remains concerned and recently addressed a five-point action plan to be carried out over the short, medium and longer term to Member States' national authorities. This action plan aims to restore consumer confidence in Europe's food supply chain by strengthening an array of controls through a series of measures falling under five key areas: 1) Food fraud; 2) Testing program; 3) Horse passport; 4) Official controls and penalties and 5) Origin labelling.
(Nederlandse versie)
Vraag met verzoek om schriftelijk antwoord E-004041/13
aan de Commissie
Auke Zijlstra (NI)
(10 april 2013)
Betreft: Stopzetting van de werkzaamheden van de onderzoekscommissie op Cyprus
Op 2 april kondigde de regering van Cyprus de oprichting aan van een commissie die onderzoek zou gaan doen naar de uitstroom van geld uit het land voorafgaand aan de goedkeuring van het financieel reddingsplan. Volgens een op 9 april in de Nederlandse krant De Telegraaf gepubliceerd artikel was de informatie die de centrale bank van Cyprus deze onderzoekscommissie heeft verstrekt onvolledig, aangezien ze slechts betrekking had op een periode van twee weken, hoewel gevraagd was om gegevens met betrekking tot transacties van het hele afgelopen jaar. Als gevolg hiervan heeft de onderzoekscommissie haar werkzaamheden moeten opschorten (246).
Daarnaast is in de Belgische krant De Morgen gemeld dat bankiers van de zwaar getroffen Bank of Cyprus bewijsmateriaal met betrekking tot meerdere gevallen van misbruik hebben vernietigd (247). Volgens een in opdracht van de centrale bank van Cyprus uitgevoerd onderzoek bevonden zich op de computers van twee voormalige managers slechts heel weinig of helemaal geen gesavede e-mails met betrekking tot de periode 2009-2012, en is gebleken dat er gebruik is gemaakt van speciale software die e-mails verwijdert. Dit betekent dat informatie over de aankoop van Griekse obligaties ook verdwenen kan zijn.
1.
Is de Commissie op de hoogte van de bovenstaande feiten?
2.
Is de Commissie het met mij eens dat aangezien belangrijke gegevens en informatie met betrekking tot transacties van de Bank of Cyprus ontbreken, de centrale bank van Cyprus haar toezichthoudende taken niet naar behoren heeft uitgevoerd?
3.
Is de Commissie van oordeel dat de centrale bank van Cyprus zich naar behoren aan haar verplichtingen als lid van het eurosysteem heeft gehouden?
4.
Hoe gaat de Commissie waarborgen dat er een gedegen onderzoek komt naar de uitstroom van geld uit Cyprus?
5.
Hoe komt het dat tijdens de hoorzitting van de Commissie economische en monetaire zaken van het Europees Parlement op 21 maart de voorzitter van de eurogroep, Jeroen Dijsselbloem, geen antwoord kon geven op een vraag van mij over de uitstroom van geld uit Cyprus?
Antwoord van de heer Rehn namens de Commissie
(11 juni 2013)
De commissie die door de Cypriotische autoriteiten is opgericht om de oorzaken van de economische en financiële crisis in Cyprus te onderzoeken, is officieel aangewezen op 2 april 2013.
De Europese Commissie kan niet vooruitlopen op de bevindingen van deze commissie.
De nationale centrale banken zijn onafhankelijke instellingen en de Europese Commissie is niet bevoegd om opmerkingen te maken over de werking ervan.
In het kader van de huidige beperkingen op kapitaalverkeer in Cyprus, volgt de Europese Commissie de kapitaalbewegingen op de voet. Vóór de oplegging van deze beperkingen, die slechts tijdelijk zouden moeten zijn, waren kapitaalbewegingen in Cyprus vrij. De Europese Commissie vertrouwt erop dat juridische onregelmatigheden met betrekking tot kapitaalbewegingen, indien deze door de betrokken partijen worden gesignaleerd, door de bevoegde rechterlijke organen grondig worden onderzocht.
(English version)
Question for written answer E-004041/13
to the Commission
Auke Zijlstra (NI)
(10 April 2013)
Subject: Cessation of the Cyprus investigative commission inquiry
On 2 April, the Cypriot government announced the setting up of a commission tasked with investigating the outflow of money from the country ahead of the approval of the financial rescue plan. According to an article published in the Dutch newspaper De Telegraaf on 9 April, data provided to this commission by the Central Bank of Cyprus were insufficient, because although the commission had asked for data covering transactions from the past year, the information provided only covered a period of fifteen days. As a consequence, the commission has been forced to suspend its inquiry (248).
Furthermore, the Belgian newspaper De Morgen reported that bankers in the hard-hit Bank of Cyprus have destroyed evidence relating to several abuses (249). According to a report commissioned by the Central Bank of Cyprus, few or no saved e-mails were found on the computers of two former managers for the period 2009-12 and special e-mail removal software was found to have been in use. Therefore, data relating to the purchase of Greek bonds may have also disappeared.
In the light of this:
Is the Commission aware of the abovementioned facts?
Does the Commission agree that, since important data and information concerning Bank of Cyprus transactions are missing, the Central Bank of Cyprus has not properly carried out its supervisory function?
Is the Commission of the opinion that the Central Bank of Cyprus has duly fulfilled its obligations as a member of the Eurosystem?
How will the Commission ensure that outflows of money from Cyprus will be properly investigated?
Why is it that, during the hearing held by the Committee on Economic and Monetary Affairs of the European Parliament on 21 March, President of the Eurogroup, Jeroen Dijsselbloem, was unable to answer a question of mine concerning outflows of money from Cyprus?
Answer given by Mr Rehn on behalf of the Commission
(11 June 2013)
The commission set up by the Cypriot authorities to investigate the reasons for the economic and financial crisis in Cyprus was officially appointed on 2 April 2013.
The European Commission cannot prejudge of the findings of this commission.
The European Commission is not habilitated to comment upon the workings of national central banks, which are independent institutions.
The European Commission is monitoring very closely capital movements in the context of the current capital restrictions in Cyprus. Prior to the imposition of these restrictions, which are meant to be temporary only, capital movements in Cyprus were free. The European Commission trusts that any legal irregularities with capital movements, should they be signalled by the concerned parties, will be properly examined by the competent judicial organs.
(Version française)
Question avec demande de réponse écrite P-004042/13
à la Commission
Agnès Le Brun (PPE)
(11 avril 2013)
Objet: Importations d'œufs ukrainiens
Par le règlement d'exécution (UE) no 88/2013, la Commission a modifié l'annexe II de la décision 2007/777/CE et l'annexe I du règlement (CE) no 798/2008 afin d'ajouter l'Ukraine parmi les pays tiers à partir desquels certaines viandes, certains produits à base de viande et certains œufs et ovoproduits peuvent être introduits dans l'Union européenne.
Par ailleurs, le prix de l'œuf en Europe est en baisse depuis plusieurs mois, ce qui suscite l'inquiétude des producteurs européens.
La Commission justifie cette autorisation par les garanties offertes par l'Ukraine en matière sanitaire. L'Ukraine ne respecte en revanche pas les mêmes règles que l'Union européenne en matière de bien-être animal.
1.
La Commission entend-elle mettre en œuvre des mesures concrètes pour empêcher la concurrence déloyale des producteurs ukrainiens, en particulier en ce qui concerne les normes de bien-être animal?
2.
Concernant le prix de l'œuf, la Commission peut-elle mesurer l'impact des importations ukrainiennes sur les cours intra-communautaires?
Réponse donnée par M. Borg au nom de la Commission
(15 mai 2013)
L'accord d'association UE-Ukraine, qui inclut l'accord sur la zone de libre-échange approfondi et complet, a été paraphé en 2012. Il prévoit l'alignement de la législation ukrainienne relative à la santé animale et à la sûreté alimentaire, dont celle qui concerne le bien-être des animaux, sur la législation correspondante de l'Union. L'Ukraine doit fournir à celle‐ci une liste de ses dispositions législatives en matière de bien‐être des animaux et présenter le calendrier selon lequel elle entend procéder au rapprochement des législations.
En attendant l'achèvement de ce processus de rapprochement, l'Union européenne importera des produits d'origine animale en provenance d'Ukraine, y compris des œufs, dans les conditions applicables aux importations provenant d'autres pays tiers.
La Commission surveille de près les quantités d'œufs et d'ovoproduits importées dans l'Union. En janvier, février et mars 2013, aucun de ces produits n'a été importé d'Ukraine.
La baisse actuelle du prix de l'œuf dans l'UE est liée au volume important d'œufs produit depuis le début de l'année 2013. Elle découle aussi d'un ajustement à la baisse des prix du marché, qui avaient atteint un niveau très élevé en 2012, après l'application de la directive 1999/74/CE établissant les normes minimales relatives à la protection des poules pondeuses (250).
(English version)
Question for written answer P-004042/13
to the Commission
Agnès Le Brun (PPE)
(11 April 2013)
Subject: Imports of Ukrainian eggs
With Implementing Regulation (EU) No 88/2013, the Commission has amended Annex II to Decision 2007/777/EC and Annex I to Regulation (EC) No 798/2008 so as to include the Ukraine among the third countries from which certain meat, meat products, eggs and egg products may be introduced into the European Union.
Moreover, egg prices in Europe have been in decline for several months, which has given rise to concern among European producers.
The Commission has justified this authorisation on the grounds of the health guarantees offered by the Ukraine. However, the Ukraine does not apply the same animal welfare rules as the EU.
1.
Does the Commission intend to implement concrete measures to prevent unfair competition from Ukrainian producers, particularly with regard to animal welfare standards?
2.
Regarding the price of eggs, is the Commission able to evaluate the impact of Ukrainian imports on intra-EU prices?
Answer given by Mr Borg on behalf of the Commission
(15 May 2013)
The EU-Ukraine Association Agreement including the Deep and Comprehensive Free Trade Area agreement was initialled in 2012. It foresees that the Ukrainian animal health and food safety legislation, including the animal welfare legislation, has to be approximated to the relevant Union legislation. Ukraine shall provide the EU with a list of its animal welfare legislation and indicate the timing for the approximation process.
Until the process of approximation of animal welfare legislation has been completed the Union will import products of animal origin, including eggs, from Ukraine under the same conditions as for other third countries.
The Commission is closely following amounts of imported eggs and egg products into the EU. In January, February and March 2013, there were no imports of eggs and egg products from Ukraine.
The current egg price fall in the EU is linked to a high level production since the beginning of 2013. It is also a result of a downward adjustment of the market that had reached very high prices in 2012 after the implementation of Directive 1999/74/EC laying down minimum standards for the protection of laying hens (251).
(Nederlandse versie)
Vraag met verzoek om schriftelijk antwoord P-004043/13
aan de Commissie
Bart Staes (Verts/ALE)
(11 april 2013)
Betreft: Baggerwerken voor oliewinning in het noordpoolgebied
Een Vlaams baggerbedrijf vroeg twee weken geleden een exportkredietverzekering aan bij de Nationale Delcrederedienst, teneinde een staatswaarborg te bekomen voor baggerwerken die het bedrijf zal uitvoeren in het kader van de uitbouw van de Sabetta-haven op het Jamal-schiereiland, gelegen in het Russische noordpoolgebied. Het bedrijf doet dit in opdracht van de Russische autoriteiten. Deze Sabetta-haven moet een cruciale rol gaan spelen in de Russische ambities om de olie‐ en gasvoorraden die zich onder het poolijs bevinden te gaan ontginnen.
Eind vorig jaar keurden dit Parlement en de Europese Raad de Verordening (EU) nr. 1233/2011 goed inzake de OESO-richtsnoeren op het gebied van door de overheid gesteunde exportkredieten (252).
In een Resolutie van 14 maart 2013 over het Stappenplan Energie 2050, neemt het Europees Parlement het op voor de Noordpoolwateren en wijst het op de gevaren van energiewinning voor het milieu (253).
Is de Commissie — als hoedster van de verdragen en toezichthouder op de uitvoering van Europese wetgeving — bereid dit dossier te onderzoeken en na te gaan of de toekenning van de staatswaarborg al dan niet in strijd zou kunnen zijn met Verordening (EU) nr. 1233/2011 en/of andere Europese regelgeving omtrent milieueffectenrapportage?
Greenpeace analyseerde het milieueffectenrapport dat het bedrijf bezorgde aan de Nationale Delcrederedienst en stelt vast dat het op verschillende vlakken niet voldoet aan de belangrijkste aspecten die zijn opgenomen in de OESO-Aanbeveling inzake de „Gemeenschappelijke Benaderingen betreffende door de overheid gesteunde exportkredieten en milieu‐ en sociale due dilligence” van 28 juni 2012. Welke stappen zal de Commissie zetten ten aanzien van de Belgische Staat en de Nationale Delcrederedienst om te verhinderen dat de OESO-Aanbeveling nog verder wordt genegeerd, en het noordpoolgebied nog verder wordt bedreigd?
Antwoord van de heer De Gucht namens de Commissie
(8 mei 2013)
De Commissie deelt de mening dat bij de toekenning van exportkredieten terdege rekening moet worden gehouden met milieuvraagstukken. De Commissie deelt ook het standpunt dat de aanbeveling van de Organisatie voor Economische Samenwerking en Ontwikkeling (OESO) inzake een gemeenschappelijke aanpak van door de overheid gesteunde exportkredieten en de in acht te nemen zorgvuldigheid op milieu‐ en sociaal gebied (de „gemeenschappelijke aanpak”), in de meest recente versie (28 juni 2012), in de internationale exportkredietgemeenschap brede steun geniet als referentie-instrument.
In het jaarlijkse activiteitenverslag over 2011 dat de Belgische autoriteiten uit hoofde van Verordening (EU) nr. 1233/2011 (254) hebben ingediend, wordt bevestigd dat de nationale exportkredietinstelling (nationale Delcrederedienst) de gemeenschappelijke aanpak van de OESO toepast om al haar transacties te toetsen op mogelijke negatieve effecten op het milieu of de samenleving.
Wat het in de vraag van het geachte Parlementslid genoemde individuele geval betreft, beveelt de Commissie aan in eerste instantie een verzoek tot de nationale Delcrederedienst of de met het toezicht op de exportkredietinstelling belaste Belgische autoriteiten te richten en te vragen naar hun standpunt over deze kwestie.
De Commissie is vanzelfsprekend altijd bereid haar rol als hoedster van het Verdrag uit te oefenen indien er redenen zijn om te vrezen dat de Europese wetgeving niet wordt toegepast. Er zij echter evenwel op gewezen dat de „gemeenschappelijke aanpak” geen onderdeel van de EU-wetgeving vormt.
(English version)
Question for written answer P-004043/13
to the Commission
Bart Staes (Verts/ALE)
(11 April 2013)
Subject: Dredging for oil extraction in the Arctic
Two weeks ago a Flemish dredging company applied to the Belgian Export Credit Agency for export credit insurance in order to obtain a state guarantee for the dredging works the company will carry out as part of the development of the Sabetta port on the Yamal Peninsula in the Russian Arctic region. the company has been commissioned to do this work by the Russian Government. The Sabetta port is to play a crucial role in Russian ambitions to extract the oil and gas reserves that lie under the Arctic ice.
At the end of last year, this Parliament and the European Council adopted Regulation (EU) No 1233/2011 on the OECD guidelines in the field of government-backed export credits (255).
In its Resolution of 14 March 2013 on the Energy Roadmap 2050, the European Parliament expresses concern over the Arctic waters and points to the dangers that oil and gas operations pose to the environment (256).
Is the Commission — as guardian of the Treaties and the oversight authority for the implementation of European legislation — prepared to examine this issue and determine whether or not the granting of a state guarantee would be in conflict with Regulation (EU) No 1233/2011 and/or other European legislation on environmental impact assessment?
Having analysed the environmental impact report that the company submitted to the Belgian Export Credit Agency, Greenpeace notes that, in several areas, it fails to satisfy the most important requirements stipulated in the OECD Recommendation on ‘Common Approaches for Government-Backed Export Credits and Environmental and Social Due Diligence’ adopted on 28 June 2012. What measures will the Commission take with regard to the Belgian State and the Belgian Export Credit Agency to prevent the OECD Recommendation being further ignored and the Arctic threatened even more?
Answer given by Mr De Gucht on behalf of the Commission
(8 May 2013)
The Commission shares the opinion that environmental concerns should duly be taken into consideration in the process of granting export credits. The Commission also shares the view that the Organisation for Economic Cooperation and Development (OECD) Recommendation on Common Approaches for Officially Supported Export Credits and Environmental and Social Due Diligence (the ‘Common Approaches’) in its latest version (28 June 2012) enjoys wide support in the international export credit community as a reference instrument.
The Annual Activity Report submitted by the Belgian authorities for the year 2011 under Regulation (EU) No 1233/2011 (257) confirms that the national Export Credit Agency (the ‘Office National du Ducroire — nationale Delcrederedienst’ or ‘ONDD’) applies the OECD Common Approaches to screen all its transactions for possible negative environmental or social effects.
Concerning the individual case mentioned in the Honourable Member’s question, the Commission would recommend addressing the query in the first place to the ONDD or the Belgian authorities which exercise the supervision of the Export Credit Agency and seek their views on the issue.
The Commission is of course always ready to exercise its role as Guardian of the Treaty where there is reason to fear that European legislation is not implemented. In any case, it has to be kept in mind that the ‘Common Approaches’ are not part of the EU legislation.
(Deutsche Fassung)
Anfrage zur schriftlichen Beantwortung E-004044/13
an die Kommission
Sabine Wils (GUE/NGL)
(11. April 2013)
Betrifft: Stuttgart 21-Subventionen
Die EU hat auf Antrag der Bundesrepublik Deutschland per Entscheidung am 12.12.2008 114,5 Mio. EUR Subventionen für das Bahnhofsprojekt Stuttgart 21 zur Verfügung gestellt.
In der Begründung wird auf eine Verdopplung der Leistungsfähigkeit des Bahnhofs durch S 21 verwiesen.
In der Antwort der Kommission auf die Frage von Michael Theurer am 01.03.2013 (E-002430-13) steht, die Förderung wäre von „unabhängigen Sachverständigen bewertet und gemäß den allgemeinen TEN-V-Bedingungen für die Finanzierung von Projekten, einschließlich des EU-Umweltrechts, als förderfähig befunden“ worden.
1.
Wer waren diese Sachverständigen; welches Urteil fällten diese über die zukünftige Leistungsfähigkeit des Bahnhofes, und war dieses Urteil ausschlaggebend für ihre Einschätzung?
2.
Wie beurteilt die EU-Kommission die Vorwürfe, dass der neue Bahnhof nicht einmal die Kapazität des alten erreichen wird?
3.
Sollten sich dies bewahrheiten, stellt dies eine politische Täuschung oder gar eine unrechtmäßige Beihilfe dar?
4.
Welche Konsequenzen zieht die Kommission für die unter 3. genannten Fälle, insbesondere für die bereits ausgezahlten Mittel?
Antwort von Herrn Kallas im Namen der Kommission
(21. Juni 2013)
1.
Bei den Sachverständigen, die diesen Vorschlag geprüft haben, handelte es sich um Fachleute, die die Kommission wegen deren Erfahrung auf dem betreffenden Gebiete und deren Unabhängigkeit von dem Projekt ausgewählt hatte. Für die befürwortende Bewertung des Vorschlags waren die Kriterien Zweckdienlichkeit, Auswirkungen, technische Ausgereiftheit und Qualität der Maßnahme ausschlaggebend. Zur quantitativen Leistungsfähigkeit des zukünftigen Bahnhofs haben sich die Sachverständigen nicht geäußert.
2.-4. Die Kapazität des neuen Bahnhofs ist nicht Gegenstand der TEN-V-Entscheidung der Kommission (258).
(English version)
Question for written answer E-004044/13
to the Commission
Sabine Wils (GUE/NGL)
(11 April 2013)
Subject: Subsidies for the Stuttgart 21 railway project
At the request of the Federal Republic of Germany, by decision of 12 December 2008 (259) the EU made available a subsidy of EUR 114.5 million for the Stuttgart 21 rail station project.
In support of this decision it is stated that Stuttgart 21 would double the station’s performance.
In its answer to the question by Michael Theurer of 1 March 2013 (E-002430/2013) the Commission states that this subsidy ‘was evaluated by external experts and was found eligible according to the general TEN-T conditions for financing projects, including due respect of the EU environmental legislation’.
1.
Who were these experts? What was their finding about the future performance of the station, and did this finding have a decisive effect on their evaluation?
2.
What is the Commission’s response to the criticisms that the new station will not even reach the capacity of the old one?
3.
Should this prove true, does this constitute political deception or even illegal aid?
4.
If so, what action will the Commission take in consequence, particularly as regards funds already paid?
Answer given by Mr Kallas on behalf of the Commission
(21 June 2013)
1.
The experts who assessed the proposal were professionals chosen by the Commission on the basis of their experience in the relevant field and their independence from the project. The positive assessment of the proposal was made against the criteria of relevance, impact, maturity and quality of the action. The performance of the future station was not quantified by the experts.
2-4. The capacity of the new station is not an objective of the TEN-T Commission decision (260).
(Deutsche Fassung)
Anfrage zur schriftlichen Beantwortung E-004045/13
an die Kommission
Ingeborg Gräßle (PPE)
(11. April 2013)
Betrifft: Umzugshilfen
Die Ziegler SA hat am 12. Dezember 2012 vor dem Europäischen Gerichtshof Klage gegen die Kommission eingereicht. Es geht um die Entscheidung der Kommission COMP/38.543 — Auslandsumzüge, in der Absprachen zwischen Umzugsunternehmen in Brüssel sanktioniert wurden. Die Kommission hat für die Erstattung der Umzugskosten ihrer Beamten die Einholung von drei verschiedenen Kostenvoranschlägen zur Bedingung gemacht.
Die Klägerin wirft nun der Kommission vor, in zweierlei Hinsicht rechtswidrig gehandelt zu haben:
Zum einen habe die Kommission ihre Sorgfaltspflicht und das Grundrecht der Klägerin auf ordnungsgemäße Verwaltung verletzt, indem die Kommission die Bedingung für die Erstattung — die Einholung von drei verschiedenen Kostenvoranschlägen — nicht überprüft habe, obwohl ihr die Auswüchse der Regelung bekannt gewesen seien.
Zum anderen hätten Beamte die Klägerin unmittelbar dazu aufgefordert, Schutzangebote bei Wettbewerbern einzuholen, und hätten damit die Klägerin unmittelbar zur Zuwiderhandlung verleitet. Aufgrund der Weigerung der Klägerin nach der Entscheidung der Kommission (COMP/38.543) weiterhin Schutzangebote bei Wettbewerbern einzuholen, erlitt die Klägerin einen erheblichen Gewinnausfall.
1.
Wie lange gab es die Praxis, fingierte Kostenvoranschläge für Umzüge einzuholen?
2.
Wie viele Fälle gibt es? Wie viele Jahre sind betroffen?
3.
Seit wann wusste die Kommission von den Absprachen der Umzugsunternehmen?
4.
Seit wann wusste die Kommission vom Verhalten ihrer Beamten hinsichtlich der Erstattung von Umzugskosten? Seit wann hätte die Kommission dies wissen müssen?
5.
Hat die Kommission die von den Beamten eingeholten Kostenvoranschläge überprüft? Wenn ja, wie?
6.
Wie kontrolliert die Kommission mittlerweile die Kostenvoranschläge? Wie kontrolliert die Kommission, dass die Angebote von verschiedenen Unternehmen eingeholt wurden?
7.
Wie wird die Aufforderung von Beamten an die Umzugsunternehmen Schutzangebote von Mitbewerbern einzuholen, bzw. die Aufforderung selbst Angebote zu fingieren von der Kommission geahndet? Welche dienstrechtlichen Konsequenzen hat dies?
8.
Welche dienstrechtlichen Konsequenzen hat das Nichtanzeigen von offensichtlichem Fehlverhalten?
Anfrage zur schriftlichen Beantwortung E-004259/13
an die Kommission
Ingeborg Gräßle (PPE)
(16. April 2013)
Betrifft: Umzugshilfen II
Die Ziegler SA hat am 12. Dezember 2012 vor dem Europäischen Gerichtshof Klage gegen die Kommission eingereicht. Es geht um die Entscheidung der Kommission COMP/38.543 — Auslandsumzüge, in der Absprachen zwischen Umzugsunternehmen in Brüssel sanktioniert wurden. Die Kommission hat für die Erstattung der Umzugskosten ihrer Beamten die Einholung von drei verschiedenen Kostenvoranschlägen zur Bedingung gemacht.
Die Klägerin wirft nun der Kommission vor, in zweierlei Hinsicht rechtswidrig gehandelt zu haben:
Zum einen habe die Kommission ihre Sorgfaltspflicht und das Grundrecht der Klägerin auf ordnungsgemäße Verwaltung verletzt, indem die Kommission die Bedingung für die Erstattung, die Einholung von drei verschiedenen Kostenvoranschlägen, nicht überprüft habe, obwohl sie die Auswüchse der Regelung gekannt hätte.
Zum anderen hätten Beamte die Klägerin unmittelbar dazu aufgefordert, Schutzangebote bei Wettbewerbern einzuholen, und hätten damit die Klägerin unmittelbar zur Zuwiderhandlung verleitet. Aufgrund der Weigerung der Klägerin, nach der Entscheidung der Kommission (COMP/38.543) weiterhin Schutzangebote bei Wettbewerbern einzuholen, erlitt die Klägerin einen erheblichen Gewinnausfall.
1.
Wie viele OLAF-Mitarbeiter haben persönlich ebenfalls gefälschte Angebote vorgelegt?
2.
Wie viele OLAF-Ermittlungen gab es? Gegen wie viele Personen/EU-Beamte/EU-Mitarbeiter wurde ermittelt? Was waren die Ergebnisse?
3.
Gab es Ermittlungen auch gegen OLAF‐Mitarbeiter? Wer führte die Ermittlungen durch? Was waren die Ergebnisse?
Gemeinsame Antwort von Herrn Šefčovič im Namen der Kommission
(19. Juni 2013)
Die geschilderte Problematik ist der Kommission gut bekannt. Wie der Anfrage zu entnehmen, werden dieselben Argumente von den Anwälten des Umzugsunternehmens in ihrer Klage gegen die Kommission vor dem Gerichtshof der Europäischen Union angeführt; mit dieser Klage wird die Entscheidung der Kommission in der Sache COMP/38.543 (Auslandsumzüge) angefochten, mit der sie Absprachen zwischen Umzugsunternehmen in Brüssel sanktioniert hat.
Die Kommission weist diese Argumente im Rahmen des Rechtsverfahrens förmlich zurück. Angesichts der anhängigen Rechtssachen T‐150/13 und T‐539/12 enthält sich die Kommission weiterer Bemerkungen und beschränkt sich auf den Hinweis, dass nach ihrem Wissen OLAF‐Mitarbeiter nicht von dieser Angelegenheit betroffen sind.
(English version)
Question for written answer E-004045/13
to the Commission
Ingeborg Gräßle (PPE)
(11 April 2013)
Subject: Relocation grants
On 12 December 2012, Ziegler SA brought an action before the European Court of Justice against the Commission. It is contesting the Commission’s decision in case COMP/38.543 (international removal services), which penalises agreements between removal companies in Brussels. The Commission made it a requirement for its officials to obtain three different quotes before relocation costs would be reimbursed.
The applicant complains that the Commission has acted illegally on two counts.
First, the Commission has infringed its duty of care and the applicant’s fundamental right to sound administration in that the Commission failed to verify the condition requiring three different quotes to be obtained before relocation costs would be reimbursed, even though it should have been familiar with its own regulatory excesses.
Second, officials asked the applicant directly to obtain cover quotes from competitors, thereby directly inciting the applicant to commit an infringement. Following the applicant’s refusal to continue obtaining cover quotes from competitors in the wake of the Commission’s decision (COMP/38.543), the applicant sustained considerable loss of earnings.
1.
How long has it been common practice to obtain fictitious relocation quotes?
2.
How many cases have there been, and in how many years?
3.
When did the Commission learn about the collusion between removal companies?
4.
How long has the Commission known about the conduct of its officials seeking reimbursement of relocation costs? Since when should the Commission have known about this?
5.
Did the Commission verify the quotes obtained by officials? If so, how?
6.
How has the Commission been verifying quotes in the meantime? How does the Commission verify that the quotes have been obtained from different companies?
7.
How does the Commission penalise officials for asking removal companies to obtain cover quotes from competitors or make up quotes themselves? What are the consequences of this under public sector employment law?
8.
What consequences does the failure to report obvious misconduct have under public sector employment law?
Question for written answer E-004259/13
to the Commission
Ingeborg Gräßle (PPE)
(16 April 2013)
Subject: Removal subsidies II
On 12 December 2012, Ziegler SA filed a complaint against the Commission before the Court of Justice of the European Union contesting the Commission’s decision in case COMP/38.543 (international removal services), which penalises collusion between removal companies in Brussels. The Commission requires its officials to obtain three different quotations as a condition for the reimbursement of removal costs.
The applicant is now complaining that the Commission has acted illegally on two counts.
First, the Commission infringed its duty of care and the applicant’s fundamental right to sound administration, by failing to review the condition requiring three different quotations to be obtained for the purpose of reimbursing relocation costs, even though it should have realised what the outcome of that rule would be.
Second, officials asked the applicant directly to obtain cover quotes from competitors, thereby directly encouraging the applicant to commit the infringement. Following the applicant’s refusal to continue to obtain cover quotes from competitors in the wake of the Commission’s decision (COMP/38.543), the applicant sustained considerable loss of earnings.
1.
How many OLAF employees have also personally submitted bogus quotes?
2.
How many OLAF investigations were there? How many people/EU officials/EU employees were investigated? What were the outcomes?
3.
Were any OLAF employees also investigated? Who carried out the investigations? What were the outcomes?
Joint answer given by Mr Šefčovič on behalf of the Commission
(19 June 2013)
The matters raised in those two questions are well known by the Commission. As indicated in the questions themselves, the same arguments are used by the lawyers of the removal company in their complaint against the Commission before the Court of Justice of the European Union contesting the Commission’s decision in case COMP/38.543 (international removal services), which penalises collusion between removal companies in Brussels.
The Commission formally refutes those arguments within the judicial proceedings. In the light of the ongoing sub judice procedures T-150/13 et T-539/12, the Commission refrains from making further comments, limiting itself to indicating that to the best of its knowledge, no staff members of OLAF are concerned by the matter.
(English version)
Question for written answer E-004046/13
to the Commission
Marina Yannakoudakis (ECR)
(11 April 2013)
Subject: Athens office of the Commission's Directorate-General for Economic and Financial Affairs
As we approach the first anniversary of the setting-up of the Athens office of its Directorate‐ General for Economic and Financial Affairs, can the Commission provide me with details of the following:
—
the number of Commission officials (including temporary and contract staff) seconded to or on mission to the above Athens office, and their functions;
—
the mission costs of seconded staff on long-term mission expressed on a monthly basis, indicating the number of staff and the number of days of mission;
—
any additional allowances (including reimbursement for any accommodation) paid to staff serving in the above office;
—
rental and utility costs for any premises related to the above office, including offices or accommodation for staff;
—
any communications or representational budgets for the above office;
—
the number (if any) of locally engaged staff (including part-time and contract staff) and their functions;
—
the staffing costs of any such locally engaged staff, expressed on a monthly basis?
Answer given by Mr Rehn on behalf of the Commission
(11 June 2013)
On 1 May 2013, the Athens office employed 24 Commission agents of which 19 at administrator level and 5 at assistant level. None of these are local agents:
14 agents (11 at administrator level and 3 at assistant level) were on long-term mission arrangements for a total commitment of ca. EUR 29 000 per month with no additional allowances specific to the staff of the office.
The office is hosted in a Greek Agency; no rent is charged and utilities are of EUR 12 700 per month. It has no communications or representational budget.
| 28,806 |
historyofourrela01portuoft_23
|
US-PD-Books
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 6,958 | 9,084 |
Nothing worthy of note occurred in these visits, except that, on the voyage, the Andamanese rendered most useful and indeed indis- pensable service in supplying the want of a sufficient crew on board the Settlement Steamer Diana. Through some unaccountable neglect or oversight, the Diana had left Rangoon on her voyage to Moulmein and Port Blair without a sufficient number of men to work her, and it was found impossible to heave up the anchor, and to perform many other necessary duties of the ship without the assist- ance of the Andamanese, which, I am bound to say, was cheerfully rendered, though they were severely over-worked and deprived of their rest at night through the exertions imposed upon them. In the beginning of this year (1864), the South Tribe renewed their depredations, but with much more caution, avoiding the armed police and escaping into the jungles whenever they appeared ; they seemed to obtain intelligence by some means, while the police were 454 A HISTORY OF OUR RELATIONS still at a distance, that they were approaching. The latter could not succeed in finding them, and never knew when or where to expect them, for they continually changed their positions to elude the police, and appeared successively in quite different directions where they knew the Native convicts would be least prepared to receive them. In this manner, not only was great damage done to the Settlement plantations, but serious loss was sustained by the convict self -sup- porters whose gardens were completely cleared of all their produce. Colonel Tytler felt the necessity of taking effective measures to oppose these lawless proceedings, but there appeared no means of putting a stop to them without actual collision with the tribe, resulting, pro- bably, in bloodshed. He was most anxious to avoid this ; and I begged him to enjoin the police not to shoot any of them, but to lie in ambush and endeavour, if possible, to capture them. A few days following two of the ring-leaders, known now as Moriarty and Sandys Sahib, were seized, and Colonel Tytler put them in irons and placed them under my care. As I had expected, some of their friends soon came to visit them, and I sent a message by them to their tribe that the prisoners were to be kept in close custody as a security for their future good behaviour, and that they should be severely punished if any of the Native convicts at the outposts were again molested. These measures and warnings were more effectual in restraining their aggressive movements than the slaughter of half the tribe would have been ; for, finding themselves foiled and fearing that we should retaliate upon the prisoners if they gave us further provocation, they left the neighbourhood. On my second expedition to Port Mouat, when returning late one evening through MacPherson's Straits, we saw the fires of the aborigines, and as soon as the steamer was anchored, I started ia a small boat to visit their encampment. We arrived opposite to it about 8 P.M. and hailed them, but instead of replying they extin- guished their fires and retreated into the woods. Topsy and an Anda- manese child, who were with me, now tried their persuasions. They assured the other aborigines that they had nothing to apprehend WITH THE ANDAMANESE. 455 from us, that we were unarmed, that it was only myself, Myjolah, who Lad come to visit them, that the only other persons in the boat were the Natire crew, and, moreover, that we had coconuts and rice in abundance, and other presents for them. These assurances satisfied them, and they commenced to wade out towards us, calling out to us to bring the boat nearer; I replied that this was impossible, as the shore was rocky and my boat had already struck against a rock, and that I was afraid on that account to approach any nearer, and asked them why they had extinguished their fires. They said that they would at once relight them and come out to us in a canoe, and in a quarter of an hour they came, — a woman steering with a paddle, and four men pulling : I filled their canoe with coconuts, bags of grain, beads, knives, looking-glasses, and other ]- resents with which two of them returned : the woman and two men accompanying us to the steamer. Next morning I again visited the camp without guard or attendants, and the abori- gines, delighted with the presents which I had left with them the night before, gave me a most welcome reception, promising that if any Europeans 'Ahboojing-eejidur) ever fell into their hands, they would bring them to the Settlement. (The last remark shows how much of Mr. Corbyn's notes regard- ing the sayings and doings of the aborigines was evolved from his own imagination. '• Sojiff-ngiji-da " means "aborigines," and tho people were evidently talking about themselves, he not understanding a word of the conversation. — M. V.P.) During the month of February, 1861, the number of aborigines of both tribes on the Settlement was upwards of forty ; who were daily employed in work with Native convicts, (which should never have been permitted. — M. V. P.), clearing sites, making thatching and bamboo frame-work, and helping in other ways in the construction of their own houses, piggeries, and cattle sheds ; but soon severe ill- ness began to prevail amongst them, and various causes combined to render them dissatisfied with their condition and treatment here. The monthly allowance for their support did not suffice for their wants, and Colonel Tytler admitted that in return for their labour 456 A HISTORY OF OTTK RELATIONS which was quite equal to that of Native convicts, they were even entitled to a larger allowance. They, moreover, complained of other discomforts. The Andaman Home was no longer tenantable, and their only dwelling was a small cow-shed, which they shared with cattle, sleeping on a raised bamboo machan above them. (It is not understood, when he saw how objectionable it was, why Mr. Corbyn allowed such a state of things. The Andamanese should have been permitted to make one of their own villages, in which, in a sheltered spot, they would have been perfectly happy. — M.V.P.} They were also impatient of the presence of a Convict Guard over them, Who watched and restricted their movementsj not allowing them the liberty of walking about the island except at certain times, and attended by them to restrain them from doing any mischief. Four of them died here ; but still nothing could be done to improve their quarters, (!) or better their condition. (All this is not under- stood. Certain subsequent correspondence snows that Mr. Corbyn and the new Superintendent Major Ford were not on good terms, but there is nothing to show that Major Ford was not anxious to treat the aborigines well ; indeed, a letter of his quoted below shows that he did not approve of the repression exercised over the Anda- manese by Mr. Corbyn. — M. V.P.} The South Tribe men were continually instigating the others to escape ; (Escape from what ? Mr. Corbyn has hitherto said that they were under no restrictions. — M. V. P.), and at length, not- withstanding the utmost vigilance of the guard, the prisoners, as well as nearly all the others, succeeded in doing so ; one of the former, Sandys Sahib, swimming in his irons to the main- land, and only Jumbo and Topsy were left, and finally they also escaped (!), and the latter most unfortunately was drowned in attempting to swim to the mainland. Such a, finale of all our hopes and efforts was indeed melancholy and disheartening, and every one predicted that we should see nothing more of the Andamanese, and that it was hopeless to attempt to do anything more with them. But I renewed the attempt, supported and encouraged by Major Ford in doing so. It occurred to me that as soon as the North Tribe knew WITH THE ANDAMANESE. 457 that Jumbo had escaped (!) they would decamp and go to some other part of the islands, and it was therefore desirable to see them, and endeavour to persuade some of the more influential of them to return to the Settlement before they had ascertained this circumstance, which would not be for several days, as Jumbo had swam from this island to the south of Aberdeen, and would therefore be many days journeying so far as the North Tribe encampment. In pursuance of this design, I went to the jungles supplied with a week's provi- sions, and took up a position on the coast about eight or nine miles northward, where I remained five days. I am happy to state that now the good understanding with them has been completely restored, and we are on the best of terms with them. Jumbo was kept here a few days and then sent back to the mainland, and he now by his own wish remains at the North Out- post Home established for them on the mainland. All the others who formerly escaped, including the prisoners Moriarty and Sandys Sahib of the South Tribe, are at the present moment on this island, all having returned of their own accord, in number thirty-eight, but no longer under any restriction (!) for they are not watched by parawallahs, and are at liberty to return to the mainland and their own homes whenever they are so disposed, — a liberty of which they freely avail themselves, but do not leave us altogether, for they generally return after a few days' absence, swimming across, or in canoes which I have provided for them. As soon as a ship now appears in port they swim to it and beg for plantains ; and if pice, of which they now know the use and ap- preciate the value, are thrown to them, they dive to a great depth for them, — even the small children being very successful at these feats. We are making some use of them now in trying to recover escaped convicts by their means, and though the experiment has not yet been quite successful, there is sufficient reason to hope that it will be ; and 3 N A HISTORY OF OUR RELATIONS the convicts, amongst whom the report has already spread that we are sending the aborigines into the jungles after runaways, will be deterred from trying to escape, by fear of having such rough police to deal with, and we may hope, therefore, that much less will now be heard of such escapes which have been so frequent lately. Crusoe and another man of his tribe were sent southward, by Major Ford's desire, to search for three Burmans who had not been heard of for a month, and one of whom left armed with a musket. A written order closed and sealed in which the Burmans were required to return immediately, and informed that the Aadamanese had be^n sent in search of them, was put into Crusoe's hands, and he was told to deliver it to them. I then took him to the South Outpost Home, gave in charge of the Tolidar of that Outpost beads, knives, and other presents, which Crusoe was informed were to be given to him as soon as he returned with the convicts ; and having supplied him and his companion with rice for seven days consumption, a cooking pot, box of matches, and also bows and arrows, which I cautioned them on no account to use against the Burmans, despatched them on their mission. In three days they returned without the Burmans whom they declared they had searched for in vain all over the main- land, but dragging after them an unfortunate convict self-supporter whom they had found some distance to the south, hunting pigs, and threatened to shoot if he did not im aodiately follow them. Crusoe claimed the reward which the Tolidar refused, telling him that he had not earned it, as the Bengalee before them was not a runaway and evidently not a Barman. (Crusoe should have been given a reward. — M, V. (Balawa da); — the latter they describe as not having a language, and being extremely ferocious; they are a tribe of whom absolutely nothing is known. WITH TBE ANDAMANESE. 459 (Here Mr. Corbyn has evidently misunderstood Crusoe, who pro- bably told him that the Balawa-da did not talk the language he did. They are the mildest of all the tribes, and were known to the Aka- .Zte'a-da, whom they used to meet at Kyd Island. — M. V. P.) A very creditable act of humanity on the part of the North Tribe aborigines, which was lately related to me by a Native convict who was the object of it, deserves to be recorded. This man, a Punjabee boatman, escaped from this Settlement with some other convicts in November, and travelled many miles northward till they came to a clearance in the interior, as extensive, he says, as Chatham, whore was a large Andamanese encampment. (No such clearance existed. — M. V. P.) Here these convicts remained a few days, kindly treated by the aborigines, but he became very ill and his companions left him. The Andamanese, more merciful than the convicts, administered various remedies and treated him most kindly, and finding that he showed no symptoms of recovery, three of them took him up and bearing him upon their shoulders carried him every day considerable distances along the coast till, in eight days' march, they brought him to North Point. Arrived there, they hailed a boat and asked the boatmen to bring them also to Ross Island, but their request was refused, and they went away unrequited for an act of mercy which cannot be too much extolled, or too long remembered in their favour. (If true.— M. V. P.) I have already made allusion to the establishment of two Outpost Homes on the mainland, the object of which is to promote intercourse and friendly intimacy with the aborigines. Clearances of land have been made, and two buildings erected. I have hopes of our being able to induce the Andamanese to cul- tivate the soil and render other useful services to us. H CORBYN. PORT BLAIR ; The 16th May, 1864. 3 K 2 460 A HISTORY OF OCR RELATIONS (This cultivation of the soil by the Andamanese has been an ignis fatuus to many officers. It is impossible to turn, by an order, or in a few years, or even in one generation, a hunting and nomadic, into a pastoral people. The labour of clearing, and keeping cleared, the jungle would be far too great for the Andamanese. They prefer, as food, the products of the chase to the products of the soil, and their dirty habits do not permit them to remain very long in one place. — M.V.P.) The following letter shows the circumstances which led to the application for the present grant-iu-aid of R200 per mensem to the Andaman Borne Letter, No. 19, from the Revd. Henry Corbyn, Chaplain of Port Blair, to Major 13. Ford, Officiating Superintendent of Port Blair. Dated, Ross Island, the 20th May, 186 L " Ths expenses of supporting the Andamanese under my care having greatly increased, since the establishment of two Homes for them on the mainland, I am obliged to beg of you to render me increased assistance in carrying out the views and wishes of Govern- ment for their civilization, pending the reply of Government to my application for a larger allowance. " On the date of my last report to Government, 16th instant, there were no less than thirty -eight aborigines of the North and South Tribes on this island, dependent on the funds of the Home for their diet and clothing ; and, in addition to these, forty have to be daily fed on the mainland on grain, purchased at the Commissariat -stores, at a cost quite equal to that of the laboring convicts. " It cannot be expected that, with all the other miscellaneous expenses of the Home, I can continue to support, in food and clothing, such a large and daily increasing number of the aborigines on the present monthly allowance ; the expense of clothing them alone would be so considerable an item that, in consequence of my inability to meet it, many of them are obliged to go naked. (There could have been no need to feed the people on the mainland on grain. The only reason why the Andamanese in the Homes at the present day are fed by the Home is because their time is taken up in working for the WITH THE ANDAMANESE. 451 Government, and they have no leisure to procure their own food. Also a small loin cloth, which would not have been very expensive, would have been ample clothing for the savages, for whom too much clothing is not desirable — M.V.P.} " You will have seen, from my accounts rendered to you, how large a sum I have advanced out of my own private funds to defray expenses already incurred on behalf of the Home, — incurred, it is true, on my own responsibility, but with views and for objects which I believed the result would justify, and Government would at some future time approve, so persuaded was I of their importance that, if it haa been necessary to have incurred those expenses without aid from Government, I should not have hesitated to do so ; and indeed, it will be soon from my accounts that, though the expenses of the Home commenced in the month of June, no part of the Government allowance was paid to me till late in November, when I received R100, and again on the 8th December, five months arrears of allow- ances due, which could not be drawn sooner because it hadnot been sanctioned. " I am sure Government will not wish me to sustain more pecu- niary Joss, through my having voluntarily undertaken duties which, in themselves, are sufficiently onerous. " Before my application for an increased allowance to the Home can be laid before Government and their reply received, much time will elapse. In the meantime, I b3g of you, as the Superintendent of this Settlement, to render me all possible assistance in meeting the demands of our improved relations, and advancing intercourse with both tribes of the aborigines in the neighbourhood of the Settlement. " Should you not feel authorized to render pecuniary aid, in anti- cipation of Government sanction, there are other ways in which you can materially help to diminish the expense of the Home, and to support the aborigines. '* I beg leave to indicate some of them — <( 1st. — It is advertised that there will be a sale by auction next Wednesday, at the Commissariat Store-rooms, of " cargo rice " in- 462 A HISTORY OF OUR RELATIONS tended for the Government elephants, but now not required, which is unfit for convicts' food, (though if the bazaar convicts, self-support- ing "bunneahs," buy it, they will probably sell it again to the labouring convicts, mixed with good rice), but would be very much appreciated by people like the aborigines, who are accustomed to coarse fare, and, therefore, are not so likely to be impaired in health by it. As it is expected that this rice will not realise one-fourth of its value, its sale would be a loss to Government, but its distribution amongst the poor Andamanese would serve a useful and merciful purpose. " 2nd. — I have also heard that there will soon be condemned bullocks for disposal ? These would be of great use to the Andamanese on the mainland. " 3rd. — All cattle which die from disease, or other natural causes, might be seut to the outposts for their sustenance. Colonel Tytler formerly issued an order, which has not been carried out for many months past, that all cattle dying naturally, after being landed on this Island, should be forthwith conveyed to the mainland and left there for the .aborigines. " I am happy to inform you that the aborigines at North Outpost have quite altered their manner and behaviour towards the convicts there. The Tolidar informs me that they give them more than they take from them, sharing with the convicts fruit which they bring in from the jungles, and fish of considerable size, three or four feet in length, which they obtain in great abundance. He is now gently and gradually leading them to work ; and endeavouring to make them un- derstand that they must earn the food which we give them ; they still continue to bring their bows and arrows, but only to shoot fish with." Major Ford, in forwarding the above letter, and Mr. Corbyn's third Narrative to the Government of India, writes in letter No. 20A., dated the 6th June, 186k— " I have the honor to forward, enclosed, the continuation of Mr. Corbyn's third Narrative, which takes up his account of events occurring with the Andaman tribes during February last, on the 15th WITH THE ANDAMANESE. 453 of which month I assumed officiating charge of this Settlement. Mr. Corbyn records now, that, shortly afterwards the Andamanese, who I found here, some forty in number, including women and children, all escaped to the mainland, swimming over to North or South Points; it was in the last attempt of this kind that Topsy, (the wife of Jumbo), who had often before evinced a most friendly and trusting disposition towards the British, was drowned ; her body was found a day or two after at South Point, she had been in ill-health and most probably had not strength to gain the opposite shore. 2. "After carefully considering all circumstances connected with these escapes, and having previously observed the system hitherto adopted for the management of the Andamanese here, I came to the conclusion that it wns impolitic to restrain them on Ross Island ; that they must be free to go and come amongst us ; but as this might in time, and as confidence increased, lead to the visits o£ larger numbers than it would be safe to have here on Ross Island, and whose care and attendance would involve a larger expenditure of convict labour and duty than the Settlement, with such a press of public works as is at present the case, can afford, I determined for these and some other considerations, all adding weight to my decision, but not necessary to record here, to cause two outpost ' Homes ' to be formed, and accompanied by Mr. Corbyn, selected two localities, each at the head of a small cove, — one on the north, and the other on the south mainland shore, situated at about the same distance (three or four miles) from Ross Island, where, at each, I have given materials for the construction of a large hut, and have stationed two armed police, and a small working party ; some six (from the Andaman Home) orderlies who have been accustomed to, and get on well with, the aborigines, and a small boat for their communica- tion. Here they have been supplied with as took of provisions, a few presents, etc., with which they feed and conciliate any Anda- manese visitors; any of whom, wishing to visit Mr. Corbyn or myself, are at liberty to find their way over to Ross in a small canoe stationed at each out-post for this purpose. They are then allowed to stay a day or two, if they like, at the Andaman Home, which I have removed A HISTORY OF OUR RELATIONS from the old site to one more under Mr. Corbyn's eye, and not quite so public, — a necessary arrangement, having now several married Christian women here. It will be necessary temporarily to withdraw or reduce the strength of the party at the outposts during the south-west monsoon, when bad weather may often render it a matter of difficulty to keep up supplies of food, etc., for a large party, as also to provide medical aid. " 3. As stated by Mr. Corbyn, I have endeavoured to utilise the Audamanese, by trying through them to recapture some recently escaped convicts ; they have not as yet been successful, it is some- thing, however, to have got them to understand, as they now do, that I will reward them for bringing in anyone who they find beyond our Settlement, if they briag him unharmed. " 4i. In conclusion, I beg to bring to the favourable notice of Government, the unwearied exertions of Mr. Corbyn to improve our good understanding with the people of these islands, — in so doing I beg to submit a copy of his letter to me, urging an increase to the Andaman Home allowance to B200 a month, which 1 beg respectfully to recommend may be granted, — principally that he may have some m^ans wherewith to start a school for such Andamanese children whose parents can be induced to let them remain somewhat longer on Ross Island, where I propose it should be established ; and which will doubtless, be a further means towards the civilizing of these people, and extending our influence amongst their tribes." (It was afterwards found that a school on Ross Island was a mis- take, as the children were too closely associated with the soldiers and convicts, and learnt to drink, and a number of other bad habits. — M. V. P.) It is due to Mr. Corbyn that his own accounts of his dealings with the Andamanese should be giren, and I therefore publish them in full, but on Major Ford taking charge of the Settlement he found it necessary to make changes in the Andaman Home which led to Mr. Corbyn's resignation of the charge of it, and on the 22nd June, 1864, Mr. J. N. Homfray was appointed to the charge in his place. WITH THK ANDAMANESE. 405 What should have led Mr. Corbyn to suspect that all was not going well in the Home was that, on the 1st March, 1864, all the Andamanese who had been staying in it escaped by swimming to the mainland. Mr. Corbyn went to the northward in the Diana to look for them and caught five of the Northern Tribe, and one of the Southern, thus showing that he considered them to be under some sort of restraint. On the 10th, the officers of the Diana bad a friendly interview with some of the Southern Tribe, and it became evident that they did not dislike us personally, but they objeated to the semi-captivity in which they were kept on Ross Island. On the 26th March, 1864, the dead body of an Andamanese woman was found lying on South Point beach. The remains could not be identified, but were said at the time to be those of Topsy, the wife of Jumbo, who had done so much good service for us. She was in ill-health when she escaped from Ross, and is believed to have bee a drowned in swimming across. Mr. Corbyn remarked that ib was very difficult to induce the Andamanese to remain with us. Jumbo was put in irons by him for running away, and swam across to the mainland in these. Major Ford objected to this restraint, or to irons being put on the Anda- manese at all, and opened two Homes for the aborigines on the main- land, at Lekera-Barnga, and South Corbyu's Cove. Three trusty convicts, accustomed to the Andamanese, were kept in these, and a store of condemned grain, biscuits, etc., to be used as presents. Any Andamanese who came to these Homes was allowed to remain as long O as he liked, and was fed. If the aborigines wanted to come to Ross, on lighting a signal fire at the nearest point opposite on the mainland, a canoe was sent over for them. On one occasion Major Ford went in the Diana to North Bav and was hailed by two "runaway" Andamanese women, Harriett of the South Tribe, and Annie of the North Tribe, who willingly came on board, and went on to Port Meadows, Middle Strait, Port Camp- bell, Port Mouat, Redskin Island, where there had shortly before been a friendly meeting between our people and the Andnmanese of the South Tribe, and Jollyboys' Island. The party returned 3 o 466 A HISTOYR OF OUR RELATION'S through MacPherson's Straits. Very few Andamanese were seen on this trip, but those who were met with (and who, of course, were all members of the Aka- Sea-da, tribe) were all friendly. At this time an allowance of R200 per mensem for the Andaman Homes was granted by the Government of India in Letter No. 1670, dated 28th July, 1864. During the months of December, 1863, and January, 1864, the summit of Mount Harriet was cleared, and a road made to it. The Government of India enjoined great caution on all the parties employed on this work, and ordered that any collection of Andaman- ese in their neighbourhood should be discouraged as much as possible and intercourse with them prevented when not indispensable, as, seeing the tools in use, the Andamanese would be tempted to steal them, and thus disputes would be caused. On the 2nd April, 1864, the Settlement was placed under the orders of the Chief Commissioner of British Burmah, and attached to the Tenasserim Commissionership ; and on the 7th of the month, Major General the Hon'ble Sir R. Napier, K.C.B., visited Port Blair officially. He approved of what was being done with regard to the aborigines. Towards the end of 1863 the treatment of the Andaman- ese by Mr. Corbyn seems to have suffered some unexplained change. The attention of the Government was drawn to this on the 15th January, 1864, when they note that they had formerly thought that the Andamanese under Mr. Corbyn were remaining voluntarily in the Settlement, and consider it doubtful whether any good can be ex- pected from forcibly detaining the people, as it now appeared Mr. Corbyn's object to do. Major Ford was requested to report on the line of conduct Mr. Corbyn had now adopted towards these Anda- manese, the majority of whom, it will be remembered, were originally induced by friendly overtures to come into the Settlement. It would seem as if Mr. Corbyn was impatient with the Anda- manese for not more readily taking to the mode of life he prescribed for them, and for adhering to their own customs ; and he endeavoured by restraint and harsh treatment to compel them to do as he wished. On the 31st May, 1864, the Government of India further note WITH THE ANDAMANKSE. that Jumbo had been put in irons for running away, and entirely dis- approve of this proceeding. They directed Mr. Corbyn to submit a Report of his proceedings with the Andamanese every moath, and he somewhat surprised them by remarking that, " making friends with the Andamanese increased the number of escapes, as the convicts could now wander anywhere with impunity." The Government at once called on the Superinten- dent for a report on this matter, and Major Ford suggested that the Andamanese should be encouraged to recapture the runaway convicts, and bring them in unharmed, and that a reward should be given for every convict so brought in. This suggestion was acted on from then till the present day, and the Andamanese in return for the benefits and attention they have received from us, have acted as a sort of jungle police. Mr. Corbyn, however, objected to this proposal, on the ground lhat it would give the Andamanese a " police control " over the con- victs, and they would then ill-use them, and let loose " their worst passions." In the meantime, an occurrence took place at the North Outpost which caused all friendly relations with the Andamanese to be broken off. On the 12th June, 1861, two of the Andamanese visit ing at the North Home, got angry with the Sub-Gangsman in charge there, because he would not give them all the food they wanted, and going out of the hut they were in with him, fired on him, wounding him twice ; from the effects of these wounds he subsequently died. The Andamanese then ran away, and fired on some other convicts who were in their path, wounding one of them ; these convicts closed round them to prevent their escape, when they wounded three more, and, dropping their bows and arrows, eluded the remain- der and fled into the jungle. One of these wounded men also died from the effects of his injuries. The Andamanese aggressors were Jacko and Moriarty, who had always been well treated by us. There were other Andamanese men, and also women and children present, but they took no part in the affair which was entirely confined to the above-mentioned two. Major Ford intended to keep a small party at these outpost Homes during the south-west monsoon, but owing 3 o 2 468 •*• HISTORY OF OUR RELATIONS to this occurrence he closed them altogether, and withdrew the con- victs stationed there. He further ordered that no favour of any kind should be conferred on the Andamanese, and that these who visited us for the next three months should be treated with coldness. He stated, in reporting the matter to the Government of India, that this occurrence was much to be regretted, as the Andamanese were appa- rently never before so friendly. He objected to their restraint on Ross, and said that the Andaman Home had to be removed from its public position, on account of the Christian women on Ross who were offended by the sight of the Andamanese, and had been put in a more private place, under Mr. Corbyn's eye. On the 30th July, ]>6i, the Andamaoese wished to resume friendly rslations, but food was refused to all except children. After the affair at North Camp on the 12th June, they sent over two children to Mr. Corbyn and these were allowed to be fed, and were then sent away. This was evidently a "feeler" on the part of the Andamanese, and was seen to be so by Major Ford, who did not approve of it. Tha next day Jumbo and Jacko swam over, and Mr. Corbyn wanted to arrest them, but as we had attracted them by our own act on the previous day, of giving food to the children, Major Ford refused to allow this as it would look like treachery. He also refused Mr. Corbyn said that they told him that neither of them had anything to do with the North Camp affair, but Major Ford replied that Tolidar Gilbur Singh, with his dying breath had said that Jacko shot him. It also appeared afterwards that Jacko was the mail who had shot Pratt, for which Jumbo and Snowball were unjustly punished. While this was going on, a party of about twenty Andamanese were swimming over from North Point to Ross, and being met by these two returning, all of them turned back to Aberdeen. While they were in the water a child of about ten years of age was washed ashore on Ross near Brigade Point and drowned. The party was followed by Mr. Homfray who had them escorted beyond Aberdeen into the jungle and told to go away. Later on, a party of between twenty and thirty again swam from WITH THE ANDAMANESE. 469 North Point to Aberdeen with bows and arrows. They were met by the Overseer there, and quietly escorted to the jungle as before. They seemed submissive and dejected. Major Ford thought that during the south-west monsoon they suffered from hunger, and felt the want of the food we used to give them, and hoped that " our present atti- tude may thus do good in the end." Some Burmese convicts, who had escaped, returned of their own accord about this time and stated that the Andamanese made them and other runaways hunt pigs for them, and kept them hard at work till exhausted, laughing at them the while : the convicts, of coarse, being terrified. When they were emaciated and feeble, they were either brought back to the Settlement, or simply released by the Andamanese, who used to cut and wound the men to make them work. They thought nothing of wounding people on the slightest provocation. Many convicts died of exhaustion in the jungle, and there is no instance of any other being treated as Dudhnath was. The Government of India, having the example of Pratt's case before them, suspected that the murder of the Outpost Gangsman, Gilbur Singh, was not entirely unprovoked, and called for a report on the same. Major Ford was, however, certain that no provocation was given to Jacko. The Gangsman would not allow the Andamanese to enter the upper story of the hut where the food was kept, and when they tried to steal some coconuts he half raised his musket, this being the usual and most effectual mode of intimidating them. As soon as his back was turned he was shot. Mr. Corbyn agreed that the Gangsman was quite right in what he did, and thought that the Andamanese had a hatred of all Asiatics generally, caused by the petty (?) provocations they had suffered from them. I have learnt from the Andamanese that Major Ford's account of the murder of Gilbur Singh was quite correct, and that no other provocation, than that of refusing to give him food, was given to Jacko, who is described as being an ill-tempered and violent savage. It should be remembered that the Andamanese think nothing of murdering each other on similar provocation. (The Andamanese names of Jacko, and Moriarty, were, Jacko-Biala; Moriarty-Baura.) Mr. Horafray also, who had been in the Settlement 4,70 A HISTORY OF OUR RELATIONS since 1858, and who succeeded Mr. Corbyn in the charge of the Andaman Home, gave one many facts regarding this period of our administration before he died in 1883. During July, 1864, Port Mouat was examined and partially sur- Teyed, and Major Eord recommended its occupation. He stated that the Andamanese there were friendly, and that Crusoe and Friday, formerly prisoners at Moulmein, and now very well disposed towards us, were living there. He also pointed out that, by occupying the neck of land between Port Blair and Port Mouat, we should cut off the southern portion of the South Andaman, and thus check the Andamanese from crossing. He recommended that the work should be commenced on November 1st, and that Mr. Horn fray should be put in charge of it, and relinquish his post of Harbour Master. He also asked for a lighthouse to be placed either on Grub Island or on the Southern entrance of the Inner Harbour. The Government of India did not at that time accede to this proposal. Anything savouring of cutting off portions of land, or, as formerly proposed by Dr. Walker, with regard to Port Mouat, driving the Andamanese out of a portion of the Great Andaman, too closely resembled our treatment of the aborigines of Tasmania to be acceptable to the Government. Major Eord having been called upon for an expression of his opinion regarding the line of conduct adopted by Mr. Corbyn towards the Andamanese, replied in letter No. 54A, dated llth August, 1864, as follows : — After saying that the question of our relations with the Andaman- ese was one of the most difficult with which the Superintendent had to deal, he wrote : — " 3. I will premise my report by here referring to the Revd. Mr. Corbyn's "Narrative of Events," dated Rose Island, 2nd June, 1863, wherein he remarks OQ the Andamanese Jumbo and Snowball who appear to have been taken prisoners consequent on the death of Naval Brigadesman Pratt, (who was killed by certain Andamanese)' These prisoners had for several months been detained in fetters at the Naval Barracks under a guard of the Naval Brigade. Here I beg to remark that the man now called ' Jumbo ' is not the man known WITH THE ANDAMANESE. 417 ^ by that name formerly in the Brigade, who was a man marked with a scar on the right cheek. " When Pratt was killed a prow was here, and the Malay crew were sent over with a promise of reward to catch the Andamanese supposed to be concerned. They went, and in four days brought over eighteen people, from whom were picked two ; the original Jumbo was of the party, but one Hamilton, Colonel Tytler's orderly, pointed out another man as Jumbo, who with Snowball, (since drowned), were made prisoners, and the original Jumbo, with fifteen more, was released. (This 'original Jumbo' was afterwards known to Mr. Corbyn as Jacko, and was the man who really murdered Pratt for trying to rape his wife. — M. V. P.) " 4. These prisoners, Snowball and Jumbo, are reported to have been kept ' several months in fetters ' at the Naval Brigade barracks. These men were, I am informed, at night chained to the station signal gun with heavy brass shackles, having also leg irons on ; the brass shackles were removed by day. There is not a man in the Brigade, (I am told so by themselves), who believes that either Jumbo or Snowball had anything to do with Pratt's death.
| 9,877 |
sn87065654_1839-10-05_1_2_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,839 |
None
|
None
|
English
|
Spoken
| 4,633 | 6,548 |
LIBERTY, MONDAY, OCTOBER 5, 1831. DEMOCRATIC STATE RIGHTS DEMOCRATIC. A. O. H. ELECTION OF STATE, T. H. Woodward. STATE TREASURER Samuel Craig. To the Voters. A. Brown & J. Thompson. We have been authorized to Announce A. Brown & J. Thompson as a candidate for CHANCELLOR of the State of Mississippi, election in November next. We have been authorized to announce H. H. HICKS as a candidate for CHANCELLOR of the State of Mississippi, election in November next. C. C. CAGE is a candidate for the office of Judge of the Third Judicial District, to fill the vacancy occasioned by the resignation of the Hon. James Walker, at the next November election. We are authorized to announce Henry G. Steele as a candidate for the office of District Attorney, for the Third Judicial District, at the next November election. We are authorized to announce Col. Win. A. Stone as a candidate for the office of Judge of the Third Judicial District, at the next November election. We are authorized to announce Clay S. Smith as a Candidate for the office of District Attorney for the Third Judicial District, at the next election. We are authorized to announce W. S. Smith as a Candidate for the office of District Attorney for the Third Judicial District, at the next election. We are authorized to announce W. S. Smith as a Candidate for the office of District Attorney for the Third Judicial District, at the next election. We are authorized to announce THOMAS GARNER a candidate for the office of Assessor and Collector of Amite county, at the ensuing election, in November next. WHO CAN BEAT THIS AID. William June, of this place, has three negro boys who walked two miles, and picked, in one day 947 pounds of Cotton, from a piney woods hold; the picking as follows; Dick picked 330 lbs., and "322, No. 305." To the Piney Woods Planter, TO THE PEOPLE OF MISSISSIPPI .. '.. NO. 1. THE NEXT PRIMARY. The heavy conflict among political parties, at the present moment, looks mainly to the Presidential election, in 1840. 2. I will, if you please, Mr. Editor, lay open to you and the people the state and condition of this matter. 3. Gen. Washington was elected to the Presidency in 1789, unanimously, being the father of his country; but in his second election he could have been beaten by Mr. Jefferson, with a considerable majority, at least, in their native State, Virginia. 4. As everyone will not understand this without some explanation, the writer of this article will enter a little into particulars. 5. Mr. Jay negotiated a treaty with Britain, with one or two terms exceptions, but at length choked up by its own deposits. Thus federalism was suspended, and Mr. Jefferson is now and ever will be termed the apostle of democracy. Is it not singular that he is appealed to by both parties of the present day. 6. The haughty spirit of federalism was bowed down, but by no means annihilated. James Madison and James Monroe filled up a long space, enshrouded with the power of the people. 7. Previous to Mr. Monroe's going out of office, Mr. Crawford, of Georgia, was looked to by the people as the regular republican candidate, and nominated as usual by the republican party. The writer of this article was decidedly with Mr. Crawford. 8. Ambition now, which had lain dormant so long, began to develop itself. Mr. Adams Claimed the right of his father, Mr. Clay, a proud, temperate, and powerful man, considered it was high time that he should fill the presidential chair. Mr. Calhoun could not understand why he was not as worthy as Crawford, both being Southern men; he laid in his claim accordingly. Under this state of things there is very little doubt but that Mr. Crawford would have been the President. But empire had been long rolling to the West with a strong tide. Those new States began to feel the weight which they could throw into the scale of the Northern or Southern interests of the Atlantic States. In addition to this, one of them contained within her dominion a very extraordinary man, who had recently signalized himself in the war of 1815, and possessed a popularity of a kind not claimed by any of the other candidates already in the field. His military fame was great he was a new and unexpected competitor, and his being a candidate gave an entirely new aspect to affairs. The other candidates had new arrangements to make to re-modify their forces and stand upon the defensive. General Jackson came forward as a republican candidate, as did all the others, Mr. Adams excepted; in addition to that, he possessed a lion-like courage, which he had displayed before the great Emporium of the South-west. This gave him an ascendancy over his republican competitors. Mr. Calhoun threw himself under his wing and became a candidate for the Vice Presidency. By a defect in the Constitution Mr. Adams became President, and Federalism revived. Jackson went into office determined to affect two objects; viz: to remove the Indians and prostrate the National Bank, both of which he accomplished. The time for his retirement was approaching, there existed some Satanic spirits, who, in conclave, concluded to nominate Judge White as his successor. He was also of the republican party. The intention was to enlist under the banner of White, the disaffected of all parties, making him a nucleus, round which to concentrate. The grand Convention nominated Van Buren, and Gen. Jackson's not advocating White, set the amalgamation party into a ferment. And the General has been heavily vituperated ever since. At the head of this no-party party are Henry Clay, of Ky., and John Bell, of Tenn. Clay is ambitious and talented to excess. He once stood high on the republic against him, when he would have indulged in the forgiveness of a wrong by demonstration, of a change of heart. But before we are "to pluck the motto from our brother" should examine well our own heart, to see they are "right in the sight of Heaven." After our heart, have received all the preparation of which they are susceptible, to constitute us impartial criticism on the conduct of others, we should discover error, contrary to true holiness. True charity teaches us to forgive each other, fault, and unless we do this, we can find. This is the time for the next election, and we are ready to support the principles of the party, and to support the principles of the party. The character of the man. There are, however, numerous contradictions. Conundrums. Why is Henry Clay's position in the "Whig" party? Because he is the principal key in the pack. For indeed, wherever found, who keeps his decently sun-gauze, mourn warr. Knowing no man, nor sect, nor party. A. L. it is known. Grenadaj Sept. 17, 1839. The Mississippi, Jackson; Southern kind of ..i.:.. y.tn.l.ili renuire to be error, examining in different ways, in order that they may be amended. Some err in forming too hasty friendships, for strangers; others, in not, forming friendship, at all. Home err in imputing intolerable motives to good action; and others, in imputing good motives to improper actions. Others again, err from a misapprehension of the true cause, which influence our actions; and some from too much charity in finding the errors of mankind. Thus the world is replete with error, and hence the propriety and wisdom of the Divine command to "forgive one another, as our heavenly father forgives us." And unless this Divine precept be complied with, nothing but feuds and contentions, strifes and animosities will exist among mankind, and this life become, a scene of continual warfare and destruction; wretchedness and misery. But to proceed with the subject set forth in our text, which will afford us much wholesome instruction. The teaching of the Divine writer is not the doctrine of selfish and narrow-minded mortals, who consider every person not "native" as unworthy of confidence and protection, but it is a holy and heavenly command given to man to govern him in his intercourse with his fellow mortal. The spirit which the text infuses is not the spirit of fanaticism; it is not the spirit of wily politicians, nor that of designing intriguers. No; it is the spirit of true Christianity, which teaches that all mankind are brothers; that, although oceans and mountains to the People of Mississippi. Fellow-Citizens: Early last spring my name, as a candidate for the office of Chancellor, was announced in the papers at Jackson, Vicksburg, and Natchez, and I requested, through others, to have it inserted in the public journals in other parts of the State. At this late day, I am surprised to find it particularly omitted, especially in the North, and this is a reason for this brief address. During the whole winter and spring, I was detained in the Courts at Raymond and Jackson, and prevented from visiting distant counties; and during the two months preceding the 9th inst., Mr. Howard, the Reporter of the decisions of the Appellate Court, and myself have been engaged in the compilation of a complete digest of the Statutes of the State, with references to those decisions, embracing as well the laws affecting the rights and duties of the courts, as those modified or repealed, on which rights are still to be litigated with the acts of Congress relative to land titles and other matters of application here, and a Manual for Clerks, Sheriffs, and Justices of the Peace a work greatly needed; and if the intervening summer has been actively used by any of my competitors, in the usual modes of electioneering, either by tour, popular address, or an appropriate distribution of printed circulars, I have the satisfaction of believing the work, on which I have toiled, will be an acceptable contribution to the Courts, the Bar, and the country. I have written neither letter nor circular, and have scarcely the time left within which to pass rapidly through a majority of the counties on the track of one or more visiting my friends. The Board of County Police for the County and State aforesaid, having. Banner and Marshall County Republican, failed to appoint Inspectors for tho Gene- f lolly Springs; Free Press, llernantio; rn flection, to no neia on tno nrst Mon- ; Whig Advocate, Canton. Democrat, Ao- day and day following in November next. InmbuB! Eastern Clarion, Paulding; Piney Therefore, by virtue of the power in mo : Woods Planter; Liberty', Mississippi Free vested, as Sheriff, I do hereby appoint the Trader, Natchez; will tive the above one following named persons to servo as In- . . . i ,fn i . I . : -'i insertion, and send tneir niu to mo bi spectors at ine scverui precincts in sum Raymond. . a. u. county nna state aioresuiu, on me nrsi Monday in iovemuer next, anu oay ioi-- lowing; viz; A LIST tlF LETTERS TTREMAlMNu in the Post Ulhco a? II Liberty. Mi., on the 1st day of Oc tobcr, 1S39, wlncn, it not lawen out by the 1st day of Jan. next, will bo sent to the General rostuince as aeaa ieuers A. Arnold Thomas ELECTIONS. Andrew. Gray Anderson Daviu Bate, burton Burri. Wm Bate.R Batchelor N'apoleoh Brown John Bate. Col Win Beatty L Capel Johri Cox Henry Cotton A B ! Cain E Cassel. Reuben Chadick Richard Chocolate Josiah C C CainWmF Caston Wm L Cahsay J C Curry Mrs Mary Dunn Henry Dcnman James Dolany James Everett Henry R 15 ' Btitler Aaron 3 Butler Judgo ( 2 Batchelor Madison Butlor Aaron H lioatour Lawrenco Bate. W &J. 'Briggs.John W 4 Cox Robert 3 3 Cox David, 3 Curry Dudley Chapman Robt N Caston Gabriol Covington Susan Caston Joseph Cain Isaiah Collinsworth John Carraway B A Liberty, Tickfaw, " I Spurlock s, Smith's; Zion Hill,. Talbert, (Z P Butler, JV C Harrell; N Chalfant, N Button, L Wall, Thus Holden, W B Hales, W C Butler, G N Burris, E Smith, W Adams, John Adams, P Hughs, G P Butler, Wm B Claughton, LD Taylor, B Anderson, Felders James Falls N t Editors, to tender in person my claims to Franklin W D your confidence and support. nlinnr those claims 1 shall dlS- flilmoro W . t. .1 nl.To..) Iijirriera be. . . .' rr- 'T.i i n-l l,..;i'.n- (?nurln MrMarirnrnt M Gill John tains may lurm 8s.. . . dultl 10 alieci eitner .uiiuucm-o v.. . nYHrth Thomas of Wm i mriitiii .iiu v . - - 3 1) Day Jonathan . Dunn Jno A Dunn Sylvester" E V Freeman James Ferguson David Frith John E G Graves Wm J . i i.i ..i . ... t ... ..... i;nrriun via and countries, mey khuuiu not 'pi10 (ri "iff In venrs Ol m youtii were ---, emoloved in Virginia and Tennessee id 0mion j P twecn nations destroy tho love and confidence that ought to exist between man and man. It cherishes tho noblest sentiment of our hearts, love for one another. But once let the opposite ipirit take possession of our minds that of hatred and di trust of strangers, and we at once destroy all 1 1. r r.n tup rnrreni uu? uiss "-' I ral Clerks' offices. From 1821 until ISSi, 1 Harrirrf ton Jeptha I was exclusively occupied in the practice Haynes i hos o of law, in Alabama, whose statutory sys- H-'0 torn is mainlv congenerous with ours ; and Hoiioway u the philanthropic feelings, sentimenlsand cmo- evcr since the latter year I have continti-j Jenkin) jogeph tions which characUrise the christian's life. We ed the practice in this State. I assert it j&ckon vvilcy must estimate every man, worth by his acts; jot vaunlingly, Dili as a iuci iiiipuiia.. Jonf9 vhll but if our hearts bo closed against the overture, for you to know, that through those Clgh- Jackson Wm A of stranger, for admission into our society, and teen y ears, wunetu nny i i. Share of our reject, we justly incur, not only burdens of a heavy, profound concern against the will of the king, command we have flagrantly violated, as set forth in the text, "and if a stranger sojourn with thee in your land, ye shall not vex him." We cannot form a correct opinion of the character of our fellow man, but from his conduct in whatever station he may be placed. His outward acts, form an unerring index to the inner man, to the heart, from which all his acts flow. Gorton Joseph Garner H 3 Hall LP Hampton II T 2 Hunt David Holden The Jones John Jones Win L 3 Little Junius M 2 Moore Thos L Merrill John Marsh Laban .1 f'1. n.l A nrtnllillll ... i. i n ma in ino Ajiinncerv unu the displeasure of the people on earth. 'run nH1m. Moore William pin 4ua......v... r i Montgomery John cial trust solicited, I have received it. Morglon j)r Sumpter Dirr until now have I asked the sum- Middleton William o ne rnnnlrvmnn. nor i esirCQ Ollice. lies. hvo. "y.... K. ii i.iviii;,.n,.nrT A f a.ob Hint iii u tiicn i now nsmrc. noi u- In the midst of the turmoil, the town of St. Louis, known for its hospitality and hospitality, thrives. The town of St. Louis, known for its hospitality and hospitality, thrives. The town of St. Louis, known for its hospitality and hospitality, thrives. The town of St. Louis, known for its hospitality and hospitality, thrives. The town of St. Louis, known for its hospitality and hospitality, thrives. If his heart be pure, his acts will be good; but if we can endure it, it will be evil, his conduct will condemn him, not only in the estimation of the righteous, but also in the estimation of the righteous. It is earnestly desired by the people of the United States that the new and honorable claims of the candidates should alone be allowed. McKay Sunnay McDowell James. Nunnory John o p 2 Proctor Dr Isaac D 2 noble station, those, whose fortunes have been, regarded and jj,ejr political creeds not Reames Letnuc not to have breathed, at birth, the same atmos-.. t.f,,n vn for election or repro- Richmond Jno u. J....i - ht.::i Rollins Lemis P piere wuu nimsen, wu may am. no.. i bation. l o tne aspirants to me manuimi i jjgiiffu c mate his worth in society, and the goodness of j ctato Leastings. in which the agi- 0 n 2 Reynolds Thomas Rembert Timothy Rice Robert" Robinson Aaron S 2 Smith Wm r ft-.1..-.l. -1 r! - r nrtic.e,, uunt.g. tno rres uency iican lttdJer, and. in no less than a t BBiiuigiuii. i neso two articles, ist, to ..........-..1- t. U I.... i. J.!.... A f I Ins heart, we may say una irum, m tatinff problems OI ino consiliuiiou nuu oi. iS n possesses not a christian spirituui tuai ni i. measures of contested policy are 10 uu sui- Smiley Rov Alexander Bwranngan J w U not right in the sight of God,' for he has hot ve( Where laws are to be enacted not Swearingen Thomas treated as a brother, the stranger who dwells administered all party predilection and with him. The person who is thus prejudiced, controversy ought to be referred. Un them Thompson. against stranger, is deprived of one of the great, victory or defeat can be tested. Your JJompnTlio. e,ton treder.ck est of christian enjoyments that of exercising Whig and your Democratic Conventions burner George bexevolence and hospitality towards his breth- did not nominate to JilUlCiai omce. jii eu- V ren. But a disposition, which is .ometimes man- termg the canvass 1 had not even instinct Van Norman Wm fosted, to undervalue tho character of Strang- 10 indicate to me a resort to any caic- VV ere because thev happened to be born in the oth- word, mucU less 10 cmer 10 any cwss, 11 Wilson John i 1 thorn im r nssns! nur. 1 00 leni Deiiuiiiuu wnuiin?ion vvm vt numnitwn in er slates, or in a. lorcigu inns, uruuiic, iim nu -- - , - . ww o . . . t . . r Un nnnpnl in vnni tin ted moral sentiment Whittington Hcndorson Wilkinson btephen muph from a want of common honesty, a. from to appeal 10 youi uimeu uiurui bciihiih.ui ,,., .6. w an ignorant and unfounded prejudice, which the end common interests, to respond by your VUIUO lJ HlO Ut,0 IflWIlO liHJ 3 . 1 v pay the debts of insolvents to British mer chants, who had eloped at the beginning of the revolution ; and 2d, restricting our navigation with the West India Islands to vessels of 70 tons. But the high re gnrd for his revolutionary ser ices with held any antagonist. fi. His successor wns a rank Federalist, angel ruined. Mr. Bell is second in or der, and possessss an intriguing adroit ness superior to his master. 19. Henry Clay has set his heart upon the Presidency, and were he ele'eted, Mr. Bell would be his Prime Minister he is the Taleyrand of the times 20. Like Cataline of old, Clay's place ia in nmluwfv nil the disaffected, and to dc Mr. Adams, who obtained the passage of , . . , , . . . Djunde- the Alien and Sedition Laws, which stam- of community . Buch is pea mm as a federalist. . . fc ..... of ,hinirs a. ... .. I ,.. I I " . vnat tney meant uy a ibderausi in ONE OF THE PEOPLE these times was a man who was of opinion that the common people were unfit and in capable of self-governsient such was Al exander Hamilton, perhaps the most ac For the Piney Wood. Planter A SHORT SERMON. And if a trthfrcr Boiourti with thee in your a nnt vmw hitn Knt ihtk at ru 11 ror complished man in America. He may he that'wdieth with you, shall be unto yoa as considered the leunderol the United States one bom among you, ana momnuu tovo mm Bank, and had been the advocate of a con- " thy-ir.-L.vmce. . v.. e , , . , . I The text present, to our view a .uDjeci 01 stitution, of a much more monurchial cast , , . J. - . 1 1 II 1 viuavvni. iiiijuiiiv. a.w vu.......v. than, the ono which really went down. joined upon Ui u one of TaBt moracnt) re. For instance, he was in favor of a Senate late to our conduct towards "the stranger who for life, I sojourns with us." In our intercourse with us, it was then that Mr. Jefferson came to our country, the conduct of our fellow man, frequently in the midst of a second term, disappointed Adam of a second term, in the good will of the people. The first part of the text, like some proud stream rolling along, our memory, whilst the former, along uninterruptedly for a considerable remainder and ready witnesses to the best and most meritorious conduct, could not eradicate. There are few, very few, very high-minded individuals in any community, in fact, there are none, who, in the inspired language of the text, would not regard "a stranger as one born amongst them, and love him as themselves," if his conduct, during his own life, be unimpeachable. It is then, ungenerous, illiberal, and show, a wicked and perverse heart, to reject the humble claims of Btranager, to a share of our confidence and respect, and to bestow upon them degrading and inhuman epithets, merely because we were not acquainted with them all our lives. But this anti-christian and selfish spirit vanishes from the heart, when illuminated by the light of the gospel, and the peace and happiness shed abroad in the soul, from a consciousness of having "done unto others, as we would have they should unto us." How would that haughty and tyrannical spirit be humbled? How would that voice, which now thunders in bitter and sarcastic language against strangers, be changed, if fortune should throw the individual who uses it into a land of just such Christian, as himself? "What is a Bank Director?" Inquired a schoolmaster of a little girl, a few days since. "Pa says it is a man who borrows all the money put in the bank to put up pork." "Take your seat child, you have answered correctly. "Cincinnati News." "They've discharged me, by thunder!" as Cannon said when the democrats Polked him out. One of continued probity and undeviating moral principle, has he acquired sufficient legal knowledge and eminence to render him qualified? Are his head, near and habits such as to justify him in aspiring to a trust so exceedingly important to your rights? But though it is incumbent on all to exclude from the office of Chancellor even the names of party contention, yet very soon after three of the candidates were announced, myself included, the Yazoo City Whig held forth one of them as a favorite, to the disparagement of the rest yeas, as the exclusive Whig candidate - as if to be honest or capable, one must be a Whig as if, too, the elective franchise of Mississippi should be illustrated by the triumph of a Whig Chancellor! That movement, I am told, was followed up not directly, but still very efficiently, in the Southern Sun, and more directly in the Brandon Sentinel. The gentleman intended thus to be advanced, must be fully and wholly exempted even from connivance in the attempt. Still it is to be regretted. Religious intolerance will bring every office into the ranks of its virulence and discord if for not being a Whig, a candidate must be branded as a Democrat though he will be neither the better nor wiser for either title. I can answer for myself, that as I never have, so I never will, deny or abjure one iota of my political tenets. I shall not palter among parties but and State of Mississippi; I do hereby give public notice that I will hold an Election at the different precincts in the county afore said, on the 1st Monday and day following in November next, for the purpose of electing State and County Officers, required by the Constitution and Laws of this State. To wit: 1 Governor. 1 Chancellor. 2 Members of Congress. 1 State Treasurer. j 1 Auuitor of Public Accounts. 1 1 Secretary of State. 2 Representatives. 1 Senator.. 1 Sheriff. 1 Coroner. ' 1 Judge of Probnto. '!' 1 Clerk of Circuit Court. .1. 1 Clerk of Probate Court. 1 Tax Collector. 1 County Treasurer. s 1 Ranger. ' 1 Cotin'y Surveyor.. 5 Members of the Board of County Police. I 10 Justices of tho Peace ; to wit : District No. 1, composed of Liberty an! Zion Hill, 2 Justices otitic Peace. " " 2, composed of Toler'rf and Tickfaw, 2 Justices of lfc Peace. ' ' , " 3, composed of TalbcrtV, 1 1 j. Justices of the Peace. " . " 4, composed of Smith's ani ,. SpurlockV, 2 Justices of the Peace. : " " f, composed of Tickfaw, 5 ; Just ices of the Peace. Given under niv hand and seal this day of October, 1839. c. w. Mcknight, Sheriff. L.S i BY ALEXANDER G. McNUTT Governor of the Stale of Mississipjn- 5 To the Sherikfop Amite Couwxrjj " GREETING:) '. With the beginning of the sale, I have received information that a vacancy has occurred in the office of the Honorable Judge of the third Judicial District, by the resignation of the Honorable James Walker. I will sell to the highest bidder on a credit till January, 1811, on Saturday, the 6th day of November next, in Liberty, the following tracts of land belonging to the estate of Thomas Robinson, deceased, subject to the widow's dower, to wit: the North Quarter of No. 18, in Township 3, of Range 5, East, containing 77 and 6-100 of an acre, also, the West of No. 7, in Township 3, of Range 5, East, containing 78 and 5-100 of an acre; also, the South East Quarter of the South West Quarter No. 7, in Township 3, of Range 5, East, containing 39 and 2-100 of an acre; also, the North West Quarter of the North West Quarter of Section No. 18, in Township 2, of Range 5, East, containing 38 and 68-100 of an acre; also, the South West Quarter of the North West Quarter of Section No. 18, in Township 3, of Range 5, East, containing 38 and 68-100 of an acre; all lying in Amite county, Missouri. JAMES F. ROBINSON. Administrator. Sept. 23. 32-3t-Prs fee $6. I do, therefore, issue this writ, author , ing and requiring you to hold an electi & in your county on the 4th and 5th days; November next, to fill said vacancy j ami j do, moreover, enjoin you to conduct tb(? same, in all respects, conformnbly to la and make due return thereof to the Sc rotary of State. In testimony whereof I have hereunto . set my hand and caused the-grcl seal of the State to be amed, ' 5 . Jackson, this 22d day of August A. D. 1839, and of the sovcreignt) ' of the State of- Mississippi, &t twenty-third. f A. G. McNUTT. I, By tho Governor, Titos. B. Woodward, ' Secretary of State state of Mississippi,) Amitg Countv. ) TY Virtue of the above writ of election tome directed, from his E:tcel lent A. G McNutt, Governor in an,d fortl - T-Hr- '.
| 9,319 |
https://github.com/VHAINNOVATIONS/Telepathology/blob/master/Source/Java/VistaImagingDataSourceProvider/main/src/java/gov/va/med/imaging/vistaimagingdatasource/dicom/storage/SeriesUIDCheckResultDAO.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,015 |
Telepathology
|
VHAINNOVATIONS
|
Java
|
Code
| 395 | 1,541 |
/**
*
Package: MAG - VistA Imaging
WARNING: Per VHA Directive 2004-038, this routine should not be modified.
Date Created: Nov, 2009
Site Name: Washington OI Field Office, Silver Spring, MD
Developer: vhaiswlouthj
Description: DICOM Study cache manager. Maintains the cache of study instances
and expires old studies after 15 minutes.
;; +--------------------------------------------------------------------+
;; Property of the US Government.
;; No permission to copy or redistribute this software is given.
;; Use of unreleased versions of this software requires the user
;; to execute a written test agreement with the VistA Imaging
;; Development Office of the Department of Veterans Affairs,
;; telephone (301) 734-0100.
;;
;; The Food and Drug Administration classifies this software as
;; a Class II medical device. As such, it may not be changed
;; in any way. Modifications to this software may result in an
;; adulterated medical device under 21CFR820, the use of which
;; is considered to be a violation of US Federal Statutes.
;; +--------------------------------------------------------------------+
*/
package gov.va.med.imaging.vistaimagingdatasource.dicom.storage;
import gov.va.med.imaging.core.interfaces.exceptions.ConnectionException;
import gov.va.med.imaging.core.interfaces.exceptions.MethodException;
import gov.va.med.imaging.exchange.BaseTimedCacheValueItem;
import gov.va.med.imaging.exchange.TimedCache;
import gov.va.med.imaging.exchange.business.dicom.UIDCheckInfo;
import gov.va.med.imaging.exchange.business.dicom.UIDCheckResult;
import gov.va.med.imaging.url.vista.VistaQuery;
import gov.va.med.imaging.url.vista.exceptions.InvalidVistaCredentialsException;
import gov.va.med.imaging.url.vista.exceptions.VistaMethodException;
import gov.va.med.imaging.vistaimagingdatasource.common.CacheableEntityDAO;
import gov.va.med.imaging.vistaimagingdatasource.common.VistaSessionFactory;
import java.io.IOException;
public class SeriesUIDCheckResultDAO extends CacheableEntityDAO<UIDCheckResult>
{
private String RPC_MAGV_SERIES_UID_CHECK = "MAGV SERIES UID CHECK";
private TimedCache<SeriesUIDCheckResultCacheItem> cache = new TimedCache<SeriesUIDCheckResultCacheItem>("SeriesUIDCheckResult");
public SeriesUIDCheckResultDAO(VistaSessionFactory sessionFactory)
{
this.setSessionFactory(sessionFactory);
}
@Override
protected UIDCheckResult getEntityFromCacheByCriteria(Object criteria)
{
UIDCheckInfo uidCheckInfo = (UIDCheckInfo)criteria;
UIDCheckResult cachedValue = null;
Object key = getCacheKey(uidCheckInfo);
SeriesUIDCheckResultCacheItem cacheItem = cache.getItem(key);
if (cacheItem != null)
{
// Item was found in the cache. Return it...
cachedValue = cacheItem.getUIDCheckResult();
}
return cachedValue;
}
@Override
public VistaQuery generateGetEntityByCriteriaQuery(Object criteria)
{
UIDCheckInfo uidCheckInfo = (UIDCheckInfo)criteria;
VistaQuery vm = new VistaQuery(RPC_MAGV_SERIES_UID_CHECK);
vm.addParameter(VistaQuery.LITERAL, uidCheckInfo.getPatientDFN());
vm.addParameter(VistaQuery.LITERAL, uidCheckInfo.getStudyAccessionNumber());
vm.addParameter(VistaQuery.LITERAL, uidCheckInfo.getSiteID());
vm.addParameter(VistaQuery.LITERAL, uidCheckInfo.getInstrumentID());
vm.addParameter(VistaQuery.LITERAL, uidCheckInfo.getStudyInstanceUID());
vm.addParameter(VistaQuery.LITERAL, uidCheckInfo.getSeriesInstanceUID());
return vm;
}
@Override
public UIDCheckResult translateGetEntityByCriteria(Object criteria, String returnValue) {
return VistaImagingDicomStorageUtility.translateUIDCheckResults(returnValue, ((UIDCheckInfo)criteria).getSeriesInstanceUID(), FIELD_SEPARATOR1);
}
@Override
protected void cacheEntityByCriteria(Object criteria, UIDCheckResult uidCheckResult)
{
UIDCheckInfo uidCheckInfo = (UIDCheckInfo)criteria;
if (!uidCheckResult.isFatalError())
{
SeriesUIDCheckResultCacheItem cacheItem = new SeriesUIDCheckResultCacheItem(uidCheckInfo, uidCheckResult);
cache.updateItem(cacheItem);
}
}
private Object getCacheKey(UIDCheckInfo uidCheckInfo)
{
StringBuffer buffer = new StringBuffer();
buffer.append(uidCheckInfo.getSeriesInstanceUID() + "_");
buffer.append(uidCheckInfo.getStudyInstanceUID() + "_");
buffer.append(uidCheckInfo.getPatientDFN() + "_");
buffer.append(uidCheckInfo.getStudyAccessionNumber() + "_");
buffer.append(uidCheckInfo.getSiteID() + "_");
buffer.append(uidCheckInfo.getInstrumentID());
return buffer.toString();
}
class SeriesUIDCheckResultCacheItem extends BaseTimedCacheValueItem
{
UIDCheckResult result;
UIDCheckInfo uidCheckInfo;;
public SeriesUIDCheckResultCacheItem(UIDCheckInfo uidCheckInfo, UIDCheckResult result)
{
this.uidCheckInfo = uidCheckInfo;
this.result = result;
}
@Override
public Object getKey()
{
return getCacheKey(uidCheckInfo);
}
public UIDCheckResult getUIDCheckResult()
{
return result;
}
}
}
| 13,703 |
Subsets and Splits
Token Count by Language
Reveals the distribution of total tokens by language, highlighting which languages are most prevalent in the dataset.
SQL Console for PleIAs/common_corpus
Provides a detailed breakdown of document counts and total word/token counts for English documents in different collections and open types, revealing insights into data distribution and quantity.
SQL Console for PleIAs/common_corpus
Provides a count of items in each collection that are licensed under 'CC-By-SA', giving insight into the distribution of this license across different collections.
SQL Console for PleIAs/common_corpus
Counts the number of items in each collection that have a 'CC-By' license, providing insight into license distribution across collections.
Bulgarian Texts from Train Set
Retrieves all entries in the training set that are in Bulgarian, providing a basic filter on language.
License Count in Train Set
Counts the number of entries for each license type and orders them, providing a basic overview of license distribution.
Top 100 Licenses Count
Displays the top 100 licenses by their occurrence count, providing basic insights into which licenses are most common in the dataset.
Language Frequency in Dataset
Provides a simple count of each language present in the dataset, which is useful for basic understanding but limited in depth of insight.
French Spoken Samples
Limited to showing 100 samples of the dataset where the language is French and it's spoken, providing basic filtering without deeper insights.
GitHub Open Source Texts
Retrieves specific text samples labeled with their language from the 'Github Open Source' collection.
SQL Console for PleIAs/common_corpus
The query performs basic filtering to retrieve specific records from the dataset, which could be useful for preliminary data exploration but does not provide deep insights.
SQL Console for PleIAs/common_corpus
The query retrieves all English entries from specific collections, which provides basic filtering but minimal analytical value.
SQL Console for PleIAs/common_corpus
Retrieves all English language documents from specific data collections, useful for focusing on relevant subset but doesn't provide deeper insights or analysis.
SQL Console for PleIAs/common_corpus
Retrieves a specific subset of documents from the dataset, but does not provide any meaningful analysis or insights.
SQL Console for PleIAs/common_corpus
Retrieves a sample of 10,000 English documents from the USPTO with an open government type, providing a basic look at the dataset's content without deep analysis.
SQL Console for PleIAs/common_corpus
This query performs basic filtering to retrieve entries related to English language, USPTO collection, and open government documents, offering limited analytical value.
SQL Console for PleIAs/common_corpus
Retrieves metadata of entries specifically from the USPTO collection in English, offering basic filtering.
SQL Console for PleIAs/common_corpus
The query filters for English entries from specific collections, providing a basic subset of the dataset without deep analysis or insight.
SQL Console for PleIAs/common_corpus
This query performs basic filtering, returning all rows from the 'StackExchange' collection where the language is 'English', providing limited analytical value.
SQL Console for PleIAs/common_corpus
This query filters data for English entries from specific collections with an 'Open Web' type but mainly retrieves raw data without providing deep insights.
Filtered English Wikipedia Articles
Filters and retrieves specific English language Wikipedia entries of a certain length, providing a limited subset for basic exploration.
Filtered English Open Web Texts
Retrieves a subset of English texts with a specific length range from the 'Open Web', which provides basic filtering but limited insight.
Filtered English Open Culture Texts
Retrieves a sample of English texts from the 'Open Culture' category within a specific length range, providing a basic subset of data for further exploration.
Random English Texts <6500 Ch
Retrieves a random sample of 2000 English text entries that are shorter than 6500 characters, useful for quick data exploration but not revealing specific trends.
List of Languages
Lists all unique languages present in the dataset, which provides basic information about language variety but limited analytical insight.