content
stringlengths 0
1.88M
| url
stringlengths 0
5.28k
|
|---|---|
Walkin the Sidelines-What’s Your Why?
By SCOTT BAKER
For The Express
The famous comedic duo, Abbot and Costello are widely known for their skit, “Who’s On First.”
Through much confusion, the duo attempts to come to a definitive understanding of whose playing where on the baseball field. The duo knew what they were trying to figure out yet couldn’t make it happen.
Similarly, many athletes often know what they want but have much confusion in trying to make it happen. Other athletes may not know what they want at all.
Therefore, athletes must ask themselves, what’s my why?
Yes athletes, I ask you, what’s your why?
You might say, who’s my what? Or, where’s my who?
That’s right, I said, what’s your why?
All too often we go through life doing tasks and duties because we feel they are what we are to be doing. In other words, we do certain tasks just because we are supposed to. At least we think that we are supposed to. Often, we do so with little purpose in mind. Many young athletes often do this as well. Their coaches or perhaps parents tell them that working out will make them better.
So what do they do, they workout. What are they doing? Working out of course. Therefore, the assumption is that they are going to get better. Caution, working out may or may not help someone to “get better.” Just as with people in general, athletes must consider what it is that they want to get better at before they set about getting better.
You see for explanation purposes I will state it this way. If my feet are bothering me and I want to get them feeling better so that I can begin to walk more and even sleep better, I’m not going to go to a dentist and have a root canal. Why? Because while the rootie might ensure that I never have a tooth issue again, it will be doing nothing to make my feet better. In fact, I could have all of my teeth rooted out and my feet would still be a problem.
So back to athletes we go. An athlete is told that they need to workout in order to get better, so what do they do, they head straight to the weight room and start pounding the weights. Ok, let me explain. They are perhaps likely going to get a whole lot stronger but what if what they needed to “get better” was to become quicker or faster? Lift all they want or can and a likely result will be that they get no faster and even perhaps slower and slower.
You see, just like I need the right doctor to treat me for certain ailments, athletes need certain workouts to meet their needs. This is one big reason why athletes need to ask, what’s my why when considering a workout plan. They should not simply workout for the sake of working out. The workout that they choose should be conducive to their goals for the workout.
First, however, they must ask themselves what their goal is in working out. Do they need to get bigger? Do they need to get stronger? Faster? Quicker? Jump higher? Once they understand their needs, they can then go about finding or developing a workout regime that makes sense in terms of their needs and goals.
Once the correct workout has been developed, the athlete must then ask the next why question. That is, why am I doing this? You might say, wait, I thought we just answered the why question. We did answer a why question but not this why question. This why am I doing this question is asking your reasoning for working out to get better in the first place.
In other words, is the athlete working out because they personally want to get better? Are they working out because their parents or coaches are pushing them to get better? Do they want to play high school sports or do they have a desire to go to a higher level? Do they have a general desire to want to get better by working out in the first place?
Seriously, the answers here do matter because they will determine what needs done and perhaps how hard one might work towards meeting a stated goal. These questions truly are important because if an athlete has both a goal in mind and a true purpose behind their workouts, those workouts are very likely to be very effective in achieving their intended purpose. If there is no goal or purpose in mind and the athlete is not working out in an organized program because they want to, the results will be minimal and could be better stated as, a waste of time. I have seen both ends of the spectrum on this.
I’ve seen athletes who are very haphazard with their workouts. Some who even worked exceptionally hard yet had no direction. They didn’t know their why. They just worked out because that’s what athletes are to do. In fact, at times, they actually worked out too much to the point that they failed to get any better in any capacity. I have also witnessed athletes who have been very directed or organized in their workouts. They knew their why, worked very hard and ultimately achieved their desired goals.
Working out is no different than anything else we do in life. If we are to gain maximum benefit from the work we do, we must have a clear goal in mind as well as an organized plan that will help us to achieve that plan. If those things are not in place, it is highly likely that a whole lot of work will be done, a whole lot of time wasted for very little benefit or gain.
So athletes, I ask, what’s your why? Do you know? If you do, do you know how to achieve it? If so, go! If not, consider your goal, talk to a knowledgeable person about how to help you organize and then likewise, go.
Failing to prepare will be preparing to fail. That is just plain crazy. Prepare for success and get going now.
Good luck. | https://www.lockhaven.com/sports/local-sports/2019/06/walkin-the-sidelines-whats-your-why/ |
will allow you to look at a developmental model of communication and apply the model to a film assigned by the instructor.
Write a 750-1000 word paper that analyzes a relationship within a film assigned by the instructor. Include the following:
Using Knapp’s developmental model of communication, analyze a relationship in the film that has spanned the full spectrum of stages.
Write a reflection on the communication messages sent and received in each stage, from the beginning to the end of the relationship.
Make sure that you clearly summarize the characteristics of each stage and give concrete examples of messages that are illustrative of each developmental stage.
Focusing a relationship portrayed in the film, analyze the relationship in terms of the following three dialectic tensions: a) Connection versus autonomy, b) Predictability versus novelty, and c) Openness versus privacy
How do these tensions influence relational maintenance behaviors?
Analyze conflicts that are present in this relationship: Identify the type of conflict and the strategies used to resolve the conflict (if the conflict has not been resolved, suggest a conflict management style that may be effective in resolving the conflict).
This paper should include one to two credible references. | https://helphomeworks.com/interpersonal-relationships-are-constantly-changing-this/ |
In network database terminology, a relationship is a set each set is made up of at least two types of records: an owner record (equivalent to parent in the hierarchical model) and a member record (similar to the child record in the hierarchical model. A network diagram is a unique kind of cluster diagram that represents a cluster or small structure of computers or other networking devices preidentified icons or symbols are used to draw network appliances and the style of lines between two nodes describes the type of connection. Physical diagram should be separate from logical as logical shows you usually how data flows through network and how it is configured for example from ip perspective and physical diagram shows you for example how devices are racked and cabled inside the cabinet or installed on the building floor-plan. The critical path method leverages precedence diagrams (also known as project network diagrams) this method is useful in creating project schedules and managing high-risk activities on the critical path. Network analysis entails a group of techniques for presenting information relating to time and resources so as to assist in the planning, scheduling, and controlling of projects the information, usually represented by a network, includes the sequences, interdependencies, interrelationships, and criticality of various activities of the project.
A project manager arranges the activities of a new project -- one without historic precedent -- in a diagram, or program network, estimating the time and resources needed to complete each project. Class diagrams, sequence diagrams, and use case diagrams remain the most in vogue what this implies is that you need to know just 20% of the uml language to explain 80% of your modeling needs you do not need to know or comprehend the entire notation, to communicate effectively using uml diagrams. Advantages and disadvantages of gantt charts advantages of gantt charts it creates a picture of complexity i am quite a fan of diagrams and charts we think in pictures therefore, if we can see complex ideas as a picture, this will help our understanding it organises your thoughts.
Network diagrams help us in the following ways: - • helps us find our critical / non-critical activities so if we know our critical activities we would like to allocate our critical people on the critical task and medium performing people on the non-critical activities. Quick answer a project network diagram is a visual chart outlining the sequence of steps needed to complete a project project network diagrams are commonly used in service industries that require tasks to be completed by certain deadlines. A network diagram can be created by hand or by using diagram software there are two types of network diagrams, activity on arrow ( aoa ) and activity on node ( aon ) activity on node diagrams are generally easier to create and interpret.
Aon: advantages: network diagram is unique construction of network diagram is easier aon representation is natural and does not contain artificial elements on the network no dummy activities are used events are not used easy to understand at every level of management aon are easier to revise that aoa when there are changes in the network. A network diagram is a graphical representation of the project and is composed of a series of connected arrows and boxes to describe the inter-relationship between the activities involved in the project. The disadvantages of network diagram in project management is that it takes a lot of time to produce and it is very costly the other disadvantage is that it may be complex which might lead it to. You can draw a uml class diagram on a whiteboard and i can understand it without quibbling over notation but somewhere along the line someone got the idea that a drawing notation could somehow be a process in it's own right, or at least a formal part of a larger process. The fully connected network topology diagram examples was created using conceptdraw pro software with computer and networks solution the computer and networks solution from computer and networks area of conceptdraw solution park provides examples, templates and vector stencils library with symbols of local area network (lan) and wireless lan (wlan) equipment.
Hub acts as a junction to connect different nodes present in star network, and at the same time it manages and controls whole of the network star topology diagram: advantages of star topology 1). Network analysis and gantt charts are two project management tools that aid in carrying out tasks against a time tangent in a project, networks form the basis for controlling the project while the wbs forms the backbone of the project tasks and deliverables, the scheduled time for each task to take place is demonstrated by a network diagram. A network topology refers to the way in which nodes in a network are connected to one another the network structure defines how they communicate each kind of arrangement of the network nodes has its own advantages and disadvantages here we tell you about the same. Dependencies and network diagram the network diagram is a schematic representation showing the sequence and relationship/ dependency of the tasks along with their duration all the tasks, except the first and the last, are linked with at least one predecessor and successor to have a proper sequence of work.
A network topology refers to the way in which nodes in a network are connected to one another the network structure defines how they communicate each kind of arrangement of the network nodes has its own advantages and disadvantages. Hierarchical network design provides efficient, fast and logical traffic forwarding patterns for enterprise network topologies while minimizing the cost of connecting multiple devices at network endpoints. Network diagrams project management 2 introduction to network diagrams • a network diagram is a flow chart of all tasks which make up a project • the chart demonstrates how each task relates to another • provides a logical flow of events • commonly used • network diagrams are made up of a collection of task dependencies known as.
Best answer: the network diagram shows the logical sequence of tasks ie the dependencies between the tasks it doesn't reflect timing directly, (two boxes one above the other may or may not be executed at the same time) although dates can be included in each box of the network. Pros and cons of network diagrams in this article, we will be looking at the advantages and disadvantages of this form of analysis within operations management network diagrams are used to show how a large project or task can be broken down into a logical series of sub tasks. System mapping, netmap, network diagram, network analysis, network mapping a network diagram is made up of a set of nodes and lines that connect those nodes usually a product of social network analysis, a network diagram is the visual display of how people (or other elements) in a network are connected.
Project network diagrams a project network illustrates the relationships between activities / tasks in the project showing the activities as nodes or on arrows between event nodes are two main ways to draw those relationships activity on arrow advantages. Network diagram the host a (1721610100) on subnet a needs to send packets to host d (1721620200) on subnet b as shown in the diagram, host a has a /16 subnet mask what this means is that host a believes that it is directly connected to all of network 1721600 but using arp for everything has disadvantages these are some of the. The qualitative approaches will not measure the social network structure as the quantitative approaches can (extent or size of social capital eg), but qualitative approaches could eg applied.
2018. | http://rxassignmenteckg.icecondoassignments.info/the-disadvantage-of-network-diagram.html |
In the 16th century, Dutch Renaissance artist Pieter Bruegel the Elder painted a village scene filled with people doing nonsensical things. They are each illustrating an old Dutch saying, adage, or proverb. The painting has been called The Blue Cloak or The Folly of the World, but its actual title is Netherlandish Proverbs. It's slightly reminiscent of Hieronymus Bosch's Garden of Earthly Delights, but much less creepy.
The precise number of proverbs that Netherlandish Proverbs contains is somewhat uncertain because modern scholarly interpretations vary, and in some case, more than one proverb might be assigned to the same component in the painting. Critics have identified approximately 112 identifiable proverbs and idioms in the scene, although Bruegel may have included others which cannot be determined because they have either disappeared from usage or the language had changed.
Bruegel has hidden his proverbs in the characters as well as in the buildings and in the landscape in highly imaginative ways. At the center of the painting is a woman placing a blue cloak (hence the painting’s original title) over her husband, indicating that she is cuckolding him. The man biting into the wooden pillar is a hypocrite. The man who’s filling a pond after his calf drowned is one who takes action after a disaster. The person who spills his porridge, will never be able to spoon it all back into the bowl. The two men defecating out of the same hole indicates they are inseparable companions. | https://www.neatorama.com/2018/01/21/Netherlandish-Proverbs/ |
The show must go on.
Johnny Depp took the stage with his band the Hollywood Vampires in Denmark on Wednesday, amid domestic violence allegations made by his estranged wife Amber Heard.
The actor looked relaxed as he performed alongside fellow band members Alice Cooper and Joe Perry on the fourth stop on their European tour.
One concertgoer gushed about the performance, telling PEOPLE the crowd went crazy for Depp.
“Johnny seemed okay. I heard some women in the crowd saying that he looked a little sad at the beginning of the show but I think that is just how he is. He looked happy,” one concertgoer told PEOPLE. “When he opened his mouth the women in the crowd started screaming and cried out for him – and he just smiled.”
Fans swiftly took to social media, posting numerous snaps of the actor rocking out on stage at the venue in Horsens, which once served as a state penitentiary.
“Look where I am,” one user wrote alongside a shot of Depp onstage.
Another fan praised Depp for his impressive guitar playing skills.
“I almost like him more playing guitar then when he’s acting,” they wrote.
The performance comes as new photos and more shocking details about his marriage to Heard continue to unfold.
Heard was granted a temporary restraining order against Depp on May 27. In the court filing, the actress claims Depp was abusive to her throughout their relationship.
For much more about Depp and Amber’s toxic marriage and explosive divorce, pick up the new issue of PEOPLE, on newsstands Friday
New photos published in this week’s PEOPLE cover story show Heard with facial injuries that allegedly resulted from a December 2015 altercation with Depp that she cited in her court filing. | https://people.com/movies/johnny-depp-performs-in-denmark-with-band-amid-abuse-allegations/ |
The utility model discloses a surfboard tail fin fixing structure convenient to disassemble and assemble, which comprises a surfboard, a groove is formed in the surfboard, fixing grooves are symmetrically formed in the groove, the surfboard is connected with a tail fin, a cavity is formed in the tail fin, a limiting groove is formed in the top of the tail fin, the limiting groove is communicated with the cavity, and the fixing grooves are communicated with the cavity. Fixing blocks are symmetrically welded and fixed to the two sides of the limiting groove, the tail fin is fixed into the groove, the fixing blocks correspond to the fixing grooves, the surfboard and the tail fin are jointly connected with a fixing device, and a push-out device is fixedly connected into the tail fin. The tail fin is fixed by embedding the triangular block into the limiting groove and embedding the fixing block into the fixing groove, the rotating shaft is rotated by rotating the first knob, and the left-hand thread and the right-hand thread are rotated, so that the straight rods are driven to move oppositely, the push block is driven to move, and the triangular block is pushed back. Therefore, fixation of the tail fin is relieved. | |
- relate the meaning to prior knowledge to comprehend the text.
We started to build Anna’s reading comprehension skills by focusing on very simple texts (e.g., simple 2-3 word sentences). As she developed competence, we gradually increased the length and complexity of the written texts.
We started by working on simple factual understanding of the text. Later we introduced more complex inferences.
From prior instruction, we knew that Anna could read each word in a simple sentence and derive its meaning. However, we wanted to make sure that she was combining the words in each sentence as she read to derive the meaning of the full sentence.
Goal for Basic Factual Reading Comprehension
Initially we worked with Anna to build her basic factual understanding of simple texts that she read. Her goal was:
Anna will decode or recognize by sight each written word in a sentence in sequence, access the meanings of the words, process them together to derive the meaning of the sentence, and then select a picture that represents the target sentence from a field of 4 options with at least 80% accuracy over at least 2 consecutive sessions.
Teaching Basic Comprehension Skills
In this task, the instructor first presented Anna with 4 pictures as possible response options. She then presented a short written sentence to Anna. Anna had to decode or recognize by sight each of the words in sequence and then combine the words to determine the meaning of the entire sentence. Anna then responded by selecting the picture that represented the meaning of the written sentence from the array of pictures.
Since Anna was still developing language skills related to syntax or sentence structure, we started with short simple sentences (e.g., mom naps; dad runs). We only included words that Anna was able to recognize by sight or decode.
We wanted to make sure that Anna was reading each of the words, retrieving their meanings, and then combining the words according to the sentence structure to understand the meaning of the sentence. So we carefully selected the pictures that we provided as response options for each target sentence. For example, if the target sentence was “Max naps”, we included one picture of her friend Max napping (the correct response since it represented the meaning of the target sentence). We also provided response options that changed only one part of the sentence: For example, we included a picture of “Mom naps” which just changed the person in the sentence and we included a picture of “Max hops” which just changed the verb in the sentence. In order to respond correctly, Anna had to read both words in the sentence and combine them to derive the correct meaning.
As with all of the other instructional activities, we always varied the location of the correct response in the array of choices. After each instructional session, we conducted an error analysis to determine areas of difficulty for Anna. We looked for patterns in the data. Was she guessing based on the first word in the sentence? Or was she relying on the last word in the sentence suggesting she might be having difficulty holding all the words in her working memory? Or was she always selecting the picture in the same location suggesting that she did not understand the task?
In this video, you will see Anna during instruction in basic factual comprehension. She has a book with 10 sentences and photos about her family and friends; there is a new sentence and photo on each page. Each of the photos is initially covered with a post-it note. First the instructor reviews the photos that are possible response options for Anna (i.e., photos of “Max naps”, “Max hops”, and “Mom naps”). The instructor then shows Anna the written sentence and helps her point to each of the words in sequence; Anna says each word as she points to it. Then she has to retrieve the meaning of each word and combine them to derive the meaning of the sentence. Once she knows the meaning of the sentence, she points to the photo that represents the sentence. Then she uncovers the photo in the book and checks to see if she is correct.
As soon as Anna demonstrated competence reading a simple sentence and matching it to a photo representing the sentence, we then introduced her to simple reading comprehension questions. Initially, we focused on answering simple factual questions (e.g., Who is running?, What is Mickey doing?, What did Mickey give Minnie?).
In this video, you will see Anna reading a simple story about Mickey Mouse and Minnie Mouse and answering simple factual questions about the story. First she reads the page in the book out loud (“Mickey gives Minnie a kiss”) and then she responds to the question, “What did Mickey give Minnie?” She says the answer out loud and also uses letter cards to write it out (i.e., “kiss”).
As you saw in this video, initially we asked a question at the end of every page to minimize the working memory demands on Anna. Later, we encouraged Anna to read several pages, recall the content, and then answer simple factual comprehension questions.
We taught her to use a simple summarization strategy to support her reading comprehension. After she read each paragraph, she answered the questions: Who is it about? What happened?
Once Anna demonstrated competence with factual questions about the story, we introduced questions that required her to make inferences from the text: What will happen next? How does Mickey feel? Why is Mickey happy? Remember that we regularly worked on these types of questions with Anna when we read books to her and talked about the books. At this point, she was learning to transfer her comprehension skills to reading comprehension.
For more information on teaching reading comprehension skills to children with complex communication needs like Anna, visit our website on Literacy Instruction. | https://aac-learning-center.psu.edu/literacy-for-learner-with-asd-parent/putting-it-all-together-building-reading-comprehension/ |
Since we last wrote, the Coalition for Small Business Tax Fairness has doubled in size and now represents more than 70 business associations. Together, our organizations represent hundreds of thousands of independent businesses, professionals and taxpayers across all sectors of the economy and all regions of the country that employ millions of Canadians. Minister, we are renewing our call for your government to set aside these changes in favour of a comprehensive review of Canadian tax policy.
We have been following your government’s public comments on the proposed changes closely. We are alarmed by the significant gap between the government’s statements on the expected effects of the proposals and the analyses by Canadian tax practitioners. This requires immediate clarification.
Your government has stated that it is concerned with the growing number of Canadian Controlled Private Corporations (CCPCs) and the goal of the tax changes is to ensure business owners pay the same rates as other Canadians in pursuit of tax fairness. You have also suggested that your proposals would not affect business owners with incomes under $150,000.
1. Business owners at all levels of income will be potentially affected by at least one of the three measures in this package of changes, including those earning well below $150,000.
2. Many – if not most – business owners will face a higher overall tax burden in the future if these proposals proceed.
Changes to income sprinkling have the potential to affect all incorporated taxpayers that have family members as shareholders who contribute to the business, regardless of income. In fact, this could remove the benefit of sharing business income from taxpayers earning $50,000, not just those above $150,000.
The additional paperwork associated with the “reasonableness test” will also bring added costs and complexity for many business owners who will struggle to cope with compliance requirements due to the ambiguity created by the new rules and fear of being unfairly penalized by CRA. We worry that your government is not fully aware of many formal and informal ways family members in businesses play critical roles in contributing to the success of the business and believe there will be many unintended consequences of your proposed changes on all business owners, including those in the middle class.
- Under the current corporate tax regime in almost all provinces, business earnings inside a corporation are actually under-integrated. This means the business owner will pay more tax on business income earned inside a corporation (and distributed as a dividend to the owner) as compared to the same earnings in an individual’s hands.
- Many business that are financed have debt arrangements that require a fixed amount of retained earnings to be left in the corporation, or limit the amount that can be distributed to the shareholders.
- Many businesses incur losses in their start up years that the shareholder cannot use to offset personal income.
- Successful businesses (particularly in the high-tech sector) use retained profits in the corporation to invest in other start-ups (angel funding). Such investments carry a high level of risk and punitive levels of taxation will reduce an important source of financing for new firms.
While we recognize you have not put forward draft legislation on passive income rules, tax practitioners agree that the current proposals could result in a combined corporate and personal tax burden for an Ontario business owner of as much as 73% on corporately-earned investment income and 59% on corporately-realized capital gains (assuming a business owner is paying the highest marginal rate of taxation). This is far more than what an employee with a similar level of investment income would pay. Regardless of the level of income however, the consensus is that the proposed tax changes would result in higher combined corporate and personal taxes for business owners across the board, and would therefore no longer be aligned with the key tax principle of integration.
Furthermore, your government seems to be asserting that middle-class business owners could use other retirement vehicles such as RRSPs and TFSAs if they want to save for retirement. While many do use these vehicles, a large number of business owners require the flexibility of retaining passive investments in the business to ensure they can quickly access money for the business itself since current RRSP rules do not allow for business reinvestment. While government may reap a short-term benefit by encouraging business owners to withdraw any money available for investments from the business, this will have long-term negative consequences as businesses are left cash strapped in challenging times or when an opportunity for growth or expansion occurs.
It is our understanding based on analysis done by many tax professionals in Canada, that the tax changes on capital gains will have a material impact on intergenerational transfers of business, again regardless of income level. There is fear that long-standing family businesses may be forced to sell the business to non-family members in order to decrease the ultimate tax bill on transition, whether on the retirement of the current business owner or on death. For example, the tax bill for an intergenerational transfer that results from the death of the owner will effectively increase by as much as 70% from what it was before July 18, 2017. Depending on province or territory, the former capital gains rate on death of about 24-27% will increase to an effective dividend rate between 40-46%. And this increased tax cost can apply as a result of a death that occurred before July 18, 2017 contradicting the statement that none of the proposals are retroactive.
The proposed tax changes may limit women from benefitting from entrepreneurship. As two-thirds of Canadian incorporated businesses are majority owned by men, the restrictions on sharing income with a spouse are likely to remove a disproportionately higher number of women from benefiting from business ownership. In addition, while entrepreneurs do have optional access to limited Employment Insurance benefits during maternity or parental leaves, female led businesses can currently use passive income investments to ensure their business remains open during a maternity leave, protecting the income of both the business owner and the employees. We believe strongly that the proposed changes on income sprinkling and passive income would fail a gender-based analysis.
Minister, the Coalition urges you to review carefully the dozens of analyses of your proposed changes by tax professionals across the country. While we are aware of a few academic papers supporting your changes, tax practitioners are united in the view that these changes have the potential to affect business taxpayers at all levels of income and increase their rates of taxation to levels higher than that of other taxpayers. To assist your efforts, we have listed five reports supporting our concerns and would be pleased to provide others to your staff.
Report 2: Moodys Gartner Tax Law - Proposed Tax Changes: What Do They Mean To You?
Report 5: Goldberg, Killoran and Goodis – Is a 93% tax rate fair to Canadian small business owners?
We would like to reiterate our offer that should there be worrisome abuses of the current tax system, we stand ready to work with the federal government to pursue ways to tighten the rules. The current proposals are not the solution and are creating unnecessary uncertainty for business owners. While we appreciate your public statements indicating an openness to "tweaking" the proposals, we feel the significance of these proposals requires far more than a few tweaks.
- Take these proposals off the table.
- Launch meaningful consultations with the business community to address any shortcomings in tax policy without unfairly targeting independent businesses.
- Consider a comprehensive review of the Canadian tax system with a view toward fairness and simplification for all taxpayers, which was recommended by the Standing Committee on Finance in their report dated December 2016.
Please do not hesitate to reach out to any of the undersigned groups and sectoral associations should you have any questions or comments about the contents of this letter. We remain committed to working with you. | https://family-enterprise-xchange.com/article/4165-coalition-for-small-business-tax-fairness-second-letter-to-bill-morneau |
The thought of relapse can be scary for a person recovering from addiction, as well as for their loved ones.
But for many people, relapse is part of the recovery process.
It’s crucial to realize that relapse does not mean that treatment has failed! It simply means the treatment plan needs to be readjusted.
Remember, drugs and alcohol have actual physical effects on the brain as well as the body. Research that’s supported by the National Institute on Drug Abuse and many other organizations affirms this. Any chronic condition that’s being managed—diabetes, arthritis, multiple sclerosis—can “flare up” from time to time. Maybe the medication stops working, or maybe the disease progresses and more aggressive care is needed.
Relapse isn't the patient's fault.
There are many reasons a person in recovery might start using drugs or alcohol again, but the actual use is usually related to a trigger. While detoxification begins the process of detoxifying your system from the effects of drugs and alcohol, it doesn’t reverse the changes in the brain that have been caused by drugs or alcohol.3 As a result, the recovering brain will always be more susceptible to a craving activating a compulsion to use. That’s why long-term treatment is important for long-term recovery.
There are both environmental and mental triggers that may cause a person to relapse. Physical triggers include places where someone used drugs or alcohol, the people with whom someone associated at the time of the usage, objects (like a pipe), or even a song or movie.4 Mental triggers may include being exposed to one of the stresses that caused a person to turn to drugs or alcohol, such as a grueling job or a bad relationship.5 They can also be related to traumas including physical or sexual abuse.6 Of course, every person in recovery is different, and personal triggers vary widely.
If you feel yourself slipping back into addiction, or you’re worried about someone you love, don’t be afraid to get help. Call your doctor to discuss "ramping up" your treatment plan temporarily, or join a peer support group and share your concerns. There’s no shame in needing to adjust your treatment plan, or in being proactive and taking early action to prevent relapse. Ask for the help you need to stay on track.
An estimated 60% of people recovering from addiction will deal with some kind of relapse, according to the National Institute on Drug Abuse (NIDA).11 And if it happens, additional treatment or plan adjustments may be needed. So what should you do in the event of a relapse?
As soon as possible, call your doctor to discuss the relapse and form a new recovery plan. Depending upon the severity and the duration of the relapse, a detoxification may be necessary. The doctor may recommend a new type of therapy or peer support group, or medication to help with recovery.
No matter what, remember: Do not lose hope.
Relapse does not mean you or your loved one has lost all the ground gained while in recovery. Someone who's relapsed is still in a better place than they were when they first sought treatment. Even after relapse, you still have the recovery techniques, tools, and information you'll need to get back on track. You can identify the specific trigger that caused you to resume your addictive behaviors and you can work with a therapist to treat any issues that might be contributing. You may also realize that you need more support, either from friends or family or from others in recovery.
Even if you have relapsed, that does not mean your recovery journey is over. Adjust your treatment plan, resume your recovery, and keep moving forward on the path toward a healthy and happy life. | https://www.shatterproof.org/recovery/The-Reality-of-Relapse |
Non-GAAP basic and diluted operating income (loss) per common share (1)
$
0.48
$
(0.52
)
Basic and diluted weighted average common shares outstanding
87.0
86.9
As of June 30,
As of December 31,
2019
2018
Adjusted Book Value (1)
$
684.0
$
587.8
Common shares outstanding at end of period
87.1
87.0
Adjusted Book Value per common share (1)
$
7.86
$
6.76
(1) Non-GAAP operating income (loss) and adjusted book value are Non-GAAP financial measures that exclude (or include) amounts that are included in (or excluded from) total Syncora Holdings Ltd. net income (loss) and common shareholders' equity, respectively, which are presented in accordance with GAAP. See below for reconciliations between GAAP and Non-GAAP financial measures.
(2) For purposes of our loss per share calculation, $(73.0) million is included for 2019, which is related to the accounting effect for the purchases of the Series B perpetual non-cumulative preference shares.
Financial Results
Consolidated Statements of Operations
Net premiums earned were $1.8 million for the six months ended June 30, 2019, as compared to $23.1 million for the six months ended June 30, 2018. The decrease was primarily due to premiums ceded under the reinsurance agreement with Assured Guaranty Corp., as well as $13.8 million of premium accelerations in 2018, as compared to none in 2019.
Net investment income decreased by $4.5 million from $21.4 million for the six months ended June 30, 2018 to $16.9 million for the six months ended June 30, 2019. The decrease was primarily due to lower invested assets as a result of the surplus note payments made during 2018 and from the purchases of Twin Reef Preferred Securities in 2019, as well as lower income on remediation bonds in 2019 as compared to the prior period.
Net unrealized and realized gains on investments increased by $4.0 million to $7.5 million for the six months ended June 30, 2019 from $3.5 million for the six months ended June 30, 2018. The change was primarily due to unrealized gains in our equities portfolio.
Net loss on insurance cash flow certificates was $24.9 million for the six months ended June 30, 2019, as compared to earnings of $30.1 million for the six months ended June 30, 2018. The decrease was due to lower expected losses on remediated policies. The prior period benefit was a result of a reduction to reimbursements owed to third party UCF holders upon the receipt of cash from the GreenPoint litigation settlement.
Net loss on credit default and other swap contracts was $0.8 million for the six months ended June 30, 2019, as compared to $24.7 million for the six months ended June 30, 2018. The decrease was primarily due to the cession of most credit default and other swap contracts under the reinsurance agreement with Assured Guaranty Corp.
Other income and fees were $3.0 million for the six months ended June 30, 2019, as compared to $14.3 million for the same period last year. The prior period included income from the sale of a real estate development option.
Net recoveries and loss adjustment expenses were $109.4 million for the six months ended June 30, 2019, as compared to losses of $14.6 million for the six months ended June 30, 2018. The favorable change was primarily due to public finance and RMBS positive developments.
Loss on debt prepayment was $41.7 million for the six months ended June 30, 2019, as compared to $91.4 million for the same period last year, as a result of the payments made on the long-term notes which had not yet been fully accreted to par. On April 30, 2019, Syncora Guarantee Inc. made a net payment of $169.9 million on its long-term and short-term notes.
Operating expenses were $25.8 million for the six months ended June 30, 2019, as compared to $28.5 million for the same period last year. The decrease was primarily due to headcount reductions and includes one-time board of director incentive plan payments.
Consolidated Balance Sheets
Total assets decreased by $243.3 million from $1,690.4 million as of December 31, 2018 to $1,447.1 million as of June 30, 2019 primarily as a result of the final surplus note payment and the purchase of $97.3 million of aggregate face amount of Pass-Through Trust Preferred Securities issued by the Twin Reefs Pass-Through Trust for $82.7 million.
Total liabilities decreased by $211.7 million from $1,040.9 million as of December 31, 2018 to $829.2 million as of June 30, 2019. The decrease was primarily due to lower unpaid losses as a result of public finance and RMBS positive developments as described above, as well as from the full paydown of the surplus note payable.
issued; 87,057,571 and 86,968,547 shares outstanding, 3,044,588 shares held as
treasury; $0.01 par value) and additional paid-in capital
2,718,343
2,717,633
Accumulated deficit
(2,121,238
)
(2,085,637
)
Accumulated other comprehensive income
15,163
1,828
Total Syncora Holdings Ltd. shareholders' equity
612,268
633,824
Total shareholders' equity
617,926
649,524
Total liabilities and shareholders' equity
$
1,447,089
$
1,690,382
Non-GAAP Financial Measures
This earnings release references Non-GAAP operating income (loss) and Adjusted Book Value, financial measures that are not calculated in accordance with GAAP. A Non-GAAP financial measure is a numerical measure of financial performance or financial position that excludes (or includes) amounts that are included in (or excluded from) the most directly comparable measure calculated and presented in accordance with GAAP. While the Company does not manage its business or measure its performance using Non-GAAP financial measures, we are presenting these Non-GAAP financial measures because they provide greater transparency and enhanced visibility into the underlying performance of our business and, with respect to Adjusted Book Value, the effect of certain items that the Company believes will reverse from GAAP book value over time. In addition, we have included these measures because we believe they provide investors with important additional information to compare the Company to other financial guarantors. Non-GAAP operating income (loss) and Adjusted Book Value as calculated do not consider timing or amounts, if any, dividend restrictions under New York Insurance Law applicable to the insurance subsidiaries and contractual constraints with respect to any dividend payment. Reference should be made to Note 13 in the most recently issued consolidated GAAP financial statements. In addition, because other financial guarantors may calculate Non-GAAP operating income (loss) and Adjusted Book Value or similarly titled measures differently, or may not be subject to the restrictions noted above, Non-GAAP operating income (loss) and Adjusted Book Value may not necessarily be comparable to similarly titled measures reported by other financial guarantors. Non-GAAP operating income (loss) and Adjusted Book Value are not substitutes for the most directly comparable GAAP measures, should not be viewed in isolation and may be subject to change.
The following table reconciles GAAP net income (loss) attributable to common shareholders of Syncora Holdings Ltd. to Non-GAAP operating income (loss) attributable to common shareholders of Syncora Holdings Ltd.:
Syncora Holdings Ltd.
Reconciliation of GAAP Net Income (Loss) to Non-GAAP Operating Income (Loss)
Elimination of non-credit impairment net realized and unrealized fair value (gains) and losses on credit derivatives in excess of the present value of the expected estimated economic credit losses, and non-economic payments. The fair value adjustments on derivative financial instruments are heavily influenced by, and fluctuate, in part according to, market interest rates, credit spreads and other factors that management cannot control or predict and that are not expected to result in an economic gain or loss. In addition, this adjustment presents all financial guaranty contracts on a more consistent basis of accounting, whether or not they are subject to derivative accounting rules.
(2)
Elimination of surplus note accretion as the full face amount of the surplus notes (including interest paid-in-kind) is included in the Adjusted Book Value calculation.
(3)
Elimination of realized gains (losses) on the Company's investments, except for gains and losses on investments for which the fair value option of accounting was elected and changes in net unrealized gains (losses) on equity securities. The timing of realized gains and losses, which depends largely on market credit cycles, can vary considerably across periods. The timing of sales is largely subject to the Company's discretion and influenced by market opportunities, as well as the Company's tax and capital profile.
(4)
Elimination of the results from discontinued operations related to American Roads LLC. On July 16, 2018, the Company closed the sale of American Roads LLC.
(5)
Elimination of the tax effects related to the above adjustments. SHI has a significant tax NOL that is offset by a full valuation allowance in the GAAP consolidated financial statements. As a result, for purposes of Non-GAAP measures, the Company utilizes a 0% effective tax rate until the expiration of these NOLs.
The following table reconciles GAAP common shareholders' equity to Adjusted Book Value:
Addition of the excess of the outstanding liquidation preference of the SGI Series B non-cumulative preferred shares over their carrying values. Including the SGI Series B non-cumulative preferred shares at their outstanding liquidation value instead of their carrying value is more in line with the residual value to common shareholders.
(2)
Elimination of pre-tax deferred acquisition costs as these amounts represent net deferred expenses that have already been paid and will be expensed in future accounting periods.
(3)
Elimination of the consolidated net credit derivative liability which represents an estimate of the fair value of the Company's guarantees issued as CDS contracts in excess of the present value of the expected losses. By excluding the net credit derivative liability, this metric eliminates the benefit to our shareholders' equity embedded therein from the Company's non-performance risk, which reflects the market's view of the risk that the Company will not be able to financially honor its obligations as they become due. The fair value adjustments on derivative financial instruments are heavily influenced by, and fluctuate, in part according to, market interest rates, credit spreads and other factors that management cannot control or predict and that are not expected to result in an economic gain or loss. In addition, by including our best estimate of losses we expect to incur on our CDS contracts if we were to hold such CDS contracts to maturity and pay claims as they arise over the remaining life of such contracts, the metric presents our guarantees of insurance and derivatives on a consistent basis, which results in a more meaningful measure of our value.
(4)
Addition of the pre-tax net present value of estimated net future credit derivative revenues. Including the net present value of estimated net future credit derivative revenues enables an evaluation of the value of future estimated credit derivative revenue for which there is no corresponding GAAP financial measure.
(5)
Addition of the pre-tax value of the unearned premium reserve on financial guaranty contracts in excess of expected losses to be expensed on an individual policy level, net of reinsurance as the unearned premium reserve on financial guaranty contracts represents revenues that are expected to be earned in the future.
(6)
Addition of the deferred gain on insurance cash flow certificates which represent the excess of amounts paid to directly or effectively defease or, in substance, commute the Company's exposure on certain of its financial guarantee insurance policies over the amount of future expected claim payments on those policies. As these remediation costs have already been paid, the effect of these deferred gains is deemed to be economic.
(7)
Elimination of the deferred loss on reinsurance which is amortized over the life of the underlying reinsured contracts and which represents the difference between amounts paid for the reinsurance and the amount of liabilities for policy benefits relating to those underlying reinsured contracts. The effect of this deferred loss is considered economic as the reinsurance premium has already been paid.
(8)
Addition to the full face amount, in excess of the carrying amount, of the surplus notes payable held by third parties (including interest paid-in-kind), as including the full face amount of the surplus notes is consistent with the treatment of these instruments as debt.
(9)
Elimination of the pre-tax unrealized gains on the Company's investments that are recorded as a component of accumulated other comprehensive income ("AOCI"), excluding the effects of foreign exchange. The effects of the AOCI component of the fair value adjustment on investments are not deemed economic until the Company sells such investments.
(10)
Elimination of the tax effects related to the above adjustments. SHI has a significant tax NOL that is offset by a full valuation allowance in the GAAP consolidated financial statements. As a result, for purposes of Non-GAAP measures, the Company utilizes a 0% effective tax rate until the expiration of these NOLs.
Conference Call Details
The Company plans to host a conference call at 8:30 a.m. on Thursday, August 15, 2019, to discuss its financial results for the six months ended June 30, 2019. The earnings call will be webcast via the Investor Events page of the Investor Relations section of the Company's website, or by dialing (877) 512-9165 (U.S. toll free), or (706) 679-5795 outside the U.S., Puerto Rico and Canada, approximately 10 minutes prior to the scheduled start time and providing conference ID# 5598246. Following conclusion of the call, the Company will post a transcript on its website alongside a replay of the webcast. The replay will also be available via telephone by dialing (855) 859-2056 (U.S. toll free), or (404) 537-3406 outside the U.S., Puerto Rico and Canada, and providing conference ID# 5598246.
Important Information
This press release contains statements about future results, plans and events that may constitute "forward-looking" statements within the meaning of the U.S. federal securities laws. The Company cautions you that the forward-looking information presented in this press release is not a guarantee of future events, and that actual events may differ materially from those made in or suggested by the forward-looking information contained in this press release. In addition, forward-looking statements generally can be identified by the use of forward-looking terminology such as "may," "plan," "seek," "comfortable with," "will," "expect," "intend," "estimate," "anticipate," "believe" or "continue" or the negative thereof or variations thereon or similar terminology. Forward-looking statements are subject to a number of risks and uncertainties, many of which are beyond the Company's control. These risks and uncertainties include, but are not limited to, the factors described in the Company's historical filings with the New York State Department of Financial Services, and in the Company's and Syncora Guarantee Inc.'s GAAP and statutory financial statements, as applicable, posted on its website at www.syncora.com. Readers are cautioned not to place undue reliance on forward-looking statements which speak only as of the date they are made. The Company does not undertake to update forward-looking statements to reflect the impact of circumstances or events that arise after the date the forward-looking statements are made.
Please note that once you make your selection, it will apply to all future visits to NASDAQ.com.
If, at any time, you are interested in reverting to our default settings, please select Default Setting above.
If you have any questions or encounter any issues in changing your default settings, please email [email protected].
CLOSEX
Please confirm your selection:
You have selected to change your default setting for the Quote Search. This will now be your default target page;
unless you change your configuration again, or you delete your
cookies. Are you sure you want to change your settings?
CLOSEX
Please disable your ad blocker (or update your settings to ensure that javascript and cookies are enabled), so that we can continue to provide you with the first-rate market news and data you've come to expect from us. | |
- Format:
- Hardback
- Related Formats:
- Paperback, Ebook(PDF), Ebook(EPUB)
- ISBN:
- 9781783097579
- Published:
- 29th Mar 2017
- Publisher:
- Multilingual Matters
- Number of pages:
- 120
- Dimensions:
- 210mm x 148mm
- Availability:
- Available
Have you ever been told that raising your child to speak multiple languages will harm their development? Are teachers or other professionals suspicious of your efforts? Are you sometimes unsure if you are helping your child's language development, or are you uncertain where to start? It is increasingly recognised among researchers that, far from harming a child's development, being exposed to multiple languages from birth or early childhood can result in linguistic, creative and social advantages. The authors, all multilinguals themselves, parents of multilingual children, and researchers on language and multilingualism, aim to provide advice and inspiration for multilingual families across the world. The latest research on multilingualism and the authors' own experiences are used to provide a friendly, accessible guide to raising and nurturing happy multilingual children.
The book is successful in clearly communicating the processes involved in multilingual acquisition to readers who might not have a prior knowledge. It is effectively organized in a way that leads readers to understand why it is important to acquire multiple languages, what to expect during this process, and how to assist children to successful acquisition. The cases of the children provide real-life examples to illustrate and simplify concepts such as code switching, cross-linguistic interference, transfer errors and language awareness, which might be foreign concepts to individuals without a background in the field of linguistics.
LINGUIST List 28.4124
This book is exactly what parents of multilingual children have been looking for: an inspiring, entertaining, and at the same time scientifically accurate account of what it means to raise children with more than two languages. The book is packed with facts, ideas, and advice for parents and it shows both the benefits and the challenges of early multilingualism.
Antonella Sorace, University of Edinburgh, UK
This is the first reader friendly book of advice on trilingual upbringing to appear, illustrated by three case studies from parents who have experienced the tactics that worked and some which backfired. The well-informed, knowledgeable authors provide an excellent balance between fascinating personal anecdotes and serious commentary which includes many tips, practical hints and some warnings on how to cope with the challenges involved.
Hugo Baetens Beardsmore, Vrije Universiteit Brussel and Université Libre de Bruxelles, Belgium
"Raising Multilingual Children" is a great mix of personal advice based on experience, as well as information based on academic research. With examples based on three different family situations, this book makes you realise that there is no "one fit solution" to multilingual parenting. Not all families are the same, therefore you can select and use the information which is relevant to yours.
"Raising Multilingual Children" It is an informative read for any family who are seeking to raise children with multiple languages.
Bilingual Kidspot blog
Julia Festman works at the Pedagogical University Tyrol, Austria. She is the mother of Aya (12) and Noam (8), and they speak German, English and some Hebrew.
Gregory J. Poarch works at the University of Münster, Germany. He is the father of Loïc (15) who speaks Dutch, English and German.
Jean-Marc Dewaele works at Birkbeck, University of London, UK. He is the father of Livia (20) who speaks English, Dutch, French, some Spanish and some martial art Japanese. | https://www.multilingual-matters.com/page/detail/?k=9781783097579 |
The meanings I have recorded in these pages emerged through readings, … This section of the ATA website contains my personal interpretations of the 78 Tarot cards.
Tarot Card Meanings – Trusted Tarot
Tarot Card Meanings. Today's Tarot deck has fixed upon the 78 card standard that was popular … The following Tarot card meanings are the interpretations I have …
List of Tarot Card Meanings – Tarot Meaning and…
List of Tarot Card Meanings "Will we get a list of Tarot card meanings?'. Is on of the first things my students ask w hen we are starting out looking at the Tarot cards. | http://www.psychic-catherine.com/2016/09/12/tarot-cards-and-meanings-list/ |
Since the establishment of this award in 1996, the Graham Foundation has awarded over $815,000 in recognition of promising doctoral students whose dissertations represent original and advanced scholarship in architecture with exciting potential to move the field in new directions. The applications are reviewed by a diverse panel of recognized scholars within architectural discourse. Two Carter Manny Awards are given each year, one for dissertation research and one for writing.
We are pleased to announce winner of the 2018 Carter Manny Award for writing and a $20,000 award is Kylie R. J. Seltzer, a PhD candidate at University of Pittsburgh's Department of History of Art and Architecture. Seltzer's dissertation, Housing Identities: Displaying Race and Environment in Paris, 1870–1892, analyzes the intersection of race and architecture through the subject of housing in nineteenth-century Paris.
For more information, visit http://grahamfoundation.org/. | https://www.haa.pitt.edu/news/kylie-rj-seltzter-winner-2018-carter-manny-award-writing |
This chapter applies to all Children Looked After. It should be read in conjunction with the government guidance documents and related chapters.
Note that different provisions apply to children who acquire Looked After status as a result of a remand to local authority accommodation or Youth Detention Accommodation. In relation to those children, please see Remands to Local Authority Accommodation or to Youth Detention Accommodation Procedure, Care Planning for Young People on Remand.
RELEVANT GUIDANCE
DfE, Promoting the Education of Looked After and Previously Looked After Children
DfE and DHSC, Special educational needs and disability code of practice 0 to 25 years- Statutory guidance for organisations who work with and support children and young people with special educational needs and disabilities (2015)
DfE, Supporting pupils at school with medical conditions – Statutory guidance, (2015)
RELATED CHAPTERS
The Personal Education Plan (PEP)
When a Child is Absent from School and School Exclusions
Celebrating a Child's Achievements
AMENDMENTThis chapter was reviewed in June 2020.
Carers can be the positive advocates for Children Looked After. They deal with the educational issues, problems and successes, on a day-to-day basis. They are the link to teachers, parents and other professionals.
- Introduce themselves to the class teacher or Head of Year and Designated Teacher;
- Ensure that the child attends school every day;
- Notify the school as early as possible during the first school day of absence;
- Supply the school with evidence of the child's illness;
- Accompany the child to and from school, according to the child's age and ability;
- Seek support from the child's social worker and Virtual School if problems occur;
- Maintain regular contact with the school and attend parents' evening and school functions e.g. school plays, sports day. If unable to do so, ensure alternative arrangements are put in place e.g. social worker attend, alternative date/time;
- Encourage the child to have aspirations in their life from the earliest stage.
- Ensure that the child has somewhere quiet to study and do homework;
- Encourage and support the child to do their homework and offer/seek help where appropriate;
- . Encourage all children to develop their own talents, interests and hobbies;
- . Ensure children are a member of the library;
- . Build a supply of books and read to or with the child as appropriate to their age;
- Encourage children to watch educational television programmes and videos/DVDs and go on outings to places of interest. Use everyday situations to promote learning;
- Encourage children to participate in school and after-school activities;
- Keep information on the child's educational circumstances and achievements;
- Check with the child how things are at school; discuss education on a routine/regular basis;
- Encourage children to do well educationally, consider an appropriate career and go into further or higher education;
- Act as an advocate on behalf of the child and intervene immediately if there is a problem with education;
- Liaise with social workers (and other relevant people e.g. Virtual School) in relation to educational issues;
- Celebrate success and reward the child when they do well;
- Contribute to The Personal Education Plan (PEP);
- To encourage children to engage with the Virtual School Team members to support and enhance their educational experience. | https://knowsleychildcare.proceduresonline.com/p_resp_fc.html |
- Katie Trowbridge
You Failed... Celebrate It!
Updated: Jan 4
You failed.
Those two words can cause embarrassment, anxiety, and even depression. Yet, these two words can also cause us to become more creative and confident.
Do you remember the first time you tried to ride a bike? Did someone run beside you as you furiously peddled, ready to catch you when you fell? And, you did fall. You probably fell several times. Skinned a knee...felt a little embarrassed...but you kept trying. What about that first piano lesson? Did you master Bach the first time you sat down in front of the keys? Of course, not. That is a ridiculous notion. Yet, many young people today are so afraid of failing that they refuse to even try, stunting their ability to be creative critical thinkers.
Psychologists have identified five reasons people fear failure:
Experiencing shame and embarrassment
Devaluing our self-worth
Having an uncertain future
Upsetting important others
Important others losing interest
Knowing that failure can be a frightening endeavor, it is vital that we simultaneously encourage failure and success. While this seems like a contradiction, the two work together. Therefore, how can we take away the negative stigma of failure so our kids learn to embrace it instead of fear it?
Much of the way we view failure comes from our mindset. Carol S. Dweck, Ph.D. wrote a book titled, Mindset, the New Psychology of Success. In a 2016 interview for The Atlantic, she spoke about embracing setbacks,
“When students had more of a growth mindset, they held the view that talents and abilities could be developed and that challenges were the way to do it. Learning something new, something hard, sticking to things—that’s how you get smarter. Setbacks and feedback weren’t about your abilities, they were information you could use to help yourself learn. With a growth mindset, kids don’t necessarily think that there’s no such thing as talent or that everyone is the same, but they believe everyone can develop their abilities through hard work, strategies, and lots of help and mentoring from others.”
Think of this...
Does your child see taking an upcoming test as a way to monitor how much they have learned or a way to compare themselves to their peers? With a growth mindset, facing challenges - like a grueling test - will be viewed as valuable feedback rather than something to fear. .
The question remains - how do we instill confidence and creativity through failure?
Model it
Give yourself permission to fail as a parent, educator, adult. Young people watch what we do. They learn from us.
If we embrace failure for what it can help us accomplish - then our youth will learn that failure is a normal and acceptable occurrence.
Let your kids see you try something new - make a challenging new recipe, create a piece of art, hike a difficult terrain. Give them a chance to see you fail and recover. | https://www.curiosity2create.org/post/you-failed-celebrate-it |
this forum made possible by our volunteer staff, including ...
master stewards:
Nicole Alderman
Anne Miller
Pearl Sutton
r ranson
Mike Haasl
James Freyr
stewards:
paul wheaton
Joylynn Hardesty
Burra Maluca
garden masters:
Steve Thorn
Greg Martin
gardeners:
Kate Downham
Jay Angler
thomas rubino
Forums:
food as medicine
berries
Elderberry elixer
Jack Collingsworth
Posts: 2
posted 3 weeks ago
2
This past summer I was able to finally get a decent crop of elderberries the
deer
and birds hadn't eaten and my wife and I were able to get six quarts of juice we used to make our elixer. I had read of the benefits of the berry and started to take a tablespoon each morning to start my day and thought nothing more about it. Now we are well into the cold/flu season and I work part time in retail with major interaction with the general public, as do all of my fellow salesmen. I noticed everyone I work with has had at least one major respiratory bout this season, but I've remained unscathed and symptom free. My instincts tell me it's the elixer...
rosemary schmidt
Posts: 52
5
posted 3 weeks ago
2
This is what I want Jack! I live outside of town on acreage, plenty of room for all the elderberry I can fit in! I wouldn't mind having a lot of different ways to use the
fruit
though. I suppose I'd better start out with a lot of netting so that at least I can get one good crop! How do you prepare your elixer?
Jack Collingsworth
Posts: 2
posted 3 weeks ago
3
We use a cup of the berries, three cups of
water
, a one inch (+/-) piece of fresh ginger, three or four cloves and a cinnamon stick. Simmer for twenty minutes or until the berries are soft. Remove from heat, strain through a wire colander crushing the berries to get all the juice possible. Discard the cinnamon stick, cloves and ginger, plus any berry residue (skins). While it's still warm, add a cup of
local
honey
and stir to dissolve. After this cools, we put it in quart canning jars with a lid and store in the refrigerator.
rosemary schmidt
Posts: 52
5
posted 2 weeks ago
Awesome Jack! TYVM
He's dead Jim. Grab his tricorder. I'll get his wallet and this tiny ad:
Exciting Updates to Dailyish Freebies!!!!
https://permies.com/t/135568/Exciting-Updates-Dailyish-Freebies
Post Reply
Bookmark Topic
Watch Topic
New Topic
Boost this thread!
Similar Threads
Three Ways to Use Elderberries & Elderflowers to Ward Off Sickness (Besides Elderberry Syrup)
Norovirus - personally tested a potential remedy for stomach flu!
my favourite ferments. What's yours?
What is your favourite herbal cold/flu remedy or preventative?
Hi John Moody, looking forward to your book!
2020 work trades for PDC, PTJ and/or SKIP
More... | https://permies.com/t/134644/kitchen/Elderberry-elixer |
MOVIE NEWS: BIRDMAN
BIRDMAN or The Unexpected Virtue of Ignorance is a black comedy that tells the story of an actor (Michael Keaton) – famous for portraying an iconic superhero – as he struggles to mount a Broadway play. In the days leading up to opening night, he battles his ego and attempts to recover his family, his career, and himself.
Birdman is an upcoming American comedy film directed by Alejandro González Iñárritu. The film stars Michael Keaton, Emma Stone, Edward Norton, Andrea Riseborough, Zach Galifianakis, Naomi Watts, and Amy Ryan. The film will be released on October 17, 2014.
Alejandro González Iñárritu is Mexican director, his most famous American film to date is 21 Grams staring Benicio del Toro, Naomi Watts and Sean Penn. | https://www.newstalkflorida.com/entertainment/michael-keaton-goes-crazy-birdman-trailer/ |
Every Monday evening in Minneapolis, there’s a drawing to select the names of those lucky individuals who will get a bed for the month. The numbers of shelter seekers, men and women, have been increasing in recent months. Currently, there are more than 100 homeless men showing up for the Monday lottery. Their odds are not good. Only about 10 to 15 will get a bed in one of the three church-based shelters. The lottery losers will be found sleeping in parks and like places, praying for good weather.
The lottery for homeless people is a reminder that housing assistance for those with little income is a question of luck. Only about one-quarter of those who qualify for housing assistance receive any support.
Across the Twin Cities, rents have been steadily increasing, and more and more people are finding themselves homeless or with rents that leave little money for food and other necessities. The number of Twin Cities families paying over half of their income for housing has more than doubled since 2000 (to 153,312, or nearly one in seven metro households). Many are elderly or disabled, and the uneven economic recovery has left increasing numbers of working people unable to cover the cost of housing.
The lack of affordable housing provides the context for Wednesday’s meeting of the Metropolitan Council. At this meeting, members will vote on three key amendments to the council’s new Housing Policy Plan. This plan creates a road map for an equitable approach to meeting our region’s affordable-housing needs. The council’s plan also guides municipalities that are required by state law to include a housing element in their comprehensive plans, explaining how each will meet its share of affordable housing.
These amendments will not improve the lottery odds overnight, but they will establish a new level of public commitment to addressing the demand for affordable housing over the next decade. The council should adopt these amendments to expand housing choice for everyone across the Twin Cities region.
One amendment before the council specifies for each municipality the number of new affordable units, by income level, that represent a fair share of the region’s projected demand (37,900 units) by the year 2030. Community amounts are based on forecast household growth, but increase should a community have relatively low numbers of existing affordable units or large numbers of low-wage jobs. Under this distribution formula, Bloomington, for example, has a need for about 50 new affordable-housing units per year, with half being affordable to households with annual incomes under $26,000.
The Housing Policy Plan also lays out how the council will review an individual community’s housing element as well as help implement the housing goals of its comprehensive plan. In its review role, the council will comment on whether a community is fulfilling its statutory responsibility to identify land at needed densities for affordable housing, and identify programs or policy actions that could be employed to help every community meet their affordable-housing goals.
The third major amendment provides the factors used to determine a community’s Housing Performance Score. This score awards extra points to cities for producing and preserving affordable housing and for adopting housing-related community initiatives, such as creating a rental licensing system or administering a housing rehab program. The score will be used by the council to prioritize communities applying to it for resources such as those to recover polluted land or enhance livability of downtown areas.
While some local governments have raised concerns about the formula for assigning need, we believe the Housing Policy Plan is consistent with state statute and takes a reasonable approach to fairly allocating the region’s demand for affordable housing. Some have suggested that the plan creates expectations beyond available resources, and while that is a valid concern, the council is only calculating the housing need and encouraging communities to do what they can, not requiring any specific expenditure of local funds. Increased state and federal funding is also needed, as are private-sector jobs at pay levels that minimize the need for public assistance.
Adoption of the amendments to the Housing Policy Plan is just one step to expanding housing affordability across the metro region, but it is an important step in supporting municipal plans and policies that offer housing opportunities to families at the full range of incomes found in our region.
Gail Dorfman is executive director of St. Stephen’s Human Services and is a member of the Metropolitan Council. Chip Halbach is executive director of the Minnesota Housing Partnership. | https://www.startribune.com/finding-shelter-in-the-twin-cities-shouldn-t-be-a-matter-of-luck/312279361/ |
# National Socialist Working Association
The National Socialist Working Association, sometimes translated as the National Socialist Working Community (German: Nazionale Sozialiste Arbeitsgemeinschaft) was a short-lived group of about a dozen Nazi Party Gauleiter brought together under the leadership of Gregor Strasser in September 1925. Its full name was the Arbeitsgemeinschaft der nord- und westdeutschen Gaue der NSDAP (Working Association of the North and West German Gaue of the NSDAP). Aligned with the more "socialist" wing of the Party, it unsuccessfully sought to steer the Party leadership in that direction by updating the Party program of 1920. Perceived as a threat to his leadership by Party Chairman Adolf Hitler, its activities were curtailed shortly after the Bamberg Conference of 14 February 1926 presided over by him, and it was formally dissolved on 1 October of that year.
## Background
After the failed Beer Hall Putsch of November 1923, the Nazi Party was outlawed and Adolf Hitler, being found guilty of treason, was jailed in Landsberg prison. After his release in December 1924, Hitler re-founded the Party on 27 February 1925 in Munich. At that time, it largely was centered in the state of Bavaria in southern Germany. Hitler realized that if his movement were to become the national force that he envisioned, it would have to expand into the rest of the country, in particular, into both Prussia and Berlin, the national capital. Banned from public speaking in most of Germany, on 11 March 1925 Hitler charged Gregor Strasser, then the Gauleiter of Niederbayern (Lower Bavaria), with setting up Party organizations throughout northern Germany. As a Reichstag Deputy, Strasser possessed two advantages: first, he had a parliamentary rail pass and could travel throughout the country while incurring no cost to the Party and, secondly, he enjoyed parliamentary immunity and could not be banned from speaking or sued for slander during his speechmaking. An effective public speaker and a skilled organizer, he traveled widely throughout Germany delivering speeches and establishing local Party organizations. He often personally selected the local (Ortsgruppenleiter) and regional (Gauleiter) Party administrators, subject to Hitler’s approval. The rapid development of the party structure in northern Germany in the following months was mainly the work of Strasser. Many of the local organizations in the north had to be created from scratch, and by the end of 1925 they numbered 262, as opposed to only 71 at the time of the 1923 putsch.
## Formation
The Working Association was Strasser's attempt to consolidate the then still young and divergent Party organizations in northern and western Germany. The Gauleiter in these regions were more interested in appealing to the working class masses in the large industrial cities of northern Germany through a greater emphasis on social aims, than were the members of the Party leadership based in the more rural area of Bavaria. Consequently, their ideological approach was more attuned to the "socialist" or "anti-capitalist" element of National Socialism.
In addition, there were longstanding personal animosities between the northerners and many of the leaders of the Party in Bavaria. These dated from the time of the Party's dissolution when the two groups belonged to different Nazi front organizations. Strasser and northerners who had been in the National Socialist Freedom Movement had an intense hostility towards some Party leaders at the Munich headquarters who had belonged to the rival Greater German People's Community, in particular, Hermann Esser, Julius Streicher and Philipp Bouhler. The Working Association organizers sought to curb what they perceived as the growing power and influence of these Munich leaders whom they felt to be too bureaucratic and controlling.
Discussions about forming a consortium of sorts, at first referred to as a "Westblock," to counterbalance the Munich leadership began in Elberfeld on 20 August 1925 between Strasser, Joseph Goebbels, then the Business Manager (Geschäftsführer) of Gau Rhineland-North, and other northern Party leaders. Strasser then took the initiative to call a meeting at Hagen in Westphalia for 10 September 1925. Though Strasser himself was absent due to his mother's serious illness, the meeting took place as scheduled with around 25 northern leaders present. The attendees formally established the "Working Association of the North and West German Gaue of the NSDAP." Strasser was elected Director of the Working Association and Goebbels became the Business Manager. Elberfeld, the seat of Gau Rhineland-North, served as the organization's headquarters. A journalistic organ named the National Socialist Letters (Nationalsozialistischen Briefe, or NS-Briefe) was established, which appeared twice a month from 1 October 1925, and was published by Strasser and edited by Goebbels. Organizational statutes were adopted which were careful to state that the Working Association existed "with the express approval of Adolf Hitler."
Most of the actions taken at this first meeting were purely organizational in nature, such as arranging for the sharing of political and organizational resources, including propaganda materials and speakers, and working on coordinated joint political statements. The only policy decision taken was related to the question of electoral participation, and the representatives at Hagen unanimously agreed to reject participation in all elections, sending a letter to this effect to Hitler. This was aimed at pushing the Party toward obtaining power not by parliamentary means, but by mobilizing the urban masses into paralyzing the nation's economic and social systems through strikes, street terror and other activist tactics.
## Members
The Working Association was composed of eleven Gaue, nearly all representing sections of Prussia (with the exception of the Free City of Hamburg).
Other prominent Nazis who were part of the Working Association included Helmuth Brückner, Friedrich Hildebrandt, Heinrich Haake, Hanns Kerrl, Erich Koch, and Wilhelm Stich.
## Aims and actions
### Policy proposals
Following the Hagen meeting, the Working Association advocated consolidation of the Gaue in the Rhineland and Ruhr areas into one large Gau encompassing all of Germany's industrial heartland. In October, it issued a call for the dismissal of Esser, then the Party's Propaganda Leader.
The Working Association also urged support for a proposed referendum on the expropriation without compensation of the former royal and princely ruling houses of Germany. This was the same position taken by the two leading left-wing parties, the German Communist Party and the Social Democratic Party of Germany. This stance angered Hitler who feared that it would imperil the substantial financial support that he was deriving from many of the former nobles and from conservative business donors who favored his opposition to Communists, Socialists and trade unionists.
In foreign policy, many Working Association members, including Strasser, Goebbels, Kaufmann and Rust held "national-bolshevist" ideas then common to many young right-wing German intellectuals. They saw in the Soviet Union a successful socialist national state and some, including Rust, even advocated an alliance between Germany and the Soviet Union. They also admired the activism of the German Communist Party in attracting and mobilizing working class support. Of course, these views were incompatible with the anti-Communist and Lebensraum policies advocated by Hitler in Mein Kampf.
The National Socialist Program consisting of 25 points had been proclaimed by Hitler in February 1920. Strasser felt that it was due for an update and began working on revisions to it in November 1925. His draft program called for the nationalization of all land, which would then be leased out. All estates over 1,000 acres would be broken into smaller peasant holdings. Fifty-one percent of "vital" and forty-nine percent of "non-vital" industrial production would be publicly owned but management would remain in private hands. Politically, it called for strengthening the office of the Reich President while the Reichstag would be replaced by a corporatist "Chamber of Estates," representing occupational sectors and public institutions such as churches and universities. Germany's federal structure would be abolished and the President, elected to a seven-year term by the legislature, would appoint national and provincial executives and administrators. While proposing new ideas in the areas of the economy and government structure, it retained many of the nationalist, völkisch and anti-semitic underpinnings of the original program. It called for the restoration of Germany's 1914 borders and the return of its former colonies. In addition, it advocated the expulsion of those Jews who had entered Germany since 1 August 1914 and the revocation of citizenship from all others.
### Subsequent meetings
The second meeting of the Working Association took place in Hanover on 22 November 1925, where Strasser presented his draft document for consideration. The meeting did not result in the uniformly favorable response to the proposals that Strasser had hoped for, however. The Gauleiter, all being equals, jealously guarded their right to independent action, and there were genuine differences of opinion among them with regard to ideological issues. The members recommended that additional comments be submitted in writing and the draft would be reviewed at the next meeting in late January. Critiques which survive show that some attacked it as too radical from a socialist viewpoint and not radical enough in its völkisch aspects.
Strasser's failure to keep Hitler informed of developments was a tactical error, for the Munich leadership was becoming increasingly suspicious of the activities of the Working Association. Around Christmas, Gottfried Feder, a leading Party theoretician and a co-author of the 1920 Party program was given a copy of the draft program by a local Party official and he subsequently informed Hitler. When Strasser learned of this, he belatedly sent Hitler a copy on 8 January 1926 with the explanation that he was merely gathering views from colleagues for a possible revision.
The third meeting of the Working Association took place on 24 January 1926 at the Hanover home of Gauleiter Rust. It became contentious when Feder arrived as Hitler's representative. Goebbels demanded that he be ejected, shouting: "We don't want any stool pigeons!" However, a vote was taken and Feder was allowed to participate. On the issue of expropriation, the proposal was weakened to say only that, if the expropriation of the nobles were to pass, then the property of all Jews who had entered Germany since August 1914 should likewise be confiscated. The draft program was again vigorously debated and there was even less agreement than previously, with not only Feder but Haase, Ley and Pfeffer voicing concerns on various points. In the end, the Strasser draft was not approved and further work on a new proposal was delegated to a small group.
## The Bamberg Conference
Though not intended as a direct threat to Hitler's leadership, the circulation and discussion of a revised Party program would clearly set the precedent that regional leaders could participate in the formulation of major Party policy. Hitler felt this would embroil the Party in endless doctrinal disputes that would detract from the main goal of attaining power. Rather than the party line being defined by him as Führer, he instead would be bound by a program subject to interpretation and change by the Party membership. The issue at stake was whether the Party was to be guided by the Führerprinzip or whether authority was to be ultimately decided by the membership. Hitler perceived that if allowed to become an effective policy-setting organization, the Working Association might be able to mount a challenge to his supreme authority. In addition, Strasser's draft program also exposed the internal policy rifts in the Party. Hitler's response was swift, direct and forceful.
Hitler first met with Strasser in early February and secured his promise that the draft program would be withdrawn. He then called for a meeting of the Party leadership to be held in Bamberg in Upper Franconia on Sunday, 14 February 1925. Some sixty officials were invited, but the northern representatives were outnumbered by the southern attendees. Many of the prominent Working Association members did not attend: Kaufmann was not invited (ostensibly because Munich did not know he was a Gauleiter), Pfeffer chose to absent himself, Haase did not attend due to illness and his Deputy Gauleiter, Hermann Fobke, also elected not to attend.
There was no agenda and no debate. Hitler spoke for two hours and forcefully opposed the positions advocated by the Working Association. He denied that any change in the Party program was needed, and that to tamper with it would dishonor the memory of those "martyrs" who had fallen in the 1923 putsch. In particular, he denounced the position favoring expropriation of the royal and princely houses, famously declaring: "For us there are today no princes, only Germans." He also firmly ruled out any thought of alliance with Soviet Russia and reaffirmed his view that the future of Germany depended on obtaining additional Lebensraum in the east. Stunned by the forcefulness of Hitler's oration, Strasser spoke briefly and offered no defense or rebuttal. He was made to promise to retrieve all copies of the draft program that had been distributed, and he subsequently wrote to his membership on 5 March requesting that all copies be returned. Hitler had reasserted his authority as supreme Party leader and stamped out any potential threat from the Working Association, which was left an empty shell that soon faded into irrelevance.
Goebbels did not speak at all. He confided in his diary:
Short discussion. Strasser speaks. Hesitant, trembling, clumsy ... I cannot say a word! I am stunned! ... My heart aches! ... I want to cry! ... A horrible night! Probably one of my greatest disappointments. I can no longer wholly believe in Hitler. This is terrible. I have lost my inner support. I am only half myself.
## Aftermath and dissolution
### Personnel shifts
Hitler, however, was shrewd enough to appear generous in his victory, and moved to co-opt any further latent opposition. In order to divide the dissidents, he sought to tie them more closely to his Munich leadership. In April 1926, Hitler removed Esser as Propaganda Leader and Strasser was named Chairman for Organization and Propaganda, being formally created Party Reichspropagandaleiter on 16 September.
In addition, Hitler approved the proposed merger of Gau Rhineland-North and Gau Westphalia into Großgau Ruhr, which took place on 7 March 1926. The new entity was entrusted to a tripartite leadership of Goebbels, Kaufmann and Pfeffer. After a few months of this unwieldy arrangement, Kaufmann was made sole Gauleiter on 20 June, while Pfeffer was given responsibility for the Sturmabteilung (SA) in July, taking over as Supreme SA Leader on 1 November and serving until August 1930 when he resigned in a dispute with Hitler. Recognizing Goebbels' talents, Hitler began a campaign of lavishing attention on him. In the months following the Bamberg Conference, Hitler met with him several times and invited him to speak at important Party meetings, praising his performances and appearing jointly with him. He put his personal Mercedes at his disposal and even presented him with a bouquet of red roses on one occasion. At the end of August, Goebbels was offered the prestigious post of Gauleiter of the now expanded Gau Berlin-Brandenburg, which he accepted in late October 1926. The "charm offensive" worked, and Goebbels would remain one of Hitler's most loyal lieutenants until the end of the regime.
### Reinforcing centralized control
In addition to essentially decapitating the Working Association, Hitler set about tightening and centralizing his control over the Gaue. On 16 April 1926, a memorandum was issued to all Gauleiter insisting on pre-approval by Munich of all pamphlets issued by local Party organizations. Next, on 22 May 1926, Hitler convened a national membership meeting in Munich to consolidate his organizational hold over the Party. The meeting approved sweeping changes to the Party bylaws. These confirmed Hitler's leadership of the Party and declared the 25 points of the program of 1920 to be "immutable." Hitler, reelected as Chairman of the Party, was made superior to the executive committee and answerable only to the general meeting. He was given final discretion over the expulsion of Party members, and even local branches. To maintain Party discipline, he instituted the Uschla, an internal Investigation and Settlement Committee, whose chairman was named by him, along with the chairmen of other major Party committees. On 1 July 1926, new directives for Gaue and local branches were issued by Hitler which stated that "since the NSDAP represents a large study group, smaller study groups in the form of combinations of individual Gaue have no justification."
Next, a Party Congress was held in Weimar on 3-4 July 1926, its first since the putsch, where Führerprinzip was on full display. Hitler discouraged initiative from the membership and reserved to himself all final decisions on resolutions and proposals. He was adamant that no issues associated with the Working Association be advanced, rejecting outright a proposal to favor blue-collar workers for positions as Gauleiter, whenever possible. All final programmatic, administrative and organizational decision-making power resided solely in the person of Hitler. The Weimar Congress reinforced the Party's image as a unified and disciplined political organization.
The formal dissolution of the Working Association was announced by Strasser in the NS-Briefe of 1 October 1926. Finally, on 26 April 1927, the Völkischer Beobachter, the Party newspaper, declared that the NS-Briefe was not an official publication of the Nazi Party. Hitler would never again face a threat to his supreme leadership of the Party from the membership.
### Fate of individual members
Several members of the Working Association, including Haase, Klant, Schlange, Schultz and Vahlen, were removed from their Gauleiter positions within about a year of the organization's dissolution. Yet several other members, such as Hildebrandt, Kaufmann, Kerrl, Koch, Ley, Lohse, Rust and Telschow went on to have long careers in the Party and the government of Nazi Germany until the fall of the regime in May 1945. Most successful of all was Goebbels, who became Party Reichspropagandaleiter in April 1930 and Reichsminister of Propaganda in March 1933, following the Nazi seizure of power. He would retain these posts, as well as that of Gauleiter of Berlin, until his suicide on 1 May 1945, and even was named by Hitler in his final political testament as his successor as Reich Chancellor. As for Strasser, after serving as Party Reichspropagandaleiter, he became the Party Reichsorganisationsleiter in January 1930, responsible for all Party organization and personnel matters. After Hitler, he was widely considered to be the most powerful and influential member of the Party hierarchy during those years. However, he had a falling out with Hitler over policy and tactical differences, which led to his resignation in December 1932; thereafter, he played no important role in the Party. Hitler had him murdered by the SS in Gestapo headquarters in Berlin during the Night of the Long Knives on 30 June 1934. | https://en.wikipedia.org/wiki/National_Socialist_Working_Association |
In an article in Food research International, Vol 29, 325-330 (1996), the content of caffeine in various teas and styles of brew were compared.
One of the formosa oolongs had less caffeine than the green and black teas on a dry weight basis, but when all were prepared to supplied directions, they had similar caffeine levels. When brewed for a series of three repeated brews, the caffeine concentration was higher in the first brew for one of the other Formosa oolongs than other green, black, and oolong teas. The caffeine content decreased dramatically from the first to the third brew, about 50-70mg/cup in first cup, 15-25 in second, and 5-10 in third, each brew about 5 minutes in length.
Bag teas had slightly less caffeine than loose teas. This could be due to the use of broken and poorer quality leaves in bags.
Theobromine was also measured, which was very low: 1.5-3mg/cup for first brew, 0.5-1 in second, 0.2-0.5 in third. Black teas had slightly more theobromine, attributed to the fact that younger leaves have more theobromine, and the young leaves are chosen for black tea production due to higher polyphenol levels.
One other interesting result was that no (less than detection limit, 0.1mg/cup) theophylline was detected in any of the brews.
This paper challenges many of the popular assertions about the caffeine content of teas, in that:
1. All teas have roughly similar caffeine contents, and one cannot rely on the belief that green tea has less caffeine, as asserted by many popular claims. One such claim is that degree of fermentation governs caffeine content, with green having 1/3 and oolong having 2/3 the caffeine content of black tea. This has been debunked repeatedly. [See new information at the end of this section] Small differences in average caffeine contents of green vs black tea may be due to the use of China varietals for green and Assam varietals for black, a line which comes closer to elimination with Indian green teas and oolongs. Another is the use of younger or more mature leaves, where there is some variation. Caffeine is a product of the natural metabolism of RNA in the plant and thus will vary with senescence. Some caffeine may also be made during fermentation, but it is not a sufficiently orderly process to clearly delineate such even multiples as 1/3, 2/3, etc.[See new information at the end of this section] Fermentation time is decided by taste and plantation experience, not by biochemistry, and is not controlled to scientific tolerances.
2. Caffeine content does depend on brew technique and leaf size and variety, and that without an accurate analysis as such available from a qualified laboratory, one cannot assert that some teas have a lower or greater caffeine dose.
3. One popular assertion suggests that tea can be decaffeinated by brewing quickly and discarding the first brew. Since tea must be decaffeinated greater than 90% to be considered decaf (and most commercial decafs are >98% decaffeinated), the second brew, although lower in caffeine, is *not* decaffeinated (65-75% of caffeine coming out in the first five minute brew).
Making informed decisions about what is a suitable level of caffeine in one's diet is a personal decision, and although doses of less than 200mg/day of caffeine have generally not been associated with health risks, one should *always* consult with a doctor and *not* consider any of this (or other literature) to be advice on your personal health.
I urge all tea drinkers to be wary of advice on caffeine levels in tea, particularly results which say that green or oolong tea has less caffeine.
(February 11, 2000)
Caffeine varies in the fresh green leaf depending on fineness of pluck. The fourth leaf (Coarse) has about one third less than the first leaf (Very Fine Pluck). Caffeine varies with type -seedling tea (3-5%) has perhaps twice that of clonal tea (1-3%). As most green tea is seedling (i.e bushes derived from seeds) and much black tea is clonal (bushes derived from VP - vegetative propagation) this means that black teas have often, weight for weight, less caffeine. But also green teas are often liquored with less leaf.
Caffeine is also variable depending on season - some clones hit 5% in December, down to 2% in July, in Kenya. And on nitrogen fertiliser which can add a tenth to the normal caffeine level.
Incidentally caffeine level can be manipulated in the factory - withering temperature peak for caffeine is 25 deg C, ten degrees above and below this reduce caffeine by 0.2 to 0.3% ponts. Likewise withering time - longer wither gives more caffeine, straightline response up to 30 hours (not that anyone would normally wither more than 20 hours). However, length of ferment decreases caffeine, down from 3.2% at zero minutes to 2.8% after 90 minutes, | https://www.nobleharbor.com/tea/caffiene.html |
A few months ago I was hired into a management position at a company that’s working from home during the pandemic. It’s my first time managing a team remotely and I’m struggling with building rapport with my direct reports. I’ve tried one-on-one virtual coffee chats but it hasn’t really worked. I usually get to know my team with informal office chats and taking them out for lunch, but now I don’t have that option. What can I do to get to know my team remotely?
The First Answer
Yvonne Ruke Akpoveta, change management strategist and adviser, OliveBlue and the Change Leadership, Toronto
It’s possible that your predecessor could be affecting your team’s current dynamics. Perhaps they had a great relationship with their previous leader and may still feel loyalty toward them, which translates to coldness toward you. They may be apprehensive about what changes a new manager brings to the team and aren’t quite sure how to act or behave in a first meeting. Their previous manager could have created a very formal relationship with your team which has set the tone for how they interact with you. Be patient in getting to know them and understanding the team culture. Your team may also be taking their time to get to know you before opening up.
What didn’t work about your coffee chats? If they seemed shy or quiet, try asking general questions about their personal interests. If they responded with short, one-word answers, try asking open-ended questions. Be careful not to give solutions as you do not know them well enough.
Consider holding informal group virtual events, like online trivia, that help you observe the dynamics of the team, and how they interact with others. This can help you pick up on their sense of humour, style of communication and what makes them laugh or get excited.
Informal group events can also help you identify common grounds with your team, like personal interests outside work, where they live, favourite movies or hobbies. This will help you connect and authentically engage with them during your next one-on-one.
You could also ask a willing staff member to facilitate the next event. If it’s someone that the team is familiar with, and trusts, participants are less likely to have their guards up.
The Second Answer
Bruce Sandy, principal, Pathfinder Coaching, Vancouver
This is not an uncommon question and challenge for many managers and staff, especially extroverted ones, during this pandemic. You likely derive energy and more connection from meeting with staff or people in person. This is not true for everyone. There are many individuals who like and prefer to meet others remotely.
It will be important for you to shift your focus and your perspective on meeting staff remotely. If you continue to hold the perspective that getting to know staff remotely is difficult then this will likely become a self-fulfilling prophecy for you and your team.
Take a moment to write down your judgments, fears and concerns about working remotely. Once you are aware of your fears and concerns, you can choose what to do with them. Try not to feed them.
Instead, try to hold a neutral and curious perspective about working remotely. Focus on how working remotely is affecting your staff. Use working remotely as a way of discovering more about your team members, their views, hopes, concerns and thoughts. Ask what your staff values about their work and working as part of the team. Ask how the pandemic and working remotely is (or is not) affecting their work as individuals and as team members.
Be curious about how you as the new leader can work most effectively to support them as well as embodying the values of the organization. Indicate that you want to design a conscious, flexible and adaptive working relationship with them as individuals and team members that works both remotely and in person.
Have a question for our experts? Send an e-mail to [email protected]
Stay ahead in your career. We have a weekly Careers newsletter to give you guidance and tips on career management, leadership, business education and more. Sign up today. | https://www.theglobeandmail.com/business/careers/career-advice/article-how-can-i-get-to-know-my-work-team-remotely-during-the-covid-1/ |
---
abstract: |
In this note, we give a necessary and sufficient condition under which the comparison theorem holds for multidimensional stochastic differential equations (SDEs) with jumps and for matrix-valued SDEs with jumps.\
$\textit{Keywords: Vibility property; Viscosity solution; Comparison theorem.}$
author:
- Xuehong Zhu
date: 'June 7, 2010'
title: On the comparison theorem for multidimensional SDEs with jumps
---
Introduction {#sec:intro}
============
The comparison theorem for real-valued SDEs turns out to be one of the classic results of this theory. We can refer the reader to \[1\], \[2\], \[6\], \[7\] and so on. It allows to compare the solutions of two real-valued SDEs whenever we can compare the drift and the diffusion coefficients. Thus they are all sufficient conditions.
Until in \[4\], Peng and Zhu originally studied comparison theorem of 1-dimensional SDEs with jumps through the viability theory (see Peng and Zhu \[5\]) and got the necessary and sufficient condition. In the manuscirpt of \[3\], Hu and Peng studied the multidimensional situation without jumps applying the viability theory.
The objective of this paper is to give a necessary and sufficient condition under which the comparison theorem holds for multidimensional SDEs with jumps. For this, we still apply the stochastic viability property (SVP) for SDEs with jumps studied in \[5\] and combine the technique used in \[3\].
The paper is organized as follows: in the next section, we recall the viability criteria for SDEs with jumps; in section 3, we study the comparison theorem for multidimensional SDEs with jumps and for matrix-valued SDEs with jumps.
A characterization for SDEs with jumps under state constraint {#sec:intro}
=============================================================
Let $(\Omega,{\cal{F}},P,({\cal{F}}_{t})_{t\geq 0})$ be a complete stochastic basis such that $\mathcal{F}_{0}$ contains all $P$-null elements of ${\cal{F}}$, and $\mathcal{F}_{t^{+}}:=\cap_{\ep>0}\mathcal{F}_{t+\ep}=\mathcal{F}_{t},t\geq
0$, and $\mathcal{F}=\mathcal{F}_{T}$, and suppose that the filtration is generated by the following two mutually independent processes:\
(i) a $d$-dimensional standard Brownian motion $(W_{t})_{0\leq
t\leq T}$, and\
(ii) a stationary Poisson random measure $N$ on $(0,T]\times E$, where $E\subset R^{l}\setminus\{0\}$, $E$ is equipped with its Borel field ${\mathscr{B}}_{E}$, with compensator $\hat{N}(dtde)=dtn(de)$, such that $n(E)<\infty$, and $\{\tilde{N}((0,t]\times
A)=(N-\hat{N})((0,t]\times A)\}_{0<t\leq T}$ is an $\mathcal{F}_{t}$-martingale, for each $A\in \mathscr{B}_{E}$.
By $T>0$ we denote the finite real time horizon.
We consider a jump diffusion process as follows: $$X^{t,x}_{s}=x+\int^{s}_{t}b(r,X^{t,x}_{r})dr+\int^{s}_{t}\sigma(r,X^{t,x}_{r})dW_{r}\\
+\int^{s}_{t}\int_{E}\gamma(r,X^{t,x}_{r-},e)\tilde{N}(drde),s\in
[t,T], \eqno(2.1)$$ where $$\begin{array}{l}
b:[0,\infty)\times R^{m} \rightarrow R^{m},
\gamma:[0,\infty)\times R^{m} \times R^{l} \rightarrow R^{m},\\
\sigma=\{\sigma_{\alpha}^{i}\}:[0,\infty)\times R^{m} \rightarrow
R^{m\times d},i=1,2,...,m,\a=1,2,...,d.
\end{array}$$
[**Definition 2.1.**]{} The SDE (2.1) enjoys the stochastic viability property (SVP in short) in a given closed set $K\subset R^{m}$ if and only if: for any fixed time interval $[0,T]$, for each $(t,x)\in
[0,T]\times K$, there exists a probability space $(\Omega,{\cal{F}},P)$, a $d-$dimensional Brownian motion $W$, a stationary Poisson process $N$, such that $$X^{t,x}_{s}\in K ,\mbox{ \ } \forall \mbox{ \ }s \in [t,T] \mbox{ \
} \mbox{ \ }P-a.s..$$
We assume that, there exists a sufficiently large constant $\mu>0$ and a function $\rho: R^{l}\rightarrow R_{+}$ with $$\int_{E}\rho^{2}(e)n(de)<\infty,$$ such that
(A1)$b,\sigma,\gamma\mbox{ \ }\mbox{are continuous in}\mbox{ \ }
(t,x),$
(A2) for all $x,x'\in R^{m}$, $t\in [0,+\infty)$ $$\begin{array}{ll}
| b(t,x)-b(t,x')|+|\s(t,x)-\s(t,x')|\leq \mu|x-x'|,\\
|b(t,x)|+|\s(t,x)|\leq \mu(1+|x|),\\
|\g(t,x,e)-\g(t,x',e)|\leq \rho(e)|x-x'|,\forall e\in E,\\
|\g(t,x,e)|\leq \rho(e)(1+|x|),\forall e\in E.
\end{array}$$ Here $\langle\cdot\rangle$ and $|\cdot|$ denote, respectively, the Euclidian scalar product and norm. Obviously under the above assumptions there exists a unique strong solution to SDE (2.1). $C$ is a constant such that $$C\geq 1+2\mu+\mu^{2}+\int_{E}\rho^{2}(e)n(de).$$
We denote by $C_{2}([0,T]\times R^{m})$ (resp,. $C^{1,2}_{2}([0,T]\times R^{m})$) the set of all functions in $C([0,T]\times R^{m})$ (resp., $C^{1,2}([0,T]\times R^{m})$) with quadratic growth in $x$. In fact, the SVP in $K$ is related to the following PDE: $$\left\{
\begin{array}{l}
\mathscr{L}u(t,x)+\mathscr{B}u(t,x)-Cu(t,x)+d^{2}_{K}(x)=0,\mbox{ \
}(t,x)\in (0,T)\times R^{m},\\
u(T,x)=d^{2}_{K}(x),
\end{array}
\right. \eqno{(2.2)}$$ where we denote, for $\p\in C_{2}^{1,2}([0,T]\times R^{m})$ , $$\mathscr{L}\p(t,x):=\frac{\partial \p(t,x)}{\partial t}+\langle
D\p(t,x),b(t,x)\rangle +\frac{1}{2}tr[D^{2}\p(t,x)\s\s^{T}(t,x)],$$ $$\mathscr{B}\p(t,x):=\int_{E}[\p(t,x+\g(t,x,e))-\p(t,x)-\langle
D\p(t,x),\g(t,x,e)\rangle]n(de).$$
[**Definition 2.2.**]{} We say a function $u\in C_{2}([0,T]\times
R^{m})$ is a viscosity supersolution (resp., subsolution) of (2.2) if, $u(T,x)\geq d^{2}_{K}(x)$ (resp., $u(T,x)\leq d^{2}_{K}(x)$) and for any $\p\in C_{2}^{1,2}([0,T]\times R^{m})$ and any point $(t,x)\in [0,T]\times R^{m}$ at which $u-\p$ attains its minimum (resp., maximum), $$\mathscr{L}\p(t,x)+\mathscr{B}\p(t,x)-C\p(t,x)+d^{2}_{K}(x)\leq
0,\mbox{ \ (resp., }\geq 0).$$ u is called a viscosity solution if it is both viscosity supersolution and subsolution.
Now let us recall the characterization of SVP of SDE (2.1) in $K$ (see \[5\]):
[**Lemma 2.3.**]{}We assume (A1) and (A2). Then the following claims are equivalent:\
[(i)]{}SDE (2.1) enjoys the SVP in $K$;\
[(ii)]{}$d^{2}_{K}(\cdot)$ is a viscosity supersolution of PDE (2.2).
Comparison theorem for SDEs with jumps {#sec:intro}
======================================
multidimensional SDEs {#sec:intro}
---------------------
Let $\mathcal{S}^{2}_{[0,T]}$ denote the set of $\mathcal{F}_{t}$-adapted c$\grave{a}$dl$\grave{a}$g $m$-dimensional processes\
$\{X_{t},0\leq t\leq T\}$ which are such that $$\|X\|_{\mathcal{S}^{2}_{[0,T]}}:=(E[\sup_{0\leq t\leq
T}|X_{t}|^{2}])^{\frac{1}{2}}<\infty.$$
Consider the following two SDEs: $i=1,2,$ $$X^{i}_{s}=x^{i}+\int_{t}^{s}b^{i}(r,X^{i}_{r})ds+\int_{t}^{s}\s^{i}(r,X^{i}_{r})dW_{r}+\int_{t}^{s}\int_{E}\g^{i}(r,X^{i}_{r-},e)\tilde{N}(drde),
\eqno{(3.1)}$$ where $(b^{i},\s^{i},\g^{i}),i=1,2$ satisfy (A1) and (A2), and $x^{1},x^{2}\in R^{m}$. The objective of this section is to study when the comparison theorem holds for two SDEs with jumps of type (3.1). We will find that the comparison theorem can be transformed to a viability problem in $R^{m}_{+}\times R^{m}$ of $(X^{1}-X^{2},X^{2})$.
[**Theorem 3.1.**]{} Suppose that $(b^{i},\s^{i},\g^{i}),i=1,2$ satisfy (A1) and (A2). Then the following are equivalent:
[(i)]{} For any $t\in [0,T]$, $x^{1},x^{2}\in R^{m}$ such that $x^{1}\geq x^{2}$, the unique adapted solutions $X^{1}$ and $X^{2}$ in $\mathcal{S}^{2}_{[t,T]}$ to the SDE (3.1) over time interval $[t,T]$ satisfy: $$X^{1}_{s}\geq X^{2}_{s},s\in[t,T],P-a.s.;$$
[(ii)]{} $\s^{1}\equiv \s^{2}$, and for any $t\in
[0,T],k=1,2,...,m,$ $$\left\{\begin{array}{ll}
{\rm(a)}& \s^{1}_{k} \mbox{ \ depends only on \ }x_{k},\\
{\rm(b)}&\forall x'\in R^{m}, \forall x\geq
0,x_{k}+\g^{1}_{k}(t,x+x',e)-\g^{2}_{k}(t,x',e)\geq 0,n(de)-a.s.,\\
{\rm(c)}& \mbox{for all \ }x',\d^{k}x\in R^{m}, \mbox{ \ such that
\ }\d^{k}x\geq0,(\d^{k}x)_{k}=0,\\
& b^{1}_{k}(t,\d^{k}x+x')-\displaystyle\int_{E}\g^{1}_{k}
(t,\d^{k}x+x',e)n(de)\geq
b^{2}_{k}(t,x')-\displaystyle\int_{E}\g^{2}_{k} (t,x',e)n(de).
\end{array}\right.$$
[**Proof:** ]{}Set $\bar{X}_{s}=(X^{1}_{s}-X^{2}_{s},X^{2}_{s})$, then (i) is equivalent to the following:
For any $t\in [0,T]$, $\forall \bar{x}=(x^{1},x^{2})$ such that $x^{1}\geq 0$, the unique solution $\bar{X}$ to the following SDE over time interval $[t,T]$: $$\bar{X}_{s}=\bar{x}+\int_{t}^{s}\bar{b}(r,\bar{X}_{r})ds+\int_{t}^{s}\bar{\s}(r,\bar{X}_{r})dW_{r}+\int_{t}^{s}\int_{E}\bar{\g}(r,\bar{X}_{r-},e)\tilde{N}(drde),
\eqno{(3.2)}$$ satisfies $\bar{X}^{1}_{s}\geq 0,s\in [t,T],P-a.s.$, where for $\bar{x}=(\bar{x}^{1},\bar{x}^{2})$, $$\begin{array}{l}
\bar{b}(s,\bar{x})=(b^{1}(s,\bar{x}^{1}+\bar{x}^{2})-b^{2}(s,\bar{x}^{2}),b^{2}(s,\bar{x}^{2})),\\
\bar{\s}(s,\bar{x})=(\s^{1}(s,\bar{x}^{1}+\bar{x}^{2})-\s^{2}(s,\bar{x}^{2}),\s^{2}(s,\bar{x}^{2})),\\
\bar{\g}(s,\bar{x},e)=(\g^{1}(s,\bar{x}^{1}+\bar{x}^{2},e)-\g^{2}(s,\bar{x}^{2},e),\g^{2}(s,\bar{x}^{2},e)).
\end{array}$$
So we can apply Lemma 2.3 to SDE (3.2) and the convex closed set $K:=R^{m}_{+}\times R^{m}$, i.e., (i) is equivalent to that $d^{2}_{K}(\cdot)$ is a viscosity supersolution of PDE (2.2).
we can see that $\forall x=(x^1,x^2)\in R^{2m}$, $$\Pi_{K}(x)=\left(\begin{array}{c}
(x^{1})^{+}\\\\
x^{2}
\end{array}\right),
x-\Pi_{K}(x)=\left(\begin{array}{c}
-(x^{1})^{-}\\\\
0
\end{array}\right).$$ So $$d^{2}_{K}(x)=|(x^{1})^{-}|^{2}=\sum\limits_{k=1}^{m}I_{\{x^{1}_{k}<0\}}|x^{1}_{k}|^{2}.$$ And $$(D^{2}d^{2}_{K})(x)\left\{\begin{array}{ll} =0_{2m\times 2m},&
\mbox{when \ }x\in K^\circ,\\
\mbox{does not exist},& \mbox{when \ }x\in \partial K,\\
=(a_{ij})_{2m\times 2m},& \mbox{when \ }x\in R^{2m}\backslash K,
\end{array}
\right.$$ where $$a_{ij}=0,\mbox{ \ when \ }i\neq j,\mbox{ \ } a_{ii}=\left\{
\begin{array}{ll}
0,& m<i\leq 2m,\\
0,& 1\leq i\leq m,x^{1}_{i}\geq 0,\\
2,& 1\leq i\leq m,x^{1}_{i}< 0.
\end{array}
\right.$$
From the above analysis and the Lipschitz condition of $b^{1}$ w.r.t. $x$, we can easily check that: $d^{2}_{K}(\cdot)$ is a viscosity supersolution of PDE (2.2) if and only if,\
\
$\mbox{(ii)}'$ $\forall t\in [0,T], \forall (x,x')\in R^{m}\times
R^{m}$, $$\begin{array}{ll}
&-2\langle
x^{-},b^{1}(t,x^++x')-b^{2}(t,x')\rangle+\sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}|\s^{1}_{k}(t,x+x')-\s^{2}_{k}(t,x')|^{2}\\
&+\sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}\displaystyle\int_{E}[|(x_{k}+\g_{k}^{1}(t,x+x',e)-\g_{k}^{2}(t,x',e))^{-}|^{2}\\
&\mbox{ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ }-|x_{k}|^{2}-2x_{k}(\g_{k}^{1}(t,x+x',e)-\g_{k}^{2}(t,x',e))]n(de)\\
&+\sum\limits_{k=1}^{m}I_{\{x_{k}\geq
0\}}\displaystyle\int_{E}|(x_{k}+\g_{k}^{1}(t,x+x',e)-\g_{k}^{2}(t,x',e))^{-}|^{2}n(de)\\
\leq & C^*|x^{-}|^{2},
\end{array}$$ where $C^*\geq 4\mu+\mu^{2}+\int_{E}\rho^{2}(e)n(de)$ is a constant which does not depend on $t,x,x'$. Then the left thing we need to do is to prove: $\mbox{(ii)}\Leftrightarrow \mbox{(ii)}'$.
$\mbox{(ii)}'\Rightarrow\mbox{(ii)}$: If we pick $x\geq 0$, we can immediately get (b) in (ii) from (ii)$'$.
Pick $x<0$, by (ii)$'$ we have $$\sum\limits_{k=1}^{m}2x_{k}
[b^{1}_{k}(t,x')-b^{2}_{k}(t,x')]+|\s^{1}(t,x+x')-\s^{2}(t,x')|^{2}\leq
C^{*}|x|^{2}.$$ Let $x$ tend to $0_{-}$, we get that $\s^{1}\equiv \s^{2}$.
And $\forall \d^{k}x\in R^{m}$, such that, $\d^{k}x\geq0,(\d^{k}x)_{k}=0$. Pick $x=\d^{k}x-\ep e_{k},\ep>0$. From (ii)$'$ we get: $$-2\ep
[b^{1}_{k}(t,\d^{k}x+x')-b^{2}_{k}(t,x')]+|\s^{1}_{k}(t,x+x')-\s^{1}_{k}(t,x')|^{2}\leq
C^{*}\ep^{2}.$$ Let $\ep$ tend to 0, we have $$\s^{1}_{k}(t,\d^{k}x+x')=\s^{1}_{k}(t,x').$$ We deduce quickly that $\s^{1}_{k}$ depends only on $x_{k}$.
With $x=\d^{k}x-\ep e_{k},\ep>0$ again, from (ii)$'$ we can also get $$-2\ep
[b^{1}_{k}(t,\d^{k}x+x')-b^{2}_{k}(t,x')]+\int_{E}[-\ep^{2}+2\ep(\g^{1}_{k}(t,x+x',e)-\g^{2}_{k}(t,x',e))]n(de)\leq
C^{*}\ep^{2}.$$ Dividing by $-2\ep$ and letting $\ep$ tend to 0, we have $$b^{1}_{k}(t,\d^{k}x+x')-\int_{E}\g^{1}_{k} (t,\d^{k}x+x',e)n(de)\geq
b^{2}_{k}(t,x')-\int_{E}\g^{2}_{k} (t,x',e)n(de).$$
(ii)$\Rightarrow$(ii)$'$. For $x\geq 0$, from (b) in (ii), we know that (ii)$'$ holds true. If there exist some $1\leq k\leq n$, such that $x_{k}<0$, then from (ii) we have $$\begin{array}{ll}
&-2\langle
x^{-},b^{1}(t,x^{+}+x')-b^{2}(t,x')\rangle+\sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}|\s^{1}_{k}(t,x+x')-\s^{1}_{k}(t,x')|^{2}\\
&+\sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}\displaystyle\int_{E}[|(x_{k}+\g^{1}_{k}(t,x+x',e)-\g^{2}_{k}(t,x',e))^{-}|^{2}\\
&\mbox{ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ }-|x_{k}|^{2}-2x_{k}(\g^{1}_{k}(t,x+x',e)-\g^{2}_{k}(t,x',e))]n(de)\\
&+\sum\limits_{k=1}^{m}I_{\{x_{k}\geq
0\}}\displaystyle\int_{E}|(x_{k}+\g^{1}_{k}(t,x+x',e)-\g^{2}_{k}(t,x',e))^{-}|^{2}n(de)\\
\leq &
\sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}|\s^{1}_{k}(t,x_{k}+x_{k}')-\s^{1}_{k}(t,x_{k}')|^{2}\\
&+ \sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}2x_{k}(b^{1}_{k}(t,\d^{k}x+x')-b^{2}_{k}(t,x')-\displaystyle\int_{E}[\g^{1}_{k}(t,\d^{k}x+x',e)-\g^{2}_{k}(t,x',e)]n(de))\\
&+\sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}\displaystyle\int_{E}[|(x_{k}+\g^{1}_{k}(t,x+x',e)-\g^{1}_{k}(t,\d^{k}x+x',e))^{-}|^{2}-|x_{k}|^{2}\\
&\mbox{ \ \ \ \ \ \ \
\ \ \ \ \ \ \ \ \ \ \ \ \ \ }-2x_{k}(\g^{1}_{k}(t,x+x',e)-\g^{1}_{k}(t,\d^{k}x+x',e))]n(de)\\&
+\sum\limits_{k=1}^{m}I_{\{x_{k}\geq
0\}}\displaystyle\int_{E}|(\g^{1}_{k}(t,x+x',e)-\g^{1}_{k}(t,\d^{k}x+x',e))^{-}|^{2}n(de)\\
\leq &
\sum\limits_{k=1}^{m}I_{\{x_{k}<0\}}|\s^{1}_{k}(t,x_{k}+x_{k}')-\s^{1}_{k}(t,x_{k}')|^{2}\\
&+\sum\limits_{k=1}^{m}\displaystyle\int_{E}|\g^{1}_{k}(t,x+x',e)-\g^{1}_{k}(t,\d^{k}x+x',e)|^{2}n(de)\\
\leq & (\mu^{2}+\displaystyle\int_{E}\rho^{2}(e)n(de))|x^{-}|^{2}\\
\leq & C^{*}|x^{-}|^{2}.
\end{array}
\eqno{\Box}$$
[**Remark 3.2.**]{} For the holding of comparison theorem for multidimensional SDEs with jumps, condition (ii) in Theorem 3.1 is very natural. $\s^{1}\equiv \s^{2}$ and condition (a) are the results of that the sign of $dW$ is not always positive or negative; To consider condition (b) and (c), let us transform our SDEs to the following forms: $$\begin{array}{rl}
X^{i}_{s}=&x^{i}+\displaystyle\int_{t}^{s}[b^{i}(r,X^{i}_{r})-\displaystyle\int_{E}\g^{i}(r,X^{i}_{r-},e)n(de)]dr+\displaystyle\int_{t}^{s}\s^{i}(r,X^{i}_{r})dW_{r}\\
&+\displaystyle\int_{t}^{s}\displaystyle\int_{E}\g^{i}(r,X^{i}_{r-},e)N(drde).\end{array}$$ So condition (b) implies that jumps should occur in the way of holding the advantage. While condition (c) display the form that the new drift coefficients should satisfy. In the classical real-valued case without jumps, we are very familiar with this form.
[**Corollary 3.3.**]{} Let $m=1$ and suppose that $(b^{i},\s^{i},\g^{i}),i=1,2$ satisfy (A1)and (A2). Then the following are equivalent:
[(i)]{} For any $t\in [0,T]$, $x^{1},x^{2}\in R$ such that $x^{1}\geq x^{2}$, the unique adapted solutions $X^{1}$ and $X^{2}$ in $\mathcal{S}^{2}_{[t,T]}$ to the SDE (3.1) over time interval $[t,T]$ satisfy: $$X^{1}_{s}\geq X^{2}_{s},s\in[t,T],P-a.s.;$$
[(ii)]{}For any $t\in [0,T],x\in R$, $$\left\{ \begin{array}{l} \s^{1}(t,x)\equiv\s^{2}(t,x),\\
b^{1}(t,x)-\displaystyle\int_{E}\g^{1}(t,x,e)n(de)\geq b^{2}(t,x)-\displaystyle\int_{E}\g^{2}(t,x,e)n(de),\\
x_{1}+\g^{1}(t,x_{1},e)\geq
x_{2}+\g^{2}(t,x_{2},e),\forall x_{1}\geq x_{2}, n(de)-a.s..
\end{array}
\right.$$
This has already been established in \[4\].
[**Corollary 3.4.**]{} Let $m=1$. When $\g^{1}\equiv\g^{2}\neq 0$ and suppose that $(b^{i},\s^{i},\g^{1}),i=1,2$ satisfy (A1)and (A2). Then the following are equivalent:
[(i)]{} For any $t\in [0,T]$, $x^{1},x^{2}\in R$ such that $x^{1}\geq x^{2}$, the unique adapted solutions $X^{1}$ and $X^{2}$ in $\mathcal{S}^{2}_{[t,T]}$ to the SDE (3.1) over time interval $[t,T]$ satisfy: $$X^{1}_{s}\geq X^{2}_{s},s\in[t,T],P-a.s.;$$
[(ii)]{}For any $t\in [0,T],x\in R$, $$\left\{ \begin{array}{l} \s^{1}(t,x)\equiv\s^{2}(t,x),\\
b^{1}(t,x)\geq b^{2}(t,x),\\
[**Corollary 3.5.**]{} Let $m=1$. When $\g^{1}\equiv\g^{2}\equiv 0$ and suppose that $(b^{i},\s^{i}),i=1,2$ satisfy (A1) and (A2). Then the following are equivalent:
[(i)]{} For any $t\in [0,T]$, $x^{1},x^{2}\in R$ such that $x^{1}\geq x^{2}$, the unique adapted solutions $X^{1}$ and $X^{2}$ in $\mathcal{S}^{2}_{[t,T]}$ to the SDE (3.1) over time interval $[t,T]$ satisfy: $$X^{1}_{s}\geq X^{2}_{s},s\in[t,T],P-a.s.;$$
[(ii)]{}For any $t\in [0,T],x\in R$, $$\s^{1}(t,x)\equiv\s^{2}(t,x),\mbox{ \ }b^{1}(t,x)\geq b^{2}(t,x).$$
This is the classical result in SDEs without jump.
Although when $\g^{1}\equiv\g^{2}$, it is very convenient for us to get the comparison theorem. But in fact, it’s not necessary for the holding of comparison theorem. The following is an counter-example, where $\g^{1}$ is not necessarily equal to $\g^{2}$, but the comparison theorem can still hold true.
[**Example 3.6.**]{} Let $m=1$. Set $$b^{i}(t,x)=\int_{E}\g^{i}(t,x,e)n(de),\s^{i}\equiv0,i=1,2.$$ We have the following two SDEs: $$X^{i}_{s}=x^{i}+\int_{t}^{s}\int_{E}\g^{i}(r,X^{i}_{r-},e)N(drde).$$ Then we can immediately see that as long as $$x_{1}+\g^{1}(t,x_{1},e)\geq
x_{2}+\g^{2}(t,x_{2},e),\forall x_{1}\geq x_{2},n(de)-a.s.,$$ the comparison theorem: [(i)]{} in Corollary 3.3 holds true. While in this case, we only need, for all $t\in [0,T], x\in R$, $$\g^{1}(t,x,e)\geq
\g^{2}(t,x,e),n(de)-a.s..$$
Matrix-valued SDEs {#sec:intro}
------------------
Since the first and the second derivatives of the function $d^{2}_{\mathbb{S}_{+}^{m}}(y), y\in {\mathbb{S}^{m}}$ have been studied due to Hu and Peng \[3\], where $\mathbb{S}^{m}$ is the space of symmetric real $m\times m$ matrices, and $\mathbb{S}_{+}^{m}$ is the subspace of $\mathbb{S}^{m}$ containing the nonnegative elements in $\mathbb{S}^{m}$. So at the end of this paper, we can study the comparison theorem for matrix-valued SDEs with jumps. Without loss of generality, we set $d=1$.
Consider the following two SDEs (i=1,2): $$X^{i}_{s}=x^{i}+\int_{t}^{s}b^{i}(r,X^{i}_{r})ds+\int_{t}^{s}\s^{i}(r,X^{i}_{r})dW_{r}+\int_{t}^{s}\int_{E}\g^{i}(r,X^{i}_{r-},e)\tilde{N}(drde),
\eqno{(3.3)}$$ where, for $i=1,2,$ $$b^i:[0,\infty)\times \mathbb{S}^{m}\rightarrow \mathbb{S}^{m},\mbox{
\ }\s:[0,\infty)\times \mathbb{S}^{m}\rightarrow
\mathbb{S}^{m},\mbox{ \ }\g:[0,\infty)\times \mathbb{S}^{m}\times
R^{l}\rightarrow \mathbb{S}^{m}.$$
[**Theorem 3.7.**]{} Suppose that $b^i,\s^i,\g^i$(i=1,2) satisfy (A1) and (A2). Then the following are equivalent:
[(i)]{} For any $t\in [0,T]$, $x^{1},x^{2}\in \mathbb{S}^{m}$ such that $x^{1}\geq x^{2}$, the unique adapted solutions $X^{1}$ and $X^{2}$ in $\mathcal{S}^{2}_{[t,T]}(\mathbb{S}^{m})$ to the SDE (3.3) over time interval $[t,T]$ satisfy: $$X^{1}_{s}\geq X^{2}_{s},s\in[t,T],P-a.s.;$$
[(ii)]{} $\forall t\in [0,T],\forall (x,x')\in \mathbb{S}^{m}\times
\mathbb{S}^{m}$, $$\begin{array}{ll}
&-4\langle x^{-},b^1(t,x^++x')-b^2(t,x')\rangle\\
&+\langle
D^{2}d^{2}_{\mathbb{S}_{+}^{m}}(y)(\s^1(t,x+x')-\s^2(t,x')),(\s^1(t,x+x')-\s^2(t,x'))\rangle\\
&+2\displaystyle\int_{E}
[\|(x+\g^1(t,x+x',e)-\g^2(t,x',e))^{-}\|^{2}-\|x^{-}\|^{2}\\
& \ \ \ \ \ \ \ \ \ +2\langle
x^{-},\g^1(t,x+x',e)-\g^2(t,x',e)\rangle]n(de)\\
\leq & C^*\|x^{-}\|^{2},
\end{array}$$ where $C^{*}\geq 4\mu+\mu^{2}+\int_{E}\rho^{2}(e)n(de)$ is a constant which does not depend on $t,x,x'$.
[**Proof:** ]{}We can see from the appendix of \[3\] that, for any $y\in
\mathbb{S}^{m}$, $y$ has an expression: $$y(\l,A)=e^{A}\sum\limits_{i=1}^{m}\l_{i}e_{i}e^{T}_{i}e^{-A},$$ where $A$ is an antisymmetric real $m\times m$ matrix $(A^{T}=-A)$, $\l_{i}\in R$, $\{e_{1},e_{2},...,e_{m}\}$ is the standard basis of $R^{m}$.
If we set $$y^{+}(\l,A)=e^{A}\sum\limits_{i=1}^{m}\l^{+}_{i}e_{i}e^{T}_{i}e^{-A},\mbox{
\
}y^{-}(\l,A)=e^{A}\sum\limits_{i=1}^{m}\l^{-}_{i}e_{i}e^{T}_{i}e^{-A}.$$ Then from \[3\], we have $$d^{2}_{\mathbb{S}_{+}^{m}}(y)=\|y^{-}\|^{2},
\Pi_{\mathbb{S}_{+}^{m}}(y)=y^{+},\mbox{ \ and \ }\nabla
d^{2}_{\mathbb{S}_{+}^{m}}(y)=-2y^{-},$$ where $\|y\|=(tr(y^{2}))^{\frac{1}{2}}$. This with Lemma 2.3, we can use the same method as Theorem 3.1 to finish the proof of the theorem. We omit it.
[00]{}
L. I. Gal’cuk, M. H. A. Davis, A note on a comparison theorem for equations with different diffusions, *Stochastics 6 (1982) 147-149.*
N. Ikeda and S. Watanabe, A comparison theorem for solutions of stochastic differential equations and its applications, *Osaka J. Math. 14 (1977) 619-633.*
Y. Hu and S.Peng, On the comparison theorem for multidimensional BSDEs, *C. R. Math. Acad. Sci. Paris 343 (2006), No.2, 135-140.*
S. Peng and X. Zhu, Necessary and Sufficient Condition for Comparison Theorem of 1-dimensional Stochastic Diffrential Equations, *Stochastic Processes and their Applications, 116 (2006) 370-380.*
S. Peng and X. Zhu, The viability property of controlled jump diffusion processes, *Acta. Math. Sinica, English Series, Aug., 2008, Vol. 24, No. 8, pp. 1351-1368.*
T. Yamada, On Comparison theorem for solutions of stochastic differential equations and its applications, *J. Math. Kyoto Univ. 13 (1973) 497-512.*
J. A. Yan, A comparison theorem for semimartingales and its applications, *Séminaire de Porbabilités, XX, Lecture Notes in Mathematics, vol. 1204, Springer, Berlin, 1986, pp. 349-351.*
| |
In our day to day practice we frequently see risk assessments methodologies stretched to «fit the clients’ case». In other words, users select improper tools to deliver results. This is a brief summary for the Failure Modes and Effects Analysis (FMEA) risk matrix one of the most common risk assessments methodologies. In the coming weeks we will review several of these methodologies and will end the review with a comparison.
FMEA was one of the first systematic techniques for preventative failure analysis. It allowed to study problems that might arise from malfunctions of military systems (1950). It involves reviewing as many components, assemblies, and subsystems as possible to identify potential failure modes, and their causes and effects (consequences). FMEA identifies failure modes, not hazards (malfunctions), like HAZOP does. That’s a subtle, but significant philosophical shift. Failure modes and effects analysis constitute today the backbone of Risk Assessment common practices.
FMEA starts with an event, a failure, due to an hazard. However, but it does not require a detailed identification of all the possible hazards (like HAZOP) . Subsequently it evaluates failures‘ effects, often following simplified methodologies as described below. FMEA does not explicitly require a detailed understanding/modelling of the systems’ functional relationships.
In FMEA a failure probability can only be estimated or reduced by understanding its mechanism. Therefore if the system is not well understood or an inexperienced reviewer starts the exercise, it is very likely that some failure mode will be left-out. Inter-dependencies are generally neglected, unless a specific effort is made to include cascading events (domino effects). FMEA generally give a false sense of precision and simplicity of risk matters to their users.
Common practice FMEA generally do not include detailed consequences’ analyses. The risk is not properly calculated (oftentimes underestimated). It is common for example, when applying FMEA, to see teams selecting the worst among financial, human, or environmental category of consequences and forgetting their possible combinations.
Probability Impact Graphs (PIGs risk matrix) often display the results. PIGs 4×4 or 5×5 risk matrix cells coloring gives a sense for risk criticality. Many interpretative problems afflict PIGs. Events with low p, high C are very different than those with high p, low C. PIGS will however prioritize then similarly (See Figure above).
FMEAs require time. For the curious readers here are two extreme examples:
Tagged with: event failure, Failure Modes and Effects Analysis, FMEA, risk criticality, risk methodologies
Category: Consequences, Hazard, Risk analysis, Risk management, Uncategorized
Nice article. That is the very reason why those who do FMEA and DRBFM not just mandatorily tend to use iMODELER to look at interconnections, soft factors and dynamics as well. | https://www.riskope.com/2015/01/15/failure-modes-and-effects-analysis-fmea-risk-methodology/ |
Zinc is an essential mineral found in cells throughout the body. It plays a key role in growth, immune function, and reproduction.What Are The Benefits of Taking Zinc?...
A vegan diet has an abundant list of health benefits; however, it neglects a key micronutrient found in animal products: B-12. Without it, one may become at risk of...
Recent Articles
Did you know certain foods can cause increased bodily inflammation? Nourish your body with kinder and cleaner non-processed foods such as dark leafy greens, superfoods, fruits, root vegetables, nuts, seeds, grains, and healthy oils. | https://www.assuaged.com/news/tag/vitamins-and-minerals |
Let us now consider what could appear as being in the present instant were it utterly cut off from past and future. We can only guess; for nothing is more occult than the absolute present. There plainly could be no action; and without the possibility of action, to talk of binarity would be to utter words without meaning. There might be a sort of consciousness, or feeling, with no self; and this feeling might have its tone. Notwithstanding what William James has said, I do not think there could be any continuity like space, which, though it may perhaps appear in an instant in an educated mind, I cannot think could do so if it had no time at all; and without continuity parts of the feeling could not be synthetized; and therefore there would be no recognizable parts. There could not even be a degree of vividness of the feeling; for this [the degree of vividness] is the comparative amount of disturbance of general consciousness by a feeling. At any rate, such shall be our hypothesis, and whether it is psychologically true or not is of no consequence. The world would be reduced to a quality of unanalyzed feeling. Here would be an utter absence of binarity. I cannot call it unity; for even unity supposes plurality. I may call its form Firstness, Orience, or Originality. It would be something which is what it is without reference to anything else within it or without it, regardless of all force and of all reason. Now the world is full of this element of irresponsible, free, Originality. [—]We mostly neglect them; but there are cases, as in qualities of feeling, self-consciousness, etc., in which such isolated flashes come to the front. Originality, or Firstness, is another of my Categories. | http://commens.org/dictionary/entry/quote-minute-logic-chapter-i-intended-characters-treatise-2 |
The hierarchy that Sarah Nexus uses to hold the model allows for varying sized and overlapping fragments to be retained when they provide information of value to the model. The method applied here is unique to Sarah Nexus.
The structural explanation for the prediction provided by Sarah Nexus is conveyed by highlighting those fragment(s) that Sarah Nexus considers meaningful. Derek Nexus also highlights fragments of the query compound in order to illustrate the matches to patterns (Markush structures) used to hold knowledge within Derek Nexus.
Both models highlight parts of the query compound for the same purpose – to draw the user’s attention to parts of the structure that influenced that prediction. How these are identified is however, very different. Derek Nexus relies on patterns drawn by experts whereas Sarah Nexus identifies those with statistical significance automatically. | https://www.lhasalimited.org/Default.aspx.ShortcutID-574668.faq_id-1178.htm |
A technique commonly used by dividend investors to value dividend-issuing stocks is the Dividend Discount Model (DDM), which seeks to determine a fair share price based on the dividend provided by the company relative to a number of other company-specific factors. In the case of TFII, the DDM model, as implemented by StockNews, implies a negative return of 75.23% relative to its current price. To help understand and contextualize the model's evaluation of TFII, investors may wish to consider are:
- Relative to all dividend yielding stocks in our set, TFII offers a dividend yield in the bottom 0.8% of its fellow sector mates.
- Regarding its relative worth based on the dividend discount model, TFI International Inc's estimated return of -75.23% surpasses about merely 18.36% of dividend issuers we applied the dividend discount model to.
- In terms of who is growing the amount of dividends they return to shareholders, TFII boasts a higher growth rate in terms of its annual cash distributed to its owners than 9.45% of the dividend issuers in our set.
TFII Dividend Chart
TFII Dividend History
|Ex-Dividend Date||Type||Payout Amount||Change|
|Loading, please wait...|
TFII Dividends vs. Peers
TFII's dividend yield currently ranks #6 of 28 vs. its peers in the Trucking Freight category. | https://stocknews.com/stock/TFII/dividends/ |
Forced displacement resulting from armed conflict is a significant problem for regions experiencing prolonged humanitarian crises. Afghanistan is one such country with an estimated 1.2 million internally displaced persons (IDPs), with a large concentration in the capital of Kabul. IDPs face limited resources, as well as challenges in accessing health services through traditional channels leading to disproportionate burden of disease. Recently, inconsistent funding has forced healthcare provisions within the Kabul IDP camps to close. The broader structural factors that negatively impact health and the more specific barriers to healthcare accessibility among IDPs is not well understood. | https://globalprojects.ucsf.edu/project/healthcare-access-among-internally-displaced-persons-kabul-afghanistan |
It is only a slight exaggeration to say that the British mathematician Alan Turing (1912–1954) saved the Allies from the Nazis, invented the computer and artificial intelligence, and anticipated gay liberation by decades — all before his suicide at age 41. In November a major motion picture starring Benedict Cumberbatch as Turing will be released, based on the classic biography by Dr. Andrew Hodges, who teaches mathematics at Wadham College, University of Oxford (he is also an active contributor to the mathematics of fundamental physics). Hodges tells how Turing’s revolutionary idea of 1936 — the concept of a universal machine — laid the foundation for the modern computer and how Turing brought the idea to practical realization in 1945 with his electronic design.
Newsletter
Be in the know!
Subscribe to eSkeptic: our free email newsletter and get great podcasts, videos, reviews and articles from Skeptic magazine, announcements, and more in your inbox once or twice a week.
Skeptic Digital
Read Skeptic on Apple or Android devices, or on PC or Mac via PocketMags.com. | https://www.skeptic.com/tag/nazis/ |
This page is provided as a resource for students, parents/guardians, and coaches to locate current factual information and to increase their knowledge about these highly available substances. Basically, there is no shortcut for the discipline required to eat a nutritionally balanced diet or for the effort required to attain the level of physical conditioning required by athletic endeavors. Believing otherwise can potentially have an adverse affect on the long-term health of young athletes.
Many national organizations, including the National Federation of State High School Associations (NFHS) have published position statements and created policies regarding the use of anabolic steroids, dietary supplements, and other performance-enhancing substances. Student-athletes and their parent/guardians should always consult with a qualified health care provider prior to making any decision about the use of any over-the-counter or prescribed substances.
Anabolic steroids are controlled substances that are illegal to use or possess without a doctor's prescription. The use of anabolic steroids and other performance-enhancing substances violates the legal, ethical, and competitive equity standards along and imposes unreasonable long-term health risks.
Dietary supplements are not evaluated or regulated by the Food and Drug Administration (FDA), therefore there is no guarantee as to the accuracy of the dosage, content, ingredients, or purity contained within. Very few scientific studies exist on the short-term or long-term side effects associated with the use of dietary supplements which increases the risks associated with their use. | https://www.mpssaa.org/membership-services/supplements-performance-enhancing-substances/ |
How Crowdsourcing Keeps Igniting Change
In Part I of our series on crowdsourcing, we shared how the new form of networking is helping solve important problems in science and medicine, transforming the way citizens and governments work together, and changing the world’s definition of who an innovator can be. But these are just a few of the ways crowdsourcing is shifting the world’s social and economic landscape. Discover more on how crowdsourcing is helping communities come together to solve global challenges, creating new opportunities and risks for startups and investors, and helping public and private organizations design more user-centric products than ever before.
1. It’s helping organizations incorporate more diverse perspectives
In the years before the internet, researchers faced challenges in gathering input from audiences outside of their local reach. Today, crowdsourcing provides researchers with a fast, easy, and cost-efficient way to gather perspectives and feedback from a wide range of populations and demographics.
The UN has used a cross-cultural crowdsourcing challenge to solicit ideas on how to get refugees the information and services they need. Through the UN’s crowdsourcing efforts, global brainstorm sessions spanned the distance from Africa to India, as hundreds contributed their perspectives on how to help refugees achieve integration in their new communities.i Participants in the crowdsourcing challenge included members of the UN Refugee Agency and their partner organizations, as well as the refugees themselves.ii
2. It’s bringing new opportunities—and new risks—to startups and investors
Crowdsourcing can offer new opportunities for startups, inventors, and investors. By giving aspiring entrepreneurs instant access to investors, online crowdfunding platforms can help creative people build successful businesses quickly and easily. This form of funding accelerates innovation by helping to fund truly unique, ‘niche’ ideas—ideas that might have had trouble generating funding in the past. With the help of crowdfunding, new businesses can achieve their goals more efficiently by spending their early days developing great products, rather than devoting their time to fundraising.
With the rise of equity crowdfunding, investors can purchase stock in new businesses they’re helping to fund. Signed into law in May, 2016, Title III of the federal Jumpstart our Business Startups (JOBS) Act now allows unaccredited investors (individuals with less than $1 million in net worth or less than $200,000 in annual income) to invest in startups through online crowdfunding.iii Today, everyday individuals are funding new projects and helping new businesses grow.
Yet by making it easier for every startup to gain investors, crowdfunding is also making investing more risky. First, investors may find themselves putting their stock in creators with no track record. Second, a startup may take more risks. When a startup has an enormous network of investors who have all donated smaller amounts, there is less pressure on the business to achieve results for any one investor.
Traditionally, when a large investor considered whether or not to go ‘all in’ on a new business, the new business had to take the time to assess its risks, develop a sound strategy, and convince the investor that the business would achieve its goals. Since crowdfunding provides new businesses with access to such a large network of potential investors, businesses can simply replace any investor who feels the project is too risky. Finally, there is the argument that, with more projects funded, there is the potential for a larger number of projects that fail. To help protect investors against the risks of equity crowdfunding and enhance confidence in the crowdfunding ecosystem, AIG has recently launched a new product, crowdfunding insurance.
3. It’s helping organizations like AIG leverage great ideas and bring them to life
Organizations can develop more user-centric products by using crowdsourcing to understand customer needs. In a crowdsourcing initiative, NASA invited the public to propose new ideas for products that would incorporate NASA’s technologies to meet real consumer needs. Having invented items such as the sensor behind our smartphone cameras, Teflon®, Velcro®, and even baby formula, NASA now collaborates directly with consumers through crowdsourcing to understand which products they’d like to see next.iv
AIG is also using crowdsourcing to enhance our market research and receive feedback directly from consumers. Through AIG Connections, our online insights community, more than 1000 consumers across the U.S. give us candid feedback every week on a wide range of ideas, from concepts for new products to marketing materials to business strategies. AIG Connections is helping AIG gain insights into the insurance market more quickly and efficiently: with our mobile platform, we can view results of our research in real time, as the data is coming in.
Participants in the project are not simply ‘a crowd’—we select them carefully to represent the insurance-buying public, and new members join every three months. We’re hearing that the open discussions and live chats we’re hosting for our participants are creating a great community that promotes new ideas about insurance and technology. One participant comments, “The thoughts of other members have made me consider other [insurance]…and opened my eyes to some topics I would not have thought about….” Another participant comments, “It has been an interesting journey learning all about new and upcoming [ideas] for the future like the Internet of Things….It’s so nice to be with an insurance company that wants to be on the same level as their customers.” AIG Connections is just one of the many ways we’re getting closer to customers, listening to their needs, and creating more valued solutions.
Crowdsourcing at AIG has also helped us to develop some of our most innovative products. As a global organization with over 60,000 employees, we want to make sure our employees’ best ideas get heard by our senior executives and translated into action to help our clients. That’s why we created our Innovation Bootcamp, or IBC Program. Launched in 2013, IBC brings together employees from across our organization to generate new products and processes. IBC teams develop their own innovation concepts and present them to a panel of senior executives, who select the winning idea. Sometimes this idea becomes our company’s next big innovation.
In 2014, an IBC team created and presented the concept for what is now Robotics Shield SM, AIG’s pioneering risk mitigation solution for the robotics industry. Through further vetting and development, including conversations with our broker partners about emerging risks and exposures in the robotics sector, AIG realized that there was indeed a rapidly growing need for comprehensive insurance to protect companies that manufacture or use robots today. Launched in 2015, AIG Robotics Shield now provides end-to-end risk management solutions for a booming industry. The winner of a 2016 Innovation Award from Business Insurance, Robotics Shield is just one of our many innovations brought to you by the power of the crowd.
| |
This week we’re discussing IT risk management, a topic that is never really complete and should always be part of the conversation at your place of business. At its most basic level, IT risk management is applying risk management methods to any area of information technology; you identify threats and vulnerabilities to your resources, and decide what actions to take and when. While this sounds simple enough, it’s a crucial subset of your company’s overall risk management and requires constant monitoring and improvement. Let’s dive in.
IT Risk Management Importance
As with all aspects of risk management, IT risk management is an indefinite process. New threats and vulnerabilities emerge in the business environment almost as quickly as solutions can be prepared. This is even more so true in IT, as technology advances at an ever-increasing rate. Old threats and solutions need to be reevaluated regularly to ensure the processes in place are still effective and are being followed. The identification, assessment, and management of IT risks ensures your business continues to operate smoothly and you avoid any fines for negligence or noncompliance.
It may often be the case that after identifying a threat to one of your assets, your company decides not to take countermeasures to lower risk. This often occurs with resources that aren’t vital to the company. This is standard, and an essential component of management as you decide how to best allocate your resources. IT risk management is essential because it forces you to take a closer look at all of your company’s assets and determine their value and importance in your priorities.
You’ll also find there is an increasing number of regulations and a demand for operational transparency. Not only when required, but for the safety of other businesses, third parties and partners might request proof of your compliance with certain laws, policies, regulations, or best practices. An organization in the U.S. may only have to be compliant with NIST, but for doing business globally, they’ll then have to check compliance against ISO to show they meet international standards.
After a study discussed by Safran, we know a staggering 92% of CEOs that were surveyed agree that having information about risk is important or critical to long-term success. In addition to the aforementioned reasons, it really comes down to being able to plan for business continuity and understanding your goals for your organization. You didn’t think people wanted to know their IT risk just for amusement, did you?
IT Risk Management Methodology
Different methodologies and frameworks were created to guide the IT management process, and each has its own steps and processes. Often, you’ll find that these frameworks align with content. ISO and COBIT, for example, are very similar and so companies prepping assessments will typically choose just one or the other for content.
ISO covers information security management (policy/procedures), whereas NIST 800-53 covers actual controls/safeguards but you will find that both will have you verify that your organization employs a secure log-on procedure. Some crossover is never a bad thing as it allows you to ensure that you’re not bypassing any important areas of risk management.
Ultimately, the standards you select for your assessment are going to bring to light some degree of risk. I’ve briefly mentioned some of these, but the following standards and best practices are popular for use in understanding IT risk and are worth briefly looking into:
- COBIT
- ISO 27001
- CIS Cloud Security
- CSA Critical Controls
- NIST 800 Series & CSF
Many tools offer limited visibility and leave organizations vulnerable to threats both internally and within third-party networks. Utilizing data-driven security ratings can help you continuously monitor and measure your cybersecurity.
Feel free to sign up for a trial of CyberWatch and pick one of the suggested standards for IT risk management. We now let you select whatever content library you want to try. Let us know if you have any questions, and remember that you may want to stay in the bliss of being ignorant of your risk, but you can’t plan for what you don’t know. | https://riskwatch.com/2019/02/13/it-risk-management/ |
INTRODUCTION
============
Goats (*Capra hircus*) have been modified by humankind ever since their domestication during the late Neolithic, approximately 10,500 years ago, in the Fertile Crescent \[[@b1-ajas-19-0381]--[@b3-ajas-19-0381]\]. As domesticated goats spread from the Fertile Crescent, humans exerted minor selection pressure. The largest genetic change happened through natural selection and random genetic drift, the latter causing genes to be fixed in small populations \[[@b4-ajas-19-0381]\]. As humans began to exert selection pressure on domesticated goats, geographical differences arose and those differences have been noted in various studies \[[@b5-ajas-19-0381]--[@b7-ajas-19-0381]\]. Two major historical events shaped the raising of goats in Europe, especially northern Europe, and have had an impact on dairy goats worldwide. The first event, which happened approximately 3,000 years after the domestication of the goat, was a small mutation in the human population \[[@b8-ajas-19-0381]\]. This mutation was in a regulatory region near the gene for lactase that allowed lactose tolerance to persist into adulthood \[[@b9-ajas-19-0381],[@b10-ajas-19-0381]\]. With this mutation, goats and cattle could serve another important role other than meat and hides. Milk is a complete food, easily digested, and easily obtained from domesticated, lactating ruminants. This mutation was so important that nearly all Europeans and people of European descent carry this mutation. The second event was the defeat of the Umayyad army by Charles Martel and his Frankish troops near Poitiers (central France) in 732 BCE \[[@b11-ajas-19-0381]\]. One of the items left behind by the hastily retreating Umayyad forces were their goats that they used for milk and cheesemaking. This region of France has become the premier commercial dairy goat hub in the world \[[@b12-ajas-19-0381]\]. With increased selection, regional phenotypic differentiation became more apparent. Interest grew in standardizing animals and later in improving their productivity and one of the early pioneers of breed standardization and improvement was Robert Bakewell, who is considered to be the father of modern animal improvement \[[@b13-ajas-19-0381]\]. From Bakewell's time on, humans have used many tools to assist in the amelioration of dairy goats. The objective of this paper is to examine those tools. These tools generally include genetic evaluation (biometrics), and most recently genomics.
BIOMETRICS
==========
Early biometric studies in dairy goats focused upon estimating heritabilities \[[@b14-ajas-19-0381]--[@b16-ajas-19-0381]\], which are needed for predicting breeding values, the main component in any genetic evaluation and breed improvement program \[[@b17-ajas-19-0381]\] and upon the estimation of genetic correlations. In addition to the aforementioned genetic studies, projection and adjustment factors specifically for dairy goats were developed \[[@b18-ajas-19-0381]\]. The 305-d lactation, which is the standard lactational length in dairy cattle and by default is the standard lactational length in dairy goats in the United States, was divided into 13 stages, with the shortest stages in early lactation. Sets of factors were developed for four ages at freshening, two seasons, two levels of herd production, and two breed groups \[[@b18-ajas-19-0381]\]. Theses projection factors enabled dairy goat producers to compare objectively records of goats at all stages of lactation. These projected records also enabled more accurate culling and breeding decisions and were a first step towards genetic evaluations of goats, which was to come later. Multiplicative age-season adjustment factors for milk and fat yields of five breeds of dairy goats were also estimated and published \[[@b19-ajas-19-0381]\]. These adjustment factors reflected the changes in milk and fat yields associated with age and season of freshening. As in dairy cattle, these adjustment factors indicated that milk records of goats are affected differently in different seasons for a particular age. Prior to the development of these adjustment factors, goat records were adjusted using age factors for dairy cows \[[@b19-ajas-19-0381]\]. In the early 1980's, genetic evaluations of production traits of milk and fat yields soon followed and in 1989, genetic evaluation of dairy goats was extended to include evaluation of protein yield and also in 1989, evaluations of milk, fat, and protein yields for Oberhasli and experimental breeds were added \[[@b20-ajas-19-0381]\]. Diverse genetic background of parents was accounted for with an animal model that included all animal relationships. Due to a smaller sample size, the animal model system implemented for dairy goats differed from the one for dairy cattle in that all breeds were processed simultaneously. Genetic trend in 1984 for the five breeds with largest population sizes ranged from 3.8 to 5.2 kg/yr for milk yield. These changes in evaluation procedures improved the usefulness of dairy goat evaluations and aided the dairy goat industry in making genetic improvement \[[@b20-ajas-19-0381]\].
In 1997, type traits were included in the genetic evaluation \[[@b21-ajas-19-0381]\]. Covariance components for final score and 13 linear type traits of dairy goats were estimated by multitrait restricted maximum likelihood using canonical transformation with an animal model. Heritabilities estimates from that study are presented in [Table 1](#t1-ajas-19-0381){ref-type="table"}. Genetic correlations of linear type traits and final score were positive except for dairyness (−0.15) and teat diameter (−0.10); the largest correlations with final score were 0.66 for fore udder attachment, 0.44 for rear udder arch, 0.36 for rump width, and 0.30 for strength \[[@b21-ajas-19-0381]\]. Later refinements to the animal model were made and genetic progress has continued to chart production and type traits \[[@b22-ajas-19-0381],[@b23-ajas-19-0381]\].
The most recent advancement in the genetic evaluation of production traits in dairy goats has been the incorporation of the test-day model \[[@b24-ajas-19-0381]\]. Test day data for daily milk yield and fat, protein, and lactose content have been analyzed using four test day models with different methodologies to address fixed effects. The reference model contained a fixed effect of year-season of kidding with regression on polynomials nested within the year-season classes, and a random effect of herd test day. In the second model the lactation curve effect from the reference model was replaced by a fixed effect of days in milk (in 3-d periods), the same for all year-seasons of kidding. Two other models were obtained from the reference model by removing the fixed year-season of kidding effect and considering the herd test day effect as either fixed or random, respectively. The models were compared by using two criteria: mean-squared error of prediction and a test of bias affecting the genetic trend. The mean-squared error of prediction indicated a preference for the model with random herd test-day effect, whereas bias preferred the model with the fixed effect of days in milk. Heritability estimates for daily milk yield and milk fat and protein content were 0.26 and 0.24 to 0.27 ([Table 1](#t1-ajas-19-0381){ref-type="table"}), respectively \[[@b24-ajas-19-0381]\]. Generally, biometric studies have switched from classical studies on heritabilities and genetic correlations of milk and component yields to studies involving longevity \[[@b25-ajas-19-0381]\] or incorporating genomic information into standard genetic evaluations \[[@b26-ajas-19-0381]\].
GENOMICS
========
In the beginning of the genomics era in the early 1990's, research studies investigated the influence of major genes upon productivity traits but has evolved rapidly \[[@b27-ajas-19-0381]--[@b29-ajas-19-0381]\]. Marker- or gene-assisted selection has been applied to the α~s1~-casein gene in goats. One study stated that "... the selection for major genes will be more profitable at the breed level if an efficient breeding scheme is already running to be able to account for these optimizations over time \[[@b27-ajas-19-0381]\]". The knowledge of major genes affecting dairy traits in goats has been well established for protein, and more precisely casein content which is the main component of milk protein. So far, seven variants corresponding to 14 alleles have been identified in many European breeds \[[@b30-ajas-19-0381],[@b31-ajas-19-0381]\] and classified according to their synthesis rate of α~s1~-casein as 'strong' (A, B, C), 'intermediate' (E), 'weak' (F,G) and 'null' (O) when α~s1~-casein is absent. The quantitative effects of goat α~s1~-casein variants on dairy traits were studied and have indicated that the difference for protein content between the extreme genotypes AA (favorable) and FF was 4.5 g/kg. These results indicate that milk from AA goats have higher protein, casein, and fat content, and a higher casein: protein ratio than milk from FF goats. A major gene such as α~s1~-casein can also explain a major portion of the total genetic variation in protein content. One study compared estimates of genetic parameters for Alpine goats using an animal model including or excluding α~s1~-casein fixed effect \[[@b28-ajas-19-0381]\]. The heritability of protein content changed from 0.66 to 0.34 when the α~s1~-casein effect was accounted for, showing that variance at this major gene represents about 50% of total genetic variance of protein content in this goat population \[[@b28-ajas-19-0381]\]. When ignoring or accounting for α~s1~-casein, genetic correlations between protein yield and protein content were 0.09 and −0.22, respectively \[[@b28-ajas-19-0381],[@b32-ajas-19-0381]\].
In a recent study in China, a variant within the α~s1~-casein gene (a 11-bp indel variant determined as II, ID, or DD) was related to primiparous litter size in five breeds of Chinese goats. Individuals with the II genotype had the largest litter size when compared with ID or DD genotypes \[[@b33-ajas-19-0381]\]. The authors propose that the 11-bp indel variant (II) could be an effective molecular marker for increasing litter size of goats.
From major genes, the genomic focus shifted to microsatellites for parentage testing \[[@b34-ajas-19-0381]--[@b36-ajas-19-0381]\]. Microsatellites, also called short tandem repeats or simple sequence repeats, are scattered throughout the genome of all mammalian species. Microsatellites are identified by constructing polymerase chain reaction (PCR) primers for the DNA flanking the microsatellite region. In one of the original studies on PCR primers, two multiplex systems spanning 11 microsatellite loci each were evaluated for parentage testing in goats \[[@b34-ajas-19-0381]\]. Eight of the loci originated from goats, nine were from cattle and five were from sheep, with 18 of the loci mapped to 16 different autosomes. Parentage exclusion probabilities were computed to be greater than 0.999999 with the probability of finding two identical genotypes is less than 10^−15^. Thus, microsatellite markers are a very reliable tool for parentage identification. The number of PCR primers is periodically evaluated and the number of recommended primer is now 14 ([Table 2](#t2-ajas-19-0381){ref-type="table"}) \[[@b37-ajas-19-0381]\]. Ancillary to parentage testing, microsatellite markers have been used in pedigree verification \[[@b38-ajas-19-0381]\]. Of the 388 pedigree verifications (dam-offspring) in a nucleus herd of Murciano-Granadina goats in Spain, 71.9% (279) resulted compatible, while 16.2% (63) were incompatible. These errors were probably due to the archaic system used for animal identification and for data transfer. Thus, microsatellite should be considered for verification to reduce errors. This is important because only about a 10% parentage misidentification can reduce genetic progress by as much as 4% \[[@b38-ajas-19-0381]\].
Microsatellites have also been used to evaluate genetic distances among breeds, which is a tool used in the conservation and management of animal genetic resources, especially the conservation of endangered indigenous breeds \[[@b39-ajas-19-0381]--[@b41-ajas-19-0381]\]. In a genetic diversity study on nine dairy breeds of Canary Islands goats (Fuerteventura - Feral Esquinzo, Fuerteventura - Feral Ajui-Costa, Fuerteventura - Domestic, Gran Canaria, Lanzarote, La Gomera, La Palma, North Tenerife, and South Tenerife) using 27 microsatellite markers, a mean of 5.9 alleles per population per marker was found and F~IS~ values ranged between 0.45 and −0.48, and F~ST~ was 0.04 \[[@b42-ajas-19-0381]\]. In a structured population, the fixation index, F, is the reduction in heterozygosity relative to Hardy-Weinberg expectation \[[@b43-ajas-19-0381]\]. F can be partitioned into three levels. F~IT~ is the measure of an individual (I) relative to the total population (T), F~IS~ is the measure of an individual (I) relative to the subpopulation (S), and F~ST~ is the measure of a subpopulation (S) relative to the total (T) \[[@b43-ajas-19-0381]\]. F~IS~ (inbreeding coefficient) is interpreted as a correlation measure between alleles rather than a probability, which means that it can have negative values. Positive values of F~IS~ indicate that the individual is less heterozygous than expected given the subpopulation's heterozygosity, i.e. inbred, and negative values of F~IS~ indicate that the individual is more heterozygous then expected given the subpopulation, i.e. outbred. High F~ST~ (gene fixation coefficient) implies a considerable degree of differentiation among populations. In this Canary Island study, an F~ST~ of only 0.04 indicates that most of the breeds were genetically similar indicating a high degree of interbreeding.
In a study on Chinese dairy goats, the genetic diversity of six breeds, four developed breeds (Guanzhong, Laoshan, Wendeng, and Xinong Saanen) and two introduced breeds (Saanen and Nubian), was examined using 15 microsatellite markers \[[@b44-ajas-19-0381]\]. A mean of 4.9 alleles per population per marker was found, F~IS~ values ranged between 0.09 and −0.08, and F~ST~ was 0.08. The four native Chinese breeds share a common ancestor of Saanen, which was imported from Europe many decades before. There was close genetic relationship between Wendeng and Laoshan and between Guanzhong and Xinong Saanen, which were both in agreement with the formation history and geographical distribution of the breeds in China. As expected, Nubian was genetically distant from Saanen and the four Chinese breeds.
In a Thai dairy goat study on genetic diversity, five imported breeds (Alpine, Jamunapari, Nubian, Saanen, and Toggenburg) were evaluated using five microsatellite markers \[[@b45-ajas-19-0381]\]. A mean of 7.4 alleles per population per marker was found, F~IS~ values ranged between 0.18 and −0.04, and F~ST~ was 0.07. As expected, Alpine, Saanen, and Toggenburg provided one phylogenetic cluster while Jamunapari and Nubian provided two other clusters.
In a Brazilian dairy goat study, Moxotó, which is a local goat breed well-adapted to semiarid Northeast Brazil, was compared to two exotic dairy goat breeds (Alpine and Saanen) using 11 microsatellite markers \[[@b46-ajas-19-0381]\]. Northeast Brazil has the greatest number of goats in the country and imported goat breeds are being crossed with Moxotó, which is eroding the genetic base of the Moxotó. Means of 7.0 alleles for Alpine and Saanen and 3.5 for Moxotó were found, and F~IS~ values ranged between 0.32 and −0.10. F~ST~ was higher for herds (F~ST~ S = 0.08) than for breeds (F~ST~ P = 0.03), indicating similarity between the imported breeds and the existence of crosses between them. As expected, the genetic distance was greatest between Moxotó and the imported breeds, which were of similar phylogenetic clusters.
In addition to the above usages of microsatellite markers, they have been used to verify dairy goat products \[[@b47-ajas-19-0381]\]. Adulteration of cheeses and other dairy goat products can affect the profitability of many small-scale goat producers. An easy method of authentication can contribute to breed sustainability and conservation and improve profitability for dairy goat producers. This could have a significant impact on the rural economy of particular geographic areas with protected status. The Girgentana is an endangered goat breed from Sicily (Italy) and has semi-protected status \[[@b48-ajas-19-0381],[@b49-ajas-19-0381]\]. A panel of 20 microsatellite markers were used on Girgentana, Maltese, and Derivata di Siria goats and eight microsatellite markers alleles were present in Maltese and Derivata di Siria goats but absent in Girgentana goats. Three microsatellite markers (FCB20, SRCRSP5, and TGLA122) were concluded to be the best set of markers, and the authors proposed that these three microsatellite markers could be applied in a breed genetic traceability system of Girgentana dairy products in order to detect adulteration due to Maltese and Derivata di Siria goat breeds.
The successor to microsatellite markers is single nucleotide polymorphisms, frequently called SNPs (pronounced "snips"). A SNP is the single-pair difference at a specific location on specific chromosome. For example, a SNP can occur when the nucleotide cytosine (C) is replaced with the nucleotide thymine (T). SNPs occur normally throughout the genome of all livestock species, including goats. Under the umbrella of the International Goat Genome Consortium (IGGC, <http://www.goatgenome.org/>), several research projects involved in sequencing the goat genome successfully identified approximately twelve million high quality SNP variants in the goat genome \[[@b50-ajas-19-0381]\]. The goal of the IGGC was to create a SNP database including biological and technical characteristics using reliable bioinformatic SNP detection procedures. In addition, the technological success rate of the SNP design, which included even spacing of SNPs on the genome and selection of minor allele frequencies (MAF) suitable to use in diverse breeds, was an important aspect of IGGC's SNP database. The SNPs were identified within and between six breeds (Alpine, Boer, Creole, Katjang, Saanen, and Savanna), providing for a robustness for breeds that were even not part of the original study \[[@b51-ajas-19-0381]\]. Validation of the SNP content was conducted with ten goat breeds and 52,295 SNPs were successfully genotyped and used in the manufacturing of a SNP chip (Illumina, Inc, San Diego, CA, USA). The development of the 52K goat SNP chip has accelerated advances in goat genomic studies.
The most obvious starting point for the SNP chip was in evaluating production traits \[[@b52-ajas-19-0381],[@b53-ajas-19-0381]\]. Shortly after the development of the 52K goat SNP chip, a genome-wide association study (GWAS) was conducted on economically important production traits in dairy goats in the UK \[[@b53-ajas-19-0381]\]. A GWAS combines the resulting genotypic data from the SNP chip with phenotypic data such as milk yield \[[@b54-ajas-19-0381]\]. The GWAS on UK dairy goats examined milk yield and udder conformation traits \[[@b53-ajas-19-0381]\]. In that study, the phenotypic data consisted of a total of 137,235 milk yield records on 4,563 goats each scored for 10 conformation traits (udder traits of udder furrow, udder depth, and udder attachment, teat traits of teat shape, teat angle, and teat placement, and feet and leg traits of front legs, back legs, front feet, back feet). The genotypic data consisted of 2,381 of the 4,563 goats genotyped with the 52K goat SNP chip. A genome-wide significant SNP for milk yield was identified on chromosome 19 with additional lesser influential SNPs on chromosomes 4, 8, 14, and 29. Three genome-wide significant SNP for conformation of udder attachment, udder depth, and front legs were identified on chromosome 19 with lesser influential SNPs on chromosomes 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, 21, 23, and 27. However, the proportion of total variance explained by the significant SNPs was low and ranged between 0.4% and 7.0% for milk yield and between 0.1% and 13.8% for conformation traits, thus confirming the polygenic nature of these traits. This conclusion was later supported by a smaller GWAS study on milk yield in U.S. dairy goats \[[@b55-ajas-19-0381]\].
SNPs and GWAS have great potential for traits that are hard or costly to measure \[[@b56-ajas-19-0381]\], and udder health traits are exactly that type of trait because they not only influence milk production but also animal health, milking ability, and longevity. A study in France performed a GWAS on somatic cell count (SCC) as an indirect measure of mastitis resistance \[[@b57-ajas-19-0381]\]. The phenotypic data for the GWAS consisted of SCC on 1,941 Alpine and Saanen goats sired by 20 artificial insemination bucks and the genotypic data of those same females genotyped with the 52K goat SNP chip (Illumina Inc., USA). In the Saanen breed, a genome-wise significant SNP for SCC was identified on chromosome 19, with a region of 33 to 42 Mb in length that included candidate genes associated with response to intramammary infections (retinoic acid receptor α \[*RARA*\], and Janus kinase signaling pathway genes \[*STAT3*, *STAT5A*, and *STAT5B*\]). These SNP effects were not present in the Alpine breed. In an Eastern European study using significantly lower animal numbers, researchers found 10 candidate genes (pentraxin 3 \[*PTX3*\], interleukin-6 \[*IL6*\], C-type lectin domain family 4 member \[*CLEC4E*\], interleukin 8 \[*IL8*\], interleukin 1 receptor antagonist \[*IL1RN*\], interleukin 15 receptor subunit alpha \[*IL15RA*\], tumor necrosis factor superfamily member 13 \[*TNFSF13*\], suppressor of cytokine signaling 3 \[*SOCS3*\], tumor necrosis factor \[*TNF*\], and toll-like receptor 3 \[*TLR3*\]) for resistance to mastitis and gastrointestinal parasitism \[[@b58-ajas-19-0381]\].
Another GWAS study in France examined supernumerary teats (SNT) in goats \[[@b59-ajas-19-0381]\]. Supernumerary teats are undesirable due to impaired machine-milking efficiency, which can increase milking time and lead to possible injury of the udder. The phenotypic data for the GWAS consisted of SNT score (present or absent) on 810 Saanen goats sired by nine artificial insemination bucks and 1,185 Alpine goats sired by 11 artificial insemination bucks and the genotypic data of those same females genotyped with the 52K goat SNP chip (Illumina Inc., USA). No significant SNP effects were found and there was no evidence of segregation of a major gene for SNT in Saanen and Alpine breeds, thus indicating the polygenic nature of this trait.
As with microsatellite marker, a reduced panel SNP chip has been proposed for use in parentage and pedigree verification \[[@b60-ajas-19-0381]\]. In an Italian study, the 52K goat SNP chip (Illumina Inc., USA) was used to develop a 3-step procedure to identify a low-density SNP panel for highly accurate parentage assessment. A reference sample of 109 Alpine goats with known pedigree relationships was genotyped using the 52K chip, then the authors identified a panel of 200 SNPs that was further reduced to two final panels of 130 and 114 SNPs with random coincidental match inclusion (probability of finding two identical genotypes as mentioned earlier in microsatellites) of 1.51×10^−57^ and 2.94×10^−34^, respectively. In the reference data set of 109 Alpine goats, both panels correctly identified all parent--offspring relationships. Further work by these researchers constructed a 195 SNP panel with even greater accuracy \[[@b61-ajas-19-0381]\]. Thus, a reduced panel SNP chip could substitute for microsatellite markers but with a much higher degree of accuracy.
GWAS studies can also identify candidate genes affecting production traits \[[@b62-ajas-19-0381]\]. In a French GWAS, a diacylglycerol O-acyltransferase 1 (*DGAT1*) gene on chromosome 14 was identified as a functional and positional candidate gene affecting fat content. A reference sequence of the *DGAT1* gene was completed and 29 polymorphisms were found, including two novel mutations, R251L and R396W. In the Saanen breed, the frequency of the R251L mutation was 3.5%. In both Saanen and Alpine breeds, the frequency of the R396W mutation was 13% and 7%, respectively. Both mutations were associated with a notable decrease in milk fat content.
GENOMIC SELECTION
=================
Combining biometrics and genomics yields genomic selection \[[@b54-ajas-19-0381],[@b63-ajas-19-0381]\]. Genomic selection methods yield genomic estimated breeding values (GEBV), which are more accurate than estimated breeding values (EBV) \[[@b64-ajas-19-0381]\]. French researchers are at the forefront in calculating and utilizing GEBV. In France, all Alpine and Saanen progeny-tested bucks were genotyped using the Illumina 52K goat SNP chip. A reference population consisted of 677 bucks and 148 selection candidates. Using a single-step approach with genomic best linear unbiased prediction (GBLUP), prediction accuracy of candidates was improved from 22% to 37% for both breeds compared to the two-step method and was greater than that based on parent average of official evaluations \[[@b65-ajas-19-0381]\]. From that study, the across-breed heritability estimates are presented in [Table 1](#t1-ajas-19-0381){ref-type="table"} and are similar to heritability estimates for yield traits that were calculated nearly four decades earlier \[[@b14-ajas-19-0381]\] and type traits calculated nearly two decades earlier \[[@b21-ajas-19-0381]\].
Also, in France, three weighted single-step GBLUP (ssGBLUP) methods were more efficient for detecting SNPs associated with protein content (α~s1~-casein) and yielded a better prediction of genomic breeding values than unweighted ssGBLUP \[[@b66-ajas-19-0381]\]. Unweighted ssGBLUP was also compared to a gene content method that was previously developed to account for multiple α~s1~-casein alleles \[[@b67-ajas-19-0381]\]. However, the gene content method did not improve accuracies of genomic evaluations compared to ssGBLUP probably due the small number of animals genotyped (3,696 Alpine and 3,506 Saanen). The weighted ssGBLUP methods put more weight on SNPs with larger effects, improved accuracies of genomic evaluation over ssGBLUP, and had the added advantage of faster computing, were simpler, and required ssGBLUP to be run only twice.
An English GWAS used single step genomic selection to estimate breeding values (GEBV) for feed efficiency and body weight in a dairy goat herd \[[@b68-ajas-19-0381]\]. Feed accounts for the largest proportion of costs in dairy farming. There are differences in the efficiency of individual animal's ability to convert energy to milk and the genetic improvement of feed efficiency could reduce feed costs per unit of output. The accuracy of GEBV were low for this population (0.28 for both traits); however, the authors stated that records have only been collected for the last year and the validation population only contained 320 individuals. However, as the reference population containing related animals increases, accuracy is expected to increase also.
A recent study in Spain, using 50,649 lactation records on 19,067 goats of the Florida breed which represented daughters of 4,397 dams and 500 sires, indicated that ssGBLUP methodology increased average reliability of the estimations by 1.06% over classical BLUP methodology \[[@b26-ajas-19-0381]\]. The correlation between A (pedigree relationship) matrix and G matrix was 0.826, which indicated a moderate degree of misidentification of parentage. The correlation between the EBV and GEBV was 0.989 but when only the EBVs of the animals genotyped were compared, the correlation between the estimates obtained with both approaches decreased to 0.952. However, the average reliability of the estimates increased by 5.86%. This increased reliability might be similar to the previous reliability because only 625 animals representing 538 dams and 87 sires were genotyped with the Illumina 52K goat SNP chip.
CONCLUSION
==========
In the most recent history of the dairy goat, biometric and genomic approaches have been used to select animals of highest genetic merit, and therefore, to improve breeds. Biometric approaches have concentrated upon more accurate estimates of heritabilities and genetic correlations, the former is used in the EBV and the latter is used in the formulation of selection indices. EBV and selection indices have been used in various countries to improve milk, fat, and protein yields. The genomics approach started with microsatellite markers, which have been very important in parentage determination and in genetic conservation studies. Microsatellite markers are an inexpensive means to determine genetic diversity within and across breeds. Most recently, genomics has focused upon SNP and the wealth of information that this technology brings.
**CONFLICT OF INTEREST**
We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.
Support was provided by the USDA National Institute for Food and Agriculture (NIFA) Evans-Allen Project OKLUSAHLU2017 (accession number 1012650).
######
Heritability estimates for production and type traits using a biometrical or genomics approach \[citation follows the estimates\]
Trait Biometrical Genomics
----------------------- ------------------------------ ------------------------------
Milk yield (kg) 0.26 \[[@b24-ajas-19-0381]\] 0.30 \[[@b65-ajas-19-0381]\]
Fat (%) 0.24 \[[@b24-ajas-19-0381]\] 0.30 \[[@b65-ajas-19-0381]\]
Protein (%) 0.27 \[[@b24-ajas-19-0381]\] 0.30 \[[@b65-ajas-19-0381]\]
Final score 0.27 \[[@b21-ajas-19-0381]\]
Stature 0.52 \[[@b21-ajas-19-0381]\]
Strength 0.29 \[[@b21-ajas-19-0381]\]
Dairyness 0.24 \[[@b21-ajas-19-0381]\]
Teat diameter 0.38 \[[@b21-ajas-19-0381]\]
Rear legs 0.21 \[[@b21-ajas-19-0381]\]
Rump angle 0.32 \[[@b21-ajas-19-0381]\]
Rump width 0.27 \[[@b21-ajas-19-0381]\]
Fore udder attachment 0.25 \[[@b21-ajas-19-0381]\] 0.29 \[[@b65-ajas-19-0381]\]
Rear udder height 0.25 \[[@b21-ajas-19-0381]\] 0.27 \[[@b65-ajas-19-0381]\]
Rear udder arch 0.19 \[[@b21-ajas-19-0381]\]
Udder depth 0.25 \[[@b21-ajas-19-0381]\] 0.31 \[[@b65-ajas-19-0381]\]
Suspensory ligament 0.33 \[[@b21-ajas-19-0381]\] 0.34 \[[@b65-ajas-19-0381]\]
Teat placement 0.36 \[[@b21-ajas-19-0381]\] 0.29 \[[@b65-ajas-19-0381]\]
######
Microsatellites panel primers for parentage testing in goats
Marker Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′) Fragment sizes in bp
---------- --------------------------------- --------------------------------- ----------------------
CSRD247 GGACTTGCCAGAACTCTGCAAT CACTGTGGTTTGTATTAGTCAGG 216--240
ILSTS008 GAATCATGGATTTTCTGGGG TAGCAGTGAGTGAGGTTGGC 174--182
ILSTS19 AGGGACCTCATGTAGAAGC ACTTTTGGACCCTGTAGTGC 146--152
ILSTS87 AGCAGACATGATGACTCAGC CTGCCTCTTTTCTTGAGAGC 133--151
INRA005 TTCAGGCATACCCTACACCACATG AAATATTAGCCAACTGAAAACTGGG 115--121
INRA006 AGGAATATCTGTATCAACCGCAGTC CTGAGCTGGGGTGGGAGCTATAAATA 107--123
INRA023 GAGTAGAGCTACAAGATAAACTTC TAACTACAGGGTGTTAGATGAACTC 195--215
INRA063 GACCACAAAGGGATTTGCACAAGC AAACCACAGAAATGCTTGGAAG 171--177
MAF65 AAAGGCCAGAGTATGCAATTAGGAG CCACTCCTCCTGAGAATATAACATG 117--135
MCM527 GTCCATTGCCTCAAATCAATTC AAACCACTTGACTACTCCCCAA 152--164
OARFCB20 GGAAAACCCCCATATATACCTATAC AAATGTGTTTAAGATTCCATACATGTG 95--105
SRCRSP5 GGACTCTACCAACTGAGCTACAAG TGAAATGAAGCTAAAGCAATGC 163--179
SRCRSP8 TGCGGTCTGGTTCTGATTTCAC CCTGCATGAGAAAGTCGATGCTTAG 220--240
SRCRSP23 TGAACGGGTAAAGATGTG TGTTTTTAATGGCTGAGTAG 77--103
| |
CROSS-REFERENCE TO RELATED APPLICATIONS
STATEMENT REGARDING SPONSORED RESEARCH
FIELD OF THE INVENTION
BACKGROUND OF THE INVENTION
SUMMARY OF THE INVENTION
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
The present invention claims the benefit of U.S. Provisional Patent Application Ser. No. 61/253,008 filed Oct. 19, 2009.
This invention was made with government support under Grant No. ZXL-5-44205-01 awarded by the U.S. Department of Energy, National Renewable Energy Laboratory. The government has certain rights in this invention.
The present invention relates generally to photovoltaic cells and the layered structure thereof. More particularly, the present invention relates to a back contact buffer layer of a thin-film photovoltaic cell.
There is no admission that the background art disclosed in this section legally constitutes prior art.
It is well known that solar cells or photovoltaic cells (PV cells) can be used to convert solar energy into current and voltage, or electric energy. Typical photovoltaic cells include a substrate and two ohmic contacts (i.e., electrode layers) for passing current to an external electrical circuit. The cell also includes an active semiconductor junction, usually comprised of two or three semiconductor layers in series. The two-layer type of semiconductor cell consists of an n-type layer and a p-type layer. The three-layer type includes an intrinsic (i-type) layer positioned between the n-type layer and the p-type layer for absorption of light radiation. The photovoltaic cells operate by having readily excitable electrons that can be energized by solar energy to higher energy levels, thereby creating positively charged holes and negatively charged electrons at the interface of various semiconductor layers. The creation of these positive and negative charge carriers creates a net voltage across the two electrode layers in the photovoltaic cell, and establishes a current of electricity.
In order to improve the performance of photovoltaic cells, it is advantageous to decrease the thickness of the various protective and active layers to reduce materials usage and weight, improve mechanical flexibility, and improve light transmissibility into and through the structure. Thin-film and ultra-thin-film photovoltaic cells utilize thin-film semiconductor materials to form the various active layers of the cells. These thin film semiconductor materials offer several distinct advantages over thicker crystalline materials, insofar as they can be easily and economically fabricated into a variety of devices by mass production processes.
As the thickness of the various functional layers decreases, the impact of defects within the layer structures and at the layer junction interfaces becomes more pronounced. One such defect is the presence of current-shunting, short circuit defects. These defects seriously impair the performance of the photovoltaic devices fabricated from thin film semiconductor materials and also detrimentally affect production yield. These process-related defects are thought to either be present in the morphology of the substrate electrode, or develop during the deposition or subsequent processing of the semiconductor layers.
Shunt defects are present in photovoltaic devices when one or more low resistance current paths develop through the semiconductor body of the device, allowing current to pass unimpeded between the electrodes thereof. Under operating conditions, a photovoltaic device in which a shunt defect has developed, exhibits either (1) a low power output, since electrical current collected at the electrodes flows through the defect region (the path of least resistance) in preference to an external load, or (2) complete failure where sufficient current is shunted through the defect region to “short out” the device.
16
12
14
17
In certain instances, barrier layers may provide passivation of shunt defects. U.S. Pat. No. 4,251,286 to Barnett shows PV cells having n- and p-layers made from copper sulfide and cadmium sulfide forming a heterojunction interface. In one embodiment, the PV cells may include a blocking layer () of zinc sulfide formed between the collector p-layer () and the back contact (). In another embodiment, the blocking layer may be a localized cadmium sulfate layer () disposed on the exposed portions of the cadmium sulfide active layer.
U.S. Pat. No. 4,598,306 to Nath et al. shows barrier layers formed from oxides, nitrides and carbides of indium, tin, cadmium, zinc, antimony, silicon, and chromium. These barrier layers are transparent and preferably applied between a transparent electrode and the semiconductor body. Such barrier layers were applied to amorphous silicon p-i-n-PV cells having a stainless steel back contact.
U.S. Pat. No. 7,098,058 to Karpov et al. discloses a method of applying a bonding material onto a semiconductor layer having electrical non-uniformities. The formed semiconductor layers of a photovoltaic cell are immersed into a solution of the bonding material and an electrolyte. The semiconductor layers are energized by way of light energy causing an electrical potential within the semiconductor layers. The bonding material is carried to the semiconductor surface by an electrochemical reaction that causes a redistribution of the positive and negative ions of an electrolyte solution. The bonding material becomes selectively applied to areas of aberrant electric potential by way of the energized semiconductor layers.
Thus, it would be desirable to provide a buffer or barrier layer that is compatible with CdS/CdTe flexible, thin film PV cells that is effective for CdTe layers of about 0.5 microns or less and convenient to apply.
The present invention relates generally to photovoltaic cells and methods for the fabrication thereof. More particularly, the present invention relates to a photovoltaic cell having a buffer layer and a method of manufacturing photovoltaic cell having such a buffer layer.
Various aspects of this invention will become apparent to those skilled in the art from the following detailed description of the preferred embodiment, when read in light of the accompanying drawings.
FIG. 1
10
12
14
16
18
20
22
24
Referring now to the drawings, there is illustrated in a prior art photovoltaic (PV) cell, shown generally at , having two active semiconductor layers: an n-type layer formed of cadmium sulfide (CdS) , and a p-type layer formed of cadmium telluride (CdTe) . These semiconductor layers are connected between a transparent conductive oxide (TCO) front electrode and a back contact (back electrode) . A protective transparent substrate (or superstrate) , e.g., glass or polymer film, forms the outermost layer. When exposed to sunlight, the PV cell produces an electrical output, shown schematically as current flow , that powers an external load .
FIG. 1
14
26
26
26
28
26
28
24
There is also illustrated schematically in , a structural non-uniformity or electrical defect, such as a pinhole occurring in the p-type semiconductor layer , which is one example of an electrical shunt . During the metallization process, the back contact may partially fill the pinhole bridging the internal electrical pathway and causing the shunt . The shunt provides a low resistance path between the front and back electrodes, as illustrated by a short-circuited current path . Various other structural non-uniformities or defects may exist throughout portions of the semiconductor layers. They may occur for numerous reasons, and can include defects caused by the deposition process used to form the semiconductor layers or defects caused by morphological irregularities in the deposition surface of the substrate layer. The resulting short-circuit connection or shunt allows electrical current to flow directly through the PV cell, as shown by the short-circuit current path , thus bypassing the working load such as a motor or a light.
26
10
While not illustrated, other defects may also form shunts . Some examples include projections extending from one active layer to one contact or craters that reduce the material thickness of the active layers between the electrodes. Other electrical anomalies may also include weak diodes which are areas of the PV cell structure that exhibit forward current leakage paths. Materials, such as dopants used to form the various layers of the PV cell, may also diffuse through the cell layers and inhibit electrical output of the cell . In addition, PV cells have intentional discontinuities such as scribe lines, which are areas of separation within a layer, intentionally created, to electrically separate contiguous cells within a cell array.
FIG. 2
FIG. 2
100
110
100
110
100
120
100
120
120
116
120
116
112
114
116
118
112
114
110
118
114
Referring now to , there is illustrated one embodiment of a CdS/CdTe PV cell, shown generally at having a buffer layer . In one embodiment of the PV cell , the buffer layer is configured as a CdS buffer layer . The PV cell includes a substrate layer , which may alternatively be configured as a superstrate layer depending on the formation sequence of the other layers or the orientation of the PV cell relative to the overhead sun when it is used. The substrate layer may be formed from a transparent polymer such as, for example, polyimide, a glass material such as, for example, soda-lime glass, or any other suitable material through which light may pass. The substrate layer may be flexible. A TCO front contact is formed next to the substrate layer . The TCO layer may be, for example, a zinc oxide (ZnO) layer or any other transparent material capable of forming part of the PV cell electric circuit. Active semiconductor layers, such as an n-type layer and a p-type layer are in electrical communication with the TCO layer and a back contact layer . In the embodiment shown in , the semiconductor layers are an n-type CdS layer and a p-type CdTe layer . Alternatively, other materials or alloys, such as Group II-VI alloys, may be used to form the semiconductor layers. Though not shown, an intrinsic (i.e., i-type) layer may be deposited between the n-type and p-type layers, forming a p-i-n semiconductor configuration. Alternatively, the semiconductor layers may be a plurality of interconnected p-n or p-i-n semiconductor layers. Additionally, the semiconductors layers may be arranged as n-p or n-i-p layers. In one non-limiting example, the CdS buffer layer is formed between the back contact and the CdTe p-layer in a multilayer CdTe-based solar cell.
FIG. 3
FIG. 1
FIG. 2
FIGS. 3-5
110
200
10
26
210
100
110
110
100
114
114
As shown in , there are illustrated box-and-whisker plots of conversion efficiencies of cells with and without the CdS back buffer layer . The box-and-whisker plot illustrates the conversion efficiency (Y-axis, expressed as percentage) of a standard PV cell, similar to the PV cell of without the shunt . The box-and-whisker plot is a comparative efficiency plot of the PV cell . Data generated from tests of the above-described CdS/CdTe p-n PV cell embodiment, similar to the embodiment of , shows a substantial increase in conversion efficiency of a thin-film PV device having the CdS buffer layer . This buffer layer is also effective for ultra-thin film PV devices. In the embodiment of the PV cell used to develop the plots shown in , the CdTe layer is approximately 0.3 microns (nm). The thickness of the CdTe layer , however, may be 0.5 μm or less.
110
10
100
10
220
10
230
110
100
220
230
100
230
10
240
250
100
FIGS. 3-5
FIG. 4
FIG. 1
FIG. 5
The addition of the CdS buffer layer , as shown in the box-and-whisker plots of , has particular advantages in efficiency and yield of the solar cells. Referring now to , there is illustrated a comparative plot of open circuit voltages (Y-axis, expressed in volts) for the PV cell and the buffered PV cell . As referred to in describing the comparative box-and-whisker plots, the PV cell was constructed without an electrical defect, as shown in . The plot shows a lower range of open circuit voltage for the conventional PV cell . The plot illustrates the improvement made by the addition of the back buffer layer in the buffered PV cell . As can be seen from the comparative plots and , the PV cell exhibits a more consistent and higher value for open circuit voltage as shown by the higher and narrower box portion of the plot . As shown in , the fill factor (Y-axis, expressed as percentage) of the PV cell , shown as plot , exhibits a lower fill factor percentage than shown by plot representing the PV cell .
110
100
114
10
14
114
110
FIGS. 3-5
FIGS. 3-5
The presence of the CdS buffer layer allows the PV cell to be made with a thinner CdTe p-type layer than has been generally possible on prior PV cells, such as PV cell . In certain embodiments, an ultra-thin CdTe layer may be on the order of 0.5 micron (500 nm) or less in thickness. Additionally, thickness ranges outside of those for the ultra thin CdTe layer may also be similarly benefitted. The data, plotted in , was generated with PV cells having a p-type CdTe layer and of approximately 0.3 microns in thickness. These box-and-whisker plots illustrate three important figures of merit (efficiency, open circuit voltage, and fill-factor) for ensembles of 35 small-area cells. (The box and whisker plots indicate the median value as the interior line, the top and bottom of the box indicates the 75% and 25% percentile, and the extremes show the 95% and 5% percentiles.) As shown in , the shunt-passivation properties of the CdS buffer layer provide increased conversion efficiencies, increased open-circuit voltage, and increased percentage of fill-factor.
FIGS. 6 and 7
FIGS. 6 and 7
FIG. 6
FIG. 2
FIG. 1
10
100
270
100
10
10
100
110
100
110
Referring now to the box-and-whisker plots of , there are illustrated comparative efficiency plots of conventional PV cells, similar to the PV cell , and CdS buffered PV cells, similar to the PV cell . The data, plotted in , was generated from PV cells having a CdTe p-type layer thickness of approximately 0.5 microns. As shown in , the plot of efficiency of the buffered PV cell shows the average efficiency to be higher by about 2% absolute and the variation of efficiency is smaller than for PV cell . PV cell differs from PV cell in that a back buffer layer of has been added to the structure of . In one embodiment of the PV cell , buffer layer consists of a sputtered CdS layer.
110
110
112
110
It is to be understood that, in PV cells, CdS is used as an n-type semiconductor layer. As such, applying another layer formed from an n-type material, such as CdS, to create a n-type CdS/p-type CdTe/n-type CdS cell structure would normally be highly unfavorable for solar cell operation. The inventors herein have discovered that the insertion of a CdS buffer layer results in remarkably improved cell performance. While not wishing to be bound by theory, the inventors believe that the improvements in PV cells may be due, in part, to an altered property of the CdS buffer layer . The CdS back buffer layer , unlike the front CdS active layer , changes its conductivity type to intrinsic or slightly p-type during the post-deposition steps of the fabrication process. The resulting CdS buffer layer serves as a buffer/passivation layer at CdTe/Back contact interface.
118
110
100
118
118
118
While not wishing to be bound by theory, the inventors now believe that the presence of the back contact may also influence the change in conductivity of the CdS buffer layer to intrinsic or slightly p-type during the post-deposition steps of the fabrication process. In one embodiment of the PV cell , the back contact can be made from or include, for example, elemental forms of one or more of copper, silver, gold, titanium, carbon and molybdenum. In another embodiment, the back contact may be made from any suitable conductive material, which may be doped or alloyed with, for example, elemental constituent forms of one or more of copper (Cu), silver (Ag), gold (Au), titanium (Ti), carbon (C), and molybdenum (Mo). In one embodiment, the carbon material may be a carbon nanotube material. In general, these elements may include Group I elements of the Periodic Table which, when substituted for the Group II element, i.e., cadmium (Cd) in the CdS, will tend to compensate the natural n-type activity of the adjacent CdS blocking layer. In the alternative or additionally, Group V elements may be substituted for the Group VI element, i.e., sulfur (S) in the CdS, will also tend to compensate the natural n-type activity of the adjacent CdS blocking layer. In a broad aspect of the invention, the conductive material of the back contact may be characterized by those materials exhibiting a high work function. The work function of the conductive material may be generally defined as the energy required to remove an electron from just below the surface of a substance into the vacuum space. The work function may be characterized by the energy used to liberate the electrons such as, for example, a photoelectric work function using photon energy, a thermionic work function using heat energy, and a field electron emission using an electric field. The value of work function for generally applicable conductive elements may be in the general range of approximately 4.5 to 5.5 eV. Some applicable materials, such as for example titanium (Ti), may be slightly outside of the lower end of this range.
118
300
110
300
300
110
While further not wishing to be bound by theory, the inventors believe that certain constituents in the back contact such as Cu , for example, diffuse or otherwise migrate into the CdS buffer layer . The copper exhibits a strong affinity for CdS and causes the CdS layer to lose its n-type conductivity. The Cu may change the conductivity of the CdS buffer layer to an intrinsic (i-type) layer or a slightly p-type layer.
300
110
310
300
310
110
300
310
110
310
300
110
114
112
300
300
118
300
118
110
300
110
300
110
FIG. 8
As a continuing expression of non-binding theory, the inventors believe that the Cu diffuses through the CdS buffer layer exhibiting a concentration gradient, shown generally at that is greater near the source of Cu . illustrates a schematic representation of one such concentration gradient across the CdS buffer layer . Other concentration gradients of Cu or other appropriate conductivity killing materials may be used. In one embodiment, the gradient is generally isolated to CdS buffer layer . In another embodiment, the concentration gradient of Cu diffuses through the CdS buffer layer and further diffuses through a portion of the CdTe p-type layer , terminating prior to reaching the CdS n-type layer . The diffusion of Cu can occur during the manufacturing process or after assembly and may be further based on exposure to elevated temperatures. In one embodiment, the Cu source is the back contact . In another embodiment, the Cu is applied as either a coating on the back contact , a thin elemental layer, or a dopant applied to the CdS buffer layer . In one embodiment, the diffusible Cu material may alternatively be silver, gold, molybdenum, titanium, or carbon. A target source can be provided for depositing the dopant onto the CdS buffer layer , where the target source includes at least one of copper, silver, gold, molybdenum, titanium, or carbon. The dopant can be deposited within the same deposition chamber as the CdS buffer layer. In yet another embodiment, a thermal energy input, from any suitable source, may be provided on the order of 150° C. to facilitate diffusion of the diffusible material into the buffer layer .
110
110
112
110
114
114
114
In another embodiment, the CdS buffer layer may be produced in a stoichiometric proportion of cadmium and sulfur. Such a proportion causes the CdS buffer layer to exhibit an insulating characteristic consistent with an intrinsic (i-type) layer. This stoichiometric composition of the buffer layer may be contrasted with the slightly sulfur-deficient nature of the CdS n-type semiconductor layer . Such n-type behavior in CdS may also be produced by doping with a Group III element such as indium or with a Group VII element such a chlorine. The advantage of a high resistivity CdS buffer layer is the ability to reduce the thickness of the CdTe layer , while maintaining high PV cell performance. This reduction in thickness of the CdTe layer has many benefits. Reduction in the CdTe layer thickness reduces the amount of tellurium thus lowering manufacturing costs due to the expense of tellurium, which is a rare element. A thinner CdTe layer reduces the amount of cadmium which reduces fabrication costs and reduces the potential for heavy metal pollution. Another benefit is the improved transparency of the thinner CdTe layer .
114
114
110
In certain embodiments, improved transparency through a thinner CdTe layer permits more light wavelengths to pass through to lower layers, such as those in double and triple junction cells. The improved transparency allows the PV coating to be semi-transparent, which is useful for window applications. Additionally, the thin PV layers allow the use of a back reflector that permits more light to be directed back through the cell for subsequent electron excitation, which improves efficiency. As a frame of reference, known PV cells have been constructed with CdTe layers on the order of 2.3-3.5 microns and as high as 10 microns. By contrast, the inventors have now shown that the thickness of the CdTe layer , when used in conjunction with the CdS buffer layer has been produced in a range of 0.5 microns and 0.3 microns and may be still further reduced.
112
114
In another embodiment of a photovoltaic cell having a CdS buffer layer, an intrinsic layer may be disposed between the n-type CdS layer and the p-type CdTe layer , in the form of a generic n-i-p structure. A portion of such a PV cell structure may be in the form of a n-type CdS/i-type layer/p-type CdTe/CdS buffer layer. In certain embodiments, the i-type layer may be formed from a variety of materials such as, for example, an i-type CdTe layer in conjunction with the p-type CdTe layer. In another embodiment, the PV cell may be configured as n-type CdS/i-type CdTe/p-type ZnTe/CdS buffer layer.
110
110
Unlike other existing buffer layers and shunt passivation schemes, the CdS buffer layer uses the same material that is already used in the cell fabrication process. Thus, the buffer layer , and its application onto the cell, can be performed in the same deposition chamber where the main CdS and CdTe layers are deposited. In this case no vacuum break or other steps associated with use of an additional apparatus are necessary.
116
100
116
116
The substrate material is moved to a suitable processing environment for deposition of the TCO layer . In one embodiment of the method of forming the PV cell , the TCO layer is deposited by a form of sputtering such as, for example, RF sputtering, magnetron sputtering, and the like. It should be understood that any suitable application process may be used to form the TCO layer .
112
114
116
112
114
FIG. 2
The various active semiconductor layers (CdS , CdTe , and the like) are deposited onto the TCO layer . In the embodiment shown in , the semiconductor layers are deposited as a n-CdS layer and a p-CdTe layer . Other layers, such as an intrinsic layer or numerous stacked semiconductor layers, may be formed on the previously applied portions of the cell if desired.
In one embodiment of the method, the semiconductor layers are deposited by sputtering. The semiconductor layers are sputter deposited within an evacuated sputtering chamber that contains a target source of CdS and a target source of CdTe.
110
114
110
110
110
114
110
110
Once the semiconductor layers have been formed, a CdS buffer layer is applied onto the CdTe layer . In certain embodiments, the CdS buffer layer can have a thickness that ranges from about 30 nm to about 50 nm. In one embodiment, the CdS buffer layer is deposited by sputtering. In yet another embodiment, the CdS buffer layer is sputter deposited onto the CdTe layer within the same sputtering deposition chamber and using the same CdS target source. In yet another embodiment, the CdS buffer layer is deposited within the same sputtering chamber but using a different sputtering source. In yet another embodiment, the CdS buffer layer is deposited in a different chamber using sputtering, evaporation, chemical bath deposition, or other suitable method for depositing the CdS.
110
112
100
110
110
110
110
110
2
2
2
2
2
The back CdS buffer layer is deposited with similar deposition parameters that are used for the front CdS layer . For example, in one embodiment of the deposition process, the parameters may comprise 35 W of RF (radio frequency, 13.56 MHz) power, 18 mTorr Ar sputter gas pressure, and 250° C. substrate temperature. Alternatively, other deposition parameters may be used such as, for example, 20 W of RF power, 18 mTorr Ar gas pressure. Alternatively, the power and pressure levels may further be changed to 40 W of RF power and 9 nTorr Ar gas pressure. In one embodiment of the PV cell having the back contact buffer layer , the ultra-thin (less that 0.5 micron CdTe) cells may have an optimum thickness of the back CdS buffer layer in the range of 30 nm to 50 nm. While not wishing to be bound by any particular theory, the inventors have found that the optimum CdS thickness depends on the thickness of the absorber (CdTe) layer and whether the back CdS buffer layer is deposited prior to or after a CdClannealing treatment. In one embodiment, the CdClannealing treatment may be conducted at a temperature of approximately 400° C. In one embodiment of applying the back contact buffer layer, the back CdS buffer layer is applied prior to the CdCltreatment process. In another embodiment of a method of applying a back buffer layer, the back CdS buffer layer may be applied after the CdCltreatment. In another embodiment, the CdClannealing treatment is conducted after the step of applying a back contact layer onto the CdS buffer layer.
2
2
118
110
118
100
After completion of the CdS buffer layer deposition/CdCltreatment or CdCltreatment/CdS buffer layer deposition sequence, the back contact is applied onto the CdS buffer layer . The back contact is electrically connected to the cell . The electrical connections may be formed in an offline process whereby connections are formed between selected portions of the active layers and the back contact. Alternatively, the electrical connections may be made internally by scribing.
The principle and mode of operation of this invention have been explained and illustrated in its preferred embodiment. However, it must be understood that this invention may be practiced otherwise than as specifically explained and illustrated without departing from its spirit or scope.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1
is a schematic view of a prior art photovoltaic cell showing current flow in a closed circuit pathway and a shunted circuit pathway.
FIG. 2
is a schematic view of an embodiment of a photovoltaic cell having a buffer layer.
FIG. 3
is a comparative box-and-whisker plot of conversion efficiencies for 35 PV cells with and without a buffer layer, where the CdTe layer thickness is about 0.3 μm.
FIG. 4
is a comparative box-and-whisker plot of open-circuit voltage measurements for PV cells with and without a buffer layer, where the CdTe layer thickness is about 0.3 μm.
FIG. 5
is a comparative box-and-whisker plot of fill factor measurements for PV cells with and without a buffer layer, where the CdTe layer thickness is about 0.3 μm.
FIG. 6
is a comparative box-and-whisker plot of % Efficiency for a CdS/CdTe PV cell and a CdS/CdTe/CdS cell formed using manufacturing parameters defined by a first embodiment, each having a CdTe layer thickness of 0.5 μm.
FIG. 7
is a comparative box-and-whisker plot of % Efficiency for a CdS/CdTe PV cell and a CdS/CdTe/CdS cell formed using manufacturing parameters defined by a second embodiment, each having a CdTe layer thickness of 0.5 μm.
FIG. 8
is a schematic representation of a concentration gradient of material diffused through the thickness of an embodiment of a PV cell. | |
More than a hundred fragments of spent nuclear fuel were removed from the seabed in the latest phase of work to clean up and shut down the former nuclear research site at Dounreay.
The particles were detected and retrieved by a remotely-operated vehicle that systematically scanned an area of seabed equivalent in size to more than 10 football pitches.
The robotic system recovered 115 particles during the two-month operation. Of these, 29 were in the higher hazard category defined by independent experts as a "significant" threat to health.
Another 16 suspected fragments detected by the ROV also gave readings in this category but were not retrieved. Six could not be targeted accurately for retrieval and 10 were buried deeper in the sediment than the 45cm reach of the ROV retrieval system.
Monitoring of local beaches was carried out during the seabed clean-up. A total of 15 particles, none of them "significant", were detected and retrieved onshore since seabed clean-up started on June 1. Of these, 14 were removed from local beaches.
Two small areas of elevated radioactivity were detected during a survey of land adjacent to the site and zoned for development as a low-level waste disposal facility. One of these contained a "minor" particle. Both areas were excavated and this survey is continuing.
Dounreay clean-up contractor DSRL reported all the finds to the Scottish Environment Protection Agency. The results will also be considered by the Particles Retrieval Advisory Group, a body of independent experts set up to advise DSRL and SEPA.
The offshore clean-up is the implementation phase of a major study carried out with public consultation to identify the best practicable environmental option to address a legacy of discharges from the former research site.
This summer's work focused on an area at the west of the main particle plume on the seabed. The plume maps were produced by Dounreay Particles Advisory Group, a body of independent experts, and based on the results of studies and detailed statistical analysis. The maps indicate that the most radioactive particle remnants are located in this area, where fishing is prohibited.
Phil Cartwright, particles and contaminated land manager at DSRL, said: "This was the first full phase of seabed clean-up following a demonstration last autumn of the detection and retrieval technique.
"The area targeted was discussed with the Scottish Environment Protection Agency and Particles Retrieval Advisory Group and provided a range of challenges to the detection equipment. The information we gained will assist DSRL to develop the best way forward for this project and by SEPA and PRAG to consider the effectiveness of the retrieval technique and if the plume map needs to be changed. The retrieval of 115 particles, with total radioactivity of 500 million becquerels (of ceasium-137) is a positive start to the seabed clean-up." | http://www.rovworld.com/article-print-3593.html |
This experimental course on photography will encourage the participants to follow a playful approach to all the stages of the creative process of producing an image. It will instigate you to engage in making use of photography in a free, unobstructed manner, liberated from its technical and theoretical restrictions and use it as an independent artistic medium. In this context, you will be encouraged to release your imaginations and play with the often misunderstood idea of �abstraction� in photography.
The course will be based on historical visual references as a point of inspiration and initiation of discussion, which you will take on to produce your own photographs. The visual references will include a historical development of abstraction in photography as well as further references from important art movements, which were influenced by photography and from which photography took influences too. The visual references will be designed as such, so that they introduce you to a diversity of techniques and methods and they will be concise with only the necessary information.
Each week we will explore a different period and style of photographic abstraction and you will be asked to experiment and explore some of the techniques suggested by that particular photographic style and/or invent your own. You will produce some images which you will discuss the following week. It will be quite open as regards the themes, on which you will work in your practice. Although, you will be given some themes to work on, it will also be up to you to decide whether you want to work with a particular idea in mind as a group theme, and/or whether you want to explore something individually. Also, you will be free to choose whether you want to work in small groups to produce a collaborative project or individually.
By exploring freely different aspects of all the main photographic movements, you will gain a good knowledge of the history of photographic abstraction and of photography in general within the broader context of the historical developments in the arts. You will obtain this knowledge through your own practice.
The attitude of this course will be focused on the idea of play and this will be introduced not only in the making of the images but also in the way of presenting them. You will be encouraged to be creative and push the traditional boundaries of presenting a photograph. Other art forms can be introduced, such as drawing, sculpture, music, writing etc depending on individual talents.
Each session will last three hours. The majority of the time will be devoted to presenting and discussing your work produced the week before. During this discussion all of you will talk about your work and comment on each other�s photographs. This discussion will be the core of each session, as it will provide you with the opportunity to extract ideas from your own work, discuss the process you followed, reflect on it and on the result you achieved and make decisions for your future explorations on the weekly projects to follow. At the same time, I will be answering your questions, helping you to clarify your ideas and giving you suggestions for further experimentation.
The rest of the time of each session will be devoted to introducing the next style of photographic abstraction and providing you with some food for thought in order to embark on a new photographic exploration until the next session. Occasionally, during this section of the session, I will encourage you to play for five minutes with your cameras inside the room with whatever objects, surfaces and lighting are available. The purpose of this will be to produce sketch images as a brainstorming of the new ideas you are going to explore after you leave the session. In this sense, the sessions themselves will have a playful character and they will introduce you to different levels of receiving and processing information. At the end of each lesson handouts will be given with the visual references printed in contact sheets and with some relevant bibliography for further reading for those interested. Occasionally, I will also be bringing books and photographic albums in the sessions for you to look at. | http://playingandreality.co.uk/page4a.html |
Astronomers have found a temperate planet a bit bigger and bulkier than Earth, orbiting a small star just 40 light-years away. The newly announced world could be among the best targets to search for signs of life elsewhere in the cosmos.
“Small worlds are common,” says Lauren Weiss of the Université de Montréal. And this planet, she says, is one of the closest known rocky worlds outside our solar system. “It's in our sun's backyard.”
Using a telescope in Chile, astronomers watched the planet cross the face of a red dwarf star called LHS 1140, in the constellation Cetus. The world, named LHS 1140b, is about 1.4 times wider than Earth and it sits comfortably in an orbit where liquid water could flow on its surface.
Using a different telescope in Chile, the team then monitored how much the planet’s gravity tugs on its star, allowing them to determine that LHS 1140b is about 6.6 times as massive as Earth. That means the little world is rocky, perhaps with a large iron core surrounded by a thin mantle—kind of like an overgrown Mercury, comments Laura Schaefer of Arizona State University.
“We still don't know much about it though, so it will be really exciting as we get more data,” she says.
The discovery team is particularly excited about gazing at the newfound world because it is close enough to Earth for existing telescopes to tell whether it has an atmosphere and, if so, whether its air contains signs of alien life.
“The scientist in me wants to be super cautious and consider all the reasons why we might not find life on this planet,” says study leader Jason Dittmann of Harvard University, whose team describes the new planet today in Nature.
“However, I also like a good bet and might be a secret optimist, so I'd place my bet that life is common in the universe and that it could even be on LHS 1140b.”
Adding Up the Evidence
Today, more than 3,400 planets are known to orbit other stars, and as telescopes and observing techniques have improved, an increasing number of new discoveries are these small, probably rocky worlds that cling to stars much smaller than the sun.
Last year, scientists revealed that three Earth-size worlds orbit a small, nearby star called TRAPPIST-1. Then, an Earth-size world orbiting the nearest star to our own, a tempestuous red dwarf called Proxima Centauri, zoomed in and stole the trio’s thunder. Not to be undone, scientists revealed earlier this year that TRAPPIST-1 hosts not just three, but at least seven worlds, a handful of which could be habitable.
And last week, scientists from Europe and the U.K. announced that they had detected an atmosphere around a nearby exoplanet called GJ 1132b—the smallest such world to offer up any clues about its gassy constituents. The achievement is pleasing proof that spying on molecules in the atmospheres of rocky worlds is possible with today’s instruments.
All of this adds up to huge hopes for LHS 1140b. None of the planets found to date can be described as truly Earth-like, since we don’t know enough about them to make that comparison. But this world may offer our best shot yet at adding up attractive traits that may be friendly to life.
First, the planet’s density suggests it is solid, the kind of place where life could thrive on, under, or above the surface. Some of the TRAPPIST-1 worlds may check this box, too, but many of their compositions are still mysterious.
“Even small planets ... are not necessarily ‘terrestrial’ worlds like the Earth,” Weiss says. These other planets could contain a smattering of rock but have surfaces smothered by thick shrouds of gas that are disastrous for complex life.
Yet, “the high density and small size of [LHS 1140b] suggest that a mixture of iron and silicates—the same rocky materials that constitute the Earth—could comprise this planet,” she says.
The team found the new super-Earth with the MEarth-South telescope array, which sits on Cerro Tololo in Chile.
PHOTOGRAPH BY JONATHAN IRWIN
Second, LHS 1140b’s gravity is strong enough to hold onto an atmosphere, with a caveat: The planet’s five-billion-year-old home star is quiet for now, but it’s likely the star was prone to flares when it was younger. If so, the cranky star might have blown away the planet’s atmosphere with violent eruptions and obliterated any life-forms that could have evolved.
Still, this planet is far enough from its star that any potential atmosphere had a better chance of surviving early stellar tantrums. Its distance also means temperatures would be comfortable for life as we know it, unlike the otherwise similar, but very roasted, GJ 1132b.
Finally, LHS 1140b crosses the face of its star, which offers a prime view for astrobiologists. When scientists are trying to peer into an alien atmosphere to look for signs of life, what they’re actually doing is trying to see through it. As planets pass between their stars and Earth, the distant starlight shines through their gassy sheaths and illuminates whatever molecules might be in there.
To get precise measurements of those molecules and their ratios with existing and soon-to-be-existing instruments, scientists need a nice, nearby star like LHS 1140.
First Taste
It’s totally possible the first whiff of life beyond Earth could come from future glimpses of alien atmospheres—a ratio of gases that isn’t quite right, or peculiar molecules that would be hard for chemistry and geology alone to produce.
Dittmann and his team have already scrutinised LHS 1140b using the Hubble Space Telescope and hope to do the same with telescopes in Chile later this year.
But he’s really excited about looking for gases like methane, ozone, and carbon dioxide using bigger, shinier tools that could become available in the next decades: the James Webb Space Telescope, the Giant Magellan Telescope, and the European Extremely Large Telescope, among others.
“Realistically, we're going to be getting our first tastes of these atmospheres sometime in the next decade,” Dittmann says. | https://www.nationalgeographic.com.au/space/new-super-earth-may-be-best-yet-for-finding-signs-of-life.aspx |
How Companies Are Addressing Mental Health in the Workplace
Though burnout captures most of the headlines when it comes to problems troubling employees, it’s not the biggest issue workers are dealing with today. A study published in the October 2021 issue of Harvard Business Review (HBR) concluded: “Mental health challenges are now the norm among employees across all organizational levels.” The Mayo Clinic found a major increase in the number of U.S. adults who reported symptoms of addiction, anxiety, depression and insomnia since the start of the pandemic.
While stress around the COVID-19 pandemic gets most of the blame, it’s not the only culprit. "The murders of George Floyd and other Black Americans by the police; the rise in violence against Asian Americans and Pacific Islanders (AAPIs); wildfires; political unrest; and other major stressors unfolded in quick succession, compounding the damage to our collective mental health," wrote Kelly Greenwood and Julia Anas, authors of the HBR study, “It’s a New Era for Mental Health at Work.”
Some might argue that these are personal problems, unrelated to the job, which employees should address as individuals. Experts caution that employers shouldn’t leave this to chance. “Now is the moment for managers to ask difficult personal questions, to learn how to listen, identify and help workers who are struggling,” said David Rock, founder and CEO of the NeuroLeadership Institute, a global neuroscience consultancy currently advising many Fortune 500 companies.
Greenwood and Anas's article reached the same conclusion: "Employers must move from seeing mental health as an individual challenge to a collective priority. Given all the workplace factors at play, companies can no longer compartmentalize mental health as an individual’s responsibility to address alone through self-care, mental health days, or employee benefits."
One of the factors exacerbating the mental health crisis is the long wait time to get help via traditional health plans. The typical wait time between asking for help and getting an appointment is four to six weeks according to Sandra Kuhn, behavioral health consulting leader at Mercer Consulting, one of the oldest human resources consulting practices in the world.
Related Article: Dealing With the Mental Health Pandemic at Work
A Look at the Emerging Mental Health Start-Up World
To bridge that gap, a number of start-ups have emerged that aim to make it easier for employers to deliver assistance to workers at the moment they need it. Consider Ginger, an on-demand mental health provider that was founded in 2011 and is now owned by Headspace. Accessed via an app, the virtual platform is supported by proprietary technology that is built on what the company calls the world’s largest mental health data set. The platform brings together coaches, therapists and psychiatrists with an individual user to ensure the employee receives the appropriate level of care when they want it. Both on-demand and regularly scheduled care is available round the clock. Sessions are delivered via text, video or a self-guided framework. Ginger includes specialized offerings for LGBTQ+, racial trauma, veterans, traditionally underserved groups, and economically disadvantaged groups.
Modern Health, another platform, aims to provide the tools workers need to “build resilience, proactively engage in their mental health, and get the clinical support they need when they need it.” Offerings include clinical therapy; community sessions led by therapists and coaches that include topics such as Honoring LGBTQ+ Voices, BIPOC Mental Health, Healing Latinx/Hispanic Communities, Healing Black Communities and Healing Asian Communities; skill building workshops on topics such as job related stress, loneliness and setting boundaries; as well as self-paced courses which blend multimedia learning, guided exercises and optional coaching.
BetterUp, a so-called “coaching experience,” offers BetterUp Care, which brands itself as a “comprehensive mental health solution that is redefining employee engagement, productivity, and business growth.” It aims to meet each person’s individual needs across the entire well-being spectrum. Its creators argue that with BetterUp, users are less stressed, more productive and more resilient in the face of difficulties. What does that mean for your organization? Ideally, a substantial reduction in health care costs and a thriving, high-performing culture. The “coaching experience” features over 19,000 NCQA based credentialed licensed therapists as well as a diverse and clinically versatile provider network that matches user preferences and needs, aiming to ensure that workers get the help and support that they need.
Learning Opportunities
Addressing Employee Needs and Wants with a Digital Workplace
The workplace is getting more and more digital – both in how we work and where we work
Maintaining a Human-Centered Approach During Digital Transformation
When it comes to digital transformation - people drive change, not technology
The Evolution of Employee Recognition
Leveraging the power of appreciation to improve the employee experience
How to Build a More Innovative and Resilient Workplace Culture
What would happen if every member of your team came to work focused on finding solutions and creating better results?
There are also on-demand providers like BetterHelp, Talkspace and others that were initially geared to consumers and later launched enterprise offerings. They connect individuals with licensed, trained, experienced and accredited psychologists (PhD / PsyD), marriage and family therapists (LMFT), clinical social workers (LCSW / LMSW), and board licensed professional counselors (LPC). Here, users have the option of texting their therapist in a "room" on the site, in the app (Android, iOS) or contacting via a phone call or video. Talkspace also provides 24/7 access to a therapist.
BetterHelp offers more than 30 weekly, topic-based, interactive group session webinars facilitated by therapists who are experts in that topic/field. The company states that its groupinars are completely anonymous, accessible to all members and kept up to date with current events. BetterHelp provides organizational administrators with the ability to monitor utilization rates, assess mutual stressors, review satisfaction surveys/scores, and track outcomes and effectiveness all with aggregated level (non-PII) reports.
Related Article: The Cure to Burnout Is Not Self-Care
Overcoming Lingering Mental Health Stigmas
While some workers embrace these services when they need them, for some, there's still a stigma around needing help with mental health. To combat that an increasing number of CEOs and other managers are openly talking about their own struggles. Take, for example, Matthew Cooper, co-founder of EarnUp. In an op-ed published in Quartz he wrote, “In the spirit of transparency and destigmatization, I share that I continue to live with a group of mental health challenges that includes severe anxiety, suicidal ideation, panic attacks, and depression.” Cooper stepped down as CEO but remains involved in the company.
Employees at Buffer are encouraged to talk about and treat their struggles with mental health. “We delight in the joys of life — new babies, pets, plants! work and life achievements! — and we don’t shy away from the hard stuff — depression, anxiety, burnout, and grieving,” wrote Courtney Seiter, the company’s former director of people, in a blog post.
Seiter clearly understands what many other managers have yet to learn. "The future of workplace mental health demands culture change — with more vulnerability, compassion, and sustainable ways of working." | https://www.reworked.co/talent-management/how-companies-are-addressing-mental-health-in-the-workplace/ |
I’ve started a new feature on my Book Buzz blog this year. (Book Buzz is the children’s book blog I write for students; I post information about books, authors and illustrators, and about special book-related events.) Each week I post the Thursday Theme, where I present three or four books related to a common topic. Themes so far have included Bats, Johnny Appleseed, Little Red Hen stories, and a couple more.
Have you ever noticed how easy it is to begin a project that requires regular input, and how burdensome it becomes to follow through consistently with it?
By the time I think of a theme, search my library catalog for books that fit (all the books I write about are from my collection), save a copy of the covers to use, write the description for each book, and type it all up, I’ve got well over an hour invested each of these posts! (And of course that doesn’t include the time it takes to actually read the books!) Is it really worthwhile to keep doing it week after week?
Yes, I think it is. For one thing, it’s helping me to really discover what’s in my collection. Usually when we receive a shipment of new books, my assistant unpacks them and handles any processing that’s needed, and then they go out to the shelves for students and teachers to check out. Occasionally I have time to sit down and read them first, but not always, particularly with chapter books. In researching these themes, I’m re-discovering titles I’ve ordered for our library, and I’m seeing which books on a given topic are the most current and useful, which ones may need to be weeded, and where the gaps are for future ordering.
I’m also honing a different type of reading and writing skill. I’ve always thought I’d like to do some book reviewing, but it’s hard for me to keep a critical eye on a book that I’m reading for enjoyment, and nearly all the books I read are for enjoyment. (Hmmm, I may have just put into words why so many kids don’t like book reports – it spoils the fun of reading!) So this is an opportunity to take the time to read for the specific purpose of summarizing and sharing what’s special about each of the books I include in a theme post.
I’m still finding my voice with this. I’m trying to aim this blog at kids, but sometimes my summaries sound more like book reviews for adults or book annotations for teachers and librarians, who I hope are also reading Book Buzz, rather than persuasive booktalks for students. But I plan to stick with it, and hopefully it will keep getting better! | https://ljune.edublogs.org/2010/10/22/writing-about-books/ |
Am Fam Physician. 1999;59(11):3225-3228
Inhaled corticosteroids, such as beclomethasone, are the medications most commonly used to control asthma, but problems with compliance limit their effectiveness, especially in children and elderly patients. Leukotriene receptor antagonists are now considered to be alternative first-line controller medications. The oral leukotriene receptor antagonist montelukast has demonstrated efficacy in both adults and children, and is well tolerated. Malmstrom and associates compared oral montelukast, inhaled beclomethasone and placebo in patients with chronic asthma who required the daily use of a controller medication.
The 12-week study included 895 patients 15 to 85 years of age who required at least a single daily puff of an as-needed, short-acting inhaled beta agonist. Eligibility criteria also included a forced expiratory volume in one second (FEV1) of 50 to 85 percent of the predicted value, and an increase of at least 15 percent in the absolute FEV1 after inhalation of a beta agonist.
Patients were randomized to receive one of three treatments: (1) montelukast, 10 mg in the evening, (2) inhaled beclomethasone, 200 μg twice daily or (3) placebo. The study design included a two-week placebo run-in period, a 12-week double-blind treatment period and a three-week double-blind placebo washout period. Withdrawal from therapy was evaluated by switching a subset of patients who received active treatment to placebo in a blinded manner. If severe episodes of asthma developed, patients were treated with oral steroids; patients who had more than two worsening episodes were dropped from the study.
Spirometry was performed at each visit, and participants completed questionnaires about daytime asthma symptoms and nocturnal awakening. They also kept a diary of morning and evening peak expiratory flow rates and daily use of as-needed salbutamol.
Compared with placebo, both montelukast and beclomethasone provided significant benefit with respect to FEV1, daytime symptom scores, as-needed beta agonist use, morning and evening peak expiratory flow rates and nocturnal awakenings. FEV1 improved 13.1 percent with inhaled beclomethasone, compared with an improvement of 7.4 percent with oral montelukast. Beclomethasone had a larger mean effect than montelukast. The reduction in asthma attacks was similar in the beclomethasone and montelukast groups, and both active treatment groups showed significantly reduced eosinophil counts. Clinical adverse events were similar in all three groups.
The authors conclude that oral montelukast and inhaled beclomethasone provide similar protection against worsening episodes of asthma. Both are generally well tolerated. Although there was similar compliance in all groups in this study, data suggest that oral therapy is associated with greater adherence.
In an accompanying editorial, Smith points out that the response to inhaled corticosteroids, the gold standard treatment, may be 70 to 80 percent. It is not clear whether this is due to noncompliance, a lack of effect, poor delivery to the lungs or a combination of these factors. Smith also compared the positive and negative attributes of inhaled corticosteroids and leukotreine receptor antagonists (see the accompanying table). It remains impossible to predict an individual patient's responsiveness to one treatment or the other, and the place for leukotriene receptor antagonists in the treatment of asthma is not yet well defined. Nevertheless, Smith believes that leukotriene receptor antagonists may be a good first choice in patients with mild persistent asthma (symptoms occurring less than daily) based on the safety and oral bioavailability of this class of drugs. In patients with moderate persistent asthma (symptoms occurring daily), inhaled corticosteroids may be a better first choice because of the higher likelihood that they will be effective. In patients with severe persistent asthma (continuous symptoms), the addition of antileukotrienes to treatment with corticosteroids (inhaled and oral) and long-acting beta agonists may be beneficial. | https://www.aafp.org/pubs/afp/issues/1999/0601/p3225.html |
Even though slowing global demand after the Great Recession affected Asia in recent years, improving trade figures in the region are now a ray of hope for globalization. But is the current recovery in Asian exports likely to continue?
Amid all the rhetoric about protectionism, improving trade figures in Asia are a ray of hope for globalization. An export powerhouse for a long time now, Asia has, however, felt the heat in recent years, as global demand slowed after the Great Recession, in turn bringing down the pace of international trade expansion. Thankfully, the tide appears to be turning of late. In China, for example, net exports contributed 0.3 percentage points to real GDP growth in both Q1 and Q2; the positive contribution in Q1 was the first since Q2 2015.1 In India, where exports had faced strong headwinds due to slower growth in key markets such as Europe, real exports grew 10.3 percent year over year in Q1 2017, the fastest pace of growth since Q2 2014. Similar trends of export recovery can also be seen in other key Asian economies (figure 1). Growing export volumes, combined with an uptick in commodity prices (commodities are a key export item for countries such as Indonesia and Malaysia), have pushed up export values for these countries (figure 2), which, in turn, has aided their external balances. That augurs well for currencies in the region facing potential downside pressure from rising interest rate differentials with the United States.
So, is the current recovery in Asian exports likely to continue? It seems probable, given that key fundamentals such as global demand and regional trade are likely to remain positive.
Global growth fundamentals for 2017 appear much better than they were a year before. According to the International Monetary Fund (IMF), world GDP is set to grow 3.5 percent in 2017 and 3.6 percent in 2018, up from a 3.1 percent rise last year, with growth in both advanced and emerging economies set to rise (figure 3).2 Troubled economies in the Eurozone appear to be getting back on track. Growth in Ireland (5.2 percent in 2016) and Spain (3.2 percent in 2016) has surged, while in Greece, inflation is edging up, rekindling hopes of a break from deflation.3 The story for emerging economies, especially those in Asia, is even brighter. While China’s strong GDP growth in Q1 and Q2 2017 (6.9 percent) helped dispel fears of a slowdown, India, with growth of 7.0 percent in Q4 2016 and 6.1 percent in Q1 2017, appears to have shrugged off any major dent in growth due to demonetization.
Asian growth has continued unabated over the years, driven in recent years by emerging economies such as China and India.4 Consequently, within Asia, the flow of goods and services has gone up sharply. For example, back in 1980, North America and Europe had the biggest share in exports from emerging and developing countries in Asia, while exports within the region itself were just 6.6 percent of the total (figure 4).5 By 2016, the region had the highest share in its own exports, highlighting a strong rise in demand from within the region. This is not surprising given favorable demographics and increasing prosperity, leading to a sharp rise in the middle class in the region.6 Also, Asian companies have rapidly moved up the value chain from being mere assemblers of semifinished products. Be it automobiles or smartphones, countries such as China and India are moving up the value chain and closing the gap, albeit in different degrees, with advanced manufacturing majors like South Korea and Japan7—and they are increasingly exporting to one another.
Global commodity prices have been on a rebound since 2016. For example, since the beginning of 2016 (until August 21, 2017), the price of Brent crude has gone up 38.3 percent, while rubber and coal prices are up 49.8 percent and 78.8 percent, respectively (figure 5). Asian commodity exporters such as Indonesia and Malaysia have benefitted from this resurgence in commodity prices. For example, the value of exports (in Malaysian ringgits) of inedible crude materials from Malaysia went up 40.7 percent year over year in Q1 2017 and 35.9 percent in Q2. Similarly, exports of mineral fuels and related products grew 41.1 percent in Q1, the fastest pace of expansion since Q2 2010, and the momentum has continued into Q2 as well. Palm oil exports, in particular, have been a key beneficiary of rising prices.
The trend is similar in Indonesia, where the value of mining and related exports (in US dollars) went up 37.2 percent in Q2 2017, the highest rise since Q3 2010. The rise in commodity prices is also translating into higher prices for refined products and, hence, exports of those products. Singapore, in particular, has benefitted, with the country’s export value of petroleum products rising 30.1 percent in Q4 2016, and then by 70.4 percent in Q1 2017; the growth momentum continued into the second quarter of this year as well. This trend of healthy commodity exports is likely to continue, given increasing global demand and elevated prices; although commodity prices have flattened of late, they remain high compared with 2015 and early 2016.
Supporting trade fundamentals in Asia is a return to stability of key currencies in the region. Currencies were a worry last year, as speculation increased about possible moves by the US Federal Reserve (Fed). However, the Fed’s interest rate path has become clearer in recent weeks.8 This has eased the pressure on key Asian currencies. For example, the Malaysian ringgit, the Indian rupee, and the Indonesian rupiah have stabilized this year (figure 6). Currencies are also likely to benefit from improving economic fundamentals across the globe. Within the Eurozone, rising inflation is a positive development, especially in debt-laden economies.9 In Greece, for example, where inflation went up above 1.0 percent this year—for the first time since August 2012—rising consumer prices, if sustained, will push up nominal GDP, thereby reducing the debt burden as a share of nominal GDP. The European Central Bank will be in no mood to stem this momentum. The same holds true for the Bank of Japan in its long-running fight against deflation.
Akrur Barua is an economist and is based in Mumbai, India.
Asian exports: Time to bet on a strong show has been added to your bookmarks.
Asian exports: Time to bet on a strong show has been removed from your bookmarks. | https://www2.deloitte.com/insights/us/en/economy/asia-pacific-economic-outlook/2017/q4-strong-show-in-Asian-exports.html |
Arctia dejeani is a medium-sized macro-moth, which only occurs on the Iberian Peninsula. It is one of the species investigated in the study (picture: Henrique Pereira).
The study area, the Portuguese Peneda-Gerês National Park, consists of fragments of different habitat types like forest, scrubland and meadows (picture: Henrique Pereira).
The most accurate predictor of species diversity at a given location is the total size of the remaining habitat around it. Fragmentation, the sizes of the habitat fragments of the sampling points and the distances from other fragments are irrelevant. These are the findings of a research project headed by the German Centre for Integrative Biodiversity Research (iDiv) and the Martin Luther University Halle-Wittenberg (MLU), recently published in the renowned Journal of Biogeography. This brings clarity to a scientific debate on how biodiversity can be conserved best in human-modified landscapes. The researchers suggest rethinking the prevailing approaches of island biogeography to manage biodiversity.
The theory of island biogeography from the 1960s is typically used as a basis for predicting species richness in a location. According to this theory, species richness depends on the size of the insular area and its distance from the ‘mainland’; its degree of isolation. Conservation biologists adopted the concept to assess the effect of increasing habitat fragmentation on population development caused by, for example, roads, clearcutting and agricultural use. However, researchers have increasingly questioned the accuracy of this approach. An alternative could be the habitat amount hypothesis, according to which only the total available area of the habitat in the surrounding landscape determines biodiversity; fragmentation, the sizes of the fragments and their distances from each other, plays no role.
“Identifying which of these two theories is correct is essential to develop the best management strategies for conservation in countryside landscapes,” says study coordinator Prof Henrique M. Pereira. Pereira heads the Biodiversity and Conservation Research Group at the iDiv research centre and the University of Halle.
To answer this question, the joint first authors Dr Thomas Merckx (UCLouvain) and Dr Murilo Dantas de Miranda from the iDiv research centre and the University of Halle (MLU), led by Prof Henrique M. Pereira (iDiv/MLU) compared the two approaches, the ‘habitat amount hypothesis’ and the ‘patch size and isolation effect’ with empirical data specifically collected for the purpose.
The researchers worked in three different habitat types, forest, scrubland and meadows, in the Portuguese Peneda-Gerês National Park. There they collected moths with light traps and sorted them according to their preferred habitat type. They then determined the number of species collected at a given spot and set this proportionally to the total surrounding amount of the respective habitat type, the area of the sampled fragment and distance from the nearest other fragment. The results show that the number of species of both forest and meadow moths is more dependent on the total area of the preferred habitat than on the configuration of habitat patches. Thus, the results support the habitat amount hypothesis.
This finding was also confirmed through the calculation of beta and gamma diversity, that is, the heterogeneity and spatial distribution of species diversity in the region: consideration of the total amount of the habitat by using the cSAR-model (countryside species area relationship) provided better results than by implementing the commonly used SAR-model.
"Our work adds to a growing body of evidence suggesting that the habitat amount hypothesis is correct," says Pereira. Ultimately, this insight may cause a major paradigm shift in biodiversity science: Ecology textbooks will have to be rewritten and landscape management policies changed. For decisions on conservation measures, we might thus need to put more focus on preserving the total area of habitats rather than on their interconnectedness,” says Pereira. | https://www.idiv.de/en/news/news_single_view/news_article/biodiversity-10.html |
Approx. Interview & Role Commencement Date(s):
Interviews: As and When Suitable Candidates Identified
Start: ASAP thereafter
NB
- Strong Applicants may be contacted sooner, ahead of the closing date, to hold Skype Interview with Muslim Hands; therefore, please include your Skype ID in your application.
- Muslim Hands reserves the right to end the application procedure early should the right candidate be found ahead of the ‘closing date’ [25th September 2020].
Background
Muslim Hands is a UK based international relief organisation working in over 40 countries worldwide. The Head Office in Nottingham and a fundraising team in Whitechapel London; occasional travel between the two locations. Muslim Hands UK is seeking an enthusiastic and passionate individual to coordinate our programmatic work in the UK through an exciting period of growth and change as we have ambitious plans to grow our activities within this area.
Main purpose of the Role
The UK Programmes Manager manages MH interventions in the UK. The incumbent will ensure that MH UK programmes department implement effective programmes across in line with the MH global Strategy. The role will also be responsible for the monitoring and reporting of UK the department work across multiple platforms.
The UK Programmes Manager will also ensure that Muslim Hands is present in relevant forums and national and local discussions around the areas of intervention. The position will report to Director of Programmes and manage the UK programmes team.
The candidate will have experience with project management within the development sector in the UK. Ideally will have experience and knowledge of the education and food security sector in the UK.
Main responsibilities
Strategy
- To formulate the UK programmes strategy plans in line with the MH global strategy
- To ensure that MH UK programmes are in line with Global MH strategy
- Carry out an annual review of UK programmes
Programme Management
- Review proposals of proposed interventions to ensure innovative projects and programmes are designed adhering to sectoral standards, principles of humanitarian interventions and best practices
- Oversee and lead the full programmatic cycle of all UK programme
- Carry out thorough needs assessments to address specific needs.
- Working with partners develop and design projects and programme within the UK
- Effectively coordinate and liaise with partners to successfully implement
- Interventions
- Ensure effective M&E arrangements are in place and carry out full project cycle monitoring, facilitate internal and external evaluation of impact evaluations of all projects as deemed necessary
- Ensure all programme are in line with MH procedures and policy and follow the correct documentation and templates
- Ensure the effective use of the internal programme management system
- Ensure all UK programmes are in line with due diligence, risk and legal concerns
Finance
- Develop MH UK programme budget
- ensure effective and efficient utilization of programme funds
- Ensure documents and relevant procedures are followed
- Liaise with relevant stakeholders within fundraising to ensure UK programmes are funded and communicated to Donors
Networking
- To become an essential member of discussion of forum on UK development Agenda
- Using MH and other networks with local CSOs and Government bodies to promote MH UK programmes
- Coordinate with internal stakeholders to ensure the internal visibility of MH UK programmes
Capacity Building
- Provide all stakeholders with technical advice and support on UK issues
- Ensure areas of MH are in line with current UK CSO trends
- Provide training to UK partners to ensure they can utilise MH systems and projects in line with MH policies and PM procedures
General Responsibilities
- To undertake all tasks and duties in an effective, efficient, transparent and wholly accountable manner
- To demonstrate Muslim Hands’ values and ethics in own working practices, approach and conduct
- To support with Fundraising activities from time-to-time, committing to partake in approximately 5-Live-TV-Appeals during our peak periods.
- To undertake any reasonable responsibilities as required by Line Manager
- To promote and adhere to all Muslim Hands Policies, Procedures and Professional Practices
NB: This Job Description is illustrative and non-exhaustive in scope. The post-holder may be required to undertake any reasonable tasks as and when required by Line Manager from time to time to reflect the changing needs of the Organisation
Person specification
Essential Requirements
Ability to demonstrate current eligibility to work within the United Kingdom
Must be able to either
Provide a valid Disclosure Barring Service (DBS) certificate (issued within the last year) when requested by Muslim Hands;
OR
Undertake to provide full cooperation for Muslim Hands to perform a DBS Check at the required level appropriate for this / similar role.
How to Apply
Please register your interest and apply by sending in your current CV and a suitable covering letter by using the apply section below.
Deadline for applications is 25th September 2020 however we reserve the right to end the application procedure early should the right candidate be found.
NB: Unfortunately, we will only be able to contact successful candidates so if you have not heard from us by the closure date unfortunately your application will have been unsuccessful.
In 1993, a community in Nottingham, moved by the devastation of the Bosnian war, sprang into action. A small group of volunteers began collecting money, clothes and medicine for the people of Bosnia.
Muslim Hands, an international aid agency and NGO, grew from this grass roots movement and since these first efforts, we have responded to countless more emergencies, as well as establishing long term projects such as schools, healthcare clinics and livelihood programmes worldwide.
We are working in over 50 countries and have field offices in over 30 of these. By working closely with our partners and offices on the ground, we are able to distribute aid in an effective, efficient, transparent and wholly accountable manner and to make a lasting difference to the communities we work with.
Dedicated to tackling the root causes of poverty around the world, Muslim Hands is passionate about working beyond the provision of immediate relief, towards supporting communities over the long-term. | https://jobs.thirdsector.co.uk/job/455623/uk-programmes-manager/ |
GNE myopathy is a slowly progressive muscle disease resulting in marked disability, including wheelchair use, and ultimately requiring dependent care and for which there is no treatment available. This trial will evaluate the efficacy of N-acetyl-D-mannosamine monohydrate (ManNAc) in a randomized-placebo- controlled, double-blind study of ManNAc in subjects with GNE myopathy.
ManNAc, the first committed precursor for the biosynthesis of Neu5Ac (sialic acid), and a substrate of the GNE enzyme defective in GNE myopathy, is being developed for this orphan indication. A first-in- human Phase 1 trial has been completed and an Open-Label Phase 2 trial is ongoing. NN109 is a randomized, double-blinded, placebo-controlled trial to evaluate the efficacy and safety of ManNAc in subjects with GNE myopathy. We hope that this study will inform future trials and will eventually lead to FDA approval for ManNAc in GNE myopathy.
The primary efficacy endpoint and design this trial in 50 GNE myopathy subjects is based on knowledge collected for 5 years as part of an ongoing natural history study (NCT01417533; PI: Dr. Nuria Carrillo) which led to the development of the GNE Myopathy Disease Progression Model. This disease progression model is a novel tool that has allowed the design of a trial that overcomes the challenges of determining treatment effect in this rare and slowly progressive disease. The disease progression model facilitates recruitment of subjects within a wide range of the disease spectrum, increasing the generalizability of our findings to the patient population. Furthermore, our strategy could be applied to other slowly progressive muscle diseases. Finally, we hope that our trial and patient recruitment efforts will increase awareness of GNE myopathy and identification of undiagnosed patients.
The objective of NN109 is to evaluate the efficacy of ManNAc in subjects with GNE myopathy as measured by ability to slow progression of muscle decline compared to placebo.
NN109 is supported by NIAMS and NINDS (U01 AR070498) and includes a partnership with Berry Consultants. | https://neuronext.org/projects/nn109-magine |
Learn to Edit A Thesis Paper: brief guide that will educate you on precisely what you must know to get started.
It’s likely that if you should be viewing this informative article you have been asked to edit a thesis paper. Thesis documents are incredibly complex essay papers that are expected at higher degrees of education. If you’ve never written someone else’s paper before when it is only at that sort of degree of writing, then chances are you’re most likely confused on what variety of edits you’ll want to make. With a thesis paper, you will desire to spend attention that is particular which type of edits you create. In this specific article we shall expose you to which type of edits you’ll want to make, including; framework, language, and proofreading.
Forms of Edits in a Thesis Paper
Editing another individual’s thesis paper should include making edits towards the dwelling, the language, you need to include proofreading. Each one of these kinds of edits can provide you information that is valuable how to edit their paper. Editing should ensure it is easier when it comes to readers to know and more comfortable in order for them to read. You ought to focus on the flow regarding the essay, as then you may need to help edit the paper to make it easier to read if it sounds disjoint.
Structure Edits
The dwelling for the essay is fundamental. The flow of the entire essay is what could make or break the essay for the reader if you”re editing a thesis paper. Then you’ll likely lose the interest of your reader if you don’t have a decent flow to the writing. When coming up with these edits try and suggest linking words, supply the writer some feedback on what they are able blog link to increase the structure, and perhaps even restructure some of the sentences.
Language Edits
Language edits would be the beloved forms of edits to produce in terms of modifying thesis papers. The language into the thesis essay is professional, be punctual, and can include appropriate terminology for the niche. You need to look for typos, misspelled words, and grammar that is incorrect as they could be the most natural edits to create.
Next, you really need to search for the tone associated with the paper while making certain most of the sentences make use of a expert tone. A thesis paper is supposed to seem like a lecture that is educational message. So imagine your self reading it aloud. Then you can cross them out or make suggested edits if you can’t imagine a person standing on a podium saying certain words.
Lastly, determine in the event that terminology is proper. This is often probably one of the most laborious edits to make as it tests your understanding for the subject. Then you’ll have an easier time making these types of edits if you”re in the same class as the person who’s thesis paper you’re editing. If you should be maybe not within their class, then take time to fact always check all the information on the web. This will be your best possibility of seeing if they’re utilizing the terminology right or incorrect. Also mark done any terminology or definitions you do not comprehend.
Proofreading Edits
The final form of edits you”re planning to want to make are proofreading edits. This consists of errors that are spelling any difficulties with the layout or formatting, and whatever else that’s not highly relevant to the paper. Often you are going to notice people go off track with filler sentences or talk about a topic that is not associated with this issue. These must be modified down to result in the paper more accurate.
The place to start?
You should begin at the beginning of the paper. This is the thesis. Be sure that initial sentences that are few represent all of those other paper. You can do this by skimming through the paper then re-reading the thesis. Next, you need to skim within the paper to see any structure errors. These edits are often spotted immediately and that can easily be ignored when you start reading.
The edits that are next should make are edits to spelling and grammar. These are usually underlined in Microsoft word or docs that are google. This will make it quite easy to spot any errors, and you will make use of the edit features to edit these mistakes quickly. You can also run the paper via an editing computer software to get recommended grammar and edits to syntax. These services frequently cost money however.
Next, you will want to begin proofreading the paper for just about any mistakes or mistakes. You need to repeat this by reading each phrase individually. Make sure every simple truth is appropriately cited into the proper structure, APA or MLA, and look to see if the data within the essay is important. If there is a component, you’re not certain about or hardly understand, mark a user comment and tell the writer it better that they need to describe. | http://cest-la-vie.co.jp/archives/885 |
[Food intake and biochemical variables: overall nutrition and metabolic status of a group of non-institutionalized elderly in Venezuela].
To evaluate the quality of life, and to establish local reference standards, the nutritional and metabolic status were assessed in two-hundred-eleven non-institutionalized adults divided in two groups: the experimental (> or = 60 years old), and the control (< 60 years old). The anthropometric nutritional status was assessed with the Quetelet Index with no significant differences between the age groups. The 24-hour recall method in the dietetic evaluation showed a high lipid and protein diet, which is characteristic of the region. The diet is deficient in energy, carbohydrates, fiber, copper, and zinc. Biochemical determinations of zinc, copper, total protein, albumin, alkaline phosphatase, triglyceride, total cholesterol, HDL-cholesterol, LDL-cholesterol, glucose, and insulin, were performed on 12-hours fasting subjects without significant (p < 0.05) age-based differences, except albumin levels, which reflects overall protein status. On the other hand, albumin, trygliceride, total cholesterol, HDL-cholesterol, LDL-cholesterol, and copper levels showed sex-based and age-sex-based significant differences (p < 0.05). Similar studies should be made on institutionalized or free-living individuals, from different socioeconomic levels and a nutritional status assessed by anthropometric measures, body composition, and food intake.
| |
July 31, 2008
TESTIMONY OF ROBERT GREENSTEIN,
EXECUTIVE DIRECTOR, CENTER ON BUDGET AND POLICY PRIORITIES,
BEFORE THE SUBCOMMITTEE ON WORKFORCE PROTECTIONS COMMITTEE ON EDUCATION AND LABOR
Hearing Titled: "The Growing Income Gap in the American Middle Class"
Thank you for the invitation to testify about widening income inequality in the United States. As former Federal Reserve chairman Alan Greenspan has said, “this is not the type of thing which a democratic society — a capitalist democratic society — can really accept without addressing," and I commend the subcommittee for holding this hearing.
My testimony falls into three parts. | https://www.cbpp.org/sites/default/files/archive/7-31-08inc-testimony.htm |
MedLine Citation:
|PMID: 8401498 Owner: NLM Status: MEDLINE|
|
|
Abstract/OtherAbstract:
|Spinal muscular atrophy (SMA) is the second most common lethal, autosomal recessive disease in Caucasians, second only to cystic fibrosis. In an effort to identify the causative gene in SMA, we have used radiation hybrid (RH) mapping to prepare a high resolution physical map of the proximal region of chromosome 5 (5q11-13) which contains the SMA gene. The map of the SMA region, which spans approximately 4 Mb, contains 19 loci including 9 polymorphic DNA markers, 8 monomorphic sequence tagged sites (STS) and two genes. Based upon the RH map the two polymorphic loci which most closely flank the SMA locus were estimated to be separated by approximately 750 kb. Using two different directional cloning schemes, several new clones between the genetic markers which most closely flank SMA were isolated. These new clones within the SMA candidate region, together with cosmid clones prepared from one RH hybrid which retains an approximately 1 Mb segment spanning the SMA region as its only human DNA, will greatly facilitate efforts to identify the gene for SMA. In addition, analysis of cloned DNA segments from within the SMA candidate region has identified the presence of a novel, chromosome 5-specific, low copy repeated sequence which is distributed throughout the region containing the SMA gene as well as in at least four other regions of chromosome 5. Whether or not these novel repeated sequences throughout the SMA region are involved in the disease remains to be determined.|
|
|
Authors:
|T G Thompson; K E Morrison; P Kleyn; U Bengtsson; T C Gilliam; K E Davies; J J Wasmuth; J D McPherson|
|
|
Related Documents :
|15322428 - A long pcr-based molecular protocol for detecting normal and expanded znf9 alleles in m...
|
1503558 - Carrier detection of deletions in female relatives of x-linked disorders by non-isotopi...
9199568 - Localization of a novel x-linked progressive cone dystrophy gene to xq27: evidence for ...
1914518 - In situ hybridization of two markers closely flanking the spinal muscular atrophy gene ...
18584448 - Diagnostic accuracy of the mmpi-2 malingering discriminant function index in the detect...
1978318 - Diastrophic dysplasia gene maps to the distal long arm of chromosome 5.
|
|
Publication Detail:
|Type: Journal Article; Research Support, Non-U.S. Gov't|
|
|
Journal Detail:
|Title: Human molecular genetics Volume: 2 ISSN: 0964-6906 ISO Abbreviation: Hum. Mol. Genet. Publication Date: 1993 Aug|
|
|
Date Detail:
|Created Date: 1993-11-05 Completed Date: 1993-11-05 Revised Date: 2006-11-15|
|
|
Medline Journal Info:
|Nlm Unique ID: 9208958 Medline TA: Hum Mol Genet Country: ENGLAND|
|
|
Other Details:
|Languages: eng Pagination: 1169-76 Citation Subset: IM|
|
|
Affiliation:
|Department of Biological Chemistry, College of Medicine, University of California, Irvine 92717.|
|
|
Export Citation:
|APA/MLA Format Download EndNote Download BibTex|
|MeSH Terms|
|
|
Descriptor/Qualifier:
|
Animals
|
Base Sequence
Child
Chromosome Mapping
Chromosomes, Human, Pair 5*
Cricetinae
Cricetulus
DNA Primers
European Continental Ancestry Group / genetics
Female
Genes, Lethal
Genes, Recessive
Humans
Hybrid Cells / radiation effects
In Situ Hybridization, Fluorescence
Male
Molecular Sequence Data
Muscular Atrophy, Spinal / genetics*
Pedigree
Polymerase Chain Reaction
Repetitive Sequences, Nucleic Acid*
|Chemical|
|
|
Reg. No./Substance:
|0/DNA Primers|
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine
Previous Document: A contig of non-chimaeric YACs containing the spinal muscular atrophy gene in 5q13.
Next Document: Detection of aneuploidy and chromosomal mosaicism in human embryos during preimplantation sex determ... | http://www.biomedsearch.com/nih/High-resolution-physical-map-region/8401498.html |
A stressed-out stepmom, misunderstood by her husband and mistreated by her step-kids, reaches out for support in an online forum. She describes her situation in detail – the step-kids, their ages, how often they come over. She describes how the kids complain about everything - the food, their activities, how bored they are. How their dad drops everything so that life revolves around the stepkids’ desires on those weekends together. There are no house rules, and no discipline. At the end of her post, the stepmom writes about her fears, feelings and frustrations: “I’m so alone, I feel like I don’t matter, and I’m afraid my relationship will fail because I don’t know how much more of this I can take”.
A Sea of Solutions.
Solutions and well-intentioned advice come pouring in – Talk to your husband about your feelings. – Try planning activities that you can all enjoy together ahead of time. – Let each family member pick an activity on a revolving basis every weekend. – Disengage and go out with your girlfriends on those weekends instead.
The advice received is endless, combined with occasional judgements about how ‘you signed up for this’ and ‘you’re letting this happen to you’, implying that somehow it’s the stepmoms fault and she should have known better.
But not a single one of those answers gets to the root of the problem – that the stepmom feels alone and fears her relationship will fail. Instead, this root of the problem is looked at as an afterthought, something that happens because of what is happening on the outside. I’ve seen this time and time again in online support groups.
A stepmom’s feelings and fears are often overlooked or minimized, with responses like “don’t take it personally” or “just let it go”.
But what if doing the opposite is the key to healing yourself and the situation? What if you shouldn’t let go, and should take it personally? That is, after all, what you’re doing anyways, isn’t it?
Well, I suggest you do just that, to the most-extreme sense of the word. Allow me to explain.
Don’t Let It Go.
Letting go implies that you simply ignore your feelings. It implies that your feelings are not important and that you are exaggerating by being angry, upset, or hurt.
This is just not true.
Never.
Your feelings do matter, and are of the utmost importance to your own life functioning. Working through your feelings allows you to show up as the best step mom you can be in your unique situation.
Take It Personally.
By ‘take it personally’, I mean that you make it about you and explore your negative feelings.
Look at what is being activated inside of you. Don’t overlook the feelings, ignore them or stuff them down. Instead, explore what is causing you to react this way. Explore how that reaction may be coming up in different parts of your life, especially in your past. Healing those feelings and fears may just be the solution to all your problems.
Really.
When you stuff down those negative emotions, they just accumulate inside of you until you can’t handle them anymore and explode.
A disclaimer: Taking it personally does NOT mean that you tell everyone about it, react from those negative feelings and cause more drama. It means you turn inwards and deal with your feeling first.
Tuning Inwards.
When you “take it personally”, you look inwards to work through those problems to resolve your role in what is happening. You can start with understanding your own emotions and reactions to what is happening. You can learn to understand what fears and beliefs may be driving your responses.
Once you clean up your role in what is happening, you are in a better place to decide what is best for you and your family. You can listen to your intuition, rather than the voice of fear, for those answers. After you deal with your own feelings and the limiting beliefs behind them, you are in a better place to act in an empowered way, rather than re-act emotionally to what is happening on the surface. It takes a lot of self-awareness to be able to do this.
For example, you may feel sad and rejected every time the kids show a lack of appreciation for what you do. The underlying problem may be that you don’t truly appreciate yourself. The underlying belief that you are not worthy of appreciation may be triggered every time your step-kids don’t say thank you. When you learn to appreciate yourself, others tend to follow suite. If you find creative ways to make your step-kids give thanks, you may still not feel appreciated unless you deal with your own limiting beliefs first.
You can come up with your own creative solutions to the problem. That’s not to say that the opinions and advice you receive are not valuable. However, if you receive that advice through the filter of denying your own fears and emotions, no external solution will ever be enough.
Those solutions you come up with may very well be disengaging and going out with your girlfriends, talking to your husband about your feelings, pre-planning activities, or a combination of the above. Those same answers that were offered up in the support group may indeed contain the solution you need.
The point is that when the answer comes from a self-fulfilled and empowered place within you, it’s then that you can achieve a true sense of accomplishment and peace as a stepmom. Rather than someone else telling you what to do in your desperate attempt to try anything and deny your own feelings, you can deal with your feelings first, then tune into your own inner-expert.
Your intuition can be your best friend and is there to support you in any moment. All you need to do it choose to believe in yourself and put your own emotional needs first, for the highest good of all those involved.
You can become emotionally resilient and learn to process your feelings rather than deny them. It’s then that you can achieve true peace despite whatever chaos is going on around you.
As a stepmom, you may reach a point in your family where you feel lost, confused and disconnected. In those moments, you may want someone to tell you what to do next. You may feel an urge to vent and ask for advice from family, friends, or even online stepmom communities. I encourage you to take a moment to journal, explore your own feelings, and see where this reaction within you is coming from. That doesn’t mean that it’s your fault or that you are to blame. It just means you’re willing to do your part to show up fully and completely to deal with the situation.
Have you ever experienced the inner-peace that comes from following your intuition? I’d love to hear about a situation where you dealt with your feelings first, tuned into your own inner expert, and found a creative solution to your problem. Now’s the time to brag, let’s hear all about it.
Anna de Acosta is an intuitive guide, life coach for stepmoms, and creator of the Mindful Stepmom guided meditation series, available on iTunes.
Anna teaches stepmoms to tune into and honor their desires, be mindful of their reactions, and act from an emotionally intelligent place in order to live in peace and be the change they want to see in their blended families.
She shares about her life and experience raising a mixed-culture, blended family of six over at her blog, annadeacosta.com.
Have a question you want answered by Anna? Write in to [email protected] with the subject “Dear Anna”.
This information is intended for entertainment purposes only, not meant to substitute legal, medical, or mental health professional advice
Check out Anna’s website at https://www.annadeacosta.com/
Or click on the pink icons below for Anna’s awesome social media! | https://socialstepmom.com/advice-is-over-rated/ |
As I discussed in the previous entry, a recent Guardian blog post (structured loosely as a news article) made worldwide headlines. It was trumpeted by the Guardian blogger as an "exclusive"; he was given a copy of a paper soon to be published in the journal Ecological Economics. Because he didn't provide any context for the paper (the authors were not interviewed, nor were any independent experts), I thought I'd jump into this vacuum. Let's start with the first paragraph of the study's abstract:
There are widespread concerns that current trends in resource-use are unsustainable, but possibilities of overshoot/collapse remain controversial. Collapses have occurred frequently in history, often followed by centuries of economic, intellectual, and population decline. Many different natural and social phenomena have been invoked to explain specific collapses, but a general explanation remains elusive.
Anthropologists are loathe to make sweeping generalizations about the dissolution and/or reorganization of prehistoric cultures. This hasn't stopped popular narratives about carrying capacity from taking hold and remaining immune to mounting evidence that challenges prevailing views. Let's return to the study's abstract:
In this paper, we build a human population dynamics model by adding accumulated wealth and economic inequality to a predator-prey model of humans and nature. The model structure, and simulated scenarios that offer significant implications, are explained. Four equations describe the evolution of Elites, Commoners, Nature, and Wealth. The model shows Economic Stratification or Ecological Strain can independently lead to collapse, in agreement with the historical record.
In other words, overconsumption by elites and/or resource depletion lead to societal collapse, the authors assert. Early in the paper, they walk us through the historical record, citing, among other examples, the fall of the Roman Empire and the crumbling of ancient societies from Southeast Asia to the American Southwest as case studies that suggest "the process of rise-and-collapse is actually a recurrent cycle found throughout history." The question this raises, they write, is "whether modern civilization is similarly susceptible" to a crash. One of the questions nagging at me when I read this study was whether prehistoric societies are appropriate analogues for our 21st century world. Oxford's Steve Rayner, an anthropologist I contacted, provided valuable context:
Whether historical empires were fragile or robust depends on your time perspective and how you divide up historical epochs.
But the authors insist in their paper:
The fall of the Roman Empire, and the equally (if not more) advanced Han, Mauryan, and Gupta Empires, as well as so many advanced Mesopotamian Empires, are all testimony to the fact that advanced, sophisticated, complex, and creative civilizations can be both fragile and impermanent.
Rayner counters:
But China as a civilization dates from at least 2070 BCE, that makes it 4000 years old at present. Just because it has been eclipsed by the west for a mere couple of centuries should not blind us to this. The first Egyptian dynasty began around 3000 BCE and the Ptolemys collapsed in 30 BCE when Egypt was incorporated into the Roman Empire, which lasted another 400-500 years, before itself morphing into the Holy Roman Empire and Byzantium respectively, the latter morphing into the Ottoman Empire. These seem to me to be pretty long epochs in human terms, if not in geological ones. Nothing lasts for ever and arguably while individual human societies come and go humanity seems to be better off in general today than ever before.
He also said that "the very idea of collapse is ideologically loaded" and offered a suggestion:
For a much more balanced approach to the issue of technological innovation and sustainability I recommend you take a look at the final chapter of Joseph Tainter's book "The Collapse of Complex Societies."
As it happens, I'm very familiar with Tainter's work, that book in particular. And since Tainter, a Utah State University anthropologist, was repeatedly cited by the authors, I already thought it would be good to get his thoughts. His first response was curt:
Overall I found the paper to be trivial and deeply flawed. It is amazing that anyone would take it seriously, but clearly some people do (at least in the media). You are correct that they cite my work a lot, but they seem not to have been influenced by it, or even to understand it. I suspect they were strongly influenced by the work of Peter Turchin—for which, please see the attached (short) review.
He then promised to send a more detailed response, which he emailed several days later. Here it is in full (emphasis mine)
It is interesting how collapse theories mirror broader societal issues. During the Cold War, we had theories ascribing collapse to elite mismanagement, class conflict, and peasant revolts. As global warming became a public issue, scholars of the past began to discover that ancient societies collapsed due to climate change. As we have become concerned about sustainability and resource use today, we have learned that ancient societies collapsed due to depletion of critical resources, such as soil and forests. Now that inequality and “the 1%” are topics of public discourse, we have this paper focusing largely on elite resource consumption. Models depend on the assumptions that go into them. Thus the first four pages of the paper are the part most worth discussing. The paper has many flaws. The first is that “collapse” is not defined, and the examples given conflate different processes and outcomes. Thus the authors are not even clear what topic they are addressing. Collapses have occurred among both hierarchical and non-hierarchical societies, and the authors even discuss the latter (although without understanding the implications for their thesis). Thus, although the authors purport to offer a universal model of collapse (involving elite consumption), their own discussion undercuts that argument. Contrary to the authors’ unsubstantiated assertion, there is no evidence that elite consumption caused ancient societies to collapse. The authors simply have no empirical basis for this assumption, and that point alone undercuts most of the paper. The authors assert that there is a “two-class structure of modern society,” and indeed their analysis depends on this being the case. The basis for this assertion comes from two papers published in obscure physics journals. That’s right, this assertion does not come from peer-review social science. It comes from journals that have no expertise in this topic, and whose audience is unqualified to evaluate the assertion critically. In other words, there is no empirical or substantiated theoretical basis for this paper’s model. In modeling, once one has established one’s assumptions and parameters, it is a simple matter to program the mathematics that will give the outcome one wants or expects. For this reason, models must be critically evaluated. Unfortunately, most readers are unable to evaluate a model’s assumptions. Instead, readers are impressed by equations and colored graphs, and assume thereby that a model mimics real processes and outcomes. That seems to be the case with this paper, and it represents the worst in modeling.
Others I queried, such as the Canadian scientist Vaclav Smil, and George Mason University's Mark Sagoff, noted the model's Limits to Growth echo. Sagoff was bluntly dismissive:
I skimmed the article yesterday and saw that it was the Club of Rome all over again -- the computer that cried wolf. I have no doubt that many empires fell as others rose. Now the average man lives better than the ancient emperor. We have seen creative destruction before and we will see it again. But what destroys improves. There is nothing here [in the paper] that was not presented in the 1960s and 1970s by Paul Ehrlich and other "Cassandras" as they called themselves. Their views, repeated in this [Guardian] article and study, have been completely discredited.
Sagoff ended on a down note:
I am sorry to have seen the paper you sent -- it is discouraging. Nobody learns anything or bothers to try.
So what do the authors of the study think of this harsh criticism? (I'm still waiting to hear back from additional social and environmental scientists. I'd like to know if others have a more charitable take on the paper). I've contacted two of the three co-authors repeatedly this week, asking to interview them about their paper--including how it's been characterized in the media and the critiques lodged in this space. But they have declined. They say they would rather wait to speak to the press until their paper is published in several weeks. If that's the case, then I think they will come to regret giving a Guardian writer an advance peek for a story ahead of publication. A second wave of media interest is unlikely to be triggered by the paper's official publication. Perhaps the authors are fine with that. One of them, Eugenia Kalnay, a University of Maryland atmospheric scientist, did convey to me, via email, her approval of the Guardian article:
Dr. Nafeez Ahmed wrote an excellent discussion based on a pre-publication draft of the paper.
Ahmed wrote an uncritical appraisal of the study. He didn't bother to inquire about the merits of the model or its results. If Kalnay and her colleagues would like to engage in actual discussion of their paper, I encourage them to visit this space. I will gladly post their responses. | https://www.discovermagazine.com/environment/judging-the-merits-of-a-media-hyped-collapse-study |
Gerbil-ethereum is a package to interact with the Ethereum network from Gerbil Scheme. It is an alternative to “web3.js” and other interfaces to the Ethereum network; it is not at all a reimplementation of the Ethereum protocol, and relies on an existing node such as Geth or Parity to implement the Ethereum protocol.
Copyright and License
Copyright 2020 Mutual Knowledge Systems, Inc. All rights reserved. Gerbil-Ethereum is distributed under the Apache License, version 2.0. See the file LICENSE.
What does Gerbil Ethereum do?
Gerbil-ethereum provides an interface to an Ethereum node’s JSON RPC server, just like web3.js does, but with Gerbil Scheme as the underlying language platform, rather than node.js or a browser. Notable modules include but are not limited to the below:
-
tx-tracker.ssprovides an interface to ensure transactions are posted, no matter what. A tracked transaction will be retried until it succeeds, even if the process crashes and restarts. This is essential for decentralized applications such as atomic swaps or state channels, that require you to post a transaction before a deadline under pain of losing your assets. Messages are scheduled and persisted before they are issued, so that a temporary machine crash or network crash won’t cause you to either forget to post or post twice.
-
assembly.ssprovides an assembler for the EVM as an embedded DSL. This assembler can be used directly to write contracts using Scheme functions as a macro-assembler, or it can be used indirectly as the embedded backend of a compiler. Either way, you can achieve more efficient and safer code than by using extremely badly designed languages such as Solidity.
-
batch-send.ssincludes a tiny batch transfer contract written in EVM assembly, that allows you to send tokens to many different addresses in a single transaction. This is important in that it allows a single confirmation for multiple transfers, cutting into the runtime latency and build-time complexity to properly track many simultaneous transactions and nurse them to completion in an adversarial network. In the near future, we may also offer a similar contract to batch multiple contract calls.
-
json-rpc.ssoffers you a typechecked FFI to all the usual Ethereum JSON RPC APIs.
There are plenty of other support files, and we’ll keep working on this library as we build software on top of it.
Why use Gerbil Ethereum?
-
Better Language, Simpler Code: Gerbil Ethereum can achieve functionality similar to that of libraries in other languages at a fraction of the complexity, because the underlying language is more expressive. First-class continuations and threads enable you to directly express in Scheme massively concurrent computations that require jumping through many hoops in other languages, such as async functions, monads, trampolines, thread pools, factory factories, etc. Scheme’s unique ability for syntactic abstraction not only makes the code much more succint, but also much safer, by protecting the users from errors introduced by developers when they manually follow “design patterns”, or fail to follow them, especially as they subsequently evolve their code. Using prototype object orientation for type descriptors, we can leverage both ad-hoc and parametric polymorphism to factor our code into small pieces of incremental functionality that nicely build on each other, rather than large monolithic pieces of code that constantly repeat each other. In the end, that means not only much less code to write, but even more importantly for cryptocurrency software, much less code to audit.
-
npmpackage manager. But to enjoy the benefit of this ecosystem, you’ll soon find yourself pulling hundreds or thousands of libraries from as many unidentified developers. That’s millions of lines of code that no one has the hope to ever audit, what more in a combination that moves too fast for an audit to remain valid very long. Indeed, cryptocurrency wallets have been attacked not just through existing bugs in such libraries, but also through supply chain attacks wherein bad actors took over some remote indirect dependency of a wallet so as to gain access to its users’ assets. By contrast, Gerbil may have fewer libraries, but it includes everything required to interact with Ethereum, except for a few thousand lines of code that can be readily audited, written by a small group of well-identified reputable individuals who have been working on this or similar software for decades, plus a few small well-audited libraries that everyone trusts and use (such as Bitcoin’s secp256k1, Ethereum’s keccak, or Google’s leveldb).
-
Safer Programming Model: with Gerbil Ethereum, we are creating a programming model for building decentralized applications that are safe by construction. Our current code base does not yet offer builtin protection against all the attacks that we are thinking of preventing, yet the programming model it offers is already significantly more robust than that offered by platforms such as web3.js. For instance, we take persist-before-messaging discipline seriously, with persistent activities, proper transactionality, and in the future distributed replication. We also build and test our code with deterministic build tools that ensure that if it works for us, it will work for everyone.
-
We use optional third-party analytics cookies to understand how you use GitHub.com so we can build better products. Learn more.
We use optional third-party analytics cookies to understand how you use GitHub.com so we can build better products.
You can always update your selection by clicking Cookie Preferences at the bottom of the page. For more information, see our Privacy Statement. | https://www.interchains.cc/18866.html |
All construction supplies will be moved south of the stadium.
The east side of Faurot Field is under construction for the entire 2013 football season, and once completed will create 5,000 more seats for fans. Renovations are projected to be complete by Opening Day 2014.
Amid an active construction site at Faurot Field at Memorial Stadium, Mizzou Athletics is opting for a wait-and-see approach on crowd control and foot traffic.
But first, the construction site needs to be cleared so the area is usable for spectators.
The cleanup process includes laying concrete, covering up exposed areas and moving all equipment to an area south of the stadium. The cranes will festoon the student side of the stadium all season, and athletics officials have debated decorating them for games.
The east side of Memorial Stadium will be an active construction site for the duration of the 2013 season as crews build an upper deck that will have more than 4,000 seats and a club level with at least 800 seats, according to Mizzou Athletics. The renovations will also comply with new Americans with Disabilities Act regulations.
In the meantime, the east side will need to be safe for the thousands of students going to the game, athletics spokesman Chad Moller said. Inspectors will check the area before each home game to make sure it is secure.
The construction on the east side is the second phase of a renovation to Memorial Stadium. For first phase, the rock M was moved closer to the field, and the north concourse was expanded. The west tower was also renovated.
Once work on the east side is completed, the capacity will increase by more than 5,000 seats. For the 2013 season, the official capacity was reduced by 3,880 seats — to 67,124 — due to construction.
During the work, the vast majority of the east side will be unusable, and foot traffic will be impacted, Moller said. In the path to the student entrances are three concrete towers and many more supports. Students will continue to use traditional student gates now situated under the skeleton of the upper deck.
The construction might cause the Tiger's Lair student section to make adjustments to its game day operations, but director Jake Hamilton said he is waiting until after Saturday's game against Murray State to make any judgements.
"We don't know what the construction is going to do for us, and so we want to wait and see," Hamilton said.
Wait-and-see is Mizzou Athletics’ approach as well. While other student entrances will deal with the same problems, Athletics has told Tiger's Lair that everything will work the same way, Hamilton said.
"We have no way of knowing until the first game," Moller said.
If something changes from the norm on game days, Moller said it will be communicated to fans.
Hamilton visited the construction site to hang the Tiger's Lair flag, and he said he thought the stadium will be ready for Saturday.
“A couple days ago, I was like, ‘This is not going to get done,’" he said. "But they have laid concrete, boarded up exposed things. They have had to barricade off some spots where they don't want people, and that's what is going to be difficult for us."
With certain areas off-limits, Hamilton and his team cannot plan ahead because they will not really know what they have to work with until game day.
Hamilton's main concern is getting people in the stadium and line control. The construction might complicate the process, he said, but he thinks it will be good for Tiger's Lair. He plans on using the construction site as a resource to help with line control since the supports can act as physical barriers.
"The new additions are beautiful, and we work around whatever we need to as long as we can get our people into the stadium," Hamilton said. "I'm not worried about it." | https://www.themaneater.com/stories/sports/game-days-disrupt-faurot-field-renovation-project |
Poverty Point is a 1 square mile 2.
I would hope not. We recently celebrated five years of continuous presence in low earth orbit on the International Space Station. Tomorrow, the lowly pub may once again help foster a burgeoning economy in some far away places. This reflects the tensions between Congress and the Democratic Administration about the priority role of SLS and Orion versus commercial crew.
Sputnik 1 was launched by an R-7 rocket. Mineral wealth in the Superior Upland is legendary. It has not accepted this mantle easily nor always carried it willingly; the principles and ideals of its founders have been tested by the pressures and exigencies of its dominant status.
Archeological and linguistic data has enabled scholars to discover some of the migrations within the Americas. China first launched a person into space 42 years after the launch of Vostok 1, on 15 Octoberwith the flight of Yang Liwei aboard the Shenzhou 5 Divine Vessel 5 spacecraft.
Gilruth was the person who suggested to John F. Other organizations across the Department of Commerce that handle space include: After all, the U. Fearing Soviet nuclear weapons launched from orbit, the U. Soviets, in turn, were pictured as the ultimate villains, with their massive, relentless efforts to surpass America and prove the power of the communist system.
Air Force made an upgrade to its Joint Space Operations Center JSpOC to improve space surveillance, collision avoidance, launch support, and the ability to provide more precise and timely orbital information.
What kind of space program should we foster and what to do next with it remains a recurring question. Eventually, I'll need to clean my bar.
The national capital is Washingtonwhich is coextensive with the District of Columbiathe federal capital region created in So after we have the infrastructure to reliably get off the planet, we will make those inevitable discoveries on the moon.
The rolling, rocky hills of southeastern New England are not dissimilar to the Piedmont, while, farther northwest, the rugged and lofty White Mountains are a New England analogue to the Blue Ridge.
Space Race Heats Up Inthe Soviet space program took another step forward with the launch of Luna 2, the first space probe to hit the moon.
Its space science program includes successful missions to asteroids and the Moon, with follow-on return missions planned.
Canada Canada became the fourth nation to operate a satellite in space with the launch of Alouette 1 in The communities were located near good arable land, with dry farming common in the earlier years of this period. All with one big bow. Sure, we have profitable communications satellites pushing television signals to cell phones in some parts of the world.
The EC focuses its resources on three primary areas: About the author Violetta Orban Violetta is an Italian young professional of international relations, collaborating with various think tanks in geopolitics and foreign policy analysis.
The NGA uses imagery from space-based, national intelligence reconnaissance systems, as well as commercial satellites and other sources, to develop imagery and map-based intelligence solutions and provide geospatial intelligence support for global world events, disasters and military actions.
Both nations could be seen as simply responding to what they see as the U. Within this area, societies participated in a high degree of exchange; most activity was conducted along the waterways that served as their major transportation routes.
If an imminent threat is perceived, a satellite or its operators might preemptively attack via dazzling lasers, jamming microwaves, kinetic bombardment or any other number of possible methods. In recent years, Luxembourg has also taken interest in the asteroid mining industry.
While Mexico has yet to create a space infrastructure, it is well on its way. For years Russia and China have pushed for the ratification of a legally binding United Nations treaty banning space weapons—a treaty that U. There is broad agreement that it would be ideal if there were a more active space traffic management system, and more open access to data.
This is the first satellite that will have been completely developed by Emirates engineers at the Mohammed bin Rashid Space Centre. Watch video · Inthe Soviet space program took another step forward with the launch of Luna 2, the first space probe to hit the moon.
Time Series Analysis by State Space Methods: Second Edition (Oxford Statistical Science Series) 2nd Revised ed.
Edition.
High Acceleration, High Life Cycle, Reusable In-Space Main Engine: This custom bibliography from the NASA Scientific and Technical Information Program lists a sampling of records found in the NASA Aeronautics and Space Database.
The scope of this topic includes technologies for the crew exploration vehicle. China has outmaneuvered the United States in recent years, particularly with regard to trade, says President-Elect Donald J. | https://bukimyvomuwyle.gabrielgoulddesign.com/an-analysis-of-united-states-space-exploration-51338xn.html |
A Future for Clean Coal?
Nearly two years after Barack Obama spearheaded the COP21 climate accord and just over five months after his successor announced the United States would withdraw from it, Donald Trump cast a long shadow over the UN climate negotiators who came together for the COP23 climate change conference in Bonn. At the first major global climate talks since Trump took office, the new sheriff in Washington made it clear that the fight between green energy – solar, wind, hydro and nuclear and fossil fuels – oil, coal, gas and shale – is far from over.
Trump’s envoys to Bonn may have been the most visible sceptics in attendance, but their presence alone does not entirely explain why policymakers the world over aren’t rushing to create fully “renewable” energy grids. The British and Canadian “Powering Past Coal” alliance unveiled at the end of the COP23 is seen as a rebuke to Trump – but China, India, Germany, and Russia, which are heavily reliant on fossil fuels, are also conspicuously absent.
It’s unlikely any of those countries will sign up soon. The global economy, for the most part, still relies on the traditional fuels that make up 80% of the global energy mix. Even where green energy plays a prominent role, campaigners can’t agree on what “green” means. Jean-Luc Mélenchon may want France to abandon nuclear power entirely, but his countrymen will never follow Germany down that road. The Swedes voted in a 1980 referendum to close all nuclear stations; they still rely on 10 nuclear reactors for more than 40 per cent of all energy, and decided just last year to allow for more.
No one has so far worked out how to move people and goods without using fossil fuel energy. Voters in Western democracies want to be able to reliably switch on their lights, turn up their heating or air-conditioning, start their cars, get on buses, and order from Amazon. Denizens of emerging markets and the developing world want to be able to generate power without having to burn noxious fuels in their homes.
One of the most bitter energy battlegrounds at the COP23 may have been the Trump administration’s commitment to coal, but the US was hardly the only advocate in the room. Many of the most populous nations in the world – China, India, and Indonesia (and yes, the US) still rely on coal for at least half of their electricity generation. IEA energy analysts see a greater amount of renewable capacity coming online over the next several years, but they also acknowledge coal will remain a key energy source for decades to come. Even as public discourse in Europe takes a different tack, the amount of lignite or brown coal production used to generate electricity in EU member states has barely changed in the last 20 years.
Many of the arguments the U.S. put forward in defence of fossil fuels are voiced even more strongly in the developed world. In Africa, the challenge of providing 600 million people who have no access to energy is pushing leaders on the continent to demand the same energy rights as their richer neighbours to the north. In pursuit of electrification, they argue that the massive coal reserves of the continent should be harnessed. As Naeema Ahmed, of the London-based Africa Alternative Energy Initiative (AAEI), told the Ghana News Agency: “As a matter of urgency, countries need to look at alternative ways of accessing and using cleaner fossil fuels as well as renewable energy for economic development.”
That viewpoint has been echoed by the Africa Progress Panel (chaired by former UN Secretary General Kofi Annan), which recently produced a report backing the use of Africa’s coal reserves with other energy sources “in as cost-effective and technologically efficient manner as possible, so that no-one is left behind.” One year ago, Nigerian Finance Minister Kemi Adeosun appealed to a joint World Bank-IMF meeting by saying: “We in Nigeria have coal but we have power problems, yet we’ve been blocked because it is not green. There is some hypocrisy because we have the entire Western industrialisation built on coal energy. Now that Africa wants to use coal they deny us.”
In both the U.S. and Nigeria, critics of the international finance bodies and multilateral development banks continue to make the case for clean coal technology, pointing out that many poor countries sit on coal reserves and cannot realistically build stable energy infrastructure based on nuclear, wind, solar and other energy sources. In Bonn, chief US delegate George David Banks even raised the prospect of a “clean coal alliance” which would presumably stand in direct opposition to the Anglo-Canadian Powering Past Coal bloc.
To preserve the global drive towards reduced emissions reductions, the two sides need to find some middle ground. One way to square this circle would be to invest seriously in carbon capture and storage (CCS) technologies, for which the EU allocated €1 billion in 2009 but of which no demonstration projects currently exist in the EU member states. Despite mistrust from environmental groups, CCS technologies are seen as indispensible for reaching the 2050 climate targets set by the Paris agreement. The Treasury Department recently changed the rules governing the financing of fossil fuel projects in developing countries, calling on the World Bank to follow suit.
While the initial batch of projects promoted across Europe ran into a variety of financial, political, or feasibility constraints in the years after the EU decided to back them, that does not mean it is time to throw in the towel. New CCS projects continue to come online in the US, non-EU members like Norway, and in Asia; in Iceland, a pilot project is now managing negative carbon emissions by removing CO2 from the atmosphere and turning them into solid stone. If these “negative emissions” projects end up being the key to upgrading the world’s coal-fired plants without having to take them offline, they could be the key to helping poorer countries while driving global emissions down. | https://www.huffingtonpost.co.uk/entry/green-black-energy_uk_5a1ff2cce4b064ca3c151239 |
Radiopharmaceuticals may be used as diagnostic or therapeutic agents by virtue of the physical properties of their constituent radionuclides. Thus, their utility is not based on any pharmacologic action per se. Most clinically used drugs of this class are diagnostic agents incorporating a gamma-emitting nuclide which, because of physical, metabolic or biochemical properties of its coordinated ligands, localizes in a specific organ after intravenous injection. The resultant images can reflect organ structure or function. These images are obtained by means of a gamma camera that detects the distribution of ionizing radiation emitted by the radioactive molecules.
In radioimaging, the radiolabel is a gamma-radiation emitting radionuclide and the radiotracer is located using a gamma-radiation detecting camera (this process is often referred to as gamma scintigraphy). The imaged site is detectable because the radiotracer is chosen either to localize at a pathological site (termed positive contrast) or, alternatively, the radiotracer is chosen specifically not to localize at such pathological sites (termed negative contrast).
Many of the procedures presently conducted in the field of nuclear medicine involve radiopharmaceuticals which provide diagnostic images of blood flow (perfusion) in the major organs and in tumors. The regional uptake of these radiopharmaceuticals within the organ of interest is proportional to flow; high flow regions will display the highest concentration of radiopharmaceutical, while regions of little or no flow have relatively low concentrations. Diagnostic images showing these regional differences are useful in identifying areas of poor perfusion, but do not provide metabolic information of the state of the tissue within the region of apparently low perfusion.
It is well known that tumors often have regions within their mass which are hypoxic. These result when the rapid growth of the tumor is not matched by the extension of tumor vasculature. A radiopharmaceutical which localizes preferentially within regions of hypoxia could be used to provide images which are useful in the diagnosis and management of therapy of tumors, as suggested by Champman, “Measurement of Tumor Hypoxia by Invasive and Non-Invasive Procedures—A Review of Recent Clinical Studies”, Radiother. Oncol., 20(S1), 13-19 (1991). Additionally, a compound which localizes within the hypoxic region of tumors, but is labeled with a radionuclide with suitable alpha- or beta-emissions could be used for the internal radiotherapy of tumors. In the brain or heart, hypoxia typically follows ischemic episodes produced by, for example, arterial occlusions or by a combination of increased demand and insufficient flow.
However, many radionuclides are less than ideal for routine clinical use. For example, the positron-emitting isotopes (such as 18F) are cyclotron-produced and short-lived, thus requiring that isotope production, radiochemical synthesis, and diagnostic imaging be performed at a single site or region. The costs of procedures based on positron-emitting isotopes are very high, and there are very few of these centers worldwide. While 123I-radiopharmaceuticals may be used with widely-available gamma camera imaging systems, 123I has a 13 hour half-life (which restricts the distribution of radiopharmaceuticals based on this isotope) and is expensive to produce. Nitroimidazoles labeled with 3H are not suitable for in vivo clinical imaging and can be used for basic research studies only.
A number of factors must be considered for optimal radioimaging in humans. To maximize the efficiency of detection, a radionuclide that emits gamma energy in the 100 to 200 keV range is preferred. To minimize the absorbed radiation dose to the patient, the physical half-life of the radionuclide should be as short as the imaging procedure will allow. To allow for examinations to be performed on any day and at any time of the day, it is advantageous to have a source of the radionuclide always available at the clinical site.
A variety of radionuclides are known to be useful for radioimaging, including Ga-67, Tc-99m, In-111, I-123, and I-131. The preferred radioisotope for medical imaging is Tc-99m. Its 140 keV gamma-photon is ideal for use with widely-available gamma cameras. It has a short (6 hour) half life, which is desirable when considering patient dosimetry. Tc-99m is readily available at relatively low cost through commercially-produced 99Mo/Tc-99m generator systems. As a result, over 80% of all radionuclide imaging studies conducted worldwide utilize Tc-99m. See generally Reedijk J. “Medicinal Applications of heavy-metal compounds” Curr. Opin. Chem. Biol. (1999) 3(2): 236-240; and Hom, R. K., Katzenellenbogen, J. A. “Technetium-99m-labeled receptor-specific small-molecule radiopharmaceuticals: recent developments and encouraging results” Nuc. Med. and Biol. (1997) 24: 485-498. These advantages, coupled with the fact that Single Photon Emission Computed Tomography cameras are optimized for the 140 keV energy of Tc-99m, clearly demonstrate the superiority of Tc-99m-labeled imaging agents.
Recently, a new Tc(I) labeling system has been developed. Aberto, R., Schibli, R., Egli, A., Schubiger, A. P., Abram, U., Kaden, T. A. “A Novel Organometallic Aqua Complex of Technetium for the Labeling of Biomolecules: Synthesis of [99mTc(OH2)3(CO)3]+ from [99mTcO4]− in Aqueous Solution and Its Reaction with a Bifunctional Ligand” J. Am. Chem. Soc. (1998) 120: 7987-7988; and Alberto, R., Schibli, R., Daniela, A., Schubiger, A. P., Abram, U., Abram, S., Kaden, T. A. “Application of technetium and rhenium carbonyl chemistry to nuclear medicine—Preparation of [Net4]2[TcCl3(CO)3] from [NBu4][TcO4] and structure of [NEt4][Tc2(u-Cl)3(CO)6]; structures of the model complexes [NEt4][Re2(u-OEt)2(u-OAc)(CO)6] and [ReBr({—CH2S(CH2)2Cl}2(CO)3]” Transition Met. Chem. (1997) 22: 597-601. This system takes advantage of the organometallic Tc(I) carbonyl chemistry. Importantly, the chemistry of [99mTc(OH2)3(CO)3]+ has been elucidated and simplified to the point where the methods are routine and offer a practical alternative to the currently employed Tc(V) chemistry. In contrast to the highly reactive Tc(V)-oxo cores, where the chemistry is sometimes unpredictable and includes labeling cleanup steps, the Tc(I) method offers an attractive labeling alternative. However, unlike the Tc(V)-oxo core, the Tc(I)(CO)3+ core limits the number of possible coordination geometries available for Tc due to the presence of the three carbonyl groups. The facial arrangement of carbonyl ligands around the metal center also impose steric constraints on the binding possibilities of the remaining three sites.
Moreover, the [99mTc(OH2)3(CO)3]+ complex can be readily prepared in saline under 1 atm of carbon monoxide (CO). This water and air stable Tc(I) complex is a practical precursor to highly inert Tc(I) complexes, due in part to the d6 electron configuration of the metal center. As already pointed out, the preparation of the organometallic tris(aquo) ion is simple and straightforward, allowing for convenient manipulation and product formation. Substitution of the labile H2O ligands has been shown to leave the Tc(CO)3+ core intact. This stable core has the additional advantage of being smaller and less polar than the routinely employed Tc(V)-oxo systems. This characteristic could be advantageous in biologically relevant systems where the addition of the metal center effects the size, shape, and potentially the bioactivity of the compounds.
Although various chelators are currently employed in the binding of tectnetium, all of these tracers suffer from one or more disadvantages which render them less than ideal: HYNIC requires coligands; MAG3 may be only used with the Tc(V)-oxo species; EDTA/DTPA is used primarily with Tc(V)-oxo and its ability to retain label is poor. Hence, additional Technetium-99m chelators are needed. Novel radiolabeled chelators that display rapid, efficient labeling and demonstrate superior labeling retention for both Tc(V)-oxo and Tc(I)-tricarbonyl cores without the use of coligands are attractive candidates for clinical evaluation as potential chelators for biologically relevant molecules.
| |
1.Please introduce yourself.
I am the Deputy Internet Editor of The Hindu. Ranging from print to digital, I have just completed 20 years of work experience as an editor and in communications. I have worked with The Hindu, the US Consulate in Chennai and the United Nations Millennium Campaign in New Delhi.
Original Link:
http://blog.getspini.com/swep-inspire/
2. What made you choose journalism as your profession?
Actually, I spent the first 16 years of my life wanting to be a vet! However, I have always been an avid reader and as a child and teenager I was very influenced by my grandfather, who retired as the Director General of All India Radio after being Principal Information Officer to the Government of India during the Emergency. As a young adult, I heard him speak often about the power and responsibility of the press and his own unhappiness at having to oversee the implementation of Emergency in this country.
I was always interested in journalism, from the time when I was editor of my school and college newsletters. I did my BA in English Literature and then worked at a social sciences journal, Seminar, soon after college. I did a post graduate diploma in Publishing from Oxford Brookes University in the UK. I joined The Hindu after that and spent seven years editing, first with the Sunday Magazine, Folio, and the Hindu’s Newspaper in Education Programme, and then with the Tamil Nadu news desk and Frontline magazine. My early exposure to different kinds of writing and a range of issues really helped me see the world differently. I got progressively more interested in various development and social issues and I took a year off work and went to the UK to do a Master of Science degree in Media and Communications at the London School of Economics and Political Science.
This course was based in the department of social psychology and it really strengthened my love for journalism and gave me a solid theoretical base from which to learn about and think about issues. I think journalists have one of the most rewarding jobs in the world. When practiced ethically, journalism can provide a moral compass to make sense of the world, help people decipher the realities around them and to hold power to account. I have worked in other organizations, holding progressively more responsible positions dealing with various communication forms, campaigns and media, but I have only ever truly felt at home in journalism because there is a clear ethical purpose to what we do.
3. What is your opinion on digital media vs newspaper in the future? And how work friendly will the digital media be for women?
I think in India, at least, the newspaper will still be around for a long time to come, despite the doomsday predictions that abound these days on the future of print. There is a different charm and pace to newspaper publishing and I am fortunate to have been on both sides of the fence. However, we live in a very digital world and even print journalists desperately need to equip themselves with the skills to live and work in a digital world.
But the way in which people are accessing information now, through social media and the mobile phone, has disrupted the way in which journalism is practiced today. Newspapers need to adapt to meet these new technologies and user needs while ensuring that stringent quality checks are in place. On the digital front there is too much noise, sensationalizing of content and a focus on the private lives of individuals that is not doing anything for the practice of journalism. There needs to be a middle ground where we cater as a profession to readers, using new technologies and serving our readers with a range of content that will enrich their lives, not treat them as consumers or generators of page views.
There is great scope for digital media to be more friendly for women. The technology that is available today ensures that you can work from home comfortably and ensure a work-life balance. However, organizations also need to allow a work from home option and that is not so prevalent in the media/news industry, especially in India.
4. SWEP is a group of women who have taken break from career for family. A few are interested in getting back on their toes and a few looking for options to work from home. What are the options for these women in your field? Can you guide those who are interested in journalism and writing?
Journalism and digital media offers great scope for women who are returning to the workplace. Many media organizations rely on content from freelance journalists who have specialized in some field. Another potential source of business for writers is in content creation and writing. Many corporate organizations outsource content to freelance writers for publicity material, websites, newsletters, blogs and so on.
For a news journalist, it may be harder to work from home on hard core reporting as they would need an institutional affiliation, but many freelance reporters specialize in some area and are often called upon to contribute opinion pieces and blogs. Of course, being a freelancer also comes with its share of insecurities, and it is hard work to chase up on jobs or on payments, but if one is willing to deal with that amount of risk then it is a great way to ensure work at one’s own pace and some independence in terms of structuring one’s time!
5. How important is vast reading and keeping a broad, inclusive mind in journalism?
This is very important. Journalism rests on the assumption that the journalist will sift through the wide swathes of information that are available and then present them to the reader in a cohesive and responsible way that helps them make sense of the world in which they life. Journalism is a key pillar of democracy and it is the journalist’s duty to present the plurality of thought that exists in the public sphere.
For this, they must read widely and make connections and sense of what is going on around them, keep an ear to the ground and understand how society is working around them. Unfortunately, the digital landscape has changed so much with the near monopoly that Facebook and Google have over the digital space, that people are increasingly speaking in echo chambers, and their one-sided views are being reinforced. This has led to a sharp polarization of views that we see played out on social media platforms today, with the abundance of fake news and online trolling that is going on. Journalists are increasingly giving up their mandate to be objective and are participating in this polarization.
6. Piece of advice for the ladies in SWEP
Women often underestimate themselves and realize their potential late, by which time society and patriarchy have ensured that their spirit is crushed! I would say be confident, follow your instincts, but back it up with hard work and be street smart! | https://theinterviewportal.com/2018/08/20/the-hindu-editor-interview/ |
One of the greatest social injustices is that people who are marginalized experience more illnesses, disability, and shorter lives than those who are more affluent (Benzeval, Judge, and Whitehead, 1995). In this dissertation I critique the notion that health is affected by poverty through primarily material factors. In fact, poor women are systematically excluded from resources and opportunities to pursue their health. This feminist action research project addressed how poverty and exclusion influenced poor women's health, examined how a group of women negotiated their experiences of poverty and health, and developed action strategies to address their shared concerns. For 1 V2 years I worked with a group of 30 poor women and gathered qualitative data from 15 meetings, 32 interviews, and 30 sets of fieldnotes. The women lived in material deprivation and could not afford the most basic living necessities. They felt stereotyped, excluded, and invisible in their every day lives. The stereotype of the "welfare recipient" fueled institutional stigmatization and surveillance. Welfare, health care, and community recreation workers were threatening, withheld important information, and limited the women's access to services through chscriminatory practices and policies. The women had limited access to health-promoting resources, and their interactions with authorities were shaming which negatively influenced their psychosocial health through stress, depression, low self-esteem, and anger. Services that were meant to help them labelled them as poor and hurniliated them. The women's shame, material scarcity, and limited access to resources engendered feelings of lack of control and hopelessness and influenced their health. The women's varied discourses of poverty and health reflected attempts at finding legitimacy in a society that systematically excluded and de-legitimized them. Through their conversations and our feminist action research work together, they uncovered legitimate identities within experiences of poverty and ill-health and advocated action and social change. They cited a "livable" income, accessible health-promoting resources, and redressing stigmatizing practices and policies as changes required to improve their health. These findings confirmed that the social determinants of health must be reframed to better understand the effects of exclusion on poor women's health and that inclusion, respect, and dignity are fundamental conditions for promoting health.
Item Media
Item Citations and Data
License | https://open.library.ubc.ca/soa/cIRcle/collections/ubctheses/831/items/1.0076911 |
By Jacklin Kwan
Early results from the Canadian Hydrogen Intensity Mapping Experiment (CHIME) have recorded bursts of radio waves from outside our Milky Way. This finding constitutes the second ever recording of these repeating ‘fast radio bursts’ (FRBs) in history. These intense bursts of low-frequency radiation have only been detected once before in 2015 at the Arecibo radio telescope in Puerto Rico.
The repeating FRB from a single source was one of 13 bursts detected during CHIME’s pre-commissioning phase in July to August 2018. The CHIME telescope was only running at a fraction of its full sensitivity and field-of-view, but has already published two papers in Nature concerning its findings.
The CHIME observatory is located in the Okanagan Valley in British Columbia. Made up of four 100-metre semi-cylindrical antennas, CHIME is sensitive to radio waves emitted by the most abundant matter in space: neutral hydrogen. It will be able to map over 3% of the total observable volume of the Universe, more than many other current surveys.
Researchers from CHIME’s participating institutions found that the majority of the 13 bursts were within the lowest frequencies in the telescopes range. This suggests that other FRBs are likely to be found below CHIME’s minimum of 400 MHz.
What exactly causes these FRBs remains a mystery. The fact that the signals are repeating rules out one-off events like supernovae or mergers. With their data showing signs of “scattering,” scientists from the CHIME team have concluded that the FRB sources are likely to be intense astrophysical objects in unique locations in their galaxies. An online list has compiled a list of theories that include collapsing neutron stars, interstellar collisions, and yes, alien spacecraft.
There is still a lack of observed data. FRB events show great diversity, revealing that there is still much to uncover before researchers can truly begin giving more conclusive statements about their characteristics, origin, and specific locations.
Many astronomers are excited at the possibility that FRBs can reveal valuable information about the environments that surround them and that they travel through. As the radio waves make their way to Earth, they may travel through clouds of gas, causing the different wavelengths that make up the radio burst to slow down by different amounts. By studying the spread of wavelengths that reach Earth, and their respective times of arrival, researchers can better understand how much material the radiation had to travel through on its journey. | https://mancunion.com/2019/01/15/radio-bursts-from-deep-space-puzzle-astronomers/ |
Any laboratory adding orthodontic aligners to their offerings should be well-versed on the FDA requirements. This article covers all options for laboratories seeking to enter into this market space.
1 CEU • Cost: $8 • Expires June 30, 2024
With stud-style abutment overdentures, a choice must be made regarding whether to incorporate the housing/patrix indirectly in the laboratory or directly intraorally. This article discusses each approach.
1 CEU • Cost: $8 • Expires May 31, 2024
This article reviews two popular methods of classifying dental ceramics, which are based on their microstructure and method of fabrication.
1 CEU • Cost: $8 • Expires April 30, 2024
The seamless flow of information, quality products and expert technique are the basis for a successful analog denture and patient acceptance.
1 CEU • Cost: $0 • Expires May 31, 2024
An Uncommon Bond
Laboratories have more and more often found themselves fielding questions from dentists about cementation and bonding. As growth continues, the laboratory must be willing and ready to provide its dentists with information, research, and informed opinions.
A Screw-Free Fixed Hybrid Prosthesis in Two Visits
This article reviews digital technology and describes clinical approaches to using efficient optical scanning and laboratory fabrication methods for full-arch rehabilitation with dental implants.
High-End 3D Printing Becomes Affordable
The future is now with 3D printing in dental laboratories. Anyone who has been hesitant to purchase a printer should educate themselves right away . | https://idt.cdeworld.com/?page=12 |
Enhancement of anatomical learning and developing clinical competence of first-year medical and allied health profession students.
Hands-on educational experiences can stimulate student interest, increase knowledge retention, and enhance development of clinical skills. The Lachman test, used to assess the integrity of the anterior cruciate ligament (ACL), is commonly performed by health care professionals and is relatively easy to teach to first-year health profession students. This study integrated teaching the Lachman test into a first-year anatomy laboratory and examined if students receiving the training would be more confident, competent, and if the training would enhance anatomical learning. First-year medical, physician assistant and physical therapy students were randomly assigned into either the intervention (Group A) or control group (Group B). Both groups received the course lecture on knee anatomy and training on how to perform the Lachman test during a surface anatomy class. Group A received an additional 15 minutes hands-on training for the Lachman test utilizing a lightly embalmed cadaver as a simulated patient. One week later, both groups performed the Lachman test on a lightly embalmed cadaver and later completed a post-test and survey. Students with hands-on training performed significantly better than students with lecture-only training in completing the checklist, a post-test, and correctly diagnosing an ACL tear. Students in Group A also reported being more confident after hands-on training compared to students receiving lecture-only training. Both groups reported that incorporating clinical skill activities facilitated learning and created excitement for learning. Hands-on training using lightly embalmed cadavers as patient simulators increased confidence and competence in performing the Lachman test and aided in learning anatomy.
| |
Published on: 12:37PM Aug 08, 2011
Enjoy high milk prices, especially with high feed prices. But there is a delicate balance being maintained. Any slight change in this balance can result in significant movement either way.
Milk prices continue to remain strong. USDA announced the July Federal Order Class prices last week, with Class III announced at a new record high of $21.39. This beat the previous record in July 2007 by a penny, and is welcomed news given the high feed prices being experienced. The question now is how long it will last.
August Class III futures currently indicate a higher price is yet to come and most likely it will. The majority of the August contract has already been priced, and futures are beginning to flat-line about 10 cents above July’s record. Subsequent months hold a discount to the cash with traders thinking a retracement may take place at any time.
Will dairy remain immune to the effects of the plummeting Dow and other financial markets? Initially, investors are pulling money out of some of these markets due to the uncertainty. The raising of the national debt ceiling did little if anything to calm fears in the U.S. or international markets. Now that Standard & Poor’s downgraded the U.S. debt rating to AA+ from the previous AAA rating, more concern is rippling through the markets. Eventually, this will impact consumers.
Last week, the monthly report on consumer spending indicated a drop of 0.2% in June, the first decline in 20 months. Income increased 0.1%, the lowest increase since September. This could spell trouble for dairy consumption and eventually prices. The argument is always made that people have to eat. That certainly is true, but diets and food products purchased can change when disposable income becomes tight. All we need to do is look back to the last recession two years ago. Class III milk prices declined into the $9 range. I am not suggesting this will happen again, and I do not really believe it will go that low. I am suggesting that milk prices certainly could decline from current levels.
Time of year is certainly in the favor of keeping milk prices higher for a longer period of time. Hot, humid weather over the past month has impacted milk output, with milk plants indicating a decrease of milk receipts of 10% on an average. Cheese yield has declined as a result of lower components. This comes at a time when increased volumes of milk will be moving to bottling to fill school pipelines. Higher Class I demand at a time of year when buyer interest of cheese and butter increases generally supports prices. Now throw in a significant decrease in milk production and prices could remain supported despite the outside pressure from other markets. Keep in mind there generally is a lag time in the dairy industry with pricing, so be prepared. Do not feel complacent. Utilized option strategies to establish floor prices and protect income.
World dairy prices are slowly declining, according to the Global Dairy Trade (Fonterra) auctions. U.S. prices will not be able to defy this weakness without limiting export ability. Major exporters of dairy products are expecting higher milk production for 2011. Argentina forecasts production to increase 4%. Australia estimates an increase of 3%, New Zealand up 5%, the European Union up 1%, and the U.S. increasing 1%.
We know there are plenty of heifers waiting in the wings. A somewhat favorable milk/feed ratio could increase production significantly in the months ahead. Many dairy farmers I have talked with are planning to increase cow numbers in the months ahead.
For now, let’s enjoy high milk prices, especially with high feed prices, but there is a delicate balance being maintained. Any slight change in this balance can result in significant movement either way.
Grain prices need to be monitored closely. Financial markets are putting significant pressure on grain futures despite the concerns over production and stocks. This will give an opportunity to protect feed prices. I recommend the purchase of call options and call option spreads in corn and soybean meal before the World Agricultural Supply and Demand report on Thursday. The trade is anticipating a decrease of acres, potentially resulting in tighter stocks next year.
Upcoming reports:
- California Class I price on August 10
- World Agricultural Supply and Demand report on August 1
- Fluid milk sales on August 12
- Fonterra auction
- July Milk Production report on August 18
- September advanced Class I price on August 19
- July Cold Storage report on August 22
Robin Schmahl is a commodity broker and owner of AgDairy LLC, a full-service commodity brokerage firm located in Elkhart Lake, Wisconsin. He can be reached at 877-256-3253 or through their website at www.agdairy.com.
The thoughts expressed and the data from which they are drawn are believed to be reliable but cannot be guaranteed. Any opinions expressed are subject to change without notice. There is risk of loss in trading and may not be suitable for everyone. Those acting on this information are responsible for their own actions.
keyword:
-
PREV
"Like Kind Exchanges" - General Overview
-
NEXT
Immigration Reform: What Would It Mean for Your Employees? | https://www.agweb.com/blog/AgDairy_Market_Update__236/milk_prices_are_supported_%E2%80%93_for_now |
how to plot multiple graph on top of images together?
4 views (last 30 days)
Commented: DARSHAN KUMAR BISWAS on 5 Jul 2022
Suppose there are multiple numbers of images and I have to plot graph over each one of them and display all of them together. How can I do it?
2 Comments
Answers (1)
DGM on 4 Jul 2022
Edited: DGM on 4 Jul 2022
This is an oversimplified example:
% a picture comes from somewhere
A = imread('peppers.png');
% some data comes from somewhere
x = linspace(0,2*pi,100);
y = sin(x);
% get data range
xrange = min(x)+[0 range(x)];
yrange = min(y)+[0 range(y)];
% display the image
hi = image(xrange,yrange,A); hold on
% display the plot
hp = plot(x,y,'c');
How exactly the plot and image need to be located/scaled with respect to each other is something you'll have to decide. If there are multiple images, read/create them and then plot them in subplots using a loop.
There are other examples of overlaying plots on images. Here is one using contourf():
1 Comment
See Also
Categories
Find more on Line Plots in Help Center and File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!Start Hunting! | https://it.mathworks.com/matlabcentral/answers/1753355-how-to-plot-multiple-graph-on-top-of-images-together |
The marvelously diverse Orchidaceae constitutes the largest family of angiosperms. The genus Cymbidium in Orchidaceae is well known for its unique vegetation, floral morphology, and flower scent traits. Here, a chromosome-scale assembly of the genome of Cymbidium ensifolium (Jianlan) is presented. Comparative genomic analysis showed that C. ensifolium has experienced two whole-genome duplication (WGD) events, the most recent of which was shared by all orchids, while the older event was the τ event shared by most monocots. The results of MADS-box genes analysis provided support for establishing a unique gene model of orchid flower development regulation, and flower shape mutations in C. ensifolium were shown to be associated with the abnormal expression of MADS-box genes. The most abundant floral scent components identified included methyl jasmonate, acacia alcohol and linalool, and the genes involved in the floral scent component network of C. ensifolium were determined. Furthermore, the decreased expression of photosynthesis-antennae and photosynthesis metabolic pathway genes in leaves was shown to result in colorful striped leaves, while the increased expression of MADS-box genes in leaves led to perianth-like leaves. Our results provide fundamental insights into orchid evolution and diversification. | https://researchoutput.ncku.edu.tw/en/publications/the-cymbidium-genome-reveals-the-evolution-of-unique-morphologica |
By Thomas Moran | Staff Writer
In the past year, men in positions of power have been accused of various forms of misconduct. Following the trend, the Rev. Bill Hybels, founder and pastor of an evangelical megachurch in the Chicago area, stepped down from his position on April 10 after allegations of misconduct were brought against him.
According to the Chicago Tribune, Hybels announced his stepping down last October, but did not, at that time, explain that claims had been brought against him that he had engaged in inappropriate behavior with women of his congregation for decades, some of whom had been employees.
Though the allegations brought against Hybels were never proven and he continues to deny them, the impact of his stepping down are far-reaching. The church Hybels founded and pastored, Willow Creek Community Church, has eight locations across the Chicago region and more than 25,000 weekly attendees.
Baylor psychology lecturer Dr. Tamara Lawrence has studied power dynamics in relationships and suggests that there are some similarities between interpersonal and group-wide power dynamics. Lawrence suggests that one potential link may be in an individual’s original intentions for pursuing powerful positions.
“Why do they want to be in a position of power?” Lawrence asked. “Is it for personal gain or is it to promote social responsibility? I really think the answer to that question can really predict how ethically people are going to use their power. That’s the crucial component: their motive for wanting to be in a position of power.”
Dr. William Bellinger, chair of the religion department chair, said a crucial part of evading these problems with clergy is accountability.
“Ministers have a sense of responsibility and an influence over a congregation and it is really a shame when they abuse that influence in that way,” Bellinger said.
Bellinger pastored a rural congregation at Union Baptist Church in eastern North Carolina and served other congregations intermittently. Having been a minister himself, Bellinger emphasized the importance of good training and sufficient accountability for clergy men and women.
Congregations need the support of a constructive and virtuous leader, Bellinger said. However, congregations should resist idolizing their clergy.
“In the free church tradition, of which Baptists are certainly a part, I do think there is often a tendency to put pastors on a pedestal and to forget that pastors are human as well,” Bellinger said. “The pastor ought not to have all of the power in a congregation. Baptist tradition suggests that you can trust the community.”
Clergy should constantly seek personal improvement both spiritually and emotionally, Bellinger said. Cultivating integrity and empathy for the congregation is a crucial element of clergy life, no matter how demanding it can be.
Sherman junior Reyna Diaz highlighted that clergy should be held to higher ethical standards as leaders of church communities.
“I think clergy do a lot of good,” Diaz said. “Not everybody is like that. There are some really good people. It’s great that our nation is speaking up against leaders who abuse their positions of power.”
Bellinger said events like this should be viewed as further motivation to continue shedding light on the areas of the church that need improvement. When situations like this arise, leaders should be held accountable, but forgiveness is also necessary. | https://baylorlariat.com/2018/04/19/bill-hybels-exit-sparks-conversation/ |
Karine Molloy was born in 1983 in New Carlisle, Gaspésie (Quebec, Canada). Her interest in the arts woke up at the age of 5 when she practiced classical ballet until she was 11 years old. Subsequently, she discovers Van Gogh at the local library, it’s love at first sight. A first painting class introduces her to the pleasure of colors and the freedom of creation. Dramatic art and theater are linked together with the (figurative) painting behind the scenes. Her passion for nature leads her first to studies in forestry. At the end of this program, she start studying in visual arts (2004) at the University of Sherbrooke. She delves deeper into Riopelle, Miro and Matisse then discovers Frida Kahlo. As many artists who make it vibrate by their gestures, their intensity, their colors, their freedom.
In 2010 is unveiled his first solo exhibition in abstraction. Many individual exhibitions followed, all of which were presented at recognized dissemination centers in 2012, 2013, 2014, 2015. Winner of several awards from emerging artists, the artist continues her career as a professional artist on the south shore of Montreal.
If we compare its beginnings in abstraction (2009) and the current period we can affirm that the essence of the artist has been preserved: color and intensity. The movement has evolved into a more assertive form. | https://galerieroussil.com/en/artistes/molloy-karine/ |
---
abstract: 'We introduce the concentrated information of tripartite quantum states. For three parties Alice, Bob, and Charlie, it is defined as the maximal mutual information achievable between Alice and Charlie via local operations and classical communication performed by Charlie and Bob. We derive upper and lower bounds to the concentrated information, and obtain a closed expression for it on several classes of states including arbitrary pure tripartite states in the asymptotic setting. We show that distillable entanglement, entanglement of assistance, and quantum discord can all be expressed in terms of the concentrated information, thus revealing its role as a unifying informational primitive. We finally investigate quantum state merging of mixed states with and without additional entanglement. The gap between classical and quantum concentrated information is proven to be an operational figure of merit for mixed state merging in absence of additional entanglement. Contrary to pure state merging, our analysis shows that classical communication in both directions can provide advantage for merging of mixed states.'
author:
- Alexander Streltsov
- Soojoon Lee
- Gerardo Adesso
bibliography:
- 'literature.bib'
date: 'June 30, 2015'
title: Concentrating tripartite quantum information
---
*Introduction*.—Correlations between parts of a composite system are crucial to dictate its collective behavior and to determine its usefulness for functional tasks involving the correlated components. This is true both for physical models in condensed matter and statistical mechanics [@Wolf2008], and for complex systems in the biological, engineered and social domains [@Shalizi]. In classical and quantum systems, correlations between two parties are generally quantified by the *mutual information*. In a thermodynamic context, mutual information quantifies the amount of work required to erase all the correlations established between two parties [@Groisman2005]. In the context of quantum communication [@Wilde], mutual information plays a fundamental role to describe the classical capacity of a noisy quantum channel connecting the two parties [@Bennett1999]. Maximizing the mutual information between, say, Alice and Charlie, within a larger system potentially involving other cooperative or competitive players, ensures that a reliable communication channel is established between the chosen sender and receiver, so that Alice and Charlie can implement quantum cryptography or quantum state transfer protocols with high success [@Nielsen2000].
In this Letter we introduce and study a quantum informational task that we name *information concentration*. We consider a general communication scenario involving three parties, Alice, Bob, and Charlie, who initially share an arbitrary mixed quantum state. Our main question can then be formulated as follows:*“How much can Charlie learn about Alice by asking Bob?”* To answer this question we analyze the task of maximizing the mutual information between Alice and Charlie via a cooperative strategy by Charlie and Bob only relying on local operations and classical communication (LOCC). The corresponding maximal mutual information between Alice and Charlie is termed *concentrated information (CI)*.
. Concentrating information in tripartite quantum states. Panel (a) shows the initial situation: Alice, Bob, and Charlie share a quantum state $\rho^{ABC}$; additionally, Charlie has access to a quantum register $R$. Bob and Charlie perform local operations and classical communication (LOCC), aiming to maximize the mutual information between Alice and Charlie. The final state shared by Alice and Charlie is illustrated in Panel (b).](Fig1){width="0.7\columnwidth"}
In the classical domain this quantity coincides with the total mutual information between Alice and the remaining two parties, since in this case Bob can share all his knowledge with Charlie via a classical channel. However, the situation changes completely if quantum theory is applied. As we will show, the CI is in general below the maximal value achievable in the classical case. We derive upper and lower bounds to the CI which depend on classical and quantum correlations in different partitions of the original tripartite state. Remarkably, when the three players share asymptotically many copies of an arbitrary pure state, we obtain a closed expression for the CI, only depending on the initial entropic degrees of Alice’s and Charlie’s subsystems. The CI can be further evaluated exactly in some classes of mixed states. The broad relevance of the concept is underlined by showing that distillable entanglement [@Bennett1996], entanglement of assistance [@DiVincenzo1999], and quantum discord [@Zurek2000; @Ollivier2001] can all be expressed in general as exact functions of CI.
Finally, we study the usefulness of the CI in the context of quantum state merging [@Horodecki2005; @Horodecki2007]. We extend state merging to the realistic case of mixed states, and show that for this generalized task classical communication in one direction is strictly less powerful than general LOCC. Furthermore, by exploiting recent breakthrough results on conditional mutual information [@Fawzi2014; @Sutter2015], we prove that the CI yields a faithful figure of merit for *LOCC quantum state merging* *(LQSM)*, a variant of state merging operating on mixed states without additional entanglement. The results of this Letter provide fundamental and practical advances for quantum information theory and its applications in a multipartite scenario.
*Concentrated information: Setting and definitions*.—We consider three parties, Alice, Bob, and Charlie, sharing a quantum state $\rho=\rho^{ABC}$. The aim of Bob and Charlie is to concentrate their mutual information with Alice on Charlie’s side via LOCC. To this aim, Charlie makes use of an auxiliary quantum register $R$, so that the total initial state is given by $$\sigma_{i}=\rho^{ABC}\otimes\rho^{R}.\label{eq:initial}$$
In the concentration process, Bob and Charlie perform an LOCC protocol which maximizes the mutual information between Alice and Charlie (see Fig. \[fig:1\]). Noting that the total system of Charlie consists of two subsystems $C$ and $R$, the maximal mutual information achievable in this process is given by $$\begin{aligned}
{\cal I}(\rho) & =\sup_{\Lambda}I^{A:CR}(\sigma_{f}).\label{eq:I}\end{aligned}$$ In the above expression, $I^{A:CR}$ is the mutual information between Alice’s system $A$ and Charlie’s system $CR$, the supremum is taken over all LOCC protocols $\Lambda=\Lambda_{B\leftrightarrow CR}$ between Bob and Charlie, and the final state $\sigma_{f}=\sigma_{f}^{ACR}$ is the state shared by Alice and Charlie after the application of the LOCC protocol $\Lambda$ on the initial state $\sigma_{i}$: $$\sigma_{f}=\mathrm{Tr}_{B}[\Lambda[\sigma_{i}]].\label{eq:final}$$ The quantity defined in Eq. (\[eq:I\]) will be referred to as *concentrated information (CI)*. We will also consider the case of one-way LOCC where the classical communication is directed from Bob to Charlie only. The maximal mutual information in this case will be called *one-way concentrated information*, and we will denote it by ${\cal I}_{\rightarrow}$. We will also study the situation where a large number of copies of the state $\rho$ is available. The corresponding regularized CI is given as $${\cal I}^{\infty}(\rho)=\lim_{n\rightarrow\infty}\frac{1}{n}{\cal I}(\rho^{\otimes n}),$$ and its one-way version will be denoted by ${\cal I}_{\rightarrow}^{\infty}$.
At this point it is useful to note that the CI is never smaller than its one-way version ${\cal I}_{\rightarrow}$ and never larger than the total mutual information $I^{A:BC}$: $${\cal I}_{\rightarrow}(\rho)\leq{\cal I}(\rho)\leq I^{A:BC}(\rho).\label{eq:inequality}$$ The first inequality is evident by observing that one-way LOCC is a restricted version of general LOCC. The second inequality represents the fact that Bob and Charlie cannot concentrate more mutual information than is initially present in the total state $\rho$. The proof follows by noting that any operation acting on the systems of Bob and Charlie cannot increase their mutual information with Alice [@Vedral2002], and thus: $I^{A:CR}(\sigma_{f})\leq I^{A:BCR}(\sigma_{i})$. Together with the fact that $I^{A:BCR}(\sigma_{i})=I^{A:BC}(\rho)$ this completes the proof of Eq. (\[eq:inequality\]). We remark that the CI has a natural interpretation as the amount of information Charlie can obtain about Alice by asking Bob, within the considered quantum communication scenario.
*Bounding the CI*.—Having introduced the CI, we will now show a powerful upper bound, which also relates ${\cal I}$ to the distillable entanglement $E_{d}$. As we will also see below in this Letter, the bound is tight in a large number of relevant scenarios, including all pure states in the asymptotic limit.
\[thm:1\]CI is bounded above as follows: $${\cal I}(\rho)\leq\min\left\{ I^{A:BC}(\rho),S(\rho^{A})+E_{d}^{AB:C}(\rho)\right\} .\label{eq:upbound}$$
We note that the same bound also applies to the regularized concentrated information ${\cal I}^{\infty}$. The proof of the theorem can be found in the Supplemental Material [@epaps], see section 1 there.
Due to Eq. (\[eq:inequality\]), the above theorem also provides an upper bound on the one-way CI. Similarly, any lower bound on ${\cal I}_{\rightarrow}$ is also a lower bound for ${\cal I}$. We will now show that ${\cal I}_{\rightarrow}$ can be bounded below as follows: $${\cal I}_{\rightarrow}(\rho)\geq\max\left\{ I^{A:C}(\rho^{AC}),I^{A:B}(\rho^{AB})-\delta^{A|B}(\rho^{AB})\right\} ,\label{eq:lower bound}$$ where $\delta$ is the quantum discord [@Zurek2000; @Ollivier2001], a measure of quantumness of correlations (for more details and alternative definitions see also [@Henderson2001; @Streltsov2011; @Piani2011; @Modi2012; @Brandao2013; @Streltsov2014]). The inequality ${\cal I}_{\rightarrow}(\rho)\geq I^{A:C}(\rho^{AC})$ can be seen by noting that this amount of mutual information between Alice and Charlie is always achieved if Bob and Charlie do not interact. On the other hand, the inequality ${\cal I}_{\rightarrow}(\rho)\geq I^{A:B}(\rho^{AB})-\delta^{A|B}(\rho^{AB})$ can be seen by noting that erasing Charlie’s system cannot increase the CI: ${\cal I}_{\rightarrow}(\rho)\geq{\cal I}_{\rightarrow}(\rho^{AB}\otimes\ket{0}\bra{0}^{C})$. To complete the proof of Eq. (\[eq:lower bound\]), we note that for states of the form $\rho^{AB}\otimes\rho^{C}$ the CI and its one-way version coincide, and are given by [@Streltsov2013; @Streltsov2014] $${\cal I}(\rho^{AB}\otimes\rho^{C})={\cal I}_{\rightarrow}(\rho^{AB}\otimes\rho^{C})=I^{A:B}(\rho^{AB})-\delta^{A|B}(\rho^{AB}).\label{eq:discord}$$
We note that both of the aforementioned quantities bounding the CI, namely the distillable entanglement and the quantum discord, are usually difficult to compute for an arbitrary state. However, closed expressions for both quantities are known for many important families of states [@Horodecki2009; @Modi2012]. For instance, the distillable entanglement can be evaluated exactly for all maximally correlated states, and that quantum discord can be evaluated for any state $\rho^{AB}$ of rank two, if the subsystem $A$ is a qubit. This renders the bounds on the CI analytically accessible in several relevant cases. Finally, we also mention that the bounds provided in Eqs. (\[eq:upbound\]) and (\[eq:lower bound\]) can be adapted to obtain alternative upper and lower bounds on the CI, which may be easier to evaluate. In particular, any upper bound on the distillable entanglement (such as the logarithmic negativity [@vidalwerner; @eisertphd; @plenioprl], which is a computable entanglement monotone related to the entanglement cost under operations preserving the positivity of the partial transpose [@eisertppt; @ishi]) provides a (looser) upper bound on the CI via Eq. (\[eq:upbound\]). Similarly, (looser) lower bounds can be derived from Eq. (\[eq:lower bound\]) by providing upper bounds on quantum discord; since quantum discord is defined as a minimization problem, it is easy to provide computable bounds also in this situation; see e.g. [@Girolami2011; @HuFan2013].
*Exact evaluation of CI*.—We now show that, impressively, closed formulae for the CI can be obtained for a number of relevant classes of states. We start by considering the situation where Alice, Bob, and Charlie share a pure state $\ket{\psi}=\ket{\psi}^{ABC}$. In this case, the one-way CI is given exactly by $${\cal I}_{\rightarrow}(\ket{\psi})=S(\rho^{A})+E_{a}(\rho^{AC}).\label{eq:pure states}$$ Here, $E_{a}$ is the entanglement of assistance which was defined in [@DiVincenzo1999] as follows: $E_{a}(\rho^{AC})=\max\sum_{i}p_{i}E_{d}(\ket{\psi_{i}}^{AC})$. The maximum is taken over all decompositions of the state $\rho^{AC}$, while the distillable entanglement of a pure state $\ket{\psi_{i}^{AC}}$ is equal to the von Neumann entropy of the reduced state [@Bennett1996]: $E_{d}(\ket{\psi_{i}}^{AC})=S(\rho_{i}^{A})$. For the proof of Eq. (\[eq:pure states\]) we refer to the Supplemental Material [@epaps], see section 2 there. We will now evaluate the regularized CI for an arbitrary tripartite pure state $\ket{\psi}=\ket{\psi}^{ABC}$. Remarkably, in this scenario ${\cal I}^{\infty}$ and ${\cal I}_{\rightarrow}^{\infty}$ both coincide with the bound provided in Theorem \[thm:1\], i.e., the bound is tight for all pure states in the asymptotic setting.
\[thm:2\] For any pure state $\ket{\psi}=\ket{\psi}^{ABC}$ it holds: $${\cal I}^{\infty}(\ket{\psi})={\cal I}_{\rightarrow}^{\infty}(\ket{\psi})=S(\rho^{A})+\min\{S(\rho^{A}),S(\rho^{C})\}.$$
This theorem provides a simple expression for the regularized CI of pure states, and shows that one-way LOCC operations suffice for optimal information concentration in the asymptotic setting. For the proof of the theorem we refer to the Supplemental Material [@epaps], see section 3 there.
Finally, we consider an instance of mixed states, where Bob is in possession of two particles $B_{1}$ and $B_{2}$, each of them being correlated exclusively with Alice or Charlie. If the state shared by Alice and Bob is pure, the scenario is covered by states of the form $$\rho=\ket{\psi}\bra{\psi}^{AB_{1}}\otimes\rho^{B_{2}C}.\label{eq:product}$$ As we show in section 4 of the Supplemental Material [@epaps], the results presented in this Letter allow to evaluate the regularized CI for this set of states: $$\mathcal{I}^{\infty}(\rho)=S(\rho^{A})+\min\{S(\rho^{A}),E_{d}(\rho^{B_{2}C})\}.\label{eq:distillable_entanglement}$$ Importantly, this implies that the bound provided in Theorem \[thm:1\] is asymptotically saturated for all states given in Eq. (\[eq:product\]).
*CI as a unifying quantum informational primitive.*—The approach presented in this Letter allows to unify three fundamental quantities in quantum information theory: distillable entanglement $E_{d}$ [@Bennett1996], entanglement of assistance $E_{a}$ [@DiVincenzo1999], and quantum discord $\delta$ [@Zurek2000; @Ollivier2001]. As we will see in the following, all these quantities can be traced to a common origin, since all of them can be written in terms of the CI.
For $E_{a}$ this can be seen by using Eq. (\[eq:pure states\]), which implies that the entanglement of assistance of a state $\rho^{AC}$ is related to the one-way CI as follows: $E_{a}(\rho^{AC})={\cal I}_{\rightarrow}(\ket{\psi})-S(\rho^{A})$, where $\ket{\psi}=\ket{\psi}^{ABC}$ is a purification of $\rho^{AC}$. The relation to quantum discord $\delta$ is evident from Eq. (\[eq:discord\]), according to which the amount of discord in a state $\rho^{AB}$ can be expressed in terms of CI as follows: $\delta^{A|B}(\rho^{AB})=I^{A:B}(\rho^{AB})-\mathcal{I}(\rho^{AB}\otimes\rho^{C})$, where $\rho^{C}$ is an arbitrary state of Charlie’s system $C$. Finally, the relation between CI and distillable entanglement is given by Eq. (\[eq:distillable\_entanglement\]), which implies that $E_{d}(\rho^{B_{2}C})=\mathcal{I}^{\infty}(\rho)-\log_{2}d_{A}$, for an arbitrary state $\rho^{B_{2}C}$, with $\rho=\ket{\phi^{+}}\bra{\phi^{+}}^{AB_{1}}\otimes\rho^{B_{2}C}$, $\ket{\phi^{+}}^{AB_{1}}=\sum_{i}\ket{ii}^{AB_{1}}/\sqrt{d_{A}}$, and $d_{A}=d_{B_{1}}=d_{B_{2}}$.
It is straightforward to extend the aforementioned results to entanglement of formation $E_{f}$ and entanglement cost $E_{c}$ by using the relation between quantum discord and entanglement of formation [@Koashi2004; @Fanchini2011; @Madhok2011; @Cavalcanti2011], and recalling that $E_{c}$ is equal to regularized $E_{f}$ [@Hayden2001]. It is thus reasonable to expect that other important quantities might be also recast in terms of the CI.
*LOCC quantum state merging (LQSM)*.—We will now show that the task of concentrating information presented in this Letter is closely related to the task of merging quantum states via LOCC, that we analyze here. In the latter task, Bob and Charlie aim to merge their parts of the total state $\rho=\rho^{ABC}$ on Charlie’s side via LOCC, while preserving the coherence with Alice. To this end, Charlie has access to an additional register $R$, and the overall initial state $\sigma_{i}$ is again given by Eq. (\[eq:initial\]). It is instrumental to compare this task to the standard quantum state merging as presented in [@Horodecki2005; @Horodecki2007]. In contrast to that well established protocol, in LQSM Bob and Charlie are not allowed to use any additional entangled resource states, and the overall state $\rho$ is not restricted to be pure.
We now introduce the fidelity of LQSM as follows: $${\cal F}(\rho)=\sup_{\Lambda}F(\sigma_{f},\sigma_{t})\label{eq:F}$$ with Uhlmann fidelity $F(\rho,\sigma)=\mathrm{Tr}(\sqrt{\rho}\sigma\sqrt{\rho})^{1/2}$. Here, the desired target state $\sigma_{t}=\sigma_{t}^{ACR}$ is the same state as $\rho=\rho^{ABC}$ up to relabeling the systems $B$ and $R$. The final state $\sigma_{f}$ was already introduced in Eq. (\[eq:final\]), and the supremum is taken over all LOCC operations $\Lambda=\Lambda_{B\leftrightarrow CR}$ between Bob and Charlie.
The relevance of the quantity defined in Eq. (\[eq:F\]) comes from the fact that it faithfully captures the performance of the considered task. In particular, a state $\rho$ admits *perfect LQSM* if and only if ${\cal F}(\rho)=1$, while ${\cal F}(\rho)<1$ otherwise. As we will see in a moment, the fidelity is closely related to the gap between quantum and classical CI, which can then be regarded as a faithful figure of merit for LQSM on its own right. In particular, we will find that perfect LQSM is possible if and only if the CI is equal to the total mutual information $I^{A:BC}$: $${\cal F}(\rho)=1\Leftrightarrow{\cal I}(\rho)=I^{A:BC}(\rho),\label{eq:perfectLQSM}$$ while ${\cal I}(\rho)<I^{A:BC}(\rho)$ otherwise. This result implies an operational equivalence between information concentration and LQSM: a state admits perfect LQSM if and only if it admits perfect information concentration, i.e., if all the mutual information available in the state can be concentrated on Charlie’s side. To prove the statement in Eq. (\[eq:perfectLQSM\]) we will establish a link between ${\cal F}$ and ${\cal I}$ formalized by the following theorem.
\[thm:3\]The fidelity of LQSM is bounded below as $${\cal F}(\rho)\geq2^{-\frac{1}{2}[I^{A:BC}(\rho)-{\cal I}(\rho)]}.$$
The proof of the theorem is based on very recent results from [@Fawzi2014] and can be found in the Supplemental Material [@epaps], see section 5 there. From this result it is evident that perfect information concentration implies perfect LQSM: ${\cal I}(\rho)=I^{A:BC}(\rho)\Rightarrow{\cal F}(\rho)=1$. The other direction follows straightforwardly by continuity of the mutual information.
These results demonstrate that the gap $I^{A:BC}(\rho)-{\cal I}(\rho)$ has an inherent operational meaning, quantifying the deviation from perfect LQSM. Note that this gap is a genuinely quantum feature, and vanishes for fully classical states. In the classical domain all the mutual information available in the state can be concentrated via classical communication.
Furthermore, we will provide another necessary condition for perfect LQSM. In particular, Bob and Charlie can perfectly merge their systems via LOCC on Charlie’s side only if the state $\rho=\rho^{ABC}$ satisfies the inequality $E^{AB:C}(\rho)\geq E^{A:BC}(\rho)$ for all entanglement measures $E$. The statement can be proven directly by using the fact that any valid entanglement monotone $E$ cannot increase under LOCC [@Horodecki2009]. This implies that any state $\rho$ which violates the above inequality for some entanglement measure does not allow for perfect LQSM.
*Quantum state merging of mixed states*.—Finally, we will show that the novel concepts of information concentration and LQSM are also useful in the context of conventional quantum state merging [@Horodecki2005; @Horodecki2007]. We first introduce the asymptotic fidelity of LQSM, ${\cal F}^{\infty}(\rho)=\lim_{n\rightarrow\infty}{\cal F}(\rho^{\otimes n})$, and note that a state $\rho$ allows for *perfect asymptotic LQSM* if and only if its asymptotic fidelity is ${\cal F}^{\infty}(\rho)=1$. As we show in section 6 of the Supplemental Material [@epaps], perfect asymptotic LQSM implies perfect asymptotic information concentration: $${\cal F}^{\infty}(\rho)=1\Rightarrow{\cal I}^{\infty}(\rho)=I^{A:BC}(\rho).\label{eq:asymptotic}$$ This result means that Bob and Charlie cannot merge their state via LOCC even in the asymptotic scenario, if the regularized CI is below the total mutual information $I^{A:BC}$. The importance of this result lies in the fact that the regularized CI can be evaluated exactly in a large number of relevant scenarios, as was demonstrated previously in this Letter.
Using the tools presented above, we are now in position to extend quantum state merging to mixed states in the following way. For a given state $\rho=\rho^{ABC}$, we supplement Bob and Charlie with additional entangled states $\ket{\phi}=\ket{\phi}^{B'C'}$. If we now adjust these states such that the CI of the total state $\rho\otimes\ket{\phi}\bra{\phi}$ becomes equal to the total mutual information $I^{A:BC}$, the amount of entanglement in $\ket{\phi}$ provides a lower bound on the amount of resources needed to merge the mixed state $\rho$. This shows how the tools just developed can be used to gain new results in the established framework of state merging.
In the next step we will demonstrate how results from quantum state merging can be carried over to LQSM. In particular, the results presented in [@Horodecki2005; @Horodecki2007] imply that Bob and Charlie can asymptotically merge their parts of a pure state $\ket{\psi}=\ket{\psi}^{ABC}$ via LOCC if and only if their conditional entropy $S(\rho^{BC})-S(\rho^{C})$ is not positive. This result can be immediately extended to mixed states: if a state $\rho=\rho^{ABC}$ has nonpositive conditional entropy, it allows for perfect LQSM asymptotically, i.e., $S(\rho^{BC})-S(\rho^{C})\leq0\Rightarrow{\cal F}^{\infty}(\rho)=1.$ Together with Eq. (\[eq:asymptotic\]) this means that perfect asymptotic information concentration is also possible in this case. Note that the converse is not true in general: there exist mixed states $\rho$ which allow for perfect LQSM, but have positive conditional entropy.
Finally, we will show that, in quantum state merging of mixed states, general LOCC are strictly more powerful than one-way LOCC. This is notable, since both procedures are instead equivalent in the traditional quantum state merging of pure states [@Horodecki2005; @Horodecki2007], for which classical communication in both directions does not provide any advantage. In particular, we will present a family of states allowing for perfect state merging with general LOCC in the single-shot scenario, but which cannot be merged via one-way LOCC even asymptotically. The following family of states has this property: $$\begin{aligned}
\rho & =\frac{1}{4}\left(\ket{0}\bra{0}^{B}\otimes\ket{00}\bra{00}^{AC}+\ket{1}\bra{1}^{B}\otimes\ket{10}\bra{10}^{AC}\right.\\
& \left.+\ket{\psi}\bra{\psi}^{B}\otimes\ket{01}\bra{01}^{AC}+\ket{\psi_{\bot}}\bra{\psi_{\bot}}^{B}\otimes\ket{11}\bra{11}^{AC}\right),\nonumber \end{aligned}$$ with mutually orthogonal states $\ket{\psi}$ and $\ket{\psi_{\bot}}$ such that $0<|\braket{0|\psi}|<1$. Clearly, this state can be merged with two rounds of classical communication already in the single-shot scenario. The proof that the state cannot be merged via one-way LOCC even asymptotically is strongly based on the present framework of information concentration, and the details are provided in section 7 of the Supplemental Material [@epaps].
*Conclusion*.—In this Letter we introduced the concentrated information (CI) of arbitrary tripartite quantum states, provided upper and lower bounds to it, and an explicit expression for all tripartite pure states in the asymptotic setting and other families of mixed states. We also investigated LOCC quantum state merging, a variation of the standard quantum state merging protocol where the merging procedure is performed on mixed states via LOCC only, and proved that CI is a faithful figure of merit for this task. We also proved that distillable entanglement, entanglement of assistance, and quantum discord can all be expressed as exact functions of CI, and demonstrated how the methods developed here can be used to generalize standard quantum state merging to mixed states, thus providing novel insights on such communication primitive. We expect that further investigation of the concepts developed here may lead to an operational classification of multipartite quantum states, different from what emerges from the notions of entanglement and other quantum correlations known today.
*Acknowledgements*.—We thank Marco Piani for very helpful comments. A. S. acknowledges financial support by the Alexander von Humboldt-Foundation, the John Templeton Foundation, the EU (IP SIQS), the ERC (AdG OSYRIS), and the EU-Spanish Ministry (CHISTERA DIQIP). S. L. acknowledges financial support by the Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Education (NRF-2012R1A1A2003441). G. A. acknowledges financial support by the Foundational Questions Institute (FQXi-RFP3-1317) and the ERC StG GQCOP (Grant Agreement No. 637352).
Supplemental Material {#supplemental-material .unnumbered}
=====================
\[sub:proof1\]Upper bound on CI
-------------------------------
Here we will prove that the concentrated information is bounded above as follows: $${\cal I}(\rho)\leq\min\left\{ I^{A:BC}(\rho),S(\rho^{A})+E_{d}^{AB:C}(\rho)\right\} .\label{eq:upbound-1}$$ The inequality ${\cal I}(\rho)\leq I^{A:BC}(\rho)$ was already proven in Eq. (\[eq:inequality\]) of the main text, and it remains to show the inequality ${\cal I}(\rho)\leq S(\rho^{A})+E_{d}^{AB:C}(\rho)$. For this we will show that any final state $\sigma_{f}^{ACR}=\mathrm{Tr}_{B}[\Lambda[\sigma_{i}]]$ with initial state $\sigma_{i}=\rho^{ABC}\otimes\rho^{R}$ and an LOCC protocol $\Lambda=\Lambda_{B\leftrightarrow CR}$ satisfies the inequality $$I^{A:CR}(\sigma_{f}^{ACR})-S(\rho^{A})\leq E_{d}^{AB:C}(\rho^{ABC}).$$ Noting that the LOCC protocol $\Lambda=\Lambda_{B\leftrightarrow CR}$ does not affect Alice’s subsystem and using the relation $E_{d}^{AB:C}(\rho^{ABC})=E_{d}^{AB:CR}(\sigma_{i})$, this inequality is equivalent to $$S(\sigma_{f}^{CR})-S(\sigma_{f}^{ACR})\leq E_{d}^{AB:CR}(\sigma_{i}).$$ The latter inequality can be proven by using the fact that the distillable entanglement is bounded below as [@Devetak2005] $$S(\sigma_{f}^{CR})-S(\sigma_{f}^{ACR})\leq E_{d}^{A:CR}(\sigma_{f}^{ACR}),$$ and is nonincreasing under LOCC and under discarding subsystems: $$\begin{aligned}
E_{d}^{A:CR}(\sigma_{f}^{ACR}) & \leq E_{d}^{AB:CR}(\sigma_{f}^{ABCR})\leq E_{d}^{AB:CR}(\sigma_{i})\end{aligned}$$ with $\sigma_{f}^{ABCR}=\Lambda[\sigma_{i}]$. This completes the proof.
\[sub:pure\]One-way CI for pure states
--------------------------------------
In the following, we will prove that the one-way concentrated information for a pure state $\ket{\psi}=\ket{\psi}^{ABC}$ is given by $${\cal I}_{\rightarrow}(\ket{\psi})=S(\rho^{A})+E_{a}(\rho^{AC}),\label{eq:pure states-1}$$ where $E_{a}$ is the entanglement of assistance.
To prove Eq. (\[eq:pure states-1\]), note that for any state $\rho=\rho^{ABC}$ the one-way concentrated information can be written as follows: $${\cal I}_{\rightarrow}(\rho)=\sup_{\{M_{i}^{B}\}}I^{A:CR}\bigg(\sum_{i}p_{i}\rho_{i}^{AC}\otimes\ket{i}\bra{i}^{R}\bigg)\label{eq:one-way-1}$$ with $p_{i}\rho_{i}^{AC}=\mathrm{Tr}_{B}[M_{i}^{B}\rho]$. We will now show that the supremum in the above expression can be achieved over rank-1 POVMs. For this, note that any POVM $\{M_{i}\}$ can be refined to a rank-1 POVM $\{M_{ij}\}$ such that $\sum_{j}M_{ij}=M_{i}$. In the next step we will show that such a refined POVM leads to a larger mutual information, i.e., $$I^{A:CR}\left(\sum_{ij}p_{ij}\rho_{ij}^{AC}\otimes\ket{ij}\bra{ij}^{R}\right)\geq I^{A:CR}\left(\sum_{i}p_{i}\rho_{i}^{AC}\otimes\ket{i}\bra{i}^{R}\right)$$ with $p_{ij}\rho_{ij}^{AC}=\mathrm{Tr}_{B}[M_{ij}^{B}\rho]$. This can be seen by rewriting this expression as follows: $$\sum_{ij}p_{ij}\left[S(\rho_{ij}^{AC})-S(\rho_{ij}^{C})\right]\leq\sum_{i}p_{i}\left[S(\rho_{i}^{AC})-S(\rho_{i}^{C})\right].$$ The latter inequality is true due to the concavity of the conditional entropy [@Nielsen2000]. This proves that the supremum in Eq. (\[eq:one-way-1\]) can be performed over rank-1 POVMs.
In the next step it is crucial to note that, for a pure state $\ket{\psi}=\ket{\psi}^{ABC}$ and a rank-1 POVM $\{M_{i}^{B}\}$, each state $\rho_{i}^{AC}$ in Eq. (\[eq:one-way-1\]) is also pure. This implies that the mutual information on the right-hand side of Eq. (\[eq:one-way-1\]) can be written as follows: $$I^{A:CR}\bigg(\sum_{i}p_{i}\ket{\psi_{i}}\bra{\psi_{i}}^{AC}\otimes\ket{i}\bra{i}^{R}\bigg)=S(\rho^{A})+\sum_{i}p_{i}S(\rho_{i}^{C}).\label{eq:one-way-2}$$ Note that the maximization over rank-1 POVMs in Eq. (\[eq:one-way-1\]) is equivalent to a maximization over all decompositions of the state $\rho^{AC}$ in Eq. (\[eq:one-way-2\]). This completes the proof of Eq. (\[eq:pure states-1\]).
\[sub:Asymptotic-1\]Asymptotic CI for pure states
-------------------------------------------------
Here we will show that for any pure state $\ket{\psi}=\ket{\psi}^{ABC}$ the regularized CI and its one-way version coincide, and both are given as $${\cal I}^{\infty}(\ket{\psi})={\cal I}_{\rightarrow}^{\infty}(\ket{\psi})=S(\rho^{A})+\min\{S(\rho^{A}),S(\rho^{C})\}.$$ For this, we use Eq. (\[eq:pure states\]) in the main text, which implies that the regularized one-way CI can be written as follows: $${\cal I}_{\rightarrow}^{\infty}(\ket{\psi})=S(\rho^{A})+E_{a}^{\infty}(\rho^{AC})$$ with the regularized entanglement of assistance $E_{a}^{\infty}(\rho)=\lim_{n\rightarrow\infty}E_{a}(\rho^{\otimes n})/n$. In the next step we use the fact that the regularized entanglement of assistance of the state $\rho^{AC}$ is equal to the smallest of the local entropies [@Smolin2005]: $$E_{a}^{\infty}(\rho^{AC})=\min\{S(\rho^{A}),S(\rho^{C})\}.$$ It follows that for pure states the regularized one-way CI is given by $${\cal I}_{\rightarrow}^{\infty}(\ket{\psi})=S(\rho^{A})+\min\{S(\rho^{A}),S(\rho^{C})\}.$$ On the other hand, recall that Theorem \[thm:1\] in the main text also holds in the asymptotic scenario. Applying Theorem \[thm:1\] to a pure state, we find that the regularized CI is bounded above as follows: $${\cal I}^{\infty}(\ket{\psi})\leq S(\rho^{A})+\min\{S(\rho^{A}),S(\rho^{C})\}.$$ Combining these results completes the proof.
\[sub:DistillableEntanglement\]CI and distillable entanglement
--------------------------------------------------------------
In the following we consider tripartite states of the form $$\rho=\ket{\psi}\bra{\psi}^{AB_{1}}\otimes\rho^{B_{2}C},\label{eq:rho}$$ assuming without loss of generality that all subsystems $A$, $B_{1}$, $B_{2}$, and $C$ have the same dimension. We will prove that the regularized CI for this set of states can be given as follows: $${\cal I}^{\infty}(\rho)=S(\rho^{A})+\min\{S(\rho^{A}),E_{d}(\rho^{B_{2}C})\}.\label{eq:asymptotic-2}$$
To prove this statement, we first invoke Theorem \[thm:1\] in the main text, which implies that the regularized CI in this case is bounded above as follows: $${\cal I}^{\infty}(\rho)\leq S(\rho^{A})+\min\{S(\rho^{A}),E_{d}(\rho^{B_{2}C})\}.$$ To complete the proof, we will now show that ${\cal I}^{\infty}$ is also bounded below by the same expression. To show this, suppose that the distillable entanglement between Bob and Charlie is smaller than the entropy of Alice’s state: $$E_{d}(\rho^{B_{2}C})=\alpha S(\rho^{A})\label{eq:Ed}$$ with $\alpha<1$. Bob can then asymptotically teleport the fraction $\alpha$ of his states to Charlie by using Schumacher compression [@Schumacher1995]. This means that for any $\varepsilon>0$ there exist integers $m\leq\alpha n$ and an LOCC protocol $\Lambda$ between Bob and Charlie such that $$||\Lambda(\rho^{\otimes n})-\ket{\psi}\bra{\psi}_{ac}^{\otimes m}\otimes\ket{\psi}\bra{\psi}_{ab}^{\otimes n-m}||\leq\varepsilon.\label{eq:teleportation}$$ Note that the states $\ket{\psi}_{ab}$ and $\ket{\psi}_{ac}$ are both equivalent to the state $\ket{\psi}^{AB_{1}}$ in Eq. (\[eq:rho\]), but $\ket{\psi}_{ab}$ is shared by Alice and Bob while $\ket{\psi}_{ac}$ is shared by Alice and Charlie. Here $||M||=\mathrm{Tr}\sqrt{M^{\dagger}M}$ is the trace norm of the operator $M$, and the integers $n$ and $m$ satisfy the inequality $$\alpha\geq\frac{m}{n}\geq\alpha-\varepsilon.\label{eq:integers}$$
In the next step, observe that by LOCC Bob and Charlie can transform the pure state $\ket{\psi}_{ab}$ shared by Alice and Bob into a mixed state $\sigma_{ac}$ shared by Alice and Charlie. It is crucial to note that this procedure can be performed in such a way that the mutual information of $\sigma_{ac}$ is equal to $S(\rho^{A})$ [@Streltsov2013]. Together with Eq. (\[eq:teleportation\]) this reasoning implies that for any $\varepsilon>0$ there exist integers $n$ and $m$ satisfying Eq. (\[eq:integers\]) and an LOCC protocol $\Lambda$ between Bob and Charlie such that $$||\Lambda(\rho^{\otimes n})-\ket{\psi}\bra{\psi}_{ac}^{\otimes m}\otimes\sigma_{ac}^{\otimes n-m}||\leq\varepsilon.$$ With the mutual information of $\ket{\psi}_{ac}$ and $\sigma_{ac}$ given by $2S(\rho^{A})$ and $S(\rho^{A})$ respectively, it is easy to verify that the mutual information of $\ket{\psi}\bra{\psi}_{ac}^{\otimes m}\otimes\sigma_{ac}^{\otimes n-m}$ is given by $(n+m)S(\rho^{A})$.
To complete the proof of Eq. (\[eq:asymptotic-2\]) we will use continuity of the mutual information. In particular, for two states $\rho=\rho^{XY}$ and $\sigma=\sigma^{XY}$ with $||\rho-\sigma||\leq1$, the mutual information satisfies the following inequality: $$\begin{aligned}
|I^{X:Y}(\rho)-I^{X:Y}(\sigma)| & \leq3T\log_{2}d+3h(T).\label{eq:continuity-1}\end{aligned}$$ Here, $d$ is the dimension of the total Hilbert space, $T=||\rho-\sigma||/2$ is the trace distance between $\rho$ and $\sigma$, and $h(x)=-x\log_{2}x-(1-x)\log_{2}(1-x)$ is the binary entropy. The aforementioned inequality (\[eq:continuity-1\]) can be proven directly by using continuity of the von Neumann entropy [@Audenaert2007].
It follows that for any $0<\varepsilon\leq1/2$ there exist integers $n$ and $m$ satisfying Eq. (\[eq:integers\]) such that $${\cal I}(\rho^{\otimes n})\geq(n+m)S(\rho^{A})-3\varepsilon\log_{2}d^{n}-3h(\varepsilon).$$ Note that in the above expression $d$ is the dimension of a single copy of the state $\rho$ (i.e., the dimension of $\rho^{\otimes n}$ is given by $d^{n}$). In the next step we will use Eq. (\[eq:integers\]), thus arriving at the following inequality: $$\begin{aligned}
\frac{1}{n}{\cal I}(\rho^{\otimes n}) & \geq\left(1+\alpha\right)S(\rho^{A})-\varepsilon\left[S(\rho^{A})+3\log_{2}d^{n}\right]-3h(\varepsilon)\end{aligned}$$ which is true for any $0<\varepsilon\leq1/2$ and some integer $n$. By using Eq. (\[eq:Ed\]) this result implies that the regularized CI is bounded below by $${\cal I}^{\infty}(\rho)\geq S(\rho^{A})+E_{d}(\rho^{B_{2}C}),$$ which completes the proof of Eq. (\[eq:asymptotic-2\]) for the case $E_{d}(\rho^{B_{2}C})<S(\rho^{A})$. On the other hand, if $E_{d}(\rho^{B_{2}C})\geq S(\rho^{A})$, Bob can asymptotically teleport all copies of his state to Charlie. Using the same lines of reasoning as above we see that the regularized CI is given by $2S(\rho^{A})$ in this case. This completes the proof of Eq. (\[eq:asymptotic-2\]).
\[sub:CI-and-fidelity\]CI and fidelity of LQSM
----------------------------------------------
Here we will prove that the fidelity of LQSM for any state $\rho=\rho^{ABC}$ is bounded below as $${\cal F}(\rho)\geq2^{-\frac{1}{2}[I^{A:BC}(\rho)-{\cal I}(\rho)]}.$$ In the first step, note that every LOCC operation between Bob and Charlie can be regarded as a unitary by introducing an environment $E$, i.e., the final state $\sigma_{f}^{ACR}$ shared by Alice and Charlie can be written as $\sigma_{f}^{ACR}=\mathrm{Tr}_{BE}[\sigma_{f}^{ABCRE}]$ with the total final state $$\sigma_{f}^{ABCRE}=U(\rho^{ABC}\otimes\rho^{R}\otimes\rho^{E})U^{\dagger}$$ and a unitary $U$ acting on all systems but $A$.
In the next step, we will use the main result from a recent work [@Fawzi2014]: there exists a quantum operation $\Lambda$ from $CR$ to $BCRE$ which allows to recover the total final state $\sigma_{f}^{ABCRE}$ from the reduced state $\sigma_{f}^{ACR}$, with fidelity bounded below as $$F\left(\sigma_{f}^{ABCRE},\Lambda[\sigma_{f}^{ACR}]\right)\geq2^{-\frac{1}{2}I(A:BE|CR)_{\sigma_{f}^{ABCRE}}},\label{eq:fawzi}$$ where $I(X$:$Y|Z)$ is the conditional mutual information.
This means that by acting on his particles $C$ and $R$, Charlie can locally recover the total final state $\sigma_{f}^{ABCRE}$ from the reduced state $\sigma_{f}^{ACR}$ with fidelity bounded below by Eq. (\[eq:fawzi\]). As the fidelity is invariant under unitaries and nondecreasing under discarding subsystems, Charlie can obtain the desired target state $\sigma_{t}^{ACR}$ with fidelity bounded below by Eq. (\[eq:fawzi\]), and thus $${\cal F}(\rho)\geq2^{-\frac{1}{2}I(A:BE|CR)_{\sigma_{f}^{ABCRE}}}$$ for any final state $\sigma_{f}^{ABCRE}$. The proof is complete by noting that the conditional mutual information of $\sigma_{f}^{ABCRE}$ can be written as $$I(A:BE|CR)_{\sigma_{f}^{ABCRE}}=I^{A:BC}(\rho^{ABC})-I^{A:CR}(\sigma_{f}^{ACR}),$$ which can be verified by inspection.
\[sub:Asymptotic\]Asymptotic LQSM and regularized CI
----------------------------------------------------
Here we will prove that perfect asymptotic LQSM implies perfect asymptotic information concentration, i.e., $${\cal F}^{\infty}(\rho)=1\Rightarrow{\cal I}^{\infty}(\rho)=I^{A:BC}(\rho).\label{eq:asymptotic-3}$$ For proving this statement, it is important to note that ${\cal F}^{\infty}(\rho)=1$ implies that for any $\varepsilon>0$ there exists an integer $n\geq1$ and an LOCC protocol $\Lambda$ between Bob and Charlie such that $$||\sigma_{f}-\sigma_{t}^{\otimes n}||\leq\varepsilon.\label{eq:perfect}$$ Here, the target state $\sigma_{t}=\sigma_{t}^{ACR}$ is equivalent to the state $\rho=\rho^{ABC}$ up to relabeling the particles $B$ and $R$, the final state $\sigma_{f}$ is given by $\sigma_{f}=\mathrm{Tr}_{B}[\Lambda[\sigma_{i}^{\otimes n}]]$ with initial state $\sigma_{i}=\rho^{ABC}\otimes\rho^{R}$, and $||M||=\mathrm{Tr}\sqrt{M^{\dagger}M}$ is the trace norm of the operator $M$.
We will now complete the proof of Eq. (\[eq:asymptotic-3\]) by using Eqs. (\[eq:perfect\]) and continuity of mutual information in Eq. (\[eq:continuity-1\]). In particular, these results imply that for any $0<\varepsilon\leq1/2$ there exists an integer $n\geq1$ such that $${\cal I}(\rho^{\otimes n})\geq I^{A:BC}(\rho^{\otimes n})-3\varepsilon\log_{2}d^{n}-3h(\varepsilon),$$ where now $d$ is the dimension of the total system $ABC$. This result implies that for states $\rho$ satisfying ${\cal F}^{\infty}(\rho)=1$ the regularized concentrated information ${\cal I}^{\infty}$ is bounded below by $I^{A:BC}$. Noting that ${\cal I}^{\infty}$ is bounded above by the same quantity completes the proof.
\[sub:LOCC\]General LOCC versus one-way LOCC
--------------------------------------------
Here we will consider the following family of states $$\begin{aligned}
\rho & =\frac{1}{4}\left(\ket{0}\bra{0}^{B}\otimes\ket{00}\bra{00}^{AC}+\ket{1}\bra{1}^{B}\otimes\ket{10}\bra{10}^{AC}\right.\label{eq:rho-1}\\
& \left.+\ket{\psi}\bra{\psi}^{B}\otimes\ket{01}\bra{01}^{AC}+\ket{\psi_{\bot}}\bra{\psi_{\bot}}^{B}\otimes\ket{11}\bra{11}^{AC}\right),\nonumber \end{aligned}$$ with orthogonal states $\ket{\psi}$ and $\ket{\psi_{\bot}}$ such that $0<|\braket{0|\psi}|<1$. In particular, we will prove that the state cannot be merged via one-way LOCC even in the asymptotic scenario. Using the same arguments as in section \[sub:Asymptotic\] of this Supplemental Material, it is enough to prove that the regularized one-way concentrated information is strictly below the total mutual information: $${\cal I}_{\rightarrow}^{\infty}(\rho)<I^{A:BC}(\rho).\label{eq:proof_theorem2-1}$$
For proving this statement, we will use results from section \[sub:Bound\] of this Supplemental Material, which imply that a state $\rho=\rho^{ABC}$ cannot be merged via one-way LOCC in the asymptotic scenario if its regularized discord is strictly larger than the mutual information of $\rho^{BC}$ $$\lim_{n\rightarrow\infty}\frac{1}{n}\delta^{AC|B}(\rho^{\otimes n})>I^{B:C}(\rho^{BC}).$$ Using the fact that for the family of states considered here the reduced state $\rho^{BC}$ is maximally mixed, it remains to show that the regularized discord is nonzero. This can be seen by noting that the state given in Eq. (\[eq:rho-1\]) has nonzero discord $\delta^{AC|B}(\rho)>0$, and by proving that the discord is additive for this family of states. Additivity is shown in section \[sub:Additivity\] of this Supplemental Material, and the proof is complete.
\[sub:Bound\]Bounding one-way CI
--------------------------------
In this section we will prove the following bound for the one-way CI: $${\cal I}_{\rightarrow}\left(\rho^{ABC}\right)\leq I^{A:BC}\left(\rho^{ABC}\right)+I^{B:C}\left(\rho^{BC}\right)-\delta^{AC|B}\left(\rho^{ABC}\right),\label{eq:bound}$$ where $\delta$ is the quantum discord.
For proving this, we first note that the amount of discord $\delta^{X|Y}$ in a quantum state $\rho^{XY}$ can be expressed as follows [@Streltsov2013; @Streltsov2014]: $$\delta^{X|Y}\left(\rho^{XY}\right)=I^{X:Y}\left(\rho^{XY}\right)-\sup_{\left\{ M_{i}^{Y}\right\} }I^{X:Z}\left(\sum_{i}\mathrm{Tr}_{Y}\left[M_{i}^{Y}\rho^{XY}\right]\otimes\ket{i}\bra{i}^{Z}\right),$$ and the supremum is taken over all POVMs $\{M_{i}^{Y}\}$ on the subsystem $Y$. For proving the inequality (\[eq:bound\]) we will use the fact that its right-hand side can also be written as $I^{A:C}(\rho^{AC})+I^{B:AC}(\rho^{ABC})-\delta^{AC|B}(\rho^{ABC})$ which is further equivalent to $I^{A:C}(\sigma^{AC})+\sup_{\{M_{i}^{B}\}}I^{AC:R}(\sigma^{ACR})$ with supremum over all POVMs $\{M_{i}^{B}\}$ and the state $\sigma^{ACR}$ is defined as $$\sigma^{ACR}=\sum_{i}\mathrm{Tr}_{B}\left[M_{i}^{B}\rho^{ABC}\right]\otimes\ket{i}\bra{i}^{R}.$$ Note that the same state $\sigma^{ACR}$ can also be used to express the one-way concentrated information as follows: $${\cal I}_{\rightarrow}(\rho^{ABC})=\sup_{\left\{ M_{i}^{B}\right\} }I^{A:CR}\left(\sigma^{ACR}\right).$$ Using the aforementioned results, the inequality (\[eq:bound\]) is equivalent to $$\sup_{\left\{ M_{i}^{B}\right\} }I^{A:CR}\left(\sigma^{ACR}\right)\leq I^{A:C}\left(\sigma^{AC}\right)+\sup_{\left\{ M_{i}^{B}\right\} }I^{AC:R}\left(\sigma^{ACR}\right).$$ The proof of Eq. (\[eq:bound\]) now follows by using the inequality $$I^{A:CR}\left(\sigma^{ACR}\right)\leq I^{A:C}\left(\sigma^{AC}\right)+I^{AC:R}\left(\sigma^{ACR}\right),$$ which is a direct consequence of the subadditivity of von Neumann entropy [@Nielsen2000].
\[sub:Additivity\]Additivity of discord
---------------------------------------
Here we will show that discord $\delta^{X|Y}$ is additive for states of the form $$\rho^{XY}=\sum_{i}p_{i}\ket{i}\bra{i}^{X}\otimes\ket{\psi_{i}}\bra{\psi_{i}}^{Y}.\label{eq:additivity}$$ This can be seen by using the Koashi-Winter relation, relating quantum discord $\delta$ and entanglement of formation $E_{f}$ as follows [@Koashi2004; @Fanchini2011; @Madhok2011; @Cavalcanti2011]: $$\delta^{X|Y}(\rho^{XY})=E_{f}(\rho^{XZ})-S(\rho^{XY})+S(\rho^{Y}),$$ where the total system $XYZ$ is in a pure state $\ket{\psi}^{XYZ}$. In the next step, note that the state $\rho^{XY}$ in Eq. (\[eq:additivity\]) can be purified as follows: $$\ket{\psi}^{XYZ}=\sum_{i}\sqrt{p_{i}}\ket{i}^{X}\otimes\ket{\psi_{i}}^{Y}\otimes\ket{i}^{Z}.$$ In the final step, we note that the state $\rho^{XZ}$ has the following form: $$\rho^{XZ}=\sum_{i,j}a_{ij}\ket{i}\bra{j}^{X}\otimes\ket{i}\bra{j}^{Z}$$ with parameters $a_{ij}=\sqrt{p_{i}p_{j}}\braket{\psi_{j}|\psi_{i}}$. States of this form are also known in the literature as maximally correlated states, and their entanglement of formation is known to be additive [@Horodecki2003]. This also implies that quantum discord is additive for the states given in Eq. (\[eq:additivity\]).
| |
Give financial literacy priority
FINANCIAL Services Ombudsman Dominic Stoddard was blunt in his assessment of the national capacity to manage money.
Almost half of our citizens, 44 per cent, were classified in a 2013 survey as having low financial ability. More than half of the people over 60 who took the survey, 68 per cent, had no personal or occupational pension plan. Among this country's entrepreneurs, 67 per cent were operating without financial statements and a third of those who were, did not understand them.
Stoddard oversees the revamped National Financial Literacy Programme (NFLP), which was moved to the Office of the Financial Services Ombudsman in 2016. The programme, which has been existence since 2007, has coached 200,000 people, 91,000 of whom participated in the programme between 2016 and 2018. That, Stoddard quite accurately noted, is a drop in the bucket.
The NFLP isn’t the only initiative that’s been undertaken to improve financial literacy. In November 2018, Term Finance, a web-based credit business operating in the Caribbean that targets individuals and Small and Medium Enterprises, hosted financial wellness training for employees in Trinidad and Tobago.
The Unit Trust Corporation also undertook financial workshops that month to teach attendees in Sangre Grande, Carenage, Bon Accord and Bethel the principles of proper budgeting and planning. Both of these institutions undertook these projects at no cost, and while it’s an excellent outreach and public relations opportunity for them, it’s also good business, because informed financial customers are always going to be better business collaborators.
There is little indication that the state has seen the wisdom in improving the quality of financial literacy among the public at large. Financially literate citizens are less likely to be dependent on the state and better equipped to contribute to the economy, so it would seem sensible to adopt a wider-ranging programme focused on correcting a dramatic shortfall in financial literacy that affects households as potently as it does small business.
Failing to do so is likely to be a recipe for continued state support of citizens on the margins, an unacceptable and unnecessarily humiliating situation given the work that many of these people have done over their working lives and can do in the future, since many of those targeted by the NFLP are in primary and secondary school.
It’s clearly time to acknowledge the value of improving national financial literacy by introducing more comprehensive training in basic money management and entrepreneurship directly into the school system.
Financial literacy is a fundamental tool of personal empowerment. It’s not something for business people only. It's of value to everyone and has an outsized impact on the sectors of the public managing limited resources. | https://newsday.co.tt/2019/07/29/give-financial-literacy-priority/ |
This year, 160 firms from across England and Wales took part in the survey, making it one of the biggest of its kind in the UK, and it is widely regarded as the leading annual health check for mid-sized practices. Once again, many thanks to those practices that took part. As in previous years, participants provided two years’ data – the most recent accounting period and the previous one – allowing us to compare results on a like-for-like basis.
All of the main headlines from the survey show that participants have had a strong year. Headlines include the following.
One of the key findings from the survey is that the financial stability of many of the participating practices appears to have improved. In last year’s survey, we reported that partners’ total drawings (including income tax payments) had exceeded profits for two consecutive years in a fifth of practices. We also reported that median equity partner capital (the combined total of capital accounts, current accounts and tax reserves) had fallen by 7.5% between 2012 and 2013. The results from this year’s survey show that partners’ drawings exceeded profits for two consecutive years in just 8% of practices, and that median equity partner capital had increased by 8%. Both of these are measures that the Solicitors Regulation Authority (SRA) looks at when assessing a practice’s financial stability, and our findings will no doubt be welcomed by it.
We also found that, despite increased workflow, total lock-up (work-in-progress and debtors combined) for all participants fell slightly, to a median of 153 days, and one in eight was regularly operating near to their overdraft facility, compared to one in five last year. Both are encouraging, as past experience shows us that the early stages of an economic recovery are often the most dangerous time for service-based businesses.
In the last few years, we have seen some large increases in the amounts of interest received by participants, and, indeed, there has been another 6% increase this year. With the base rate holding steady at 0.5%, and with banks reining in the rates that they are paying on client monies, the increase has resulted primarily from practices holding greater amounts of client money, as opposed to better interest rates.
Finally, we asked participants for their thoughts on their own future over the next few years. One in six practices thought it likely that they would seek external investment for expansion, and a similar number said that they were likely to bring in one or more non-lawyer owners (such as HR, IT or finance managers, or spouses). In line with last year, a third of practices told us that they were likely to merge with another practice within the next two to three years, although only a fifth were already speaking to other practices.
Throughout 2014, financial stability featured heavily in sector messaging. The SRA’s publication of good and bad behaviours was intended to change attitudes toward managing a firm’s financial affairs, which ultimately serves to deliver better outcomes for firms and their clients.
It is encouraging to note an increase in income metrics and a reduced number of firms where partners’ drawings exceeded profits. Firms should not forget past struggles, and maintaining a focus on reform will support organic growth and place the firm in a stronger position for the future.
Measuring success is crucial, and we believe understanding ‘what good looks like’ will help firms to achieve their ambitions.
The LMS Financial Benchmarking Survey 2014, published by the Law Management Section in association with Hazlewoods, and sponsored by Lloyds Bank Commercial Banking, is available to Section members now, at the special price of £75, or to non-members at £150. Survey participants receive a copy free of charge, plus a personalised report, comparing their results against all other participants.
The Law Management Section will provide you with support, advice, networking opportunities and enable the sharing of best practice with peers.
The current Section Engagement Programme has been created in consultation with the Section Committee
These issues will be addressed through a range of activities including: Webinars, Magazines, Regional Forums, Seminars, a Conference, Website, E-newsletters and a LinkedIn Group. | http://communities.lawsociety.org.uk/law-management/magazine/2015/february-2015/hope-springs/5046663.article |
Nutritional and microbiological quality of sun-dried silver cyprinid during storage (2018-11-23)Silver cyprinid is a cheap, accessible, highly nutritious food that is incorporated diets of infants as a fortified protein source. However, this silver cyprinid is prone to degradation during storage but the effect of ...
-
An investigation into the productivity of block laying on building sites in Kampala (2019-04)On many public buildings, use is made of concrete blocks. Previous research shows that the productivity of workers is a major cause of poor performance of building projects in Uganda. As such poor productivity of block ...
-
Modelling the impact of stunting on childhood survival in Buhweju district and the cost of its prevention (2019-03)Stunting affects close to 2.4 million children in Uganda and it is among the major contributors to the annual loss in productivity equivalent to $899 million. This study sought to identify the risk factors for the persistently ...
-
The impact of oil imports on economic growth: Evidence from Uganda (Makerere University, 2019-02-20)Production processes for most goods and services of every country depend on energy with oil inclusive. However, for a country like Uganda with few alternative sources of energy, over dependency on oil imports is likely to ...
-
The legal framework for addressing the refuge problem in Uganda: Strengths and weaknesses (Makerere University, 2018-11)This study analysed how the refugee legal regime in Uganda was addressing the recurrent refugee problem. Refugees are a desperate and vulnerable category of people, who will have been forced by threats of human execution ...
-
Teacher awareness and support to HIV infected and affected learners: A case of secondary schools in Ngora District (2018-11-05)This study examined the support teachers provide to learners infected with and affected by HIV/AIDS in secondary schools in Ngora district. Specifically, the study assessed teachers’ awareness of the existence of HIV ...
-
The role of metabolites in cassava (Manihot esculenta Crantz) resistance to Whitefly (Bemisia tabaci) (Makerere University, 2019-04)The whitefly (Bemisia tabaci) (Gennadias, 1889) is a major challenge in cassava production especially for most African regions. This is because most of the varieties used are susceptible to the pest resulting in severe ...
-
Contribution of NAADS programme to rural farmers in Bukedea District (2018-07-05)The National Agricultural Advisory Services (NAADS) Program of Uganda is one of the pillars of Plan for Modernisation of Agriculture (PMA) implemented since 2001. This study was undertaken to assess the contribution of ...
-
Secondary teachers perception of formative writing assessment and its influence on their practice (2018-10)This study sought to investigate how teachers perceived Formative writing Assessment and how this impacted on their practice. It was carried out in Kampala district involving six teachers and eighteen students. The study ...
-
Effectiveness of Motivational Factors: A Case Study of Kakira Sugar Limited (Makerere University, 2018-12-17)The purpose of the study was to evaluate the effectiveness of the motivational factors at Kakira Sugar Limited. The study was guided by the following objectives; to find out the effectiveness of leadership styles in ...
-
Impact of Remittances on Gross Domestic Savings in Uganda (Makerere University, 2019-02-25)This study examined the impact of remittance inflows on gross domestic savings rate (GDS) in Uganda using secondary quarterly data for the period 1999-2017. The other macroeconomic variables used included; deposit interest ...
-
The Impact of External Debt on Uganda’s Economic Growth (Makerere University, 2019-02-12)This study examined the impact of external debt on Uganda‟s economic growth over the period 1987-2017 using the Autoregressive Distributed-lagged (ARDL) model estimation techniques after carrying out diagnostic tests on ...
-
The Effect of Micro-Credit on Women Empowerment in Uganda: The Case of BRAC (Makerere University, 2018-11-07)Women empowerment has continuously become a key concern on the Uganda’s development agenda. This is aimed at improving their status in the society and also to strengthen their self-esteem. Various programs have been ...
-
In vitro antifungal effect of combined extracts of Euphorbia hirta L. And Carica papaya L. (2018)Trichophyton rubrum accounts for up to 69.5 % of all dermatophyte infections worldwide including ringworms (Tinea). High costs of treatment, drug resistance, side effects and increasing incidences of such fungal infections ...
-
ECOWAS and security in West Africa (Makerere University, 2018-09-25)The thesis of this essay is that ECOWAS could be a model organization for regional security in Africa. The essay analyzes Sub-regional organizations in addressing regional insecurity in Africa and uses ECOWAS as a case ...
-
Prevalence and factors associated with Diarrhoea among children under-five and household adaptation strategies in flash flood prone Bwaise II and III parishes, Kawempe Division, Kampala Uganda (2018-11)Introduction: Diarrhoea remains a major cause of morbidity and mortality among U5 in Uganda with prevalence of 20%. Bwaise has poor sanitation and hygiene coupled with frequent flash floods have increased prevalence of ...
-
The role of NGOs in monitoring and reporting human rights violations to treaty bodies in Uganda: A case study of selected NGOs (2018-11-28)This study was set out to examine the role played by human rights NGOs in Uganda in fulfilling their obligations of monitoring and reporting before the international treaty bodies. The study was interested in exploring the ...
-
Assessing differences in secondary school attendance before and after the introduction of universal secondary education in Uganda (Makerere University, 2018-08)The objective of the study was to investigate differences in secondary school attendance before and after the introduction of Universal Secondary Education (USE) in Uganda. The study focused on children of the secondary ...
-
The determinants of Uganda’s coffee exports: 1980-2013 (Makerere University, 2018-06)Uganda has continued to depend on primary commodities such as coffee, tea, banana, and others as its valuable exports despite price shocks in the world markets. This study therefore intend to empirically examine the ...
-
Role of Microfinance in Empowering Women Entrepreneurs in Peri-Urban Areas in Uganda: Case Study Pride Microfinance Institution (Makerere University, 2017-12)The main objective of the research is to determine the role of Microfinance in the economic empowerment of women entrepreneurs in Kampala District based on the perceptions of Pride Microfinance beneficiaries in peri urban ... | http://dspace.mak.ac.ug/recent-submissions?offset=0 |
The invention discloses a body-in-white welding spot CAE automatic grouping method and device and a storage medium, and belongs to the technical field of computer-aided engineering, and the method specifically comprises the following steps: 1, importing all welding spot data of an automobile body-in-white, manually deleting round surface and central point data in the welding spot data, and only reserving entity part data of the welding spots; 2, numbering entities of all welding spots by software; 3, layer welding groups with different layer numbers are established and used for storing different welding spot information subsequently; 4, counting the number of the solid surfaces of all the welding spots; 5, creating nodes in the entity center, wherein the numbers of the nodes are in one-to-one correspondence with the entity numbers; and step 6, according to the number of the solid surfaces of the welding spots, automatically grouping nodes in the centers of the newly created welding spots according to rules. According to the method, the TCL and the API command library of the Hypermesh software are utilized for secondary development, the welding spot features are automatically recognized by the software to be grouped, automatic classification and grouping are carried out one by one, and the method has the advantages of being fast, efficient and high in accuracy. | |
1 a lot more argument against legalization has just been taken off the table thanks to a study that was funded by the U.S. Division of Justice. The study was commissioned to ascertain the influence of cannabis legalization, and what they discovered was that there does not appear to be a adverse impact on neighboring states, as a lot of may well claim.
Researchers applied statistics on drug possession and distribution arrests in a mixture of states that had legalized and neighboring states. They had been hunting to obtain 3 certain items namely, how legalization impacted law enforcement sources inside the states that had legalized, how it impacted the very same sources in neighboring non-legal states, and no matter if cannabis legalization had any impact on drug trafficking.
“Legalizing marijuana did not have a noticeable influence on indicators in states that bordered these that legalized,” the study concluded, adding that “there had been no noticeable indications of an enhance in arrests connected to transportation or trafficking offenses in states along the northern or southern borders.”
Arrests for possession substantially dropped in Washington and Colorado following legalization in 2012, falling even additional just after retail sales became readily available. Whilst not as a great deal information and facts was readily available on Oregon, as cannabis had only been legal for a year at the time of the study, they nevertheless discovered that throughout the period straight away just after legalization the currently smaller quantity of marijuana arrests in the state dropped to practically zero.
“No noticeable alter in the trend line for marijuana occurred just after recreational use was legalized in Colorado,” the study authors mentioned of information on possession convictions in Kansas from 2011 to 2014.
Researchers also looked at neighboring states, like Oklahoma and Kansas, exactly where cannabis remains illegal for adult use, and what they discovered was intriguing. Rather than potentially rising cannabis-connected crimes – as prohibitionists may well recommend – the quantity of arrests in Oklahoma really fell slightly just after legalization in Colorado, regardless of the reality that cannabis arrests remained the majority of drug possession charges.
Even even though the study was funded by the federal government, they are not claiming any duty for the benefits. On every single web page of the study there is a disclaimer stating that: “[o]pinions or points of view expressed are these of the author(s) and do not necessarily reflect the official position or policies of the U.S. Division of Justice.”
Basically, they have funded the study that discovered state legal marijuana does not negatively influence neighboring states, but they do not necessarily agree with the findings. On the other hand, the information does not lie. The reality of the matter is that the fears that cannabis legalization would enhance crime and the trafficking of the plant are 1 step closer to getting dispelled with this study. | https://allcbdgummies.com/2019/10/12/federally-funded-study-finds-cannabis-legalization-does-not-negatively-influence-other-states/ |
What is Psychotherapy and how does it differ from Counselling?
My approach to Psychotherapy:
I am trained in Relational Gestalt Psychotherapy, and have also been influenced by my studies in and experience with modern approaches to psychodynamic self-psychology. Both these approaches are relational therapeutic approaches, which means they are based in the understanding that growth and change come from the development of a relationship between client and therapist, and on the therapist's capacity for relationship, inclusion and confirmation which describe specific ways of relating: the capacity for feeling into the experience of the other while still retaining full sense of our own self as individual. Gestalt also emphasises the importance of phenomenological experience in the here and now.
Relational therapies are based on the understanding that our sense of self and who we are develops from being seen, acknowledged and having our emotions recognised and validated by others. It does not take living in an environment of abuse for aspects of our selves to not have been responded to as fully as we might have needed. Many factors including caregivers' own trauma histories or ongoing social stressors despite otherwise loving family environments, may have impacted on caregivers capacities to provide good enough emotional attunement in the full complexity of infants and young children's lives. These issues can lead to ongoing emotional distress that can be diagnosed as mental disorder later in life.
Relational psychotherapy can be helpful in addressing many mental health issues such as depression, anxiety, personality disorders, dissociation or adjustment disorders, as well as the impacts of ongoing stress and both immediate and long-term effects of trauma and abuse. Grief and loss are other life transitions for which a relational psychotherapeutic approach can be helpful in providing support and relief.
My aim is to provide an environment of safety and I am experienced in working with powerful emotions.
Medicare Rebate is available with a Mental Health Care Plan from your GP. | http://www.kallenakucers.com/psychotherapy-and-counselling.html |
We do not give, rent or sell your personal information to any outside company for its use in marketing or solicitation.
About This Policy
This Privacy and Security Statement describes the privacy practices of Balloons Etc., Inc., BalloonsDirect.com and its affiliates ("our", or "we"). It applies to our interactions with our customers and visitors, including, but not limited to:
- Use of our websites, including mobile websites
- Phone and email communications
- Social media interactions on our websites and other third party websites like Facebook, YouTube, Pinterest, Google+, Instagram and Twitter
- to contact you with product updates, new product offerings and special offers, at your discretion
- Viewing our online advertisements or emails
Information We Collect
Contact Information
We may collect the names and user names of our customers and other visitors. Additionally, we may collect your purchase history, billing and shipping addresses, phone numbers, email addresses, and other digital contact information. We may also collect information that you provide us about others.
Payment Information
When you make a purchase we collect your payment information, including information from your credit or debit card, check, PayPal account or gift card.
Demographic Information
We may collect information about products or services you like, reviews you submit, or where you shop. We might also collect information like your age or gender.
Location Information
If you use our mobile websites or applications, we may collect location data obtained from your mobile device. If you use our websites, we may collect location data obtained from your IP address. You can control how we use your device’s location information in the settings menu of your device.
Other Information
We may collect any of the information or content that you provide through our websites, mobile applications, or online forums. If you use our websites, we collect your IP (Internet Protocol) address and other related information such as the type of browser and operating system you are using. We might also track the pages you visit, look at what website you came from, or what website you visit when you leave us. We collect this information using the tracking tools described in the Our Tracking Techniques section at the bottom of this page. To control those tools, please read the Your Privacy Preferences and Our Tracking Techniques sections.
How Information is Collected
We collect information directly from you. The following are a few examples of when we collect information from you:
- During website or survey registration.
- In connection with an online or in store purchase.
- If you use an online forum, submit a question or provide us with comments or reviews or contact us in any way.
- If you use an online forum, submit a question or provide us with comments or reviews or contact us in any way.
- If you return a product.
- If you apply or inquire about employment.
- In connection with your interactions with us as a registered user of our websites.
We collect information from you passively. We may use tracking tools like browser cookies, flash cookies, and web beacons. Please see the Our Tracking Techniques section below for more information.
We collect information from other sources. We may get information about you from third party business partners, like an updated address from a shipping vendor. We may collect information about you from a friend. For example, if your friend purchases something for us to send to you or if your friend provides your information through one of our refer-a-friend type features. If you use one of these features, please ensure that you only submit email addresses of individuals with whom you have a close personal or family relationship, who would be interested in receiving the communication, and who has authorized you to share their email address.
How We Use Information
We use the information we collect for our business purposes, including:
To respond to your questions and requests. Examples include:
- Fulfilling orders, ensuring proper delivery or providing services (such as delivering an electronic copy of your receipt).
- Registering you for a particular website.
- Processing a return.
- Responding to a product or service review.
To improve our products and services.
We may use your information to make website, mobile application, or product and service improvements.
To look at website and mobile application trends and customer interests.
We might use your information to customize your experience with us. We may also combine information we get from you with information about you we have received from third parties or publicly available sources to assess trends and interests.
For our marketing.
In certain circumstances, we may send you communications about special promotions or offers via regular mail, email, or other electronic channels, including ads on social media platforms. We may send you emails if you have registered on a website and indicated you want to receive this information or if you gave us your information in our store. We may also notify you of new website features or product and service offerings. To manage our communications with you, follow the instructions in the Your Privacy Preferences section below. We may use information to deliver you marketing communications (including online ads) based on your interests. For example, if you view a product on our website, you may see ads for that product on our or third party websites and applications.
To communicate with you about your account or our relationship.
For employment purposes.
We may use the personal information you provide in connection with a job application or related inquiry for the purpose of processing and responding to your application or inquiry.
For social media.
For other uses we may disclose to you.
We may also use personal information with your consent, and as otherwise permitted or required by law.
Information Sharing
We may share your information for our business purposes and as legally required or permitted, including:
With third parties who perform services on our behalf.
We share information with our service providers, such as our delivery service providers who ship and deliver your online orders.
If we think we have to in order to comply with the law.
For example, we will disclose information to respond to a court order or subpoena. We may also disclose information if a government agency or investigatory body requests it.
To protect us.
For example, we will disclose information if we suspect fraud. We will also share information as part of an investigation. We may also disclose personal information to assist us in collecting a debt owed by you.
At your direction.
For example, if you ask us to provide your information to a third-party to facilitate the resolution of a dispute.
Your Privacy Preferences
You can register or change your preferences to receive or not receive marketing communications from us by emailing us. Please allow sufficient time for your preferences to be processed. Even if you opt out of receiving marketing messages, we may still contact you for transactional purposes like confirming or following up on an order, responding to customer service inquiries, asking you to review a product or service you have ordered, or notifying you of product recalls. If you later opt back into getting marketing communications from us, we will remove your information from our opt-out databases.
For more information about how we may collect information to provide you with interest based ads or learn about our users' interests and how you may register your preferences regarding that collection, please read the Our Tracking Techniques section below.
Our Sites and Children
Our websites and mobile applications are not created for children. To our knowledge we do not collect information online from children under 18. If you are a parent or guardian and think we have information about your child, please Contact Us. To learn more about how to protect your child online, visit the FTC's www.OnGuardOnline.gov.
Your California Privacy Rights
If you live in California and have an established business relationship with us, you can request a list of the personal information we have shared with third parties for their marketing purposes. We will also give you a list of the third parties that have received your information. You can make a request one time each year.
To exercise your rights, you can email us or write to us at the address below. Mention in your letter that you are making a "California Shine the Light" inquiry. We will respond within 30 days.
Security
When you place orders on our websites, all of your order information, including your credit card number and delivery address, is transmitted through the Internet using Secure Sockets Layer (SSL) technology. SSL technology causes your browser to encrypt your order information before transmitting it to our secure server. SSL technology, an industry standard, is designed to prevent someone other than operators of our websites from capturing and viewing your personal information.
While we use industry standard means to protect our websites and your information, the Internet is not 100% secure. The measures we use are appropriate for the type of information we collect. We cannot promise that your use of our websites or mobile applications will be completely safe. We encourage you to use caution when using the Internet. Online access to your personal information is protected with a password you select. We strongly recommend that you do not share your password.
Links
Our websites may contain links to third party websites. If you click on one of those links, you will be taken to websites we do not control. This Privacy and Security Statement does not apply to the information practices of those websites. You should read the privacy policies of other websites carefully. We are not responsible for third party websites.
Changes to this Privacy and Security Statement
From time to time we may change our privacy policies. We will notify you of any material changes to our Privacy and Security Statement by posting an updated copy on our website. Please check our website periodically for updates.
Our Tracking Techniques
We collect personal and other information about users over time and across different websites when you use this website or service. We also have third parties that collect personal information this way. We or our vendors use several common online tracking tools to collect this information. These may include browser and flash cookies. We may also use web beacons and similar technologies. We or third parties may also collect or receive information from our mobile applications and others’ applications and use that information to provide measurement services and targeted ads. We (and our third party service providers) also use these tools:
- To track new visitors to our websites.
- To recognize returning customers.
- To learn what site referred you to our website or mobile application.
- To store your password if you are registered on our website.
- To personalize your experience on our website, mobile application and on third-party social networking websites, plug-ins and applications.
- To collect and store geographic data determined by the IP address of your computer.
- To optimize and tailor our websites and mobile applications.
- To make product recommendations.
- So we can better understand our customers and website visitors and their interests.
Account Registration and Use
My Account registration is an optional service provided by our website. You do not have to register to browse or shop online. When you register, you are asked for personal information such as your name, address, phone number, email address, and a username and password that you select. This information may be used to help make your online shopping quicker and easier, by pre-filling certain parts of your shopping information.
Contact Us
If you have additional questions you can call us at 1-888-323-5181, fax us at 1-703-879-7505, or reach us by email using our Contact Page. You can write to us at: | https://www.balloonsdirect.com/privacy-policy |
BACKGROUND
1. Field
2. Description of Related Art
The following description relates to a neural network method and apparatus.
The technological automation of processes such as recognition, for example voice recognition and speech recognition, has been implemented through processor implemented neural network models, as specialized computational architectures, which, after substantial training, may provide computationally intuitive mappings between input patterns and output patterns. The trained capability of generating such mappings may be referred to as a learning capability of the neural network. Further, because of the specialized training, such specially trained neural network may thereby have a generalization capability of generating a relatively accurate output with respect to an input pattern that the neural network may not have been trained for, for example.
SUMMARY
This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.
In a general aspect, a processor implemented data processing method includes receiving a first input plane corresponding to a first input channel from among a plurality of input planes of an input feature map, receiving a first weight plane corresponding to the first input channel among a plurality weight planes of a weight kernel, generating first cumulative data by accumulating multiplication results from multiplication operations between at least a portion of first input elements in the first input plane, and at least a portion of first weight elements in the first weight plane; and generating a first output plane corresponding to a first output channel among a plurality of output planes of an output feature map based on the first cumulative data, wherein each of the plurality of input planes, and each of the plurality of weight planes respectively correspond to an input channel, and wherein each of the plurality of output planes corresponds to an output channel.
The generating of the first output plane may include generating the first output plane based on a sum of cumulative data for each input channel including the first cumulative data.
The method may include receiving a second input plane corresponding to a second input channel among the input planes, receiving a second weight plane corresponding to the second input channel among the plurality of weight planes; and generating second cumulative data by accumulating multiplication results from multiplications between at least a portion of second input elements in the second input plane, and at least a portion of second weight elements in the second weight plane.
The generating of the first output plane may include generating the first output plane based on a sum of the first cumulative data and the second cumulative data.
The generating of the first cumulative data may include extracting, from the first input plane, first input element vectors corresponding to the portion of the first weight elements, generating first weighted input element vectors corresponding to multiplication results from multiplication operations between the first input element vectors and the portion of the first weight elements; and generating the first cumulative data by accumulating the first weighted input element vectors.
The extracting of the first input element vectors may include determining offsets corresponding to the first input element vectors based on indices of the portion of the first weight elements; and extracting the first input element vectors from the first input plane based on the determined offsets.
A size of the first input element vectors and a size of the first weighted input element vectors may correspond to a single instruction multiple data (SIMD) operation unit.
When the first cumulative data is generated, an operation of multiplying zero weight elements corresponding to a value of zero among the portion of the first weight elements and the portion of the first input elements may be skipped.
The method may further include determining a number of non-zero weight elements not corresponding to zero among the first weight elements; and selecting an operation type corresponding to the determined number of non-zero weight elements from among a plurality of operation types to perform a preset type of operation.
The generating of the first cumulative data may include generating the first cumulative data by accumulating the multiplication results from the multiplication operations between the portion of the first input elements and the non-zero weight elements corresponding to the portion of the first weight elements based on the selected operation type.
The generating of the first cumulative data may include extracting, from the first input plane, first input element vectors corresponding to the non-zero weight elements based on indices of the non-zero weight elements, generating first weighted input element vectors corresponding to multiplication results from multiplication operations between the first input element vectors and the non-zero weight elements corresponding to the portion of the first weight elements; and generating the first cumulative data by accumulating the first weighted input element vectors.
The method may further include separately multiplying respective weight elements of each of the weight planes by plural elements of the first input plane.
In a general aspect, a data processing apparatus includes one or more processors configured to receive a first input plane corresponding to a first input channel from among a plurality of input planes of an input feature map, receive a first weight plane corresponding to the first input channel among a plurality of weight planes of a weight kernel, generate first cumulative data by accumulating multiplication results from multiplication operations between at least a portion of first input elements in the first input plane and at least a portion of first weight elements in the first weight plane; and generate a first output plane corresponding to a first output channel among a plurality of output planes of an output feature map respectively corresponding to output channels based on the first cumulative data, wherein each of the plurality of input planes, and each of the plurality of weight planes respectively correspond to an input channel, and wherein each of the plurality of output planes corresponds to an output channel.
The processor may further be configured to generate the first output plane based on a sum of cumulative data for each input channel including the first cumulative data.
The processor may be further configured to receive a second input plane corresponding to a second input channel among the input planes, receive a second weight plane corresponding to the second input channel among the plurality of weight planes; and generate second cumulative data by accumulating multiplication results from multiplications between at least a portion of second input elements in the second input plane and at least a portion of second weight elements in the second weight plane.
The processor may be further configured to generate the first output plane based on a sum of the first cumulative data and the second cumulative data.
The processor may be further configured extract, from the first input plane, first input element vectors corresponding to the portion of the first weight elements; generate first weighted input element vectors corresponding to multiplication results from multiplication operations between the first input element vectors and the portion of the first weight elements; and generate the first cumulative data by accumulating the first weighted input element vectors.
The processor may be further configured to determine offsets corresponding to the first input element vectors based on indices of the portion of the first weight elements; and extract the first input element vectors from the first input plane based on the determined offsets.
A size of the first input element vectors and a size of the first weighted input element vectors may correspond to a single instruction multiple data (SIMD) operation unit.
When the first cumulative data is generated, an operation of multiplying zero weight elements corresponding to a value of zero among the portion of the first weight elements and the portion of the first input elements may be skipped.
The processor may be further configured to determine a number of non-zero weight elements not corresponding to zero among the first weight elements; and select an operation type corresponding to the determined number of non-zero weight elements from among a plurality of operation types to perform a preset type of operation.
The processor may be further configured to generate the first cumulative data by accumulating the multiplication results from the multiplication operations between the portion of the first input elements and the non-zero weight elements corresponding to the portion of the first weight elements based on the selected operation type.
The processor may be further configured to extract, from the first input plane, first input element vectors corresponding to the non-zero weight elements based on indices of the non-zero weight elements, generate first weighted input element vectors corresponding to multiplication results from multiplication operations between the first input element vectors and the non-zero weight elements corresponding to the at least portion of the first weight elements; and generate the first cumulative data by accumulating the first weighted input element vectors.
The apparatus may include a memory storing instructions that, when executed by the one or more processors, configure the one or more processors to perform the receiving of the first input plane, the receiving of the first weight plane, the generating of the first cumulative data, and the generating of the first output plane.
In a general aspect, a processor-implemented method performed by a processor of an electronic apparatus includes receiving an input plane of a layer of a neural network including a plurality of input elements, receiving a weight plane corresponding to the input plane of the layer, the weight plane including a plurality of weight elements; and generating an output plane by accumulating multiplication results obtained by performing a multiplication operation between each of the weight elements in the weight plane and a corresponding input element of the input elements in the input plane.
When a zero weight element corresponding to a value of zero is present among the weight elements, a multiplication between the zero weight element and an input element corresponding to the zero weight element may be skipped.
A convolution operation associated with the layer of the neural network may be performed based on single instruction multiple data (SIMD).
The input plane and the weight plane may correspond to a single input channel, and the output plane corresponds to a single output channel.
The input plane may be one of a plurality of input planes corresponding to an input feature map of the layer, and the weight plane is one of a plurality of weight planes corresponding to a weight kernel of the layer, and wherein an output feature map of the layer is determined based on the output plane, and one or more output planes generated based on one or more other input planes excluding the input plane among the plurality of input planes, and one or more other weight planes excluding the weight plane among the plurality of weight planes.
In a general aspect, a processor-implemented method includes receiving an input feature map including a plurality of input planes, receiving a weight kernel including a plurality of weight planes, performing a cumulative convolution operation between the input feature map and the weight kernel, and generating an output plane based on the cumulative convolution operation.
The method may further include generating cumulative planes by performing multiply and accumulate (MAC) operations between the plurality of input planes and the plurality of weight planes.
The output plane may be generated by accumulating outputs of the cumulative planes.
Other features and aspects will be apparent from the following detailed description, the drawings, and the claims.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1
illustrates an example data processing apparatus with a neural network implementation, in accordance with one or more embodiments.
FIG. 2
illustrates an example convolution operation, in accordance with one or more embodiments.
FIG. 3
illustrates an example sliding window convolution operation.
FIGS. 4
5
and respectively illustrate example generations of an output plane through cumulative convolution operations, in accordance with one or more embodiments.
FIGS. 6
7
and respectively illustrate example multiply and accumulate (MAC) operations between an input plane and a weight plane for cumulative convolution operations, in accordance with one or more embodiments.
FIGS. 8 through 10
respectively illustrate example cumulative convolution operations using single instruction multiple data (SIMD) processing, in accordance with one or more embodiments.
FIG. 11
illustrates an example zero-skipping of a cumulative convolution operation, in accordance with one or more embodiments.
FIG. 12
illustrates an example of performing zero-skipping using a preset operation type, in accordance with one or more embodiments.
FIG. 13
is a flowchart illustrating an example cumulative convolution operation, in accordance with one or more embodiments.
FIG. 14
is a flowchart illustrating an example data processing method with a neural network implementation, in accordance with one or more embodiments.
FIG. 15
illustrates an example data processing apparatus with a neural network implementation, in accordance with one or more embodiments.
FIG. 16
illustrates an example electronic apparatus, in accordance with one or more embodiments.
Throughout the drawings and the detailed description, unless otherwise described or provided, the same drawing reference numerals will be understood to refer to the same elements, features, and structures. The drawings may not be to scale, and the relative size, proportions, and depiction of elements in the drawings may be exaggerated for clarity, illustration, and convenience.
DETAILED DESCRIPTION
The following detailed description is provided to assist the reader in gaining a comprehensive understanding of the methods, apparatuses, and/or systems described herein. However, various changes, modifications, and equivalents of the methods, apparatuses, and/or systems described herein will be apparent after an understanding of the disclosure of this application. For example, the sequences of operations described herein are merely examples, and are not limited to those set forth herein, but may be changed as will be apparent after an understanding of the disclosure of this application, with the exception of operations necessarily occurring in a certain order. Also, descriptions of features that are known after an understanding of the disclosure of this application may be omitted for increased clarity and conciseness.
The features described herein may be embodied in different forms and are not to be construed as being limited to the examples described herein. Rather, the examples described herein have been provided merely to illustrate some of the many possible ways of implementing the methods, apparatuses, and/or systems described herein that will be apparent after an understanding of the disclosure of this application.
As used herein, the term "and/or" includes any one and any combination of any two or more of the associated listed items.
Throughout the specification, when an element, such as a layer, region, or substrate, is described as being "on," "connected to," or "coupled to" another element, it may be directly "on," "connected to," or "coupled to" the other element, or there may be one or more other elements intervening therebetween. In contrast, when an element is described as being "directly on," "directly connected to," or "directly coupled to" another element, there can be no other elements intervening therebetween. As used herein, the term "and/or" includes any one and any combination of any two or more of the associated listed items.
Although terms such as "first," "second," and "third" may be used herein to describe various members, components, regions, layers, or sections, these members, components, regions, layers, or sections are not to be limited by these terms. Rather, these terms are only used to distinguish one member, component, region, layer, or section from another member, component, region, layer, or section. Thus, a first member, component, region, layer, or section referred to in examples described herein may also be referred to as a second member, component, region, layer, or section without departing from the teachings of the examples.
The terminology used herein is for describing various examples only and is not to be used to limit the disclosure. The articles "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. The terms "comprises," "includes," and "has" specify the presence of stated features, numbers, operations, members, elements, and/or combinations thereof, but do not preclude the presence or addition of one or more other features, numbers, operations, members, elements, and/or combinations thereof.
Unless otherwise defined, all terms, including technical and scientific terms, used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains and based on an understanding of the disclosure of the present application. Terms, such as those defined in commonly used dictionaries, are to be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and the disclosure of the present application and are not to be interpreted in an idealized or overly formal sense unless expressly so defined herein.
Also, in the description of example embodiments, detailed description of structures or functions that are thereby known after an understanding of the disclosure of the present application will be omitted when it is deemed that such description will cause ambiguous interpretation of the example embodiments.
Hereinafter, examples will be described in detail with reference to the accompanying drawings, and like reference numerals in the drawings refer to like elements throughout.
FIG. 1
FIG. 1
illustrates an example data processing apparatus with a neural network implementation, in accordance with one or more embodiments. The data processing apparatus as described hereinafter may refer to an apparatus that processes data for a neural network, and will be hereinafter simply referred to as a data processing apparatus. Referring to , a data processing apparatus 100 may include a neural network 110. The data processing apparatus may process one or more operations associated with the neural network 110. As a non-limiting example, the one or more operations associated with the neural network 110 may include an object recognition operation, an image recognition operation, a speech recognition operation, a voice recognition operation, and a user verification operation, as only examples. Herein, it is noted that use of the term 'may' with respect to an example or embodiment, e.g., as to what an example or embodiment may include or implement, means that at least one example or embodiment exists where such a feature is included or implemented while all examples and embodiments are not limited thereto.
The one or more operations may be implemented through processor-implemented neural network models, as specialized computational architectures that, after substantial training, may provide computationally intuitive mappings between input data or patterns and output data or patterns or pattern recognitions of input patterns. The trained capability of generating such mappings or performing such pattern recognitions may be referred to as a learning capability of the neural network. Such trained capabilities may also enable the specialized computational architecture to classify such an input pattern, or portion of the input pattern, as a member that belongs to one or more predetermined groups. Further, because of the specialized training, such specially trained neural network may thereby have a generalization capability of generating a relatively accurate or reliable output with respect to an input pattern that the neural network may not have been trained for, for example.
In an example, the neural network 110 may be a deep neural network (DNN), as a non-limiting example. The DNN may include a plurality of layers. For example, the deep neural network may include an input layer to which input data is applied, an output layer for outputting a result derived through prediction based on training and the input data, and a plurality of hidden layers for performing a neural network operation between the input layer and the output layer.
In an example, the input layer may correspond to, or may be referred to as, the lowest layer of the neural network, and the output layer may correspond to, or may be referred to as, the highest layer of the neural network. A layer order may be assigned and named or referred to sequentially from the output layer, that is the highest layer, to the input layer that is the lowest layer. For example, a Hidden Layer 2 may correspond to a layer higher than a Hidden Layer 1 and the Input Layer, but lower than the Output Layer.
The DNN may include one or more convolutional layers, and may further include one or more of fully connected layers, a recurrent neural network, and the like, or may include different or overlapping neural network portions respectively with such full, convolutional, or recurrent connections, according to machine learning used to process information.
As noted, the neural network 110 may perform the one or more operations, for example, the object recognition operation or the user verification operation by mapping input data and output data that are in a nonlinear relationship based on deep learning approaches, such as in a convolution neural network or a recurrent neural network. The deep learning approach may refer to a machine learning method used to recognize, as non-limiting examples, an image or a voice (or speech) from a big dataset. The deep learning approach may be construed as a problem-solving process in optimization to locate a point at which energy or loss is minimized while training the neural network 110 using prepared training data. The deep learning approach may be classified into supervised or unsupervised learning, through which weights corresponding to an architecture or model of the neural network 110 may be obtained. Through such obtained weights or elements of kernel(s), the input data and the output data may be mapped according to a trained objective of the neural network 110.
FIG. 1
The neural network 110 may be a deep neural network (DNN) including a plurality of layers which includes an input layer, at least one hidden layer, and an output layer. For example, as illustrated in , a first layer 110, one or more second layers 120, and an nth layer 130 may be at least a portion of the plurality of layers. The neural network 110 may include, as examples, at least one of a fully connected network, a convolutional neural network (CNN), or a recurrent neural network (RNN). For example, at least a portion of the plurality of layers in the neural network 110 may correspond to a CNN, and another portion of the plurality of layers in the neural network 110 may correspond to a fully connected network.
In the CNN or CNN portion, data input to each layer may be referred to as an input feature map or volume, and data output from each layer may be referred to as an output feature map or volume. The input feature map from a previous layer and the output feature map of a current layer may be referred to as activation data. In addition, an input feature map in an input layer may correspond to input data.
To process the operation associated with the neural network 110, the data processing apparatus 100 may perform a convolution operation between an input feature map and a weight kernel for each convolutional layer, and generate an output feature map based on a result of the convolution operation. The weight kernel may have multiple channels, corresponding to the number of channels of the input feature map, and there may further be multiple weight kernels resulting in the generation of an output feature map of multiple channels. The neural network 110 may have a capacity sufficient to implement a function, when a width and a depth of the neural network 110 are sufficiently large. The neural network 110 may achieve optimal performance when the neural network 110 learns or is trained with a sufficiently large amount of training data through a training process, as discussed above.
A weight kernel may be predetermined, e.g., the weight kernel includes trained weight elements, which indicates that it is determined before the neural network 110 is initiated (implemented). The initiation of the neural network 110 may indicate that the neural network 110 is ready for inference. In an example, the initiation of the neural network 110 may indicate that the neural network 110 is loaded in a memory, or that input data for the inference is input to the neural network 110 after the neural network 110 is loaded in the memory. Inference is the process of applying a trained neural network to an input to produce an output.
As is further described below, a convolution operation may be performed by accumulating, in an output feature map, intermediate results of the convolution operation, and may not require a buffering operation of converting a weight kernel or an input feature map to a form suitable for a convolution and storing it in a buffer. That is, the convolution operation may use data of the input feature map stored in a planar form. Thus, efficiency of the convolution operation may be improved greatly. Additionally, in the convolution operation, a unit operation may correspond to multiplying one weight element corresponding to a scalar and one input plane corresponding to a matrix. Thus, for weight elements having a value of zero, zero-skipping may be effectively processed through software.
FIG. 2
FIG. 2
FIG. 2
is a diagram illustrating an example convolution operation. Referring to , an output feature map 230 may be generated through the performance of a convolution operation between a weight kernel 210 and an input feature map 220. In the example of , data of the weight kernel 210, the input feature map 220, and the output feature map 230 may be stored in a planar form in a memory. In an example, each of weight kernels 1 through D of the weight kernel 210 may include C weight planes, the input feature map 220 may include C input planes, and the output feature map 230 may include D output planes, wherein C and D are natural numbers. The C weight planes of the weight kernel 210 and the C input planes of the input feature map 220 may respectively correspond to input channels, and the D output planes may respectively correspond to output channels. In this example, C corresponds to the number of the input channels, and D corresponds to the number of the output channels.
∗
∗
Each weight plane and each output plane may include elements of a preset bit-width. For example, each weight plane may have a size of KK, and each input plane and each output plane may have a size of WH, in which W, K, and H indicate respective numbers of elements. An element of a weight plane may also be referred to as a weight element, and an element of an input plane and an element of an output plane may also be referred to as an input element and an output element, respectively. In an example, a convolution operation may be performed elementwise.
∗
Hereinafter, it may be assumed for convenience of description that a width and a height of a weight plane are the same as K, and a size of an input plane and a size of an output plane are the same as WH. However, a width and a height of a weight plane, and a size of an input plane and a size of an output plane may differ from each other according to an example.
FIG. 3
illustrates an example of a sliding window convolution operation, in accordance with one or more embodiments.
FIG. 3
Referring to , by implementing a sliding window-based convolution operation, a convolution operation is performed as a weight kernel 310 slides into an input feature map 320, and thus an output feature map 330 is generated.
Such sliding window convolution operation may be typically implemented to perform a convolution operation, and differs from a cumulative convolution operation described herein. For example, in the sliding window convolution operation, a buffering operation may be performed on the input feature map 320 to generate column vectors. However, in one or more examples, a cumulative convolution operation herein may accumulate, in the output feature map 330, intermediate results of a convolution operation, and thus there may not be a need to perform operations such as a buffering operation as in the sliding window convolution operation.
FIG. 3
2∗
2∗
By the sliding window convolution operation, an operation between the weight kernel 310 and data stored in a noncontinuous address of the input feature map 320 may be performed while the weight kernel 310 is sliding across the input feature map 320, and thus the input feature map 320 may be converted to a suitable form of continuous data to increase a speed of processing the operation. In the example of , a sliding stride is 1, and zero-padding may be applied to each of horizontal and vertical directions of the input feature map 320 through two rows of zero element vectors. In this example, KC row vectors corresponding to the weight kernel 310 are defined, and the input feature map 320 is converted to KC column vectors.
A column vector may be buffered in a column buffer from the input feature map 320 in a planar structure or an interleaved structure. In an example of the planar structure, while the input feature map 320 is being buffered as a column vector, a noncontinuous maximum memory access may occur to an extent of a result from a multiplication of a height K of a kernel and the number C of input channels to determine one output element. In an example of the interleaved structure, while the input feature map 320 is being buffered as a column vector, the noncontinuous maximum memory access may occur to an extent of the height K of the kernel to determine one output element.
In contrast, in one or more examples, by a cumulative convolution operation discussed herein, the intermediate results of the convolution operation may be accumulated in the output feature map 330, and thus such additional buffering operation may not be needed to convert the input feature map 320 to such planar or interleaved structure. Thus, the cumulative convolution operation may minimize a memory access and maximize a speed of processing the convolution operation.
FIGS. 4
5
and respectively illustrate examples of generating an output plane through a cumulative convolution operation, in accordance with one or more embodiments.
FIGS. 4
5
FIGS. 4
5
As previously discussed, in an example, an output feature map may include D output planes. and respectively illustrate a process of generating one of the D output planes. The process illustrated in and may be repeated for each of the D output planes, and the output feature map may be generated.
FIG. 4
FIG. 5
FIG. 5
FIG. 5
Referring to , an output plane 430 may be generated through the implementation of a convolution operation between an input feature map 410 and a weight kernel 420. In an example, the weight kernel 420 may be a dth weight kernel among D weight kernels, and the output plane 430 may be a dth output plane among the D output planes. For example, the input feature map 410 may include one or more input planes 510 as illustrated in , and the weight kernel 420 may include one or more weight planes 520 as illustrated in . Additionally, the output plane 430 may correspond to an output plane 540, as illustrated in .
FIG. 5
FIG. 5
Referring to , the input planes 510 may include, as non-limiting examples, input planes 511, 512, and 513. The number of the input planes 510 corresponds to the number C of input channels. In the example of , the number C of the input channels is three. However, the number three is provided as an example for convenience of description, and thus the number of input planes may be less than 3 or greater than 3 as corresponding to the number C of the input channels. The weight planes 520 may include, as non-limiting examples, weight planes 521, 522, and 523, and cumulative planes 530 may include, as non-limiting examples, cumulative planes 531, 532, and 533.
The cumulative plane 531 may be generated through a multiply and accumulate (MAC) operation between the input plane 511 and the weight plane 521. The cumulative plane 532 is generated through a MAC operation between the input plane 512 and the weight plane 522. The cumulative plane 533 may be generated through a MAC operation between the input plane 513 and the weight plane 523. The MAC operation will be described hereinafter in greater detail. When the cumulative planes 530 are generated, the output plane 540 is generated based on the cumulative planes 530. For example, the output plane 540 may be generated through a sum of the cumulative planes 530.
FIGS. 6
7
and respectively illustrate an example MAC operation between an input plane and a weight plane for a cumulative convolution operation, in accordance with one or more embodiments.
FIG. 6
FIG. 6
1
9
∗
Referring to , a cumulative plane 630 may be generated based on a MAC operation between each of input elements in an input plane 610 and each of weight elements in a weight plane 620. The weight plane 620 may include, as a non-limiting example, weight elements w through w. Although the weight plane 620 is illustrated as having a size of 33 for convenience of description, the size of the weight plane 620 is not limited to the illustrated example and the weight plane 620 may have various other sizes. Although not illustrated in , each of the input plane 610 and the cumulative plane 630 may include a plurality of elements, and an elementwise convolution operation may be performed.
FIG. 7
FIG. 6
FIG. 7
FIG. 6
FIG. 6
1
9
1
9
∗
∗
Referring to , an input plane 711 may correspond to the input plane 610 of , weight elements w through w of a weight plane of may correspond to the weight elements w through w of the weight plane 620 of , and a cumulative plane 740 may correspond to the cumulative plane 630 of . An input plane 712 may be generated by performing zero-padding on the input plane 711 based on a sliding stride. For example, when a size of the input plane 711 is WH and the sliding stride is 1, the input plane 712 may have a size of (W+2)(H+2).
1
9
1
9
1
2
9
Considering a sliding window approach, between the weight plane including the weight elements w through w and the input plane 712, in one or more examples, response regions 721 through 729 in the input plane 712 that respectively respond to the weight elements w through w may be defined. For example, input elements in the response region 721 respond to the weight element w, input elements in the response region 722 respond to the weight element w, and input elements in the response region 729 respond to the weight element w.
1
9
∗
∗
A size of the response regions 721 through 729 is the same as a size of the input plane 711. In addition, respective offsets of the response regions 721 through 729 are determined based on respective indices of the weight elements w through w. For example, when a width of the input plane 711 is W+2, the offsets of the response regions 721 through 729 are defined as (W+2)a+b, in which "a" denotes a quotient obtained by dividing (i-1) by K, and "b" denotes a remainder obtained by dividing (i-1) by K, and i denotes an index of an weight element and K denotes a width of a weight kernel. In this example, an offset may be determined based on an input plane, for example, an original point of the input plane to which padding is applied. Thus, the offset of the response region 721 is 0, the offset of the response region 722 is 1, and the offset of the response region 729 is (W+2)2+2.
1
9
FIG. 7
FIG. 7
Multiplication results 731 through 739 are generated from respective multiplications between input elements in the response regions 721 through 729 and the weight elements w through w. The cumulative plane 740 is generated by accumulating each of the multiplication results 731 through 739. In an example, an output plane may be generated through a sum of C cumulative planes. In this example, the cumulative plane 740 of corresponds to one of the C cumulative planes. The process described above with reference to is repeated for each of the C cumulative planes, and the output plane is generated. Each of elements in the multiplication results 731 through 739 may also be referred to as a multiplication result element. Additionally, in an example of an output feature map including D output planes, the output feature map may be determined through the D output planes generated in such a cumulative manner.
As described above, an output feature map may be generated by accumulating multiplication results, for example, the multiplication results 731 through 739, that correspond to intermediate results of a convolution operation. Accordingly, an operation of converting an input feature map to continuous data, and storing the continuous data in a buffer, may not be needed. Thus, it is possible to reduce an amount of time used for such conversion and buffering, and accelerate an operational speed of the convolution operation and save memory space used to store the converted data.
FIGS. 8 through 10
respectively illustrate an example of a cumulative convolution operation using single instruction multiple data (SIMD) processing, in accordance with one or more embodiments. SIMD may refer to an operation processing method of a processor that processes multiple data with a single instruction. As to be described hereinafter, a cumulative convolution operation according to one or more embodiments may be performed through SIMD.
FIG. 8
Referring to , a weight plane 810 slides into a sliding region 821 of an input plane 820, and a MAC operation is performed therebetween, and a cumulative region 831 of a cumulative plane 830 is determined. Similarly, the weight plane 810 slides into a sliding region 822 of the input plane 820, and a MAC operation is performed therebetween, and a cumulative region 832 of the cumulative plane 830 is determined. Additionally, the weight plane 810 slides into a sliding region 823 of the input plane 820, and a MAC operation is performed therebetween, and a cumulative region 833 of the cumulative plane 830 is determined. A height of the sliding regions 821 through 823 may correspond to a height of the weight plane 810, and a height of the cumulative regions 831 through 833 may correspond to a single element. Through such process described above, a relationship between sliding regions and cumulative regions may be established.
FIG. 9
FIG. 9
1
9
1
9
∗
∗
∗
∗
Referring to , a sliding region 910 in an input plane 900 may include response regions 911 through 919 of weight elements w through w. Respective offsets of the response regions 911 through 919 are determined based on respective indices of the weight elements w through w. For example, as illustrated in , the offsets of the response regions 911 through 919 are defined as (W+2)a+b. In this example, the offsets of the response regions 911 through 919 are 0, 1, 2, (W+2), (W+2)+1, (W+2)+2, (W+2)2, (W+2)2+1, and (W+2)2+2, respectively. An offset may be determined based on a sliding region, for example, an original point of each sliding region.
From the response regions 911 through 919, input element vectors are extracted and stored in registers r1 through r9. For example, a first input element vector of the response region 911 is stored in the register r1, and a second input element vector of the response region 912 is stored in the register r2. Similarly, the input element vectors are respectively stored in the registers r1 through r9 in sequential order.
1
9
1
2
Each of the input element vectors may be multiplied elementwise by a corresponding weight element among the weight elements w through w, and thus weighted input element vectors are generated. In an example, the first input element vector of the response region 911 is stored in the register r1 and multiplied by the weight element w, and thus a first weighted input element vector is generated. Similarly, the second input element vector of the response region 912 is stored in the register r2 and multiplied by the weight element w, and thus a second weighted input element vector is generated. A size of the response regions 911 through 919, the input element vectors, and the weighted input element vectors may correspond to a SIMD operation unit.
The weighted input element vectors generated through such processes described above may be accumulated, and a cumulative vector corresponding to the sliding region 910 may be generated. The process may be repeated for each of sliding regions, and cumulative vectors respectively corresponding to the sliding regions may be generated. The generated cumulative vectors may form a cumulative plane. Here, a cumulative plane and a cumulative vector may refer to different forms of cumulative data, and may collectively be referred to as cumulative data.
FIG. 10
Referring to , a previously stored cumulative vector, hereinafter referred to as a first cumulative vector, is loaded from an output region 1011 in an output plane 1010 and then stored in a register r10. When a new cumulative vector, hereinafter referred to as a second cumulative vector, is generated through registers r1 through r9, the first cumulative vector and the second cumulative vector is accumulated in the register r10 and stored in the output region 1011.
FIG. 10
In the example of , a process of storing a cumulative vector in the output region 1011 is performed at least one time. In an example, a first cumulative vector is generated through a MAC operation between a first input plane and a first weight plane that correspond to a first input channel, and stored in the output region 1011. Subsequently, a second cumulative vector may be generated through a MAC operation between a second input plane and a second weight plane that correspond to a second input channel. The generated first cumulative vector and second cumulative vector are accumulated and stored in the output region 1011. However, when an initial value is stored in the output region 1011, that is when a cumulative vector is initially generated, an operation of loading a cumulative vector from the output region 1011 may be omitted, and a newly generated cumulative vector may be stored in the output region 1011 without an accumulating operation.
When cumulative vectors are repeatedly stored in the output region 1011 based on the number of input channels (e.g., the number of accumulations is one less than the number of the input channels), an output element vector corresponding to the output region 1011 is determined. Additionally, such processes for the output region 1011 is performed on remaining output regions in the output plane 1010, the output plane 1010 may then be determined. Thus, a cumulative convolution operation may be implemented through SIMD.
FIG. 11
illustrates an example of zero-skipping of a cumulative convolution operation, in accordance with one or more embodiments.
In an example, a convolution operation may be performed for each input plane as a unit, or for each response region in an input plane as a unit, and thus may effectively process zero-skipping through software, or a combination of software and hardware.
FIG. 11
1
9
Referring to , multiplication results 1141 through 1143 are generated from respective multiplications between input elements in response regions 1121 through 1123 and weight elements w through w.
FIG. 11
3
5
8
9
Referring to the example illustrated in , weight elements w through w, w, and w are zero (0). A weight element corresponding to zero is referred to as a zero weight element, and a weight element not corresponding to zero is referred to as non-zero weight element. In this example, multiplication results, such as, for example, the multiplication result 1143, which is generated from a zero weight element, may not affect data of a cumulative plane or an output plane, and thus operations to obtain such multiplication results may be skipped.
FIG. 12
illustrates an example of performing zero-skipping based on a preset operation type, in accordance with one or more embodiments.
FIG. 12
FIG. 12
Referring to , in operation 1210, zero encoding is performed. Through the zero encoding, the number of non-zero weight elements included among the weight elements is determined. In the example of , the number of non-zero weight elements may be determined to be four as a result of the zero encoding.
FIG. 12
FIG. 12
∗
∗
∗
In operation 1220, an operation type corresponding to the determined number of non-zero weight elements may be selected from among operation types, and data corresponding to the non-zero weight elements is loaded into a register. In the example of , operation type 4 corresponding to the four non-zero weight elements may be selected. The operation types may be set to perform respective types of operation that are preset respectively based on the number of non-zero weight elements. For example, a corresponding operation type may be set for an example where non-zero weight elements are not present among the weight elements, and a corresponding operation type may be set for an example where all the weight elements are non-zero weight elements. When the number of the operation types is defined as N and the number of the weight elements is defined as KK, N may be KK+1 (N = KK+1). In the example of , K = 3, and N = 10. The type of operation may refer to operations related to whether a MAC operation is performed with a zero weight element or a non-zero weight element. In an example, the type of operation is determined based on the number of zero weight elements or the number of non-zero weight elements.
FIG. 12
∗
1
2
6
7
Data to be loaded to a register may correspond to at least a portion of an input plane. For example, an input element vector corresponding to a non-zero weight element may be loaded to the register. An offset corresponding to the input element vector may be determined based on an index of the non-zero weight element, and the input element vector may be extracted from the input plane based on the determined offset and stored in the register. In the example of , offsets 0, 1, (W+2)+2, and (W+2)2 are determined based on w, w, w, and w corresponding to the non-zero weight elements, and input element vectors corresponding to the determined offsets are loaded to registers reg1, reg2, reg3, and reg4.
FIG. 12
1
2
6
7
A preset type of operation may include a type of operation that performs a MAC operation between non-zero weight elements and data loaded to a register, and generates cumulative data. The data may be loaded to the register based on the number of the non-zero weight elements and an offset. For example, a MAC operation between a non-zero weight element and an input element vector stored in a register may be performed. In the example of , weighted input element vectors corresponding to multiplication results from multiplications between the non-zero weight elements w, w, w, and w and the input element vectors stored in the registers reg1, reg2, reg3, and reg4 are generated, and the generated weighted input element vectors are accumulated to generate cumulative data.
FIG. 12
In operation 1230, a source code corresponding to each operation type may be executed. In an example, a source code corresponding to each of operation types 0 through 9, as only examples, may be stored in a memory code area, and a source code corresponding to the selected operation type may be loaded from the memory code area and executed. In the example of , a source code corresponding to operation type 4 is executed. Such source code may occupy a memory space less, and thus the use of the source code may not degrade memory efficiency greatly.
FIG. 13
FIG. 13
FIG. 13
FIG. 13
FIG. 13
FIGS. 1-12
FIG. 13
is a flowchart illustrating an example of a cumulative convolution operation, in accordance with one or more embodiments. The operations in may be performed in the sequence and manner as shown, although the order of some operations may be changed or some of the operations omitted without departing from the scope of the illustrative examples described. Many of the operations shown in may be performed in parallel or concurrently. One or more blocks of , and combinations of the blocks, can be implemented by special purpose hardware-based computer that perform the specified functions, or combinations of special purpose hardware and computer instructions. In addition to the description of below, the descriptions of are also applicable to , and are incorporated herein by reference. Thus, the above description may not be repeated here.
FIG. 13
d
1
2
Referring to , in operation 1301, a weight kernel w is obtained. In an example, "d" may denote an index of an output channel, and may be a natural number, for example, 1 through D, with an initial value of 1. Respective weight kernels may correspond to respective output channels, respectively. For example, a weight kernel w may correspond to a first output channel, and a weight kernel w may correspond to a second output channel.
c
1
2
<mrow><msubsup><mi mathvariant="normal">w</mi><mi mathvariant="normal">c</mi><mi mathvariant="normal">d</mi></msubsup></mrow>
<mrow><msubsup><mi mathvariant="normal">W</mi><mn mathvariant="normal">1</mn><mi mathvariant="normal">d</mi></msubsup></mrow>
<mrow><msubsup><mi mathvariant="normal">W</mi><mn mathvariant="normal">2</mn><mi mathvariant="normal">d</mi></msubsup></mrow>
In operation 1302, an input plane i is obtained. In operation 1303, a weight plane is obtained. In an example, "c" denotes an index of an input channel, and may be a natural number, for example, 1 through C, with an initial value of 1. Input planes and weight planes may respectively correspond to input channels. In an example, an input plane i and a weight plane correspond to a first input channel, and an input plane i and a weight plane correspond to a second input channel.
c
c
c
<mrow><msubsup><mi mathvariant="normal">w</mi><mi mathvariant="normal">c</mi><mi mathvariant="normal">d</mi></msubsup><mn>.</mn></mrow>
In operation 1306, a MAC operation is performed. In an example, cumulative data is generated by accumulating multiplication results from multiplications between at least a portion of input elements in the input plane i and at least a portion of weight elements in the weight plane In this example, input element vectors corresponding to at least a portion of the weight elements are extracted from the input plane i, weighted input element vectors corresponding to multiplication results from multiplications between the extracted input element vectors and at least a portion of the weight elements are generated, and then the cumulative data is generated by accumulating the weighted input element vectors. In this example, offsets corresponding to the input element vectors may be determined based on indices of at least a portion of the weight elements, and the input element vectors are extracted from the input plane i based on the determined offsets.
In operations 1304 and 1305, zero-skipping is performed. Specifically, in operation 1304, zero encoding is performed. In operation 1305, an operation type is selected. When the number of non-zero weight elements is determined through the zero encoding, an operation type corresponding to the determined number of non-zero weight elements is selected, and input elements corresponding to the non-zero weight elements are loaded to a register. For example, input element vectors corresponding to the non-zero weight elements are loaded to the register.
When the operation type is selected, operations based on a preset operation type may be performed. For example, the operations may include multiplying non-zero weight elements and the input elements, or the input element vectors, in the register, and generating the cumulative data, for example, a cumulative vector, by accumulating results of the multiplying. Thus, when the cumulative data is generated, an operation of multiplying zero weight elements and the input elements may be skipped.
1
1
2
2
<mrow><msubsup><mi mathvariant="normal">W</mi><mn mathvariant="normal">1</mn><mi mathvariant="normal">d</mi></msubsup></mrow>
<mrow><msubsup><mi mathvariant="normal">W</mi><mn mathvariant="normal">1</mn><mi mathvariant="normal">d</mi></msubsup><mn mathvariant="normal">.</mn></mrow>
<mrow><msubsup><mi mathvariant="normal">W</mi><mn mathvariant="normal">2</mn><mi mathvariant="normal">d</mi></msubsup></mrow>
<mrow><msubsup><mi mathvariant="normal">W</mi><mn mathvariant="normal">2</mn><mi mathvariant="normal">d</mi></msubsup><mn mathvariant="normal">.</mn></mrow>
In operation 1307, an output is accumulated. For example, cumulative data corresponding to an output of a MAC operation may be accumulated. For example, when a first repetition for c which is 1 (c = 1) is performed, an input plane i is obtained and a weight plane is obtained, and first cumulative data is generated by accumulating multiplication results from multiplications between at least a portion of first input elements in the obtained input plane i and at least a portion of first weight elements in the obtained weight plane When a second repetition for c which is 2 (c = 2) is performed, an input plane i is obtained and a weight plane is obtained, and second cumulative data is generated by accumulating multiplication results from multiplications between at least a portion of second input elements in the obtained input plane i and at least a portion of second weight elements in the obtained weight plane In this example, the generated first cumulative data and second cumulative data are accumulated. When a Cth repetition for c which is C (c = C) is performed, an output plane is generated based on a sum of cumulative data for each input channel.
In operation 1308, c and C are compared. When c and C are different, for example, when c is less than C, c is increased by 1 in operation 1309, and operation 1302 is performed. When c is equal to C, d and D are compared in operation 1309. When d and D are different, for example, when d is less than D, d is increased by 1 in operation 1311 and operation 1301 is performed. A convolution may be performed on all input channels while an output channel is set or fixed through operations 1308 and 1309, and a convolution operation may be performed on all output channels by changing an output channel through operations 1310 and 1311.
FIG. 14
FIG. 14
FIG. 14
FIG. 14
FIG. 14
FIGS. 1-13
FIG. 14
is a flowchart illustrating an example of a data processing method for a neural network, in accordance with one or more embodiments. The operations in may be performed in the sequence and manner as shown, although the order of some operations may be changed or some of the operations omitted without departing from the scope of the illustrative examples described. Many of the operations shown in may be performed in parallel or concurrently. One or more blocks of , and combinations of the blocks, can be implemented by special purpose hardware-based computer that perform the specified functions, or combinations of special purpose hardware and computer instructions. In addition to the description of below, the descriptions of are also applicable to , and are incorporated herein by reference. Thus, the above description may not be repeated here.
FIG. 14
FIGS. 1 through 13
Referring to , in operation 1410, a processing apparatus obtains a first input plane corresponding to a first input channel among input planes of an input feature map respectively corresponding to input channels. In operation 1420, the processing apparatus obtains a first weight plane corresponding to the first input channel among weight planes of a weight kernel respectively corresponding to the input channels. In operation 1430, the processing apparatus generates first cumulative data by accumulating multiplication results from multiplications between at least a portion of first input elements in the obtained first input plane and at least a portion of first weight elements in the obtained first weight plane. In operation 1440, the processing apparatus generates a first output plane corresponding to a first output channel among output planes of an output feature map respectively corresponding to output channels based on the generated first cumulative data. For a more detailed description of a data processing method with a neural network implementation, reference may be made to what has been described above with reference to .
FIG. 15
is a diagram illustrating an example of a data processing apparatus for a neural network, in accordance with one or more embodiments.
The data processing apparatus 1500 may receive input data, and process an operation of a neural network associated with the received input data. The operation of the neural network may include, as non-limiting examples, an object recognition operation and a user verification operation, as examples. The processing apparatus 1500 may perform one or more of the operations or methods described herein in relation to processing by the neural network, and provide a user with a result of processing by the neural network. The processing apparatus 1500 may perform a cumulative convolution operation as described above while processing the operation of the neural network.
FIG. 15
Referring to , the processing apparatus 1500 may include one or more processors 1510 and one or more memories 1520. In the examples, a "processor" may mean one or more processors, and a "memory" may mean one or more memories. The memory 1520 may be connected to the processor 1510, and store instructions executable by the processor 1510, and data to be processed by the processor 1510 or data processed by the processor 1510. The memory 1520 may include a non-transitory computer-readable medium, for example, a high-speed random-access memory (RAM), and/or a nonvolatile computer-readable storage medium, for example, at least one disk storage device, a flash memory device, and other nonvolatile solid-state memory devices.
FIGS. 1 through 14
The processor 1510 may execute instructions to perform one or more of the operations or methods described above with reference to . For example, when an instruction stored in the memory 1520 is executed by the processor 1510, the processor 1510 may obtain a first input plane corresponding to a first input channel among input planes of an input feature map respectively corresponding to input channels, obtain a first weight plane corresponding to the first input channel among weight planes of a weight kernel respectively corresponding to the input channels, generate first cumulative data by accumulating multiplication results from multiplications of at least a portion of first input elements in the obtained first input plane and at least a portion of first weight elements in the obtained first weight plane, and generate a first output plane corresponding to a first output channel among output planes of an output feature map respectively corresponding to output channels based on the generated cumulative data. In an example, the data processing apparatus 1500 may further store instructions, for example, in memory 1520, which when executed by the processor 1510 configure the processor 1510 to implement such one or more or any combination of operations described herein.
FIG. 16
is a diagram illustrating an example of an electronic apparatus, in accordance with one or more embodiments.
FIGS. 1 through 15
FIGS. 1 through 15
The electronic apparatus 1600 may receive input data, and process an operation of a neural network associated with the received input data. The operation of the neural network may include, as non-limiting examples, an object recognition operation and a user verification operation, as examples. The electronic apparatus 1600 may perform a cumulative convolution operation as described above while processing the operation of the neural network. The electronic apparatus 1600 may include the processing apparatus described above with reference to , and perform an operation of the processing apparatus as described above with reference to .
FIG. 16
Referring to , the electronic apparatus 1600 may include one or more processors 1610, one or more memories 1620, a camera 1630, a storage device 1640, an input device 1650, an output device 1660, and a network interface 1670. The processor 1610, the memory 1620, the camera 1630, the storage device 1640, the input device 1650, the output device 1660, and the network interface 1670 may communicate with one another through a communication bus 1680.
FIGS. 1 through 15
The one or more processors 1610 may execute a function and an instruction in the electronic apparatus 1600. For example, the processor 1610 may process instructions stored in the memory 1620 or the storage device 1640. The processor 1610 may perform one or more of the operations or methods described above with reference to .
The memory 1620 may store information to be used to process the operation of the neural network. The memory 1620 may include a computer-readable storage medium or a computer-readable storage device. The memory 1620 may store instructions to be executed by the processor 1610, and store related information while software or an application is being executed by the electronic apparatus 1600.
The camera 1630 may capture a still image, a moving or video image, or both images. The camera 1630 may capture an image of a facial region to be input by a user for facial verification or recognition. The camera 1630 may also provide a three-dimensional (3D) image including depth information of objects.
The storage device 1640 may include a computer-readable storage medium or a computer-readable storage device. The storage device 1640 may store a greater amount of information for a longer period of time, compared to the memory 1620. The storage device 1640 may include, for example, a magnetic hard disk, an optical disc, a flash memory, a floppy disk, and other types of nonvolatile memory that are well-known in the related technical field.
The input device 1650 may receive an input from a user through a traditional input method, including, as non-limiting examples, a keyboard and a mouse, and a new input method, for example, a touch input, a voice input, and an image input. The input device 1650 may include, for example, a keyboard, a mouse, a touchscreen, a microphone, and other devices that may detect the input from the user and transmit the detected input to the electronic apparatus 1600.
The output device 1660 may provide an output of the electronic apparatus 1600 to a user through a visual, auditory, or tactile channel. The output device 1660 may include, for example, a display, a touchscreen, a speaker, a vibration generator, and other devices that may provide the output to the user. The network interface 1670 may communicate with an external device through a wired or wireless network.
FIGS. 1-16
The neural network apparatuses, data processing apparatuses, the electronic apparatus, data processing apparatus 100, processor 1510, memory 1520, processor 1610, memory 1620, camera 1630, storage device 1640, input device 1650, output device 1660, network interface 1670, and other devices, and other components described herein with respect to are implemented as, and by, hardware components. Examples of hardware components that may be used to perform the operations described in this application where appropriate include controllers, sensors, generators, drivers, memories, comparators, arithmetic logic units, adders, subtractors, multipliers, dividers, integrators, and any other electronic components configured to perform the operations described in this application. In other examples, one or more of the hardware components that perform the operations described in this application are implemented by computing hardware, for example, by one or more processors or computers. A processor or computer may be implemented by one or more processing elements, such as an array of logic gates, a controller and an arithmetic logic unit, a digital signal processor, a microcomputer, a programmable logic controller, a field-programmable gate array, a programmable logic array, a microprocessor, or any other device or combination of devices that is configured to respond to and execute instructions in a defined manner to achieve a desired result. In one example, a processor or computer includes, or is connected to, one or more memories storing instructions or software that are executed by the processor or computer. Hardware components implemented by a processor or computer may execute instructions or software, such as an operating system (OS) and one or more software applications that run on the OS, to perform the operations described in this application. The hardware components may also access, manipulate, process, create, and store data in response to execution of the instructions or software. For simplicity, the singular term "processor" or "computer" may be used in the description of the examples described in this application, but in other examples multiple processors or computers may be used, or a processor or computer may include multiple processing elements, or multiple types of processing elements, or both. For example, a single hardware component or two or more hardware components may be implemented by a single processor, or two or more processors, or a processor and a controller. One or more hardware components may be implemented by one or more processors, or a processor and a controller, and one or more other hardware components may be implemented by one or more other processors, or another processor and another controller. One or more processors, or a processor and a controller, may implement a single hardware component, or two or more hardware components. A hardware component may have any one or more of different processing configurations, examples of which include a single processor, independent processors, parallel processors, single-instruction single-data (SISD) multiprocessing, single-instruction multiple-data (SIMD) multiprocessing, multiple-instruction single-data (MISD) multiprocessing, and multiple-instruction multiple-data (MIMD) multiprocessing.
FIGS. 1-16
The methods illustrated in that perform the operations described in this application are performed by computing hardware, for example, by one or more processors or computers, implemented as described above executing instructions or software to perform the operations described in this application that are performed by the methods. For example, a single operation or two or more operations may be performed by a single processor, or two or more processors, or a processor and a controller. One or more operations may be performed by one or more processors, or a processor and a controller, and one or more other operations may be performed by one or more other processors, or another processor and another controller, e.g., as respective operations of processor implemented methods. One or more processors, or a processor and a controller, may perform a single operation, or two or more operations.
Instructions or software to control computing hardware, for example, one or more processors or computers, to implement the hardware components and perform the methods as described above may be written as computer programs, code segments, instructions or any combination thereof, for individually or collectively instructing or configuring the one or more processors or computers to operate as a machine or special-purpose computer to perform the operations that are performed by the hardware components and the methods as described above. In one example, the instructions or software include machine code that is directly executed by the one or more processors or computers, such as machine code produced by a compiler. In another example, the instructions or software include higher-level code that is executed by the one or more processors or computers using an interpreter. The instructions or software may be written using any programming language based on the block diagrams and the flow charts illustrated in the drawings and the corresponding descriptions in the specification, which disclose algorithms for performing the operations that are performed by the hardware components and the methods as described above.
The instructions or software to control computing hardware, for example, one or more processors or computers, to implement the hardware components and perform the methods as described above, and any associated data, data files, and data structures, may be recorded, stored, or fixed in or on one or more non-transitory computer-readable storage media. Examples of a non-transitory computer-readable storage medium include read-only memory (ROM), random-access programmable read only memory (PROM), electrically erasable programmable read-only memory (EEPROM), random-access memory (RAM), dynamic random access memory (DRAM), static random access memory (SRAM), flash memory, non-volatile memory, CD-ROMs, CD-Rs, CD+Rs, CD-RWs, CD+RWs, DVD-ROMs, DVD-Rs, DVD+Rs, DVD-RWs, DVD+RWs, DVD-RAMs, BD-ROMs, BD-Rs, BD-R LTHs, BD-REs, blue-ray or optical disk storage, hard disk drive (HDD), solid state drive (SSD), flash memory, a card type memory such as multimedia card micro or a card (for example, secure digital (SD) or extreme digital (XD)), magnetic tapes, floppy disks, magneto-optical data storage devices, optical data storage devices, hard disks, solid-state disks, and any other device that is configured to store the instructions or software and any associated data, data files, and data structures in a non-transitory manner and provide the instructions or software and any associated data, data files, and data structures to one or more processors or computers so that the one or more processors or computers can execute the instructions. In one example, the instructions or software and any associated data, data files, and data structures are distributed over network-coupled computer systems so that the instructions and software and any associated data, data files, and data structures are stored, accessed, and executed in a distributed fashion by the one or more processors or computers.
While this disclosure includes specific examples, it will be apparent, after an understanding of the disclosed application, that various changes in form and details may be made in these examples without departing from the scope of the claims and their equivalents. The examples described herein are to be considered in a descriptive sense only, and not for purposes of limitation. Descriptions of features or aspects in each example are to be considered as being applicable to similar features or aspects in other examples. Suitable results may be achieved if the described techniques are performed in a different order, and/or if components in a described system, architecture, device, or circuit are combined in a different manner, and/or replaced or supplemented by other components or their equivalents. Therefore, the scope of the disclosure is defined not by the detailed description, but by the claims and their equivalents, and all variations within the scope of the claims and their equivalents are to be construed as being included in the disclosure.
Clause 1. A processor-implemented method performed by a processor of an electronic apparatus, the method comprising: receiving an input plane of a layer of a neural network including a plurality of input elements; receiving a weight plane corresponding to the input plane of the layer, the weight plane including a plurality of weight elements; and generating an output plane by accumulating multiplication results obtained by performing a multiplication operation between each of the weight elements in the weight plane and a corresponding input element of the input elements in the input plane.
Clause 2. The method of clause 1, wherein, when a zero weight element corresponding to a value of zero is present among the weight elements, a multiplication between the zero weight element and an input element corresponding to the zero weight element is skipped.
Clause 3. The method of any of clauses 1-2, wherein a convolution operation associated with the layer of the neural network is performed based on single instruction multiple data (SIMD).
Clause 4. The method of any of clauses 1-3, wherein the input plane and the weight plane correspond to a single input channel, and the output plane corresponds to a single output channel.
Clause 5. The method of any of the clauses 1-4, wherein the input plane is one of a plurality of input planes corresponding to an input feature map of the layer, and the weight plane is one of a plurality of weight planes corresponding to a weight kernel of the layer, and wherein an output feature map of the layer is determined based on the output plane, and one or more output planes generated based on one or more other input planes excluding the input plane among the plurality of input planes, and one or more other weight planes excluding the weight plane among the plurality of weight planes.
Clause 6. A processor-implemented method comprising: receiving an input feature map including a plurality of input planes; receiving a weight kernel including a plurality of weight planes; performing a cumulative convolution operation between the input feature map and the weight kernel; and generating an output plane based on the cumulative convolution operation.
Clause 7. The method of clause 6, further comprising generating cumulative planes by performing multiply and accumulate (MAC) operations between the plurality of input planes and the plurality of weight planes.
Clause 8. The method of clauses 6 or 7, wherein the output plane is generated by accumulating outputs of the cumulative planes.
Furthermore the following clauses describe data processing methods according to one or more embodiments. | |
Empathy/Antipathy in U.S. Literature and Law
Rajini Srikanth
"Constructing the Enemy is a fascinating book—nuanced and engaging—that weaves together legal theory, the realities of legal practice, historical vignettes, and literary analysis. Srikanth artfully straddles disciplines and adds important new insights. Her refined, subtly developed topic is quite timely, and her ideas about empathy/antipathy are both challenging and accessible."Daniel Kanstroom, Boston College
In her engaging book, Constructing the Enemy, Rajini Srikanth probes the concept of empathy, attempting to understand its different types and how it is—or isn't—generated and maintained in specific circumstances.
Using literary texts to illuminate issues of power and discussions of law, Srikanth focuses on two case studies— the internment of Japanese citizens and Japanese Americans in World War II, after the bombing of Pearl Harbor, and the detainment of Muslim Americans and individuals from various nations in the U.S. prison at Guantanamo Bay.
Through primary documents and interviews that reveal why and how lawyers become involved in defending those who have been designated “enemies,” Srikanth explores the complex conditions under which engaged citizenship emerges. Constructing the Enemy probes the seductive promise of legal discourse and analyzes the emergence and manifestation of empathy in lawyers and other concerned citizens and the wider consequences of this empathy on the institutions that regulate our lives.
Excerpt
Reviews
"Srikanth dares to ask whether empathy could function as a national ethos. This is a startlingly different approach from the one we customarily see in commentary about the wars in Iraq and Afghanistan or about other conflicts in which the United States has involved itself. Her discussions of a wide range of issues are clearly structured, and her main argument is organized around the different kinds of empathy (strategic, compassionate, and ethical) that emerge in different contexts. Combining legal and literary texts, Srikanth not only distinguishes her treatment of empathy from that of other sources but also offers a fascinating cross-disciplinary contribution to the field of U.S. Cultural Studies. Srikanth’s exploration of the trope of empathy offers other pleasures, chief among which is her richly textured prose. But perhaps the most compelling feature of Constructing the Enemy is the author’s commitment to an ethical politics." Samir Dayal, Bentley University
"This engaging book argues that empathy can start individuals and nations on the road to justice.... This useful book demonstrates how the multidisciplinary approach championed in American studies can prepare citizens to move from displays of compassionate empathy to an ethical empathy of constructive engagement.... Highly recommended."Choice
"Constructing the Enemy presents a lucid argument against monolithic understandings of empathy.... Srikanth makes her case through a careful consideration of American literature and the legal work surrounding the histories of internment and detainment in the United States.... Constructing the Enemy represents a timely contribution to Asian American studies, human rights scholarship, and, in particular, critical legal studies."MELUS: Multi-Ethnic Literature of the U.S.
"Srikanth adopts the most biting critical project in 2012 in Constructing the Enemy to discuss cultural studies understandings of the legal and literary products arising from the conditions subsequent to 11 September 2001 in America.... [S]he creates a unified and continuously unfolding argument by centring her attention on empathy as a trope... [T]he critical argument here is both effective and in need of critical response and expansion, the book reads like an extremely effective seminar retracing empathy in American literary culture, which may very well inspire readers to pedagogical or curricular innovations."The Year's Work in English Studies
"Srikanth underscores, through a series of profoundly thoughtful chapters in Constructing the Enemy, that while US citizens like to think of themselves as pluralistic and welcoming, these attributes have been impaired by a sense that their vulnerability is radically unique."American Literature
Contents
Acknowledgements
Introduction: The Landscape of Empathy1. Literary Imagination and American Empathy
2. Deserving Empathy? Renouncing American Citizenship3. Hierarchies of Horror, Levels of Abuse: Empathy for the Internees4. Guantánamo: Where Lawyers Connect with the “Worst of the Worst”Conclusion: Prognosis: The Future of Empathy in the United StatesNotes
References
Index
| |
Today, we are witnessing events that have fundamentally changed the face of business: how its run, what products and services are in demand, and how to keep up with an ever-changing customer experience. The global crisis, and all that has come with it, has shaken businesses to their cores, leaving some to rethink their overall operations and interactions with stakeholders. Their strategies have shifted to an increased focus on digitization and automation.
On the bright side, there are companies that have shown resilience, and even thrived, during the global crisis. How are these businesses succeeding when others are scrambling to just keep the lights on? They have done so by adapting to the current situation faster, demonstrating greater agility, higher productivity, and a stronger connection to their customers. A recent McKinsey study highlighted that these companies are leading because they have been better than others at identifying weaknesses and opportunities. But most importantly, they have been able to reconfigure their existing business processes and quickly digitalize new ones – to adapt and capture new opportunities.
Rapidly adapting to new and ever-changing market demands
The most successful companies have one mission in common: they respond to changing market conditions with ease and agility, while consistently delivering exceptional experiences for all stakeholders. They are intelligent enterprises.
So, how can a company get on the path to becoming an intelligent enterprise? Many businesses already reap the benefits from using SAP´s core ERP and data solutions (SAP S/4HANA, SAP ECC, SAP HANA, etc.) and line of business (LoB) applications (SuccessFactors, Ariba, Concur, Qualtrics, etc.), to meet today’s and tomorrow’s demands. These customers have a rich landscape, equipped with both SAP and third-party systems, but they may not be able to capture the full potential that this setup can bring. Our customers want to get more value from their existing landscape, and they want to drive more revenue from an untapped ecosystem of partners.
This is where the ability to integrate and extend in the cloud, with SAP Business Technology Platform (SAP BTP), becomes pivotal.
The system landscapes in most enterprises today range from everything between on-premise to cloud, across multiple vendors, creating friction for users. Customers can refine and enhance their business operations along the entire value chain by connecting processes, data, and experiences across SAP and third-party solutions with our integration capabilities.
Innovation leads to success
One of our favorite customer success stories is from one of our global oil & gas industry customers, Murphy Oil. They were lacking visibility into their oil well operations from onshore. Their data was spread across 15 systems and coordinating allocation of field resources to solve production problems was a manual effort. This meant sometimes it took many tries to get people, equipment, and spare parts aligned, which greatly impacted production and revenue.
In a very short period of time, the customer implemented a digital remote operations center solution on SAP BTP, that unified information and integrated business processes that sat in different systems. Moreover, they enabled the information and processes to expand all the way to mobile devices. This remote operation center ensures that the customer has intelligent data management, smart allocation of resources, improved safety conditions of staff, and a seamless flow of processes.
Innovation isn’t just about the latest and greatest trends to come out of technology. Innovation is, foremost, about how it impacts the business. For instance, finding paper-based and manual processes that are ready to be digitized is one of the best forms of innovation a company can achieve.
This was the case for an agricultural company, Ruralco, who had several legacy POS systems across their network, and their staff was limited by system capacity and functions, such as inventory visibility and sales history intel. The customer deployed scanning technology using SAP Fiori on mobile devices, interacting in real-time, via SAP BTP, with the company’s core SAP ERP, MDG, and CX systems. This system is geared to provide the absolute highest-level of in-store or on-the-road customer experiences. A real win for innovation, right there.
Multiple use cases, one solution
The aforementioned stories are great examples of what SAP BTP can help our customers achieve. On that thought, what do our customers especially value in the platform that brings them real business impact? We consistently hear two overarching themes that give SAP BTP its edge over the competition: integration and extension.
“Integration” is a relatively understandable concept, just from the word alone. Connecting different line of LoB applications from both SAP and non-SAP to automate processes and workflows is quite comprehensible.
“Extension,” on the other hand, needs some explaining to form an association. Customers use the platform for a number of reasons, including:
- Consolidation of multiple Fiori applications
- Building out supplier and distributor portals to expand the reach of SAP data, apps, and processes beyond the enterprise
- Creating mobile applications for remote operations and offline access
- Switching from building in-app extensions in ABAP to building extensions on the platform
- Additionally, we hear from our customers that the more they develop application extensions, the faster and easier it becomes, given the ability to reuse shareable logic and leverage built-in accelerators
All of these use cases constitute the value of SAP BTP as not just an integration platform, but as an extension platform, as well.
To align with customer expectations and to simplify their experiences, we focus on two initiatives: The Integration Suite and the Extension Suite. Let’s delve a bit deeper into SAP BTP, its two Suites, and its platform foundation.
Integration Suite
The Integration Suite is THE integration platform for SAP-to-SAP integrations, SAP- to -non-SAP integrations, cloud-to-cloud, and cloud- to -on-premise. The Integration Suite not only provides the integration technology for message-based integration, API-based integration, or event-based integration, it also provides pre-built integration content, as well. This helps to speed up the integration project times for our customers.
To see this in action, let’s look at how one of our customers, a global cosmetics company, is benefiting from their integrations. This company interfaces with multiple third-party and banking systems using the Integration Suite. In addition, they work with a set of implementation partners, and each new point project takes only four to six weeks from ideation to production, highlighting the speed that they are achieving. The customer experienced a 70% quicker time-to-delivery for app development projects, with a 40% cost reduction.
Another great SAP integration story is from global mining company, where SAP is one of the key vendors that the business is working with in the area of innovation. In one particular case, the maintenance teams were creating multitudes of upkeep requests, going to the backend directly, causing tremendous latency in their performance. To address this, the company integrated their ERP data with SAP HANA Cloud, which significantly reduced their latency. This created a “Digital Integration Hub,” enabling the company to have a centralized, digital integration layer that facilitates seamless data access across the enterprises for both SAP and non-SAP systems.
Extension Suite
- Simplifying application user experience: Endress+Hauser, an industrial process engineering solutions company, needed to integrate and combine data that was held in disparate systems and departments to enable greater visibility and access to all insights. They partnered with SAP to implement a business data and integration hub that leverages their data assets and drives innovation for their customers through AI. The company is now benefitting from a five-times faster project speed and lower costs compared to previous projects.
- Delivering agile process automation: An international online food ordering company, Delivery Hero, wanted to automate their capital approval process to enable the effective and quick deployment of capital to support their many development projects. SAP delivered an automated capital-approval workflow that shrunk the process from 20 days to two days. The automated process supports the funding approval for 1K+ employees working on development and marketing projects across the global company.
- Providing digital workplaces for the intelligent enterprise: A German cable company, Norddeutsche Seekabelwerke (NSW), launched a major project to institute design thinking across functional boundaries, to produce innovative new applications. Within two weeks, the teams hashed out requirements to build an operations dashboard application that supports managers to take action. Finance leaders and top executives have ready access to a graphical overview that shows them where the whole business stands economically. It lets them drill down into planned and actual costs and revenues in an intuitive user interface adaptable to their roles.
- Enabling new differentiating business solutions: As part of an Australian organization’s evolution to a mature protection and education hub, Taronga Conservation Society partnered with SAP to implement a cloud-based platform for delivering new ways of supporting its core processes, including finance, procurement, payroll, and human resources. They developed a mobile application to unify and simplify the employee experience, improving employee engagement on incidents and notifications. Employees are now getting visibility into incidents and notifications, which was not the case before this project.
Multicloud Readiness
While the Integration and Extension Suites focus on solving dedicated business needs, the underlying foundation of SAP BTP offers a secure, multicloud, future-proof underpinning that embraces all major hyperscaler infrastructures (AWS, Azure, Google Cloud, etc.) and cloud-based, native technologies.
Speaking of hyperscalers, I’m often asked the question: How does SAP BTP differ from the hyperscalers? This question is best answered by getting into the mind frame of a developer. Developers need a platform that provides acceleration.
SAP provides an open business platform, optimized for the SAP landscape, across the major hyperscalers, as a managed service with built-in accelerators. These accelerators address developer productivity, connections to SAP and non-SAP systems, and pre-built content that understands the context of SAP applications. Compare this to building from the ground up on a hyperscaler – devoid of acceleration! You can achieve faster time to value with SAP BTP, without the worry of looking to a specific hyperscaler to get the job done.
SAP BTP helps to run the intelligent enterprise
The overarching value of SAP BTP is that it’s the best platform to run SAP; it’s the only platform to truly extend and integrate our solutions with no disruption to the core, and to build capabilities that are tightly coupled with an SAP-run process. In other words, SAP BTP is the best platform to run anything SAP or anything tightly coupled to SAP workloads.
SAP BTP is essential for the SAP customer because we’ve built in everything you need to accelerate development and achieve faster time to value. It contains all the business content, processes, workflows, integrations, automation, innovation: all the end-to-end tools needed to achieve significant impact for the business and to stay future-proof. SAP has the next generation business solutions for the intelligent enterprise, and the underlying platform to optimize how it all runs together.
Learn more about SAP BTP in the Discovery Center. | https://blogs.sap.com/2020/09/30/the-way-forward-integrating-and-extending-your-sap-landscape-in-the-cloud/ |
The utility model provides equipment for degrading organic wastewater by ozonization. The device comprises an oxygen tank, an ozone generator, a rotor flow meter, a reaction device, an ozone absorption device and an ozone concentration detector, the input end of the ozone generator is connected with the oxygen tank through a pipeline; wherein the output end of the ozone generator is connected withthe rotor flow meter through a pipeline, the rotor flow meter is connected with the reaction device through a pipeline, the reaction device is connected with the ozone absorption device through a pipeline, and the ozone absorption device is connected with the ozone concentration detector through a pipeline; the turbulence degree and the flow speed of inlet water of the reaction device are increased through a reflux process; according to the present utility model, the fluidization degree of the ozone catalyst in the reaction apparatus is increased, the mass transfer efficiency and the catalytic efficiency of the catalyst and the ozone are improved, and the metal oxide catalyst is used so as to make the ozone generate a large amount of hydroxyl radicals during the oxidation process, and thehydroxyl radicals have characteristics of strong oxidation ability, no selectivity, and good wastewater treatment effect. | |
This project will produce an integral mobility solution concept and implement it as prototype. It will link together electric as well as non-electric systems intermodally, both of private and public operators.
The change to electric mobility will achieve success when it accommodates the changes in mobility behaviour currently being experienced, and provides suitable solutions. It is becoming less and less important to have one’s own car and flexible mobility services such as public transport and car-sharing are becoming more popular.
The focus of the I-eMM project is to study a holistic mobility services concept, in which electric and non-electric solutions offered by electric vehicle fleet operators and public transport providers are linked together. To do this, possibilities for comprehensive solutions involving electric vehicle fleets and public transport service providers are being studied, using transportation data from the Rhine-Neckar region. This is producing concepts for mobility solutions that envisage business processes spanning multiple operators. Further concepts are being developed for a comprehensive operations management system for the fleets of the car-sharing operators and the public transport providers, with a joint coordination centre. Here the public transport operations control system and the systems for data connections with the electric vehicles are being merged and combined with concepts for information services of users and for a common posting and payment system.
The methods and concepts developed represent the basic planning criteria for innovative mobility concepts. With these, new and improved mobility solutions can be created, especially in the area of public transport, with additional benefits for the customers. | https://www.fzi.de/en/research/projekt-details/i-emm/ |
CASE STUDY: Gasoline Remediation by the Red Sea, Saudi ArabiaRecovering LNAPL despite extreme climatic conditions by the Red Sea.
Background
At an active bulk fuel facility on the west coast of Saudi Arabia, historical spills and leaks had resulted in up to 1.8 metres of gasoline floating on the water table. The site and geographic location required a flexible, low-infrastructure solution that could withstand the extreme climactic conditions without interfering with the facility’s operations.
Location: West Coast of Saudi Arabia
Client: Saudi Arabian Environmental Consulting Firm, on behalf of a major Oil & Gas Company.
Duration: 4 years
Project Value: $550,000 CDN
Geology: Unconfined aquifer, Silty sand.
Approach
The oil & gas company hired a local environmental consulting firm to characterize the site. On behalf of their client, the firm tendered an initial pilot project to five companies for bid. IRSL earned the pilot project based on their price and innovative approach.
Vacuum-Enhanced Pneumatic Skimming
To meet the challenges associated with this site, IRSL recommended extracting the LNAPL (Light Non-Aqueous Phase Liquid) through vacuum-enhanced extraction wells instrumented with pneumatic skimmers. A full-time engineer remained on-site for the project’s 4-year duration to continuously adjust and optimize the system.
Applied Technologies
Free product removal was completed through vacuum extraction wells instrumented with pneumatic skimmers equipped with hydrophobic filters. The filters allowed only the LNAPL to pass, leaving the water behind, while the vacuums increased the radius of the skimmers.
This system was flexible enough to fulfill a number of important criteria:
- Little infrastructure, and minimal power, leaving a very small ecological footprint.
- Minimal equipment to be transported to the site also meant minimal maintenance on-site.
- The vacuum system and skimmers could be easily moved and optimized.
- The efficiency of the skimmers negated the need for a treatment system.
Challenges
A number of conditions made this project exceptionally challenging:
- Located on the edge of the Red Sea, the site was tidally influenced, with water tables rising and falling up to 0.5 metres throughout the day.
- The project required continuous, proactive optimization with regard to cycle length and numbers, as well as skimmer position.
- The remote location necessitated minimal and low-maintenance equipment as the equipment, and its replacement parts, had to be transported from North America.
- The extreme climatic conditions required equipment designed to withstand very high temperatures, humidity, corrosion, and dust.
- The active bulk fuel facility’s rigorous health and safety regulations required all equipment to be explosion-proof and highly secured.
Results
- Over 30,000 litres of gasoline were removed over the course of the project.
- The extracted liquid was greater than 99.998% gasoline, minimizing the need to treat extraneous water and translating into real cost savings for the client.
- The purity of the gasoline enabled the company to stream it into their production, effectively paying for the project.
- The pilot project was deemed a complete success, initiating plans for several full-scale projects. | https://irsl.ca/project/gasoline-remediation-red-sea-saudi-arabia/ |
2018 Ipsos-RIAD Survey on Legal Disputes and Risk Awareness of Europeans
Conducted by Ipsos at the request of the International Association of Legal Protection Insurance (RIAD) on a sample of 8,000 Europeans (Belgium, Czech Republic, France, Germany, Hungary, Ireland, the Netherlands, and Switzerland) the aim of this survey is to provide information regarding how consumers perceive legal risks and how they want to solve their legal disputes. In this context the survey also asks who consumers want to turn to and which qualities they find important when seeking legal advice. A particular point of interest is the question whether millennials stand out from the general population in regard to their particular fears or preferences. The 2017/2018 survey was carried out online, using selected random samples of 1,000 individuals per country that are representative of the general population aged 18 and over (using the quota method: age, gender, region).
More than 25% of Europeans have been involved in a legal dispute within the past 5 years.
On average, every third to fourth person has had a legal dispute within the past 5 years. An exception is Switzerland where people appear to be more litigious with almost 50% of the population, i.e. every second person, having recently experienced a legal clash. When asked about the areas of life in which disputes occur, we see that most disputes are about the workplace (between 7% and 19% of cases, average: 10.25%), followed by housing (4% to 16% of cases, average: 8.5%), family matters (4% to 16% of cases, average: 8.38%) and cars (6% to 11% of cases, average: 8.13%). In the Czech Republic the number of disputes in family matters is exceptionally high (16%) compared to other countries while for issues with regard to housing the frequency of disputes is very low in the Netherlands (4%).
Most Europeans do not think that they are exposed to the risk of legal disputes while a larger share of Germans, Swiss and Czech people feel at risk.
Generally, Europeans consider the biggest risks for legal disputes in the areas of finance, banking, insurance and telephony.
Regarding their personal situation, however, people evaluate the level of being involved in a legal dispute as generally low. Exceptions are Germany, Switzerland, and the Czech Republic where people feel more exposed to legal risks across all areas of life. Their biggest concerns are cars (39% of Czechs, 47% of Swiss, 52% of Germans; 9% to 25% in the other countries) and mobility issues (28% of Czechs, 39% of Swiss, 40% of Germans; 11% to 18% in the other countries).
Overall, the judgment of millennials regarding the level of risk of a legal dispute in the different areas of life concurs with the general population. Exceptions are for housing where millennials see a higher risk for legal disputes than the rest of the population.
While the general population estimates that the risk of a legal dispute developing in the area of housing is rather low with 6% (the Netherlands) to 36% (Switzerland), across all countries, housing is the only area where millennials see a considerably higher risk (levels between 11% (the Netherlands) and 49% (Switzerland)). France is an exception: the general population and millennials estimate the level of risk similarly low (15% of millennials and 14% of the general population estimate that there is a risk).
For housing, the risk level of a legal dispute is estimated particularly high in Switzerland (36%), Germany (33%) and the Czech Republic (25%); millennials in these countries estimate the level of risks even higher: Switzerland (49%), Germany (43%) and the Czech Republic (32%).
When it comes to legal disputes, in all countries people most fear the costs and the Dutch and French are particularly concerned about the waste of time and energy. At the same time, particularly in France and Belgium, people feel that they are not sufficiently informed regarding legal matters.
Access to justice is essential because legal disputes often concern vital aspects of people’s lives such as being able to keep one’s apartment, continuing to earn one’s living or receiving compensation for an injury to cover medical treatment. Consequently, many Europeans fear the costs incurred by a legal dispute; this anxiety is particularly high in the Czech Republic (53%) and Ireland (50%). Dutch people are more afraid of wasting their time and energy (33%) than fearing the costs (30%) and for French people the fear of costs (29%) and of wasting time and energy (28%) are almost the same.
Germans (27%) are the only nationals who are extremely scared that they are deprived of their rights; for Germans this is a bigger threat than the time and energy they have to invest in a dispute (19%); only topped by concerns regarding the costs (38%). Being deprived of rights is significantly less important for other nationals: 18% in Ireland, 17% in Switzerland, 15% in Hungary and 10% or less in the other countries.
While Europeans have obvious fears when exposed to legal disputes, they also feel that they lack information. Across all countries, people feel the least informed about the costs of disputes, second comes the steps to take in order to defend themselves. In third place, people think that they are not informed about their rights and, fourth, they do not know who to turn to in case of a legal dispute.
The feeling of not being sufficiently informed is especially high in France and Belgium. Only 14% of the French people and 18% of the Belgians think that they have enough information about the costs necessary to settle legal disputes. This varies between 24% and 30% in the other countries. Only 23% French and 30% Belgians feel that they are sufficiently informed about the measures to be taken to defend themselves while 45% of the Dutch and 44% of the Hungarian people feel sufficiently informed about this (41% in German, 34% in Ireland, 27% in the Czech Republic, 40% in Switzerland). 26% of French and 33% of Belgian people know their rights (between 38% and 50% of the population in the other countries). 27% of the French and 36% of the Belgians know who to address if they have legal issues (in Germany and the Netherlands 57%, 53% in Switzerland, 49% in Hungary, 46% in Ireland and 42% in the Czech Republic know who to turn to).
Competence, quality of services and comprehensibility of information are the skills Europeans look for when they seek legal advice and they turn to lawyers and legal protection insurers to find them. The majority of the French, however, prefer to look for legal solutions on the internet.
In most countries citizens turn primarily to lawyers when they need help in a legal dispute. Numbers are particularly high in Germany (83%), the Czech Republic (82%) and Ireland (72%).
The situation is different in the Netherlands, Switzerland and France. In the Netherlands 59% turn to legal protection insurers and only 43% name lawyers as their reference in a legal dispute. In Switzerland legal protection insurers and lawyers are on the same level with 55% of the people quoting them as the most important resource for legal advice. However, 35% of Swiss people contact legal protection insurers first and only 25% contact lawyers first.
The French appear to be innovative and daring considering that more people look for advice on the internet (44%) than contacting a lawyer (38%). Also, France is the only country where a significant proportion of people (33%) seek counsel from consumer associations (the proportion is considerably lower in all other countries: between 5% in Germany and 23% in Ireland) and where legal protection insurers are equally consulted. However, the share of people considering legal protection insurers as their first source of information is with 17% higher than the 12% share turning first to consumer associations.
Evaluation of resources: lawyers and legal protection insurers perform well on the competence dimension but across Europe performances are assessed very differently: Germans, Swiss, Belgians and Dutch esteem legal protection insurers rather high whilst Czech, French, Hungarian and Irish people tend to rank their services on the lower end of the scale.
In Germany and Switzerland legal protection insurers score best with second positions after lawyers on all dimensions, in the value-for-money category legal protection insurers score first before lawyers who are ranked second.
Belgians conclude that the performance of lawyers is best in all categories except when it comes to delivering value for money where lawyers rank the lowest and legal protection insurers second after consumer associations. In the Netherlands, where legal protection insurers are the most important resource for legal assistance, lawyers clearly lead the field when it comes to competence in legal disputes and quality of services (legal protection insurers rank second on both dimensions). Legal protection insurers score, however, better regarding the understandability of information and their availability. They clearly outrank lawyers in the Netherlands when it comes to offering value for money: insurers rank first and lawyers last.
In the Czech Republic, France, Hungary and Ireland legal protection insurers rank lower than lawyers on all dimensions. The only exception is in France where legal protection insurers (third) outrank lawyers (last) on the value for money dimension (consumer associations take first rank). The way French people evaluate the performance of consumer associations (ranking first or second on all dimensions) reflects the fact that France is the only country where consumer associations play a significant role as resource for legal counsel.
Type of services: in most countries people prefer providing for legal risks by paying for a legal protection insurance instead of paying ad hoc for legal advice when a legal dispute arises.
People in the Czech Republic, Hungary and Ireland prefer to pay for legal advice once a legal dispute arises while in the other countries a majority of consumers consider legal protection insurance as a viable solution to cover legal risks: In Belgium, the Netherlands and Switzerland, every second person feels that way, in Germany 47% and in France 44% of the people rather pay for legal protection insurance than ad hoc for legal services.
In terms of importance attributed to the different services offered by legal protection insurance, it is difficult to establish a clear trend across Europe. It is obvious, however, that people in Hungary and Ireland attach more importance to the accessibility and the quality of information than other nationals. 61% of Hungarians and 65% of Irish people prioritise accessibility of information in contrast to only 40% of other nationals, and 70% of Hungarians and 71% of Irish people attach importance to the quality of information offered by legal protection insurance, as opposed to only 41% of other nationals.
While the recommendation of competent lawyers is somewhat important in most countries (not in the Netherlands) it is remarkable that receiving financial restitutions of legal expenses is only a top priority in Germany and Belgium.
Face to face vs social networks? All generations, including millennials, want to speak either on the phone or face-to-face with a person when they have a legal problem.
The overwhelming majority of Europeans prefer to interact with a real person on the phone or face-to-face when they have to deal with health, legal, financial, connectivity and energy issues. However, half or more of the population prefer to connect with energy providers online (Germany 58%, the Netherlands 62%, Ireland 65%, Switzerland 56%, Hungary 56%, Belgium 50%) and in Belgium the majority also prefers to communicate online with telephone companies.
Though millennials are slightly less inclined than the overall population to connect face-to-face or via the telephone with providers in the health, legal, insurance and bank sector, on the whole they share the preferences of the general population and overall prefer face-to-face or telephone interactions. However, in all countries, millennials would rather communicate with telephone companies and energy providers online.
The same applies to relationships with legal protection insurers: all generations prefer to talk directly to a person on the telephone or face to face rather than to interact online. Using email is in all countries the third choice for communications with legal protection insurers.
Please find more details concerning the results of the survey here. | http://riad-online.eu/de/kernthemen/consumer-survey/ |
How can we tell what style of faulting was responsible for a particular earthquake? Especially in cases where there is limited instrumentation in a region, or where geologists have difficulty accessing the affected areas? What if the fault responsible does not break the surface? In this unit, we will show how modern space geodesy allows us to measure movements of Earth's surface over wide areas without the need to visit the region in question, and we will demonstrate the various Earth processes that we are able to measure and monitor in this way. Specifically, we will show how a technique known as Interferometric Synthetic Aperture Radar (InSAR) has revolutionized our ability to study earthquakes on the continents, by allowing us to measure where, over what spatial extent, how far, and in what direction, earthquakes have caused the ground to move.
Learning Goals
Unit 3 Learning Outcomes
×
- Students will relate the displacement of Earth's surface and the line-of-sight displacement measured by InSAR.
- Students will infer the locations, amplitudes and mechanisms of Earth processes by interpreting real interferogram data.
- Students will relate short-term deformation processes (as recorded by InSAR) with long-term deformation processes (as recorded in the landscape), and hypothesize potential reasons behind any differences.
Unit 3 Teaching Objectives
- Cognitive: Promote student ability to explore and visualize the relationship between the displacement of Earth's surface and the line-of-sight displacement measured by InSAR.
- Behavioral: Facilitate students in interpreting InSAR data (radar interferograms) in terms of magnitude of displacement and/or displacement rate, spatial pattern, and spatial extent, and making inferences about the underlying Earth processes.
Context for Use
Description and Teaching Materials
This unit contains instructional, discussion and practical elements.
Part 1:
For students who are unfamiliar with InSAR data and the underlying principles, a short PowerPoint presentation is provided. It could be incorporated into a longer lecture on faulting styles, presented as a standalone mini-lecture at the start of a lab class, or provided to students to study out of class.Presentation on the background theory of InSAR (PowerPoint 2007 (.pptx) 11.7MB May4 18)
This is a ~25-slide presentation that could be incorporated into a lecture setting, presented at the start of a lab, or provided to students for independent review, designed to provide an accessible introduction to SAR and InSAR. The presentation includes supplemental information in the form of additional comments included as slide notes, in order to assist instructors with their presentation of the material. It is also provided in the form of a handout, where the slides are accompanied by the notes.
'How does InSAR work?' handout with slides and notes (Acrobat (PDF) 22.9MB May4 18)
Part 2:
In order to deepen students' understanding and/or encourage reflection upon the material, a set of questions is provided. These could be used in a classroom setting, for example in think-pair-share exercises, or in group discussions, or alternatively could be given as a homework exercise to students and subsequently discussed in class time. In either case, these questions are intended as a means of low-stakes formative assessment, rather than a rigorous evaluation of student understanding. These questions are the primary assessment for this unit.
Questions for discussion or formative assessment (Microsoft Word 2007 (.docx) 291kB Nov28 15)
Part 3:Students will gain hands-on experience with interpretation of InSAR data of a real earthquake (the M6.4 1995 Dinar, Turkey event). This can be conducted purely as a paper exercise, or, if computer access is possible, the imagery can also be manipulated and viewed within Google Earth.
- First, students are asked to identify the expected style of faulting from the topography (building on insights gained in Unit 2).
- Students are then asked to estimate the maximum surface deformation that occurred on either side of the fault, and use this information to estimate the uplift, subsidence, throw and slip that occurred in the earthquake.
- Next, students are asked to construct a displacement profile across the interferogram (in essence, an exercise in interferometric phase unwrapping).
- Finally, a comparison is made between the earthquake deformation profile and the topography along the same profile. Students are asked to relate the short-term deformation due to the earthquake to the long-term deformation recorded in the landscape, estimating the number of earthquakes necessary to form that topography and to suggests reasons for any differences in the shapes of the two profiles.
Files:
Lab exercise handouts, including instructions and questions for the lab exercise.
Unit 3 student exercise (Microsoft Word 2007 (.docx) 361kB Nov29 15)
Unit 3 Student exercise additional handouts (Zip Archive 1.3MB Nov29 15)
Google Earth KMZ files of Dinar interferograms (to be optionally used in the lab exercise).
Dinar Google Earth KMZ files (Zip Archive 562kB Apr6 15)
Interferogram files of additional earthquakes (Christchurch, New Zealand; Xizang, China; Kilauea, Hawaii; Myanmar; Simeulue, Indonesia; Iran; Wells, Nevada) if a broader range of examples is useful (to be optionally used in the lab exercise).
InSAR KMZ files of additional earthquakes (Zip Archive 22.2MB Apr6 15)
InSAR poster files of additional earthquakes (Zip Archive 19.8MB Apr6 15)
InSAR metadata file (Excel 2007 (.xlsx) 36kB Apr6 15)
Teaching Notes and Tips
If the students end up using Google Earth, some good general Google Earth tutorials for both the instructor and the student can be found on the SERC site.
Some tips specifically for this exercise (as detailed in the student assignment):
You can adjust the transparency of the image overlay—if you want to see some of the detail of the underlying imagery—by editing the overlay using Get Info or Properties (depending whether you are using the PC or Mac version). [About 30% transparency tends to be a good compromise.] Look in particular for the locations of mountains and lakes around the epicentral area, which are diagnostic of the tectonic setting and style of faulting.
Using the Path tool, it is possible to draw a cross-section along a chosen line:
- First you must make a path. The Path tool is located in the toolbar, to the left of the Image Overlay tool. You can click on the appropriate button or select Add Path from the Add menu. You can make a straight line with two mouse clicks, one at each end of the line. While the Add Path (or Edit Path) pop-up window is open, the line vertices can be edited by clicking on them.
- Add a name for the path if you feel like it. Click OK in the Add Path window.
- Right click on the newly-created path in the Temporary Places list. Select "Show Elevation Profile" from the pop-up menu.
Assessment
Formative Assessment
Questions that could be used as part of a class discussion (e.g. as part of a think-pair-share exercise) or a homework exercise, to provide a formative assessment of, and/or encourage reflection upon, the material covered in the presentation. These are further described in Part 2 above.
Questions for discussion or formative assessment (Microsoft Word 2007 (.docx) 291kB Nov28 15)
Model answers to the discussion questions.
References and Resources
- Eyidoǧan, H. and A. Barka, The 1 October 1995 Dinar earthquake, SW Turkey, Terra Motae, 8, 5, 479–485.
- T.J. Wright, B.E. Parsons, J.A. Jackson, M. Haynes, E.J. Fielding, P.C. England, and P.J. Clarke, 1999, Source parameters of the 1 October 1995 Dinar (Turkey) earthquake from SAR interferometry and seismic bodywave modelling. Earth and Planetary Science Letters, 172, 1-2, 23–37. | https://serc.carleton.edu/getsi/teaching_materials/imaging_active_tectonics/unit3.html |
RAW is a comprehensive platform that accelerates data engineering projects by allowing developers to easily access, integrate, and deliver data services as APIs. The platform includes development tools, testing, CI/CD, hosting and managed operations.
We have compiled a list of sample use cases to better understand how to use RAW in practice. Each of these targets a different application of the platform and together cover the various parts of a data pipeline from acquisition, transformation up to data sharing:
- Real-time data integration without ETL/ELT pipelines. Learn how to use RAW to build APIs that join and serve data in real-time. We compare with a common-place solution: building a data lake/warehouse then using tools such as DBT or Denodo/MuleSoft. We demonstrate how many such scenarios can instead be accomplished far more quickly and simply in RAW and with access to real-time data instead of waiting for data ingestion or paying for data duplication.
- Augment your data integration pipeline with real-time data. Learn how to use RAW to augment your existing ETL/ELT infrastructure with real-time data from other data sources. We focus in RAW's capabilities to access and transform complex data and compare with common-place solutions such as FiveTran, DBT or custom Python or Scala code. We demonstrate how these scenarios can be implemented easily in RAW and enable real-time data in your data engineering pipeline.
- Share data in real-time. Learn how to use RAW to expose data as APIs to other internal or external users and applications. In particular we focus on how to create and share multiple "virtual real-time views" in RAW, without having to create, extend or modify existing data pipelines.
Choose one of the above to get started!
If you have questions/comments, reach out to us directly or leave a message in our discussion forum. | https://docs.raw-labs.com/docs/use-cases/overview/ |
Botanical Name: Sesamum indicum nigrum L.
Common Name: Black sesame seed.
Source of Earliest Record: Shennong Bencao Jing
Part Used & Method for Pharmaceutical Preparations: The ripe sesame seeds are gathered in autumn, then they are dried in the sun.
Properties & Taste: Sweet and neutral.
Meridians: Liver and kidney
Functions: 1. To tonify the essence and blood; 2. To moisten the intestines and move feces
Indications & Combinations:
1. Deficient essence and blood manifested as dizziness, blurred vision and early graying of the hair. Black sesame seed (Heizhima) is used with Mulberry leaf (Sangye) in the formula Sang Ma Wan.
2. Constipation due to dryness in the intestines. Black sesame seed (Heizhima) is used with Chinese angelica root (Danggui), Cistanche (Roucongrong) and Arborvitae seed (Baiziren).
Dosage: 10-30 g (The herb is most effective when fried.)
Cautions & Contraindications: This herb should not be used in cases with diarrhea. | http://www.epharmacognosy.com/2012/04/black-sesame-seed-heizhima-sesamum.html |
Desheng School International (DSI) provides a blend of holistic education that allows each student to explore and develop not only in the core academic work but also, through a range of Co-Curricular Activities (CCAs) that cater to the students’ varied interests and capabilities, in their experiential learning.
Through CCAs, students discover their interests and talents while developing values and competencies like perseverance and mental endurance that will prepare them for a rapidly changing world. CCAs also promote friendships among students from diverse backgrounds as they learn, play and grow together. More importantly, CCAs are set up to be fun and enjoyable in the students growing process.
CCA Groupings
There are three major CCA Groups offered in DSI:
Group A: Life-Skills, Sports and Games
Aim: Healthy Leaders who are well disciplined team players equipped with life-skills pursuing an active lifestyle
Group A CCAs available in 2018-19:
1. Badminton
2. Basketball
3. Football
4. Rugby
5. Shuttle
6. Track and Field
Group B: Clubs and Societies
Aim: Develop intellectual and social capacities
Group B CCAs available in 2018-19:
1. Creative Arts Club
2. Hobbies Club
3. Library Club
4. Mathematics Olympiad Society
5. Model United Nations (MUN) Club
6. Science Technology Engineering Mathematics (STEM) Club
Group C: Performing Arts
Aim: Platform to blossom artistic and creative expressions
Group C CCAs available in 2018-19:
1. Modern Dance
2. String Orchestra
3. Vocal Ensemble
CCA Requirements
Expectations
In line with the School’s Mission and Vision to provide our students a platform for well-rounded development and to instill the value of perseverance, all students are expected to join and remain in one CCA while they are in DSI.
Attendance
Students are expected to be committed to their CCAs and attend all sessions. It is the responsibility of the students to inform and request to be excused from their Teachers-in-charge if they are unable to attend any sessions with valid reasons (e.g. sick, parental written request, clashes with other major events at the discretion of the Teachers-in-charge… etc.). Please note that remedial lessons cannot be used as an excuse to skip CCA sessions.
CCA Scoring Rubrics
To ensure accountability and encourage students to participate actively in their CCAs, every student will be graded and score reflected in their semester report based on the following CCA Scoring Rubrics:
Developing
Consolidating
Expanding
Attendance
(Note: Does not include absence with valid reasons)
Attendance less than 75%
Attendance over 75%
Attendance over 90%
Effort
Student puts in some effort during CCA
Student puts in considerable effort during CCA
Student puts in maximum effort during CCA.
Leadership
Some evidence of leadership. Student is compliant to instructions but hesitant to take up leadership roles.
Good leadership potential.
Student is responsible in carrying out instructions and willing to take up leadership roles.
Excellent leadership qualities. Full of initiatives and willing to lead by example.
Selection and Transfer of CCA
Selection
New students are given the opportunity to choose and try out CCA of their choice and submit their CCA confirmation request by Term 1 Week 5. Students are strongly encouraged to be committed and stay on in their chosen CCA to enjoy the full benefits of continuity and leadership opportunities.
Transfer
Students who wish to transfer CCA are permitted on a case-by-case basis with valid reasons (such as medical or parental objections) after approval at the following levels using the CCA Transfer Request Form: | http://xixiao.qijian360.com/Life/showimg.php?id=15 |
VANCOUVER, BRITISH COLUMBIA--(CCNMatthews - May 16, 2006) - EuroZinc Mining Corporation (TSX:EZM)(AMEX:EZM) is pleased to announce that the government of Portugal has granted the Company four new exploration concessions in the Iberian Pyrite Belt (IPB)---Castro Verde, Albernoa, Mertola and Alcoutim---giving the Company the largest exploration land package ever assembled by a single company in the IPB of Portugal. The IPB is one of the most prospective belts in the world for base metal deposits and is host to more than 85 deposits that total in excess of 1.7 billion tonnes of massive sulphide.
The four new concessions, along with the Malhadinha concession granted on the 24th of October, 2005, cover an area of 2,683 square kilometres, and represent most of the IPB from the Spanish border in the southeast to the Lousal mine in the northwest, a distance of over 100 kilometres. The 2006 surface exploration program on these concessions and the mining concessions they surround is budgeted at US$10 million, and is part of the Company's overall strategy of developing internal opportunities by completing systematic exploration adjacent to its flagship operations.
The concession agreements provide EuroZinc with the exclusive right to undertake exploration on the Albernoa, Mertola and Alcoutim concessions for a period of three years. Following the initial three years, EuroZinc has the option to extend the agreement for two-one year periods with a 50% reduction in the area after each year extension, or the Company can apply to have the exploration concession converted to an exploitation concession. In the case of the Castro Verde concession, which surrounds the Neves-Corvo mining lease, EuroZinc has the exclusive right to undertake exploration on the concession for a period of five years. Following the initial five years, EuroZinc has the option to extend the agreement for three-one year periods with a 50% reduction in the area after each year extension, or the Company can apply to have the exploration concession converted to an exploitation concession. Minimum annual work expenditures on these four concessions total EUR 600,000 with annual cash payments totaling EUR 70,000.
The four concessions cover the favorable stratigraphy that hosts, and is on strike to, the Neves-Corvo, Aljustrel, Lousal, Juliana and Sao Domingo mines. Three-dimensional inversion software will be used to re-process historic gravity and magnetic data to highlight areas that may be related to mineralization. Re-processing of gravity and magnetic data, as well as compilation of all historic geology, geophysics and drilling will commence in the next few weeks when the large database is received from the government. The Company will prioritize targets identified from this work for additional geophysics and/or diamond drilling to be completed in the third and fourth quarters of this year. The company believes that new deposits can be identified at much greater depths using this new technology.
EuroZinc Mining Corporation is a Canadian based company engaged in the acquisition, exploration, development and mining of base metal deposits internationally. The Company owns the Neves-Corvo mine in Portugal, which is currently the largest and highest grade underground copper mine in Europe, and will soon become a zinc mine as well. The Company also owns and is preparing to reopen the Aljustrel mine in Portugal, which will be one of the largest zinc mines in Europe and will also produce lead, silver and copper.
Certain of the statements made and information contained herein is "forward- looking information" within the meaning of the Ontario Securities Act or "forward-looking statements" within the meaning of Section 21E of the Securities Exchange Act of 1934 of the United States. Forward-looking statements are subject to a variety of risks and uncertainties which could cause actual events or results to differ from those reflected in the forward-looking statements, including, without limitation, risks and uncertainties relating to foreign currency fluctuations; risks inherent in mining including environmental hazards, industrial accidents, unusual or unexpected geological formations, ground control problems and flooding; risks associated with the estimation of mineral resources and reserves and the geology, grade and continuity of mineral deposits; the possibility that future exploration, development or mining results will not be consistent with the Company's expectations; the potential for and effects of labour disputes or other unanticipated difficulties with or shortages of labour or interruptions in production; actual ore mined varying from estimates of grade, tonnage, dilution and metallurgical and other characteristics; the inherent uncertainty of production and cost estimates and the potential for unexpected costs and expenses, commodity price fluctuations; uncertain political and economic environments; changes in laws or policies, foreign taxation, delays or the inability to obtain necessary governmental permits; and other risks and uncertainties, including those described under Risk Factors Relating to the Company's Business in the Company's Annual Information Form and in each management discussion and analysis. Forward-looking information is in addition based on various assumptions including, without limitation, the expectations and beliefs of management, the assumed long term price of copper and zinc; that the Company can access financing, appropriate equipment and sufficient labour and that the political environment within Portugal will continue to support the development and operation of mining projects. Should one or more of these risks and uncertainties materialize, or should underlying assumptions prove incorrect, actual results may vary materially from those described in forward-looking statements. Accordingly, readers are advised not to place undue reliance on forward-looking statements.
The TSX and AMEX have not reviewed and do not accept responsibility for the adequacy or the accuracy of this release. | http://www.marketwired.com/press-release/EuroZinc-Assembles-Largest-Exploration-Land-Package-History-Iberian-Pyrite-Belt-Portugal-594959.htm |
When it comes to ex-offender employment, it is important to work in partnership with all of the key stakeholders involved in the process. Not only do the ex-offenders need support, but also the people who work with them and the potential employers who hire them. They also need guidance to help make the recruitment process successful. This is something that Nacro knows only too well.
Nacro is a social justice charity that uses diverse and innovative approaches to strengthen communities and improve the lives of some of the most vulnerable people throughout England and Wales. It runs two major services: one for ex-offenders and one for employers looking to recruit from this talent pool.
The Resettlement Advice Service is a free, national helpline for people with criminal records and the practitioners who work with them, e.g. probation officers and employment advisors. Via this helpline, as well as through the online resources Nacro have put together, they can resolve the various issues they may be facing in areas such as housing, managing money, employment and education (e.g., how to disclose a criminal record to a potential employer).
The second service is the Employer Advice Service. This seeks to promote best practice among employers, education providers and other organisations by giving them practical guidance, operational support and the relevant training they may need to make informed decisions concerning ex-offenders. Just as ex-offenders and practitioners can access free support through the Resettlement Advice Service, so too can employers receive support from legal officers through a similar helpline. Nacro has also produced a guide, Recruiting safely and fairly, in partnership with the Chartered Institute of Personnel and Development (CIPD) and the Disclosure and Barring Service (DBS) aimed at helping employers develop and implement effective ex-offender recruitment and retention policies.
In October 2015 Nacro launched the Aeneid Project. It is a ground-breaking initiative that seeks to improve the education, training and employment opportunities of individuals with criminal records, as well as up-skill practitioners and provide local employers and educational establishments with the resources, support and training needed to be able to confidently access this potential talent pool of more than 10 million people. The overall aims of the project are to positively change individuals' lives, address employers' chronic skills shortages, and strengthen communities.
The Aeneid Project works in partnership with each of the key stakeholders involved in ex-offender employment. For employers, Nacro runs one-day workshops on how to recruit safely and fairly. These sessions are attended by HR and CSR professionals with responsibility for: recruitment and retention, equality and diversity matters, and safeguarding. The objective is to provide them with the skills and confidence to make informed decisions about applicants or existing staff or volunteers with criminal records. Nacro also runs free, one-day training workshops in safer admissions for universities and colleges; and also criminal record disclosure for practitioners.
They also run tailored training programmes for ex-offenders, supporting them to move towards economic self-sufficiency. These programmes begin by supporting participants to become psychologically more resilient, before providing them with valuable skills, specific training and work experience/trials with local employers from various sectors. Participants also receive one-to-one sessions, advocacy and after-care support (where necessary).
Finally, Nacro regularly meets with relevant key stakeholders (including local authorities and local and national government representatives such as the Department for Work and Pensions and the Ministry of Justice) to devise and implement local, regional and national strategies with the aim of raising awareness and involvement in both the project and the focused support that they can access from the Employer Advice Service.
The Aeneid Project has been successfully run in Bedford and Hertfordshire. From January 2017, Nacro began to expand to other areas including Manchester. In a report by the Department for Work and Pensions, Manchester was recognised as an offender hotspot; it is also undergoing major regeneration and devolution of its criminal justice system thus a key area for the Aeneid Project to be delivered.
On the 16th March Nacro hosted an Employers' Event, 'Recruiting safely and fairly: Employing ex-offenders to capture talent', at the Manchester Central Library. Senior business and HR professionals from private, public and third sector organisations heard from a range of key stakeholders and industry experts from Eversheds Sutherland, Freshfields, ACAS, Business in the Community (BITC) and the Department for Work and Pensions (DWP). They also took part in a workshop on the safe and fair recruitment of ex-offenders. The event marked the formal launch of the Aeneid Project in Manchester. This year-long initiative will be measured so that the success rate of the intervention can be empirically proven. | http://www.theexceptionals.org/blog/the-aeneid-project |
Between May and October 2018, CESR engaged in a series of community mapping exercises, gathered stories from partners, and reflected on existing resources in order to better understand the community of users of CESR’s OPERA Framework and what it needs. This process generated a briefing paper, The Next Act for OPERA, which shares insights gathered from those consultations.
The report details OPERA users’ need for additional practical guidance and a desire for creative models for sustained support. Based on CESR’s conversations, it is clear that future resources on OPERA should build strategic, as well as technical skills. In addition, CESR aims to support users as they tailor and adapt OPERA to specific contexts. Finally, users have asked that CESR also finds ways to empower experimentation with OPERA and facilitate sharing of learning, to enrich the framework by drawing on users’ experience and expertise.
CESR’s hopes to use this information to expand and refine OPERA further to help meet the demands of the economic, social and cultural rights community for support building capacity to strengthen rights-claiming over the coming years. CESR is extremely grateful to everyone who collaborated with us on this project. The generous spirit in which people gave their time and shared their views is deeply appreciated. | https://cesr.org/next-act-opera-0?page=2 |
- For the concept in the Foundation series, see Scientism (Foundation).
Scientism refers to a belief in the universal applicability of the systematic methods and approach of science, especially the view that empirical science constitutes the most authoritative worldview or most valuable part of human learning to the exclusion of other viewpoints. The term frequently implies a critique of the more extreme expressions of logical positivism and has been used by social scientists such as Friedrich Hayek, philosophers of science such as Karl Popper, and philosophers such as Hilary Putnam to describe the dogmatic endorsement of scientific methodology and the reduction of all knowledge to only that which is measurable.
"Scientism" can apply in either of two equally pejorative senses:
- To indicate the improper usage of science or scientific claims. This usage applies equally in contexts where science might not apply, such as when the topic is perceived to be beyond the scope of scientific inquiry, and in contexts where there is insufficient empirical evidence to justify a scientific conclusion. It includes an excessive deference to claims made by scientists or an uncritical eagerness to accept any result described as scientific. In this case the term is a counter-argument to appeals to scientific authority.
- To refer to "the belief that the methods of natural science, or the categories and things recognized in natural science, form the only proper elements in any philosophical or other inquiry," or that "science, and only science, describes the world as it is in itself, independent of perspective" with a concomitant "elimination of the psychological dimensions of experience."
The term is also used to highlight the possible dangers of lapses towards excessive reductionism in all fields of human knowledge.
For sociologists in the tradition of Max Weber, such as Jürgen Habermas, the concept of scientism relates significantly to the philosophy of positivism, but also to the cultural rationalization of the modern West.
Contents
Overview
Reviewing the references to scientism in the works of contemporary scholars, Gregory R. Peterson detects two main broad themes:
- It is used to criticize a totalizing view of science as if it were capable of describing all reality and knowledge, or as if it were the only true way to acquire knowledge about reality and the nature of things;
- It is used to denote a border-crossing violation in which the theories and methods of one (scientific) discipline are inappropriately applied to another (scientific or non-scientific) discipline and its domain. An example of this second usage is to label as scientism any attempt to claim science as the only or primary source of human values (a traditional domain of ethics) or as the source of meaning and purpose (a traditional domain of religion and related worldviews).
Mikael Stenmark proposes the expression scientific expansionism as a synonym of scientism. In the Encyclopedia of science and religion, he writes that, while the doctrines that are described as scientism have many possible forms and varying degrees of ambition, they share the idea that the boundaries of science (that is, typically the natural sciences) could and should be expanded so that something that has not been previously considered as a subject pertinent to science can now be understood as part of science (usually with science becoming the sole or the main arbiter regarding this area or dimension).
According to Stenmark, the strongest form of scientism states that science has no boundaries and that all human problems and all aspects of human endeavor, with due time, will be dealt with and solved by science alone. This idea has also been called the Myth of Progress.
E. F. Schumacher in his A Guide for the Perplexed criticized scientism as an impoverished world view confined solely to what can be counted, measured and weighed. "The architects of the modern worldview, notably Galileo and Descartes, assumed that those things that could be weighed, measured, and counted were more true than those that could not be quantified. If it couldn’t be counted, in other words, it didn’t count."
Relevance to science/religion debates
As of 2006[update] the term was often used[by whom?] against vocal critics of religion-as-such. Philosopher Daniel Dennett responded to criticism of his book Breaking the Spell: Religion as a Natural Phenomenon by saying that "when someone puts forward a scientific theory that [religious critics] really don't like, they just try to discredit it as 'scientism'".
Michael Shermer, founder of The Skeptics Society, draws a parallel between scientism and traditional religious movements, pointing to the cult of personality that develops around some scientists in the public eye. He defines scientism as a worldview that encompasses natural explanations, eschews supernatural and paranormal speculations, and embraces empiricism and reason.
The Iranian scholar Seyyed Hossein Nasr has stated that in the West, many will accept the ideology of modern science, not as "simple ordinary science", but as a replacement for religion.
Gregory R. Peterson writes that "for many theologians and philosophers, scientism is among the greatest of intellectual sins".
Susan Haack argues that the charge of "scientism" caricatures actual scientific endeavor. No single form of inference or procedure of inquiry used by scientists explains the success of science. Instead we find:
- the inferences and procedures used by all serious empirical inquirers
- a vast array of tools of inquiry, from observational instruments to mathematical techniques, as well as social mechanisms that encourage honesty. These tools are diverse and evolving, and many are domain-specific.
Philosophy of scienceMain article: Philosophy of science
In his essay, Against Method, Paul Feyerabend characterizes science as "an essentially anarchic enterprise" and argues emphatically that science merits no exclusive monopoly over "dealing in knowledge" and that scientists have never operated within a distinct and narrowly self-defined tradition. He depicts the process of contemporary scientific education as a mild form of indoctrination, aimed at "making the history of science duller, simpler, more uniform, more 'objective' and more easily accessible to treatment by strict and unchanging rules."
[S]cience can stand on its own feet and does not need any help from rationalists, secular humanists, Marxists and similar religious movements; and ... non-scientific cultures, procedures and assumptions can also stand on their own feet and should be allowed to do so ... Science must be protected from ideologies; and societies, especially democratic societies, must be protected from science... In a democracy scientific institutions, research programmes, and suggestions must therefore be subjected to public control, there must be a separation of state and science just as there is a separation between state and religious institutions, and science should be taught as one view among many and not as the one and only road to truth and reality.
— Feyerabend, Against Method, p.viii
Religion and philosophy
Philosopher of religion Keith Ward has said scientism is philosophically inconsistent or even self-refuting, as the truth of the statements "no statements are true unless they can be proven scientifically (or logically)" or "no statements are true unless they can be shown empirically to be true" cannot themselves be proven scientifically, logically, or empirically.
Rationalization and modernityMain article: Rationalization (sociology)
In the introduction to his collected oeuvre on the sociology of religion, Max Weber asks why "the scientific, the artistic, the political, or the economic development [elsewhere]… did not enter upon that path of rationalization which is peculiar to the Occident?" According to the distinguished German social theorist, Jürgen Habermas, “For Weber, the intrinsic (that is, not merely contingent) relationship between modernity and what he called ‘Occidental rationalism’ was still self-evident.” Weber described a process of rationalisation, disenchantment and the “disintegration of religious world views” that resulted in modern secular societies and capitalism.
“Modernization” was introduced as a technical term only in the 1950s. It is the mark of a theoretical approach that takes up Weber's problem but elaborates it with the tools of social-scientific functionalism… The theory of modernization performs two abstractions on Weber's concept of “modernity”. It dissociates “modernity” from its modern European origins and stylizes it into a spatio-temporally neutral model for processes of social development in general. Furthermore, it breaks the internal connections between modernity and the historical context of Western rationalism, so that processes of modernization… [are] no longer burdened with the idea of a completion of modernity, that is to say, of a goal state after which “postmodern” developments would have to set in… Indeed it is precisely modernization research that has contributed to the currency of the expression “postmodern” even among social scientists.
— Jürgen Habermas, The Philosophical Discourse of Modernity
Habermas is critical of pure instrumental rationality, arguing that the “Social Life–World” is better suited to literary expression, the former being “intersubjectively accessible experiences” that can be generalized in a formal language, while the latter “must generate an intersubjectivity of mutual understanding in each concrete case”:
The world in which human beings are born and live and finally die; the world in which they love and hate, in which they experience triumph and humiliation, hope and despair; the world of sufferings and enjoyments, of madness and common sense, of silliness, cunning and wisdom; the world of social pressures and individual impulses, of reason against passion, of instincts and conventions, of shared language and unsharable feelings and sensations…
Range of meanings
Standard dictionary definitions include the following applications of the term "scientism":
- The use of the style, assumptions, techniques, and other attributes typically displayed by scientists.
- Methods and attitudes typical of or attributed to the natural scientist.
- An exaggerated trust in the efficacy of the methods of natural science applied to all areas of investigation, as in philosophy, the social sciences, and the humanities.
- The use of scientific or pseudoscientific language.
- The contention that the social sciences, such as economics and sociology, are only properly sciences when they abide by the somewhat stricter interpretation of scientific method used by the natural sciences, and that otherwise they are not truly sciences.
- "A term applied (freq. in a derogatory manner) to a belief in the omnipotence of scientific knowledge and techniques; also to the view that the methods of study appropriate to physical science can replace those used in other fields such as philosophy and, esp., human behaviour and the social sciences."
- "1. The collection of attitudes and practices considered typical of scientists. 2. The belief that the investigative methods of the physical sciences are applicable or justifiable in all fields of inquiry."
- As a form of dogma: "In essence, scientism sees science as the absolute and only justifiable access to the truth."
See also
- Antiscience
- Antireductionism
- Conflict thesis
- Evolutionism
- Human experimentation in the United States
- Mary Midgley
- Non-overlapping magisteria
- Obscurantism
- Panglossianism
- Positivism
- Pseudoskepticism
- Reductionism
- Relationship between religion and science
- Relativism
- Science of morality
- Scientific reductionism
- Scientific imperialism
- Scientistic materialism
- Science wars
- Technologism
- Technological dystopia
- Techno-utopianism
- World view
References
- ^ Sorell, Tom. Scientism: Philosophy and the Infatuation with Science. Routledge, 1994, p. 1ff.
- ^ Rey, Abel. "Review of La Philosophie Moderne." The Journal of Philosophy, Psychology and Scientific Methods 6.2 (1909): 51-53.
- ^ cf. Abraham Maslow: "There are criticisms of orthodox, 19th Century scientism and I intend to continue with this enterprise." Toward a Psychology of Being, Preface to 1st edition
- ^ Hayek in "The Counter Revolution Of Science: Studies on the Abuse of Reason". Liberty Fund Inc. June 1, 1980.
- ^ Hacohen, Malachi Haim (2002). Karl Popper: the formative years, 1902-1945 : politics and philosophy in interwar Vienna. Cambridge University Press. ISBN 9780521890557.
- ^ a b Putnam, Hilary (1992). Renewing Philosophy. Cambridge, MA: Harvard University Press. pp. x.
- ^ a b Outhwaite, William (1988) Habermas: Key Contemporary Thinkers, Polity Press, second edition 2009, p. 22.
- ^ Merriam-Webster's Collegiate Dictionary. Merriam-Webster. 2003. p. 1112. ISBN 9780877798095. LCCN 2003003674. http://books.google.com/books?id=TAnheeIPcAEC&pg=PA1112. "Scientism: … an exaggerated trust in the efficacy of the methods of natural science applied to all areas of investigation (as in philosophy, the social sciences, and the humanities)"
- ^ Ryder, Martin (2005). "Scientism". In Carl Mitcham. Encyclopedia of Science, Technology, and Ethics (3rd ed.). Detroit: MacMillan Reference Books. http://carbon.ucdenver.edu/~mryder/scientism_este.html. "Today the term is used with pejorative intent to dismiss substantive arguments that appeal to scientific authority in contexts where science might not apply. This over commitment to science can be seen in epistemological distortions and abuse of public policy."
- ^ a b Blackburn, S. (2005). The Oxford Dictionary of Philosophy. Oxford paperbacks. Oxford University Press. p. 331-332. ISBN 9780198610137. LCCN 2006271895. http://books.google.com/books?id=WHILCw0hDA4C&pg=PA332. "Scientism: Pejorative term for the belief that the methods of natural science, or the categories and things recognized in natural science, form the only proper elements in any philosophical or other inquiry."
- ^ After reviewing the usage of the term by contemporary scholars, Gregory R Peterson concludes that "the best way to understand the charge of scientism is as a kind of logical fallacy involving improper usage of science or scientific claims." (p.753). From: "Peterson, Gregory R. (2003) Demarcation and the Scientistic Fallacy. Zygon: Journal of Religion and Science 38 (4), 751-761. doi: 10.1111/j.1467-9744.2003.00536.x"
- ^ Scientism by Martin Ryder - University of Colorado. (Accessed: July 05 2007)
- ^ Robert Bannister, "Behaviorism, Scientism and the Rise of The "Expert"
- ^ Haack, Susan, (2003). Defending Science Within Reason: Between Scientism and Cynicism. Amherst, NY: Prometheus Books
- ^ Michael Collins, A Critical Analysis of Competency-based Systems in Adult Education, Adult Education Quarterly, March 20, 1983 vol. 33 no. 3 pp.174-183
- ^ Irwin Chargaff, In Dispraise of Reductionism, Bioscience, 47.11, Dec 1997, pp.795-7
- ^ R Keith Sawyer, Connecting Culture, Psychology and Biology: Essay Review on Inghilleri’s From Subjective Experience to Cultural Change, Human Development, vol.43, 2000, pp.56–59
- ^ a b "Peterson, Gregory R. (2003) Demarcation and the Scientistic Fallacy. Zygon: Journal of Religion and Science 38 (4), 751-761. doi: 10.1111/j.1467-9744.2003.00536.x"
- ^ a b c As described by Mikael Stenmark, author of the article about the topic of Scientism in: J. Wentzel Vrede van Huyssteen (editor). Encyclopedia of science and religion, 2nd ed. Thomson Gale. 2003. (p.783)
- ^ G. Monastra, M. M. Zarandi, Science and the Myth of Progress, 2004.
- ^ David Orr, Environmental Literacy: Education as if the Earth Mattered, Twelfth Annual E. F. Schumacher Lectures, October 1992, Great Barrington, Massachusetts
- ^ Robinson, Marilynne. "Hysterical Scientism: The Ecstasy of Richard Dawkins."Harper's Magazine Nov. 2006.
- ^ Sholto Byrnes, "'When it comes to facts, and explanations of facts, science is the only game in town'", 'New Statesman', 10 April 2006
- ^ Shermer, Michael. "The Shamans of Scientism." Scientific American June 2002.
- ^ Chittick, William (2007). The Essential Seyyed Hossein Nasr. Bloomington: World Wisdom. ISBN 1933316381.
- ^ Susan Haack, Defending Science - Within Reason: Between Scientism And Cynicism, Prometheus Books, 2003
- ^ Feyerabend writes: "Imre Lakatos loved to embarrass serious opponents with jokes and irony and so I, too, occasionally wrote in a rather ironical vein. An example is the end of Chapter 1: 'anything goes' is not a 'principle' I hold ... but the terrified exclamation of a rationalist who takes a closer look at history". Feyerabend (1993), p.vii.
- ^ Feyerabend, P. and Feyerabend, P.K. (1993). Against Method (3rd. ed.). Verso. pp. viii,9,11. ISBN 9780860916468. http://books.google.com/books?id=8y-FVtrKeSYC&lpg=PP9&pg=PA11.
- ^ See e.g. Keith Ward, Is Religion Dangerous? and the discussion by Alston, William P. (2003). "Religious language and verificationism". In Moser, Paul K.; Copan, Paul. The Rationality of Theism. New York: Routledge. pp. 26–34. ISBN 0415263328.
- ^ Habermas, Jürgen, The Philosophical Discourse of Modernity, Polity Press (1985), ISBN 0-7456-0830-2, pp.2–3
- ^ Olson, R. (2008). Science and scientism in nineteenth-century Europe. University of Illinois Press. p. 4. ISBN 9780252074332. LCCN 2007005146. http://books.google.com/books?id=h8C7fe50J0AC&pg=PA1.
- ^ Habermas, J.; Shapiro, J.J. (1971). Toward a rational society: student protest, science, and politics. Beacon paperbacks. Beacon Press. p. 50–51. ISBN 9780807041772. LCCN 73121827. http://books.google.com/books?id=cW7PmVj7kzQC&pg=PA50.
- ^ Random House Dictionary of the English Language. 1987.
- ^ Webster's Ninth New Collegiate Dictionary. 1983. Cf. "Scientism" definition 1, Oxford English Dictionary web edition, accessed October 16, 2009
- ^ Webster. 1983.
- ^ Webster. 1983. Definition #3 for Scientism.
- ^ Webster. 1983. Definition #2 for Scientism.
- ^ "Scientism" definition 2, Oxford English Dictionary web edition, accessed October 16, 2009
- ^ The American Heritage Dictionary of the English Language: Fourth Edition. 2000. Bartleby.com (archived 24 January 2008)
- ^ "Scientism" - PBS.org. Faith and Reason.
External links
Analytic philosophy PhilosophersJ. L. Austin · Australian Realists · Alfred Ayer · Berlin Circle · G. E. M. Anscombe · C. D. Broad · Rudolf Carnap · Donald Davidson · Michael Dummett · Gottlob Frege · Paul Grice · Saul Kripke · Carl Hempel · Jaakko Hintikka · David Lewis · G. E. Moore · Hilary Putnam · W. V. O. Quine · Bertrand Russell · Gilbert Ryle · Peter Singer · Peter Strawson · Bas van Fraassen · Vienna Circle · John Wisdom · Ludwig Wittgenstein · more ... Theories
Deflationism · Direct reference theory · Empiricism · Holism · Logical atomism · Logical positivism · Naturalism · Naturalized epistemology · Neopragmatism · Neutral monism · Particularism · Reductionism · Scientism · Skepticism · Verificationism · more...
Concepts
Analysis · Analytic-synthetic distinction · Counterfactual · Denotation · Definite description · Intuition · Meaning · Modality · Necessary-sufficient conditions · Paradox of analysis · Possible world · Reflective equilibrium · Rigid-flaccid designators · Sense data · Sense and Reference · Supervenience · Thought experiment
Related articlesCategory · Task Force · Stubs · DiscussionCategories:
- 19th-century philosophy
- 20th-century philosophy
- Natural sciences
- Naturalism
- Philosophical terminology
- Metatheory of science
- Political theories
- Religion and science
Wikimedia Foundation. 2010.
Look at other dictionaries: | https://enacademic.com/dic.nsf/enwiki/113581/Scientism |
CoolSpots enable a wireless mobile device to automatically switch between multiple radio interfaces, such as WiFi and Bluetooth, in order to increase battery lifetime. The main contribution of this work is an exploration of the policies that enable a system to switch among these interfaces, each with diverse radio characteristics and different ranges, in order to save power ? supported by detailed quantitative measurements. The system and policies do not require any changes to the mobile applications themselves, and changes required to existing infrastructure are minimal. Results are reported for a suite of commonly used applications, such as file transfer, web browsing, and streaming media, across a range of operating conditions. Experimental validation of the CoolSpot system on a mobile research platform shows substantial energy savings: more than a 50% reduction in energy consumption of the wireless subsystem is possible, with an associated increase in the effective battery lifetim...
Trevor Pering, Yuvraj Agarwal, Rajesh K. Gupta, Ro
Real-time Traffic
Effective Battery Lifetime
|
MOBISYS 2006
|
Multiple Radio Interfaces
|
Wireless Mobile Device
|
Wireless Networks
|
claim paper
Related Content
»
Adaptive Power Control and Selective Radio Activation for LowPower InfrastructureMode 8021...
»
Performance Validation on Multicore Mobile Devices
»
EMiLi EnergyMinimizing Idle Listening in Wireless Networks
»
Modeling energy efficiency in wireless internet communication
»
Integrated power management for video streaming to mobile handheld devices
»
Research on multicast routing protocols for mobile adhoc networks
»
An Efficient Handover Scheme Based on Fast Mobile IPv6
»
Heterogeneous vs homogeneous MPSoC approaches for a Mobile LTE modem
»
A survey of Mobile IP in cellular and Mobile AdHoc Network environments
more »
Post Info
More Details (n/a)
Added
24 Dec 2009
Updated
24 Dec 2009
Type
Conference
Year
2006
Where
MOBISYS
Authors
Trevor Pering, Yuvraj Agarwal, Rajesh K. Gupta, Roy Want
Comments
(0)
Researcher Info
Computer Networks Study Group
Computer Vision
Join Our Newsletter
receive notifications of our new tools
Explore & Download
Proceedings Preprints
Top 5 Ranked Papers
Publications
Books
Software
Tutorials
Presentations
Lectures Notes
Datasets
Explore Subject Areas
Life Sciences
Algorithms
Applied Computing
Artificial Intelligence
Augmented Reality
Automated Reasoning
Bioinformatics
Biomedical Imaging
Biomedical Simulation
Biometrics
Business
Chemistry
Cognitive Science
Combinatorics
Communications
Computational Biology
Computational Geometry
Computational Linguistics
Computer Animation
Computer Architecture
Computer Graphics
Computer Networks
Computer Science
Computer Vision
Control Systems
Cryptology
Data Mining
Database
Digital Library
Discrete Geometry
Distributed And Parallel Computing
Document Analysis
ECommerce
Economy
Education
Electrical and Computer Engineering
Electronic Publishing
Embedded Systems
Emerging Technology
Finance
Forensic Engineering
Formal Methods
FPGA
Fuzzy Logic
Game Theory
GIS
Graph Theory
Hardware
Healthcare
Human Computer Interaction
Image Analysis
Image Processing
Information Technology
Intelligent Agents
Internet Technology
Knowledge Management
Languages
Latex
Logical Reasoning
Machine Learning
Management
Mathematics
Medical Imaging
Modeling and Simulation
Multimedia
Music
Natural Language Processing
Neural Networks
Numerical Methods
Operating System
Operations Research
Optimization
Pattern Recognition
Physics
Programming Languages
Remote Sensing
Robotics
Security Privacy
Sensor Networks
Signal Processing
Social Networks
Social Sciences
Software Engineering
Solid Modeling
System Software
Theoretical Computer Science
User Interface
VHDL
Virtual Reality
Virtualization
Visual Languages
Visualization
VLSI
Wireless Networks
Productivity Tools
International On-screen Keyboard
Graphical Social Symbols
OCR Text Recognition
CSS3 Style Generator
Web Page to PDF
Web Page to Image
PDF Split
PDF Merge
Latex Equation Editor
Sci2ools
Document Tools
PDF to Text
PDF to Postscript
PDF to Thumbnails
Excel to PDF
Word to PDF
Postscript to PDF
PowerPoint to PDF
Latex to Word
Repair Corrupted PDF
Image Tools
JPG to PS
JPG to PDF
Extract Images from PDF
Image Converter
Sciweavers
About
Community
Report Bug
Request Feature
Cookies
Contact
Copyright © 2009-2011 Sciweavers LLC. All rights reserved. | http://www.sciweavers.org/publications/coolspots-reducing-power-consumption-wireless-mobile-devices-multiple-radio-interfaces |
Though Hades is a creature of the darkness, he remembers a time when there was only light. It may be hard to believe that the dread Lord of the Underworld could have ever been anything but. However, Fate decreed that he should not keep his innocence for very long, because of the violent legacy that preceded him.
Ouranos
o0o
No, no. It could not possibly end like this! Facing ruin at the hands of his own family, his offspring! They owed him their very existence! He was the most powerful god that had ever existed! If not for him, Hellas would not exist! How could this happen to him? He was ageless and timeless, a being born of the heavens!
o0o
He was the one who had brought rains to the valleys and fields of this realm, to make things grow to feed gods and mortals alike. He'd existed before Hellas was settled, and had borne witness to hunter-gatherers settling in the area, attracted by the relatively mild weather and fertile lands that were a result of the warming of the continent.
Over the centuries, the Hellenes developed a more sustaining way of life, learning to take seeds from plants and create crops that could feed larger numbers of people instead of relying on gathering from whatever plants they could find within an area. Domestication of animals followed, from chickens to goats. The humans also kept cats and dogs that were descended from those who fed off the vermin that followed the crops, and those who lived off the scraps left by humans. Weapons and tools of leather, flint, and wood were augmented by those of bronze.
The mortals worshiped him as the All-father, the life-giver, the one whose essence seeded the fertile earth to give the humans the sustenance they needed. Sometimes he came down to the land, and coupled with a nubile young girl, but his seed never took root, and he was unable to understand why.
Then Gaea came along. The mortals started to worship her as well, thanking her for the bounty that came from the land. He was intrigued by her, and taken by her beauty.
However, she first took his elder brothers as lovers; Tartarus of the dark realms below the earth, and then Pontus of the deep realms of the sea. He watched with envy as she mated with them, and bore them offspring. The mortals revered her as the All-mother, and went to her for blessings. His desire for her only grew, and he longed to possess her, but every time he came to her, she turned him away, seeking the embrace of her other lovers.
Finally, she accepted his attentions. In her, his seed took root, and she bore him a dozen children, and he took pride in them, for his sons were handsome and his daughters beautiful, and Tartarus and Pontus did not even have that many offspring between them.
His happiness ended when Gara bore him more children. Giants with more arms than they needed and creatures with one eye, were they even his? They could not possibly be, such a god as him could not sire monsters! Yet Gaea insisted that they were his, that she had taken no lovers after him.
He cast them away, refusing to bear the sight of them or acknowledge their existence. He ignored Gaea's tears and anger, and banished his brother's children as well. Hellas was his, and he would have no one, not even Gara, defy his authority!
As more and more people worshiped Gara, his jealousy and ire grew. He turned his wrath upon them, demanding that they worship him and him alone, above all else. Hellas was his first, and it would remain so. He would not allow his mate or children to usurp the adulation he so rightfully deserved.
o0o
His children rose against him, calling him arrogant and cruel, that he was not a good father or ruler. He cursed them and his lover, and lashed out at them, attempting to put them in their place. He was the All-father, and would allow none to challenge his power. He had existed for millennia, and would not see his rule ended! He repelled his offspring, admonishing them, causing the heavens itself to shake with his wrath.
Unfortunately, Kronos proved more crafty than his siblings or mother, by pretending to surrender, bending the knee and swearing fealty to his sire. Kronos had always been his favorite child, for he saw the most of himself in his youngest son than any of his other sons or daughters. Ouranos blessed his son with his power, and Kronos used it to keep his siblings obedient.
He did not realize Kronos' true intentions until it was too late. When he tried to use his power against his son, Kronos simply laughed, wrapping his hands around his father's neck, Ouranos tried to struggle, but Kronos did something that horrified him.
Somehow, when Ouranos tried to use his power, Kronos would merely divert it, his grip tightening. Never in his many centuries of existence had the All-father felt so helpless. His children surrounded him, and one handed the sickle to Kronos.
The blade came down, slicing his flesh. He recognized Gaea's magic in the weapon, and the cuts seared like a thousand flames, not that Ouranos would know since he had never come to physical harm before. He tried to fight, to summon the strength of the heavens, to make the skies lash out at his wayward offspring, but his life and power drained from him with every slash of the sickle.
He looked up at Kronos, who had eyes exactly like his own. He might not have the power to actively bring down those who had betrayed him, but he could still curse them, and so he did.
"Hear this, son of mine!" he managed to gasp out as blood filled his lungs from the puncture wounds to his chest, energy sapping from him as he body tried to heal itself. "For the unforgivable act of betraying your own father, you will suffer the same fate! Fear your own children, and forever rue the day that you brought about my demise!"
His son laughed at him as Ouranos felt the blade slice through his neck, but he saw the tiniest flick of fear in Kronos' eyes before the darkness engulfed him. | https://www.fictionpress.com/s/3304516/1/Khthonios |
At the Oct. 29 called board meeting, Dr. Phipps and the Board of Trustees discussed the results of the parent and employee surveys and the options for re-opening schools to 4 days a week.
Please see the summary video from Dr. Phipps on Thursday night’s called board meeting regarding the preparation to move to 4-days a week instruction and to review the parent and employee survey results.
Oct. 29 board meeting summary from Dr. Phipps
To view the parent and employee survey results, click here
Option B –
1. Plexiglass shields arrive and are installed in classrooms across the district,
beginning with elementary schools. *
Then…
2. In 2 weeks, elementary school A/B students return 4 days per week.
Then…
3. In 1 more week, middle school A/B students return 4 days per week.
Then…
4. after winter break, all A/B students return 4 days per week.
*The timeline for delivery and installation is dependent upon the SC SDE
process.
**The district will work with fully virtual parents to have their students return if
the parent selects to have them return to face-to-face instruction. This process may
be delayed as logistics are arranged to accommodate the increased enrollment.
Plexiglass use in schools
Consistent with its existing policy, DHEC is providing further information
regarding use of plexiglass barriers between students. As noted in the
COVID-19: Frequently Asked Questions for School Officials from August 14,
2020, appropriate plexiglass use, combined with other measures, allows for
shorter distances for social distancing.
In scenarios in which students are seated closer apart than six feet, the students would not be considered close contacts when:
1. appropriate plexiglass is utilized, and
2. distance between students is at least three feet apart, and
3. the students are wearing cloth face coverings or face masks that cover the nose and mouth (the plexiglass does not serve as a substitute to mask-wearing).
Plexiglass is considered appropriately sized and utilized if it surrounds three sides (the front and two sides) of the edges of the student’s desk and extends at least a foot above each child’s head when seated at the desk and at least a foot beyond the end of the desk on either side. There may be acceptable other configurations, as determined on an individual basis by DHEC.
Click here to see the document from the October 29 Called Board Meeting. | https://www.lancastercsd.com/uncategorized/2020/10/30/update-from-october-29-called-board-of-trustees-meeting/ |
The present invention relates to the use of 2-furyl- and 2-thienyl-substituted di- and tetrahydropyrans as aroma chemicals, to aroma chemical compositions comprising at least one 2-furyl- or 2-thienyl-substituted di- or tetrahydropyran and to a method for preparing an aroma chemical composition, in particular a fragranced composition, specifically a fragranced ready-to-use composition, which comprises incorporating at least one 2-furyl- or 2-thienyl-substituted di- or tetrahydropyran into such a composition. The present invention further relates to specific 2-furyl- and 2-thienyl-substituted di- and tetrahydropyrans and to a method for their preparation.
BACKGROUND OF THE INVENTION
Aroma chemicals, especially fragrances, are of great interest especially in the field of cosmetics and cleaning and laundry compositions. Fragrances of natural origin are mostly expensive, often limited in their available amount and, on account of fluctuations in environmental conditions, are also subject to variations in their content, purity etc. To circumvent these undesirable factors, it is therefore of great interest to create synthetic substances which have organoleptic properties that resemble more expensive natural fragrances or which have novel and interesting organoleptic profiles.
Despite a large number of already existing synthetic aroma chemicals (fragrances and flavorings), there is a constant need for new components in order to be able to satisfy the multitude of properties desired for extremely diverse areas of application. These include, firstly, the organoleptic properties, i.e. the compounds should have advantageous odiferous (olfactory) or gustatory properties. Furthermore, aroma chemicals should, however, also have additional positive secondary properties, such as e.g. an efficient preparation method, the possibility of providing better sensory profiles as a result of synergistic effects with other fragrances, a higher stability under certain application conditions, a higher extendability, a better staying power, etc.
However, since even small changes in chemical structure bring about massive changes in the sensory properties such as odor and also taste, the targeted search for substances with certain sensory properties such as a certain odor is extremely difficult. The search for new fragrances and flavorings is therefore in most cases difficult and laborious without knowing whether a substance with the desired odor and/or taste will even actually be found.
I
II
2
4
2
4
2,4,4-Trisubstituted tetrahydropyran compounds have been repeatedly mentioned as aroma chemicals. For example, EP 0383446 A2 describes 2,4,4-trisubstituted tetrahydropyran of the formula (A), wherein Ris methyl or ethyl and Ris linear or branched C-C-alkyl or C-C-alkenyl.
a
b
1
8
2
8
5
12
U.S. Pat. No. 4,962,090 describes 2,4-disubstituted and 2,2,4-trisubstituted tetrahydropyranyl-4-ethers of the formula (B), wherein R′ represents methyl or ethyl and Rand Rare selected from hydrogen, phenyl, C-C-alkyl and C-C-alkenyl or taken together represent C-C-cycloalkyl or alkylcycloalkyl.
L. Liu et al., J. Am. Chem. Soc. 2016, 138, 10822-10825 describe a method for preparing chiral 2-substituted 4-methylene tetrahydropyrans by asymmetric Prins cyclization of an aromatic or aliphatic aldehyde with 3-methylprop-3-en-1-ol. Inter alia, the synthesis of 2-(furan-2-yl)-4-methylenetetrahydropyran and its regioisomer is described.
J. A. Marco et al. describe in Tetrahedron 2003, 59, 4085-4101 the synthesis of conjugated γ- and δ-lactones from aldehydes and ketones via ring-closing metathesis. Inter alia the synthesis of 2-(2-furyl)-4-methyl-3,6-dihydro-2H-pyran is described.
So far, 2-furyl- and 2-thienyl-substituted di- and tetrahydropyrans have not yet been suggested as aroma chemicals.
SUMMARY OF THE INVENTION
It was an object of the present invention to provide substances exhibiting pleasant organoleptical properties and which can be advantageously used as aroma chemicals.
It was a further object of the present invention to provide substances which can be used as an aroma chemical in ready-to-use compositions. In particular, odor-intensive substances having a pleasant odor are sought. Furthermore, these aroma chemicals should be combinable with other aroma chemicals, allowing the creation of novel advantageous sensory profiles. In addition, these aroma chemicals should be obtainable from readily available starting materials, allowing their fast and economic manufacturing.
It was surprisingly found that these and further objects are achieved by the compounds of the formula (I), by mixtures thereof [meaning mixtures of two or more different compounds (I), e.g. 2, 3 or 4 different compounds (I)], by stereoisomers thereof and by mixtures of stereoisomers thereof.
Accordingly, a first aspect of the present invention relates to the use of a compound of the general formula (I), including the stereoisomers thereof, as an aroma chemical:
wherein
X is O or S;
1
5
1
4
Ris hydrogen, OH, O—C-C-alkyl or O—(C═O)—R;
2
3
4
R, R, Rare hydrogen;
2
3
4
1
or one of R, R, Rtogether with Rrepresents a double bond; and
5
1
4
Ris selected from the group consisting of hydrogen and C-C-alkyl.
The invention also relates to the use of a mixture of different compounds of the formula (I), including mixtures of double bond isomers, and of mixtures of stereoisomers thereof, as aroma chemicals.
The present invention further relates to aroma chemical compositions comprising at least one compound of formula (I), a stereoisomer thereof or a mixture of stereoisomers thereof, as defined above, and at least one further compound selected from the group consisting of aroma chemicals different from compounds (I) and non-aroma chemical carriers.
It was further found that the compounds of the general formula (I) generally exhibit a pleasant and characteristic odor and can be used to produce fragranced ready-to-use compositions. In addition, they can advantageously be combined with other aroma chemicals different from compounds (I) to create new scent profiles.
Therefore, the present invention further relates to a method of preparing an aroma chemical composition, in particular a fragranced composition, specifically a fragranced ready-to-use composition, comprising incorporating at least one compound of formula (I), a stereoisomer thereof or a mixture of stereoisomers thereof, into a composition, in particular into a ready-to-use composition.
The invention also relates to the use of a compound of formula (I), a stereoisomer thereof, a mixture of stereoisomers thereof or a mixture of different compounds (I), as defined above, for modifying the scent character of a fragranced ready-to-use composition.
Amongst the group of compounds of formula (I), the 2-(2-furyl)-tetrahydropyran compounds of formula (I.a) described hereinafter and the 2-(2-thienyl)-tetrahydropyran compounds of formula (I.b) described hereinafter have not been described in the art.
Therefore, the present invention also relates to novel compounds of the general formula (I.a)
1
5
5
1
4
1
4
wherein
Ris hydrogen, OH, O—C-C-alkyl or O—(C═O)—R, and
Ris selected from the group consisting of hydrogen and C-C-alkyl;
a mixture of different compounds (I.a), a stereoisomer thereof or a mixture of stereoisomers thereof;
and to a method for producing such compounds.
Furthermore, the present invention relates to novel compounds of the general formula (I.b)
1
5
2
3
4
2
3
4
1
5
1
4
1
4
wherein
Ris hydrogen, OH, O—C-C-alkyl or O—(C═O)—R,
R, R, Rare hydrogen;
or one of R, R, Rtogether with Rrepresents a double bond;
Ris selected from the group consisting of hydrogen and C-C-alkyl;
a mixture of different compounds (I.b), a stereoisomer thereof or a mixture of stereoisomers thereof;
and to a method for producing such compounds.
The invention also relates to a mixture of at least two different compounds of the formula (I). In particular, the mixture comprises two or three double bond isomers of the compound of the formula (I).
The compounds of formula (I), their mixtures, their stereoisomers or the mixtures of their stereoisomers possess advantageous organoleptic properties, in particular a pleasant odor. Therefore, they can be favorably used as an aroma chemical for example in perfume compositions, body care compositions (including cosmetic compositions, products for oral and dental hygiene, hygiene articles, cleaning compositions (including dishwashing compositions), textile detergent compositions, compositions for scent dispensers, foods, food supplements, pharmaceutical compositions, crop protection compositions and other ready-to-use compositions.
By virtue of their physical properties, the compounds of formula (I), their stereoisomers or the mixtures of their stereoisomers have particularly good, virtually universal solvent properties for other fragrances and other customary ingredients in fragranced ready-to-use compositions such as, in particular, perfume compositions. Therefore, the compounds of formula (I), their stereoisomers or the mixtures of their stereoisomers are favorably combinable with other aroma chemicals, allowing, in particular, the creation of perfume compositions having novel advantageous sensory profiles.
Furthermore, the compounds of formula (I), their stereoisomers or the mixtures of their stereoisomers can be produced in good yields and purities by a one-step or a two-step synthesis, respectively, starting from readily available starting compounds. Thus, the compounds of formula (I), their stereoisomers or the mixtures of their stereoisomers, can be produced in large scales and in a simple and cost-efficient manner.
DETAILED DESCRIPTION OF THE INVENTION
1
4
1
4
1
3
1
2
In the context of the present invention, the expression “C-C-alkyl” refers to methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl and tert-butyl. Preferably, the expression “C-C-alkyl” refers to C-C-alkyl, i.e. to methyl, ethyl, n-propyl and isopropyl, and in particular to C-C-alkyl, i.e. to methyl and ethyl.
2
3
4
1
2
3
4
1
2
3
4
1
2
1
3
1
4
1
If one of R, R, Rtogether with Rrepresents a double bond, this means of course that the double bond is formed by the bond present between the carbon atoms to which R, Ror Rand Rare bound and a bond formed by R, Ror Rtogether with R. Thus, if Rtogether with Rrepresents a double bond, this results in a compound of formula (I-1). If Rtogether with Rrepresents a double bond, this results in a compound of formula (I-2). If Rtogether with Rrepresents a double bond, this results in a compound of formula (I-3).
These compounds can be regarded as double bond isomers of each other.
3
4
2
4
2
3
Seeing that Rand Rin compounds I-1 are H, Rand Rin compounds I-2 are H, and Rand Rin compounds I-3 are H, compounds of formulae I-1, I-2 and I-3 can be depicted more simply as follows:
1
1
1
1
5
1
4
If Ris H, the compound (I) is a compound of formula (I-4). If Ris OH, the compound (I) is a compound of formula (I-5). If Ris O—C-C-alkyl, the compound (I) is a compound of formula (I-6). If Ris O—(C═O)—R, the compound (I) is a compound of formula (I-7).
1
5
1
1
4
The term “stereoisomers” encompasses both optical isomers, such as enantiomers or diastereomers, the latter existing due to more than one stereogenic center in the molecule, as well as geometrical isomers (cis/trans isomers) as a specific form of diastereomers. The compounds of the formula (I) have at least one stereogenic center, namely the carbon atom of the di- or tetrahydropyran ring carrying the furan (X═O) or thiophene ring (X═S). In case that Ris hydrogen, OH, O—C-C-alkyl or O—(C═O)—R, the compound of formula (I) has one more stereogenic center (namely at the carbon atom of the di- or tetrahydropyran carrying R). The invention provides both the pure enantiomers or diastereomers and their mixtures and the use according to the invention of pure enantiomers or of pure diastereomers of the compound (I) or of mixtures thereof.
In the present context, the term “compound I”, “compound (I)” or “compound of formula (I)”, when not defined as a specific stereoisomer or a specific mixture of stereoisomers, refers to the form of the compound as it is obtained in a non-stereoselective method used for its production. The term is however also used if it is not necessary or not possible to specify in more detail the stereochemistry of the compound (I).
If in the following the compound of formula (I) is defined to be a specific, defined compound (and not to be a mixture of different compounds I), this means that the compound contains less than 5% by weight, preferably less than 3% by weight and in particular preferably less than 1% by weight of other compounds I, relative to the overall weight of the specific, defined compound I and the optionally present other compound(s) I.
1
4
1
4
In mixtures containing different compounds (I), these may differ in the definition of one or more radicals Rto Rand/or X. Preferably, the compounds in the mixture differ only in the definition of one or more radicals Rto R. More preferably, the mixture contains two or three of the compounds (I-1), (I-2) and (I-3). Due to the preparation process, such mixtures may moreover contain minor amounts of compound (I-5). “Minor amount” means less than 3% by weight, preferably less than 1% by weight, relative to the total weight of the compounds (I-1), (I-2), (I-3) and (I-5) contained in the mixture. In general, the mixture of two or three of the compounds (I-1), (I-2) and (I-3) is a mixture of double bond isomers, which means that in all compounds (I-1), (I-2) and (I-3) contained in the mixture (and in compound (I-5), if present) X has the same meaning and is thus either in each case O or is in each case S. Mixtures in which X in (I-1), (I-2) and/or (I-3) has different meanings are also suitable for the object of the present invention, but are less economic, seeing that mixtures in which X in all compounds (I) has the same meaning are often formed automatically in the production process.
In a preferred embodiment of the present invention, in compounds of the general formula (I), X is O.
In another preferred embodiment of the present invention, in compounds of the general formula (I), X is S.
2
3
4
1
In a preferred embodiment of the present invention, in compounds of the general formula (I), one of R, R, Rtogether with Rrepresents a double bond.
2
1
3
1
4
1
More preferably, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond, or is a compound (I-2), where Rtogether with Rrepresents a double bond, or is a compound (I-3), where Rtogether with Rrepresents a double bond, or is a mixture of at least two of the compounds (I-1), (I-2) and (I-3). Such mixtures of at least two of the compounds (I-1), (I-2) and (I-3) are preferably mixtures of double bond isomers of compounds (I), meaning that in all compounds (I-1), (I-2), (I-3) contained in the mixture, X has the same meaning.
1
1
The compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH [compound (I-5)]. “Minor amount” means less than 3% by weight, preferably less than 1% by weight, relative to the total weight of the compounds (I-1), (I-2) and (I-3) or a mixture thereof, including the compound I in which Ris OH.
2
1
3
1
4
1
In a particular embodiment, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond. In another particular embodiment, the compound of formula (I) is a compound (I-2), where Rtogether with Rrepresents a double bond. In another particular embodiment, the compound of formula (I) is a compound (I-3), where Rtogether with Rrepresents a double bond. Specifically, the compound of formula (I) is a compound (I-2).
In yet another particular embodiment, the compound of formula (I) is a mixture of at least two of the compounds (I-1), (I-2) and (I-3). More particularly, the mixture contains compound I-2 and one or both of compounds I-1 and I-3. In an alternative more particular embodiment, the mixture contains compounds I-1 and I-2 and optionally also compound I-3. In yet another alternative more particular embodiment, the mixture contains compounds (I-2) and (I-3); or contains all three compounds (I-1), (I-2) and (I-3).
In particular, the mixture contains compounds I-2 and I-3 and optionally also compound I-1, where compound I-1 is contained in an amount of from 0 to 10% by weight, compound I-2 is contained in an amount of from 1 to 80% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, I-2 and I-3. Preferably, the mixture is a mixture of double bond isomers, meaning that in compounds (I-2) and (I-3) contained in the mixture, X has the same meaning. Specifically, the mixture contains all three compounds (I-1), (I-2) and (I-3), where compound I-1 is contained in an amount of from 0.1 to 10% by weight, compound I-2 is contained in an amount of from 1 to 79.9% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, I-2 and I-3. Preferably, the mixture is a mixture of double bond isomers, meaning that in all compounds (I-1), (I-2), (I-3) contained in the mixture, X has the same meaning.
In a specific embodiment of the binary mixture of compounds (I-2) and (I-3), compound (I-3) predominates, i.e. it is present in an amount of more than 50% by weight, based on the weight of the mixture consisting of compounds (I-2) and (I-3). In particular, it is present in an amount of from 70 to 99% by weight, more particularly from 75 to 98% by weight and specifically from 75 to 95% by weight, based on the weight of the mixture consisting of compounds (I-2) and (I-3); the difference to 100% being the compound (I-2).
In a specific embodiment of the ternary mixture of compounds (I-1), (I-2) and (I-3), compound (I-2) predominates. In particular, it is present in an amount of from 50 to 80% by weight, more particularly from 55 to 75% by weight and specifically from 60 to 70% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). Specifically, in the ternary mixture the compound (I-3) is the second most frequent component, and is in particular present in an amount of from 15 to 45% by weight, more particularly from 20 to 40% by weight and specifically from 28 to 39.5% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). The compound (I-1) is specifically the minor compound and is in particular present in an amount of from 0.1 to 10% by weight, more particularly from 0.5 to 5% by weight and specifically from 0.5 to 2% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). As a matter of course, the percentages of compounds (I-1), (I-2) and (I-3) add to 100%.
In another specific embodiment of the ternary mixture of compounds (I-1), (I-2) and (I-3), compound (I-3) predominates. In particular, it is present in an amount of from 50 to 90% by weight, more particularly from 55 to 90% by weight and specifically from 55 to 85% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). Specifically, in the ternary mixture the compound (I-2) is the second most frequent component, and is in particular present in an amount of from 9 to 45% by weight, more particularly from 9 to 44.5% by weight and specifically from 13 to 44.5% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). The compound (I-1) is specifically the minor compound and is in particular present in an amount of from 0.1 to 10% by weight, more particularly from 0.5 to 5% by weight and specifically from 0.5 to 2% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). As a matter of course, the percentages of compounds (I-1), (I-2) and (I-3) add to 100%.
Specifically, the mixture contains compounds I-1, I-2 and I-3, where compound I-1 is contained in an amount of from 0.5 to 1.5% by weight, compound I-2 is contained in an amount of from 15 to 73.5% by weight, and compound I-3 is contained in an amount of from 25 to 84.5% by weight, relative to the total weight of compounds I-1, I-2 and I-3. As a matter of course, the percentages of compounds (I-1), (I-2) and (I-3) add to 100%.
As said, in such mixtures of at least two of the compounds (I-1), (I-2) and (I-3), in all compounds (I-1), (I-2), (I-3) contained in the mixture, X preferably has the same meaning.
1
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris hydrogen [the compound (I) being thus a compound (I-4)].
1
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris OH [the compound (I) being thus a compound (I-5)].
1
1
1
1
1
4
1
2
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris O—C-C-alkyl [the compound (I) being thus a compound (I-6)]. In particular Ris O—C-C-alkyl (i.e. Ris methoxy or ethoxy). Specifically, Ris methoxy.
1
5
5
5
1
1
4
1
2
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris O—(C═O)—R[the compound (I) being thus a compound (I-7)]. Preferably, Ris C-C-alkyl, in particular C-C-alkyl. Specifically, Ris methyl (i.e. Ris acetoxy).
2
1
3
1
4
1
1
1
1
1
2
1
3
1
4
1
1
1
1
2
1
3
1
4
1
1
More preferably, however, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond, or is a compound (I-2), where Rtogether with Rrepresents a double bond, or is a compound (I-3), where Rtogether with Rrepresents a double bond, or is a mixture of at least two compounds (I-1), (I-2) and (I-3) (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH); or is a compound (I) in which Ris hydrogen; or is a compound (I) in which Ris OH; or is a compound (I-1) in which Ris methoxy. In particular, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond, or is a compound (I-2), where Rtogether with Rrepresents a double bond, or is a compound (I-3), where Rtogether with Rrepresents a double bond, or is a mixture of at least two compounds (I-1), (I-2) and (I-3) (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH); or is a compound (I) in which Ris hydrogen; or is a compound (I) in which Ris OH. Specifically, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond, or is a compound (I-2), where Rtogether with Rrepresents a double bond, or is a compound (I-3), where Rtogether with Rrepresents a double bond, or is a mixture of at least two compounds (I-1), (I-2) and (I-3) (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH). The above mixtures are preferably mixtures of double bond isomers, in which X in all compounds (I) contained therein has the same meaning.
2
3
4
1
In a particular embodiment of the present invention, in compounds of the formula (I), X is O and one of R, R, Rtogether with Rrepresents a double bond.
2
1
3
1
4
1
1
1
In a more particular embodiment, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and in which X is O, or is a compound (I-2), where Rtogether with Rrepresents a double bond and in which X is O, or is a compound (I-3), where Rtogether with Rrepresents a double bond and in which X is O, or is a mixture of at least two compounds (I-1), (I-2) and (I-3) in which X is O. As already said above, the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH. “Minor amount” means less than 3% by weight, preferably less than 1% by weight, relative to the total weight of the compounds (I-1), (I-2) and (I-3) or a mixture thereof, including the compound I in which Ris OH.
2
1
3
1
4
1
In an even more particular embodiment, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is O. In another even more particular embodiment, the compound of formula (I) is a compound (I-2), where Rtogether with Rrepresents a double bond and X is O. In another even more particular embodiment, the compound of formula (I) is a compound (I-3), where Rtogether with Rrepresents a double bond and X is O. Specifically, the compound of formula (I) is a compound (I-2) in which X is O.
In yet another even more particular embodiment, the compound of formula (I) is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case X is O. More particularly, the mixture contains compounds (I-2) and (I-3) or contains all three compounds (I-1), (I-2) and (I-3), where in each case X is O.
In particular, the mixture contains compounds I-2 and I-3 and optionally also compound I-1, where in each case X is O; where compound I-1 is contained in an amount of from 0 to 10% by weight, compound I-2 is contained in an amount of from 1 to 80% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, 1-2 and I-3. Specifically, the mixture contains all three compounds (I-1), (I-2) and (I-3), where in each case X is O; where compound I-1 is contained in an amount of from 0.1 to 10% by weight, compound I-2 is contained in an amount of from 1 to 79.9% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, I-2 and I-3.
In a specific embodiment, the compound of formula (I) is a binary mixture of compounds (I-2) and (I-3), where in each case X is O and where compound (I-3) predominates, i.e. it is present in an amount of more than 50% by weight, based on the weight of the mixture consisting of compounds (I-2) and (I-3). In particular, it is present in an amount of from 70 to 99% by weight, more particularly from 75 to 98% by weight, specifically from 80 to 95% by weight, and very specifically from 90 to 95% by weight, based on the weight of the mixture consisting of compounds (I-2) and (I-3); the difference to 100% being the compound (I-2).
In a specific embodiment, the compound of formula (I) is a ternary mixture of compounds (I-1), (I-2) and (I-3), where in each case X is O and where compound (I-2) predominates. In particular, it is present in an amount of from 50 to 80% by weight, more particularly from 55 to 75% by weight and specifically from 60 to 70% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). Specifically, in the ternary mixture the compound (I-3) is the second most frequent component, and is in particular present in an amount of from 15 to 45% by weight, more particularly from 20 to 40% by weight and specifically from 28 to 39.5% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). The compound (I-1) is specifically the minor compound and is in particular present in an amount of from 0.1 to 10% by weight, more particularly from 0.5 to 5% by weight and specifically from 0.5 to 2% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). As a matter of course, the percentages of compounds (I-1), (I-2) and (I-3) add to 100%.
In another specific embodiment, the compound of formula (I) is a ternary mixture of compounds (I-1), (I-2) and (I-3), where in each case X is O and where compound (I-3) predominates. In particular, it is present in an amount of from 50 to 90% by weight, more particularly from 70 to 90% by weight and specifically from 75 to 85% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). Specifically, in the ternary mixture the compound (I-2) is the second most frequent component, and is in particular present in an amount of from 9 to 45% by weight, more particularly from 9 to 29.5% by weight and specifically from 13 to 24.5% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). The compound (I-1) is specifically the minor compound and is in particular present in an amount of from 0.1 to 10% by weight, more particularly from 0.5 to 5% by weight and specifically from 0.5 to 2% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). As a matter of course, the percentages of compounds (I-1), (I-2) and (I-3) add to 100%.
Specifically, the mixture contains compounds I-1, I-2 and I-3, where in each case X is O, where compound I-1 is contained in an amount of from 0.5 to 1.5% by weight, compound I-2 is contained in an amount of from 15 to 73.5% by weight, and compound I-3 is contained in an amount of from 25 to 84.5% by weight, relative to the total weight of compounds I-1, I-2 and I-3. As a matter of course, the percentages of compounds (I-1), (I-2) and (I-3) add to 100%.
1
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris hydrogen and X is O (the compound (I) being thus a compound (I-4) in which X is O).
1
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris OH and X is O (the compound (I) being thus a compound (I-5) in which X is O).
1
1
1
1
1
4
1
2
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris O—C-C-alkyl and X is O (the compound (I) being thus a compound (I-6) in which X is O). In particular Ris O—C-C-alkyl (i.e. Ris methoxy or ethoxy) and X is O. Specifically, Ris methoxy and X is O.
1
5
5
5
1
1
4
1
2
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris O—(C═O)—Rand X is O (the compound (I) being thus a compound (I-7) in which X is O). Preferably, Ris C-C-alkyl, in particular C-C-alkyl, and X is O. Specifically, Ris methyl (i.e. Ris acetoxy) and X is O.
2
1
3
1
4
1
1
1
1
1
2
1
3
1
4
1
1
1
1
2
1
3
1
4
1
1
More preferably, however, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is O, or is a compound (I-2), where Rtogether with Rrepresents a double bond and X is O, or is a compound (I-3), where Rtogether with Rrepresents a double bond and X is O, or is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case and X is O (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH and X is O); or is a compound (I) in which Ris hydrogen and X is O; or is a compound (I) in which Ris OH and X is O; or is a compound (I) in which Ris methoxy and X is O. In particular, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is O, or is a compound (I-2), where Rtogether with Rrepresents a double bond and X is O, or is a compound (I-3), where Rtogether with Rrepresents a double bond and X is O, or is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case and X is O (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH and X is O); or is a compound (I) in which Ris hydrogen and X is O; or is a compound (I) in which Ris OH and X is O. Specifically, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is O, or is a compound (I-2), where Rtogether with Rrepresents a double bond and X is O, or is a compound (I-3), where Rtogether with Rrepresents a double bond and X is O, or is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case X is O (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH and X is O).
2
3
4
1
In another particular embodiment of the present invention, in compounds of the formula (I), X is S and one of R, R, Rtogether with Rrepresents a double bond.
2
1
3
1
4
1
1
1
In another more particular embodiment, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and in which X is S, or is a compound (I-2), where Rtogether with Rrepresents a double bond and in which X is S. or is a compound (I-3), where Rtogether with Rrepresents a double bond and in which X is S, or is a mixture of at least two compounds (I-1), (I-2) and (I-3) in which X is S. As already said above, the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH. “Minor amount” means less than 3% by weight, preferably less than 1% by weight, relative to the total weight of the compounds (I-1), (I-2) and (I-3) or a mixture thereof, including the compound I in which Ris OH.
2
1
3
1
4
1
In another even more particular embodiment, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is S. In another even more particular embodiment, the compound of formula (I) is a compound (I-2), where Rtogether with Rrepresents a double bond and X is S. In another even more particular embodiment, the compound of formula (I) is a compound (I-3), where Rtogether with Rrepresents a double bond and X is S. Specifically, the compound of formula (I) is a compound (I-2) in which X is S.
In yet another particular embodiment, the compound of formula (I) is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case X is S. More particularly, the mixture contains compounds (I-2) and (I-3) or contains all three compounds (I-1), (I-2) and (I-3), where in each case X is S.
In particular, the mixture contains compounds I-2 and I-3 and optionally also compound I-1, where in each case X is S; where compound I-1 is contained in an amount of from 0 to 10% by weight, compound I-2 is contained in an amount of from 1 to 80% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, I-2 and I-3. Specifically, the mixture contains all three compounds (I-1), (I-2) and (I-3), where in each case X is S; where compound I-1 is contained in an amount of from 0.1 to 10% by weight, compound I-2 is contained in an amount of from 1 to 79.9% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, I-2 and I-3.
In a specific embodiment, the compound of formula (I) is a binary mixture of compounds (I-2) and (I-3), where in each case X is S and where compound (I-3) predominates, i.e. it is present in an amount of more than 50% by weight, based on the weight of the mixture consisting of compounds (I-2) and (I-3). In particular, it is present in an amount of from 50 to 99% by weight, more particularly from 55 to 90% by weight and specifically from 55 to 80% by weight, based on the weight of the mixture consisting of compounds (I-2) and (I-3); the difference to 100% being the compound (I-2).
In a specific embodiment, the compound of formula (I) is a ternary mixture of compounds (I-1), (I-2) and (I-3), where in each case X is S and where compound (I-3) predominates. In particular, it is present in an amount of from 50 to 80% by weight, more particularly from 55 to 75% by weight and specifically from 55 to 70% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). Specifically, in the ternary mixture the compound (I-2) is the second most frequent component, and is in particular present in an amount of from 10 to 45% by weight, more particularly from 20 to 44.5% by weight and specifically from 25 to 43% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). The compound (I-1) is specifically the minor compound and is in particular present in an amount of from 0.1 to 10% by weight, more particularly from 0.5 to 5% by weight and specifically from 0.5 to 2% by weight, based on the weight of the mixture consisting of compounds (I-1), (I-2) and (I-3). As a matter of course, the percentages of compounds (I-1), (I-2) and (I-3) add to 100%.
1
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris hydrogen and X is S (the compound (I) being thus a compound (I-4) in which X is S).
1
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris OH and X is S (the compound (I) being thus a compound (I-5) in which X is S).
1
1
1
1
1
4
1
2
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris O—C-C-alkyl and X is S (the compound (I) being thus a compound (I-6) in which X is S). In particular Ris O—C-C-alkyl (i.e. Ris methoxy or ethoxy) and X is S. Specifically, Ris methoxy and X is S.
1
5
5
1
4
1
2
In another preferred embodiment of the present invention, in compounds of the general formula (I), Ris O—(C═O)—Rand X is S (the compound (I) being thus a compound (I-7) in which X is S). Preferably, Ris C-C-alkyl, in particular C-C-alkyl, and X is S.
5
1
Specifically, Ris methyl (i.e. Ris acetoxy) and X is S.
2
1
3
1
4
1
1
1
1
2
1
3
1
4
1
1
1
2
1
3
1
4
1
1
More preferably however, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is S, or is a compound (I-2), where Rtogether with Rrepresents a double bond and X is S, or is a compound (I-3), where Rtogether with Rrepresents a double bond and X is S, or is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case and X is S (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH and X is S); or is a compound (I) in which Ris hydrogen and X is S; or is a compound (I) in which Ris OH and X is S. In particular, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is S, or is a compound (I-2), where Rtogether with Rrepresents a double bond and X is S, or is a compound (I-3), where Rtogether with Rrepresents a double bond and X is S, or is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case and X is S (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH and X is S); or is a compound (I) in which Ris OH and X is S. Specifically, the compound of formula (I) is a compound (I-1), where Rtogether with Rrepresents a double bond and X is S, or is a compound (I-2), where Rtogether with Rrepresents a double bond and X is S, or is a compound (I-3), where Rtogether with Rrepresents a double bond and X is S, or is a mixture of at least two compounds (I-1), (I-2) and (I-3), where in each case X is S (where the compound (I-1), the compound (I-2), the compound (I-3) or the mixture of at least two compounds (I-1), (I-2) and (I-3) may contain a minor amount of a compound I in which Ris OH and X is S).
The compounds of formula (I), the stereoisomers thereof, the mixtures of stereoisomers thereof and mixtures of two or more different compounds (I) are useful as aroma chemicals.
The term “aroma chemical” denotes a substance which is used to obtain a sensory impression, to be more precise an olfactory or flavor impression, in particular a fragrance or flavor impression. The term “olfactory” denotes an odor impression without any positive or negative judgement, while the term “fragrance” (also termed “perfume” or “scent”) is connected to an odor impression which is generally felt as pleasant. A flavor induces a taste impression.
“Pleasant odor”, “pleasant odor impression”, “pleasant odiferous properties”, “odor impression felt as pleasant” and similar terms are hedonistic expressions which describe the niceness and conciseness of an odor impression conveyed by an aroma chemical. The more general hedonistic expressions “advantageous sensory properties” or “advantageous organoleptic properties” describe the niceness and conciseness of an organoleptic impression conveyed by an aroma chemical. In terms of the present invention, the terms “organoleptic” and “sensory” relate to olfactory or flavor properties. “Niceness” and “conciseness” are terms which are familiar to the person skilled in the art, a perfumer. Niceness generally refers to a spontaneously brought about, positively perceived, pleasant sensory impression. However, “nice” does not have to be synonymous with “sweet”. “Nice” can also be the odor of musk or sandalwood. “Conciseness” generally refers to a spontaneously brought about sensory impression which—for the same test panel—brings about a reproducibly identical reminder of something specific. For example, a substance can have an odor which is spontaneously reminiscent of that of an “apple”: the odor would then be concisely of “apples”. If this apple odor were very pleasant because the odor is reminiscent, for example, of a sweet, fully ripe apple, the odor would be termed “nice”. However, the odor of a typically tart apple can also be concise. If both reactions arise upon smelling the substance, in the example thus a nice and concise apple odor, then this substance has particularly advantageous sensory properties.
3
The term “odor-intensive substances” refers to substances or aroma chemicals exhibiting intense odor impressions. Intense odor impressions are to be understood as meaning those properties of aroma chemicals which permit a striking perception even in very low gas space concentrations. The intensity can be determined via a threshold value determination. A threshold value is the concentration of a substance in the relevant gas space at which an odor impression can just still be perceived by a representative test panel, although it no longer has to be defined. A substance class which probably belongs to the most odor-intensive known substance classes, i.e. has very low odor threshold values, are thiols, whose threshold value is often in the ppb/mrange.
Preferably, the compound of formula (I) or a mixture thereof or a stereoisomer thereof or a mixture of stereoisomers thereof as defined above is used for imparting an olfactory impression. In particular, the compound of formula (I) or a mixture thereof or a stereoisomer thereof or a mixture of stereoisomers thereof as defined above is used as a fragrance.
galbanum
galbanum
In particular, a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof is used to impart a , herbal, smoky, leather note; or is used to produce a scent with a , herbal, smoky, leather note. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is O, are present in a weight ratio of ca. 1:65.5:33.5.
galbanum
galbanum
In particular, a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof is used to impart a herbal, smoky, spicy, nutmeg, , leather, oakmoss note; or is used to produce a scent with a herbal, smoky, spicy, nutmeg, , leather, oakmoss note. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is O, are present in a weight ratio of ca. 1:19.5:79.5.
In particular, a mixture of the above-described compounds (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof is used to impart a spicy, nutmeg, smoky, tobacco, leather, phenol note; or is used to produce a scent with a spicy, nutmeg, smoky, tobacco, leather, phenol note. Specifically, compounds (I-2) and (I-3), wherein X is O, are present in a weight ratio of 7:92.
galbanum
galbanum
In particular, compound (I-2), wherein X is O, or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a root, , leather, spicy note; or is used to produce a scent with a root, , leather, spicy note.
1
2
3
4
In particular, the compound (I) wherein Ris H and X is O (and of course R, Rand Rare H) (=a compound (I-4) wherein X═O) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a smoked, lime, hickory, green, sweet note; or is used to produce a scent with a smoked, lime, hickory, green, sweet note.
1
2
3
4
galbanum
galbanum
In particular, the compound (I) wherein Ris OH and X is O (and of course R, Rand Rare H) (=a compound (I-5) wherein X═O) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a , floral note; or is used to produce a scent with a , floral note.
1
2
3
4
3
In particular, the compound (I) wherein Ris OCHand X is O (and of course R, Rand Rare H) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a watery, melon, slightly bitter note; or is used to produce a scent with a watery, melon, slightly bitter note.
In particular, a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is S, or a mixture of stereoisomers thereof is used to impart a green, herbal, chives, woody note; or is used to produce a scent with a green, herbal, chives, woody note. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is S, are present in a weight ratio of 1:39:60.
1
2
3
4
In particular, the compound (I) wherein Ris OH and X is S (and of course R, Rand Rare H) (=a compound (I-5) wherein X═S) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a beer, burnt note; or is used to produce a scent with a beer, burnt note.
The compounds (I), the mixtures thereof, the stereoisomers thereof or the stereoisomer mixtures thereof are generally used in a ready-to-use composition, in particular in a fragranced ready-to-use composition. “Fragranced ready-to-use composition”, as used herein, refers to a ready-to-use composition which predominately induces a pleasant odor impression.
Fragranced ready-to-use compositions are for example compositions used in personal care, in home care, in industrial applications as well as compositions used in other applications, such as pharmaceutical compositions or crop protection compositions.
Preferably, the compounds (I), the mixtures thereof, the stereoisomers thereof or the stereoisomer mixtures thereof are used in a composition selected from the group consisting of perfume compositions, body care compositions (including cosmetic compositions), products for oral and dental hygiene, hygiene articles, cleaning compositions (including dishwashing compositions), textile detergent compositions, compositions for scent dispensers, foods, food supplements, pharmaceutical compositions and crop protection compositions. The compounds (I), the stereoisomers thereof, the stereoisomer mixtures thereof or the double bond isomers thereof are used as an aroma chemical, preferably as a fragrance, in the above compositions.
galbanum
In particular, a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof is used to impart a , herbal, smoky, leather note to the above-listed compositions. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is O, are present in a weight ratio of ca. 1:65.5:33.5.
galbanum
In particular, a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is O or a mixture of stereoisomers thereof is used to impart a herbal, smoky, spicy, nutmeg, , leather, oakmoss note to the above-listed compositions. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is O, are present in a weight ratio of ca. 1:19.5:79.5.
In particular, a mixture of the above-described compounds (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof is used to impart a spicy, nutmeg, smoky, tobacco, leather, phenol note to the above-listed compositions. Specifically, compounds (I-2) and (I-3), wherein X is O, are present in a weight ratio of 7:92.
galbanum
In particular, compound (I-2), wherein X is O, or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a root, , leather, spicy note to the above-listed compositions.
1
2
3
4
In particular, the compound (I) wherein Ris H and X is O (and of course R, Rand Rare H) (=a compound (I-4) wherein X═O) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a smoked, lime, hickory, green, sweet note to the above-listed compositions.
1
2
3
4
galbanum
In particular, the compound (I) wherein Ris OH and X is O (and of course R, Rand Rare H) (=a compound (I-5) wherein X═O) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a , floral note to the above-listed compositions.
1
2
3
4
3
In particular, the compound (I) wherein Ris OCHand X is O (and of course R, Rand Rare H) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a watery, melon, slightly bitter note to the above-listed compositions.
In particular, a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is S, or a mixture of stereoisomers thereof is used to impart a green, herbal, chives, woody note to the above-listed compositions. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is S, are present in a weight ratio of 1:39:60.
1
2
3
4
In particular, the compound (I) wherein Ris OH and X is S (and of course R, Rand Rare H) (=a compound (I-5) wherein X═S) or a stereoisomer thereof or a mixture of stereoisomers thereof is used to impart a beer, burnt note to the above-listed compositions.
Details to the above-listed compositions are given below.
In addition to the olfactory properties, the compounds (I), the mixtures thereof, the stereoisomers thereof or the stereoisomer mixtures thereof exhibit advantageous secondary properties.
For example, they can provide better sensory profiles as a result of synergistic effects with other fragrances, which means that they can provide a booster effect for other fragrances. They are therefore suitable as boosters for other fragrances.
Accordingly, another aspect of the invention relates to the use of the compounds (I), the mixtures thereof, the stereoisomers thereof or the stereoisomer mixtures thereof for modifying the scent character of a fragranced composition; and specifically to the use as a booster for other fragrances.
Booster effect means that the substances enhance and intensify in perfumery formulations the overall impression of the mixture. In the mint range, for example, it is known that menthyl methyl ether intensifies the perfumery or taste mixtures of peppermint oils and particularly in top notes brings about a considerably more intensive and more complex perception although the ether itself, being a pure substance, develops no particular intensive odor at all. In fragrance applications, Hedione® (methyl dihydrojasmonate), which as a pure substance only exhibits a light floral jasmin-note, reinforces diffusion, freshness and volume of a perfume composition as an odor booster. Booster effects are particularly desired when top-note-characterized applications are required, in which the odor impression is to be conveyed particularly quickly and intensively, for example in deodorants, air fresheners or in the taste sector in chewing gums.
To achieve such a booster effect, the compounds (I), the mixtures thereof, the stereoisomers thereof or the stereoisomer mixtures thereof are generally used in an amount of 0.1-20% by weight, preferably in an amount of 0.5 to 5% by weight, in particular in an amount of from 0.6 to 3% by weight, based on the total weight of the fragrance mixture.
Furthermore, the compounds (I), the mixtures thereof, the stereoisomers thereof or the stereoisomer mixtures thereof can have further positive effects on the composition in which they are used. For example, they can enhance the overall performance of the composition into which they are incorporated, such as the stability, e.g. the formulation stability, the extendability or the staying power of the composition.
In another aspect, the present invention relates to an aroma chemical composition comprising the compounds (I), mixtures thereof, the stereoisomers thereof or stereoisomer mixtures thereof. The term “aroma chemical composition”, as used herein, refers to a composition which induces a pleasant odor impression.
a compound of formula (I) or a mixture thereof [i.e. mixture of different compounds (I)], or a stereoisomer thereof or a stereoisomer mixture thereof; and
at least one further aroma chemical and/or at least one non-aroma chemical carrier, where the non-aroma chemical carrier is in particular selected from the group consisting of surfactants, oil components (emollients) and solvents.
Preferably, the aroma chemical composition comprises
The further aroma chemical is of course different from the compound of formula (I) or its stereoisomers or mixtures of its stereoisomers.
By virtue of their physical properties, the compound of formula (I), the mixtures thereof, the stereoisomers thereof or the stereoisomer mixtures thereof have particularly good, virtually universal solvent properties for other fragrances and other customary ingredients in fragranced ready to use compositions such as, in particular, perfume compositions. Therefore, they are well combinable with other aroma chemicals, allowing, in particular, the creation of perfume compositions having novel advantageous sensory profiles. Especially, as already explained above, they can provide a booster effect for other fragrances.
Accordingly, in one preferred embodiment, the aroma chemical composition comprises the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above; and at least one further aroma chemical.
The further aroma chemical can for example be one, preferably 2, 3, 4, 5, 6, 7, 8 or further aroma chemicals, selected from the group consisting of:
1
9
9
3
2a
1
3
1
1
3
9
1
1
10
9
1
1
1
2
2
3
1
1
1
2
2a
3
5
9
10
Geranyl acetate (3,7-Dimethyl-2,6 octadien-1yl acetate), alpha-hexylcinnamaldehyde, 2-phenoxyethyl isobutyrate (Phenirat), dihydromyrcenol (2,6-dimethyl-7-octen-2-ol), methyl dihydrojasmonate (preferably with a content of cis isomer of more than 60% by weight) (Hedione, Hedione HC), 4,6,6,7,8,8-hexamethyl-1,3,4,6,7,8-hexahydro-cyclopenta[g]benzopyran (Galaxolid), tetrahydrolinalool (3,7-dimethyloctan-3-ol), ethyllinalool, benzyl salicylate, 2-methyl-3-(4-tert-butylphenyl)propanal (Lysmeral), cinnamyl alcohol, 4,7-methano-3a,4,5,6,7,7a-hexahydro-5-indenyl acetate and/or 4,7-methano-3a,4,5,6,7,7a-hexahydro-6-indenyl acetate (Herbaflorat), citronellol, citronellyl acetate, tetrahydrogeraniol, vanillin, linalyl acetate, styrolyl acetate (1-phenylethyl acetate), octahydro-2,3,8,8-tetramethyl-2-acetonaphthone and/or 2-acetyl-1,2,3,4,6,7,8-octahydro-2,3,8,8-tetramethylnaphthalene (Iso E Super), hexyl salicylate, 4-tert-butylcyclohexyl acetate (Oryclone), 2-tert-butylcyclohexyl acetate (Agrumex HC), alpha-ionone (4-(2,2,6-trimethyl-2-cyclohexen-1-yl)-3-buten-2-one), n-alpha-methylionone, alpha-isomethylionone, coumarin, terpinyl acetate, 2-phenylethyl alcohol, 4-(4-hydroxy-4-methylpentyl)-3-cyclohexenecarboxaldehyde (Lyral), alpha-amylcinnamaldehyde, ethylene brassylate, (E)- and/or (Z)-3-methylcyclopentadec-5-enone (Muscenon), 15-pentadec-11-enolide and/or 15-pentadec-12-enolide (Globalide), 15-cyclopentadecanolide (Macrolide), 1-(5,6,7,8-tetrahydro-3,5,5,6,8,8-hexamethyl-2-naphthalenyl)ethanone (Tonalid), 2-isobutyl-4-methyltetrahydro-2H-pyran-4-ol (Florol), 2-ethyl-4-(2,2,3-trimethyl-3-cyclopenten-1-yl)-2-buten-1-ol (Sandolen), cis-3-hexenyl acetate, trans-3-hexenyl acetate, trans-2/cis-6-nonadienol, 2,4-dimethyl-3-cyclohexenecarboxaldehyde (Vertocitral), 2,4,4,7-tetramethyloct-6-en-3-one (Claritone), 2,6-dimethyl-5-hepten-1-al (Melonal), borneol, 3-(3-isopropylphenyl)butanal (Florhydral), 2-methyl-3-(3,4-methylenedioxyphenyl)-propanal (Helional), 3-(4-ethylphenyl)-2,2-dimethylpropanal (Florazon), 7-methyl-2H-1,5-benzodioxepin-3(4H)-one (Calone), 3,3,5-trimethylcyclohexyl acetate (preferably with a content of cis isomers of 70% by weight) or more and 2,5,5-trimethyl-1,2,3,4,4a,5,6,7-octahydronaphthalen-2-ol (Ambrinol S). Within the context of the present invention, the aforementioned aroma chemical(s) are accordingly preferably combined with the compound of formula (I) or a stereoisomer thereof or a mixture of stereoisomers thereof or a double bond isomer thereof as defined above. trade name of Symrise GmbH, Germany;trade name of Givaudan AG, Switzerland;trade name of BASF SE, Germany;trade name of International Flavors & Fragrances Inc., USA;trade name of Danisco Seillans S.A., France;trade name of Firmenich S.A., Switzerland;trade name of PFW Aroma Chemicals B.V., the Netherlands.
A further embodiment of the invention relates to a composition comprising the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above and at least one further aroma chemical selected from the group consisting of methyl benzoate, benzyl acetate, geranyl acetate, 2-isobutyl-4-methyltetrahydro-2H-pyran-4-ol and linalool.
A further embodiment of the invention relates to a composition comprising the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above and 2-isobutyl-4-methyltetrahydro-2H-pyran-4-ol.
A further embodiment of the invention relates to a composition comprising the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above and methyl benzoate.
Where trade names are given above, these refer to the following sources:
Further aroma chemicals with which the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above can be combined e.g. to give a composition according to the invention can be found e.g. in S. Arctander, Perfume and Flavor Chemicals, Vol. I and II, Montclair, N. J., 1969, self-published or K. Bauer, D. Garbe and H. Surburg, Common Fragrance and Flavor Materials, 4th Ed., Wiley-VCH, Weinheim 2001. Specifically, mention may be made of:
angelica
angelica
cananga
cassia
cassia
eucalyptus citriodora
eucalyptus
galbanum
galbanum
litsea cubeba
massoia
mimosa
origanum
perilla
styrax
tagetes
verbena
extracts from natural raw materials such as essential oils, concretes, absolutes, resins, resinoids, balsams, tinctures such as e.g.
ambergris tincture; amyris oil; seed oil; root oil; aniseed oil; valerian oil; basil oil; tree moss absolute; bay oil; mugwort oil; benzoin resin; bergamot oil; beeswax absolute; birch tar oil; bitter almond oil; savory oil; buchu leaf oil; cabreuva oil; cade oil; calmus oil; camphor oil; oil; cardamom oil; cascarilla oil; oil; absolute; castoreum absolute; cedar leaf oil; cedar wood oil; cistus oil; citronella oil; lemon oil; copaiba balsam; copaiba balsam oil; coriander oil; costus root oil; cumin oil; cypress oil; davana oil; dill weed oil; dill seed oil; Eau de brouts absolute; oak moss absolute; elemi oil; tarragon oil; oil; oil; fennel oil; pine needle oil; oil; resin; geranium oil; grapefruit oil; guaiacwood oil; gurjun balsam; gurjun balsam oil; helichrysum absolute; helichrysum oil; ginger oil; iris root absolute; iris root oil; jasmine absolute; calmus oil; camomile oil blue; roman camomile oil; carrot seed oil; cascarilla oil; pine needle oil; spearmint oil; caraway oil; labdanum oil; labdanum absolute; labdanum resin; lavandin absolute; lavandin oil; lavender absolute; lavender oil; lemongrass oil; lovage oil; lime oil distilled; lime oil pressed; linalool oil; oil; laurel leaf oil; mace oil; marjoram oil; mandarin oil; bark oil; absolute; musk seed oil; musk tincture; clary sage oil; nutmeg oil; myrrh absolute; myrrh oil; myrtle oil; clove leaf oil; clove flower oil; neroli oil; olibanum absolute; olibanum oil; opopanax oil; orange blossom absolute; orange oil; oil; palmarosa oil; patchouli oil; oil; peru balsam oil; parsley leaf oil; parsley seed oil; petitgrain oil; peppermint oil; pepper oil; pimento oil; pine oil; pennyroyal oil; rose absolute; rose wood oil; rose oil; rosemary oil; Dalmatian sage oil; Spanish sage oil; sandalwood oil; celery seed oil; spike-lavender oil; star anise oil; oil; oil; fir needle oil; tea tree oil; turpentine oil; thyme oil; tolubalsam; tonka absolute; tuberose absolute; vanilla extract; violet leaf absolute; oil; vetiver oil; juniper berry oil; wine lees oil; wormwood oil; winter green oil; hyssop oil; civet absolute; cinnamon leaf oil; cinnamon bark oil, and fractions thereof, or ingredients isolated therefrom;
individual fragrances from the group of hydrocarbons, such as e.g. 3-carene; alpha-pinene; beta-pinene; alpha-terpinene; gamma-terpinene; p-cymene; bisabolene; camphene; caryophyllene; cedrene; farnesene; limonene; longifolene; myrcene; ocimene; valencene; (E,Z)-1,3,5-undecatriene; styrene; diphenylmethane;
the aliphatic alcohols such as e.g. hexanol; octanol; 3-octanol; 2,6-dimethylheptanol; 2-methyl-2-heptanol; 2-methyl-2-octanol; (E)-2-hexenol; (E)- and (Z)-3-hexenol; 1-octen-3-ol; mixture of 3,4,5,6,6-pentamethyl-3/4-hepten-2-ol and 3,5,6,6-tetramethyl-4-methyleneheptan-2-ol; (E,Z)-2,6-nonadienol; 3,7-dimethyl-7-methoxyoctan-2-ol; 9-decenol; 10-undecenol; 4-methyl-3-decen-5-ol;
the aliphatic aldehydes and acetals thereof such as e.g. hexanal; heptanal; octanal; nonanal; decanal; undecanal; dodecanal; tridecanal; 2-methyloctanal; 2-methylnonanal; (E)-2-hexenal; (Z)-4-heptenal; 2,6-dimethyl-5-heptenal; 10-undecenal; (E)-4-decenal; 2-dodecenal; 2,6,10-trimethyl-9-undecenal; 2,6,10-trimethyl-5,9-undecadienal; heptanal diethylacetal; 1,1-dimethoxy-2,2,5-trimethyl-4-hexene; citronellyloxyacetaldehyde; (E/Z)-1-(1-methoxypropoxy)-hex-3-ene; the aliphatic ketones and oximes thereof such as e.g. 2-heptanone; 2-octanone; 3-octanone; 2-nonanone; 5-methyl-3-heptanone; 5-methyl-3-heptanone oxime; 2,4,4,7-tetramethyl-6-octen-3-one; 6-methyl-5-hepten-2-one;
the aliphatic sulfur-containing compounds such as e.g. 3-methylthiohexanol; 3-methylthiohexyl acetate; 3-mercaptohexanol; 3-mercaptohexyl acetate; 3-mercaptohexyl butyrate; 3-acetylthiohexyl acetate; 1-menthene-8-thiol;
the aliphatic nitriles such as e.g. 2-nonenenitrile; 2-undecenenitrile; 2-tridecenenitrile; 3,12-tridecadienenitrile; 3,7-dimethyl-2,6-octadienenitrile; 3,7-dimethyl-6-octenenitrile;
the esters of aliphatic carboxylic acids such as e.g. (E)- and (Z)-3-hexenyl formate; ethyl acetoacetate; isoamyl acetate; hexyl acetate; 3,5,5-trimethylhexyl acetate; 3-methyl-2-butenyl acetate; (E)-2-hexenyl acetate; (E)- and (Z)-3-hexenyl acetate; octyl acetate; 3-octyl acetate; 1-octen-3-yl acetate; ethyl butyrate; butyl butyrate; isoamyl butyrate; hexyl butyrate; (E)- and (Z)-3-hexenyl isobutyrate; hexyl crotonate; ethyl isovalerate; ethyl 2-methylpentanoate; ethyl hexanoate; allyl hexanoate; ethyl heptanoate; allyl heptanoate; ethyl octanoate; ethyl (E,Z)-2,4-decadienoate; methyl 2-octinate; methyl 2-noninate; allyl 2-isoamyloxy acetate; methyl-3,7-dimethyl-2,6-octadienoate; 4-methyl-2-pentyl crotonate;
the acyclic terpene alcohols such as e.g. geraniol; nerol; linalool; lavandulol; nerolidol; farnesol; tetrahydrolinalool; 2,6-dimethyl-7-octen-2-ol; 2,6-dimethyloctan-2-ol; 2-methyl-6-methylene-7-octen-2-ol; 2,6-dimethyl-5,7-octadien-2-ol; 2,6-dimethyl-3,5-octadien-2-ol; 3,7-dimethyl-4,6-octadien-3-ol; 3,7-dimethyl-1,5,7-octatrien-3-ol; 2,6-dimethyl-2,5,7-octatrien-1-ol; and the formates, acetates, propionates, isobutyrates, butyrates, isovalerates, pentanoates, hexanoates, crotonates, tiglinates and 3-methyl-2-butenoates thereof;
the acyclic terpene aldehydes and ketones such as e.g. geranial; neral; citronellal; 7-hydroxy-3,7-dimethyloctanal; 7-methoxy-3,7-dimethyloctanal; 2,6,10-trimethyl-9-undecenal; geranyl acetone; as well as the dimethyl- and diethylacetals of geranial, neral, 7-hydroxy-3,7-dimethyloctanal; the cyclic terpene alcohols such as e.g. menthol; isopulegol; alpha-terpineol; terpine-4-ol; menthan-8-ol; menthan-1-ol; menthan-7-ol; borneol; isoborneol; linalool oxide; nopol; cedrol; ambrinol; vetiverol; guajol; and the formates, acetates, propionates, isobutyrates, butyrates, isovalerates, pentanoates, hexanoates, crotonates, tiglinates and 3-methyl-2-butenoates thereof;
the cyclic terpene aldehydes and ketones such as e.g. menthone; isomenthone; 8-mercaptomenthan-3-one; carvone; camphor; fenchone; alpha-ionone; beta-ionone; alpha-n-methylionone; beta-n-methylionone; alpha-isomethylionone; beta-isomethylionone; alpha-irone; alpha-damascone; beta-damascone; beta-damascenone; delta-damascone; gamma-damascone; 1-(2,4,4-trimethyl-2-cyclohexen-1-yl)-2-buten-1-one; 1,3,4,6,7,8a-hexahydro-1,1,5,5-tetramethyl-2H-2,4a-methano-naphthalene-8(5H)-one; 2-methyl-4-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2-butenal; nootkatone; dihydronootkatone; 4,6,8-megastigmatrien-3-one; alpha-sinensal; beta-sinensal; acetylated cedar wood oil (methyl cedryl ketone);
the cyclic alcohols such as e.g. 4-tert-butylcyclohexanol; 3,3,5-trimethylcyclohexanol; 3-isocamphylcyclohexanol; 2,6,9-trimethyl-Z2,Z5,E9-cyclododecatrien-1-ol; 2-isobutyl-4-methyltetrahydro-2H-pyran-4-ol;
the cycloaliphatic alcohols such as e.g. alpha-3,3-trimethylcyclohexylmethanol; 1-(4-isopropylcyclohexyl)ethanol; 2-methyl-4-(2,2,3-trimethyl-3-cyclopent-1-yl)butanol; 2-methyl-4-(2,2,3-trimethyl-3-cyclopent-1-yl)-2-buten-1-ol; 2-ethyl-4-(2,2,3-trimethyl-3-cyclopent-1-yl)-2-buten-1-ol; 3-methyl-5-(2,2,3-trimethyl-3-cyclopent-1-yl)pentan-2-ol; 3-methyl-5-(2,2,3-trimethyl-3-cyclopent-1-yl)-4-penten-2-ol; 3,3-dimethyl-5-(2,2,3-trimethyl-3-cyclopent-1-yl)-4-penten-2-ol; 1-(2,2,6-trimethylcyclohexyl)pentan-3-ol; 1-(2,2,6-trimethylcyclohexyl)hexan-3-ol;
the cyclic and cycloaliphatic ethers such as e.g. cineol; cedryl methyl ether; cyclododecyl methyl ether; 1,1-dimethoxycyclododecane; (ethoxymethoxy)cyclo-dodecane; alpha-cedrene epoxide; 3a,6,6,9a-tetramethyldodecahydronaphtho[2,1-b]furan; 3a-ethyl-6,6,9a-trimethyldodecahydronaphtho[2,1-b]furan; 1,5,9-trimethyl-13-oxabicyclo-[10.1.0]trideca-4,8-diene; roseoxide; 2-(2,4-dimethyl-3-cyclohexen-1-yl)-5-methyl-5-(1-methylpropyl)-1,3-dioxane;
the cyclic and macrocyclic ketones such as e.g. 4-tert-butylcyclohexanone; 2,2,5-trimethyl-5-pentylcyclopentanone; 2-heptylcyclopentanone; 2-pentylcyclopentanone; 2-hydroxy-3-methyl-2-cyclopenten-1-one; 3-methyl-cis-2-penten-1-yl-2-cyclopenten-1-one; 3-methyl-2-pentyl-2-cyclopenten-1-one; 3-methyl-4-cyclopentadecenone; 3-methyl-5-cyclopentadecenone; 3-methylcyclopentadecanone; 4-(1-ethoxyvinyl)-3,3,5,5-tetramethylcyclohexanone; 4-tert-pentylcyclohexanone; 5-cyclohexadecen-1-one; 6,7-dihydro-1,1,2,3,3-pentamethyl-4(5H)-indanone; 8-cyclo-hexadecen-1-one; 7-cyclohexadecen-1-one; (7/8)-cyclohexadecen-1-one; 9-cyclo-heptadecen-1-one; cyclopentadecanone; cyclohexadecanone;
the cycloaliphatic aldehydes such as e.g. 2,4-dimethyl-3-cyclohexenecarbaldehyde; 2-methyl-4-(2,2,6-trimethylcyclohexen-1-yl)-2-butenal; 4-(4-hydroxy-4-methylpentyl)-3-cyclohexene carbaldehyde; 4-(4-methyl-3-penten-1-yl)-3-cyclohexenecarbaldehyde;
the cycloaliphatic ketones such as e.g. 1-(3,3-dimethylcyclohexyl)-4-penten-1-one; 2,2-dimethyl-1-(2,4-dimethyl-3-cyclohexen-1-yl)-1-propanone; 1-(5,5-dimethyl-1-cyclo-hexen-1-yl)-4-penten-1-one; 2,3,8,8-tetramethyl-1,2,3,4,5,6,7,8-octahydro-2-naphthalenyl methyl ketone; methyl 2,6,10-trimethyl-2,5,9-cyclododecatrienyl ketone; tert-butyl (2,4-dimethyl-3-cyclohexen-1-yl) ketone;
the esters of cyclic alcohols such as e.g. 2-tert-butylcyclohexyl acetate; 4-tert-butylcyclohexyl acetate; 2-tert-pentylcyclohexyl acetate; 4-tert-pentylcyclohexyl acetate; 3,3,5-trimethylcyclohexyl acetate; decahydro-2-naphthyl acetate; 2-cyclopentylcyclopentyl crotonate; 3-pentyltetrahydro-2H-pyran-4-yl acetate; decahydro-2,5,5,8a-tetramethyl-2-naphthyl acetate; 4,7-methano-3a,4,5,6,7,7a-hexahydro-5 or 6-indenyl acetate; 4,7-methano-3a,4,5,6,7,7a-hexahydro-5 or 6-indenyl propionate; 4,7-methano-3a,4,5,6,7,7a-hexahydro-5 or 6-indenyl isobutyrate; 4,7-methanooctahydro-5 or 6-indenyl acetate;
the esters of cycloaliphatic alcohols such as e.g. 1-cyclohexylethyl crotonate;
the esters of cycloaliphatic carboxylic acids such as e.g. allyl 3-cyclohexylpropionate; allyl cyclohexyloxyacetate; cis- and trans-methyl dihydrojasmonate; cis- and trans-methyl jasmonate; methyl 2-hexyl-3-oxocyclopentanecarboxylate; ethyl 2-ethyl-6,6-dimethyl-2-cyclohexenecarboxylate; ethyl 2,3,6,6-tetramethyl-2-cyclohexenecarboxylate; ethyl 2-methyl-1,3-dioxolane-2-acetate;
the araliphatic alcohols such as e.g. benzyl alcohol; 1-phenylethyl alcohol, 2-phenylethyl alcohol, 3-phenylpropanol; 2-phenylpropanol; 2-phenoxyethanol; 2,2-dimethyl-3-phenylpropanol; 2,2-dimethyl-3-(3-methylphenyl)propanol; 1,1-dimethyl-2-phenylethyl alcohol; 1,1-dimethyl-3-phenylpropanol; 1-ethyl-1-methyl-3-phenylpropanol; 2-methyl-5-phenylpentanol; 3-methyl-5-phenylpentanol; 3-phenyl-2-propen-1-ol; 4-methoxybenzyl alcohol; 1-(4-isopropylphenyl)ethanol;
the esters of araliphatic alcohols and aliphatic carboxylic acids such as e.g. benzyl acetate; benzyl propionate; benzyl isobutyrate; benzyl isovalerate; 2-phenylethyl acetate; 2-phenylethyl propionate; 2-phenylethyl isobutyrate; 2-phenylethyl isovalerate; 1-phenylethyl acetate; alpha-trichloromethylbenzyl acetate; alpha,alpha-dimethylphenylethyl acetate; alpha,alpha-dimethylphenylethyl butyrate; cinnamyl acetate; 2-phenoxyethyl isobutyrate; 4-methoxybenzyl acetate;
the araliphatic ethers such as e.g. 2-phenylethyl methyl ether; 2-phenylethyl isoamyl ether; 2-phenylethyl 1-ethoxyethyl ether; phenylacetaldehyde dimethyl acetal; phenylacetaldehyde diethyl acetal; hydratropaaldehyde dimethyl acetal; phenylacetaldehyde glycerol acetal; 2,4,6-trimethyl-4-phenyl-1,3-dioxane; 4,4a,5,9b-tetrahydroindeno[1,2-d]-m-dioxine; 4,4a,5,9b-tetrahydro-2,4-dimethylindeno[1,2-d]-m-dioxine;
the aromatic and araliphatic aldehydes such as e.g. benzaldehyde; phenylacetaldehyde; 3-phenylpropanal; hydratropaaldehyde; 4-methylbenzaldehyde; 4-methylphenylacetaldehyde; 3-(4-ethylphenyl)-2,2-dimethylpropanal; 2-methyl-3-(4-isopropylphenyl)propanal; 2-methyl-3-(4-tert-butylphenyl)propanal; 2-methyl-3-(4-isobutylphenyl)propanal; 3-(4-tert-butylphenyl)propanal; cinnamaldehyde; alpha-butylcinnamaldehyde; alpha-amylcinnamaldehyde; alpha-hexylcinnamaldehyde; 3-methyl-5-phenylpentanal; 4-methoxybenzaldehyde; 4-hydroxy-3-methoxybenzaldehyde; 4-hydroxy-3-ethoxybenzaldehyde; 3,4-methylenedioxybenzaldehyde; 3,4-dimethoxybenzaldehyde; 2-methyl-3-(4-methoxyphenyl)propanal; 2-methyl-3-(4-methylenedioxyphenyl)propanal;
the aromatic and araliphatic ketones such as e.g. acetophenone; 4-methylacetophenone; 4-methoxyacetophenone; 4-tert-butyl-2,6-dimethylacetophenone; 4-phenyl-2-butanone; 4-(4-hydroxyphenyl)-2-butanone; 1-(2-naphthalenyl)-ethanone; 2-benzofuranylethanone; (3-methyl-2-benzofuranyl)ethanone; benzo-phenone; 1,1,2,3,3,6-hexamethyl-5-indanyl methyl ketone; 6-tert-butyl-1,1-dimethyl-4-indanyl methyl ketone; 1-[2,3-dihydro-1,1,2,6-tetramethyl-3-(1-methylethyl)-1H-5-indenyl]ethanone; 5′,6′,7′,8′-tetrahydro-3′,5′,5′,6′,8′,8′-hexamethyl-2-acetonaphthone; the aromatic and araliphatic carboxylic acids and esters thereof such as e.g. benzoic acid; phenylacetic acid; methyl benzoate; ethyl benzoate; hexyl benzoate; benzyl benzoate; methyl phenylacetate; ethyl phenylacetate; geranyl phenylacetate; phenylethyl phenylacetate; methyl cinnamate; ethyl cinnamate; benzyl cinnamate; phenylethyl cinnamate; cinnamyl cinnamate; allyl phenoxyacetate; methyl salicylate; isoamyl salicylate; hexyl salicylate; cyclohexyl salicylate; cis-3-hexenyl salicylate; benzyl salicylate; phenylethyl salicylate; methyl 2,4-dihydroxy-3,6-dimethylbenzoate; ethyl 3-phenylglycidate; ethyl 3-methyl-3-phenylglycidate;
the nitrogen-containing aromatic compounds such as e.g. 2,4,6-trinitro-1,3-dimethyl-5-tert-butylbenzene; 3,5-dinitro-2,6-dimethyl-4-tert-butylacetophenone; cinnamonitrile; 3-methyl-5-phenyl-2-pentenonitrile; 3-methyl-5-phenylpentanonitrile; methyl anthranilate; methyl-N-methylanthranilate; Schiff bases of methyl anthranilate with 7-hydroxy-3,7-dimethyloctanal, 2-methyl-3-(4-tert-butylphenyl)propanal or 2,4-dimethyl-3-cyclohexenecarbaldehyde; 6-isopropylquinoline; 6-isobutylquinoline; 6-sec-butylquinoline; 2-(3-phenylpropyl)pyridine; indole; skatole; 2-methoxy-3-isopropyl-pyrazine; 2-isobutyl-3-methoxypyrazine;
the phenols, phenyl ethers and phenyl esters such as e.g. estragole; anethole; eugenol; eugenyl methyl ether; isoeugenol; isoeugenyl methyl ether; thymol; carvacrol; diphenyl ether; beta-naphthyl methyl ether; beta-naphthyl ethyl ether; beta-naphthyl isobutyl ether; 1,4-dimethoxybenzene; eugenyl acetate; 2-methoxy-4-methylphenol; 2-ethoxy-5-(1-propenyl)phenol; p-cresylphenylacetate;
the heterocyclic compounds such as e.g. 2,5-dimethyl-4-hydroxy-2H-furan-3-one; 2-ethyl-4-hydroxy-5-methyl-2H-furan-3-one; 3-hydroxy-2-methyl-4H-pyran-4-one; 2-ethyl-3-hydroxy-4H-pyran-4-one;
the lactones such as e.g. 1,4-octanolide; 3-methyl-1,4-octanolide; 1,4-nonanolide; 1,4-decanolide; 8-decen-1,4-olide; 1,4-undecanolide; 1,4-dodecanolide; 1,5-decanolide; 1,5-dodecanolide; 4-methyl-1,4-decanolide; 1,15-pentadecanolide; cis- and trans-11-pentadecen-1,15-olide; cis- and trans-12-pentadecen-1,15-olide; 1,16-hexadecanolide; 9-hexadecen-1,16-olide; 10-oxa-1,16-hexadecanolide; 11-oxa-1,16-hexadecanolide; 12-oxa-1,16-hexadecanolide; ethylene 1,12-dodecanedioate; ethylene 1,13-tridecanedioate; coumarin; 2,3-dihydrocoumarin; octahydrocoumarin.
Advantageous are combinations with aroma chemicals with a sweet note, such as vanillin, 2,5-dimethyl-4-hydroxy-2H-furan-3-one (furaneol) or 3-hydroxy-2-methyl-4H-pyran-4-one (maltol), of the sweet note of which is boosted by the compound (I) or its stereoisomers or its double bond isomers.
A further aspect of the invention is directed to a composition comprising the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above and at least one component selected from the group consisting of surfactants, emollients (oil component) and solvents.
One embodiment of the invention is directed to a composition comprising the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above and at least one solvent.
In the context of the present invention, a “solvent” serves for the dilution of the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above to be used according to the invention without having its own odiferous properties. Some solvents have fixing properties at the same time.
The one or more solvent(s) can be present in the composition from 0.01 to 99% by weight based on the composition. In a preferred embodiment of the invention, the composition comprise 0.1 to 90 weight %, preferably 0.5 to 80 weight % of solvent(s) based on the composition. The amount of solvent(s) can be chosen depending on the composition. In one embodiment of the invention, the composition comprises 0.05 to 10 weight %, preferably 0.1 to 5 weight %, more preferably 0.2 to 3 weight % based on the composition. In one embodiment of the invention, the composition comprises 20 to 70 weight %, preferably 25 to 50 weight % of solvent(s) based on the composition.
Preferred solvents are ethanol, isopropanol, dipropylene glycol (DPG), propylene glycol, 1,2-butylene glycol, glycerol, diethylene glycol monoethyl ether, diethyl phthalate (DEP), isopropyl myristate (IPM), triethyl citrate (TEC), and benzyl benzoate (BB).
Especially preferred solvents are selected from the group consisting of ethanol, propylene glycol, dipropylene glycol, triethyl citrate, benzyl benzoate and isopropyl myristate.
In a preferred embodiment of the invention, the solvent is selected from the group consisting of ethanol, isopropanol, diethylene glycol monoethyl ether, glycerol, propylene glycol, 1,2-butylene glycol, dipropylene glycol, triethyl citrate and isopropyl myristate.
According to a further aspect, the compound of formula (I), mixtures thereof, stereoisomers thereof, or mixtures of stereoisomers thereof are suitable for use in surfactant-containing compositions. According to their characteristic scent profiles, they can especially be used for the perfuming of surfactant-containing compositions such as, for example, cleaners (in particular laundry care products and all-purpose cleaners).
One embodiment of the invention is therefore directed to a composition comprising the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above and at least one surfactant.
The surfactant(s) may be selected from anionic, non-ionic, cationic and/or amphoteric or zwitterionic surfactants. Surfactant-containing compositions, such as for example shower gels, foam baths, shampoos, etc., preferably contain at least one anionic surfactant.
The compositions according to the invention usually contain the surfactant(s), in the aggregate, in a quantity of 0 to 40% by weight, preferably 0 to 20% by weight, more preferably 0.1 to 15% by weight, and particularly 0.1 to 10% by weight, based on the total weight of the composition. Typical examples of nonionic surfactants are fatty alcohol polyglycol ethers, alkylphenol polyglycol ethers, fatty acid polyglycol esters, fatty acid amide polyglycol ethers, fatty amine polyglycol ethers, alkoxylated triglycerides, mixed ethers and mixed formals, optionally partly oxidized alk(en)yl oligoglycosides or glucuronic acid derivatives, fatty acid-N-alkyl glucamides, protein hydrolyzates (particularly wheat-based vegetable products), polyol fatty acid esters, sugar esters, sorbitan esters, polysorbates and amine oxides. If the nonionic surfactants contain polyglycol ether chains, they may have a conventional homolog distribution, although they preferably have a narrow-range homolog distribution.
3
Zwitterionic surfactants are surface-active compounds which contain at least one quaternary ammonium group and at least one —COOH or —SO) group in the molecule. Particularly suitable zwitterionic surfactants are the so-called betaines, such as the N-alkyl-N,N-dimethyl ammonium glycinates, for example, cocoalkyl dimethyl ammonium glycinate, N-acylaminopropyl-N,N-dimethyl ammonium glycinates, for example, cocoacylaminopropyl dimethyl ammonium glycinate, and 2-alkyl-3-carboxymethyl-3-hydroxyethyl imidazolines, containing 8 to 18 carbon atoms in the alkyl or acyl group, and cocoacylaminoethyl hydroxyethyl carboxymethyl glycinate. The fatty acid amide derivative known under the CTFA name of Cocamidopropyl Betaine is particularly preferred.
3
Ampholytic surfactants are also suitable, particularly as co-surfactants. Ampholytic surfactants are surface-active compounds which, in addition to a C8 to C18 alkyl or acyl group, contain at least one free amino group and at least one —COOH— or —SOH— group in the molecule and which are capable of forming inner salts. Examples of suitable ampholytic surfactants are N-alkyl glycines, N-alkyl propionic acids, N-alkylaminobutyric acids, N-alkyliminodipropionic acids, N-hydroxyethyl-N-alkylamidopropyl glycines, N-alkyl taurines, N-alkyl sarcosines, 2-alkylaminopropionic acids and alkylaminoacetic acids containing around 8 to 18 carbon atoms in the alkyl group. Particularly preferred ampholytic surfactants are N-cocoalkylaminopropionate, cocoacylaminoethyl aminopropionate and acyl sarcosine.
Anionic surfactants are characterized by a water-solubilizing anionic group such as, for example, a carboxylate, sulfate, sulfonate or phosphate group and a lipophilic group. Dermatologically safe anionic surfactants are known to the practitioner in large numbers from relevant textbooks and are commercially available. They are, in particular, alkyl sulfates in the form of their alkali metal, ammonium or alkanolammonium salts, alkylether sulfates, alkylether carboxylates, acyl isethionates, acyl sarcosinates, acyl taurines containing linear C12-8 alkyl or acyl groups and sulfosuccinates and acyl glutamates in the form of their alkali metal or ammonium salts.
Particularly suitable cationic surfactants are quaternary ammonium compounds, preferably ammonium halides, more especially chlorides and bromides, such as alkyl trimethyl ammonium chlorides, dialkyl dimethyl ammonium chlorides and trialkyl methyl ammonium chlorides, for example, cetyl trimethyl ammonium chloride, stearyl trim ethyl ammonium chloride, distearyl dimethyl ammonium chloride, lauryl dimethyl ammonium chloride, lauryl dimethyl benzyl ammonium chloride and tricetyl methyl ammonium chloride. In addition, the readily biodegradable quaternary ester compounds, such as, for example, the dialkyl ammonium methosulfates and methyl hydroxyalkyl dialkoyloxyalkyl ammonium methosulfates marketed under the name of Stepantexe and the corresponding products of the Dehyquart® series, may be used as cationic surfactants. “Esterquats” are generally understood to be quaternized fatty acid triethanolamine ester salts. They can provide the compositions with particular softness. They are known substances which are prepared by the relevant methods of organic chemistry. Other cationic surfactants suitable for use in accordance with the invention are the quaternized protein hydrolyzates.
One embodiment of the invention is directed to a composition comprising the compound of formula (I) or a mixture thereof, or a stereoisomer thereof or a stereoisomer mixture thereof as defined above and at least one oil component.
The oil components are typically present in a total quantity of 0.1 to 80, preferably 0.5 to 70, more preferably 1 to 60, even more preferably 1 to 50% by weight, in particular 1 to 40% by weight, more particularly 5 to 25% by weight and specifically 5 to 15% by weight based on the composition.
18
38
6
22
6
10
6
18
6
22
6
22
6
22
The oil components may be selected, for example, from Guerbet alcohols based on fatty alcohols containing 6 to 18 and preferably 8 to 10 carbon atoms and other additional esters, such as myristyl myristate, myristyl palmitate, myristyl stearate, myristyl isostearate, myristyl oleate, myristyl behenate, myristyl erucate, cetyl myristate, cetyl palmitate, cetyl stearate, cetyl isostearate, cetyl oleate, cetyl behenate, cetyl erucate, stearyl myristate, stearyl palmitate, stearyl stearate, stearyl isostearate, stearyl oleate, stearyl behenate, stearyl erucate, isostearyl myristate, isostearyl palmitate, isostearyl stearate, isostearyl isostearate, isostearyl oleate, isostearyl behenate, isostearyl oleate, oleyl myristate, oleyl palmitate, oleyl stearate, oleyl isostearate, oleyl oleate, oleyl behenate, oleyl erucate, behenyl myristate, behenyl palmitate, behenyl stearate, behenyl isostearate, behenyl oleate, behenyl behenate, behenyl erucate, erucyl myristate, erucyl palmitate, erucyl stearate, erucyl isostearate, erucyl oleate, erucyl behenate and erucyl erucate. Also suitable are esters of C-C-alkyl-hydroxycarboxylic acids with linear or branched C-C-fatty alcohols, more especially dioctyl malate, esters of linear and/or branched fatty acids with polyhydric alcohols (for example propylene glycol, dimer dial or trimer triol), triglycerides based on C-C-fatty acids, liquid mono-, di- and triglyceride mixtures based on C-C-fatty acids, esters of C-C-fatty alcohols and/or Guerbet alcohols with aromatic carboxylic acids, more particularly benzoic acid, esters of dicarboxylic acids with polyols containing 2 to 10 carbon atoms and 2 to 6 hydroxyl groups, vegetable oils, branched primary alcohols, substituted cyclohexanes, linear and branched C-C-fatty alcohol carbonates such as, for example, dicaprylyl carbonate (Cetiol@ CC), Guerbet carbonates based on fatty alcohols containing 6 to 18 and preferably 8 to 10 carbon atoms, esters of benzoic acid with linear and/or branched Cto C-alcohols (for example Finsolv® TN), linear or branched, symmetrical or nonsymmetrical dialkyl ethers containing 6 to 22 carbon atoms per alkyl group such as, for example, dicaprylyl ether (Cetiol® OE), ring opening products of epoxidized fatty acid esters with polyols and hydrocarbons or mixtures thereof.
The compounds of formula (I), the mixtures thereof, the stereoisomers thereof or the mixtures of stereoisomers thereof as defined above can be used in a wide range of aroma chemical compositions. The olfactory properties, the substance properties (such as solubility in customary solvents and compatibility with further customary constituents of such compositions), as well as the toxicological acceptability of the compounds of formula (I), the stereoisomers thereof, the mixtures of stereoisomers thereof or the double bond isomers thereof underline their particular suitability for the stated use purposes and compositions.
Suitable aroma chemical compositions are for example perfume compositions, body care compositions, products for oral and dental hygiene, hygiene articles, cleaning compositions, textile detergent compositions, compositions for scent dispensers, foods, food supplements, pharmaceutical compositions and crop protection compositions.
Perfume compositions can be selected from fine fragrances, air fresheners in liquid form, gel-like form or a form applied to a solid carrier, aerosol sprays, scented cleaners, perfume candles and oils, such as lamp oils or oils for massage.
Examples for fine fragrances are perfume extracts, Eau de Parfums, Eau de Toilettes, Eau de Colognes, Eau de Solide and Extrait Parfum.
Body care compositions include cosmetic compositions, and can be selected from after-shaves, pre-shave products, splash colognes, solid and liquid soaps, shower gels, shampoos, shaving soaps, shaving foams, bath oils, cosmetic emulsions of the oil-in-water type, of the water-in-oil type and of the water-in-oil-in-water type, such as e.g. skin creams and lotions, face creams and lotions, sunscreen creams and lotions, after-sun creams and lotions, hand creams and lotions, foot creams and lotions, hair removal creams and lotions, after-shave creams and lotions, tanning creams and lotions, hair care products such as e.g. hairsprays, hair gels, setting hair lotions, hair conditioners, hair shampoo, permanent and semi-permanent hair colorants, hair shaping compositions such as cold waves and hair smoothing compositions, hair tonics, hair creams and hair lotions, deodorants and antiperspirants such as e.g. underarm sprays, roll-ons, deodorant sticks and deodorant creams, products of decorative cosmetics such as e.g. eye-liners, eye-shadows, nail varnishes, make-ups, lipsticks and mascara.
Products for oral and dental hygiene include for example toothpaste, dental floss, mouth wash, breath fresheners, dental foam, dental gels and dental strips.
Hygiene articles can be selected from joss sticks, insecticides, repellents, propellants, rust removers, perfumed freshening wipes, armpit pads, baby diapers, sanitary towels, toilet paper, cosmetic wipes, pocket tissues, dishwasher and deodorizer.
Cleaning compositions, such as e.g. cleaners for solid surfaces, can be selected from perfumed acidic, alkaline and neutral cleaners, such as e.g. floor cleaners, window cleaners, dishwashing detergents both for handwashing and machine washing use, bath and sanitary cleaners, scouring milk, solid and liquid toilet cleaners, powder and foam carpet cleaners, waxes and polishes such as furniture polishes, floor waxes, shoe creams, disinfectants, surface disinfectants and sanitary cleaners, brake cleaners, pipe cleaners, limescale removers, grill and oven cleaners, algae and moss removers, mold removers, facade cleaners.
Textile detergent compositions can be selected from liquid detergents, powder detergents, laundry pretreatments such as bleaches, soaking agents and stain removers, fabric softeners, washing soaps, washing tablets.
Food means a raw, cooked, or processed edible substance, ice, beverage or ingredient used or intended for use in whole or in part for human consumption, or chewing gum, gummies, jellies, and confectionaries.
A food supplement is a product intended for ingestion that contains a dietary ingredient intended to add further nutritional value to the diet. A dietary ingredient may be one, or any combination, of the following substances: a vitamin, a mineral, an herb or other botanical, an amino acid, a dietary substance for use by people to supplement the diet by increasing the total dietary intake, a concentrate, metabolite, constituent, or extract. Food supplements may be found in many forms such as tablets, capsules, softgels, gelcaps, liquids, or powders.
Pharmaceutical compositions comprise compositions which are intended for use in the diagnosis, cure, mitigation, treatment, or prevention of disease as well as articles (other than food) intended to affect the structure or any function of the body of man or other animals.
Crop protection compositions comprise compositions which are intended for the managing of plant diseases, weeds and other pests (both vertebrate and invertebrate) that damage agricultural crops and forestry.
The compositions according to the invention can further comprise one or more substances, such as, for example: preservatives, abrasives, anti-acne agents, agents to combat skin aging, antibacterial agents, anti-cellulite agents, antidandruff agents, anti-inflammatory agents, irritation-preventing agents, irritation-alleviating agents, antimicrobial agents, antioxidants, astringents, sweat-inhibiting agents, antiseptics, antistatics, binders, buffers, carrier materials, chelating agents, cell stimulants, cleaning agents, care agents, hair removal agents, surface-active substances, deodorizing agents, antiperspirants, emulsifiers, enzymes, essential oils, fibers, film formers, fixatives, foam formers, foam stabilizers, substances for preventing foaming, foam boosters, fungicides, gelling agents, gel-forming agents, hair care agents, hair shaping agents, hair smoothing agents, moisture-donating agents, moisturizing substances, humectant substances, bleaching agents, strengthening agents, stain removal agents, optical brighteners, impregnating agents, soil repellents, friction-reducing agents, lubricants, moisturizing creams, ointments, opacifiers, plasticizers, covering agents, polish, shine agents, polymers, powders, proteins, refatting agents, exfoliating agents, silicones, skin-calming agents, skin-cleansing agents, skin care agents, skin-healing agents, skin lightening agents, skin-protective agents, skin-softening agents, cooling agents, skin-cooling agents, warming agents, skin-warming agents, stabilizers, UV-absorbent agents, UV filters, fabric softeners, suspending agents, skin-tanning agents, thickeners, vitamins, oils, waxes, fats, phospholipids, saturated fatty acids, mono- or polyunsaturated fatty acids, α-hydroxy acids, polyhydroxy fatty acids, liquefiers, dyes, color-protection agents, pigments, anticorrosives, polyols, surfactants, electrolytes, organic solvents or silicone derivatives.
The compounds of formula (I), the mixtures thereof, the stereoisomers thereof and the mixtures of stereoisomers thereof as defined above, as well as the aroma chemical compositions according to the invention comprising them can also be in microencapsulated form, spray-dried form, in the form of inclusion complexes or in the form of extrusion products. The properties can be further optimized by so-called “coating” with suitable materials with regard to a more targeted release of the scent, for which purpose preferably waxy synthetic substances such as e.g. polyvinyl alcohol are used.
The microencapsulation can take place for example by the so-called coacervation method with the help of capsule materials, e.g. made of polyurethane-like substances or soft gelatin. The spray-dried perfume oils can be produced for example by spray-drying an emulsion or dispersion comprising the compound of formula (I), its stereoisomer, the mixtures of its stereoisomers as defined above and composition obtainable by the above method of the invention, wherein carrier substances that can be used are modified starches, proteins, dextrin and vegetable gums. Inclusion complexes can be prepared e.g. by introducing dispersions of fragrance compositions and cyclodextrins or urea derivatives into a suitable solvent, e.g. water. Extrusion products can be produced by melting the compound of formula (I), its stereoisomer, the mixtures of its stereoisomers as defined above or the composition obtainable by the above method of the invention with a suitable wax-like substance and by extrusion with subsequent solidification, optionally in a suitable solvent, e.g. isopropanol.
Generally, the total amount of the compounds of formula (I), the mixtures thereof, the stereoisomers thereof or the mixture of stereoisomers thereof in the aroma chemical compositions according to the present invention is typically adapted to the particular intended use or the intended application and can, thus, vary over a wide range. As a rule, the customary standard commercial amounts for scents are used.
The compositions according to the invention can comprise the compounds of formula (I), the mixtures thereof, the stereoisomers thereof or the mixture of stereoisomers thereof as defined above in an overall amount of from 0.001 to 99.9% by weight, preferably from 0.01 to 90% by weight, more preferably from 0.05 to 80%, in particular from 0.1 to 60% by weight, more particularly from 0.1 to 40% by weight, e.g. from 0.1 to 10% by weight or 0.1 to 15% by weight, based on the total weight of the composition.
In one embodiment of the invention, the compositions comprise the compounds of formula (I), the mixtures thereof, the stereoisomers thereof or the mixture of stereoisomers thereof as defined above in an overall amount of from 0.001 to 5 weight %, preferably from 0.01 to 2 weight % based on the total weight of the composition.
A further embodiment of the invention is directed to a method of preparing an aroma chemical composition, in particular a fragranced composition, especially a fragranced ready-to-use composition, comprising incorporating at least one compound of formula (I), a mixture thereof, a stereoisomer thereof or a mixture of stereoisomers thereof into the target composition, e.g. a ready-to-use composition, resulting in an aroma chemical composition, in particular in a fragranced composition, especially in a fragranced ready-to-use composition. Alternatively, the invention is directed to a method of preparing an aroma chemical composition, in particular a fragranced composition, especially a fragranced ready-to-use composition, comprising mixing at least one compound of formula (I), a mixture thereof, a stereoisomer thereof or a mixture of stereoisomers thereof with at least one aroma chemical different from compounds (I) and/or with at least one non-aroma chemical carrier. Suitable and preferred aroma chemicals different from compounds (I) and non-aroma chemical carriers are described above.
For example, the method can be carried out by mixing at least one compound of formula (I), a stereoisomer thereof or a mixture of stereoisomers thereof, as defined above, and at least one further compound selected from the group consisting of aroma chemicals different from compounds (I) and non-aroma chemical carriers.
The invention is also directed to a method for modifying the scent character of an aroma chemical composition, in particular of a fragranced composition, especially of a fragranced ready-to-use composition, comprising incorporating at least one compound of formula (I), a mixture thereof, a stereoisomer thereof or a mixture of stereoisomers thereof into an aroma chemical composition, in particular into a fragranced composition, especially into a fragranced ready-to-use composition.
In particular, the invention is directed to a method of preparing a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, comprising including the compounds of formula (I), the mixtures thereof, the stereoisomers thereof or the mixture of stereoisomers thereof as defined above or in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition.
galbanum
In one embodiment the invention is directed to a method for imparting a , herbal, smoky, leather note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is O, are present in a weight ratio of ca. 1:65.5:33.5.
galbanum
In another embodiment the invention is directed to a method for imparting a herbal, smoky, spicy, nutmeg, , leather, oakmoss note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is O, are present in a weight ratio of ca. 1:19.5:79.5.
In another embodiment the invention is directed to a method for imparting a spicy, nutmeg, smoky, tobacco, leather, phenol note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including a mixture of the above-described compounds (I-2) and (I-3), wherein X is O, or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition. Specifically, compounds (I-2) and (I-3), wherein X is O, are present in a weight ratio of 7:92.
galbanum
In another embodiment the invention is directed to a method for imparting a root, , leather, spicy note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including the compound (I-2), wherein X is O, or a stereoisomer thereof or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition.
1
2
3
4
In another embodiment the invention is directed to a method for imparting a smoked, lime, hickory, green, sweet note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including the compound (I) wherein Ris H and X is O (and of course R, Rand Rare H) (=a compound (I-4) wherein X═O) or a stereoisomer thereof or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition.
galbanum
1
2
3
4
In another embodiment the invention is directed to a method for imparting a , floral note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including the compound of formula (I) wherein Ris OH and X is O (and of course R, Rand Rare H) (=a compound (I-5) wherein X═O) or a stereoisomer thereof or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition.
1
2
3
4
3
In another embodiment the invention is directed to a method for imparting a watery, melon, slightly bitter note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including the compound of formula (I) wherein Ris OCHand X is O (and of course R, Rand Rare H) or a stereoisomer thereof or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition.
In another embodiment the invention is directed to a method for imparting a green, herbal, chives, woody note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including a mixture of the above-described compounds (I-1), (I-2) and (I-3), wherein X is S, or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition. Specifically, compounds (I-1), (I-2) and (I-3), wherein X is S, are present in a weight ratio of 1:39:60.
1
2
3
4
In another embodiment the invention is directed to a method for imparting a beer, burnt note to a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition, which comprises including the compound of formula (I) wherein Ris OH and X is S (and of course R, Rand Rare H) (=a compound (I-5) wherein X═S) or a stereoisomer thereof or a mixture of stereoisomers thereof in a perfume composition, body care composition, product for oral and dental hygiene, hygiene article, cleaning composition, textile detergent composition, composition for scent dispensers, food, food supplement, pharmaceutical composition or crop protection composition.
In a further aspect, the invention relates to a compound of the general formula (I.a)
1
5
5
1
4
1
4
wherein
Ris hydrogen, OH, O—C-C-alkyl or O—(C═O)—R,
wherein Ris selected from the group consisting of hydrogen and C-C-alkyl;
a mixture thereof, a stereoisomer thereof or a mixture of stereoisomers thereof.
1
1
1
In particular, in compounds (I.a) Ris selected from the group consisting of hydrogen, OH, methoxy, ethoxy and acetoxy. More particularly, Ris selected from the group consisting of hydrogen, OH and methoxy. Specifically, Ris hydrogen or OH.
1
5
1
4
1
4
In an alternative particular embodiment of compounds (I.a) Ris selected from the group consisting of OH, O—C-C-alkyl and O—(C═O)—R; preferably from OH and O—C-C-alkyl; more preferably from OH, methoxy and ethoxy, and in particular from OH and methoxy.
In a further aspect, the invention relates to a compound of the general formula (I.b)
1
5
2
3
4
2
3
4
1
5
1
4
1
4
wherein
Ris hydrogen, OH, O—C-C-alkyl or O—(C═O)—R,
R, R, Rare hydrogen;
or one of R, R, Rtogether with Rrepresents a double bond;
Ris selected from the group consisting of hydrogen and C-C-alkyl;
a mixture thereof, a stereoisomer thereof or a mixture of stereoisomers thereof.
2
1
3
1
4
1
1
2
1
3
1
4
1
1
2
1
3
1
4
1
2
1
3
1
4
1
1
Preferably, in compounds (I.b), Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond, or compound (I.b) is a mixture of at least two such compounds; or in compounds (I.b), Ris hydrogen or OH. In particular, in compounds (I.b), Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond, or compound (I.b) is a mixture of at least two such compounds; or in compounds (I.b), Ris OH. Specifically, in compounds (I.b), Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond, or compound (I.b) is a mixture of at least two such compounds. The compounds (I.b), in which Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond, or Rtogether with Rrepresents a double bond or the mixture of at least two such compounds may contain minor amounts of compound (I.b) in which Ris OH.
In a further aspect, the invention relates to a mixture of at least two compounds of formula (I) as defined above.
2
1
3
1
4
1
In particular, the mixture is a mixture of a least two compounds I-1, I-2 and I-3, where in compound I-1, Rtogether with Rrepresents a double bond, in compound I-2, Rtogether with Rrepresents a double bond and in compound I-3, Rtogether with Rrepresents a double bond. In such mixtures, X in all compounds I-1, I-2 and I-3 contained in the mixture preferably has the same meaning. Preferably, the mixture of I-1, I-2 and/or I-3 is a mixture containing compound I-2 and one or both of compounds I-1 and I-3; or is a mixture containing compounds I-1 and I-2 and optionally also compound I-3; or is a mixture containing compounds I-2 and I-3 and optionally also compound I-1; or is a mixture containing compounds I-1, I-2 and I-3; and is specifically a mixture containing compounds I-1 and I-2, where preferably X in all compounds I-1, I-2 and I-3 contained in the mixture has the same meaning.
In another specific embodiment, the mixture contains compounds I-2 and I-3 and optionally also compound I-1. Specifically, the mixture contains compounds I-2 and I-3 and optionally also compound I-1, where compound I-1 is contained in an amount of from 0 to 10% by weight, compound I-2 is contained in an amount of from 1 to 80% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, I-2 and I-3, where preferably X in all compounds I-1, I-2 and I-3 contained in the mixture has the same meaning. More specifically, the mixture contains compounds I-1, I-2 and I-3, where compound I-1 is contained in an amount of from 0.1 to 10% by weight, compound I-2 is contained in an amount of from 1 to 79.9% by weight, and compound I-3 is contained in an amount of from 15 to 99% by weight, relative to the total weight of compounds I-1, I-2 and I-3, where preferably X in all compounds I-1, I-2 and I-3 contained in the mixture has the same meaning. Even more specifically, the mixture contains compounds I-1, I-2 and I-3, where compound I-1 is contained in an amount of from 0.5 to 1.5% by weight, compound I-2 is contained in an amount of from 15 to 73.5% by weight, and compound I-3 is contained in an amount of from 25 to 84.5% by weight, relative to the total weight of compounds I-1, I-2 and I-3, where preferably X in all compounds I-1, I-2 and I-3 contained in the mixture has the same meaning.
In a specific embodiment of the mixture of the invention, X is S.
The compounds of the formula (I) can be prepared by the methods as described in the below schemes or in the synthesis descriptions of the working examples, or by standard methods of organic chemistry. The substituents, variables and indices are as defined above for formula (I), if not otherwise specified.
+
1
4
To be more precise, the compounds (I) can be prepared by standard methods for preparing cyclic ethers, e.g. by a Prins reaction including reacting isoprenol (3-methylbut-3-en-1-ol) 1 with furfural (X═O) or thiophene carbaldehyde (X═S) 2, as shown in scheme 1 below. The reaction of 1 with 2 is generally carried out under acidic conditions, using for example hydrochloric acid, sulfuric acid, acetic acid, trifluoroacetic acid, methanesulfonic acid or p-toluene sulfonic acid or using a polymeric acid, such as a strongly acidic cation exchanger. The term “strongly acidic cationic exchanger” refers to a cationic exchanger in the H form which has strongly acidic groups. The strongly acidic groups are generally sulfonic acid groups; they are generally bonded to a polymer matrix, which can be e.g. gel-like and/or macroporous. Preference is given to styrene (co)polymers containing sulfonic acid groups, specifically to styrene-divinyl benzene copolymers containing sulfonic acid groups (e.g. a resin of the Amberlyst® brand from Rohm and Haas, such as Amberlyst®131). Further details are given below in context with methods A and B. Suitably, the water formed in the reaction is removed, generally by distillation, in order to promote the reaction. The reaction is generally carried out in an organic solvent, especially if an acid different from acidic cationic exchangers is used. Suitable solvents are e.g. alkanes, such as pentane or hexane, halogenated C-C-alkanes, such as dichloromethane, chloroform or dichloroethane, cycloalkanes, such as cyclohexane, aromatic hydrocarbons, such as toluene and the xylenes, aliphatic ethers, such as diethyl ether, diisopropylether or methyl-tert-buty ether, cyclic ethers, such as tetrahydrofuran or the dioxanes, or carboxylic acid esters, such as ethyl acetate. If an acidic cationic exchanger is used, the reaction can also be carried out neat, i.e. without solvent.
1 and 2 are usually applied in a molar ratio of 0.9:1 to 1.5:1 and preferably in a molar ratio of 1:1 to 1.3:1. It is expedient to use 1 in slight excess is order to avoid the formation of acetals as side products which would be favoured if 2 were used in excess.
Further details are given below in context with methods A and B.
1
2
3
4
1
The reaction generally results in a crude product mixture containing a compound of the formula (I) where Ris OH (termed I′ in the following) one or more of compounds of formula (I) where one of R, R, Rtogether with Rrepresents a double bond (termed I″ in the following). The dotted line is intended to show that one of the three dotted bonds is a double bond, whereas the other two are single bonds.
Compounds I′ and I″ can be separated from each other, if desired. If compound I″ is a mixture of various double bond isomers, these can be separated from each other or enriched in one double bond isomer. Suitable separation and enrichment methods are known in the art and are for example distillative or chromatographic methods.
1
If desired, compounds I″ can be hydrogenated to compounds I in which Ris H. Suitable hydrogenation conditions are described below in context with methods A and B.
1
1
5
1
4
If desired, compound I′ can be dehydrated to give compounds I″. Alternatively, if desired, compound I′ can be alkylated to compounds I in which Ris O—C-C-alkyl, or acylated to compounds I in which Ris O—(C═O)—R. Suitable alkylation and acylation conditions are described below in context with methods A and B.
The invention also relates to a method for preparing compounds (I.a) and compounds (I.b). The reactions of the invention as described hereinafter are performed in reaction vessels customary for such reactions, the reaction being carried out in a continuous, semicontinuous or batchwise manner. In general, the particular reactions will be carried out under atmospheric pressure. The reactions may, however, also be carried out under reduced or elevated pressure.
1
2
3
4
1
(i) reacting 3-methylbut-3-en-1-ol with furan-2-carbaldehyde in the presence of a Brønsted acid to obtain a crude product mixture containing a compound of the formula (I) as defined herein, where X is O and Ris OH, and one or more of compounds of formula (I), where X is O and one of R, R, Rtogether with Rrepresents a double bond; and
1
(ii) optionally isolating the compound of formula (I), where X is O and Ris OH; or, alternatively to step (ii),
2
3
4
1
1
2
3
4
1
or, alternatively to steps (ii) and (iii),
(iii) optionally separating the compounds of formula (I), where X is O and one of R, R, Rtogether with Rrepresents a double bond, from the compound of formula (I), where X is O and Ris OH, and subjecting the compounds of formula (I), where one of R, R, Rtogether with Rrepresents a double bond, to a hydrogenation reaction;
1
(iv) optionally subjecting the crude product mixture obtained in step (i) to a hydrogenation reaction and optionally isolating the compound of formula (I), where X is O and Ris H.
To be more precise, the present invention relates to a method for preparing the compound of formula (I.a) or a mixture thereof, which method comprises the following step (i) and the optional steps (ii) to (iv):
This method is in the following also referred to as method A.
1
1
1
1
5
1
4
Step (ii) leads to compounds (I.a) in which Ris OH, whereas steps (iii) and (iv) yield compounds (I.a) in which Ris H. Thus, in the first instance, method A yields compounds (I.a) in which Ris H or OH. The compound (I.a) obtained in step (ii) can however be further converted into compounds (I.a) in which Ris O—C-C-alkyl or O—(C═O)—R.
1
1
5
1
4
(v) optionally subjecting the product obtained in step (ii) (i.e. the compound of formula (I.a), where Ris OH) or the reaction mixture as obtained in step (i) to an alkylation or acylation reaction (to yield compounds (I.a) in which Ris O—C-C-alkyl or O—(C═O)—R).
Accordingly, method A comprises an optional step (v):
1
5
1
1
1
4
Generally, one of steps (ii), (iii) or (iv) has to be carried out; an exception being for example if the compound (I.a) obtained in step (ii) is to be further converted into a compound (I.a) in which Ris O—C-C-alkyl or O—(C═O)—R. In this case, the reaction mixture as obtained in step (i) can be used for the further conversion without preliminarily isolating in step (ii) the compound (I.a) in which Ris OH, although it is generally expedient to first isolate the compound (I.a) in which Ris OH in order to reduce the probability of the formation of undesired side products.
1
1
2
3
4
1
In the reaction in step (i) of the method A a crude product mixture containing a compound of formula (I), where X is O and Ris OH, i.e. a compound of formula (I.a), where Ris OH, and one or more of compounds of formula (I), where X is O one of R, R, Rtogether with Rrepresents a double bond, i.e. one or more of compounds of formulae (I-1), (I-2) or (I-3) as defined herein, where X in each case is O, is prepared. The conversion is effected by reacting isoprenol (3-methylbut-3-en-1-ol) 1 and furfural (furan-2-carbaldehyde) 2 as depicted in the reaction scheme 2 below (compare for example: U.S. Pat. No. 4,962,090, EP 0383446 and L. Liu et al., J. Am. Chem. Soc. 2016, 138, 10822-10825):
1
In scheme 2 the formula (II) represents one of the elimination products of formulae (I-1), (I-2) or (I-3) as defined herein, wherein X in each case is O, or any mixture of these elimination products. The formula (I.a′) represents a compound of formula (I.a) where Ris OH.
1
In step (i) isoprenol and furfural undergo an addition reaction in the presence of a Brønsted acid as catalyst to yield a mixture of the tetrahydropyranol compound of the formula (I.a), where Ris OH, and one or more of the corresponding elimination products of the formula (II). This reaction may be regarded to belong to the group of reactions known in the art as Prins reactions.
Isoprenol and furfural are usually applied in a molar ratio of 0.9:1 to 1.5:1 and preferably in a molar ratio of 1:1 to 1.3:1. It is expedient to use isoprenol in slight excess is order to avoid the formation of acetals as side products which would be favoured if furfural were used in excess.
The Brønsted acid used in the reaction may be any Brønsted acid known in the art and is preferably selected from strong Brønsted acids, such as strongly acidic cation exchange resins, sulfuric acid, methanesulfonic acid and p-toluenesulfonic acid, specifically from methane sulfonic acid and strongly acidic cation exchange resins.
+
The term “strongly acidic cationic exchanger” refers to a cationic exchanger in the H form which has strongly acidic groups. The strongly acidic groups are generally sulfonic acid groups; they are generally bonded to a polymer matrix, which can be e.g. gel-like and/or macroporous. Preference is given to styrene (co)polymers containing sulfonic acid groups, specifically to styrene-divinyl benzene copolymers containing sulfonic acid groups. Commercial examples for such cationic exchangers are Lewatit® (Lanxess), Purolite® (The Purolite Company), Dowex® (Dow Chemical Company), Amberlite® (Rohm and Haas Company), Amberlyst® (Rohm and Haas Company). Preferred strongly acidic cation exchangers are: Lewatit® K 1221, Lewatit® K 1461, Lewatit® K 2431, Lewatit® K 2620, Lewatit® K 2621, Lewatit® K 2629, Lewatit® K 2649, Amberlite® FPC 22, Amberlite® FPC 23, Amberlite® IR 120, Amberlyst® 131, Amberlyst® 15, Amberlyst® 31, Amberlyst® 35, Amberlyst® 36, Amberlyst® 39, Amberlyst® 46, Amberlyst® 70, Purolite® SGC650, Purolite® C100 H, Purolite® C150H, Dowex®50X8, Serdolit® red and Nation® NR-50. Specifically, resins of the Amberlyst® brand from Rohm and Haas, and very specifically Amberlyst®131 is used. Alternatively, the cation exchanger can be a perfluorinated ion exchange resin, sold e.g. under the Nafion® brand of DuPont.
The Brønsted acid different from acidic cationic exchanger resins is generally used in catalytic amounts.
The amount of strongly acidic cation exchanger is not very critical, but yet for economic and processing aspects it is generally used in catalytic amounts. Usually, the strongly acidic cation exchanger is used in an amount of from about 5 up to about 40% by weight, preferably in an amount of from about 10 to about 40% by weight and particularly preferably in an amount of from about 15 to about 30% by weight, in each case based on the sum of the weights of 1 and 2. Here, the figures refer to the ready-to-use cation exchanger which is generally pretreated with water and accordingly can comprise amounts of up to about 70% by weight, preferably of about 30 to about 70% by weight and particularly preferably of about 40 to about 70% by weight of water. Particularly in the case of a discontinuous procedure, an additional addition of water when carrying out the process may therefore be superfluous. The specified strongly acidic cation exchangers can be used either individually or else in the form of mixtures.
1
4
If an acid different from acidic cationic exchangers is used in the reaction in step (i) of method A, the reaction is generally carried out in a suitable organic solvent that is inert under the reaction conditions of step (i). Suitable solvents are e.g. alkanes, such as pentane or hexane, halogenated C-C-alkanes, such as dichloromethane, chloroform or dichloroethane, cycloalkanes, such as cyclohexane, aromatic hydrocarbons, such as toluene and the xylenes, aliphatic ethers, such as diethyl ether, diisopropylether or methyl-tert-buty ether, cyclic ethers, such as tetrahydrofuran or the dioxanes, or carboxylic acid esters, such as ethyl acetate. The specified solvents can be used on their own or in the form of mixtures with one another. Specifically, an aromatic hydrocarbon is used. If an acidic cationic exchanger is used, the reaction can also be carried out in the presence of a solvent that is inert under the reaction conditions. Suitable solvents are those listed above. Generally however, when a strongly acidic cation exchanger is used as Brønsted acid, the reaction is carried out neat, i.e. without the addition of an organic solvent.
The reactants can in principle be contacted with one another in any desired sequence. For example, isoprenol and the Brønsted acid, optionally dissolved or dispersed in an inert solvent, can be initially charged and mixed with each other. The obtained mixture can then be admixed with furfural. Conversely, furfural, optionally dissolved or dispersed in an inert solvent, can be initially charged and admixed with a mixture of isoprenol and the Brønsted acid. Alternatively, furfural may first be mixed with the Brønsted acid and the mixture is then admixed with isoprenol. As a further alternative all reactants can be added simultaneously to the reaction vessel.
It has been found to be beneficial to initially charge the reaction vessel with a mixture of isoprenol and the Brønsted acid, possibly as a dispersion or solution in a solvent, but preferably without solvent, and then to add furfural, which is employed in dissolved form or, preferably, as such.
In general, the reaction in step (i) of method A is performed under temperature control. The reaction is typically effected in a closed or preferably in an open reaction vessel with stirring apparatus. The reaction temperature of reaction of method A depends on different factors, in particular on the acidity and the quantity used of the Brønsted acid, and can be determined by the person skilled in the art in the individual case, for example by simple preliminary tests. In general, the conversion of method A is performed at a temperature in the range from 10 to 150° C., preferably in the range from 30 to 120° C., more preferably in the range from 40 to 110° C. and specifically in the range from 50 to 100° C. In case that the obtention of dehydrated compounds II with C—C double bonds is desired, higher reaction temperatures, e.g. around 100° C., e.g. from 80 to 120° C. or 90 to 110° C., are expedient to promote the elimination and removal of water from intermediately formed compounds I.a′. If saturated compounds I.a′ are desired, reaction temperatures below 100° C., such as 30 to 90° C. or 50 to 80° C. are more suitable.
1
1
1
1
The work-up of the reaction mixtures obtained in step (i) of method A and the isolation of the mixture of the compound of formula (I.a), where Ris OH, and one or more of the elimination products of the formula (II), are effected in a customary manner, for example by an aqueous extractive work-up or by removing the solvent, for example under reduced pressure. Generally, a mixture of the compound (I.a), where Ris OH, and one or more of the elimination products (II), is obtained in sufficient purity by applying such measures or a combination thereof. Thus, additional purification steps, in particular elaborated ones such as chromatography or distillation, are usually only required in case the separation of the elimination products of the formula (II) from the compound of formula (I.a), where Ris OH, is sought, as described herein below. However, if desired, further purification of a mixture of the compound (I.a), where Ris OH, and one or more of the elimination products (II) can be effected by methods commonly used in the art.
1
Preferably, the reaction mixture obtained in the step (i) of method A, for work-up, is diluted with a polar organic solvent that is insoluble or only slightly soluble in water and suitable for dissolving the reaction products obtained, such as e.g. ethyl acetate or dichloromethane. Afterwards the mixture is possibly filtered in order to remove the cation exchange resin that may have been used as Brønsted acid. The obtained product solution is then treated with an aqueous basic solution, such as aqueous sodium hydrogen carbonate. After removal of the aqueous phase, the organic phase is optionally treated again with the aforementioned aqueous basic solution. Preferably, the organic phase is afterwards washed with an aqueous solution having a neutral or approximately neutral pH value, such as brine. The organic phase containing the mixture of the compound (I.a), where Ris OH, and one or more of the elimination products (II) can then be introduced into a further reaction step, either directly or after partial or complete removal of the solvent. Alternatively, the organic phase is concentrated and the crude product thus obtained is subsequently retained for uses or sent directly to a use, for example used in a further reaction step, or subjected to further purification steps as described below.
1
1
1
In optional step (ii) of method A the compound (I.a), where Ris OH, is isolated from the mixture of the compound (I.a), where Ris OH, and the one or more elimination products (II) obtained in step (i). The isolation can be achieved by subjecting the mixture to at least one of the suitable purification procedures known in the art, such as distillation or chromatography, in particular distillation. In fact, the compound of formula (I.a) with Rbeing OH can be isolated from the mixture obtained in step (i) of method A by distillation in high purity.
1
2
3
4
1
1
In optional step (iii) of method A the mixture of the compound (I.a), where Ris OH, and the one or more elimination products (II) obtained in step (i) is subjected to a separation process in order to separate the one or more of the elimination products (II), i.e. the one or more of compounds of formula (I) with X being O and one of R, R, Rtogether with Rrepresenting a double bond, from the compound (I.a), where Ris OH. The one or more of the elimination products (II) are then subjected to a hydrogenation reaction.
The separation can be achieved by employing one or more of the suitable purification procedures known in the art, such as distillation or chromatography, in particular distillation. In fact, the one or more of the elimination products (II) can be isolated from the mixture obtained in step (i) of method A by distillation in high purity.
1
In order to achieve a higher yield of the one or more elimination products (II) after the separation process it is typically beneficial to increase the proportion of the one or more elimination products (II) in the mixture of the compound (I.a), where Ris OH, and the one or more elimination products (II) obtained in step (i). This can be achieved by shifting the reaction equilibrium of the conversion in step (i) of method A in the direction of the elimination products of formula (II) by applying harsher reaction conditions, such as a higher reaction temperature, a greater amount of acid or a longer reaction time, or by removing water from the reaction equilibrium. If one or more of these measures are taken, the conversion of step (i) typically allows for the complete or nearly complete conversion of the starting materials isoprenol and furfural into the elimination products of the formula (II). Subsequent distillative purification according to step (iii) will then afford the one or more elimination products (II) in good yield and high purity.
1
The isolation of step (ii) and the separation of step (iii) can be typically conducted in a single purification run, such as in particular a single distillation run, to afford one fraction that consists, at least primarily, of compound of formula (I.a) with Rbeing OH and another fraction that consists, at least primarily, of the one or more of the elimination products (II).
1
In the hydrogenation reaction of step (iii) the one or more of the elimination products (II) obtained in the separation procedure are subjected to a hydrogenation reaction affording the tetrahydrofuran compound of the formula (I.a), where Ris H (termed I.a″ in scheme 3), as shown in scheme 3 below.
The hydrogenation can in principle be accomplished by using any hydrogenation method known in the art to be suitable for similar conversions. Preferably, the hydrogenation is conducted by employing gaseous hydrogen as reducing agent in the presence of a catalyst typically comprising at least one transition metal, in particular one from the groups IVB, VIIIB or IB of the Periodic Table (CAS version), for example zirconium, palladium, platinum, iron, cobalt, nickel, rhodium, iridium, ruthenium or copper. These metals may be present in the catalyst in the form of one of their salts, oxides or complexes, or, alternatively in metallic form. A preferred metal in this regard is nickel, especially in the form of Raney nickel. The hydrogenation in step (iii) can be carried out in analogy to the conversions described e.g. in J. H. Tyman et al., Tetrahedron Lett. 1970, 11, 4507; V. H. Rawal et al., J. Org. Chem. 1993, 58, 7718; B. M. Trost et al., J. Am. Chem. Soc. 2006, 128, 6745; L. Coulombel et al., Eur. J. Org. Chem. 2009, 33, 5788; and P. L. Alsters et al., Org. Process Res. Dev. 2010, 14, 259.
1
6
The hydrogenation in step (iii) of method A may be conducted without a solvent, but is preferably conducted in the presence of a solvent that is inert under the hydrogenation conditions, such as in particular a protic organic solvent preferably selected from C-C-alkanols, especially from methanol, ethanol and isopropanol.
The hydrogenation is typically carried at a hydrogen pressure in the range from 1 to 2 bar, preferably in the range from 1 to 1.5 bar and in particular from 1 to 1.2 bar. The temperature is usually in the range from 10 to 50° C. and preferably in the range from 20 to 40° C., e.g. from 20 to 30° C. or from 20 to 25° C.
1
1
1
The work-up of the reaction mixture obtained in step (iii) of method A and the isolation of the tetrahydrofuran compound of formula (I.a), where Ris H, are effected in a customary manner, for example by filtration and removal of the solvent, for example under reduced pressure. Generally, the product of formula (I.a) with Rbeing H is then obtained in sufficient purity and additional purification steps, such as chromatography or distillation are usually not necessary, but may be applied in case a very pure product of formula (I.a) with Rbeing H is desired.
1
1
In optional step (iv) of method A the mixture of the compound (I.a), where Ris OH, and one or more of the elimination products (II) obtained in step (i) is subjected to a hydrogenation reaction affording the tetrahydrofuran compound of formula (I.a) with Rbeing H, as shown in scheme 3 above.
The hydrogenation reaction in step (iv) is carried out in analogy to the one described herein above in the context of step (iii) of the method A.
1
1
In order to achieve a higher yield of the tetrahydrofuran compound of formula (I.a), where Ris H, in step (iv) of method A, it is typically beneficial to increase the proportion of the elimination products (II) in the mixture of the compound (I.a), where Ris OH, and one or more of the elimination products (II) obtained in step (i). This can be achieved by shifting the reaction equilibrium of the conversion in step (i) of method A in the direction of the elimination products of formula (II) by applying one or more of the measures described herein above.
1
1
1
4
Furthermore, the tetrahydropyranol compound of the formula (I.a), where Ris OH, obtained in step (i) or step (ii) of method A may be subjected to a alkylation reaction in order to prepare a compound of formula (I.a), where Ris O—C-C-alkyl.
1
1
6
6
1
4
1
4
The alkylation reaction is performed under conventional alkylation reaction conditions that are well known in the art. Preferably, the compound (I.a) with Rbeing O—C-C-alkyl is prepared by alkylating compound (I.a) with Rbeing OH using the alkylation reagent R—Y, wherein Ris a C-C-alkyl group and Y represents a leaving group, selected from halogen, such as Cl, Br, I, and sulfonates, such as tosylate, mesylate, triflate or nonaflate, typically in the presence of a base.
Suitable bases are typically selected from inorganic bases and organic bases.
2
3
2
3
2
3
2
3
4
4
Suitable inorganic bases that can be used in this alkylation reaction are for example alkali metal carbonates, e.g. LiCO, NaCO, KCOor CsCO, alkali metal hydroxides, e.g. LiOH, NaOH or KOH, and hydride donors, e.g. NaH, LiAlHor NaBH.
Suitable organic bases that can be used in this alkylation reaction are for example tertiary amines, e.g. trimethylamine, triethylamine, tripropylamine, ethyldiisopropyl-amine and the like, or basic N-heterocycles, such as morpholine, pyridine, lutidine, DMAP, DABCO, DBU or DBN.
1
1
1
4
1
4
The work-up of the reaction mixtures obtained in the alkylation reaction and the isolation of the product of formula (I.a) with Rbeing O—C-C-alkyl are effected in a customary manner, for example by an aqueous extractive work-up or by removing the solvent, e.g. under reduced pressure. The desired product is generally obtained in sufficient purity by applying such measures or a combination thereof. However, additional purification steps, such as chromatography or distillation may be performed if a very pure compound of formula (I.a) with Rbeing O—C-C-alkyl is desired.
1
1
5
The tetrahydropyranol compound of the formula (I.a), where Ris OH, obtained in step (i) or step (ii) of method A may also be subjected to a acylation reaction in order to prepare a compound of formula (I.a), where Ris O—(C═O)—R.
1
5
1
5
5
5
Generally, the ester of formula (I.a) with Rbeing O—(C═O)—Rcan efficiently be prepared by reacting the compound (I.a), where Ris OH, with the carboxylic acid R—COOH, wherein Rhas one of the meanings defined herein, or an acid anhydride thereof, or a mixture of the carboxylic acid R—COOH with an acid anhydride thereof. The reaction is typically performed in the presence of an esterification catalyst or a base.
Suitable esterification catalysts that can be applied in this reaction are well known in the art. Suitable esterification catalysts are for example metal based catalysts, e.g. iron, cadmium, cobalt, lead, zinc, antimony, magnesium, titanium and tin catalysts in the form of metals, metal oxides or metal salts, such as metal alcoxylates, mineral acids, such as sulfuric acid, hydrochloric acid or phosphoric acid, or organic sulfonic acids, such as methane sulfonic acid or para-toluene sulfonic acid.
Suitable bases are for example organic bases, as defined above, such as in particular pyridine, lutidine or DMAP, specifically DMAP.
1
5
1
5
5
Alternatively, the ester of formula (I.a) with Rbeing O—(C═O)—Rcan be prepared by reacting the compound (I.a), where Ris OH, with an acid halogenide of the formulae R—(C═O)Y′, wherein Rhas one of the meanings defined herein and Y′ is halogen, such as Cl, Br or I, in the presence of an organic base, preferably one of those defined above.
1
5
1
5
Preferably, the ester of formula (I.a) with Rbeing O—(C═O)—Ris prepared by reacting the compound (I.a), where Ris OH, with an acid anhydride of the carboxylic acid R—COOH in the presence of an organic base.
1
5
The individual reaction conditions for the preparations of the ester of formula (I.a) with Rbeing O—(C═O)—R, as outlined above, are well known in the art.
1
5
1
5
The work-up of the reaction mixtures obtained in the acylation reaction and the isolation of the product of formula (I.a) with Rbeing O—(C═O)—Rare effected in a customary manner, for example by an aqueous extractive work-up or by removing the solvent, e.g. under reduced pressure. The desired product is generally obtained in sufficient purity by applying such measures or a combination thereof. However, additional purification steps, such as chromatography or distillation may be performed if a very pure compound of formula (I.a) with Rbeing O—(C═O)—Ris desired.
1
2
3
4
1
(i′) reacting 3-methylbut-3-en-1-ol with thiophene-2-carbaldehyde in the presence of a Brønsted acid to obtain a crude product mixture containing a compound of the formula (I.b), where Ris OH, and one or more of compounds of formula (I.b), where one of R, R, Rtogether with Rrepresents a double bond,
1
(ii′) optionally isolating the compound of formula (I.b), where Ris OH; or, alternatively to step (ii′),
2
3
4
1
1
2
3
4
1
or, alternatively to steps (ii′) and (iii′),
(iii′) optionally separating the compounds of formula (I.b), where one of R, R, Rtogether with Rrepresents a double bond, from the compound of formula (I.b) where Ris OH, and, if desired, subjecting the compounds of formula (I.b), where one of R, R, Rtogether with Rrepresents a double bond, to a hydrogenation reaction;
1
or, alternatively or additionally to steps (iii′) and (iv′),
(iv′) optionally subjecting the crude product mixture obtained in step (i) to a hydrogenation reaction and optionally isolating the compound of formula (I.b), where Ris H.
1
(v′) optionally subjecting the compound of formula (I.b), where Ris OH, to an alkylation or acylation reaction.
The present invention further relates to a method for preparing one of the compounds of formula (I.b) as defined herein above, or a mixture thereof, which method comprises the following step (i′) and the optional steps (ii′) to (v′):
This method is herein also referred to as method B.
1
2
3
4
1
1
1
1
5
1
4
Step (ii′) leads to compounds (I.b) in which Ris OH, step (iii′) leads either to compounds (I.b) in which one of R, R, Rtogether with Rrepresents a double bond (if the hydrogenation reaction is not carried out), or, if the hydrogenation of such compounds is carried out, to compounds (I.b) in which Ris hydrogen, and step (iv′) yields compounds (I.b) in which Ris H. Step (v′) yields compounds (I.b) in which Ris O—C-C-alkyl or O—(C═O)—R.
1
5
1
1
1
4
Generally, one of steps (ii′), (iii′) or (iv′) has to be carried out; an exception being for example if the compound (I.b) obtained in step (ii) is to be further converted in step (v′) into a compound (I.b) in which Ris O—C-C-alkyl or O—(C═O)—R. In this case, the reaction mixture as obtained in step (i) can be used in step (v′) for the further conversion without preliminarily isolating the compound (I.b) in which Ris OH in step (ii′), although it is generally expedient to first isolate the compound (I.b) in which Ris OH in step (ii′) in order to reduce the probability of the formation of undesired side products in step (v′).
2
3
4
1
1
The steps (i′) to (iv′) of the method B correspond to the steps (i) to (iv) of method A of the present invention and can be carried out in analogy to the procedures described for the steps (i) to (iv) herein above, with the exception that in step (i′) thiophene-2-carbaldehyde is used instead of furfural, and with the exception that in step (iii′) the hydrogenation reaction can be skipped, so that compounds of formula (I.b), where one of R, R, Rtogether with Rrepresents a double bond, can be obtained. In addition, the alkylation and acylation reactions according to step (v′) of method B correspond to the procedures described above for alkylating or acylating the tetrahydropyranol compound of the formula (I.a) with Rbeing OH and can be conducted in analogous fashion.
2
3
4
1
2
3
4
1
2
3
4
1
Compounds (I) different from compounds (I.a) and (I.b) (e.g. compounds (I) in which X is O and one of R, R, Rtogether with Rrepresents a double bond) can be prepared in an analogous manner. For example, compounds (I) in which X is O and one of R, R, Rtogether with Rrepresents a double bond can be prepared in analogy to method A, where however in step (iii) the hydrogenation step is skipped and the compounds (I) in which X is O and one of R, R, Rtogether with Rrepresents a double bond are isolated from the reaction mixture of step (i).
The following examples serve as further illustration of the invention.
EXAMPLES
1. Preparation Examples
Abbreviations
Analytics:
1
2
3
4
1
1a) Preparation of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol (Compound of Formula (I.a) with R═OH) and the Corresponding Three Elimination Products with an Exo- or Endocyclic Double Bond (Compounds of Formula (I) with X═O and R, Ror RTogether with RRepresenting a Double Bond)
Dihydropyran Analogs:
Methylidene Analog:
E Isomer:
Z Isomer:
2
3
4
1
1b) Preparation of a Mixture of 2-(furan-2-yl)-dihydropyrans and 2-(furan-2-yl)-4-methylidene-tetrahydropyran with an Endo- or Exocyclic Double Bond (=Elimination Products of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol; Mixture of Compounds I-1, I-2 and I-3 with X═O=Mixture of Compounds of Formula (I) with X═O and R, Ror RTogether with RRepresenting a Double Bond)
1
1c) Preparation of 2-(2-furan-2-yl)-4-methyl-tetrahydropyran (Compound of Formula (I.a) with RBeing H)
Z Isomer:
E Isomer:
1
3
1d) Preparation of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-yl-acetate (Compound of Formula (I.a) with RBeing O—(C═O)—CH)
E Isomer:
Z Isomer:
1
3
1e) Preparation of 2-(2-furan-2-yl)-4-methoxy-4-methyl-tetrahydropyran (Compound of Formula (I.a) with RBeing OCH)
E Isomer:
Z Isomer:
1
2
3
4
1f) Preparation of 2-(thien-2-yl)-4-methyl-tetrahydropyran-4-ol (Compound of Formula (I.b) with RBeing OH and R, Rand RBeing Each H)
E Isomer:
Z Isomer:
2
3
4
1
1g) Preparation of a Mixture of 2-(thiophen-2-yl)-dihydropyrans and 2-(thiophen-2-yl)-4-methylidene-tetrahydropyran with an Endo- or Exocyclic Double Bond (=Elimination Products of 2-(thiophen-2-yl)-4-methyl-tetrahydropyran-4-ol; Mixture of Compounds I-1, I-2 and I-3 with X═S=Mixture of Compounds of Formula (Ib) in which R, Ror RTogether with RRepresent a Double Bond)
Dihydropyran Analogs:
Methylidene Analog:
1
2
3
1h) Preparation of 2-(2-furan-2-yl)-4-ethoxy-4-methyl-tetrahydropyran (Compound of Formula (I.a) with Rbeing OCHCH)
E Isomer:
Z Isomer:
2. Olfactory Tests
DMAP: 4-(dimethylamino)-pyridine
EA: ethyl acetate
RT: room temperature
THF: tetrahydrofuran
MTBE: methyl-tert-butyl ether
The purity of the products was determined by gas chromatography on the basis of area-%:
GC column: DB-WAX (30 m (length), 0.25 mm (ID), 0.25 micrometer (film);
Temperature program: 5 min at 50° C., 50° C. to 230° C. at 6° C./min, 10 min at 230° C.
Temperature of the injector 200° C.; temperature of the detector 230° C. Flow: 1.4 ml/min
13
The products were identified by C NMR.
3
To a mixture of isoprenol (3-methylbut-3-en-1-ol) (40 g, 0.464 mol) and 20 g of the strongly acidic cation exchanger Amberlyst®131 (wet; from Rohm&Haas; washed with water, then with methanol and again with water before use) furfural (37.9 g, 0.395 mol) was slowly added at RT with stirring. The exothermic reaction was continued for 3 h at a temperature of 70° C. Afterwards the reaction mixture was set to RT and the cation exchanger was filtered off. The filtrate was mixed with 100 mL of EA and 100 mL of water. The organic phase was separated and washed with a saturated aqueous solution of NaHCOand then with brine. The organic extracts were combined and dried with sodium sulfate. After evaporating the solvent at reduced pressure, 47.9 g of the crude product were obtained containing about 71.84% of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol and 19.95% of the elimination products 2-(furan-2-yl)-4-methylidene-tetrahydropyran, 2-(furan-2-yl)-4-methyl-5,6-dihydro-2H-pyran and 2-(furan-2-yl)-4-methyl-5,6-dihydro-2H-pyran, as per GC analysis (area %). The crude product was subjected to a distillative separation resulting in two main fractions.
The first fraction of the distillation proved to be a mixture of the three elimination products with a purity of 95.3% (GC area %) and with a molar ratio of 1:65.5:33.5 of the of the compounds I-1:I-2:I-3, where in each case X is O.
13
3
C NMR (125 MHz, CDCl): δ=22.97, 33.26, 65.79, 68.89, 106.77, 110.08, 119.64, 131.19, 142.21, 154.41.
13
3
C NMR (125 MHz, CDCl): δ=34.82, 38.64, 68.47, 73.53, 106.78, 109.58, 110.06, 142.29, 143.28, 154.19.
The second fraction proved to be 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol with a purity of 97.7% (GC area %) and a ratio of its E and Z isomers of 3:1, as determined by NMR.
13
3
C NMR (125 MHz, CDCl): δ=22.33, 26.11, 35.54, 39.81, 63.77, 68.28, 78.79, 106.74, 110.11, 142.29, 154.13, 170.32.
13
3
C NMR (125 MHz, CDCl): δ=21.57, 22.41, 37.26, 40.66, 64.72, 69.93, 79.33, 106.70, 110.14, 142.31, 153.83, 170.24.
The reaction was repeated and 398.7 g of crude product were subjected to a fine distillation using a 60 cm column with a 4 cm diameter. 59 cm of the column were filled with column packing (DN30 A3-1000 2.4610 8 27×50 mm). Several fractions were isolated, fraction 4 being the isomer I-2 (with X═O) in a purity of 97.3%.
3
A mixture of isoprenol (21.50 g, 0.249 mol) and furfural (20 g, 0.208 mol) in 200 mL of toluene was stirred at 20° C. At this temperature, 2 drops of methansulfonic acid were added to the reaction mixture (light exotherm). The mixture was stirred at reflux for 5 h while water was being distilled during the reaction. Afterwards, the reaction mixture was set to RT. To the mixture 100 mL of water were added and the organic phase was washed with a 5% solution of NaHCOand with water. The organic extracts were combined and dried with sodium sulfate. After evaporating the solvent at reduced pressure, 30.3 g of the crude product were obtained containing about 6% of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol and 80.7% of the elimination products 2-(furan-2-yl)-4-methylidene-tetrahydropyran, 2-(furan-2-yl)-4-methyl-5,6-dihydro-2H-pyran and 2-(furan-2-yl)-4-methyl-5,6-dihydro-2H-pyran, as per GC analysis (area %). The crude product was subjected to a distillative separation resulting in a major fraction that proved to be a mixture of the three elimination products with a purity of 97.8% (GC area %) and with a molar ratio of 1:19.5:79.5 of the compounds I-1:I-2:I-3, where in each case X is O.
The reaction was repeated and 59.9 g of crude product were subjected to a fine distillation using a 21 cm column filled with column packing (DN30 A3-1000 2.4610 8 27×50 mm). Several fractions were isolated, fraction 3 containing 7% of I-2 and 92% of I-3, where in each case X is O.
2
3
4
1
2
2
2
15 g of a mixture of the three elimination products I-1, I-2 and I-3 with X═O with an exo- or endocyclic double bond (compounds of formula (I) with X═O and R, Ror Rtogether with Rrepresenting a double bond) were dissolved in 360 mL of methanol. To this mixture 9 g of Raney nickel (50% in water) was added. The reaction vessel was connected to a gasburet filled with water. Then Hwas pressed directly from the gas-bottle into the gasburet in a way that the Hconsumption could be monitored. The reaction proceeded at 25° C. The experiment was continued for 4.5 h and a 2.5 L consumption of Hwas observed. The catalyst was filtered off and the solvent was evaporated at reduced pressure. 16.2 g of crude product were obtained that contained 95% of the hydrogenated product. The crude product was subjected to a distillative separation resulting in a major fraction that proved to be the desired 2-(2-furyl)-4-methyl-tetrahydropyran in a 3:2 Z/E ratio with a 96% purity.
13
3
C NMR (125 MHz, CDCl): δ=22.25, 30.18, 34.25, 38.13, 68.27, 72.81, 106.02, 110.01, 141.83, 155.13.
13
3
C NMR (125 MHz, CDCl): δ=20.19, 25.22, 33.00, 35.26, 62.60, 68.27, 107.18, 109.99, 141.83, 154.84.
3
DMAP (0.2 g, 1.64 mmol) was added to a solution of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol (10 g, 0.055 mol) in 50 mL of THE at RT. The obtained mixture was refluxed at 53° C. while acetic anhydride (7 g, 1.25 eq.) was slowly added at this temperature. After 6 h, approximately 85% conversion was observed by GC. The reaction was cooled down to RT and slowly quenched with 50 mL of water. Afterwards 50 mL of EA were added. The organic phase was separated and washed with a saturated aqueous solution of NaHCOand the with brine. The organic extracts were combined and dried with sodium sulfate. After evaporating the solvent at reduced pressure 6.9 g of a crude product was obtained containing about 81.5% of the title compound, as per GC analysis (area %). Purification by column chromatography afforded the title compound having a purity of 99% (GC area %) as a mixture of its E and Z isomers. NMR analysis revealed a E/Z isomer ratio of 7:3.
13
3
C NMR (125 MHz, CDCl): δ=31.59, 38.14, 42.03, 63.94, 67.52, 68.44, 106.65, 110.03, 142.16, 154.61.
13
3
C NMR (125 MHz, CDCl): δ=25.19, 40.05, 43.58, 65.59, 68.55, 70.66, 106.75, 110.13, 142.25, 154.05.
1
3
To a dispersion of sodium hydride (1.3 eq) in 75 mL of THE a solution of 10 g of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol (compound of formula (I.a) with R=OH) in 30 mL of THE was slowly added at 0° C. The mixture was stirred for 30 min at 0° C. Then 1.3 eq of methyl iodide were slowly added at RT. After the addition, the mixture was stirred at 40° C. for 4 h. The reaction mixture was cooled to 0° C. and the addition of 0.25 eq of NaH followed by 0.25 eq of methyl iodide was repeated. The mixture was then stirred for 17 h at 40° C. The reaction was slowly quenched with 50 mL of water. The organic phase was extracted with 3 times 50 mL of MTBE. The organic extracts were combined and washed with 50 mL of NHsolution and with 50 mL of brine. The organic extracts were combined and dried with sodium sulfate. After evaporating the solvent at reduced pressure 9.6 g of crude product were obtained containing 95% of the desired methyl ether according to the GC (area %). The crude product was subjected to a distillative separation resulting in a major fraction that proved to be the desired 2-(2-furan-2-yl)-4-methoxy-4-methyl-tetrahydropyran with a purity of 99% (GC area %). NMR analysis indicated a E/Z mixture in a ratio 7:3.
13
3
C NMR (125 MHz, CDCl): δ=24.84, 34.92, 39.22, 48.69, 63.77, 68.12, 71.18, 106.44, 110.01, 142.13, 154.84.
13
3
C NMR (125 MHz, CDCl): δ=20.26, 36.59, 40.33, 48.20, 65.43, 70.42, 72.48, 106.51, 110.11, 142.20, 154.35.
3
To a mixture of isoprenol (20 g, 0.232 mol) and 10 g of the strongly acidic cation exchanger Amberlyst® 131 (wet; from Rohm&Haas) thiopene-2-carbaldehyde (22.13 g, 0.197 mol) was slowly added at RT with stirring. The exothermic reaction was continued for 3 h at a temperature of 70° C. Afterwards the reaction mixture was set to RT and the cation exchanger was filtered off. The filtrate was mixed with 100 mL of EA and 100 mL of water. The organic phase was separated and washed with a saturated aqueous solution of NaHCOand then with brine. The organic extracts were combined and dried with sodium sulfate. After evaporating the solvent at reduced pressure, 28.5 g of the crude product were obtained containing about 67.45% of 2-(thien-2-yl)-4-methyl-tetrahydropyran-4-ol and 14.68% of the elimination products 2-(thien-2-yl)-4-methylidene-tetrahydropyran, 2-(thien-2-yl)-4-methyl-5,6-dihydro-2H-pyran and 2-(thien-2-yl)-4-methyl-5,6-dihydro-2H-pyran, as per GC analysis (area %). The crude product was subjected to a distillative separation resulting in two main fractions. The major fraction was 2-(thien-2-yl)-4-methyl-tetrahydropyran-4-ol with a purity of 98.2% (GC area %) and a ratio of its E and Z isomers of 55:45, as determined by NMR.
13
3
C NMR (125 MHz, CDCl): δ=31.55, 38.14, 46.23, 64.14, 67.86, 71.07, 123.57, 124.47, 126.38, 145.80.
13
3
C NMR (125 MHz, CDCl): δ=25.19, 40.01, 47.73, 65.79, 68.76, 73.22, 123.74, 124.78, 126.38, 145.09.
4
4
To a solution of the distillated product from example 1f) (5.5 g, 0.027 mol) in 35 mL of toluene were slowly added 0.8 g of NaHSO(0.007 mol) at RT. The reaction was stirred at 110° C. (reflux) for 3 h. After this time, 37% conversion of the 2-(thien-2-yl)-4-methyl-tetrahydropyran-4-ol was observed and the reaction was stopped. The mixture was cooled to RT and NaHSOwas filtered off. To the fitrate 50 mL of water were added. The organic phase was separated and washed with water and brine. The organic extracts were combined and dried with sodium sulfate. After evaporating the solvent at reduced pressure, 2.4 g of crude product were obtained containing about 61% of 2-(thien-2-yl)-4-methyl-tetrahydropyran-4-ol and 36% of the elimination products 2-(thien-2-yl)-4-methylidene-tetrahydropyran, 2-(thien-2-yl)-4-methyl-5,6-dihydro-2H-pyran and 2-(thien-2-yl)-4-methyl-5,6-dihydro-2H-pyran, as per GC analysis (area %). Purification by column chromatography afforded the title compounds with a purity of 98.8% (GC area %) and with a molar ratio of 1:39:60 of the compounds I-1:I-2:I-3, where in each case X is S.
13
3
C NMR (125 MHz, CDCl): δ=22.91, 37.33, 66.15, 71.55, 119.72, 123.77, 124.68, 126.43, 131.37, 145.59.
13
3
C NMR (125 MHz, CDCl): δ=34.77, 42.78, 68.89, 76.37, 109.46, 123.64, 124.69, 126.45, 143.53, 145.37.
1
To a dispersion of sodium hydride (1.3 eq) in 70 mL of toluene a solution of 12 g of 2-(furan-2-yl)-4-methyl-tetrahydropyran-4-ol (compound of formula (I.a) with R=OH) in 20 mL of toluene was slowly added at 0° C. The mixture was stirred for 30 min at 0° C. The reaction was heated to 87° C. for 2 h and at this temperature 0.7 eq of diethylsulfate were slowly added. After the addition, the mixture was stirred at 87° C. for 3 h. The reaction was slowly quenched with 50 mL of water and the mixture was then stirred for 48 h at RT. The organic phase was separated and dried with sodium sulfate. After evaporating the solvent at reduced pressure 11.2 g of crude product were obtained containing 90% of the desired ethyl ether according to the GC (area %) in a Z/E ratio of 30:60. Purification by column chromatography resulted in two major fractions that proved to be the desired 2-(2-furan-2-yl)-4-ethoxy-4-methyl-tetrahydropyran. NMR analysis indicated that the first fraction was the E isomer (95% purity [GC area %)] and the second fraction was a Z/E mixture in a ratio 85:15 (97% purity [GC area %)].
13
3
C NMR (125 MHz, CDCl): δ=16.01, 25.57, 35.45, 39.66, 56.06, 63.87, 68.18, 71.00, 106.39, 110.01, 142.10, 154.96.
13
3
C NMR (125 MHz, CDCl): δ=16.13, 20.99, 37.10, 40.85, 55.52, 65.42, 70.38, 72.29, 106.48, 110.10, 142.17, 155.46.
In order to test the quality and intensity of the odor of the compounds (I) of the present invention, scent strip tests were performed.
For this purpose, strips of absorbent paper were dipped into solution containing 1 to 10% by weight solution of the compound (I) to be tested in ethanol. After evaporation of the solvent (about 30 sec.) the scent impression was olfactively evaluated by a trained perfumer.
The results of the scent test are summarized in table 1.
TABLE 1
Results of the scent tests.
Ex-
ample
Odor
no.
Compound
Description
1.1
<chemistry id="CHEM-US-00014" num="00014"><img id="EMI-C00014" he="23.88mm" wi="23.88mm" file="US20210207057A1-20210708-C00014.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Galbanum, Herbal, Smoky, Leather
1<sup>st </sup>fraction of example 1a)
Isomers of formulae (I-1), (I-2) and
(I-3), where in each case X = O, at a
molar ratio of 1:65.5:33.5
1.2
<chemistry id="CHEM-US-00015" num="00015"><img id="EMI-C00015" he="23.88mm" wi="23.88mm" file="US20210207057A1-20210708-C00015.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Spicy, Nutmeg, Smoky, Tobacco, Leather, Phenol
Product of fine distillation of 1b)
Isomers of formulae (I-2) and (I-3),
where in each case X = O, at a molar
ratio of 7:92
1.3
<chemistry id="CHEM-US-00016" num="00016"><img id="EMI-C00016" he="23.88mm" wi="23.88mm" file="US20210207057A1-20210708-C00016.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Root, Galbanum, Leather, Spicy
Product of fine distillation of 1a)
Isomer of formula (I-2), where X = O,
with a purity o 97.3%
1.4
<chemistry id="CHEM-US-00017" num="00017"><img id="EMI-C00017" he="23.88mm" wi="23.88mm" file="US20210207057A1-20210708-C00017.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Herbal, Smoky, Spicy, Nutmeg, Galbanum, Leather, Oakmoss
Compound of example 1b)
Isomers of formulae (I-1), (I-2) and (I-3),
where in each case X = O, at a molar
ratio of 1:19.5:79.5
1.5
<chemistry id="CHEM-US-00018" num="00018"><img id="EMI-C00018" he="23.88mm" wi="23.88mm" file="US20210207057A1-20210708-C00018.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Smoked, Lime, Hickory, Green, Sweet
Compound of example 1c)
Compound of formula (I.a), where R<sup>1 </sup>=
H, with E/Z ratio of 2:3
1.6
<chemistry id="CHEM-US-00019" num="00019"><img id="EMI-C00019" he="23.11mm" wi="23.88mm" file="US20210207057A1-20210708-C00019.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Galbanum, Floral
2<sup>nd </sup>fraction of example 1a)
Compound of formula (I.a), where R<sup>1 </sup>=
OH, with E/Z ratio of 3:1
1.7
<chemistry id="CHEM-US-00020" num="00020"><img id="EMI-C00020" he="24.89mm" wi="23.88mm" file="US20210207057A1-20210708-C00020.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Weak
Compound of example 1d)
Compound of formula (I.a), where R<sup>1 </sup>=
O—(C═O)—CH<sub>3</sub>, with E/Z ratio of 7:3
1.8
<chemistry id="CHEM-US-00021" num="00021"><img id="EMI-C00021" he="23.11mm" wi="23.88mm" file="US20210207057A1-20210708-C00021.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Watery, melon, slightly bitter
Compound of example 1e)
Compound of formula (I.a), where R<sup>1 </sup>=
O—CH<sub>3</sub>, with E/Z ratio of 7:3
1.9
<chemistry id="CHEM-US-00022" num="00022"><img id="EMI-C00022" he="23.88mm" wi="23.88mm" file="US20210207057A1-20210708-C00022.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Green, Herbal, Chives, Woody
Product of example 1g)
Isomers of formulae (I-1), (I-2) and (I-3),
where in each case X = S, at a molar
ratio of 1:39:60
1.10
<chemistry id="CHEM-US-00023" num="00023"><img id="EMI-C00023" he="23.11mm" wi="23.88mm" file="US20210207057A1-20210708-C00023.TIF" alt="embedded image" img-content="table" img-format="tif" /></chemistry>
Beer, Burnt
Compound of example 1f)
Compound of formula (I.b), where R<sup>1 </sup>=
OH, with E/Z ratio of 55:45 | |
Azuh, Dominic E. and Amodu, L. O. and Azuh, Akunna E. and Oresanya, Toluwalope and Matthew, Oluwatoyin (2017) Factors of Gender Inequality and Development among Selected Low Human Development Countries in Sub-Saharan Africa. Journal Of Humanities And Social Science (JOSR-JHSS). 01-07. ISSN 279-0837, p-ISSN: 2279-0845.
|
PDF
|
Download (536Kb)
Abstract
Gender inequality and poor women empowerment retard improvement in living standards of women and act as a clog in their contributions to governance and economic development. Gender inequality lower quality of life and culminates in limited productivity, hinder economic efficiency and growth. For over three decades, gender issues have been at the front burner of international summits. In spite of much progress in recent times, gender inequalities remain pervasive in many dimensions of life in various regions around the world particularly in sub-Saharan Africa (SSA). Treatment of women is yet to be fairer and related policies can be more effective to improve the status of women. No-doubt studies have been carried out on gender inequality, but less emphasis has been raveled with respect to hindrances and implications of gender inequality. Hence, understanding the nature of gender inequality will not only promote sound awareness among African countries, but also ignite government efforts as well as NGOs toward effective interventions for reduction of gender inequality especially in the economic and political realms where women are made worse off by the socio-cultural milieu. The methodological approach to this paper was based on reviews of published multiple documents to draw up statistical profile of the situation of women in selected countries of low human Development index in SSA to show the existence of gender inequality. The paper found among all the 12 low human development countries and SSA region examined that gender indicators such as human development index, expected years of schooling, mean years of schooling, estimated gross national per capita, share of seats in parliament, population with at least secondary education and labor-force participation rate are all in favor of men. The paper concludes with recommendations to narrow the gender gaps. | http://eprints.covenantuniversity.edu.ng/7944/ |
During large group training sessions, 6 to 15 participants engage in 45 to 60 minute workouts that include warm ups, mobility training, metabolic conditioning, and cool-downs. High-intensity cross training classes are available for both beginners and elite exercisers. Click here to view the class schedule.
The Underground Lab
Since the age of 6, Fernando Rodriguez knew that fitness and athletics would play a big role in his life. While most kids his age were busy at play, Fernando was swimming four hours each day and eagerly counting the hours until his next meet. His hard work paid off, earning him a spot on the Mexican Olympic swim team and instilling him with a passion for fitness that would continue into his adult life.
Today, Fernando draws from his years of athletic and coaching experience to guide others toward their fitness goals in his own private training studio, The Underground Lab. Alongside his staff of fellow certified trainers and fitness aficionados, Fernando leads group workouts that combine traditional exercises with imaginative and innovative techniques. The team also conducts personal-training sessions, employing a variety of cardio and strength-training equipment, and designs a unique 19-day nutrition program to help clients lose weight rapidly in preparation for special events, such as a wedding or an outing in a flimsy rowboat. | https://www.groupon.com/deals/the-underground-lab-1-kansas-city |
Author of new book on writing feature articles shares top tips
Share this
There is no shortcut to good writing. Whether you are writing for print or online, aim to engage, inform and entertain.
An excellent feature requires meticulous research. Writers must find the right market, come up with a viable idea and develop a sharp angle before securing first-class interviews with appropriate experts.
Here are five pillars for enhancing your skills, which have evolved from my latest book, Writing Feature Articles (pictured below), published by Routledge.
1) Find the right market
A good writer begins by finding the right audience for their work before developing the content.
I suggest selecting three possible outlets, then researching each one to determine the most suitable in terms of editorial pillars and audience, before narrowing it down to one title.
No related posts.
Always check that your chosen publication has not run a similar feature before undertaking an in-depth study of its audience needs and the house-style.
Articles need compelling angles, from which you can then develop a headline.
Write the headline first before crafting the rest of the content. Why? Because without a headline an article can lack clear direction, which might impact on the structure and would be unlikely to engage the commissioning editor.
Furthermore, the headline will help you determine who to interview and the questions to ask
3) Keep it factual
Always keep to the facts. Avoid including your opinion or general comments, because unless you are a bonafide expert on the subject about which you are writing, such content is likely to downgrade your article. | |
In 1896 Becquerel brought us to the threshold of the great discovery.
These are associated with the names of Marconi, Becquerel, and Langley.
These rays are often called Becquerel rays in honor of their discoverer.
Becquerel may be considered one of the creators of electro-chemistry.
In two of the most severe of Becquerel's cases the blood coagulated firmly, and in a slight case the clot was dark and loose.
The iron was in excess of that in the normal blood, but in Becquerel's cases the mean was 0.381—less than the normal.
Shortly after Becquerel's discovery, experiments proved that salts of the rare metal thorium are radio-active.
In 1896, Becquerel found that compounds of uranium, and also the metal itself, are radio-active.
Becquerel noted that carbon phosphoresces at a certain elevated temperature preceding the dark red.
And thus, by a sort of accident, he led up to the discovery of the Becquerel rays, so called.
becquerel bec·que·rel (bě-krěl', běk'ə-rěl')
n.
A unit of measurement of radioactivity, equal to one disintegration per second.
|becquerel|
The SI derived unit used to measure the rate of radioactive decay. When the nucleus of an atom emits nucleons (protons and/or neutrons) and is thereby transformed into a different nucleus, decay has occurred. A decay rate of one becquerel for a given quantity means there is one such atomic transformation per second.
|Becquerel |
Family of French physicists, including Antoine César (1788-1878), one of the founders of the science of electrochemistry; his son Alexandre Edmond (1820-1891), noted for his research on phosphorescence, magnetism, electricity, and optics; and his grandson Antoine Henri (1852-1908), who discovered spontaneous radioactivity in uranium. Antoine Henri Becquerel's work led to the discovery of radium by Marie and Pierre Curie, with whom he shared the 1903 Nobel Prize for physics. | http://www.dictionary.com/browse/becquerel |
What Is Decorum?
Decorum is essentially the suitable way of presenting something for a given circumstance. The word has definitions for everyday usage and a specific definition relating to the field of rhetoric. In ordinary usage, the word decorum basically means good taste and appropriate propriety in both dress and conduct. Within the field of rhetoric, it is the practice of ensuring that the words used are suitable for the subject matter, the audience being addressed, the occasion, and the person who is speaking the words. Overall, the word means to be presented in a way suitable for the given occasion.
The word decorum has origins in Latin, coming from words like decor and decorus which have to do with beauty or what is pleasing to the senses. In ordinary English, the word is used to mean the appropriate conventions of dress and conduct required in specific situations. For example, anybody who attends the opera is expected to have a particularly high level of decorum.
Most of the time, the usage of the word in modern English is mainly synonymous with manners and being well-presented. The rules of decorum can be thought of as the rules of etiquette, which tend to be different for different situations but are generally intended to show respect to the host and the other guests present in any formal situation. If somebody is unaware of these codes, he or she is said to have “no sense of decorum.”
Ancient Greece’s rhetoricians have also created a specific definition for the term decorum. The meaning is closely related to the modern meaning, but it is specifically related to the field of argumentation and debate. Words used in an argument should be suited to the subject being discussed and the person who is discussing them, as well as being appropriate for the circumstances, occasion, and audience being addressed.
It is generally thought that if rhetorical decorum is achieved the argument will be well received by those present. Rhetorical “vices” are breaches of the necessary decorum for presenting an argument in writing and speech and will result in an unfavorable reception. Many of these vices have been identified in the study of rhetoric. Decorum relies heavily on its appropriateness for a particular context or audience, however, so its evaluation can be rather subjective. What may be seen as a vice in one situation may be wholly appropriate in another. | https://www.languagehumanities.org/what-is-decorum.htm |
Are Franz Kafka’s representations of law and legality figments of his imagination, or do they go beyond his obsessive probing of his neurosis to reflect issues that also engaged the social and legal theorists of his time? Does Kafka’s conception of law offer anything new in respect to law, justice, and bureaucracy that was not explored by his contemporaries or by later legal scholars? This paper uses Kafka’s office writings as a starting point for re-examining the images of law, bureaucracy, hierarchy and authority in his fiction - images which are traditionally treated as metaphors for things other than law. The paper will argue that the legal images in Kafka’s fiction are worthy of examination, not only because of their bewildering, enigmatic, bizarre, profane, and alienating effects or because of the deeper theological or existential meanings they suggest, but also as exemplifications of a particular concept of law and legality which operates paradoxically as an integral part of the human condition under modernity. To explore this point, the paper places Kafka’s conception of law in the context of his overall writing, which the paper presents as a series of representations of the modern search for a lost Heimat. Kafka’s writing, the paper argues, takes us beyond the instrumental understanding of law advanced by various schools of legal positivism and allows us to grasp law as a form of experience.
This essay first sketches the contours of the existing debate on Kafka’s literary work. Next, it argues that Kafka’s office writings, his training and daily work as a lawyer, and his career as a bureaucrat have significance for his fiction. The essay then explores the ways in which Kafka’s legal work shaped his ideas about law and legality, focusing on his unfinished novel, The Castle. Like Josef K. in The Trial, the protagonist of The Castle, known only as “K.,” is subjected to an ethical form of judgment that lies beyond the scope and jurisdiction of positive law. This ethical form of judgment, which is ordinarily regarded as the sphere of justice, delivers what in Kafka’s world appears to be an incomprehensible form of injustice. Shifting its focus to The Trial, the paper goes on to show that Kafka’s law is not only dissimilar to positive law, but also defies categorization as religious law, natural law, or customary law. The paper ends by making three interrelated points: First, Kafka’s notion of law takes us beyond a Weberian concern with the rise of bureaucracy and the rationalization of modern society. Second, Kafka’s office writings illustrate that the images of law in his fiction, which critics regard as expressing his “ambivalence about the law,” are based on his experience of working with the law as an insider and an outsider at the same time. This dual perspective allowed Kafka to observe the contradictions intrinsic to the internal and external operations of law. Third, Kafka’s work reveals the role of “non-rational” elements in the formation of modern law and legal institutions. This occurs, however, in the context of Kafka’s numerous representations of the search for Heimat, the peaceful and harmonious community to which the modern individual would like to belong and with which he or she longs to identify. | https://westminsterresearch.westminster.ac.uk/item/9048w/in-search-of-heimat-a-note-on-franz-kafka-s-concept-of-law |
Members of the Austrian Academic Library Consortium and the Austrian Science Fund established an agreement with Springer which includes access to more than 2,000 of Springer’s subscription journals, as well as allowing authors to publish open access in subscription journals.
The open access agreement covers the open access charge for affiliated corresponding authors in subscription-based journals that are offering the hybrid open access option, Open Choice. The agreement will begin on January 1, 2016.
IIASA has established an agreement with MDPI (Multidisciplinary Digital Publishing Institute) allowing authors to benefit from a 10% discount on article processing charges (APCs) when publishing in an MDPI journal. The agreement starts May 15, 2016 and has been renewed for 2019.
MDPI (Multidisciplinary Digital Publishing Institute) is an academic open access publisher based in Basel, Switzerland, and was initially founded in 1996 to collect and preserve rare chemical research samples. All MDPI content is open access, distributed under a Creative Commons License and hence freely accessible to readers. MDPI finances its publications through article processing charges (APC), paid by authors and their institutions.
As a member of the Austrian Academic Consortium (Kooperation E-Medien Österreich, KEMÖ) we have signed an agreement with the Taylor & Francis Group on offsetting article publishing charges against subscription costs for KEMÖ members for the subscription contract 2017-2019.
Researchers affiliated with IIASA may publish (as corresponding authors) papers choosing the open access option in selected Taylor & Francis journals (without additional payment of APCs). The publisher will ask you whether you’d like to make use of this opportunity once your paper has been accepted in the publication process. | http://www.iiasa.ac.at/web/home/resources/publications/oa/agreements.html |
“We need to talk more about ‘Ocean Change’ and the effects of acidification, warming and so on,” said the United Nations Special Envoy for the Ocean, Peter Thomson, at the UN Ocean Conference in 2017. “As it stands, SDG14 [United Nation Sustainable Development Goal 14, protecting life below the water] represents the only universal commitment we have to save life in the ocean for our grandchildren to enjoy.” This international initiative and other environmental directives, particularly on the European level, hinge on the availability of ocean data to monitor threats like acidification and the health of the marine food chain, which directly affect human health. The Copernicus Marine Service is regularly updating its product portfolio with new or improved products. This issue of Copernicus Observer presents the latest evolutions.
Marine life is vital for the economic and food security of billions of people. Hence marine ecosystem health must therefore be viewed through the lens of human health.
In order to keep track of the marine ecosystem’s health even more efficiently, the Copernicus programme’s marine component, the Copernicus Marine Service, has expanded its offer as it strives to continually respond to the needs of the global community. In April 2019, a new product of the family of biogeochemical variables was released: the ocean pH, indicator of the ocean acidity, crucial for understanding the pressures put on marine ecosystems.
A full suite of biogeochemical observation-based products and models are now available and are presented below. The updates expand on and strengthen the existing extensive biogeochemical catalogue of products that are produced thanks to modelling and include a wide range of variables, from nutrients and plankton to oxygen and carbon dioxide distribution (CO2).
These products have benefited from research and development (R&D) performed as part of the Atlantos Horizon 2020 project and various Copernicus Marine Service Evolution R&D projects.
Given our rapidly changing environment, models play a key role in predicting future scenarios describing the possible impact of climate change on the oceans and marine ecosystems, and providing information in areas where direct observations are not available. Mercator Ocean International is, by the way, developing a new version of the Copernicus Marine global biogeochemical model, which will lead to better indicators for ocean monitoring and forecasting.
The recent updates on the biogeochemical products include:
- Ocean acidity and other variables related to the ocean’s uptake of excess carbon from the atmosphere from 2001 to 2017 (see here). These are derived from in situ data sets (SOCAT) and data fusion techniques.
- Phytoplankton Functional Type (PFT) – a segmentation of different types of phytoplankton (the base of the marine food chain) using satellite-derived ocean colour data from 1997 to 2017 (see here) useful to better understand the food web, marine ecosystems and fish dynamics;
- Nutrients – includes the addition of in situ data on the concentration of nitrates, phosphates and silicates (see here). These are computed using data fusion techniques applied to Argo biogeochemical (Argo BGC) floats equipped with an oxygen sensor. Argo BGC is an extension of the Argo programme, which includes a global array of some 4,000 in situ floats that take key ocean measurements (called profiles).
Ocean Acidification
The ocean acts as a sinkhole for the excess CO2 in the atmosphere produced by human activities. As such, it buffers the warming effects that this CO2 would have if left in the atmosphere. However, the price for this buffering is a dramatic change in the ocean’s chemistry, commonly referred to as ocean acidification. It is unclear whether the ocean can continue to absorb CO2 at the same rate or if it may become saturated. Moreover, an increasingly acidic ocean puts marine ecosystems at risk as this can impact biological processes like photosynthesis, respiration, calcification and reproduction among other things. Calcifying species like shellfish, coral and even phytoplankton are particularly affected as their shells and skeletons may not be able to withstand the changing ocean chemistry. All this leads to less biodiversity and thus, less food security for humans.
In mid-April of this year, the Copernicus Marine Service released much anticipated carbonate products that help measure the ocean’s uptake/absorption of atmospheric CO2. These include: 1) ocean acidity (seawater pH) surface distribution across the ocean; 2) ocean surface partial pressure of CO2, and 3) sea-to-air flux of CO2 (the ocean’s uptake of CO2). These products are derived from a combination of in situ technology (including ships), numerical models and a neural network that uses machine learning and indirect measurements to estimate variables in areas where no data is available.
Prior to the release of the acidity variable in the catalogue, the Copernicus Marine Service released the global ocean acidity yearly mean trend from 2001-2017 under their Ocean Monitoring Indicator section (OMI) (refer to the graph below) that was selected to support the publication of the 2018 European SDG14 indicator related to ocean acidity (Eurostat publication). The trend in the results shows that the ocean is steadily becoming more acidic over time with the pH decreasing by 0.0017 pH units annually. The pH of contemporary surface ocean waters is already 0.1 pH units lower than in pre-industrial times. This 0.1 pH unit change is equivalent to a 30% increase in ocean acidity since pre-industrial times.
Yearly mean surface pH reported on total scale showing a clear increase in ocean acidity over time. Credit: Copernicus Marine Service Ocean Monitoring Indicator (OMI)
The new pH product adds detail to this OMI trend, by showing that the distribution of acidification is not homogeneous across the ocean. The pH is displayed on a regular grid (1°x1°) with a monthly resolution from 2001 to the end of 2017. The most acidic regions (with low pH values) are found in upwelling regions such as the Equatorial Pacific Ocean and the Arabian Sea where old naturally dissolved inorganic carbon-enriched waters reach the ocean surface. The less acidic regions (with higher pH values) are found in subpolar and polar waters, especially during spring and summer when photosynthesis draws down dissolved inorganic carbon.
Additionally, this new product includes two other key parameters: ocean surface partial pressure of CO2 and surface ocean CO2 flux (which measures the ocean’s uptake of CO2). The partial pressure of CO2 is the gas phase of CO2 above the ocean surface, which finds equilibrium with the CO2 in the water, thereby determining the extent to which the CO2 dissolves in the water. This is an important variable for monitoring CO2 in the Earth system as well as calculating and estimating the other CO2-related variables. These products are derived from a neural network methodology using the SOCAT data set (in situ network).
About one fourth of human-induced CO2 in the atmosphere is stored in the ocean through carbon uptake. This is largely measured through the CO2 flux (surface downward flux) over the global ocean. In general, the ocean acts as a sink or a well for CO2. However, the ocean’s uptake of CO2 varies greatly from one region to another. Positive reddish values in the map below correspond to the ocean’s uptake of CO2.
Reconstructed surface downward flux of CO2 averaged over 2001 to 2016. Positive values correspond to the ocean’s uptake of CO2. Credit: Copernicus Marine Service MultiObservation Thematic Assembly Centre
Phytoplankton Functional Types (PFTs)
“Ocean Colour” refers to the measurement of chlorophyll-a in the ocean and is used as a proxy to measure phytoplankton. Phytoplankton are a microscopic algae that forms the base of the marine food chain. Through photosynthesis, they are responsible for absorbing large amounts of CO2 (see CO2 biological pump in the illustration below). They also produce more than half of the oxygen content in the Earth’s system. It is thus important to closely monitor phytoplankton, as fluctuations have strong impacts on carbon and oxygen cycling as well as on the marine ecosystems and subsequently human food sources.
The role of phytoplankton in the carbon cycle. Credit: Copernicus Marine Service Ocean State Report 2 Summary
Traditional ocean colour products measure total surface chlorophyll-a, the green pigment produced by plants that is vital for photosynthesis and is visible by satellite. Thanks to recent scientific innovations, this satellite data is now segmented to identify different types of phytoplankton based on their reflective properties in the new product release. This Phytoplankton Functional Type (PFT) data is assimilated into numerical models, making them both more accurate and detailed. The TOSCA Copernicus Marine Service Evolution project developed the first system that assimilates the new ocean colour product for PFTs into a marine ecosystem model for the Atlantic and global oceans. The RITMARE R&D project has worked on this for the Mediterranean Sea. The outcomes of this project were used for the April 2019 release of the PFT product, which provides estimations of PFTs in the Mediterranean Sea from 1997 to 2017.
Nutrients
The health of phytoplankton depends also on the nutrients available in their immediate habitats. Thus, these nutrient variables are important tools to predict the impact of climate change on marine resources. The new nutrient product is derived from in situ observations and complements other Copernicus Marine products displaying nutrient concentrations from model outputs. This new product is key for the scientific validation and accuracy checking of such model outputs.
This represents a milestone because monitoring nutrients across the ocean remains challenging, mostly because of the lack of data. However, over the last decade, the Argo BGC array has provided new measurement capabilities for biogeochemical parameters that are used to improve biogeochemistry models. The new product update benefits from these Argo-BGC nutrient profiles. More than 30,000 vertical profiles (data collected at different depths during the dive of a given float) are available from 2004 to 2018 and are mostly located in the north Atlantic Ocean and the Antarctic region (figure 4). The future integration of the Argo BGC data into the Copernicus biogeochemical model will mark a major improvement in the model’s accuracy and predictive capabilities. | https://www.copernicus.eu/en/observer-copernicus-tracks-ocean-acidity-and-other-variables-are-key-marine-life |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.