content
stringlengths 0
1.88M
| url
stringlengths 0
5.28k
|
|---|---|
$3M NSF award to launch alternative energy research, PhD program
A new effort at Arizona State University to educate and train students in renewable and solar energy is receiving backing by the National Science Foundation (NSF).
Through its Integrative Graduate Education and Research Traineeship (IGERT) program, the NSF is providing $3 million to ASU to help develop a doctoral program in energy and to equip students with the skills needed to find solutions to the energy challenges of the future by establishing the IGERT Solar Utilization Network (SUN) program.
“ASU is taking a leadership role regarding research, education and policy issues in renewable energy utilization,” said ASU President Michael Crow. “We are working at the leading edge of transforming our society from a fossil-fuel-focused energy consumer to a sustainable, renewable-energy based consumer.”
The IGERT SUN program will focus on four key research areas including biological conversion, photovoltaics, solar thermal and sustainable policy. Over a period of five years, some 24 graduate students will complete in-depth core courses in these four SUN research concentrations, as well as conduct research and interact with local, national and international sustainable energy stakeholders.
The program will provide the groundwork necessary to create an energy doctoral program by 2016, offered through ASU’s Global Institute of Sustainability.
“At ASU, we are strong in three important areas: biological energy conversion, photovoltaics and solar thermal energy conversion,” said Willem Vermaas, Foundation Professor in ASU’s School of Life Sciences, College of Liberal Arts and Sciences, and lead scientist in the program. “Because we have those three, we are in a unique position to say, ‘Now let’s train students so they are not only experts in those areas, but also so they can understand the pros and cons of the various ways of creating alternative energy.’ We also need to teach them about the social, environmental and economic contexts of emerging solar technologies so societal transformation can happen,” he added.
Until the doctoral program is established, students will choose a PhD in a traditional degree program within engineering, the natural sciences, or the social sciences, with a concentration in energy.
ASU’s goal is to attain 25 percent minority participation, effectively doubling the current levels in STEM (science, technology, engineering and math) fields at ASU by recruiting underrepresented minority students through its existing, extensive network of mentorship relationships with minority education programs.
“We are trying to build on people’s strengths, and develop their thinking and their understanding of this complex issue, so they can make contributions that others haven’t,” said Vermaas. “We want to teach students to use this type of broad training and knowledge of energy issues in their own unique ways to help secure energy supplies and improve conservation in the coming decades.”
“This is exactly the kind of transdisciplinary program we are committed to,” said Gary Dirks, director of LightWorks. “With our combined efforts, we can solve our grand energy challenges.”
LightWorks is a university initiative that pulls light-inspired research at ASU under one strategic framework. This effort leverages the university’s strengths, particularly in renewable energy fields including artificial photosynthesis, biofuels, and next-generation photovoltaics.
The IGERT Solar Utilization Network program begins this fall semester.
ASU’s commitment to solar
Solar energy reaching the Earth is several orders of magnitude larger than human energy consumption, and conversion of a small part of solar energy to electricity or fuels could significantly help in sustainable energy generation.
Arizona State University is a logical place for solar energy research and education. Because of its long-standing emphasis on this area starting in the 1970s, the university established the Center for the Study of Early Events in Photosynthesis (now the Center for Bioenergy and Photosynthesis) in 1988 and the Photovoltaics Test Laboratory in 1992.
Today, the university exceeds 15 megawatts (MW) of solar energy capacity, which is more than 20 percent of ASU’s peak load – and the most solar capacity of any university in the United States. ASU’s goal is to reach a university-wide total of 20 MW of solar energy capacity by 2014. | https://news.asu.edu/content/3m-nsf-award-launch-alternative-energy-research-phd-program |
Exceptional people do exceptional work. The people of Shape Burlington who put this report together are exceptional. They are eloquent representatives of the diversity of Burlington’s population as well as first-rate interviewers, facilitators, writers, and include a highly competent web master. All their time and personal expenses were contributed freely as caring and concerned Burlington citizens.
We thank you for volunteering and accepting our assignments without reservation. We congratulate all of you on a job well done.
We could not have developed this Report without the guidance and input of consultants Peter Macleod, Joslyn Trowbridge and Chris Ellis of MASS LBP.
We owe so much to Dr. Joey Edwardh and Ted Hildebrandt of Community Development Halton who provided the administrative services and expertise in community development.
We are honoured that Mayor Cam Jackson had confidence in our integrity and judgment to select a committee and to reach out to Burlington citizens for their views on better and more effective communication and involvement with City Council and Staff. We thank Mayor Jackson for this opportunity to serve our community. We believe we have fulfilled the terms of reference for this advisory committee.
For us, this has been a journey of discovery, which has reinforced our belief that we live in one of the finest communities in Canada.
This Report reflects accurately the views of those people who took the time and opportunity to share their opinions on how we might improve civic engagement and two-way communication with local government. City Council can honour these citizens by considering carefully each and every one of the recommendations. . . In our opinion, these eight (8) recommendations must all be implemented.
We understand that these recommendations will require City Hall and Burlington residents to re-think how local government communicates and interacts with the community in a more participatory and consensual mode. We believe the implementation of these recommendations will foster more informed deliberation, inspire greater confidence in local government, and build a more caring community.
John Boich, Co-Chair Walter Mulkewich, Co-Chair
Transforming the culture at City Hall – City Hall must reinvent itself.
As social, technological and demographic trends alter the face of every community, municipal governments are struggling to adapt their long-established practices to meet the challenges of an ever-evolving new world.
Burlington is experiencing a period of rapid growth and change. Citizens are more literate, more educated and more connected than ever before. They are also busier, more distracted and require more from those who represent them, develop the policies and provide the services in their community.
Formed at the request of the Mayor, Shape Burlington was given the freedom to act independently. We spent three months working with Burlington residents and City Hall staff and members of Council to learn more about how the City operates and how it engages with residents.
Shape Burlington is comprised of citizens who live in all areas of the city. They bring a broad mix of experience and expertise to their commitment. We were assisted in our research and procedures by MASS LBP, a public consultation company with expertise in citizen engagement and democratic innovation.
We investigated practices from communities around the world. Who is facing similar challenges? How are they doing it? What can we learn? What best practices are already being implemented, and how can Burlington create its own recommendations?
We conducted interviews with members of current Advisory Committees. We spoke with representatives of cultural and sports groups; representatives of the business community; citizen groups and high school students. We met with City staff at different levels from many different departments. We interviewed Department heads and managers, Councillors and the Mayor. And throughout, we met with many Burlington residents in public forums and listened to them via our website. Ail expressed their hopes for creating a better City and also their frustrations over how City Hail makes decisions or sometimes fails to listen.
Tasked with recording a broad spectrum of messages and observations, Shape Burlington has delineated 14 specific issues that were constant themes in our investigation. From this, we have identified eight recommendations that can help Burlington navigate the future.
Some are self-evident; some are bold. But all come from the people who live in and work for this City. They call for increased engagement and a dearer vision; for more communication to a recovery of trust; for a sense of belonging and more meaningful participation of all segments of our community.
Recommendations
Engagement: Transform the City Hall culture to promote active citizenship and civic engagement
Promoting active citizen engagement and meaningful public dialogue requires a culture shift at City Hall. A crucial first step is the development an Engagement Charter – a plain language policy document developed with public involvement that incorporates benchmarks and accountabilities, and describes the value, purpose and opportunities for citizens to influence city policies.
The charter would explain how to navigate City Hall and its services. It should stipulate best practices for various kinds of public consultation and affirm the city’s commitment to inform citizens and respond to their ideas and contributions. t would address the question of reaching out to a diverse population.
The charter would incorporate an early notification system to provide citizens and groups information about meetings, events and issues, and to allow reasonable amounts of
time to understand, discuss and develop positions before decisions are made. A guide for its development could be the Edmonton PublicInvolvement process.
Vision: Shift City Hall processes to greater involvement of all citizens in a shared vision of our city
Citizens should be more fully involved in preparing Burlington’s Strategic Plan after each municipal election. It is the single best time for them to influence the City’s long-term direction.
The 2011strategic planning process is an ideal opportunity to begin implementing the principles set out in this report. Citizens should be involved in writing the plan.In this way, they will participate in developing a vision statement for Burlington, set out with clear and measurable action plans that the community can buy into. Some participants could be chosen through citizen juries or random selection.
The strategic planning process and the municipal election itself should be linked explicitly in the minds of voters. n this way the election and the development of the strategic plan would be twinned democratic processes and act as the principal conduits through which the city renews and resets itself every four years.
Communication: Empower people by overcoming the communications deficit
The City should foster the development of an independent information service, including a web-based community news and information portal through start-up subsidies and encouraging community support.
In addition, the Communications Department at City Hall should be fundamentally transformed into a timely and reliable source of City information free of political bias. t is an essential step in providing more resources to foster information, education and continuous learning.
After a comprehensive review of diverse multimedia communications processes, the transformation would include a revamped and more frequent City Talk,webcasts of committee and Council meetings and a user-friendly, well-written website that incorporates the latest web2.0 and gov2.0 innovations to make government more accessible and interactive.
Members of Council are encouraged to develop their own communication vehicles that are separate from the corporate communications process.
A robust, independent professional media is essential in a functioning democracy. We encourage the local news outlets to develop the business and technological solutions that will allow them to reclaim their proper role in the community.
Trust: Improve the public’s trust and confidence in City government
Staff and members of Council should review their protocols and procedures for dealing
. with citizens to improve public trust,confidence and respect for citizens. This would include ongoing staff training programs and establishing cross-department and measurable
, customer service standards.
The delegation process should be overhauled so that is not an obscure or intimidating experience for citizens unfamiliar with City Hall or unaccustomed to public speaking. To make citizens feel more welcome, Council, staff and the public should work together to amend the Procedural Bylaw, develop a new manual and provide staff assistance to delegations as required.
To enhance transparency and access, Council could periodically hold its meetings in different geographical areas across the City, including libraries, community centres and schools where students could participate in the proceedings.
Belonging: Build a caring and inclusive community
The City should reach out to minorities, marginalized groups and all of Burlington’s geographical areas. This would include building greater social cohesion through strategic promotion of Burlington’s opportunities and celebrating each others’ success.
In partnership with the community, the City should establish a policy of inclusivity measurements to ensure that City policies, programs and services reflect our changing population. This includes the needs associated with changing population groups, such as seniors and people from diverse backgrounds, and the social, economic and cultural contributions of these groups. The goal is to forge a city where all participate in building the infrastructure for caring and the opportunities to belong.
As society moves faster and individuals become more mobile, creating a sense of place and marking important milestones become more significant. This can be accomplished through pageants and fairs, special occasions and events – a cycle of distinctive annual events that have widespread appeal and draw the community together.
An inclusive community is one that provides opportunities for the optimal well-being and healthy development of all children, youth and adults. All members of the community gain from social inclusion – those who are vulnerable for reasons of poverty, racism, or fear of difference – as well as the broader community that benefits when everyone is able to participate as a valued and contributing member of the community
Participation: Empower committees and community organizations that work for people
An Office of Engagement should be established to foster and implement recommendations contained in this report.
The Director of the Office, reporting to the City Manager, would implement the Engagement Charter, working with municipal departments to review their policies and design more effective forms of consultation and engagement. This would include a program to support different levels of.citizen access and providing meeting space for community/neighbourhood councils and other community-based groups organized around specific issues.
The Director should consider initiating discussions with community groups to develop a template for independent community or neighbourhood councils such as developed in Quebec City, Portland (Oregon) and Los Angeles.
The Director would provide support for Burlington’s Citizen Advisory Committees, important local institutions whose potential has not yet been fully realized because of variation in their
operation, constitution and purpose. Council needs to rethink the structure, responsibilities, standards and accountabilities of future advisory committees. One option is to establish committees that cut across different issue areas.
Youth: Reach out to the next generation
In cooperation with the school boards, Council should invest in meaningful initiatives at different grade levels. Members of Council and staff should be made available to speak to students in their schools.
A specific proposal is involvement in the Grade 10 Civics program, already in place.
Initial meetings with the Director of the Halton District School Board have produced enthusiastic interest in augmenting this program with a module that could be created with input from the City, the school boards and a committee with experience in both these fields.
Using their volunteer hours as currency, students should be brought into the planning process in ways that they help define: creating a website and social networks that allow them to engage with issues that are important to them: transit, sports facilities, bicycle paths, cultural events, festivals, environmental issues, education and diversity.
There is a genuine need, and value, to reach out to Burlington’s youth. Lifelong civic engagement begins here.
Governance: Define roles and responsibilities
A.governance review should be undertaken to clearly define and differentiate the roles and responsibilities of Council and staff.
Workshops, conducted after each election, would help ensure that Council members make effective decisions and spend their time appropriately and effectively at the policy-making level. They will also ensure that staff is empowered to do their job of administration, providing advice and implementing Council policies and decisions.
Messages & Observations
Burlington is using traditional models in a new age
The City of Burlington public involvement processes and methods of engaging the public for both decision- and policy-making are based on traditional models that belong to the past.
Significant social and demographic changes, population growth, increased urbanization, and new technology in the past 30+ years mean that changes in the modes of civic engagement and communication between citizens and government are necessary to relate to a changing society. In recent years, a wide variety of innovations in civic engagement and democratic inclusion have been developed in municipalities and communities in Canada, U.S. and globally.
Burlington is not on the cutting edge of these developments to match its leading edge economy and above average literacy and education rates.
Everyone recognizes the need for improvement
There appears to be as a broad consensus among the public, City staff and members of Council that the processes of public involvement should be improved. However, there are many different viewpoints on what and how extensive these improvements should be.
The public wants more extensive change than City Hall does.
While staff and members of Council generally agree that improvements are needed, most believe that the City is doing a better job in communicating and promoting and civic engagement than does the public. Further, the public appears to favour greater changes than those suggested by Council or staff.
Many believe that City Hall is not listening
There is a broad consensus among representatives of citizens who deal with City Hall as well as the public at large that City Council and staff is not listening. Citizens want to see that their input is taken seriously and has a meaningful impact on outcomes.
Citizen confidence in local democracy is declining
There is a broad consensus that public confidence and trust of the City and its democratic processes have declined, especially in the past few years. Most members of Council agree.
Tomorrow’s major transformative issues will require a new form of leadership.
Burlington will face a number of significant transformative issues over the next decade: greater urbanization and intensification 1 the impact of build-out on taxes, an aging population, and the need to adjust services for seniors and youth, low income groups and those from diverse backgrounds.
These issues will require leadership at all levels of City Hall to enhance civic engagement.If there is not effective public involvement in the decisions and policy-making processes, the community could become even more distressingly polarized.
Good citizenship means citizen responsibility
Good citizenship is a two-way street Citizens have a responsibility to help make a better community and take part in decision and policy making in an appropriate manner and with mutual respect. The public involvement process should give citizens the greatest opportunities to exercise those responsibilities.
Issues Governance – the roles of Council and staff
Some citizens suggested that a lack of unified direction and leadership from City Council made it more difficult for staff members to do their job and, further, that staff members were not sufficiently empowered and trusted. Others suggested that staff had undue influence over Council and its decisions. These questions of leadership and respective roles are governance issues, but they have a significant impact on the ability of City Hall to establish a high level oftrust for effective public engagement. Some citizens suggested
that staff members are frustrating to deal with because they do not have a sense of Council’s direction or goals. The public has difficulty putting issues into their strategic context when they do not understand Council’s goals or feel Council’s directions do not represent a community consensus.
Governance – size of Council
There was a widespread view that the size of Council should be re-visited. Many citizens felt that Council members were too overburdened to make good policy decisions or be able to respond as well as they should to public demands for input and service. However, Council has been the same size for 13 years and it appears that only in the past few years has the concern about its size become a major factor. So are other factors at play? There were some suggestions that the issue is not so much size as one of establishing better standards, measurements, and process for accountability. There were some suggestions that Council members need not spend as much time on service issues and they should restrict their time and efforts to focus on policy directions and major issues, and show greater trust in City staff to do their job.
Service quality and process
Many citizens thought that the quality of service, response time and staff attitude has declined. Interestingly, several members of Council agreed. Citizens’ experience with City Hall is a major determinant in creating trust in municipal government and the democratic process. Citizens have a right to be well treated, as customers and as citizens. The City does not appear to have a clear quality service policy, although one is in early stages of development.
Not au citizens feel included or respected
Some citizens felt business groups and other organizations have a better relationship with City Hall than those involved in activities such as social justice and the environment They believe that the City should do more to reach out to all citizens and sectors of society.
A number of citizens said they felt intimidated and faced an adversarial attitude on the part of Council when they attended Council or committee meetings as delegates,
Staff reports and presentations
A specific suggestion, repeated several times, was that staff reports should, as olten as possible, include options for Council and public to consider so that there is a greater ability to evaluate the best possible direction. Further, the suggestion was made that staff presentations at public meetings should be dear, succinct and relevant to the audience.
And, the suggestion was made that the Chairs of public meetings, whether they are Councillors or staff, should be trained in conducting meetings.
The need for more and better information
While we live in an information-based society, communications about the local community, local government and local issues have declined. To have information is to have power.
The local information deficit is significant and is a major deterrent to public involvement. There was agreement among all participants that the decline of traditional media as a source of information and platform for debate is a major issue, Fewer professional journalists cover City Hail. Council and committee meetings are often unreported.
Compared to 15 years ago when Burlington had three newspapers and frequent radio and television coverage, fewer pages are devoted to City news and there is no radio or television coverage to speak of. Cable TV is still present but competes in a multi channel and multimedia universe. There was some feeling that the media often shows bias, City Talk received mixed reviews, with a large number of people perceiving it as more of a political document than an information provider. Citizens, especially those involved with
various organizations, expressed a desire to receive information before issues are discussed.
The need for more education
A common comment was that many residents do not understand City Hall’s procedures and policies and therefore require some basic education so they can navigate the system better and have more confidence to engage.
Importance of early citizen engagement
There was wide agreement among the public, Council and staff that it is important to involve citizens as early as possible in the decision-making process, especially for major issues. Citizens felt that they are consulted too late, after the staff report is already in a final or semifinal form. The timeline after a final report is publicly tabled is often only a few days before a committee meeting, leaving citizens little time to adequately prepare if they wish to express their views effectively.
The need for meaningful dialogue
Public information sessions and many public meetings do not allow citizens to become engaged in dialogue with each other to arrive at a consensus. We heard from some members of Council that meetings and processes where residents have dialogue and help frame solutions result in better buy-in because citizens feel they have had an impact.
The influence of single-issue groups
The influence of single-issue groups received mixed reviews. Some citizens considered them to be a major barrier to allowing the opinions of the large spread of citizens to be heard effectively. Several members of Council indicated that this was an issue. Other citizens believed single-issue groups are positive and effective.
More effective use of digital communications
Digital communication and new information technologies are enabling improved interactivity, information-sharing and collaboration as well as a range of social media services, wikis and biogs. They are substantially changing how we communicate and use information. With some exceptions, most people have access to this digital world, particularly young people whose civic involvement is so important. The City should be prepared for the next wave of wireless technology. The City’s website has come in for criticism because it is not user friendly and does not contain useful information. The City has not yet entered the web 2.0 stage. So the City’s proposed website revisions and social media considerations are timely. Some have suggested that web-based communication tools can complement and even replace many traditional meetings. Burlington’s knowledge base could be expanded by a Burlington Wikipedia, a repository of public-sourced information on a range of local subjects.
The importance of public involvement in major policy plans of the city
The Strategic Plan, Official Plan, Capital and Operating Budgets, the Parks and Recreation Master Plan and the Transit Plan are all policy blueprints. Typically, they are the most difficult for the public to provide critical input. There is a need to develop processes to obtain better and more effective public input at the earliest stages. Further, there was a strong feeling that the Strategic Plan does not include sufficiently specific and measurable goals to be effective.
The need to make more effective use of Citizens Advisory Committees
There is a public perception that the Citizen Advisory Committees are not listened to sufficiently. The City is not taking full advantage of this important resource.
Representatives of Advisory Councils have mixed reports on the effectiveness of their activities in terms of influencing City Council decisions and the community’s quality of life. A common issue is that the committees often have difficulty meeting timelines to provide advice.
North versus South,new versus established
It was noted that different geographical areas in the City, particularly new neighbourhoods in the northern and eastern areas, do not feel part of the Burlington community. Some residents of these areas may feel closer to neighbouring municipalities in terms of entertainment and shopping.
Excelence in government
One of the best measures of a city’s quality of life is the successful engagement of its citizens with their elected local government. This has been an ongoing issue for Burlington for many years. Citizen engagement is a broad and complex issue, which, ultimately, has its roots in the state of social cohesion in the community. One aspect of citizen engagement is the effectiveness of the communications between the local elected government and the citizens they serve,
In 1997, the City of Burlington hosted a citizens’ workshop on community-based government. Subsequently, City Council appointed a Citizens’ Community-Based Government Committee, which presented a report to City Council in October 1997 with recommendations to improve citizen engagement and communications. After 1997, City Council changed from seventeen elected members to a smaller size of seven members including the Mayor, all of who also served on Halton Regional Council. Other dramatic changes since 1997 include the diminished role of the local media, the use of digital and web based technology, and rapid population growth.
Mayor Cam Jackson has expressed his belief that the City’s communications with its citizens needs to be enhanced to achieve higher levels of awareness and civic engagement. Others have expressed similar concerns. Encouraging broader citizen engagement and improving the way local government communicates with its citizens is a commitment that should involve ongoing, two-way community dialogue. Mayor Jackson has announced the creation of a “Mayor’s Citizen Advisory Committee on Civic Engagement”.
He has asked respected community activists John Boich and Walter Mulkewich to co-chair the committee and select the committee members ensuring a broad range of representation, including gender equity, diversity and geographic representation from across the city. This committee will prepare a report for the Mayor. Their recommendations will be shared with the public and council. John Boich is the former Chair of the Rambo Creek Ratepayers Association, a local citizens group advocating for the citizens in the greater downtown area. Walter Mulkewich is a former Mayor of Burlington and was a member of the 1997 Community-Based Government Committee.
Terms of Reference
1. Review the 1997 report on Community-Based Government (Report of the Community Based government Committee,October 29, 1997; City File: 130) and other relevant information on citizen engagement.
2. Review civic engagement with local municipal government through research of current modes of communications between the City and its citizens, as well as the type and level of citizen engagement with the City through Advisory Committees and other means.
3. Develop a work plan, including a communications plan and a budget to meet the mandate of the committee.
4. Solicit information and ideas from members of City Council, City Staff, ratepayer and citizen groups, community organizations, high school students and the general public.
5. Review best practices in communication in the public and private sectors as well as civil society.
6. Consider the culture required to incubate and nurture the engagement of the public, in the public decision making process.
7. Hold focus groups in different areas of the City, which will include invited participants representing a broad cross section of Burlington life, as well as being open to the public.
8. Prepare a final report on its findings and recommendations by March 31,2010. This committee will present this report for the Mayor and share their recommendations with the public.
Purpose
The Mayor’s Citizen Advisory Committee on Civic Engagement is established to move us closer to realizing our Future Focus Seven goals to be “customer focused where residents are part of City Council’s decision-making process” and “striving to keep residents informed and engaged so that all members of Burlington community have the opportunity to have their voices heard.” This Committee will provide ideas and recommendations that could be helpful to implement this Council’s approved goals and strategic actions of the Future Focus Seven strategic plan: ·
Future Focus Seven: Excellence in government
12.2 Engage citizens more effectively in city Council’s decision-maki ng processes by: 12.2.A Exploring every opportunity to raise awareness of city services through different forms of communications technology and offer additional opportunities for citizens to provide their views to council; and,
12.2.B Develop framework and protocol which council may consider for undertaking enhanced public consultation.
Committee composition and organization
Committee Members: Maximum of 10
Administrative Support Departmental Resource Support External Resource
Recruitment and selection
Voluntary, inclusive citizen representation ensuring balanced gender and geographic representation
Mayor’s staff As requested TBA
1. The Committee shall be selected by the Co-chairs.
2. The Committee shall be representative of the social and community fabric of Burlington. Citizens who have had active experience with City Hall as users of services or participants pertaining to City government will be an asset to the committee’s work.
Resources
This committee will be resourced through the Mayor’s office. City staff and Council are asked to be available to provide information and input to the Committee’s work, as requested by the Committee.
Acknowledgements
This Shape Burlington Report is only possible because of the huge commitment, hard work, and outstanding contributions of many people in a short period of time from November
2009 to April 2010. Therefore it is important to not only acknowledge them, but also thank them.
Our citizen volunteers
We thank an incredible group of committed citizens from every geographic area of Burlington representing the diversity of our population who attended many committee meetings and consultations with the public as well as doing individual research.
• The Co-Chairs: John Boich and Walter Mulkewich
• The Steering Committee: Doug Brown, Leslie Bullock,Amy Collard, Ken Edwards, Hussein Hamdani, Blair Lancaster, Paul Sharman, Lorraine Sommerfeld, John Searles
• Sub-Committees (Research, Communications, Community Dialogue, Writing): Marilyn Abraham, David Auger, Kale Black,Neil Bryson, David Conrath, Joey Edwardh, Larissa Fenn, Mark Gregory, Mark Henderson, Tim Lindsay, Paul Mitchell, Rennie Mohammed, Roland Tanner, Chris Walker.
• Other participants: A number of citizens were only able to attend some meetings. Carolyn Forbes, Kurt Koster, Anisa Mirza, John Morrison, Yaw Obeng, Karen Parmenter, Andy Rotsma, Judi Smith, Bob Wood, Ken Woodruff, Pat Wright.
Mayor Cam Jackson
The project was initiated by Mayor Cam Jackson who appointed the Co-Chairs and approved the Terms of Reference. We appreciate his support and commitment without input or interference from his office or City Hall, allowing our committee and report to be independent. We also appreciate his support by providing the resources of his office.
Finally, we appreciate the contribution from the Mayor’s Pride in Our Community Fund (within the Burlington Community Foundation) and financial support from the Mayor’s budget.
The public
We thank people in the Burlington community who responded to our request for input.
• Citizens who attended our three public roundtable workshops.
• Representatives of community organizations who attended three small group conversations
• Representatives of the City of Burlington Citizen Advisory Committees.
• Students at Corpus Christi and Central High Schools.
• Citizens who participated in our on-line survey and dialogue on our website.
Council and City staff
We thank all the members of Council and staff who gave us their time to openly share their experience, skill, knowledge, and vision.
Burlington Community Foundation
Shape Burlington is extremely thankful for the $15,000 grant received from the Burlington Community Foundation (BCF) through its Mayor’s Pride in Our Community Fund. This grant made it possible for Shape Burlington to enter into a partnership with Community Development Halton (CDH) and to engage MASS LBP as consultants to our project. We are also thankful for the interest shown by BCF in our process and for the input of representatives of BCF at several Shape Burlington meetings.
Community Development Halton
Community Development Halton (CDH) is a community-based organization providing Burlington with social planning and community development capability. We were pleased to have CDH as full partners as advisors and participants. CDH assisted the Co-Chairs in the supervision of our consultant, MASS LBP. Joey Edwardh, Executive Director, and Ted Hildebrandt, Director of Social Planning, participated in many of our Shape Burlington committee meetings and public conversations as well as being full participants in our Research Committee. We thank them for their knowledge and skills, as well as meeting space for several meetings.
MASS LBP
MASS LBP is a new kind of company that works with visionary governments and organizations to deepen and improve their efforts to engage and consult with citizens. We were pleased to have Peter Macleod, Joslyn Trowbridge and Chris Ellis work with us throughout this project. MASS LBP helped establish a context and direction for our work plan and final report. They provided us with two important papers, a reflection paper on the trends in local democracy and an environmental scan of trends in innovation in civic engagement in local municipalities. They attended a number of meetings of our Committee and sub-committees, and they facilitated the conversations with City Staff and two of the public roundtables. They also helped facilitate our conversation with the representatives of the Citizen Advisory Committees. Finally, they summarized all our research, conversations, interviews, and meetings and gave us their analysis of the process and its findings to help us shape our final report.
Website (www.shapeburlington.ca)
We are grateful for the many hours of volunteer time of our Webmaster, Roland Tanner, who created and maintained the website. We also thank for the members of the Communication Committee who provided advice.
Three General Managers met with MASS LBP and the Shape Burlington Co-c.::hairs for a candid conversation on the role of citizens in municipal governance. The General Managers perceive a shift in municipal governance that is moving to a more upstream process of citizen engagement and public consultation, doing more engagement earlier in the policy making process. They see staff and Council working more cooperatively with citizens now than ever before, making an effort to be transparent and more open about the constraints facing the City and the changes that are in Burlington’s future. This shift to a more robust process of citizen engagement is still in its early stages, the General Managers say, and thus the implications are still ill defined. Nevertheless, they feel there is a consistent effort being made at City Hall to improve the public’s awareness of new cost containment policies and the impacts this has on the City’s services.
Internally, City Hall faces several challenges to engaging citizens more effectively. The first is a lack of clear measurement of which departments are working collaboratively. This is related to a lack of standards for public consultation and engagement across the departments – while some departments, such as Planning, must adhere to Provincial standards in notification and consultation, others do not. Not measuring what departments
are doing in terms of consultation, and not having best practices and standards to adhere to give the feeling, in the words of one General Manager, of being in a pinball machine, with many consultation activities happening across departments. Without the time and resources to benchmark engagement practices, effective public consultation will be harder.
Other internal challenges include the lack of diversity in City Hall staff, which detracts from the City accurately reflecting the growing cultural and linguistic diversity of Burlington’s community. This lack of diversity can present challenges for customer service and engagement activities. Finally, General Managers expressed concern over the formal rules of Standing Committees and delegations to Council meetings, which can prevent some citizens from communicating their views in a way that makes sense to them.
External challenges to effective public consultation and engagement identified by General Managers include the lack of public trust in democratic institutions and the high expectations and volume of demands placed by citizens on staff and elected officials. The lack of public trust makes positive messaging of the City’s activities difficult – General Managers feel that the public assumes staff is not very involved or caring and not on the public’s “side.” At the same time, citizens are demanding more from staff and elected officials, expecting quick turnaround times to their questions or concerns. These factors combine to make communication, messaging, and consultation resource-intensive.
Speaking about the process of public meetings in particular, General Managers identified two problems. First, they feel that citizens only come out to a meeting if they are upset or unhappy with a situation. This means that broad and inclusive representation is hard to achieve, as only vocal individuals with a stake in the outcome attend. It also compounds efforts to get high levels of participation in priority-setting and visioning meetings, as these meetings do not offer a point of contention for participants to engage on.
For example, consultation on the City’s budget traditionally sees low participation, but offers citizens the greatest opportunity to affect change for the future. Second, an increasingly mobile population means high turnover for neighbourhoods, and thus a different slate of participants show up at each public meeting. This erodes the consensus and knowledge
built through previous consultations, placing more constraints on moving forward through an issue during a series of consultations.
Based on these internal and external challenges, General Managers identified opportunities for improvement to the City’s public consultation and engagement practices. These opportunities are as follows:
• Set standards of engagement and consultation across departments and embed them as aspects of performance management to help change the culture at City Hall
o Look at best practices within City departments and establish corporate consistency
o Establish measurements and benchmarks to respond to citizens in an appropriate manner and time frame, especially when considering vocal groups and contentious issues
o Promote a culture in which staff recognize citizen knowledge as complementary to their own professional expertise
o Help the next Council term to look at expectations and roles around communication and engagement
• Work towards a “one window” service approach where all staff are ambassadors for all City programs and services to break down “professional silos”
• Improve communication with and messaging to citizens by:
o Being clear about expectations and how cost containment strategies will
affect programs and services
o Encourage broad conversations on the City’s future rather than just ‘hot button’ issues
o Use new technology better and begin a social media strategy to reach out to the public in a variety of ways
• Improve citizens’ knowledge of how city government works, potentially by offering educational sessions on and offline
Department Directors
MASS LBP and the Shape Burlington Co-Chairs met with seven department directors, representing the Traffic and Transit, Parks and Recreation, Roads and Parks Maintenance,
·Engineering, Corporate Strategic nitiatives, Finance and Environment departments. The Directors agreed that the rapid pace of technological change require their departments be able to adapt their modes of communication. n light of technological advancements, increased resources and staff time need to be dedicated to learning, using, and sharing new technologies. They noted that the main internal challenge lies in determining the priorities for devoting money and training time to keep pace with new technologies for internal and external communication.
When asked about their views on the role citizens have to play in municipal governance, City Directors felt that overall citizens are deeply engaged. This engagement contributes to high citizen expectations of interaction with Burlington municipal government, especially in comparison to other municipalities. Directors perceive pressure from citizens to provide increased transparency and accountability, and for government to present a sound rationale for its decision-making. The challenge in responding to that pressure lies in providing information that is succinct while using a convenient mechanism for input and feedback.
Directors note that their staff has trouble determining what and how much information they should provide to the public, as well as the amount of resources to dedicate to this task.
They also said that while certain segments of the population, particularly retired or older citizens and those who oppose an issue, can regularly attend and be vocal at public meetings, other demographics such as commuters and younger citizens with families are harder to get feedback from. However, the consistent positive responses to the City’s Quality of Services survey leads Directors to believe that the majority of citizens are satisfied with City Hall.
When asked what they thought was working well in terms of public consultation, Directors expressed pride in a “commitment to excellence in governance at the top” in City Hall culture, including engaging and consulting with citizens to incorporate citizen input into decision-making. Council was particularly praised for its efforts in this regard. Directors identified the ability to make materials such as reports available to citizens online as greatly facilitating City Hall’s ability to provide citizens with an abundance of real-time information. They were also pleased with the interest citizens demonstrated in providing feedback. As noted above, the Quality of Services Survey consistently results in a high rate of return and positive comments. Opportunities for interest groups and special focus groups to make presentations to Council also garner a high level of participation.
Building on these successes and responding to the challenges identified, Directors discussed opportunities to improve the City’s public consultation and citizen engagement activities.
These opportunities are as follows:
• Better communicate the existing opportunities for engagement and consultation
Use more web-based media to counteract the decline in local print media, For example, use web-casting for sessions on the budget
@ Involve commuter citizens and those without young families/lack of time
Modify the Quality of Services survey to include more questions on engagement
® Consult citizens on improving the website to identify what types and how much information the public wants
Finally, the Directors expressed the need to communicate to citizens that their job, as staff, is to bring many different perspectives of an issue to the conversations that interest groups and citizens are involved in, but not to advocate for any particular perspective. Their challenge is to remain neutral during consultations and allow all options to stay on the table throughout the duration of public input, which can conflict with citizen demand for direction, guidance, and the elimination of unpopular options.
Other Staff
Thirteen staff, including Clerk’s department and communications staff, Councillors’ Assistants, customer service and accessibility coordinators, T and business staff and graphic designers, met with MASS LBP and Shape Burlington to discuss their perspective as frontline staff who communicate with Burlington residents often, if not daily. Many of the challenges they identified related to customer service and the transactions that occur between citizens and City Hall. nternally, staff recognized that they had limited capacity in serving citizens and other customers with different linguistic backgrounds, and that the elderly may not find their services accessible.
The counters on the first floor of City Hall are often the first point of contact for many citizens, and the staff recognized the need to constantly strive for improvement in customer service. n addition, staff identified difficulty in using plain, simple language to inform citizens about an issue. One participant remarked that some reports produced were even difficult for Councillors to understand.
On communications, staff felt that there was a lack of strategic and standard marketing across departments, and expressed concern that some official City communications looked like advertisements for Councillors, instead of focusing on City information and activities. Finally, staff echoed the concerns of General Managers and Directors that the formal rules for presenting to Council and the language used in Council meetings could alienate and discourage citizen participation.
External challenges to effective public consultation and engagement identified by staff included only receiving negative feedback from citizens and thus not being able to identify what staff was doing right, and the lack of initiative from citizens to inform themselves about the issues. Staff felt that they were doing a good job of getting information out to citizens, and expressed frustration when citizens emerged at the end of a public consultation process to claim they had not been informed. t is often too late to consider public input at the stage in which citizens start to provide input. This “not in my back yard” impetus for getting involved is frustrating to staff who feel that they have provided avenues for input early in the decision-making stage.
Finally, staff felt that there was a low level of awareness of the division of responsibilities between Federal,Provincial and Municipal levels of government, remarking that citizens often asked staff to change services that the City does not provide.
Other external challenges identified by staff echoed what we heard in conversations with General Managers and Directors, as well as in departments. The public perception that government employees do not work very hard, the need for staff to remain politically neutral throughout the consultation process, and the difficulty in engaging young citizens were mentioned as factors preventing effective engagement.
While staff felt that their role in customer service, particularly having a live answer switchboard, was making a positive impact on how citizens perceive municipal government, they were concerned that one “hot button” issue that receives negative press can be detrimental to citizens’ positive perceptions.
Opportunities for improvement i dentified by staff include:
• Break down issues to show how they impact citizens and localize meetings to increase engagement
o For example, show how the Official Plan or other planning/visioning documents can affect citizens
•Involve the public earlier on issues and keep them involved throughout the decision making process
• Mail and communication from the City should reflect City business and be politically neutral
• Citizen participation in Council meetings should be less formal,more modern and “real”
•Implement standards and training for customer service for frontline staff
o This is currently being reviewed
• Measure how departments are faring on customer service, implement a system for following-up with complaints
• Market the City better to increase a sense of pride, use strategic marketing
• Advertise outside of City facilities (we go to them instead of expecting citizens to come to us)
Clerks and Communications Department
We spoke with five Department staff responsible for community relations, council services, committee services and communications. This session addressed current practices to interact with and respond to citizens as well as the successes and challenges staff have experienced when connecting with citizens. The department faces several internal
11challenges to effective consultation and engagement. Citizens are demanding more
f information and expecting quicker response times. This places pressure on staff to balance
completing their daily tasks and core work while responding to this demand.
Taking on new staff and using new technology to increase department capacity is a potential solution, but these both take time and resources for training and management. Staff struggle with reporting back to the public on how public input will be used to make changes, and have difficulty communicating operational plans in plain language.
Communication costs, such as marketing, branding, and ensuring consistency across departments, can be high, and the public is usually at odds over this spending, as it competes with spending on core services. Thus staff face increased demand for clear, fast and effective communication, but there is a lack of public will to spend money to obtain this kind of communication.
The Clerks and Communications staff also identified the difficulty in staying neutral during public consultation on a contentious issue, and are often asked by citizens for information on the “best option”,which City staff cannot give. Finally, staff identified a “work squeeze” in the middle of a Council’s four year term, where pressure for results mounts as the lead up to the next election begins. They felt that the “City sees customers, but Council sees voters.”
A main external challenge Clerks and Communications staff face is “private sector demands” on the public sector. n the private sector, niche marketing, customized experience, and access to information and technology raise customer service expectations. These are often replicated in the expectations citizens place on elected officials and public servants.
However, the process by which the public sector gathers, interprets, and weighs competing demands and remains neutral and open to all opinions prevents them from offering customized services to each citizen. For example, many staff noted that citizens demand an unrealistic response time to emails (usually two hours). Many citizens send a second email if they do not receive a reply within two hours or so, placing demands on staff that staff simply cannot meet.
Other external challenges echo the conversations with other City staff – the public misconception that staff do not work hard or long hours, a changing audience at public meetings does not allow staff time to keep up with input and demand for changes to plans, and the lack of public awareness of the division of services between the City and the Province. Despite these difficulties, Clerks and Communications staff felt that they did provide excellent customer service and that considering the volume of requests, their response times were adequate. They pride themselves in working to be information providers and to get the right information to the right person, and hold their internal communications to a high standard. They identified the following opportunities for improvement:
• Need research that establishes:
o What does the public think of us?
o What information do you want to hear?
o How do you want to hear it?
• Consistent public notification and consultation process prior to the drafting of reports
o Find a best practice that works with the legislative requirements
• Dedicate more staff and more staff time to the Citizens’ Advisory Committees
• Expand the department’s arsenal of communication methods, including the use of social media and new information technologies
Planning Department
Six staff from the Planning Department responsible for Policy, Development, Planning, Site Plans and Urban Design met with MASS LBP and the Shape Burlington Co-Chairs to identify challenges their department faces when consulting with the public. They identified a shift in the planning and development field towards more public input and consultation, but noted that this takes time and resources to do effectively. The complicated nature of planning
presents staff with a significant challenge when communicating with the public. Specifically, documents and reports, such as the Official Plan, contain information that is imperative for citizens to understand, but are often written “by bureaucrats for bureaucrats.”
This makes it difficult for staff to help people make an informed contribution, and significant resources are required to communicate both the big picture vision associated with planning and the specific tradeoffs associated with a particular project. n particular, staff noted the lack of citizen understanding of the legislative requirements around city planning, which means citizens are asking to change plans that are not always up for negotiation.
Staff feels that the public is only engaged on a topic when it affects them personally, and that citizens do not understand nor respect the stages of consultation associated with planning. They noted that citizens have the greatest opportunity for input during the policy, visioning, and budgeting stages, but usually participate in public meetings that happen after these stages and are mostly meant to inform the public of what is happening. This results in frustration on both sides. Staff also find that citizens come to a public meeting misinformed, thus forcing time to be dedicated to educating and informing citizens on the project rather than providing input or feedback. n addition, the length of time between consultations presents a challenge, as neighbourhoods change and different people show up to different stages of the consultation.
This makes Planning Department staff feel as if they are “speaking to a parade” and erodes the knowledge and consensus built in previous public meetings. Staff also noted that participation rates in rural areas are low, contributing to uneven consultation across the city. Finally, staff felt that citizens are generally adverse to land-use change, and have difficulty communicating the demographic necessity of these changes for Burlington.
Despite these difficulties, the Planning Department prides themselves on their public engagement efforts, noting that they often go above and beyond the legislative requirements for consultation. They try to use public consultation activities as “teachable moments” to help educate the public on how the planning and development process works, and note that of 2000 Customer Service Questionnaires distributed last year, less than 2% had negative comments.
Opportunities for improvements identified by Planning Department staff are:
•Implement a more streamlined, continuous process of engagement that focuses on the positive implications of development
• Dedicate more staff and more time to innovations in public consultation
• Explore ways to cope with the changing audience in public meetings
• Fill in gaps left by the decline of the local media
o Use website to better communicate planning and development projects in a more timely manner
City Talk
The five conversations with City Hall Staff included a short discussion on City Talk, the City of Burlington’s corporate newsletter. Many staff agreed that the newsletter is in need of redesign, and that this is in fact underway (City Talk was previpusly outsourced and is now being brought back in house). They agree that City Talk is an important source of information for citizens who are not online, but feel that it has “lost its way” over the past few years. Staff would like to see City Talk include more information on what is happening in the City and less space devoted to Councillors’ activities. One staff member suggested a survey or inquiry into how the public uses City Talk and what they would like to see it contain. | https://burlingtongazette.ca/the-shape-burlington-report-as-presented-to-city-council-in-2010/ |
The Regional Forum Trans-Balkan Cultural Corridor Greece-Bulgaria-Romania – Shared Heritage and Common European Future (Plovdiv, 16-17 November 2007) is part of a project initiated by the Regional Governor of Plovdiv Region under the EU Communication Strategy of the Republic of Bulgaria 2007, and is realised in partnership with the Association for Cultural Tourism. The Forum will develop and specify the ideas from the Regional Forum Cultural Corridors of South East Europe and the commitments of Varna Declaration (Varna, 2005) and the Regional Forum Communication of Heritage (Opatija, 2006). The project is linked with the project Cultural heritage: education – science – preservation – integrated in tourism (HERITAGE: ESPRIT) by UACEG, NAA, ACT and ICOMOS/Bulgaria, selected by the Ministry of Education and Science Study on National Historic and Culture Legacy as a part of European Cultural Heritage and Advanced Methods for Preserving.
The theme of the Forum is the cultural corridor Eastern Trans-Balkan cultural road between the three countries – a basis for mutual knowledge of each other, sustainable regional development and enhancement of the positive image of the countries from the region of South East Europe. One of the goals the Forum puts forward is to foster the undertaking of common actions through the creation of a mechanism for partnership between the concerned parties for a balances sustainable development of the cultural heritage, cultural tourism and cultural industry along the Eastern Trans-Balkan road as a basis for a regional politic for the preservation and use of the cultural values.
The participants – Bulgarian regional administrations and municipalities, representatives of the regional authorities from Greece and Romania, the neighbouring countries along the Eastern Trans-Balkan road, experts from Bulgaria, Greece and Romania, representatives of NGO – will adopt a Final document for the undertaking of common actions for realisation of the first cultural corridor between the three countries – members of the European Union.
An integral part of the Regional Forum in the Exhibition Cultural Corridors and Cultural Heritage of South East Europe, arranged by the Association for Cultural Tourism. It will present with modern information technologies the concept for the cultural corridors, the achievement of Bulgaria in its development and the role of the Eastern Trans-Balkan road and the major cultural values along it. | https://seecorridors.eu/?w_p=105&w_l=2 |
Join now to get access to this content and more.
Become a SOAP member and have access to our benefits.
Member Benefits
- For Review: SOAP Consensus Statement on Neuraxial Procedures in Thrombocytopenic Parturients
- Sample Centers of Excellence Applications
- ASA Corner
- SOAP Policy and Procedure Manual (P&P Manual)
- SOAP Expert Opinions
- SOAP's Learning Modules
- Bylaws
- 2019 Annual Meeting Lecture Videos
- December 2018 - SOAP Unofficial Guide to ASA Committees Webinar
- Submit a Position
- View Job Postings
- Previous Meeting Archives
- Previous Meeting Abstract Search
- CMS Guidelines
- Member Benefits
- Newsletter Clinical Articles
- ACOG Documents
- Search our Patient Safety Archive
- Ask SOAP a Question
- Global Health Opportunities
- And more…
Members
Obstetrical Anesthesia Workforce Survey: 30 Year Update
Abstract Number: BP 3
Abstract Type: Original Research
Background: Surveys investigating the obstetrical anesthesia workforce were conducted in 1981, 1992 and 2001 to characterize and understand obstetrical anesthesia practice. The thirty-year update of this survey was conducted in 2012. Anesthesia providers from hospitals in the United States were surveyed to identify the number and types of providers, services, and methods used to provide obstetric anesthesia.
Methods: Using the American Hospital Association Annual Survey of Hospitals, a randomized stratified sample of hospitals was generated based on number of births per year and U.S. census region. Strata were defined as: Stratum I ≥ 1,500 births, Stratum II ≥ 500-1,499 births, Stratum III < 500 births. A total of 341 Stratum I, 440 Stratum II, and 415 Stratum III hospitals were identified. Phone calls were placed to each hospital to obtain contact information for the anesthesia group providing obstetrical services. Providers were personally contacted via phone by a physician to obtain email contact information. Electronic questionnaires (Survey Monkey) were sent via email.
Results: Data collection for Stratum I hospitals is complete, with the other Strata to follow. Of the hospitals and providers contacted, 56% provided accurate contact information and 12% declined to participate. The response rate was 45% from those who provided contact information and 25% overall. Initial results from Strata I responses show administration of regional labor analgesia has increased compared to 2001 and is available 24 hours per day at 100% of Strata I hospitals, with 97% of providers in-house. PCEA use in Strata I hospitals was 35% in 2001 and is now approximately 84%. Independent nurse anesthetists provided obstetrical anesthesia services in 4.5% of hospitals, which is increased from 2001. While 93% of Strata I hospitals allow postpartum tubal ligations, 22% state that inadequate staffing interferes with provision of anesthesia for these cases either always or at off-hours.
Conclusion: In the 10 years since the last survey, there have been some significant changes in how hospitals provide obstetric anesthesia. Additionally, the ubiquitous use of technology has changed survey techniques since 2001, with email being the primary method for data collection. Obstetric anesthesia surveys continue to provide useful information about the practice of obstetric anesthesia. | https://soap.org/meetings/2013-abstracts-list/2013-abstract-details/?id=BP%203 |
A Message from the Director…
This month's Compass features planning around the revitalization of the York Road corridor, as well as some important milestones for other planning and redevelopment initiatives that are in the works throughout the City of Baltimore.
Admittedly, sometimes progress may seem slow, but some of the best revitalization efforts are those that are not only well planned, but strategically implemented.
Given the national economic context in which we find ourselves, Baltimore has been making great strides.
We are committed to planning for neighborhood revitalization, while encouraging private investments that will help Baltimore grow and thrive.
Market
Ventures, Inc., a firm that specializes in the planning and development of
urban food markets, was hired to create a regeneration plan for Lexington
Market. Market Ventures is leading a team of architects, engineers, and
placemaking experts in this effort.
Please visit the Lexington Market website, or the Lexington Market Facebook page, to complete this 10-minute survey. The deadline for completing the survey is March 16, 2014.
The Opportunity Collaborative (“the Collaborative”), funded by a $3.5 million
HUD grant, is a consortium charged with developing a Regional
Plan for Sustainable Development.
In February 2012, the Collaborative began a
three-year process to develop a plan that links our region’s housing,
transportation and workforce development investments, with a focus on reducing
regional disparities.
Government, philanthropic and private sector
partners are working together with community members to develop a practical
plan to connect all of our citizens to a prosperous and sustainable future.
In order to
improve quality of life and opportunity in our region, the Collaborative wants to know what
you think of your community and what you value most when it comes to your
neighborhood and overall well-being.
Please take the
survey here, to help ensure that the plan reflects input from people throughout
the Baltimore area.
The U.S. Green Building Council (USGBC) Wintergreen awards
recognize excellence in high performance, healthy design, building,
environmental stewardship and community impact.
The 2013 Leadership Award was
presented to the Baltimore City Office of Sustainability and Commission on
Sustainability for their broad reaching community impact.
The Baltimore
Sustainability Program’s leadership structure goes beyond providing
examples for practice and education, by creating a successful structure for
implementing sustainable actions. Visit the Office of Sustainability webpage for more information.
York Road runs through the heart of north central
Baltimore City and into Baltimore County, and by many accounts, this commercial
corridor is thriving. The last few years have witnessed the establishment of
many successful new businesses, the re-opening of the Senator Theater, and a
total overhaul of Belvedere Square and Market. However, development has
been uneven, many buildings are underutilized or in a state of disrepair and
the corridor lacks a cohesive image as a commercial destination.
With these opportunities and challenges in mind,
staff from the Department of Planning, Baltimore Development Corporation and
Loyola University joined with institutional and community partners for the York
Road Urban Land Institute (ULI) Technical Assistance Panel (TAP) in June 2013.
This multi-day planning process examined opportunities for improving the
York Road corridor from 39th Street in Baltimore City to Towsontown Boulevard
in Towson. Over 200 area stakeholders were present for discussions and
recommendations, which focused on opportunities for commercial revitalization,
transportation and streetscaping improvements, and improved urban design.
The final document is available on our website here.
As a
result of the ULI TAP, the York Road Commercial Revitalization Planning
Team (including representatives from the
Department of Planning) convened to facilitate implementation of the report’s
recommendations.
The group’s first major initiative is an RFP for a consultant
to develop an urban design and commercial strategies plan that will build from
the ULI recommendations and other past community engagement.
The end-result
will provide a blueprint of action items and create a vision for the commercial
corridor for the York Road Commercial Revitalization Planning Team (and
eventually for a new York Road redevelopment organization) to share with
businesses, communities, the City of Baltimore, and potential investors.
The York Road Commercial Revitalization Planning Team RFP for an "Urban
Design and Commercial Straegies Plan for Baltimore City’s York Road Corridor”
is available on the Department of Planning website.
Proposals are due March 28, 2014.
Two Request for Proposals (RFP) for West Side redevelopment projects have been issued by the City, along with a Request for Fee Proposals from architecture firms to assist with development concepts, renderings, and historic preservation consulting for future redevelopment of additional City-owned properties in the Bromo Tower Arts & Entertainment District.
“I am very excited about the actions underway in the UniverCity Partnership project area. Architects, urban planners and food retail experts are currently working with tenants, customers and other stakeholders on a capital improvement program to restore Lexington Market as the region’s magnet for fresh and unique foods,” said Mayor Stephanie Rawlings-Blake.
“An enterprising developer senses that the Everyman Theater and our efforts at Lexington Market have created an opportunity for smaller infill projects, and is preparing 106 through 110 North Eutaw Street for renovation this summer. Bike lanes and a dog park will be completed next fall, just in time to serve the new residents of the 520 Park Avenue project, as well as existing residents of Seton Hill and Mount Vernon.
These are just a few of the forthcoming projects that demonstrate how much progress has been made in the past 3 years. I am pleased with the UniverCity Partnership’s continued focus on developing downtown’s west side as a mixed-use, mixed-income neighborhood," Mayor Rawlings-Blake added.
The two RFPs, as well as a Request for Fee Proposals, are located on BDC’s website.
For more information on these offerings, please contact Nancy Jordan-Howard, BDC, at 410-837-9305, or [email protected].
The number of housing units is a
good indicator of progress toward growing the City, by retaining current residents and attracting
new residents. Between 2010 and 2014,
the following changes have taken place in the housing market:
STAY CONNECTED: | http://content.govdelivery.com/accounts/MDBALT/bulletins/a90e63 |
Class structure and the class formation of skilled workers in Edinburgh, c.1850-c.1900
View/
Open
GrayRQ_1973redux.pdf (52.03Mb)
Date
1973
Author
Gray, Robert Quentin
Metadata
Show full item record
Abstract
This study analyses the social position, behaviour and ideology of artisans in Victorian Edinburgh. It is argued that the emergence of class institutions and ideologies can only be understood historically, and that ideology must be seen in a dynamic relation to the changing experience of actors, rather than as fixed and static. The emergence of new ideologies and institutions must thus be explained in the context of a basic ambivalence and instability of world views. The often noted ambivalence of the artisan strata in nineteenth century society provides an illustration of this; as a preliminary to analysis of these strata an attempt is made to clarify the concept of "labour aristocracy". Three relevant levels of analysis are identified: the structural differentiation in the class situations of working class groups; cultural distinctions, arising from the behaviour patterns and styles of life of different groups; and the impact of these differences on working class movements. A marked structural differentiation is a necessary, but not sufficient pre-condition for the existence of a "labour aristocracy" at the other two levels.
Part one of the study is concerned with the problem of structural differentiation. This is set in the local context of urban development. The traditional functions of the city, and the exceptional size of its middle class co-existed with the growth of population, newer industries and industrial and working class districts. The local working population was occupationally heterogeneous; the wide range of skilled trades facilitates comparative occupational analysis. This analysis reveals wide economic differences between skilled and unskilled labour, but also within the skilled working class itself. A group of exceptionally prosperous trades contrasts with precariously placed trades marked by wide internal differences and large lower sections. This picture of occupational differences is broadly confirmed by the more rigorous evidence of workers' earnings (as opposed to wage-rates) and the physique of children of men in different occupations. Wide differences in social experience were similarly associated with the methods of production and industrial organisation typical of nineteenth century industry, which depended heavily on the skills, experience and initiative of apprenticed craftsmen, rather than on bureaucratised managerial systems.
Part two attempts to show the existence of separate sub-cultures and patterns of behaviour within the working class,and to trace the emergence of an upper, "aristocratic" stratum. Thus it is argued that the 1850's to 70's were marked by the formation of an occupationally heterogeneous upper stratum of "superior artisans". Evidence is presented of a differentiation in housing conditions, which, it is argued, had cultural meanings, linked to particular perceptions of urban neighbourhoods and evaluations of the home and family life. Leisure, voluntary organisation membership and marriage patterns also suggest the cultural distinctiveness of the upper stratum, as do the values and behaviour patterns associated with the practice of "thrift". The social experience of the skilled worker inclined him to think in terms of a relatively long-run improvement in his situation. He might become a small master, or enter certain white collar occupations, but this possibility was less important than the economic range within the skilled working class, and the opportunities and aspirations associated with it; the small master and white collar groups were anyway closest socially to the upper working class, rather than to the middle class proper. The impression of separation from the middle class is reinforced by an examination of the meanings of artisan aspirations. Although these aspirations were often formulated in terms of "respectability" and "self help ", in a language apparently adopted from middle class value systems, they took on new meanings as they were adapted to artisan conditions of life. The artisan's outlook was therefore an ambivalent one, marked by a strong sense of class identity, an insistence on the independence of working class institutions, and certain "solidaristic" modes of behaviour sharply divergent from those of the middle class, as well as by "respectability ".
Part three shows the impact of these cultural patterns on labour movements. The 1860's and 70's saw the assertion of a distinctive trade union and working class identity and political presence in the city; this class formation was strongly marked by the position and outlook of the labour aristocracy. The typical aspiration was for an acceptance of the corporate status of the organised working class, a symbolic recognition of its claim to a stake in the community. Claims of this kind were generally contained after 1867 within a middle class dominated Liberal party, of which working class radicalism was a relatively autonomous component part. The last two decades of the century saw marked changes in trade unionism and working class politics, and it is argued that these reflected the shifting position and attitudes of skilled workers, as much as the more discussed growth of unskilled workers' trade unionism. Emphasis is laid on changes in the work situation of skilled labour, arising from technological change and the growing scale of industry, and on the emergence of a more homogeneous urban working class culture (though one still characterised by extremely wide differences). Three important skilled trades (compositors, shoemakers and engineers) were involved in disputes arising from technological change, which had a considerable impact on trade union opinion in Edinburgh. It is suggested that socialist ideas and programmes appealed to artisans in the light of these experiences, and that the emergence of a more broadly based and politically autonomous labour movement should be explained in terms of this convergence of socialist activity with the industrial experience of skilled trade unionists. It is therefore argued that the developments of the 1880's and 90'o should be related to changes in the situation, activity and outlook of the labour aristocracy, Who came to play a leading role in a wider class movement, and that many features of British labour politics in subsequent years reflect this influence. | https://era.ed.ac.uk/handle/1842/32357 |
Recently, many readers have asked me if I should immunize older relatives who suffer from these diseases. This is a matter for medical experts, and I have sought the opinions of some experts. All strongly recommend that anyone in doubt contact their doctor and discuss their respective medical conditions.
Q: My 80-year-old mother has chronic lymphocytic leukemia. For weeks, her oncologist would not say “yes” or “no” to the vaccine. After a lot of pressure, he finally replied: “This will not work for you. Your immune system is too weak to produce antibodies.” She asked if she could still take the vaccine, just in case it could provide a little protection. , He told her that he had finished discussing with her.
First, some basic knowledge. Overall, the elderly have responded very well to the two Covid-1
However, people 65 years and older receiving cancer treatment were not included in these studies. As a result, it is not clear what level of protection they might receive.
Regarding safety, there is currently no evidence that cancer patients are more likely to suffer side effects from Pfizer-BioNTech and Moderna vaccines than others. Dr. Armin Shahrokni, a geriatrician and oncologist at Sloan Kettering Memorial Hospital, said, generally, “We believe these vaccines are safe for (cancer) patients, including elderly patients.
This exception applies to everyone, not just cancer patients: people who are allergic to the components of the Covid-19 vaccine or experience severe allergic reactions after the initial injection should not use the Covid-19 vaccine.
For patients whose immune system is suppressed by potential cancer or treatment, the efficacy should be considered. It is worth noting that patients with blood and lymph node cancers and patients receiving chemotherapy or radiation therapy may be slow to respond to the vaccine.
Even in this case, “we have every reason to believe that if their immune system is fully functional, they will have a certain degree of response to the vaccine,” which may be beneficial, said Dr. William Dale, Chair of Supportive Treatment. Director of the Center for Medicine and Cancer Aging Research in the City of Hope, a comprehensive cancer center in Los Angeles County.
In some cases, consider balancing the timing of cancer treatment and immunization. Hohl, who remembers Sloan Kettering, said that for patients with serious diseases that need to be treated as soon as possible, we should not postpone (cancer) treatment because we want to preserve immune function and vaccinate.
Dr. Catherine Liu, professor of vaccines and infectious diseases at the Fred Hutchinson Cancer Research Center in Seattle, said one approach might be to try to schedule the Covid vaccine between possible cycles of chemotherapy.
Dr. William Cance, chief medical and scientific officer of the American Cancer Society, said his organization “strongly supports the vaccination of cancer patients and cancer survivors, especially the elderly.” Considering the shortage of vaccines, he also recommended signing a contract with Covid-19 Of cancer patients, if their oncologists think they are good candidates, they should receive antibody therapy as soon as possible. These infusion therapies from Eli Lilly and Co. and Regeneron Pharmaceuticals rely on synthetic immune cells to help fight infections.
Q: Should my 97-year-old mother be vaccinated against Covid in a nursing home with dementia?
The Alzheimer’s Association also strongly encourages immunization against Covid-19,” said Beth Kallmyer, Vice President of Care and Support, whether it is for people in long-term care (people with dementia) or people in the community.
“The question I want to ask is,’Can my loved one live long enough to see the benefits of vaccination?'” said Dr. Joshua Uy, medical director of the Philadelphia Nursing Home and University Geriatrics Research Director. Perelman School of Medicine, Pennsylvania.
Uy suggested that potential benefits include not getting sick or dying from Covid-19, visiting family or friends, interacting with other residents, and participating in activities. (Due to partial benefits, these benefits may start to occur within a few weeks after residents in the facility are fully immunized. “I recommend this vaccine for 97-year-old people with severe dementia,” Uy said.
Dr. Michael Rafii, associate professor of clinical neurology at the Keck School of Medicine at the University of Southern California, said minimizing pain is a key factor. He said: “Even if a person has advanced dementia, you want to do anything that can reduce the risk of the disease. This vaccine can provide protection to individuals from suffering from severe Covey’s disease.”
Rafi said: “My advice is, no matter what state of dementia, everyone should be vaccinated.” He pointed out that this includes hospice care for patients with dementia.
If possible, relatives should rest assured, because people wearing masks and holding needles may cause anxiety for people with dementia. Rafi said: “Let the vaccinated people explain who they are, what they are doing and why they are wearing masks in clear and simple language.”
Question: I am 80 years old and suffer from type 2 diabetes and autoimmune diseases. Should I get the vaccine?
There are two parts to this question. The first is related to “comorbidities”-suffering from multiple diseases. Should elderly people with comorbidities get the Covid vaccine?
Absolutely, because they have a higher risk of serious illness from Covid, said infectious disease expert Dr. Abinash Virk, co-chair of Mayo Clinic’s Covid-19 vaccine promotion.
She said: “Pfizer and Modena’s research specifically targeted older people with comorbidities. They showed that the vaccine response was similar to that of younger people.”
The second part is related to autoimmune diseases such as lupus or rheumatoid arthritis, which also puts people at a higher risk. The concern here is that vaccines may trigger an inflammatory response, thereby exacerbating these diseases.
Philippa Marrack, director of the Department of Immunology and Genomic Medicine at the National Jewish Health Council in Denver, said that there are no scientific and rigorous data on the response of patients with autoimmune diseases to Pfizer and Moderna vaccines.
So far, the cause of concern has not surfaced. Malak said: “Now more than 100,000 people have received these vaccines, including some vaccines that may have autoimmune diseases, and there are no systematic reports of problems.” She suggested that if patients have autoimmune diseases Really worried, they should discuss with their doctors to postpone immunization until other Covid vaccines with different formulations are available.
Last week, the National Multiple Sclerosis Association recommended that most patients with multiple sclerosis (another serious autoimmune disease) should use Pfizer or Moderna Covid vaccine.
KHN (Kaiser Health News) is a non-profit news service covering health issues. It is an independent editing program of KFF (Kaiser Family Foundation) and has nothing to do with Kaiser Permanente. | https://infoglitz.com/how-to-assess-whether-elderly-people-with-chronic-diseases-should-receive-the-covid-19-vaccine/ |
Born in Melbourne, Australia, in 1949, Daryl Braithwaite became one of Australia's most successful pop singers, both as a solo act and with the band Sherbet. Braithwaite moved to Sydney in the mid-'60s and sang in a number of bands before joining Sherbet in 1970. Between 1970 and Sherbet's demise in 1983, Braithwaite enjoyed huge success, both with the band and with a number of solo single releases. Following the breakup of Sherbet -- after a period where they recorded under the name The Sherbs -- Braithwaite left the music industry for a number of years. This period saw him working, for a time, as a labourer on a council road gang. In 1988, however, Braithwaite returned to music when he signed with CBS/Sony and released Edge. Featuring four hit singles (including the Australian number one "As the Days Go By"), Edge became a huge success and was followed in 1991 by the triple-platinum Rise. Rise became Braithwaite's second number one album in as many releases and gave him only his second solo number one single since 1974 with "The Horses."
Braithwaite's 1993 album Taste the Salt, hit the Australian top 20 and featured covers of material written by likeminded artists such as Bruce Hornsby, Robbie Robertson and Sheryl Crow.
A 1994 single-disc retrospective of his Sony solo career -- Six Moons: The Best of 1988-1994 -- also charted and included exclusive material, such as the Tim Finn-penned "Blue Hills."
Although Braithwaite's next studio album wouldn't arrive for a further 12 years, he spent the intervening period touring widely, both as a solo artist and with a reformed Sherbet, as well as making the occasional musical theatre appearance.
When Snapshot arrived in 2005 it featured production from Scott Kingman, founder of the disbanded Melbourne rock act, Horsehead.
Next, on 2008's The Lemon Tree he revisited key tracks from his career in an acoustic setting and while 2011 marked 40 years since Braithwaite's first hit single with Sherbet, the anniversary coincided with the release of his first ever live DVD. | https://music.apple.com/il/artist/daryl-braithwaite/259806027 |
The swimming pool will be opened to members and their guests as follows:-
Swimmers shall be required to leave the pool during heavy local thunderstorms. The Committee may at any time amend these hours.
Servants may accompany children to the pool but children may NOT be left in their sole charge. Servants are not permitted to enter the pool.
Children under 5 years old may use the Ladies Changing room. From 5 years and above, children MUST use the Changing Room allocated to their respective sexes.
The Committee accepts no responsibility for any accident or injury of whatsoever nature to members, their guests or their children.
Swimmers MUST take a shower and use the footbath before entering the pool. No member, guest or child may enter the pool if they are suffering from any contagious disease or infectious disease.
Toys, flotation appliances, other than training equipment such as rings and kickboards, shall NOT be allowed in the pool.
No smoking or food or refreshments are allowed in the pool or within a radius of four feet of the edge of the pool unless with prior consent of the committee member in writing for functions or private parties.
All members and guests using the pool must wear proper swimming attire. Any member entering the pool in clothes other than swimming attire will be fined RM10.00 for each offence.
Any member or members who shall be responsible for another member entering the pool in clothes other than swimming attire will be fined RM10.00 for each offence.
The Committee reserves the right to decide what constitute proper swimming attire.
No swimming shall be permitted after 7.00pm if pool lighting is malfunctioning.
Only very small infants and the person in charge of them are allowed in the wading pool.
The swimming pool is restricted for use by club members and their children only.
Members bringing in guests to use the swimming pool must comply with Rule 40 and will be charged RM5.00 per guest per day. Members shall be responsible for the observance of the Club Rules and Bye-laws by their guests.
Any member or his guest, who conduct themselves in such a manner that constitute harm or injury to other swimmers or themselves, shall be asked to stop and failing to do so, the Pool Attendant shall have the authority to ask the offenders to leave.
Any non-compliance shall result in a RM10.00 fine being imposed on the offending member or for his guest. Repeated non-compliance shall lead to suspension of any member responsible from use of the pool for a maximum period of 6 months for an offence.
The Management Committee may from time to time, add to, alter and repeal Bye-Laws for the regulation of the affairs of the club. Such Bye-laws so made, added to, altered or repealed shall come into operation and binding on members after they have been posted in the club premises for fifteen days. | http://sarawakclub.com/?page_id=199 |
The present invention relates to a power tool, and in particular, to a hammer drill or a drill having a hammer function.
EP1157788
discloses a typical hammer drill which can operate in a hammer only mode, a drill only mode and a combined hammer and drill mode. During the operation of such a hammer, a considerable amount of vibration can be generated. The vibration is caused by the operation of the rotary drive mechanism and/or the hammer mechanism, depending on the mode of operation of the hammer drill, combined with the vibratory forces applied to and experienced by the drill bit when it is being used on a work piece. These vibrations are transferred to the body of the hammer drill, which in turn are transferred to a rear handle being used by the operator to support the hammer drill. The transfer of vibration to the rear handle from the body, and subsequently to the operator's hand can not only be painful but can result in injury, particularly when the hammer drill is used over long periods of time. It is therefore desirable to minimise the amount of vibration transferred from the body to the rear handle.
One solution is to moveably mount the rear handle on body of the hammer drill to allow relative movement between the two and to locate a vibration dampening mechanism between the body and the rear handle to minimise the amount of vibration transferred to the rear handle from the body.
GB2407790
GB2407790
describes one such vibration dampening mechanism for a hammer drill by which the amount of vibration transferred to the rear handle from the body is reduced. However, the design of such a dampening mechanism results in the movement of the rear handle being restricted to a direction which is linear in a rearward and forward movement, in a direction parallel to the longitudinal axis of the hammer drill along which a reciprocating ram and piston travel. This does not provide the most efficient method of reducing the amount of vibration transferred to the rear handle. This is due to the nature of the vibration applied to the body of the hammer and the distribution of the masses within the hammer. This results in an overall or combined vibration which has a direction of movement which is different from a rearward and forward linear movement. Furthermore, the direction of movement of the combined vibration will vary depending on which part of the body or handle it is measured. The restriction in the direction of the movement of the rear handle in the hammer drill described in does not take into account.
US5,025,870
discloses a hammer drill according to the preamble of claim 1 having a damped rear handle. The direction of movement of the handle is restricted to a simple forward and backward movement.
According to the invention, there is provided a hammer drill in accordance with claim 1.
The dominant vibration at a point is the main vibration expected to be experienced at a point when the power tool is working under certain operating conditions.
By seeking to restrict the direction of movement of the rear handle relative to the body to that of or close to the dominant vibration, which results from the sum of all types vibrations applied to the body of the hammer in combination with the distribution of the masses within the hammer, the reduction in the transfer of vibration to the rear handle from the body can be optimised.
Five embodiments of the present invention will now be described with reference
Figure 1
shows a schematic view of a vertical cross section of a hammer drill;
Figure 1A
Figure 1
shows the vector addition of the two types of vibration in the reverse direction of the top and of the handle to that shown in ;
Figure 1B
Figure 1
shows the vector addition of the two types of vibration in the reverse direction of the bottom end of the handle to that shown in ;
Figure 2
shows a schematic view of a vertical cross section of a hammer drill according to the first embodiment of the present invention;
Figure 3A
shows a top view of the lower lever;
Figure 3B
Figure 3
shows a cross sectional view of a strut of the lever shown in in the direction of Arrows Z;
Figure 4
shows a schematic view of a vertical cross section of a hammer drill according to the second embodiment of the present invention;
Figure 5
shows a schematic view of a vertical cross section of a hammer drill according to the third embodiment of the present invention;
Figure 5A
Figure 5
shows a perspective view of the T bar shown in ;
Figure 6
shows a schematic view of a vertical cross section of a hammer drill according to the fourth embodiment of the present invention;
Figure 7
shows a schematic view of the rear of a hammer drill according to the fifth embodiment of the present invention; and
Figure 8
shows a schematic view of the rear of a hammer drill according to the sixth embodiment of the present invention.
Five embodiments of the present invention will now be described with reference to the enclosed drawings of which:
Figures 1
2, 3A and 3B
The first embodiment of the present invention will now be described with reference to , . driving the rotary gear chain and/or wobble drive to operate the hammer drill in either hammer only mode, drill only mode or combined hammer and drill mode depending on the type of operation selected by the user.
Mounted on the front of the body 4 is a tool holder 12, for example, an SDS plus type tool holder. Held within the tool holder 12 is a drill bit 14.
Mounted on the rear of the body 4 is a handle 10 having two ends 16,18. The handle 10 is mounted so that it can move relative to the body 4. The two ends 16,18 of the handle 10 are each connected to the body 4 via connecting sections 20,22. Located within each connecting section 20,22 is a vibration dampening mechanism (which are described in more detail below) which act between the body 4 and the handle 10 in order to reduce the amount of vibration transferred from the body 4 to the handle 10 during the operation of the hammer drill. Bellows 24 surround each of the two connecting sections 20,22.
The operation and internal mechanics of such a hammer drill do not form part of the invention and there are many such designs disclosed in prior art. It will be appreciated that the present embodiment of the invention can be utilised on any type of drill having a handle 10 moveably attached to the rear of the body 4 of the drill, irrespective of its range of modes of operation or internal design of its component parts.
Figure 1
Figure 1
Figure 1
Figure 1
The hammer drill has a centre of gravity 26. For clarity, the three directions of travel, X, Y and Z are shown in . The X direction, as viewed in , is vertical. The Y direction, as viewed in , is horizontal and parallel to the plane of the paper on which Figure is drawn. The Z direction, as viewed in , is horizontal but perpendicular to the plane of the paper on which Figure is drawn.
During the operation of the hammer drill in hammer only mode, impacts, generated by the electric motor driving the wobble drive, ram and beat piece ("hammer mechanism"), are imparted to the drill bit 14 along axis 28 (in the X direction) which is substantially parallel to and co-axial with the longitudinal axis of the drill bit. This drives the drill bit 14 forward into a work piece (not shown). The work piece, which is typically stone or brick resists the forward movement of the drill bit 14. This causes the drill bit 14 to rebound backwards, away from the work piece, towards the body 4 of the hammer, along the axis 28.
Figure 1
As such, a force F(t) 30 is generated on the body 4 along the axis 28 in both directions due to the impacts of the hammer mechanism and the rebound of the drill bit 14 off the work piece. This results in vibrations in the body 4 of the hammer, the direction of the driving force of the vibrations being along the axis 28. This results in linear vibrations in the body 4 in the X direction indicated by Arrow A in , the direction being parallel to the axis 28.
The centre of gravity is located within a vertical plane in which the axis 28 is located. As such, the centre of gravity 26 is located directly below the axis 28.
Figure 1
In addition to the linear vibrations (Arrow A), as the centre of gravity 26 is located below the axis 28, angular vibrations are generated about the centre of gravity 26. The direction of the vibrational forces of the angular vibrations is indicated by Arrow B in . This results in a twisting torque (in the X - Y plane) about the centre of gravity 26, in addition to the linear vibration (Arrow A).
The connecting sections 20,24 are constructed to reduce the amount of vibrations transferred from the body 4 to the handle 10. They are arranged to reduce both the linear vibrations (direction of Arrow A) and the angular vibrations (direction of Arrow B).
The centre 32 of the top end 18 of the handle 10 is the point where the top end 18 of the handle 10 makes contact with the top connecting section 22.
The centre 34 of the bottom end 16 of the handle 10 is the point where the bottom end 16 of the handle 10 makes contact with the bottom connecting section 20.
First, the movement 40 due to the vibrations of the top end 18 of the handle 10 will now be described.
x1
θ1
The centre 32 of the top end 18 of the handle 10 will, if rigidly connected to the body 4, will experience two types of vibration applied to it which act in combination to produce a single resultant vibrational movement. The first type of vibration is resultant from the linear vibration of the body 4 in the direction of Arrow A. The size and direction (a), relative to the body 4, of the vibration at the centre 32 which results from the linear vibration (Arrow A) is represented by an Arrow 36 (the direction of the Arrow 36 being the same as the direction of the vibration, the length of the arow 36 being dependent on the amplitude of the vibration). The second type of vibration is resultant from the angular vibration of the body 4 about the centre of gravity 26 in the direction of Arrow B. The size and direction (a), relative to the body 4, of the vibration at the centre 32 which results from the angular vibration (Arrow B) is represented by a second Arrow 38 (the direction of the Arrow 38 being the same as the direction of the vibration, the length of the Arrow 38 being dependent on the amplitude of the vibration). The direction of the second Arrow 38 is tangential to the periphery of a circle having a centre point at the centre of gravity 26 of hammer drill. By vector adding the two Arrows 36,38 representing the two vibrations, the size and direction of the resultant vibration, relative to the body 4 at the centre 32 of the top end 18 of the handle 10, can be calculated. This is shown by a third Arrow 40 (the direction of the Arrow 40 being the same as the direction of the vibration, the length of the Arrow 40 being dependent on the amplitude of the vibration). The third Arrow 40 represents the direction and size of the "dominant" vibration at the centre 32 of the top end 18 of the handle 10 (when the hammer drill is operating in the hammer only mode).
Figure 1
Figure 1
Figure 1
Figure 1
Figure 1
Figure 1A
Figure 1
When the body 4 is vibrating, it oscillates backwards and forwards parallel to the axis 28 and clockwise and anti-clockwise about the centre of gravity 26. It should be noted that, however, when the body 4 is travelling backwards (to the right when viewed in ), it is travelling clockwise (when viewed in ). This results in the direction of Arrows 36,38,40 shown in . When the body 4 is travelling forwards (to the left when viewed in ), the body 4 is also travelling anti-clockwise (when viewed in ). This would result in the direction of the Arrows being reversed as shown in . Nevertheless, the direction of the Arrows 36', 38',40', though reversed, is the same orientation relative to the body 4 as those shown on .
Second, the movement 46 due to the vibration of the bottom end 16 of the handle 10 will now be described.
The centre 34 of the bottom end 16 of the handle 10 will, if rigidly attached to the body 4, also experience two types of vibration applied to it which act in combination to produce a single vibrational movement. The first type of vibration is resultant from the linear vibration of the body 4 in the direction of Arrow A.
x2
θ2
The size and direction relative to the body 4 (a) of the vibration which results from the linear vibration (Arrow A) is represented by Arrow 42 (the direction of the Arrow 42 being the same as the direction of the vibration, the length of the Arrow 42 being dependent on the amplitude of the vibration). The second type of vibration is resultant from the angular vibration of the body 4 about the centre of gravity 26 in the direction of Arrow B. The size and direction relative to the body 4 (a) of the vibration which results from the angular vibration (Arrow B) is represented by a second Arrow 44 (the direction of the Arrow 44 being the same as the direction of the vibration, the length of the Arrow 44 being dependent on the amplitude of the vibration). [The direction of the second Arrow 44 is tangential to the periphery of a circle having a centre point at the centre of gravity 26]. By vector adding the two Arrows 42,44 representing the two vibrations, the size and direction, relative to the body 4 at the centre 34 of the bottom end 16 of the handle 10, can be calculated. This is shown by a third Arrow 46 (the direction of the Arrow 46 being the same as the direction of the vibration, the length of the Arrow 46 being dependent on the amplitude of the vibration). The third Arrow 46 represents the size and direction of the dominant vibration at the centre 34 of the bottom end 16 of the handle 10 (when the hammer is operating in a hammer only mode).
Figure 1
Figure 1
Figure 1
Figure 1
Figure 1
Figure 1B
Figure 1
As mentioned previously, when the body 4 is vibrating, it oscillates backwards and forwards parallel to the axis 28 and clockwise and anti-clockwise about the centre of gravity. Again, it is noted that when the body 4 is travelling backwards (to the right when viewed in ), it is travelling clockwise about the centre of gravity 26 (when viewed in ). This results in the direction of the Arrows 42, 44, 46 shown in . When the body is travelling forwards (to the left when viewed in ), the body 4 is also travelling anti-clockwise (when viewed in ). This would result in the direction of the Arrows 42', 44', 46' being as shown in . Nevertheless, the direction of the Arrows 42', 44', 46', though reversed, is the same orientation relative to the body 4 as those in .
In the present embodiment, the orientation of the dominant vibration, Arrow 46, of the centre 34 of the bottom end 16 of the handle 10 is approximately vertical. The orientation of the dominant vibration, Arrow 40, of the centre 32 of the top end 18 of the handle 10 is approximately forty five degrees to the vertical.
The present invention optimises the vibration reduction by the connecting sections 20, 22, in order to minimise the amount of vibration transferred to the handle 10 from the body 4, by restricting the direction of movement of the ends 16,18 of the handle 10, which connect to the body 4 via the connecting sections 20,22, to that of the dominant vibration at those ends 16, 18 caused by the linear vibration (Arrow A) in combination with the angular vibration (Arrow B) of the body. In other words, the movement of the top end 18 is restricted so that it can only move in the direction of the Arrow 40 relative to the body 4, and the movement of the bottom end 16 is restricted so that it can only move in the direction of the Arrow 46 relative to the body.
Once the direction of movement of two ends 16,18 of the handle 10 is restrained to be the same as the direction of the dominant vibration acting on those ends 16, 18, at the respective ends 16,18, a vibration dampening or absorption mechanism is then added to absorb the vibration. As the ends 16,18 of the handle 10 are restrained in their direction of travel to that of the dominant vibration experienced at each of the ends 16,18, the effect of the dampening mechanism is maximised.
Figure 2
The mechanisms by which the movement of the two ends 16,18 of the handle 10 is restrained to that of the direction of the resultant vibration applied to each end 16,18, will now be described with reference to .
Each of the connecting sections 20,22 comprise a lever 52,54. One end 58,60 of each lever 52,54 is pivotally connected to the centre 32, 34 of an end 16,18 of the handle 10. The other end 62,64 of each lever 52,54 is pivotally connected to the body 4. The position of the pivot points is such to restrict the direction of the travel of the ends 16,18 of the handle to the direction (Arrows 40, 46) of the dominant vibration applied to that end 16, 18.
Figures 2 and 3
The lower lever 52 will now be described in more detail with reference to .
Figure 3B
The first end 60 of the lower lever 52 comprises a bearing 66 which allows the first end 60 to pivot in relation to the end 16 of the handle 10 to which the first end 60 is connected. The second end 64 of the lower lever 52 also comprise a bearing 68 which allows the second end 64 to pivot in relation to the body 4 to which the second end 64 is connected. The two ends 60,64 are interconnected via two struts 70,72, each of which have an "I" profile, as shown in , for rigidity. The lower lever 52 can be constructed from plastic to reduce weight.
The first end 60 of the lower lever 52 is pivotally connected to the centre 34 of the bottom end 16 of the handle 10 and is capable of pivoting about a horizontal axis which projects parallel to the Z axis. The second end 64 of the lower lever 52 is pivotally connected to the body 4 at a point indicated by reference number 50. The second end 64 is also capable of pivoting about a parallel horizontal axis which also projects parallel to the Z axis. The position of the point 50 is selected so that the resultant movement of the centre 34 of the lower end 16 of the handle 10 is restricted to that of the direction of the dominant vibration (Arrow 46).
This is achieved by locating the point 50 on the body 4 in a direction perpendicular to direction of the dominant vibration (Arrow 46), from the centre 34 of bottom end of handle 10. Thus, as the lower lever 52 pivots about point 50, the end 60 pivotally connected to the centre 34 of the handle 10 moves in direction of Arrow 46. The distance between point 50 and the centre 34 of the lower end of the handle 10 can be adjusted to suit the internal construction of the hammer drill. However, the greater the distance, the more linear the movement of the centre 34 of the bottom end 16 of the handle 10 over a greater range of movement. However, the greater the amplitude of the vibration experienced by the bottom end 16, the more the movement of the handle 10 will deviate from the direction of Arrow 46 at the extreme ends (peak of the amplitude) of the vibratory movement due to the circular movement of the lever 52 as it pivots about the point 50.
The length of the lever 52 will therefore ideally be determined by the expected amplitude of the vibrations which will be experienced by the bottom end 16 of the handle 10.
Figure 2
The upper lever 52 will now be described in more detail with reference to . The basic construction of the upper lever 54 is the same as that of the lower lever 52.
Figure 2
The first end 58 of the upper lever 54 comprises a bearing (not shown) which allows the first end 58 to pivot in relation to the upper end 18 of the handle 10 to which the first end 58 is connected. The second end 62 of the lower lever 52 also comprises a bearing (not shown) which allows the second end 62 to pivot in relation to the body 4 to which the second end 62 is connected. The two ends 58,62 are interconnected via two struts (not shown), each of which have an "I" profile. However, unlike the lower lever 52, which is straight along its length, the upper lever 54 is curved along its length as best seen in . This is due to the location of the two connection points of the lever and the desire to keep the lever 54 within the body 4 of the hammer drill without altering its outer shape 2. The upper lever 54 can be constructed from plastic to reduce weight.
The first end 58 of the upper lever 54 is pivotally connected to the centre 32 of the upper end 18 of the handle 10 and is capable of pivoting about a horizontal axis which projects parallel to the Z axis. The second end 62 of the upper lever 54 is pivotally connected to the body 4 at a point indicated by reference number 48. The second end 62 is capable of pivoting about a parallel horizontal axis which also projects parallel to the Z axis. The position of the point 48 is selected so that the resultant movement of the centre 32 of the top end 18 of the handle 10 is restricted to that of the direction of the dominant vibration (Arrow 40) acting on the centre 32.
This is achieved by locating the point 48 on the body 4 in a direction perpendicular to direction of the dominant vibration (Arrow 40), from the centre 32 of top end of handle 10. Thus, as the upper lever 54 pivots about point 48, the end 58 pivotally connected to the centre 32 of the handle 10 moves in direction of Arrow 40. As with the lower lever 52, the distance between point 48 and the centre 32 of the top end of the handle 10 can be adjusted to suit the internal construction of the hammer drill. However, the greater the distance, the more linear the movement of the centre 32 of the top end 18 of the handle 10 over a greater range of movement. However, the greater the amplitude of the vibration experienced by the top end 16, the more the movement of the handle 10 will deviate from the direction of Arrow 40 at the extreme ends (peak of the amplitude) of the vibratory movement due to the circular movement of the lever 55 as it pivots about the point 48.
The length of the lever 54 will therefore ideally be determined by the expected amplitude of the vibrations which will be experienced by the top end 18 of the handle 10.
A helical spring 56 surrounds the upper lever 54 and connects between the body 4 and the handle 10. The spring 56 acts as the vibration dampening or absorption mechanism, reducing the amount of vibration transferred to the handle 10 from the body 4. The use of such a spring 56 to reduce the amount of vibration transferred is well known in the art and as such, its operation will not be described in any further detail.
Figure 1
The dominant vibration calculated for the present embodiment has been calculated for hammer drill operating in hammer only mode. This is due the fact that the operation of the hammer mechanism generates by far the greatest amount of vibration in a hammer drill. When the hammer drill operates in the combined hammer and drill mode, in addition to the linear vibration (Arrow A) and angular vibrations (Arrow B), there will be a further angular vibration about axis 28 (in the X - Z plane) as indicated by Arrow C in . This is due to rotary action of the drill bit. However, the effect of this vibration (Arrow C) on the handle 10 is considerably less than the two vibrations (Arrow A and Arrow B) described above and therefore, for the purpose of the description of this embodiment, has been excluded. However, in the fifth embodiment of the present invention below, there is provided an example of a mechanism which can account for vibrations other than those in the X - Y plane (Arrow A and Arrow B).
Figure 4
A second embodiment will now be described with reference to . Where the same features are present in the second embodiment as the first embodiment, the same reference numbers have been used. The second embodiment is the same as the first embodiment except the mechanism by which the direction of movement of the top end 18 of the handle 10 is restrained to that of the direction of the dominant vibration has been changed. The mechanism by which the direction of movement of the bottom end 16 of the handle 10 is restrained to that of the direction of the dominant vibration is the same as the first embodiment and therefore will not be described in any more detail.
The size and direction of the dominant vibration at the centre points 32, 34 of the top 18 and bottom 16 ends of the handle 10 are the same in the second embodiment as for the first (Arrows 40, 46) and as such, their calculation has not been repeated. The dominant vibration calculated for the present embodiment has been calculated for hammer drill operating in hammer only mode.
The upper lever 54 has been replaced by a fixed bar 100. A first end 102 of the bar 100 is rigidly connected to the body 4. The bar 100 comprises two sections, 104, 106, the first section having a longitudinal axis parallel to the axis 28, the second section 106 having a longitudinal axis parallel to the Arrow 40. Formed in the handle is tubular sleeve 108 in which the second section 106 is located. The tubular sleeve 108 allows the second section 106 to slide within the sleeve along its longitudinal axis, parallel to Arrow 40. As such, the direction of movement of the top end 18 of the handle 10 is restricted.
A spring (not shown) acts as the vibration dampening or absorption mechanism which acts as a is connected between the body 4 and the handle 10 to reduce the amount of vibration transferred to the handle 10.
Figure 5 and 5A
A third embodiment will now be described with reference to . Where the same features are present in the third embodiment as the second embodiment, the same reference numbers have been used. The third embodiment is the same as the second embodiment except the mechanism by which the direction of movement of the bottom end 16 of the handle 10 is restrained to that of the direction of the dominant vibration has been changed. The mechanism by which the direction of movement of the top end 18 of the handle 10 is restrained to that of the direction of the dominant vibration is the same as the second embodiment and therefore will not be described in any more detail.
The size and direction of the dominant vibration at the centre points 32, 34 of the top 18 and bottom 16 ends of the handle 10 are the same in the third embodiment as for the first (Arrows 40, 46) and as such, their calculation has not been repeated. The dominant vibration calculated for the present embodiment has been calculated for hammer drill operating in hammer only mode.
The lower lever 52 in the second embodiment has been replaced by a T bar 200. A first end 202 of the T bar 200 is rigidly connected to the body 4. The bar 200 comprises two sections, 204, 206, the first section having a longitudinal axis parallel to the axis 28, the second top section 206 being rigidly mounted crosswise to the end of first section 204 remote from the body 4 and having a longitudinal axis perpendicular to the longitudinal axis of the first section 204. The T bar 200 is mounted on the body 4 so that the second top section 206 is horizontal within the handle 10. Formed in the handle are two sliding bushes 208 in which the second top section 106 is located. Each end 210 of the second top section locates within a corresponding sliding bush 208. The sliding bushes 208 allows the second top section 206 to slide within the sliding bushes 208 in the direction of Arrow 46. As such, the direction of movement of the bottom end 16 of the handle 10 is restricted to that of the dominant vibration of the centre point 34.
A spring (not shown) acts as the vibration dampening or absorption mechanism which acts as a is connected between the body 4 and the handle 10 to reduce the amount of vibration transferred to the handle 10.
Figure 6
A fourth embodiment will now be described with reference to . Where the same features are present in the fourth embodiment as the second embodiment, the same reference numbers have been used. The fourth embodiment is the same as the second embodiment except the mechanism by which the direction of movement of the bottom end 16 of the handle 10 is restrained has been changed. The mechanism by which the direction of movement of the top end 18 of the handle 10 is restrained to that of the direction of the dominant vibration is the same as the second embodiment and therefore will not be described in any more detail.
The size and direction of the dominant vibration at the centre points 32, 34 of the top 18 and bottom 16 ends of the handle 10 are the same in the fourth embodiment as for the first embodiment (Arrows 40, 46) and as such, their calculation has not been repeated. The dominant vibration calculated for the present embodiment has been calculated for hammer drill operating in hammer only mode.
1) The direction of movement in which the bottom end 16 of the handle 10 is restrained is no longer the same direction as that of the dominant vibration (Arrow 46) experienced at the centre 34 of the bottom end 16, but is parallel to the direction of the dominant vibration (Arrow 40) at the top end 18 of the handle 10.
2) The mechanism by which the direction of travel of the bottom end 16 is restrained is identical to that used to restrain the top end 18.
There are two differences in the fourth embodiment to he way in which the direction of movement of the bottom end 16 of the handle 10 is restrained has changed when compared to previous embodiments:
The lower lever 52 in the second embodiment has been replaced by a fixed bar 300. A first end 302 of the bar 300 is rigidly connected to the body 4. The bar 300 comprises two sections, 304, 306, the first section 304 having a longitudinal axis parallel to the axis 28, the second section 306 having a longitudinal axis parallel to the Arrow 40. Formed in the handle 10 is tubular sleeve 308 in which the second section 306 is located. The tubular sleeve 308 allows the second section 306 to slide within the sleeve along its longitudinal axis, parallel to Arrow 40. As such, the direction of movement of the bottom end 16 of the handle 10 is restricted to a direction parallel to that of the dominant vibration experienced at the top end 18 of the handle 10.
A spring (not shown) acts as the vibration dampening or absorption mechanism which acts as a is connected between the body 4 and the handle 10 to reduce the amount of vibration transferred to the handle 10.
The reason for making the direction of movement of the bottom end parallel to the direction of movement of the top end 18, and not vice versa, is that the top end 18 experiences vibrations of a greater amplitude to that of the bottom end 16.
Though the construction of the hammer drill in the fourth embodiment provides a less efficient mechanism of reducing the transfer of the vibration from the body 4 of the hammer drill to the rear handle 10 than the three previous embodiments, as the movement of only one of the ends of the handle is restricted to that the of the dominant vibration experienced at that end, the other being parallel to it, it nevertheless provides a more efficient mechanism than prior art designs. The direction of movement of the two ends 16, 18,
Figure 7
A fifth embodiment will now be described with reference to . Where the same features are present in the fifth embodiment as the first embodiment, the same reference numbers have been used. The mechanisms by which the direction of movement of the bottom and top ends 16, 18 of the handle 10 are restrained to that of the direction of the dominant vibration are the same as the first embodiment and therefore will not be described in any more detail.
Figure 5
Figure 1
shows a rear view of a hammer drill. The handle 10 is attached tot he body as shown. As such, the X, Y, Z axes are at 90 degrees to that shown in .
In the first embodiment, the dominant vibration was calculated for the for the hammer drill operating in the hammer only mode. Furthermore, in the first embodiment, the centre of gravity is located within a vertical plane in which the axis 28 is located. As such, the centre of gravity 26 is located directly below the axis 28.
Figure 5
Figure 5
Figure 5
In this, the fifth embodiment, the dominant vibration is calculated for when the hammer drill operates in the combined hammer and drill mode,. Therefore, in addition to the linear vibration (Arrow A) and angular vibrations (Arrow B), there will be a further angular vibration about axis 28 (in the X - Z plane) as indicated by Arrow C in . This is due to rotary action of the drill bit. Furthermore, the centre of gravity is located away from a vertical plane 500 in which the axis 28 is located. As such, the centre of gravity 26 is not located directly below the axis 28. The result of this is that there are angular vibrations in the X - Y, X- Z and Y-Z planes in addition to linear vibrations in the X, Y and Z directions. This results in dominant vibrations (Arrows 502, 504) at the centres 32, 34 of the top 18 and bottom 16 ends of the handle as shown in (The Arrows 502, 504 are shown as diagonal lines in . However, the reader will appreciated that as well as running the plane (X - Z plane) of the piece of paper on which the Arrows 502, 504 are drawn, the Arrows 502, 504, will also project into and away from (Y direction) the plane of the paper.)
The precise calculation of the size and direction of Arrows 502 and 504 has been omitted. However, it will be appreciated by the reader that the principles used in the first embodiment can be used to calculate the size and direction of the dominant vibrations at the centre 32, 34 of the ends 16, 18 of the handle. The types of mechanisms described in the first embodiment can then be utilised to restrict the direct of movement of the ends 16, 18 to that of their respective dominant vibrations.
Figure 8
A sixth embodiment will now be described with reference to . Where the same features are present in the sixth embodiment and the first embodiment, the same reference numbers have been used. The sixth embodiment is the same as the first embodiment except the mechanism by which the direction of movement of the bottom end 16 of the handle 10 is restrained to that of the direction of the dominant vibration has been changed. The mechanism by which the direction of movement of the top end 18 of the handle 10 is restrained to that of the direction of the dominant vibration is the same as the first embodiment and therefore will not be described in any more detail.
The size and direction of the dominant vibration at the centre points 32, 34 of the top 18 and bottom 16 ends of the handle 10 are the same in the sixth embodiment as for the first (Arrows 40, 46) and as such, their calculation has not been repeated. The dominant vibration calculated for the present embodiment has been calculated for hammer drill operating in hammer only mode.
The lower lever 52 in the first embodiment has been replaced by a T bar 200 in the same way as in the third embodiment. The same reference numbers have been used in relation to the T bar in the sixth embodiment as those used in the third.
A first end 202 of the T bar 200 is rigidly connected to the body 4. The bar 200 comprises two sections, 204, 206, the first section having a longitudinal axis parallel to the axis 28, the second top section 206 being rigidly mounted crosswise to the end of first section 204 remote from the body 4 and having a longitudinal axis perpendicular to the longitudinal axis of the first section 204. The T bar 200 is mounted on the body 4 so that the second top section 206 is horizontal within the handle 10. Formed in the handle are two sliding bushes 208 in which the second top section 106 is located. Each end 210 of the second top section locates within a corresponding sliding bush 208. The sliding bushes 208 allows the second top section 206 to slide within the sliding bushes 208 in the direction of Arrow 46. As such, the direction of movement of the bottom end 16 of the handle 10 is restricted to that of the dominant vibration of the centre point 34.
A spring (not shown) acts as the vibration dampening or absorption mechanism and is connected between the body 4 and the handle 10 to reduce the amount of vibration transferred to the handle 10. | |
About the Artemis program
The 250,000 mile trip to the moon is a massive undertaking. Now imagine the complexity of a 140-million mile trip through space to reach Mars. But NASA has formulated a plan to take man to Mars in small steps via a ambitious program called Artemis. It’s a program that will without a doubt, change the world.
The Artemis program will operate in at least seven stages in two phases. During these stages, NASA plans to send humans back to the Moon where they will set up a permanent lunar base, the Artemis Base Camp. At the South Pole of the Moon, this new base camp will become the stepping stone that will vault us to Mars and back.
In short, a Space Launch System (SLS) will carry the Orion Crew Vehicle to the orbiting Habitation and Logistics Outpost (HALO). From HALO, astronauts will use the Human Landing System (HLS) to reach the Moon’s surface and back to HALO.
About Near Rectilinear Halo Orbit
Before discussing the Artemis program, we must understand Near Rectilinear Halo Orbit or NRHO. In gravitational mechanics, a three-body problem is presented. How can an orbit be maintained around the Moon given the gravitational pull and interaction between three bodies – the Sun, Earth, and Moon. This problem is solved by putting the orbiting vehicle in a Near Rectilinear Halo Orbit.
The core mission elements that will make Artemis possible
A firm grasp of the Artemis program requires an understanding of the mission elements. There are lots of acronyms and new technologies introduced in NASA’s Artemis program.
Space Launch System (SLS)
The Space Launch System refers to the rocket used to power the Artemis spacecraft beyond Earth’s orbit. SLS will be used to launch the Orion Crew Vehicle.
Orion Crew Vehicle (OCV)
Orion is the spacecraft that will carry crewmembers to the Moon. Orion will not land on the moon but rather, will orbit around it while a Human Landing System (HLS) is used to ferry astronauts to the moon’s surface and back.
Orion will include storage space and crew quarters and a means to generate power.
Habitation and Logistics Outpost (HALO)
The Habitation and Logistics Outpost (HALO) will be the orbiting component where crewmembers will live. It will have storage space for payloads and docking ports for visiting spacecraft. HALO will be placed in a Near Rectilinear Halo Orbit around the moon and kept there using the Power and Propulsion Element ( PPE).
Human Landing System (HLS)
The Human Landing System (HLS) is the vehicle that will transport crewmembers from Orion to the lunar surface. HLS is a habitable spacecraft with its own power generation, energy storage, propulsion (chemical), communications, and tanks. The first models will hold two crew members. Later versions are planned to hold four crewmembers. At the time of this writing, three companies have been contracted to build HLS – Blue Origin, Dynetics, and SpaceX.
Exploration Ground Systems (EGS)
Exploration Ground Systems include the earth-based equipment used to launch Artemis spacecraft. EGS includes components such as the crawler-transporter, Vehicle Assembly Building, landing pads, landing runway, and the mobile launcher.
Deep Space Network (DSN)
The Deep Space network (DSN) refers to the computer network that will be used to communicate between Earth and the moon. DSN will include a 100 Mbps downlink and a 20 Mbps uplink – rather slow when compared to earth-based communication networks. This network link will be used to provide communications to crew members as well as the transport of data from the Lunar surface.
Commercial Lunar Payload Services (CLPS)
The Commercial Lunar Payload Services (CLPS) will be used to deliver scientific instruments and critical infrastructure components to the Moon. American commercial companies will be outsourced to provide these services for the Artemis program.
Volatiles Investigation Polar Exploration Rover (VIPER)
The Volatiles Investigation Exploration Rover will carry the Neutron Spectrometer System (NSS), Near-Infrared Volatiles Spectrometer System (NRVSS), Mass Spectometer Observing Lunar Operations (MSolo), and the TRIDENT drill on the Moon’s surface. About the size of a golf cart, VIPER will roam around the Moon conducting tests and analyzing results. It’s a critical component in the search for water and ice on the Moon.
Power and Propulsion Element (PPE)
The Power and Propulsion Element (PPE) will be a part of the Habitation and Logistics Outpost (HALO) module. Attached to the end of HALO, it will be in a Near Rectilinear Halo Orbit around the Moon. HALO’s PPE module will assist with communications while generating about 60 kW power for the Gateway using giant solar panels. It will also have space for storage of some payloads.
Deep Space Logistics
The Deep Space Logistics component also attaches to the Habitation and Logistics Outpost (HALO). It contains redundant navigation controls, communications systems, and power generation that let it attach and detach from HALO. It has both pressurized and unpressurized cargo areas. It will be used as the gateway for cargo, experiments, and supplies to the Gateway.
Exploration Extravehicular Activity System (xEVA)
The Exploration Extravehicular Activity System (xEVA) references the systems used in the astronaut’s spacesuit. The suit can be used for Moonwalks and spacewalks. It is designed for long life and expandability. The pressurized garment has a portable life support system, built-in communications, and infomatics systems.
Lunar Terrain Vehicle
The Lunar Terrain Vehicle (LTV) is the transportation vehicle that will be used on the Moon’s surface. It primarily uses battery storage but has limited power generation facilities built in. It can hold two crewmembers plus extra payload storage space. It can also be operated remotely and used to transport small supplies to other locations on the Moon.
Lunar Ground Stations (LGS)
Lunar Ground Stations (LGS) will include an array of 18-meter antennas. This global network will provide for current and future communication and tracking services. The number of antennas will be expanded and used for future Mars expeditions.
Lunanet
Lunanet refers to the framework and protocols used to support the communications and navigation network for NASA. Ultimately, Lunanet will be the networking framework for robotic, science, and human operations between Earth and the Moon.
Habitable Mobility Platform
The Habitable Mobility Platform (HMP) is a larger Lunar rover with a enclosed and pressurized cockpit. It includes plenty of power generation facilities and storage bays. It is critical for testing of future Mars missions which will require a Mars HMP.
Foundation Surface Habitat
The Foundation Surface Habitat (FSH) is the long-term outpost where Lunar visitors can live for up to 60 days. It will be the first step for extended occupation on the Moon.
Before building FSH, a robot will investigate the Moon’s south pole scouting for a suitable location to build the habitat. Commercial Lunar Payload Services (CLPS) and Large Scale Cargo Landers (LSCL) will be used to transport building supplies to the site.
Lunar/Mars Surface Power
The Lunar/Mars Surface Power system is a nuclear powered generator that can supply up to 10 kW of power for Moon-based equipment. This will provide power for landers, habitats, and other systems. It will be built to operate through nighttime hours and during eclipses.
The Gateway
The Gateway refers to the combination of several components. As the name implies, it acts as the gateway structure to the surface of the Moon. Included as part of the Gateway are the Power and Propulsion Element (PPE) and the Habitation and Logistics Outpost (HALO). The Gateway (PPE + HALO) will be placed on the Moon between the Artemis I and Artemis II missions.
Artemis Planned Missions (Artemis Phase 1)
Nine Artemis missions are already planned through the year 2030.
Artemis I (2021)
Artemis I will be an uncrewed test flight and the first flight of the Orion MPCV and Space Launch System rocket. Using engines from the Space Shuttle program for the core of its Space Launch System, the Orion will be pushed into space then released so it can coast 40,000 miles past the Moon before returning to Earth.
This main purpose of the Artemis I mission will be to test the SLS rocket and the heatshields which must protect the vehicle from temperatures reaching nearly 5,000 degrees Fahrenheit (about half as hot as the surface of the Sun).
This first test of the Orion will be accompanied by the launch of research utilities to study the moon in preparation for the next mission. CubeSats, small, low-cost, cube-shaped researched satellites, will be launched too. The CubeSats will study the moon and the space above it and observe space radiation, record magnetic fields, search for ice and water, map hydrogen sources, test solar sails, and do a generalized study of the moon’s surface.
The mission will last from 4-6 weeks.
Artemis I support missions
Separate support missions will be launched in between the Artemis missions. These missions include:
- Tools for mapping the lunar surface temperature, radiation, and hydrogen will be delivered by Masten, a California-based aerospace manufacturer.
- Launch of the Gateway (PPE + HALO components).
Artemis II (2023)
Artemis 2 will be the first crewed Orion spacecraft flight. It will include a lunar flyby test and return to Earth, the first such mission in more than 50 years. Four astronauts will fly aboard on a mission that may last up to 21 days. This mission is equivalent to the Apollo 8 mission.
The purpose of the mission is to test life support systems and spacesuits they wear for launch. Since the spacecraft will fly beyond our GPS navigation system satellites, it will allow a test of the new Deep Space Network (DSN).
As with Artemis I, secondary payloads of CubeSats will be launched too.
The mission will last about 10 days and will set a record for the farthest human travel beyond the far side of the Moon. The 4,600 mile distance beyond the far side of the Moon will provide the astronauts with an unusual vantage point – they will be able to see the Earth and the Moon from the Orion’s windows.
Artemis II support missions
Artemis II support missions include:
- Delivery of the VIPER rover
- Deliver of the Lunar Terrain Vehicle.
- Delivery of the ascent, transfer, and descent elements.
Artemis III (2024)
Artemis 3 will be the second crewed mission of the Artemis program and the first crewed lunar landing since Apollo 17 in 1972. It will be a historic mission. Two astronauts will use the Human Landing System (HLS) to reach the moons surface where they will stay for about a week. Two other crew members will stay board the Orion and orbit the Moon. Before the landing. additional equipment will be pre-positioned on the moon’s surface (e.g. lunar rover vehicle) waiting for the astronauts’ arrival.
Artemis Proposed Missions (Artemis Phase 2)
The remaining missions are “proposed missions”, one mission per year. These missions are a part of Artemis Phase 2. These missions would be used to test resource utilization on the moon’s surface, power requirements (nuclear), and other prolonged activities on the Moon. The missions range from 30 to 60 days in length (the later missions will be longer). The purpose of these missions is to establish Mars forward capabilities. NASA will use this period to test systems and search for resources on the Moon for fuel and life support.
Little is known about the proposed missions. However, NASA has published the timeline for Artemis Phase 2. | https://www.geekslop.com/features/science-articles/2020/all-about-nasas-ambitious-artemis-program-how-artemis-will-take-man-to-the-moon-and-mars-and-back-in-multiple-coordinated-stages |
A perfectly cooked steak that is juicy and tender inside will be a heart-looting dinner on any occasion. However, the problem is how to cook it with perfection.
But all the problems related to steaks will evaporate now with this air fryer spiced and herbed skirt steak recipe, as it will assist you in making a perfectly flavored steak.
Contents
What is the Reason to Use an Air Fryer to Make These Skirt Steaks?
Making a perfect steak out of beef using any other source than an air fryer is difficult. You can end up burning the outer side of the steaks, or the juices present inside will be dried out, resulting in hard steaks. You don’t want to have a steak without its typical tenderness. Therefore, an air fryer is used for that purpose, it will maintain the tenderness, and all the flavors will penetrate deep inside the steaks.
From Which Part of the Beef Meat is Taken to Form Skirt Steaks?
The meat for this recipe is usually taken from the lower part of the rib cage of beef. This is considered one of the most flavorful parts of beef. But make sure that you don’t have to take the meat from the hanging region as it will make hanging steak.
How to Season the Steaks to Make this Recipe?
First, you have to take the steaks in a shallow dish. Then add different herbs such as parsley, coriander, mint, or any other herbs of your choice. Then add spices like salt, pepper, red chili flakes, cayenne pepper, paprika, etc. Coat them well over the steaks by mixing them with olive oil.
More Beef Recipes
Air Fryer Bacon-Wrapped Filet Mignon
Air Fryer Spiced & Herbed Skirt Steak
Ingredients
- 3 cloves garlic minced
- 1 cup fresh parsley leaves finely chopped
- 3 tbsp fresh mint leaves finely chopped
- 1 tbsp ground cumin
- 2 tsp smoked paprika
- 1 tsp cayenne pepper
- 1 tsp red pepper flakes crushed
- as required salt and ground black pepper
- ¾ cup olive oil
- 3 tbsp red wine vinegar
- 2 (8-ounce) skirt steaks
- Non-Stick Cooking Spray
Instructions
- In a bowl, mix together the garlic, herbs, spices, oil, and vinegar.
- In a resealable bag, place the herb mixture and steaks.
- Seal the bag and shake to coat well.
- Refrigerate for about 24 hours.
- Remove the steaks from the refrigerator and place at room temperature for about 30 minutes before cooking.
- Grease the Air Fryer Basket with cooking spray and then slide inside.
- Adjust the temperature of Air Fryer to 390 °F to preheat for 5 minutes.
- After preheating, arrange the steaks into the greased Air Fryer Basket in a single layer.
- Slide the basket into Air Fryer and set the time for 10 minutes.
- After cooking time is finished, remove the steaks from Air Fryer and place onto a cutting board for about 10 minutes before slicing.
- Cut each steak into desired-sized slices and serve. | https://www.cookingschooldropout.com/air-fryer-spiced-herbed-skirt-steak/ |
Students learn techniques and aesthetics digital movie cinematography by working with professional 4K cameras. Students acquire skills in digital lens, lighting, camera movement and color grading techniques to enhance the storytelling process. Coursework includes in-class camera and lighting assignments as well as editing and color grading of short dramatic scenes. Students gain practical experience by working as crew members on each other’s projects. Not open to students who have taken MEDST 244. | https://qc-undergraduate.catalog.cuny.edu/courses/1512531 |
Strategic Management Legal and Ethical Consideration
Describe the strategic planning process for an organization. Include legal and ethical considerations for each part of the strategic planning process.
Sample Paper
Strategic Planning Process
The strategic planning process entails a set of steps to be followed in developing a plan. Organizations adopt a strategic planning process to achieve long-term goals. In this process, a roadmap is created highlighting the strategic objectives that should be prioritized to fulfill business initiatives. It is one of the tools that organizations use to streamline the functioning of their teams. The strategic planning process also allows the organization to focus on its energies and resources, thus achieving a given objective. It is essential to adhere to legal and ethical considerations at each step in the strategic planning process. This paper describes the strategic planning process for an organization defining the legal and ethical considerations that should be made at each part of the planning.
Strategic Planning Process
Determination of the Organization’s Strategic Position
This is the preparation phase and entails setting the stage for all work by determining the organization’s current strategic position. In this step, the organization gets the right stakeholders by considering internal and external sources. Identifying critical strategic issues involves employee’s suggestions, considering customer insights, and collecting market data (Burgelman et al., 2018). The analysis is also done at this phase using the SWOT analysis and helps refine the organization’s goals so that the plan can proceed constructively. Inputs from the customers, employees, and market data will be used to determine strengths, weaknesses, opportunities, and threats (SWOT) (Benzaghta et al., 2021). Synthesizing this information will give a better overview of the unique strategic position for the organization in the market from which the organization can start solidifying its strategic objectives.
Several legal and ethical considerations should be made in this step. First, the organization should not influence the views of the employees and customers in the strategic evaluation for the key issues. In evaluating the company’s strengths and weaknesses, the organization should ensure all components are represented honestly, avoiding all forms of biasness (Jennings, 2019). Employees should not be subjected to unreasonable workload, leading to poor job performance and high-stress levels. In identifying opportunities, it is essential to respect the existing organizational values. It is unethical for any strategic plan to adopt processes or systems that negate the organization’s values (Ghadge et al., 2020). When individuals are raising their concerns, they must do it independently, without fear or hesitation, since it helps in improving the quality of the discussion and decision made.
Prioritization of Objectives
After identifying the organization’s current position, the determination of objectives is done and helps achieve the goals. The objectives set should concur with the organization’s mission and vision. Prioritization of the objectives will consider the initiatives that will significantly impact the organization’s ability to achieve its mission/vision while improving its position in the market. The most critical impacts are identified and requirements for the accomplishment of goals defined. Methods for measuring the success of the strategic plan are defined based on the set goals. It is crucial to set distinct and measurable objectives to achieve the long-term strategic goals and initiatives.
There are legal and ethical considerations governing the prioritization of the objectives. Stakeholders should participate in prioritizing these objectives so that they are comfortable with the selected initiatives. Involving stakeholders will challenge the existing paradigms and offer broad perspectives to support the plan. In prioritizing these initiatives, it is essential to take an honest and truthful look at the agreed-upon risks and impacts (Ghadge et al., 2020). The needs of the stakeholders should be considered thoroughly to maintain their welfare.
Development of the Plan
The strategic plan is then developed to meet the goals successfully. In this step, appropriate tactics are communicated to attain the objectives within time. The plan should take account of all information collected. Strategy mapping is then done to visualize the entire plan and makes it simple to effectively view the business processes by identifying the gaps necessary for improvement. In this phase, strategic choices involve a trade-off in opportunity cost. Goals are set by converting the strategic objectives into specific performance targets (Burgelman et al., 2018). The company will then define the key performance indicators (KPIs) that will effectively track and monitor its ability to meet the set goals. The organization should move from big ideas to actions by transferring the strategy from the organizational level to individuals involved in the planning. These individuals then develop short-term goals and activities supporting the administrative direction. Finally, an action plan for each goal is designed to help previously established targets.
Several legal and ethical considerations govern this step. In developing a strategic plan, it is essential to subject the strategy to the developed organization’s values. Any concern in the development process conflicting with the values should be addressed immediately. It is crucial to train the employees and the management team to integrate ethics into the whole plan. Ethical officers should be consulted on the key issues that may arise in the development process (Jennings, 2019). The organization should not neglect the quality of products and services in developing the plan. It is also expected that the organization will maintain a safe working environment in the development of the strategic plan.
Execution and Management of the Plan
Once the plan has been developed, then it progresses to implementation. First, the plan is communicated to the organization’s stakeholders such as employees, suppliers, society, customers, shareholders, and owners. Next, all relevant documentation and facts about the plan are disclosed. Finally, the developed strategic plan is turned into a concrete plan by mapping the processes. The KPI dashboard provides a framework for clearly communicating the team responsibilities at each step. The implementation schedule will establish a performance management and reward system, followed by monthly and quarterly strategy meetings with established reporting procedures. Annual strategic review dates will then be set (Bryson et al., 2018). Goals and actions will be tracked at monthly meetings where the team members report on the progress of each goal. Course correction will be done if necessary. Regular review on the KPI should be done during the regular meetings.
There are several legal and ethical considerations at this phase. When communicating on the plan, it is essential to disclose all details honestly, including how they will impact all stakeholders. The organization should not leave out any side effects related to the plan. Team members should provide honest and accurate reports on the progression of each task. Accountability should be maintained at this phase, where each measure, initiative, objective, and data source should be accounted for (Jennings, 2019). This will ensure that errors and mistakes are easily identified and corrected before impacting the whole process. It is also essential to ensure the highest standards of transparency between the different departments in the planning process. Transparency will increase collaboration and team understanding to ensure timely and accurate plan objectives. There must be a platform for confidential reporting where anonymous reporting can be done (Jennings, 2019). This will allow the organization to effectively address issues arising in the planning process without putting anyone on the spot, thus avoiding internal conflicts among the team members.
Review and Revision of the Plan
After implementing the plan, it is essential to reevaluate the priorities and initiate correction strategies based on previous successes or failures. This will entail determining the KPIs that the team has achieved in a specified period and improvements that should be made to comprehensively understand and execute strategic plans (Bryson et al., 2018. Significant focus has to be put on accomplishing the top priorities while accelerating the organization’s growth.
In this phase, the organization should identify how legal and ethical considerations have been adhered to at the different stages. The organization should identify any potential opportunities and threats the plan may have to the legal environment and against them to minimize threats (Jennings, 2019). Review results should be communicated accurately to teams responsible for the adjustment.
Conclusion
Strategic planning should help the organization achieve its vision. It entails creating and maintaining a long-term perspective of the business in the market to efficiently react to competition while focusing on the current business initiatives. Strategic planning also improves the decision-making abilities of the organization. However, the organization needs to adhere to legal and ethical considerations in the strategic planning process. These are guiding principles and policies that ensure that the plan follows the right direction, eliminating malpractices that may endanger the stakeholders, environment, and the business itself. Legal and ethical considerations are vital in maintaining the business values and mission statement. Organizations should therefore strive to meet the legal and ethical requirements at each strategic planning stage to achieve the intended objective while avoiding all forms of misconduct. | https://pronursingtutors.com/strategic-management-legal-and-ethical-consideration/ |
Physicists previously detected anomalous readings in the decay of a B meson, which may mean the existence of physics beyond the current theory.
The Standard Model, which emerged in the 1970s, is a theoretical foundation that explains the world and matter at the very smallest levels of reality: elementary particles so minute they boggle the imagination and defy easy understanding. It has been a pretty successful description so far, but like most old foundations, it’s beginning to show signs of cracks and disrepair.
Of course, it’s not so much that the standard model is wrong; rather, there may be a deeper kind of physics, a dark sector that we haven’t been able to reach yet.
In other words, there are hints of something greater and even more fundamental shining through those cracks like glinting rays of sunshine. And a team of physicists from the Institute of Nuclear Physics of the Polish Academy of Sciences (IFJ PAN), working with the LHC particle accelerator at CERN, think they may be on the track of what that “something” is.
Briefly, the Standard Model divides matter and the forces of the universe into several categories of elementary particles. Pay attention now, reader, because this will go quickly. Bosons transmit force; photons (light) emerge from electromagnetic activity; eight species of gluon are involved in the strong nuclear force (holding atoms together); and the W+, W- and Z0 bosons oversee the weak nuclear force (responsible for radioactive decay). Matter comprises fermions, which are formed by quarks and leptons; there are six species of quarks, and six of leptons (which include electrons and neutrinos), together with 12 antiparticles for each. The Higgs boson provides mass for all, save the gluons and photons.
But here’s the problem—the Standard Model, in common with other theories explaining the universe (such as Quantum Mechanics and General Relativity), is not quite as comprehensive as we’d like it to be. It fails to explain some of the most interesting and pressing questions confronting physics.
For instance, it doesn’t account for the division of fermions into different families, or why matter achieved the upper hand over antimatter in the early universe. And if dark matter is indeed an actual form of “matter,” it is not explained by our current understanding of elementary particles. Perhaps most importantly, gravity (that most mysterious and fundamental of forces) is utterly unaccounted for by the Standard Model.
The Large Hadron Collider has turned its considerable particle-smashing heft to the task of seeking out new elementary particles beyond the Standard Model; but it’s possible they exist just outside the energy limit of the LHC. If this is the case, then the only way to discover their presence will be to discern their “shadow,” as it were—the influence they exert upon other particles at lower energies.
And one way this might work is if they cause “mesons”—unstable, short-lived combinations of a quark and antiquark—to decay in unusual and unexpected ways.
This is what the team believes it may have found. A few years back, the LHCb experiment, which probes the mysteries of matter and antimatter, detected anomalous readings in the decay of a B meson or “beauty” meson—a meson consisting of a light quark and a heavy beauty antiquark. It was necessary to rig up a more accurate method of determining the parameters by which the beauty quark decayed in order to test its deviation from the Standard Model; the Polish team devised a means to determine the parameters independently.
By more accurately determining the degree of deviation from the Standard Model, scientists will be able to ascertain whether the anomaly really represents the influence of unknown elementary particles beyond the Model, or whether it is merely some hitherto undiscovered property which the Model does account for.
For now, physicists hypothesize that there is something called a “Z-prime” (Z’) boson, which mediates the decay of B mesons. The LHC is gearing up now for new, higher-energy collisions. Perhaps, at last, they’ll discover the new particles, and the new physics, they’ve been searching for. | https://futurism.com/new-physics-scientists-may-glimpsed-world-beyond-standard-model |
Property Finder is the leading digital real estate platform in the Middle East and North Africa region. A UAE-born startup, Property Finder expanded its operations to Qatar, Bahrain, Saudi Arabia, and Egypt over the years. Recently, it acquired a significant stake in Zingat in Turkey. The company is one of the largest technology start-ups in the region and on a journey to becoming a Unicorn. We are aspiring to create a lighthouse technology company which will have a lasting impact in the entire tech ecosystem in our geography.
Position Summary:
- You will be responsible for creating and distributing informative, high-value social content to followers across various social media platforms including Twitter, Facebook, Instagram.
- As a Senior Social Media Manager at Property Finder, you will have the opportunity to join the ground floor of a company that is creating the future of real estate.
- You will set and execute our social media strategy, be a part of growing and engaging with key audiences, and be a fundamental piece of our external communications program.
Key Responsibilities:
- Design and implement social media strategy to align with business goals and requirements
- Set specific objectives and report on ROI
- Monitor traffic metrics and community growth and engagement
- Collaborate with internal teams to ensure brand consistency
- Community management by posting and communicating with followers, respond to queries in a timely manner and monitor customer reviews
- Maintain a consistent voice and brand across different platforms (Facebook, Youtube, Instagram, LinkedIn &, etc.)
- Suggest and implement new features to develop brand awareness
- Perform research on current benchmark trends and audience preferences.
- Execute a results-driven social media strategy.
- Manage content creation by write, proofread, edit, and publish engaging posts for various social networks
- Brief and coordinate with the creative team to design engaging posts
- Stay up-to-date with current technologies and trends in social media, design tools, and applications
- Coordinate projects for across different functions
- Ability to identify, develop and help refine compelling and creative ideas. Seek out opportunities that are unique and that serve the business and the brand.
Desired Qualifications: | https://boards.greenhouse.io/propertyfinder/jobs/5414148003 |
High-quality research articles that get many citations contain both implications and recommendations. Implications are the impact your research makes, whereas recommendations are specific actions that can then be taken based on your findings, such as for more research or for policymaking.
That seems clear enough, but the two are commonly confused.
This confusion is especially true if you come from a so-called high-context culture in which information is often implied based on the situation, as in many Asian cultures. High-context cultures are different from low-context cultures where information is more direct and explicit (as in North America and many European cultures).
Let’s set these two straight in a low-context way; i.e., we’ll be specific and direct! This is the best way to be in English academic writing because you’re writing for the world.
Implications and recommendations in a research article
The standard format of STEM research articles is what’s called IMRaD:
- Introduction
- Methods
- Results
- Discussion/conclusions
Some journals call for a separate conclusions section, while others have the conclusions as the last part of the discussion. You’ll write these four (or five) sections in the same sequence, though, no matter the journal.
The discussion section is typically where you restate your results and how well they confirmed your hypotheses. Give readers the answer to the questions for which they’re looking to you for an answer.
At this point, many researchers assume their paper is finished. After all, aren’t the results the most important part? As you might have guessed, no, you’re not quite done yet.
The discussion/conclusions section is where to say what happened and what should now happen
The discussion/conclusions section of every good scientific article should contain the implications and recommendations.
The implications, first of all, are the impact your results have on your specific field. A high-impact, highly cited article will also broaden the scope here and provide implications to other fields. This is what makes research cross-disciplinary.
Recommendations, however, are suggestions to improve your field based on your results.
These two aspects help the reader understand your broader content: How and why your work is important to the world. They also tell the reader what can be changed in the future based on your results.
These aspects are what editors are looking for when selecting papers for peer review.
Implications and recommendations are, thus, written at the end of the discussion section, and before the concluding paragraph. They help to “wrap up” your paper. Once your reader understands what you found, the next logical step is what those results mean and what should come next.
Then they can take the baton, in the form of your work, and run with it. That gets you cited and extends your impact!
The order of implications and recommendations also matters. Both are written after you’ve summarized your main findings in the discussion section. Then, those results are interpreted based on ongoing work in the field. After this, the implications are stated, followed by the recommendations.
Writing an academic research paper is a bit like running a race. Finish strong, with your most important conclusion (recommendation) at the end. Leave readers with an understanding of your work’s importance. Avoid generic, obvious phrases like “more research is needed to fully address this issue.” Be specific.
The main differences between implications and recommendations (table)
Now let’s dig a bit deeper into actually how to write these parts.
What are implications?
Research implications tell us how and why your results are important for the field at large. They help answer the question of “what does it mean?” Implications tell us how your work contributes to your field and what it adds to it. They’re used when you want to tell your peers why your research is important for ongoing theory, practice, policymaking, and for future research.
Crucially, your implications must be evidence-based. This means they must be derived from the results in the paper.
Implications are written after you’ve summarized your main findings in the discussion section. They come before the recommendations and before the concluding paragraph. There is no specific section dedicated to implications. They must be integrated into your discussion so that the reader understands why the results are meaningful and what they add to the field.
A good strategy is to separate your implications into types. Implications can be social, political, technological, related to policies, or others, depending on your topic. The most frequently used types are theoretical and practical. Theoretical implications relate to how your findings connect to other theories or ideas in your field, while practical implications are related to what we can do with the results.
Key features of implications
- State the impact your research makes
- Helps us understand why your results are important
- Must be evidence-based
- Written in the discussion, before recommendations
- Can be theoretical, practical, or other (social, political, etc.)
Examples of implications
Let’s take a look at some examples of research results below with their implications.
Example 1
The result: one study found that learning items over time improves memory more than cramming material in a bunch of information at once. The implications: This result suggests memory is better when studying is spread out over time, which could be due to memory consolidation processes.
Example 2
The result: an intervention study found that mindfulness helps improve mental health if you have anxiety. The implications: This result has implications for the role of executive functions on anxiety.
Example 3
- The result: a study found that musical learning helps language learning in children.
- The implications: these findings suggest that language and music may work together to aid development.
What are recommendations?
As noted above, explaining how your results contribute to the real world is an important part of a successful article. Likewise, stating how your findings can be used to improve something in future research is equally important. This brings us to the recommendations. Research recommendations are suggestions and solutions you give for certain situations based on your results. Once the reader understands what your results mean with the implications, the next question they need to know is “what’s next?” Recommendations are calls to action on ways certain things in the field can be improved in the future based on your results. Recommendations are used when you want to convey that something different should be done based on what your analyses revealed.
Similar to implications, recommendations are also evidence-based. This means that your recommendations to the field must be drawn directly from your results. The goal of the recommendations is to make clear, specific, and realistic suggestions to future researchers before they conduct a similar experiment. No matter what area your research is in, there will always be further research to do. Try to think about what would be helpful for other researchers to know before starting their work. Recommendations are also written in the discussion section. They come after the implications and before the concluding paragraphs. Similar to the implications, there is usually no specific section dedicated to the recommendations. However, depending on how many solutions you want to suggest to the field, they may be written as a subsection.
Key features of recommendations
- Statements about what can be done differently in the field based on your findings
- Must be evidence-based
- Must be realistic and specific
- Written in the discussion, after implications and before conclusions
- Related to both your field and, preferably, a wider context to the research
Examples of recommendations
Here are some research results and their recommendations.
Example 1
A meta-analysis found that actively recalling material from your memory is better than simply re-reading it.
- The recommendation: Based on these findings, teachers and other educators should encourage students to practice active recall strategies.
Example 2
A medical intervention found that daily exercise helps prevent cardiovascular disease.
- The recommendation: Based on these results, physicians are recommended to encourage patients to exercise and walk regularly. Also recommended is to encourage more walking through public health offices in communities.
Example 3
A study found that many research articles do not contain the sample sizes needed to statistically confirm their findings. The recommendation: To improve the current state of the field, researchers should consider doing power analysis based on their experiment’s design.
What else is important about implications and recommendations?
When writing recommendations and implications, be careful not to overstate the impact of your results. It can be tempting for researchers to inflate the importance of their findings and make grandiose statements about what their work means. Remember that implications and recommendations must be coming directly from your results. Therefore, they must be straightforward, realistic, and plausible. Another good thing to remember is to make sure the implications and recommendations are stated clearly and separately. Do not attach them to the endings of other paragraphs just to add them in. Use similar example phrases as those listed in the table when starting your sentences to clearly indicate when it’s an implication and when it’s a recommendation. When your peers, or brand-new readers, read your paper, they shouldn’t have to hunt through your discussion to find the implications and recommendations. They should be clear, visible, and understandable on their own. That’ll get you cited more, and you’ll make a greater contribution to your area of science while extending the life and impact of your work.
- The implications: these findings suggest that language and music may work together to aid development. | https://www.aje.com/arc/implications-or-recommendations-in-research/ |
Background {#Sec1}
==========
Genetic diversity is a critical component of biodiversity and affects the survival and evolution of species \[[@CR1], [@CR2]\]. Geographic isolation is an important factor that limits species dispersal and affects the genetic diversity of species \[[@CR3], [@CR4]\]. By definition, islands are smaller than continents, surrounded by water, and therefore form discrete habitats isolated from other terrestrial habitats \[[@CR5], [@CR6]\]. Generally, the water surrounding islands acts as a geographic barrier to dispersal that limits gene flow both between island populations and between island and mainland populations. Consequently, the genetic diversity of insular species tends to be more complex due to multiple factors that include the natural dispersal distance of flight-capable species and dispersal that is mediated by human activity. In such special cases, island populations have lower genetic diversity than do mainland populations due to founder effects/bottlenecks and continued isolation from the mainland \[[@CR3], [@CR7]--[@CR10]\]. To maintain a population's fitness and adapt to an island environment, a population may lose genetic diversity \[[@CR11]\]. Previous bottlenecks or continued isolation from the mainland can also decrease genetic diversity. Moreover, the loss of genetic diversity in island populations can often be caused by founder effects, breeding rates, and dispersal ability, among other factors. However, the island populations of some species, i.e., mammals and birds, have higher levels of genetic diversity than do mainland populations \[[@CR8], [@CR11], [@CR12]\].
*Bactrocera dorsalis* (Hendel) (Diptera: Tephritidae), the oriental fruit fly, is a quarantined pest that is found worldwide, is highly fecund and highly adaptable. This fly species causes serious economic losses to fruit production in tropical and subtropical areas \[[@CR13]--[@CR16]\]. The original source of *B. dorsalis* populations has been reported to be from tropical or subtropical Asia \[[@CR17]\]. To date, *B. dorsalis* has spread over Asia and to many regions around the Pacific, including Hawaii \[[@CR18]\]. *Bactrocera dorsalis* was first recorded in Taiwan in 1911 but has since spread to many other provinces in China \[[@CR19], [@CR20]\]. Wan et al. \[[@CR20]\] examined the genetic diversity and genetic differentiation of *B. dorsalis* in the Chongqing region in China. Their results indicated that the height of these mountains in this region was insufficient to prevent the long-distance dispersal of *B. dorsalis* and suggested that there would be a high frequency of gene flow among fly populations. However, Li et al. \[[@CR16]\] demonstrated that geographic isolation from mountains and canyons distributed across China, Vietnam and Thailand slowed the dispersal of *B. dorsalis* and has resulted in genetic differentiation between these regions. To date, no studies have explored the genetic diversity of *B. dorsalis* on islands. In this study, we hypothesized that six island populations of *B. dorsalis* in South China would have lower levels of genetic diversity due to their isolation from the mainland. Furthermore, the isolation of islands may also result in high levels of genetic differentiation between different island populations. In this study, we generated and analyzed a dataset of both microsatellite and mtDNA loci from *B. dorsalis* samples collected from six offshore island populations in South China to estimate the genetic divergence and dispersal ability of these flies. Our results may also suggest possible strategies for the control of this species based on their dispersal patterns.
Methods {#Sec2}
=======
Sample collection {#Sec3}
-----------------
*Bactrocera dorsalis* were sampled from six offshore islands in South China (Fig. [1](#Fig1){ref-type="fig"}), and the longitude and latitude information of all locations were recorded. No permissions were required to collect these samples from the field. The map for sample distribution was generated by DIVA-GIS version 7.1. Shangchuan Island, Hebao Island, Dong'ao Island and Wailingding Island are located in Guangdong Province, and Naozhou Island and Weizhou Island are located in Guangxi Province. A number of fruits, including mango, banana and papaya, are cultivated on the islands. However, there is an exceptionally low population density of *B. dorsalis* on the islands. Male *B. dorsalis* individuals were captured using methyl eugenol-baited traps on each island. After collection, the samples were preserved in 90 % ethanol prior to DNA extraction.Fig. 1Locations of the six island populations of *Bactrocera dorsalis* examined in this study. The map for sample distribution was generated by DIVA-GIS version 7.1
PCR amplification {#Sec4}
-----------------
DNA from individual specimens was extracted using the TIANamp Genomic DNA Kit (Qiagen, Hilden, Germany). In total, DNA was extracted from 20 flies from each island. Eight polymorphic microsatellite loci (MS4, MS6, MS12A, 4.3A, 6.8A, 4.6A, Ccmic32 and Bo-D48) were analyzed, all of which were previously developed \[[@CR14], [@CR21]--[@CR23]\] (see Additional file [1](#MOESM1){ref-type="media"}: Table S1). Primers were synthesized by Sangon Biotech Co. Ltd (Shanghai, China). PCR reactions were performed in 25 µL volumes containing 2 µL of DNA extract (40 ng/µL), 2.5 µL of 10× PCR buffer (containing Mg^2+^), 2 µL of a dNTP mixture (10 mmol/L), 1.5 µL of each primer (10 mmol/L), 0.2 µL of Taq DNA polymerase (5 U/µL) and 15.3 µL of ddH~2~O. Cycling conditions for amplification were as follows: 3 min at 94 °C followed by 35 cycles of 30 s at 94 °C, 30 s at 48 °C, 45 s at 72 °C, and an extension of 5 min at 72 °C.
The PCR-amplified products were separated using a DNF-900 High Sensitivity Large Fragment Analysis Kit in a fragment analyzer (Advanced Analytical Technologies, Inc., USA). Alleles were scored using PROSize 2.0 (Advanced Analytical Technologies, Inc., USA).
A 759-bp fragment of the cytochrome oxidase subunit I (COI) gene was amplified using primers (COI-F: CAACATTTATTTTGATTTTTTGG; COI-R: TCCATTGCACTAATCTGCCATATTA; synthesized by Sangon Biotech Co., Ltd (Shanghai, China)) and following the method described by Tang et al. \[[@CR24], [@CR25]\]. The PCR reaction volumes were the same as the microsatellite DNA amplification volumes, except the annealing temperature duration was 45 s.
Microsatellite data {#Sec5}
-------------------
Deviations from Hardy--Weinberg proportions and linkage disequilibrium were calculated using Genepop version 5.0 (<http://www.wbiomed.curtin.edu.au/Genepop/Genepop_op1.html>) \[[@CR26]\]. We estimated null allele frequencies for each locus using the expectation maximization (EM) algorithm method in the FREENA software (<http://www.montepllier.inra.fr/URLB>) \[[@CR27]\]. Population genetic parameters included the observed number of alleles (NA), the effective number of alleles (*N* ~*E*~), Shannon's information index (*I*), observed heterozygosity (*H* ~*o*~), expected heterozygosity (*H* ~*E*~), the percentage of polymorphic loci (*P*), Nei's genetic diversity (Nei's), gene flow (*N* ~*em*~), Nei's original measures of genetic identity (*I*) and genetic distance (*D*) for paired populations. These parameters were then analyzed using Popgene Version 1.3.1 \[[@CR28]\]. The population genetic structure was analyzed with STRUCTURE v.5.0 \[[@CR29]\], which uses a Bayesian Markov Chain Monte Carlo (MCMC) method to analyze the numbers of K genetic clusters. We ran K values from 1 to 6 using an admixture model and an allele frequencies correlated model. The first 100,000 repetitions were discarded as burn-in, and 10,000 MCMC repetitions were then run. Multiple runs are used to check consistency between runs. Then, the results after running STRUCTURE were then uploaded to the Structure Harvester website ([http://www.taylor0.biology.ucla.edu/structureHarvester/\#](http://www.taylor0.biology.ucla.edu/structureHarvester/%23)). Structure Harvester was used to calculate six iterations per K-value and obtained the best K-value using the ΔK method of Evanno. \[[@CR30]\]. *Nei's* genetic distance (D) for the six island populations was reconstructed for the population phylogenetic tree using the unweighted pair-group method with arithmetic mean (UPGMA) in the tools for population genetic analyses (TFPGA) program \[[@CR31]\]. We used a multidimensional factorial correspondence analysis (FCA) within the GENETIX program to identify clusters of individuals with similar genotypes based on allele frequencies and genotype \[[@CR32]\].
Isolation by distance was measured using the TFPGA software. Matrix correlations using pairwise genetic distance versus geographic distance were estimated and significance was determined using the Mantel test.
Analysis of molecular variance (AMOVA) was performed with ARLEQUIN ver. 3.5 to partition the genetic variance within and among populations based on the numbers of different alleles (*F* ~*ST*~) and the sum of squared size differences \[[@CR33]\].
Mitochondrial data {#Sec6}
------------------
Published COI sequences of *B. dorsalis* from mainland China populations and mainland populations from other countries (Cambodia, Mandalay, Laos and America) were downloaded from NCBI \[[@CR16], [@CR34]\] to characterize the genetic relationships between these mainland populations and the studied six island populations in South China. We cut and joined the amplification sequences using one pair of primers with DNAStar and manually corrected any obvious errors. Next, we aligned all sequences using MEGA6 software \[[@CR35]\]. A population phylogenetic tree was reconstructed using the UPGMA method in MEGA6 based on genetic distances. Haplotype diversity (*Hd*), the average number of differences (*k*), and nucleotide diversity (*π*) were calculated for each population using DnaSP 5.0 \[[@CR20], [@CR36]\].
The fixation index (pairwise *F* ~*ST*~) and gene flow (*N* ~*em*~) were estimated using ARLEQUIN ver. 3.5 \[[@CR33]\]. Generally, gene exchange leading to low genetic differentiation between populations occurs when *N* ~*em*~ \> 4 \[[@CR37]\]. The significance level was assessed using 1000 permutations. The index was interpreted as follows: a low degree of genetic differentiation (0 ≤ *F* ~*ST*~ \< 0.05); a medium degree of genetic differentiation (0.05 ≤ *F* ~*ST*~ \< 0.15); a high degree of genetic differentiation (0.15 ≤ *F* ~*ST*~ ≤ 0.25); and a very high degree of genetic differentiation (*F* ~*ST*~ \> 0.25) \[[@CR38], [@CR39]\].
Results {#Sec7}
=======
Microsatellite analysis {#Sec8}
-----------------------
### Hardy--Weinberg and genetic diversity {#Sec9}
All loci and samples significantly deviated from Hardy--Weinberg proportions (P \< 0.01). The average values of *F* ~*IS*~ for each locus in each population ranged from 0.0365 to 0.8353, which indicated that there were deficiencies in heterozygotes. Over all populations and loci, the locus MS12A for the DAD population had the highest null allele frequency (*N* ~*a*~ = 0.41419). The null allele frequency of the other loci and populations ranged from 0 to 0.37780. The presence of null alleles was the primary contributor to the deficiencies in heterozygotes and the departure from the Hardy--Weinberg equilibrium. There was no significant linkage disequilibrium between pairs of loci for all populations (P \> 0.05). Therefore, the eight loci were inherited independently.
In total, 107 alleles were observed for eight microsatellite loci among the six island populations, and the number of alleles per locus ranged from 7 (Locus 4.3A) to 19 (Locus 6.8A), with an average of 13.375 (Additional file [1](#MOESM1){ref-type="media"}: Table S2). The expected heterozygosity (*H* ~*E*~) of each locus ranged from 0.5397 to 0.8806, and the observed heterozygosity (*H* ~*O*~) ranged from 0.1008 to 0.6441. The observed number of alleles per island population ranged from 5.75 (Dong'ao Island) to 8 (Wailingding Island) (Table [1](#Tab1){ref-type="table"}), with an average of 7.3214. The expected heterozygosity per population ranged from 0.7532 (Wailingding Island) to 0.2442 (Hebao Island). The results showed that the six island populations all exhibited high levels of genetic diversity. The Hebao Island population exhibited a lower level of genetic diversity than did the other five island populations. Nei's genetic diversity index for the Hebao Island population was 0.1769, which was far lower than the other five island populations (Table [1](#Tab1){ref-type="table"}).Table 1Indices of genetic diversity of *Bactrocera dorsalis* populations from six islands based on microsatellite dataPopulation*N* ~*A*~*N* ~*E*~*IH* ~*O*~*H* ~*E*~*Nei'sNpP* (%)Dong'ao Island5.7500 ± 2.18763.7076 ± 1.87661.3450 ± 0.49040.2970 ± 0.23710.6740 ± 0.18500.6571 ± 0.18048100Wailingding Island8.0000 ± 2.39054.4046 ± 1.81521.6184 ± 0.41180.4313 ± 0.23590.7532 ± 0.11310.7344 ± 0.11038100Hebao Island7.1250 ± 2.16713.4046 ± 1.60791.3886 ± 0.44880.3355 ± 0.24420.2442 ± 0.17690.1769 ± 0.17258100Shangchuan Island7.6250 ± 2.87543.8322 ± 1.75471.4875 ± 0.53020.3500 ± 0.32180.6697 ± 0.19830.6869 ± 0.19338100Weizhou Island6.8750 ± 2.79993.4946 ± 1.54581.4143 ± 0.44870.2812 ± 0.21030.6796 ± 0.14940.6627 ± 0.14578100Naozhou Island7.8750 ± 2.79994.4092 ± 1.98381.6249 ± 0.43290.4016 ± 0.29060.7546 ± 0.10720.7356 ± 0.10468100Mean7.3214 ± 0.81923.8755 ± 0.43861.4798 ± 0.11920.3494 ± 0.05830.6292 ± 0.19260.6089 ± 0.21438100*N* ~*A*~ Observed number of alleles; *N* ~*E*~ Effective number of alleles \[[@CR42]\]; *I* Shannon's information index \[[@CR43]\]; *Nei's* Nei's gene diversity; *H* ~*O*~ observed heterozygosity; *H* ~*E*~ expected heterozygosity; *Np* number of polymorphic loci; *P* percentage of polymorphic loci
### Population genetic structure {#Sec10}
We analyzed the genetic structure of the different *B. dorsalis* populations using the Bayesian clustering analysis method from the STRUCTURE software. The results showed that the best possible ΔK was 3 (Fig. [2](#Fig2){ref-type="fig"}). This finding suggested that the six island populations were divided into three clusters based on the allele frequencies of the geographic populations. Hebao Island, Weizhou Island and Dong'ao Island were clustered into one branch (highlighted in blue). Shangchuan Island and Naozhou Island were grouped into another branch (highlighted in red). The last branch consisted only of the Wailingding Island population (highlighted in green) (Fig. [3](#Fig3){ref-type="fig"}).Fig. 2Line graph of genetic cluster (K) vs. Delta K Fig. 3Population genetic structure of *B. dorsalis* based on microsatellite data assigned to three clusters. Each individual is represented by a *vertical bar*
We used TFPGA software to construct an UPGMA population phylogenetic tree, and the results showed that the six island populations could be divided into three groups (Fig. [4](#Fig4){ref-type="fig"}). Hebao Island, Weizhou Island, and Dong'ao Island were classified into one group; Shangchuan Island and Naozhou Island were classified into another group; and Wailingding Island was classified into the final group. The results from the phylogenetic tree using UPGMA based on microsatellite data were consistent with those obtained from the STRUCTURE analysis.Fig. 4Phylogenetic analyses of *B. dorsalis* populations from six islands based on microsatellite variations using the unweighted pair-group method with arithmetic mean (UPGMA)
We analyzed the genetic divergence among populations based on the individual genotypes and constructed the three-dimensional FCA shown in Fig. [5](#Fig5){ref-type="fig"}. According to this graph, the results of the FCA were the same as the results from STRUCTURE and the phylogenetic tree.Fig. 5Three-dimensional correspondence analysis (FCA) of microsatellite genotypes from six offshore island populations
Hierarchical *F*-statistics were estimated for all populations as a single group and for all populations partitioned into three groups based on the results of the Bayesian clustering analysis. AMOVA results indicated that genetic variation primarily contributed to variation among individuals within populations and to variation within individuals (Table [2](#Tab2){ref-type="table"}). The genetic variation that was divided into one group and three groups was 48.6 % (*F* ~*IT*~ = 0.52765, P \< 0.001) and 47.9 % (*F* ~*IS*~ = 0.50631, P \< 0.001) of the total variation, respectively. In addition, within individual variation accounted for 47.23 % (*F* ~*IT*~ = 0.52765, P \< 0.01) and 46.75902 % (*F* ~*IT*~ = 0.53241, P \< 0.01) of the total variation for the one group and three groups analyses, respectively. Most of the total genetic variation was explained by the variation among individuals within populations.Table 2AMOVA results based on microsatellite genotypesSource of variationd.f.Variance componentsPercentage of variationFixation indicesAmong populations50.12261 Va4.16F~ST~ = 0.04161\*\*Among individuals within populations1141.43202 Vb48.6F~IS~ = 0.50715\*\*Within individuals1201.39167 Vc47.23F~IT~ = 0.52765\*\*Among groups20.13294 Va4.46153FCT = 0.04462\*\*Among populations within groups20.02457 Vb0.82472FSC = 0.00863Among individuals within populations1141.42888 Vc47.95FIS = 0.50631\*\*Within individuals1201.39325 Vd46.75902FIT = 0.53241\*\*
As shown in Table [3](#Tab3){ref-type="table"}, *Nei's* standard genetic distance (*D*) (below the diagonal) among six island populations ranged from 0.0853 to 0.4021 and *Nei's* genetic identity (I) (above the diagonal) varied from 0.6689 to 0.9182. The population genetic identity (I) between the Wailingding island population and the Weizhou island population was 0.6689, which was the minimum among all paired island populations. Accordingly, there was high genetic distance, which was 0.4021 between these paired island populations (Table [3](#Tab3){ref-type="table"}).Table 3Nei's original measures of genetic identity (above diagonal) and genetic distance (below diagonal)PopulationHebaoShangchuanNaozhouWeizhouDong'aoWailingdingHebao\*\*\*\*0.80950.84330.88970.88830.6752Shangchuan0.2113\*\*\*\*0.89680.82380.86310.7691Naozhou0.17040.1090\*\*\*\*0.88890.85390.7570Weizhou0.11690.19380.1177\*\*\*\*0.91820.6689Dong'ao0.11840.14730.15800.0853\*\*\*\*0.7410Wailingding0.39280.26250.27840.40210.2998\*\*\*\*
The relationship between genetic distance and geographic distance was determined among island ranges. The result showed that there was no relationship between genetic distance and geographic distance (Fig. [6](#Fig6){ref-type="fig"}; R^2^ = 0.0027, P = 0.855).Fig. 6The relationship between genetic distance and geographic distance of island populations
Mitochondrial analysis {#Sec11}
----------------------
We obtained 120 sequences from COI with a length of 759 bp. In total, 66 different mitochondrial haplotypes were detected in the six island populations. All populations on the six islands had high levels of nucleotide (0.0068) and haplotype diversity (0.9665). Haplotype diversity (*Hd*) for each population ranged from 0.889 to 0.995. The average number of differences (*k*) ranged from 3.895 (Wailingding Island) to 6.553 (Naozhou Island). Nucleotide diversity (*π*) for each population ranged from 0.513 % (Wailingding Island) to 0.863 % (Naozhou Island) (Table [4](#Tab4){ref-type="table"}).Table 4Haplotype diversity (Hd), average number of differences (k) and nucleotide diversity (π) for each populationPopulationNHaplotype (frequency)*Hdπk*Dong'ao Island20H1(1), H2(1), H3(5), H4(2), H5(5), H6(1), H7(1), H8(1), H9(1), H10(1), H11(1)0.889 ± 0.0490.006334.805Wailingding Island20H3(3), H5(1), H10(1), H13(1), H19(4), H23(2), H57(1), H105(1), H142(1), H143(1), H144(1), H145(1), H146(1), H147(1)0.947 ± 0.0340.005133.895Hebao Island20H3(2), H5(4), H8(1), H13(1), H19(1), H25(1), H74(1), H77(1), H102(1), H103(1), H104(1), H105(1), H106(1), H107(1), H108(1), H109(1)0.963 ± 0.0330.00624.705Shangchuan Island20H3(2), H5(2), H8(1), H11(1), H13(1), H19(2), H37(1), H77(2), H105(1), H133(1), H134(1), H135(1), H136(1),H137(1), H138(1), H139(1)0.979 ± 0.0210.006595.005Weizhou Island20H3(2), H5(2), H44(1), H62(1), H77(1), H107(1), H129(1), H140(1), H142(1), H148(1), H149(1), H150(1), H151(1), H152(1), H153(2), H154(1), H155(1)0.984 ± 0.0200.006895.232Naozhou Island20H5(2), H8(1), H25(1), H52(1), H77(1), H119(1), H120(1), H121(1), H122(1), H123(1), H124(1), H125(1), H126(1), H127(1), H128(1), H129(1), H130(1), H131(1), H132(1)0.995 ± 0.0180.008636.553Total120660.9665 ± 0.0080.006805.112*N* sample size; *Hd* haplotype diversity; *π* nucleotide diversity; *k* average number of differences
There was genetic divergence between the six island populations, as estimated by population pairwise *F* ~*ST*~ significance tests. The *F* ~*ST*~ values between paired groups ranged from −0.03194 to 0.05413. The Dong'ao Island population had a low degree of differentiation with the Wailingding Island, Hebao Island and Shangchuan Island populations (0.01024 ≤ *F* ~*ST*~ ≤ 0.01895). However, Dong'ao differentiated from the Weizhou and Naozhou Island populations (0.05065 ≤ *F* ~*ST*~ ≤ 0.05413, P \< 0.05) (Table [5](#Tab5){ref-type="table"}). Hebao Island had no differentiation from the Wailingding, Shangchuan and Naozhou Island populations (−0.00179 ≤ *F* ~*ST*~ \< 0) (Table [5](#Tab5){ref-type="table"}). There were low and medium levels of differentiation among some paired island populations. The value of gene flow (*N* ~*em*~) between each pair of populations was over four, which suggested that there was a full exchange of genes between the six island populations. The isolation of the islands did not prevent gene flow between the populations. These results were consistent with the microsatellite data.Table 5*F* ~*ST*~ values (below diagonal) and *N* ~*em*~ (above diagonal) between the six island populations of *Bactrocera dorsalis*PopulationDong'aoWailingdingHebaoShangchuanWeizhouNaozhouDong'ao\*\*\*\*48.333339.801825.88898.73779.3713Wailingding0.01024\*\*\*\*infinf42.628714.8611Hebao0.01241−0.01058\*\*\*\*inf80.6048infShangchuan0.018950−0.03194\*\*\*\*178.3258infWeizhou0.05413\*0.011590.006160.0028\*\*\*\*134.2085Naozhou0.05065\*0.03255\*−0.00179−0.000890.00371\*\*\*\*Data with asterisks indicate significant difference (P \< 0.05)
The topology of the *B. dorsalis* population maximum likelihood tree suggested that there were no independent groups in the island populations. In the phylogenetic tree, these six island populations of Southern China were clustered in one branch with different mainland populations of China (Fig. [7](#Fig7){ref-type="fig"}). We also found that the Shangchuan and Naozhou island populations were more closely related to populations from Cambodia and Myanmar than to populations from Laos and the United States (Figs. [5](#Fig5){ref-type="fig"}, [7](#Fig7){ref-type="fig"}).Fig. 7Phylogenetic analyses of *B. dorsalis* populations from six islands and other locations \[[@CR10], [@CR21]\] based on variations in mitochondrial DNA using the unweighted pair-group method with arithmetic mean (UPGMA). CSHN (Changsha, Hunan), MZYN (Mengzi, Yunnan), TSGD (Taishan, Guangdong), YFGD (Yunfu, Guangdong), ZHGD (Zhuhai, Guangdong), ZZFJ (Zhangzhou, Fujian), GZGD (Guangzhou, Guangdong), PZHSC (Panzhihua, Sichuan), NNSC (Ningnan, Sichuan), SH (Shanghai), ZSGX (Zhongshan, Guangxi), NNGX (Nanning, Guangxi), XMFJ (Xiamen, Fujian), ZJGD (Zhanjiang, Guangdong), BHGX (Beihai, Guangxi), and ZZHN (Zhengzhou, Henan) were all from China
Discussion {#Sec12}
==========
Null alleles {#Sec13}
------------
Null alleles, geographic factors and likely founder effects among populations caused heterozygote deficiencies and emerged as significant departures from the Hardy--Weinberg equilibrium \[[@CR40]\]. In this study, the frequency of null alleles in an isolated microsatellite of *Bactrocera dorsalis* was high and exceeded 0.4 only among locus 6.4. We checked the heterozygotes and found significant heterozygote deficiencies, except for locus MS12A, in several island populations.
Genetic diversity {#Sec14}
-----------------
Population genetic diversity is a product of evolutionary change over several generations \[[@CR41]\]. Thus, population genetic diversity reflects the ability of populations to adapt to local environments \[[@CR42]\]. The percentage of polymorphism, the level of heterozygosity, the number of alleles, nucleotide diversity and haplotype diversity were used to estimate population genetic diversity. Our research showed that populations of the oriental fruit fly from islands in South China had high levels of genetic diversity and were closely related to populations from mainland China based on COI data analysis. Using the mtDNA COI from five Yunnan province populations of *B. dorsalis,* Shi et al. \[[@CR43]\] showed that the average haplotype diversity and nucleotide diversity of the five populations were 0.9786 and 0.9038 %, respectively. Thus, the five Yunnan populations had higher levels of genetic diversity than did the island populations examined in this study. Analysis of the genetic diversity of *B. dorsalis* from China, Laos, and Thailand with microsatellite markers showed that the average *Nei's* genetic diversity and Shannon's information index were 0.6464 and 0.7870, respectively. The average percentage of polymorphic loci in all populations was 94.45 %. This finding suggests that mainland South China has high levels of population genetic diversity \[[@CR44]\].
However, many studies have shown that the gene flow of mammals, birds and other species from islands is blocked or reduced due to isolation, which results in lower levels of genetic diversity of island populations compared to mainland populations \[[@CR8], [@CR14], [@CR45]\]. Isolated islands have discrete boundaries that are generally thought to reduce migration between populations on islands \[[@CR3]\]. Long-term bottlenecks, founder effects, genetic drift and inbreeding may all reduce genetic diversity \[[@CR46], [@CR47]\]. Mitochondrial and microsatellite data have been previously used to estimate the genetic structure of *Apis mellifera* populations from the Canary Islands \[[@CR7]\]. The results showed that there was a lower level of genetic variation based on the average number of alleles and heterozygosity in populations on the Canary Islands than mainland populations in Iberia and Morocco \[[@CR48]\]. Boessenkool et al. reported that natural populations of robins on the Breaksea and Nukuwaiata Islands have lower levels of genetic diversity than larger mainland populations. In addition, some alleles have been lost, which is a result of bottlenecks and isolation from the mainland \[[@CR49]\]. Jensen et al. \[[@CR3]\] reported that the genetic diversity of house sparrows along a coastal latitudinal gradient from middle to Northern Norway tended to decrease in island populations compared to mainland populations. However, in our study, the results showed that the genetic diversity of *B. dorsalis* from island populations was high. The geographic isolation imposed by the sea may not hinder gene exchange. There are many reasons for high genetic diversity among island populations, including the dispersal ability of this species and both environmental and anthropogenic activities that cause frequent contact with mainland populations. The six islands have been isolated for a long period of time, and most of the islands originated from the accumulation of volcanic matter. As the islands developed, commercial activities on the islands increased, which has incidentally promoted the spread of species throughout the islands. *B. dorsalis* can use most commercial plants and fruits as host plants, and the flies can disperse between the mainland and islands by relying on the wind. According to the phylogenetic tree analysis, there were two main routes of invasion from inland China. One route was from Southeast China, and the other route was from Southwest China \[[@CR50]\]. However, whether *B. dorsalis* regularly makes migratory flights from the nearby mainland to these islands is unclear.
Genetic divergence {#Sec15}
------------------
For COI data, the value of *N* ~*em*~ among populations all exceeded 4 (*N* ~*em*~ \> 4), which showed that among populations there was a high levels of gene flow and a low and medium level of differentiation among some paired island populations. These results were consistent with the results from our microsatellite data that shows a low *Nei's* standard genetic distance (D) and a high genetic identity (I). Pairwise *F* ~*ST*~ values indicated that there was a medium degree of population differentiation between Weizhou Island and Naozhou Island. The microsatellite data indicated that population genetic variation was mostly partitioned among populations. We divided the six island populations into three groups, which were supported by the FCA. Our results were also similar to the levels of population differentiation between mainland China populations. Wan et al. \[[@CR20]\] analyzed the genetic diversity of *B. dorsalis* from six populations in Qiongqing using eight microsatellite loci. The results showed that the Qiongqing populations had low levels of population differentiation. Yao et al. \[[@CR51]\] also examined the genetic relationships among populations from Fujian, Hainan, Guangdong, Yunnan and Sichuan provinces. Except for the Fujian population, all populations had low levels of population differentiation because of the proximity between provinces. Using mtDNA from 25 populations on the China mainland, flies from mainland China had lower levels of genetic divergence than those from Thailand, Japanese and American populations \[[@CR50]\]. Li et al. \[[@CR16]\] reported that the average Nei's standard genetic distance was 0.8049 and 0.9397, for South China and Southeast Asia populations, respectively. Li et al. \[[@CR16]\] also reported that *F* ~*ST*~ was 0.25 between South China and Southeast Asia populations, which suggested that these populations had genetic divergence due to geographic isolation. Our study suggested that island *B. dorsalis* populations had high levels of genetic diversity and a low or medium level of differentiation among some paired island populations and the genetic distance of pairing populations had no correlation with geographic isolation (R^2^ = 0.0027, P = 0.855). There are several possible explanations for this pattern. First, Tephritid fruit flies are capable fliers that can fly more than 25 km under windless conditions \[[@CR52], [@CR53]\]. The distance between each island and the mainland ranged from 8.2 to 38.4 km. The distance between islands ranged from 32.4 to 519.7 km. Hebao Island, Wailingding Island and Dong'ao Island are located in Zhuhai province and are closer in proximity than are Weizhou Island and Naozhou Island. Thus, Hebao Island populations were barely differentiated from the Wailingding Island, Shangchuan Island and Naozhou Island populations. However, there was a medium degree of genetic differentiation between Dong'ao Island and Weizhou Island populations and between Dong'ao Island and Naozhou Island populations. *Bactrocera dorsalis* can migrate to and from islands on its own or with the aid of typhoons \[[@CR52]\]. The isolation of islands by water limits gene flow. However, in our study, the islands did not appear to restrict gene flow: the population genetic diversity and differentiation on the islands were similar to values observed for mainland populations. Second, based on the results of our study, commercial activities between the island and the mainland have affected the gene pool and diversity of species. These six islands all have suitable host plants for *B. dorsalis,* such as banana, pawpaw and others. Many tropical fruits, such as guava, carambola, and mango, are imported and exported from the mainland to the islands. *Bactrocera dorsalis* can lay eggs on these fruits, and the infested fruits can subsequently be transported to other areas. Therefore, gene flow is likely frequent between islands. The low levels of genetic diversity are also likely caused by the short distance between the islands and the mainland.
Conclusions {#Sec16}
===========
This study showed that island isolation may not significantly influence the genetic diversity of tephritid fruit flies. We have found that offshore island populations of *B. dorsalis* have relatively high levels of genetic diversity, whereas populations from offshore islands exhibited low genetic differentiation.
Additional file {#Sec17}
===============
**Additional file 1: Table S1.** Primer sequences and PCR characteristics of 8 microsatellite loci. **Table S2.** Indices of genetic diversity and gene flow inferred from microsatellite data.
Chunyan Yi and Chunyan Zheng contributed equally to this work
YJX conceived and designed the experiments. CYY performed the experiments. YJX, LZ, CYY and CYZ analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.
Acknowledgements {#FPar1}
================
We wish to thank G. Q. Wang, C. Cui, and Y. Q. Huang from South China Agricultural University for their help in collecting the material used in this study.
Competing interests {#FPar3}
===================
The authors declare that they have no competing interests.
Availability of data and materials {#FPar2}
==================================
The dataset supporting the results of this article is available at <http://dx.doi.org/10.5061/dryad.666sn>.
Funding {#FPar4}
=======
This study was supported by the Science Foundation for Excellent Youth Scholars of Guangdong Province (No. Yq2013031). The funders played no role in the design of the study, data collection and analysis or the decision to publish and prepare the manuscript.
| |
Proprioception provides a body map for navigation. The proprioceptive system is one of the body’s sensory feedback systems. Together with the five senses of touch, smell, taste, hearing and vision,…Continue Reading
Propolis: Natural alternative to antibiotics?
Honeybees produce a greenish-brown resinous substance called propolis. It is used as a coating for beehives, to strengthen the cells – much like a type of cement. Propolis also acts…Continue Reading
The problem with TV (and other screens)
Children learn through play. They establish brain connections through movement. These brain connections ensure that children can concentrate on a task when they reach school age. They help with impulse…Continue Reading
What does vestibular mean?
The body has various feedback systems. The five senses of hearing, smell, taste, vision and touch along with proprioception and vestibular input make up the body’s…Continue Reading
Sitting pretty: Why is cross-legged sitting important for children? | http://sandandglitter.com/page/5/ |
Distractions in a digital world
Digital overload is a problem that defines today’s workplace: the challenge of concentrating on a piece of work whilst being bombarded with a constant stream of email alerts and notifications is an all-too-familiar feeling. And that’s without the easy temptation of online procrastination thrown into the mix - digital distractions are never more than a click away. Institute of Psychiatry researchers have found persistent distractions to have a profound effect, reporting that people who were constantly distracted by emails and phone alerts saw a 10-point fall in IQ over time. In a world where our most precious resource is our attention, experts have begun to shed light on how our devices are putting a strain on our ability to focus.
Nir Eyal, productivity expert and author of ‘Indistractable’, says digital distractions are an unhealthy escape from an often-uncomfortable reality (the daunting prospect of writing a report you’ve been putting off, for example). It’s the discomfort we feel when faced with a demanding task that precedes a distraction. Perhaps it’s the feeling of dread you experience before starting a piece of work that leads you to scroll through the morning news headlines “just for a minute”. Eyal explains that our susceptibility to digital distractions is a side-effect of our ‘always-on’ culture: we have a hyper-connected relationship with our devices, and it’s the norm that we can instantly reply to emails and phone-calls, and access endless online content.
But becoming distracted by an email or social media notification might not be the crux of the problem: it is the post-distraction period – how long it takes to refocus on a task - which causes setbacks to our productivity. The length of time it takes to refocus on a task after a distraction has been subject to debate, but the latest research by the University of California found that it takes an average of 23 minutes and 15 seconds to refocus on a task (so 30 seconds to check Facebook isn’t just 30 seconds down the drain). On average, we experience a distraction every 8 minutes, and with a 9-5 job, this could lead to hours everyday spent in a refocusing limbo.
This doesn’t only lead to lost time: a Kent State University study found that we are more prone to performance and accuracy errors (especially during demanding tasks) in the refocusing period, because digital distractions increase our minds’ tendency to wander. We could be sacrificing some of our best, most concentrated thinking.
But whilst distractions can derail our concentration, pulling yourself away from work once in a while for focused, deliberate breaks is crucial. Experts recommend setting aside uninterrupted focusing blocks in which we limit our use of devices for a given time period – the infamous Pomodoro Technique suggests concentration periods of 25 minutes, punctuated by 5 minute breaks. And whilst there’s no question that technology can compromise our focus and productivity, it’s also a valuable tool for helping us stay on track. Browser add-ons like StayFocused allow users to activate a customised filter that blocks out distracting websites for a set amount of time each day, and meditation apps like HeadSpace and Insight Timer can help users to centre themselves following a distraction overload.
This article was brought to you by Dig Detox. Our mission is to help people use technology safely because we believe health is your most valuable asset. Please visit www.digdetox.com for more articles, research and information about the movement.
By Effie Webb
University of Oxford
First Published on 12 May 2020
Sources: | https://www.digdetox.com/distraction |
In a recent RAC poll, an astonishing 44% of drivers say they have been kept waiting for more than 15 seconds by drivers who have failed to notice a traffic light has gone green – that’s often long enough for lights to change to red again.
A frustrated 64% of drivers surveyed have been left waiting for 10 or more seconds.
Nearly half of the 2,498 drivers (46%) surveyed said it should take no more than three seconds to get going on green, with a third (35%) thinking between four and six seconds is a reasonable time.
Younger drivers more irritated by slow reactions at lights
Statistically speaking, those who get the most annoyed when others are slow to react to the lights turning green are male drivers aged between 17 and 34 with a huge 64% saying they get frustrated.
Men, generally, are more likely to be frustrated by other drivers who are slow to react to lights going green than women (50% v 41%).
It should only take three seconds to move off when traffic lights change to green – and anything longer is very likely to lead to anger and frustration for those behind waiting, particularly if they’re aged 44 or under.
While the overall level of frustration felt about drivers who are slow to move off when the lights change is evenly split with 46% saying they get annoyed and 54% saying it doesn’t bother them, the younger the driver the more likely they are to be irritated.
Drivers from Yorkshire and the Humber region are the most impatient in the UK with 55% confessing to getting annoyed by ‘slow coaches’ at traffic lights, compared drivers in Wales who are the most accepting with just 34% getting annoyed. | https://www.easternwestern.co.uk/news/drivers-see-red-if-kept-waiting-on-green/ |
Deforestation is one of the most dramatic land uses affecting migratory birds because it changes or removes entire regions of ecosystems and habitats. From a bird’s eye view, the impact of land use on tropical forests is unmistakable. As many migrating birds fly to and from tropical regions each year, they find larger areas of forest have been removed.
After birds have flown for weeks and thousands of kilometres across entire continents, their rainforest destinations from the year before can be degraded, severely damaged or cease to exist altogether.
Tropical rainforests are the final destinations for many migratory birds that breed in both the northern and southern hemispheres including 180 species that fly from North America each year. They rely on rainforests in equatorial regions to provide food and shelter which their breeding grounds cannot do during the colder months.
The most well known example of changing use of rainforest land is the Amazon in South America. In the last 50 years alone, an area the size of Texas has been converted into grazing and agricultural land. It is estimated that at current rates of deforestation, the Amazon may be completely transformed due to changing land use by the end of the century.
Large scale deforestation in rainforests such as in the Amazon threatens the very reasons many birds make dangerous migrations each year. It is not uncommon for migrating birds to lose 30% of their body weight while making annual migrations and after such long journeys, the loss of their wintering grounds can have a devastating effect. They rely heavily on the extremely productive and complex rainforest ecosystems for food, rest and recovery.
Local agriculture and world demand for beef and soy are the main reasons Amazonian deforestation continues and many industries rely on the rainforest to survive as well as thousands of poor local farmers.
Cattle ranches completely clear vast areas of rainforest to provide grasslands for livestock. Similarly, large scale farms producing soybeans, a main ingredient in livestock feed, cut large growing fields from the forest.
Thousands of local poor farmers live on the edge of - and depend on - the Amazon and each year they clear small fields for subsistence [small-scale] agriculture. These small crop fields break up and fragment the seamless expanses of rainforest, slowly changing and degrading its habitats.
The poor quality of soil in rainforests further perpetuates the cycle of deforestation. Without the continuous nutrients and protection of the dense forest, many of the soil’s nutrients are washed away within a few years. Consequently, the soil can no longer support agriculture or livestock.
The result is a continuous cycle of deforestation as farmers and ranchers perpetually seek new and fertile soil by clearing the forest.
See what migratory birds in your area migrate to Central and South American rainforests using the The Cornell Lab of Ornithology's Neotropical Birds Interactive Range Maps or check out these examples: Red-eyed Vireo, Purple Martin, Blackpoll Warbler
See "a Bird's Eye View" of deforestation in Brazil on the WMBD Event Google Map: Undamaged rainforest next to wide scale land use, small scale forest fragmentation and degradation, bunring plots of rainforest
Register a WMBD event to raise awareness about the effects of deforestation on migratory birds in your area and receive WMBD posters and stickers to support your event. | https://www.worldmigratorybirdday.org/2011/index7afc.html?option=com_content&view=article&id=46&Itemid=28 |
The number (P2k(m-1)-k+1,---,P2km) of feedback pulses are detected and stored at intervals (TS/2k) equal to the interval of speed evaluation (TS) divided by a multiple of 2. This number of feedback pulses is utilised to calculate the number of pulses (A) for each interval of speed evaluation and the number of pulses (B) appearing between the midpoint ((m-1)TS-TS/2) of the previous interval of speed evaluation and the midpoint (mTS-TS/2) of the current interval of speed evaluation. The results (A and B) are used to evaluate the actual speed of the servomotor. | |
Kia ora from Aotearoa.
We always know we have had a good frost when even the sand on the beach is a crispy white. That was how it was on our walk this morning. Our run of calm, clear, winter weather continues.
We had a slight hesitation when we started solving in the NW but after that it all flowed smoothly for us. All the usual Jay fun of course.
Please leave a comment telling us how you got on.
Across
1a Regular visitors may be a little taken in by colours (8)
HABITUES : A word for colours or shades surrounds ‘A’ from the clue and little or small portion.
5a Admonish a pessimist accommodating models (6)
SHAPES : A lurker hiding in the clue.
9a Indefinitely postpones the two shopping centres having switched leaders (9)
MOTHBALLS : A word for ‘the two’ and a word for shopping centres have their initial letters exchanged.
11a Taste of Burma regularly confronting French pal? (5)
UMAMI : The second and fourth letters of Burma and the French word for friend.
12a Prestige attraction around borders of Somerset (6)
LUSTRE : The first and last letters of Somerset are inside an attraction or enticement.
13a Charm of eccentric A-list chap? (8)
TALISMAN : An anagram (eccentric) of A LIST plus a synonym for chap.
15a Funny team breaking up (4-9)
SIDE-SPLITTING : A sports team and then breaking up or cleaving.
18a Popular country house on film must be target area (8,5)
SHOOTING RANGE : In the order they appear in the answer we have a verb meaning to film, then the two letter word for popular and a country house.
22a Crazy editor going after nameless Londoner (8)
COCKEYED : Somebody from London’s East End loses the abbreviation for name and finally, the abbreviation for editor.
23a Tried hard, putting roast initially in cooker (6)
STROVE : The first letter of roast is within a cooking appliance.
26 Durrell? A major keeper of this animal (5)
LLAMA : A lurker, hiding in the clue.
27a Remuneration will come after the last of my wishes (9)
YEARNINGS : Start with the last letter of ‘my’ and then remuneration or income.
28a A poser‘s catch? (6)
SITTER : A double definition.
29a Change relating to the whole (8)
INTEGRAL : An anagram (change) of RELATING.
Down
1d Most self-effacing and happy supporting topless pal (8)
HUMBLEST : Remove the first letter from a pal or close friend and then happy or fortunate.
2d Objects of ridicule only on test, oddly (5)
BUTTS : A synonym for only plus the first and third letters of ‘test’.
3d Tunics may be key when crossing road (7)
TABARDS : A computer key usually found on the left of the keyboard, then a synonym for when surrounds the abbreviation for road.
4d View across lake — rising fish (4)
EELS : Reverse (rising in a down clue) view or observe and insert L(ake).
6d Entertainer who’d broadcast at home on one (7)
HOUDINI : A homophone (broadcast) of ‘who’d’, then the short ‘at home’ word and the Roman numeral one.
7d Tramping around nursing a grouse (9)
PTARMIGAN : An anagram (around) of TRAMPING contains ‘A’ from the clue.
8d Tight-fitting fleece with natty fringes (6)
SKINNY : Fleece or remove the outside layer, then the first and last letters of natty.
10d Old Greeks showing expertise in bridges (8)
SPARTANS : A verb meaning bridges contains expertise or skill.
14d Praise cook drinking coffee (8)
FLATTERY : Cook using oil or fat in a pan contains a milky coffee drink.
16d Dryer found in freak accidents (9)
DESICCANT : An anagram (freak) of ACCIDENTS.
17d Change in fortune may be true about most of poetry (8)
REVERSAL : A synonym for poetry minus its last letter is inside true or genuine.
19d Make a speech about exercise and work (7)
OPERATE : Physical exercise is inside a word for make a speech.
20d Regret importing European metal train (7)
RETINUE : The abbreviation for European and the metal with the chemical symbol Sn are inside a word for regret.
21d Dresses down, as result of viral infection on board (6)
SCOLDS : The letters for a steamship surround a viral infection common in the winter time.
24d Title holder‘s now upset Her Majesty (5)
OWNER : An anagram (upset) of NOW and then the Queen’s regnal cypher.
25d Block put on new farm building (4)
BARN : Block or prohibition plus N(ew).
We had a short list of 1a, 9a, 22a and 3d on our preferred list for favourite this week, but couldn’t pick among them. | http://bigdave44.com/2019/06/26/dt-29087/ |
G-55, Jalan Perdana 3A, Taman Kajang Perdana, 43000 Kajang, Selangor, Malaysia.
- Description
- Information
This large brightly colored foam dice comes in 4 attractive colors, namely red, yellow, blue and green. The games played with the dice will allow children to learn about numbers and its relationships to the game they are playing. Children always love the chance of rolling the dice and thus, it's an excellent way to capture their concentration skills and interests. | https://www.usleducation.com/products/mathematics/geometry/foam-dice.html |
What is the Pay by Experience Level for Factory Workers?
An entry-level Factory Worker with less than 1 year experience can expect to earn an average total compensation (includes tips, bonus, and overtime pay) of AU$22.00 based on 61 salaries. An early career Factory Worker with 1-4 years of experience earns an average total compensation of AU$23.04 based on 232 salaries. A …Read more
What Do Factory Workers Do?
Factory workers normally work as a unit, and they are collectively responsible for the production of the goods that their factory makes. While they work as a team, they are also held individually responsible for their performance. Their responsibilities include maintaining a clean work environment and meeting a minimum output that has been specified by their employer.
Typical employers of factory workers are manufacturers that produce large quantities of goods. Factory workers may work first, …Read more
- Load raw materials onto production lines.
- Inspect finished products for defects.
- Perform assembly and sub-assembly operations.
- Operate hand held equipment.
- Use pallet jacks to transport raw materials.
FAQs About Factory Workers
What is the highest pay for Factory Workers?
Our data indicates that the highest pay for a Factory Worker is A$27.21 / hour
What is the lowest pay for Factory Workers?
Our data indicates that the lowest pay for a Factory Worker is A$19.36 / hour
How can Factory Workers increase their salary?
Increasing your pay as a Factory Worker is possible in different ways. Change of employer: Consider a career move to a new employer that is willing to pay higher for your skills. Level of Education: Gaining advanced degrees may allow this role to increase their income potential and qualify for promotions. Managing Experience: If you are a Factory Worker that oversees more junior Factory Workers, this experience can increase the likelihood to earn more. | https://www.payscale.com/research/AU/Job=Factory_Worker/Hourly_Rate |
What’s going on with Ares, the God of War? Once willfully imprisoned by the Amazons, Ares has found himself back on the outside, and he has no idea how he got free. What he does have, however, is a new, seemingly improved outlook on life. Determined to be a force against injustice, he’s intervened in a small nation’s civil war, fighting with the army of rebels against the oppressive government regime. While Wonder Woman may be sympathetic—or even supportive—of the cause, she can’t approve of Ares’ hardline tactics and near utter disregard for human lives. The regime may be wicked, but a hero must be better…right?
Not according to Ares, who believes the only way to bring down oppression is to be unyielding in the fight against it. But that’s not Diana’s way, which causes the two one-time enemies to once again trade blows. But should they be fighting each other? Don’t they want the same thing? And what about Ares’ claim that no one is really innocent in war? Is it true, and if so, then what does that say about war in general? All questions worth considering, but first Diana must survive Ares’ attack in this first look at WONDER WOMAN #60.
WONDER WOMAN #60
- Pages:
- 6
WONDER WOMAN #60 by G. Willow Wilson, Cary Nord, Mick Gray and Romulo Fajardo Jr. is in stores this Wednesday. | https://www.dccomics.com/blog/2018/12/10/first-look-wonder-woman-confronts-the-god-of-war |
The outer diameter of the metric thread is in millimeters, such as 6, 8, 10, 12, 18, 20 mm, etc. The pitch is also in millimeters, such as 0.5, 0.75, 1, 1.5, 2, 3, etc.
The outer diameter of the inch thread is in inches, (each inch equals 25.4 mm) such as 3/16, 5/8, 1/4, 1/2, etc. Therefore, the reading of the outer diameter with a metric caliper often has irregular decimals. .
Inch pitch is expressed by the number of teeth per inch. Set the caliper at 25.4 mm, align one ruler tip with the thread tip, and the other ruler tip should be inch thread if the thread tip is aligned, and metric thread if the thread is not aligned.
When measuring the pitch, it is best to print the tip of the thread on the white chalk. The mark on the chalk is relatively clear and easy to measure. To measure the metric thread pitch, you should measure a length, such as 10, 15, 20, millimeters, etc., count how many threads it contains, and calculate the pitch in inches. The thread specification is an inch thread, such as: G1". Use the metric unit mm The metric thread is specified for the thread specification, such as M30.
The imperial system is determined by how many teeth there are in one inch (24.5 cm), generally 55 degrees. The metric system is the pitch of the pitch determined by the distance between the two tooth tips, usually 60 degrees.
http://www.din571.com/product/Headed-wood-screws/
Previous: | http://www.din571.com/news/Industry-News/304.html |
Service oriented software systems running in a highly open, dynamic and unpredictable Internet environment are inevitable to face all kinds of uncertainty. To monitor the operation of the web services system behavior analysis and analysis whether the system behavior is consistent with the requirements is the basis to determine whether the system needs to be reconfigured. In this paper, an analytical platform for the behavior of a web service-oriented system based on the probabilistic model checking is introduced which provides the basis for judging whether a system needs to be reconfigured by applying the approach of probabilistic model checking to verify whether the behavior system model is satisfied requirement properties. This platform is implemented in Java language and using the dot tool that the Graphviz provides and the PRISM model checker to construct the behavior model of the web service-oriented system based on web log files, to view and edit behavior models visually, and to convert the model from one form to another to make it convenience for users to use the model checker PRISM. Finally, we can judge whether the model is satisfied the desired requirements according to the verification result.
SOA (service-oriented Architecture, Service - Oriented Architecture) provides a loosely coupled distributed computing paradigm. On the basis of technology standardization system consisting of WSDL, UDDI, SOAP etc., different types and forms of the upper business functions and data and computing resources is described and published and discovered and accessed in a unified way, thus, a computing environment surrounding of Service (WS, Web Service) is formed based on the standard and open internet technology.
Web services can be directly integrated application system based on Service or composed in some business process description language to realize the more complex business functions. The composed business process still can be accessed in the manner of web service. SBA and SBS are all called the web service–oriented system.
Web service system operating in a highly open, dynamic and unpredictable Internet environment, therefore, is inevitable to face all kinds of uncertainty, for example, the uncertainty of the number of accessing users, page views, the duration of the visit page, and the uncertainty of the user types, the process that user use, and the uncertain value that by uncertain access processes, etc.
Self-adaptive systems mean that software has autonomous capabilities, which can also be explained with reference to autonomic computing’s use of a monitor-analyze-plan-execute, or MAPE, closed control loop to achieve self-management in computer systems. The four stages of the MAPE loop are enabled by knowledge.
From the MAPE feedback control loop structure, we can find that it is the primary task to monitor and analysis the behavior of web service oriented systems. So, we design and implement an analytical platform for the behavior of a web service-oriented system based on the probabilistic model checking to provide the basis for judge whether a system needs to be reconfigured by adopting the approach of probabilistic model checking to verify whether the behavior system model is satisfied requirement properties.
The remainder of the paper is structured as follows. Section 2 introduces some basic concepts and the tools about PRISM and Graphviz which we have integrated into our platform. Section 3 presents the approach of constructing the running behavior model for a web service system based on web log files and secondly, presents to extend the running behavior model with business value to express the potential domain knowledge, and finally presents to product the requirement property formula based on the extended model. Section 4 describes the architecture of the platform and the functionalities of the subservices which consist of the platform in detail. In this section, the algorithm of each subservice is discussed and the snapshot of it is also presented. Section 5 concludes the paper and lists planned further work. | https://www.igi-global.com/article/a-platform-for-analyzing-behaviors-of-service-oriented-application-based-on-the-probabilistic-model-checking/122791 |
When you paint the picture of your life, there’s always the chance of failure
When you start painting the picture, the chances of failure are always there, writes the painter.
“I’ve been in this job for 20 years and I’ve had the same problems with the paint, and it’s like a nightmare,” he told News.
“If you try to paint on the wrong paint, it will always go wrong.
And the paint can’t stay put, so it needs to be dried.
It’s just so easy to make a mistake.”
“If you can’t get your paint to stay on the paintbrush for 10 minutes, you’ve wasted your time,” he said.
“It’s always hard to paint the same picture over and over again.”
‘The worst thing is that the paint is always wet’ When you start to paint, the paint tends to move around in the paintbrushes.
“There’s always a little droplet of paint on a piece of paper or on a page of paper and you don’t know where it came from or how it got there,” he explained.
“Sometimes you’re just going to paint it for an hour or two and then it’s going to get dirty, so you just need to dry it off.”
“The worst is that when you’re doing a painting, the brush will just keep going in the wrong direction.
If it’s wet, the whole thing just falls apart,” he added.
“That’s the worst.
So the more your paint is going in different directions, the better it looks.” “
In fact, when you paint something, the more you paint it, the less it will last.
So the more your paint is going in different directions, the better it looks.”
‘Painting is a journey’Painter Steve Bartlett started painting in his late 20s.
“I got my first painting in my late 20th birthday.
It was done in about four hours and was very very expensive, so I was very happy,” he recalled.
Bartlett, who is a teacher at the Queensland Museum, has painted for over 20 years, including for the ABC News Breakfast.
“It’s a journey,” he explains.
“Painting has been a journey to me and I want to do that all the time.”
Painting as a professionPainting was originally meant to be a hobby, but now is an integral part of his life.
A painter at the Museum, he’s currently painting for the National Trust’s Australian Art Exhibition.
“Painting, in my opinion, is the greatest art form, and if I had to choose just one art form to live my life and live in, it would be painting,” he says.
It’s like learning to play a guitar, which is another way of saying you learn to play music.” “
You learn the skills to do it as a painter and you learn how to paint well.
It’s like learning to play a guitar, which is another way of saying you learn to play music.”
The painting industryIn the 1970s, the painting industry exploded in Australia, with the likes of Andy Warhol, Robert Rauschenberg and Damien Hirst creating the biggest art exhibition in history.
But it wasn’t until 2000 that the industry was truly recognised and mainstreamed, and the paintings began to move from a hobby into an artform.
After graduating from university, he began working in painting, eventually moving to New York.
His paintings include The Man Who Could Paint a Picture, The Man With the Great Red Eyebrows and The Man Without a Past.
He’s painted for the Australian Museum since 2009, and has painted the Australian National Museum, the Victoria and Albert Museum, New Zealand’s National Museum of Modern Art and many other galleries.
There are two different types of paintings, but the most popular one is the abstract one, he said, and he paints on a blackboard.
The second type is an old school painting, and is where you get your first real exposure to a real artist.
‘I would never have imagined it would become a career’Art was originally an important part of life in the 1800s, but it’s now becoming a more recognised part of the art world, he explained, as more artists and galleries are getting into painting.
“[Painting] is like a career.
You learn the art to become a painter, and you get an education in painting.”
Art is a big business, and we’re all about creating art.
But painting is a job, and an art form,” he concluded. | https://cennetbayi.com/archives/12 |
Personal Property Limits
Items which may be retained by you are limited for safety and security reasons. The amount of personal property allowed by you is limited to those items that can be neatly and safely placed in the space designed. Under no circumstances will materials be accumulated to the point where they become a fire, sanitation, or housekeeping hazard. The following list is not all inclusive, but is a guide to the items you may be authorized.
Storage Space
Most units provide an individual locker, desk, and/or cabinet. In addition, storage boxes may be purchased from the commissary that will fit under your bed for additional storage. Locks may be purchased in the institution commissary.
Clothing
Civilian clothing of any type (except athletic apparel) is not authorized. All authorized clothing should be neatly stored in your locker. A limited number of personal sweat shirts and sweat pants are permitted. These items must be gray in color. No other colors are acceptable. Individual washcloth and towels are issued. Representative authorized footwear includes: One pair of composite-toed safety shoes, one pair of shower slippers, and two pairs of leisure shoes. Footwear can be placed neatly under the bed.
Special Purchase Items
Special purchase items may be authorized, but only to the point where they can be contained in the storage area provided for personal property. | http://www.prisonrating.com/2011/fci-terminal-island-personal-property/ |
Species are going extinct at nearly 10,000 times historical rates, and COVID-19 is a direct result of our negative interactions with wild animals around the world. Climate change, development, and illegal poaching are among the primary factors that are negatively impacting our natural resources, increasing human to wildlife conflict, and contributing to overall biodiversity loss. WildTrack is a nonprofit organization dedicated to the protection of endangered species. It uses non-invasive wildlife monitoring techniques based on indigenous knowledge to track endangered species using footprints. Within this context, WildTrackAI applies cutting-edge computer vision technology to enhance current wildlife tracking techniques in the speed and accuracy of footprint image classification, and delivers an end-to-end integrated solution for footprint tracking. Through this solution, we aim to:
- Near-term: Improve understanding of wildlife behavior;
- Mid-term: Improve protection of endangered species; and
- Long-term: Reduce biodiversity loss, reduce disease transmission to humans, and achieve a sustainable coexistence between humans and wildlife. | https://www.ischool.berkeley.edu/projects/2020/wildtrackai |
The utility model discloses a 45-degree and 90-degree mirror surface high-precision measuring tool. The 45-degree and 90-degree mirror surface high-precision measuring tool comprises a box base, and an objective table, a mirror surface measuring device and a mirror surface conveying device which are arranged on the box base, the objective table comprises a first objective table and a second objective table, and the first objective table is located above the second objective table; wherein the first objective table comprises a supporting frame and a limiting block, the supporting frame comprises a horizontal part and an oblique part, one end of the horizontal part and one end of the oblique part are fixed at an angle of 45 degrees, and the limiting block is arranged at the joint of the horizontal part and the oblique part; the mirror surface conveying device is arranged on the box base, the second objective table is located at the top of the mirror surface conveying device, a groove isformed in the second objective table, and the groove is perpendicular to the plane of the second objective table. The flatness of a mirror surface can be automatically measured, and the flatness of the mirror surface can be measured under the conditions of 45 degrees and 90 degrees. And a new thought is provided for rapid detection of the mirror surface flatness. | |
Q:
Don't understand closest pair heuristic from "The Algorithm Design Manual "
There is almost exactly the same question. But I still don't understand, how is this heuristic working and in what sequence vertexes are passed through. Also there is a picture in a book:
That shows comparison of nearest-neghbor heuristic and what I believe is a closest-pair heuristic. From the picture I may assume that on the top picture, 0 point was selected first, but on the bottom picture there was selected the leftmost or the rightmost one. Because there is nothing said about first point selection (also the closest-pair heuristic doesn't do any actions in that), I may assume that any algorithm results however good it is won't give you the bottom picture if it doesn't consider, what point to start with.
For now I just want to know, what steps closest-pair heuristic makes. A picture similar to the bottom one with numbers associated with each iteration along with explanation would be appreciated.
Here is the link to the book taken from that post.
A:
I don't have the book, but it is showing a comparison of the nearest neighbor heuristic to the optimal solution for this data. The data shown here is (-21, -5, -1, 0, 1, 3, 11).
The confusion may be between a "local" greedy algorithm and a "global" greedy algorithm (for lack of better word). The nearest neighbor shown above is strictly local. The "robot" starts at 0 and chooses to go to 1, because it is the closest path. The robot is at 1, and finds the next closest point is -1. Then the robot is at -1 and the next closest point is 3, and so on.
The closest pair is more global. It is looking at all optimal edges at once. So, the algorithm starts at 0 and finds four that are exactly 1 unit apart (0, 1), (1, 0), (-1, 0), and (0, -1). It would add two distinct pairs creating the graph (-1, 0, 1). This could be either directed or non-directed.
Then it would repeat, and notice that (1, 3) is the next smallest edge, and so on, until it arrives at the optimal solution.
The difference is that in the nearest neighbor case, the robot can only look at the neighbors of where it is currently located. In the closest pair case, you can look at all edges to choose the smallest one.
A:
I agree this is not very clear in the book (which is a bit of a downer as the reader encounters it right away - page 7 in my edition).
I think the difficulty here is not in the closest-pair heuristic itself. The key is noticing that the heuristic is not itself supposed to be the solution to the problem! Only a part (arguably the most important part) of an algorithm that is never fully described in the book (probably because this is intended as a wrong algorithm). With the heuristic, you get the pairs of vertexes that should be connected, but not the order in which they ought to be connected. For that, something more is needed.
For completeness, here is the problem statement from the book
Problem: Robot Tour Optimization
Input: A set S of n points in the plane
Output: What is the shortest cycle tour that visits each point in the set S
Now, the closest-pair heuristic, as defined in the book and quoted here, only gives you a set/list of connections, not the tour itself, and so not the required solution. To obtain the tour you would have to do something more. An overall (flawed!) solution using this strategy would look something like:
1) Initialize the output list of vertexes to visit as the empty list (call it RET).
2) Obtain the list of connections (vertex pairs) given by ClosestPair (let it be L)
3) If L is empty, jump to 12
4) Remove an arbitrary connection from L (call it C1).
5) Choose an arbitrary vertex from C1 (call it V1)
6) Append V1 to RET
7) Remove from L the other connection that contains V1 (call it C2)
8) Choose the other vertex from that connection (call it V2)
9) append V2 to RET
10) Set V1=V2
11) If L is not empty, jump back to 7
12) return RET
Or in pseudo-code
Alg(P): # P is the input set of points
RET = []
L = ClosestPairs(P)
if(L.empty()):
return RET
C1 = L.getAndRemoveRandomElement()
V1 = C1.getRandomVertex()
RET.append(V1)
while(!L.empty()):
C2 = L.getAndRemoveElementContaining(V1)
V2 = C2.getTheOtherVertex(V1)
RET.append(V2)
V1 = V2
return RET
| |
In small companies (or small implementations), some of these functions may be combined. In large companies or projects, however, several people may be assigned to one or more functions. Software developers, technical writers, graphic designers and others, for example, often supplement IT.
Challenges encountered at most KM projects
Implementing, or building a KM system is not easy. There are several challenges that must be overcome. Most difficult of them are changing the management leader's mindsets. For example, at one Indian IT company, the COO was not convinced of the need for a centralized system, particularly one that competed for already scarce resources and other business priorities. The VP of marketing liked the idea but did not appreciated the value of knowledge management. Fortunately, the project had its champions. The CEO acted as an overall driving force, realizing the advantage of arming sales with rapid and accurate customer/prospect data.In most cases, success of KM system needs an executive level sponsorship.
IBM approach
"IBM realized we could drive a lot more growth in the EAI sector, but we were constrained by an inability to reuse what had already been learned" - Scott J. Smith, Global Practice Executive, Knowledge & Content Management for IBM Global Services in Cambridge, Massachusetts.
Over the past decade, IBM has established a sophisticated KM infrastructure. At its core is a central unit consisting of three distinct elements:
(1) Developers who work on the technology side;(2) Strategists who are forward-looking pragmatists; and(3) Deployment, who work with other business units within the company to implement specific projects.
The developers create tools and systems that the strategists seek to harness to maximize business value. But it is the deployment group that exports KM, based on a perceived organizational need. Here is an example of how it works in the real world from Big Blue' own Enterprise Application Integration (EAI) Practice, where skill sets once existed in isolated pockets around the world. Due to this situation of dispersed know-how, EAI professionals in London, for example, might end up repeating work already done in Hong Kong.
Two members of the deployment team were assigned to form a team. It consisted of the EAI Practice leader; an EAI Practice member skilled in training and business processes. An EAI Practice member focusing on reuse of knowledge and human/cultural aspects. None were KM experts, but all wanted to use it to expand the area.
Why not use KM specialists?
KM experts often lack context, so it is extremely difficult to generate a valuable and dynamic knowledge network when only KM experts are involved. For example, a KM system for sales function cannot be built by KM experts alone - who do not have knowledge or experience in sales. The best results are achieved with salesmen are deeply involved in building a KM system.Knowledge networks play a focal role in the IBM process. IBM' Knowledge Network Launch Process makes use of a six-step process to facilitate a KM team.
In essence, a knowledge network is formalized networking. From a technology perspective, IBM sets up a portal and utilizes AssetWeb, an in-house collaboration and intellectual capital management application. (This infrastructure is used by as many as 50 specialized communities.)
By means of once-a- year meetings of members (starting with a launch event), more regular national and regional events, and conference calls, KM experts establish these knowledge networks as potent forces.
Result
IBM projects routinely result in a 40 percent reduction in proposal preparation time, a 30 percent decrease in the time taken to create deliverables, and expansion in EAI and other units.
Team duration
Although IBM generally completes its KM projects within 8 to 12 weeks, that doesn't mean that it implements and moves on. KM executives monitor how well the technology is being utilized via "Health Checks" that detect the degree of participation in knowledge network events and discussions, the amount of usage of portals, and other indicators.
In other companies, however, KM initiatives are rarely dispatched with such velocity. And in many cases, the team members go on to form an ongoing KM section. At one of the Big Five accounting firms, for example, the knowledge management team that began in the early 1990s eventually evolved into a permanent unit composed of about 20 people. It began as a Lotus Notes project and has evolved into a Lotus Domino-based intranet that acts as a central repository and clearinghouse for company knowledge.
The company loosely bases its KM efforts around a three-pronged structure: technology, business process, and people (human/cultural). Members from all three sectors are needed to conduct a successful KM project. You don't find all these skills in one person, so you have to ensure that all are represented in the team.
Do not focus too closely on technology. Without the process and people (human) elements, projects go astray. Currently, the human and cultural duties fall on group head - whose group will use the system. The group head will then have to drive the usage of the system.. Users will always cite different reasons not to use the new system.
In my previous company, we had implemented a knowledge sharing portal - but in the initial phases sales group did not use this portal citing: "they don't have time", "difficult to use it" etc.The business leaders must drive the adaptation and knowledge-sharing efforts, he must places strong emphasis on KM in all meetings and conferences. Further, the company highlights the achievements of team members on the company' Web site. This includes photographs, quotes, and success stories to show the value of KM from a business standpoint.
Think small
Large-scale KM projects tend to be the province of major companies specializing in service and knowledge-intensive industries like consulting, high-tech, and finance. That does not mean, however, that smaller operations in other zones cannot receive value from knowledge management. But they, too, must put together a KM team, however rudimentary, if they hope to realize project objectives.
Specialty chemical provider Advantis Technologies Inc. of Alpharetta, Georgia, wanted to add a business intelligence/reporting package (by Cognos Inc. of Ottawa, Canada) to its existing JD Edwards ERP system. Reason: generation of monthly sales reports took the IT department two weeks. According to Keith Lewis, Vice-President of Business Development at Advantis, they had plenty of valuable information that they simply couldn't gain access to in a timely Manner.
Lewis advocates a strong business presence in any KM team rather than leaving everything to IT. He headed the team and relied on key salespeople for input on report definition. An individual from systems integrator C.D. Group Inc. of Atlanta provided the JD Edwards/Cognos expertise. Lewis also added specialists in SQL Server, networking, and AS/400 to cover all technical bases. Now completed, the sales department has its reports almost instantly without involvement from IT. Instead of worrying over the accuracy of the numbers, Lewis can focus on analyzing them to detect opportunities and situations. With his experience in KM, he plans to expand its influence into general ledger and inventory Management.
Closing Thoughts
What should you look for in a KM team member? There are certain characteristics that exemplify all successful participants, including: | http://it.toolbox.com/blogs/it-marketing/knowledge-management-the-blood-lifeline-of-any-company-11926 |
This plugin will generate one centroid dot for the complete selection of path(s).
There are two options in the dialog:
- Number of linear segments per curve, default 100. The more linear segments used the more precise the centroid will be. Generally increasing the number of segments is only necessary for complex curves.
- Radius of output centroid, default 10. Controls how large the output "dot" used to mark the centroid is.
Assumptions / Requirements
- The selected path(s) are closed
- The selected path(s) do not intersect
- If multiple paths are selected, there is one outer path which completely encloses the inner paths, and (1) and (2) hold true for each path
Multiple closed paths that are not contained within each other are not supported. | https://stadtfabrikanten.org/display/IFM/Centroid |
Distance from Starkville, MS to Jacksonville, FL is 558Miles or 898 Km. You can get this distance about 9 hours 8 mins. If you want to planning travel with plane for 473 Miles or 761 Km, You can get this distance about 1 hours 30 mins .
A car with an average MPG will needs 25.83 gallons of gas to get the route between these points.
The estimated cost of gas to get between Starkville, MS and Jacksonville, FL is $58.63.
During the route, an average car will release 506.06 pounds of CO2 to the atmosphere. Your carbon footprint is 0.91 pounds of CO2 per mile.
* Average US MPG used for calculations is 21.6 MPG.
* Average US gas price used for calculation is 2.27 per gallon. | http://www.distancebetweencities.net/starkville_ms_and_jacksonville_fl/ |
Key factors to consider when buying an existing business
Not all businesses are created from the ground up. Buying an existing business that has built its brand and operational foundation is a great way to capitalize on the market. Acquiring a business reduces risk compared to starting from scratch and will help you profit immediately. So, what are the factors and considerations to look out for when evaluating a business for acquisition?
There are many factors to consider when buying a startup. Here are a few things to keep in mind when evaluating a business for acquisition.
1. Market and Industry.
It is necessary to understand overall industry trends and the current market position of the business you want to purchase. Understanding your target company’s position in the market and the overall industry trends is critical in assessing the company’s potential for success and identifying any potential risks. Market changes that might impact the company’s future are crucial considerations in buying a business.
2. Financials and Revenue.
Evaluating a target company’s financials is crucial in determining its investment potential. Analyzing the company’s sales, profit, and cash flow will give you information about its present financial situation, current performance, and future growth potential.
3. Product or service.
Assessing the product or service offered by your prospective company is a crucial aspect of due diligence for your startup acquisition. Determine if the product or service is already proven or still in development. It is essential to understand the unique selling propositions and how the product differs from the competitors to determine the likelihood of success. Comparing the target company to its competitors will give you an idea of its market position and potential for growth. This information can help you make an informed investment decision.
4. Team and Culture.
The team behind a startup plays a significant role in determining its success. It’s essential to evaluate the management and employees, including their skills, experience, and cultural compatibility with your organization. A strong, experienced, and culturally aligned team can be a significant asset and can increase the chances of success for your business.
5. Scalability.
Scalability is a vital factor to consider when assessing a business. Examine whether the operations and business model has the potential to meet the needs of a developing firm. A scalable startup has the potential to grow and generate significant returns on investment in the long term. Evaluating scalability helps investors determine if the business is a viable investment opportunity.
6. Legal and Compliance.
Reviewing a target company’s legal and compliance-related documentation is essential. This will help ensure it operates within the bounds of the law and is clear of any outstanding legal matters. This element of due diligence can secure a more seamless investing process by shielding the investor from any risks and obligations.
7. Exit strategy.
Having an exit strategy is crucial, even in a successful acquisition. Plan for an eventual exit, whether it’s a merger, an IPO, or the sale of the business. A solid exit strategy is a crucial element of effective investment planning. Exit strategies help investors maximize their returns and reduce risks.
In conclusion, there are many factors to consider when buying and acquiring an existing business. Due diligence is essential to making informed investment decisions and raising the likelihood of success of any business acquisition. This includes understanding market and industry trends, assessing the target company’s financials, product, and team, taking into account scalability and legal compliance, and having an exit strategy. Remember, a comprehensive evaluation approach can help minimize potential risks and maximize returns on investment.
If you are looking to buy or start a business, check out Startup Boost Singapore! Startup Boost Singapore is a web development and business brokerage company that helps entrepreneurs and enterprises launch startup projects in less than 14 days.
If interested in our products, contact [email protected] for more details.
Want to know how to start your own business? Check out this startup entrepreneur’s guide! | https://startupboost.sg/key-factors-to-consider-when-buying-an-existing-business/ |
ScotGems is a new closed-ended investment company that aims to provide shareholders with long-term capital growth by investing in a focused yet diversified portfolio of c 20-30 small-capitalisation companies listed on global stock markets across a range of sectors. It is expected that, at least initially, the portfolio will be weighted towards small-cap companies (those with a market cap below $2.5bn at the time of investment) in the Asia-Pacific ex-Japan and global emerging markets universes. Investments will not be selected with reference to any benchmark, nor will the portfolio be managed by reference to any index or peer group performance. The managers will build the portfolio gradually over the next six to 12 months as attractive opportunities become available, and as such may hold a relatively high level of cash in this initial period. It has been proposed that cash balances be split equally between pound sterling, US dollar and Singapore dollar, with the option to be held in short-term money market instruments to avoid capital loss from negative interest rates and limit excessive exposure to sterling.
Investment summary
ScotGems (SGEM) has commenced dealing on the London Stock Exchange today, having raised £50.3m via an initial placing and offer for subscription. A new global smaller companies investment trust, managed by Ashish Swarup and Tom Allen at Stewart Investors, SGEM will seek capital growth from a concentrated portfolio of 20-30 stocks with market capitalisations below $2.5bn, initially at least with a bias towards Asia-Pacific and emerging markets. Stewart Investors focuses on stewardship and seeks to invest in small-cap companies with strong franchises and balance sheets. The investment manager is known for closely managing capacity in its investment strategies, with many of its popular funds closed to new investment. A placing programme will allow SGEM to issue up to a further 49.7m shares at a premium to NAV, giving maximum total assets of c £100m at the IPO price. | https://www.edisongroup.com/company/scotgems/2656/ |
The Euro currency was created to establish a single market promote employment and integration between the members of the European Union. The ISO code for the currency is "EUR" and the sign "?" is used as a prefix to prices denominated in the currency.
The monetary policy is set by the European Central Bank, with headquarters in Frankfurt, Germany.
The final stage of implementation of the Euro started on January 1, 2002, when the national currencies started to be withdrawn from circulation.
The Euro is currency the currency of 19 states out of 28 European Union members.
Euro-currency.eu provides the latest exchange rates of the Euro against other currencies, and a calculator to convert to and from the different currencies.
|From Euros (EUR) to Dollars (USD)|
|1 Euros||1.21 Dollars|
|5 Euros||6.06 Dollars|
|10 Euros||12.13 Dollars|
|50 Euros||60.64 Dollars|
|100 Euros||121.27 Dollars|
|500 Euros||606.37 Dollars|
|1,000 Euros||1,212.74 Dollars|
|5,000 Euros||6,063.69 Dollars|
|10,000 Euros||12,127 Dollars|
|50,000 Euros||60,637 Dollars|
|From Dollars (USD) to Euros (EUR)|
|1 Dollars||0.82 Euros|
|5 Dollars||4.12 Euros|
|10 Dollars||8.25 Euros|
|50 Dollars||41.23 Euros|
|100 Dollars||82.46 Euros|
|500 Dollars||412.29 Euros|
|1,000 Dollars||824.58 Euros|
|5,000 Dollars||4,122.91 Euros|
|10,000 Dollars||8,245.81 Euros|
|50,000 Dollars||41,229 Euros|
Rev. | https://www.euro-currency.eu/ |
Q:
What dynamic system could these equations represent?
I have equations of a dynamic system. I need to figure out what this physical system is.
The equations are:
\begin{align}
\dot{x}_1&=bx_1+kx_2+x_3\\
\dot{x}_2&=x_1\\
\dot{x}_3&=\alpha (u-x_2)-\beta x_3
\end{align}
All I can figure out is that it is maybe a mass-spring-damper system, plus a feedback control, but I am not quite sure about the terms $x_3$ and $\dot{x}_3$. What do these two terms mean?
A:
You're right, it's a second order plant representing the mass-spring-damper system $P\left(s\right)=1/\left(s^2-bs -k\right)$ (stiffness $k$ and damping $b$ should be thus negative) under the closed-loop control action of the compensator $C\left(s\right)$, whose transfer function is:
$
C\left(s\right)=\frac{\alpha}{s+\beta}.
$
The negative feedback is closed over the position of the mass, while the set-point is given by $u$.
We can easily derive these results by applying the Laplace transform to the system of equations and then substituting $x_1$:
$$
\begin{align}
s^2x_2&=bsx_2+kx_2+x_3\\
sx_3&=\alpha (u-x_2)-\beta x_3
\end{align},
$$
from which we obtain the following transfer functions:
$$
\begin{align}
P\left(s\right)&=\frac{x_2\left(s\right)}{x_3\left(s\right)}=\frac{1}{s^2-bs-k}\\
C\left(s\right)&=\frac{x_3\left(s\right)}{u\left(s\right)-x_2\left(s\right)}=\frac{\alpha}{s+\beta}
\end{align},
$$
corresponding to the closed-loop system here below:
| |
2 edition of Program goals and subject matter taxonomies for course goals, K-12 found in the catalog.
Program goals and subject matter taxonomies for course goals, K-12
Tri-County Goal Development Project.
Published
1978
by Commercial-Educational Distributing Services in Portland, Or
.
Written in English
Edition Notes
|Statement||produced by the Tri-Country Goal Development Project.|
|Genre||Curricula.|
|The Physical Object|
|Pagination||viii, 127 p. ;|
|Number of Pages||127|
|ID Numbers|
|Open Library||OL16422355M|
Taxonomy is a hierarchical structure for the classification and/or organization of data. In content management and information architecture, taxonomy is used as a tool for organizing content. A taxonomy is an organizing principle. It is a foundati. Handbook:Program Overview-Requirements-Goals and Objectives:Goals and Objectives by an evidence based diagnostic management protocol related to that differential diagnosis, with particular emphasis on the utility of endoscopic procedures. 4. To evaluate, assess, and recommend a cost-effective treatment plan for patients. Size: KB.
Publisher Summary. This chapter discusses goals of the course. The secondary effects of reliance on direct teaching situations to imply course objectives are that teaching is not planned in accordance with predetermined objectives, the objectives implied cannot be achievable by a majority of students, and, in any event, all that is actually conveyed is a set of objectives for the teacher and. Second, students are often motivated more by the desire to attain a degree rather an inherent love of, or interest in, course subject matter. At the same time, both students and instructors value textbooks, even though “there is no correlation between textbook purchase and the grade achieved” (Carpenter et al., Cited by:
Program Goals & Objectives Goal #1: To foster students' development of competence as scientists, researchers, and scholars, including their knowledge of the ways in which practice influences science. Objectives: Our first goal specifies an emphasis on training in research and scholarship. Practical and engaging, Merryl Goldberg’s popular guide to integrating the arts throughout the K curriculum blends contemporary theory with classroom practice. Beyond teaching about the arts as a subject in and of itself, the text explains how teachers may integrate the arts―literary, media, visual, and performing―throughout subject /5(12).
Susan B. Anthony Foundation (Washington, D.C.) records
development of monetary economics
Picasso in Antibes
On-site operational performance evaluation
perils of peace
Nailing The Bar
calculus, with analytic geometry.
Vegetation adjacent to the border of Wisconsin drift in Potter County, Pennsylvania
Linkages between farm and non farm sector
short history of Jammu Raj
Sacred Unity
Fire By Night (Refiners Fire Series, Book 2)
Sunset Pass
New York: old & new
Gemhunting atlas of Australia
Meat
Tables of latitude and departure
Book repairing
This collection of program goals and subject matter taxonomies was produced by the Tri-County (Oregon) Goal Development Project in response to requests that the project make available in one volume those sections of the course goal collections that are most useful for broad-based planning and decision-making.
Taxonomy of Educational Objectives: The Classification of Educational Goals. [Bloom, Benjaman S.] on *FREE* shipping on qualifying offers. Taxonomy of Educational Objectives: The Classification of Educational Goals.5/5(1).
Taxonomy of Educational Objectives, the Classification of Educational Goals, Handbook II: Affective Domain Program goals and subject matter taxonomies for course goals R. Krathwohl, Benjamin S. Bloom, Bertram B.
Masia] on *FREE* shipping on qualifying offers. Taxonomy of Educational Objectives, the Classification of Educational Goals, Handbook II: Affective Domain4/5(1).
Taxonomy of Educational Objectives: The Classification of Educational Goals [A Committee of College and University Examiners] on *FREE* shipping on qualifying offers. Taxonomy of Educational Objectives: The Classification of Educational GoalsAuthor: A Committee of College and University Examiners.
Their framework soon became known as Bloom’s Taxonomy and provides a way of categorizing educational goals. It went on to enjoy widespread popularity among generations of teachers and instructors and has been applied across a broad range of age groups, from kindergarten to college level.
both at a K school level and at a college level. My Understanding of Standard “S” – Subject Matter and Curriculum Goals As a new student-teacher, I am just beginning to write unit and lesson plans that I will actually use to teach in the classroom.
Up to this point, most of what I have written has been simply for the sake of. One of the most common course assessment methods is the course evaluation survey. The following best practices are intended to guide departments and programs in creating or revising course evaluation questions. Clearly state the purpose at the top of the course evaluation.
Meaningful input from students is essential for improving courses. Kimberly-Clark Teams With ISSA to Provide COVID Prevention Training Ap To address the needs of cleaning professionals during the COVID pandemic, Kimberly-Clark Professional has announced a new scholarship program to help smaller cleaning organizations provide critical training on infectious disease prevention and control measures for their employees.
Example of a Well-Designed Course in: NURSING 1. Specific Context The subject matter: Nursing dimension, caring and learning how to learn “taxonomies” related to course design which is ironic as nursing is all about caring for humans.
The course activities and File Size: KB. The program functions in grades K, following the Planned Course of Instruction developed for regular education in the Fairfield Area School District. Together with the classroom teacher, the ESL teacher develops language acquisition and cognitive academic language skills through the use of sound instructional techniques.
BLOOM’S TAXONOMY Taxonomy Information and quotations in this summary, except where otherwise noted, are drawn from Krathwohl, D. A revision of Bloom’s taxonomy: An overview. Theory into Practice, 41 (4), Krathwohl participated in the creation of the original Taxonomy, and was the co-author of the revised Taxonomy.
“The Taxonomy of Educational Objectives [ ]. Taxonomy of educational objectives: the classification of educational goals, Volume 2 David R. Krathwohl Longmans, Green, - Affect (Psychology) - pages4/5(1).
Robert Marzano is a well-known researcher in education field who has proposed a taxonomy called A New Taxonomy of Educational Objectives , . This taxonomy was developed to respond to the. ucational goals yet made available to the professional educator.
If this promise is fully realized, the Taxonomy should be of considerable aid in selecting, organizing, or evaluating almost any set of instructional activities. Needless to say, such a project is worthy of every educa- tor's attention. THE NATURE, GOALS, AND CONTENT OF THE LANGUAGE SUBJECT AREAS 1.
THE NATURE, GOALS, AND CONTENT OF THE LANGUAGE SUBJECT AREAS Reference: Principles of Teaching 2 (Brenda B. Corpuz, Ph. D.) 2. Language. Note: Citations are based on reference standards. However, formatting rules can vary widely between applications and fields of interest or study.
The specific requirements or preferences of your reviewing publisher, classroom teacher, institution or organization should be applied. The volume contains a general introduction to the project, four color coded sets of indexes for locating course goals (knowledge and process classifications, language arts program goals, career education program goals, and language arts subject matter taxonomy), and pages of course goals in valuing and language arts, language, literature Author: Clifford Ferry, Sandra Scofield.
I read both Book-1 and Book-2 of Bloom's Taxonomy of Education in Anyone that studied the education reforms that our schools started implementing back inyou must read these manuscripts.
Bloom helps educators create educational objectives and give them direction in the affective domain and cognitive domain/5. Designed to be used in conjunction with a school district's educational goals and focusing on what is to be learned rather than the methodology to be used, the program and course goals presented here are intended as guidelines for planning and evaluating elementary and secondary school curricula in computer education.
Of four possible levels of goals, only program (general outcomes) and course Cited by: 1. A Validation of Yadav s Taxonomy of Educational Objectives in Cognitive Domain.
References. Index. The present book contains 21 Chapters with an effort to identify the cognitive, psychomotor and affective domain theories of teaching learning alongwith the researches advanced in the field of methods of teaching, learning and evaluation.
This document is one part of a critique series that deals with the development and evaluation of course goals in six subject matter areas for grades K The series provides an initial pool of course-level goals that are expected to be of considerable value in assisting educators with goal definition related to curriculum planning and development, instruction, evaluation, and accountability.Pro-social Goals.
To make others happy or to please others. To avoid hurting (annoying, upsetting, etc.) others. To avoid conflict (disagreement, animosity, etc.) with others. Antisocial Goals. To hurt others or make them feel bad. To cause conflict (chaos, trouble) between people. Provoking a reaction. Learning objective examples adapted from, Nelson Baker at Georgia Tech: @ How Bloom’s works with Quality Matters.
For a course to meet the Quality Matters standards it must have learning objectives that are measurable. Using a verb table like the one above will help you avoid verbs that cannot be quantified, like: understand, learn, appreciate, or enjoy. | https://jipehycolowysef.virtuosobs.com/program-goals-and-subject-matter-taxonomies-for-course-goals-k-12-book-9552ci.php |
Q:
How to know the best FASSTER formula
My data structure is in the image below and has hourly intervals. I need to forecast the Demand.
# A tsibble: 23,400 x 6 [1h] <UTC>
Date Demand WeekDay DaysAfterHoliday Influenza MAX_Temperature
<dttm> <int> <int> <int> <dbl> <dbl>
1 2017-05-01 00:00:00 122 1 0 1 19.2
2 2017-05-02 01:00:00 124 2 1 3.04 25.3
...
I know that in a day after a holiday the number of patients in the ED is higher than usual but I can't make sure that the model is taking that into account.
The data has daily, weekly and annual seasonality (especially for fixed holidays).
For multiple seasonality I can use FASSTER to handle holiday effects. I read the r documentation page on this and some presentation but in those cases the seasonality and the formula of the forecast is given to the function like this:
# NOT RUN {
cbind(mdeaths, fdeaths) %>%
as_tsibble %>%
model(FASSTER(mdeaths ~ fdeaths + poly(1) + trig(12)))
# }
Is there a way to make FASSTER search the most adequate formula? If not how can I know which is the best approach?
Thank you in advance!
A:
The fasster package currently doesn't provide any facilities for automatic model selection (https://github.com/tidyverts/fasster/issues/50).
To identify an appropriate fasster model specification, you can start by graphically exploring your data to identify its structure. Some questions you may consider include:
Is your data seasonal? Which seasonal periods are required?
Include seasonality with fourier terms via fourier(period, K) or season(period). Generally using fourier() terms are better, as being able to specify the number of harmonics (K) allows you to control the smoothness of the seasonality and reduce model parameters.
Does your data include an level or local trends?
Include a level with poly(1) or a trend with poly(2).
Are there potential exogenous regressors (a good example of this is temperature in electricity demand).
Include exogenous regressors in the same way as you would in lm().
Do the patterns in your data alternate in predictable ways (for example, seasonality on weekdays and weekends.)
Use %S% to switch between these patterns. For example to have a different seasonal pattern for weekdays and weekends you may consider day_type %S% (fourier("day", K = 7)), where day_type is a variable in your model that specifies if the day is a weekday or weekend.
A simple approach to capturing the increase in patients after a holiday would be to include DaysAfterHoliday as an exogenous regressor. As this relationship is likely non-linear, you may need to also include some non-linear transformations of this variable as exogenous regressors.
| |
Q:
Using P(A'|B') to find P(A∪B)
We have P(B) = 3/5 and P(A'|B') = 1/3.
I started with P(A∩B)' = P(B)' ∙ P(A'|B') = 2/5 ∙ 1/3 = 2/15.
Then converted P(A∩B)' to P(A'∪B').
Is P(A'∪B') = P(A∪B)', meaning we get P(A∪B) = 1 - 2/15 = 13/15?
A:
You have made two mistakes, but got the right answer! $P(A'\cap B')=P(A'|B') P(B')=\frac 1 3 (1-\frac 3 5)= \frac 2 {15}$. $P(A\cup B)=1-P(A' \cap B')=1-\frac 2 {15}=\frac {13} {15}$.
| |
During the 8th century a man by the name of Jabir ibn Hayyan (A.K.A Geber), a well-known alchemist of Persian descent, wrote of two alchemical principles: Sulfur and Mercury. These two principles revolutionized the understandings that future alchemists would gain on the nature of matter and its origins. But Geber was a very cryptic author and was careful to conceal the true principles of alchemy. He encoded his writings with a veiled style of language. Due to this coded language, we now have our modern word “jibberish”,which refers directly to Jabir and his style of writing which appeared to be pure jibberish to those unaware of the principles of alchemy. But don’t be confused by these titles of Sulfur and Mercury. Understanding the nature of Jabir’s writing style, we can see beyond the code words of Sulfur and Mercury which would lead us to believe these two properties to be elemental sulfur with its pungent smell and liquid mercury or quicksilver. Understanding Sulfur as a code word for a deeper principle, we can now begin to answer the question of “what is Sulfur?” For the sake of this article let us forget about the principle of Mercury and focus specifically on the alchemical Sulfur and what it truly is.
Alchemists studying the works of Jabir knew their Sulfur as an oily substance. This oil could be extracted and concentrated out of their choice of any substance (Plant, animal, mineral, or metal). Frater Albertus, a widely known and respected modern alchemist also points this out by saying: “Sulfur, that is, the alchemical sulfur, is usually found in its oily form adhering to the Mercury.” Although we can pin-point alchemical sulfur as an oil, it functioned as a much deeper symbol to ancient and modern alchemists. In Paracelsus’s book “Concerning the Nature of Things,”he writes that “Sulfur is the soul.” But how can an oil now become the Soul of the substance in question?
The Webster dictionary defines Soul as: The immaterial essence, animating principle, or actuating cause of an individual life. To the alchemists, the oily characteristics of their Sulfur were described in just the same manner. The Sulfur was seen as the individual signature of the plant, animal, mineral, or metal in question. It was what gave each form of life its own unique characteristics. It was the closest material manifestation of a universal principle that gave all of life its spark and being. This source of all was known to the alchemists as Prima Materia. It was the alchemists “First Matter”, or that from which all things originated from and gained life through. Ancient Indian alchemist called this First Matter Adrishta, which translates as “unseen influence.” To ancient philosophers the unseen influence behind the physical cosmos could be attributed to pure and unbounded consciousness.
Referring back to our definition of Soul, we can now attribute consciousness to the “actuating cause of an individual life.” In all ancient philosophies, consciousness proceeded matter. It created matter by interacting with itself in an internal dialogue known to the Greeks as Logos. The alchemists Sulfur became the soul of the material they were working closely with in their laboratories. This Soul was understood as the Consciousness of that material, and that consciousness was seen as the source of that particular material. Not only was consciousness the source of the material being explored, but that same consciousness was the source of all. Universal and infinite in its expression this one consciousness gave life to all forms.
Freeing the Sulfur from its corporeal body made the universal life giving force of consciousness more available to the alchemists. Further research and study into this substance as the “actuating cause” of life would later lead alchemists into deeper understandings of the nature of all life. In time this would gift the alchemists the ability to extend life indefinitely in any body (Plant, animal, even Human) by creating a direct and permanent link with the subject and the unbounded consciousness residing in all life.
With closer examination the alchemists deepened there knowledge of the relationship of consciousness to matter. Diligent study and practice would eventually lead some to awaken infinite consciousness - acting as the source of life – in matter, and in effect finishing their “great work.” The Magnum Opus of the alchemists. The confection of the philosophers stone.
“He who does not know the Sulfur knows nothing, and can accomplish nothing, neither of medicine, nor of philosophy, nor any of the secrets of Nature.” -Paracelsus
Tuesday: Oil of iron
4/15/2014
Today is Tuesday, which corresponds with the planetary influences of Mars (Oil of Iron). Here is some more in-depth information on the qualities of this oil and how you can use it on a day like today to benefit in your physical and spiritual development.
The Oil of Iron is associated with the energies of Mars and the chakra center situated within the Solar Plexus. This center is known to govern the digestion and conversion of food into energy for the body. Physically the Oil of Iron works on all systems associated with digestion (Stomach, Intestines, Liver, Gallbladder, Pancreas, etc.). When the Oil of Iron is incorporated into the body, these systems are balanced to help you effectively break down ingested foods and distribute nutrients more adequately. Problems of over or under acidity in the digestive system as well as diabetic issues are also balanced with the usage of this oil.
Spiritually, the Oil of Iron builds upon the two energy centers below it. The self-esteem associated with the energies of Saturn (Oil of Lead), and the raw emotions associated with the energies of Jupiter (Oil of Tin), are elevated and incorporated into the chakra center of the solar plexus. These energies may then be harnessed by the Will to be transmuted towards higher forms of expression and consciousness. When properly balanced this center allows you to thoroughly “digest” your thoughts, feelings, and emotions that are stimulated by the interactions in your interior and exterior environments. With thorough digestion of both physical and emotional intake, the body and consciousness can use these vital energies accordingly so that the organism may flourish.
With energy effectively distributed throughout the body, personal power increases, providing you a better grasp to utilize your Will. This strengthening of Will is the vital aspect of the Oil of Iron. With proper digestion of the thoughts, feelings, and emotions, and the conversion of these energies into power or will, the stage is set for the higher energies of the heart (Oil of Copper) to use these things as tools to reconnect you with infinite and divine consciousness.
For more information on the Oil of Iron click here.
The Oil of Iron is available for purchase in our store front, click here to purchase
What is Alchemy
4/12/2014
Modern students researching the practices and philosophies of Alchemy will often read the general definition of alchemy as “the art of transformation.” In actuality, there are various definitions and explanations attempting to define just what it is that Alchemy is. There are definitions that represent Transmutation, chemical marriages, raising of vibrations, and so on. These varying definitions lead many to misuse the term Alchemy and attribute it to many new age philosophies or healing practices that may or may not reflect the true nature of the word. Muddying up the practice, and inaccurately defining the word, we now see things in our society like: “Alchemical Massage, Alchemically prepared chocolates, Alchemy in Business, etc.” In no way do I wish to diminish these practices or modes of thinking, but taking something and using it to make something else is not necessarily what Alchemy truly is.
This article, “what is alchemy,” is an exploration into the definition of the word alchemy. This defining is intended to help make alchemical practices and theories clear, distinct, and relevant. Through explanation and exploration of the word alchemy I wish to define alchemy, and also call for a standardization of the definition throughout the alchemical community, and beyond, into adjacent realms of study – which, when understood and applied, can be found to be relevant to all things, all people, and areas of interest. To uncover the true essence of the art of alchemy, it is necessary to explore ancient alchemical texts themselves. The exploration of these texts reveals what the alchemists of old believed their Art to be. To do this, two of the most authoritative texts from eastern and western alchemical traditions will be used - the Emerald Tablet and the Rig Veda. The Emerald Tablet is reported to be more than three thousand years old and was referenced by alchemists of the west. Even today it is considered a corner stone in the beginning studies of any fledgling alchemist, and is quoted in almost every modern book pertaining to the study and practice of alchemy. The Rig Veda is believed to be at least six thousand years old and was the text used primarily by Indian alchemists. Indian alchemy and the studies of rasashastra are becoming more widely recognized and studied, making this a worthy resource for understanding alchemy on whole.
Though these texts come from vastly different places and different times, when compared side by side there are remarkable similarities. Although many ancient and sacred texts can be referenced and quoted for the sake of this exploration, only the two will be used as to maintain an air of simplicity.
Enough with prefaces, let’s explore how ancient alchemists thought of their own study and practice so that we may define and understand Alchemy.
From the Emerald Tablet:
“That which is below corresponds to that which is above, and that which is above corresponds to that which is below, in the accomplishment of the miracle of one thing”
And from the Rig Veda:
“He who knows the Father of this world as that which is below, associated with that which is above, and that which is above associated with that which is below, will have the mind of a sage.”
-Mandala 1, hymn CLXIV: 18
What does all that mean? And how does this talk of above and below explain what alchemy is?
Pulling apart these verses helps to isolate the truths that these texts are woven from.
We see that the Rig Veda describes the “Father of this world” as the Association of that which is above to that which is below. The Emerald Tablet also states that “all things have come from this one thing” (the association) - that “one thing” in the Emerald Tablet is the “father” we hear of in the Rig Veda.
What is this “one thing?” who or what is the “father?”
As stated above, the Father (the One thing) is defined as the Association of the “above corresponding to that which is below.”
ok, the “one thing/Father” is the association. But what is the “above and below” that are being referred to in these texts, and that our “one thing” is associated to and with.
The above was seen as the “heavens” - the macrocosm - that which is bigger than the biggest, or infinity. It was an inner world, a divine world, which gave birth to all that is.
The below was seen as the “Earth” – the physical manifestation - the microcosm - that which is smaller than the smallest – or the infinitesimal. It was the physicality of reality that was born from the Above.
In the Vedic perspective, the concept of below was known as point, and in contrast the concept of Above was known as infinite. To the Vedic sages, both of these concepts – the above and the below – were considered to be aspects of the self. Defining these in Sanskrit we see them named as Ananta – the infinite self, and Jiva – the point self or individual self.
Applying ancient Vedic perspective to our readings and understandings of the Emerald tablet helps to shed light on just what this thing called alchemy is.
Knowing the Above and below as aspects of the self we can see that when the infinite self (above) adopted a “point of view” to know itself, it became an individual (Jiva – the below) while still remaining infinite. This was known classically to the Vedics as Kshetragyah – the knower of the field. The “knower” was the one who has adopted a point of view as an individual to see itself as an infinite being of pure and unbounded consciousness. So then the “knower” becomes everything in between point and infinity. The Knower becomes the association between the above and the below.
The “one thing” who is the “father of this world” this “association” has now become the self. It is you. The self is not only the individual self and surely not the individual body, but rather the association between the individual and infinite, which is the whole. Whole can be defined as: Undivided, entire, or total. Whole signifies no separation, and no separation means there are no divisions between you and “it.” The world and the self. You, the association are the inside and the outside, the above and the below.
The association of the above and the below is the consciousness (which is you) - the awareness of the individual that proclaims to the self (consciousness) that “I exist – I am.” Consciousness in alchemical perspective was understood as Sulfur, which constitutes the soul of any individual form found in the universe. (Further readings pertaining to this topic – sulfur/soul - can be found in Truth of the Matter.)
Possessing true and unadulterated consciousness, one is made aware of both the individual self and infinite consciousness as the source of all. This individual, this knower, stands in-between point and infinity. His feet planted in the below and his head reaching into the above.
Understanding this association between the above and the below is the key to understanding the relationship between consciousness and matter which is the true essence of the science of Alchemy. By first understanding the association between consciousness and matter, one can then move on to the next step and become that association, becoming the “knower” of all that lies in-between point and infinity. The art and practice of alchemy is an avenue in which one can come to know that association and “know thy self.”
To answer the question of “What is alchemy?” in plain language: Alchemy is the understanding of the relationship between consciousness and matter. When these understandings are employed practically in the laboratory work, and internally to the psyche, the science and art of alchemy become manifest. Then the creations that come from the alchemist’s laboratory become the tools that he may use to direct his awareness back towards divine consciousness.
It is this definition of alchemy that must be standardized for truth to root into the minds and being of all. If alchemy is at all an “art of transformation” it is one that understands how consciousness creates and transforms itself into matter. Knowing alchemy as a practice and theory that recognizes the relationship of consciousness to matter, we can then unlock the general principles that structure alchemical theory (sulfur, mercury, & salt – The 4 elements – prima materia – etc.) Opening the doors to these understandings gives the power of wisdom back to every individual. Alchemy is just one of many paths that can be walked to know this and all as so. Understanding and incorporating this definition of alchemy is one step in recognizing the truths that alchemy points to and embodies.
|
|
Author
Avery is the lead Alchemist at Kymia Arts and routinely shares information on general alchemy topics as well as our methods and products. | https://www.kymiaarts.com/blog/archives/04-2014 |
Low-Power Computer Vision (LPCV) Challenge
LPCV is an annual competition that aims to improve the energy efficiency of computer vision for running on systems with stringent resource constraints. Visit the LPCV website to learn about the latest competitions.
LPCV is an evolution of the Low Power Image Recognition Challenge (LPIRC). Read about previous LPIRC competitions.
Low-Power Computer Vision (LPCV) Challenge at CVPR 2021
Date of 2021 LPCV Challenge: 1 August 2021
For more information on LPCV, visit lpcv.ai.
For more information on the 2021 IEEE Conference on Computer Vision and Pattern Recognition (CVPR), visit cvpr2021.thecvf.com.
Low-Power Computer Vision Workshop at ICCV 2019
2019 ICCV Workshop
Seoul, Republic of Korea
Monday, 28 October 2019
Read about previous LPIRC competitions
The 2019 IEEE Workshop on Low-Power Computer Vision concluded successfully on 28 October 2019 in Seoul. This workshop was co-located with the International Conference on Computer Vision.
This workshop features the winners of the past Low-Power Image Recognition Challenges, invited speakers from academia and industry, as well as presentations of accepted papers. Two tracks of on-site competitions were held. Google and Xilinx are the technical and financial sponsors of the on-site competitions.
In the FPGA (Field Programmable Gate Arrays) Track, the winners are:
|Rank||Team Name||Members||Emails|
|1||IPIU||Lian Yanchao, Jia Meixia, Gao Yanjie||[email protected]|
|2||SkrSkr||Weixiong Jiang, Yingjie Zhang, Yajun Ha||[email protected]|
|3||XJTU-Tripler||Boran Zhao, Pengchen Zong, Wenzhe Zhao||[email protected]
|
[email protected]
In the DSP (Digital Signal Processing) Track, the winners are:
|Rank||Team Name||Members||Emails|
|1||MIT HAN Lab||Tianzhe Wang, Han Cai, Zhekai Zhang, Song Han||[email protected]
|
[email protected]
[email protected]
[email protected]
|2||ForeverDuke||Hsin-Pai Cheng, Tunhou Zhang, Shiyu Li||[email protected]
|
[email protected]
[email protected]
The 2019 IEEE Low-Power Image Recognition Challenge (LPIRC) concluded successfully on 2020/01/31. Seven teams participated and submitted 163 solutions. This challenge has two different tracks: object detection and image classification. The winners’ solutions must outperform the solutions in earlier competitions.
Object Detection Track:
|Prize||Team||Member||Representative|
|First||MIT HAN Lab & Dawnlight||
||Tianzhe Wang ([email protected])|
|Second||Orange-Control (DiDi AI Labs)||
||Yue Shi ([email protected])|
Image Classification Track:
|Prize||Team||Member||Representative|
|First||MIT HAN Lab & Dawnlight||
||Tianzhe Wang ([email protected])|
|Second||EdgeAI, Qualcomm Canada||
||Chen Feng ([email protected])|
These teams’ solutions outperform the best solutions in literature. The winning classification model is 3% above the Pareto frontier of previous solutions (including baseline models like MobileNetV2, MnasNet, etc), while the best detection model is 5.6 mAP above previous solutions.
LPIRC started in 2015 with the aim to identify the technologies for computer vision using energy efficiently. IEEE Rebooting Computing has been the primary financial sponsor and provides administrative support. In 2019, sponsors are Google, Mediatek, Xilinx, and IEEE Circuits and Systems Society. Past sponsors include Facebook, Nvidia, IEEE GreenICT, IEEE Council of Design Automation, IEEE Council on Superconductivity. The 2019 LPIRC is organized by Purdue University and Duke University. Google provides a unified latency metric and an evaluation platform for the online track (also called On-Device Visual Intelligence Challenge).
In 2020, LPIRC is renamed to Low-Power Computer Vision Challenge (LPCVC). A new track is added for processing video captured by UAV (unmanned aerial vehicle). The 2020 LPCVC sponsors are Facebook, Xilinx, ELAN Microelectronics, Google, IEEE Rebooting Computing, IEEE Council of Electronic Design Automation, IEEE Circuits and Systems Societies. A workshop will be held on June 15, 2020 in Seattle (co-located with CVPR). More information is available at lpcv.ai.
2019 ICCV Workshop Gallery
Program for 2019 ICCV Workshop “Low-Power Computer Vision”
28 October 2019, Seoul
|Time||Speaker|
|08:30||Organizers’ Welcome
|
Yung-Hsiang Lu <[email protected]> and
Terence Martinez <[email protected]>
|08:40||Tensorflow Online Competition 2018-2019, Bo Chen <[email protected]>|
|08:50||2018 LPIRC Winners, Moderator: Peter Vajda <[email protected]>
|
|09:30||2019 LPIRC Winners, Moderator: Soonhoi Ha <[email protected]>
|
|10:10||Break|
|10:40||2018 and 2019 LPIRC Winner, Moderator: Bo Chen <[email protected]>
|
Award-winning Methods for Object Detection Challenge at LPIRC 2019, Tao Sheng <[email protected]>, Peng Lei <[email protected]>, and Yang Liu <[email protected]>
|11:10||New Perspectives, Moderator: Tao Sheng <[email protected]>
|
|12:40||Break|
|13:40||Paper Presentations, Moderator: Jaeyoun Kim <[email protected]>
|
|15:00||Break|
|15:20||Paper Presentations, Moderator: Hsin-Pai Cheng <[email protected]>
|
|16:40||Break|
|16:50||On-Site AI Acceleration Competition (by invitation only)
|
!-- Organizers:
|17:30||Adjourn|
Abstracts
08:50-09:10
Title: Algorithm-Software-Hardware Codesign for CNN Acceleration
Speaker: Soonhoi Ha <[email protected]>
Abstract: There are three approaches to improve the energy efficiency of computer vision algorithms based on convolution networks (CNN). One is to find an algorithm that gives better accuracy than the other known algorithms under the constraints of real-time performance and available resources. The second is to develop a new hardware accelerator with higher performance per watt than GPUs that are widely used. Lastly, we can apply various software optimization techniques such as network pruning, quantization, and low rank approximation for a given network and the hardware platform. While those approaches have been researched separately, algorithm-software-hardware codesign will give the better result than any one alone. In this talk, I will present an effort that has been made in our laboratory. We have developed a novel CNN accelerator, based on the hardware-software codesign methodology where CNN compiler has been developed on a simulator without hardware implementation. We are developing an NAS (Neural architecture search) framework for the CNN accelerator.
Biography: Soonhoi Ha a professor and the chair in the department of Computer Science and Engineering at Seoul National University. He received the Ph.D. degree in EECS from U. C. Berkeley in 1992. His current research interests include HW/SW codesign of embedded systems, embedded machine learning, and IoT. He is an IEEE fellow.
09:10-09:30
Title: The winning solution of LPIRC 2018 track3 and its applications to real world
Speaker: Suwoong Lee <[email protected]> and Bayanmunkh Odgerel <[email protected]>
Abstract: In this talk, we review the winning solution of LPIRC 2018 track3 and its practical applications. In the first part, detailed procedures for finding the winning solution are presented. We also present our approaches for improving the winning solution after LPIRC 2018 challenge. In the second part, several practical applications using our low-power image recognition techniques are introduced. Applications are reviewed in three aspects: software, hardware, and platforms. Finally, we conclude our talk by presenting future research directions.
Biography: Suwoong Lee is senior researcher at Electronics and Telecommunications Research Institute (ETRI). He received M.S at KAIST, and joined the creative contents research division at ETRI in 2007. He has researched various image understanding technologies and developed related products, before and after the deep learning era. His current research interest is lightweight object recognition technologies using deep learning.
The project’s contributors include Suwoong Lee <[email protected]>, Bayanmunkh Odgerel <[email protected]>, Seungjae Lee <[email protected]>, Junhyuk Lee <[email protected]>, Hong Hanh Nguyen <[email protected]>, Jong Gook Ko <[email protected]>.
Seungjae Lee is a principal researcher at the Electronics and Telecommunications Research Institute(ETRI). He has researched content identification, classification, and retrieval systems. Junhyuk Lee is CEO at Korea Platform Service Technologies (KPST). He founded KPST in 2008, and currently, he is leading deep learning and mobile edge computing R&D team at KPST. Hong Hanh Nguyen is currently working as a senior member of the R&D team of KPST. Her current research is focusing on object recognition solutions using deep learning on embedded devices. Jong Gook Ko is a principal researcher at ETRI. He joined the security research division at ETRI in 2000. His current research interest is object recognition technologies using deep learning. ETRI & KPST team participated in visual searching related challenges such as ImageNet challenge (classification and localization: 5th place in 2016, detection: 3rd place in 2017), Google Landmark Retrieval (8th place in 2018) and Low Power Image Recognition Challenge (1st place in 2018).
09:30-09:50
Title: Winning Solution on LPIRC-2019 Competition
Speaker: Hensen Chen <[email protected]>
Abstract: With the development of computer vision technology in recent years, more and more mobile/IoT devices rely on visual data for making decisions. The increasing industrial demands to deploy deep neural networks on resource constrained mobile device motivates recent research of efficient structure for deep learning. In this work, we designed a hardware-friendly deep neural network structure based on the characteristics of mobile devices. Combined with advanced training programs, our mode archive 8-bit inference top-1 accuracy in 66.93% on imagenet validation dataset, with only 23ms inference speed on Google Pixel2.
Abstract: Hensen is an algorithm engineer at Alibaba Group Inc. Hensen received Master degree in electronic engineering from Beijing University of Posts and Telecommunications in 2018 under the supervision of Prof. Jingyu Wang. Hensen’s research interest mainly focuses on model compression and efficient convolutional network.
09:50-10:10
Title: On-Device Image Classification with Proxyless Neural Architecture Search and Quantization-Aware Fine-tuning
Speaker: Ji Lin <[email protected]>
Abstract: It is challenging to efficiently deploy deep learning models on resource-constrained hardware devices (e.g., mobile and IoT devices) with strict efficiency constraints (e.g., latency, energy consumption). We employ Proxyless Neural Architecture Search (ProxylessNAS) to auto design compact and specialized neural network architectures for the target hardware platform. ProxylessNAS makes latency differentiable, so we can optimize not only accuracy but also latency by gradient descent. Such direct optimization saves the search cost by 200× compared to conventional neural architecture search methods. Our work is followed by quantization-aware fine-tuning to further boost efficiency. In the Low Power Image Recognition Competition at CVPR 19, our solution won the 3rd place on the task of Real-Time Image Classification (online track).
Biography: Ji is currently a first-year Ph.D. student at MIT EECS. Previously, He graduated from the Department of Electronic Engineering, Tsinghua University. His research interests lie in efficient and hardware-friendly machine learning and its applications
10:40-11:10
Title: Award-winning Methods for Object Detection Challenge at LPIRC 2019
Speaker: Tao Sheng <[email protected]>, Peng Lei <[email protected]>
Abstract: The LPIRC is an annual competition for the best technologies in image classification and object detection measured by both efficiency and accuracy. As the winners were announced at and LPIRC-II 2018 and LPIRC-CVPR 2019, our Amazon team has won the top prizes for object detection challenge and image classification challenge. We would like to share our award-winning methods in this talk, which can be summarized as five major steps. First, 8-bit quantization friendly model is one of the key winning points to achieve the fast execution time while maintaining the high accuracy on edge devices. Second, network architecture optimization is another winning keypoint. We optimized the network architecture to meet the latency requirement on Pixel2 phone. The third one is dataset filtering. We removed the images with small objects from the training dataset after thoroughly analyzing the training curves, which significantly improved the overall accuracy. The forth one is the loss function optimization. And the fifth one is non-maximum suppression optimization. By combining all the above steps, our final solutions were able to win the 1st prize of object detection challenge in the two consecutive LPIRC.
Biography: Dr. Tao Sheng is a Senior Deep Learning Engineer at Amazon. He has been working on multiple cutting-edge projects in the research areas of computer vision, machine learning in more than 10 years. Prior to Amazon, he worked with Qualcomm and Intel. He has strong interests in deep learning for mobile vision, edge AI, etc. He has published ten US and International patents and night papers. Most recently, he led the team to win the Top Prizes of IEEE International Low-Power Image Recognition Challenge at LPIRC-I 2018, LPIRC-II 2018, and LPIRC 2019. Dr. Peng Lei is currently an Applied Scientist at Amazon.com Services, Inc. His role is to apply advanced Computer Vision and Machine Learning techniques to build solutions to challenging problems that directly impact the company's product. He is an experienced researcher with a demonstrated history of working in both academia and industry. His research interests include object detection, person re-identification, temporal action segmentation, semantic video segmentation and motion estimation in videos. He received a Ph.D. degree from Oregon State University in 2018 with a successful record of publications including 2 CVPRs, 2 ECCVs, 1 ICCV, 2 ICPRs and 1 CVPR Workshop. He won 1st place in Low-Power Image Recognition Challenge 2019 and 4th place in DAVIS Video Segmentation Challenge 2017, and served as a reviewer for CVPR 2019, ICCV 2019 and AAAI 2020.
11:10-11:40
Title: Value-Based Deep Learning Hardware Acceleration
Speaker: Andreas Moshovos <[email protected]>
Abstract: I will be reviewing our efforts in identifying value properties of Deep Learning models that hardware accelerators can use to improve execution time performance, memory traffic and storage, and energy efficiency. Our goal it to not sacrifice accuracy and to not require any changes to the model. I will be presenting our accelerator family which includes designs that exploit these properties. Our accelerators exploit ineffectual activations and weights, their variable precision requirements, or even their value content at the bit level. Further, our accelerators also enable on-the-fly trading off accuracy for further performance and energy efficiency improvements. I will emphasize our work on accelerators for machine learning implementations of computational imaging. Finally, I will overview NSERC COHESA, a Canadian research network which targets the co-design of next generation machine learning hardware and algorithms.
Biography: Dr.Moshovos teaches at the Department of Electrical and Computer Engineering at the University of Toronto. He taught at the Northwestern University, USA, the University of Athens, Greece, the Hellenic Open University, Greece, and as a invited professor at the École polytechnique fédérale de Lausanne, Switzerland. He received a Bachelor and a Master Degree from the University of Crete, Greece and a Ph.D. from the University of Wisconsin-Madison.
His research interests lie primarily in the design of performance-, energy-, and/or cost-optimized computing engines for various applications domains. Most work thus far has been on high-performance general-purpose systems.My current work emphasizes highly-specialized computing engines for Deep Learning. He will also be serving as the Director of the newly formed National Sciences and Engineering Research Council Strategic Partnership Network on Machine Learning Hardware Acceleration (NSERC COHESA), a partnership of 19 Researchers across 7 Universities involving 8 Industrial Partners. He has been awarded the ACM SIGARCH Maurice Wilkes mid-career award, a National Research Foundation CAREER Award, two IBM Faculty Partnership awards, a Semiconductor Research Innovation award, an IEEE Top Picks in Computer Architecture Research, and a MICRO conference Hall of Fame award. He has served as the Program Chair for the ACM/IEEE International Symposium on Microarchitecture and the ACM/IEEE International Symposium on Performance Analysis of Systems and Software. He is a Fellow of the ACM and a Faculty Affiliate of the Vector Institute.
11:40-12:10
Title: Ultra-low Power Always-On Computer Vision
Speaker: Edwin Park <[email protected]>
Abstract: The challenge of on device battery power computer vision is to process computer vision at ultra low power. In tis talk, we will discuss computer vision looking at the entire pipeline from sensor to results.
Biography: Edwin Park is a Principal Engineer with Qualcomm Research since 2011. He is directly responsible for leading the system activities surrounding the Always-on Computer Vision Module (CVM) project. In this role, he leads his team in developing the architecture, creating the algorithms, and producing models so devices can “see” at the lowest power. Featuring an extraordinarily small form factor, Edwin has designed the CVM to be integrated into a wide variety of battery-powered and line-powered devices, performing object detection, feature recognition, change/motion detection, and other applications.
Since joining Qualcomm Research, Edwin has worked on a variety of projects such as making software modifications to Qualcomm radios, enabling them to support different radio standards. Edwin has also focused on facilitating carriers’ efforts worldwide to migrate from their legacy 2G cellular systems to 3G, allowing them to increase their data capacity. Edwin Park’s work at Qualcomm Research has resulted in over 40 patents.
Prior to joining Qualcomm, Park was a founder at AirHop Communications and Vie Wireless Technologies. Edwin had various engineering and management positions at Texas Instruments and Dot Wireless. He also worked at various other startups including ViaSat and Nextwave.
Park received a Master Electrical Engineering from Rice University, Houston, TX, USA and a BSEE specializing in Physical Electronics and BA in Economics also from Rice University.
12:10-12:40
Title: Hardware-Aware Deep Neural Architecture Search
Speaker: Peter Vajda <[email protected]>
Abstract: A central problem in the deployment of deep neural networks is maximizing accuracy within the compute performance constraints of low power devices. In this talk, we will discuss approaches to addressing this challenge based automated network search and adaptation algorithms. These algorithms not only discover neural network models that surpass state-of-the-art accuracy, but are also able to adapt models to achieve efficient implementation on low power platforms for real-world applications.
Biography: Peter Vajda is a Research Manager leading the Mobile Vision efforts at Facebook. Before joining Facebook, he was a Visiting Assistant Professor in Professor Bernd Girod’s group at Stanford University, Stanford, USA. He was working on personalized multimedia system and mobile visual search. Peter completed his Ph.D. with Prof. Touradj Ebrahimi at the Ecole Polytechnique Fédéral de Lausanne (EPFL), Lausanne, Switzerland, 2012.
13:40-14:00
Title: Direct Feedback Alignment based Convolutional Neural Network Training for Low-power Online Learning Processor
Speaker: Donghyeon Han <[email protected]>
Biography: Donghyeon Han received the B.S. and M.S. degree in electrical engineering from the Korea Advanced Institute of Science and Technology (KAIST), Daejeon, South Korea, in 2017 and 2019, respectively. He is currently pursuing the Ph.D. degree. His current research interests include low-power system-on-chip design, especially focused on deep neural network learning accelerators and hardware-friendly deep learning algorithms.
14:00-14:20
Title: A system-level solution for low-power object detection
Speaker: Fanrong Li <[email protected]>
Biography: Fanrong Li is a Ph.D. student at the Institute of Automation, Chinese Academy of Science. His research interests mainly focus on analyzing and designing computer architectures for neural networks as well as developing heterogeneous reconfigurable accelerators.
14:20-14:40
Title: Low-power neural networks for semantic segmentation of satellite images
Speaker: Gaetan Bahl <[email protected]>
Biography: Gaetan is a first year PhD Student at INRIA (French Institute for Research in Computer Science and Automation), funded by IRT Saint-Exupery and working on Deep Learning architectures for onboard satellite image analysis. After receiving his Master's degree from Grenoble INP - Ensimag in 2017, he worked in the photogrammetry industry for a year on digital surface model generation from drone imagery and deep learning for segmentation of 3D urban models.
14:40-15:00
Title: Efficient Single Image Super-Resolution via Hybrid Residual Feature Learning with Compact Back-Projection Network
Speaker: Feiyang Zhu <[email protected]>
Biography: Feiyang is a graduate student at the College of Computer Science of Sichuan University.
15:20-15:40
Title: Automated multi-stage compression of neural networks
Speaker: Julia Gusak <[email protected]>
Biography: Julia received her Master's degree in Mathematics and Ph.D. degree in Probability Theory and Statistics from Lomonosov Moscow State University. Now she is a postdoc at Skolkovo Institute of Science and Technology in the laboratory "Tensor networks and deep learning for applications in data mining", where she closely collaborates with Prof. Ivan Oseledets and Prof. Andrzej Cichocki. Her recent research deals with neural networks compression and acceleration. Also, she is very interested in audio-related problems, in particular, dialogue systems, text to speech and speaker identification tasks.
15:40-16:00
Title: Enriching Variety of Layer-wise Learning Information by Gradient Combination
Speaker: Chien-Yao Wang <[email protected]>
Biography: Chien-Yao Wang received the B.S. degree and PH. D. degree in applied computer science and information engineering from National Central University, Zhongli, Taiwan, in 2013 and 2017. Currently, he is a Postdoctoral Research Scholar in the Institute of Information Science, Academia Sinica. His research interests include signal processing, deep learning, and machine learning. He is an honorary member of Phi Tau Phi Scholastic Honor Society.
16:00-16:20
Title: 512KiB RAM is enough! Live camera face re-identification DNN on MCU
Speaker: Maxim Zemlyanikin <[email protected]>
Biography: Maxim is a deep learning engineer at Xperience AI. His research interests are image retrieval in various fields (face recognition, person re-identification, visual search in fashion domain) and low-power deep learning (neural network compression techniques, resource-efficient neural network architectures). Maxim received his MSc in Data Mining from the Higher School of Economics in 2019.
16:20-16:40
Title: Real Time Object Detection On Low Power Embedded Platforms
Speaker: George Jose <[email protected]>
Biography: George Jose completed his gradation in Electronics and Communication Engineering from National Institute of Technology, Calicut. He then completed his post graduation at IIT Bombay where he worked on beamforming techniques to improve distant speech recognition using microphone arrays. Currently he is working as Assistant Software Engineer at Harman International. In his 2 years of experience in the software industry, he has worked on a wide range of areas like object detection for ADAS systems, autonomous indoor navigation, adversarial defence mechanisms, speaker identification, keyword detection etc.
Organizers
- Alexander C Berg, Associate Professor, University of North Carolina at Chapel Hill, [email protected]
- Bo Chen, Software Engineer, Google Inc. [email protected]
- Yiran Chen, Associate Professor, Duke University, [email protected]
- Yen-Kuang Chen, Research Scientist, Alibaba, [email protected]
- Eui-Young Chung, Professor, Yonsei University, [email protected]
- Svetlana Lazebnik, Associate Professor, University of Illinois, [email protected]
- (contact) Yung-Hsiang Lu, Professor, Purdue University, [email protected]
- Sungroh Yoon, Associate Professor, Seoul National University, [email protected]
References
- Y. Lu, A. M. Kadin, A. C. Berg, T. M. Conte, E. P. DeBenedictis, R. Garg, G. Gingade, B. Hoang, Y. Huang, B. Li, J. Liu, W. Liu, H. Mao, J. Peng, T. Tang, E. K. Track, J. Wang, T. Wang, Y. Wang, and J. Yao. Rebooting computing and low-power image recognition challenge. In 2015 IEEE/ACM International Conference on Computer-Aided Design (ICCAD), pages 927–932, Nov 2015.
- K. Gauen, R. Rangan, A. Mohan, Y. Lu, W. Liu, and A. C. Berg. Low-power image recognition challenge. In 2017 22nd Asia and South Pacific Design Automation Conference (ASP-DAC), pages 99–104, Jan 2017.
- K. Gauen, R. Dailey, Y. Lu, E. Park, W. Liu, A. C. Berg, and Y. Chen. Three years of low-power image recognition challenge: Introduction to special session. In 2018 Design, Automation Test in Europe Conference Exhibition (DATE), pages 700–703, March 2018.
- Sergei Alyamkin, Matthew Ardi, Achille Brighton, Alexander C. Berg, Yiran Chen, Hsin-Pai Cheng, Bo Chen, Zichen Fan, Chen Feng, Bo Fu, Kent Gauen, Jongkook Go, Alexander Goncharenko, Xuyang Guo, Hong Hanh Nguyen, Andrew Howard, Yuanjun Huang, Donghyun Kang, Jaeyoun Kim, Alexander Kondratyev, Seungjae Lee, Suwoong Lee, Junhyeok Lee, Zhiyu Liang, Xin Liu, Juzheng Liu, Zichao Li, Yang Lu, Yung-Hsiang Lu, Deeptanshu Malik, Eun-byung Park, Denis Repin, Tao Sheng, Liang Shen, Fei Sun, David Svitov, George K. Thiruvathukal, Baiwu Zhang, Jingchi Zhang, Xiaopeng Zhang, and Shaojie Zhuo. 2018 low-power image recognition challenge. CoRR, abs/1810.01732, 2018.
- Yung-Hsiang Lu, Alexander C. Berg, and Yiran Chen. Low-power image recognition challenge. AI Magazine, 39(2), Summer 2018. | https://rebootingcomputing.ieee.org/lpirc |
Tag Archives: Addition
The last post about enVisionMATH and how I, as a math person and dad, go about trying to make sense of what my 6-year old brings home from first grade seems to have struck a chord among parents. The comments have been outstanding and there seems to be a real need for this kind of conversation. So I have a few more such posts coming up soon, starting with this one.
The 6-year old brought this home on Monday. Click to enlarge:
It’s about adding “near doubles”, like 3 + 4 or 2 + 3. In case you can’t read the top part or can’t enlarge the photo, here are the steps — yes, there are steps, and that’s kind of the point of this post — for adding near doubles:
“You can use a double to add a near double.” It gives: 4 + 5 and shows four blue balls and five green balls.
“First double the 4”. It shows 4 + 4 = 8, and the four blue balls, and four of the green balls with the extra green ball sort of falling to the ground.
Then it says: “4 + 5 is 4 + 4 and 1 more.” At this point you really have to look at the worksheet itself, because it’s hard to put into words what is going on:
And from there, in the fourth frame, one of the girls in the earlier frame concludes that 4 + 5 must be 9 because 8 and 1 more is 9.
The Guided Practice section has the kids doing four near-double sums. Clearly, the way the worksheet wants kids to learn how to do this is not simply to add 2 + 3, but (1) to recognize that 3 is 2 plus 1 more, (2) add 2 + 2, and (3) then add 1 to the result of 2 + 2:
There’s a thing at the bottom asking kids to explain the process and then a bunch of near-double sums to practice — presumably kids are supposed to use the method described above, but there’s nothing forcing them to do so — and some “algebra” questions with blanks in the place of variables.
I’m not sure exactly how my brain goes about adding near doubles — whether it just somehow does the addition in ways that are almost automatic thanks to 35 years of repetition, or whether there are little tricks it employs — but I am absolutely certain that I don’t do it the way enVisionMATH is telling kids how to do it. I tried it. When I read the worksheet, I thought about near-doubles that aren’t so easy, like 121 and 122. Quick! Add those together. Did you think, “122 is 121 plus one more; 121 + 121 = 242; 242 and 1 more is 243” ? I didn’t — not by a long shot. I just added the numbers together. No methods, no tricks; just old-school addition. There may be some tricks that my brain invokes to “just add the numbers” — for example, I tend to visualize the two terms of the sum stacked atop each other in the classic vertical arrangement for adding, and then visually add the digits — but I am most definitely not going through the four-step process on this worksheet.
In fact, the four-step process complicates matters so much that it’s inexplicable why they are even bringing it up. Most kids at this stage can add 2 + 3 or 5 + 6 in one step. But by introducing this method, there are four operations: comparison (find the larger of the two near-doubles), subtraction (take 1 from the larger number), addition (add the two duplicates), and another addition (add 1 to the result). Technically there is a fifth operation kids have to perform, namely recognize that the two numbers they are adding are near-doubles in the first place.
One might argue that doubling a number (in the third step) is easier than adding it to itself — kids just recognize that doubling 5 gives 10, for instance — and subtracting 1 is a very easy special case of subtraction in general that nearly everybody at this age can do without thinking, similarly for adding 1 at the end. That may be so, but it can’t be so much easier that adding in steps 1, 2 and 4 results in a net reduction in complexity or a net gain in conceptual understanding.
But what about kids who can’t add two one-digit numbers together in one step? There are some of those out there, including probably a few in my daughter’s class. This method doesn’t help those kids. Again, we may argue that adding 4 + 5 is considerably harder than the combined process of comparison, subtracting 1 from 5, doubling 4, then adding 1. But I don’t think so. A four-step process is no less cognitively demanding than a single-step process, even if the four steps are easy. And besides, life does not throw near-doubles at you to add. How is a kid going to learn to add 2 + 5, or 2/5 + 7/8, or 123.38 and 99.99 this way?
If there is some research that suggests that people really do add near doubles this way, I would love to see it. Otherwise it’s hard for me to believe that any more than a tiny fraction of the human population actually does it this way. Is there going to be some mind-blowingly cool way to do complicated arithmetic in one’s head farther down the road that uses this idea, like multiplying numbers that are near-squares or something? Perhaps I should be more patient. But for the time being, I told the 6-year old just to add the numbers together like she already knows how to do, the old-fashioned way.
| |
During my career at the NC Museum of Natural Sciences I once was forwarded a call from someone that was curious about something they had seen in their yard. She wanted to know what species of tiny hummingbirds were visiting her flowers. After a brief discussion, we came to the conclusion she was seeing one of a group of day-flying moths collectively known as Clearwing Moths, and based on her description of the colors, most likely the aptly named Hummingbird Clearwing.
This common eastern species, Hemaris thysbe, has coloration and foraging behavior reminiscent of a Ruby-throated Hummingbird, but is much smaller. A Hummingbird Clearwing Moth has a wingspan of about 1.5 – 2 inches, whereas the bird, the Ruby-throated Hummingbird, has a wingspan of 4.5 inches. Yet it is easy to see how people could mistake these diminutive rapid fliers for the bird. They hover and flit from flower to flower sipping nectar with their long proboscis. Their wings have reddish borders and they often have a greenish hue to the “hairs” on their stout bodies. These photographs of the adult moths were taken last week while visiting my parent’s in southwest Virginia. They have several Butterfly Bushes (Buddleia sp.) which are magnets for these beautiful moths.
One thing you notice when you watch one of these moths is the blur of their wings as they hover and feed. Try as I might, I could only occasionally get part of both wings in focus even at high shutter speeds. No wonder, as it is estimated they beat their wings 30-35 times per second (compare that to a Ruby-throated Hummingbird with an average of 50-60 beats per second). One thing the rapid burst of photos did reveal is the pattern of movement in the wings – the figure-8 motion (the photo above shows the start of the backward sweep of the figure 8), which provides lift in both directions.
I also noticed several individuals of the similar-looking Snowberry Clearwing (Hemaris diffinis) feeding on the Butterfly Bushes. They closely mimic bumblebees in coloration and are often called Bumblebee Moths. In one online discussion forum I even saw someone refer to these as looking half hummingbird, half bumblebee – a bumblebird! The main differences between them and the Hummingbird Clearwing is that this species tends to be slightly smaller and has a blackish abdomen with a yellow band (sometimes not complete) near the tip.
Both species have a long proboscis they insert into flowers to obtain nectar. They often place their front pair of legs on the flower as they hover and feed.
Both Hummingbird and Snowberry Clearwings are members of the hawk moth or sphinx moth family, Sphingidae. They are among the few strictly diurnal (day-flying) members of that family and are found throughout most of the eastern United States and Canada. Their caterpillars are similar to many other sphinx moth larvae in that they have a distinctive curved horn on their posterior end (caterpillars of this family are often called hornworms). The Hummingbird Clearwing’s horn is often bluish and they have a row of orange and white spots along each side surrounding the breathing pores (spiracles).
Snowberry Clearwing larvae have blackened dots along their spiracles and a horn that is yellow at the base with a black tip. Both species use various species of Haw (Viburnum sp.) and Honeysuckle (Lonicera sp.) as host plants. I always look for them on Arrowwood Viburnum and Coral Honeysuckle in my area. | https://roadsendnaturalist.com/2013/07/29/tiny-hummers-and-bumblebirds/ |
Angelica Mortis Tactica II
Note: This tactica is now old and needs an update. Many facts will not be correct for current game. However the general gist is pitched right.
This article was written by Brother Luther in Spanish and then translated. I have gone through it to tidy some odd translations — making them more understandable — but being careful not to alter the original message of the writer.
Isiah.
The perfect army
We can almost affirm with total certainty that a perfect army does not exist, at least not against all type of enemies and sceneries. For this reason, the exhaustive search of combinations, the optimization of units, the election of unbalanced armies or to be fluff-faithful to the background are mere rules you use to make the army, but they will never allow you to reach the ideal list that always ensures success.
I do not mean that these points do not have to be considered, but I am totally in agreement with commentaries that the famous game designer Jervis Johnson made in one of his interviews:
[…] the composition of an army supposes a minimum difference compared with the factor to learn to use that army until doing it well.
This is a basic truth that many players ignore, because they put their faith in winning — leading to an eternal mad dash towards those armies that they consider have better rules/weapons etc.
Everyone has their own preferences and I am not a Chaplain to give lessons of ways, but as an active general with enough campaigns under my belt I defend that true knowledge of strategy is only discovered after the use of balanced armies over a great amount of time and against widely varied opponents.
The reasons are simple:
- you will know all your weak and strong points,
- as they are balanced they are never completely tuned against any foe, which gives you certain manoeuvre margin to fight.
When you win a game thanks to a unit that was second choice that is when you will begin to see the true possibilities of your army; and only when you know how to use with effectiveness each one of the units in your Codex do you have the criteria of being able to discard them. But of course then you don't discard them because you recognise that every unit has a precise role and application. At this moment I am building my Ravenwing army. Among other objectives I wanted to be able to win at least one tournament with each of the 3 pure strains of Dark Angels (Deathwing, Ravenwing and Battle Companies), but now my true intention is to be able to deepen the understanding of handling units of bikes. The change of focus is that, although I have been years playing with power armour and terminators armies, I have never used bikes enough to handle them properly.
Another example that comes to mind here was my experience with units of Assault squads and Tactical squads in Drop Pods. For five years Assault squads were to all intent and purpose 'forgotten' by me as I never managed to see them in one of my army lists. Now, the second (Tac squads in Drop Pods) as soon as they appeared in the Space Marine Codex, became my main battle horse for long time. Nevertheless, with patience and many games, I could verify the great virtues of the assault groups and the serious deficiencies of drop pod quads. At present it is rare that I use my Battle Companies without a unit of jump packs, whereas I take a great deal of consideration in thinking if I should include units in drop pods.
The concept of balance
If we are facing the impossible mission to reach perfection in an army list (and hoping not to fight against our Nemesis army someday), then it is that better that we have decided to opt for 'balance'. When we speak of which army is balanced, what we mean is that it has a wide range of tactical capabilities; this variety does not cause it to be superior in any one facet in particular, but it also won't have great deficiencies in other facets either.
Therefore, to be able to speak of balance in an army it is necessary to know those parameters that govern it. It is not possible to establish what are exactly all the attributes that give form to an army, although I am going to propose, as an example, some of the likely attributes:
- Mobility
- Resistance
- Numbers
- Firepower
- Assault
- Morale
Next we are going to deepen in each of these aspects.
Mobility
We understand mobility as the capacity of an army to move by the battlefield. This is one of the simplest factors to evaluate, and is vitally important since it can condition the real possibilities of an army, like:
- to fulfil its objectives in a certain mission,
- to manoeuvre for being able to avoid, or on the contrary to lock, enemy units.
Example 1:
An army composed by Tactical and Devastator squads conforms a rigid, powerful and resistant block. Nevertheless, if they do not come with transports or the support of other faster units they can't be very effective because: a) they would behave very predictably once deployed (this is because that is relatively simple to avoid their firing lines and very complicated to avoid undesired assaults with them), and b) they are too slow to move to occupy distant objectives.
If we pay attention to mobility that units have, then we must classify between units with:
- Real mobility.
Units that have great mobility and/or fire-movement capabilities, e.g.: tanks, bikes, speeders, dreads.
- Apparent mobility.
Units that can be deployed in any battle zone but have limited built-in mobility, eg: scouts, squads in drop pods, terminators.
- Little mobility.
Units with limited built-in mobility, eg: infantry without transports.
Example 2:
Our army totally formed by units in drop pods fighting against an expeditionary Tau force that has gravitational tanks and many units of battle suits with jetpacks. In principle it would seem that marines have advantage, since the deep strike with drop pods is quite safe and a devastating tactic. Nevertheless, during the game, Space Marine squads came to play and produced great Tau losses, but unfortunately that was not enough to completely annihilate their army. But once on the ground as the space marine force is formed exclusively by infantry units (and with guns of a limited range), the Tau survivors do not have great problems to manoeuvre away to a safe distance in which they can patiently decimate the marines with ranged firepower.
In this simple example we can see that it is very important to know the real possibilities your army, since sometimes a poor perception of your forces or your enemy's mobility can leave you in serious disadvantage.
Resistance
This attribute basically means to us the difficulty that an adversary will have in destroying your units. It is determined by the model's attributes of toughness, armour and special saves. Although to have a high resistance can be a decisive factor to avoid wounds; this will also depend in great extent on the equipment/guns of our enemy.
Example 3:
The greater resistance of the Ravenwing bikes makes them almost invulnerable to Strength 3 attacks; the terminator armour makes them almost invulnerable to the majority of the artillery and ranged weapons.
But be aware, there are always weapons that ignore the improvements to Resistance that you have paid dearly for.
Example 4:
The use of plasma guns to kill bikes or Terminators is very efficient, since the armour and toughness of both are insufficient versus this kind of weapons.
Due to the randomness of enemies it is almost impossible not find an enemy unit that can annihilates yours easily. For that reason we return again to the concept of balance in the army list, since by means of the use of different units we can try to do more against those dangerous units with the more adequate units at our disposal.
Example 5:
A player can't decide between using a Land Raider or several Rhinos as transports. In the end he decides to use one of each. The Rhino is an expendable transport that can be used without fear even when the opponent has great amount of melta weapons, something not recommended if your transport is a Land Raider… worth 1/6 of your army! Nevertheless the Land Raider can protect the Rhino (and advance together) in battles where the enemy has many ranged weapons of strength 6 or 7.
Numbers
The numbers is a fundamental factor since it is intimately related to the capacity of your army to be able to:
- tackle different objectives/missions simultaneously,
- use deceit manoeuvres or feints,
- be able to respond when you suffered many losses.
Small armies usually are very powerful and/or can carry out better manoeuvres, but they also can be easily overwhelmed themselves and almost they do not allow easily the change of tactics during the game.
Example 6:
Deathwing is a hard army that is best to concentrate in a small area of the battlefield, which is ideal for missions to hold and keep objectives. Ravenwing, on the other hand, has a fantastic capacity to change its positions according to the evolution of the game, which makes it ideal to carry out manoeuvres to refuse a flank. Nevertheless, both armies usually include very few figures — the reason why they can lose a game in one or two very unlucky lucky turns!!
To use a greater number usually gives more capacity to throw something back, because even though you suffered many losses you will be able to respond. Normally a greater number is associated with worse equipped troops, but even they can improve themselves by taking advantage of cover by staying in ruins or forests.
Example 7:
Battle companies allow you to deploy about 40-50 Marines in normal games, which allows for a greater margin of losses during the game. In addition, as you are using many units, it is an army that can approach different missions easily (some units advance while others give fire support). Unfortunately, Tactical squads never will be able to give you the deadly potential offered by the proud members of 1st and 2nd Companies.
Firepower
This is probably the first attribute that is perceived by a player when studying his enemy. The firepower can be classified based on the number of arms available in an army among the following three types:
- Anti-light infantry (high AP, high rate of fire)
eg: bolter, flamer, heavy bolter, missile launcher (frag ammo),
- Anti-heavy infantry (low AP, upper-middle Strength and rate of fire)
eg: plasma weapons,
- Anti-tank (low AP, high Strength, low rate of fire)
eg: melta weapons, lascannon, missile launcher (krak ammo).
The use of each type of guns confers a determining advantage against certain types of units, but, as we commented previously on the players combinations chapter, as much to lack as to abuse of a certain type of firearms can be fatal in certain cases.
Example 8:
A brother Dark Angel commander without anti-tank weapons will have a bad experience against an armoured company of the Imperial Guard. After that debacle, that same brother decides to include up to 12 lascannons in his army. Although he gets himself a deserved revenge victory against the same Imperial Guard, later he has the misfortune to fight in another battle against a horde of more than 100 greenskins!
To have a great firepower usually helps to win, but sometimes this potential is only apparent, since it can be very affected by some factors, among them:
- Weapons' range,
- Line of sight (LOS), which can be limited in the battlefield,
In both cases mobility plays a decisive role, since those more static units can lose much effectiveness, whereas the moving ones gain effectiveness.
Example 9:
A devastator squad can be vital in an open field game, but in urban combat they probably can't fire at all some turns. That same squad is equipped with fearsome plasma cannons (range 36 inches) in open field, nevertheless a Dark Eldar reaper squad (with weapons of 48 inches range) can destroy them easily without fear of any reply.
Three bikers of the Ravenwing can keep at distance a squad of 5 Chaos Marines armed with 4 melta guns. They just have to keep away between 18 and 24 inches of the traitors, so they can shoot with their own twin linked bolters without themselves being in danger.
Assault
Assault is the second more determining factor in great amount of battles, and it is intimately bounded with the mobility of the army. So that an assault unit will be effective depending on the number of miniatures that can get into to the combat and how quickly (directly related to its mobility) and if it's equipment/weapon is adequate. If we take care of mobility, we can generally observe that armies usually have troops to assault (whose objective is to break the enemy lines) and/or counter-charge (whose objective is to stop the enemy charges). In the first class of assault troops are included those units with real mobility, whereas the counter charge units can be limited.
Example 10:
Bikes, assault squads with jump packs and, by smaller degree due to their greater mobility, units in transports are all considered primary assaulting units.
Besides the previous ones, veterans, terminators and dreadnoughts are valid units as counter-charge units. And as a last resort, tactical or scout squads can be used to counter-charge too.
As we mentioned previously, it is important to emphasize the second decisive parameter for an assault is the type of weapons available. Thus, we can differentiate between close combat weapons of:
- Moderate strength (conventional weapons),
- Moderate Strength, those that ignore armour saves (power weapons lightning claws and some psychic weapons),
- High strength, those that ignore armour saves (power fists, thunder hammers).
Depending on the kind of enemy we can see that each weapon could either be very efficient or totally useless.
Example 11:
A terminator with lightning claws is ideal against almost any unit of infantry, but against all type of vehicle he is incapable of damaging it easily.
It is fundamental to remember that independent of the fact that a unit can be used for any situation, it's much better to use it for combats where their abilities or equipment are more efficient. Not only must you consider the final victory of a combat, but also the cost that this combat involves and the repercussions that it will produce in the context of the battle.
Example 12:
Suppose that to maintain your fire line you must counter charge an Ork horde. Although it can win, a unit of terminators can suffer badly against a tide of Orks, still more if some hidden power claws are present. But if we also have a small assault squad, these men probably do the work better and with less risk. In addition, going this way we would release terminators for use against other more dangerous units, like for example a Big Boss and his escort mob, a threat that would make short work of the space marines assault squad.
Conversely, terminators can be used to charge against a flying Hive Tyrant that is dangerously near to our devastator squads and armoured vehicles. It is a dangerous play in which you can lose a very expensive unit, but in case of not acting the damage that it could cause in you fire line could be fatal.
Morale
Leadership is not usually considered until you are aware of the lack of it! The use of Fearless units is a great advantage of our army. To attack the morale of the adversaries is a secondary aspect, but it always must be present in the plans of an Unforgiven general.
Example 13:
Necron warriors are fearsome adversaries, and it is especially not recommended to carry out short ranged shooting against a huge phalanx of them, since their high toughness/armour and the 'We'll be back' rule makes them almost untouchable. On the other hand, a tactical squad with a fist or power weapon supported by a Chaplain could make enough damage in a close combat charge. If you cause enough casualties then he will have to take a Leadership test that could be difficult and they might not pass, and due to this that enormous unit could be fall back and be annihilated in the process.
Conclusion
These are only some of the parameters that can characterize an army. At the time of choosing your army it is vital to know which advantages are offered by each type of unit, thus then you will be able to establish what your strong points and weaknesses will be. The combination of some units will give to your battleforce excellent victory possibilities, but remember you must be the one who takes the game to where you can to better realise those advantages.
Good luck brother! | https://www.thedarkfortress.co.uk/tactica_reports/angela_mortis_tactica2.php |
According to media regulator Ofcom, which worked with the Information Commissioner’s Office to produce the Online Nation report, the average British adult spent three hours and 15 minutes a day online last year.
That was up 11 minutes from 2017, amounting to 1,192 hours or 50 days over the year, while three-quarters (75%) of people’s total time online was on mobile devices.
More than a third (35%) of the total time spent online was on sites owned by Google or Facebook. For example, around nine in ten internet users visit YouTube every month, spending an average of 27 minutes a day on the site, while a similar proportion visit Facebook, spending an average of 23 minutes a day there.
However, trust in how online providers protect users’ data varies considerably, with public trust highest for BBC News (67%) and Amazon (66%), but much lower for Facebook (31%) and YouTube (34%).
And after another year of damaging headlines about how some companies have used personal information, there has been a marked increase in the number of people who are worried about using the internet.
The proportion of those concerned has jumped from 58% to 78% in a year, with 61% of adults reporting they had a potentially harmful online experience in the past year, rising to 79% among children aged 12 to 15.
The potential online harms most commonly encountered by adults in the past year were unsolicited emails (34%), fake news (25%) and scams or fraud (22%).
Adult users also cited Facebook (28%), Instagram (16%) and Twitter (12%) as the leading sources of potentially harmful experiences.
Among children, 39% experienced offensive language online, 28% had received unwelcome friend requests, 23% encountered cyber-bullying and 20% had encountered trolling.
And although most adults (59%) agree that the benefits of going online outweigh the risks, as many as 70% say they would welcome tighter rules for social media sites, up from 52% in 2018. About two-thirds say the same about video-sharing sites (64%) and messaging services (61%).
“As most of us spend more time than ever online, we’re increasingly worried about harmful content – and also more likely to come across it,” said Yih-Choung Teh, group director of strategy and research at Ofcom. | https://www.warc.com/newsandopinion/news/brits-increasingly-concerned-about-going-online/42155 |
It fuels your body and helps your body produce energy. Pulses are rich in Vitamins A, B, C and E. They also contain a good proportion of minerals like potassium, iron, and zinc. Rice and flour fulfils the required carbohydrate, protein, and fiber consumption of the body.
Why is Indian food so healthy?
The Indian diet is noted for its inclusion of many spices, pulses and rice, not forgetting its variety of flavours and colours which are what make this cuisine so unique. Being generally low in fat, high in vegetables, fruit and lean meat, an Indian diet has many health benefits. … Low in saturated fat. Widely vegetarian.
Is eating Indian food healthy?
Curd, beans, lentils, chicken, fish or meat not only provide essential amino acids, but are also good sources of healthy fats and is low in calories. Therefore, it is safe to say that a typical Indian meal comprises of good carbs, healthy natural protein and resistant starch which is beneficial in weight loss.
What makes Indian food special?
Spices: The spices used in Indian cooking are not powdered. … These spices, when mixed, give a distinct and unique flavor to it. The complicated combination of spices and herbs in Indian cuisine makes the dishes stand out. Unlike several other countries, Indians don’t use the simple procedure of using pre-mixed spices.
Why is Indian food so unhealthy?
Indian food is fattening and unhealthy
While cooking at home, one is mindful of things like the type and amount of oil used. One ensures that oil once used is not reused for frying or cooking, a practice that causes oxidation of oil, thereby rendering it harmful to the body.
Which Indian cuisine is healthiest?
Best & Worst Indian Dishes for Your Health
- Scroll down to read all. 1 / 15. Order: Dishes With Dal. …
- 2 / 15. Skip: Naan. …
- 3 / 15. Order: Tandoori Proteins. …
- 4 / 15. Skip: Pakoras. …
- 5 / 15. Order: Chana Masala. …
- 6 / 15. Skip: Saag Paneer. …
- 7 / 15. Skip: Samosas. …
- 8 / 15. Order: Aloo Gobi.
What is the healthiest Indian dish?
Indian
- Try to avoid: any creamy curries, such as korma, passanda or masala with pilau rice, naan, bhajis, pakoras and poppadoms.
- Healthier options: tandoori-cooked meat or jalfrezi or madras with chicken, prawns or vegetables, plain rice and chapatti.
How bad is Indian food for you?
The variety of foods, spices and dishes that are native to India makes Indian food one of the most wholesome foods in the world. But lately, Indian food has begun to be categorised as unhealthy because it is being linked to high sugar and high carb food which can contribute to high cholesterol.
Why is Indian food so dirty?
The raw vegetables are often carrying harmful bacteria and aren’t thoroughly washed, which can all lead to E. coli infections and food poisoning.
Is Indian cuisine the best?
Indian cuisine is among the top ten popular cuisines in the world, standing at number nine, with an average popularity score of 62% across the 24 countries. Other than their own cuisine, which 93% of Indians claim to like, they also have a palate for Italian (80%), Chinese (77%) and American cuisines (75%).
Is Chinese food better than Indian food?
Northern Chinese food tends to feature more meat dishes and wheat-based dishes. Southern Chinese food tends to feature more vegetable dishes and rice-based dishes. So, I think Southern Chinese food is healthier. So, the conclusion is, Indian and Chinese food both are just as healthy and as unhealthy as each other.
Which Indian food is famous in the world?
Biryani is one of the most popular Indian cuisines that is served in all parts of the world. Experts say, this is a classic concoction of rice and chicken and has more variants than any other dish in the world.
Why Indian food is so tasty?
With its use of cumin, tamarind, pepper, and other powerful spicy ingredients ensuing taste combinations unlike anything found around the globe. There is a reason why Indian food is so tasty—it is the fewer numbers of overlapping flavors in ingredients that bring out a unique flavor. | https://liet.org/for-travelers/why-should-i-eat-indian-food.html |
prevented him from joining us.
Pete had been planning how to mount
his new air horn to his bike. Pete has so many items on his handle
bars it is difficult to position everything. We finally figured out
a way to get the horn on using plastic tie straps similar to how I mounted
the air horn to my bike. When Pete was first planning the install of
the horn he was pulling at the wires on his speedometer and he pulled the
wires apart. This has been an ongoing problem for Pete for quite a
while now. I couldn't believe he was actually tugging at the wires
after al the trouble he had to get them working again after the initial
time he broke the wire. This wire is small and delicate. It
took a while but Pete eventually did get the wire fixed and now he just
broke it again. I couldn't help but laugh when I saw what he had
done. The look on his face expressed how he felt, mad at himself for
doing something so stupid. I quickly took out my phone and too a
couple pictures right after Pete broke the wire. See the end of this
story for the pictures of Pete's broke speedometer wire. In one of
the pictures you get a nice view of the special club ID bracelet Tom had
made in Mexico.
For a change of pace Pete and I took
a different route from one of our regular routes. The only problem
is I can't remember the route so I can't share any detail. I do
remember it was different and I also remember commenting to Pete during
the ride that it was interesting riding in an area that we typically don't
ride. My sense of direction is not very good, matter of fact it is
horrible, almost non-existent. I'm sure I have mentioned this fact
before, I don't even try to pretend I have a sense of direction, I admit
my problem and even joke about it. One of the nice things about this
problem is almost all my bike rides are an adventure. Once I have
ridden the same area or route a few dozen times I start to remember, but
it really does take quite a few trips before it starts to sink in.
We started this ride a little before
lunch time and we decided to head to Hamlin Pub for lunch. I know I
have said this many times, but it is worth repeating, you just can't go
wrong with Hamlin Pub. All the meals are good and the service is
always fantastic. Since we are regulars at the Pub they treat us
well. We had a nice lunch and spent a few minutes watching some of
their many flat screen TVs located through out the place.
After lunch we got back on our bikes
and rode pretty much straight home. Nothing special happened on the
way home. Now that Pete has his air horn mounted to his bike he has
been using it at opportune moments and surprisingly enough he hasn't used
it a few times when he had the chance to startle someone. He keeps
threatening to use it on the trail the next time we come across a horse
rider. I keep telling Pete that using his air horn around a horse is
not a good idea, I hope he is just joking. A lot of time the horse
riders turn out to be mounted police and you can't tell right away a
mounted police from a casual horse rider. It would make for a good
story if Pete got arrested for blowing his air horn at a mounted police.
I would probably have to get his bike out after it was impounded and I
would assume Elaine would get Pete bailed out. I think I would ask
Pete to stay in jail just one night so we would have some additional
material for an interesting story.
We haven't gone north on paint creek
trail (PCT) for a long time, I think it is time to plan a ride to Lake
Orion on the trail. There is an event planned for June 3, 2006 near
the old Paint Creek Cider Mill. See the following excerpt of an
email I received from
Kristen Myers, Trailways Coordinator, Paint Creek Trailways Commission for
information on the event and also some general information about the
trail.
I think the event on June 3 sounds
fun, I am planning to ride to this event, so any one that wants to join me
is welcome. Tom and Barry, this would be a good day to come out for
a ride.
I guess I got a little off track,
but I was pretty much done with the story from this ride anyhow.
Following are the statistics from this ride, 17.0 total miles, 22.5 max
mph, 1 hour and 32 minutes time moving on bikes and an even 11.0 average
mph, another decent paced ride. | http://rhpctbikeclub.zpinaddict.com/ride_stories/2006/dt060414.htm |
We call a positive integer an antiprime if it has more divisors than any positive integer less than that number. Example antiprime numbers are: 1, 2, 4, 6, 12, 24.
The first and only line of standard input contains a single integer n, 1 ≤ n ≤ 2,000,000,000.
In the only line of standard output your program should write one integer - the largest antiprime number not greater than n. | https://www.acmicpc.net/problem/8027 |
Tea and Folklore
LIGHT OF DAY is including this bit of tea folklore just for fun!
“GYPSY’S SECRET”: The Tea Reading
Put a pinch of tea leaves in the cup and pour boiling water over them, allowing it to stand about three minutes. Drink the contents of the cup leaving tea leaves and a very small amount of liquid in the bottom.
The person whose fortune is to be told, call the “sitter” or “consultant”, should then take the cup by the handle in the left hand, rim upwards, and move it in a circle rapidly three times from left to right some of the tea leaves will seem to cling to the sides of the cup while others remain in the bottom. Next slowly invert the cup over the saucer and leave it there until all liquid drains away.
The “sitter” should approach the oracle in all seriousness and during the ritual should concentrate on his or her future destiny and “wish” that the symbol shall correctly represent happenings to come.
The handle of the cup represents the “sitter” in his or her own “sphere” or “residence” and is the “south” point of the compass. This fixed point designates “letters to” the consultant or “journeys away from”, “visitors to be expected”, distance “to and from”, etc.
The cup is divided into three parts. The rim designates the present; the side, events not far distant; and the bottom the distant future. The nearer the symbols appear to the handle the nearer to fulfillment will be the events foretold.
Telling Fortunes
Now the “seer” receives the cup from the “sitter” and proceeds to tell “his” or “her” fortune, unless of course one is to tell one’s own fortune. The “seer” should concentrate upon the cup and upon the “consultant”. The “seer” will observe that the tealeaves are scattered over the cup in apparent confusion but it will be noted after concentration that they form lines, circles, dots, small groups and figures.
Note carefully the shapes and figures assumed by the leaves. Turn the cup and view from different angles until the symbols become clear. Be patient and search carefully for symbols and not their position. The more you search the clearer they become. Note the resemblance to various objects, and their relation to each other. Sometimes bad omens will be offset by good ones; good ones may be strengthened or weakened by others, good or evil, and so on.
“The tea cup reveals good fortune (1,4,5) for you. I see a lover (3) and much success. I see the letter “L”- perhaps his name begins with “L” but you have not met him yet because he seems to be in the future – not far distant perhaps but not in the present. I see success is about to crown some venture you have undertaken or are about to undertake. But there seems to be difficulties closing in upon (2) you in the near future”.
“Fear not in this tea cup good fortune more than outweighs the bad. I see a marriage, possibly you own (4) or a friend’s. It seems certain that this good fortune that is coming will be most unexpected”.
Such objects as cats, trees, flowers, letters, numbers, etc., will be discerned by the exercise of the “seer’s” observation and imagination. Possibly these may be unconsciously strengthened by a keen intuition. Each symbol possesses some significance. They may be large or small and their size may determine their relative importance. For instance: if the likeness of a “Septre” should be observed it would mean that the “sitter” should expect some honor bestowed upon him or her. If the symbol were small, the honor received would be small and if the symbol were large, the honor might be great.
Then again: a few tea leaves may form a group that might in turn form a letter such as “M”. If this letter “M” should be close to a symbol resembling a “serpent” which is bad luck, it might mean that the “sitter” should guard against an enemy whose name begins with “M”. If on the other hand the letter “M” should appear near a symbol of a bird flying towards the handle of the cup (the “residence”) it might mean that the sitter would receive a letter from, or news of, a person whose name begins with “M”. If on the other hand the letter “M” should appear near a symbol of a bird flying towards the handle of the cup (the “residence”) it might mean that the sitter would receive a letter from, or news of, a person whose name begins with “M”. Again: If the bird were flying away from the “residence”, the sitter would be sending a letter to the person “M”.
The small tealeaves frequently form lines. A line means a journey, a long line a long journey, etc. The direction of the journey may be determined by the direction of the line. If a line should approach and reach the handle and the sitter should be away from home it would mean that he or she would return. If the line should end before it reaches the handle it would mean that the “sitter” would move to another residence. A wavy or broken line means delayed journeys and straight-line quick journeys. If a number such as “6? should be observed it would mean a journey of six days or six weeks; or possibly a journey to be taken in six weeks, etc., etc.
Dots surrounding a symbol indicate money in some form depending on the symbol. Should a leaf cling to the edge or rim of the cup some event foretold by the symbols in the cup is imminent. Someone may be thinking of the “sitter” at the very moment. Look for a letter to find a clue to the identity of this person.
Observe the complete picture as a whole as well as individual symbols for often-bad omens may outweigh good omens or vice versa. One large distinct good omen may outweigh several smaller hazy bad omens. Good and bad should be balanced against each other in determining the forecast.
If mysteries should be revealed to you, question them if you will, but cherish and keep the Gypsy’s secret.
– Princess Romana
MEANING OF SYMBOLS
ACORN—Continued health—improved health.
ANCHOR—Lucky symbol. Success in business or in love. If blurred or indistinct just the reverse.
HEART—A lover. If close to a ring, marriage to the present lover. If indistinct, the lover is fickle.
| |
The ongoing tussle between NASA and Congress for choosing the Europa Clipper’s launch vehicle looks to be continuing this year as well. The Europa Clipper is the space agency’s spacecraft that is intended to launch five years from now and study Jupiter’s moon Europa. Europa is believed to have water beneath its icy surface, and the Clipper intends to determine the moon’s habitability.
This mission has seen NASA administrator’s come at odds with Congress regarding its launch vehicle. Congress wants NASA to use Boeing’s Space Launch System, dubbed ‘SLS’ for the Clipper mission. SLS will replace Space Shuttle and is NASA’s chosen spacecraft for sending missions to the Moon under the Artemis program scheduled to land astronauts on the lunar south pole in 2024. The agency, on the other hand, wishes to use commercial launch vehicles for launching the Europa Clipper to Europa.
Now, in its budget request for the fiscal year 2021, NASA has estimated that such a move will save it and the U.S. taxpayer approximately $1.5 billion.
SpaceX’s Falcon Heavy Reusable Heavy-Lift Vehicle To Allow NASA $1.5 Billion Savings Over Boeing’s Space Launch System (SLS)
When choosing the Europa Clipper’s launch vehicle, NASA needs to keep in mind the time that it will take the vehicle to reach the moon, the path that it will follow to get there, the total thrust produced by the mission’s launch vehicle and the cost of using a particular launch vehicle. The first block of Boeing’s SLS that will carry the Artemis missions to the Moon is capable of producing 8.4 million lbs of thrust at liftoff, and with it, the expected time frame for the Europa Clipper mission to make it to Jupiter is estimated as approximately 3 years.
Estimates made by NASA suggest that completion of the spacecraft will take two to three years, and end in November 2023. Using the SLS is expected to cost NASA in between $750 million – $1 billion for the launch only – and launch costs are only one part of the equation that determines the final bill for the Clipper’s launch.
Even though NASA believes that the spacecraft itself will be ready for launch by the end of 2023, this does not mean that it will have an SLS launch vehicle ready to take it to space. SLS is unlikely to be free until 2025 at the earliest, and given that the Clipper spacecraft will be completed by 2023, the agency will have to account for storage costs during the period. These, based on prior missions, are estimated to be between $10 million – $12 million per month for the geostationary satellites and $3 million – $5 million for polar satellites.
SpaceX Falcon Heavy is less than one-fifth of SLS’ cost-per-launch but is also significantly underpowered in comparison to the super heavy-lift launch vehicle
Additionally, and before we get to the launch costs of the two alternatives to the SLS for launching the Clipper in orbit around Jupiter, it’s important to estimate the costs of storing the spacecraft. Storing it for two years will cost NASA in between $36 million – $60 million, assuming that an SLS is free and available for use at the end of 2025.
Given that it packs the biggest power punch of all options for sending Clipper to Jupiter, the SLS is also the most expensive launch vehicle option available to the space agency. Using the SLS will cost NASA at least $900 million per launch according to Administrator Bridenstine, and this price can only go up given that the estimate was provided in 2019.
In comparison, using the SpaceX Falcon Heavy’s variant capable of putting at least 26 tons into geostationary orbit (36,000 kilometers above the earth’s surface) will cost $150 million per launch. This variant of the Falcon Heavy is capable of generating a maximum thrust of 5.13 million lbs at liftoff given that its center core engines are running.
Aside from the Falcon Heavy, United Launch Alliance’sc Delta IV Heavy is also capable of carrying the 6 ton Clipper mission to Jupiter’s orbit. The Delta IV Heavy generates 2.1 million pounds of thrust at liftoff and costs between $350 million – $400 million per launch.
With deliberation for launch vehicle continuing, design parameters for Europa Clipper should remain in limbo
Performing rudimentary calculations lets us determine the cost savings ourselves based on the information available. Using the Falcon Heavy is the cheapest option available to NASA for sending the Clipper to Jupiter, yet the launch vehicle is not the lowest at the thrust spectrum’s end. Switching to SpaceX’s product will save the agency at least $750 million in per-flight launch costs, $60 million in storage costs for total minimum savings of $810 million – a figure that’s still short of the $1.5 billion range that the agency has stated in its latest budget request.
However, the savings do carry opportunity costs. Given that Boeing’s SLS is the most powerful launch vehicle of the three discussed in this piece, it also carries with it the potential to directly take the Clipper to its polar orbit around Jupiter. If the Clipper is launched using the SLS, then nine months after liftoff (depending on liftoff date) the Clipper mission only has to make one maneuver to insert itself in Jupiter’s orbit.
As opposed to this, if SpaceX Falcon Heavy is the Clipper launch vehicle, then the mission may have to make as much as three gravity assists before maneuvering and another after gravity assist from earth four years after launch (once again, depending on launch date). These stand to extend the mission time to six years.
Another option that would avoid the need for these time-taking and dangerous gravity assists (some of which would place the Clipper close to the Sun) is strapping the SpaceX Falcon Heavy with Orbital ATK’s 48BV kick stage. This would remove the need for dangerous Venus flybys and reduce the mission’s time duration.
Looking at NASA’s latest estimate of $1.5 billion cost savings, we have an inkling that the agency might also be factoring in savings through the Artemis program if resources dedicated to the SLS are not diverted for the Clipper mission. The sooner this decision is taken is the sooner Clipper designers will be able to breathe easily.
When this will happen, only time can tell. | https://techlastweek.com/2020/02/16/spacex-can-save-nasa-1-5-billion-through-falcon-heavy-based-missions-to-jupiter/ |
Helen Coombs (harpsichord and fortepiano) “A man who has not been in Italy is always conscious of an inferiority, from his not having seen what is expected a man should see.” Dr Johnson Long before the Grand Tour of the...
Featured
Lunchtime Concert
Music
Oct
6
Tue
2015
Aspects of Love
October 6, 2015 @ 1:10 pm – 1:50 pm
Musicke in the Ayre: Philippa Neaverson (soprano) & Din Ghani (lute) As well as songs about the torment of cruel lovers, Philippa and Din perform works celebrating hope, joy and contentment in love. They also include songs that recognize the...
Featured
Lunchtime Concert
Music
Oct
20
Tue
2015
Danzi’s Horn Sonatas
October 20, 2015 @ 1:10 pm – 1:50 pm
Anneke Scott (natural horn) & Steven Devine (fortepiano) Leading principal horn Anneke Scott and harpsichordist Steven Devine present two of Franz Danzi’s sonatas for fortepiano and natural horn.
Featured
Lunchtime Concert
Music
Nov
3
Tue
2015
Atlantic Treasures
November 3, 2015 @ 1:10 pm – 1:50 pm
ATLANTIC TREASURES: BRITISH AND AMERICAN LATE ROMANTIC ART SONGS Catherine Greenwell (Soprano) Michael Cockerham (Steinway) This programme showcases some of the finest composers of art songs in the late 19th and early 20th century from both sides of the Atlantic....
Featured
Lunchtime Concert
Music
Nov
17
Tue
2015
Piano Music Inspired by Nature
November 17, 2015 @ 1:10 pm – 1:50 pm
Abigail Wise (Steinway piano) The recital will be mainly composed of French piano works inspired by the natural world. It will begin with some miniatures originally written for harpsichord by Rameau and Daquin. Also included are some Romantic Lyric pieces...
Featured
Lunchtime Concert
Music
Dec
1
Tue
2015
A Golden Period of Songs
December 1, 2015 @ 1:10 pm – 1:50 pm
Richard Frewer (Tenor) David Price (Steinway Piano) Richard Frewer and David Price explore song at the turn of the nineteenth and twentieth centuries in a recital which also includes poetry readings from the age.
Featured
Lunchtime Concert
Music
Mar
8
Tue
2016
A voice of One’s Own
March 8, 2016 @ 1:10 pm – 1:50 pm
Lunchtime Concert: A Voice of One’s Own Triptych Rachel Marsh (Soprano) Kirsten Miller (Cello) Philip May (Steinway piano) Marking International Women’s Day, Triptych trio are performing a selection of works written by women. The programme includes pieces by Amy Beach,...
Lunchtime Concert
Music
Jun
14
Tue
2016
Fantasies and Sonatas
June 14, 2016 @ 1:10 pm – 1:50 pm
Internationally renowned pianist Prach Boondiskulchok will perform a programme of the rarely heard music of Stepan and J. C. Bach, alongside favourite works of the classical era by C.P.E. Bach and Mozart. The works will be performed on the Holburne...
Lunchtime Concert
Music
Jul
12
Tue
2016
Songs from Bohemia, Bavaria and Vienna
July 12, 2016 @ 1:10 pm – 1:50 pm
This choir of men’s voices often performs in partnership with a horn quartet, but on this occasion is accompanied by the Holburne’s historic Steinway Grand. The programme includes From a Bouquet of Slavonic Folksongs by Dvorak, Beethoven’s moving Prisoners’ chorus...
Lunchtime Concert
Music
Sep
13
Tue
2016
Striving for the Divine
September 13, 2016 @ 1:10 pm – 1:50 pm
A selection of songs by Schubert and chamber music by Beethoven – early Romantic music with the profound longing for higher worlds. The Danish trio Strings of Joy will perform in accurate Regency costumes. The ensemble consists of soprano Maria...
Featured
Lunchtime Concert
Music
Dec
6
Tue
2016
A Celebration of English and Festive Song
December 6, 2016 @ 1:10 pm – 1:50 pm
Soprano Lucy Simon and pianist Patricia Robertson-Glasgow perform a festive recital of English song from our much-loved native 20th Century composers Benjamin Britten, Ralph Vaughan-Williams, Herbert Howells and Peter Warlock. Enjoy a magical atmosphere of folk-music inspired melodies and Christmas-tide...
Exhibition
Lunchtime Concert
Music
Apr
18
Tue
2017
A Life in Flux
April 18, 2017 @ 1:10 pm – 1:50 pm
A Life in Flux is a companion musical programme to the special exhibition Under Changing Skies, featuring prints by Anne Desmet RA. Songs from three regions – Spain, Germany and the Americas – convey kaleidoscopic experiences of change: political upheaval,...
Exhibition
Lunchtime Concert
Music
May
9
Tue
2017
A Flemish Foray
May 9, 2017 @ 1:10 pm – 1:50 pm
The Netherlands in the time of the Brueghels was pivotal for Renaissance music, with composers of the Franco-Flemish school emerging as key players across Europe. Antwerp’s printers were active in publishing some of their work to a popular audience, while...
Lunchtime Concert
Music
Jul
11
Tue
2017
Flight of the Firebird
July 11, 2017 @ 1:10 pm – 1:50 pm
Nicolai Rimsky -Korsakov was one of the group of Russian composers known as “the Five” and the concert consists of works by him and composers associated with or influenced by him. He was keen on developing a nationalistic style of...
Lunchtime Concert
Music
Sep
12
Tue
2017
In the Still of the Night
September 12, 2017 @ 1:10 pm – 1:50 pm
Let us dream! It is the hour…This recital brings together songs from across the centuries that are reflections on the power of reverie and the nature of dreams. From Handel’s salutation to Morpheus the god of sleep, through the late...
Lunchtime Concert
Music
Nov
14
Tue
2017
A Classical Moment
November 14, 2017 @ 1:10 pm – 1:50 pm
This Autumn, join Gary Branch as he performs a collection of eighteenth-century pieces on our very own Schantz fortepiano. This lunchtime recital will take you on a journey into the world of eighteenth-century London and reveal the life of music...
Lunchtime Concert
Music
Mar
20
Tue
2018
The Golden Days of My Spring
March 20, 2018 @ 1:10 pm – 1:50 pm
Maria Danishvar Brown (Soprano) Vera Kovaleva Lewis (Piano) Join us as we celebrate Sergei Rachmaninov’s Birthday on the Museum’s own Steinway piano which he used for his British concerts from 1929-38. The songs by Sergei Rachmaninov are loved in Russia...
Lunchtime Concert
Music
Jun
12
Tue
2018
I will sing of my Love
June 12, 2018 @ 1:10 pm – 1:50 pm
“I will sing of my Love”: Scottish and English 18th century Songs for Voice and Historical Harps Anne Lewis and Bill Taylor present a programme of Scottish and English 18th-century songs, airs and dance tunes for voice and historical harps....
Lunchtime Concert
Music
Jul
3
Tue
2018
Consonant Connections
July 3, 2018 @ 1:10 pm – 1:50 pm
Consonant Connections: A musical perspective on 17th century Anglo-Dutch relationships Explore seventeenth-century Anglo-Dutch music in this lunchtime recital. In honour of our temporary exhibition, Prized Possessions, this recital looks at Constantijn Huygens – musician, poet, art connoisseur and statesman (and...
Lunchtime Concert
Music
Oct
3
Wed
2018
Music of the Georgian Theatre
October 3, 2018 @ 2:10 pm – 2:50 pm
Experience the music of the Georgian stage! Florentine Arts Ensemble present an invigorating programme of music that explores the challenges faced by 18th-century performing artists. Discover the public’s attitude toward music and the theatre, and the development of what became...
Subscribe to filtered calendar
Add to Timely Calendar
Add to Google
Add to Outlook
Add to Apple Calendar
Add to other calendar
Keep in touch
Email
Facebook
Twitter
Pinterest
Sign up for The Holburne Museum News and Updates
Name:
Email:
Great news, we've signed you up.
Sorry, we weren't able to sign you up. Please check your details, and try again.
Contact Us
The Holburne Museum Great Pulteney Street Bath BA2 4DB
01225 388569
[email protected]
Opening Hours
We are open daily 10am to 5pm (Sunday and Bank Holiday 11am to 5pm). Closed 24 to 26 December and 1 January.
Privacy and Cookies
© The Holburne Museum, 2014
Website by
The Web Foundry
Your name:
Your email address:
Send to email address,
comma separated
for multiple emails.
Cancel | https://www.holburne.org/events-view/action~posterboard/page_offset~-1/time_limit~1549497599/tag_ids~57/cat_ids~87/ |
Zachary Cross doesn't like to fall.
"You'd think doing this sport I'd be more OK with that. But I'm not. I like stay in my comfort zone," says Cross, a Chattanooga pogo enthusiast. "Basically, I just don't practice tricks. Trek pogo, that's what I like to call what I do."
Rather than focusing on tucks, grabs or spins, trek pogo is about speed and distance.
In 2017, one year after he began pogoing, Cross claimed the Guinness World Record for fastest pogo-mile at 9 minutes, 35 seconds. One week later, his record was broken. A month after that, it was broken again, setting the new world record at 7 minutes, 40 seconds, where it stands today.
Zachary “The Pogo Guy” Cross
Age: 20
Job: Full-time humanities major at University of Tennessee at Chattanooga; part-time employee at Mojo Burrito
Hometown: Chattanooga
Farthest distance traveled by pogo: 4 miles
Fastest pogo-mile to date: 8 minutes, 25 seconds
Claim to fame: 2017 Guinness World Record-holder for fastest pogo-mile at 9 minutes, 35 seconds*
*The current world record is 7 minutes, 40 seconds, which was set just a month after Cross’.
Pogo goal: To win back the world record
Cost of professional pogo stick: $430
Surprising fact about pogoing: “It’s all in your core.”
Best reaction: “Once, I had just come through Coolidge Park, and somebody shouted, ‘You’re my inspiration!’”
This July, Cross had the opportunity to go stick-to-stick with the other two record-breakers during Pogopalooza, a two-day extreme pogo competition hosted in Wilkinsburg, Pennsylvania. Leading up to the event, the three worked together to organize this special event in which they'd compete against one another in a 1-mile pogo race.
Cross came in second with a time of 8 minutes, 25 seconds.
(Read more: Kennedy: UTC sophomore hopped into history with pogo stick world record)
"I definitely shaved some time off my previous record, so I felt good about that," he says.
Back in 2017 when his world record was broken in a week, Cross says, "It was kind of funny, but I was also kind of like, I need to get that again."
In addition to reclaiming his record, Cross' other pogo goal is to learn a few tricks, just to round out his pogo resume. He'd also like to one day complete a marathon on his pogo stick — a feat accomplished only once before. In 2014, one man traveled 26.2 miles over 24 hours on his pogo stick, earning him, of course, a Guinness World Record.
"That might be a long-term, extreme goal," Cross says. "But it's floating around in my brain for sure." | https://www.timesfreepress.com/news/getout/bestmonth/story/2019/nov/01/chattanooga-world-record-breaking-pogo-guy/506811/ |
Background of the Invention
Field of the Invention
Description of related art
Summary of the Invention
Brief Description of the Drawings
Description of the Preferred Embodiment
The present invention relates in general to graphic display technique, and more specifically to a rotated graphic pattern generating system for rotating a graphic pattern stored in a display memory so that a rotated graphic pattern can be displayed.
Heretofore, in order to rotate a given graphic pattern, two methods have been known:
A first method includes an individual coordinate transformation of a required rotational angle ϑ of respective dots included in a source graphic pattern on a dot by dot basis. All of this processing is executed on the program-basis.
A second method uses a X-direction straight line generator and a Y-direction straight line generator. The X-direction straight line generator is used to rotate one line of X direction included in a source graphic pattern to be rotated, and the Y-direction straight line generator is used to rotate a left side of the source graphic pattern to be rotated, i.e., a reference point (or a leading point) of each line of the X direction. These generators are used in combination to convert respective dots included in the source graphic pattern in an incremental manner starting from the reference point.
The first method needs a large amount of calculation of trigonometric functions, because the coordinate transformation must be performed for each dot by using the trigonometric functions. Therefore, a long calculation time is inevitably required, and a large amount of hardware must be installed. On the other hand, the second method is free from the above mentioned defect of the first method, because the coordinate transformation can be obtained from only repeated addition and subtraction based on a straight line generation algorithm.
Here, the second method will be explained in more detail with reference to the drawings. Figure lA illustrates one example of dot distribution included in a given rectangular pattern P on a source coordinate. Figure lB illustrates a rotated straight line generated by the X-direction straight line generator from a line L₁ included in the source pattern P. Figure lC illustrates a rotated pattern generated by the X-direction straight line generator and the Y-direction straight line generator in combination from the rectangular pattern P on the source coordinate shown in Figure lA.
(A) the destination coordinate position (XD+l, YD), or
(B) the destination coordinate position (XD+l, YD+l).
First, the line L₁ included in the rectangular pattern P on the source coordinate and in parallel to the X-axis of the source coordinate is rotated. For this purpose, the X-direction straight line generator is used to perform the coordinate transformation starting from the leading dot a₁ (XS₁, YS₁) of the line L₁ to the trail end dot on the same line L₁ on such a dot by dot basis that after one dot is coordinate-transformed, another dot adjacent to the transformed dot is coordinate-transformed next, so that the coordinate-transformed dots are plotted on a destination coordinate. Now, assuming that the dot (XS₁, YS₁) on the source coordinate is transformed to a dot (XD, YD) on the destination coordinate, and a rotational angle ϑ is less than 45 degree, the dot (XS₁+l, YS₁) adjacent to the dot (XS₁, YS₁) on the line L₁ is transformed to
Which of (A) and (B) is selected is determined each time a dot is plotted on the destination coordinate so that there is minimized a deviation between the dot pattern plotted on the destination coordinate and a straight line M₁ obtained by geometrically rotating the line L₁ by an angle ϑ. In the example of Figure lB, (A) and (B) are alternately selected. If the rotation angle ϑ is made further small, the time of the selection of (A) will become large.
In the manner as mentioned above, the position to which one dot on the source coordinate is to be coordinate- transformed i.e., moved is determined on the destination coordinate system, and then, the dot information on the source pattern corresponding to that dot is rewritten to the dot position determined on the destination coordinate. Thereafter, the coordinate transformation of the next dot is executed in the same manner.
Thus, the above mentioned processing is repeatedly performed until the drawing operation is completed over the full length DH of the line L₁ in the X direction. Thereafter, the coordinate transformation is executed on the second line L₂. In this operation, a dot position on the destination coordinate corresponding to the leading dot of the line L₂ on the source coordinate is generated in the Y-direction straight line generator. Then, the other dot positions on the destination coordinate corresponding to the second and succeeding dots of the line L₂ are produced by the X-direction straight line generator, so that a rotated pattern of the second line L₂ is drawn.
The above operation is repeated over a full length DV in the Y direction. Thus, the rotated pattern is drawn as shown in part in Figure lC.
However, the second method as mentioned above is disadvantageous in that unredrawn portions are generated in the rotated pattern as indicated by Z₁, Z₂, Z₃ in Figure lC. In the unredrawn portions, the information before the rotation of the pattern remains. This is called "bugs". The rotated pattern having dot lack portions in the redrawn area cannot have a natural feeling.
Accordingly, it is one object of the present invention to provide a rotated graphic pattern generating system which is free from the above mentioned defects of the conventional ones.
Another object of the present invention is to provide a rotated graphic pattern generating system capable of generating a rotated graphic pattern having no unredrawn portion.
Still another object of the present invention is to provide a rotated graphic pattern generating system which comprises only a slight additional elements in comparison with the conventional one and which can produce a rotated graphic pattern having no unredrawn portion.
The above and other objects of the present invention are achieved in accordance with the present invention by a rotated pattern generating system which includes at least a X-direction straight line generator adapted to calculate, when there is to be determined a position on a destination coordinate of a next dot adjacent to a just before coordinate-transformed dot in the X direction on a source coordinate, a difference in X- and Y-directions between the position of the just before coordinate-transformed dot on the destination coordinate and a position of the next dot to be coordinate-transformed on the destination coordinate, which difference is determined by the difference on the source coordinate between the just before transformed dot and the next dot to be transformed and a required rotational angle 8, wherein the improvement comprises a detector connected to the X-direction straight line generator for discriminating whether or not a dot lack occurs each time the X-direction straight line generator generates an output, and a dot generator in response to the output of the detector to generate, when a dot lack is discriminated to generate, a signal which cause to draw on the position of the dot lack the same dot information as that of the dot adjacent to the dot lack position in the destination coordinate.
With the above arrangement, when a dot lack will occur, the position where the dot lack will occur is supplemented with the same dot information as that of the adjacent dot position in the destination coordinate. Therefore, no unredrawn portion will occur in the rotated pattern on the destination coordinate, and therefore, the rotated pattern is free from unnaturalness.
According to another aspect of the present invention, there is provided a rotated pattern generating system for rotating by a given rotational angle ϑ a dot pattern information stored in a given area in a display memory, comprising:
a display memory storing a dot information for a dot pattern to be rotated by a given rotational angle ϑ;
a source coordinate register for holding a dot coordinate position in a source coordinate defining the dot pattern before the pattern rotation;
a destination coordinate register for holding a dot coordinate position on a destination coordinate defining a dot pattern after the pattern rotation;
a X-direction straight line generator for generating a first pair of increment signals of zero or integer for X-and Y- directions, the increment signals being respectively representative of a difference in X- and Y- directions between the destination coordinate position of the just before coordinate-transformed dot and the destination coordinate position of the next dot to be coordinate-transformed, in accordance with the given rotational angle ϑ and on the basis of the difference on the source coordinate between the just before coordinate-transformed dot and the next dot to be coordinate-transformed;
a Y-direction straight line generator for generating a second pair of increment signal of zero or integer for X-and Y- direction, the second increment signals being respectively representative of a difference in X- and Y-directions between the destination coordinate position of the just before coordinate-transformed dot and the destination coordinate position of the next dot to be coordinate-transformed, in accordance with the given rotational angle ϑ and on the basis of the difference on the source coordinate between the just before coordinate- transformed dot and the next dot to be coordinate-transformed;
adder receiving the first and second increment signals and the current coordinate position data held in the destination coordinate register so as to output, as the next destination coordination position data, the results of addition to the destination coordinate register;
a drawer receiving the data from one of the source coordinate register and the destination coordinate register to calculate an address of the display memory to be accessed and to output the calculated address to the display memory;
a dot information register for holding a dot information read out from the address of the display memory designated by the drawer;
a processing unit for initializing the above mentioned generators and registers and controlling the read/write of the display memory; and
a dot generator discriminating whether or not a dot lack occurs each time the X-direction straight line generator generates the increment signal, and for generating, when a dot lack is discriminated to generate, a signal which cause to draw on the position of the dot lack the same dot information as that of the dot adjacent to the dot lack position in the destination coordinate.
The above and other objects, features and advantages of the present invention will be apparent from the following description of the preferred embodiment of the invention with reference to the accompanying drawings.
Figure lA illustrates one example of a dot distribution included in a given rectangular pattern on a source coordinate;
Figure lB illustrates a rotated straight line generated by the X-direction straight line generator from a line L₁ included in the source pattern;
Figure lC illustrates a rotated pattern generated by the X-direction straight line generator and the Y-direction straight line generator in combination from the rectangular pattern on the source coordinate shown in Figure lA;
Figure 2 is a block diagram showing one embodiment of the rotated pattern generating system in accordance with the present invention;
Figure 3A illustrates one example of a dot distribution included in a given rectangular pattern on the source coordinate;
Figure 3B illustrates a rotated straight line generated by the system shown in Figure 2 from a line L₁ on the source coordinate shown in Figure 3A;
Figure 3C illustrates a rotated pattern generated by the system shown in Figure 2 from the rectangular pattern on the source coordinate shown in Figure 3A; and
Figure 4 is a flow chart illustrating the operation of the system shown in Figure 2.
Referring to Figure 2, there is shown one embodiment of the rotated pattern generating system in accordance with the present invention. The shown system comprises a processing apparatus l0 adapted to perform necessary programmed calculations and programming operations and to control associated circuits. Namely, the processing apparatus l0 is associated with a X-direction straight line generator l2 and a Y-direction straight line generator l4. The former generator l2 is adapted to perform the following operation: When there is to be determined a position on a destination coordinate of a next dot adjacent to a reference or leading dot of a X-direction line on a source coordinate or a just before coordinate-transformed dot of a X-direction line on the source coordinate, the X-direction straight line generator l2 calculates a difference in X- and Y- directions between the destination coordinate position of the leading dot or the just before coordinate-transformed dot and the destination coordinate position of the next dot to be coordinate-transformed, in accordance with a required rotational angle ϑ and on the basis of the difference on the source coordinate between the leading dot or the just before coordinate-transformed dot and the next dot to be coordinate-transformed. On the basis of the difference thus obtained, the X-direction straight line generator generate an increment signal of zero or integer for each of the X-and Y- directions (zero or +l or -l in this embodiment). On the other hand, the Y-direction straight line generator l4 will operate, when there is to be determined a position on a destination coordinate of a next dot adjacent to a just before coordinate-transformed dot in a Y-direction line on the source coordinate, to calculate a difference in X- and Y- directions between the destination coordinate position of the just before coordinate-transformed dot and the destination coordinate position of the next dot to be coordinate-transformed, in accordance with a required rotational angle ϑ and on the basis of the difference on the source coordinate between the just before coordinate-transformed dot and the next dot to be coordinate-transformed. On the basis of the difference thus obtained, the Y-direction straight line generator generate an increment signal of zero or integer for each of the X-and Y-directions (zero or +l or -l in this embodiment). These X-and Y- direction straight line generators are well known in the art, and therefore, further explanation will be omitted.
Further, there are provided a pair of registers l6 and l8 adapted to receive and hold the values ΔX and ΔY from the processing apparatus l0, respectively. These values ΔX and ΔY are a set of integers fulfiling such a relation that ΔX/ΔY is perfectly or substantially equal to tanϑ (where ϑ is a required rotational angle).
X
X
K
K
K
In this embodiment, accordingly, the X-direction straight line generator l2 operates to receive, as an initial value, the destination coordinate position of a leading dot of the rotated pattern, which is outputted from the processing apparatus l0. In addition, the X-direction straight line generator l2 reads the integer values ΔX and ΔY held in the registers l6 and l8. On the basis of these input data, the generator l2 generates a pair of increment signals XD and YD representative of differences ΔXD and ΔYD in X- and Y- directions on the destination coordinate, which differences correspond to the difference (Δ × S=l) between the leading dot (or the just before coordinate-transformed dot) and an dot adjacent thereto on a X-direction dot line L (k=l, 2, ... DV) on the source coordinate, and which differences minimize a deviation between the transformed dot position on the destination coordinate and a straight line M obtained by geometrically rotating the line L by the angle ϑ.
Therefore,
if |ϑ| < 45°,
ΔXD = l and
|ΔYD| = l or 0.
if |ϑ| > 45°,
ΔXD = l or 0 and
|ΔYD| = l
X
X
The pair of increment signals XD and YD are inputted to an adder 20 and an AND circuit 22.
Y
Y
K
On the other hand, the Y-direction straight line generator l4 also receives, as initial value, the destination coordinate position of a leading dot of the rotated pattern, which is outputted from the processing apparatus l0. In addition, the Y-direction straight line generator l4 reads the integer values ΔX and ΔY held in the registers l6 and l8. On the basis of these input data, the generator l4 generates a pair of increment signals XD and YD representative of difference ΔXD and ΔYD in X- and Y- directions on the destination coordinate corresponding to the difference between the leading dot of the just before coordinate-transformed X-direction line and the leading dot of an adjacent X-direction line to be coordinate-transformed next. Namely, the generator l4 provides coordinate transformation information for coordinate rotation of a straight line connecting the leading dots of all the X-direction lines L on the source coordinate.
X
X
Y
Y
The system also includes another pair of registers 24 and 26 which receive and hold the destination coordinates XD and YD of the leading dot outputted from the processing apparatus l0 at the initialization stage. In the succeeding operation, the registers 24 and 26 hold the destination coordinates XD and YD inputted from the adder 20. On the other hand, the adder 20 reads the destination coordinates XD and YD from the registers 24 and 26 and adds the input increment signals XD, YD, XD and YD with the designation coordinates XD and YD. The added values are outputted and held in the registers 24 and 26, again. Namely, the registers 24 and 26 are updated each time the generators l2 and l4 generate the increment signals.
Furthermore, there are provided registers 28, 30, 32 and 34, which are respectively written at an initialization stage by the processing apparatus with the reference dot source coordinate position XS₁ and YS₁ and the dot lengths DH and DV in X- and Y- directions of a rectangular pattern on the source coordinate to be rotated, respectively. In operation, the data held in these registers 28 to 34 are read by the processing apparatus l0.
Registers 36, 38, 40 and 42 are associated to the registers 24, 26, 28 and 32, respectively, for reserving the data held in the respective registers.
X
X
The AND circuit 22 has an output connected to a dot generator 44. When the AND circuit 22 generates a logic signal of "l" in response to both the increment signals XD and YD of "l" from the generator l2, after the result of addition from the adder 20 is stored in the registers 24 and 26, the dot generator 44 reads the data XD from the register 24 and then writes a l-substracted data XD-l to the register 24. At the same time, the generator 44 generates a control signal instructing to write a dot information stored in a register 46 associated to a display memory 48, to a coordinate position (XD-l, YD). Thereafter, the generator 44 writes the data XD to the register 24, again. Namely, the content of the register 24 is returned from XD-l to XD.
The system also includes a drawer 50 which reads the data from the registers 24, 26, 28 and 30 so as to calculate an address of the display memory 48 to which a read/write should be executed. The calculated address is supplied to the display memory 48, so that a dot information is read from the designated address. The read dot information is temporarily held in the register 46.
The display memory 48 is controlled by a read/write control signal outputted from the processing apparatus l0. Namely, after a dot information held in the address of the display memory 48 designated by the drawer 50 and corresponding to the position (XS, YS) on the source coordinate is read to and held in the register 46, the dot information held in the register 46 is written to an address of the display memory designated by the drawer 50 corresponding to the position (XD, YD) on the destination coordinate corresponding to the source coordinate position (XS, YS). Furthermore, the display memory 48 is controlled by the control signal generated by the dot generator 44 to write the same dot information as that on the destination coordinate position (XD-l, YD-l), to an address of the display memory corresponding to the position determined by the coordinate position XD-l written to the register 24 from the dot generator 44 and the coordinate position YD held in the register 26.
Now, operation of the system will be explained with reference to Figure 4 in the case of a rectangular pattern P being drawn in the source coordinate and the rotational angle being less than 45 degree.
Assume that the X- and Y- direction straight line generators l2 and l4 are previously initialized to calculate necessary increments in the coordinate system in accordance with the integer values ΔX and ΔY defined by a given rotational angle ϑ, each time the dot position to be coordinate-transformed is shifted dot by dot on the source coordinate, and the various registers are set with initial values as the result of the initializing operation of the processing apparatus l0. Namely, the generators l2 and l4 are inputted with the destination coordinate position (XD₁, YD₁) from the processing apparatus l0. The coordinate position (XD₁, YD₁) constitutes a reference point. Further, the registers 24, 26, 28, 30, 32 and 34 are written with data XD₁, YD₁, XS₁, YS₁, DH and DV by the processing apparatus l0, respectively.
First, the data XD₁, YD₁, XS₁ and DH are reserved in the registers 36, 38, 40 and 42 (Step A). A dot information (al shown in Figure 3A) corresponding to the source coordinate reference position (XS₁, YS₁) is read from the display memory 48 and held in the register 46 (Step B). The data YS is incremented by +l (Step C). The dot position (a₁ shown in Figure 3C) defined by the destination coordinate position (XD₁, YD₁) is rewritten with the dot information held in the register 46 (Step D).
Next, the X-direction straight line generator l4 is operated to calculate the next draw point (XD, YD) to which a dot (b₁ shown in Figure 3A) adjacent to the reference coordinate (XS₁ and YS₁) in the same line on the source coordinate should be converted (Step E). At this time, it is discriminated whether or not both of XD and YD are incremented (Step F). If both of them are incremented, a dot (all shown in Figure 3C) corresponding to the position (XD-l, YD) is rewritten with the dot information held in the register 46 under the control of the dot generator 44 (Step G). To the contrary, if only the data XD is incremented, the dot generator 44 is not operated.
Thereafter, the data DH is decremented by l (i.e., added with -l) (Step H). Then, it is discriminated whether or not the data DH is less than zero (Step I). If DH is equal to or larger than zero, the operation is returned to the step B. Thus, the above mentioned step sequence is repeated on the dots b₁, c₁, d₁, ... until DH becomes less than zero. If DH becomes less than zero, YS is incremented by +l, and at the same time DV is decremented by l (i.e., added with -l) (Step J). Then, it is discriminated whether or not DV is less than zero (Step K). If DV is less than zero, the operation is terminated. But, if DV is not less than zero, the contents of the registers 24, 26, 28 and 32 are returned to the data stored in the registers 36, 38, 40 and 42, respectively (Step L). Then, the Y-direction straight line generator l4 is operated to calculate the destination coordinate position (XD₂, YD₂) of the leading dot (a₂ shown in Figure 3C) of the next line L₂ (Step M). The data XD₂ and YD₂ are reserved in the registers 36 and 38 (Step N), and the operation is returned to the step B. Thus, the above mentioned operation is repeated until DV becomes less than zero.
Accordingly, as shown in Figure 3C, there is obtained a rotated pattern which does not have an unredrawn dot lack called "bugs". The dots a₁₁, c₁₁, e₁₁ and g₁₁ shown in Figure 3B and the black dots shown in Figure 3C are supplemented by the dot generator 44, which correspond to the dot lack portions in a rotated pattern obtained by the conventional apparatus.
The operation of the shown system has been explained in the case of the rotational angle ϑ less than 45 degree. But, the shown system can generate a rotated pattern having no dot lack even in the case of a rotational angle not less than 45 degree. In a rotated pattern generation system using a pair of straight line generators, a pattern added with not only rotation but also inclination can be generated by adjusting the inclination between the two generated straight lines. The present invention can be also applied to this type of rotated pattern generation system. Further, the present invention can be applied to rotation of a non-rectangular pattern and rotation of a rectangular pattern out of parallel to the X- and Y- axes of the source coordinate. In these cases, however, the processing will become complicated to some extent.
The invention has thus been shown and described with reference to the specific embodiment. However, it should be noted that the invention is in no way limited to the details of the illustrated structures but changes and modifications may be made within the scope of the appended claims. | |
Ocean Moon MKAL, it’s just a phase…..
Welcome to our first clue and reveal.
Option A dives straight into the intarsia, working those waxing moons against the night sky.
Option B: while Clue 1 looks a little plainer than Option A, I do have a fun twist to share with you for our bonus clue AKA Clue 6 that will add the magic to your night sky.
Watch the tutorial below for colour selection and intarsia tips and scroll down for the Clue one reveal.
Head to this post for full MKAL details; pattern & community links. | https://ambah.co/blog/clue-1-spoilers-2/ |
Police drive-by parade makes 8-year-old Bradley’s birthday one to remember.
View More
View Less
Related Videos
In Fun & Convenience
-
Surprise Proposal Sets Bride-to-be Jumping With Joy
Rebecca was ecstatic when Adam popped the big question on their porch.
1:00
-
Dad Busts a Few Moves To Help Baby Nap
Giovanni dances his baby daughter to sleep and leaves a sweet video for mom.
0:33
-
Good Neighbor Returns a Lost Wallet
Boy uses Ring Video Doorbell to let his neighbor know that he found his son’s wallet.
0:24
-
Couple Gives Their Neighbors Something to Smile About
Angela and her husband dress up in costumes when they walk their dogs to give neighbors a good laugh.
0:31
-
Son Pulls Hilarious Prank on Dad
Gotcha, Dad! Derek uses Ring Indoor Cam to save this unexpected moment with his kids.
0:15
-
Little Boy Delivers the Gift of Generosity
Neighbors surprise a birthday girl with an unexpected delivery. | https://tv.ring.com/detail/videos/fun-convenience/video/6157029440001/uncle-surprises-birthday-boy-with-a-police-drive-by-parade?autoStart=true |
The shoulder complex is one of the most undernourished areas of the human structure. There is great kinetic potential within this powerful area of architecture, and it is crucial that when we are rehabilitating shoulder injuries or upper limb injuries and developing physical conditioning and sports performance strategies, that we take into account the true integrated nature of the shoulder within the wider ecosystem of the human body. Common injuries such as rotator cuff tears, frozen shoulder, restricted range of motion either from underused or equally inefficient overuse, must take into account the wider nature of how the shoulder complex and entire body function as an integrated structure.
In the field of injury rehabilitation and treatment of shoulder injuries, there are many ways to approach the reconditioning of a shoulder. The more traditional, specific muscle activated motor control drills show reduced efficacy for long term benefits for shoulder health. Postural adaptations and ingrained movement patterns that have been built up over long periods of time are not easily changed by conscious control and isolated exercises. We also have to take great care in understanding what biological plausibility there is in the rehabilitation and performance strategies, and the functional carry over of these approaches in real world movement situations. From a neurological perspective, higher-order structures within the brain and the central nervous system have a propensity for more compound movement synergy rather than that of individual muscle control. So in order for us to maximize the function of the shoulder, we must provide a strong biofeedback system in order to shape and create multi-dimensional diversity in the movement potential of any shoulder complex. The same argument has been made in regards to spinal stability; that no single muscle plays a dominant role in the process of spinal stability and that the contribution of individual spring-like guide wires constantly change and adapt depending on the movement based task at hand (2,3). I believe that the same may well be said for the shoulder complex.
When looking at the shoulder, we should ask ourselves first; “What does it do and why…?” Examples such as throwing, climbing, hanging, swinging all intimate that the shoulder complex has a natural, inherently powerful elastic structure that serves the upper limb as it connects it to the thorax. Attached to 17 muscles, the overall role of the shoulder blade (scapula) is to transfer power and be suitably conditioned for high quality coordinated motion, maximizing the overall degrees of freedom needed to place the hand in space through the shoulder joint (1). The scapula itself is suspended in a ‘tensegrity’ based web-like network, allowing great power generation and range of motion capacity, whilst simultaneously creating a stable environment throughout multi-variable motion. If we use the analogy of a bicycle wheel, the scapula acts as a compressed yet mobile central hub, whilst the spokes that attach to the hub represent the musculature that suspend the scapula, creating a web-like muscular suspension mesh work. Each spoke in a bicycle wheel is constantly sharing the load and acting in concert, each muscle that attaches to the scapula represents these wire spokes.
Therefore, rather than viewing the scapula as a structure that should be a restricted, over-stabilized base, a common misconception with shoulder rehabilitation strategies, we should appreciate that the innate elastic properties and stiffness of the muscular structures in which the scapula connects, enables this sling like muscular connection to efficiently facilitate the absorption and transfer of kinetic energy throughout the entire structure of the human body, all the way from upper to lower limb through the main central axis of the body. We have to harness this potential, understand the condition of any given shoulder, it’s current structural capacity and level of coordination to choose a starting point as to how and where this potential can be explored and developed for injury rehabilitation, athletic performance and longevity of the shoulder joint itself.
References:
- McQuade KJ, Borstad J, de Oliveira AS. Critical and theoretical perspective on scapular stabili- zation: what does it really mean, and are we on the right track? Phys Ther. 2016;96:1162–116
- Cholewicki J, McGill SM. Mechanical stability of the in vivo lumbar spine: implications for injury and chronic low back pain. Clin Biomech (Bristol, Avon). 1996;11:1– 15.
- McGill SM, Grenier S, Kavcic N, Cholewicki J. Coordination of muscle activity to assure stability of the lumbar spine. J Electromyogr Kinesiol. 2003;13:353–359
Kris R. | https://www.disc-kuwait.clinic/looking-at-shoulder-health-from-a-wider-perspective/ |
One hot dish. A black burnished background gives way to a fiery red center. Perfect for a modern setting. Place it on a table surface or use a plate stand to showcase it upright on a bookshelf. Pair it with the other lava collection pieces (all sold separately) for a stunning display.
case pack: 1
color: black & red
material: ceramic
number of cartons: 1
total carton weight ( lbs. ): 5
total carton length ( in. ): 17
Based on 0 reviews
Be the first to review “14.6″ X 14.6″ X 2.4″ Black & Red, Ceramic, Plate”
There are no reviews yet. | https://alluremart.com/product/14-6-x-14-6-x-2-4-black-red-ceramic-plate/ |
This is an outdated draft and should not be referenced or quoted.
There is significant overlap between usability and accessibility guidelines, and not a clear distinction between them. In most situations there is no need to differentiate between usability and accessibility, because their goals are complimentary. There are a few cases when the distinction is important, such as when looking at discrimination against people with disabilities and when defining specific accessibility standards.
This document encourages increased communication and coordination between accessibility and usability research and practice in the design and development of standards, guidelines, websites, browsers, assistive technologies, and other web tools to make them accessible to people with disabilities, inclusive, and usable for everyone.
Accessibility is about ensuring an equivalent user experience for people with disabilities. For the Web, accessibility means that people with disabilities can perceive, understand, navigate, and interact with websites and tools, and that they can contribute equally without barriers. Access to information and communications technologies is a basic human right as recognized in the UN Convention on the Rights of Persons with Disabilities (CRPD) . See Accessibility - W3C for an introduction to web accessibility.
Some accessibility guidelines primarily meet the needs of people with disabilities. For example, they ensure that websites work well with assistive technologies such as screen readers that read aloud web pages, screen magnifiers that enlarge web pages, and voice recognition software that is used to input text. Most of these guidelines are technical and relate to the underlying code rather than to the visual appearance.
Most accessibility guidelines also improve usability for everyone, and especially benefit older users, people using different devices, and others such as people with low literacy or not fluent in the language, and people with low bandwidth connections or using older technologies. While these accessibility requirements are also general usability principles, they are included in accessibility standards because they can be significant barriers to people with disabilities. For example, a website that is developed so that it can be used without a mouse is good usability; and use without a mouse is an accessibility requirement because people with some physical and visual disabilities cannot use a mouse at all. Products designed to meet accessibility requirements are more usable for everyone.
Usability is about designing products to be effective, efficient, and satisfying. Usability is part of the human-computer interaction (HCI) research and design field (which is much broader than usability testing). A key aspect of usability is following a user-centered design (UCD) process to create positive user experiences. Usability and human-centred design for interactive systems are covered in ISO 9241 Ergonomics of Human System Interaction.
User-centered design (UCD) focuses on usability goals, user characteristics, environment, tasks, and workflow in designing a user interface to meet user requirements. For example, UCD considers users' hardware, software, computer experience, task knowledge, and other characteristics in designing a website, web application, browser, and other web tool. UCD is an iterative process with well-defined methods and techniques for analysis, design, and evaluation from the first stage of projects through implementation.
Involving people with disabilities early in design processes broadens designers' perspectives and can lead to making products work better for more people in more situations.
Involving participants with disabilities in evaluation can identify usability issues more easily because people with disabilities are often more sensitive to usability problems. For example, a large number of links poorly organized on a web page will be more of a problem for people with some types of cognitive, physical, or visual disabilities.
Including accessibility guidelines helps improves usability for people with and without disabilities.
Involving Users in Web Projects for Better, Easier Accessibility introduces some basics. Just Ask: Integrating Accessibility Throughout Design provides detailed guidance on incorporating accessibility in user-centered design.
Usable accessibility combines usability and accessibility to develop positive user experiences for people with disabilities. User-centered design processes (UCD) include both techniques for including users throughout design and evaluation, and using guidelines for design and evaluation. UCD helps make informed decisions about accessible design. Thus UCD methods are an effective way to improve accessibility in websites and web tools.
The goal of web accessibility is to make the Web work well for people, specifically people with disabilities. While web accessibility standards are an effective tool to help meet that goal, meeting standards itself is not the end goal. People with disabilities effectively interacting with and contributing to the Web is the end goal.
While including users with disabilities is key to making accessibility efforts more effective and more efficient, that alone cannot address all issues. Even large projects cannot cover the diversity of disabilities, adaptive strategies, and assistive technologies. That is the role of accessibility standards.
Web Content Accessibility Guidelines (WCAG) addresses websites, including text, images, forms, and multimedia, as well as markup code, scripts, and applications.
User Agent Accessibility Guidelines (UAAG) addresses web browsers and media players, and relates to assistive technologies.
Authoring Tool Accessibility Guidelines (ATAG) addresses software or services that people use to produce web content, including code editors, content management systems, blogs, and other tools.
The WAI guidelines include considerations for people with auditory, cognitive, neurological, physical, speech, and visual disabilities, including people with age-related impairments.
The WAI guidelines are stable technical standards for meeting user requirements that apply broadly across technologies and situations. Along with the guidelines are techniques and other supporting resources that provide details on how to meet the guidelines (and thus the user requirements) in specific situations.
Web universality, digital inclusion, design for all, universal usability, and other such efforts focus on making the Web and other technology available to and usable by all people whatever their abilities, age, economic situation, education, geographic location, language, etc. (Whereas accessibility focuses specifically on people with disabilities, including people with age-related impairments.) Often projects focus on one specific user group; for example, developing design guidelines to optimize websites for older users. Many of the requirements of different user groups overlap with the requirements of people with disabilities.
Coordinating related efforts with existing accessibility work supports international harmonization and interoperability, and can expand research and resources in both areas. However, when efforts are not coordinated, it leads to duplication of effort and confusing or even conflicting results. For example, an extensive literature review on web accessibility for older users showed that most research and development of web design recommendations for older users did not consider WAI guidelines at all, even though the WAI guidelines directly address the accessibility needs of older web users.
Issues that affect people with disabilities disproportionately - These are considered accessibility barriers and need to be addressed by the WAI guidelines. For example, clear navigation mechanisms help everyone yet unclear navigation mechanisms can be particularly confusing for people with visual and cognitive disabilities. WAI welcomes comments on existing standards. New findings can be addressed through the techniques or other supporting documents, included in errata, and/or incorporated in future developments of standards.
Particular combinations of issues that create accessibility barriers - For example,needing to change settings that are difficult to find in common browsers, such as text size and color settings, is an obstacle for some users. In this case, the browser could be improved to help users customize the settings and the website could be improved to help educate users on how to customize their browsers. WAI welcomes the contribution of additional techniques, including techniques that help address accessibility issues in specific design situations.
Issues that are not specifically related to people with disabilities - For example, lack of computer skills is a common issue for some older users, people with lower income, people in less developed areas, and others. Even though such issues are not considered accessibility barriers specifically for people with disabilities and thus are not directly covered in accessibility guidelines, they may be related to accessibility issues that are covered. Therefore, design guidelines for such issues should build on existing accessibility guidelines, to take advantage of existing work and ensure harmonization.
W3C Web Accessibility Initiative (WAI) provides an international forum for collaboration between industry, disability organizations, accessibility researchers, government, and others interested in web accessibility. WAI encourages those involved in usability, digital inclusion, and others to share perspectives and participate in WAI work.
The WAI Interest Group (IG) is open for anyone to read or share feedback, comments, research findings, and questions related to web accessibility.
The e-mail address for all WAI staff is [email protected].
To contribute to WCAG, see instructions for commenting on WCAG 2.0 documents and the form for submitting WCAG 2.0 techniques.
Participating in WAI describes opportunities ranging from volunteering to implement, promote, and review guidelines, to occasional participation in an interest group, to dedicated participation in a working group.
WAI looks forward to increased collaboration among usability, digital inclusion, and accessibility research and practice.
Editors: Shawn Lawton Henry and Shadi Abou-Zahra. Contributors: participants of the WAI-AGE Task Force and the Education and Outreach Working Group (EOWG). Developed as part of the WAI-AGE Project (IST 035015) funded by the European Commission under the 6th Framework.
Copyright © 1994-2010 W3C® (MIT, ERCIM, Keio), All Rights Reserved. W3C liability, trademark, document use and software licensing rules apply. Your interactions with this site are in accordance with our public and Member privacy statements. | http://www.w3.org/WAI/EO/Drafts/access-use/accessibility-n-usability-2010-11Nov-23.html |
This short activity introduces students to plant adaptations and the process of transpiration while being a great way for you to integrate technology into the lesson. The lab uses an Absolute Pressure Sensor, some tubing, a twig with leaves, and a few items found in your science lab.
Plants transpire. They lose water through tiny pores (stomata) in their leaves through evaporation. The process of transpiration helps transport materials from the roots of a plant to its stems and leaves. Some kinds of plants, like cacti, have a thick, waxy coating that reduces water loss through transpiration. In Leaf Lessons, students model how a protective coating like those commonly found in plants found in dry climates affect the rate of transpiration when compared to a plant that does not have the coating.
To set up, take the plastic tubing and fill it with water. The tubing should be held in a "U" shape to keep the water from running out. Insert the stem into one end, taking care to not have any air bubbles at the stem. Next, connect the tubing to the pressure sensor using a connector. Finally, clamp the tubing and the sensor to the support rod so that the tubing maintains its "U" shape. Once the set-up is complete, collect data for 10 minutes.
The graph below shows how the air pressure changed. It decreased from 99.8 kPa to 92.7 kPa. Running a linear fit reveals the rate of pressure change. The air pressure decreased at a rate of 0.0182 kPa/sec. The decrease in air pressure occurred due to the evaporation of water through the pores. As the water traveled through the tubing to enter the twig and the leaves, more space became available at the end of the tubing by the sensor. This increase in space caused the air pressure to decrease.
The waxy coat of a desert dwelling plant was then modeled with petroleum jelly that was coated on both sides of the leaves. Data was collected for 10 minutes. The graph below reveals that the plant's water consumption was reduced as the air pressure decreased from an initial pressure of 100.1 kPa to 97.2 kPa. The barrier also reduced the rate of evaporation. This reduction can be seen by calculating a linear fit, which showed that the air pressure decreased only at a rate of 0.0097 kPa/sec.
In addition to providing a hands-on experience with technology, the Key Concepts in Science SPARKlabs help students make connections with the concepts they are learning through an engaging introduction, where students make predictions about what they think will happen during the investigation. The learning continues as the lab guides students with data analysis and interpretation questions that help them interpret data, review key vocabulary, and transfer the information they learned to a new contexts. | https://www.pasco.com/resources/blogs/k8/leaf-lessons.cfm |
Mushroom risotto doesn’t have to be complicated. If you can stir, you can make a delicious mushroom risotto that the whole family will love!
Risotto is a creamy rice, boiled in broth, that originated in northern Italy. Risotto seems pretty fancy, since it isn’t served everywhere, and not a whole lot of people make it often. It takes a little practice to get just right, but this recipe makes that process easy. Your efforts will be rewarded, as this dish is full of flavor, and that rich, creamy consistency that makes risotto so unique.
Start your journey into the wonderful world of risotto by making smaller batches and getting used to the flavors and textures that emerge. This recipe is simple and easy to follow, but do follow it—risotto isn’t a rice cooker kind of dish. The rice itself should not be overcooked—it will be slightly al dente, which means it will have a firmness but won’t be hard in the center at all. This recipe calls for Arborio rice, which is a short-grain Italian rice. You will love the way the earthy mushroom flavor compliments the rich and creamy rice.
PRO TIPS:
- It’s important to toast your rice. This step adds both flavor and texture.
- Be sure to heat your broth to a simmer before adding it to the rice.
- Use a ladle to help you slowly add the simmering broth, about 1/2 cup at a time.
- Stirring constantly will help cook your rice evenly.
- Be patient! Allow the rice to absorb the chicken broth 1/2 cup at a time.
-
What goes best with risotto?
Risotto can be a main course dish of its own, or served with a variety of others. It pairs really well with chicken and pork chops. Asparagus, grilled peppers and green beans go great with this dish. It is also nicely complemented by a green salad.
-
Is this recipe vegetarian?
No. This recipe calls for chicken broth, which makes the rice way more flavorful. You can adjust this to make it vegetarian by using a vegetable broth or stock. It will not be vegan, however, as there is butter in the recipe and it also calls for Parmesan cheese.
-
Can I make risotto in advance?
Not really. It will turn sticky and gluey if left in the refrigerator or in the pan for too long. It will still taste good reheated, but we recommend serving this special dish fresh.
-
Do I have to use arborio rice?
Yes. Arborio rice is a starchier rice, and the starch it releases as it is cooked slowly, is what helps to thicken the liquid it cooks in, in order to create a creamy consistency even though the rice will remain al dente. While other varieties of rice can be used, the result will not be the same as a traditional risotto and would be considered more of a rice pilaf.
If you liked this risotto, you may also be interested in some of these other delicious Italian recipes:
Watch the video below where Rachel will walk you through every step of this recipe. Sometimes it helps to have a visual, and we’ve always got you covered with our cooking show. You can find the complete collection of recipes on YouTube, Facebook Watch, or our Facebook Page, or right here on our website with their corresponding recipes. | https://thestayathomechef.com/easy-mushroom-risotto/ |
Where will everyone be in twenty years? In this lesson, your class writes a letter to their future selves. They can predict their future and think about what values will be important to them in life.
Resources:
- whiteboard
- pens
- paper
Thinking about the future
Put some headings on the board: 1 year, 5 years, 10 years, 25 years, lifetime. You could also add how old the class would be.
Ask the pupils for some suggestions of things they hope will happen to them in each time period. If they get stuck, point out when they would be leaving school or going to start work. Ask them whether they’d like to learn to drive or live in another country or have a family.
Before you get the class started on their letter, you could ask them for suggestions about what they wish adults would remember about how to treat children. This could feed into advice for their older selves about how to treat future children, nieces and nephews – maybe even pupils!
Drafting your letter
Tell the group they will be writing a letter to their future selves on the day they start their dream job. (Or another similarly important occasion).
When drafting the letter, get the group to think about these three stages:
- How old you’ll be when you open the letter, where you are and what you’ll be doing.
- What you intend to have done between now and the date the letter is opened. (For example, what have you done to get to your dream job?)
- What you hope you’ll remember as an adult.
Encourage your class to keep their letters in a safe place. Hopefully they’ll be able to return to them in the future and find the advice from their younger selves! | https://ministryofstories.org/schools/learning-resource/future-letter/ |
Battle of Britain Paintings
Anyone interested in the aeroplanes of the Battle of Britain should come to Grand Auctions, where there are several paintings of the most famous planes coming up for sale. There is a large and very impressive painting of the iconic Lancaster bomber, which even had a success in the recent past. During the Test Match between England and Australia at Lords, there was a flight of a Lancaster and two Spitfires over the ground. All the crowd stood up and cheered and play stopped. Andrew Strauss, who was batting very well at the time was soon out after play resumed, he blamed the Lancaster for his loss of concentration!
Barrie Cook
There are paintings of The Spitfire 14, Tiger Moths, The Harvard and the Sutherland flying boat. The artist, Barrie Cook, lives not far from Folkestone and is known for his superb draughtmanship and composition. Recently a painting by Barrie of a Spitfire was sold in a London auction room for over £5,000.The auction will be held at the Tower Theatre, Folkestone on 23rd May at 6 pm.
Read about Barrie Clark's other paintings.
For viewing and further information, please contact Jonathan Riley, paintings specialist at Grand Auctions, Folkestone, Kent. | http://www.grandauctions.co.uk/blog/battle-of-britain-paintings |
Q:
Converting list of lists of lists into dictionary of dictionaries (Python)
Suppose I have a list X = [[[2, 2]], [[2, 5], [3, 1]], [[3, 3], [4, 4], [1, 6]], [[1, 1], [4, 0]], [[]]]. I want to convert X into a dictionary of dictionaries like so.
G = {0: {2: 2},
1: {2: 5, 3: 1},
2: {3: 3, 4: 4, 1: 6},
3: {1: 1, 4: 0},
4: {}
}
So far I have
for i in range(0,len(X)):
for j in range(0, len(X[i])):
G[i] = {X[i][j][0]: X[i][j][1]}
which produces
{0: {2: 2}}
{0: {2: 2}, 1: {2: 5}}
{0: {2: 2}, 1: {3: 1}}
{0: {2: 2}, 1: {3: 1}, 2: {3: 3}}
{0: {2: 2}, 1: {3: 1}, 2: {4: 4}}
{0: {2: 2}, 1: {3: 1}, 2: {1: 6}}
{0: {2: 2}, 1: {3: 1}, 2: {1: 6}, 3: {1: 1}}
{0: {2: 2}, 1: {3: 1}, 2: {1: 6}, 3: {4: 0}}
Traceback (most recent call last):
G[i] = {X[i][j][0]: X[i][j][1]}
IndexError: list index out of range
First it only updates the dictionaries instead of appending new keys, second it fails me at my empty list.
Any suggestions?
A:
If you're using Python 2.7 you can use a dictionary comprehension.
X = [[[2, 2]], [[2, 5], [3, 1]], [[3, 3], [4, 4], [1, 6]], [[1, 1], [4, 0]], [[]]]
d = {k: dict(v) if v[0] else {} for k, v in enumerate(X)}
someone had a nice answer but they deleted it where they also used a dictionary comprehension but handled the empty lists better (I think). It went like so
d = {k: dict(item for item in v if item) for k, v in enumerate(X)}
| |
DescriptionPierre Jeanneret, tripod stool, teak and iron, circa 1960. Medium height stool in solid teak and iron. Round tripod structure in welded iron, lacquered grey, with a circular foot rest bar. Round seat in teak, slightly concave. Provenance and certificates available. Another interesting and nowadays relevant fact about these and other Chandigarh chairs is that all pieces were made from the trees which were logged because of the city built, so an early adaptation of ecological thinking. Literature: E. Touchaleaume & G. Moreau, « Le Corbusier Pierre Jeanneret – l'aventure indienne », Editions Gourcuff Gradenigo.
- Materials
- Origin
- Dimensions
- Stock
Teak & Iron
India
Ø 30 cm, H 61 cm
0
I have a question about this product
Shipping Quote
-
EU€ 250
-
Continental US€ 1000
-
Rest of worldPrice upon request
-
Local pickupFree of charge
Request shipping quote
Mario Bellini's Camaleonda Sectional Sofa - 1970s
Your Details: | https://goldwoodbyboris.com/archive/jeanneret-teak-iron-stool-pj-011023-1960s.html |
The glow of May 29th is much more than one would anticipate from the Sun sign itself, for its numeral value stands out and makes those born at this time different, individualistic, and somewhat strange. Innovative and in constant touch with the angelic realm and the higher realms of knowledge, they are true messengers of the gods, there to give us all something to hope for and something to believe.
Planetary Row
Inspired, artistic and talented for many things, Gemini representatives born on May 29th don’t stay in one position for too long, but hold on to it for as long as it is in sync with their sense of mission. This is usually not something they are able to explain, and might turn their direction when others least expect them to, only to follow through with what their heart is telling them to do. They sense things profoundly, emotional and sensitive more than we might expect, but still rational and eloquent enough to make things funny and light with those who cannot see their inner truth.
Hiding behind too many fences, people born on this date have the task to find love inside their Soul and connect the feminine and masculine within in order to find liberation. They will often do so in marriage or significant bonds, breaking out of their cocoon explosively, suddenly, and as they get older.
Sabian Symbol
The Sabian symbol for Gemini representatives born on May 29th:
Everything in this symbol stands for some sort of rebellion against labor, oppression, and anyone feeling less worthy because of their true nature. Liberators among Gemini, people born on this date have the ability to gather other in a cause, lead the way and show how to cure dissatisfaction of any kind. Some of them will do so in peaceful ways and form groups that will grow steadily and learn through them, and others will do so with a blast, when everyone least expects them to break the system. Whatever the case, they will become missionaries in a battle for the people at some point, one way or the other.
Purpose
All the roads that individuals born on May 29th take lead towards Uranus and its freeing stories and sudden turns that leave them breathless. The road ahead needs to be on the cliff, risky, different, standing out, and always on the verge of something they cannot handle. To ground the ideal their mind wishes to reach for, they need a strong connection to their physique and the material world in general. If they don’t, they might miss the opportunity to express and simply float around, frustrated in their bubble of ideas that seem impossible to bring the Earth.
Love and Emotions
Feelings of people born on the 29th of May are shady and change as they move along, for their sensitivity doesn’t allow their shield to stay down for very long. They are overwhelmed by other people's emotions way too often, sometimes tired out by the role of a missionary to save everyone around them. They must stay in touch with the real world, keeping their physiology free from all mind altering substances, alcohol and medication, in order to take the best that life has to offer and shine a light on their path.
Their love life is often strange, breakups come and go without true involvement or they get entangled with dependent partners that hold them down. Inspiration needs to keep on coming through their bonds and this can only happen if they value themselves enough to listen to their own needs instead of sinking into idealization and illusion. Sometimes betrayed, sometimes dishonest, they learn that believing someone is the core foundation of anything true and valuable in their life and become truly intimate only when they embrace this fact.
What They Excel In
Individuals born on the 29th of May excel in all artistic expressions imaginable. They are ready to try something new every time, and in sync with the higher spheres where ideas lie. On their mission of faith, they can become preachers or those who lead the way, but only if they truly believe in the cause guiding them. Movable, talented to do something with their arms, legs, and mind, they excel in dancing, ballet, music and writing, expressing the need of the collective through their words and movement.
Healing Crystal
Yttrium Fluorite is one of the best stones a person born on May 29th may use, for it gets them in touch with Spirit and stimulates intellectual processes that lead them towards practical solutions. It is a stone of spiritual growth, evolution of one's Soul, and supports the tenderness those born on this date carry in their heart while simultaneously shielding them from the outer world. Developing their intuition and aiding their search for synthesis of all information gathered in their mind, this crystal truly matches their personality's needs.
May 29th Birthday Gift
The choice of a birthday gift for someone born on the 29th of May can be truly easy when you think of creative ways to show your love. Choose something in color, something magical, a rainbow maker or a magician's kit. They want to feel things, hear the music and see the drawing, sensing emotions from anything written or spoken on their special day. Although they won’t give much meaning to the date of their birth itself, it is a good opportunity to bring back magic and inspiration into their lives, taking them to a faraway island, to dip their toes into the ocean, or getting them tickets to the concert of their favorite musician.
Positive Traits for May 29th Born
With a special fineness of heart, they are special among their kind, different, compassionate, caring, and truly an inspiration to everyone around them. Sent on a mission in this lifetime, they feel compelled to search for their truth and share it once it is found.
Negative Traits for May 29th Born
Lost wanderers without a cause, when they don’t have the freedom to search and stay distant from their true direction, they get abusive, antisocial, detached, seemingly uncaring and superficial.
Famous Birthdays on 29th of May
- In 1914 Tenzing Norgay was born, a Nepalese Indian mountaineer, known as one of the first two people to reach the summit of Mount Everest on the 29th of May, thus deciding to celebrate the date as his birthday. He ran away from home twice, was sent to become a monk, only to finally settle in the Sherpa community with new heights to conquer.
- In 1917 John F. Kennedy was born, the 35th President of the United States and one of the presidents recognized as truly inspirational leaders.
- In 1961 Melissa Etheridge was born, an American singer, songwriter and activist. Her talent in music led to her fight for the cause of gay and lesbian rights ever since she publicly came out in 1993.
Important Historical Events on 29th of May
- 1453 – Ottoman armies capture Constantinople and the Byzantine Empire ends.
- 1861 – The Hong Kong chamber of commerce is founded.
- 1886 – The first advertisement for Coca Cola appears.
- 1913 – The Rite of Spring by Igor Stravinsky premieres in Paris and provokes a riot.
- 1919 – The theory of general relativity by Albert Einstein is tested.
- 1999 – Discovery, the space shuttle, completes the first docking with the ISS.
Additional Information
Gemini - traits, personality, dates, characteristics and astrological sign information.
Gemini man - information and insights on the Gemini man.
Gemini woman - information and insights on the Gemini woman.
Gemini compatibility - the compatibility of Gemini with the other astrological signs in love, sex, relationships and life.
Gemini history - the history of Gemini and the stories behind it.
Gemini symbol - images and interpretations of the Gemini symbol and ruler.
Zodiac Calendar - Discover what your date of birth tells about your character, motivation and purpose in life. | https://www.astrology-zodiac-signs.com/zodiac-calendar/may/29/ |
The utility model discloses an unmanned cleaning robot, which relates to the technical field of unmanned cleaning robots and comprises an unmanned cleaning robot body. The driving wheels are mounted at the bottom of the unmanned cleaning robot main body; the flow guide strip is installed at the bottom of the unmanned cleaning robot body, and a water leakage opening is formed in the bottom of the flow guide strip; according to the unmanned cleaning robot, the cleaning efficiency of the unmanned cleaning robot body is improved, one motor is adopted to drive the two mops to conduct cleaning work, power loss is greatly reduced, the use cost of the unmanned cleaning robot body is reduced, and the water absorption sponge is arranged, so that the cleaning efficiency is improved. The water absorption sponge can absorb water stains on the road surface cleaned by the unmanned cleaning robot body, on one hand, pedestrians are prevented from slipping down due to the water stains on the road surface, the personal safety of the pedestrians is guaranteed, on the other hand, footprints caused by the fact that the pedestrians step on the road surface due to the water stains on the road surface can be avoided, and the overall cleanliness of the road surface is improved. | |
Here's a sample itinerary for a drive from Chicago to Oklahoma. If you're planning a road trip to Oklahoma, you can research locations to stop along the way. Traveling with a dog or cat? View pet-friendly stops between Chicago and Oklahoma. Camping along the way? View RV campgrounds between Chicago and Oklahoma. Find the best hotels, restaurants, and attractions based on the most talked about places recommended by Trippy members.
9:00 am start in Chicago
drive for about 2 hours
11:13 am Bloomington (Illinois)
stay for about 1 hour and leave at 12:13 pm
drive for about 1 hour
1:17 pm Springfield (Illinois)
stay for about 1 hour and leave at 2:17 pm
drive for about 1.5 hours
3:48 pm St. Louis
stay for about 1.5 hours and leave at 5:18 pm
drive for about 2.5 hours
7:42 pm Fort Leonard Wood
stay overnight and leave the next day around 10:00 am
day 1 driving ≈ 7 hours
find more stops
10:00 am leave from Fort Leonard Wood
drive for about 1.5 hours
11:36 am Springfield
stay for about 1 hour and leave at 12:36 pm
drive for about 3 hours
3:24 pm Tulsa
stay for about 1 hour and leave at 4:24 pm
drive for about 2 hours
6:29 pm arrive at Oklahoma
day 2 driving ≈ 6.5 hours
Your starting point is Chicago, Illinois.
You can enter an exact street address if you want to get precise directions, but this is optional.
Since there are only 2 travelers, we assume you're driving 1 car. You can adjust the number of people traveling at the top. We assume a maximum of 4 passengers per car, but you can change the number of cars to fit your situation.
Bloomington (Illinois) (4 answers)
questions about Bloomington (Illinois):
Inexpensive things for 4
Best free things to do in Bloomington (Illinois)?
Springfield (Illinois) (10 answers)
St. Louis (62 answers)
Forest Park (10 mentions)
St. Louis Zoo (6 mentions)
City Museum (5 mentions)
Gateway Arch (4 mentions)
Urban Chestnut Brewing Company (4 mentions)
restaurants around St. Louis:
Pappy's Smokehouse
Ted Drewes
Iron Barley Eating Establishment
Pastaria
Companion
questions about St. Louis:
Good St. Louis dines?
Great lunch places in St Louis
Good family vacation within 10 hours of St. Louis (not Branson)?
Where are the best places to stay in St. Louis?
What's the best neighborhood in St. Louis for a first time visitor?
Fort Leonard Wood
Springfield (5 answers)
Tulsa (17 answers)
Philbrook Museum of Art (2 mentions)
questions about Tulsa:
What is your favorite restaurant in Tulsa?
Best free things to do in Tulsa?
Any recommendations for Steakhouses with Cigar Lounges?
Your final destination is Oklahoma (OK).
You can enter the exact street address of your destination, but this is optional.
This section could be endless, so rather than trying to suggest every local activity or attraction, we'll leave it open-ended.
Of course, Trippy is the perfect place to ask questions because there's an entire community of travelers talking to each other and sharing tips and advice. Trippy is where you can get answers personalized for your tastes, budgets, trip dates & more!
For example, here are some questions people have asked about Oklahoma. Click on any question to see answers from the community!
Jirina from asked:
hotels in Oklahoma (1 answer)
Click the button below to explore more questions and answers related to Oklahoma.
Yes, even this step is optional, because if you're on vacation who wants the trip to end? It's okay, you can start planning your next trip!
Want to plan the trip back? Get the reverse directions for a Oklahoma to Chicago drive, or go to the main page to plan a new road trip.
You can also compare the travel time if you're flying or driving by calculating the distance from Chicago to Oklahoma. Or get a full Chicago to Oklahoma flight plan.
Don't forget about exploring your own hometown with a staycation. You can also find some cool day trips or get away for a weekend. Maybe try typing in a faraway location like London, Hong Kong, or Sydney, and get inspired for your dream trip around the world.
And if you know Chicago well, please help your fellow travelers and answer their questions about Chicago! | https://www.trippy.com/drive/Chicago-to-Oklahoma |
This system is prepared by nutritionists in a healthy and determines the quality of food and meal times for healthy and effective diet. When starting to get a nap, make sure to take three basic meals. Deleting any meal from meals will delay weight loss. Snacks or snacks prevent hunger. Two to three snacks a day can be taken.
Breakfast
A healthy breakfast model helps to lose weight in: Oatmeal with milk This breakfast is easy to prepare and eat at home, take less than 5 minutes to prepare. It is necessary to take breakfast before 11 am.
First snack
After two hours of breakfast: fresh fruit such as banana, apple, orange, fruity, or dried, such as 3 passing grains, figs, peaches, two tablespoons of raisins.
the lunch
• Dish of vegetable salad sour sauce and olive oil and put a little of it. Vegetable salad or Fatuous or salad watercress.
• Then the main course is grilled ham our or grilled shrimp, salmon or chicken, tuna, took. Lunch time between 1 pm and 5 pm
Snack again
After lunch two hours: a piece of fresh or dried fruit such as 3 grains pass, fig, peach, two tablespoons of raisins.
Dinner
• Dish salad vegetables may be very simple means tomatoes, cucumbers, onions, olive oil, salt, lemon.
• Two to three pieces of whole wheat bread.
• Medium tuna box, 3 pieces low-fat white cheese, 2 grilled shish taboos, 2 boiled eggs, or a little olive oil.
Third snack
After dinner two hours: a piece of fruit.
In addition to these types, drink three liters of water a day. Eat fish twice a week. Systems that rely on starving the body do not give a special result in the long run. So if you feel hungry, increase the share of fish, chicken or eggs. Following this system will help you lose weight without feeling hungry and healthy.
Take about 8 glasses of water a day, this helps: | http://healthstrengthdiet.com/healthy-diet-from-several-meals/ |
Q:
Check if a value exists in a Matrix field
http://sanderson.brycekirk.com/floor-plans/1-bedroom-1-bathroom/f123-f148-f248
This page displays a floor plan, of which there are many. Currently, within each floorplan entry, you add the floors it is on, along with the image of each floor:
I'm using a for loop to display a big button for each available floor, as you can see on the linked page.
My problem: I want to add disabled buttons for each floor the floorplan isn't on, but I can't figure out how to do it.
The logic should be something like this ("floors" is the name of the matrix field, "floor" is the block type handle):
IF '1' exists in entry.floors.floor.floorNumber
Show the big selectable '1' button
ELSE
Show the disabled '1' button
IF '2' exists in entry.floors.floor.floorNumber
Show the big selectable '2' button
ELSE
Show the disabled '2' button
etc for 3 and 4
It seems like their should be some straightforward solution, but I've had no luck.
Current code for displaying the floor number buttons:
{% for floor in entry.floors.all() %}
{% if floor.type.handle == 'floor' %}
<li class="tabs-title {% if loop.first %}is-active{% endif %}"><a href="#panel{{ floor.floorNumber }}" {% if loop.first %}aria-selected="true"{% endif %}><img src="{{ siteUrl }}assets/img/{{ floor.floorNumber }}.png" alt="{{ floor.floorNumber }}" /></a></li>
{% endif %}
{% endfor %}
Floor matrix:
A:
You can check if certain elements match for your Query via exists()
entry.floors.type('floor').floorNumber(1).exists()
returns true or false. However keep in mind entry.floors returns an element of type Query and you'll append the parameters type and floorNumber to the Query. These properties won't reset magically since you call the object by reference and not by value thus you'll either need to reset them
{% do entry.floors.type(null).floorNumber(null) %}
or you don't use the object directly and clone/copy it instead
{% set exists = clone(entry.floors).type('floor').floorNumber(1).exists() %}
| |
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention generally relates to color television receivers and, more particularly, to a color temperature control or correction for a color television receiver.
2. Description of the Prior Art
In an NTSC (national television standard committee) system, chromaticity close to the blackbody radiation at a color temperature of 6740° K. is selected to be a standard white color at the image transmitter side. Accordingly, the reference white color upon adjusting the white balance of a color picture tube has to be selected at this color temperature fundamentally.
However, in practice, the white color on the picture screen of the color cathode ray tube which is adjusted as described above is perceived as remarkably "reddish white" under, for example, the illumination of a fluorescent lamp having high color temperature. The reason for this is that human eyes follow illumination light and recognize "bluish white" having high color temperature around the color cathode ray tube as "pure white".
As described above, goodness or badness of the white on the picture screen of the color cathode ray tube greatly depends on the observation condition and also on the preference of each viewer. Generally, it is said that white color having color temperature higher than that of the illumination light is preferred.
While, if the color temperature is set high regardless of the content of a picture image, there arises a problem that a chromatic color, particularly flesh color, becomes bluish and hence unnatural color.
Therefore, in the art it has been proposed to control or correct the color temperature in response to the brightness of a color video signal.
FIG. 1 is a block diagram showing an example of the prior art. In FIG. 1, a composite color video signal is applied to an input terminal 1 and then fed to a Y/C separating circuit 2 where it is separated to a luminance signal Y and a chrominance signal C. The chrominance signal C is color-demodulated by a color demodulating circuit 3 which then produces red, green and blue color difference signals R-Y, G-Y and B-Y, respectively. These color difference signals R-Y, G-Y and B-Y are supplied to a matrix circuit 4. The matrix circuit 4 is also supplied with the luminance signal Y from the Y/C separating circuit 2 through a contrast adjusting variable resistor 5. Thus, the matrix circuit 4 produces red, green and blue primary color signals R, G and B. These red, green and blue primary color signals R, G and B are, respectively, supplied through gain control circuits 6R, 6G and 6B to the cathodes of a cathode ray tube 7. The input vs. output characteristics of the gain control circuits 6R, 6G and 6B are respectively shown in FIGS. 2A, 2B and 2C.
That is, the red primary color signal R is amplified linearly relative to the input. However, although the green primary color signal G and the blue primary color signal B are amplified linearly when the inputs are lower than a predetermined level, when the inputs are higher than the predetermined level, the green primary color signal G and the blue primary color signal B are respectively amplified so as to emphasize green and blue colors. In this case, the blue primary color signal B is emphasized much, while the green primary color signal G may be emphasized a little.
In this case, the above predetermined level is selected to correspond to a portion of high brightness, for example, the telop portion of a white character on a picture screen. The telop portion refers to a character display superimposed upon the television picture on the screen, for example, to display advertising information, announcements, stock market prices and the like.
Thus the telop portion of the white character and the like are made bluish, which is equivalent to the case that the color temperature is raised, white color being reproduced without being reddish. In addition, in the portion of the brightness less than the predetermined level, under the standard color temperature, for example, 9300° K. , each primary color signal is supplied to the cathode ray tube so that a flesh color or the like can be prevented from being made bluish.
However, according to such prior art color temperature control or correction system, only the portion of high brightness level such as a portion of a white character and the like can be controlled or corrected and a white color having low brightness level can not be corrected. The reason for this is that this prior art system carries out the color temperature control or correction not for the color saturation level but for the brightness.
Further, since the green and blue primary color signals are passed through the gain control circuits 6G and 6B which are non-linear circuits, there is then a defect that a non-linear characteristic causes color shading.
In addition, there is a further defect that the color temperature is changed by the adjustment of contrast.
OBJECTS AND SUMMARY OF THE INVENTION
Accordingly, it is an object of this invention to provide an improved color television receiver,
It is another object of this invention to provide a color television receiver capable of carrying out color temperature control or correction so as to produce a chromatic color as natural color and to produce a beautiful white color on the picture screen of a color cathode ray tube.
It is a further object of this invention to provide a color television receiver having a simplified construction.
According to one aspect of this invention, there is provided a color television receiver comprising:
means for detecting a color saturation level of a color from red, green and blue primary color signals or from color difference signals; and
color temperature control means for increasing at least a blue color component on a screen of a color cathode ray tube in accordance with increase of said color saturation level, said color temperature control means being controlled by the output of said color saturation level detecting means.
According to another aspect of this invention, there is provided a color television receiver comprising:
a matrix circuit for producing red, green and blue primary color signals at three output terminals respectively, said matrix circuit being supplied with a luminance signal and three color difference signals;
means for detecting a color saturation level of a color from said red, green and blue primary color signals which are supplied thereto; and
means provided on green and blue primary color signal lines for increasing the level of said blue and green primary color signals, said level increasing means being controlled by the output of said color saturation level detecting means.
According to a further aspect of this invention, there is provided a color television receiver comprising:
a matrix circuit for producing red, green and blue primary color signals in negative polarity at three output terminals, respectively, said matrix circuit being supplied with luminance signal and color difference signals;
first, second and third transistors whose bases are connected to said three output terminals, respectively, whose emitters are connected in common to the ground, and whose collectors are connected in common to a power supply source; and
subtracting means respectively provided on a blue primary color signal line and a green primary color signal line for subtracting the output of said transistors from said blue primary color signal and green primary color signal, respectively.
According to a yet further aspect of this invention, there is provided a color television receiver comprising:
a color demodulator supplied with a chroma signal and for producing three color difference signals;
a matrix circuit for producing red, green and blue primary color signals in negative polarity at three output terminals, respectively, said matrix circuit being supplied with a luminance signal and said three color difference signals from said color demodulator;
first, second and third transistors whose bases are supplied with said three color difference signals, respectively, whose emitters are connected in common to the ground, and whose collectors are connected in common to a power supply source; and
subtracting means respectively provided on a blue primary color signal line and a green primary color signal line for subtracting the output of said transistors from said blue and green primary color signals, respectively.
The other objects, features and advantages of the present invention will become apparent from the following description taken in conjunction with the accompanying drawings through which the like references designate the same elements and parts.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a block diagram showing an example of a prior art color television receiver;
FIGS. 2A to 2C are respectively graphs of input vs. output characteristics useful for explaining the prior art color television receiver shown in FIG. 1;
FIG. 3 is a block diagram showing a principle circuit arrangement of an embodiment of a color television receiver according to this invention;
FIG. 4 is a diagram useful for the explanation thereof;
FIGS. 5 and 6 are respectively diagrams useful for explaining an example of a main part of this invention;
FIG. 7 is a block diagram of another embodiment of the color television receiver according to this invention; and
FIG. 8 is a block diagram of a further embodiment of the color television receiver according to this invention.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
Now, the present invention will hereinafter be described in detail with reference to the drawings.
FIG. 3 is a block diagram showing a principle embodiment of a color television receiver according to this invention. In FIG. 3, like parts corresponding to those in FIG. 1 are marked with the same references and will not be described in detail.
First, the principle of this invention will be described and this principle is based on the following consideration.
That is, on the chromaticity diagram as shown in FIG. 4, the color temperature control or correction is inherently carried out such that the control or correction is not performed for each primary color but the controlling or correcting amount thereof must be increased as approaching the white W (namely, in accordance with the arrow directions in FIG. 4). The most accurate method for obtaining such control or correction signal is to detect a color saturation level. The color temperature can be controlled or corrected by the signal thus detected. Because, the color saturation level indicates a ratio in which each color is lightened by white color.
This invention is based on the above consideration and so, in the embodiment as shown in FIG. 3, red, green and blue primary color signals R, G and B delivered from the matrix circuit 4 are all supplied to a color saturation level detecting circuit 11 which detects the color saturation level of each color signal. The detected output is supplied through level adjusting circuits 12G and 12B to multiplying ciccuits 13G and 13B. The multiplying circuit 13G is also supplied with the green primary color signal G and the multiplying circuit 13B is also supplied with the blue primary color signal B. Then, such a control or correction is carried out that in response to the color saturation level, or as the color saturation level becomes high, the levels of the green and blue primary color signals G and B become high. In this case, the red primary color signal R is not corrected or controlled. Further, the correction or control amounts are adjusted by the level adjusting circuits 12G and 12B such that the control or correction amount of the green primary color signal G is made smaller than that of the blue primary color signal B. In addition, it may be possible that the green primary color signal G is not corrected but only the blue primary color signal B is corrected.
Thus, since the blue and green color signal components are corrected to become large as the color saturation levels thereof become high, the correction is performed such that the color temperature is just made high. As a result, white color is beautifully reproduced on the picture screen of the color cathode ray tube. While the color saturation level is low and the nearer the color approaches the primary color, the lower the correcting amount becomes so that the color temperature becomes close to the ordinary standard color temperature (for example, 9300° K.), thus a chromatic portion never being made bluish but being presented with a natural color.
By the way, if a circuit capable of accurately detecting the color saturation level is used as the color saturation level detecting circuit 11, the circuit arrangement becomes very complicated. Therefore, a description will be given on an example in which the color saturation level can be easily detected and the color temperature can be controlled or corrected simply.
The principle of this example will be described first.
As is clear from the chromaticity diagram as shown in FIG. 5, all colors can be presented by three primary colors or red, green and blue colors. In other words, every color within the triangular region encircled by red, green and blue colors on the chromaticity diagram can be represented by the three primary colors. Accordingly, on the basis of similar consideration, a desired color can be represented by white color component W and two primary colors of three primary colors of red, green and blue. By way of example, a certain color C.sub.1 on the chromaticity diagram of FIG. 5 can be presented by the white color component W and red and green primary colors R and G. In this case, the white color component W is the amount of white color contained in a certain color, namely, the amount corresponding to the color saturation level thereof.
While the principle of this example is described with reference to the chromaticity diagram of FIG. 5 as above, this principle will also be described with reference to voltage amplitudes E.sub.R, E.sub.G and E. sub.B of the respective primary color signals as follows.
That is, a desired color can be presented by three primary color signal voltages E.sub.R, E.sub.G and E.sub.B as shown in FIG. 6. Here, let us consider the minimum value of three voltage amplitudes E.sub. R, E. sub.G and E.sub.B, namely, E.sub.W =Min (E.sub.R, E.sub.G, E.sub.B). This minimum value is considered to be the voltage amplitude corresponding to the white color component of the desired color and the desired color can be presented by three of amplitudes E.sub.W, E.sub.1 =E. sub.R and E.sub.2 =E.sub.G.
As described above, this voltage amplitude E.sub.W indicates the color saturation level so that the color saturation level can be detected by detecting the voltage amplitude E.sub.W.
FIG. 7 shows an embodiment of the color television receiver according to this invention which takes the above principle into consideration.
In this embodiment, each primary color signal derived from the matrix circuit 4 has the negative polarity.
In this embodiment, as the color saturation level detecting circuit 11, there are provided three transistors 11R, 11G and 11B. The collectors of these transistors 11R, 11G and 11B are connected common and the emitters thereof are respectively grounded. The commonly connected collectors of the transistors 11R, 11G and 11B are connected through a resistor 14 to a power source terminal 15. Then, the red, green and blue primary color signals R, G and B from the matrix circuit 4 are respectively supplied to the bases of the transistors 11R, 11G and 11B and the output is derived from the common connection point of the collectors of these transistors 11R, 11G and 11B. The output therefrom is supplied through the level adjusting circuits 12G and 12B to a subtracting circuit 16G for the green primary color signal G and a subtracting circuit 16B for the blue primary color signal B, respectively.
In this case, while appropriate control or correction amounts are determined by the level adjusting circuits 12G and 12B, the correction amount for the green primary color signal may be very small unlike that for the blue primary color signal.
As mentioned before, since the signals derived from the matrix circuit 4 are the voltage signals of negative polarity (the white level has lower voltage), the base voltage of the transistor to which the minimum amplitude (the amplitude E.sub.W) of the amplitudes E.sub.R, E. sub.G and E.sub.B is supplied becomes highest and the output produced at the common connection point among the collectors of the transistors 11R, 11G and 11B is substantially dominated by the collector voltage of the transistor to which this voltage amplitude E.sub.W is supplied. Then, this output voltage becomes low when the voltage amplitude E.sub.W is small, while this output voltage becomes high when the voltage amplitude E.sub.W becomes large. Since this output voltage is supplied through the level adjusting circuits 12G and 12B to the subtracting circuits 16G and 16B, the control or correction voltage corresponding to the magntiude of the voltage amplitude E.sub.W is added to the green and blue primary color signals G and B with negative polarity, namely, so as to make the amplitudes thereof larger in the subtracting circuits 16G and 16B. In other words, when the amplitudes E.sub.W of the white color component contained in the chrominance signal C, or the color saturation level thereof is low (near the primary color), the correction voltages added in the subtracting circuits 16G and 16B with negative polarity are low, while when the amplitude E.sub.W becomes large and hence the color saturation level becomes higher (near the white color), the correction voltage to be added becomes high. That is, the higher the color saturation level becomes, the more the blue and green color components are increased. As a result, such correction is performed that the color temperature is increased.
In order to detect the color saturation level, the color difference signals R-Y, G-Y and B-Y may be used as shown in FIG. 8.
That is, this reason is as follows: ##EQU1## is established and calculating the minimum value of the primary color signal amplitude E. sub.R, E.sub.G and E.sub.B is equivalent to calculating the minimum value of the color difference signal amplitudes E.sub.R-Y, E.sub.G-Y and E.sub. B-Y. In this case, since the luminance component E.sub.Y is not contributable to the color saturation level, it is not necessary to take the luminance component E.sub.Y into consideration.
In the above embodiments, it is possible that the green primary color signal is not corrected but only the blue primary color signal is corrected.
According to this invention, since the color temperature correction or control is carried out in accordance with the color saturation level, the white color can be presented more beautifully and the chromatic colors are not made bluish and reproduced as natural color on the picture screen of the color cathode ray tube.
Especially when the method for detecting the minimum value of the primary color signal amplitudes or the color difference signal amplitudes is used as the method for detecting the color saturation level, the circuit arrangement can be made very simple.
The above description is given on the preferred embodiments of the invention, but it will be apparent that many modifications and variations could be effected by one skilled in the art without departing from the spirits or scope of the novel concepts of the invention, so that the scope of the invention should be determined by the appended claims only. | |
Read rodgers.pdf text version
Linearly Independent, Orthogonal, and Uncorrelated Variables Joseph Lee Rodgers; W. Alan Nicewander; Larry Toothaker The American Statistician, Vol. 38, No. 2. (May, 1984), pp. 133-134.
Stable URL: http://links.jstor.org/sici?sici=0003-1305%28198405%2938%3A2%3C133%3ALIOAUV%3E2.0.CO%3B2-W The American Statistician is currently published by American Statistical Association.
Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at http://www.jstor.org/about/terms.html. JSTOR's Terms and Conditions of Use provides, in part, that unless you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you may use content in the JSTOR archive only for your personal, non-commercial use. Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at http://www.jstor.org/journals/astata.html. Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed page of such transmission.
JSTOR is an independent not-for-profit organization dedicated to and preserving a digital archive of scholarly journals. For more information regarding JSTOR, please contact [email protected]
http://www.jstor.org Thu Mar 29 16:14:10 2007
Linearly Independent, Orthogonal, and Uncorrelated Variables
JOSEPH LEE RODGERS, W. ALAN NICEWANDER, and LARRY TOOTHAKER*
0, where and are the means of X and Y, respectively, and 1 is a vector of ones. The first important distinction here is that linear independence and orthogonality are properties of the raw variables, while zero correlation is a property of the centered variables. Secondly, orthogonality is a special case of linear independence. Both of these distinctions can be elucidated by reference to a geometric framework.
A GEOMETRIC PORTRAYAL
Linearly independent, orthogonal, and uncorrelated are three terms used to indicate lack of relationship between variables. This short didactic article compares these three terms in both an algebraic and a geometric framework. An example is used to illustrate the differences.
KEY WORDS: Linear independence; Orthogonality; Uncorrelated variables; Centered variables; n dimensional space.
INTRODUCTION
In the early 19701s, a series of articles and letters discussed the relationships among statistical independence, zero correlation, and mutual exclusivity (see Gibbons 1968; Hunter 1972; Pollak 1971; and Shih 1971). A related set of concepts that are equally confusing to students is firmly rooted in linear algebra: linear independence, orthogonality, and zero correlation. The series of articles cited above deal with statistical concepts in which the link between the sample and the population is critical. On the other hand, the concepts with which we are dealing apply most naturally to variables that have been fixed, either by design or in the sample. Thus, our framework is primarily algebraic and geometric rather than statistical. Unfortunately, the mathematical distinctions between our three terms are subtle enough to confuse both students and teachers of statistics. The purpose of this short didactic article is to present explicitly the differences among these three concepts and to portray the relationships among them.
AN ALGEBRAIC PORTRAYAL
Given two variables, the traditional geometric model that is used to portray their relationship is the scatterplot, in which the rows are plotted in the column space, each variable defines an axis, and each observation is plotted as a point in the space. Another useful, although less common, geometric model involves turning the space "inside-out", where the columns of the data matrix lie in the row space. Variables are vectors from the origin to the column points, and the n axes correspond to observations. While this (potentially) hugedimensional space is difficult to visualize, the two variable vectors define a two-dimensional subspace that is easily portrayed. This huge-dimensional space was often used by Fisher in his statistical conceptualizations (Box 1978), and it is commonly used in geometric portrayals of multiple regression (see Draper and Smith
x
1!
( 1 ) lanearly andepend. (2) not uncorrelated (3) not orthogonal
n
lanearly andependent (1) linearly andepend. 1
Algebraically, the concepts of linearly independent, orthogonal, and uncorrelated variables can be stated as follows. Let X and Y be vector observations of the variables X and Y. Then 1. X and Y are linearly independent iff there exists no constant a such that a x - Y = 0 (X and Y nonnull vectors). 2. X and Y are orthogonal iff X'Y = 0. 3. X and Y are uncorrelated iff (X - Z ~ ) ' ( Y P1) = -
X Y - -
(1 L1
1
(2) uncorrelated (3) not orthogonal
OJ
/
1: 3
5I
I ?.,, linearly andepend.
I not uncarelated
(3) orthogonal
.
*Joseph Lee Rodgers is Assistant Professor and W. Alan Nicewander and Larry Toothaker are Professors in the Department of Psychology at the University of Oklahoma, Norman, O K 73019. The authors express their appreciation to two reviewers whose suggestions improved this article.
Figure 1 . The relationship between linearly independent, ofthogonal, and uncorrelated variables.
O The American Statistician, May 1984, Vol. 38, No. 2
133
1981, pp. 201-203). This n-dimensional space and its two-dimensional subspace are the ones to which we direct attention. Each variable is a vector lying in the observation space of n dimensions. Linearly independent variables are those with vectors that do not fall along the same line; that is, there is no multiplicative constant that will expand, contract, or reflect one vector onto the other. Orthogonal variables are a special case of linearly independent variables. Not only do their vectors not fall along the same line, but they also fall perfectly at right angles to one another (or, equivalently, the cosine of the angle between them is zero). The relationship between "linear independence" and "orthogonality" is thus straightforward and simple. Uncorrelated variables are a bit more complex. To say variables are uncorrelated indicates nothing about the raw variables themselves. Rather, "uncorrelated" implies that once each variable is centered (i.e., the mean of each vector is subtracted from the elements of that vector), then the vectors are perpendicular. The key to appreciating this distinction is recognizing that centering each variable can and often will change the angle between the two vectors. Thus, orthogonal denotes that the raw variables are perpendicular. Uncorrelated denotes that the centered variables are perpendicular. Each of the following situations can occur: Two vari-
ables that are perpendicular can become oblique once they are centered; these are orthogonal but not uncorrelated. Two variables not perpendicular (oblique) can become perpendicular once they are centered; these are uncorrelated but not orthogonal. And finally, two variables may be both orthogonal and uncorrelated if centering does not change the angle between their vectors. In each case, of course, the variables are linearly independent. Figure 1 gives a pictorial portrayal of the relationships among these three terms. Examples of sets of variables that correspond to each possible situation are shown.
[Received April 1983. Revised October 1983. ]
REFERENCES
BOX, J.F. (1978), R . A . Fisher: The Life of a Scientist, New York: John Wiley. DRAPER, N., and SMITH, H. (1981), Applied Regression Analysis, New York: John Wiley. GIBBONS, J.D. (1968), "Mutually Exclusive Events, Independence, and Zero Correlation," The American Statistician, 22, 31-32. HUNTER, J . J . (1972), "Independence, Conditional Expectation, and Zero Covariance," The American Statistician, 26, 22-24. POLLAK, E . (1971), "A Comment on Zero Correlation and Independence," The American Statistician, 25, 53. SHIH, W. (1971), "More on Zero Correlation and Independence," The American Statistician, 25, 62.
Kruskal's Proof of the Joint Distribution of x and s2
STEPHEN M. STIGLER*
In introductory courses in mathematical statistics, the proof that the sample mean and sample variance s 2 are independent when one is sampling from normal populations is commonly deferred until substantial mathematical machinery has been developed. The proof may be based on Helmert's transformation (Brownlee 1965, p. 271; Rao 1973, p. 182), or it may use properties of moment-generating functions (Hogg and Craig 1970, p. 163; Shuster 1973). The purpose of this note is to observe that a simple proof, essentially due to Kruskal (1946), can be given early in a statistics course; the proof requires no matrix algebra, momentgenerating functions, or characteristic functions. All that is needed are two minimal facts about the bivariate normal distribution: Two linear combinations of a pair of independent normally distributed random variables are themselves bivariate normal, and hence if they are uncorrelated, they are independent. Let XI, . . . ,Xn be independent, identically distributed N ( p . , u2). Let (n We suppose that the chi-squared distribution x2(k)has been defined as the distribution of Uf + . . . + U;, where the U, are independent N ( 0 , l ) .
,=I
1 x,= -nE"x , ,
s;=-
1
" c (X, 1),=1
-
X")? .
*Stephen M. Stigler is Professor, Department of Statistics, University of Chicago, Chicago, IL 60637.
Theorem. (a) Xnhas a N(p.,u2/n) distribution. (b) (n - l)s2/u2 has a X2(n - 1) distribution. (c) Xnand s,? are independent. Proof. The proof is by induction. First consider the = (XI + X2)/2 and, after a little alcase n = 2. Here Part (a) is an immediate congebra, s i = (XI - X2)2/2. sequence of the assumed knowledge of normal distributions, and since (XI - x 2 ) / f i is N(0, I), (b) follows too, from the definition of ~ ' ( 1 ) . Finally, since cov(Xl - X2,XI + X2) = 0, X, - X2 and XI + X2 are independent and (c) follows. Now assume the conclusion holds for a sample of size n. We prove it holds for a sample of size n + 1. First establish the two relationships
x2
134
0 The American Statistician, May 1984, Vol. 38, No. 2
Information
3 pages
Report File (DMCA)
Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us: | http://www.readbag.com/psych-umn-faculty-waller-classes-fa2010-readings-rodgers |
12 January 2017 4:47pm Talks to end Europe's longest frozen conflict in Cyprus have shown "enormous progress" the new UN secretary-general has said, even as both sides remained deadlocked over the issue of Turkish troop withdrawals. Mr Guterres said he believed that they reunification Cyprus...read more
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed....
veronica: Should you ever require the services of a hacker, i implore you to try your very best to hire only professionals. [email protected] will increase your chances of getting your job completed.... | |
Large trees—key climate influencers—die first in drought
In forests worldwide, drought consistently has had a more detrimental impact on the growth and survival of larger trees, new research shows. In addition, while the death of small trees may affect the dominance of trees in a landscape, the death of large trees has a far worse impact on the ecosystem and climate's health, especially due to the important role that trees play in the carbon cycle.
"Previous studies at a few sites had shown that large trees suffer more than small trees during and after droughts, and our theory suggested this should be a globally consistent pattern, but this project was the first to test this hypothesis globally." said Los Alamos National Laboratory's Nate McDowell, a renowned forest ecologist and plant physiologist who coauthored a paper in the journal Nature Plants highlighting this research.
In a landmark study published this week, a team of researchers studied forests worldwide, ranging from semi-arid woodlands to tropic rainforests, to determine how a tree's size impacts its response to drought.
The team also included researchers from the Smithsonian's Conservation Biology Institute and Tropical Research Institute, the University of New Mexico and the U.S. Geological Survey.
Whereas previous studies documented processes at a single site, this team analyzed data from 40 drought events at 38 forest locations, systematically reviewing forests' size-death correlation worldwide for the first time.
Tree Death Greatly Affects Atmosphere and Ecosystem
Living trees soak up greenhouse gas and store it for a long time in their woody tissues, but dying trees release it—a carbon sink becomes a carbon source.
Morever, larger trees transpire, or release, more water into the atmosphere, cooling the land and supporting cloud formation, which effects how much solar radiation is reflected back to space and impacts precipitation. They also play key roles in biodiversity, creating environments on which many plant and animal species are dependent, McDowell says.
Tree death is often unpredictable, and the work by McDowell and colleagues has helped elucidate many processes. Large trees are more vulnerable, in part, due to their physiology: it's harder for them to transport the water and nutrients they need to their leaves and evaporative demands are higher. Additionally, large trees with crowns high in the canopy are exposed to higher solar radiation, and the ability to transport water to their foliage is lower.
All of this is compounded by the fact that trees close their stomata (surface pores that control gas exchange) when facing drought to prevent water loss from transpiration, but this can collapse the hydraulic transport system. And as if that weren't enough, destructive bark beetles preferentially attack larger trees.
Understory trees have it easier, with lower temperatures and wind speeds and higher humidity, and a far shorter distance to transport water from their roots to their canopy. In all of the seasonal tropical forests analyzed by the team, the growth rate of understory trees actually increased in response to drought, possibly due to the increased light reaching smaller trees caused in part by the larger trees losing foliage under stress.
Researchers sample, analyze 38 forests worldwide
The research project included both natural and experimental droughts. Accounting for standard growth/mortality rates, the team analyzed tree size-related variation responses based on diameter growth and death under drought and normal conditions; and the percentage of drought-related death.
Although a limited sample size precluded rigorous analysis across different forest types, separate analysis was conducted (with data from at least three droughts) for the following subsets: tropical and temperate forests, climates with and without seasonal precipitation flux, broadleaf and needleleaf forests, and forests with drought deaths not associated with bark beetles.
The tree-death percentage increased with increasing trunk diameter, exacerbated by extreme drought events and bark beetle kills. The percentages can misleadingly seem less severe since, under normal conditions, larger trees tend to live longer, therefore skewing the baseline. Drought-related death increased with tree size in 65 percent of the droughts examined.
According to these results and theoretical predictions previously published this year in Nature Climate Change by McDowell, large trees will suffer the most from the triple threat of 1) a warming climate, 2) drier soils and 3) more severe drought stress (intensity or frequency). Researchers note that the global consequences on ecosystem function, biodiversity, and the carbon cycle that begets climate change could be great. | https://phys.org/news/2015-09-large-treeskey-climate-influencersdie-drought.html |
For November 2011, sales of the United States Mint’s most popular gold and silver bullion coins fell to their lowest monthly levels in years. This perpetuates a slow down in bullion sales that began in the previous month
Sales of the one ounce American Silver Eagle bullion coins were 1,384,000 for November. This is down by more than 50% from the previous months total of 3,064,000. It is down by nearly two-thirds from the year ago period when sales of 4,260,000 were achieved.
Lower monthly sales for the typically popular Silver Eagles have not been seen since July 2008. Around this time, sales levels were frequently impacted by periodic suspensions and an ongoing allocation program, which limited the number of bullion coins that authorized purchasers could order from the United States Mint.
According to Michael White of the United States Mint’s Office of Public Affairs, during November 2011, there was no disruption in the availability of American Eagle gold and silver bullion coins. The sales figures constitute the orders placed by authorized purchasers.
American Gold Eagle bullion coin sales totaled 41,000 ounces for November 2011. This is down from 50,000 ounces in the previous month, and down more significantly from the 112,000 ounces sold in the year ago period. Lower monthly sales for Gold Eagles have not been seen since June 2008.
During the month, the United States Mint offered two additional bullion options. The 24 karat one ounce American Gold Buffalo coins had sales of 8,500. The five ounce America the Beautiful Silver Bullion Coins experienced sales of 3,300, accounting for 16,500 troy ounces of silver. | https://news.coinupdate.com/american-gold-and-silver-eagle-bullion-sales-plunge-1089/ |
Averages - how does this happen?
Do some of the lowest scoring individuals work for multiple departments. They could be bringing multiple departments averages down but they still only contribute a single value to the overall mean.
For example imagine there are four departments and one person that works for all four with a score of 1 and then let's say there are one other staff in each department each with a score of 5. So there are find staff total with an overall mean of (1+5+5+5+5)/5 = 4.2. In each department there are two scores - a 1 and a 5 so the average is 3.
So every department has a mean lower than the overall average because there is one person that isn't happy but they are represented in all the departments.
So it might be that satisfaction and the number of departments a person is counted in are negatively correlated? It's just a conjecture of course but it would be a plausible explanation. | http://www.talkstats.com/threads/averages-how-does-this-happen.71743/ |
Customer Reviews Of:
The North Face Greenwater Sport Sandals (For Men)
Closeouts. Next time you're on the water, make sure you get a grip in The North Face's Greenwater sport sandals; the sticky rubber outsole ensures a reliable stance even on slippery ground.
Average Rating based on 2 reviews 4.000000 0 5
-
Reviewed by sandal person from vancouver on Thursday, June 5, 2014Trust me. I wear an 8 and the size 8s had my toe sticking over the side.
These sandals are good but kind of weird, it's like they took the foot box of a shoe and stuck it on a sandal.
On most sandals, there is actually a "border" around your foot unlike a shoe.
Not so one these. Kind of a weird feeling.
Also, the back strap is non adjustable. The front two obviously are.
I really like the sandal except for these two issues. It would be a 4 if the border was like a normal sandal.
-
Verified Buyer Reviewed by linn from Deep, Deep South Texas on Saturday, May 17, 2014Good fit, good comfort right out of the box. | https://www.sierratradingpost.com/the-north-face-greenwater-sport-sandals-for-men~p~6403c/reviews/ |
GSS student grateful for school supplies donated by Min. Evelyn
NIA CHARLESTOWN NEVIS (OCTOBER 12, 2020) — Hon. Eric Evelyn, Minister of Youth and Community Development in the Nevis Island Administration (NIA), and area representative for St. George’s, Gingerland, has made a donation to the Gingerland Secondary School (GSS).
On October 09, 2020, Minister Evelyn visited GSS bearing gifts of school supplies for the entire student body.
He said he felt it was important that government officials visit the schools on occasion to support and show solidarity with faculty and students, especially with the challenges now being experienced, as a result of the COVID-19 pandemic.
“I am here not just to visit and to show support but I’m also here to give back to the Gingerland Secondary School. Of course, this is my alma mater…When I thought about making this presentation I thought that it’s best that I make a presentation that will touch every student that attends the Gingerland Secondary School and, therefore, I would have made it my business to source some supplies and all 277 students of the Gingerland Secondary School will personally benefit from the donation,” he said.
Ms. Latoya Jeffers, Education Officer responsible for the Gingerland Secondary School, accepted the books, pens, rulers and pencils on behalf of the staff and students. She turned them over to the school principal Mrs. Lineth Williams, who expressed appreciation for the donation.
Fifth form student Lebron Senior also thanked Minister Evelyn on behalf of the student body.
“We thank you for making this contribution to our school and we hope that you will continue to do this in the future and we’ll do well with the contribution that you have given us. Thank you,” he said.
Minister Evelyn also took the opportunity to commend the teachers and students for an excellent performance at the recent Caribbean Examinations Council (CXC) examinations and called on the teachers to encourage the students to do their best under the conditions of the “new normal.”
END
Disclaimer : This article was posted in its entirety as received by SKN PULSE. This media house does not correct any spelling or grammatical errors within press releases and or commentaries. The views contained within are not necessarily those of SKN PULSE. | https://www.sknpulse.com/gss-student-grateful-for-school-supplies-donated-by-min-evelyn/ |
Losing a family member can be a distressing experience. Close kins and friends would undoubtedly feel scared for the safety of the missing person. Fortunately, with today’s technology and resources, losing someone doesn’t mean losing all hope.
Here are 5 tips on finding long-lost family members:
Be specific on the Identity
The basic of finding a long-lost family member is to provide information that can be used to identify the person. Identifying a person, whether it’s by sight or sound, can be a challenging task at times. But don’t worry. There are some identifiable traits that you can look for which can you help the person. Most of the time, you have to rely on the specificity of the description of the person you’re looking for.
This basic description that you can provide to aid in the search for long-lost relatives.
- The Name of The Person
- Your Relation with them
- The whereabouts you have last known them to be
- The idea of what you expect from a person’s physical appearance and personality
- An idea of the person’s personality or background in his job
Use Social Media
Social media provides a unique opportunity to connect with people in your life, but a lot of users struggle to use this to its full advantage. Utilizing social media properly can help bring you closer to friends and family, but there are times when you need to dig deeper to find the person you’re looking for. If they are much more adept at current technology, finding them may be much easier, but, in some cases, they are not. It is best to assume they are in place that modern technology is not popular or can’t be used. In modern times, technology has revolutionized every industry, and that includes finding missing individuals. It’s no longer necessary to call around to family, friends, and neighbors in hopes that someone might have seen or heard something about a missing person. Just log onto a social networking site, such as Facebook, Twitter, or Instagram, and type in the person’s name. Then, if the missing person has an account, their posts will show up in the search results. You can check the photos to cross-check if it is the person that you are looking for.
Use Genealogy
Using genealogy to find the person is a way to track your ancestors. The family history finds on certain websites can help you find out where your ancestors came from, where they died, and how long ago they died. Most of these sites are free and allow you to do research and find out information that you may not have known about.
Trade and Industry
Suppose you have an idea of what and where your long-lost relatives work. You can find more information using the trade and industry contacts. Trade contacts are your professional network. In fact, trade contacts are probably your most important network of all. The International Trade Database allows you to search by company name, employee name, or location to find a specific person to call. Enter the info of the person you need to contact and select the Country/Area tab. Enter the country code and space, and the Trade and Investment Database will return all companies in that area that match your search. If you want to call a company, enter their employee’s name and click the “Search” button.
Hire a experts
When you are trying to find long-lost relatives and are willing to allocate some of your financial resources, you can hire an expert. A private investigator can be an invaluable tool for locating a missing person. Private Investigators make investigations easy. They perform a background check on an individual or organization, identify witnesses, locate missing persons, or track a person’s movements. If you are looking for a private investigator, try these three steps. The private investigator can help gather information and evidence and successfully locate the suspect(s). | https://www.parkspotterafrica.com/5-tips-to-finding-long-lost-family-members/ |
Tbilisi, Georgia, Nov. 29
By Nana Kirtzkhalia - Trend:
A high-voltage power transmission line, connecting Georgia and Turkey, will be commissioned on December 10, 2013. The construction of a 500-kilovolt power transmission line started several years ago and was completed in May 2012.
Georgian Deputy Energy and Natural Resources Minister Marika Valishvili said on Nov. 29 that the power transmission line is in a test mode, so it was not possible to complete the construction in time. According to Valishvili, the line allows to connect to Turkey's energy system and transmit 1,000 megawatts of electricity without any technical barriers.
The project was implemented by Georgian State Electrosystem company, its cost is 250 million euros. Azerbaijan, Georgia and Turkey are implementing the Azerbaijan-Georgia-Turkey (AGT) Power Bridge Project.
The project envisages the delivery of 1200 megawatts of electricity to Turkey. Some 600 megawatts of this amount of electricity will account for Azerbaijan. In total the project envisages annual export of up to 2,000 megawatts of electricity from Turkey to Europe. | https://en.trend.az/business/energy/2216785.html |
---
abstract: 'We prove convergence results for expanding curvature flows in the Euclidean and hyperbolic space. The flow speeds have the form $F^{-p}$, where $p>1$ and $F$ is a positive, strictly monotone and $1$-homogeneous curvature function. In particular this class includes the mean curvature $F=H$. We prove that a certain initial pinching condition is preserved and the properly rescaled hypersurfaces converge smoothly to the unit sphere. We show that an example due to Andrews-McCoy-Zheng can be used to construct strictly convex initial hypersurfaces, for which the inverse mean curvature flow to the power $p>1$ loses convexity, justifying the necessity to impose a certain pinching condition on the initial hypersurface.'
address:
- 'Albert-Ludwigs-Universität, Mathematisches Institut, Ersnt-Zermelo-Str. 1, 79104 Freiburg, Germany'
- 'Albert-Ludwigs-Universität, Mathematisches Institut, Ernst-Zermelo-Str. 1, 79104 Freiburg, Germany'
author:
- Heiko Kröner
- Julian Scheuer
bibliography:
- 'Bibliography.bib'
title: Expansion of pinched hypersurfaces of the Euclidean and hyperbolic space by high powers of curvature
---
[^1]
Introduction
============
We consider inverse curvature flows in either the Euclidean space $N={\mathbb{R}}^{n+1} $ or the hyperbolic space $N={\mathbb{H}}^{n+1}$ with sectional curvature $K_N=-1$, i.e. a family of embeddings [$$\begin{alignedat}{2} x{\colon}[0,T){\times}M{\rightarrow}N, \end{alignedat}$$]{} where $M$ is a closed, connected and orientable manifold of dimension $n$, which solves [$$\begin{alignedat}{2} \label{flow}\dot{x}={\frac{1}{F^p}}\nu,\quad 1<p<\infty. \end{alignedat}$$]{} Here $\nu=\nu(t,\xi)$ is the outward pointing normal to the flow hypersurface $M_t=x(t,M)$ and $F$ is evaluated at the principal curvatures ${\kappa}_i$ at the point $x(t,\xi)$.
Let us first state our main theorem. Therefore we will use the following assumptions for the curvature function $F$ and the initial hypersurface $M_0$.
\[1\] Let $n\ge 2$ and $$\Gamma_{+} = \{(\kappa_i)\in \mathbb{R}^n: \kappa_i>0, 1 \le i \le n\}.$$ Let $F \in C^{\infty}(\Gamma_{+})$ be a positive, strictly monotone and symmetric curvature function which is homogeneous of degree one and normalized to $F(1, ..., 1)=n$.
\[5\] Let $F$ satisfy Assumption \[1\]. Let $$x_0: M \rightarrow M_0 \subset N$$ be the smooth embedding of a hypersurface $M_{0}$ with $F_{|M_0}>0,$ which can be written as a graph over a geodesic sphere $\mathbb{S}^n$, $$M_0 = \{(u(0, y),y); y \in \mathbb{S}^n\}.$$
In the following statement of our main theorem, we let [$$\begin{alignedat}{2} H=\sum_{i=1}^n {\kappa}_i \end{alignedat}$$]{} be the mean curvature, $A$ the Weingarten operator, $\|A\|$ be its norm with respect to the induced metric and $I$ the identity. The principal curvatures ${\kappa}_{i}$, $1\leq i\leq n$, will always be labelled according to [$$\begin{alignedat}{2} {\kappa}_{1}\leq \dots\leq {\kappa}_{n}. \end{alignedat}$$]{}
\[main\_result\] Let $n\ge 2$ and let $N=N^{n+1}$ be either the Euclidean space or the hyperbolic space of constant sectional curvature $K_N=-1.$ Let $p>1$ and let $F$, $M_0$ satisfy . Furthermore, we assume that in case $K_N=0$, $M_0$ satisfies the pinching condition $$\label{3}
\|A\|^2-\frac{1}{n}H^2 < c_0H^2,$$ and in case $K_N=-1$, that $M_0$ satisfies the pinching condition [$$\begin{alignedat}{2} \label{main-2}\|A-I\|^2-{\frac{1}{n}} (H-n)^2< c_0 (H-n)^2, \end{alignedat}$$]{} where $0<c_0=c_0(F,n,p)<\frac{1}{n(n-1)}$ is sufficiently small. Then:
1. There exists a unique smooth solution on a maximal time interval $$\label{2}
x: [0, T^{*})\times M \rightarrow N,$$ of the equation $$\label{4}
\begin{aligned}
\dot x =& \frac{1}{F^p}\nu \\
x(0, \xi) =& x_0(\xi),
\end{aligned}$$ where $T^*<{\infty}$ in case $K_N=0$ and $T^*={\infty}$ in case $K_N=-1$, where $\nu = \nu(t, \xi)$ is the outward unit normal to $M_t=x(t, M)$ at $x(t, \xi)$ and $F$ is evaluated at the principal curvatures of $M_t$ at $x(t, \xi)$.
2. The flow hypersurfaces $M_t$ can be written as graphs of a function $u=u(t, \cdot)$ over $\mathbb{S}^n$ so that $$\lim_{t\rightarrow T^{*}}\inf_{\mathbb{S}^n}u(t, \cdot) =\infty$$ and properly rescaled flow hypersurfaces converge for all $m \in \mathbb{N}$ in $C^m(\mathbb{S}^n)$ to a geodesic sphere.
3. In case $K_N=0$ there exists a point $Q \in \mathbb{R}^{n+1}$ and a sphere $S^{*}=S_{R^{*}}(Q)$ around $Q$ with radius $R^{*}$ such that the spherical solutions $S_t$ with radii $R_t$ of with $M_0=S_{R^{*}}$ satisfy $$\operatorname{dist}(M_t, S_t) \le c R_t^{-\frac{p}{2}} \quad \forall \ t \in [0, T^{*}),$$ $c=c(p, M_0, F)$. Here $\operatorname{dist}$ denotes the Hausdorff distance of compact sets.
\(i) The rescalings, mentioned in (ii) of this theorem, are given by [$$\begin{alignedat}{2} {\tilde}u={\frac{u}{t}} \end{alignedat}$$]{} in case $K_N=-1$ and by [$$\begin{alignedat}{2} {\tilde}u={\frac{u}{\Theta}} \end{alignedat}$$]{} in case $K_N=0,$ where $\Theta$ is the unique radius of a sphere which exists exactly as long as the flow, i.e. for the time $T^*.$
\(ii) A result similar to (iii) can not be deduced in the hyperbolic space, cf. the nice counterexample in [@HungWang:09/2015].
\(iii) For flows by high powers of curvature, pinching conditions similar to and have already appeared for contracting flows in [@AndrewsMcCoy:03/2012] and [@Schulze:/2006]. Indeed we can mimic a counterexample to preserved convexity for contracting flows by Andrews-McCoy-Zheng [@AndrewsMcCoyZheng:07/2013 Thm. 3] and show that in general strict convexity (in particular general pinching) will be lost if $p>1$ and $F=H$.
Theorem \[main\_result\] shows the following: If we remove the assumptions $\Gamma=\Gamma_{+}$, $F_{|\partial \Gamma}=0$ as well as the concavity of $F$ in [@Gerhardt:01/2014 Theorem 1.2] and [@Scheuer:05/2015 Theorem 1.2] and replace them by a certain pinching condition for the initial hypersurface then the resulting theorems are true. This allows us e.g. to consider the interesting case $F=H$ and more generally [$$\begin{alignedat}{2} F=H_k^{{\frac{1}{k}}}, \end{alignedat}$$]{} where $H_k$ is the $k$-th elementary symmetric polynomial.
Expanding curvature flows of the form with $p=1$ have attracted a lot of attention, since they have proven to be useful in the deduction and generalization of several geometric inequalities, like the Riemannian Penrose inequality, [@HuiskenIlmanen:/2001], some Minkowski type inequalities, [@BrendleHungWang:01/2016] and [@GuanLi:08/2009], and Alexandrov-Fenchel type inequalities as in [@GeWangWu:04/2014]. The case $p=1$ has been treated in broad generality, cf. [@Gerhardt:/1990] and [@Urbas:/1990; @Urbas:/1991] for the Euclidean case, [@Gerhardt:11/2011] for the hyperbolic case and [@ChenMao:04/2018; @Ding:01/2011; @Gerhardt:/2015; @Kroner:/2018; @LiWei:/2017; @Lu:09/2016; @MakowskiScheuer:11/2016; @Scheuer:01/2017; @Zhou:04/2018] for other ambient spaces. For the case $p\neq 1$ there are fewer results. In the Euclidean case there is [@Gerhardt:01/2014; @Li:06/2010; @Schnuerer:/2006] and in the hyperbolic case there is [@Scheuer:05/2015]. All of these papers share the fact that only curvature functions $F$ are considered which vanish on the boundary of ${\Gamma}_{+}$, a property which forces preservation of convexity by definition. The goal of the present paper is the generalisation of both of these works. The second author already obtained an improvement of [@Scheuer:05/2015] in [@Scheuer:01/2015], where he could drop the pinching assumption on the initial hypersurface for some powers $p>1$ of the inverse Gauss curvature flow. But in particular for powers $p>1$ of the inverse mean curvature flow there are no results, up to the authors’ knowledge. In the recent preprint [@LiWangWei:09/2016] Li, Wang and Wei proved convergence results for the case $p<1$ in ${\mathbb{R}}^{3}$ and ${\mathbb{H}}^{3}$. The novelty in this paper is that they could also treat non-concave curvature functions, since for parabolic equations in two variables one can replace the Krylov-Safonov estimates by a regularity result due to Andrews [@Andrews:/2004]. Wei provided some new pinching estimates in the cases $p<1$ for a broad class of curvature functions in [@Wei:/2018]. Some non-homogeneous flow speeds are considered in [@ChowTsai:/1997] and [@ChowTsai:/1998].
The paper is organised as follows. In \[Not,Ev\] we collect some notation and evolution equations. In \[CEx\] we give the counterexample. In \[PE\] we prove the crucial preservation of a specific pinching of the initial hypersurface, whereafter in \[EC,HC\] we give an outline on how to finish the proof of \[main\_result\]. Here one could basically follow the lines of [@Gerhardt:01/2014] and [@Scheuer:05/2015], but due to the pinching estimates several aspects of the proofs in these references simplify so we present these simplified arguments for convenience.
Notation and preliminaries {#Not}
==========================
Let $n\geq 2$ and $N=N^{n+1}$ be either the Euclidean space or the hyperbolic space with constant sectional curvature $K_N=-1$ of dimension $n+1$. Let $M=M^n$ be a compact, connected, smooth manifold and [$$\begin{alignedat}{2} x{\colon}M{\hookrightarrow}N \end{alignedat}$$]{} be an embedding with unit outward normal vector field $\nu,$ (compare the nice note [@Samelson:07/1969]). Let $g=(g_{ij})$ be the induced metric on $M$, where $g_{ij}$ are the components of $g$ with respect to the basis $x_i={\partial}_i x$, $1\leq i\leq n$. In tensor expressions latin indices always range between $1$ and $n$ and greek indices range from $0$ to $n$ indicating components of tensors of the ambient space. The coordinate expression of a covariant derivative with respect to the Levi-Civita connection of $g$ of a tensor field $T\in T^{k,l}M$ are indicated by a semi-colon, [$$\begin{alignedat}{2} {\nabla}^r T={\left(T^{i_1\dots i_k}_{j_1\dots j_l;m_1\dots m_r}\right)}. \end{alignedat}$$]{} The second fundamental form $h=(h_{ij})$ is given by the Gaussian formula [$$\begin{alignedat}{2} x_{;ij}=-h_{ij}\nu \end{alignedat}$$]{} and the Weingarten map is denoted by $A=(h^i_j)$.
For any $q\in N$ the pointed Euclidean as well as the hyperbolic space $N{\backslash}\{q\}$ is diffeomorphic to $(0,{\infty}){\times}{\mathbb{S}}^n$ and is covered by geodesic polar coordinates. The metric is given by [$$\begin{alignedat}{2} {\bar}g_{{\alpha}{\beta}}=dr^2+{\vartheta}^2(r){\sigma}_{ij}\equiv dr^2+{\bar}g_{ij}, \end{alignedat}$$]{} where $r$ is the geodesic distance to $q$, ${\sigma}$ is the round metric on ${\mathbb{S}}^n$ and [$$\begin{alignedat}{2} {\vartheta}(r)=\begin{cases} r, &N={\mathbb{R}}^{n+1}\\
\sinh r, &N={\mathbb{H}}^{n+1}.\end{cases} \end{alignedat}$$]{} The principal curvatures ${\bar}{\kappa}_i$ of the coordinates slices $\{r={\mathrm}{const}\}$ are given by [$$\begin{alignedat}{2} {\bar}{\kappa}_i={\frac{{\vartheta}'(r)}{{\vartheta}(r)}}. \end{alignedat}$$]{} Since our hypersurfaces will all be convex, they can be written as graphs in geodesic polar coordinates over ${\mathbb{S}}^n,$ [$$\begin{alignedat}{2} M=\{(u(y),y){\colon}y\in {\mathbb{S}}^n\}, \end{alignedat}$$]{} where $u$ is a smooth function on ${\mathbb{S}}^n.$ Define [$$\begin{alignedat}{2} v=\sqrt{1+|Du|^2}=\sqrt{1+{\bar}g^{ij}u_{;i}u_{;j}}. \end{alignedat}$$]{} In terms of a graph, the second fundamental form of $M$ can be expressed as [$$\begin{alignedat}{2} h_{ij}v^{-1}=-u_{;ij}+{\bar}h_{ij}, \end{alignedat}$$]{} cf. [@Gerhardt:/2006 Rem. 1.5.1].
Let us also make some comments on the speed functions under which the family of embeddings evolve. By \[1\] these are given by smooth, symmetric functions $F$ on an open, symmetric and convex cone ${\Gamma}{\subset}{\mathbb{R}}^{n}$. It is well known, that such a function can be written as a smooth function of the elementary symmetric polynomials $s_{k}$, [$$\begin{alignedat}{2} F=\rho(s_{1},\dots,s_{n}), \end{alignedat}$$]{} compare [@Glaeser:01/1963]. The associated functions to $s_{k}$, which are defined on endomorphisms of the tangent space, are traditionally denoted by $H_{k}$ and given by [$$\begin{alignedat}{2} H_{k}(A)={\frac{1}{k!}}{\frac{d}{dt}}\det(I+tA)_{|t=0} \end{alignedat}$$]{} for all $A\in T^{1,1}(M)$, cf. [@Gerhardt:/2006 equ. (2.1.31)]. Hence also $F$ can be viewed as a function defined on the endomorphism bundle $T^{1,1}(M)$, i.e. [$$\begin{alignedat}{2} F=F(A)=F(h^{i}_{j}). \end{alignedat}$$]{} We will, however, mostly use a different description of $F$, namely as being defined on two variables $(g,h)$ by setting [$$\begin{alignedat}{2} {\mathcal}{F}(g,h)=F{\left({\frac{1}{2}} g^{ik}(h_{jk}+h_{kj})\right)}, \end{alignedat}$$]{} where $(g^{ik})$ is the inverse of the positive definite $(0,2)$-tensor $g$ and $h\in T^{0,2}(M)$. We denote by ${\mathcal}{F}^{ij}$ and ${\mathcal}{F}^{ij,kl}$ the first and second derivatives of ${\mathcal}{F}$ with respect to $h$, i.e. [$$\begin{alignedat}{2} {\mathcal}{F}^{ij}={\frac{{\partial}{\mathcal}{F}}{{\partial}h_{ij}}},\quad {\mathcal}{F}^{ij,kl}={\frac{{\partial}^{2}{\mathcal}{F}}{{\partial}h_{ij}{\partial}h_{kl}}}. \end{alignedat}$$]{} Due to the monotonicity assumption on $F$ as a function of the principal curvatures, the tensor $({\mathcal}{F}^{ij})$ is positive definite at all pairs $(g,h)$, such that $(g^{ik}(h_{kj}+h_{jk}))$ has eigenvalues in ${\Gamma}$. Compare [@Andrews:/2007], [@Gerhardt:/2006 Ch. 2] and [@Scheuer:06/2018] for more details.
We also note that we will in the sequel use the same symbol $F$ for both functions $F$ and ${\mathcal}{F}$. This will not cause confusion, since in expressions like $F^{ij}h_{ik}h^{k}_{j}$ it only makes sense to think of ${\mathcal}{F}$.
We always assume that $p>1$, set $\Phi(r)=-r^{-p}$ for $r>0$ and write [$$\begin{alignedat}{2} \Phi'(r) = \frac{d}{dr}\Phi(r),\quad \dot \Phi = \frac{d(\Phi \circ F)}{dt}. \end{alignedat}$$]{}
Evolution equations {#Ev}
===================
The proof of the following evolution equations is given in [@Gerhardt:/2006 Lemma 2.3.4], [@Gerhardt:/2006 Lemma 3.3.2] and [@Gerhardt:01/1996 Lemma 5.8].
\[EvEq\_2\] Under the flow the geometric quantities [$$\begin{alignedat}{2} \Phi=-F^{-p},\quad \chi={\frac{v}{{\vartheta}(u)}} \end{alignedat}$$]{} and $u$ evolve as follows [$$\begin{alignedat}{2} \label{401}
\dot \Phi- \Phi' F^{ij}\Phi_{;ij} =& \Phi' F^{ij}h_{ik}h^k_j\Phi+K_N\Phi'F^{ij}g_{ij}\Phi, \end{alignedat}$$]{} [$$\begin{alignedat}{2} \dot \chi - \Phi' F^{ij}\chi_{;ij} =& - \Phi' F^{ij}h_{ik}h^k_j\chi-2\chi^{-1} \Phi'
F^{ij}\chi_{;i}\chi_{;j}+\{\Phi' F + \Phi\}\frac{\bar H}{n}v \chi, \end{alignedat}$$]{} and [$$\begin{alignedat}{2} \dot u - \Phi' F^{ij}u_{;ij} =& v^{-1}(1+p)F^{-p}- \Phi' F^{ij}\bar h_{ij}, \end{alignedat}$$]{} where ${\bar}H$ denotes the mean curvature of the coordinate slice $\{r=u\}.$
\[EvEq\] Under the flow the Weingarten map form evolves by [$$\begin{alignedat}{2} \label{Evh}\dot{h}^i_j-\Phi'F^{kl}h^i_{j;kl}&=\Phi'F^{kl}h_{rk}h^r_lh^i_j-(\Phi'F-\Phi)h^i_kh^k_j+K_N(\Phi+\Phi'F){\delta}^i_j\\
&{\hphantom}{=}-K_N\Phi'F^{kl}g_{kl}h^i_j+\Phi^{kl,rs}h_{kl;j}{h_{rs;}}^i. \end{alignedat}$$]{} For $K_N=-1$ the tensor [$$\begin{alignedat}{2} b^i_j=h^i_j-{\delta}^i_j \end{alignedat}$$]{} evolves by [$$\begin{alignedat}{2} \label{EvBij}\dot{b}^i_j-\Phi'F^{kl}b^i_{j;kl}&=\Phi'F^{kl}b_{rk}b^r_l b^i_j+\Phi'F^{kl}b_{rk}b^r_l {\delta}^i_j+2\Phi b^i_j\\
&{\hphantom}{=}-{\left(\Phi'F-\Phi\right)}b^i_k b^k_j +\Phi^{kl,rs}b_{kl;j}{b_{rs;}}^i \end{alignedat}$$]{} and hence $B=b^i_i$ evolves by [$$\begin{alignedat}{2} \label{EvB}\dot{B}-\Phi'F^{kl}B_{kl}&=\Phi'F^{kl}b_{rk}b^r_lB+n\Phi'F^{kl}b_{rk}b^r_l+2\Phi B\\
&{\hphantom}{=}-{\left(\Phi'F-\Phi\right)}b^i_k b^k_i+\Phi^{kl,rs}b_{kl;i}{b_{rs;}}^i. \end{alignedat}$$]{}
is given in [@Gerhardt:/2006 Lemma 2.4.3], hence we only prove . [$$\begin{alignedat}{2} \dot{b}^i_j-\Phi'F^{kl}b^i_{j;kl}&=\Phi'F^{kl}h_{rk}h^r_lh^i_j-(\Phi'F-\Phi)h^i_kh^k_j-(\Phi+\Phi'F){\delta}^i_j\\
&{\hphantom}{=}+\Phi'F^{kl}g_{kl}h^i_j+\Phi^{kl,rs}h_{kl;j}{h_{rs;}}^i\\
&=\Phi'F^{kl}{\left(h_{rk}h^r_l-2h_{kl}+g_{kl}\right)}h^i_j+2\Phi'Fh^i_j\\
&{\hphantom}{=}-{\left(\Phi'F-\Phi\right)}{\left(h^i_k-{\delta}^i_k\right)}{\left(h^k_j-{\delta}^k_j\right)}-2{\left(\Phi'F-\Phi\right)}{\left(h^i_j-{\delta}^i_j\right)}\\
&{\hphantom}{=}-{\left(\Phi'F-\Phi\right)}{\delta}^i_j-{\left(\Phi'F+\Phi\right)}{\delta}^i_j+\Phi^{kl,rs}h_{kl;j}{h_{rs;}}^i. \end{alignedat}$$]{} Rearranging gives the result.
A counterexample to preserved convexity {#CEx}
=======================================
For contracting flows, i.e. flows of the form [$$\begin{alignedat}{2} \dot{x}=-\Phi\nu \end{alignedat}$$]{} with positive $\Phi$, Andrews-McCoy-Zheng [@AndrewsMcCoyZheng:07/2013] gave an example of a (weakly) convex hypersurface in ${\mathbb{R}}^{n+1}$ which develops a negative principal curvature instantly for a certain class of speeds $\Phi$. By continuity with respect to initial values this shows that for these $\Phi$ one can also find strictly convex initial hypersurfaces which develop negative principal curvatures quickly.
In this section we briefly sketch that we generally face the same phenomenon in our case of expanding flows. Precisely we will see that for powers $p>1$ of the inverse mean curvature flow convexity might be lost, indicating that a stronger pinching condition as for example in \[main\_result\] is needed.
We will show that the loss of convexity can occur along the flow [$$\begin{alignedat}{2} \label{CE}\dot{x}={\frac{1}{H^{p}}}\nu,\quad p>1, \end{alignedat}$$]{} for simplicity in ${\mathbb{R}}^{3}$. Contrary to the contracting case, where a more sophisticated speed is needed, here we can make use of the strong concavity of the function $\Phi=-H^{-p}$, which gives an additional negative term in [$$\begin{alignedat}{2} \Phi^{kl,rs}={\frac{p}{H^{p+1}}}H^{kl,rs}-{\frac{p(p+1)}{H^{p+2}}}H^{kl}H^{rs}=-{\frac{p(p+1)}{H^{p+2}}}g^{kl}g^{rs}. \end{alignedat}$$]{} Let us briefly recall the method in [@AndrewsMcCoyZheng:07/2013 Thm. 3] how to construct such a convex initial hypersurface. First they construct a local graph using the function [$$\begin{alignedat}{2} u(\xi)={\frac{c_{1}}{24}}\xi_{1}^{4}+{\frac{1}{2}}{\left(a_{2}+b_{2}\xi_{1}+{\frac{1}{2}} c_{2}\xi_{1}^{2}\right)}\xi_{2}^{2}, \end{alignedat}$$]{} where $a_{2},b_{2}$ are arbitrary positive numbers and [$$\begin{alignedat}{2} c_{1}={\frac{1}{4}},\quad c_{2}={\frac{2b_{2}^{2}}{a_{2}}}+{\frac{1}{4}} \end{alignedat}$$]{} There holds $u(0)=Du(0)=0$ and hence at $\xi=0$, compare [@AndrewsMcCoyZheng:07/2013 equ. (16),(17),(18)], [$$\begin{alignedat}{2} h_{ij}=u_{,ij}, \end{alignedat}$$]{} [$$\begin{alignedat}{2} h_{ij;k}=u_{,ijk} \end{alignedat}$$]{} and [$$\begin{alignedat}{2} h_{ij;kl}=u_{,ijkl}-u_{,ij}u_{,km}{u_{,l}}^{m}-u_{,ki}u_{,jm}{u_{,l}}^{m}-u_{,kj}u_{,im}{u_{,l}}^{m}, \end{alignedat}$$]{} where indices appearing after a comma denote usual partial derivatives. In the proof of [@AndrewsMcCoyZheng:07/2013 Thm. 2] it is shown that the graph of $u$ over a small ball $B_{r}(0)$ is a convex hypersurface, which is strictly convex in $\xi\neq 0$, and that this graph can be closed up to a convex hypersurface, respecting the strict convexity in $\xi\neq 0$. Due to $H(0)=a_{2}>0$, the hypersurface is strictly mean convex and is defined for short time.
It remains to show that under the flow , the entry $h_{11}(t,0)$ of the second fundamental form, which equals zero at $t=0$, drops below zero instantly. According to we have at $(t,\xi)=(0,0)$:
[$$\begin{alignedat}{2} \dot{h}_{11}&={\frac{p}{a_{2}^{p+1}}}(h_{11;11}+h_{11;22})-{\frac{p(p+1)}{a_{2}^{p+2}}}(h_{11;1}+h_{22;1})^{2}\\
&={\frac{p}{a_{2}^{p+1}}}(c_{1}+c_{2})-{\frac{p(p+1)}{a_{2}^{p+2}}}b_{2}^{2}\\
&={\frac{p}{a_{2}^{p+2}}}{\left({\frac{a_{2}}{2}}+2b_{2}^{2}-(p+1)b_{2}^{2}\right)}\\
&={\frac{p}{a_{2}^{p+2}}}{\left({\frac{a_{2}}{2}}+(1-p)b_{2}^{2}\right)}\\
&<0 \end{alignedat}$$]{} for a suitable arrangement of $a_{2}$ and $b_{2}$, due to $p>1$. Hence $h_{11}$ drops below zero instantly and the example is complete.
The pinching estimates {#PE}
======================
We define $b_{ij}=h_{ij}+K_Ng_{ij}$ where $K_N=-1$ or $K_N=0$. We set $B = b^i_i$ and $\|b\|^2=b^i_j b^j_i$ in both cases.
\[pinching\] Let $T^{*}>0$ and let $x$ be a solution of on $[0, T^{*})$. If $M_0$ satisfies the pinching condition $$\label{3_new}
\|b\|^2-\frac{1}{n}B^2 < c_0B^2,$$ where $0<c_0=c_0(F,n,p)<\frac{1}{n(n-1)}$ is sufficiently small, then remains valid for all $t \in [0, T^{*})$.
While in the Euclidean case the proof is similar to the proof of [@Scheuer:07/2016 Prop. 3.4] we need further arguments in the hyperbolic case. We begin with some facts which hold in both cases. Let $\gamma = \frac{1}{n}+c_0$ and define the quantity $$z= \|b\|^2-\gamma B^2.$$ Then, due to \[EvEq\], $z$ satisfies the evolution equation $$\label{7_new}
\begin{aligned}
\dot z -\Phi' F^{kl}z_{;kl}
=& 2 \Phi' F^{kl}b_{rk}b^r_l z - 2 (\Phi'F-\Phi)\left(b^i_kb^k_jb^j_i - \gamma B\|b\|^2\right)\\
& + 2 \Phi^{kl, rs}b_{kl;i}b_{rs;}^{\ \ \ j}\left(b^i_j-\gamma B\delta^i_j\right) - 2 \Phi'F^{kl}\left(b^i_{j;k}b^j_{i;l}-\gamma B_kB_l\right)\\
& -K_N\left\{4\Phi z - 2nc_0 \Phi'F^{kl}b_{rk}b^r_lB\right\}
\end{aligned}$$ and due to [@AndrewsMcCoy:03/2012 Lemma 2.1] we have $$\label{And_deriv_new}
\begin{aligned}
g^{kl}\left(b^i_{j;k}b^j_{i;l}-\frac{1}{n}B_kB_l\right) =& \left\|\nabla\left(A-\frac{1}{n}H\operatorname{id}\right)\right\|^2\ge \frac{2(n-1)}{3n}\|\nabla A\|^2 \\
\ge& \frac{2(n-1)}{n(n+2)}\|\nabla H\|^2= \frac{2(n-1)}{n(n+2)}\|\nabla B\|^2.
\end{aligned}$$
\(i) Let us now assume that $K_N=0$. In view of (\[3\_new\]) we have $z(0, \cdot) <0$. We want to show that $z(t, \cdot)<0$ for all $0 \le t < T^{*}$. For this we assume that there is a minimal $0<t<T^{*}$ and $x\in M_t$ so that $z(t,x)=\sup z(t, \cdot) =0$. From [@AndrewsMcCoy:03/2012 Lemma 2.3] we deduce that $$\begin{aligned}
b^i_k b^k_j b^j_i - \gamma B \|b\|^2&\ge c_0 \gamma \left(1-\sqrt{n(n-1)c_0}\right)B^3 \\ &= c_0\left(1-\sqrt{n(n-1)c_0}\right)\|b\|^2B > 0
\end{aligned}$$ in $(t,x)$.
Using we conclude that $$\label{8_new}
\begin{aligned}
0 \le &- 2c_0 (\Phi'F-\Phi)\left(1-\sqrt{n(n-1)c_0}\right) \|b\|^2B\\
&+ 2 B \Phi^{kl, rs}b_{kl;i}b_{rs;}^{\ \ \ j} \left(B^{-1}b^i_j-\gamma\delta^i_j\right) \\
& -\frac{2(n-1)}{n(n+2)}\Phi'\|\nabla B\|^2-\frac{2(n-1)}{3n}\Phi'\|\nabla b\|^2 \\
& - 2 \Phi'\left(F^{kl}-g^{kl}\right)\left(b^i_{j;k}b^j_{i;l}-\frac{1}{n} B_kB_l\right)\\
&+2 c_0 \Phi' \|\nabla B\|^2+2c_0 \Phi' \left(F^{kl}-g^{kl}\right)B_kB_l
\end{aligned}$$ in $(t,x)$. Due to [@AndrewsMcCoy:03/2012 equ. (4.3)], $$\|F^{kl}-g^{kl}\|\leq \mu\sqrt{c_{0}}$$ for a constant $\mu$ only depending on $n$ and $F$, so the terms in the second, fourth and fifth line of (\[8\_new\]) can be absorbed by the terms in the third line of (\[8\_new\]). Then the right-hand side of (\[8\_new\]) is negative, a contradiction. Note, to estimate the term in the second line of (\[8\_new\]) we used the homogeneity of $F$, $$\Phi^{kl,rs} = \Phi'F^{kl,rs} + \Phi'' F^{kl}F^{rs}$$ and $$c_1 \le \frac{F}{H} \le c_{2}$$ in $(t, x)$ where $c_i$ are positive constants depending only on $c_0$. For further details we refer to [@AndrewsMcCoy:03/2012 equ. (4.2), (4.3)].
\(ii) We assume that $K_N=-1$. The quantity $$\tilde z = z+\alpha e^{-\Lambda t},$$ where a small $\alpha>0$ and a large $\Lambda>0$ will be specified later, satisfies the evolution equation $$\label{17_new}
\begin{aligned}
\dot {\tilde z} -\Phi' F^{kl}\tilde z_{;kl}
=& -\Lambda \alpha e^{-\Lambda t}+\dot z - \dot \Phi F^{kl}z_{kl}\\
=& -\Lambda \alpha e^{-\Lambda t}+2 \Phi' F^{kl}b_{rk}b^r_l (\tilde z-\alpha e^{-\Lambda t}) \\
& - 2 (\Phi'F-\Phi)\left(b^i_kb^k_jb^j_i - \gamma B\|b\|^2\right) \\
& + 2 \Phi^{kl, rs}b_{kl;i}b_{rs;}^{\ \ \ j}\left(b^i_j-\gamma B\delta^i_j\right) - 2 \Phi'F^{kl}\left(b^i_{j;k}b^j_{i;l}-\gamma B_kB_l\right)\\
& -K_N\left\{4\Phi (\tilde z-\alpha e^{-\Lambda t}) - 2nc_0 \Phi'F^{kl}b_{rk}b^r_lB\right\}.
\end{aligned}$$
Assuming that $\alpha$ is small we have $\tilde z(0, \cdot) <0$ in view of (\[3\_new\]). We want to show that $\tilde z(t, \cdot)<0$ for all $0 \le t < T^{*}$. For this we assume that there is a minimal $0<t<T^{*}$ and $x\in M_t$ so that $\tilde z(t,x)=\sup \tilde z(t, \cdot) =0$. Due to minimality of $t$ we conclude $B(t',\cdot) > 0$ for all $0 \le t' \le t$. Especially, $$\label{30_new}
\|b\|^2-\frac{1}{n}B^2 < c_0 B^2=c_0(H-n)^2\le c_0 H^2$$ and $M_{t'}$ is strictly horospherically convex for all $0 \le t' \le t$ due to [@AndrewsMcCoy:03/2012 Lemma 2.2]. We deduce that $$0 < n < F \quad \text{in }[0, t].$$ There holds $$\|b\|^2-\frac{1}{n}B^2 = \tilde c_0B^2 \quad \text{in } (t,x)$$ with $$\tilde c_0 = c_0 -\frac{\alpha e^{-\Lambda t}}{B^2(t,x)}.$$
Note, that $0 \le \tilde c_0 < c_0$. From [@AndrewsMcCoy:03/2012 Lemma 2.3] we deduce that $$\begin{aligned}
b^i_k b^k_j b^j_i - & \left(\frac{1}{n}+\tilde c_0\right) B \|b\|^2 >0
\end{aligned}$$ in $(t,x)$ if $\tilde c_0>0$. If $\tilde c_0=0$ then $x$ is umbilical point of $M_t$, so let us write $\kappa=\kappa_i$. Then we have $$c_0n^2(\kappa-1)^2 = c_0B^2 = \alpha e^{-\Lambda t}$$ and $$\begin{aligned}
b^i_k b^k_j b^j_i - & \left(\frac{1}{n}+ c_0\right) B \|b\|^2 =-c_0n^2(\kappa-1)^3 = -\alpha e^{-\Lambda t}(\kappa-1)
\end{aligned}$$ in $(t,x)$. Using , the maximum principle, and the fact that $B(t,x)>0$ we conclude that $$\label{18_new}
\begin{aligned}
0 \le & -\Lambda \alpha e^{-\Lambda t}-2\alpha e^{-\Lambda t}\Phi'F^{kl}b_{rk}b^r_l + I_1 \\
& + 2 B \Phi^{kl, rs}b_{kl;i}b_{rs;}^{\ \ \ j} \left(B^{-1}b^i_j-\gamma\delta^i_j\right) \\
& -\frac{2(n-1)}{n(n+2)}\Phi'\|\nabla B\|^2-\frac{2(n-1)}{3n}\Phi'\|\nabla b\|^2 \\
& - 2 \Phi'\left(F^{kl}-g^{kl}\right)\left(b^i_{j;k}b^j_{i;l}-\frac{1}{n} B_kB_l\right)\\
&+2 c_0 \Phi' \|\nabla B\|^2+2c_0 \Phi' \left(F^{kl}-g^{kl}\right)B_kB_l - 4\alpha \Phi e^{-\Lambda t}
\end{aligned}$$ in $(t,x)$ where $$I_1 =
\begin{cases}
2(c_0-\tilde c_0)(\Phi'F-\Phi)B\|b\|^2 \quad &\text{if } \tilde c_0>0, \\
2(\Phi'F-\Phi)\alpha e^{-\Lambda t}(\kappa-1) \quad &\text{if } \tilde c_0=0.
\end{cases}$$ For $c_0$ sufficiently small, the term $$\|F^{kl}-g^{kl}\|$$ is small and the terms in the second, fourth and fifth line of (\[18\_new\]) can be absorbed by the terms in the third line of (\[18\_new\]). Then the right-hand side of (\[18\_new\]) is negative if $\Lambda$ is large, a contradiction.
The Euclidean case {#EC}
==================
The aim of this section is to prove Theorem \[main\_result\] for the case $K_N=0$. Due to the pinching estimates of the previous section we are in the situation that the proof in [@Gerhardt:01/2014] basically carries over literally. For convenience of the reader, and since several elements of the proof simplify due to our pinching estimates, we give an outline of the arguments involved. Throughout this section it is understood that the assumptions of \[main\_result\] hold.
We recall some simple observations. If the initial hypersurface $M_0$ is a sphere of radius $r_0>0$, i.e. $u(0, \cdot)=r_0$, then the flow hypersurfaces of the flow remain spheres and for their radii $\Theta(t)$ at time $t$ we obtain the ODE $$\label{SphFlow}
\dot \Theta = \frac{\Theta^p}{n^p}, \quad r(0) = r_0,$$ with solution $$\Theta(t) = \left(\frac{1-p}{n^p}t+r_0^{1-p}\right)^{\frac{1}{1-p}}$$ on $[0, T^{*}(r_0))$ where $$\label{sphericaltime}
T^{*}(r_0) = \frac{n^p}{p-1}r_0^{1-p}.$$ Hence the spherical flow blows up at time $T^{*}(r_0)$. The existence of a smooth solution to up to a maximal time is well known, cf. [@Gerhardt:/2006 Sec. 2.5, Sec. 2.6].
From the avoidance principle we conclude the following corollary.
\[13\] If $r_1, r_2$ are positive constants so that $$r_1 < |x(0, \cdot)| < r_2$$ where $x$ is the solution of (\[4\]) then we have $$\label{31}
\Theta(t, r_1) < |x(t, \cdot)| < \Theta(t, r_2) \quad \forall \ 0 \le t < \min\{T^{*}, T^{*}(r_1), T^{*}(r_2)\}.$$
The next aim is to show that $\max|x(t,\cdot)|$ blows up, when the time approaches $T^*.$
\[blowup\] The flow (\[4\]) only exists in a finite time interval $[0, T^{*})$ and there holds $$\label{33}
\limsup_{t \rightarrow T^{*}}\max_{M}|x(t, \cdot)| = \infty.$$
In view of Lemma \[pinching\] the hypersurfaces are convex and from (\[31\]) we deduce that the maximal time $T^{*}$ has to be finite. Due to the convexity we may write the flow hypersurfaces $M_t$ as radial graphs over the sphere, [$$\begin{alignedat}{2} M_t=\{u(t,x)x{\colon}x\in {\mathbb{S}}^n\} \end{alignedat}$$]{} for some $u\in C^{{\infty}}([0,T^*){\times}{\mathbb{S}}^n).$ Then $u$ satisfies the scalar flow equation $$\dot u = \frac{1}{vF^p}$$ where the dot indicates the total time derivative, or $$\label{32}
\frac{\partial u}{\partial t} = \frac{v}{F^p}$$ when we consider the partial time derivative, cf. [@Gerhardt:/2006 p. 98-99]. Under the assumption that $|x|$ is bounded, which is equivalent to $u\leq c,$ we also obtain the $C^1({\mathbb{S}}^n)$-estimate [$$\begin{alignedat}{2} v\leq c \end{alignedat}$$]{} due to the convexity of $M_t$ and [@Gerhardt:/2006 Thm. 2.7.10]. To obtain a $C^2({\mathbb{S}}^n)$-estimate, we need some curvature estimates. The proof is similar to the one for [@Gerhardt:01/2014 Lemma 3.10, Lemma. 4.4]: Define the auxiliary function [$$\begin{alignedat}{2} w=\log(-\Phi)+\log\chi +{\gamma}u, \end{alignedat}$$]{} which, due to \[EvEq\_2\], satisfies the evolution equation [$$\begin{alignedat}{2} \label{blowup-1}\dot{w}-\Phi'F^{ij}w_{;ij}&=\Phi'F^{ij}(\log(-\Phi))_{;i}(\log(-\Phi))_{;j}-\Phi'F^{ij}(\log\chi)_{;i}(\log\chi)_{;j}\\
&{\hphantom}{=}+(\Phi'F+\Phi){\frac{\bar{H}}{n}}v+{\gamma}(\Phi'F-\Phi)v^{-1}-{\gamma}\Phi'F^{ij}\bar{h}_{ij}. \end{alignedat}$$]{} At spatial maxima of $w$ there holds (recall $\chi={\frac{v}{u}},$) [$$\begin{alignedat}{2} \label{blowup-2}&\Phi'F^{ij}(\log(-\Phi))_{;i}(\log(-\Phi))_{;j}-\Phi'F^{ij}(\log\chi)_{;i}(\log\chi)_{;j}\\
=~&2{\gamma}\Phi'F^{ij}(\log\chi)_{;i}u_{;j}+{\gamma}^2\Phi'F^{ij}u_{;i}u_{;j}\\
=~&-2{\gamma}v\Phi'F^{ij}h^k_i u_{;k}u_{;j}+{\gamma}^2\Phi'F^{ij}u_{;i}u_{;j}, \end{alignedat}$$]{} where we used [$$\begin{alignedat}{2} v_{;i}=-v^2 h^k_i u_{;k}+v{\frac{{\bar}H}{n}}u_{;i}, \end{alignedat}$$]{} cf. [@Gerhardt:01/1996 equ. (5.29)]. Since [$$\begin{alignedat}{2} F^{ij}{\bar}h_{ij}={\frac{{\bar}H}{n}}F^{ij}{\bar}g_{ij}\geq c F^{ij}g_{ij}\geq cn, \end{alignedat}$$]{} due to the pinching estimate, we have [$$\begin{alignedat}{2} {\gamma}^2\Phi'F^{ij}u_{;i}u_{;j}-{\frac{{\gamma}}{2}}\Phi'F^{ij}{\bar}h_{ij}\leq {\gamma}\Phi'F^{ij}{\left({\gamma}u_{;i}u_{;j}-{\frac{c}{2}} g_{ij}\right)}<0 \end{alignedat}$$]{} for small ${\gamma}$ and the other half of the term $F^{ij}{\bar}h_{ij}$ can be used to absorb the other positive terms in , since the negatively signed term has the highest order in ${\frac{1}{F}}$. We obtain that $w$ is a priori bounded. It is immediate from \[EvEq\_2\] and the maximum principle that $F$ is bounded as well. Due to the pinching estimates \[pinching\] we have [$$\begin{alignedat}{2} {\kappa}_1\geq c{\kappa}_n, \end{alignedat}$$]{} also compare [@AndrewsMcCoy:03/2012 Lemma 2.2]. Hence ${\kappa}_n$ must be bounded and ${\kappa}_1\geq c>0$ as long as $u$ is bounded. Thus as long as the flow ranges in compact subsets of ${\mathbb{R}}^{n+1}$ we have uniform $C^2({\mathbb{S}}^n)$-estimates. Note that we can not use the Krylov-Safonov theory to deduce $C^{2,\alpha}({\mathbb{S}}^{n})$ estimates, since we did not assume any sign on the second derivatives of $F$.
However, due to the pinching estimates we are in the situation that $F^{ij}$ is as close to $g^{ij}$ as we want and hence we can use a parabolic version of the $C^{1,\alpha}$-estimates originally proved by Cordes [@Cordes:06/1956] and Nirenberg [@Nirenberg:/1954] for linear elliptic equations, cf. [@Lieberman:/1998 Lemma 12.13]. This theorem is also stated in [@AndrewsMcCoy:03/2012 Thm. 7.3], where in addition the reader may find the detailed procedure, how one can get Hölder estimates on the second derivatives of solutions to the curvature flow equation. Higher order estimates then follow from Schauder theory. Hence at the maximal time of existence $u$ must blow up.
Let $r_0>0$ be so that $T^{*}(r_0)=T^{*}$, where $T^{*}(r_{0})$ is given by , then for all $0 \le t < T^{*}$ there is a $\xi_t\in \mathbb{S}^n$ such that $$\label{500}
u(t, \xi_t) = \Theta(t, r_0)$$ in view of Corollary \[13\]. The spherical flow with existence time $T^*(r_0)$ provides the correct scaling factor. In particular, applying the evolution equation for the support function ${\bar}u=\chi^{-1},$ as deduced in [@Urbas:/1991 Section 2] and the oscillation estimates from [@ChowGulliver:/1996 Theorem 3.1], also compare [@McCoy:/2003 Theorem 3.1], we conclude that the following lemma holds for [$$\begin{alignedat}{2} {\tilde}u=u\Theta^{-1}. \end{alignedat}$$]{}
\[602\] Let $u$ be the solution of the scalar flow equation (\[32\]). Then there exists a positive constant $c$ such that $$\label{230}
u(t, x) -c \le \Theta(t, r_0) \le u(t, x) +c \quad \forall x \in \mathbb{S}^n,$$ hence $$\label{201}
\lim_{t \rightarrow T^{*}} {\tilde}u(t,x) =1 \quad \forall x \in \mathbb{S}^n.$$ We also have $$v-1 \le c \Theta^{-1}.$$
Literally as in [@Gerhardt:01/2014 Lemma 3.5, Lemma 3.7].
We need the following bounds for the rescaled principal curvatures.
\[Scaledkappa\] Under the flow , the rescaled principal curvatures ${\tilde}{\kappa}_i=\Theta {\kappa}_i$ satisfy [$$\begin{alignedat}{2} 0<c_1\leq {\tilde}{\kappa}_i\leq c_2 \end{alignedat}$$]{} for suitable constants $c_i=c_i(M_0).$
Due to the pinching estimates, as in the proof of \[blowup\] it suffices to prove the existence of constants $c_i$ such that [$$\begin{alignedat}{2} 0<c_1\leq \Theta F={\tilde}F=F({\tilde}h^i_j)\leq c_2. \end{alignedat}$$]{} We begin with the upper bound. For ${\lambda}>0$ define the function [$$\begin{alignedat}{2} z=\log{\tilde}F^p+{\lambda}{\tilde}u\equiv-\log(-{\tilde}\Phi)+{\lambda}{\tilde}u. \end{alignedat}$$]{} Due to \[EvEq\_2\] and , $z$ satisfies [$$\begin{alignedat}{2} \dot{z}-\Phi'F^{ij}z_{;ij}&\leq-\Phi'F^{ij}h_{ik}h^k_j+{\frac{p}{n^p}}\Theta^{p-1}+{\lambda}v^{-1}(p+1){\tilde}F^{-p}\Theta^{p-1}\\
&{\hphantom}{=}-{\lambda}p{\tilde}F^{-(p+1)}F^{ij}{\bar}g_{ij}{\tilde}u^{-1}\Theta^{p-1}-{\lambda}n^{-p}{\tilde}u\Theta^{p-1}\\
&\leq {\frac{\Theta^{p-1}}{n^p}}{\left(p-{\frac{{\lambda}}{2}}{\tilde}u\right)}+{\lambda}\Theta^{p-1}{\left(v^{-1}(p+1){\tilde}F^{-p}-{\frac{n^{-p}}{2}}{\tilde}u\right)}, \end{alignedat}$$]{} which is negative if ${\lambda}$ and ${\tilde}F$ are large enough, due to \[602\].
To prove the lower bound we proceed as in [@Gerhardt:01/2014 Lemma 3.10]. We consider the function $$w = \log(-\tilde \Phi) + \log \tilde \chi + \tilde u,$$ where ${\tilde}\chi=\Theta\chi.$ Let $0<T<T^{*}$ be arbitrary and assume that $\sup_{Q_T}w$, where $$Q_T= [0, T] \times \mathbb{S}^n,$$ is attained in $(t_0, x_0)$ with large $t_0>0$. The maximum principle implies in $(t_0, x_0)$ $$\label{301}
\begin{aligned}
0 \le& \Phi' F^{ij}(\log(-\tilde \Phi ))_i(\log(-\tilde \Phi ))_j - \Phi' F^{ij}(\log \tilde \chi)_i(\log \tilde \chi)_j \\
& + c \tilde F^{-p}\Theta^{p-1}-p\tilde F^{-(p+1)}F^{ij}\bar g_{ij}\tilde u^{-1}\Theta^{p-1}
\end{aligned}$$ where we assume w.l.o.g. that $\tilde F$ is small. The fourth term on the right-hand side of (\[301\]) is dominating the third term. From $w_i=0$ we conclude $$\label{730}
\begin{aligned}
&\Phi' F^{ij}(\log(-\tilde \Phi))_i(\log(-\tilde \Phi))_j- \Phi' F^{ij}(\log \tilde \chi)_i(\log \tilde \chi)_j
\\
=~&\Phi' F^{ij}\tilde u_i\tilde u_j + 2 \Phi' F^{ij}(\log \tilde \chi)_i \tilde u_j.
\end{aligned}$$ Here the first term on the right-hand side is of order $\tilde F^{-(p+1)}$ but $\|Du\|$ vanishes if $t$ tends to $T^{*}$ while the second term is nonpositive for the same reason as in . Hence $w$ is a priori bounded from above.
The proofs of Theorem \[main\_result\] (i) and Theorem \[main\_result\] (ii) in the Euclidean case can be completed literally as in [@Gerhardt:01/2014 Lemma 5.1], up to replacing Krylov-Safonov by the Cordes-Nirenberg type result as above.
The proof of Theorem \[main\_result\] (iii) follows exactly the arguments in [@Scheuer:07/2016] by using Theorem \[main\_result\] (i) and Theorem \[main\_result\] (ii) instead of [@Gerhardt:01/2014] as it is used in [@Scheuer:07/2016].
The hyperbolic case {#HC}
===================
Due to the pinching estimates in the hyperbolic case, [@AndrewsMcCoy:03/2012 Lemma 2.2] implies that the flow hypersurfaces remain strictly horospherically convex. Hence several aspects of the proofs in [@Scheuer:05/2015] simplify. We can easily prove the following lemma with the help of a shortcut compared to [@Scheuer:05/2015 Thm. 4.4].
From the evolution of the flow speed [$$\begin{alignedat}{2} -\Phi={\frac{1}{F^{p}}}, \end{alignedat}$$]{} [$$\begin{alignedat}{2} \label{HypDecay-1}\dot \Phi- \Phi' F^{ij}\Phi_{;ij} = \Phi' F^{ij}{\left(h_{ik}h^k_j-g_{ij}\right)}\Phi, \end{alignedat}$$]{} cf. \[EvEq\_2\], we obtain that $\max F$ is strictly decreasing. Hence by the pinching estimates all principal curvatures are bounded and due to the convexity of the flow hypersurfaces we also have uniform gradient estimates using [@Gerhardt:/2006 Thm. 2.7.10]. Since in finite time the flow remains in a compact subset of ${\mathbb{H}}^{n+1}$, we obtain the long time existence similarly as in the Euclidean case. We can estimate with the help of the pinching estimate: [$$\begin{alignedat}{2} {\frac{d}{dt}} (-\Phi)- \Phi' F^{ij}(-\Phi)_{;ij} &= \Phi' F^{ij}{\left(h_{ik}h^k_j-g_{ij}\right)}(-\Phi)\\
&\geq c{\left({\frac{1}{n}} H^{2}-n\right)}\\
&\geq c(H-n). \end{alignedat}$$]{} Hence $\max F$ must converge to $n$, for otherwise there existed $\delta>0$ with [$$\begin{alignedat}{2} F(t,\xi_{t})=\max_{M_{t}}F\geq n+\delta \end{alignedat}$$]{} for all $t>0$ and hence [$$\begin{alignedat}{2} {\kappa}_{n}(t,\xi_{t})\geq 1+\tilde{\delta} \end{alignedat}$$]{} for some $\tilde{\delta}>0$. But then [$$\begin{alignedat}{2} c\tilde{\delta}\leq {\frac{d}{dt}}{\left(\min_{M_{t}}F^{-p}\right)} \end{alignedat}$$]{} for almost every $t>0$ and $\min F^{-p}$ would converge to infinity, which is impossible. But this implies $\max {\kappa}_{1}{\rightarrow}1$ and due to the pinching estimates \[pinching\] we have [$$\begin{alignedat}{2} \max {\kappa}_{n}{\rightarrow}1. \end{alignedat}$$]{}
Set [$$\begin{alignedat}{2} w=\left(\Phi+n^{-p}\right)e^{{\frac{\alpha}{n^{p}}} t}, \end{alignedat}$$]{} where $0<\alpha<2$. From we deduce $$\label{evolution_w}
\begin{aligned}
\dot{w}-\Phi'F^{kl}w_{kl}&=\Phi'F^{ij}\left(h_{ik}h^k_j-g_{ij}\right)\Phi e^{\frac{\alpha}{n^p}t}+\frac{\alpha}{n^p}e^{\frac{\alpha}{n^p}t}\left(\Phi+n^{-p}\right).
\end{aligned}$$ Writing $\kappa_i=1+\delta_i$ with appropriate small $\delta_i\ge 0$ we obtain the following first order expansions [$$\begin{alignedat}{2} |A|^2-n=2\sum_{i=1}^{n}\delta_i+O(\delta_n^{2}) \end{alignedat}$$]{} and [$$\begin{alignedat}{2} \Phi+n^{-p}=\frac{p}{n^{p+1}}\sum_{i=1}^n\delta_i+O(\delta_n^{2}). \end{alignedat}$$]{} Furthermore, we have $\Phi' \Phi=-pF^{-2p-1}$ so that the leading term in (\[evolution\_w\]) for large $t$ is $$\label{evolut_error_term}
e^{\frac{\alpha}{n^p}t}\frac{p}{n^{2p+1}}\sum_{i=1}^n\delta_i(-2+\alpha).$$ Hence $w$ is bounded for any $\alpha<2$ and thus [$$\begin{alignedat}{2} \delta_{n}\leq ce^{-{\frac{\alpha t}{n^{p}}}}. \end{alignedat}$$]{}
In the second step set [$$\begin{alignedat}{2} {\tilde}w=\left(\Phi+n^{-p}\right)e^{{\frac{2}{n^{p}}}t} \end{alignedat}$$]{} and deduce [$$\begin{alignedat}{2} \dot{{\tilde}w}-\Phi'F^{kl}{\tilde}w_{;kl}\leq c\delta_n^2e^{\frac{2}{n^p}t}\le c e^{\frac{2-2\alpha}{n^p}t}, \end{alignedat}$$]{} where we used that the corresponding first order terms in the evolution equation for $\tilde w$, compare (\[evolut\_error\_term\]), now vanish. The result follows from the maximum principle since $2-2\alpha<0$, e.g. for $\alpha=3/2$.
In order to show that also the gradient of the graph functions $u$ converges to zero exponentially fast, we use the conformally flat parametrization of the hyperbolic space.
Defining the radial coordinate $\rho$ by [$$\begin{alignedat}{2} r=\log(2+\rho)-\log(2-\rho), \end{alignedat}$$]{} the hyperbolic space can be parametrised over the ball $B_{2}(0)$ to yield [$$\begin{alignedat}{2} {\bar}g={\frac{1}{{\left(1-{\frac{1}{4}}\rho^{2}\right)}^{2}}}{\left(d\rho^{2}+\rho^{2}{\sigma}_{ij}dx^{i}dx^{j}\right)}=e^{2\psi}{\left(d\rho^{2}+\rho^{2}{\sigma}_{ij}dx^{i}dx^{j}\right)}. \end{alignedat}$$]{} Viewing the flow hypersurfaces $M_{t}{\subset}{\mathbb{H}}^{n+1}$ as hypersurfaces ${\tilde}M_{t}{\subset}B_{2}(0)$ of the Euclidean space, the second fundamental forms are related by [$$\begin{alignedat}{2} \label{GradDecay-1}e^{\psi} h^{i}_{j}={\tilde}h^{i}_{j}+\psi_{{\beta}}{\tilde}\nu^{{\beta}}{\delta}^{i}_{j}, \end{alignedat}$$]{} cf. [@Gerhardt:/2006 Prop. 1.1.11]. Hence [$$\begin{alignedat}{2} \|{\tilde}A\|^{2}-{\frac{1}{n}} {\tilde}H^{2}=e^{2\psi}{\left(\|A\|^{2}-{\frac{1}{n}} H^{2}\right)}\leq ce^{-{\frac{2}{n^{p}}}t}, \end{alignedat}$$]{} due to \[HypDecay\] and since [$$\begin{alignedat}{2} e^{\psi}={\frac{4}{(2+{\tilde}u)(2-{\tilde}u)}}\leq ce^{{\frac{t}{n^{p}}}}, \end{alignedat}$$]{} where we also used the existence of a constant $c$ such that [$$\begin{alignedat}{2} -c<u-{\frac{t}{n^{p}}}<c, \end{alignedat}$$]{} cf. [@Scheuer:05/2015 Cor. 3.3, Lemma 3.5]. Hence the conformal hypersurfaces ${\tilde}M_{t}$ become eventually strictly convex (also note ${\tilde}H>0$ using ) and they converge uniformly to ${\partial}B_{2}(0).$ Using [$$\begin{alignedat}{2} {\tilde}v\leq ce^{{\bar}{\kappa}\cdot{\mathrm}{osc}({\tilde}u)} \end{alignedat}$$]{} again, [@Gerhardt:/2006 Thm. 2.7.10], we obtain ${\tilde}v{\rightarrow}1.$ But [$$\begin{alignedat}{2} |D{\tilde}u|^{2}={\tilde}u^{-2}{\sigma}^{ij}{\tilde}u_{i}{\tilde}u_{j}=|Du|^{2}, \end{alignedat}$$]{} as a simple calculation reveals, and hence $v{\rightarrow}1$ for the $M_{t}.$ From the proof of [@Scheuer:05/2015 Thm. 4.1] and especially equ. (4.6) in this proof we obtain [$$\begin{alignedat}{2} v-1\leq ce^{-{\lambda}t} \end{alignedat}$$]{} for suitable ${\lambda}>0$. Furthermore, using the proof of [@Scheuer:05/2015 Thm. 4.5] literally, we obtain the claim.
The proof of \[main\_result\] can now be finished as in [@Scheuer:05/2015]. Let us shortly sketch the strategy. Define a rescaling of $u$, [$$\begin{alignedat}{2} {\varphi}=\int_{r_{0}}^{u}{\frac{1}{{\vartheta}(s)}}~ds, \end{alignedat}$$]{} where $r_{0}<\inf_{M}u(0,\cdot)$ and ${\vartheta}=\sinh$. There holds [$$\begin{alignedat}{2} |Du|^{2}={\sigma}^{ij}{\varphi}_{i}{\varphi}_{j}=|D{\varphi}|^{2}\leq ce^{-{\frac{2}{n^{p}}}t}. \end{alignedat}$$]{} Due to [$$\begin{alignedat}{2} h^{i}_{j}=v^{-1}{\vartheta}^{-1}{\left({\vartheta}'{\delta}^{i}_{j}-{\left({\sigma}^{ik}-v^{-2}{\varphi}^{i}{\varphi}^{k}\right)}{\varphi}_{kj}\right)}, \end{alignedat}$$]{} where index raising and covariant differentiation are performed with respect to ${\sigma}_{ij},$ cf. [@Gerhardt:11/2011 (3.26)], we also obtain [$$\begin{alignedat}{2} |D^{2}{\varphi}|\leq ce^{-{\frac{t}{n^{p}}}}, \end{alignedat}$$]{} also compare [@Scheuer:05/2015 Thm. 4.6]. Now Sections 5 and 6 of [@Scheuer:05/2015] finish the proof verbatim, where Section 5 gives higher order estimates of the form [$$\begin{alignedat}{2} |D^{m}{\varphi}|\leq ce^{-{\frac{t}{n^{p}}}} \end{alignedat}$$]{} by differentiating the equation satisfied by $D{\varphi}$ and Section 6 relates this back to the original function $u$ and its rescaled versions.
[^1]: This work has been supported by the “Deutsche Forschungsgemeinschaft” (DFG, German research foundation) within the research grant “Harnack inequalities for curvature flows and applications”, grant number SCHE 1879/1-1.
| |
# Order-6-4 square honeycomb
In the geometry of hyperbolic 3-space, the order-6-4 square honeycomb (or 4,6,4 honeycomb) a regular space-filling tessellation (or honeycomb) with Schläfli symbol {4,6,4}.
## Geometry
All vertices are ultra-ideal (existing beyond the ideal boundary) with four order-6 square tilings existing around each edge and with an order-4 hexagonal tiling vertex figure.
## Related polytopes and honeycombs
It a part of a sequence of regular polychora and honeycombs {p,6,p}:
### Order-6-5 hexagonal honeycomb
In the geometry of hyperbolic 3-space, the order-6-5 pentagonal honeycomb (or 5,6,5 honeycomb) a regular space-filling tessellation (or honeycomb) with Schläfli symbol {5,6,5}.
All vertices are ultra-ideal (existing beyond the ideal boundary) with five order-6 pentagonal tilings existing around each edge and with an order-5 hexagonal tiling vertex figure.
### Order-6-6 hexagonal honeycomb
In the geometry of hyperbolic 3-space, the order-6-6 hexagonal honeycomb (or 6,6,6 honeycomb) is a regular space-filling tessellation (or honeycomb) with Schläfli symbol {6,6,6}. It has six order-6 hexagonal tilings, {6,6}, around each edge. All vertices are ultra-ideal (existing beyond the ideal boundary) with infinitely many hexagonal tilings existing around each vertex in an order-6 hexagonal tiling vertex arrangement.
It has a second construction as a uniform honeycomb, Schläfli symbol {6,(6,3,6)}, Coxeter diagram, , with alternating types or colors of cells. In Coxeter notation the half symmetry is = .
### Order-6-infinite apeirogonal honeycomb
In the geometry of hyperbolic 3-space, the order-6-infinite apeirogonal honeycomb (or ∞,6,∞ honeycomb) is a regular space-filling tessellation (or honeycomb) with Schläfli symbol {∞,6,∞}. It has infinitely many order-6 apeirogonal tiling {∞,6} around each edge. All vertices are ultra-ideal (existing beyond the ideal boundary) with infinitely many order-6 apeirogonal tilings existing around each vertex in an infinite-order square tiling vertex arrangement.
It has a second construction as a uniform honeycomb, Schläfli symbol {∞,(6,∞,6)}, Coxeter diagram, , with alternating types or colors of cells. | https://en.wikipedia.org/wiki/Order-6-4_square_honeycomb |
This project is a proof of principle of systems toxicology, a new approach to chemical safety evaluation that integrates molecular, cellular, and physiological data in the context of a genetically diverse animal model to develop testable hypotheses about the key molecular events leading to adverse outcomes following chemical exposure. The project aims to capitalize on the potential of two powerful population-based model organism resources, the Collaborative Cross (CC) and Diversity Outbred (DO) mice, to study the role of genetics in conferring susceptibility to chemical exposures. Through an integrated set of experiments using arsenic exposure in mice and cell lines, the molecular genetic basis of toxicological responses will be evaluated. This project will test the hypothesis that genetic analysis in the context of a quantitative environmental perturbation will reveal multiple, novel, and diverse biochemical networks that respond to chemical exposure. The proposed integrated set of experiments will enable the discovery and validation of adverse outcome pathways through three specific aims.
Aim 1 will evaluate study designs for animal testing with genetically diverse DO mice including sample size requirements for toxicity evaluation. G x E genetic loci will be mapped and incorporated into predictive computational models, and testable hypotheses will be proposed for validation.
Aim 2 will conduct a parallel, population-level arsenic exposure study of in vitro primary cell cultures to identify genetic factors underlying susceptibility and resistance using physiologically informative cellular phenotypes. The data generated in the in vitro arsenic exposure study will allow determination of the extent to which cytotoxicity, genotoxicity, and oxidative stress in cellular assays are physiologically informative for the discovery of molecular pathways that drive susceptibility and/or response in the whole organism.
Aim 3 will identify key mechanisms in renal arsenic toxicity. This study will generate a model for the effect of arsenic exposure on the kidney to predict outcomes that are contingent on genetic background. Collectively, this new approach to toxicology using DO mice will address fundamental biological questions by combining chemical interventions with genetic variation. It will establish causal pathways across multiple levels of molecular and physiological outcomes to yield results with relevance to clinical translation.
Regulatory toxicology seeks to create safety thresholds for chemical exposure in humans based on experimental studies in animals, but results of such studies may not accurately predict human sensitivity because they fail to accommodate the genetic diversity that exists across human populations. We will use population-based, genetically diverse mice to study the complex interplay between genetic variation and environmental factors that determine cellular and organismal responses to arsenic exposure. Through a novel statistical analysis of our data, we will account for individual genetic variation and provide a data-driven model that can be translated to risk assessment for human chemical exposure. ! | https://grantome.com/grant/NIH/R01-ES029916-03 |
Let's first graph `y = sin\ 2x` (without the "+ 1") to get an idea of what phase shift means.
The amplitude is 1 and the period is `(2π)/2 = π.`
I have drawn a little more than 2 cycles, starting from `x = 0`.
Now let's consider the phase shift. Using the formula above, we will need to shift our curve by:
Phase shift `=-c/b=-1/2=-0.5`
This means we have to shift the curve to the left (because the phase shift is negative) by `0.5`. Here is the answer (in blue). I have kept the original y = sin 2x (in dotted gray) so you can see what's happening.
Note that the curve passes through:
Get the Daily Math Tweet! | https://www.intmath.com/trigonometric-graphs/ans-3.php?a=0 |
Q:
How will I be able to compare two button presses from a choice of three?
I have 3 buttons
b1
b2
b3
I want to now have these buttons be pressed in turns.
So turn one I press and turn 2 another person presses.
So after turn two, I will compare the names of the buttons.
b1.addActionListener(new ActionListener() {
public void actionPerformed( ActionEvent event ) {
b1.setEnabled(false);
if (!b1.isEnabled() && !b2.isEnabled()) {
//computeWinner(b1.getText(), b2.getText());
} else if(!b1.isEnabled() && !b3.isEnabled()) {
//computeWinner(b1.getText(), b2.getText());
}
}
});
This was what I thought would work, but there are many things wrong with this,
First, since I disable the buttons the second user always has one less option. and second the if statements do not seem to work? how should I compare the
JButton b3 = new JButton ("hello"); <- hello lable of the buttons?
EDIT:
I was able to successfully compare the two buttons. Now my only problem is that for the second player one of the buttons are disabled(how can I capture the first button press and the second without disabling them?). And that after the comparison I don't know how to reset the board to go again. (for a set number of loops.)
Thank you for the help!
A:
The following code will print the label of the button which has been pressed. I hope, you should be able to proceed from here. Feel free to let me know if you face any further issue.
ActionListener actionListener = new ActionListener(){
public void actionPerformed(ActionEvent actionEvent) {
System.out.println(actionEvent.getActionCommand());
}
};
| |
Jaramogi Oginga Odinga University of Science and Technology (JOOUST) has unveiled a modern molecular and microbiology laboratory to boost scientific research in the region.
The laboratory equipped at a cost of Sh33 million through the National Research Fund (NRF) infrastructure support, will boost research in fresh water, human health and molecular microbiology.
The modern technology equipment in the lab will also enable researchers and students undertake advanced cell research on plants and animals through DNA and RNA tests.
Speaking during the commissioning of the laboratory, State Department for University Education Principal Secretary Amb Simon Nabukwesi said the laboratory is a testimony of commitment by the government in supporting priority areas of science, technology and innovation.
Amb Nabukwesi observed that cell research is vital for society that wants to advance adding that it is from such research infrastructure that innovations that contribute to the economic and social development of the country emerge.
He said the laboratory will support research excellence by providing students and scientists with cutting edge research skills and knowledge that can continuously be applied to avoid skill loss.
“A good number of you (academic staff) are educated in foreign countries where the laboratories are equipped with sophisticated equipment. When you come back and you are unable to practice the same, the knowledge acquired is lost overtime and that’s why we are suffering as a country,” Nabukwesi said.
The PS commended JOOUST under the stewardship of Prof Stephen Agong for their commitment and efforts in ensuring that the university laboratories are equipped through partnership with the NRF and acknowledged the role played by the university management in achieving the milestone.
He said that the government is committed to improve productivity of research funding by encouraging enhanced migration of science from laboratories to the market place, improving how it strategically aids investments in public good science that underpins the economy, directly boosts economic growth through market driven research and to simplify the entire research system.
NRF CEO Dr Jemmimah Onsare revealed that NRF funded twenty other institutions in the country with infrastructure development funds to boost research in the country.
Dr Onsare further disclosed that JOOUST had initially applied for Sh100 million funding but because other institutions in the region namely Eldoret University and Bukura Agricultural Institute qualified for equipment funding on similar thematic areas, the funding was cut to Sh33 million to avoid duplication.
She encouraged JOOUST to partner with such institutions which benefited from the equipment funding to maximise on research resources available within universities in the region.
Dr Onsare said the newly commissioned laboratory is a National facility open to all researchers in the country and directed the JOOUST management to come up with mechanism to ensure researchers have access to the facility.
The NRF CEO called on JOOUST to utilise the facility to undertake research on highland rice and sorghum production to boost food security in the region and at the same time assured public institutions in the country that applied for research funds on desert locust that the government will release the funds starting July.
The occasion was attended by Siaya deputy governor Dr James Okumbe, officials from Ministry of Education, and CEO’s of NACOSTI and the, Kenya National Innovation Agency. | https://www.kenyanews.go.ke/jooust-unveils-state-of-the-art-lab-research-facilities/ |
The relevance of the evolution of experimental studies for the interpretation and evaluation of some trace physical evidence.
In order for trace evidence to have a high evidential value, experimental studies which mimic the forensic reality are of fundamental importance. Such primary level experimentation is crucial to establish a coherent body of theory concerning the generation, transfer and persistence of different forms of trace physical evidence. We contend that the forensic context, at whatever scale, will be specific to each individual forensic case and this context in which a crime takes place will influence the properties of trace evidence. It will, therefore, be necessary in many forensic cases to undertake secondary level experimental studies that incorporate specific variables pertinent to a particular case and supplement the established theory presented in the published literature. Such studies enable a better understanding of the specific forensic context and thus allow more accurate collection, analysis and interpretation of the trace physical evidence to be achieved. This paper presents two cases where the findings of secondary level experimental studies undertaken to address specific issues particular to two forensic investigations proved to be important. Specific pre-, syn- and post-forensic event factors were incorporated into the experimental design and proved to be invaluable in the recovery, analysis and in achieving accurate interpretations of both soil evidence from footwear and glass trace evidence from a broken window. These studies demonstrate that a fuller understanding of the specific context within which trace physical evidence is generated and subsequently collected, as well as an understanding of the behaviour of certain forms of trace physical evidence under specific conditions, can add evidentiary weight to the analysis and interpretation of that evidence and thus help a court with greater certainty where resources (time and cost) permit.
| |
This invention relates to electrical engineering. In particular, the invention relates to the design of electrochemical device storing electric energy, and can be used in modern power engineering, for example, in devices storing regenerative braking energy in transport, as traction batteries for electric transport (electric vehicles, hybrid electric vehicles), in emergency power systems when operating in a floating or trickle charge mode.The proposed invention ensures steady operation of this device due to stable preservation of a given concentration of electrolyte components on the electrodes, and improvement of service life in various modes of operation. | |
A recent settlement agreement between Lesley University in Cambridge, Massachusetts and the U.S. Justice Department says that food allergies may constitute a “disability” under the Americans With Disabilities Act.
The settlement stems from complaints that the University did not offer gluten-free foods to its students. Under the agreement, Lesley University says it must provide gluten-free food in its dining hall, develop individualized meal plans for students with food allergies, provide a dedicated space for storage and preparation of gluten-free and allergen-free foods to avoid cross-contamination, display notices concerning food allergies and identify foods containing specific allergens, train staff about food allergies, and pay a $50,000 cash settlement to the affected students. More information about the settlement is available here.
The attorneys at DeBlasio & Donnell LLC are experienced business and personal injury trial lawyers. To schedule an appointment to speak with one of our attorneys, call us Toll Free at (877) 646-9245 or contact us via our website at http://dd-lawfirm.com/contact.php.
DISCLAIMER: This blog post is not legal advice and should not be relied on by anyone as legal advice in their particular situation. Furthermore, while DeBlasio & Donnell LLC welcomes communications via its website, please be aware that communicating any information to DeBlasio & Donnell LLC or any of its attorneys through its web site or via any other method without a formal engagement with the Firm does not constitute or create an attorney-client relationship between you (or any other users, senders or recipients) and DeBlasio & Donnell LLC or any of its attorneys. For your protection, please do not send us confidential information until you have spoken with one of our lawyers and received authorization to send that information to our Firm. Thank you. | https://www.dgllc.net/university-settles-ada-claim-that-food-allergies-are-disability/ |
Led by HH Sheikha Fatima bint Mubarak. The Family Development Foundation was established on10th of May 2006 at the service of the Emirati community and to keep up with the contemporary data and developments. What the “Mother of the Nation” HH Sheikha Fatima bint Mubarak, has done is clear and evident. Her Highness has exerted her utmost efforts to achieve a better reality for women, so that they are able to face challenges and accomplish achievements.
The FDF aims at fostering, developing the family in general, women, and children in particular. It emphasizes the role of the family in social upbringing, promoting a comprehensive vision in dealing with the issues of women and children and achieving family sustainable development to set up a society that is able to compete with learning and knowledge. It also focuses on continuous development of capabilities and skills, with special attention paid to her social outcomes which related to her low establishment moreover in line with community development sector in the emirate of Abu Dhabi.
– An aware, tight Emirati family capable of facing challenges
The family constitutes the core of the mission and the responsibility of the Family Development Foundation. The latter is considered to be the main reference in handling such issues. In the scope of its strategic transformation, the Foundation seeks to provide meaningful programs to increase closeness within the family, by working to limit family conflicts, treating those effectively with the participation of other foundations operating in the frame of the social development sector.
– A safe and healthy family environment for children, enhancing their values and motivating their innovative capacities
The childhood category is the largest in the Emirate of Abu Dhabi. Child citizens (age 0-14) constitute 39%, while youth (age 15-19) constitute 11% of the total number of the population in the Emirate – according to statistics dating back to mid .2013
Lack of programs tending to children from the early childhood stage up until youth led the Family Development Foundation to take responsibility for childhood development. Thus, children became one of the Foundation’s priorities. The Foundation works to provide programs that contribute to shaping creative children, who are proud of their moral values and belong to safe and healthy families. The Foundation shall start providing several significant programs, including the early education program
– Activation of the societal role of women by developing their capacities and highlighting their achievements
Efforts exerted to enable women in the Emirate of Abu Dhabi are distributed. The lack of a specific body that would be responsible for enabling women renders the entire situation in need of further efforts. Based on the latter,
the Family Development Foundation prioritized the enabling of women, it also intensified its programs that aim at supporting women, coming together with its partners to attain the best practices that ensure development of women’s capacities and enabling them socially and economically, which would ensure women’s habilitation, independence, production and full rights.
– Contribution to the preparation of a generation of youth that is aware, by enhancing their life and leadership skills and strengthening their active participation in society
Societal changes and the vast acceleration of technological advancement, as well as the diversity of nationalities and cultures in the Emirate of Abu Dhabi may lead to negative effects in terms of the Emirate’s customs, traditions and historical image. Therefore, the Foundation seeks to include programs that enhance national identity and belonging for the youth of Abu Dhabi. Such programs emphasize the needs of various stages. The Foundation will also provide programs that contribute to decreasing negative foreign behaviors within the Emirate’s society.
– Effective contribution to providing a decent life for the elderly, by enabling them and benefiting from their heritage
Generally speaking, the UAE is considered to be one of the young, youthful societies. Social focus was not fully directed at the category of the elderly, which would reflect negatively on the society, due to the lack of effective communication with those society pioneers, who carry a large legacy of undocumented heritage. In order to support other priorities, the Family Development Foundation will work with its partners to activate the role of such category of the society to turn it into a source of expertise and learned lessons to achieve certain goals that belong to other categories. The Foundation will also document the oral heritage communicated by the elderly members of the society
– Cooperate with the authorities and organizations of similar competency in order to share information and experiences, develop and cooperate scopes for shared work.
Based on the vision and strategy of Abu Dhabi Government, regarding building effective partnerships that promote sustainable development in the social, economic and environmental sectors, the Family development foundation (FDF) seeks through its strategic objective to leverage partnerships to achieve Abu Dhabi plan 2020. | https://abudhabimagazine.ae/12675/ |
Waiting for Godot is generally considered as a masterpiece example of what has come to be known as the theater of the absurd. The play is written by an Irish novelist, Samuel Beckett, a prominent literary figure well known for this work, and remembered as the founder of the theatre of absurd. The play was performed in 1949, having the theme of existentialist philosophy. The play Waiting for Godot is famous for purposeless characters, meaningless actions, and lacking a basic plot.
The in-depth analysis gives a lot of themes and sometimes it seems that the play is revolving around Christian religion and Beckett making fun of it. Some of the agreeable themes are below.
1. ABSURDITY
The world absurd means that "the quality or state of being ridiculous or wildly unreasonable." The definition exactly fits the theme of unreasonable and absurd. The play has the repetition of many words and phrases, nonsensical lines, purposeless characters, meaningless dialogues, and wordplay. Characters both Vladimir and Estragon have dementia, forget everything even about their own identities. The text is full of humor but mixed up with tragedy that makes it different from other kinds of play. Beckett thus presents an eerie play that sits uneasily on the border between tragedy and comedy, in territory one can only call the absurd. Vladimir and Estragon's nonsensical actions, suicide attempts, and rude behavior with Lucky on the Pozo's side create a discomforting effect on the audience. The play confuses readers as well as the audience whether to laugh or cry at the events presented on the stage. The useless conversations and extreme utterance of characters showed the emptiness and aimless world after World War II.
2. PURPOSELESSNESS OF LIFE
Purposelessness in the play seems from the very first act by the meaningless actions of Vladimir and Estragon. All the major characters are purposeless. It seems that Vladimir and Estragon have some purpose, but Godot's not arriving makes their waiting vain. The visiting of Pozo and Lucky in the first act likely seems that Pozo wants to sell him but failed to do so as the play progress and is ultimately shown to be equally purposeless. They are simply wandering from place to place, while on the other hand, Estragon and Lucky doing different acts even an empty suicide attempt. Their traveling may even be counterproductive because they cannot seem to go any distance without falling. The theater of absurd has a special message that life is purposeless vividly shows in the play Waiting for Godot. The boy's message is also equally vain, that Godot is never coming. Both Estragon and Vladimir are waiting for a long time without any purpose completely conform to the characteristics of the theater of absurd.
3. UNCERTAINTY OF TIME
Time is uncertain in this play, but in the opening scene, it passes normally. Morning, daytime, and evening pass systematically, but the characters are sometimes showing confusion about it again and again. Many scenes show that they wait a long time. In the second act, the growth of leaves also suggests the same, and on the other hand, Estragon and Vladimir have no firm idea of how long they have been together or how long ago they did other things, such as climb the Eiffel Tower or pick grapes in Macon country.
Characters are pessimistic that lead them to suicide, and it seems the scenes and event repeating the same way every day, but Estragon and Vladimir never remember to bring the rope they would need to hang themselves.
It shows the meaningless life and cheap use of time in extreme despair, the aftermath of the effect of World War II.
4. THEME OF RELATIONSHIP
Relationship and Friendship is one of the major themes of the play Waiting for Godot. The writer explores and portrays different types of relationships ranging from friendship to slave and ownership. Of course, they are different entities with different physical as well as mental problems but collectively they play a big role in the play.
Three types of associations portray the theme of relationship in “Waiting for Godot”.
1. Relationship between Estragon and Vladimir
2. Association of Pozzo and Lucky
3. Relationship of Estragon and Vladimir with Godot.
Vladimir and Estragon's relationship is seemingly dependent on each other having a good friendship.
Vladimir added, “Don’t touch me! Don’t question me! Don’t speak to me! Stay with me!”
The relationship between Pozo and Lucky is like a slave and master. Lucky is a slave in the first act. His character presents a miserable condition of humanity.
Friendship is very delicate in Waiting for Godot, as each character is separated from each other. Relationships teeter between a terror of friendlessness and an essential inability to connect. This tension is central to the play. The problems that keep characters apart vary from physical disgust to ego to a fear of others’ suffering.
5. THEME OF EXISTENTIALISM
Both the characters Vladimir and Estragon put themselves into an absurd situation just like humans have been put in the world without any motivation. The question of existence is revolving around the play. Throughout the play, they are restricted to change their miserable and excruciating condition of life. Samuel Beckett's play 'Waiting for Godot' exposes that it is up to the individual to change the meaning of life through personal experience in the earthly world and make it better.
In very simple words the philosophy of existentialism means that every person is responsible for his actions and no second person is pulling his strings or controlling his fate. Every character in the play are independent with little restrictions, but they never want to improve their lives. The solution (which none of the characters take) would seem to be action and choice despite the ever-presence of uncertainty, and an awareness of one’s surroundings and past actions.
Interesting Thing!
How many languages you can speak? Do you know the varieties of language? No! Pleasure, you can go through here to explore the Varieties of Language. | https://www.msmsol.com/2020/12/major-themes-in-waiting-for-godot.html |
PRIORITY CLAIM
The instant patent application is related to and claims priority from the co-pending provisional India patent application entitled, “Oscillator with PCB Coil Inductance to Detect Metal Proximity”, Serial No.: 202041038857, Filed: 9 Sep. 2020, which is incorporated in its entirety herewith to the extent not inconsistent with the description herein.
BACKGROUND
Technical Field
Related Art
Embodiments of the present disclosure relate generally to electronic measurements, and more specifically to making determination of inductance-change immune to changes in environmental conditions.
Change in inductance of an inductor is often exploited to measure parameters related to several phenomena. As an example, fluid flow rate and direction (the term fluid includes liquids and gases) can be estimated based on the principle of inductance change of an inductor when the inductor (when powered and carrying an alternating, or at least varying, current) is brought in proximity with a metal that is set in motion (e.g., rotary) by the fluid. Corresponding circuitry containing the inductor can generate signal(s) representative of inductance-change, and thereby enable estimation of the fluid-flow rate and/or direction.
However, environmental conditions such as ambient temperature and ambient humidity can also cause changes in inductance. Such inductance changes that are not due to the phenomenon being measured (e.g., fluid-flow) can affect the measurement of the parameters (e.g., fluid flow rate and/or direction) and yield erroneous values for the parameters.
Aspects of the present disclosure are directed to techniques for making determination of inductance-change immune to changes in environmental conditions, and applications of such techniques.
BRIEF DESCRIPTION OF THE VIEWS OF DRAWINGS
Example embodiments of the present disclosure will be described with reference to the accompanying drawings briefly described below.
FIG. 1A
is a block diagram of an example device implemented according to aspects of the present disclosure, in an embodiment.
FIG. 1B
is a block diagram of a frequency comparison block, in an embodiment of the present disclosure.
FIG. 2
is a diagram of an example topology that may be used to implement oscillators described in the present disclosure.
FIG. 3A
is a diagram illustrating the manner in which a device can be used to determine flow-rate of a fluid (liquid or gas).
FIGS. 3B and 3C
are diagrams used to illustrate the manner of computation of fluid-flow rate, in an embodiment of the present disclosure.
FIG. 4A
is a diagram of a device implemented according to aspects of the present disclosure that is capable of determination of fluid-flow rate as well as determination of the direction of fluid-flow, in an embodiment of the present disclosure.
FIG. 4B
is a block diagram of a frequency comparison block, in another embodiment of the present disclosure.
FIGS. 5A, 5B and 5C
are diagrams used to illustrate the manner of determination of direction of fluid-flow as well as rate of fluid-flow, in an embodiment of the present disclosure.
FIG. 6
is a diagram illustrating a printed circuit board (PCB) containing a sensor in integrated circuit form used for determination of fluid-flow rate and direction, and also illustrates the layout of inductor coils used by the sensor, in an embodiment of the present disclosure.
In the drawings, like reference numbers generally indicate identical, functionally similar, and/or structurally similar elements. The drawing in which an element first appears is indicated by the leftmost digit(s) in the corresponding reference number.
DETAILED DESCRIPTION
1. Overview
A device implemented according to an aspect of the present disclosure includes a first oscillator, a second oscillator and a frequency comparison block. The first oscillator includes a first inductor-capacitor (LC) tank circuit, the first oscillator to generate first sustained oscillations at a first resonant frequency determined by the first LC tank circuit. A first inductor of the first LC tank circuit has a first default inductance. The second oscillator includes a second LC tank circuit, the second oscillator to generate second sustained oscillations at a second resonant frequency determined by the second LC tank circuit. A second inductor of the second LC tank circuit has a second default inductance.
The frequency comparison block is connected to receive each of the first sustained oscillations and the second sustained oscillations. When a metal is in proximity to one of the first inductor and the second inductor, the corresponding one of the first default inductance and the second default inductance changes, thereby changing the frequency of the corresponding one of the first sustained oscillations and the second sustained oscillations from the first resonant frequency and the second resonant frequency respectively. The frequency comparison block is designed to perform a comparison of the frequencies of the second sustained oscillations and the first sustained oscillations to determine a change in a corresponding one of the first default inductance and the second default inductance.
In an embodiment, the frequency comparison block is designed to obtain a ratio of the frequencies of the second sustained oscillations and the first sustained oscillations, and is implemented to contain a frequency counter, a frequency divider and a logic block. In an example application, the device is used to determine a rate of flow of a fluid.
In another embodiment, the device additionally includes a third oscillator and another frequency counter. The third oscillator includes a third LC tank circuit, the third oscillator to generate third sustained oscillations at a third resonant frequency determined by the third LC tank circuit. A third inductor of the third LC tank circuit has a third default inductance. The frequency comparison block is designed to obtain a ratio of the frequencies of the second sustained oscillations and the first sustained oscillations, as well as the third sustained oscillations and the first sustained oscillations. In an example application, the device is used to determine a direction of flow of a fluid.
Several aspects of the present disclosure are described below with reference to examples for illustration. However, one skilled in the relevant art will recognize that the disclosure can be practiced without one or more of the specific details or with other methods, components, materials and so forth. In other instances, well-known structures, materials, or operations are not shown in detail to avoid obscuring the features of the disclosure. Furthermore, the features/aspects described can be practiced in various combinations, though only some of the combinations are described herein for conciseness.
2. Example Device
FIG. 1A
100
0
160
1
160
190
110
0
160
1
160
190
110
120
120
190
120
120
120
120
110
is a diagram illustrating the details of an example device in an embodiment of the present disclosure. Device is shown containing LC oscillator-B, LC oscillator-A, frequency comparison block and printed circuit board (PCB) . LC oscillator-B, LC oscillator-A, and frequency comparison block are mounted on PCB , and in an embodiment are implemented using discrete blocks/components. However, in an alternative embodiment, only inductors A and B are implemented in discrete form, with frequency comparison block implemented in integrated circuit (IC) form. In such an embodiment, inductors A and B are outside the IC, and inductor A, inductor B and the IC are mounted on PCB .
0
160
132
120
135
132
120
135
161
0
0
0
120
LC oscillator-B is shown containing capacitor B, inductor B and amplifier B. Capacitor B and inductor B form an LC (inductor-capacitor) tank circuit, and the values of L and C determine the resonant frequency of oscillations. The output of the LC tank is shown coupled to amplifier B, which employs positive feedback (not shown) and generates sustained oscillations (i.e., oscillations that do not decay with respect to time when the oscillator is powered ON) on path B having resonant frequency F. The magnitude of F is inversely proportional to the square root of inductance L of inductor B.
1
160
132
120
135
132
120
1
135
161
1
1
1
LC oscillator-A is shown containing capacitor A, inductor A and amplifier A. Capacitor A and inductor A (L) form another LC tank circuit, and the values of L and C determine the resonant frequency of oscillations. The output of the LC tank is shown connected to amplifier A, which employs positive feedback (not shown) and generates sustained oscillations on path A having resonant frequency F. The magnitude of F is inversely proportional to the square root of inductance of L.
1
0
110
100
161
161
The inductors L and L may be implemented in the form of coils having one or more turns, and located on each hemisphere (or each half, depending on the shape of the PCB) of PCB to maximize the sensitivity of the measurements made by device . However, other forms and locations for the inductors can also be employed. Oscillations on each of paths A and B may be sinusoidal in nature.
120
120
132
132
161
161
161
161
190
170
161
1
161
0
100
100
In an embodiment described in detail below, inductors A and B are implemented to have the same inductance value and tolerance levels. Similarly capacitors A and B are implemented to have the same capacitance value and tolerance levels. As a result the (resonant) frequency of oscillations of the signals (i.e., the output of the oscillators) on paths A and B is the same. It is noted however, that the inductance and capacitance values of the two LC tanks can in general be different, thereby resulting in different frequencies of oscillations on paths A and B. In such case, frequency comparison block and logic block (both described below) may be implemented with corresponding changes to the techniques (than if the frequency of oscillation of signals A (F) and B (F) are equal) to make measurements such as, for example, determination of parameters related to fluid-flow, etc. For example, a calibration of device may need to be performed before deploying to field. Also, with different resonant frequencies, a fixed offset in frequency difference or CD (count difference, both noted in sections below) will result, but will not impact the capabilities of device described herein.
160
160
220
220
250
240
299
250
210
220
220
201
250
240
250
240
225
225
225
225
1
161
0
161
FIG. 4
FIG. 2
FIG. 2
FIG. 1
FIG. 4
FIG. 1
FIG. 4
FIG. 2
An example topology that may be used to implement either of oscillators A and B (as well as the oscillators of ) is shown in . The oscillator topology of is shown containing two cross-coupled transistors (A and B), with an LC tank circuit (inductor and capacitor connected in parallel) as the load. Power supply Vdd () is connected to the center-tap of inductor . Current source is connected between the source terminals of each of transistors A and B, and ground (GND ). The values of inductances of inductor and capacitance of capacitor determine the resonant frequency of oscillations. The combination of inductor and capacitor corresponds to the LC tank circuit in oscillators of and . The cross-coupling (from drain of one transistor to gate of the other) provides positive feedback, and ensures sustained (non-decaying) oscillations at the resonant frequency, which is available across nodes A and B as a differential signal, or between either of the nodes A and B and ground as a single-ended signal, and corresponds to the outputs (e.g., F (A), F (B), etc.) of the oscillators of and . The operation of the circuit of is well-known in the relevant arts, and is not described here in the interest of conciseness. It is also noted that other existing techniques and topologies can also be used instead to implement the oscillators. For example, circuits employing negative-resistance devices such as a tunnel diode can be combined with LC tank circuit to implement the oscillators noted herein.
160
160
120
1
120
2
Each of oscillators A and B has a ‘default oscillation frequency.’ As used herein ‘default oscillation frequency’ refers to the oscillation frequency of an oscillator when the inductance of the inductor in the tank circuit of the oscillator remains unchanged and unaffected by external factors such as proximity of the oscillator (or more precisely, the inductor in its LC tank circuit) to a metal, environmental factors such as temperature, humidity, etc. Similarly, each of inductors A (L) and B (L) has a ‘default value’ of inductance, the default value being the value with which the inductor was designed for and implemented. However, the inductance may be affected (and therefore be caused to change from the default value) by external factors such as proximity of the inductor to a metal, environmental factors such as temperature, humidity, etc.
1
1
160
0
160
1
0
1
0
1
0
1
0
1
0
FIG. 1
As noted above, change in inductance of an inductor can be exploited to measure parameters related to several phenomena. As is well known, presence of a metallic object (metal) in the vicinity of an inductor (having current flowing through it) changes its inductance (from its default value). The magnitude of change in inductance generally depends on how close the metal is to the inductor. Thus, for example, presence of a metal close to inductor L would change the inductance of L from its default value. However, any such change would be (at least partially) indistinguishable from any change in inductance caused by environmental factors. For example, change in ambient temperature can cause a corresponding change in inductance. According to an aspect of the present disclosure, a reference oscillator (B in ) having a reference inductor (L) is used in addition to the main oscillator A. Environmental factors would affect L and L, and therefore frequencies F and F, substantially equally, thereby resulting in equal changes in F and F. Hence, by comparing F with F, changes in L or L (if any) due to factors other than environmental factors can be determined, and used in several applications.
120
1
1
120
0
0
120
120
120
0
120
1
Presence of a metal in the vicinity of inductor A would change the value of L, and therefore, F. Similarly, presence of a metal in the vicinity of inductor B would change the value of L, and therefore, L. Inductors A and B are positioned sufficiently apart that a metal in the vicinity of inductor A does not significantly affect L, and a metal in the vicinity of inductor B does not significantly affect L.
FIG. 1A
190
161
161
1
0
190
191
120
120
Continuing with the description of , frequency comparison block receives signals A and B, and compares the two signals to determine if any change (from the default value) has occurred in the respective frequencies F and F. Based on the result of the comparison, frequency comparison block indicates on path that the inductance of the corresponding inductor (A or B) has changed.
1
0
190
1
0
1
0
190
1
1
0
190
0
190
190
The comparison of F and F can be achieved in various ways, as will be apparent to a skilled practitioner based on the disclosure provided herein. For example, frequency comparison block can be implemented to obtain a difference of F and F obtained over a count window. If F is greater than F, frequency comparison block concludes that L has decreased in the count window. If F is less than F, frequency comparison block concludes that L has decreased in the count window. Frequency comparison block also infers presence of metal in the vicinity of the corresponding oscillator/inductor based on the results of comparison. Further, based on the magnitude of the difference, frequency comparison block can determine other conditions, such as, for example, the distance between the metal and the corresponding oscillator/inductor, based on the principle that the change in inductance of an inductor is inversely proportional to the distance between the inductor and the metal.
190
1
0
190
161
161
161
161
Alternatively, frequency comparison block can be implemented to perform the comparison by obtaining a ratio of F and F (rather than a difference), and arrive at corresponding conclusions. Frequency comparison block may internally convert the sinusoidal oscillations on path A and B to digital square-wave signals (for e.g., using comparators) prior to the comparison, and the resulting digital signals are also referred to for convenience as signals A and B herein.
190
1
0
1
0
190
140
150
170
FIG. 1B
FIG. 1B
In an embodiment of the present disclosure, frequency comparison block is designed to compare F and F by obtaining a ratio of F and F, and is implemented as illustrated in . In , frequency comparison block is shown as containing counter , divider and logic block .
140
161
140
154
150
154
140
140
154
140
140
140
160
161
161
150
154
Counter counts the number of cycles of signal A. Counter may be implemented, for example, using a chain of flip-flops connected in sequence, and receives a signal from divider . Signal may, for example, be connected to an “enable” terminal of counter that enables the counting operation of counter . Signal indicates start and end instants defining a ‘count window’ of counter . Counter may be implemented in a known way. Thus, counter can be used to obtain the number of oscillations (cycles) of oscillator A (as represented by signal A or a signal derived from it) by counting the number of rising or falling edges of signal A occurring in a fixed duration (count window). The count window is set by divider via path , as noted below.
140
161
1
161
0
1
0
120
120
The digital count obtained by counter in the count window is dependent on the frequencies of signals A (F) and B (F), which in turn are respectively inversely proportional to inductances L and L of inductors A and B respectively (in general, F α 1/√L). As is well known in the relevant arts, an inductance value of an inductor changes when there is electromagnetic coupling between the inductor and a metal (when the inductor is powered ON and carrying an alternating current). The degree of change in inductance generally depends on how close the metal is to the inductor.
150
161
154
140
154
154
154
161
161
161
154
140
154
140
154
140
170
147
1
0
Divider is a digital block that divides the frequency of signal B by a fixed value (although the value itself is programmable or can be changed easily) to generate a frequency-divided signal on path . As an example, the logic-high duration (or the logic-low duration, or one cycle/period)) of the frequency-divided signal can be used to enable counter to count, thus defining the count-window. Alternatively, rather than forwarding the frequency-divided signal itself on path , signals derived from the frequency-divided signal can instead be forwarded on path to set the count window. Signal may be synchronous with signal B to get an accurate count window that can be represented as an integer multiple of the time period of signal B. Signal A is gated with signal (within counter , details not shown). When signal is asserted (e.g., logic HIGH), counter gets a periodic input and counter operation starts. When signal is de-asserted (e.g., logic-LOW), counter is frozen (stops incrementing/counting), and the count value is sent to logic block . Thus, the count value on path represents a ratio of the frequencies F and F.
170
147
170
0
1
170
120
120
Logic block receives the count value occurring in the count window on path , and processes the count value. One type of processing performed by logic block is to determine if a change in count from the default count value (count value when each of the inductances of inductors L and L is unchanged) has taken place. Such change from the default count value enables logic block to determine which one (but not both) of inductances of inductors A and B has changed. Such change is indicative only of factor(s) other than environmental effects on the inductors, provided that environmental factors affect both the inductors equally to the same extent.
0
161
140
140
147
1
0
1
0
1
161
0
161
0
154
Assuming that N cycles of F (B) comprise the ‘count window’ of counter , then the count generated by counter on path equals (N×F)/F, wherein F and F are respectively the default oscillation frequencies of F (A) and F (B), ‘×’ represents the multiplication operator, and ‘N’ represents the cycles of F in count window .
170
1
0
120
120
1
0
1
0
1
0
1
0
1
0
1
0
0
1
170
191
170
Logic block obtains a count difference (CD) given by the expression [N−(N×F)/F]. CD is indicative of a change in inductance of one of inductances of inductors A and B. Thus, when the default values L and L, and therefore default value of frequencies F and F, are equal, and there is no change in inductances L and L, CD equals zero. A negative value of CD indicates that F has increased (F remaining unchanged at its default value) in the count window, and therefore that inductance of L has decreased in the count window. A positive value of CD indicates that F has increased (F remaining unchanged at its default value) in the count window, and therefore that inductance of L has decreased in the count window. A value of zero of CD indicates that no changes, or equal changes, have occurred in the inductances of L and L. When metal is in proximity to either of the two inductors, the corresponding inductance decreases and hence frequency of the corresponding oscillator increases. So, based on the sign of CD, logic block determines which inductor is in proximity to the metal, and provides such information on path . Further, logic block also determines, based on the magnitude of CD, the (approximate) distance of the metal from the corresponding inductor.
120
120
120
120
1
0
100
100
Environmental changes such as, for example, changes in heat and/or humidity, would typically affect inductances of A and B equally, i.e., in the same way and to the same extent. From the above description, it may be appreciated that as long as changes in environment (e.g., heat and humidity) affect inductances of both inductors A and B in the same way and to the same extent (and therefore affecting F and F in the same way/same extent), count difference (CD) will remain zero. Therefore, the use of a reference oscillator having a reference inductor in device (in addition to just one oscillator, as in some prior technique) enables device to be used to determine parameters related to one or more phenomena (e.g., fluid-flow) that can be made to cause changes in inductance values, while being substantially immune to environmental effects on inductances.
100
100
Device can be employed to detect, for example, displacement, rectilinear motion and rotational motion of a metallic object, and based on such detection determine parameters of several phenomena. One example use of device is in the measurement of fluid-flow that causes a piece of metal to rotate in a circular motion, as described next.
3. Determining Fluid-Flow Rate
FIG. 3A
FIG. 1B
FIGS. 3A, 3B and 3C
FIG. 1
100
110
120
120
100
120
120
is a diagram illustrating the manner in which device of can be used to determine flow-rate of a fluid (liquid or gas). In , only PCB and the inductors A and B are shown for simplifying the description. However, it is to be understood that device would contain all the other components/blocks of as well, with inductors A and B being disposed as indicated.
110
260
260
240
260
110
220
230
260
220
220
170
PCB is shown placed in proximity to disc/plate , for example, in such a way that the center of disc aligns with shaft , and the planes of disc and PCB are substantially parallel to each other. One half of the disc is metal (), while the other half is non-metal (). Alternatively, disc may contain only the metal portion , the other half of the disc containing no material at all. In other alternative embodiments, rather than one-half of the disc, metal () may cover a larger or smaller proportion of the disc, with corresponding changes to the techniques applied in logic block to determine fluid-flow rate, as would be apparent to one skilled in the relevant arts upon reading the disclosure herein.
FIG. 3A
0
1
110
200
260
260
260
240
110
260
240
260
250
240
210
0
220
220
0
120
1
120
0
132
132
1
0
Referring again to , it may be observed that the locations of inductor L and L are such that they are on different hemispheres (or halves) of PCB and may thus ensure that metal electromagnetically couples (at least predominantly) to only one inductor during every half rotation of disc . In the description below, a circular shape for disc is assumed, although other shapes can also be used. Disc is fixed to shaft . The combination of PCB and disc (plus shaft ) can be assembled to be contained within a structure (e.g., a cylinder), not shown. Using suitable mechanisms (not shown), disc can be made to rotate (as indicated by ) about shaft by the fluid (e.g., water flowing in a pipe, with the disc coupled to the inside of the pipe by the suitable mechanisms) whose rate of flow is desired to be measured. The number of rotations of the disc per unit time would be indicative of the rate of flow of the fluid. Marker indicates the electromagnetic linkage between inductor L and metal , the linkage causing currents to flow in metal , which in turn reduces the inductance of inductor L. In the embodiment described below, the default values (values unchanged by interactions with a metal, environment, etc.) of inductors A (L) and B (L) are equal, capacitances of capacitors A and B are equal, and therefore, default frequency F equals default frequency F.
100
260
250
220
120
1
120
0
220
230
220
0
0
220
1
1
FIGS. 3B and 3C
FIG. 3B
FIG. 3C
With device powered ON and operational, as disc rotates (as indicated by ) due to fluid flow, in every rotation of the disc, metal portion alternately moves to be proximal to inductor A (L) and B (L). In , that an inductor is proximal to metal is indicated by a dot-filled circle, while that an inductor is proximal to non-metal is indicated by a circle with no filling. Thus, illustrates the condition when metal portion is proximal (e.g., directly below) to inductor L (as indicated by the dot-filled circle for L), while illustrates the condition when metal portion is proximal to (e.g., directly below) inductor L (as indicated by the dot-filled circle for L).
220
0
0
1
140
1
0
0
220
0
1
1
140
1
0
1
0
0
1
FIG. 3B
When metal portion is proximal to inductor L as illustrated in , the magnitude of L is reduced (as noted above), while the magnitude of L remains unchanged (i.e., equal to default value). As noted above, the count generated by counter equals (N×F)/F. With L reduced from its default value due to metal , F increases (F remaining the same due to no change in L), and the count generated by counter becomes less than the default value of [(N×F)/F]. The default value of [(N×F)/F] is its value when the values of inductances L and L are not affected by any metal and equal their respective default values.
220
1
230
1
0
1
220
1
0
0
140
1
0
FIG. 3B
When metal portion is proximal to inductor L (as disc rotates) and as illustrated in , the magnitude of L is reduced, while the magnitude of L remains unchanged (i.e., equal to default value). With L reduced from its default value due to metal , F increases (F remaining the same due to no change in L), and the count generated by counter becomes greater than the default value of [(N×F)/F].
1
0
140
230
230
170
170
170
Denoting the default value of [(N×F)/F] as ‘Default Count (NC)”, the count (C) generated by counter as disc rotates as “Measured Count (MC)”, then the count difference (CD) equals [“Measured Count”−Default Count”], and will alternate between a positive value and a negative value during each rotation of disc . Logic block maintains a local copy of NC, which may be programmed into logic block . Logic block also continuously computes CD.
230
220
1
140
230
230
170
During one half of the rotation of disc , metal is proximal to inductor L, there may be one or more instances of MC generated by counter . The specific number of instance(s) of MC depends on the speed of rotation of disc . However, it may be appreciated from the description above that each instance of MC will be greater than NC. Thus, during such half of the rotation of disc , each of logic block ′s computations of CD will be positive.
230
220
0
140
230
230
170
During the other half of the rotation of disc , metal is proximal to inductor L, there may be one or more instances of MC generated by counter . The specific number of instance(s) of MC depends on the speed of rotation of disc , as also noted above. However, it may be appreciated from the description above that each instance of MC will be less than NC. Thus, during such half of the rotation of disc , each of logic block 's computations of CD will be negative.
170
230
170
170
230
170
170
171
Logic block computes the time between transitions between positive and negative values of CD. Twice the time computed equals the time for one rotation of disc . Logic block may internally maintain a real-time clock, using which logic block computes the time for one rotation. From the time thus obtained for one rotation, the number of rotations per second (rps), or rotations per minute (rpm) is calculated. From rps or rpm, and (if necessary) based on the manner in which disc is coupled to the fluid (e.g., specific details of the coupling mechanism such as gears, gear ratios, etc., (parameters related to which may be stored in logic block beforehand by the system deployer)), logic block determines the rate of fluid flow (e.g., in meters per second), and provides the value on path .
120
120
The computed fluid-flow rate may be immune to environmental changes on the inductance values of inductors A and B, due to the reasons described above.
100
0
1
0
1
170
FIG. 3A
FIGS. 3B and 3C
It is noted here that the techniques described above with respect to rotational motion of metal can be adapted to detect rectilinear motion of a metallic object also. For example, device as shown in can be placed proximal (and parallel) to a surface that moves in a straight line such as a conveyor belt. A metallic object placed on the moving surface would cause a corresponding one of inductance L and L (illustrated in ) to change as the surface moves in a straight line, thereby causing F and F (and therefore CD) to change correspondingly as the metal passes beneath the corresponding inductor. Logic block can be implemented to compute the time between a transition between a positive and a negative value (or vice versa) of CD to determine the speed of the surface.
120
120
100
With two inductors (A and B) it is possible to detect only the rate of fluid flow, but not the direction. Therefore, device can only be used for metering of unidirectional fluid flow.
According to another aspect of the present disclosure a device capable of measuring both the rate as well as direction of fluid flow is implemented using an additional third inductor, as described next.
4. Determining Direction of Flow and Rate of Flow
FIG. 4A
FIG. 4
400
400
2
405
1
405
0
405
410
490
410
2
405
1
405
0
405
490
410
420
42
420
41
420
40
42
142
40
42
41
40
410
is a diagram of a device implemented according to aspects of the present disclosure, and which is capable of determination of fluid-flow rate as well as determination of the direction of flow. Device is shown containing oscillators (LC oscillator —A), (LC oscillator —B), (LC oscillator —-C, and PCB , frequency comparison block , and PCB . Oscillators (LC oscillator —A), (LC oscillator —B), (LC oscillator —-C, and frequency comparison block are mounted on PCB , and in an embodiment are implemented using discrete blocks/components. However, in an alternative embodiment, only inductors A (L), B (L) and C (L) are implemented in discrete form, with the remaining components and/or blocks of implemented in integrated circuit (IC) form. In such an embodiment, inductors L, and L are outside the IC, and all of L, L and L and the IC are mounted on PCB .
405
405
405
FIG. 1A
In general, each of oscillators A, B and C is similar to the oscillators of .
0
405
432
420
435
432
420
435
409
40
LC oscillator-C is shown containing capacitor C, inductor C and amplifier C. Capacitor C and inductor C form an LC (inductor-capacitor) tank circuit, and the values of L and C determine the resonant frequency of oscillations. The output of the LC tank is shown connected to amplifier C, which employs positive feedback (not shown) and generates sustained oscillations (i.e., oscillations that do not decay with respect to time as long as the oscillator is powered ON) on path C having resonant frequency F.
1
405
432
420
435
432
420
435
409
41
LC oscillator-B is shown containing capacitor B, inductor B and amplifier B. Capacitor B and inductor B form an LC (inductor-capacitor) tank circuit, and the values of L and C determine the resonant frequency of oscillations. The output of the LC tank is shown connected to amplifier B, which employs positive feedback (not shown) and generates sustained oscillations (i.e., oscillations that do not decay with respect to time as long as the oscillator is powered ON) on path B having resonant frequency F.
2
405
432
420
435
432
420
435
409
42
LC oscillator-A is shown containing capacitor A, inductor A and amplifier A. Capacitor A and inductor A form an LC (inductor-capacitor) tank circuit, and the values of L and C determine the resonant frequency of oscillations. The output of the LC tank is shown connected to amplifier A, which employs positive feedback (not shown) and generates sustained oscillations (i.e., oscillations that do not decay with respect to time as long as the oscillator is powered ON) on path A having resonant frequency F.
FIG. 1A
FIG. 1A
40
41
42
420
420
420
42
41
40
42
41
40
432
432
432
42
41
40
42
41
40
42
41
40
490
470
1
2
490
470
400
Similar to as in the example of , each of frequencies F, F and F has a default value. Each of inductors A, B and C has a respective default inductance L, L and L. In the description below, L, L and L each have the same default value and manufacturing tolerance levels. Similarly, capacitors A, B and C are implemented to have the same capacitance value and tolerance levels. As a result, the default values of F, F and F are the same. However, L, L and L, and therefore F, F and F, can in general have different default values, with frequency comparison block and logic block (both described below) implemented with corresponding changes to the techniques described below. For example, with different resonant frequencies, a fixed offset in frequency difference or CD and/or and CD (count difference, both noted in sections below) will result. Frequency comparison block and logic block can be implemented to account for such offset in their respective operations described below, and their operations will not impact the capabilities of device described herein. Similar to as in , a metal in the vicinity of an inductor changes the frequency of the corresponding oscillator.
490
409
409
409
490
409
409
409
409
42
41
40
490
491
490
190
490
42
40
42
41
Frequency comparison block receives signals A, B and C. Frequency comparison block compares frequencies of signals A and C, as well as B and C to determine if any change (from the default value) has occurred in the respective frequencies F, F and F. Based on the result of the comparison, frequency comparison block indicates on path that the inductance of the corresponding inductor has changed. The operation of frequency comparison block is similar to that of frequency comparison block , and therefore only briefly described below in the interest of conciseness. Thus, frequency comparison block can perform the comparison noted above by obtaining the differences of the corresponding pair of frequencies (F and F, and F and F), or by obtaining a ratio of the corresponding pair of frequencies.
490
42
40
42
41
42
40
42
41
490
440
460
450
470
FIG. 4B
FIG. 4B
In an embodiment of the present disclosure, frequency comparison block is designed to compare frequency pairs (F and F, and F and F) by obtaining a ratio of F and F, and F and F, and is implemented as illustrated in . In , frequency comparison block is shown as containing counters and , divider and logic block .
420
420
420
620
400
410
600
420
420
420
410
410
420
621
633
623
410
420
420
631
632
600
420
420
420
600
FIG. 6
FIG. 6
FIG. 6
The inductors A, B and C may be implemented in the form of coils, and in an embodiment are circularly spaced apart at 120 degree intervals (with respect to center of circle ) to maximize the sensitivity and coverage of the measurements by device . is a diagram illustrating such layout of the inductors, and additionally shows PCB and sensor IC (integrated circuit) . In , inductor coils A, B and C may be implemented in the form of conductive tracks printed on PCB . A small portion of each of the conductive tracks is printed on the opposite side of PCB to enable the layout of each coil as shown in . Thus, for example, with respect to inductor B, vias and connect the small portion (indicated by a dotted line) of the track printed on the opposite side of PCB . Inductors A and C are implemented similarly. In alternative embodiments, other angles and/or layouts of the inductors may be employed. Further, while each inductor coil is shown as having two-turns, they may, in general, have more or fewer turns. Rectangular bars such as and represent signal pads used for connection to pins of sensor . Each of inductors A, B and C is shown connected between two corresponding pins of sensor .
FIG. 6
FIG. 4B
FIG. 4B
FIG. 6
FIG. 4B
FIG. 6
FIG. 4B
600
470
600
410
410
620
467
447
601
608
600
470
601
608
410
600
In the example of , sensor IC incorporates all the circuit blocks/components of except logic block , which is implemented external to sensor IC and to PCB , for example, in the form of a microcontroller. However, it is noted that fewer or all of the blocks of can be implemented separate from PCB . In , the outputs of sensor IC correspond to the signals on paths and of , and are shown to be provided respectively on paths and . Sensor IC may also provide other signals, not shown in , but which may include, for example, internal nodes/paths of the blocks of , excluding those of logic block . All such node/paths (including paths and ) may be terminated on a connector (also not shown) on PCB . The external microcontroller interfaces with sensor IC via such connector.
260
240
400
410
400
260
110
40
41
42
FIG. 3A
FIG. 1
In the interest of conciseness, it is assumed in the following description that the arrangement of plate/disc along with shaft and the corresponding coupling mechanisms to the fluid (whose direction is to be measured) as noted in is used in conjunction with device , and the details/illustrations are not repeated here. PCB or device , in general, is placed in proximity to disc in a manner similar to that as noted above with respect to PCB of . Also, it is assumed that default values of inductances L, L and L are all equal the default resonant frequencies
260
410
410
260
620
240
FIG. 6
In an embodiment, disc is placed proximal to PCB , with the planes of PCB and disc being substantially parallel to each other, and the center of circle () encompassing the three inductors aligns with (is on the same line as) shaft .
FIG. 2
405
405
405
40
41
42
440
460
450
405
405
405
The example topology of described above may be used to implement each of the oscillators A, B and C. The sinusoidal signals F, F and F may be converted to digital square wave signals by front-end components (e.g., comparators) contained within counters and , and divider . It is also noted here that oscillators A, B and C may be implemented in other forms and using other topologies as well, as is well known in the relevant arts.
460
409
460
454
450
454
460
460
454
460
460
460
405
409
Counter counts the number of cycles of signal A. Counter may be implemented, for example, using a chain of flip-flops connected in sequence, and receives a signal from divider . Signal may, for example, be connected to an “enable” terminal of counter that enables the counting operation of counter . Signal indicates start and end instants defining a ‘count window’ of counter . Counter may be implemented in a known way. Thus, counter can be used to obtain the number of oscillations (cycles) of oscillator A by counting the number of rising or falling edges of signal A occurring in a fixed duration (count window).
440
460
440
409
409
440
460
470
447
467
Counter operates similar to counter described above (except that counter receives signal B rather than A), and the description is not repeated in the interest of conciseness. Counters and forward their respective count values determined to logic block via respective paths and .
450
40
454
440
460
454
454
Divider is a digital block that divides the frequency of signal F by a fixed value (although the value itself is programmable or can be changed easily) to generate a frequency-divided signal on path . As an example, the logic-high duration (or the logic-low duration, or one cycle/period) of the frequency-divided signal can be used to enable each of counters and to count, thus defining the count-window. Alternatively, rather than forwarding the frequency-divided signal itself on path , signals derived from the frequency-divided signal can instead be forwarded on path to set the count window.
FIG. 1A
440
460
409
409
409
409
409
409
409
42
41
40
Similar to as noted above with respect to , the count obtained by counters and are respectively dependent on the frequencies of signal pairs A/C and B/C. The frequencies of signals A, B and C are respectively inversely proportional to inductances L, L and L. The degree of change in inductance depends on how close the metal is to the corresponding inductor(s).
470
460
440
467
447
Logic block receives the respective count values of counters and occurring in the count window on respective paths and , and processes the count values to determine direction of fluid-flow and rate of flow as described below.
FIG. 1
405
40
Similar to as in , oscillator C may be viewed as a ‘reference’ oscillator, and inductor L a ‘reference’ inductor. Due to the use of a reference inductor, measurement of direction of fluid-low may be rendered immune to changes in environmental conditions such as for example, temperature and humidity.
400
410
42
41
40
400
40
41
42
40
41
42
40
41
220
260
42
260
FIGS. 4 and 5
FIGS. 5A, 5B and 5C
FIGS. 5A, 5B and 5C
FIG. 5A
FIG. 5A
The manner in which device determines direction of fluid-flow is described next with references to . In each of , only PCB and inductors L, L and L are shown, although it is to be understood that the other components/blocks of device would also be present. The locations of inductors L, L and L are indicated respectively by circles with internal labels , and . In each of , a hashed circle (e.g., circles with labels and in ) indicates that the metal portion of disc is proximal to the corresponding inductors as the disc rotates due to fluid flow, while a non-hashed circle (e.g., circle with label in ) indicates that the non-metal portion of disc is proximal to the corresponding inductor(s) as the disc rotates due to fluid flow.
260
40
41
220
260
42
230
260
41
40
42
FIGS. 5A, 5B and 5C
FIG. 5A
As disc rotates, the conditions indicated in occur. represents a condition when inductors L and L are proximal to metal of disc , and inductor L is proximal to non-metal of disc . As a result, the inductance values of L and L reduce from their default values, while the inductance of L remains unchanged at its default value.
42
41
40
42
41
40
220
260
Based on the description provided above, the values of the respective frequencies F, F and F change (increase) from their default values when the corresponding inductors L, L and L is/are proximal to metal as disc rotates.
FIG. 5A
41
42
40
40
41
42
460
42
40
440
41
40
2
470
460
1
470
440
In the situation of , L decreases from its default value, L remains at its default value, and L decreases from its default value. Correspondingly, F and F increase above their default values, while F remains at its default value. Therefore, the output of counter ([(N×F)/F] reduces to below its default value, and the output of counter ([(N×F)/F] remains unchanged at its default value. Therefore, the computation count difference (CD)=[“Measured Count”−Default Count”] made by logic block for counter will be negative, and the computation count difference (CD)=[“Measured Count”−Default Count”] made by logic block for counter will be zero.
FIG. 5B
2
470
460
1
470
440
Following the logic noted above, for the situation of , the computation count difference (CD)=[“Measured Count”−Default Count”] made by logic block for counter will be zero, and the computation count difference (CD)=[“Measured Count”−Default Count”] made by logic block for counter will be negative.
FIG. 5C
2
470
460
1
470
440
Similarly, for the situation of , the computation count difference (CD)=[“Measured Count”−Default Count”] made by logic block for counter will be positive, and the computation count difference (CD)=[“Measured Count”−Default Count”] made by logic block for counter will also be positive.
FIGS. 5A, 5B and 5C
FIG. 5A
FIG. 5B
FIG. 5C
FIG. 5A
FIG. 5A
FIG. 5C
FIG. 5B
FIG. 5A
260
260
260
260
With combined reference to , a sequence progression of disc that goes through the sequence of , followed by that of followed by that of followed by that of , then repeating the same sequence, indicates that disc is rotating in the clockwise direction. A sequence progression of disc that goes through the sequence of , followed by that of followed by that of followed by that of , then repeating the same sequence, indicates that disc is rotating in the anti-clockwise direction.
1
2
470
The count difference values CD and CD computed by logic block are summarized as follows:
FIG. 5A
1
2
CD is negative.
For : CD is zero,
FIG. 5B
1
2
CD is zero.
For : CD is negative,
FIG. 5C
1
2
CD is positive.
For : CD is positive,
470
260
From the above, Logic block determines the direction of rotation of disc as follows:
1
2
260
a) If the sequence of CD is zero, then negative, then positive AND the sequence of CD is negative, then zero, then positive, THEN the direction of rotation of disc is clockwise.
1
2
260
b) If the sequence of CD is zero, then positive, then negative AND the sequence of CD is negative, then positive, then zero, THEN the direction of rotation of disc is counter-clockwise.
260
470
471
Based on the determination of whether the rotation of disc is clockwise or counter-clockwise, logic block forwards on path the direction of fluid flow (e.g., left or right, north or south, etc.).
470
1
2
It may be noted that the rate of fluid-flow can be determined by logic block based on the time taken for either CD or CD to complete one cycle, as would be obvious to one skilled in the relevant arts.
260
It may also be noted that due to the techniques described above (including the use of a reference oscillator), oscillator-frequency can be measured (e.g., by counters) with high accuracy, thereby enabling detection of small inductance changes. This may permit a larger distance between disc and the inductor coils than otherwise possible.
5. Conclusion
References throughout this specification to “one embodiment”, “an embodiment”, or similar language means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, appearances of the phrases “in one embodiment”, “in an embodiment” and similar language throughout this specification may, but do not necessarily, all refer to the same embodiment.
FIGS. 1A, 1B, 2, 4A and 4B and 6
While in the illustrations of , although terminals/nodes are shown with direct connections to (i.e., “connected to”) various other terminals, it should be appreciated that additional components (as suited for the specific environment) may also be present in the path, and accordingly the connections may be viewed as being “electrically coupled” to the same connected terminals.
While various embodiments of the present disclosure have been described above, it should be understood that they have been presented by way of example only, and not limitation. Thus, the breadth and scope of the present disclosure should not be limited by any of the above-described embodiments, but should be defined only in accordance with the following claims and their equivalents. | |
Background: The observation that specific members of the microbial intestinal community can be shared among vertebrate hosts has promoted the concept of a core microbiota whose composition is determined by host-specific selection. Most studies investigating this concept in individual hosts have focused on mammals, yet the diversity of fish lineages provides unique comparative opportunities from an evolutionary, immunological and environmental perspective. Here we describe microbial intestinal communities of eleven individual Atlantic cod (Gadus morhua) caught at a single location based on an extensively 454 sequenced 16S rRNA library of the V3 region.
Results: We obtained a total of 280447 sequences and identify 573 Operational Taxonomic Units (OTUs) at 97% sequence similarity level, ranging from 40 to 228 OTUs per individual. We find that ten OTUs are shared, though the number of reads of these OTUs is highly variable. This variation is further illustrated by community diversity estimates that fluctuate several orders of magnitude among specimens. The shared OTUs belong to the orders of Vibrionales, which quantitatively dominate the Atlantic cod intestinal microbiota, followed by variable numbers of Bacteroidales, Erysipelotrichales, Clostridiales, Alteromonadales and Deferribacterales.
Conclusions: The microbial intestinal community composition varies significantly in individual Atlantic cod specimens caught at a single location. This high variation among specimens suggests that a complex combination of factors influence the species distribution of these intestinal communities. | https://pubmed.ncbi.nlm.nih.gov/24206635/ |
CHILD-BRIGHT is proud to offer opportunities to help involve future generations of researchers, health professionals and leaders in patient-oriented work in Canada. Meet Simon Robins, one of our 2017 Summer Studentship recipients, and read his reflections on his time at CHILD-BRIGHT.
Name: Simon Robins
Studying: Master of Library and Information Studies, UBC
Focus of summer internship:
CHILD-BRIGHT Optimizing the Management of Pain and Irritability project
"Through the CHILD-BRIGHT summer studentship program, I’ve been able to assist my research team in developing an outreach strategy which ensures successful knowledge translation of our research process and outcomes to a broader audience through a new website. The research project being communicated is titled “Optimizing the Management of Pain and Irritability in Children with Severe Neurological Impairments,” and is led by Dr. Hal Siden. This study evaluates the assessment and management of pain and irritability in children with neurological impairment. This is a randomized, multi-site trial of a clinical pathway to focus and streamline the evaluation and assessment of this population.
To effectively translate this online knowledge and revise existing content on Dr. Siden’s past projects, I relied heavily on the patient-oriented research articles and the webinar discussions from the summer studentship program. Above all, I made sure to keep in mind the importance of creating a website which is orientated towards patients and their families and is easily understood by non-academics. I primarily achieved this by implementing a user-friendly design and by testing our content on our Family Advisory Committee (upcoming).
For the bulk of my project, I re-designed and drafted new content for PedPalASCNET's website using WordPress. To begin, I reviewed existing content from other lab websites, and drafted content based on trends I found. I then planned interviews to gather families’ stories on their experiences participating in our research, and to test the early designs and content to make sure that they are usable and understandable. Focus groups have been scheduled to gather similar feedback from families.
In addition, I managed PedPalASCNET’s social media/mailing lists. This work with social media directly informed our ongoing outreach strategy by allowing me to analyze our twitter data, our website usage through Google Analytics, and the analytics on our MailChimp emails. We made an effort to find twitter users who identified as families of sick children and track which tweets were popular. As a result, the research network now has a better sense of what the research and patient communities engage with the most, and we have tailored our web content according to these trends.
As a library and information studies student I am highly interested in outreach and scholarly communications within academic libraries and research networks, and I feel I have gained greater exposure to this type of work by helping to redesign the website and conduct outreach through social media and patient interviews. Through weekly tweets and retweets about current event articles and the latest academic research, I feel more confident about my ability to generate engagement and attract new followers within the research, patient, and caregiver communities. I also feel more confident about my ability to translate knowledge within websites by employing user-centred design and by framing complicated research topics into language that is easier to understand. This above all depends upon caregiver and patient feedback.
In the future I will continue to involve patients and caregivers when designing the information resources which are meant to serve them and their health providers." | https://www.child-bright.ca/new-blog/2017/9/14/meet-our-summer-student-simon-robins |
In early 2003, Elyse Sewell was a relatively anonymous 20-year-old research assistant at a biology lab. She aspired to attend medical school, having recently graduated magna cum laude from the University of New Mexico with a double major in Spanish and biology.
Instead, Sewell found herself in Hollywood starring in the debut season of the reality TV show "America's Next Top Model." Her 5-foot-10, 114-pound body was a perfect fit for the competition; Sewell effortlessly advanced to be one of the final three contestants competing for a $100,000 modeling contract from Revlon.
Then, unprovoked, show host Tyra Banks ushered Sewell off "America's Next Top Model" with a jaw-dropping dig.
"Elyse, your look is very strong for the fashion world — for the hard-core, die-hard fashion world," said Banks, herself a supermodel. "I admire your intelligence — I think you are so smart. But one thing with that intelligence is it can intimidate people. And there's a way to use that intelligence in a way that doesn't feel like you're maybe putting down other people or sounding derogatory."
Translation: while you look anorexic enough to work as a model, there's really no place on my reality TV show for an intelligent and self-assured woman.
As media critic and journalist Jennifer Pozner watched this scene unfold on TV in the summer of 2003, it set her mind racing. What would girls watching the show take away from the comments — that a mind is a terrible thing to use?
By that time, a couple years had already passed since Pozner founded Women in Media & News to increase awareness about women's portrayal in media. In 2010 she also wrote a book, "Reality Bites Back: the Troubling Truth about Guilty Pleasure TV," that examines the societal implications of reality TV and offers practical tips for improving media literacy.
"I kept noticing more and more deeply problematic, regressive ideologies packaged on reality TV as if they were a reflection of just who we happen to be as Americans today," she said.
Pozner's perspective is increasingly relevant in light of the fact that millions of Americans are watching reality TV each day. Consider, for example, that a typical episode of MTV's "Jersey Shore" — the most-watched reality TV show for children age 12-17 during the 2011 television season — attracts about 5 million viewers. Additionally, in recent weeks the Fox franchise "American Idol" attracted a combined 34 million viewers for a pair of shows on back-to-back weeknights.
New research indicates that a growing cadre of this reality programming is especially detrimental to girls because of what the Parents Television Council, a non-partisan education organization advocating responsible entertainment, calls "a disturbingly unrealistic portrayal of 'reality' with harsh, demeaning, degrading and sexualized dialogue." For example, according to the Girl Scout Research Institute, girls age 11-17 who regularly watch reality TV are much more inclined than reality TV non-watchers to agree with statements like "Gossiping is a normal part of a relationship between girls" and "Being mean earns you more respect than being nice."
Because reality TV really started gaining a major cultural foothold in 2002, it follows that the girls who are now teenagers have never known a media landscape that didn't prominently feature reality TV.
"It doesn't surprise me that preteens and teenagers wouldn't be overly critical about this genre," Pozner explained. "They have grown up with TV that tells them that this is reflecting real people and real life, without telling them that this is a highly edited, manipulated surreality that only seeks out people who can be turned into caricatures."
And yet, despite the potential pitfalls reality TV poses younger viewers, effective strategies exist for parents to shield their teens from the most unsavory content today and, in the long run, prepare those impressionable minds to become tomorrow's savvy and informed consumers of media.
An indelible impact
Last year the Parents Television Council set out to answer a question: "What messages are being communicated to young viewers through the lens and language of reality television?"
Knowing that MTV has the four most popular reality TV shows for ages 12-17 — "Jersey Shore," "Real World," "Teen Mom 2" and "16 and Pregnant" — Parents Television Council commissioned an independent content analysis of the language on the four MTV reality shows. The results of that analysis provided the framework for its study "Reality on MTV: Gender Portrayals on MTV Reality Programming," published in December.
The study particularly distilled some eye-opening results about the portrayal of women in the MTV reality shows. For example, the major findings included the following: "Only 24 percent of what females said about themselves was positive" and "Overall, women were more disparaging than men when speaking of themselves or someone of their own gender."
Although Melissa Henson, Parents Television Council's director of communications and public education, played an integral role in mapping out which issues the study would cover, some of the findings surprised even her.
"I think we were all surprised to see so much of all the negative, belittling language directed at women coming from other women," Henson said. "It communicates the idea to girls that you can have no true girlfriends because your only goal in life is to find a man, and therefore every other woman is a potential love rival and therefore you can have no true female friendships."
The Parents Television Council study validated and buttressed the results of the Girl Scouts Research Institute's survey from earlier in 2011, "Real to Me: Girls and Reality TV," based on 1,141 interviews of girls age 11-17.
The Girl Scout survey assigned respondents to one of three categories — regular reality TV viewers (47 percent), those who watch reality TV sometimes (30 percent) and those who rarely/never watch reality TV (23 percent) — and then contrasted the responses of regular reality TV viewers against the respondents who rarely/never (watch) reality TV.
Girl Scout Research Institute concluded, "Of girls surveyed, regular reality TV viewers differ dramatically from their non-viewing peers in their expectations of peer relationships, their overall self-image, and their understanding of how the world works."
By way of illustration, 49 percent of the girls who regularly view reality TV said they're happier when they have a boyfriend or are dating someone — while only 28 percent of the non-viewing girls responded similarly.
Media critic Pozner cites the dearth of functional media literacy among today's youth as a primary catalyst leading to passive media consumption, a state of mind that allows reality TV and television advertising to gain an almost impervious foothold in the worldview of teenage girls.
"We just don't teach (enough) media literacy," Pozner said. "Media companies want us to engage with media in a passive way because that passivity is really key to a mindset that fosters consumption. ... We can't be passive when we watch television, because that's when the advertising messages and the ideological messages sneak in under our defenses."
Strategies for parents
As undesirable as some of the reality TV content may be, experts offer a multitude of strategies for parents to help their teens make wise choices about consuming and internalizing media.
Parents Television Council's Henson advises practical measures such as cutting the cord on all MTV programming ("there's nothing redemptive about it," she said) and removing televisions from bedrooms.
"Watch with your kids whenever possible," Henson said. "That way if they're exposed to (negative) messages in the shows that they're watching, at least you're there to provide a counterbalance. ... You can explain to them that what they're seeing is not true reality, but a manipulated reality."
In conjunction with its "Real to Me" survey results, the Girl Scout Research Council published a "Tips for Parents" primer. General topical categories in the tip sheet include things like encouraging your daughter to look beyond the mirror ("Compliment her on her talents and praise her for her values or willingness to try new things. Encourage her to pursue interests that are not based on improving her looks"), and creating alternatives for the entire family ("You can even think about ways you can use what you see on TV to get the family interested in other things. For instance: Try out a recipe seen on a cooking program").
Pozner is quick to point out that instilling teens with enough media literacy to make sense of reality TV will yield benefits that extend decades into the future and include all forms of media they'll consume throughout their lives.
"The first step to becoming active media consumers is to be really critical — and that doesn't mean being negative," Pozner said. "That means asking questions (to) break the cycle of taking in images and then changing our consumer behavior or our ideological outlook without even realizing that we're doing it in response to media. ...
"I get mail all the time from teenagers and young adults saying that they have changed their (reality TV) viewership habits very thoroughly," Pozner said. "Some have said that they've stopped watching, but many of them said it's not that they stopped watching but that they just have the tools they need to deconstruct what is being sold to them and to think more critically about the media they engage with." | https://www.deseret.com/2012/5/26/20414980/combating-the-negative-impacts-of-reality-tv-on-girls-sense-of-self |
Gujarat’s power sector has witnessed significant developments since the unbundling of the Gujarat Electricity Board in 2005. Today, we have one holding company, GUVNL and six subsidiaries, of which four are in distribution, one in generation and one in transmission. Our journey started with an accumulated loss of Rs 80 billion in 2005. Last year, we generated a surplus of about Rs 5.5 billion. Our six subsidiaries have been generating surpluses consistently for the past 10 years.
Gujarat is a power-surplus state, with an installed capacity of around 27,000 MW. Of this, the installed capacity from conventional sources is around 19,500 MW, while renewables contribute to around 7,500 MW, which includes 5,500 MW of wind power and 1,700 MW of solar power. Across states, Gujarat comes second in terms of installed wind capacity and sixth in terms of installed solar capacity. In the past 10 years, around 16,000 MW of capacity was added in the state, which included around 10,000 MW from conventional sources and around 6,000 MW from renewables.
On October 9, 2017, we successfully met a peak demand of 17,097 MW without any load shedding or power cuts. Recently, on June 21, 2018, we successfully met the entire day’s peak energy demand of 376 MUs, which was almost 10 per cent of the national peak demand.
Renewable energy initiatives
The state has taken various initiatives and policy measures for the development and promotion of renewable energy. We notified the solar power policy in 2015, wind power policy in 2016, small hydel policy in 2016, waste-to-energy policy in 2016 and recently, in June 2018, we have notified the solar-wind hybrid policy. The objective of the solar-wind hybrid policy is to minimise the variability and optimally utilise the required infrastructure, mainly land and the transmission system.
Gujarat was the first state in the country to develop a state-of-the-art solar park (at Charanka in northern Gujarat). This park has a potential of 850 MW, against which 700 MW of capacity has already been made operational. The state is developing two more solar parks, one at Radhanesda with a capacity of 750 MW and the other at Harshad of nearly 500 MW.
During 2017-18, the state tied up 1,000 MW of capacity through competitive bidding. Power purchase agreements (PPAs) were signed for 500 MW of wind power at a price range of Rs 2.43 to
Rs 2.45 per unit. The Rs 2.43 per unit bid, which we received for wind-based projects, is in fact the lowest in the country.
Another 500 MW of solar capacity has been tied up at Rs 2.65 to Rs 2.67 per unit through reverse auctions. To recall, in 2010, the state had paid a feed-in tariff of almost Rs 15 per unit to the capacity allocated by the government to solar developers. We expect tariffs to come down further in the short and medium term.
On June 23, 2018, the state’s chief minister launched a new scheme, Surya Shakti Kisan Yojana, wherein farmers can generate electricity using solar panels and sell the surplus power generated to the grid. Under the first phase of the scheme, grid-connected solar panels will be provided to over 12,000 farmers and will cover 137 feeders in 33 districts of the state. The scheme would provide farmers with 12 hours of power supply for agricultural pumps during the day. Moreover, farmers can sell the surplus power to discoms and earn significant amounts from such sales. The scheme has been devised in a way that farmers get their investment back (around 5 per cent of the total project cost) within 8-18 months. Based on the success of the pilot, the scheme is likely to be extended to cover the remaining 7,000 agricultural consumers, covering 1.45 million farmers.
Transmission and distribution performance
The state transmission utility, the Gujarat Energy Transmission Corporation has a network of around 1,900 substations and about 61,000 ckt. km of transmission lines. The state’s transmission losses are around 4 per cent, substation availability is around 99.85 per cent and transmission line availability is 99.53 per cent.
The state is currently catering to around 17 million consumers, of which 14.5 million are catered to by state-owned discoms and the remaining 2.5 million are catered to by private discoms. We have already achieved 100 per cent village electrification in 2007-08. Further, in 2013-14, we also achieved 100 per cent household electrification. The state’s focus is now on electrification of hamlets, which are in scattered pockets and habitations. We are committed to providing quality and reliable power to all our consumers.
The aggregate technical and commercial (AT&C) losses have come down to around 12-13 per cent at present, against the Ujwal Discom Assurance Yojana’s trajectory of around 14.5 per cent. In urban areas like Vadodara city, AT&C losses have come down to less than 5 per cent. The average cost to the consumer in Gujarat is around Rs 6.02 per unit, while the average revenue realisation per unit is around Rs 6.10. Therefore, we generate a surplus of 7-8 paise per unit. Gujarat discoms are perhaps amongst the few discoms in the country to generate such a surplus.
Future plans
Renewable energy is the future for Gujarat. The state’s vision is to have 40 per cent capacity from renewable sources by the year 2030, which is equivalent to around 23,000 MW of renewable energy. We aim to add 1,000 MW of wind power and 2,000 MW of solar power every year through competitive bidding.
A conducive regulatory framework is in place for the deployment of wind, solar, mini-hydel, biomass and wind-solar hybrid capacities. The state is also taking steps in the area of developing offshore wind energy. India’s first offshore wind farm project is coming up in the Gulf of Khambhat in Gujarat. This project is being supported by the European Union as well as the Ministry of New and Renewable Energy, the National Institute of Wind Energy and the state government of Gujarat. Expressions of interest for around 1,000 MW of capacity have already been invited. Offshore wind farms have certain advantages over conventional wind plants, including the huge availability of land, higher wind speed (20 per cent more), lower turbulence and more consistent wind availability.
Old and inefficient generation plants are also being phased out and new capacities based on efficient supercritical technologies are being planned. In the past two years we have phased out 1,320 MW of conventional capacity. The state has also undertaken strategic initiatives for utilising coal at pithead power stations, through rationalisation of coal linkages and through steps taken under the government’s flexible utilisation of coal scheme. On the transmission side, we are ensuring the necessary investments to meet the network expansion and upgradation requirement. In the past five years, we have incurred a capex of around Rs 130 billion. We plan to infuse Rs 54.5 billion of capex in the next two years.
On the distribution side, initiatives are being taken for transmission and distribution (T&D) loss reduction, including administrative measures covering theft and pilferage of electricity. The state is installing underground cabling, automated infrastructure for energy auditing and digital surveillance for theft detection and prevention. T&D losses in the state have been brought down to less than 18 per cent in 2017-18 from 38 per cent in 2001.
Challenges
On the generation front, a major challenge is the lack of assured supply of fuel for achieving economical generation costs. Thermal power constitutes a significant proportion of the state’s installed capacity; however, the state does not have any coal deposits. Also, the landed price of coal after freight and taxes comes to almost two and a half to three times higher than the pithead coal prices. The state has no gas feed, limited lignite deposits as well as limited hydro potential. Land acquisition is another major challenge.
On the transmission front, cost overruns and right-of-way issues have led to delays in infrastructure deployment.
On the distribution front, the average cost of supply to discoms has been increasing, primarily on account of an increase in conventional fuel prices and rising T&D costs. In addition, high cross-subsidisation in tariffs is leading to the migration of a considerable number of open access consumers. Further, in Gujarat we have accorded must-run status to renewable resources and hence, renewable energy integration and real-time generation management to balance infirm generation is a huge challenge. Going forward, the availability of energy storage technologies on a commercial basis and advanced software for forecasting renewable generation would play a vital role in addressing these challenges.
Outlook
Gujarat’s power demand is increasing at a rate of 6-7 per cent. Hence, huge investments are being made in the generation, transmission and distribution segments. The key lies in improving efficiency so that consumers do not have to pay anything extra for the investments proposed in the short, medium or long term.
The state has been proactive in adopting grid modernisation technologies, which can provide solutions for system-level challenges such as transient stability and network congestion for reliable and secure grid operations. Further, measures such as the mapping of assets for real- time data integration, predictive maintenance, replacement of obsolete technology, adoption of advanced technologies like digital substations, gas-insulated switchgear and hybrid switchgear, substation automation and dynamic line rating are also being implemented.
In short, while Gujarat’s power sector has witnessed a remarkable growth over the past several years, the various initiatives and schemes currently under way are expected to significantly improve operational efficiency and ensure reliable and quality power to all consumers. | https://powerline.net.in/2018/07/20/gujarat-power-surplus-state/ |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.