id
stringlengths 4
78
⌀ | score
stringclasses 809
values | title+body
stringlengths 11
32.8k
⌀ | Unnamed: 3
stringclasses 2
values |
|---|---|---|---|
52g7b9 | 1 | I got a shot today. Wouldn't be the first time I've gotten involved in doctor penetration. | null |
52g5ap | 1 | Why did the video of the eighth note get taken off of youtube?. It got flagged. | null |
52g4w7 | 1 | A young man was in a relationship with a horse.... He was said to be very unstable. | null |
52g4hp | 1 | Researchers Claim To Have Recorded Dolphins Having A "Conversation" . . . . .. and turns out, they're racist. | null |
52g3xl | 864 | A kid asks his dad, "what's the difference between 'realistically' and 'potentially'"?. His dad responds, "realistically you've heard this joke before, potentially, you will hear it again". | null |
52g2xv | 38 | I was paper-thin as a kid..
So I got ripped. | null |
52g2sq | 10 | 3 guys walked into a bar.... I was outside, i didn't see what happend... | null |
52g2rs | 8 | Give a dog a bone and you've made a friend for the day,. teach a dog to bone and you'll have friends for life. | null |
52g1a6 | 5 | I tried to teach a class on how hard it is to make a Fibonacci Sequence.. But it spiraled WAY out of control! | null |
52g15s | 44 | A Scotsman is tending his flock of sheep... (long). when he decides to take a nap under a nearby tree.
After he falls asleep, a young woman walking on a nearby road decides to play a joke on him.
She lifts up his kilt, takes a ribbon from her hair, ties it around his manhood, and leaves with a giggle.
After awhile the Scotsman wakes up and walks over by the bushes to take a wee.
He lifts up his kilt and is amazed to see a bright blue ribbon tied around his manhood.
without skipping a beat he says "well I don't know where you've been laddie, but I can see you won first prize!"
| null |
52g0xa | 0 | Electric hot air balloons. How? | null |
52fzg1 | 3 | A superposition walks into a bar . . .. . . . or ***did*** it??? | null |
52fym0 | 3 | A DNA molecule walks into a bar. "What will it be?" asks the bartender.
"ATCGGCAGGCTTCAGTTGCA" says the DNA molecule. | null |
52fyer | 8 | Why did Joey fall of the swing?. Because he doesn't have arms.
Knock knock.
Who's there?
Not Joey. | null |
52fydb | 0 | So I heard that you can now rent Belgian comics for events and suchlike.... ... apparently their alright, not to showy. Does what it says on the Tintin. | null |
52fy95 | 3 | Did you hear about the priest that got knighted?. Congratulations to Sir Mon | null |
52fy7b | 475 | A gorilla dies at the Zoo.... Just before the zoo opens. It's the only gorilla that that the zoo can afford, and it was by a large margin, the zoo's most popular attraction, so the owner goes to the former gorilla keeper and offers him an extra $300 every day if he'll put on a gorilla suit, go in the gorilla exhibit, and pretend to be a gorilla until the zoo can replace the deceased gorilla.
After a bout a week, word catches on that the gorilla has been acting more and more interesting, and people are coming in from all over the state to see the new gorilla. The zoo is getting more and more money, and due to this the former gorilla keeper asks for a raise of $200 more dollars a day to keep up the act. The zoo owner agrees, so long as the patronage keeps up.
Come another month, the interest in the gorilla has started to wear off, and the former keeper gets word. He creates an elaborate stunt to get more patrons and keep up his raise, by climbing over the enclosures fences, and climbing on top of the lions den. After dangling above the den for a good half hour, the man gets tired and slips into the den, and starts shouting "Help me! Help me I don't want to die!", Quickly a lion pounces on him and whispers in his ear "Shut the fuck up before you get us both fired!". | null |
52fxib | 0 | 10 to live. Doctor: "I'm sorry but you suffer from a terminal illness and have only 10 to live."
Patient: "What do you mean, 10? 10 what? Months? Weeks?!"
Doctor: "Nine, eight, seven...."
| null |
52fw5a | 0 | Donald Trump. That was the joke | null |
52fw3c | 95 | What do you call a gay drive-by?. A fruit roll up. | null |
52fv4g | 4 | You know that problem people have where they eat whatever is in front of them?. That's why I cant be a gynecologist. | null |
52fusc | 4 | After many years of studying at a university, I’ve finally become a PhD… or. After many years of studying at a university, I’ve finally become a PhD… or Pizza Hut Deliveryman as people call it. | null |
52fu5y | 14 | Strange that the chimney tends to survive a house fire.. as a cold reminder of where the fire should have been. -Jimeoin | null |
52ftmx | 4 | A Saskatchewan Farmer Retires. A 65 year old Saskatchewan farmer decides to retire and move to the Rocky Mountains after living his whole life on the prairies. A few months later a friend comes to visit.
"What do you think of the mountains?" his friend asks.
"They are okay, but they sure obscure the view." | null |
52ft67 | 15 | I unsubscribed from the official earthbending subreddit.. Getting tired of all these Internet Toph Guys. | null |
52frpf | 0 | Does a bear crap in the woods?. Does the Pope crap on the broken lives and dreams of 200 deaf boys? | null |
52frn1 | 2 | how do you disappoint a reddit user.... [removed] | null |
52frk2 | 0 | What are those. Lol | null |
52frbo | 4 | A guy walks into a bar... I don't know what happens next. I was standing outside. | null |
52fq3e | 3 | My friend, Andy has two tickets for the 2017 Super Bowl.. They are box seats plus airfare and hotel accommodations. He didn't realize when he bought them that the Super Bowl game is the same day as his wedding - - so he can't go. If you are interested and want to go instead of him, it's at St. Michael's Church. Her name is Donna and she will be the one in the white dress. | null |
52fp5o | 0 | NYC subway is the only place.... Where you can get on the Number 1 train and watch some guy take a Number 2. | null |
52fnx8 | 85 | How can a redneck tell his twin sisters apart?. By taste. | null |
52fmzw | 77 | Three guys are hiking through the woods when they find a lamp. One of them picks it up, rubs it, and out pops a Genie.
It booms "You have finally freed me after all these years, so I'll grant each one of you 3 wishes."
The first guy immediately blurts out "I want a billion dollars." POOF, he's holding a printout that shows his account balance is now in fact 1,000,000,003.50
The second man thinks for a bit, then says "I want to be the richest man alive." POOF, he's holding papers showing his net worth is now well over 100 billion.
The third guy thinks even longer about his wish, then says "I want my left arm to rotate clockwise for the rest of my life." POOF, his arm starts rotating.
The Genie tells them it's time for their second wish.
First guy says: "I want to be married to the most beautiful woman on earth." POOF, a stunning beauty wraps herself around his arm.
Second guy says "I want to be good-looking and charismatic, so I can have every girl I want." POOF, his looks change and the first guy's wife immediately starts flirting with him.
Third guy says "I want my right arm to rotate counter-clockwise until I die." POOF, now both his arms are rotating, in opposite directions.
The genie tells them to think very carefully about their third wish.
First guy does, and after a while says "I never want to become sick or injured, I want to stay healthy until I die." POOF, his complexion improves, his acne is gone and his knees don't bother him any more.
Second guy says "I never want to grow old. I want to stay 29 forever." POOF, he looks younger already.
Third guy smiles triumphantly and says "My last wish is for my head to nod back and forth." POOF, he's now nodding his head and still flailing his arms around.
The genie wishes them good luck, disappears, and the men soon go their separate ways.
Many years later they meet again and chat about how things have been going. First guy is ecstatic: "I've invested the money and multiplied it many times over, so me and my family will be among the richest of the rich pretty much forever. My wife is a freak in the sheets, and I've never gotten so much as a cold in all these years."
Second guy smiles and says "Well, I built charities worldwide with a fraction of my wealth, I'm still the richest guy alive and also revered for my good deeds. I haven't aged a day since we last met, and yes, your wife is pretty wild in bed."
Third guy walks in, flailing his arms around and nodding his head, and says:
"Guys, I think I fucked up." | null |
52fmr8 | 0 | The sun said they were powerful, so did the moon. The sun replied, but I give you power
Moon said I am full o your power. | null |
52flih | 0 | What do you call an upside down blonde?. A brunette with bad breath. | null |
52fkqi | 68 | Civil War Jokes you say?. I General Lee don't find them funny | null |
52fjvq | 31 | The Nervous Priest. A new priest at his first mass was so nervous he could hardly
speak. After mass, he asked the monsignor for suggestions to help him do better in the future.
The monsignor replied, "When I am worried about getting
nervous on the pulpit, I put a glass of vodka next to the water glass. If I start to get nervous, I take a sip."
So next Sunday he took the monsignor's advice. At the
beginning of the sermon, he got nervous and took a drink. He proceeded to talk up a storm.
Upon his return to his office after the mass, he found the following note on the door:
1. Sip the vodka, don't gulp.
2. There are 10 commandments, not 12.
3. There are 12 disciples, not 10.
4. Jesus was consecrated, not constipated.
5. Jacob wagered his donkey, he did not bet his ass.
6. We do not refer to Jesus Christ as the late J.C.
7. The Father, Son, and Holy Ghost are not referred to as Daddy, Junior and the spook.
8. David slew Goliath, he did not kick the s**t out of him.
9. When David was hit by a rock and was knocked off his donkey,
don't say he was stoned off his a**.
10. We do not refer to the cross as the "Big T."
11. When Jesus broke the bread at the last supper he said, "Take
this and eat it for it is my body." He did not say "Eat me".
12. The recommended grace before a meal is not: Rub-A-Dub-Dub thanks for the grub, Yeah God.
13. Next Sunday there will be a taffy pulling contest at
St.Peter's not a peter pulling contest at St. Taffy's.
| null |
52figo | 0 | Wanna hear a joke. Donald Trump | null |
52fhi7 | 4 | I am a master of tearable puns. But only on paper | null |
52fgtx | 0 | TIL if you repost a joke in this subreddit you can get a lot of Karma.. ELI5: What does a repost need to make it to front page? | null |
52fgt1 | 5 | Farting. Farting in a lift is wrong on so many levels! | null |
52fg9y | 0 | I surprised my wife by giving her a pearl necklace.. I tell ya, she's such an ingrate. Instead of thanking me, all she did was complain.
"Uh that's so gross, do you know how hard that is to clean up?"
Women, amirite? | null |
52ff63 | 5 | I went to my local city's zoo. They had just one animal. A dog!. It was a shit zu. | null |
52feyl | 6 | Parrot with no legs (NSFW). My uncle told me this joke, when I was a kid:
A suspicious husband who's working all day wants to spy on his wife. He decides to buy a parrot. There are 3 parrots to choose from at the local pet shop. The first one has perfect eye-sight but can't speak. The second one can speak two languages fluently but is blind. The third one is the total package, but he has no legs...he's standing on his dick.
The husband buys the bird, shows it to his wife and puts it into the bedroom. After a long day at work, the husband is rushing into the bedroom to ask the parrot: "Anything happened while I was gone?" "Yeah, there was this guy..." "What?! What was he doing here?" "He was kissing your wife and slowly undressed her." "..." "Than he threw her on the bed, and kept kissing her." "I'm going to kill this guy! What happened then?" "She opened his pants..."
"Go on!" "I don't know what happened after that..." "WHAT?! Why?" "I got stiff." | null |
52fdw9 | 0 | Sam and Dean from Supernatural are just like engineers. Every time they try to solve a problem, they create new ones | null |
52fcnc | 2 | What is a Muslim's favorite type of meat?. Shalami! haha! | null |
52fbxf | 378 | How is a gynecologist like a pizza delivery boy?. They both get close enough to smell it, but if they eat it, they'll be fired. | null |
52fbrp | 2 | Let me tell you a joke about chocolate bars..... ....I'm sure you'll snicker. | null |
52fbpb | 419 | A cowboy rode into town and stopped at a saloon for a drink.. Unfortunately, the locals always had a habit of picking on strangers, which he was. When he finished his drink, he found his horse had been stolen.
He went back into the bar, handily flipped his gun into the air, caught it above his head without even looking and fired a shot into the ceiling.
“Which one of you sidewinders stole my horse?!”, he yelled with surprising forcefulness.
No one answered.
“Alright, I’m gonna have another beer, and if my horse ain’t back outside by the time I finish, I’m gonna do what I dun in Texas! And I don’t like to have to do what I dun in Texas!”
Some of the locals shifted restlessly. The man, true to his word, had another beer, walked outside, and his horse has been returned to the post.
He saddled up and started to ride out of town. The bartender wandered out of the bar and asked, “Say partner, before you go… what happened in Texas?”
The cowboy turned back and said, “I had to walk home.” | null |
52fb9h | 0 | I asked my girlfriend to fly to Italy with me to get married and eat melon.. She told me "I cantaloupe". | null |
52fb5q | 1 | What was Nazi Germany's favorite sea animal?. Adolfin. | null |
52fb02 | 6 | What did the bread say after its massage?. Ahh, I kneaded that. | null |
52fapf | 4 | We're hosting a charity event for the people who struggle to reach orgasm.. If you can't come, do let me know. | null |
52faoc | 0 | Difference between realistic and potential. A kid walks upto his dad. He asks him to explain the difference between the words realistically and potentially.
His father responds by telling him to go ask his mother if she would sleep with their neighbour, Brett, for a million dollars. He then told him to also ask his sister whether she would sleep with their neighbour, Brett, for a million dollars. And he also told him to ask his brother whether he would sleep with Brett for a million dollars.
The kid asks everyone. He comes back and tells his dad that they all said yes.
His father responds that potentially, we're sitting on 3 million dollars. Realistically, we have two whores and a faggot in the family. | null |
52fa9e | 21 | Terrorists now have a brand new state of the art weapon that can be hidden in plain sight. The Galaxy Note 7 | null |
52fa1n | 25 | new iPhone 7. son: Daddy, buy me the new iPhone 7
Dad: What is the magic word?
son: Natasha
Dad: who is Natasha
son: your lover
Dad: do you need also a case? | null |
52f9z4 | 20 | What does a bum call a dumpster.. A Bed and Breakfast. | null |
52f9w1 | 1 | Was is the epitome of machoness?. When a guy about to have a blowjob can't get up and say: Does this happen to you often? | null |
52f9tm | 0 | My friend told me that he likes his steak well-done. We are no longer friends | null |
52f93u | 0 | What do bears in Mexico eat?. The same shit as all the other bears. What? Were you expecting a pun? | null |
52f8v4 | 1076 | Two old guys, one 80 and one 87, were sitting on a park bench one morning.. The 87-year-old had just finished his morning jog and wasn't
even short of breath.
The 80-year-old was amazed at the guy's stamina and asked him what he did to have so much energy.
The 87-year-old said, "Well, I eat rye bread every day.
It keeps your energy level high and you'll have great stamina with the ladies."
So, on the way home the 80-year-old stopped at the bakery.
As he was looking around, the saleslady asked if he needed any help.
He said, "Do you have any rye bread?"
She said, "Yes, there's a whole shelf of it.
Would you like some?"
He said, "I want five loaves."
She said, "My goodness, five loaves! By the time you get to the 3rd loaf, it'll be hard."
He replied,
"I can't believe everybody knows about this shit but me." | null |
52f868 | 0 | Doctor Octopus robbed a bank today.. He didn't have a gun, but he was well armed. | null |
52f77w | 0 | what did homer Simpson say when he was mad. dough..... | null |
52f672 | 19 | What noise does a Russian Sheep make?. It Blyats. | null |
52f5wy | 9 | What can fly but can't be given?. A fuck. | null |
52f5mq | 0 | What did Stevie Wonder say when he tried marihuana?. "This shit is not tobacco." | null |
52f5mo | 2 | What do people drive in the fall?. Autumn-mobiles. | null |
52f50e | 16 | Gabe Newell should be the World President. He will prevent World War 3. | null |
52f4zz | 26 | What's 7 inches and makes women submissive?. A knife. | null |
52f4ts | 220 | Put the punchline in the title. How do you spoil a joke? | null |
52f4fk | 5 | What do you call a promiscuous girl in special ed?. A tater thot | null |
52f49i | 4 | A blonde is driving along the road one day and she passes an open field.. As she is driving by she sees another blonde out in the middle of the field in a row boat rowing frantically even though she is not in any water and is not making any progress.
Furious at what she sees the blonde pulls over her car on the side of the road and gets out of the car. After observing the blonde rowing frantically and getting nowhere, she can't contain her rage any longer.
"HEY!!" the blond screams at the other blonde in the rowboat. "IT'S STUPID BLONDES LIKE YOU THAT MAKE US SMART BLONDES LOOK BAD AND IF I COULD SWIM I WOULD COME OUT THERE AND KICK YOUR ASS!!" | null |
52f3gk | 0 | Why was Rose sad about the new iPhone 7?. There was no jack | null |
52f370 | 0 | My favorite word is …. My favorite word is "world domination". It's two words now, but not when I'm done with if. | null |
52f31p | 3 | I had another job interview today.. The interviewer said, “What would you say your greatest weakness is?”
I said, “I think I’d have to say my listening skills are my greatest strength.” | null |
52f2zw | 3 | A Tech Support Story. This guy calls in to complain that he gets an "Access Denied" message every time he logs in.
It turned out he was typing his user name and password in capital letters.
Tech Support: "OK, let's try once more, but use lower case letters"
Customer: "But i only have capital letters on my keyboard" | null |
52ezoj | 66 | How a phone recall works.. Samsung: Send us your exploding phone.
Microsoft/Nokia: A software update will fix that.
Apple: You are using it wrong. | null |
52ezge | 2 | I just met a girl with 12 nipples.... Sounds pretty freaky, *dozen tit.* | null |
52ezfl | 0 | I was going to tell you a joke about sodium but.... Na. | null |
52ez9p | 13 | I have a sexual attraction and fetish for car races. I just love getting off to a good start | null |
52ex56 | 0 | Why don't counterfeiters need a college degree?. They already make a lot of money. | null |
52ex1e | 2 | Wal-Mart supercenters are going to be getting dental clinics to go with their pharmacies and vision centers..... There will actually be two clinics in each store---one regular clinic and an express clinic for people with ten teeth or less. | null |
52ewv7 | 47 | Why was the 4 year old African kid crying?. He was having a mid-life crisis. | null |
52euwm | 0 | The uniform tells all. Three boys attended a private elementary school run by priests. These boys always made sure to come to school prepared and in complete uniform, which they loved because of their amazing blue blazers, slick blue tie, and sweet black pants.
During class, Father John would lecture and always use the chalkboard. This left the priest's hands covered in chalk and whenever a student needed assistance doing homework, he would leave a handprint on the blazer of the student after patting the student on the back for a job well done.
Every kid could tell who had the most help as some students had more prints left over than others. The three boys liked to do weekly checks on their wardrobe to see who was struggling in order to help out that student.
One day they all brought their uniforms over to the first boy's house. The first boy pulled out his blazer and there were two handprints on the back. The boys laughed at the first boy because he needed help.
The second boy pulled out his uniform and he had five handprints on his back. The other boys starting laughing even harder at the second boy for all the help he needed.
Finally the third boy pulled out his blazer and the other boys wet shocked in awe that no handprints were ever found. The third boy stood with his head held high so proud of his accomplishment. "Wow, im jealous," said the first boy, "and you even got new white pants too!" | null |
52euoz | 0 | change the girl. If you can't change the girl , change the girl | null |
52eu52 | 8 | Why can't you hear a pterodactyl urinate?. The "P" is silent | null |
52etyd | 79 | A priest, a pedophile and a rapist. A priest, a pedophile, and a rapist walk into a bar. Then he sits down | null |
52etvx | 151 | My friends asked me what I liked about Switzerland. Well the flags a big plus. | null |
52erw4 | 0 | If a kiss is first base, and making love is a home run, what do you call a threesome?. Extra Innings! | null |
52eq8v | 0 | Incest is alright. as long as it stays in the family | null |
52eoxe | 22 | Why does ACDC prefer Android to Apple?. She's Got The Jack | null |
52eogz | 1 | Is sex work?. If so, then I am unemployed. | null |
52eo7j | 0 | My friends were always drunk in college. The punchline?
Full, at every event. | null |
52emrc | 54 | Why would I donate £2 to save a kid's life?. I'd rather spend that £2 on a condom to prevent a kid's life. | null |
52emmo | 7 | My girlfriend said I have crusty feet.. I blame my socks. | null |
52em5z | 22 | Person 1: "Have you seen that new movie about the tractor?". Person 2: "No, but the trailer looks good." | null |
52ely3 | 1 | We are not talking over a radio!. This relationship is over!
Me: This relationship is what? Over | null |
52elim | 0 | What do you call two gay Irishmen?. Patrick Fitzmichael and Michael Fitzpatrick | null |
52ekmo | 0 | He asked a genie to be able to create the best games ever but... .. now everyone he fucks becomes homosexual, a gay-maker. | null |
52ekfj | 6 | Why couldn't Hillary Clinton keep up her US presidential campaign?. She was let down by a weak Constitution. | null |
Subsets and Splits