question
stringlengths 18
1.2k
| facts
stringlengths 44
500k
| answer
stringlengths 1
147
|
|---|---|---|
From which language do we get the word 'bizarre'? | Bizarre Synonyms, Bizarre Antonyms | Thesaurus.com
Word Origin & History
bizarre 1640s, from Fr. bizarre "odd, fantastic" (16c.), originally "handsome, brave," perhaps from Basque bizar "a beard" (the notion being of bearded Spanish soldiers making a strange impression on the French); alternative etymology traces it to It. bizarro "angry, fierce, irascible," from bizza "fit of anger."
Example Sentences for bizarre
He leaned over the balustrade of stone near a squat vase holding a tropical plant of a bizarre shape.
But then I remind myself that the Russian ballet is nothing if not bizarre.
This nose ornament does not seem absurd; on these dark skins the effect is almost as pleasing as it is bizarre.
I wanted to surround myself with that, you know—to get the bizarre note into my work.
Scarcely a word but evokes an image, a strange, bizarre image, often a complication of images.
It's the bizarre, the dimly seen, the mysterious for good or evil.
Yet in the choice of words, one may search for the bizarre and unusual rather than for the truly picturesque.
That he—he should thus be bound up with things so black and bizarre!
They're perfectly conventional and so can't distinguish between originality that's artistic and originality that's only bizarre.
He was in a vast, wild desert, bristling with bizarre plants.
| Basque |
In which year were MOT tests introduced into Britain? | Bizarre Synonyms, Bizarre Antonyms | Thesaurus.com
Word Origin & History
bizarre 1640s, from Fr. bizarre "odd, fantastic" (16c.), originally "handsome, brave," perhaps from Basque bizar "a beard" (the notion being of bearded Spanish soldiers making a strange impression on the French); alternative etymology traces it to It. bizarro "angry, fierce, irascible," from bizza "fit of anger."
Example Sentences for bizarre
He leaned over the balustrade of stone near a squat vase holding a tropical plant of a bizarre shape.
But then I remind myself that the Russian ballet is nothing if not bizarre.
This nose ornament does not seem absurd; on these dark skins the effect is almost as pleasing as it is bizarre.
I wanted to surround myself with that, you know—to get the bizarre note into my work.
Scarcely a word but evokes an image, a strange, bizarre image, often a complication of images.
It's the bizarre, the dimly seen, the mysterious for good or evil.
Yet in the choice of words, one may search for the bizarre and unusual rather than for the truly picturesque.
That he—he should thus be bound up with things so black and bizarre!
They're perfectly conventional and so can't distinguish between originality that's artistic and originality that's only bizarre.
He was in a vast, wild desert, bristling with bizarre plants.
| i don't know |
Which Cole Porter musical featured the song 'Just One Of Those Things'? | Cole Porter Is Dead; Songwriter Was 72
Cole Porter Is Dead; Songwriter Was 72
By The Associated Press
SANTA MONICA, Calif., Oct. 15--Cole Porter, the world-famed composer and lyricist, died at 11:05 P.M. today at a Santa Monica hospital, where he underwent kidney surgery last Tuesday. He was 72 years old.
Mr. Porter wrote the lyrics and music for his songs, and to both he brought such an individuality of style that a genre known as "the Cole Porter song" became recognized.
The hallmarks of a typical Porter song were lyrics that were urbane or witty and a melody with a sinuous, brooding quality. Some of his best-known songs in this vein were "What Is This Thing Called Love," "Night and Day," "Love for Sale" and "Begin the Beguine."
But an equally typical and equally recognizable Porter song would have a simple, bouncy melody and a lyric based on a long and entertaining list of similarities, opposite or contrasts. "Let's Do It" ticked off the amiable amatory habits of birds, flowers, crustacea, fish, insects, animals and various types of humans, while "You're the Top" was an exercise in the creation of superlatives that included such items as "the nimble tread of the feet of Fred Astaire," "Garbo's salary" and "Mickey Mouse."
Still a third type of Porter song was exclamatory in both lyrics and melody. "Just One of Those Things," "From This Moment On" and "It's All Right With Me" were instances.
Reflected His Living
The glossy opulence of the scores Mr. Porter wrote for Broadway and Hollywood was a valid reflection of his own manner of living. Between World Wars he and his wife, the former Linda Lee of Louisville, Ky., were active in a gay international set that gathered at Paris, the Riviera and Venice.
Their home on the Left Bank in Paris had platinum wallpaper and chairs upholstered in zebra skin. Mr. Porter once hired the entire Monte Carlo Ballet to entertain his house guests. For a party in Venice, where he rented the Palazzo Rezzonico for $4,000 a month, he hired 50 gondoliers to act as footmen and had a troupe of high-rope walkers perform in a blaze of lights.
Most of Mr. Porter's songs were written far from Broadway. His score for "Anything Goes," which included "I Get a Kick Out of You," "You're the Top," "All Through the Night" and the title song, was composed while he was cruising down the Rhine. He wrote the songs for "Jubilee" ("Begin the Beguine," "Just One of Those Things" and "Why Shouldn't I?" among others) during a round-the- world cruise with the show's librettist, Moss Hart.
But Mr. Porter was no dilettante composer. Not even the rigors of his busy social rounds interfered with his creativity.
"I've done lots of work at dinner, sitting between two bores," he once said. "I can feign listening beautifully. I can work anywhere."
Praised by Rodgers
He was a careful craftsman whose work won the admiration of his peers. Richard Rodgers has said, "Few people realize how architecturally excellent his music is. There's a foundation, a structure and an embellishment. Then you add the emotion he's put in and the result is Cole Porter."
Mr. Porter himself could not characterize his songs.
"I don't know how my music gets that way," he said when he was asked to make the effort. "I simply can't analyze it. I can analyze the music of others. The word for Dick Rodgers's melodies, I think, is holy. For Jerome Kern, sentimental. For Irving Berlin, simplicity. For my own, I don't know."
Mr. Porter was a trim, slight, dark man, groomed in subdued, elegant taste. He usually sported a boutonniere in the lapel of his well-tailored suits. His speech was quiet, reserved, almost clipped.
He was born on a 750-acre farm in Peru, Ind., on June 9, 1892, the son of Samuel Fenwick Porter, a fruit grower, and the former Kate Cole. He could play the violin when he was 6 and the piano when he was 8. At the age of 10 he composed a song, "The Bobolink Waltz," that pleased his mother so much that she had it published in Chicago.
Despite the boy's musical leanings, his maternal grandfather, J. O. Cole, who had made a fortune in the lumber business, wanted him to be a lawyer. To this ostensible end, young Porter was sent to Worcester Academy in Massachusetts and to Yale, where he wrote two of the most famous of all college songs, "Bingo Eli Yale" and the "Yale Bulldog Song."
He continued his studies at the Harvard Law School but, at the suggestion of the dean, transferred to the School of Music. With a fellow student, T. Lawrason Riggs, he wrote a show, "See America First," which was produced on Broadway in 1916 with a cast that included Clifton Webb. It was a failure. Mr. Porter then joined the French Foreign Legion where he had a specially constructed portable piano made for him so that he could carry it on his back and entertain the troops in their bivouacs.
In 1919 he married Mrs. Linda Lee Thomas, widow of E. R. Thomas, a banker and publisher, and settled in Paris.
Mr. Porter made casual contributions to two revues during the early 1920's, "Hitchy-Koo" and "Greenwich Village Follies of 1924," but he was not induced to write a Broadway score again until 1928, where he contributed the songs to "Paris," a play with incidental music that starred Irene Bordoni. Only five of Mr. Porter's songs were used in the final production, but one was the provocatively amusing "Let's Do It."
During the intervening years he had been writing and performing songs for the amusement of his friends, but the reception accorded "Let's Do It" apparently convinced him that he could communicate pleasurably to a broader audience. As a result, a steady series of Porter show scores and a wide variety of memorable songs followed during the next 15 years.
Among these shows and songs were "Fifty Million Frenchmen" in 1929 ("You Do Something To Me"); "Wake Up and Dream," also 1929 ("What Is This Thing Called Love"); "The New Yorkers" in 1930 ("Love for Sale"); "Gay Divorce" in 1932 with Fred Astaire ("Night and Day"); "Anything Goes" with Ethel Merman, Victor Moore and William Gaxton in 1934 ("You're the Top," "I Get a Kick Out of You"); "Jubilee" in 1935 ("Begin the Beguine," "Just One of Those Things"); "Red, Hot and Blue" with Miss Merman, Jimmy Durante and Bob Hope in 1936 ("It's De-lovely," "Down in the Depths of the '0th Floor").
Also, "Leave It to Me" in 1938 in which Mary Martin made her Broadway debut singing "My Heart Belongs to Daddy"; "Dubarry Was a Lady" with Miss Merman and Bert Lahr in 1939 ("Friendship"); "Panama Hattie" with Miss Merman in 1940 ("Make It Another Old Fashioned, Please"), "Let's Face It" in which Danny Kaye sang "Melody in 4F" in 1941; "Something for the Boys" with Miss Merman in 1943 and "Mexican Hayride" with Bobby Clark in 1944.
While Mr. Porter was horseback riding in the summer of 1937, his horse slipped, threw him and fell on top of him, breaking both his legs and damaging his nervous system. One result of Mr. Porter's accident was chronic osteomyelitis, a bone disease. In attempts to alleviate this, he was subjected to more than 30 operations during the next 20 years but, despite this, his right leg had to be amputated in 1958. For the rest of his life, Mr. Porter lived under the constant pressure of pain and, reversing his previously gay social life, became a virtual recluse.
Worked in Wheel Chair
Still he continued to turn out his songs. The score for "Leave It to Me," written shortly after his accident, was composed while he was almost completely bedridden. In order to continue his work, he had his piano placed on blocks so that he could roll up to the keyboard in his wheel chair.
At the end of World War II, Mr. Porter hit what seemed to be a dry period. Two successive shows-- "Seven Lively Arts" in 1944 and "Around the World in 80 Days" in 1946--were failures. But in 1948 he came back with his biggest artistic and commercial success, "Kiss Me Kate," a musical treatment of "The Taming of the Shrew."
In this score, Mr. Porter was not only at his Porterian best with such songs as "Too Darn Hot," "Always True to You in My Fashion" and "So in Love," but he also revealed a remarkable talent for blending the idioms of both Porter and Shakespeare in "I've Come to Wive It Wealthily in Padua," "I Am Ashamed that Women Are So Simple," "I Hate Men" (which Brooks Atkinson called "the perfect musical sublimation of Shakespeare's evil-tempered Kate") and the kind of grammatical challenge that Mr. Porter relished, a song written entirely in the subjunctive, "Were Thine That Special Face."
Other Musicals
Mr. Porter's later Broadway scores included "Out of This World" (1950), "Can-Can" (1953) and "Silk Stockings" (1955).
For films he wrote "I've Got You Under My Skin" and "Easy to Love" for "Born to Dance" in 1936; "Rosalie" and "In the Still of the Night" for "Rosalie" in 1937; "I Concentrate on You" for "Broadway Melody" in 1940 and "You'd Be So Nice to Come Home To" for "Something to Shout About" in 1943.
Mr. Porter's wife died in 1954. During his last years he lived in a nine-room, memorabilia-filled apartment in the Waldorf Towers. On weekends he was driven to a 350-acre estate in the Berkshires and in the summers he lived in California.
He rarely saw anyone except intimate friends. A 90-minute television program honoring him was presented in 1960, and a party celebrating his 70th birthday was given in 1962, but he was unwilling to attend either event. When Yale University wished to confer an honorary degree of Doctor of Humane Letters on him in 1960, Mr. Porter accepted on condition that the presentation be made in his apartment.
| Paris (disambiguation) |
In 1930, which Canadian city hosted the first Empire Games? | Cole Porter - Biography - IMDb
Cole Porter
Biography
Showing all 34 items
Jump to: Overview (4) | Mini Bio (1) | Spouse (1) | Trivia (23) | Personal Quotes (3) | Salary (2)
Overview (4)
5' 6" (1.68 m)
Mini Bio (1)
Cole Porter was born June 9, 1891, at Peru, Indiana, the son of pharmacist Samuel Fenwick Porter and Kate Cole. Cole was raised on a 750-acre fruit ranch. Kate Cole married Samuel Porter in 1884 and had two children, Louis and Rachel, who both died in infancy. Porter's grandfather, J.G. Cole, was a multi-millionaire who made his fortune in the coal and western timber business. His mother introduced him to the violin and the piano. Cole started riding horses at age six and began to studying piano at eight at Indiana's Marion Conservatory. By age ten, he had begun to compose songs, and his first song was entitled "Song of the Birds".
He attended Worcester Academy in Worcester, Massachusetts, in 1905, an elite private school from which he graduated in 1909 as class valedictorian. That summer he toured Europe as a graduation present from his grandfather. That fall, he entered Yale University and lived in a single room at Garland's Lodging House at 242 York Street in New Haven, CT, and became a member of the Freshman Glee Club. In 1910, he published his first song, "Bridget McGuire". While at Yale, he wrote football fight songs including the "Yale Bulldog Song" and "Bingo Eli Yale," which was introduced at a Yale dining hall dinner concert. Classmates include poet Archibald Macleish , Bill Crocker of San Francisco banking family and actor Monty Woolley . Dean Acheson , later to be U.S. Secretary of State, lived in the same dorm with Porter and was a good friend of Porter. In his senior year he was president of the University Glee club and a football cheerleader.
Porter graduated from Yale in 1913 with a BA degree. He attended Harvard Law school from 1913 to 1914 and the Harvard School of Music from 1915 to 1916. In 1917 he went to France and distributed foodstuffs to war-ravaged villages. In April 1918 he joined the 32nd Field Artillery Regiment and worked with the Bureau of the Military Attache of the US. During this time he met the woman who would become his wife, Linda Lee Thomas, a wealthy Kentucky divorcée, at a breakfast reception at the Ritz Hotel in Paris. He did not, as is often rumored, join the French Foreign Legion at this time, nor receive a commission in the French army and see combat as an officer.
In 1919 he rented an apartment in Paris, enrolled in a school specializing in music composition and studied with Vincent D'indy. On December 18, 1919, married Linda Lee Thomas, honeymooning in the south of France. This was a "professional" marriage, as Cole was, in fact, gay. Linda had been previously married to a newspaper publisher and was described as a beautiful woman who was one of the most celebrated hostesses in Europe. The Porters made their home on the Rue Monsieur in Paris, where their parties were renowned as long and brilliant. They hired the Monte Carlo Ballet for one of their affairs; once, on a whim, they transported all of their guests to the French Riviera.
In 1923 they moved to Venice, Italy, where they lived in the Rezzonico Palace, the former home of poets Elizabeth Barrett Browning and Robert Browning . They built an extravagant floating night club that would accommodate up to 100 guests. They conducted elaborate games including treasure hunts through the canals and arranged spectacular balls.
Porter's first play on Broadway featured a former ballet dancer, actor Clifton Webb . He collaborated with E. Ray Goetz , the brother-in-law of Irving Berlin , on several Broadway plays, as Goetz was an established producer and lyricist.
His ballad "Love For Sale" was introduced on December 8, 1930, in a revue that starred Jimmy Durante and was introduced by Kathryn Crawford . Walter Winchell , the newspaper columnist and radio personality, promoted the song, which was later banned by many radio stations because of its content. In 1934, his hit "Anything Goes" appeared on Broadway. During the show's hectic rehearsal Porter once asked the stage doorman what he thought the show should be called. The doorman responded that nothing seemed to go right, with so many things being taken out and then put back in, that "Anything Goes" might be a good title. Porter liked it, and kept it. In 1936, while preparing for "Red, Hot and Blue" with Bob Hope and Jimmy Durante , Ethel Merman was hired to do stenographic work to help Porter in rewriting scripts of the show. He later said she was the best stenographers he ever had.
Porter wrote such classic songs as "Let's Do It" in 1928, "You Do Something To Me" in 1929, "Love For Sale" in 1930, "What Is This Thing Called Love?" in 1929, "Night and Day" in 1932, "I Get A Kick Out Of You" in 1934, "Begin the Beguine" in 1935, "My Heart Belongs to Daddy" in 1938, "Don't Fence Me In" in 1944, "I Love Paris" in 1953, "I've Got You Under My Skin", In the Still of The Night", "You'd Be So Nice To Come Home To", "True Love", "Just One Of Those Things", "Anything Goes", "From This Moment On", "You're The Top", "Easy to Love" and many, many more.
On October 24, 1937, taking a break from a re-write of what would be his weakest musical, "You Never Know", visiting as a guest at a countess' home, Piping Rock Club in Locust Valley, New York, he was badly injured in a fall while horseback-riding. Both of his legs were smashed and he suffered a nerve injury. He was hospitalized for two years, confined to a wheelchair for five years and endured over 30 operations to save his legs over the next 20 years. During his recuperation he wrote a number of Broadway musicals.
On August 3, 1952, his beloved mother died of a cerebral hemorrhage. His wife, Linda, died of cancer on May 20, 1954. On April 3, 1958, he sustained his 33rd operation, and still suffering from chronic pain, his right leg was amputated. He refused to wear an artificial limb and lived as a virtual recluse in his apartment at the Waldorf-Astoria in New York City. He sought refuge in alcohol, sleep, self-pity and sank into despair. He even refused to attend a "Salute to Cole Porter" at the Metropolitan Opera on May 15, 1960, and the commencement exercises at Yale University in June of 1960 when he was conferred with an Honorary Doctorate of Humane Letters, or his 70th birthday party arranged by his friends at the Orpheum Theater in New York City in June 1962.
After what appeared to be a successful kidney stone operation at St. John's hospital in Santa Monica, California, he died very unexpectedly on October 15, 1964. His funeral instructions were that he have no funeral or memorial service and he was buried adjacent to his mother and wife in Peru, Indiana.
- IMDb Mini Biography By: Mike McKinley <[email protected]>
Spouse (1)
Trivia (23)
Older brother and sister (Louis and Rachel) died in infancy
Pictured on a 29¢ US commemorative postage stamp in the Performing Arts series, issued 22 May 1991, celebrating the 100th anniversary of his birth.
His musical Kiss Me Kate, performed at the Open Air Theatre, was nominated for a 1998 Laurence Olivier Theatre Award as Outstanding Musical Production of 1997.
His musical High Society, performed at the Open Air Theatre, was nominated for a 2004 Laurence Olivier Theatre Award as Outstanding Musical Production of 2003.
His musical, Anything Goes performed at the Royal National Theatre: Olivier in 2002, was awarded the 2003 Laurence Olivier Theatre Award for Outstanding Musical Production.
His musical Anything Goes, performed at the Royal National Theatre in London, England was awarded the 2002 London Critics Circle Award (Drama) for Best Musical.
His musical, Kiss Me Kate, performed at the Victoria Palace Theatre in London, was awarded the 2001 London Critics Circle Theatre Award for Best Musical.
Referenced in the song 'The Call of the Wild (Merengue)' by David Byrne on his 1989 album, 'Rei Momo'.
In 1949, won two Tony Awards for "Kiss Me, Kate": Best Composer and Lyricist, and for music and lyrics as part of the Best Musical Award.
It is said that while on his honeymoon in Ravenna (Italy), he was so impressed by the mood of the small Mausoleum of Galla Placidia that he wrote his famous song "Night and Day" while thinking of the starry sky mosaic under Mausoleum's cupola.
Class valedictorian of Worcester Academy in Worcester, Massachusetts - an elite prep school. Alums include 1960s icon Abbie Hoffman , "Durango Kid" cowboy actor Charles Starrett and screenwriter Caitlin McCarthy .
A member of the Delta Kappa Epsilon fraternity, from his undergraduate days.
Lived at the Waldorf-Astoria Tower in New York City from 1939 through 1964. A young hotel worker named Glory Santos was assigned to his suite as room service concierge soon after he moved in. He befriended her and would play new compositions he was working on to get her opinion. Among the first of these compositions was the song called "I Concentrate on You".
Was portrayed by Cary Grant in Night and Day (1946) Kevin Kline in the movie, De-Lovely (2004), both based (to some degree) on his life.
He was considered somewhat "washed up" at the time that he wrote what would become his greatest musical "Kiss Me, Kate". Although many of the musicals that he wrote songs for between 1937 and 1948 achieved respectable runs, none of them contained any truly classic hit songs. That changed when he wrote the score for "Kiss Me, Kate", which contained "So In Love", "Wunderbar", "Too Darn Hot", "Brush Up Your Shakespeare", "Were Thine That Special Face", and others. However, because "Kate" was written in 1948, there is no mention of it at all in the Cole Porter biographical film "Night and Day".
Inducted into the Songwriters Hall of Fame in 1970.
His estate continues to earn revenue in excess of $3 million per year, which is disbursed among numerous relatives.
When he died he gave his 350 acre estate, known as Buxton Hill, to Williams College.
He was awarded a Star on the Hollywood Walk of Fame for Recording at 7080 Hollywood Boulevard in Hollywood, California.
The lyrics to "I Get A Kick Out Of You", which first appeared in the Broadway musical "Anything Goes" (1936), were changed in the aftermath of the kidnapping of the Lindbergh child in 1932. The lines, "I Never cared for those nights in the air or the fair (ordeal) Mrs. Lindbergh went through" became "flying too high with some guy in the sky is my idea of nothing to do".
Some 900 songs are attributed to him.
In his series 20th Century Greats (2004), British composer and presenter Howard Goodall made a case for Porter as one of the four most important composers of the 20th century, along with Leonard Bernstein , Bernard Herrmann and the Lennon ( John Lennon )\McCartney ( Paul McCartney ) songwriting partnership.
Cole Porter was so fond of the "So Good Fudge" made in his hometown of Peru, Indiana, at Louis Arnold's Candy Kitchen, that he had nine pounds sent to him each month wherever he was in the world.
Personal Quotes (3)
I am the most enthusiastic person in the world. I like everything as long as it's different.
[on the official studio response to 'In The Still of the Night'] Imagine making Louis B. Mayer cry! What could possibly top that?
It seems strange to me that changes in my lyrics are often made, and even changes to the music, without anyone even asking my permission.
Salary (2)
| i don't know |
Which Hollywood actress did trumpet player Harry James marry? | Trumpet Blues: The Life of Harry James by Peter J. Levinson - JazzTimes
By Jack Sohmer
Trumpet Blues: The Life of Harry James by Peter J. Levinson
A working associate and friend of Harry James from 1959 to his death in 1983, former booking agent and publicist Peter Levinson offers a no-nonsense look at the trumpeter’s lifetime career in music, from a childhood spent in his father’s traveling circus band, through his many years as a superstar celebrity, to his final decline as both artist and man. Although undoubtedly sincere in his professed love for jazz, Levinson surprisingly says very little about the music itself. Most notably, he neglects to describe in his own words how James differed in style and technique from other trumpet players, how his bands ranked musically in comparison with those of his contemporaries, and finally, how we should reconcile his blatant commercialism in the 1940s and ’50s with his oft-expressed admiration for Louis Armstrong and other jazzmen.
Levinson is especially strong in ferreting out the details of James’ early career as a circus bandsman, but he is too quick in glossing over his first big-time gig with the Ben Pollack band of the mid-1930s. The far more well-chronicled 1937-38 Benny Goodman period is treated better, thanks to already published research and a plethora of personal interviews with such important primary sources as Harry’s first wife, Louise Tobin, who sang with Goodman in 1939, and about 200 other musicians, friends, and business associates. Because of them, we learn much about the man behind the horn. Apparently a lusty guy from puberty onwards, Harry never learned to restrain his impulses, even when married to one of the most popular pin-up girls of the 1940s, top-ranking Hollywood actress Betty Grable. Even his sidemen marveled at his insatiable appetite, endurance, and, especially, his indiscriminate taste. Beautiful or ugly, young or old, they were all grist for his mill. Harry’s legendary exploits in hotel bedrooms were only exceeded by his gargantuan thirst for booze and his self-destructive need to gamble away every dollar he earned, habits that ultimately even consumed Betty’s considerable savings as well. Levinson reports that by the time of her death in 1973, eight years after their 22-year-long marriage had ended, Harry and Betty had lost around $24 million at both the Las Vegas gaming tables and the track. His drinking, however, was by far the more serious of their problems, having eventually led him, on several occasions, to treat Betty like a punching bag. In 1965, Betty finally sued for divorce on the grounds of extreme cruelty. Harry kept his band working in Las Vegas and on the road to pay off his debts, but he had already lost the best meal ticket he was ever to have.
Harry loved his horn first and foremost, with baseball running a close second, and from his youth he was gifted with such great chops that he never even had to warm up before playing, much less engage in routine practicing as most hornmen do. It all came so easily to him. But, as was also the case with Bix Beiderbecke and Bunny Berigan, that superhuman tolerance for round-the-clock heavy drinking ultimately demanded its prize. Perhaps because of the better medical care available in the 1970s Harry did not die as young as Bix and Bunny had, but all accounts indicate that toward the end there was scarcely anything left of the one-time musical powerhouse. He was only 67 at the time of his death, but he looked much, much older. Additionally, because of cancer and the loss of his teeth, he had not been able to blow a note for some time.
Levinson did a good job of piecing together Harry’s story from those who knew him personally, but in some cases his knowledge of jazz history is way off. For example, he says that in 1937, when Johnny Hodges recorded Harry’s swing instrumental, “Peckin’,” lyrics were added and the title was changed to “Foolin’ Myself.” Actually, “Foolin’ Myself,” a tune that Billie Holiday also recorded, has nothing to do with “Peckin'” except that both were recorded at the same session. Indeed, Hodges’ “Peckin'” was initially rejected and did not surface on record until the late 1970s, when it appeared on a bootleg LP. Elsewhere, Levinson says that Lionel Hampton’s first recording on vibes was Louis Armstrong’s 1931 “Shine,” but the discographies, as well as Louis’ and Hamp’s own accounts, tell us that it was “Memories of You,” which was recorded five months earlier. Perhaps these gaffes are not too important in themselves, but they do cast doubt on the credibility of some of Levinson’s other remarks.
In the course of reading, you may discover things you probably never knew about Harry’s relationship with his most illustrious stars-Frank Sinatra and Buddy Rich-among many other sidemen, singers, and show biz buddies. For example, the late Helen Forrest, who had sung with Artie Shaw and Goodman before joining James, tells of her unrequited love for the very much still married bandleader, who continually romanced his “chirp,” all the while putting off her dreams of marriage on the grounds that his father objected to her being Jewish! Harry was also seeing Betty during this time, and when she got pregnant the busy trumpet player was forced to ask Louise for a divorce. This being 1943, if a hot film property and WWII dream girl like Grable were involved in a sex scandal, it would have wrecked her career, and Harry’s as well. Too much was at stake. Louise was high-pressured into a quickie Mexican divorce by Harry’s lawyer, thus freeing her errant husband to marry Betty and save the day for Hollywood.
Like other pre-rock superstars, such as Sinatra and Rich, whose most supportive fans in the ’50s and ’60s were either big Vegas spenders or their middle-class wannabes, Harry was having the ball of his life. Ever the kid and thinking that the gravy train would never stop, he never even thought of saving or investing his money. It was only a matter of time, then, before his losses put him into serious debt to the mob. In a short time, he was virtually an indentured servant, his expensive ongoing payroll for his band and staff, his unpaid back taxes, and his continuing jones for the bottle and the tables eventually reducing him to financial ruin.
In his prime, a period that lasted far longer for him than it did for most trumpeters, Harry James was the living definition of a celebrity virtuoso, a modern-day Paganini or Liszt. He could swing with great flamboyance and heat, he could play the blues with sincerity, and he could endow ballads with “schmaltzy” romanticism. But, perhaps most importantly, in his latter years he could finally turn his band around to reflect his longstanding love for the Basie sound, which he demonstrated not only in his choice of arrangements by Neal Hefti and the late Ernie Wilkins, but also in his own adaptations of the styles of Buck Clayton and Harry Edison. James was certainly no musical innovator in the sense of a Louis, Roy, or Dizzy, but he was unquestionably the most technically well-endowed, versatile, and influential trumpeter of his time. It’s just a shame that he never grew up.
Next Article
| Betty Grable |
In Chinese philosophy, what are the terms for contrasting and complementary forces or principles of the universe? | JAMES, HARRY HAAG | The Handbook of Texas Online| Texas State Historical Association (TSHA)
Texas State Historical Association (TSHA)
Site
JAMES, HARRY HAAG
Harry James was a popular trumpeter and bandleader of the big band era. He appeared cameo or with Benny Goodman’s band in many movies of the 1940s and 1950s. Duncan Schiedt Collection.
JAMES, HARRY HAAG (1916–1983). Harry Haag James, jazz trumpet player and big-band leader, was born to Everett Robert and Maybelle (Stewart) James on March 15, 1916, in Albany, Georgia. James began his stage life as the circus contortionist in the Haag Circus, which later became the Christy Brothers Circus. The gimmick was "the Youngest and Oldest Contortionists in the World," because young Harry worked with a seventy-year-old partner. He started his musical education with the drums at age four in the circus band. He learned to play piano and trumpet with his father, the circus bandmaster.
Though thought by many to be a native Texan, Harry James did not arrive in Texas until the 1930s, when he and his parents moved to Beaumont. There he played trumpet and led a band. In 1934 he toured as a trumpet player with Joe Gill. When he joined Art Hicks and His Orchestra in 1934 he met vocalist and North Texas native Louise Tobin. They married in 1935. Tobin, a rising star in her own right, would later be featured with Benny Goodman’s orchestra before relenting to James’s wishes that she give up her career to start a family; they had two sons.
James joined Ben Pollack's band in 1935 and made his recording debut with the group early in 1936. Fame came later that year, when James joined Benny Goodman's orchestra. He made a name for himself with fiery trumpet solos and an appearance in the band's 1938 movie, Hollywood Hotel. After he started the Harry James Band in 1939, his hit song "You Made Me Love You" (1941) sold more than a million copies. Other popular Harry James recordings included "Carnival in Venice" and "Flight of the Bumble Bee." Early in his career as bandleader, James hired an unknown Frank Sinatra upon the recommendation of his wife Louise, but Sinatra soon left his band and accepted an offer to join Tommy Dorsey.
Listen to this artist
James had a great technique that showed off rich, brassy tones. A true virtuoso, Harry, along with his band, developed the boogie-woogie style for big-band swing. His romantic ballads, the key to his success, shot him to fame as a big-band leader. In 1941 a national poll voted his band the number-one dance band in the country. He appeared on radio shows for Danny Kaye, Coca Cola, and Jack Benny, and also on his own series, sponsored by Chesterfield Cigarettes. Some of the famous musicians who performed with Harry James in the 1940s were Dick Haymes, Frank Sinatra, and Helen Forrest. Into the 1950s and 1960s Harry and the band were joined as well by Buddy Rich, Sam Firmature, Jack Perciful, and Ray Sims.
James continued to be popular, appearing cameo or with Benny Goodman's band in many movies, including Two Girls and a Sailor (1944), Young Man with a Horn (1950), The Benny Goodman Story (1955), and Anything Goes (1956). Still an active musician in the 1970s, he was quoted then as saying, "I don't look at people as changing, being old or being young. I just look down from the stand to see if people are having fun."
James divorced Louise Tobin in 1943 and promptly married actress Betty Grable. He and Betty moved to Las Vegas, where Harry played for many years. They had two daughters but were divorced in 1965. Afterward, he married Joan Boyd, a Las Vegas showgirl, with whom he had a son. James died of cancer at the age of sixty-seven on July 5, 1983, in Las Vegas, Nevada. That year he was inducted into the Big Band and Jazz Hall of Fame. The Museum of the Gulf Coast’s Music Hall of Fame in Port Arthur also honors James as a music legend, and he has a star on the Hollywood Walk of Fame.
BIBLIOGRAPHY:
Charles Eugene Claghorn, Biographical Dictionary of Jazz (Englewood Cliffs, New Jersey: Prentice–Hall, 1982). Peter Gammond, The Oxford Companion to Popular Music (Oxford University Press, 1991). Roger D. Kinkle, The Complete Encyclopedia of Popular Music and Jazz: 1900–1950 (4 vols., New Rochelle, New York: Arlington House, 1974). Vertical Files, Dolph Briscoe Center for American History, University of Texas at Austin. Leo Walker, The Big Band Almanac (Hollywood: Vinewood Enterprises, 1978).
Alan Lee Haworth
| i don't know |
Which body of water separates Alaska from Russia? | Interview with Russian travelers: What body of water separates alaska from russia - Russian cities today
Interview with Russian travelers: What body of water separates alaska from russia
Details
SocButtons v1.6
From Chukotka to Alaska: "walruses" from the Perm region crossed the Bering Strait. Interview
Two residents of Perm region - Kulyapin Alexander and Elena Guseva (Berezniki) hit the "Russian Book of Records." In August, they took part in a relay swim Chukotka-Alaska across the Bering Strait, body of water that separates Alaska from Russia.
Elena Guseva and Alexander Kulyapin, the participants of the project "Chukotka-Alaska 2013"
The start took place August 5tn from Cape Dezhnev (Chukotka, Russia), finish - August 11th at Cape Prince of Wales (Alaska, USA). During the six days, 65 swimmers from 18 countries have overcome 134 kilometers instead of the planned 86 kilometers – given the northern and southern currents and wind. Kulyapin Alexander and Elena Guseva crossed together for about 10% of the route - 14 km.
The participants had to fight strong swim ocean excitement, cold wind gusts up to 17-22 m/s and dense fog. The water temperature in the Bering Strait ranged from 2 to 8 °C. Swimmers were in the water without a wetsuit.
Alexander Kulyapin: things do not go according to our plan. In Khabarovsk, we thought that we could cross the Bering Strait in two days. According to our calculations, everyone had to go into the water 2 times. But it so happened that uncharted streams opened. We had to overcome them with a very low speed and large effort.
Good to know - Can you drive from Alaska to Russia .
Also, tides were a complete surprise to us. Several counter-streams between Alaska and the Big Diomede Islands (Ratmanov Island) were a serious obstacle for swimmers. A group of 30 participants, for two days stormed the 18-kilometer section of the strait. Because of the difficult weather conditions the duration of each race has been reduced from 20 to 10 minutes.
Alexander Kulyapin: Among us there are those who swim the breaststroke and those who the front crawl. When we stopped moving, we decided that at this stage will front crawl swimmers will swim instead of us. The rest of the male swimmers were on duty.
Read the article: " Myth & Facts: How much did Russia sell Alaska for ".
During the relay Alexander Kulyapin made five attempts. First, he said, was at night - in the darkness, and the next, unscheduled - early in the morning. We had to urgently replace the Argentine swimmer, who could not go to his start. Also, the relay participants were on duty.
Alexander Kulyapin: In the boat, except the spare swimmer, certainly was a man who helps to get out of the water. Because of the cool, our hands were shackled and it was quite difficult to approach the boat and jump into it for us.
Alexander Kulyapin: Once the race started, the weather in the body of water separating Alaska from Russia changed. Storm (4-5 points) was almost constant. In 6 points there was a short stop. We fixed this point with this GPS and stopped. What's interesting, when the race was stopped - the storm subsided and when we started again - it intensified. How to explain it, I do not know. When we came back from Yakutsk city, the shaman and Yakuts later perform the ritual - to lure the host of the ocean. But he had us up until we sailed to Alaska. Once we got to the coast, a storm turned into calm at once, the sun came out. The Americans said they have not experienced such good weather a long time.
Hospital ship of the Pacific Fleet "Irtysh" accompanied the race.
Alexander Kulyapin: Conditions were very good - a sauna, special shower for heating - all you need to recover the heat balance. The whole medical team watched over our health - they measured blood pressure, pulse, temperature. There were not deep hypothermia in swimmers - body temperature below 32 degrees did not fall. This allows all swimmers to recover quickly and be ready for the next race. By the wat, how far is Alaska from Russia ?
Finishing point was the American settlement Wales with a population of 160 people. In the school a memorial plate dedicated to swim was erected. "In America, we felt ourselves like guests. We were greeted very warmly, the mayor came out immediately, shook hands with all, Eskimos cheered, "- says the athlete.
At home Alexander Kulyapin returned at the end of August.
| Bering Strait |
Which Frenchman did John Isner memorably defeat 70- 68 in the fifth set of this year's Wimbledon Championship? | The Bering Strait is the narrow body of water that separates
Add this question to a group or test by clicking the appropriate button below.
Grade 8 Bodies of Water and Continents
The Bering Strait is the narrow body of water that separates Russia from Alaska
True
False
You need to have at least 5 reputation to vote a question down. Learn How To Earn Badges .
| i don't know |
Which composer wrote the operas 'The Pearl Fishers' and 'Carmen'? | Georges Bizet in a nutshell
Born: 25 Oct 1838 in Paris. Zodiac: Scorpio
Died: 3 June 1875 in Paris. Age: 36
Cause of death: Heart attacks.
Father: Adolphe - hairdrsser, wigmaker and music teacher
Mother: Aimée - talented pianist
Siblings: none
Wife: Genevieve daughter of his teacher Prof.Jacques Halevy
Children: one son, Jean, with his mother's maid and one son, Jacques, with his wife Genevieve.
Grave Cimetière du Père Lachaise, Paris
Influenced by: Schubert, Gounod, Saint-Saens, Offenbach.
Major works
OPERA: Best known for Carmen, he in fact wrote 30 operas, many of which are rarely performed.
- The Pearl Fishers - set in Ceylon (Sri Lanka)
- The Fair Maid of Perth
- Djamileh
- Carmen
ORCHESTRAL: He wrote a symphony when he was 17. It was discovered in 1935 in the archives of the Paris Conservatory where he studied.
- Symphony in C
PIANO: He was an accomplished pianist and wrote many pieces for the keyboard.
- Chromatic Variations
Personality
Curly black hair, square jaw, great beard, bright alert eyes, impressive appearance.
He had a good sense of humour and was well liked. He did however have a violent temper and was prone to challenge people to fights or even duels.
Heavy smoker in spite of recurring throat problems (probably throat cancer).
Left-wing politically. Anti-religious. Womaniser.
Bizet Quotes
"Ah, music! What a beautiful art! But what a wretched profession!"
"Religion is a means of exploitation employed by the strong against the weak; religion is a cloak of ambition, injustice and vice."
Travels and career
- Age 9 - Entered Paris Conservatoire (below their minimum age)
- Age 17 - Produced the Symphony in C, his first.
- Age 19 - Won the prestigious Prix de Rome
- Age 20-23 - Lived and studied in Rome at the Villa Medici where he was popular with the other students.
- Age 25 - 'The Pearl Fishers', his first important opera, staged in Paris.
- Age 31 - Married Genevieve, rich daughter of his former teacher.
- Age 32 - Although as Prix de Rome winner he was exempt from conscription, he joined the National Guard to defend Paris in the Siege during the Franco-Prussian War.
- Age 34 - Birth of son Jacques
- Age 36 - Premier of 'Carmen'.
- Appointed chevalier de la Legion d'Honneur.
- Died of a heart attack 3 months later.
Bizet in Art
A fascinating collection of images - art, portraits, caricatures, cartoons, album covers and postage stamps.
Amazon Store
| Georges Bizet |
By what name is the Jewish Day of Atonement also known? | Georges Bizet | Biography & History | AllMusic
google+
Artist Biography by Rovi Staff
Known for one of the world's most popular operas, Carmen, Georges Bizet deserves attention as well for other works of remarkable melodic charm. Many of his works received cool receptions on their premieres but are now considered central to the repertory of classical music.
Bizet was born in Paris on October 25, 1838, and grew up in a happy, musical family that encouraged his talents. He learned to read music at the same time he learned to read letters, and equally well. Entering the Paris Conservatory before he was ten, he earned first prize in solfège within six months, a first prize in piano in 1852, and eventually, the coveted Prix de Rome in 1857 for his cantata Clovis et Clotilde. His teachers had included Marmontel for piano and Halévy for composition, but the greatest influence on him was Charles Gounod , of whom Bizet later said "You were the beginning of my life as an artist." Bizet himself hid away his Symphony in C, written when he was 17, feeling it was too much like its models, Gounod 's symphonies. The two years spent in Rome after winning his prize, would be the only extensive time, and a greatly impressionable one, that Bizet would spend outside of Paris in his brief life. When he returned to Paris, he lost confidence in his natural talents and began to substitute dry Germanic or academic writing for his own developing idiom. He composed a one-act opera for production at the Opéra-Comique, but the theater's director engaged him to write a full-length opera instead, Les pêcheurs de perles (The Pearl Fishers). It was not a success at the time, but despite a few weaknesses, the work was revived in 1886, and its sheer beauty has earned it a respected position among the lesser-played operatic repertory. In 1863 Bizet 's father bought land outside Paris where he built two bungalows, one of which Bizet frequently used as a compositional retreat. He began a friendship (apparently not a physical one) with a neighbor-woman named Céleste Mogador, a former actress, author, courtesan, circus rider, and dance-hall girl. She is said to have been the model for his masterpiece's title role of Carmen. Bizet earned his living as an accompanist and publishing house arranger. Meanwhile, he poured his creative efforts into an immense five-act opera in the grand tradition, Ivan IV, but it was never performed. This proved to be a pattern for the rest of his career. Bizet would work hard to get an opera produced, and even if he did, it would usually receive only a handful of performances. Bizet 's corpus of unfinished works is large, and testifies to his unsettled existence and his difficulty in finding a place in France's notoriously hierarchical and conservative musical world. In 1869 Bizet married Geneviève Halévy, daughter of his teacher. The marriage did not turn out to be a happy one, primarily due to her family's history of mental illness. In 1872, Bizet 's splendid incidental music for the play L'arlèsienne was poorly received, but when the composer assembled the music into an orchestral suite for a November performance, it found great acclaim. At last confident of his creative vision, Bizet was able to steer his final masterpiece through various obstacles, including the objections of singers and theater directors who were shocked by Carmen's subject matter. When the opera had its premiere on March 3, 1875, it was received barely well enough to hang on for future productions. Although it took audiences only a few weeks to catch on, Bizet died convinced it was a failure.
| i don't know |
Which Russian did Serena Williams defeat in straight sets in the Ladies Singles Final at this year's Wimbledon Championship? | Wimbledon Ladies' Singles Final: Serena Williams Wins Fourth Wimbledon Title, Thirteenth Grand Slam - SBNation.com
Getty Images
Wimbledon Ladies' Singles Final: Serena Williams Wins Fourth Wimbledon Title, Thirteenth Grand Slam
A breakdown of the Wimbledon 2010 Ladies Singles Final between No. 1 Serena Williams and No. 21 Vera Zvonareva.
StoryStream
7 Total Updates since July 3, 2010
Important 3
| Vera Zvonareva |
Which composer wrote the operas 'Lohengrin' and 'Tannhauser'? | Wimbledon Ladies' Singles Final: Serena Williams Wins Fourth Wimbledon Title, Thirteenth Grand Slam - SBNation.com
Getty Images
Wimbledon Ladies' Singles Final: Serena Williams Wins Fourth Wimbledon Title, Thirteenth Grand Slam
A breakdown of the Wimbledon 2010 Ladies Singles Final between No. 1 Serena Williams and No. 21 Vera Zvonareva.
StoryStream
7 Total Updates since July 3, 2010
Important 3
| i don't know |
What name is given to the Jewish New Year? | Introduction to the Jewish Calendar
The Jewish week (shavu'a) begins on Sunday and ends on Shabbat:
days of the week
The Importance of Shabbat
The fourth of the ten mitzvot (commandments) is, "Remember the Sabbath day, to keep it holy" (Ex. 20:8, KJV). Shabbat is therefore considered to be the most important day of the week, since the observance of Shabbat is explicitly set forth as one of the Ten Commandments . In fact, Shabbat is considered the most important of the Jewish Holidays, even more important than Rosh HaShanah and Yom Kippur!
During Shabbat , no "work" (defined under 39 main categories associated with the building of the Tabernacle in the desert) is to be performed, since this would violate the idea of "rest" (shabbaton) that is to mark the day.
Weekly Torah Readings
Weekly Torah readings are divided into 54 sections. A given weekly section is called a parashah (pl. parashiyot) and is read during a synagogue service. Each portion has a Hebrew name (usually the first word of the section). A haftarah is a reading from the Nevi'im (prophets) that is recited directly following the Torah reading. For a table of the weekly readings, click here .
Jewish Months
The duration of a Hebrew month (chodesh) is measured by the amount of time it takes for the moon to go through a lunar cycle, about 29.5 days:
Rosh Chodesh
The appearance of the new moon is called Rosh Chodesh ("head of the month"). Twelve chodeshim make a Shanah, or year. The new moon is observed in synagogues with additional prayers.
Lunar Leap Years
Since the solar year is 365 days long but a moon year is only 354 days (29.5 x 12), an extra month is added to the Hebrew calendar every two or three years. The formula is a bit esoteric, but every 19 years there are seven leap years (the third, sixth, eighth, eleventh, fourteenth, seventeenth and nineteenth years). In a leap year a 13th month is added called Adar Sheni (Adar II).
In the Tanakh, the first month of the calendar is Nisan (when Passover occurs - see Exod. 12:12); however, Rosh Hashanah ("head of the year") is in Tishri, the seventh month, and that is when the year number is increased.
The Jewish Year (שָׁנָה שֶׁל עִבְרִית)
The Jewish year is cyclical, with seasonal holidays and festivals. The names of the months of the Jewish calendar year were adopted during the time of Ezra the Scribe, after the return from the Babylonian exile.
months of the year
The three bold-faced festival names are known as Shalosh Regalim, the three "Pilgrim Festivals" (Exod. 23:14), that focus on key national events in Israel's history (i.e., the Exodus). These festivals mark the three times in the yearly liturgical cycle when all Jews are required to go up to Jerusalem to pray and sacrifice. Today, Jews mark these times with extended worship and prayer, study, distinctive prayer melodies, and festive meals.
The Jewish High Holidays run from the ten days from Rosh HaShanah to Yom Kippur and focus on individual repentance (teshuvah).
The date of Jewish holidays does not change from year to year. However, since the Jewish year is not the same length as the solar year on the Gregorian calendar, the date will appear to "shift" when viewed from the perspective of the Gregorian calendar.
Four Jewish New Years
You might be surprised to discover that by the time the Mishnah was compiled (200 AD), the Jewish sages had identified four separate new-year dates for every lunar-solar year (the modern Jewish calendar was ratified by Hillel the Elder in the 3rd century AD):
Nisan 1 (i.e., Rosh Chodashim ) marks the start of the month of the Exodus from Egypt and the beginning of Jewish national history. As such, it represents the start of the Biblical year for counting the festivals ( Exod. 12:2 ). Note that the month of Nisan is also called Aviv since it marks the official start of spring.
Elul 1 marks the start of the year from the point of view of tithing cattle for Temple sacrifices. Since the Second Temple was destroyed in 70 AD, the rabbis decreed that this date should mark the time of Selichot , or preparation for repentance before Rosh Hashanah. Elul 1 marks the start of the last month of summer.
Tishri 1 was originally associated with the agricultural "Feast of Ingathering" at the "end of the year" ( Exod. 23:16, 34:22 ), though after the destruction of the Second Temple, the sages decided it would mark the start of the civil year in the fall. Tishri 1 was therefore called Rosh Hashanah ("the head of the year") which begins a ten-day "trial" of humanity climaxing on the Day of Atonement ( Yom Kippur ).
Shevat 15 (i.e., Tu B'Shevat ) originally marked the date for calculating the tithes of the harvest (ma'aserot) that farmers would pledge to the priests of Israel. This was the start of the year from the point of view of tithing of fruit trees. Today Tu B'Shevat represents a national Arbor Day in Israel, with tree planting ceremonies in Israel. Unlike the other three "new years," Tu B'Shevat begins in the middle of the month, during a full moon in winter.
In practical terms, however, there are two "New Years" in Jewish tradition. The first occurs two weeks before Passover (Nisan 1) and the second occurs ten days before Yom Kippur (the other two "new years" are not regularly observed, except by the Ultra Orthodox). The first New Year is Biblical and is called Rosh Chodashim (see Exod. 12:2 ). This is the month of the redemption of the Jewish people -- and it is also the month in which Yeshua was sacrificed upon the cross at Moriah for our sins. Oddly enough for most Christians, "New Years Day" should be really celebrated in the Spring....
The "Dual Aspect" Calendar
In this connection, notice that the calendar is divided into two equal parts of exactly six lunar months each, both of which center on redemptive rituals and end with harvests. The first half of the divine calendar begins on Rosh Chodashim (i.e., Nisan 1; Exod. 12:2 ), which is followed by the instruction to select the Passover lamb on Nisan 10 ( Exod. 12:3 ), slaughter it in the late afternoon of 14th ( Exod. 12:6-7 ) and eat it on the 15th ( Exod. 12:8 ). The Passover itself initiated the seven day period of unleavened bread (from Nisan 15-22), wherein no leaven was to be consumed ( Exod. 12:15-20 ). On an agricultural level, Passover represents spring, the season of the firstfruit harvests (i.e., chag ha-katzir: חַג הַקָּצִיר), and so on. On the "other side of the calendar," Yom Teruah (or Rosh Hashanah) marks the start of the second half of the year ( Exod. 23:16, Lev. 23:24 ), which is followed by the Yom Kippur sacrifice ten days later, on Tishri 10 ( Lev. 23:27 ), followed by the weeklong festival of Sukkot ("Tabernacles") that occurs from Tishri 15-22 ( Lev. 23:34-36 ). On an agricultural level, Sukkot represents the reaping of the the fall harvest (i.e., chag ha'asif: חַג הָאָסִף) at the "end of the year" ( Exod. 23:16 ). In other words, in some respects the fall holidays "mirror" the spring holidays on the divine calendar, and indeed, both sides of the calendar represent different aspects of God's redemptive plan for the world. As I've written about elsewhere, the spring holidays represent the first advent of Yeshua (i.e., Yeshua as Suffering Servant, Lamb of God, Messiah ben Yosef), whereas the fall holidays represent His second advent (Yeshua as Conquering Lord, Lion of the Tribe of Judah, Messiah ben David).
Cycles of Time...
As mentioned above, instead of thinking of time as a linear sequence of events (i.e., the measurement of motion), Jewish thinking tends to regard it in terms of a spiral or "helix," with a forward progression delimited by an overarching (and divine) pattern that recurs cyclically throughout the weeks, months, and years of life. This can be seen in the Hebrew language itself. Some of the sages note that the Hebrew word for "year" - shanah (שָׁנָה) - shares the same root as both the word "repeat" (שָׁנָה) and the word "change" (שִׁנָּה). In other words, the idea of the "Jewish year" implies ongoing "repetition" - mishnah (מִשְׁנָה) - or an enduring "review" of the key prophetic events of redemptive history as they relived in our present experiences... (The idea that the events of the fathers were "parables" for us is expressed in the maxim: מַעֲשֵׂה אֲבוֹת סִימָן לַבָּנִים / ma'aseh avot siman labanim: "The deeds of the fathers are signs for the children.") The Jewish year then repeats itself thematically, but it also changes from year to year as we progress closer to the coming Day of Redemption... We see this very tension (i.e., constancy-change), for example, in the "dual aspect" of the ministry of Yeshua our Messiah. In His first advent Yeshua came as our Suffering Servant and thereby fulfilled the latent meaning of the spring holidays, and in His second advent He will fulfill the latent meaning of the fall holidays. Nonetheless, we still commemorate both the "type and its fulfillment" every year during Passover by extending the ritual of the Seder to express the reality of Yeshua as the world's "Lamb of God," just as we commemorate the fall holidays in expectation of His rule and reign as our King....
None of this is meant to suggest, by the way, that there isn't an "end point" in the process - a Day in which we will be with God and enjoy His Presence forever... The idea of the "cycles" of time, or "timeless patterns within time," suggests, however, that the "seed" for our eternal life with God has already been sown - and was indeed foreknown even from the Garden of Eden - despite the fact that we presently groan while awaiting the glory of heaven...
How to calculate the Jewish Year
The year number on the Jewish calendar represents the number of years since creation, calculated by adding up the ages of people in the Tanakh back to the time of creation. To calculate the Jewish Year from our Gregorian calendar, you subtract 1,240 and then add 5,000. For example, if the year is 2005, subtract 1,240 to get 765. Then add 5,000 to obtain the Jewish year of 5765. Note that this works only up to Rosh Hashanah of the current Gregoraian calendar: after Rosh Hashanah (the Jewish New Year) add one more year (e.g., 5766). For information about how to write the Hebrew year, click here .
How to determine Jewish Leap Years
A year is a Jewish "leap year" if the number year mod 19 is one of the following: 0, 3, 6, 8, 11, 14, or 17. Use a scientific calculator with the mod function to determine the result. For example, 5771(mod)19 = 14, indicating that it is a leap year.
What is the true Jewish Year?
Some have said that the Jewish Year counts from creation but excludes the various years of the captivities, while Rabbinical tradition states there are about 165 "missing years" from the date of the destruction of the First Temple to the date of the destruction of the Second Temple. Others suggest that there are some missing years in the Hebrew calendar due to a corruption in the accounting of the years of the Persian monarchies, and that these years were consciously suppressed in order to disguise the fact that Daniel's prophecy of the 70 weeks pointed to Yeshua as the true Mashiach of Israel. In short, educated uncertainty exists regarding the exact year we are living in since the Creation of the Universe by God...
The Jewish Festival Seasons - Mo'edim
Jewish time is cyclical and prophetic, a sort of a ascending spiral to God. The observant Jew will pray three times every day. On the seventh day of the week, Shabbat is celebrated, as is Rosh Chodesh at the start of the new month. In addition, the various larger periods of time, seasons, have their own prophetic role and function in the overall rhythm of Jewish life.
Note: The Jewish calendar can be a bit tricky to understand, especially if you are new to the study of the Jewish way of thinking about time!
In particular, you must remember that a Jewish holiday begins on the evening previous to the day indicated on a Jewish calendar (unless that happens to be a Sabbath, in which case the date is moved earlier). For example, Yom HaShoah (Holocaust Memorial Day) occurs on Nisan 27 - unless that day is a Sabbath - in which case it is moved earlier to Nisan 26 (whenever in doubt, consult an authoritative Jewish calendar).
Spring - Deliverance
| Rosh Hashanah |
In May 2010, 158 people were killed when an Air India plane overshot the runway at which Indian city's airport? | Rosh Chodashim - Biblical New Years Day
Rosh Chodashim -
calendar
Introduction
Nisan 1 is the Biblical New Years Day, the start of the month of the Exodus from Egypt and the beginning of Jewish national history. It is also the first month used for counting the festivals ( mo'edim ) of the Hebrew Calendar and for reckoning the years of reign of the Kings of Israel.
The Biblical New Year begins at the appearance of the first "new moon" of spring, that is, when the waxing crescent of the moon is first sighted. Biblically, this new moon is called called Rosh Chodashim (ראשׁ חֳדָשִׁים), "the head of the months," and its observance is considered the very first commandment given to Israel before the great Exodus from Egypt took place:
This month shall be unto you the beginning of months:
it shall be the first month of the year to you.
Names for Rosh Chodashim
In the Scriptures and Jewish tradition there are various names given to "this month," including the following:
Rosh Chodashim (ראשׁ חֳדָשִׁים), the "head of the months." The month of Nisan is counted as first for the purpose of counting the days, months, and holidays of the Hebrew calendar.
Chodesh Ha-Aviv (חדֶשׁ הָאָבִיב), "the month of spring," so named because it marked the time of the Exodus from Egypt ( Exod. 13:3-4; 23:15; 34:18; Deut. 16:1 ). From the verse, "Guard (שָׁמוֹר) the month of spring and make Pesach for the LORD" ( Deut. 16:1 ), the sages inferred that an additional month (of Adar) should be inserted into the calendar when necessary to ensure that the holiday of Passover would always occur in the spring. (For more, see the Jewish Calendar pages.)
Chodesh Ha-rishon (חדֶשׁ הָרִאשׁוֹן), "the first month," so named because the other months are named in relation to it, similar to the days of the week in the Hebrew calendar (i.e., the first day, the second day, etc.). This is the most frequent designation of this month in Scripture. The Ramban (Nachmanides) wrote: "By counting every month from Nisan, we constantly commemorate the miracle that God performed when He took us out of slavery."
Chodesh HaGeulah (חדֶשׁ הַגְּאֻלָּה), "the month of the redemption." This is an inferred name from the Scriptures, since the redemption from Egypt took place during the month of Nisan. The Babylonian Talmud (Tractate Rosh Hashanah 11a) states: "In Nisan our forefathers were redeemed from Egypt and in Nisan we will be redeemed." In that sense, Nisan is also Chodesh ha-Yeshuah (חדֶשׁ הַיְשׁוּעָה), the "month of the salvation," both in terms of the physical deliverance from Egypt, but more profoundly in terms of the spiritual salvation given at Zion/Moriah through the Messiah.
Chodesh Nisan (חדֶשׁ נִיסָן), "the month of Nisan," the name given to the first month after the Babylonian Exile ( Esther 3:7; Neh. 2:1 ). Some think that the word Nisan (נִיסָן) derives from a Sumerian word that means "first fruits" (indicative of aviv, or spring), though most Jewish commentators think nisan derives either from the word nissim (נִסִּים, "miracles"), suggesting a link to the miracles of the Exodus, or to the word nitzan (נִצָּן), meaning "bud" ( Song 2:12 ). Still others suggest that Nisan comes from the verb nus (נוּס), meaning "to flee," both in relation to Israel's flight from Egypt and Egypt's flight from Israel (i.e., when the pursuing Egyptian cavalry fled (נָסִים) before the sea closed upon them ( Exod. 14:25, 27 ).
According to the sages, after the Babylonian Exile and the prophecy of Jeremiah was fulfilled (i.e., "it will no longer be said 'as the LORD lives, who took the people of Israel out of Egypt,' rather it will be said 'as the LORD lives, who raised up and brought the people of Israel from the Northern Land' ( Jer. 16:14-15 ), the Jews began to call the months by the names commonly used in exile as a reminder of God's faithfulness.
Chodesh HaMelakhim (חדֶשׁ הַמְּלָכִים), "the month of the kings." The 1st of Nisan is counted as the new year for the purpose of counting the reign of kings of Israel (in Exodus 12:2, the word lakhem (לָכֶם), "to you," can be rearranged to form the word melekh (מֶלֶךְ), "a king."). For instance, if a king ascended the throne just a week before the new moon of Nisan, that week would be reckoned as a year in the chronicles of Israel's kings.
Chodesh Yehudah (חדֶשׁ יְהוּדָה), "the month of Judah." Jewish tradition assigns the month of Nisan to the royal tribe of Judah (יְהוּדָה), in whose merit both the Holy Temple was built and from whom the Messiah Yeshua would descend. The tribe of Judah was divinely favored because:
Judah was functionally the "firstborn" son of Israel (Reuben, Shimon, and Levi had been disqualified).
Judah saved Joseph from death ( Gen. 37:26 ).
Judah saved Tamar from death and disgrace ( Gen. 38:26 ).
Judah had interceded on behalf of his father Jacob to preserve Benjamin's freedom at the cost of his own ( Gen. 44:16-34 ). This last quality, in particular, is known as mesirat nefesh (מְסִירַת נֶפֵשׁ), "self sacrifice," and reveals Judah's role as Israel's intercessor.
When Jacob blessed his sons on his deathbed, he prophesied that Judah would be praised by his other brothers and ultimately be the source of the Messiah of Israel ( Gen. 49:8-10 ).
According to Jewish tradition, at the time of the Exodus from Egypt it was a descendant of Judah - Nachshon ben Aminadav ( Num. 1:7 ) -- who initiated the parting of the Sea of Reeds by walking into the waters until the sea split (Shemot Rabbah).
The name Judah (יְהוּדָה) includes the Name YHVH (יהוה) with the insertion of the letter Dalet (ד), suggesting that Judah would be the "door" or "gate" into the presence of God (Yeshua was from the tribe of Judah who described Himself as ha-sha'ar (הַשַּׁעַר) "the gate"( John 10:9 )). The arrangement of the tribes placed Judah directly in front of the door into the Mishkan ( Num. 2:3 ; see Bamidbar for more information).
Indeed, according to Jewish tradition, the dedication and inauguration of the Mishkan also occurred on Nisan 1: "Rabbi Yossi used to say, 'When did the Inauguration of the Mishkan occur? It began on the twenty third of Adar, and concluded on the first of Nisan. And on all of the first seven days, Moses used to set up the Mishkan and take it apart at the end of the day. On the eighth day, he set it up, and did not take it apart. And that eighth day was Shabbat, and it was the Rosh Chodesh of Nisan" (BaMidbar Rabbah).
Rebirth of Creation
According to the sages, there are two orders of creation: the natural and the supernatural. The natural order of creation refers to the physical creation of the heavens and the earth, whereas the supernatural refers to spiritual re-creation, or rebirth. On the Jewish calendar, the natural order of creation is celebrated during Rosh Hashanah (i.e., Tishri 1), whereas the supernatural is celebrated on Rosh Chodashim (i.e., Nisan 1).
The midrash states: "When the Holy One, blessed be He, created the world, He established the beginning of months and years (i.e., Rosh Hashanah), but when He chose Ya'akov and his children for service, He established Nisan as the month of redemption and rebirth" (Shemot Rabbah). According to the medieval Jewish sage Nachmanides (i.e., the Ramban), the Egyptian belief in the zodiac implied that God had abandoned the affairs of the natural world by consigning them under the forces of the stars and constellations. In response, the LORD chose the month of Nisan (the constellation of the lamb) for the Passover sacrifice in order to demonstrate that Israel did not leave on account of the influence of the stars but entirely because of the power of God....
How Many "New Years Days"?
As we've seen, the Torah designates the month of Nisan (Scripturally called aviv, or "spring") as the first month of the year ( Exod. 12:2 ). Originally, then, the Hebrew calendar was lunar and observational. When the new moon was sighted, a new month begun. Since the Torah also identified Sukkot as "the end of the (harvest) year" ( Exod. 23:16 ), the sages of the Mishnah later identified the Fall month of Tishri (i.e., the "seventh month") as the start of a new year.... During the Babylonian exile (6th century BC), Babylonian names for the months (i.e., Tammuz) were adopted. This might harken back to the earlier Summerian Calendar of Abraham's day...
By the time the Mishnah was compiled (200 AD), the sages had identified four new-year dates for every lunar-solar year (the modern Jewish calendar was apparently ratified by Hillel the Elder in the 3rd century AD):
Nisan 1 (i.e., Rosh Chodashim ) marks the start of the month of the Exodus from Egypt and the beginning of Jewish national history. As such, it represents the start of the Biblical year for counting the festivals ( Exod. 12:2 ). Note that the month of Nisan is also called Aviv since it marks the official start of spring.
Elul 1 marks the start of the year from the point of view of tithing cattle for Temple sacrifices. Since the Second Temple was destroyed in 70 AD, the rabbis decreed that this date should mark the time of Selichot , or preparation for repentance before Rosh Hashanah. Elul 1 marks the start of the last month of summer.
Tishri 1 was originally associated with the agricultural "Feast of Ingathering" at the "end of the year" ( Exod. 23:16, 34:22 ), though after the destruction of the Second Temple, the sages decided it would mark the start of the civil year in the fall. Tishri 1 was therefore called Rosh Hashanah ("the head of the year") which begins a ten-day "trial" of humanity climaxing on the Day of Atonement ( Yom Kippur ).
Shevat 15 (i.e., Tu B'Shevat ) originally marked the date for calculating the tithes of the harvest (ma'aserot) that farmers would pledge to the priests of Israel. This was the start of the year from the point of view of tithing of fruit trees. Today Tu B'Shevat represents a national Arbor Day in Israel, with tree planting ceremonies in Israel. Unlike the other three "new years," Tu B'Shevat begins in the middle of the month, during a full moon in winter.
In practical terms, however, there are two "New Years" in Jewish tradition. The first occurs two weeks before Passover (Nisan 1) and the second occurs ten days before Yom Kippur (the other two "new years" are not regularly observed, except by the ultra-orthodox). The first New Year marks the month of the redemption of the Jewish people -- and it is also the month in which Yeshua was sacrificed upon the cross at Moriah to redeem us from our sins. The second marks the month of Israels' corporate salvation that will be fulfilled in the End of Days. Oddly enough for most Christians, "New Years Day" should be really celebrated in the spring, certainly not in "January."
All of this is in striking contrast, however, with the most widely used calendar in the world today -- the "Gregorian Calendar" -- named after Pope Gregory XIII who reigned over the Catholic Church in the 1500's. For more information about this calendar, click here .
Shabbat Hachodesh
The New Moon of Nisan is the most significant of the "new moons" of the Jewish calendar since it initiates the first month of the Biblical Calendar - and therefore represents the Biblical "New Year's Day." Of all the various Rosh Chodesh celebrations, then, Rosh Chodesh Nisan is foundational, since it presents the starting point for the cycle of the yearly festivals ( mo'edim ) that reveal prophetic truths about the LORD God of Israel and His beloved Son, Yeshua the Mashiach, blessed be He.
The Shabbat preceding Nisan 1 is called HaChodesh and is one of the four special Shabbatot (special Sabbaths) intended to ready oneself for the holiday of Passover (which begins two weeks later on Nisan 15). In addition to the regular Torah reading for Shabbat, Exodus 12:1-20 is read and Ezekiel 45:16-46:18 is recited as Haftarah.
Chodesh tov, chaverim!
Rosh Chodesh Nisan Blessing
Since Rosh Chodesh Nisan marks the new beginning of the Biblical year, we humbly ask the LORD to help us prepare for the coming month and the season of Passover:
יְהִי רָצוֹן מִלְּפָנֵיךָ יהוה אֱלהֵינוּ וֵאלהֵי אֲבוֹתֵינוּ
שֶׁתְּחַדֵּשׁ עָלֵינוּ חדֶשׁ טוֹב בַּאֲדנֵינוּ יֵשׁוּעַ הַמָּשִׁיחַ אָמֵן
ye·hi · ra·tzon · mil·fa·ne·kha · Adonai · E·lo·hei·nu · ve·lo·hei · a·vo·tei·nu
she·te·cha·desh · a·lei·nu · cho·desh · tov · ba'a·do·nei·nu · Ye·shu·a · ha·ma·shi·ach · A·men
"May it be Your will, LORD our God and God of our fathers,
that you renew for us a good month in our Lord Yeshua the Messiah. Amen."
Download Study Card
Thanking God for the Appointed Times
It is surely appropriate to thank the LORD God of Israel for the holidays as a revelation of Yeshua our Messiah at this time, as well:
בָּרוּךְ אַתָּה יהוה אֱלהֵנוּ מֶלֶךְ הָעוֹלָם
אֲשֶׁר נָתַן לָנוּ חַגִּים חֻקּוֹת וּמוֹעֲדִים לְשִׂמְחָה
לִכְבוֹד יֵשׁוּעַ הַמָּשִׁיחַ אֲדוֹנֵינוּ ־ אוֹר הָעוֹלָם
ba·rukh · at·tah · Adonai · E·lo·he·nu · me·lekh · ha·o·lam,
a·sher · na·tan · la·nu · chag·gim, · chuk·kot, · u'mo·a·dim · le·sim·chah,
likh·vod · Ye·shu·a · ha·ma·shi·ach · A·do·ne·nu - ohr · ha·o·lam
"Blessed art You, LORD our God, King of the universe,
who has given to us holidays, customs, and seasons of happiness,
for the glory of our Lord Yeshua the Messiah - the Light of the world"
Download Study Card
To a good year in our Messiah!
The following prayer is customarily said during Rosh Hashanah , but it is equally applicable for the New Year of Nisan and the Season of Passover:
יְהִי רָצוֹן מִלְּפָנֶיךָ יהוה אֱלהֵינוּ
וֵאלהֵי אֲבוֹתֵינוּ
שֶׁתְּחַדֵּשׁ עָלֵינוּ שָׁנָה טוֹבָה וּמְתוּקָה
בַּאֲדנֵינוּ יֵשׁוּעַ הַמָּשִׁיחַ אמן
ye·hi · ra·tzon · mil·fa·ne·kha, · Adonai · E·lo·hei·nu
ve·lo·hei · a·vo·tei·nu,
she·te·cha·desh · a·lei·nu · sha·nah · to·vah · u·me·tu·kah
ba·A·do·nei·nu · Ye·shu·a · ha·Ma·shi·ach [a·men]
"May it be your will, LORD our God
and God of our fathers,
that you renew for us a good and sweet year
in our Lord Yeshua the Messiah." [Amen]
| i don't know |
In May 2010, 98 people were killed when terrorists attacked two mosques in which Pakistani city? | Pakistani Taliban attack two mosques in Lahore, target Muslim sect | Latest News & Updates at Daily News & Analysis
Pakistani Taliban attack two mosques in Lahore, target Muslim sect
Shares0
Amir Mir | Fri, 28 May 2010-02:53pm , ISLAMABAD , DNA
At least 80 people were killed and over 100 injured, 25 of them seriously, when two groups of attackers from the Tehrik-i-Taliban Pakistan attacked two mosques of the Ahmadiyya community in Lahore.
At least 75 people were killed and 108 injured, 25 of them seriously, when two groups of fidayeen attackers belonging to the Tehrik-i-Taliban Pakistan (TTP) attacked two mosques of the minority Muslim Ahmadiyya community in the Model Town and Garhi Shahu areas of Lahore.
Thousands of worshippers, including women and children, were at Friday prayers when the raids at the mosques began.
The Ahmadiyya community, also called the Qadiani community, was declared non-Muslim in Pakistan in 1974. Since then, the sect has experienced years of state-sanctioned discrimination and occasional attacks by extremist Sunnis. Its four million-odd members have seen their religious rights curtailed by law.
Usually described as the heart of Punjab, Lahore, the province’s capital, has witnessed a series of fidayeen (suicide) attacks in recent months, almost all of which were carried out by the TTP.
It is for the first time in recent years, however, that any Ahmadiyya place of worship has been attacked, that too on such a large scale and in coordinated fashion. The Hakeemullah Mehsud-led TTP has claimed responsibility for both attacks.
Numerous explosions were heard at the mosques and gunfire continued for hours, with images of at least two gunmen firing at the police from the roof of one of the mosques.
Police said gunmen opened fire shortly after Friday prayers and threw grenades at the mosques, which are in residential neighbourhoods, one upscale (Model Town) and the other a heavily congested part of the walled city.
At least a dozen heavily armed fidayeen attackers carrying hand grenades and automatic weapons, with some wearing suicide bombers' jackets, stormed the mosques in two groups of seven and five. They hurled grenades and fired at worshippers.
The majority of those killed were at the Garhi Shahu mosque. Two senior superintendents of the Lahore police were seriously injured during gun battles with the attackers.
At the Garhi Shahu mosque, the attackers took many worshippers hostage and assumed control of the building. The police took almost three hours to kill the attackers and take control of the mosque.
Some police officers said two attackers at the Garhi Shahu mosque blew themselves up to avoid capture. One attacker at the Model Town mosque was arrested. He was seriously injured and taken to the Jinnah hospital.
| Lahore |
Which Spanish football team plays its home games at the Stadio Riazor? | 80 killed in terror attacks in Lahore - International - Jerusalem Post
80 killed in terror attacks in Lahore
ByASSOCIATED PRESS
Pakistan gunmen seize 2 mosques belonging to minority Ahmadi sect.
311_Pakistan terror. (photo credit:ASSOCIATED PRESS)
LAHORE, Pakistan — Terrorists attacked two mosques packed with hundreds of worshippers from a minority sect in eastern Pakistan on Friday. Over 80 people were killed and dozens wounded in the worst ever attack against the Ahmadi sect.
The assaults in Lahore were carried out by at least seven men, including three suicide bombers, officials said. Two attackers were captured. At one point, a gunman fired bullets from atop a minaret.
Be the first to know - Join our Facebook page.
RELATED:
Pakistan blocks YouTube over 'sacrilege'
Ahmadis are reviled as heretics by mainstream Muslims for their belief that their sect's founder was a savior foretold by the Quran, Islam's holy book.
Muslim leaders have accused Ahmadis of defying the basic tenet of Islam that says Mohammed was the final prophet, but Ahmadis argue their leader was the savior rather than a prophet.
Under pressure from hard-liners, the Pakistani government in the 1970s declared the Ahmadis a non-Muslim minority. They are prohibited from calling themselves Muslims or engaging in Muslim practices such as reciting Islamic prayers.
A US-based Ahmadi spokesman, Waseem Sayed, said the sect abhors violence and was deeply concerned about the attacks. He estimated Pakistan, a country of 180 million, had around 5 million Ahmadis.
Worldwide he estimated there were tens of millions of Ahmadis, but said that they have faced the most violence in Pakistan, and that this was the worst attack in the history of the sect.
Relevant to your professional network? Please share on Linkedin
Tags:
| i don't know |
Which Latin phrase, that translates literally as 'at first sight', refers, in law, to evidence in a trial which is suggestive, but not conclusive, of something? | Appendix:List of Latin phrases (P–Z) - Wiktionary
Appendix:List of Latin phrases (P–Z)
Definition from Wiktionary, the free dictionary
Appendix:List of Latin phrases (F–O)
Appendix:List of Latin phrases (P–Z)
This appendix lists direct English translations of Latin phrases. Some of the phrases are themselves translations of Greek phrases, as Greek rhetoric and literature reached its peak centuries before that of Ancient Rome:
Contents
pace
"with peace"
Loosely, "be at peace", "with due deference to", "by leave of" or "no offense to". Used to politely acknowledge someone who disagrees with the speaker or writer.
pace tua
Also "contracts must be honored". Indicates the binding power of treaties.
panem et circenses
"bread and circuses"
From Juvenal, Satire X , line 81. Originally described all that was needed for emperors to placate the Roman mob. Today used to describe any entertainment used to distract public attention from more important matters.
parens patriae
"parent of the nation"
A public policy requiring courts to protect the best interests of any child involved in a lawsuit. See also Pater Patriae.
pari passu
Thus, "moving together", "simultaneously", etc.
parva sub ingenti
"the small under the huge"
Implies that the weak are under the protection of the strong, rather than that they are inferior. Motto of Prince Edward Island .
passim
"here and there"
Less literally, "throughout" or "frequently". Said of a word that occurs several times in a cited texts. Also used in proof reading , where it refers to a change that is to be repeated everywhere needed.
pater familias
"father of the family"
Or "master of the house". The eldest male in a family, who held patria potestas ("paternal power"). In Roman law , a father had enormous power over his children, wife, and slaves, though these rights dwindled over time. Derived from the phrase pater familias, an Old Latin expression preserving the archaic -as ending.
A euphemism for the British Empire . Adapted from Pax Romana.
pax Dei
Used in the Peace and Truce of God movement in 10th-Century France.
Pax Deorum
"Peace of the Gods"
Like the vast majority of inhabitants of the ancient world, the Romans practiced pagan rituals, believing it important to achieve a state of Pax Deorum (The Peace of the Gods) instead of Ira Deorum (The Wrath of the Gods).
pax et bonum
"peace and the good"
Motto of St. Francis of Assisi and, consequently, of his monastery in Assisi , in the Umbria region of Italy . Translated in Italian as pace e bene.
pax et lux
Pax Sinica
"Chinese Peace"
A euphemism for periods of peace in East Asia during times of strong Chinese imperialism . Adapted from Pax Romana.
pax vobiscum
"peace [be] with you"
A common farewell. The " you " is plural ("you all"), so the phrase must be used when speaking to more than one person; pax tecum is the form used when speaking to only one person.
pecunia non olet
"the money doesn't smell"
According to Suetonius , when Emperor Vespasian was challenged by his son Titus for taxing the public lavatories , the emperor held up a coin before his son and asked whether it smelled or simply said non olet ("it doesn't smell"). From this, the phrase was expanded to pecunia non olet, or rarely aes non olet ("copper doesn't smell").
"if you can use money, money is your slave; if you can't, money is your master"
Written on a old Latin tablet in downtown Verona (Italy).
pendent opera interrupta
From the Aeneid of Virgil , Book IV.
per
"By, through, by means of"
See specific phrases below.
per ardua ad astra
"through adversity to the stars"
Motto of the British Royal Air Force , the Royal Australian Air Force , the Royal Canadian Air Force , and the Royal New Zealand Air Force . The phrase was derived from H. Rider Haggard 's famous novel The People of the Mist, and was selected and approved as a motto for the Royal Flying Corps on March 15 , 1913 . In 1929, the Royal Australian Air Force decided to adopt it as well.
per aspera ad astra
"through hardships to the stars"
From Seneca the Younger . Motto of NASA and the South African Air Force . A common variant, ad astra per aspera ("to the stars through hardships"), is the state motto of Kansas . Ad Astra ("To the Stars") is the title of a magazine published by the National Space Society . De Profundus Ad Astra ("From the depths to the stars.") is the motto of the LASFS .
per capsulam
(per pro)
"through the agency"
Also rendered per procurationem. Used to indicate that a person is signing a document on behalf of another person. Correctly placed before the name of the person signing, but often placed before the name of the person on whose behalf the document is signed, sometimes through incorrect translation of the alternative abbreviation
per pro.
as "for and on behalf of".
per quod
"by reason of which"
In a UK legal context: "by reason of which" (as opposed to per se which requires no reasoning). In American jurisprudence often refers to a spouse's claim for loss of consortium.
per rectum
pia mater
"pious mother"
Or "tender mother". Translated into Latin from Arabic. The delicate innermost of the three membranes that cover the brain and spinal cord.
pinxit
"one painted"
Thus, "he painted this" or "she painted this". Formerly used on works of art, next to the artist's name.
pluralis majestatis
"plural of majesty"
The first-person plural pronoun when used by an important personage to refer to himself or herself; also known as the "royal we".
pollice verso
"with a turned thumb"
Used by Roman crowds to pass judgment on a defeated gladiator. It is uncertain whether the thumb was turned up , down , or concealed inside one's hand. Also the name of a famous painting depicting gladiators by Jean-Léon Gérôme .
pons asinorum
"bridge of asses"
Any obstacle that stupid people find hard to cross. Originally used of Euclid 's Fifth Proposition in geometry .
Pontifex Maximus
"Greatest High Priest"
Or "Supreme Pontiff". Originally an epithet of the Roman Emperors , and later a traditional epithet of the pope . The pontifices were the most important priestly college of the ancient Roman religion ; their name is usually thought to derive from pons facere ("to make a bridge"), which in turn is usually linked to their religious authority over the bridges of Rome, especially the Pons Sublicius .
posse comitatus
"to be able to attend"
Thus, to be able to be made into part of a retinue or force. In common law, posse comitatus is a sheriff's right to compel people to assist law enforcement in unusual situations.
post aut propter
"after it or by means of it"
Causality between two phenomena is not established (cf. post hoc, ergo propter hoc).
post cibum
Usually rendered postmortem. Not to be confused with post meridiem.
post prandial
"after the time before midday"
Refers to the time after any meal. Usually rendered postprandial.
post scriptum
(p.s.)
"after what has been written"
A postscript . Used to mark additions to a letter, after the signature. Can be extended to post post scriptum
(p.p.s.)
post tenebras lux
"after darkness, light"
A motto of the Protestant Reformation inscribed on the Reformation Wall in Geneva, Switzerland . A former motto of Chile , replaced by the current one, Por la Razón o la Fuerza (Spanish: "By Right or Might"). Another obsolete motto is aut concilio aut ense.
prima facie
"at first sight"
Used to designate evidence in a trial which is suggestive, but not conclusive, of something (e.g., a person's guilt).
prima luce
" prime mover "
Or "first moving one". A common theological term, such as in the cosmological argument , based on the assumption that God was the first entity to "move" or "cause" anything. Aristotle was one of the first philosophers to discuss the "uncaused cause", a hypothetical originator—and violator of— causality .
primum non nocere
"first, to not harm"
A medical precept. Often falsely attributed to the Hippocratic Oath , though its true source is probably a paraphrase from Hippocrates ' Epidemics, where he wrote, "Declare the past, diagnose the present, foretell the future; practice these acts. As to diseases, make a habit of two things: to help, or at least to do no harm."
A title of the Roman Emperors (cf. princeps ).
principia probant non probantur
"principles prove; they are not proved"
Fundamental principles require no proof; they are assumed a priori.
prior tempore potior iure
"earlier in time, stronger in law"
A legal principle that older laws take precedent over newer ones. Another name for this principle is lex posterior.
pro bono
"for the good"
The full phrase is pro bono publico ("for the public good"). Said of work undertaken voluntarily at no expense, such as public services . Often used of a lawyer 's work that is not charged for.
pro Brasilia fiant eximia
quem di diligunt adulescens moritur
"he whom the gods love dies young"
Other translations of diligunt include "prize especially" or "esteem". From Plautus , Bacchides, IV, 7, 18. In this comic play, a sarcastic servant says this to his aging master. The rest of the sentence reads: dum valet sentit sapit ("while he is healthy, perceptive and wise").
questio quid iuris
From the Summoner's section of Chaucer 's General Prologue to the Canterbury Tales , line 648.
qui bono
Common nonsensical Dog Latin misrendering of the Latin phrase cui bono ("who benefits?").
qui pro quo
literally qui instead of quo ( medieval Latin )
Unused in English, but common in other modern languages (for instance Italian and Polish). Used as a noun , indicates a misunderstanding.
Trivia: The expression "quid pro quo" is not used in Italian. An exchange of favours is indicated by "do ut des", another Latin expression meaning "I give in order that you give".
qui tacet consentire videtur
"he who is silent is taken to agree"
Thus, silence gives consent. Sometimes accompanied by the proviso "ubi loqui debuit ac potuit", that is, "when he ought to have spoken and was able to".
qui transtulit sustinet
"he who transplanted still sustains"
Or "he who brought us across still supports us", meaning God . State motto of Connecticut . Originally written as sustinet qui transtulit in 1639.
quia suam uxorem etiam suspiciore vacare vellet
"because he should wish even his wife to be free from suspicion"
Attributed to Julius Caesar by Plutarch , Caesar 10. Translated loosely as "because even the wife of Caesar may not be suspected". At the feast of Bona Dea , a sacred festival for females only, which was being held at the Domus Publica, the home of the Pontifex Maximus , Caesar, and hosted by his second wife, Pompeia , the notorious rhetorian Clodius arrived in disguise. Caught by the outraged noblewomen, Clodius fled before they could kill him on the spot for sacrilege. In the ensuing trial, allegations arose that Pompeia and Clodius were having an affair, and while Caesar asserted that this was not the case and no substantial evidence arose suggesting otherwise, he nevertheless divorced, with this quotation as explanation.
quid est veritas
In the Vulgate translation of John 18:38, Pilate 's question to Jesus .
quid novi ex Africa
"What of the new out of Africa?"
Less literally, "What's new from Africa?" Derived from an Aristotle quotation.
quid pro quo
"what for what"
Also translated "this for that" or "a thing for a thing". Signifies a favor exchanged for a favor.'
Trivia: The expression "quid pro quo" is not used in Italian. An exchange of favours is indicated by "do ut des", another Latin expression meaning "I give in order that you give".
quid nunc
"What now?"
Commonly shortened to quidnunc. As a noun, a quidnunc is a busybody or a gossip. Patrick Campbell worked for The Irish Times under the pseudonym "Quidnunc".
quidquid Latine dictum sit altum viditur
"whatever has been said in Latin seems deep"
Or "anything said in Latin sounds profound". A recent ironic Latin phrase to poke fun at people who seem to use Latin phrases and quotations only to make themselves sound more important or "educated". Similar to the less common omnia dicta fortiora si dicta latina.
quis custodiet ipsos custodes?
"Who will guard the guards themselves?"
From Juvenal 's On Women , originally referring to the practice of having eunuchs guard women and beginning with the word sed ("but"). Usually translated less literally, as "Who watches the watchmen?" This translation is a common epigraph , such as of the Tower Commission and Alan Moore 's Watchmen comic book series.
quis ut Deus
"Who [is] as God?"
Usually translated "Who is like unto God?" Questions who would have the audacity to compare himself to a Supreme Being.
quo errat demonstrator
A pun on quod erat demonstrandum.
quo fata ferunt
quo usque tandem
"For how much longer?"
From Cicero 's Ad Catilinam speech to the Roman Senate regarding the conspiracy of Catiline : quo usque tandem abutere Catilina patientia nostra ("For how much longer, Catiline, will you abuse our patience?").
quo vadis
"Where are you going?"
According to John 13:36, Saint Peter asked Jesus Domine, quo vadis ("Lord, where are you going?") on the Appian Way in Rome . The King James Version has the translation "Lord, whither goest thou?"
quod erat demonstrandum
( Q.E.D. )
"which was to be demonstrated"
The abbreviation is often written at the bottom of a mathematical proof . Sometimes translated loosely into English as "The Five Ws",
W.W.W.W.W.
, which stands for "Which Was What We Wanted".
quod erat faciendum
(Q.E.F)
"which was to be done"
Or "which was to be constructed". Used by Euclid in his Elements when there was nothing to prove, but there was something be constructed, for example a triangle with the same size as a given line.
quod est
quod gratis asseritur, gratis negatur
"what is asserted without reason may be denied without reason"
If no grounds have been given for an assertion, there is no need to provide grounds for contradicting it.
quod licet Iovi non licet bovi
"what is permitted to Jupiter is not permitted to an ox"
If an important person does something, it does not necessarily mean that everyone can do it (cf. double standard ). Iovi (also commonly rendered Jovi) is the dative form of Iuppiter ("Jupiter" or "Jove"), the chief god of the Romans.
quod me nutrit me destruit
"what nourishes me destroys me"
Thought to have originated with Elizabethan playwright Christopher Marlowe . Generally interpreted to mean that that which motivates or drives a person can consume him or her from within. This phrase has become a popular slogan or motto for pro-ana websites, anorexics and bulimics . In this case the phrase is literally describing food.
quod natura non dat Salmantica non praestat
"what nature does not give, Salamanca does not provide"
Refers to the Spanish University of Salamanca , meaning that education cannot substitute the lack of brains.
quod vide (q.v.)
"which see"
Used after a term or phrase that should be looked up elsewhere in the current document or book. For more than one term or phrase, the plural is quae vide
(qq.v.)
ratione soli
"by account of the ground"
Or "according to the soil". Assigning property rights to a thing based on its presence on a landowner's property.
re
"in the matter of"
More literally, "by the thing". From the ablative of res ("thing" or "circumstance"). Often used in e-mail replies. It is a common misconception that the "Re:" in e-mail replies stands for reply, response, or regarding, or is simply the prefix meaning "again". The use of Latin re, in the sense of "about, concerning", is English usage. Whether to leave it in Latin or to translate it may depend on the usage of the target language, but the Internet norm is to leave it in Latin.
rebus sic stantibus
"with matters standing thus"
The doctrine that treaty obligations hold only as long as the fundamental conditions and expectations that existed at the time of their creation hold.
reductio ad absurdum
"leading back to the absurd"
A common debate technique, and a method of proof in mathematics and philosophy, that proves the thesis by showing that its opposite is absurd or logically untenable. In general usage outside mathematics and philosophy, a reductio ad absurdum is a tactic in which the logic of an argument is challenged by reducing the concept to its most absurd extreme. Translated from Aristotle 's "ἡ εις άτοπον απαγωγη" (hi eis atopon apagogi, "reduction to the impossible").
reductio ad infinitum
"leading back to the infinite"
An argument that creates an infinite series of causes that does not seem to have a beginning. As a fallacy, it rests upon Aristotle's notion that all things must have a cause, but that all series of causes must have a sufficient cause, that is, an unmoved mover. An argument which does not seem to have such a beginning becomes difficult to imagine.
regnat populus
"the people rule"
State motto of Arkansas , adopted in 1907. Originally rendered in 1864 in the plural, regnant populi ("the peoples rule"), but subsequently changed to the singular.
Regnum Mariae Patrona Hungariae
res gestae
"things done"
(1) A phrase used in law representing the belief that certain statements are made naturally, spontaneously and without deliberation during the course of an event, they leave little room for misunderstanding/misinterpretation upon hearing by someone else ( i.e. by the witness who will later repeat the statement to the court) and thus the courts believe that such statements carry a high degree of credibility. (2) In history, a Latin biography
res ipsa loquitur
"the thing speaks for itself"
A phrase from the common law of torts meaning that negligence can be inferred from the fact that such an accident happened, without proof of exactly how. A mock Latin clause sometimes added on to the end of this phrase is sed quid in infernos dicit ("but what the hell does it say?"), which serves as a reminder that one must still interpret the significance of events that "speak for themselves".
res judicata
"judged thing"
A matter which has been decided by a court. Often refers to the legal concept that once a matter has been finally decided by the courts, it cannot be litigated again (cf. non bis in idem and double jeopardy ).
respice finem
"look back at the end"
i.e., "have regard for the end" or "consider the end". Generally a memento mori , a warning to remember one's death.
respiciendum est iudicanti ne quid aut durius aut remissius constituatur quam causa deposcit nec enim aut severitatis aut clementiae gloria affectanda est
"the judge must see that no order be made or judgment given or sentence passed either more harshly or more mildly than the case requires; he must not seek renown, either as a severe or as a tender-hearted judge"
A maxim on the conduct of judges.
respondeat superior
"let the superior respond"
Regarded as a legal maxim in agency law, referring to the legal liability of the principal with respect to an employee. Whereas a hired independent contract acting tortiously may not cause the principal to be legally liable, a hired employee acting tortiously will cause the principal (the employer) to be legally liable, even if the employer did nothing wrong.
res nullius
"nobody's thing"
Goods without an owner. Used for things or beings which belong to nobody and are up for grabs, e.g., uninhabited and uncolonized lands, wandering wild animals, etc. (cf. terra nullius, "no man's land").
rex regum fidelum et
"king even of faithful kings"
rigor mortis
"stiffness of death"
The rigidity of corpses when chemical reactions cause the limbs to stiffen about 3–4 hours after death. Other signs of death include drop in body temperature ( algor mortis , "cold of death") and discoloration ( livor mortis , "bluish color of death").
Romanes eunt domus
"Romanes go the house"
An intentionally garbled Latin phrase from Monty Python's Life of Brian . Its translation is roughly, as said by a centurion in the movie, "'People called Romanes they go the house'", but its intended meaning is "Romans, go home!" When Brian is caught vandalizing the palace walls with this phrase, rather than punish him, the centurion corrects his Latin grammar , explaining that Romanus is a second declension noun and has its plural in -i rather than -es, that ire ("to go") must be in the imperative mood to denote a command, and that domus takes the accusative case without a preposition as the object. The final result of this lesson is the correct Latin phrase Romani ite domum .
rosa rubicundior lilio candidior omnibus formosior semper in te glorior
"redder than the rose, whiter than the lilies, fairer than all things, I do ever glory in thee"
rus in urbe
"Farm in the city"
Generally used to refer to a haven of peace and quiet within an urban setting, often a garden, but can refer to interior decoration.
salus populi suprema lex esto
"the welfare of the people is to be the highest law"
From Cicero 's De Legibus, book III, part III, sub. VIII. Quoted by John Locke in his Second Treatise, On Civil Government, to describe the proper organization of government. Also the state motto of Missouri and of Harrow.
salva veritate
Salvator Mundi
"Savior of the World"
Christian epithet, usually referring to Jesus . The title of paintings by Albrecht Dürer and Leonardo da Vinci .
salvo errore et omissione
"save for error and omission"
Appears on statements of "account currents".
salvo honoris titulo
"save for title of honor"
Sancta Sedes
More literally, "Sacred Seat". Refers to the Papacy or the Holy See .
Sancta Simplicitas
sapere aude
"dare to be wise"
From Horace 's Epistularum liber primus , Epistle II, line 40. Popularized by its use in Kant 's What is Enlightenment? to define the Enlightenment . Frequently used in mottos, such as for the University of Otago , University of New Brunswick , Phystech , Manchester Grammar School , town of Oldham , and the University of New Zealand before its dissolution.
Sapientia et Doctrina
Motto of Fordham University , New York.
sapienti sat
"enough for the wise"
From Plautus . Indicates that something can be understood without any need for explanation, as long as the listener has enough wisdom or common sense. Often extended to dictum sapienti sat est ("enough has been said for the wise", commonly translated as "a word to the wise is enough").
semper fidelis
"always faithful"
Motto of Exeter and several other cities; more recently has become the motto of United States Marine Corps and the Swiss Grenadiers . Also the motto of the Rot-Weiss Oberhausen and Plymouth Argyle football clubs. The US Marines often abbreviate it to Semper Fi.
semper paratus
Motto of the United States Coast Guard and the United States Cavalry 's 12th Regiment.
semper reformanda
"always reforming"
A shortened form of a motto of the Protestant Reformation , Ecclesia reformata semper reformanda est secundu Verbum Dei ("the reformed Church must be always reforming according to the Word of God"), which refers to the Protestant position that the church must continually re-examine itself, reconsider its doctrines , and be prepared to accept change, in order to conform more closely to orthodox Christian belief as revealed in the Bible . The shortened form, semper reformanda, literally means "always about to be reformed", but the usual translation is taken from the full sentence where it is used in a passive periphrastic construction to mean "always reforming."
semper ubi sub ubi
"always where under where"
A common English- New Latin translation joke . The phrase is nonsensical in Latin, but the English translation is a pun on "always wear underwear".
Senatus Populusque Romanus
"The Senate and the People of Rome"
The official name of the Roman Republic . "
SPQR
" was carried on battle standards by the Roman legions . In addition to being an ancient Roman motto, it remains the motto of the modern city of Rome .
sensu stricto
Less literally, "in the strict sense".
Servo Permaneo Bovis Provestri
"Save the Last Bullet for Yourself"
Meaning "After giving it everything you've got against the enemy,save the last effort to save yourself".
sesquipedalia verba
"words a foot and a half long"
From Horace 's Ars Poetica , "proicit ampullas et sesquipedalia verba" ("he throws down his high-flown language and his foot-and-a-half-long words"). A self-referential jab at long words and needlessly elaborate language in general.
si peccasse negamus fallimur et nulla est in nobis veritas
"if we refuse to make a mistake, we are deceived, and there's no truth in us"
From Christopher Marlowe 's The Tragical History of Doctor Faustus , where the phrase is translated "if we say that we have no sin, we deceive ourselves, and there's no truth in us".
si quaeris peninsulam amoenam circumspice
"if you seek a delightful peninsula, look around"
State motto of Michigan , adopted in 1835. Said to have been based on the tribute to architect Christopher Wren in St Paul's Cathedral , London , which reads si monumentum requiris circumspice ("if you seek a memorial, look around").
Si tacuisses, philosophus mansisses
"If you had kept your silence, you would have stayed a philosopher"
This quote is often attributed to the Latin philosopher Boethius of the late fifth and early sixth centuries. It translates literally as, "If you had been silent, you would have remained a philosopher." The phrase illustrates a common use of the subjunctive verb mood. Among other functions it expresses actions contrary to fact. Sir Humphrey Appleby translated it to the PM as: "If you'd kept your mouth shut we might have thought you were clever".
si vales valeo
(SVV)
"if you are well, I am well"
A common beginning for ancient Roman letters. Also extended to si vales bene est ego valeo ("if you are well, that is good; I am well"), abbreviated to
SVBEEV
. The practice fell out of fashion and into obscurity with the decline in Latin literacy.
si vis pacem para bellum
"if you want peace, prepare for war"
From Vegetius , Epitoma rei militaris. Origin of the name parabellum for some ammunition and firearms, such as the luger parabellum.
sic
"thus"
Or "just so". States that the preceding quoted material appears exactly that way in the source, despite any errors of spelling, grammar, usage, or fact that may be present. Used only for previous quoted text; ita or similar must be used to mean "thus" when referring to something about to be stated.
sic et non
More simply, "yes and no".
sic gorgiamus allos subjectatos nunc
"we gladly feast on those who would subdue us"
sic semper tyrannis
"thus always to tyrants"
State motto of Virginia , adopted in 1776. Attributed to Brutus at the time of Julius Caesar 's assassination, and to John Wilkes Booth at the time of Abraham Lincoln 's assassination; whether it was actually said at either of these events is disputed.
sic transit gloria mundi
"thus passes the glory of the world"
From the Bible . A reminder that all things are fleeting. During Papal Coronations , a monk reminds the pope of his mortality by saying this phrase, preceded by pater sancte ("holy father") while holding before his eyes a burning paper illustrating the passing nature of earthly glories. This is similar to the tradition of a slave in Roman triumphs whispering "memento mori".
sic utere tuo ut alienum non laedas
"use [what is] yours so as not to harm [what is] of others"
Or "use your property in such a way that you do not damage others'". A legal maxim related to property ownership laws, often shortened to simply sic utere ("use it thus").
sic vita est
"thus is life"
Or "such is life". Indicates that a circumstance, whether good or bad, is an inherent aspect of living.
signetur
sine qua non
"without which not"
Used to denote something that is an essential part of the whole. See also condicio sine qua non.
sine scientia ars nihil est
"without knowledge, skill is nothing"
Motto of The International Diving Society.
sit venia verbo
"may there be forgiveness for the word"
Similar to the English idiom "pardon my French".
sola fide
"by faith alone"
The material principle of the Protestant Reformation and one of the five solas , referring to the Protestant claim that the Bible teaches that men are saved by faith even without works.
sola gratia
"by grace alone"
A motto of the Protestant Reformation and one of the five solas , referring to the Protestant claim that salvation is an unearned gift (cf. ex gratia), not a direct result of merit .
Sola lingua bona est lingua mortua
"the only good language is a dead language"
sola scriptura
"by scripture alone"
The formal principle of the Protestant Reformation and one of the five solas , referring to the Protestant idea that the Bible alone is the ultimate authority, not the pope or tradition .
soli Deo gloria
(S.D.G.)
"glory to God alone"
A motto of the Protestant Reformation and one of the five solas , referring to the idea that God is the creator of all good things and deserves all the praise for them. Johann Sebastian Bach often signed his manuscripts with the abbreviation
S.D.G.
to invoke this phrase, as well as with
AMDG
"hope is the anchor of [my] life"
Motto of the Doran family.
spiritus mundi
"spirit of the world"
From The Second Coming (poem) by William Butler Yeats . Refers to Yeats' belief that each human mind is linked to a single vast intelligence, and that this intelligence causes certain universal symbols to appear in individual minds. The idea is similar to Carl Jung 's concept of the collective unconscious .
spiritus ubi vult spirat
"the spirit spreads wherever it wants"
From El espiritu donde quiera se infunde by Fernando Porturas ( http://www.cayetano-pae.org/Spiritus.htm ). Refers to The Gospel of Saint John, where he mentions how Jesus told Nicodemus "The wind blows wherever it wants, and even though you can hear its noise, you don't know where it comes from or where it goes. The same thing happens to whomever has been born of the Spirit". It is the motto of Cayetano Heredia University .
splendor sine occasu
Loosely "splendour without diminishment" or "magnificence without ruin". Motto of British Columbia .
stamus contra malo
"we stand against by evil"
The motto of the Jungle Patrol in The Phantom . The phrase actually violates Latin grammar because of a mistranslation from English, as the preposition contra takes the accusative case . The correct Latin rendering of "we stand against evil" would be "stamus contra malum".
stante pede
Less literally, "in the strict sense".
stupor mundi
"the wonder of the world"
The title by which Frederick II, Holy Roman Emperor , was known. More literally translated "the bewilderment of the world", or, in its original, pre- Medieval sense, "the stupidity of the world".
sua sponte
Motto of the U.S. Army Rangers . Also a legal term .
Sub Cruce Lumen
"The Light Under the Cross"
Motto of the University of Adelaide , Australia. Refers to the figurative "light of learning" and the Southern Cross constellation, Crux .
sub judice
"under a judge"
sub poena
"under penalty"
Commonly rendered subpoena. Said of a request, usually by a court, that must be complied with on pain of punishment. Examples include subpoena duces tecum ("take with you under penalty"), a court summons to appear and produce tangible evidence, and subpoena ad testificandum ("under penalty to testify"), a summons to appear and give oral testimony.
sub rosa
"under the rose"
"In secret", "privately", "confidentially" or "covertly". In the Middle Ages , a rose was suspended from the ceiling of a council chamber to indicate that what was said in the "under the rose" was not to be repeated outside. This practice originates in Greek mythology, where Aphrodite gave a rose to her son Eros , and he, in turn, gave it to Harpocrates , the god of silence, to ensure that his mother's indiscretions—or those of the gods in general, in other accounts—were kept under wraps.
sub specie aeternitatis
"under the sight of eternity"
Thus, "from eternity's point of view". From Spinoza , Ethics.
sub verbo; sub voce
Literally "highest good". Also summum malum ("the supreme evil").
sunt lacrimae rerum
"there are tears for things"
From Virgil , Aeneid . Followed by et mentem mortalia tangunt ("and mortal things touch my mind"). Aeneas cries as he sees Carthaginian temple murals depicting the deaths of the Trojan War . See also hinc illae lacrimae.
sunt omnes unum
suo jure
"in one's own right"
Used in the context of titles of nobility , for instance where a wife may hold a title in her own right rather than through her marriage.
suo moto
"upon one's own initiative"
Also rendered suo motu. Usually used when a court of law, upon its own initiative, (i.e., no petition has been filed) proceeds against a person or authority that it deems has committed an illegal act. It is used chiefly in South Asia .
supero omnia
A declaration that one succeeds above all others.
surgam
terra nova
"new land"
Also latin name of Newfoundland (island portion of Canadian province of Newfoundland and Labrador , capital- St. John's ), also root of French name of same, Terre-Neuve
terra nullius
"land of none"
That is, no man's land . A neutral or uninhabited area, or a land not under the sovereignty of any recognized political entity.
terras irradient
"let them illuminate the lands"
Or "let them give light to the world". An allusion to Isaiah 6.3: plena est omnis terra gloria eius ("the whole earth is full of his glory"). Sometimes mistranslated as "they will illuminate the lands" based on mistaking irradiare for a future indicative third- conjugation verb, whereas it is actually a present subjunctive first-conjugation verb. Motto of Amherst College ; the college's original mission was to educate young men to serve God.
tertium non datur
"a third is not given"
A logical axiom that a claim is either true or false, with no third option.
tertium quid
"a third something"
1. Something that cannot be classified into either of two groups considered exhaustive; an intermediate thing or factor. 2. A third person or thing of indeterminate character.
timeo Danaos et dona ferentes
"I fear Greeks, even bearing gifts"
Danaos being a term for the Greeks . In Virgil 's Aeneid , II, 49, the phrase is said by Laocoön when warning his fellow Trojans against accepting the Trojan Horse . The full original quote is quidquid id est timeo Danaos et dona ferentis, quidquid id est meaning "whatever it is" and ferentis being an archaic form of ferentes. Commonly mistranslated "Beware of Greeks bearing gifts".
timidi mater non flet
"A coward's mother does not weep"
A Latin proverb . Occasionally appears on loading screens in the game Rome: Total War .
timor mortis conturbat me
"the fear of death confounds me"
A Latin refrain originating in the response to the seventh lesson in the Office of the Dead . In the Middle Ages , this service was read each day by clerics . As a refrain, it appears also in other poems and can frequently be found inscribed on tombs.
translatio imperii
"transfer of rule"
Used to express the belief in the transfer of imperial authority from the Roman Empire of antiquity to the Medieval Holy Roman Empire .
Treuga Dei
"Truce of God"
A decree by the medieval Church that all feuds should be cancelled during the Sabbath —effectively from Wednesday or Thursday night until Monday. See also Peace and Truce of God .
tu autem
"you indeed"
Also "even you" or "yes, you", in response to a person's belief that he will never die. A memento mori epitaph .
tu autem domine miserere nobis
"But Thou, O Lord, have mercy upon us"
Phrase said at the end of biblical readings in the liturgy of the medieval church.
tu fui ego eris
"I was you; you will be me"
Thus, "what you are, I was; what I am, you will be.". A memento mori gravestone inscription to remind the reader that death is unavoidable (cf. sum quod eris).
tu ne cede malis, sed contra audentior ito
"you should not give in to evils, but proceed ever more boldly against them"
From Virgil , Aeneid , 6, 95.
tu quoque
"you too"
The logical fallacy of attempting to defend one's position merely by pointing out the same weakness in one's opponent. If a politician is criticized for advocating an inadequately-funded plan, and replies that his or her opponent's plan is equally inadequately funded, this is a 'tu quoque' argument: undermining the counterproposal on the same basis does not make the original plan any more satisfactory. Tu quoque may also refer to a "hypocrisy" argument, a form of ad hominem where a claim is dismissed as untrue on the basis that the claimant has contradicted his own advice. While contradiction may make the claimant's argument unsound, it does necessarily not make his claims untrue. It comes from the supposed last words of Julius Caesaer (" Et tu, Brute? ")
tuebor
"where [it is] well, there [is] the fatherland"
Or "where I prosper, there is my country". Patriotic motto.
ubi caritas et amor Deus ibi est
"where there is charity and love, God is there"
ubi mel ibi apes
"where [there is] honey, there [are] bees"
ubi dubium ibi libertas
"where [there is] doubt, there [is] freedom"
Anonymous proverb.
"Where [there is] a right, there [is] a remedy"
ubi non accusator ibi non iudex
"where [there is] no accuser, there [is] no judge"
Thus, there can be no judgement or case if no one charges a defendant with a crime. The phrase is sometimes parodied as "where there are no police, there is no speed limit".
ubi re vera
"when, in a true thing"
Or "whereas, in reality..." Also rendered ubi revera ("when, in fact" or "when, actually").
ubi solitudinem faciunt pacem appellant
"when they make a wasteland, they call it peace"
ubi sunt
"where are they?"
Nostalgic theme of poems yearning for days gone by. From the line ubi sunt qui ante nos fuerunt ("Where are they, those who have gone before us?").
una salus victis nullam sperare salutem
"the only safety for the conquered is to hope for no safety"
Less literally, "the only safe bet for the vanquished is to expect no safety". Preceded by moriamur et in media arma ruamus ("let us die even as we rush into the midst of battle") in Virgil 's Aeneid , book 2, lines 353–354. Used in Tom Clancy 's novel Without Remorse , where character Clark translates it as "the one hope of the doomed is not to hope for safety".
ultimo mense
Urbi et Orbi
"To the City and the Circle [of the lands]"
Meaning "To Rome and the World". A standard opening of Roman proclamations. Also a traditional blessing by the pope .
Urbs in Horto
Motto of the City of Chicago .
Usus magister est optimus
ut biberent quoniam esse nollent
"so that they might drink, since they refused to eat"
Also rendered with quando ("when") in place of quoniam. From a story by Suetonius (Vit. Tib., 2.2) and Cicero (De Natura Deorum, 2.3). The phrase was said by Roman admiral Publius Claudius Pulcher right before the battle of Drepana , as he threw overboard the sacred chickens which had refused to eat the grain offered them—an unwelcome omen of bad luck. Thus, the sense is, "if they do not perform as expected, they must suffer the consequences".
ut incepit fidelis sic permanet
"as she began loyal, so she persists"
Thus, the state remains as loyal as ever. Motto of Ontario .
ut desint vires tamen est laudanda voluntas
"though the power be lacking, the will is to be praised all the same"
From Ovid , Epistulae ex Ponto (III, 4, 79).
ut infra
A vade-mecum or vademecum is an item one carries around, especially a handbook.
vade retro Satana
"Go back, Satan !"
An exhortation for Satan to begone, often used in response to temptation . From a popular Medieval Catholic exorcism formula, based on a rebuke by Jesus to Peter in the Vulgate , Mark 8:33: vade retro me Satana ("step back from me, Satan!"). The older phrase vade retro ("go back!") can be found in Terence 's Formio I, 4, 203.
vae victis
"Woe to the conquered!"
Attributed by Livy to Brennus , the chief of the Gauls , while he demanded more gold from the citizens of the recently-sacked Rome in 390 BC.
vanitas vanitatum omnia vanitas
"vanity of vanities; everything [is] vanity"
More simply, "vanity, vanity, everything vanity". From the Vulgate , Ecclesiastes , 1:2.
vaticinium ex eventu
"prophecy from the event"
A prophecy made to look as though it was written before the events it describes, while in fact being written afterwards.
vel non
"or not"
Summary of alternatives, ie. "this action turns upon whether the claimant was the deceased's grandson vel non."
velocius quam asparagi coquantur
"more rapidly than asparagus will be cooked"
Or simply "faster than cooking asparagus". Ascribed to Augustus by Suetonius (The Lives of the Twelve Caesars, Book 2 (Augustus), para. 87). Can refer to anything done very quickly. A very common variant is celerius quam asparagi cocuntur ("more swiftly than asparagus is cooked").
veni, vidi, vici
"I came, I saw, I conquered"
The text message sent by Julius Caesar to the Roman Senate to describe his battle against King Pharnaces II near Zela in 47 BC. Sometimes used by magicians as a catch phrase similar to abracadabra in completing a performance.
"I came, I saw, I went"
vera causa
"true cause"
verba ita sunt intelligenda ut res magis valeat quam pereat
"words are to be understood such that the subject matter may be more effective than wasted"
A legal maxim.
"words fly away, writings remain"
verbatim et litteratim
"word by word and letter by letter"
Verbi divini minister
"servant of the divine Word"
A priest (cf. Verbum Dei).
Verbum Dei
vi veri universum vivus vici
"by the power of truth, I, a living man, have conquered the universe"
From Christopher Marlowe 's The Tragical History of Doctor Faustus . Note that v was originally the consonantal u , and was written the same before the two forms became distinct, and also after in many cases, when u and v were both capitalized as V: thus, Vniversum. Also, universum is sometimes quoted with the form ueniversum (or Veniversum), which is presumably a combination of universum and oeniversum, two classically-attested spellings). Recently quoted in the film, V for Vendetta, by the main character, V.
via
Thus, "by way of" or "by means of".
I'll contact you via e-mail.
via media
"middle road"
The Anglican Communion has claimed to be a via media between the errors of the Roman Catholic Church and the extremes of Protestantism . Can also refer to the radical middle political stance.
via, veritas, vitae
The motto of the University of Glasgow .
vice versa
"with position turned"
Thus, "the other way around", "conversely", etc. Historically, vice is more properly pronounced as two syllables, but the one-syllable pronunciation is extremely common.
victoria aut mors
See aut vincere aut mori.
victoria concordia crescit
The official club motto of Arsenal FC.
victrix causa diis placuit sed victa Catoni
"the victorious cause pleased the gods, but the conquered cause pleased Cato "
Lucanus , Pharsalia 1, 128. Dedication on the south side of the Confederate Memorial at Arlington National Cemetery .
vide infra
Vive ut vivas
"live so that you may live"
The phrase essentially means that one should live life to the fullest and without fear of a possible future consequence.
vocatus atque non vocatus Deus aderit
"called and not called, God will be present", or "called and even not called, God approaches"
Attributed to the Oracle at Delphi . Used by Carl Jung as a personal motto adorning his home and grave.
volenti non fit injuria
"to one willing, no harm is done" or "to he who consents, no harm is done
used in tort law to delineate the principle that one cannot be held liable for injuries inflicted on an individual who has given his consent to the action that gave rise to the injury.
votum separatum
An independent, minority voice.
vox clamantis in deserto
"the voice of one shouting in the desert" (or, traditionally, "the voice of one crying in the wilderness")
From Isaiah 40, and quoted by John the Baptist in the Gospels . Usually the "voice" is assumed to be shouting in vain, unheeded by the surrounding wilderness. However, in this phrase's use as the motto of Dartmouth College , it is taken to denote an isolated beacon of education and culture in the "wilderness" of New Hampshire .
vox nihili
vox populi
"voice of the people"
Sometimes extended to vox populi vox Dei ("the voice of the people [is] the voice of God"). In its original context, the extended version means the opposite of what it's frequently taken to mean: the source is usually given as the monk Alcuin , who advised Charlemagne that nec audiendi qui solent dicere vox populi vox Dei quum tumultuositas vulgi semper insaniae proxima sit, meaning "And those people should not be listened to who keep saying, 'The voice of the people [is] the voice of God,' since the riotousness of the crowd is always very close to madness." (Works, Letter 164)
| Prima facie |
The name of which chemical element, with the symbol 'Ac', is derived from the Greek for 'ray'? | Appendix:List of Latin phrases - Wiktionary
Appendix:List of Latin phrases
Appendix:
*List of Latin phrases
Warning, this page may be too large for some browsers. If so, the sections can be reviewed individually:
This appendix lists direct English translations of Latin phrases. Some of the phrases are themselves translations of Greek phrases, as Greek rhetoric and literature reached its peak centuries before that of Ancient Rome:
Contents
A B C D E F G H I J L M N O P Q R S T U V
This list is a combination of the three divided pages, for users who have no trouble loading large pages and prefer a single page to scroll or search through. The contents of the list cannot be edited here, and are kept automatically in synch with the divided lists (A-E), (F-O) and P-Z) through template inclusion.
a bene placito
"from one who has been pleased well"
Or "at will", "at one's pleasure". This phrase, and its Italian (beneplacito) and Spanish (beneplácito) derivatives, are synonymous with the more common ad libitum ("at pleasure").
abusus non tollit usum
"abuse does not preclude proper use"
a caelo usque ad centrum
"from the sky to the center"
Or "from heaven all the way to the center of the earth". In law, can refer to the obsolete cuius est solum eius est usque ad coelum et ad inferos maxim of property ownership.
a capite ad calcem
From top to bottom; all the way through. Equally a pedibus usque ad caput.
a contrario
"from the opposite"
Equivalent to "on the contrary" or "au contraire". An argumentum a contrario is an "argument from the contrary", an argument or proof by contrast or direct opposite.
a Deucalione
a fortiori
"from the stronger"
Loosely, "even more so" or "with even stronger reason". Often used to lead from a less certain proposition to a more evident corollary.
a mari usque ad mare
"from sea to sea"
From Psalm 72:8, "Et dominabitur a mari usque ad mare, et a flumine usque ad terminos terrae" ( KJV : "He shall have dominion also from sea to sea, and from the river unto the ends of the earth"). National motto of Canada .
a pedibus usque ad caput
"from feet to head"
Completely. Similar to the English expressions "from tip to toe" or "from top to toe". Equally a capite ad calcem. See also ab ovo usque ad mala.
a posse ad esse
"from being able to being"
"From possibility to actuality" or "from being possible to being actual"
a posteriori
"from the latter"
Based on observation (i.e., empirical knowledge ), the reverse of a priori. Used in mathematics and logic to denote something that is known after a proof has been carried out. In philosophy, used to denote something that can be known from empirical experience.
a priori
"from the former"
Presupposed, the reverse of a posteriori. Used in mathematics and logic to denote something that is known or postulated before a proof has been carried out. In philosophy, used to denote something that can be known without empirical experience. In everyday speech, it denotes something occurring or being known before the event.
ab absurdo
"from the absurd"
Said of an argument that seeks to prove a statement's validity by pointing out the absurdity of an opponent's position (cf. appeal to ridicule ) or that an assertion is false because of its absurdity. Not to be confused with a reductio ad absurdum , which is usually a valid logical argument.
ab abusu ad usum non valet consequentia
"a consequence from an abuse to a use is not valid"
Inferences regarding something's use from its misuse are invalid. Rights abused are still rights (cf. abusus non tollit usum).
ab aeterno
"from the eternal"
Literally, "from the everlasting" or "from eternity". Thus, "from time immemorial", "since the beginning of time" or "from an infinitely remote time in the past". In theology, often indicates something, such as the universe, that was created outside of time.
ab antiquo
ab extra
"from beyond"
A legal term meaning "from without". From external sources, rather than from the self or the mind (ab intra).
ab hinc
Often rendered abhinc (which in Latin means simply "since" or "ago").
ab imo pectore
"from the bottom of my heart"
More literally, "from the deepest chest". Attributed to Julius Caesar . Can mean "with deepest affection" or "sincerely".
ab inconvenienti
"from an inconvenient thing"
New Latin for "based on unsuitability", "from inconvenience" or "from hardship". An argumentum ab inconvenienti is one based on the difficulties involved in pursuing a line of reasoning, and is thus a form of appeal to consequences ; it refers to a rule in law that an argument from inconvenience has great weight.
ab incunabulis
"from the cradle"
Thus, "from the beginning" or "from infancy". Incunabula is commonly used in English to refer to the earliest stage or origin of something, and especially to copies of books that predate the spread of the printing press around AD 1500.
ab initio
"from the beginning"
"At the outset", referring to an inquiry or investigation. In literature, refers to a story told from the beginning rather than in medias res (from the middle). In law , refers to something being the case from the start or from the instant of the act, rather than from when the court declared it so. A judicial declaration of the invalidity of a marriage ab initio is a nullity . In science, refers to the first principles . In other contexts, often refers to beginner or training courses. Ab initio mundi means "from the beginning of the world".
ab intestato
From someone who dies with no legal will (cf. ex testamento).
ab intra
From the inside. The opposite of ab extra.
ab irato
"from an angry man"
By a person who is angry. Used in law to describe a decision or action that is detrimental to those it affects and was made based on hatred or anger, rather than on reason. The form irato is masculine; however, this does not mean it applies only to men, rather 'person' is meant, as the phrase probably elides "homo," not "vir."
ab origine
ab ovo usque ad mala
"from the egg to the apples"
From Horace , Satire 1.3. Means "from beginning to end", based on the Roman main meal typically beginning with an egg dish and ending with fruit (cf. the English phrase soup to nuts ). Thus, ab ovo means "from the beginning", and can also connote thoroughness.
ab uno disce omnes
"from one, learn all"
From Virgil's Aeneid . Refers to situations where a single example or observation indicates a general or universal truth.
(a.U.c.)
"from the founding of the city"
Refers to the founding of Rome , which occurred in 753 BC according to Livy 's count. Used as a reference point in ancient Rome for establishing dates, before being supplanted by other systems. Also anno Urbis conditae
(a.U.c.)
("in the year that the city was founded").
ab utili
absens haeres non erit
"an absent person will not be an heir"
In law, refers to the principle that someone who is not present is unlikely to inherit.
absente reo
"with the defendant being absent"
In the absence of the accused.
absit iniuria
"let injury be absent"
Expresses the wish that no insult or wrong be conveyed by the speaker's words, i.e., "no offense". Also rendered absit iniuria verbis "let injury be absent from these words". Contrast with absit invidia.
absit invidia
"let ill will/jealousy be absent"
Said in the context of a statement of excellence. Unlike the English expression "no offense", absit invidia is intended to ward off jealous deities who might interpret a statement of excellence as hubris. Also extended to absit invidia verbo, meaning "may ill will/jealousy be absent from these words." Contrast with absit iniuria. An explanation of Livy's usage.
absit omen
"let an omen be absent"
In other words, "let there not be an omen here". Expresses the wish that something seemingly ill-boding does not turn out to be an omen for future events, and calls on divine protection against evil.
absolutum dominium
absolvo
"I acquit"
A legal term said by a judge acquitting a defendant following a trial. Te absolvo or absolvo te, translated, "I forgive you," said by Roman Catholic priests during the Sacrament of Confession prior to Vatican II .
abundans cautela non nocet
"abundant caution does no harm"
Thus, one can never be too careful; even excessive precautions don't hurt anyone.
abusus non tollit usum
"misuse does not remove use"
An axiom stating that just because something can be, or has been, abused, does not mean that it must be, or always is. Abuse does not, in itself, justify denial of use
accusare nemo se debet nisi coram Deo
"no one ought to accuse himself except in the Presence of God"
A legal maxim denoting that any accused person is entitled to make a plea of not guilty, and also that a witness is not obliged to give a response or submit a document that will incriminate himself . A very similar phrase is nemo tenetur seipsum accusare.
Accipe Hoc
Motto of 848 Naval Air Squadron, Royal Navy.
acta est fabula plaudite
"The play has been performed; applaud!"
A common ending to ancient Roman comedies, also claimed by Suetonius in Lives of the Twelve Caesars to have been Caesar Augustus ' last words. Applied by Sibelius to the third movement of his String Quartet no. 2 so that his audience would realize it was the last one, as a fourth would normally be expected.
acta non verba
Acta Sanctorum
"Deeds of the Saints "
Also used in the singular, Acta Sancti ("Deeds of the Saint"), preceding a specific Saint's name. A common title of works in hagiography .
actus non facit reum nisi mens sit rea
"The act is not guilty unless the mind is also guilty."
A legal term outlining the presumption of mens rea in a crime .
actus reus
"guilty act"
The actual crime that is committed, rather than the intent or thought process leading up to the crime. Thus, the external elements of a crime, as contrasted with mens rea, the internal elements.
ad absurdum
"to the absurd"
In logic, to the point of being silly or nonsensical. See also reductio ad absurdum . Not to be confused with ab absurdo ("from the absurd").
adaequatio intellectûs nostri cum re
"conformity of our minds to the fact"
A phrase used in epistemology regarding the nature of understanding.
ad abundantiam
"to abundance"
In legal language, used when providing additional evidence to an already sufficient collection. Also used commonly, as an equivalent of "as if this wasn't enough".
"to the stars through difficulty"
Motto of Kansas, and other organisations.
ad astra per alia porci
"to the stars on the wings of a pig"
A favorite saying of John Steinbeck . A professor told him that he would be an author when pigs flew. Every book he wrote is printed with this insignia.
ad captandum vulgus
"in order to court the crowd"
To do something to appeal to the masses. Often used of politicians who make false or insincere promises to appeal to popular interest. An argumentum ad captandum is an argument designed to please the crowd.
ad eundem
"to the same"
An ad eundem degree , from the Latin ad eundem gradum ("to the same step" or "to the same degree"), is a courtesy degree awarded by one university or college to an alumnus of another. It is not an honorary degree, but a recognition of the formal learning that earned the degree at another college.
A motto of Renaissance humanism . Also used in the Protestant Reformation .
ad fundum
"to the bottom"
Said during a generic toast , equivalent to "bottoms up!" In other contexts, generally means "back to the basics".
ad hoc
"to this"
Generally means "for this", in the sense of improvised on the spot or designed for only a specific, immediate purpose.
Rather than relying on ad hoc decisions, we should form a consistent plan for dealing with emergency situations.
ad hominem
"to the man"
Connotations of "against the man". Typically used in argumentum ad hominem, a logical fallacy consisting of criticizing a person when the subject of debate is the person's ideas or argument, on the mistaken assumption that the validity of an argument is to some degree dependent on the qualities of the proponent.
(ad int)
"for the meantime"
As in the term "chargé d'affaires ad interim" for a diplomatic officer who acts in place of an ambassador.
ad Kalendas Graecas
"to the Greek Kalends "
Attributed by Suetonius in Lives of the Twelve Caesars to Caesar Augustus . The phrase means "never" and is similar to phrases like " when pigs fly ". The Kalends (also written Calends) were specific days of the Roman calendar , not of the Greek , and so the "Greek Kalends" would never occur.
( ad lib )
"toward pleasure"
Loosely, "according to what pleases" or "as you wish"; libitum comes from the past participle of libere, "to please". It typically indicates in music and theatrical scripts that the performer has the liberty to change or omit something. Ad lib is specifically often used when someone improvises or ignores limitations.
ad litem
"to the lawsuit"
A legal term referring to a party appointed by a court to act in a lawsuit on behalf of another party who is deemed incapable of representing himself. An individual who acts in this capacity is called a guardian ad litem .
ad lucem
"to the light"
ad nauseam
"to the point of disgust"
Literally, "to the point of nausea ". Sometimes used as a humorous alternative to ad infinitum. An argumentum ad nauseam is a logical fallacy involving basing one's argument on prolonged repetition, i.e., repeating something so much that people are "sick of it".
ad oculos
Meaning "obvious on sight" or "obvious to anyone that sees it".
ad pedem litterae
"to the foot of the letter"
Thus, "exactly as it is written". Similar to the English idiom "to the letter", meaning "to the last detail".
ad perpetuam memoriam
"to the perpetual memory"
Generally precedes "of" and a person's name, and is used to wish for someone to be remembered long after death.
ad pondus omnium
(ad pond om)
"to the weight of all things"
More loosely, "considering everything's weight". The abbreviation was historically used by physicians and others to signify that the last prescribed ingredient is to weigh as much as all of the previously mentioned ones.
ad quod damnum
"to what damage"
Meaning "according to the harm" or "in proportion to the harm". The phrase is used in tort law as a measure of damages inflicted, implying that a remedy , if one exists, ought to correspond specifically and only to the damage suffered (cf. damnum absque injuria).
ad referendum
"for life or until fault"
Usually used of a term of office.
addendum
An item to be added, especially a supplement to a book. The plural is addenda.
adequatio intellectus et rei
"correspondence of the mind and reality"
One of the definitions of the truth. When the mind has the same form as reality, we think truth. Also found as adequatio rei et intellectus.
adsum
Equivalent to "Present!" or "Here!" The opposite of absum ("I am absent").
adversus solem ne loquitor
"Don't speak against the sun"
I.e., don't argue the obvious
aegri somnia
From Horace , Ars Poetica, 7. Loosely, "troubled dreams".
aequitas
aetatis suae
"of his own age"
Thus, "at the age of". Appeared on portraits, gravestones, etc. Sometimes extended to anno aetatis suae
(AAS)
, "in the year of his age". Sometimes shortened to just aetatis
(aet.)
.
alea iacta est
"the die is cast"
Said by Julius Caesar upon crossing the Rubicon in 49 BC , according to Suetonius . The original meaning was roughly equivalent to the English phrase "the game is afoot", but its modern meaning, like that of the phrase " crossing the Rubicon ", denotes passing the point of no return on a momentous decision and entering into a risky endeavor where the outcome is left to chance.
alenda lux ubi orta libertas
"Let learning be cherished where liberty has arisen."
The motto of Davidson College .
alias
"otherwise"
An assumed name or pseudonym . Similar to alter ego, but more specifically referring to a name, not to a "second self".
alibi
"elsewhere"
A legal defense where a defendant attempts to show that he was elsewhere at the time a crime was committed.
His alibi is sound; he gave evidence that he was in another city on the night of the murder.
alis aquilae
"on eagles wings"
taken from the Book of Isaiah, Chapter 40. "But those who wait for the Lord shall find their strength renewed, they shall mount up on wings like eagles, they shall run and not grow weary, they shall walk and not grow faint."
alis grave nil
"nothing is heavy to those who have wings"
motto of the Pontifical Catholic University of Rio de Janeiro ( Pontifícia Universidade Católica do Rio de Janeiro - PUC-RIO).
alis volat propris
"she flies with her own wings"
State motto of Oregon . Can also be rendered alis volat propriis.
Aliquantus
"something that stands for something else"
A foundational definition for semiotics
alma mater
"nourishing mother"
Term used for the university one attends or has attended. Another university term, matriculation , is also derived from mater. The term suggests that the students are "fed" knowledge and taken care of by the university. The term is also used for a university's traditional school anthem.
alter ego
"other I"
Another self, a second persona or alias . Can be used to describe different facets or identities of a single character, or different characters who seem representations of the same personality. Often used of a fictional character 's secret identity .
alterius non sit qui suus esse potest
"Let no man belong to another that can belong to himself"
Final sentence from Aesop ascribed fable (see also Aesop's Fables ) " The Frogs Who Desired a King " as appears in the collection commonly known as the "Anonymus Neveleti" (fable "XXIb. De ranis a Iove querentibus regem"). Motto of Paracelsus . Usually attributed to Cicero .
alterum non laedere
One of Justinian I 's three basic legal precepts.
alumna or
alumnus
"pupil"
Sometimes rendered with the gender-neutral alumn or alum in English. A graduate or former student of a school, college or university. Alumna (pl. alumnae) is a female pupil, and alumnus (pl. alumni) is a male pupil—alumni is generally used for a group of both males and females. The word derives from alere, "to nourish", a graduate being someone who was raised and taken care of at the school (cf. alma mater).
amicus curiae
"friend of the court"
An adviser, or a person who can obtain or grant access to the favour of powerful group, like a Roman Curia . In current U.S. legal usage, an amicus curiae is a third party allowed to submit a legal opinion (in the form of an amicus brief) to the court.
amiterre legem terrae
"to lose the law of the land"
An obsolete legal term signifying the forfeiture of the right of swearing in any court or cause, or to become infamous.
amor est vitae essentia
"love is the essence of life"
As said by Robert B. Mackay, Australian Analyst.
amor et melle et felle est fecundissmismus
"love is rich with both honey and venom"
Amor fati
"love of fate"
Nietzscheian alternative world view to memento mori [remember you must die]. Nietzsche believed amor fati to be more life affirming.
amor omnibus idem
from Virgil 's Georgics III.
amor patriae
(an.)
"in the year"
Also used in such phrases as anno urbis conditae (see ab urbe condita), Anno Domini, and anno regni.
(A.D.)
"in the Year of the Lord"
Short for Anno Domini Nostri Iesus Christi ("in the Year of Our Lord, Jesus Christ"), the predominantly used system for dating years across the world, used with the Gregorian calendar , and based on the perceived year of the birth of Jesus Christ . The years before Jesus' birth were once marked with a. C.n ( Ante Christum Natum , "Before Christ was Born"), but now use the English abbreviation BC ("Before Christ").
Augustus was born in the year 63 BC , and died AD 14 .
anno regni
"In the year of the reign"
Precedes "of" and the current ruler.
Annuit Cœptis
"He Has Approved the Undertakings"
Motto on the reverse of the Great Seal of the United States and on the back of the U.S. one dollar bill . "He" refers to God , and so the official translation given by the U.S. State Department is "He [God] has favored our undertakings".
annus horribilis
"horrible year"
A recent pun on annus mirabilis, first used by Queen Elizabeth II to describe what a bad year 1992 had been for her, and subsequently occasionally used to refer to many other years perceived as "horrible". In Classical Latin , this phrase would actually mean "terrifying year". See also annus terribilis.
annus mirabilis
"wonderful year"
Used particularly to refer to the years 1665 – 1666 , during which Isaac Newton made revolutionary inventions and discoveries in calculus, motion, optics and gravitation. Annus Mirabilis is also the title of a poem by John Dryden written in the same year. It has since been used to refer to other years, especially to 1905 , when Albert Einstein made equally revolutionary discoveries concerning the photoelectric effect, Brownian motion and the special theory of relativity. (See Annus Mirabilis Papers )
annus terribilis
aqua vitae
"water of life"
"Spirit of Wine" in many English texts. Used to refer to various native distilled beverages , such as whisky in Scotland and Ireland, gin in Holland, brandy (eau de vie) in France, and akvavit in Scandinavia.
aquila non capit muscas
"an eagle doesn't catch flies"
A noble or important person doesn't deal with insignificant issues.
arare litus
From Gerhard Gerhards' (1466-1536) [better known as Erasmus] collection of annotated Adagia (1508). Wasted labour.
arbiter elegantiarum
"judge of tastes"
One who prescribes, rules on, or is a recognized authority on matters of social behavior and taste. Said of Petronius . Also rendered arbiter elegentiae ("judge of a taste").
arcus senilis
Also "silver coin". Mentioned in Domesday , signifies bullion , or silver uncoined .
arguendo
"for arguing"
For the sake of argument. Said when something is done purely in order to discuss a matter or illustrate a point.
Let us assume, arguendo, that your claim is correct.
argumentum
"argument"
Or "reasoning", "inference", "appeal", "proof". The plural is argumenta. Commonly used in the names of logical arguments and fallacies , preceding phrases such as a silentio ("by silence"), ad antiquitatem ("to antiquity"), ad baculum ("to the stick"), ad captandum ("to capturing"), ad consequentiam ("to the consequence"), ad crumenam ("to the purse"), ad feminam ("to the woman"), ad hominem ("to the person"), ad ignorantiam ("to ignorance"), ad judicium ("to judgment"), ad lazarum ("to poverty"), ad logicam ("to logic"), ad metum ("to fear"), ad misericordiam ("to pity"), ad nauseam ("to nausea"), ad novitatem ("to novelty"), ad personam ("to the character"), ad numerum ("to the number"), ad odium ("to spite"), ad populum ("to the people"), ad temperantiam ("to moderation"), ad verecundiam ("to reverence"), ex silentio ("from silence"), and in terrorem ("into terror").
ars celare artem
"art [is] to conceal art"
An aesthetic ideal that good art should appear natural rather than contrived.
ars gratia artis
" art for art's sake "
Translated into Latin from Baudelaire 's "L'art pour l'art". Motto of Metro-Goldwyn-Mayer . This phrasing is a direct transliteration of 'art for the sake of art.' While very symmetrical for the MGM logo, the better Latin word order is 'Ars artis gratia.'
ars longa vita brevis
"art is long, life is short"
The Latin translation by Horace of a phrase from Hippocrates , often used out of context. The "art" referred to in the original aphorism was the craft of medicine, which took a lifetime to acquire.
asinus ad lyram
"an ass to the lyre"
From Gerhard Gerhards' (1466-1536) [better known as Erasmus] collection of annotated Adagia (1508). An awkward or incompetent individual.
asinus asinum fricat
"the jackass rubs the jackass"
Used to describe two people lavishing excessive praise on one another.
assecuratus non quaerit lucrum sed agit ne in damno sit
"the assured does not seek profit but just indemnity for the loss"
Refers to the insurance principle that the indemnity cannot be larger than the loss.
audeamus
"let us dare"
Motto of Otago University Students' Association , a direct response to the university's motto of sapere aude ("dare to be wise").
audemus jura nostra defendere
"we dare to defend our rights"
State motto of Alabama , adopted in 1923. Translated into Latin from a paraphrase of the stanza "Men who their duties know / But know their rights, and knowing, dare maintain" from the poem "What Constitutes a State?" by 18th-century author William Jones.
audentes fortuna iuvat
"fortune favors the bold"
From Virgil , Aeneid X, 284 (where the first word is in the archaic form audentis). Allegedly the last words of Pliny the Elder before he left the docks at Pompeii to rescue people from the eruption of Vesuvius in 79. Often quoted as audaces fortuna iuvat.
audere est facere
"to dare is to do"
audi alteram partem
"hear the other side"
A legal principle of fairness. Also worded as audiatur et altera pars ("let the other side be heard too").
audio hostem
Motto of 845 NACS Royal Navy
aurea mediocritas
From Horace 's Odes II, 10. Refers to the ethical goal of reaching a virtuous middle ground between two sinful extremes. The golden mean concept is common to many philosophers, chiefly Aristotle .
auri sacra fames
"accursed hunger for gold"
From Virgil , Aeneid 3,57. Later quoted by Seneca as "quod non mortalia pectora coges, auri sacra fames": "What aren't you able to bring men to do, miserable hunger for gold!"
auribus teneo lupum
"I hold a wolf by the ears"
A common ancient proverb, this version from Terence . Indicates that one is in a dangerous situation where both holding on and letting go could be deadly. A modern version is "To have a tiger by the tail."
aurora australis
"southern dawn"
The Southern Lights , an aurora that appears in the Southern Hemisphere . It is less well-known than the Northern Lights, or aurorea borealis. The Aurora Australis is also the name of an Antarctic icebreaker ship.
aurora borealis
The Northern Lights, an aurora that appears in the Northern Hemisphere .
aut Caesar aut nihil
"either Caesar or nothing"
Indicates that the only valid possibility is to be emperor , or a similarly prominent position. More generally, "all or nothing". Adopted by Cesare Borgia as a personal motto.
aut concilio aut ense
"either by meeting or by the sword"
Thus, either through reasoned discussion or through war. A former motto of Chile , post tenebras lux ultimately replaced by Por la Razon o la Fuerza (Spanish) ' by reason or by force '.
aut pax aut bellum
The motto of the Gunn Clan .
Aut viam inveniam aut faciam
"I will find a way, or I will make one"
Medical shorthand for "twice a day".
bona fide
In other words, "well-intentioned", "fairly". In modern contexts, often has connotations of "genuinely" or "sincerely". Bona fides is not the plural (which would be bonis fidebus), but the nominative , and means simply "good faith". Opposite of mala fide.
bona notabilia
—
In law, if a person dying has goods, or good debts, in another diocese or jurisdiction within that province, besides his goods in the diocese where he dies, amounting to a certain minimum value, he is said to have bona notabilia; in which case, the probat of his will belongs to the archbishop of that province.
bona officia
A nation's offer to mediate in disputes between two other nations.
bona patria
A jury or assize of countrymen, or good neighbors.
bona vacantia
United Kingdom legal term for ownerless property that passes to The Crown .
boni pastoris est tondere pecus non deglubere
"It is of a good shepherd to shear his flock, not to flay them."
Tiberius reportedly said this to his regional commanders, as a warning against taxing the populace excessively.
bonum commune communitatis
"common good of the community"
Or "general welfare". Refers to what benefits a society, as opposed to bonum commune hominis, which refers to what is good for an individual.
bonum commune hominis
"common good of a man"
Refers to an individual's happiness, which is not "common" in that it serves everyone, but in that individuals tend to be able to find happiness in similar things.
busillis
—
Pseudo-Latin meaning "baffling puzzle" or "difficult point". John of Cornwall (ca. 1170 ) was once asked by a scribe what the word meant. It turns out that the original text said in diebus illis magnis plenæ ("in those days there were plenty of great things"), which the scribe misread as indie busillis magnis plenæ ("in India there were plenty of large busillis").
Refers to a situation where nobody is safe from anybody, each man for himself.
capax infiniti
"capable of the infinite"
a pejorative term refering (at least) to some Christian doctrines of the incarnation of the Son of God when it asserts that humanity is capable of housing full divinity within its finite frame. Related to the Docetic heresy and sometimes a counterpoint to the Reformed 'extracalvinisticum.'
caput inter nubila (condit)
"head in the clouds"
So aggrandized as to be beyond practical (earthly) reach or understanding (from Virgil 's Aeneid and the shorter form appears in John Locke 's Two Treatises of Government)
Caritas Christi
"The love of Christ"
It implies a command to love as Christ loved. Motto of St. Franicis Xavier High School located in West Meadowlark Park (Edmonton) .
carpe diem
"seize the day"
An exhortation to live for today. From Horace , Odes I, 11.8. By far the most common translation is "seize the day," though carpere normally means something more like "pluck," and the allusion here is to picking flowers. The phrase collige virgo rosas has a similar sense.
carpe noctem
"seize the night"
An exhortation to make good use of the night, often used when carpe diem, q.v., would seem absurd, e.g., when observing a deep sky object or conducting a Messier marathon .
Carthago delenda est
"Carthage must be destroyed"
From Roman senator Cato the Elder , who ended every speech of his between the second and third Punic Wars with ceterum censeo Carthaginem esse delendam, literally "For the rest, I am of the opinion that Carthage is to be destroyed." Other translations include "In conclusion, I declare that Carthage must be destroyed." and "Furthermore, I move for Carthage to be destroyed."
The user is responsible for checking whether the goods suit his need.
Cedant arma togae
"Let military power yield to civilian power," Cicero , De Officiis . See Toga , it:Cedant arma togae
celerius quam asparagi cocuntur
"more swiftly than asparagus is cooked"
Or simply "faster than cooking asparagus". A variant of the Roman phrase velocius quam asparagi coquantur, using a different adverb and an alternate mood and spelling of coquere .
cepi corpus
"I got the body"
In law, it is a return made by the sheriff, upon a capias, or other process to the like purpose; signifying, that he has taken the body of the party.
certum est quod certum reddi potest
"It is certain if it is capable of being rendered certain"
Often used in law when something is not known, but can be ascertained (e.g. the purchase price on a sale which is to be determined by a third-party valuer)
cessante ratione legis cessat ipsa lex
"When the reason for the law ceases, the law itself ceases."
A rule of law becomes ineffective when the reason for its application has ceased to exist or does not correspond to the reality anymore.
cetera desunt
In the sense of "approximately" or "about". Usually used of a date.
circulus vitiosus
In logic, begging the question , a fallacy involving the presupposition of a proposition in one of the premises (see petitio principii). In science, a positive feedback loop. In economics, a counterpart to the virtuous circle .
citius altius fortius
Motto of the modern Olympics .
Clamea admittenda in itinere per atturnatum
A writ whereby the king of England could command the justice in eyre to admit one's claim by an attorney, who being employed in the king's service, cannot come in person.
clausum fregit
An action of tresspass; thus called, by reason the writ demands the person summoned to answer to wherefore he broke the close (quare clausum fregit), i.e. why he committed such a trespass.
claves Sancti Petri
"the keys of Saint Peter "
A symbol of the Papacy .
The means of discovering hidden or mysterious meanings in texts, particularly applied in theology and alchemy .
clerico admittendo
"about to be made a clerk"
In law, a writ directed to the bishop, for the admitting a clerk to a benefice upon a ne admittas, tried, and found for the party who procures the writ.
clerico capto per statutum mercatorum
In law, a writ for the delivery of a clerk out of prison, who is imprisoned upon the breach of statute merchant.
clerico convicto commisso gaolae in defectu ordinarii deliberando
In law, a writ for the delivery of a clerk to his ordinary, that was formerly convicted of felony; by reason that his ordinary did not challenge him according to the privilege of clerks.
clerico intra sacros ordines constituto non eligendo in officium
In law, a writ directed to the bailiffs, etc, that have thrust a bailiwick or beadleship upon one in holy orders; charging them to release him.
Codex Iuris Canonici
The official code of canon law in the Roman Catholic Church (cf. Corpus Iuris Canonici).
Coelum non animum mutant qui trans mare currunt
"Those who hurry cross the sea change the sky [upon them], not their souls or state of mind"
"congress in the way of beasts"
An medical euphemism for the doggy-style sexual position.
"pick, girl, the roses"
"Gather ye rosebuds while ye may", 1909, by John William Waterhouse .
Exhortation to enjoy fully the youth, similar to Carpe diem, from De rosis nascentibus (also titled Idyllium de rosis ) attributed to Ausonius or Virgil .
communibus annis
"in common years"
One year with another; on an average. "Common" here does not mean "ordinary," but "common to every situation"
communibus locis
"in common places"
A term frequently used among philosophical and other writers, implying some medium, or mean relation between several places; one place with another; on a medium. "Common" here does not mean "ordinary," but "common to every situation"
communis opinio
compos mentis
"in control of the mind"
Describes someone of sound mind. Sometimes used ironically. Also a legal principle, non compos mentis ("not in control of one's faculties"), used to describe an insane person.
concordia cum veritate
Motto of the University of Waterloo .
concordia salus
The official name of Switzerland , hence the use of " CH " for its ISO country code , " .ch " for its Internet domain , and " CHF " for the ISO three-letter abbreviation of its currency, the Swiss franc .
coniunctis viribus
Or "with united powers". Sometimes rendered conjunctis viribus.
Consuetudo pro lege servatur
"Custom is kept before the law"
An inconsistently applied maxim. See also consuetudo est altera lex (custom is another law) and consuetudo vincit communem legem (custom overrules the common law)
consummatum est
The last words of Jesus on the cross in the Latin translation of John 19:30.
contemptus saeculi
"scorn for the times"
Despising the secular world. The monk or philosopher 's rejection of a mundane life and worldly values.
contra spem spero
A word that makes itself impossible
contraria contrariis curantur
"the opposite is cured with the opposite"
First formulated by Hippocrates to suggest that the diseases are cured with contrary remedies. Antonym of Similia similibus curantur (the diseases are recovered with similar remedies. )
contra bonos mores
Offensive to the conscience and to a sense of justice.
contra legem
cor ad cor loquitur
"heart speaks to heart"
From Augustine 's Confessions , referring to a prescribed method of prayer: having a "heart to heart" with God. Commonly used in reference to a later quote by John Henry Cardinal Newman . A motto of Newman Clubs.
cor meum tibi offero domine prompte et sincere
"my heart I offer to you Lord promptly and sincerely"
cor unum
"one heart"
A popular school motto. Often used as names for religious and other organisations such as the Pontifical Council Cor Unum .
coram Deo
"in the Presence of God"
A phrase from Christian theology which summarizes the idea of Christians living in the Presence of, under the authority of, and to the honor and glory of God .
coram populo
"in the presence of the people"
Thus, openly.
"the corruption of the best is the worst"
corruptus in extremis
Motto of the fictional Springfield Mayor Office in The Simpsons TV-Show
Corruptissima re publica plurimae leges
"When the republic is at its most corrupt the laws are most numerous"--Tacitus
Cras amet qui nunquam amavit; quique amavit, cras amet
"May he love tomorrow who has never loved before; And may he who has loved, love tomorrow as well"
It's the refrain from the 'Pervigilium Veneris', a poem which describes a three day holiday in the cult of Venus, located somewhere in Sicily, involving the whole town in religious festivities joined with a deep sense of nature and Venus as the "procreatrix", the life-giving force behind the natural world.
Credo in Unum Deum
"I Believe in One God"
The first words of the Nicene Creed .
credo quia absurdum est
"I believe it because it is absurd"
A very common misquote of Tertullian 's et mortuus est Dei Filius prorsus credibile quia ineptum est ("and the Son of God is dead: in short, it is credible because it is unfitting"), meaning that it is so absurd to say that God's son has died that it would have to be a matter of belief, rather than reason. The misquoted phrase, however, is commonly used to mock the dogmatic beliefs of the religious (see fideism ). This phrase is commonly shortened to credo quia absurdum, and is also sometimes rendered credo quia impossibile est ("I believe it because it is impossible")or, as Darwin used it in his autobiography, credo quia incredibile.
crescamus in Illo per omina
"May we grow in Him through all things"
crescit eundo
"it grows as it goes"
State motto of New Mexico , adopted in 1887 as the territory's motto, and kept in 1912 when New Mexico received statehood. Originally from Lucretius ' On the Nature of Things book VI, where it refers in context to the motion of a thunderbolt across the sky, which acquires power and momentum as it goes.
cruci dum spiro fido
"while I live, I trust in the cross", "Whilst I trust in the Cross I have life"
Motto of the Sisters of Loreto (IBVM) and its associated schools. A second translation is "Whilst I trust in the Cross I have life"
cucullus non facit monachum
cui bono
"Good for whom?"
"Who benefits?" An adage in criminal investigation which suggests that considering who would benefit from an unwelcome event is likely to reveal who is responsible for that event (cf. cui prodest). Also the motto of the Crime Syndicate of America , a fictional supervillain group. The opposite is cui malo ("Bad for whom?").
cui prodest
"for whom it advances"
Short for cui prodest scelus is fecit ("for whom the crime advances, he has done it") in Seneca 's Medea. Thus, the murderer is often the one who gains by the murder (cf. cui bono).
cuius est solum eius est usque ad coelum et ad inferos
"Whose the land is, all the way to the sky and to the underworld is his."
First coined by Accursius of Bologna in the 13th century. A Roman legal principle of property law that is no longer observed in most situations today. Less literally, "For whosoever owns the soil, it is theirs up to the sky and down to the depths."
cuius regio, eius religio
"whose region, his religion"
The privilege of a ruler to choose the religion of his subjects. A regional prince's ability to choose his people's religion was established at the Peace of Augsburg in 1555.
Cuiusvis hominis est errare, nullius nisi insipientis in errore perseverare.
"Anyone can err, but only the fool persists in his fault."
— Marcus Tullius Cicero, Philippica XII, ii, 5
culpa
"fault"
Also "blame" or " guilt ". In law, an act of neglect. In general, guilt, sin, or a fault. See also mea culpa .
cum gladiis et fustibus
From the Bible. Occurs in Matthew 26:47 and Luke 22:52.
cum gladio et sale
Motto of a well-paid soldier. See salary .
cum grano salis
Not to be taken too seriously or as the literal truth.
Yes, the brochure made it sound great, but such claims should be taken cum grano salis.
cum laude
"with praise"
The standard formula for academic Latin honors in the United States. Greater honors include magna cum laude and summa cum laude.
A Roman custom in which disgraced Romans (particularly former Emperors) were pretended to have never existed.
damnum absque injuria
"damage without injury"
A loss that results from no one's wrongdoing. In Roman law , a man is not responsible for unintended, consequential injury to another resulting from a lawful act. This protection does not necessarily apply to unintended damage by negligence or folly.
data venia
"with due respect" or "given the excuse"
Used before disagreeing with someone.
dat deus incrementum
Motto of Westminster School , a leading British independent school.
de bonis asportatis
Trespass de bonis asportatis was the traditional name for larceny , or wrongful taking of chattels.
Decus Et Tutamen
"An ornament and a safeguard"
Inscription on one pound coins . Originally on 17th century coins, it refers to the inscribed edge as a protection against the clipping of precious metal. The phrase originally comes from Virgil 's Aeneid .
"The descent into the cave of the rabbit"
Down the Rabbit Hole
de facto
"in fact"
Said of something that is the actual state of affairs , in contrast to something's legal or official standing, which is described as de jure. De facto refers to the "way things really are" rather than what is "officially" presented as the fact.
Although the emperor held the title and trappings of head of state, the Shogun was the de facto ruler of Japan .
de fideli
"with faithfulness"
A clerk makes the declaration De fideli on when appointed, promising to do his or her tasks faithfully as a servant of the court.
de futuro
Usually used in the context of "at a future time"
de gustibus non est disputandum
"there is not to be discussion regarding tastes"
Less literally "In matters of taste there is no dispute" or simply "There's no arguing taste". A similar expression in English is "There's no accounting for taste". Bartlett's Familiar Quotations, without attribution, renders the phrase as de gustibus non disputandum; the verb "to be" is often assumed in Latin, and is rarely required.
de integro
de jure
"by law"
"Official", in contrast with de facto. Analogous to "in principle", whereas de facto is to "in practice". In other contexts, can mean "according to law", "by right" or "legally". Also commonly written de iure, the classical form.
de lege ferenda
"from law to be passed"
de lege lata
de minimis non curat praetor
"The commander does not bother with the smallest things."
Also "The chief magistrate does not concern himself with trifles." Trivial matters are no concern of a high official (cf. aquila non capit muscas, "the eagle does not catch flies"). Sometimes rex ("the king") or lex ("the law") is used in place of praetor , and de minimis is a legal term referring to things unworthy of the law's attention.
de mortuis aut bene aut nihil
"about the dead, either well or nothing"
Less literally, "speak well of the dead or not at all" (cf. de mortuis nil nisi bonum).
de mortuis nil nisi bonum
"about the dead, nothing unless a good thing"
From de mortuis nil nisi bonum dicendum est, "nothing must be said about the dead except the good", attributed by Diogenes Laertius to Chilon . In legal contexts, this quotation is used with the opposite meaning, as defaming a deceased person is not a crime. In other contexts, it refers to taboos against criticizing the recently deceased.
de nobis fabula narratur
"about us is the story told"
Thus, "their story is our story". Originally referred to the end of Rome's dominance. Now often used when comparing any current situation to a past story or historical event.
de novo
"from the new"
"Anew" or "afresh". In law, a trial de novo is a retrial. In biology, de novo means newly-synthesized , and a de novo mutation is a mutation that neither parent possessed or transmitted. In economics, de novo refers to newly-founded companies, and de novo banks are state banks that have been in operation for five years or less.
de omnibus dubitandum
"be suspicious of everything, doubt everything"
Karl Marx 's favorite motto. He used this to explain his standpoint: "Critique everything in a capitalist economy".
de omni re scibili et quibusdam aliis
"about every knowable thing, and even certain other things"
A 15th-century Italian scholar wrote the De omni re scibili portion, and a wag added et quibusdam aliis.
"Free From Having Been Oppressed"
Commonly mistranslated as "To Liberate the Oppressed". The motto of the United States Army Special Forces .
The semi-Hispanicized form Deogracias is a Philippine first name.
Deo Optimo Maximo
(DOM)
"To the Best and Greatest God"
Derived from the Pagan Iupiter Optimo Maximo ("To the best and greatest Jupiter"). Printed on bottles of Benedictine liqueur.
Deo vindice
Motto of the Confederate States of America . An alternate translation is "With an avenging God".
Deo volente
"with God willing"
This was often used in conjunction with a signature at the end of letters. It was used in order to signify that "God willing" this letter will get to you safely, "God willing" the contents of this letter come true.
deus ex machina
"a god from a machine"
From the Greek Από μηχανής Θεός (Apo mēchanēs Theos). A contrived or artificial solution, usually to a literary plot. Refers to the practice in Greek drama of lowering by machine an actor playing a god or goddess, typically either Athena or (as in Euripides ) the Dioscuri onto the stage to resolve an insuperable conflict in the plot.
The principal slogan of the Crusades .
deus otiosus
Dicto simpliciter
"[From] a maxim, simply"
I.e. "From a rule without exception." Short for A dicto simpliciter, the a often being dropped by confusion with the indefinite article. A dicto simpliciter occurs when an acceptable exception is ignored or eliminated. For instance, the appropriateness of using opiates is dependent on the presence of extreme pain. To justify the recreational use of opiates by referring to a cancer patient or to justify arresting said cancer patient by comparing him to the recreational user would be a dicto simpliciter.
"my word [is] my bond"
Motto of the London Stock Exchange
diem perdidi
"I have lost the day"
From the Roman Emperor Titus . Passed down in Suetonius 's biography of him in Lives of the Twelve Caesars (8)
Diem Ex Dei
Dies Irae
"Day of Wrath"
Refers to the Judgment Day in Christian eschatology . The name of a famous 13th-century Medieval Latin hymn by Tommaso da Celano , used in the Mass for the dead.
differentia specifica
dirigo
"I direct"
In Classical Latin , "I arrange". State motto of Maine . Based on a comparison of the state of Maine to the star Polaris .
dis aliter visum
"it seemed otherwise to the gods"
In other words, the gods have different plans than mortals, and so events do not always play out as people wish them to.
dis manibus sacrum
(D.M.S.)
"Sacred to the ghost-gods"
Refers to the Manes , Roman spirits of the dead. Loosely "To the memory of". A conventional inscription preceding the name of the deceased on pagan grave markings, often shortened to dis manibus
(D.M.)
, "for the ghost-gods". Preceded in some earlier monuments by hic situs est
(H. S. E.)
dixi
"I have spoken"
A popular eloquent expression, usually used in the end of a speech. The implied meaning is: "I have said all that I had to say and thus the argument is settled".
["...", ...] dixit
Used to attribute a statement or opinion to its author, rather than the speaker.
do ut des
"I give that you may give"
Often said or written for sacrifices, when one "gives" and expects something back from the gods.
Docendo discitur
"It is learned by teaching"
Also translated "One learns by teaching." Attributed to Seneca the Younger .
Docendo disco, scribendo cogito
I learn by teaching, think by writing.
dolus specialis
special intent
"The ... concept is particular to a few civil law systems and cannot sweepingly be equated with the notions of ‘special’ or ‘specific intent’ in common law systems. Of course, the same might equally be said of the concept of ‘specific intent,’ a notion used in the common law almost exclusively within the context of the defense of voluntary intoxication."—Genocide scholar William Schabas [1]
Motto of the University of Oxford .
Dominus vobiscum
"Lord be with you"
Phrase used during and at the end of Catholic sermons, and a general greeting form among and towards members of Catholic organizations, such as priests and nuns. See also pax vobiscum.
dona nobis pacem
"give us peace"
Often set to music, either by itself or as part of the Agnus Dei prayer of the Mass (see above). Also an ending in the video game Haunting Ground .
donatio mortis causa
"giving in expectation of death"
A legal concept where a person in imminent mortal danger need not meet the requisite consideration to create or modify a will .
draco dormiens nunquam titillandus
"a sleeping dragon is never to be tickled"
Motto of the fictional Hogwarts school in the Harry Potter series; translated more loosely in the books as "never tickle a sleeping dragon".
dramatis personae
"the parts of the play"
More literally, "the masks of the drama"; more figuratively, "cast of characters". The characters represented in a dramatic work.
Duae tabulae rasae in quibus nihil scriptum est
"Two minds, not one single thought"
Stan Laurel , inscription for the fanclub logo Sons of the Desert .
Ductus exemplo
"Leadership by Example"
This is the motto for the United States Marine Corps' Officer Candidates School located at Marine Corps Base Quantico; Quantico, Virginia.
dulce bellum inexpertis
"war is sweet to the inexperienced"
War may seem pleasant to those who have never been involved in it, though the more experienced know better. A phrase from Erasmus in the 16th century .
dulce et decorum est pro patria mori
"It is sweet and honorable to die for the fatherland."
From Horace , Odes III, 2, 13. Used by Wilfred Owen for the title of a poem about World War I , Dulce et Decorum Est .
dulce et utile
"a sweet and useful thing"
Horace wrote in his Ars Poetica that poetry must be dulce et utile ("pleasant and profitable"), both enjoyable and instructive.
dulce periculum
e pluribus unum
'From many, (comes) One.'
Usually translated 'Out of many, (is) One.' Motto of the United States of America. Inscribed on the Capitol and many coins used in the United States of America. The motto of the Sport Lisboa e Benfica Portuguese soccer club.
Ecce Homo
'Behold the Man'
From the Latin Vulgate Gospel according to St. John (XIX.v) (19.5, Douay-Rheims) , where Pilate speaks these words as he presents Christ , crowned with thorns, to the crowd. Oscar Wilde opened his defense with this phrase when on trial for sodomy , characteristically using a well-known Biblical reference as a double entendre. It is also the title of Nietzsche 's autobiography and of the theme music by Howard Goodall for the BBC comedy Mr. Bean .
Often confused with id est (i.e.)
ego te absolvo
'I absolve you'
Part of the absolution -formula spoken by a priest as part of the sacrament of Penance (cf. absolvo).
ego te provoco
emeritus
'veteran'
Also 'worn-out'. Retired from office. Often used to denote a position held at the point of retirement, as an honor, such as professor emeritus or provost emeritus. This does not necessarily mean that the honoree is no longer active.
ens causa sui
'existing because of oneself'
Or 'being one's own cause'. Traditionally, a being that owes its existence to no other being, hence God or a Supreme Being (cf. Primum Mobile ).
errare humanum est
'to err is human'
From Seneca the Younger . The full quote is errare humanum est perseverare diabolicum: 'to err is human; to persist is of the Devil'.
erratum
'error'
Or 'mistake'. Lists of errors in a previous edition of a work are often marked with the plural, errata ('errors').
esse est percipi
'to be is to be perceived'
George Berkeley 's motto for his idealist philosophical position that nothing exists independently of its perception by a mind except minds themselves.
esse quam videri
'to be, rather than to seem'
Truly being something, rather than merely seeming to be something. State motto of North Carolina and academic motto of several schools, including North Carolina State University , Berklee College of Music , and Columbia College Chicagoas well as Connell's Point Public School and Cranbrook High School in Sydney, Australia. From chapter 26 of Cicero 's De amicitia ('On Friendship'). Earlier than Cicero, the phrase had been used by Sallust in his Bellum Catilinae (54.6), where he wrote that Cato esse quam videri bonus malebat ('he preferred to be good, rather than to seem so'). Earlier still, Aeschylus used a similar phrase in Seven Against Thebes, line 592, ou gar dokein aristos, all' enai thelei ('his resolve is not to seem the best, but in fact to be the best').
esto perpetua
'may it be perpetual'
Said of Venice by the Venetian historian Fra Paolo Sarpi shortly before his death. Also the state motto of Idaho , adopted in 1867.
et alibi
(et al.)
'and elsewhere'
A less common variant on et cetera used at the end of a list of locations to denote unlisted places.
et alii
(et al.)
'and others'
Used similarly to et cetera ('and the rest'), to stand for a list of names. Alii is actually masculine , so it can be used for men, or groups of men and women; the feminine, et aliae, is appropriate when the 'others' are all female. Et alia is correct for the neuter. [3] APA style uses et al. if the work cited was written by more than two authors; MLA style uses et al. for more than three authors.
Pluralized as et sequentia ('and the following things'), abbreviations: et seqq., et seq. ., or sqq.
et suppositio nil ponit in esse
'a supposition puts nothing in being'
More typically translated as "sayin' it don't make it so"
'And you, Brutus ?'
Also 'Even you, Brutus?' or 'You too, Brutus?' Used to indicate a betrayal by someone close. From Shakespeare 's Julius Caesar , based on the traditional dying words of Julius Caesar . However, these were almost certainly not Caesar's true last words; Plutarch quotes Caesar as saying, in Greek (which was the language of Rome's elite at the time), 'και συ, τεκνον;' (Kai su, teknon?), in English 'You as well, (my) child?' Some have speculated based on this that Brutus was Caesar's child, though there is no substantial evidence of this.
et uxor
Ex Astris Scientia
'From the Stars, Knowledge'
The motto of the fictional Starfleet Academy on Star Trek . Adapted from ex luna scientia, which in turn was modeled after ex scientia tridens.
ex cathedra
'from the chair'
A phrase applied to the declarations or promulgations of the Pope when, preserved from even the possibility of error by the action of the Holy Ghost (see Papal Infallibility ), he solemnly declares or promulgates to the Church a dogmatic teaching on faith or morals as being contained in divine revelation, or at least being intimately connected to divine revelation. Used, by extension, of anyone who is perceived as speaking as though with supreme authority or with arrogance.
ex Deo
'from fraud '
'From harmful deceit'; dolus malus is the Latin legal term for 'fraud'. The full legal phrase is ex dolo malo non oritur actio ('an action does not arise from fraud'). When an action has its origin in fraud or deceit, it cannot be supported; thus, a court of law will not assist a man who bases his course of action on an immoral or illegal act.
ex facie
'from the face'
Idiomatically rendered 'on the face of it'. A legal term typically used to note that a document's explicit terms are defective without further investigation.
ex gratia
'from kindness'
More literally 'from grace'. Refers to someone voluntarily performing an act purely out of kindness, as opposed to for personal gain or from being forced to do it. In law, an ex gratia payment is one made without recognizing any liability or legal obligation.
ex hypothesi
' nothing may come from nothing '
From Lucretius , and said earlier by Empedocles . Its original meaning is 'work is required to succeed', but its modern meaning is a more general 'everything has its origins in something' (cf. causality ). It is commonly applied to the conservation laws in philosophy and modern science. Ex nihilo often used in conjunction with the term creation, as in creatio ex nihilo, meaning 'creation, out of nothing'. It is often used in philosophy or theology in connection with the proposition that God created the universe from nothing.
ex oblivione
The title of a short story by H.P. Lovecraft .
ex officio
'from the office'
By virtue of office or position; 'by right of office'. Often used when someone holds one position by virtue of holding another. A common misconception is that ex officio members of a committee or congress may not vote, but this is not guaranteed by that title.
ex opere operantis
'from the work of the one working'
A theological phrase contrasted with ex opere operato , referring to the notion that the validity or promised benefit of a sacrament depends on the person administering it.
ex opere operato
'from the work that worked'
A theological phrase meaning that the act of receiving a sacrament actually confers the promised benefit, such as a baptism actually and literally cleansing one's sins . The Catholic Church affirms that the source of grace is God, not just the actions or disposition of the recipient.
ex oriente lux
'from the East, the light'
Superficially refers to the sun rising in the east, but alludes to culture coming from the Eastern world.
ex parte
'from a part'
A legal term meaning 'by one party' or 'for one party'. Thus, on behalf of one side or party only.
'from a thing done afterward'
Said of a law with retroactive effect.
ex scientia tridens
'from knowledge, sea power.'
The United States Naval Academy motto. Refers to knowledge bringing men power over the sea comparable to that of the trident -bearing Greek god Poseidon .
ex scientia vera
The motto of the College of Graduate Studies at Middle Tennessee State University .
ex silentio
'from silence'
In general, the claim that the absence of something demonstrates the proof of a proposition. An argumentum ex silentio (' argument from silence ') is an argument based on the assumption that someone's silence on a matter suggests ('proves' when a logical fallacy ) that person's ignorance of the matter or their inability to counterargue validly.
ex tempore
'This instant', 'right away' or 'immediately'. Also written extempore.
ex vi termini
'from the force of the term'
Thus, 'by definition'.
ex vivo
'out of or from life'
Used in reference to the study or assay of living tissue in an artificial environment outside the living organism.
ex voto
'from the vow'
Thus, in accordance with a promise. An ex voto is also an offering made in fulfillment of a vow.
excelsior
'higher'
exceptio firmat regulam in casibus non exceptis
'The exception confirms the rule in cases which are not excepted'
A juridical motto which means that exception , as for example during a ' state of exception ', does not put in danger the legitimity of the rule in its globality. In other words, the exception is strictly limited to a particular sphere (see also: exceptio strictissimi juris est .
excusatio non petita accusatio manifesta
'an excuse that has not been sought is an obvious accusation'
More loosely, 'he who excuses himself, accuses himself'—an unprovoked excuse is a sign of guilt. In French, qui s'excuse, s'accuse.
Literally 'believe one who has had experience'. An author's aside to the reader.
expressio unius est exclusio alterius
'the expression of the one is the exclusion of the other'
'Mentioning one thing may exclude another thing'. A principle of legal statutory interpretation : the explicit presence of a thing implies intention to exclude others; e.g., a reference in the Poor Relief Act 1601 to 'lands, houses, tithes and coal mines' was held to exclude mines other than coal mines. Sometimes expressed as expressum facit cessare tacitum (broadly, 'the expression of one thing excludes the implication of something else').
'still in existence; surviving'
adjective:
extant law is still existing, in existence, existent, surviving, remaining, undestroyed. Usage, when a law is repealed the extant law governs.
extra domus
'(placed) outside of the house'
Refers to a possible result of Catholic ecclesiastical legal proceedings when the culprit is removed from being part of a group like a monastery.
Extra Ecclesiam nulla salus
'Outside the Church there is no salvation'
This expression comes from the writings of Saint Cyprian of Carthage, a bishop of the third century. It is often used to summarise the doctrine that the Catholic Church is absolutely necessary for salvation.
Extra omnes
'Out, all of you.'
It is issued by the Master of the Papal Liturgical Celebrations before a session of the Papal Conclave which will elect a new Pope . When spoken, all those who are not Cardinals , or those otherwise mandated to be present at the Conclave, must leave the Sistine Chapel .
extra territorium jus dicenti impune non paretur
'he who administers justice outside of his territory is disobeyed with impunity'
Motto of Prince Alfred College in Adelaide , Australia.
fac simile
Origin of the word facsimile, and, through it, of fax .
facta, non verba
"actions, not words"
Motto of United States Navy Destroyer Squadron 22, and the Canadian Fort Garry Horse armoured regiment (Militia).
falsus in unum, falsus in omnibus
"false in one thing, false in everything"
A Roman legal principle indicating that a witness who willfully falsifies one matter is not credible on any matter. The underlying motive for attorneys to impeach opposing witnesses in court: the principle discredits the rest of their testimony if it is without corroboration.
felo de se
"felon from himself"
An archaic legal term for one who commits suicide , referring to early English common law punishments, such as land seizure, inflicted on those who killed themselves.
fere libenter homines id quod volunt credunt
"as a rule, men willingly believe that which they wish to"
People believe what they wish to be true, even if it isn't. Attributed to Julius Caesar .
festina lente
"hurry slowly"
An oxymoronic motto of St Augustine . It encourages proceeding quickly, but with calm and caution. Equivalent to 'More haste, less speed'.
fiat iustitia et pereat mundus
"let justice be done, even should the world perish"
(fd)
"Defender of the Faith"
A title given to Henry VIII of England by Pope Leo X on October 17 , 1521 before Henry became a heresiarch . Still used by the British monarchs, it appears on all British coins, usually abbreviated.
fides qua creditur
"the faith by which it is believed"
the personal faith which apprehends, contrasted with fides quae creditur
fides quae creditur
"the faith which is believed"
the content of "the faith," contrasted with fides qua creditur
fides quaerens intellectum
the motto of Saint Anselm , found in his Proslogion
fidus Achates
A faithful friend. From the name of Aeneas 's faithful companion in Virgil 's Aeneid .
flagellum dei
flectere si nequeo superos, Achaeronta movebo
"If I cannot move heaven I will raise hell"
habeas corpus
"you may have the body"
A legal term from the 14th century or earlier. Refers to a number of legal writs to bring a person before a court or judge, most commonly habeas corpus ad subjiciendum ("you may have the body to bring up"). Commonly used as the general term for a prisoner's legal right to have the charge against them specifically identified.
habemus papam
"we have a pope"
Used after a Roman Catholic Church papal election to announce publicly a successful ballot to elect a new pope.
hac lege
haec olim meminisse iuvabit
"one day, this will be pleasing to remember"
Commonly rendered in English as "One day, we'll look back on this and smile". From Virgil 's Aeneid 1.203.
Hannibal ante portas
Refers to wasting time while the enemy is already here. Attributed to Cicero.
Hannibal ad portas
" Hannibal is at the gates"
Roman parents would tell their misbehaving children this, invoking their fear of Hannibal.
haud ignota loquor
"I speak not of unknown things"
Thus, "I say no things that are unknown". From Virgil 's Aeneid , 2.91.
hic abundant leones
Written on uncharted territories of old maps.
hic et nunc
(HJ)
"here lies"
Also rendered hic iacet. Written on gravestones or tombs, preceding the name of the deceased. Equivalent to hic sepultus ("here is buried"), and sometimes combined into hic jacet sepultus
(HJS)
hic manebimus optime
"here we'll stay excellently"
According to Titus Livius the phrase was pronounced by Marcus Furius Camillus , addressing the senators who intended to abandon the city, invaded by Gauls , in 390 BCE circa. It is used today to express the intent to keep one's position even if the circumstances appear adverse.
hic sunt leones
Written on uncharted territories of old maps.
hinc illae lacrimae
"hence those tears"
From Terence , Andria, line 125. Originally literal, referring to the tears shed by Pamphilus at the funeral of Chrysis, it came to be used proverbally in the works of later authors, such as Horace (Epistula XIX, 41).
historia vitae magistra
"history, the teacher of life"
From Cicero , Tusculanas, 2, 16. Also "history is the mistress of life".
homo homini lupus
"man [is a] wolf to man"
First attested in Plautus ' Asinaria ("lupus est homo homini"). The sentence was drawn on by Hobbes in Leviathan as a concise expression of his human nature view.
homo sum humani a mi nihil alienum puto
"I am a human being; nothing human is strange to me"
From Terence , Heautontimoroumenos. Originally "strange" or "foreign" (alienum) was used in the sense of "irrelevant", as this line was a response to the speaker being told to mind his own business, but it is now commonly used to advocate respecting different cultures and being humane in general. Puto ("I consider") is not translated because it is meaningless outside of the line's context within the play.
Medical shorthand for "at bedtime".
horas non numero nisi serenas
"I do not count the hours unless they are sunny"
A common inscription on sundials .
hortus in urbe
"A garden in the city"
Motto of the Chicago Park District , a playful allusion to the city's motto, urbs in horto, q.v.
horribile dictu
That is, "a horrible thing to relate". A pun on mirabile dictu.
hostis humani generis
"enemy of the human race"
Cicero defined pirates in Roman law as being enemies of humanity in general.
hypotheses non fingo
"I do not fabricate hypotheses"
From Newton , Principia . Less literally, "I do not assert that any hypotheses are true".
Not to be confused with an intelligence quotient .
i.e.
Abbreviation for id est, above.
Iesus Nazarenus Rex Iudaeorum
( INRI )
" Jesus of Nazareth , King of the Jews"
Based on a Christian belief that "this one is King of the Jews" was written in Latin, Greek and Aramaic at the top of the cross Jesus was crucified on.
igne natura renovatur integra
"through fire, nature is reborn whole"
An alchemical aphorism invented as an alternate meaning for the acronym INRI .
igni ferroque
"with fire and iron"
A phrase describing scorched earth tactics. Also rendered as igne atque ferro, ferro ignique, and other variations.
ignis fatuus
Legal term for "in court".
in girum imus nocte et consumimur igni
"We enter the circle at night and are consumed by fire"
A palindrome said to describe the behavior of moths. Also the title of a film by Guy Debord .
in hoc signo vinces
Words Constantine claimed to have seen in a vision before the Battle of Milvian Bridge .
in illo tempore
"in that time"
"at that time", found often in Gospel lectures during Masses, used to mark an undetermined time in the past.
in limine
"at the outset"
Preliminary, in law referring to a motion that is made to the judge before or during trial, often about the admissibility of evidence believed prejudicial
in loco
"in the place"
That is, "at the place".
The nearby labs were closed for the weekend, so the water samples were analyzed in loco.
"in the place of a parent"
A legal term meaning "assuming parental (i.e., custodial) responsibility and authority".
in luce Tua videmus lucem
"in Thy light we see light"
in lumine tuo videbimus lumen
"in your light we will see the light"
in manus tuas commendo spiritum meum
"into your hands I entrust my spirit"
According to Luke 23:46, the last words of Jesus on the cross.
in medias res
"into the middle of things"
From Horace . Refers to the literary technique of beginning a narrative in the middle of, or at a late point in, the story, after much action has already taken place. Examples include the Iliad , the Odyssey , and Paradise Lost . Compare ab initio.
in necessariis unitas, in dubiis libertas, in omnibus caritas
"in necessary things unity, in doubtful things liberty, in all things charity"
"Charity" ( caritas ) is being used in the classical sense of "compassion" (cf. agape ). Motto of the Cartellverband der katholischen deutschen Studentenverbindungen . Often misattributed to Augustine of Hippo .
in nuce
I.e. "in potentiality." Comparable to "potential", "to be developed".
In omnia paratus
Motto of the so-called secret society of Yale in the sitcom Gilmore Girls .
In omnibus requiem quaesivi, et nusquam inveni nisi in angulo cum libro
"Everywhere I have searched for peace and nowhere found it, except in a corner with a book"
in partibus infidelium
"in the parts of the infidels"
That is, "in the land of the infidels", infidels here referring to non- Christians . After Islam conquered a large part of the Roman Empire, the corresponding bishoprics didn't disappear, but remained as titular sees .
in personam
"into a person"
"Directed towards a particular person". In a lawsuit in which the case is against a specific individual, that person must be served with a summons and complaint to give the court jurisdiction to try the case. The court's judgment applies to that person and is called an "in personam judgment." In personam is distinguished from in rem, which applies to property or "all the world" instead of a specific person. This technical distinction is important to determine where to file a lawsuit and how to serve a defendant . In personam means that a judgment can be enforceable against the person, wherever he or she is. On the other hand, if the lawsuit is to determine title to property (in rem), then the action must be filed where the property exists and is only enforceable there.
in propria persona
"in silicon "
Coined in the early 1990s for scientific papers. Refers to an experiment or process performed virtually, as a computer simulation. The term is Dog Latin modeled after terms such as in vitro and in vivo. The Latin word for silicon is silicium, so the correct Latinization of "in silicon" would be in silicio, but this form has little usage.
in situ
"in the place"
In the original place, appropriate position, or natural arrangement. In medical contexts, it implies that the condition is still in the same place and has not worsened, improved, spread, etc.
In spe
"in hope"
"future" ("My mother-in-law in spe", i.e. "My future mother-in-law"), or "in embryonic form", as in " Locke 's theory of government resembles, in spe, Montesquieu 's theory of the separation of powers."
In specialibus generalia quaerimus
"To seek the general in the specifics"
That is, to understand the most general rules through the most detailed analysis.
in statu nascendi
"in the state of being born"
Just as something is about to begin.
in toto
"in wine [there is] truth"
That is, wine loosens the tongue.
(Referring to alcohol 's disinhibitory effects.)
in vitro
"in glass"
An experimental or process methodology performed in a "non-natural" setting (e.g., in a laboratory using a glass test tube or Petri dish), and thus outside of a living organism or cell. The reference to glass is merely an historic one, as the current usage of this term is not specific to the materials involved, but rather to the "non-natural" setting employed. Alternative experimental or process methodologies would include in vitro, in silico, ex vivo and in vivo.
In vitro fertilization is not literally done "in glass", but rather is a technique to fertilize egg cells outside of a woman's body. By definition, it is thus an ex vivo process.
"in life" or "in a living thing"
An experiment or process performed on a living specimen.
incredibile dictu
inter arma enim silent leges
"In the face of arms, the law falls mute," more popularly rendered as "during warfare, in fact, the laws are silent"
Said by Cicero in Pro Milone as a protest against unchecked political mobs that had virtually seized control of Rome in the '60s and '50s BC. Also used in the Star Trek DS9 episode of the same name to justify Admiral William Ross' decision to assist Agent Sloan from Section 31 in destabilizing the Romulan Senate.
inter caetera
Title of a papal bull .
inter spem et metum
inter vivos
"between the living"
Said of property transfers between living persons, as opposed to inheritance; often relevant to tax laws.
intra muros
Thus, "not public". Source of the word intramural. See also Intramuros .
intra vires
That is, "within the authority".
ipsa scientia potestas est
Or "by that very fact".
Ira Deorum
"Wrath of the Gods"
Like the vast majority of inhabitants of the ancient world, the ancient Romans practiced pagan rituals, believing it important to achieve a state of Pax Deorum ("Peace of the Gods") instead of Ira Deorum ("Wrath of the Gods"): earthquakes, floods, famine, etc.
ita vero
"thus indeed"
A useful phrase, as the Romans had no word for "yes", preferring to respond to questions with the affirmative or negative of the question (i.e., "Are you hungry?" was answered by "I am hungry" or "I am not hungry", not "Yes" or "No").
"go, the things have been sent"
The final words of the Roman Missal , meaning "leave, the mass is finished".
iura novit curia
"the court knows the laws"
A legal principle in civil law countries of the Roman-German tradition (e.g., in Brazil , Germany and Italy ) that says that lawyers need not to argue the law, as that is the office of the court. Sometimes miswritten as iura novat curia ("the court renews the laws").
juris ignorantia est cum jus nostrum ignoramus
"it is ignorance of the law when we do not know our own rights"
Johannes est nomen ejus
"John is its name / Juan es su Nombre"
Motto of the Seal of the Commonwealth of Puerto Rico
jus ad bellum
"law towards war"
Refers to the "laws" that regulate the reasons for going to war. Typically, this would address issues of self-defense or preemptive strikes
jus in bello
"law in war"
Refers to the "laws" that regulate the conduct of combatants during a conflict. Typically, this would address issues of who or what is a valid target, how to treat prisoners, and what sorts of weapons can be used. The word jus is also commonly spelled ius.
jus primae noctis
lucus a non lucendo
"[it is] a grove by not being light"
From late 4th-century grammarian Honoratus Maurus, who sought to mock implausible word origins such as those proposed by Priscian . A pun based on the word lucus ("dark grove") having a similar appearance to the verb lucere ("to shine"), arguing that the former word is derived from the latter word because of a lack of light in wooded groves. Often used as an example of absurd etymology .
lupus in fabula
"the wolf in the story"
With the meaning "speak of the wolf, and he will come". Occurs in Terence 's play Adelphoe.
lupus non mordet lupum
"a wolf does not bite a wolf"
lux et lex
"light and law"
Motto of the prestigious liberal arts school, Franklin & Marshall College . Light in reference to Benjamin Franklin 's many innovations and discoveries. Law in reference to John Marshall as one of the most notable Supreme Court Justices.
lux et veritas
"light and truth"
A translation of the Hebrew Urim and Thummim . Motto of Yale University and Indiana University . An expanded form, lux et veritas floreant ("let light and truth flourish"), is the motto of the University of Winnipeg
lux hominum vita
"life the light of men"
lux sit
" let there be light "
A more literal Latinization of the phrase "let there be light", the most common translation of fiat lux ("let light arise", literally "let light be made"), which in turn is the Latin Vulgate Bible phrase chosen for the Genesis line "ג וַיֹּאמֶר אֱלֹהִים, יְהִי אוֹר; וַיְהִי-אוֹר" ("And God said: 'Let there be light.' And there was light"). Motto of the University of Washington .
Used to indicate that it is the moment to address more important, urgent, issues.
mala fide
"in bad faith"
Said of an act done with knowledge of its illegality, or with intention to defraud or mislead someone. Opposite of bona fide.
mala tempora currunt
"bad times are upon us"
Also used ironically, e.g.: New teachers know all tricks used by pupils to copy from classmates? Oh, mala tempora currunt!.
malum discordiae
"apple of dischord"
Alludes to the apple of Eris in the judgement of Paris , the mythological cause of the Trojan War . It is also a pun based on the near- homonymous word malum ("evil"). The word for "apple" has a long a vowel in Latin and the word for "evil" a short a vowel, but they are normally written the same.
malum quo communius eo peius
"the more common an evil is, the worse it is"
(m.p.)
"with one's own hand"
With the implication of "signed by one's hand". Its abbreviated form is sometimes used at the end of typewritten or printed documents or official notices, directly following the name of the person(s) who "signed" the document exactly in those cases where there isn't an actual handwritten signature .
manus celer Dei
"the swift hand of God"
Originally used as the name of a ship in the Marathon game series, its usage has spread.
manus manum lavat
"one hand washes the other"
famous quote from Lucius Annaeus Seneca . It implies that one situation helps the other.
mare clausum
In law, a sea under the jurisdiction of one nation and closed to all others.
mare liberum
In law, a sea open to international shipping navigation.
mare nostrum
"our sea"
A nickname given to the Mediterranean Sea during the height of the Roman Empire , as it encompassed the entire coastal basin.
"the mother of the family"
The female head of a family. See paterfamilias.
materia medica
"medical matter"
The branch of medical science concerned with the study of drugs used in the treatment of disease. Also, the drugs themselves.
me vexat pede
"it annoys me at the foot"
Less literally, "my foot itches". Refers to a trivial situation or person that is being a bother, possibly in the sense of wishing to kick that thing away.
Mea Culpa
"My Fault"
Used in Christian prayers and confession to denote the inherently flawed nature of mankind. Can also be extended to mea maxima culpa ("my greatest fault"). Also used similarly to the modern English slang "my bad".
Media vita in morte sumus
"In the midst of our lives we die"
A well-known sequence, falsely attributed to Notker during the Middle Ages. It was translated by Cranmer and became a part of the burial service in the funeral rites of the Anglican Book of Common Prayer .
meliora
Carrying the connotation of "always better". The motto of the University of Rochester .
Melita, domi adsum
"Honey, I'm home!"
A relatively common recent Latinization from the joke phrasebook Latin for All Occasions . Grammatically correct, but the phrase would be anachronistic in ancient Rome .
memento mori
"remember that [you will] die"
Figuratively "be mindful of dying" or "remember your mortality", and also more literally rendered as "remember to die", though in English this ironically misses the original intent. An object (such as a skull) or phrase intended to remind people of the inevitability of death. A more common theme in Christian than in Classical art. The motto of the Trappist order .
memento vivere
Also, "remember that you have to live." Literally rendered as "remember to live."
memores acti prudentes futuri
"mindful of what has been done, aware of what will be"
Thus, both remembering the past and foreseeing the future. From the North Hertfordshire District Council coat of arms.
mens agitat molem
"the mind moves the mass"
An accommodation between disagreeing parties to allow life to go on. A practical compromise.
montani semper liberi
State motto of West Virginia , adopted in 1872.
Montis Insignia Calpe
"Badge of the Rock of Gibraltar "
more ferarum
used to describe any sexual act in the manner of beasts
morituri te salutant
"those who are about to die salute thee"
Used once in Suetonius' Life of the Divine Claudius, chapter 21, by the condemned prisoners manning galleys about to take part in a mock naval battle on Lake Fucinus in AD 52. Popular misconception ascribes it as a gladiator's salute.
mors vincit omnia
"death conquers all" or "death always wins"
An axiom often found on headstones.
That is, the natural world is not sentimental or compassionate.
natura non facit saltum ita nec lex
"nature does not make a leap, thus neither does the law"
Shortened form of "sicut natura nil facit per saltum ita nec lex" ("just as nature does nothing by a leap, so neither does the law"), referring to both nature and the legal system moving gradually.
navigare necesse est vivere non est necesse
"to sail is necessary; to live is not necessary"
Attributed by Plutarch to Gnaeus Pompeius , who, during a severe storm, commanded sailors to bring food from Africa to Rome.
ne cede malis
"do not give in to misfortune"
Used as a level name in the Marathon series to reflect the doomed theme of the level, and derived from the family motto of one of the developers.
ne sutor ultra crepidam
"Cobbler, no further than the sandal!"
Thus, don't offer your opinion on things that are outside your competence. It is said that the Greek painter Apelles once asked the advice of a cobbler on how to render the sandals of a soldier he was painting. When the cobbler started offering advice on other parts of the painting, Apelles rebuked him with this phrase in Greek, and it subsequently became a popular Latin expression.
nec dextrorsum, nec sinistrorsum
"Neither to the left nor to the right"
Do not get distracted. This Latin phrase is also the motto for Bishop Cotton Boys School and the Bishop Cotton Girls High school, both located in Bangalore, India.
nec plus ultra
"nothing more beyond"
Also ne plus ultra or non plus ultra. A descriptive phrase meaning the best or most extreme example of something. The Pillars of Hercules , for example, were literally the nec plus ultra of the ancient Mediterranean world. Charles V 's heraldic emblem reversed this idea, using a depiction of this phrase inscribed on the Pillars—as plus ultra , without the negation. This represented Spain's expansion into the New World.
The motto of the Dutch 11th air manouvre brigade 11 Air Manoeuvre Brigade
nemine contradicente
(nem. con.)
"with no one speaking against"
Less literally, "without dissent". Used especially in committees, where a matter may be passed nem. con., or unanimously .
"no one gives what he does not have"
Thus, "none can pass better title than they have".
nemo iudex in sua causa
"no man shall be a judge in his own cause"
Legal principle that no individual can preside over a hearing in which he holds a specific interest or bias.
nemo me impune lacessit
"no one provokes me with impunity"
Motto of the Order of the Thistle , and consequently of Scotland , found stamped on the milled edge of certain British pound sterling coins. It is also the motto of the Montressors in the Edgar Allan Poe short story " The Cask of Amontillado "
nemo nisi per amicitiam cognoscitur
"No one learns except by friendship"
Used to imply that one must like a subject in order to study it.
nemo tenetur seipsum accusare
"no one is bound to accuse himself"
A maxim banning mandatory self-incrimination . Near-synonymous with accusare nemo se debet nisi coram Deo. Similar phrases include: nemo tenetur armare adversarium contra se ("no one is bound to arm an opponent against himself"), meaning that a defendant is not obligated to in any way assist the prosecutor to his own detriment; nemo tenetur edere instrumenta contra se ("no one is bound to produce documents against himself", meaning that a defendant is not obligated to provide materials to be used against himself (this is true in Roman law and has survived in modern criminal law , but no longer applies in modern civil law ); and nemo tenere prodere seipsum ("no one is bound to betray himself"), meaning that a defendant is not obligated to testify against himself.
nihil dicit
nil sine numine
"nothing without the divine will"
Or "nothing without providence ". State motto of Colorado , adopted in 1861. Probably derived from Virgil 's Aeneid Book II, line 777, "non haec sine numine devum eveniunt" ("these things do not come to pass without the will of the gods"). See also numina .
nil volentibus arduum
"Nothing [is] arduous for the willing"
"Nothing is impossible for the willing"
nisi Dominus frustra
"if not the Lord, [it is] in vain"
That is, "everything is in vain without God ". Summarized from Psalm 127, "nisi Dominus aedificaverit domum in vanum laboraverunt qui aedificant eam nisi Dominus custodierit civitatem frustra vigilavit qui custodit" ("unless the Lord builds the house, they work on a useless thing who build it; unless the Lord guards the community, he keeps watch in vain who guards it"). The motto of Edinburgh .
nisi prius
"unless previously"
In England, a direction that a case be brought up to Westminster for trial before a single judge and jury. In the United States, a court where civil actions are tried by a single judge sitting with a jury, as distinguished from an appellate court .
nolens volens
"unwilling, willing"
That is, "whether unwillingly or willingly". Sometimes rendered volens nolens or aut nolens aut volens. Similar to willy-nilly, though that word is derived from Old English will-he nil-he ("[whether] he will or [whether] he will not").
noli me tangere
"do not touch me"
Commonly translated "touch me not". According to the Gospel of John , this was said by Jesus to Mary Magdalene after his resurrection .
noli turbare circulos meos
"Do not disturb my circles!"
That is, "Don't upset my calculations!" Said by Archimedes to a Roman soldier who, despite having been given orders not to, killed Archimedes at the conquest of Syracuse . The soldier was executed for his act.
nolle prosequi
"to be unwilling to prosecute"
nolo contendere
"I do not wish to contend"
That is, " no contest ". A plea that can be entered on behalf of a defendant in a court that states that the accused doesn't admit guilt, but will accept punishment for a crime. Nolo contendere pleas cannot be used as evidence in another trial.
A scientific name of unknown or doubtful application.
nomen est omen
"the name is a sign"
Thus, "true to its name".
nomen nescio
"I do not know the name"
Thus, the name or person in question is unknown.
nomen nudum
"naked name"
A purported scientific name that does not fulfill the proper formal criteria and therefore cannot be used unless it is subsequently proposed correctly.
non bis in idem
A legal principle forbidding double jeopardy .
non causa pro causa
"not the cause for the cause"
Also known as the " questionable cause " or "false cause". Refers to any logical fallacy where a cause is incorrectly identified.
non compos mentis
"not in control of the mind"
See compos mentis. Also rendered non compos sui ("not in control of himself"). Samuel Johnson , author of the first English dictionary, theorized that the word nincompoop may derive from this phrase.
Motto of São Paulo city, Brazil . See also pro Brasilia fiant eximia.
non facias malum ut inde fiat bonum
"you should not make evil in order that good may be made from it"
More simply, "don't do wrong to do right". The direct opposite of the phrase " the ends justify the means ".
non impediti ratione congitatonis
Motto of radio show Car Talk .
non in legendo sed in intelligendo legis consistunt
"the laws depend not on being read, but on being understood"
non liquet
"it is not proven"
Also "it is not clear" or "it is not evident". A sometimes controversial decision handed down by a judge when they feel that the law is not complete.
non mihi solum
non obstante veredicto
"not standing in the way of a verdict "
A judgment notwithstanding verdict , a legal motion asking the court to reverse the jury 's verdict on the grounds that the jury could not have reached such a verdict reasonably.
non olet
non omnis moriar
"I shall not all die"
"Not all of me will die", a phrase expressing the belief that a part of the speaker will survive beyond death.
non progredi est regredi
"to not go forward is to go backward"
non prosequitur
"he does not proceed"
A judgment in favor of a defendant when the plaintiff failed to take the necessary steps in an action within the time allowed.
Non scholae sed vitae discimus
"We learn not for school, but for life."
from Seneca
non sequitur
"it does not follow"
In general, a non sequitur is a comment which is absurd due to not making sense in its context (rather than due to being inherently nonsensical or internally inconsistent), often used in humor. As a logical fallacy , a non sequitur is a conclusion that does not follow from a premise.
non serviam
"I will not serve"
Possibly derived from a Vulgate mistranslation of the Book of Jeremiah . Commonly used in literature as Satan 's statement of disobedience to God , though in the original context the quote is attributed to Israel , not Satan.
non sum qualis eram
"I am not such as I was"
Or "I am not the kind of person I once was". Expresses a change in the speaker.
non vi, sed verbo
Martin Luther on Catholic church reform. (see Reformation )
nosce te ipsum
From Cicero , based on the Greek γνῶθι σεαυτόν (gnothi seauton), inscribed on the Temple of Apollo at Delphi . A non-traditional Latin rendering, temet nosce ("thine own self know"), is translated in The Matrix as "know thyself".
nota bene
Also "contracts must be honored". Indicates the binding power of treaties.
panem et circenses
"bread and circuses"
From Juvenal, Satire X , line 81. Originally described all that was needed for emperors to placate the Roman mob. Today used to describe any entertainment used to distract public attention from more important matters.
parens patriae
"parent of the nation"
A public policy requiring courts to protect the best interests of any child involved in a lawsuit. See also Pater Patriae.
pari passu
Thus, "moving together", "simultaneously", etc.
parva sub ingenti
"the small under the huge"
Implies that the weak are under the protection of the strong, rather than that they are inferior. Motto of Prince Edward Island .
passim
"here and there"
Less literally, "throughout" or "frequently". Said of a word that occurs several times in a cited texts. Also used in proof reading , where it refers to a change that is to be repeated everywhere needed.
pater familias
"father of the family"
Or "master of the house". The eldest male in a family, who held patria potestas ("paternal power"). In Roman law , a father had enormous power over his children, wife, and slaves, though these rights dwindled over time. Derived from the phrase pater familias, an Old Latin expression preserving the archaic -as ending.
A euphemism for the British Empire . Adapted from Pax Romana.
pax Dei
Used in the Peace and Truce of God movement in 10th-Century France.
Pax Deorum
"Peace of the Gods"
Like the vast majority of inhabitants of the ancient world, the Romans practiced pagan rituals, believing it important to achieve a state of Pax Deorum (The Peace of the Gods) instead of Ira Deorum (The Wrath of the Gods).
pax et bonum
"peace and the good"
Motto of St. Francis of Assisi and, consequently, of his monastery in Assisi , in the Umbria region of Italy . Translated in Italian as pace e bene.
pax et lux
Pax Sinica
"Chinese Peace"
A euphemism for periods of peace in East Asia during times of strong Chinese imperialism . Adapted from Pax Romana.
pax vobiscum
"peace [be] with you"
A common farewell. The " you " is plural ("you all"), so the phrase must be used when speaking to more than one person; pax tecum is the form used when speaking to only one person.
pecunia non olet
"the money doesn't smell"
According to Suetonius , when Emperor Vespasian was challenged by his son Titus for taxing the public lavatories , the emperor held up a coin before his son and asked whether it smelled or simply said non olet ("it doesn't smell"). From this, the phrase was expanded to pecunia non olet, or rarely aes non olet ("copper doesn't smell").
"if you can use money, money is your slave; if you can't, money is your master"
Written on a old Latin tablet in downtown Verona (Italy).
pendent opera interrupta
From the Aeneid of Virgil , Book IV.
per
"By, through, by means of"
See specific phrases below.
per ardua ad astra
"through adversity to the stars"
Motto of the British Royal Air Force , the Royal Australian Air Force , the Royal Canadian Air Force , and the Royal New Zealand Air Force . The phrase was derived from H. Rider Haggard 's famous novel The People of the Mist, and was selected and approved as a motto for the Royal Flying Corps on March 15 , 1913 . In 1929, the Royal Australian Air Force decided to adopt it as well.
per aspera ad astra
"through hardships to the stars"
From Seneca the Younger . Motto of NASA and the South African Air Force . A common variant, ad astra per aspera ("to the stars through hardships"), is the state motto of Kansas . Ad Astra ("To the Stars") is the title of a magazine published by the National Space Society . De Profundus Ad Astra ("From the depths to the stars.") is the motto of the LASFS .
per capsulam
(per pro)
"through the agency"
Also rendered per procurationem. Used to indicate that a person is signing a document on behalf of another person. Correctly placed before the name of the person signing, but often placed before the name of the person on whose behalf the document is signed, sometimes through incorrect translation of the alternative abbreviation
per pro.
as "for and on behalf of".
per quod
"by reason of which"
In a UK legal context: "by reason of which" (as opposed to per se which requires no reasoning). In American jurisprudence often refers to a spouse's claim for loss of consortium.
per rectum
pia mater
"pious mother"
Or "tender mother". Translated into Latin from Arabic. The delicate innermost of the three membranes that cover the brain and spinal cord.
pinxit
"one painted"
Thus, "he painted this" or "she painted this". Formerly used on works of art, next to the artist's name.
pluralis majestatis
"plural of majesty"
The first-person plural pronoun when used by an important personage to refer to himself or herself; also known as the "royal we".
pollice verso
"with a turned thumb"
Used by Roman crowds to pass judgment on a defeated gladiator. It is uncertain whether the thumb was turned up , down , or concealed inside one's hand. Also the name of a famous painting depicting gladiators by Jean-Léon Gérôme .
pons asinorum
"bridge of asses"
Any obstacle that stupid people find hard to cross. Originally used of Euclid 's Fifth Proposition in geometry .
Pontifex Maximus
"Greatest High Priest"
Or "Supreme Pontiff". Originally an epithet of the Roman Emperors , and later a traditional epithet of the pope . The pontifices were the most important priestly college of the ancient Roman religion ; their name is usually thought to derive from pons facere ("to make a bridge"), which in turn is usually linked to their religious authority over the bridges of Rome, especially the Pons Sublicius .
posse comitatus
"to be able to attend"
Thus, to be able to be made into part of a retinue or force. In common law, posse comitatus is a sheriff's right to compel people to assist law enforcement in unusual situations.
post aut propter
"after it or by means of it"
Causality between two phenomena is not established (cf. post hoc, ergo propter hoc).
post cibum
Usually rendered postmortem. Not to be confused with post meridiem.
post prandial
"after the time before midday"
Refers to the time after any meal. Usually rendered postprandial.
post scriptum
(p.s.)
"after what has been written"
A postscript . Used to mark additions to a letter, after the signature. Can be extended to post post scriptum
(p.p.s.)
post tenebras lux
"after darkness, light"
A motto of the Protestant Reformation inscribed on the Reformation Wall in Geneva, Switzerland . A former motto of Chile , replaced by the current one, Por la Razón o la Fuerza (Spanish: "By Right or Might"). Another obsolete motto is aut concilio aut ense.
prima facie
"at first sight"
Used to designate evidence in a trial which is suggestive, but not conclusive, of something (e.g., a person's guilt).
prima luce
" prime mover "
Or "first moving one". A common theological term, such as in the cosmological argument , based on the assumption that God was the first entity to "move" or "cause" anything. Aristotle was one of the first philosophers to discuss the "uncaused cause", a hypothetical originator—and violator of— causality .
primum non nocere
"first, to not harm"
A medical precept. Often falsely attributed to the Hippocratic Oath , though its true source is probably a paraphrase from Hippocrates ' Epidemics, where he wrote, "Declare the past, diagnose the present, foretell the future; practice these acts. As to diseases, make a habit of two things: to help, or at least to do no harm."
A title of the Roman Emperors (cf. princeps ).
principia probant non probantur
"principles prove; they are not proved"
Fundamental principles require no proof; they are assumed a priori.
prior tempore potior iure
"earlier in time, stronger in law"
A legal principle that older laws take precedent over newer ones. Another name for this principle is lex posterior.
pro bono
"for the good"
The full phrase is pro bono publico ("for the public good"). Said of work undertaken voluntarily at no expense, such as public services . Often used of a lawyer 's work that is not charged for.
pro Brasilia fiant eximia
quem di diligunt adulescens moritur
"he whom the gods love dies young"
Other translations of diligunt include "prize especially" or "esteem". From Plautus , Bacchides, IV, 7, 18. In this comic play, a sarcastic servant says this to his aging master. The rest of the sentence reads: dum valet sentit sapit ("while he is healthy, perceptive and wise").
questio quid iuris
From the Summoner's section of Chaucer 's General Prologue to the Canterbury Tales , line 648.
qui bono
Common nonsensical Dog Latin misrendering of the Latin phrase cui bono ("who benefits?").
qui pro quo
literally qui instead of quo ( medieval Latin )
Unused in English, but common in other modern languages (for instance Italian and Polish). Used as a noun , indicates a misunderstanding.
Trivia: The expression "quid pro quo" is not used in Italian. An exchange of favours is indicated by "do ut des", another Latin expression meaning "I give in order that you give".
qui tacet consentire videtur
"he who is silent is taken to agree"
Thus, silence gives consent. Sometimes accompanied by the proviso "ubi loqui debuit ac potuit", that is, "when he ought to have spoken and was able to".
qui transtulit sustinet
"he who transplanted still sustains"
Or "he who brought us across still supports us", meaning God . State motto of Connecticut . Originally written as sustinet qui transtulit in 1639.
quia suam uxorem etiam suspiciore vacare vellet
"because he should wish even his wife to be free from suspicion"
Attributed to Julius Caesar by Plutarch , Caesar 10. Translated loosely as "because even the wife of Caesar may not be suspected". At the feast of Bona Dea , a sacred festival for females only, which was being held at the Domus Publica, the home of the Pontifex Maximus , Caesar, and hosted by his second wife, Pompeia , the notorious rhetorian Clodius arrived in disguise. Caught by the outraged noblewomen, Clodius fled before they could kill him on the spot for sacrilege. In the ensuing trial, allegations arose that Pompeia and Clodius were having an affair, and while Caesar asserted that this was not the case and no substantial evidence arose suggesting otherwise, he nevertheless divorced, with this quotation as explanation.
quid est veritas
In the Vulgate translation of John 18:38, Pilate 's question to Jesus .
quid novi ex Africa
"What of the new out of Africa?"
Less literally, "What's new from Africa?" Derived from an Aristotle quotation.
quid pro quo
"what for what"
Also translated "this for that" or "a thing for a thing". Signifies a favor exchanged for a favor.'
Trivia: The expression "quid pro quo" is not used in Italian. An exchange of favours is indicated by "do ut des", another Latin expression meaning "I give in order that you give".
quid nunc
"What now?"
Commonly shortened to quidnunc. As a noun, a quidnunc is a busybody or a gossip. Patrick Campbell worked for The Irish Times under the pseudonym "Quidnunc".
quidquid Latine dictum sit altum viditur
"whatever has been said in Latin seems deep"
Or "anything said in Latin sounds profound". A recent ironic Latin phrase to poke fun at people who seem to use Latin phrases and quotations only to make themselves sound more important or "educated". Similar to the less common omnia dicta fortiora si dicta latina.
quis custodiet ipsos custodes?
"Who will guard the guards themselves?"
From Juvenal 's On Women , originally referring to the practice of having eunuchs guard women and beginning with the word sed ("but"). Usually translated less literally, as "Who watches the watchmen?" This translation is a common epigraph , such as of the Tower Commission and Alan Moore 's Watchmen comic book series.
quis ut Deus
"Who [is] as God?"
Usually translated "Who is like unto God?" Questions who would have the audacity to compare himself to a Supreme Being.
quo errat demonstrator
A pun on quod erat demonstrandum.
quo fata ferunt
quo usque tandem
"For how much longer?"
From Cicero 's Ad Catilinam speech to the Roman Senate regarding the conspiracy of Catiline : quo usque tandem abutere Catilina patientia nostra ("For how much longer, Catiline, will you abuse our patience?").
quo vadis
"Where are you going?"
According to John 13:36, Saint Peter asked Jesus Domine, quo vadis ("Lord, where are you going?") on the Appian Way in Rome . The King James Version has the translation "Lord, whither goest thou?"
quod erat demonstrandum
( Q.E.D. )
"which was to be demonstrated"
The abbreviation is often written at the bottom of a mathematical proof . Sometimes translated loosely into English as "The Five Ws",
W.W.W.W.W.
, which stands for "Which Was What We Wanted".
quod erat faciendum
(Q.E.F)
"which was to be done"
Or "which was to be constructed". Used by Euclid in his Elements when there was nothing to prove, but there was something be constructed, for example a triangle with the same size as a given line.
quod est
quod gratis asseritur, gratis negatur
"what is asserted without reason may be denied without reason"
If no grounds have been given for an assertion, there is no need to provide grounds for contradicting it.
quod licet Iovi non licet bovi
"what is permitted to Jupiter is not permitted to an ox"
If an important person does something, it does not necessarily mean that everyone can do it (cf. double standard ). Iovi (also commonly rendered Jovi) is the dative form of Iuppiter ("Jupiter" or "Jove"), the chief god of the Romans.
quod me nutrit me destruit
"what nourishes me destroys me"
Thought to have originated with Elizabethan playwright Christopher Marlowe . Generally interpreted to mean that that which motivates or drives a person can consume him or her from within. This phrase has become a popular slogan or motto for pro-ana websites, anorexics and bulimics . In this case the phrase is literally describing food.
quod natura non dat Salmantica non praestat
"what nature does not give, Salamanca does not provide"
Refers to the Spanish University of Salamanca , meaning that education cannot substitute the lack of brains.
quod vide (q.v.)
"which see"
Used after a term or phrase that should be looked up elsewhere in the current document or book. For more than one term or phrase, the plural is quae vide
(qq.v.)
ratione soli
"by account of the ground"
Or "according to the soil". Assigning property rights to a thing based on its presence on a landowner's property.
re
"in the matter of"
More literally, "by the thing". From the ablative of res ("thing" or "circumstance"). Often used in e-mail replies. It is a common misconception that the "Re:" in e-mail replies stands for reply, response, or regarding, or is simply the prefix meaning "again". The use of Latin re, in the sense of "about, concerning", is English usage. Whether to leave it in Latin or to translate it may depend on the usage of the target language, but the Internet norm is to leave it in Latin.
rebus sic stantibus
"with matters standing thus"
The doctrine that treaty obligations hold only as long as the fundamental conditions and expectations that existed at the time of their creation hold.
reductio ad absurdum
"leading back to the absurd"
A common debate technique, and a method of proof in mathematics and philosophy, that proves the thesis by showing that its opposite is absurd or logically untenable. In general usage outside mathematics and philosophy, a reductio ad absurdum is a tactic in which the logic of an argument is challenged by reducing the concept to its most absurd extreme. Translated from Aristotle 's "ἡ εις άτοπον απαγωγη" (hi eis atopon apagogi, "reduction to the impossible").
reductio ad infinitum
"leading back to the infinite"
An argument that creates an infinite series of causes that does not seem to have a beginning. As a fallacy, it rests upon Aristotle's notion that all things must have a cause, but that all series of causes must have a sufficient cause, that is, an unmoved mover. An argument which does not seem to have such a beginning becomes difficult to imagine.
regnat populus
"the people rule"
State motto of Arkansas , adopted in 1907. Originally rendered in 1864 in the plural, regnant populi ("the peoples rule"), but subsequently changed to the singular.
Regnum Mariae Patrona Hungariae
res gestae
"things done"
(1) A phrase used in law representing the belief that certain statements are made naturally, spontaneously and without deliberation during the course of an event, they leave little room for misunderstanding/misinterpretation upon hearing by someone else ( i.e. by the witness who will later repeat the statement to the court) and thus the courts believe that such statements carry a high degree of credibility. (2) In history, a Latin biography
res ipsa loquitur
"the thing speaks for itself"
A phrase from the common law of torts meaning that negligence can be inferred from the fact that such an accident happened, without proof of exactly how. A mock Latin clause sometimes added on to the end of this phrase is sed quid in infernos dicit ("but what the hell does it say?"), which serves as a reminder that one must still interpret the significance of events that "speak for themselves".
res judicata
"judged thing"
A matter which has been decided by a court. Often refers to the legal concept that once a matter has been finally decided by the courts, it cannot be litigated again (cf. non bis in idem and double jeopardy ).
respice finem
"look back at the end"
i.e., "have regard for the end" or "consider the end". Generally a memento mori , a warning to remember one's death.
respiciendum est iudicanti ne quid aut durius aut remissius constituatur quam causa deposcit nec enim aut severitatis aut clementiae gloria affectanda est
"the judge must see that no order be made or judgment given or sentence passed either more harshly or more mildly than the case requires; he must not seek renown, either as a severe or as a tender-hearted judge"
A maxim on the conduct of judges.
respondeat superior
"let the superior respond"
Regarded as a legal maxim in agency law, referring to the legal liability of the principal with respect to an employee. Whereas a hired independent contract acting tortiously may not cause the principal to be legally liable, a hired employee acting tortiously will cause the principal (the employer) to be legally liable, even if the employer did nothing wrong.
res nullius
"nobody's thing"
Goods without an owner. Used for things or beings which belong to nobody and are up for grabs, e.g., uninhabited and uncolonized lands, wandering wild animals, etc. (cf. terra nullius, "no man's land").
rex regum fidelum et
"king even of faithful kings"
rigor mortis
"stiffness of death"
The rigidity of corpses when chemical reactions cause the limbs to stiffen about 3–4 hours after death. Other signs of death include drop in body temperature ( algor mortis , "cold of death") and discoloration ( livor mortis , "bluish color of death").
Romanes eunt domus
"Romanes go the house"
An intentionally garbled Latin phrase from Monty Python's Life of Brian . Its translation is roughly, as said by a centurion in the movie, "'People called Romanes they go the house'", but its intended meaning is "Romans, go home!" When Brian is caught vandalizing the palace walls with this phrase, rather than punish him, the centurion corrects his Latin grammar , explaining that Romanus is a second declension noun and has its plural in -i rather than -es, that ire ("to go") must be in the imperative mood to denote a command, and that domus takes the accusative case without a preposition as the object. The final result of this lesson is the correct Latin phrase Romani ite domum .
rosa rubicundior lilio candidior omnibus formosior semper in te glorior
"redder than the rose, whiter than the lilies, fairer than all things, I do ever glory in thee"
rus in urbe
"Farm in the city"
Generally used to refer to a haven of peace and quiet within an urban setting, often a garden, but can refer to interior decoration.
salus populi suprema lex esto
"the welfare of the people is to be the highest law"
From Cicero 's De Legibus, book III, part III, sub. VIII. Quoted by John Locke in his Second Treatise, On Civil Government, to describe the proper organization of government. Also the state motto of Missouri and of Harrow.
salva veritate
Salvator Mundi
"Savior of the World"
Christian epithet, usually referring to Jesus . The title of paintings by Albrecht Dürer and Leonardo da Vinci .
salvo errore et omissione
"save for error and omission"
Appears on statements of "account currents".
salvo honoris titulo
"save for title of honor"
Sancta Sedes
More literally, "Sacred Seat". Refers to the Papacy or the Holy See .
Sancta Simplicitas
sapere aude
"dare to be wise"
From Horace 's Epistularum liber primus , Epistle II, line 40. Popularized by its use in Kant 's What is Enlightenment? to define the Enlightenment . Frequently used in mottos, such as for the University of Otago , University of New Brunswick , Phystech , Manchester Grammar School , town of Oldham , and the University of New Zealand before its dissolution.
Sapientia et Doctrina
Motto of Fordham University , New York.
sapienti sat
"enough for the wise"
From Plautus . Indicates that something can be understood without any need for explanation, as long as the listener has enough wisdom or common sense. Often extended to dictum sapienti sat est ("enough has been said for the wise", commonly translated as "a word to the wise is enough").
semper fidelis
"always faithful"
Motto of Exeter and several other cities; more recently has become the motto of United States Marine Corps and the Swiss Grenadiers . Also the motto of the Rot-Weiss Oberhausen and Plymouth Argyle football clubs. The US Marines often abbreviate it to Semper Fi.
semper paratus
Motto of the United States Coast Guard and the United States Cavalry 's 12th Regiment.
semper reformanda
"always reforming"
A shortened form of a motto of the Protestant Reformation , Ecclesia reformata semper reformanda est secundu Verbum Dei ("the reformed Church must be always reforming according to the Word of God"), which refers to the Protestant position that the church must continually re-examine itself, reconsider its doctrines , and be prepared to accept change, in order to conform more closely to orthodox Christian belief as revealed in the Bible . The shortened form, semper reformanda, literally means "always about to be reformed", but the usual translation is taken from the full sentence where it is used in a passive periphrastic construction to mean "always reforming."
semper ubi sub ubi
"always where under where"
A common English- New Latin translation joke . The phrase is nonsensical in Latin, but the English translation is a pun on "always wear underwear".
Senatus Populusque Romanus
"The Senate and the People of Rome"
The official name of the Roman Republic . "
SPQR
" was carried on battle standards by the Roman legions . In addition to being an ancient Roman motto, it remains the motto of the modern city of Rome .
sensu stricto
Less literally, "in the strict sense".
Servo Permaneo Bovis Provestri
"Save the Last Bullet for Yourself"
Meaning "After giving it everything you've got against the enemy,save the last effort to save yourself".
sesquipedalia verba
"words a foot and a half long"
From Horace 's Ars Poetica , "proicit ampullas et sesquipedalia verba" ("he throws down his high-flown language and his foot-and-a-half-long words"). A self-referential jab at long words and needlessly elaborate language in general.
si peccasse negamus fallimur et nulla est in nobis veritas
"if we refuse to make a mistake, we are deceived, and there's no truth in us"
From Christopher Marlowe 's The Tragical History of Doctor Faustus , where the phrase is translated "if we say that we have no sin, we deceive ourselves, and there's no truth in us".
si quaeris peninsulam amoenam circumspice
"if you seek a delightful peninsula, look around"
State motto of Michigan , adopted in 1835. Said to have been based on the tribute to architect Christopher Wren in St Paul's Cathedral , London , which reads si monumentum requiris circumspice ("if you seek a memorial, look around").
Si tacuisses, philosophus mansisses
"If you had kept your silence, you would have stayed a philosopher"
This quote is often attributed to the Latin philosopher Boethius of the late fifth and early sixth centuries. It translates literally as, "If you had been silent, you would have remained a philosopher." The phrase illustrates a common use of the subjunctive verb mood. Among other functions it expresses actions contrary to fact. Sir Humphrey Appleby translated it to the PM as: "If you'd kept your mouth shut we might have thought you were clever".
si vales valeo
(SVV)
"if you are well, I am well"
A common beginning for ancient Roman letters. Also extended to si vales bene est ego valeo ("if you are well, that is good; I am well"), abbreviated to
SVBEEV
. The practice fell out of fashion and into obscurity with the decline in Latin literacy.
si vis pacem para bellum
"if you want peace, prepare for war"
From Vegetius , Epitoma rei militaris. Origin of the name parabellum for some ammunition and firearms, such as the luger parabellum.
sic
"thus"
Or "just so". States that the preceding quoted material appears exactly that way in the source, despite any errors of spelling, grammar, usage, or fact that may be present. Used only for previous quoted text; ita or similar must be used to mean "thus" when referring to something about to be stated.
sic et non
More simply, "yes and no".
sic gorgiamus allos subjectatos nunc
"we gladly feast on those who would subdue us"
sic semper tyrannis
"thus always to tyrants"
State motto of Virginia , adopted in 1776. Attributed to Brutus at the time of Julius Caesar 's assassination, and to John Wilkes Booth at the time of Abraham Lincoln 's assassination; whether it was actually said at either of these events is disputed.
sic transit gloria mundi
"thus passes the glory of the world"
From the Bible . A reminder that all things are fleeting. During Papal Coronations , a monk reminds the pope of his mortality by saying this phrase, preceded by pater sancte ("holy father") while holding before his eyes a burning paper illustrating the passing nature of earthly glories. This is similar to the tradition of a slave in Roman triumphs whispering "memento mori".
sic utere tuo ut alienum non laedas
"use [what is] yours so as not to harm [what is] of others"
Or "use your property in such a way that you do not damage others'". A legal maxim related to property ownership laws, often shortened to simply sic utere ("use it thus").
sic vita est
"thus is life"
Or "such is life". Indicates that a circumstance, whether good or bad, is an inherent aspect of living.
signetur
sine qua non
"without which not"
Used to denote something that is an essential part of the whole. See also condicio sine qua non.
sine scientia ars nihil est
"without knowledge, skill is nothing"
Motto of The International Diving Society.
sit venia verbo
"may there be forgiveness for the word"
Similar to the English idiom "pardon my French".
sola fide
"by faith alone"
The material principle of the Protestant Reformation and one of the five solas , referring to the Protestant claim that the Bible teaches that men are saved by faith even without works.
sola gratia
"by grace alone"
A motto of the Protestant Reformation and one of the five solas , referring to the Protestant claim that salvation is an unearned gift (cf. ex gratia), not a direct result of merit .
Sola lingua bona est lingua mortua
"the only good language is a dead language"
sola scriptura
"by scripture alone"
The formal principle of the Protestant Reformation and one of the five solas , referring to the Protestant idea that the Bible alone is the ultimate authority, not the pope or tradition .
soli Deo gloria
(S.D.G.)
"glory to God alone"
A motto of the Protestant Reformation and one of the five solas , referring to the idea that God is the creator of all good things and deserves all the praise for them. Johann Sebastian Bach often signed his manuscripts with the abbreviation
S.D.G.
to invoke this phrase, as well as with
AMDG
"hope is the anchor of [my] life"
Motto of the Doran family.
spiritus mundi
"spirit of the world"
From The Second Coming (poem) by William Butler Yeats . Refers to Yeats' belief that each human mind is linked to a single vast intelligence, and that this intelligence causes certain universal symbols to appear in individual minds. The idea is similar to Carl Jung 's concept of the collective unconscious .
spiritus ubi vult spirat
"the spirit spreads wherever it wants"
From El espiritu donde quiera se infunde by Fernando Porturas ( http://www.cayetano-pae.org/Spiritus.htm ). Refers to The Gospel of Saint John, where he mentions how Jesus told Nicodemus "The wind blows wherever it wants, and even though you can hear its noise, you don't know where it comes from or where it goes. The same thing happens to whomever has been born of the Spirit". It is the motto of Cayetano Heredia University .
splendor sine occasu
Loosely "splendour without diminishment" or "magnificence without ruin". Motto of British Columbia .
stamus contra malo
"we stand against by evil"
The motto of the Jungle Patrol in The Phantom . The phrase actually violates Latin grammar because of a mistranslation from English, as the preposition contra takes the accusative case . The correct Latin rendering of "we stand against evil" would be "stamus contra malum".
stante pede
Less literally, "in the strict sense".
stupor mundi
"the wonder of the world"
The title by which Frederick II, Holy Roman Emperor , was known. More literally translated "the bewilderment of the world", or, in its original, pre- Medieval sense, "the stupidity of the world".
sua sponte
Motto of the U.S. Army Rangers . Also a legal term .
Sub Cruce Lumen
"The Light Under the Cross"
Motto of the University of Adelaide , Australia. Refers to the figurative "light of learning" and the Southern Cross constellation, Crux .
sub judice
"under a judge"
sub poena
"under penalty"
Commonly rendered subpoena. Said of a request, usually by a court, that must be complied with on pain of punishment. Examples include subpoena duces tecum ("take with you under penalty"), a court summons to appear and produce tangible evidence, and subpoena ad testificandum ("under penalty to testify"), a summons to appear and give oral testimony.
sub rosa
"under the rose"
"In secret", "privately", "confidentially" or "covertly". In the Middle Ages , a rose was suspended from the ceiling of a council chamber to indicate that what was said in the "under the rose" was not to be repeated outside. This practice originates in Greek mythology, where Aphrodite gave a rose to her son Eros , and he, in turn, gave it to Harpocrates , the god of silence, to ensure that his mother's indiscretions—or those of the gods in general, in other accounts—were kept under wraps.
sub specie aeternitatis
"under the sight of eternity"
Thus, "from eternity's point of view". From Spinoza , Ethics.
sub verbo; sub voce
Literally "highest good". Also summum malum ("the supreme evil").
sunt lacrimae rerum
"there are tears for things"
From Virgil , Aeneid . Followed by et mentem mortalia tangunt ("and mortal things touch my mind"). Aeneas cries as he sees Carthaginian temple murals depicting the deaths of the Trojan War . See also hinc illae lacrimae.
sunt omnes unum
suo jure
"in one's own right"
Used in the context of titles of nobility , for instance where a wife may hold a title in her own right rather than through her marriage.
suo moto
"upon one's own initiative"
Also rendered suo motu. Usually used when a court of law, upon its own initiative, (i.e., no petition has been filed) proceeds against a person or authority that it deems has committed an illegal act. It is used chiefly in South Asia .
supero omnia
A declaration that one succeeds above all others.
surgam
terra nova
"new land"
Also latin name of Newfoundland (island portion of Canadian province of Newfoundland and Labrador , capital- St. John's ), also root of French name of same, Terre-Neuve
terra nullius
"land of none"
That is, no man's land . A neutral or uninhabited area, or a land not under the sovereignty of any recognized political entity.
terras irradient
"let them illuminate the lands"
Or "let them give light to the world". An allusion to Isaiah 6.3: plena est omnis terra gloria eius ("the whole earth is full of his glory"). Sometimes mistranslated as "they will illuminate the lands" based on mistaking irradiare for a future indicative third- conjugation verb, whereas it is actually a present subjunctive first-conjugation verb. Motto of Amherst College ; the college's original mission was to educate young men to serve God.
tertium non datur
"a third is not given"
A logical axiom that a claim is either true or false, with no third option.
tertium quid
"a third something"
1. Something that cannot be classified into either of two groups considered exhaustive; an intermediate thing or factor. 2. A third person or thing of indeterminate character.
timeo Danaos et dona ferentes
"I fear Greeks, even bearing gifts"
Danaos being a term for the Greeks . In Virgil 's Aeneid , II, 49, the phrase is said by Laocoön when warning his fellow Trojans against accepting the Trojan Horse . The full original quote is quidquid id est timeo Danaos et dona ferentis, quidquid id est meaning "whatever it is" and ferentis being an archaic form of ferentes. Commonly mistranslated "Beware of Greeks bearing gifts".
timidi mater non flet
"A coward's mother does not weep"
A Latin proverb . Occasionally appears on loading screens in the game Rome: Total War .
timor mortis conturbat me
"the fear of death confounds me"
A Latin refrain originating in the response to the seventh lesson in the Office of the Dead . In the Middle Ages , this service was read each day by clerics . As a refrain, it appears also in other poems and can frequently be found inscribed on tombs.
translatio imperii
"transfer of rule"
Used to express the belief in the transfer of imperial authority from the Roman Empire of antiquity to the Medieval Holy Roman Empire .
Treuga Dei
"Truce of God"
A decree by the medieval Church that all feuds should be cancelled during the Sabbath —effectively from Wednesday or Thursday night until Monday. See also Peace and Truce of God .
tu autem
"you indeed"
Also "even you" or "yes, you", in response to a person's belief that he will never die. A memento mori epitaph .
tu autem domine miserere nobis
"But Thou, O Lord, have mercy upon us"
Phrase said at the end of biblical readings in the liturgy of the medieval church.
tu fui ego eris
"I was you; you will be me"
Thus, "what you are, I was; what I am, you will be.". A memento mori gravestone inscription to remind the reader that death is unavoidable (cf. sum quod eris).
tu ne cede malis, sed contra audentior ito
"you should not give in to evils, but proceed ever more boldly against them"
From Virgil , Aeneid , 6, 95.
tu quoque
"you too"
The logical fallacy of attempting to defend one's position merely by pointing out the same weakness in one's opponent. If a politician is criticized for advocating an inadequately-funded plan, and replies that his or her opponent's plan is equally inadequately funded, this is a 'tu quoque' argument: undermining the counterproposal on the same basis does not make the original plan any more satisfactory. Tu quoque may also refer to a "hypocrisy" argument, a form of ad hominem where a claim is dismissed as untrue on the basis that the claimant has contradicted his own advice. While contradiction may make the claimant's argument unsound, it does necessarily not make his claims untrue. It comes from the supposed last words of Julius Caesaer (" Et tu, Brute? ")
tuebor
"where [it is] well, there [is] the fatherland"
Or "where I prosper, there is my country". Patriotic motto.
ubi caritas et amor Deus ibi est
"where there is charity and love, God is there"
ubi mel ibi apes
"where [there is] honey, there [are] bees"
ubi dubium ibi libertas
"where [there is] doubt, there [is] freedom"
Anonymous proverb.
"Where [there is] a right, there [is] a remedy"
ubi non accusator ibi non iudex
"where [there is] no accuser, there [is] no judge"
Thus, there can be no judgement or case if no one charges a defendant with a crime. The phrase is sometimes parodied as "where there are no police, there is no speed limit".
ubi re vera
"when, in a true thing"
Or "whereas, in reality..." Also rendered ubi revera ("when, in fact" or "when, actually").
ubi solitudinem faciunt pacem appellant
"when they make a wasteland, they call it peace"
ubi sunt
"where are they?"
Nostalgic theme of poems yearning for days gone by. From the line ubi sunt qui ante nos fuerunt ("Where are they, those who have gone before us?").
una salus victis nullam sperare salutem
"the only safety for the conquered is to hope for no safety"
Less literally, "the only safe bet for the vanquished is to expect no safety". Preceded by moriamur et in media arma ruamus ("let us die even as we rush into the midst of battle") in Virgil 's Aeneid , book 2, lines 353–354. Used in Tom Clancy 's novel Without Remorse , where character Clark translates it as "the one hope of the doomed is not to hope for safety".
ultimo mense
Urbi et Orbi
"To the City and the Circle [of the lands]"
Meaning "To Rome and the World". A standard opening of Roman proclamations. Also a traditional blessing by the pope .
Urbs in Horto
Motto of the City of Chicago .
Usus magister est optimus
ut biberent quoniam esse nollent
"so that they might drink, since they refused to eat"
Also rendered with quando ("when") in place of quoniam. From a story by Suetonius (Vit. Tib., 2.2) and Cicero (De Natura Deorum, 2.3). The phrase was said by Roman admiral Publius Claudius Pulcher right before the battle of Drepana , as he threw overboard the sacred chickens which had refused to eat the grain offered them—an unwelcome omen of bad luck. Thus, the sense is, "if they do not perform as expected, they must suffer the consequences".
ut incepit fidelis sic permanet
"as she began loyal, so she persists"
Thus, the state remains as loyal as ever. Motto of Ontario .
ut desint vires tamen est laudanda voluntas
"though the power be lacking, the will is to be praised all the same"
From Ovid , Epistulae ex Ponto (III, 4, 79).
ut infra
A vade-mecum or vademecum is an item one carries around, especially a handbook.
vade retro Satana
"Go back, Satan !"
An exhortation for Satan to begone, often used in response to temptation . From a popular Medieval Catholic exorcism formula, based on a rebuke by Jesus to Peter in the Vulgate , Mark 8:33: vade retro me Satana ("step back from me, Satan!"). The older phrase vade retro ("go back!") can be found in Terence 's Formio I, 4, 203.
vae victis
"Woe to the conquered!"
Attributed by Livy to Brennus , the chief of the Gauls , while he demanded more gold from the citizens of the recently-sacked Rome in 390 BC.
vanitas vanitatum omnia vanitas
"vanity of vanities; everything [is] vanity"
More simply, "vanity, vanity, everything vanity". From the Vulgate , Ecclesiastes , 1:2.
vaticinium ex eventu
"prophecy from the event"
A prophecy made to look as though it was written before the events it describes, while in fact being written afterwards.
vel non
"or not"
Summary of alternatives, ie. "this action turns upon whether the claimant was the deceased's grandson vel non."
velocius quam asparagi coquantur
"more rapidly than asparagus will be cooked"
Or simply "faster than cooking asparagus". Ascribed to Augustus by Suetonius (The Lives of the Twelve Caesars, Book 2 (Augustus), para. 87). Can refer to anything done very quickly. A very common variant is celerius quam asparagi cocuntur ("more swiftly than asparagus is cooked").
veni, vidi, vici
"I came, I saw, I conquered"
The text message sent by Julius Caesar to the Roman Senate to describe his battle against King Pharnaces II near Zela in 47 BC. Sometimes used by magicians as a catch phrase similar to abracadabra in completing a performance.
"I came, I saw, I went"
vera causa
"true cause"
verba ita sunt intelligenda ut res magis valeat quam pereat
"words are to be understood such that the subject matter may be more effective than wasted"
A legal maxim.
"words fly away, writings remain"
verbatim et litteratim
"word by word and letter by letter"
Verbi divini minister
"servant of the divine Word"
A priest (cf. Verbum Dei).
Verbum Dei
vi veri universum vivus vici
"by the power of truth, I, a living man, have conquered the universe"
From Christopher Marlowe 's The Tragical History of Doctor Faustus . Note that v was originally the consonantal u , and was written the same before the two forms became distinct, and also after in many cases, when u and v were both capitalized as V: thus, Vniversum. Also, universum is sometimes quoted with the form ueniversum (or Veniversum), which is presumably a combination of universum and oeniversum, two classically-attested spellings). Recently quoted in the film, V for Vendetta, by the main character, V.
via
Thus, "by way of" or "by means of".
I'll contact you via e-mail.
via media
"middle road"
The Anglican Communion has claimed to be a via media between the errors of the Roman Catholic Church and the extremes of Protestantism . Can also refer to the radical middle political stance.
via, veritas, vitae
The motto of the University of Glasgow .
vice versa
"with position turned"
Thus, "the other way around", "conversely", etc. Historically, vice is more properly pronounced as two syllables, but the one-syllable pronunciation is extremely common.
victoria aut mors
See aut vincere aut mori.
victoria concordia crescit
The official club motto of Arsenal FC.
victrix causa diis placuit sed victa Catoni
"the victorious cause pleased the gods, but the conquered cause pleased Cato "
Lucanus , Pharsalia 1, 128. Dedication on the south side of the Confederate Memorial at Arlington National Cemetery .
vide infra
Vive ut vivas
"live so that you may live"
The phrase essentially means that one should live life to the fullest and without fear of a possible future consequence.
vocatus atque non vocatus Deus aderit
"called and not called, God will be present", or "called and even not called, God approaches"
Attributed to the Oracle at Delphi . Used by Carl Jung as a personal motto adorning his home and grave.
volenti non fit injuria
"to one willing, no harm is done" or "to he who consents, no harm is done
used in tort law to delineate the principle that one cannot be held liable for injuries inflicted on an individual who has given his consent to the action that gave rise to the injury.
votum separatum
An independent, minority voice.
vox clamantis in deserto
"the voice of one shouting in the desert" (or, traditionally, "the voice of one crying in the wilderness")
From Isaiah 40, and quoted by John the Baptist in the Gospels . Usually the "voice" is assumed to be shouting in vain, unheeded by the surrounding wilderness. However, in this phrase's use as the motto of Dartmouth College , it is taken to denote an isolated beacon of education and culture in the "wilderness" of New Hampshire .
vox nihili
vox populi
"voice of the people"
Sometimes extended to vox populi vox Dei ("the voice of the people [is] the voice of God"). In its original context, the extended version means the opposite of what it's frequently taken to mean: the source is usually given as the monk Alcuin , who advised Charlemagne that nec audiendi qui solent dicere vox populi vox Dei quum tumultuositas vulgi semper insaniae proxima sit, meaning "And those people should not be listened to who keep saying, 'The voice of the people [is] the voice of God,' since the riotousness of the crowd is always very close to madness." (Works, Letter 164)
| i don't know |
Which French football team plays its home games art Stade Velodrome? | UEFA EURO 2016 - Hosts - Marseille city guide - UEFA.com
Marseille city guide
Population: 860,363
City ambassadors: Basile Boli (former French international), Florent Manaudou (2012 Olympic-winning swimmer)
Marseille – the second best destination on the planet according to The New York Times, and the world’s fifth most beautiful coastal city in the opinion of the prestigious National Geographic – is visited by more than five million people every year. Dubbed ‘2016’s coolest destination’ by the press, France’s oldest city has established a reputation as a dynamic and outward-looking metropolis.
The old port©Thinkstock
A city of passion and football, Marseille was a European Capital of Culture in 2013 and organises thousands of cultural and sporting events throughout the summer.
No visit to Marseille would be complete without seeing the beaches and the spectacular rocky inlets (calanques in French) that punctuate the city’s 57km of coastline.
Come and experience UEFA EURO 2016 in one of Europe’s most beautiful cities.
Back to menu
HISTORY
The city’s history is inextricably linked with that of the Mediterranean Sea, which was crossed by the Greek explorers from the city of Phocaea who founded Marseille in 600 BC. The largest port in the Mediterranean, Marseille is an outward-looking city that combines heritage and modernity. In the midst of an urban regeneration process, the city is now focused on tourism and has established itself as a prime destination for Mediterranean cruise ships.
Five million people visited Marseille in 2013, when it was a European Capital of Culture, and many more are expected to follow this year – and in 2017, when it will be the European Capital of Sport. The city’s 57km of coastline (of which 20km is in the Calanques National Park), its 300 days of sunshine a year, its green spaces and areas of natural beauty, its warm and welcoming people and its accessibility are all major assets in terms of the city’s image. Recently classified as an ‘area of excellence’ on account of the quality of its higher education, scientific research and technological innovation, Marseille is seeking to boost its competitiveness on the international stage and be regarded as a ‘hot spot’ of the knowledge economy. The large numbers of local ‘French tech’ start-ups in the digital, transmedia and audiovisual sectors (notably around the Belle de Mai hub) have put the city in the vanguard of developments in these industries.
Back to menu
FAMOUS RESIDENTS
• Edmond Rostand, dramatist and member of the French Academy (1868–1918) – author of Cyrano de Bergerac
• Marcel Pagnol, writer and filmmaker (1895–1974) – perhaps the most famous of all Provencal authors, both for his books and for his films
• Jean-Claude Izzo, journalist and writer (1945–2000) – Izzo rejuvenated the French noir genre with his crime novels set in Marseille
• IAM, rap group (formed in 1989) – these pioneers of French rap created a Marseille scene that is still vibrant today
• César Baldaccini, sculptor (1921–1998) – a world-renowned artist behind many sculptures in Marseille, perhaps the most famous a giant thumb
Back to menu
THINGS TO SEE
• The Notre-Dame-de-la-Garde church stands high above Marseille and offers panoramic views of the city and its harbour. The church was constructed between 1853 and 1899 on the site of a former military camp, and the golden statue of the Virgin with child that sits atop it is known as 'La Bonne Mère' and has become the symbolic protector of Marseille.
Notre-Dame de la Garde basilica©AFP
• The Château d'If was built in 1527 on one of the Frioul islands in the Bay of Marseille on the orders of King Francis I. Initially used as a fort, Château d'If soon became a royal prison. The famous iron mask and Edmond Dantès, the Count of Monte Cristo, were both housed here (although Alexandre Dumas's Count is a purely fictional character).
• Le Musée des Civilisations de l’Europe et de la Méditerranée (MuCEM – Museum of the Civilisations of Europe and the Mediterranean), designed by architect Rudy Ricciotti and located at the entrance to the old port, has become a symbol of the city's regeneration. The museum's daring cubic architecture, connected by a spectacular walkway to the historical Saint-Jean fort, a Vauban fortification, attracted 2.6 million visitors in its first year after opening in June 2013 during Marseille's reign as European Capital of Culture.
• Le Panier is the oldest urban district of any city in France and overlooks the Old Port. The quarter is located on the site of the first Greek settlement. The stepped streets and alleyways convey a typical Mediterranean atmosphere and also contain 'La Vieille Charité', an almshouse built by Pierre Puget in 1670, now home to museums and a cultural centre.
• The Calanques National Park, established on 18 April 2012, is the first periurban park in Europe and the first in France to incorporate both land and marine environments. A paradise for divers and climbers, the Park covers 85 square kilometres of land south of Marseille as well as 435 square kilometres of Mediterranean Sea and is home to protected species of flora and fauna.
Back to menu
TRANSPORT
Getting there
Marseille is served by an international airport, a TGV railway station and several motorways. The city is easily accessed and has a network of over 1,100km of roads. Marseille is linked to the Rhône Valley and northern Europe by the A7 motorway, to Spain by the A55 and to Italy by the A50 and A8.
In addition to overland access, the Marseille-Provence airport at Marignane, with its MP2 terminal for low-cost airlines, connects Provence to the rest of the world via 132 scheduled flights, the most in France outside Paris. More than eight million passengers used the airport in 2012. Connections to the city are by bus and motorway.
Saint-Charles railway station©Thinkstock
The TGV arrives at the Saint-Charles railway station in the heart of Marseille. The journey time to Paris is just over three hours while Lyon is a mere one hour and 40 minutes away. Marseille's international bus station is adjacent to the railway station and has departures to all major European cities. Ferry lines also link Marseille to Corsica, Algeria and Tunisia.
Distances to other UEFA EURO 2016 venues
Nice – 215km
FOOTBALL
The Stade Vélodrome©UEFA.com
Football is the passion of the people of Marseille. Olympique de Marseille – ‘OM’ – are a core component of the city’s social fabric, and Stade Vélodrome is the team’s home. Inaugurated in 1937 in preparation for the FIFA World Cup in France the following year, the stadium has been renovated on several occasions (notably prior to the 1998 FIFA World Cup). In preparation for UEFA EURO 2016, its capacity has been increased to 67,000 and it has acquired a roof. The stadium is one of the city’s most popular tourist destinations.
Marseille are the most decorated club in the history of French football, having won the French league nine times, the French Cup ten times and the League Cup three times. However, their victory against AC Milan in the 1993 UEFA Champions League final (having lost to Belgrade’s FK Crvena zvezda in the final two years earlier) is their standout honour, entitling them to wear the coveted star on their shirts. That European title – the only time a French club has ever won the competition – was the high point of Bernard Tapie’s reign as president of Marseille, which lasted from 1986 to 1994.
In recent years, Marseille have had a number of European campaigns and won the UEFA Intertoto Cup in 2005. Under the stewardship of coach Didier Deschamps – who had captained the team in their Champions League triumph – they topped the French league in 2010, won the League Cup three times and lifted the Trophée des Champions twice.
The club’s colours, sky blue and white, and their motto, ‘Droit au but’, can be found all over the city, testifying to the locals’ visceral attachment to their club.
Famous players
• Jean-Pierre Papin (1963–) – a prodigious goalscorer, Papin won the 1991 Ballon d'Or and achieved immortality in the eyes of Marseille supporters
Jean-Pierre Papin©Bob Thomas/Getty Images
• Marius Trésor (1950–) – a French international defender at the 1982 World Cup, Trésor played for Marseille from 1972–80
• Didier Deschamps (1968–) – the current France coach captained OM to UEFA Champions League glory and managed the team from 2009–12
• Roger Magnusson (1945–) – this Swedish player was an OM superstar in the 1970s with his superb dribbling skills
• Basile Boli (1967–) – a hero of the 1993 victory, his headed goal against Milan has gone down in history
Did you know?
Ahmed Ben Bella, who would go on to become Algerian President, played and scored a goal for OM in a cup match against Antibes in the 1939/40 season.
Back to menu
OTHER SPORTS
A candidate city to become the 2017 European Capital of Sport, Marseille also actively encourages other elite sports. The Cercle des Nageurs de Marseille (CNM) swimming club has won water polo titles and trained swimming champions (Camille Lacourt, Frédérick Bousquet and Fabien Gilot among others).
©AFP/Getty Images
The Stade Vélodrome also regularly hosts RC Toulonnais rugby matches. The club completed a historic double in 2014, dominating the Top 14 League and Heineken Cup. The nearby Palais des Sports stages the ATP Open 13 tennis tournament in February and is home to many other indoor sports competitions.
USEFUL LINKS
| Marseille |
What was the capital city of the People's Democratic Republic of Yemen until 1990? | France coast past Iceland and into Euro 2016 semi-final | Football | The Guardian
Share on Messenger
Close
This was France serving notice of their quality. A team who had rather huffed and puffed up to now, scraping through late in contests they had been expected to win at a canter, rediscovered their rhythm in the drizzle of Saint-Denis to cast Iceland from the tournament. Their opponents have provided one of the most refreshing and uplifting stories of these finals, the fans’ Viking chant still echoing defiantly around the arena long after the final whistle, but the natural order has been restored. In the end the smallest nation ever to grace a major finals endured their fairytale being trampled underfoot by a true contender.
Iceland’s beautiful journey finally comes to an end at Euro 2016 | Barney Ronay
Read more
Didier Deschamps could survey the scene with satisfaction from his dugout, substituting those players who had been flirting with suspension long before the end and even forgiving the odd pang of defensive frailty exposed after the interval. There is an acceptance those errors will have to be eradicated on Thursday. Germany await in Marseille, a tête-à-tête which usually brings the French out in a cold sweat when it comes to major finals. Memories drift to Seville in 1982, Guadalajara in 1986, even the Maracana in 2014, when Les Bleus have been defeated by foes whom they have not defeated in a competitive game for 58 years. “Confident? No,” said Olivier Giroud. “The Germans are world champions and favourites. But we want to write a new chapter in the history of French football.”
On this evidence they will believe they can stretch Joachim Löw’s team at Stade Vélodrome. It is the thrill of the attacking play which gives the French hope, combined with the belief that the blend of spiky aggression and purring quality offered by Paul Pogba and Blaise Matuidi can set them apart. They were irrepressible from the outset here, a team who have tended to rouse themselves late instead stirring early. By the interval the scoreline suggested a thrashing: not quite a trouncing to match that mustered by Germany against Brazil in Belo Horizonte two years ago but not far off. Iceland, so resilient and combative to this point, simply could not cope with the brutality of it all.
There was so much to admire in the rewards taken up to the interval. Matuidi’s wonderfully arced pass, eased over Birkir Saevarsson and beyond Kari Arnason from the halfway line, had set the tone. Giroud trundled on to the delivery and belted through Hannes Halldorsson’s legs to force his team ahead. Just before the interval it was Pogba sliding a pass from deep, Giroud confusing a shattered Icelandic back-line with a stepover, and there was Antoine Griezmann skipping away from Arnason and Ragnar Sigurdsson before lobbing the goalkeeper. The chip was cheeky, that of a striker thriving under the weight of expectation, and for a while at least the locals’ booming Hosanna drowned out the Iceland Huh. Arnason would not return for the second half.
France will go all out for it against Germany, says Didier Deschamps
Read more
Pogba’s thumping header from Griezmann’s corner, the Juventus midfielder leaping above Jon Dadi Badvarsson and planting his effort beyond Saevarsson on the goal-line, was just as emphatic. France have seen only flashes of their young talisman to date and they will need him to be at his authoritative best in Marseille, but the power which has propelled his club side was in evidence as he stamped his authority on the tie. Deschamps could also draw encouragement from the contribution of Newcastle’s Moussa Sissoko, playing with an effervescence too often lacking last term on Tyneside, on the right and the continued brilliance of Dimitri Payet, flitting between flank and central playmaker with such menace.
A beleaguered back-line never really came close to snuffing out his threat, the West Ham man a blur of movement, forever eking out space in which to wound wary opponents. He had been loitering on the edge of the area when Bacary Sagna crossed, Giroud knocked down and Griezmann laid off, Payet spitting away an accurate left-foot shot to register his third goal of the tournament. It seems remarkable now that this is a player who had felt forgotten while labouring at Marseille prior to that move to Upton Park. He has been France’s most consistent attacking player at these finals.
France 5-2 Iceland: Euro 2016 quarter-final – as it happened
Read more
Iceland were dizzied by it all. Their unity and commitment were never in doubt, their spirit retained as Kolbeinn Sigthorsson converted Gylfi Sigurdsson’s centre, but there was to be no recovery from those first-half deficiencies. “It was a mental thing,” said the departing joint-manager, Lars Lagerback. “We just didn’t use our brains or play our normal way. We weren’t sharp enough with our decision-making, were too passive and made silly mistakes.” They were vulnerable throughout. That much was clear when Giroud, leaping above Sverrir Ingason and Halldorsson to reach Payet’s free-kick, flicked in an easy fifth.
Yet France may not have similar joy against Germany. Their defence yielded again, through Birkir Bjarnason’s far-post header, to suggest frailty, and Hugo Lloris also conjured an astonishing save from Ingason’s point-blank attempt. Samuel Umtiti, on international debut, was several times stretched positionally, which may give the suspended Adil Rami a way back in Marseille. At least Iceland could depart with the game’s last goal. They have been magnificent at these finals but it is the French who can sense real reward.
| i don't know |
'Teardrop', by the British hip-hop duo 'Massive Attack', is the theme tune to which American drama series? | The importance of the theme tune | The National
The importance of the theme tune
Ben East
June 9, 2011
When the American singer-songwriter Andrew Gold died last week, every obituary noted his 1977 hit Lonely Boy and his work with Linda Ronstadt. But Gold will forever be fondly remembered for writing Thank You for Being a Friend. Onstage, he used to call it his accountant's favourite song, and he freely admitted that it took him only an hour to write. So why did it make him a fortune? Because it was immortalised as the theme tune for the famous 1980s American sitcom, The Golden Girls, although the version on the show wasn't even sung by Gold, but Cynthia Fee. Proof, then, that writing a timeless hit doesn't necessarily need endless promotion or radio play. It just needs to be attached to a popular television show.
Of course, there are two types of theme tunes. The ones composed specifically for the programme - such as the marching-band brilliance of Mike Post and Pete Carpenter's The A Team, or Mark Snow's spookily haunting composition for The X Files. And then there are the tracks, like Thank You for Being a Friend, plucked from existing music libraries because they seem to fit the spirit of a show.
Naturally, it's easy to assume that the latter process is much more straightforward. But it comes with its own dangers. Choose a song that's too well known - which is the temptation, clearly - and it just seems a little bit lazy. So the original theme for the otherwise impeccable US medical drama House - Massive Attack's Teardrop - was a little irritating, not least because this brooding epic seems to have been used as a backdrop for every other dramatic moment on American television.
So if non-original music must be used, it's best to pluck it from obscurity. Classic American drama series are adept at bringing to our attention unearthed gems that expertly tie in with the feel of a show. Only the most enthusiastic of hip-hop fans worked out that the evocative title music to the mid-20th century period drama Mad Men was actually the instrumental version of RJD2's 2006 track A Beautiful Mine. The British country/dance band Alabama 3 were probably as surprised as anyone else when representatives from a new gangster drama came calling. But Woke Up this Morning - with its refrain "You woke up this morning/Got yourself a gun" - was heard by The Sopranos producer David Chase on the radio, and the rest was history.
The most intriguing non-original theme tune of recent times, however, is surely Way Down in the Hole, a blues track taken from Tom Waits's 1987 album Franks Wild Years and used to spectacular effect in The Wire's opening sequences. It seemed incongruous in a show dominated by gangs and urban American music, but its opening line - "When you walk through the garden/you gotta watch your back" - was a perfect summation of what was to come. Each season used a different artist's recording of the song - from Steve Earle to The Neville Brothers - which made the theme an event in itself.
The tracks began, then, to have a life outside the show. Original themes have enjoyed similar success: The Rembrandts scored a worldwide hit with the ubiquitous I'll Be There for You when they lengthened the original Friends theme tune written by the producers David Crane and Marta Kauffman. Similarly, Glen A Larson & Stu Phillips no doubt permitted themselves a smile when the wonderfully 1980s synth-heavy theme to Knight Rider was sampled by Busta Rhymes on the Turn It Up remix in 1998, firing him to the top of the charts worldwide.
Is such success proof that a theme works, or simply a comment on our nostalgia-obsessed times? Probably a bit of both: the British techno band Orbital remixed the spooky original Doctor Who theme - without question one of the most enduring of all time - to such grand effect in 2001, it's tempting to suggest it provoked the relaunch of the show (and indeed, the latest Doctor, Matt Smith, took to the stage when they played it at Glastonbury last year). And it wasn't just the popularity of Don Johnson's crime-fighting in Miami Vice that propelled Jan Hammer's theme tune to the top of the American charts in 1985 (it remains the last instrumental to do so), but the wonderfully New Wave sounds he employed.
And as the American networks continue to produce drama as deep and satisfying as cinema, one hopes that they pay as much attention to the theme tune, rather than simply digging out a track from iTunes. There is a glorious precedent for this - and not just in the grand openings to Dallas and Dynasty. Angelo Badalamente's work for David Lynch's Twin Peaks series was not only suitably creepy, his very presence on the project suggested that this was television to be taken seriously. Although having said that... can you get much better than Joe Raposo's Sesame Street? We think not.
| The House |
Launched in 1973, what was the name of the USA's first space station? | Real Song Theme Tune - TV Tropes
Real Song Theme Tune
You need to login to do this. Get Known if you don't have an account
Share
YMMV
A Theme Tune which already existed as a well-known song. Most often, a cover of the original by an unknown artist is used, though use of the original is increasingly common.
Tends to be more common for dramatic series, though it is not unheard of for the Sitcom . Rarely occurs in children's shows.
In some cases the new version may become better-known than the original. In some rare cases it might blow the first popular version out of the water, leaving future generations to assume that the song hadn't been all that popular beforehand. See The Lone Ranger below for an example.
This trope does not cover cases where the theme music already existed, but is not well known in its own right. (Thus, the use of "As Time Goes By" in Casablanca does not count.) Most Anime have J-pop theme tunes that change every season, but that doesn't count, either - Anime Theme Song is its own "trope".
Examples:
open/close all folders
Anime & Manga
Knights of the Zodiac, the DiC dub of Saint Seiya , used the Bowling for Soup cover of A Flock of Seagulls song "I Ran (So Far Away)".
Neon Genesis Evangelion : Every episode ends with a different cover of the standard "Fly Me To The Moon"; several were performed by Megumi Hayashibara , both in and out of character as Rei Ayanami.
The Rebuild films have another cover of "Fly Me to the Moon", this time by Utada Hikaru , as well as a cover (once again by Hayashibara) of the Japanese standard "Tsubasa o kudasai", originally released by the group Akai Tori in 1971.
Speaking of Gainax, the ending theme of Kare Kano is a cover of "Yume no naka e", a 1973 song by Yousui Inoue. In the West, it's known only through its use in this show .
Paradise Kiss used Franz Ferdinand 's "Do You Want To" for its ending theme. Somehow, the American release managed to keep the rights for it.
In the older times, frequently used by MTV and VIVA for the various anime they showed in Germany. This had some, ah, "interesting" results, like the song "Star" from Nova International (which has the line "I wanna drive a big fat Cadillac" as part of its lyrics), set to the opening - of all things - of InuYasha . Yep.
They also changed one of the smoothest opening songs (Hellsing's Logos Naki World
) to some random heavy metal song
by Keith Flint of the British techno group The Prodigy .
Speaking of Hellsing, the ending used the song Shine by Mr. Big , a band who was actually quite popular over in japan.
Speed Grapher uses Duran Duran 's "Girls on Film" in the original Japanese version. The song doesn't appear in the English language version due to licensing issues.
Serial Experiments Lain used "Duvet", by British rock band Boa, for its opening theme.
Gunslinger Girl used "The Light Before We Land" by The Delgados for its opening theme.
Maria�Holic uses a cover of Yellow Magic Orchestra 's "Kimi ni Mune Kyun" for its ending theme.
Eden of the East uses "Falling Down" by Oasis for its opening theme. Due to copyright reasons, The Dub uses Falling Down for the first episode and generic J-pop for the rest.
Ergo Proxy 's ending theme is "Paranoid Android" by Radiohead .
Mushishi uses "The Sore Feet Song" by Ally Kerr as its opening theme, and the second season does it again by using "Shiver" by Lucy Rose as its opening theme.
Maison Ikkoku used Gilbert O'Sullivan's "Alone Again (Naturally)" as an OP, and "Get Down" by the same singer as the closing theme for episode 24. This was apparently a bit of cross-promotion that didn't pan out. The US release did not get the rights and doesn't use either.
Romeo X Juliet uses a Japanese translation of "You Raise Me Up" as an OP... then uses the original version in the finale.
Texhnolyze had "Guardian Angel" by Juno Reactor as its opening theme.
Every ending theme of Heaven's Lost Property from episode two onwards. Most of them are covers by the anime's cast members, but episode five's song ("Yuke! Yuke! Kawaguchi Hiroshi") is a self-covered version by the original singer.
The opening theme of A Little Snow Fairy Sugar is a Japanese remake of "Sugar Baby Love," the 1974 debut single of the British band The Rubettes.
The Legend of Black Heaven uses a shortened version of John Sykes' "Cautionary Warning"
both as the show's theme and as a song played by the main character...to save the universe.
While not an entirely straight example Full Metal Panic? Fumoffu uses a variation of Santana and Michelle Branch's song "Game of Love" for the ending.
The Italian opening for the first of the Time Bokan series is a cover of Video killed the Radio star.
Ōkami-san uses a cover of '78 pop hit "Akazukin-chan Goyoujin" ("Little Red Riding Hood Beware") as its ending theme. Given the motif of the show, an appropriate choice.
Soredemo Machi wa Mawatteiru uses a cover of Sugar Babe's "DOWN TOWN". It makes it into a Dancing Theme too.
Another Shaft example is Dance in the Vampire Bund . It uses a cover of "Friends" by Rebecca.
The Deltora Quest anime uses Delta Goodrem's "In This Life" for one opening. Strangely both the Deltora Quest author and Delta Goodrem are Australians.
JAM Project was formed specifically to counteract this trend.
The theme to One Piece , "Believe", is a reworded version of Lolita's "Dreamin' of You".
Supernatural : The Animation uses "Carry on My Wayward Son" as its ED.
Heaven's Memo Pad 's ED is Mr. Big's "Colorado Bulldog", of all things.
The voice actors of the three female leads of anohana: The Flower We Saw That Day did a cover of "Secret Base ~Kimi ga Kureta Mono~ (10 Years After Ver.)," which was sung beforehand by Scandal. The song itself was a revival of the song "Secret Base ~Kimi ga Kureta Mono~," which was originally sung by Zone—and this version was covered by the cast of Kyou no Go no Ni , two and a half years before AnoHana ! Since the lyrics were essentially the same, this means that the song has been used in at least two shows!
From the 2012 anime adaptation of JoJo's Bizarre Adventure :
The song "Roundabout" by British band Yes is used as the ending theme of season one, which covered "Phantom Blood" (9 episodes) and "Battle Tendency" (17 episodes). Since the whole thing was much too long to use as the ending in one piece (being over 8 minutes in length), different sections were used in different episodes, sometimes using the opening to lead into the credits.
For "Stardust Crusaders", the anime uses "Walk Like An Egyptian" by The Bangles for its first half (24 episodes) and "Last Train Home" by Pat Metheny Group for the second (another 24 episodes, officially labeled "Battle in Egypt").
And for the fourth part, "Diamond is Unbreakable", the ending is Savage Garden 's first single "I Want You".
Deadman Wonderland 's theme tune "One Reason" is a reworded version of Fade's song "Black Hearts and Dollar Signs"—performs by Fade.
Initial D uses various Eurobeat tunes licensed from Avex Trax's Super Eurobeat library, just like it's video game counterpart Initial D Arcade Stage
The obscure (in the West) anime Hanada Shonen Shi uses the Backstreet Boys songs "I Am The One" and "Drowning" as OP and ED respectively.
Comic Books
Invariably, every time Iron Man 's radio malfunctions, the song blaring out through his speakers is the Black Sabbath song of the same name.
Fan Works
The fake movie Calvin and Hobbes III: Double Trouble uses "Calvin and Hobbes" by Pure Joy, fittingly enough.
Films — Animation
Cars featured a cover of Tom Cochrane's "Life is a Highway" by Rascal Flatts during the montage of Mack driving with Lightning McQueen in his trailer through the interstate.
Finding Nemo features a Robbie Williams cover of Bobby Darin's "Beyond The Sea" (originally Charles Trenet's French-language "La Mer") during the closing credits.
Yellow Submarine used The Beatles ' eponymous song.
Studio Ghibli 's Whisper of the Heart featured John Denver's "Take Me Home Country Roads" performed by Olivia Newton-John. The song figures in the storyline; as part of a school assignment, Shizuku writes a set of original lyrics to the song.
Another Ghibli example: Only Yesterday closes with a Japanese-language translation of "The Rose", originally a hit for Bette Midler.
Shrek (in)famously uses "All Star" by Smash Mouth .
Films — Live-Action
Quincy Jones' "Soul Bossa Nova" was used as the opening credit theme for all the Austin Powers films. Jones even cameos as himself leading a band playing the song in Goldmember.
The Dueling Banjo Arrangement by Arthur "Guitar Boogie" Smith became famous for it's appearance in Deliverance and is rarely mentioned without Deliverance also being mentioned, so much so that the song is often referred to as the song from Deliverence.
Although not completely associated with the movie, Scott Joplin's "The Entertainer" was long since forgotten until it was the main theme in The Sting .
An American Werewolf in London used three different covers of "Blue Moon": Bobby Vinton in the opening, Sam Cooke during the Painful Transformation , and the Marcels for the end credits. Also used "Bad Moon Rising", by Creedence Clearwater Revival.
Brazil used several versions of "Aquarela do Brasil" as its theme music. Jeff Muldaur does the comical, yodelling version heard on Sam's car radio; Bachianos Brazil Samba the one on the end credits; and no less than Kate Bush provided a further one which was supposed to be heard over Sam's first flying dream. For some unfathomable reason, the last one was cut, but can be heard on the soundtrack album.
The Graduate used Simon & Garfunkel's "The Sounds of Silence", "April Come She Will", and "Scarborough Fair". The best-known Simon & Garfunkel tune in the movie, "Mrs. Robinson", was debuted in the movie so it doesn't quite fit this trope.
The Doors ' "The End".
Also of course "The Ride of the Valkyries" by Richard Wagner during the helicopter attack. Some viewers who weren't into classical music — among them the inhabitants of the area where the sequence was filmed - assumed that the piece was written for the film.
2001: A Space Odyssey uses a climactic fanfare that comes from Richard Strauss's "Also Sprach Zarathustra", written in 1896. The work wasn't that popular in the English-speaking world at the time, so it's understandable that many viewers assume it was written especially for the movie.
Sky Captain and the World of Tomorrow ends with a cover of "Over the Rainbow" from The Wizard of Oz .
As do both The Abominable Dr. Phibes and Dr. Phibes Rises Again. The latter memorably sung by VINCENT PRICE.
I Wake Up Screaming uses "Over the Rainbow" as its Love Theme . This is somewhat odd considering that studios in this era preferred to recycle songs from their own song publishers' catalogs, but I Wake Up Screaming was made by 20th Century-Fox and "Over the Rainbow" was, of course, written for MGM's The Wizard of Oz .
David Lynch 's Blue Velvet uses Bobby Vinton's song of the same name - not only as its title, but also as a theme song.
Ironically though, the song that became more identified with the movie was Roy Orbison 's "In Dreams."
Which in the movie is referred to as "Candy-Colored Clown" after its opening line "The candy-colored clown they call the sandman."
Stand by Me uses the Ben E. King song of the same name.
The Death Note films and " Dani California ".
The film Freddy vs. Jason used Ill Nino's song 'How Can I Live' as the main theme in the end credits. The song eventually came out on their 2003 album Confession, but they thought the song fit the mood of the film so well they decided to use it before release.
Watchmen used Bob Dylan's 'Desolation Row' as the theme over the credits — except that My Chemical Romance covered the rather folksy lyrics as a punk song, which worked surprisingly well. The very memorable title sequence had another Dylan song, though this time his original version — " The Times They Are A-Changin' ".
Dr. Strangelove or: How I Learned to Stop Worrying and Love the Bomb :
For its opening theme tune, the film uses a lush arrangement of the old standard "Try a Little Tenderness" over B-52 aerial refueling footage, turning it into machine porn.
Closing the film with stock footage of nuclear explosions overlaid with Very Lynn singing "We'll Meet Again" is also quite memorable.
The Transformers films seem to have this strange obsession with Linkin Park 's music and managed to utilize this with What I've Done playing in the credits of the first filmnote it was also played in the background of another scene. The it got subverted with New Divide being recorded specifically for the second film , and was mixed into the film's actual score at various points. The third film continued the tradition by having the song Iridescent as its theme, though slightly re-recorded to better fit with the film's grim mood.
There's also the liberal use of Green Day 's 21 Guns in Revenge of The Fallen. Bumblebee meanwhile, ends up using bits from The Cars' Drive, Player's Baby Come Back, Rick James' Superfreak and the Pointer Sisters' I'm so Excited at different points in the films as part of his speech.
Little Manhattan used Only The Strongest Survive by Elvis Presley as its opening credits song.
Hatari! opens - after a cold opening - with Henry Mancini's arrangement of Just For Tonight by Hoagy Carmichael.
Se7en uses a remix of the Nine Inch Nails song Closer in the opening credits.
Guess Who's Coming to Dinner uses "The Glory of Love".
Down with Love uses the song of the same name, recorded decades earlier.
Live-Action TV
WGNA's Salem uses the song "Cupid Carries a Gun" by Marilyn Manson , which is a track from his next, currently unnamed album.
Absolutely Fabulous uses "This Wheel's On Fire". Julie Driscoll's recording of the song in the 60's was a hit in the UK, and she re-recorded the song for the show.
It was replaced by a cover by Jennifer Saunders and Adrian Edmondson.
Arli$$ had Dusty Springfield's "I Only Want to Be With You".
As Time Goes By uses a rendition of the song "As Time Goes By".
Ax Men uses the Jimi Hendrix version of "All Along the Watchtower" for season 1.
Barter Kings uses Bachman-Turner Overdrive's "Takin' Care of Business".
The Australian version uses Wes Carr's cover of "Is She Really Going Out with Him?"
Betty White 's Off Their Rockers uses Twisted Sister 's "We're Not Gonna Take It."
The Benny Hill Show used a fast version of Boots Randolph's "Yakety Sax" as its closing theme. They also used an instrumental arrangement of "Mah Na Mah Na" as background music for fast-paced comedy sequences.
Big Love uses The Beach Boys ' "God Only Knows."
In season 4, it was replaced with "Home" by The Engineers.
Boardwalk Empire uses "Straight Up and Down" by The Brian Jonestown Massacre.
Border Security uses "Would I Lie to You" by Eurythmics.
Bosom Buddies used a version of Billy Joel's "My Life". (It's replaced by something generic and instrumental on the DVDs.)
Bottom uses "BB's Blues" over its opening credits, and "Last Night" over the closing credits. Both covered by the show's house band, The Bum Notes .
Cake Boss uses a cover of "Sugar (Honey Honey)" sung by The Nerds.
Also used on Glory Daze .
CSI : Each show in the franchise takes its Theme Tune from a song by The Who : "Who Are You" for the original, "Won't Get Fooled Again" for CSI: Miami , "Baba O'Riley" for CSI: NY , and "I Can See For Miles" for CSI: Cyber . As TIME Magazine said, "[the fact the album Who's Next has only eight tracks] provides the only natural curb on the expansion of the C.S.I. franchise."
It was lampshaded in an episode of Two and a Half Men , featuring a CSI parody which, for its Theme Tune , used The Who's wildly inappropriate "Squeeze Box".
Charmed used Love Spit Love's version of The Smiths ' "How Soon Is Now?", which was first used in the movie The Craft, which was thematically similar to the first few seasons.
El Chavo del ocho used Jean Jacques Perrey's "The Elephant Never Forgets" as its theme tune, which in turn is an arrangement of Beethoven's Turkish March (aka Marcia Alla Turca)
Chespirito's other series, El Chapul�n Colorado , used Perry-Kingsley's "Baroque Hoedown"note Best known in the U.S. and Canada as the theme to the Disney Theme Parks' Main Street Electrical Parade. as the closing theme.
China Beach opens to the Diana Ross and the Supremes song, "Reflections".
Chuck opens to an instrumental cut of "Short Skirt Long Jacket" by CAKE .
Class (2016) uses "Up All Night" by Alex Clare.
Community uses "At Least It Was Here" by The 88.
Cops uses "Bad Boys" by Inner Circle as its theme.
Cosmos , the Carl Sagan documentary series, used Heaven and Hell [side 1, third movement] by Vangelis as its theme tune. Several other Vangelis pieces were used in the soundtrack, including "Pulstar" and "Alpha".
Cover Up, a short-lived CBS action-drama, used Bonnie Tyler's "Holding Out For A Hero" as its theme.
Crime Story , set in the Rat-Pack '60s, used Del Shannon's "Runaway", redone by him with lyrics tweaked for the show.
Dave's World used (a cover of) "You May Be Right" by Billy Joel .
The first three seasons of The Dead Zone used Jeff Buckley 's song "New Year's Prayer" from Sketches For My Sweetheart The Drunk .
De Pies a Cabeza, a Colombian soap opera, not only used the song of the same name from Mexican group Maná, as theme tune. All the ambient music was taken from their studio album "¿Dónde Jugarán los Niños?".
Deadliest Catch uses "Wanted Dead or Alive" by Bon Jovi .
Dejémonos de Vainas, a very famous Colombian soap opera, used the song " Yo-yo
" from Rose Royce.
Similarly, the Brazilian soap opera Salve Jorge (known on Spanish-speaking countries as La guerrera), used the 2012 hit "Girl On Fire" by Alicia Keys as its theme song.
The Dennis Miller Show on HBO originally opened with Tears for Fears' "Everybody Wants To Rule The World".
Designing Women used Ray Charles's "Georgia on my Mind".
The first 5 seasons used an instrumental that featured Johnny Carson 's bandleader, Doc Severinson , on the trumpet. In the 6th season, the opening credits featured Ray Charles himself on the piano, singing, while the Designing Women hung around looking pleased.
Densha Otoko : (a Japanese live-action drama) used The Electric Light Orchestra 's Twilight as its theme song.'
This was of course a Shout-Out to the legendary "Daicon IV" con opening animation from 1984, which also used the song.
The first episode used "Mr. Roboto" by Styx .
Deutschland 83 used two different songs in different markets. The original German broadcast used "Blue Monday" by New Order , while the US and UK broadcasts used a German song of the era, "Major Tom (Coming Home)" by Peter Schilling.
Dirty Jobs uses "We Care A Lot" by Faith No More ; some older episodes use a replacement written by the show's composer due to rights issues, though.
Doctor Doctor used "Good Lovin'" by the Rascals.
Don't Forget The Lyrics ( FOX Game Show ) uses the Doobie Brothers' "China Grove".
The Drew Carey Show used "Moon Over Parma", "Cleveland Rocks", and "Five O'Clock World" at various times.
Drive used Can't Stop The World by Gavin Rossdale.
Duck Dynasty uses ZZ Top 's "Sharp Dressed Man" for the TV broadcasts of the first six seasons, and The 4onthefloor's "Workin' Man Zombie" on the DVD releases.
The video game review show The Electric Playground has "Skybike 1" from the Skeleton Warriors video game as its title tune.
Entourage uses "Superhero" by Jane's Addiction.
Ever Decreasing Circles uses Dmitri Shostakovich's Prelude in D-flat major, Op.34 No.15.
Extras uses Cat Stevens' "Tea For the Tillerman" over the end credits, much like The Office example below.
Family Matters used Ray Charles's "What a Wonderful World"... for all of one episode, before switching to an original tune.
Another Billy Joel example comes from The Fanelli Boys, which uses "Why Should I Worry" (Joel's contribution for Oliver & Company ).
The Fast Show : The first series featured Paul Whitehouse singing Esther Phillips' 'Release Me' as a theme, with the comedy element provided by Whitehouse's crooner being grotesquely distorted as if in a hall of mirrors.
A Fine Romance (1980's British sitcom) uses a version of the song "A Fine Romance" sung by the show's star Judi Dench .
Frank's Place used Louis Armstrong 's "Do You Know What It Means to Miss New Orleans?"
Freaks and Geeks uses Joan Jett 's "Bad Reputation".
Friends used The Rembrandt's "I'll Be There For You".
The Frugal Gourmet on PBS used a portion of the famous Water Music by George Frideric Handel, specifically the Bourrée movement of the Suite in F major
Game On , a BBC sitcom, used "Where I Find My Heaven" by the Gigolo Aunts.
The George Lopez Show opens every episode with "Low Rider" by War.
Get a Life (Chris Elliot's sitcom) opened every show with R.E.M. 's "Stand".
Gilmore Girls opens with a version of "Where You Lead" which Carole King re-recorded with her daughter.
Gimme Gimme Gimme naturally opens with the ABBA song, albeit a Kathy Burke and James Dreyfuss cover.
The Golden Girls had a cover of Andrew Gold's "Thank You for Being a Friend" as its theme.
Grace Under Fire used Aretha Franklin 's cover of "Lady Madonna" by The Beatles .
Grey's Anatomy used "Cosy On The Rocket" by Psapp with its opening credits.
Happy Days used "Rock Around the Clock" by Bill Haley And His Comets before switching to an original theme song. The version of "Rock Around the Clock" the show used wasn't the original 1954 recording either: they had the aging Haley re-record the song.
"Rock Around the Clock" was the opening theme for the first two seasons. The original "Happy Days" song ("Sunday, Monday, happy days...") was always the closing theme. For the third season, they started using their own song at the beginning and end, probably to make more money off royalties. The version of "Happy Days" used as the end theme for seasons 1 and 2 was performed by Jimmy Haas, and when it became the main theme, it was replaced by a version from Pratt & McClain (and that version was replaced again for the show's final season with a more modern arrangement from Bobby Arvon).
It was also kept for the syndicated rerun version of the series that was circulated while the original series was still on the air. Entitled Happy Days Again, the original 1954 recording of the song by Bill Haley and His Comets was used instead of the 1974 re-recording.
Hearts Afire used "That's the Way of the World" by Earth, Wind, and Fire as one of its ending themes. It also derived its title from the song's lyrics.
of Tom Bergeron's (The) Hollywood Squares was Teena Marie's 1981 single "Square Biz"
with new lyrics.
Homefront , an early '90s drama set during World War II , had a rendition of Johnny Mercer's "Ac-cent-tchu-ate the Positive" as its theme.
Hotel Hell uses the eponymous "Hotel Hell" by the Australian band Skyhooks, thus also making it a Title Theme Tune .
Canadian talk show The Hour once used "Use It" by The New Pornographers , before switching to "The Good in Everyone" by Sloan (not coincidentally, both Canadian bands.)
House uses an instrumental version of "Teardrop" from Mezzanine by Massive Attack for its theme. In other countries a different song
is used called 'House', composed by Scott Donaldson and Richard Nolan for the show. Once you've heard the Massive Attack version of the credits, the other one will really grate, because the cuts in the credits are perfectly timed to fit with "Teardrop", and they are a lot less powerful with a different song.
Notably, in one episode a cover of "Teardrop" performed by José González, complete with lyrics, is played at the end.
And, on the DVDs (at least the ones available for purchase in the UK), the two songs ("House" and the "Teardrop" instrumental) alternate with each episode.
Additionally, the intro for the first episode of Season 6 used "No Surprises" by Radiohead .
How To Make It In America uses Aloe Blacc's I Need A dollar.
Human Giant uses "Romantic Rights" by dancepunk band Death From Above 1979
Hung (HBO) uses "I'll Be Your Man" by The Black Keys.
Ice Road Truckers uses Aerosmith's "Livin' On The Edge" for its first four seasons.
The Inbetweeners uses "Gone Up In Flames" by Morning Runner.
The Insiders, an obscure 80s cop show and Miami Vice knockoff, famously used "Just A Job To Do" by Genesis .
InSecurity uses "The Sun Ain't Shining No More" by The Asteroids Galaxy Tour
The American dub of Iron Chef uses several songs from Hans Zimmer's Backdraft soundtrack.
The Jack Benny Program used a medley of "Yankee Doodle Dandy" and "Love in Bloom" as its opening theme, and "Hooray for Hollywood" as its closing theme.
Jack Horkheimer Star Gazer uses Isao Tomita's version of Claude Debussy's " "Arabesque No. 1
"
Jackass : The jangly polka is "Corona" by Eighties alternative punk trio Minutemen . An interesting choice, considering that it's a recording that's as old as most of the show's audience.
Jam And Jerusalem uses Kate Rusby's cover of The Village Green Preservation Society, originally recorded by The Kinks , as its theme music.
Joan of Arcadia used a version of "One Of Us" that Joan Osborne specially re-recorded to fit the length and pace of the credits better.
Joan Jett 's "Bad Reputation" was used as a theme by two very different shows- Freaks and Geeks and American Chopper
Joey used the penultimate part of "Sunny Hours" by Long Beach Dub Allstars.
The game show The Joker's Wild in its first seasons used "The Savers" by Jean-Jacques Perry and Gershon Kingsley.
FOX TV's short-lived legal procedural �Justice� used Warren Zevon's �Lawyers, Guns and Money� as its opening theme.
Kitchen Nightmares uses "Misirlou" by Dick Dale .
In the early 1980s, KQTV (the ABC affilliate in St. Joseph, MO) used the instrumental opening of Devo 's "Snowball" to open their nightly news program. The viewer demographic for KQTV did not overlap greatly with the listener demographic for Devo, so most viewers probably thought it was original music.
Lie to Me uses Ryan Star's "Brand New Day" (no relation to the Sting song).
Life Goes On : "Ob-La-Di Ob-La-Da", a cover version sung by the cast.
Life on Mars (2006) uses David Bowie's "Life on Mars". The song is also a plot theme.
The Lone Ranger : The opera William Tell reached the pinnacle of its popularity in The Thirties . Everyone had heard of it, and more importantly everyone knew the overture by heart. Unfortunately, the use of the final movement of the overture as the theme song for The Lone Ranger associated it so strongly with the Western genre that the opera basically became unstageable in America. Because of this, some might assume the song doesn't fit the trope because the opera isn't popular now. In any case, it's also an example of Public Domain Soundtrack .
Louie uses "Brother Louie" by Stories.
Made In Canada used "Blow At High Dough" by The Tragically Hip.
The Man in the High Castle uses "Edelweiss" from The Sound of Music , sung by Jeanette Olsson.
Married... with Children uses "Love and Marriage" by Frank Sinatra (and was replaced on the DVD with a cheery, instrumental soundalike in both the opening and closing credits — save the end credits to the season four episode "Buck Saves the Day" where, instead of Peg and Al on the couch, it shows Al, Bud, Steve, and the kids still in the woods).
Marry Me uses "Home" by Edward Sharpe and the Magnetic Zeros.
MasterChef Australia uses the Katy Perry song "Hot 'N' Cold".
May to December uses "September Song" from Knickerbocker Holiday . (Which meant the ITV sitcom September Song couldn't.)
Misfits uses "Echoes" by The Rapture.
Mock the Week uses a short clip of News Of The World by The Jam .
Monday Night Football uses a lyrically-modified version of Hank Williams, Jr. 's 1984 hit "All My Rowdy Friends Are Coming Over Tonight" - or it did until Williams made some inappropriate remarks about President Obama. ESPN announced that it was discontinuing use of the song.
Similarly, NBC's Sunday Night Football uses a theme adapted from Joan Jett's "I Hate Myself for Loving You".
And now the NFL Network uses a modified version of The Ramones ' "Blizkrieg Bop" sung by Cee Lo Green for Thursday Night Football.
TV coverage of the Barclays Premier League uses "Fire" by Kasabian.
Monty Python's Flying Circus uses John Phillip Sousa's "Liberty Bell" march as theme music, and such was their influence they've effectively made it their own. The original, like most Sousa marches, goes into a different melody which is nowhere near as well-known. The original also has no razzberries.
Newton's Apple, from 1983 to 1990, used Kraftwerk's "Ruckzuck", from their 1971 self-titled debut album, then from 1990-1994, a remixed version , then an original song afterwards. For the home video releases, they used a different but similar-sounding tune, due to licensing issues.
The Newlywed Game used "Summertime Guy".
Many live-action shows on Nickelodeon do this - a lot. Below are a few examples...
The Amanda Show 's theme song was essentially the Wizard's Peak theme from Spyro the Dragon With Lyrics .
Drake & Josh used "I Found a Way" by Drake Bell.
Unfabulous used "Unfabulous" by Jill Sobule.
Zoey 101 used "Follow Me" by Jamie Lynn Spears.
iCarly uses "Leave It All To Me" by Miranda Cosgrove and Drake Bell.
Victorious uses "Make It Shine" by Victoria Justice.
Sam & Cat uses "Just Fine" by Backhouse Mike.
Noah's Arc : The remixed variety of "Remember the Love" by Adriana Evans.
The Norm Show used "Too Bad" by Doug and the Slugs.
In a rare game show example, the short-lived Mark Goodson-Bill Todman game Now You See It used Quincy Jones' "Chump Change" as the theme on both versions. Bill Cosby also used this same music on The New Bill Cosby Show. Other game shows that used actual recordings as themes:
The Price Is Right : From 1956 to 1961, they used "Sixth Finger Tune," which was taken from a stage show called "Six Fingers For A Five-Fingered Glove."
Password : Its 1961-1963 theme was called "Holiday Jaunt" and was used as early as 1958.
Seven Keys: "Everything's Coming Up Roses."
Match Game : From 1962 to 1967, it was "A Swingin' Safari" by Bert Kaempfert. The pilot used the Billy Vaughn arrangement.
Eye Guess: For the first two years the theme was Al Hirt's "Sugar Lips."
The Face Is Familiar (a short-lived CBS nighttime show from 1966): "Brasilia" by Herb Alpert.
The Love Experts, a short lived game show-panel game hybrid hosted by Bill Cullen , used Bebu Silvetti's "Spring Rain".
NUMB3RS used a sample from Talking Heads' "Once in a Lifetime" in the first season.
The Frugal Gourmet on PBS used a movement from "Water Music Suite Number 1" by Handel.
The O.C. used Phantom Planet's "California."
The Office (UK) uses a cover of Handbags and Gladrags, as made famous by Rod Stewart.
In one episode, Ricky Gervais as Brent sang the song over the closing credits.
The Osbournes used a cover of Crazy Train by Ozzy Osbourne , as remade by Pat Boone- in a jazz style.
One Tree Hill used Gavin DeGraw's I Don't Want To Be as its theme song for its first four seasons. From Season 5 onwards, they did away with the credits.
A few seasons later, they brought back the theme song, this time having it performed by a different artist every week.
Out of This World used David Lee Roth 's cover of "Swinging on a Star", with reworked lyrics.
Overhaulin used Kicking Harold's "Gasoline" for the first few seasons, switched to an instrumental song with an Opening Narration , and switched back in 2014.
Party of Five used "Closer to Free" by the BoDeans.
Peep Show uses Harvey Danger's "Flagpole Sitta", starting in season 2.
Pit Boss uses a hip-hop remix of Keith Mansfield's "Funky Fanfare" (as heard in those "feature presentation" bumpers in Kill Bill and Grindhouse).
Pretty Little Liars uses "Secret" by The Pierces.
Primeval uses "All Sparks" by Editors for its ending theme.
Unless you're not in the UK. It recycles the opening theme for the ending theme in overseas broadcasts (at least in Australia it does).
"All Sparks" was only used for the televised broadcast of the show's first season. When season 1 was released on DVD, the credits used the opening theme.
Portlandia uses "Feel It All Around" by chillwave artist Washed Out.
Providence used Chantal Kreviazuk's cover of the Beatles' "In My Life".
The first two Quatermass series used "Mars - The Bringer of War" from Holst's The Planets.
The Ranch uses "Mamas Don't Let Your Babies Grow Up to be Cowboys," a well-known country song. It fits the "good ole boy" vibe of the show, and it's a nod to Debra Winger's role in Urban Cowboy .
Reba , the eponymous sitcom of country singer/actress Reba McEntire , used a partial rewrite of her single "I'm a Survivor."
The Rebel Billionaire: Branson's Search for the Best, the globetrotting reality show by borrowed mostly the instrumental section of the theme from the film Live and Let Die
Rescue Me ( The BBC version, not the American firefighter show ) uses a male cover of the Fontella Bass song of the same name as its theme.
Rescue Me , the American firefighter show, also falls under this: it uses "C'mon C'mon"
by the Von Bondies.
Roswell used a shortened version of "Here with me" by Dido.
Russell Howard's Good News uses an abridged instrumental of "Fast Fuse" by Kasabian.
The Royle Family used "Half The World Away" by Oasis .
Scrubs used the song "Superman" by Lazlo Bane, with a cover being used in the Postscript Season . The version of "Superman" used as the theme is faster and in a different key than the original version.
Los Simuladores , being an Argentine show, uses Astor Piazzolla's "Cité Tango".
Sharpe uses an extended version the traditional British military song "Over the Hills and Far Away", using the lyrics from George Farquah's 1706 play The Recruiting Officer. Although written during the War of Spanish Succession, they are fortuitously fitting for Sharpe's career, which also took him "to Flanders, Portugal and Spain" (well, actually Waterloo is in Brabant, but that's close enough to Flanders).
Southland uses an instrumental version of Dulce Pontes' version of Cancao Do Mar.
Soul Man (and possibly another show) used, appropriately enough, "Soul Man". Doubly appropriate as the lead actor is also one of The Blues Brothers .
Hangin' with Mr. Cooper used "Soul Man" for its second season before changing to an original theme song.
Smallville uses Save Me by Remy Zero.
The Sopranos uses "Woke Up This Morning (Chosen One Mix)" by electro-blues group Alabama 3. The difference between the original and the Chosen One Mix (both of which predate their use in The Sopranos by a couple years) is that the former is in the first person, and the more famous latter version is in the second person.
Star Trek: Enterprise was the first of the series not to have a symphonic theme tune — it used "Faith of the Heart", performed by Russell Watson. (A more well-known version of the song is performed by Rod Stewart on the soundtrack of Patch Adams .) In the third and fourth seasons, they decided something was missing—a thumping backbeat. In what was essentially a country song.
The closing credits music, now known as "Archer's Theme", was originally intended to be the Enterprise theme, and was written by the same man who wrote the theme for Deep Space Nine . Executive Meddling ensued, and it was replaced with "Faith of the Heart". This
is what that would have looked like. An even earlier concept
, however, was a throwback to other Trek series, including the Opening Narration and footage of the ship.
Starting in its third season, the Discovery Channel show Storm Chasers used Bon Jovi 's "Blaze of Glory" as its theme tune.
Sue Thomas: F.B.Eye used "Who I Am" by Jessica Andrews.
Sugar Rush uses Blondie 's "One Way Or Another".
Super Nanny uses Men At Work's "Be Good Johnny" as its theme: it's actually a re-recorded version from a Colin Hay solo album, but it sounds practically identical to the original.
Suits uses "Greenback Boogie" by Ima Robot as it's theme.
Supernatural , as stated above, uses Kansas' "Carry On Wayward Son", though the series only used it in the first season before it was relegated to being the theme for the Season Finale recap.
The Australian-set BBC sitcom Supernova used I Can See for Miles by the Who.
Teachers uses Belle & Sebastian's "The Boy With the Arab Strap".
That '70s Show uses a cover of Big Star 's "In the Street". Obscure, but kinda famous in an underground way. From season 2 on it was performed by Cheap Trick .
The Celebrity Apprentice Uses "For The Love of Money" by The OJ's.
Third Watch used "Keep Hope Alive" by the Crystal Method.
This Old House on PBS used Fats Waller's "Louisiana Fairy Tale" from 1979 to 2003 before it switched to an original theme.
Tour of Duty , a Vietnam War series, used the Rolling Stones' "Paint It Black" over the opening credits.
Top Gear uses 'Jessica' by the Allman Brothers Band.
The Top Gear presenters lampshaded their use of the song during the second America special, when the original song came on over the radio. "On tonight's program..."
Originally the closing theme was "Out of the Blue" by Elton John .
True Blood uses "Bad Things" by Jace Everett.
Twin Peaks used an instrumental version of Falling by Julee Cruise.
2 Broke Girls uses "Second Chance" by Peter Bjorn and John.
The Twilight Zone the 80s version mixed the classic theme with The Grateful Dead 's "Dark Star".
Two Guys, a Girl and a Pizza Place originally used the song "Blister in the Sun" by Violent Femmes. It switched to an original song in season 3 at the same time the show's name was changed and the pizza place was dropped.
Soul Train used several real songs as its theme: most famously "TSOP (The Sound of Philadelphia" by MFSB. Though "TSOP" was only used for nine of the show's 28 seasons (six of which used remixed versions), most fans consider it the theme song for the show.
TSOP was originally written to be the official song to be named "Soul Train," but it was decided not to closely associate it with the show. Mother Father Sister Brother (MFSB) released it as a single, becoming the first disco song to reach #1 on the Billboard charts.
Veronica Mars used "We Used To Be Friends" by The Dandy Warhols . For the third season, The Powers That Be switched to a slower, ostensibly Darker and Edgier version of the song.
Vikings uses "If I Had A Heart" by Fever Ray.
Vision On, a BBC children's series of the '60s and '70s, used Al Hirt's "Java" over its end credits.
Walt Disney Presents , (The Wonderful World of Disney) used an instrumental medley of well-known songs from Disney movies, including "When You Wish Upon a Star", "Whistle While You Work", and "Zip a Dee Doo Dah". At least one of the tunes — "It's a Small World" — was from the theme parks.
Weeds uses "Little Boxes" by Malvina Reynolds�the original in the first season, a different cover by a different artist every episode after that.
Including, on at least one occasion, a French version.
Whale Wars uses The Smashing Pumpkins' "Bullet with Butterfly Wings"
What I Like About You used the song of the same title, covered by Lillix.
Wings : Piano sonata No. 20 by Franz Schubert.
The Wire uses Tom Waits's "Way Down In The Hole". Each season is done by a different artist - season one was by The Blind Boys of Alabama, season two was Waits's original version and season three was by The Neville Brothers. Season four's version was a specially recorded R'n'B version to represent the show's shift in focus to children on the streets. Season five was sung by Steve Earle, who also played a recurring role in the show.
The Wonder Years : The Joe Cocker version of "With a Little Help From My Friends".
You Bet Your Life (Groucho Marx's Game Show ) used an instrumental version of the song "Hello, I Must Be Going/Hurray for Captain Spalding" from the classic Marx Brothers musical Animal Crackers .
The Young Ones used a cover of Cliff Richard 's song of the same name sung by the cast.
NYC 22 uses Jay-Z 's "Heart of the City (Ain't No Love)".
The opening theme of Retro Game Master is a remix of Ode To Joy.
True Detective uses "Far from Any Road" by The Handsome Family in season 1 and "Nevermind" by Leonard Cohen in season 2.
This is surprisingly common in soap operas in countries such as Portugal, where the song used will usually be from The '80s . As of this writing, nearly all the soaps on channel 1 use a Real Song Theme Tune.
Pinball
The Getaway: High Speed II features ZZ Top 's "La Grange" as the main theme music.
The main background music for The Twilight Zone is an instrumental version of the 1982 song "Twilight Zone", by Golden Earring.
As one would expect, Star Wars Episode I uses John Williams' score from the movie.
Star Trek: The Next Generation has Dennis McCarthy's reworked version of the original Star Trek theme.
Three of Daft Punk 's soundtrack tunes are used in the TRON: Legacy pinball.
The Addams Family , unsurprisingly, uses the original theme.
Creature from the Black Lagoon has five '50s pop hits licensed for its main theme: "Rock Around the Clock", "Get a Job", "Summertime Blues", "Willie and the Hand Jive", and "Red River Rock".
Data East Pinball 's Back to the Future uses ZZ Top 's "Doubleback," along with Huey Lewis and the News ' "The Power of Love" and "Back in Time".
Red & Ted's Road Show uses country singer Carlene Carter's "Every Little Thing" for its signature theme. Appropriate, given she voices "Red" in the game.
Bally 's Playboy pinball has Cy Coleman's "Playboy's Theme", from the TV show Playboy After Dark, as its main tune.
Gottlieb 's Rocky plays "Gonna Fly Now", otherwise known as the "Rocky theme".
Indiana Jones: The Pinball Adventure plays "The Raider's March" and other songs from the series.
Junk Yard uses an instrumental version of "Money (That's What I Want)" by The Beatles .
Data East 's Secret Service features "Nobody Does It Better" (from The Spy Who Loved Me ), along with music from Mission: Impossible , Get Smart , Secret Agent Man , and other spy programs.
At the end of a game, the table plays the chorus from "Nobody Does It Better" while lyrics are shown on the display.
Aside from using James Horner's theme song for its main play, Apollo 13 uses Norman Greenbaum's "Spirit in the Sky" for its Jackpot theme.
No points for guessing what real song gets used in the various Star Wars pinball games.
Stern Pinball 's Shrek plays the first verse of Smash Mouth 's "All Star".
Data East 's The Who's Tommy includes twenty-one songs from the Broadway musical, sung by the original performers.
Bally 's 1976 KISS pinball plays a short version of "Rock and Roll All Nite" when starting a game, and ends the game with a tinny version of "Shout it Out Loud".
Stern 's 2015 KISS features ten songs from the band, including "Hotter Than Hell," "Black Diamond," "Lick It Up," "Love It Loud," and "Detroit Rock City."
Not surprisingly, Guns N' Roses features nine of the band's songs, including "Welcome to the Jungle," "Night Train," and the exclusive "Ain't Going Down". Also, Slash confirms that the game has eight more original recordings which were taken off the masters.
Lethal Weapon 3 lets players choose from C+C Music Factory's "Gonna Make You Sweat (Everybody Dance Now)", ZZ Top 's "Sharp Dressed Man", or the game's own music.
NASCAR features Sammy Hagar's "I Can't Drive 55," a popular song among NASCAR fans.
Unsurprisingly, The Wizard of Oz uses music from the MGM movie it's licensed from, most notably "We're Off to See the Wizard".
And the Gilligan's Island pinball uses the theme tune from the television series.
The Party Zone plays several Real Life songs throughout the game, such as "Pinball Wizard" by The Who , "De'funkt" by Defunkt, "Feelings" by Morris Albert, "Come Fly with Me" by Frank Sinatra , and "Purple Haze" by Jimi Hendrix .
The Pink Panther pinball plays Henry Mancini's famous song during multiball.
Unsurprisingly, AC/DC features twelve songs from the band, and smart players can choose different songs at appropriate times to maximize their score. The Limited and Preimum Edition tables even include a more advanced sound system to augment the experience.
Subverted in Cr�e Ball — while the game features the M�tley Cr�e songs "Dr. Feelgood", "Live Wire", and "Home Sweet Home", they are only available in the Music Demo on the title screen. The in-game music consists of cycled PCMs by arcade Pinball composer Brian Schmidt.
The main game theme in Spy Hunter and WHO dunnit is Henry Mancini 's "Peter Gunn".
Metallica features a dozen songs for the player to choose from, including "Creeping Death," "One," "Master of Puppets," "Battery," "For Whom the Bell Tolls," and "Fade To Black". An Expansion Pack update added "Ride the Lightning" and "Blackened".
Gottlieb 's Haunted House plays segments of Toccata and Fugue in D Minor throughout the game.
Stern Pinball 's Mustang has a soundtrack of road tunes from Sony; the Pro edition has four songs, while the Premium and Limited Editions add four more. Selections include "Ace of Spades" (Motorhead), "Free Ride" (Edgar Winter), "Drag City" (Jan & Dean), and "My Own Worst Enemy" (Lit).
Harlem Globetrotters On Tour plays "Sweet Georgia Brown," the Globetrotters' theme, at the start of each game.
Rollergames uses a remixed version of the TV show's theme for its main game music. The design team wanted to use the original music, but Williams' German distributor refused to carry the machine if that had happened.
The music for Full Throttle is from the British metal group Redline, who compose the music for the television coverage for the annual Isle of Man T.T. motobike races. The game's main theme is "King Of The Mountain" from the album Vice.
Sega Pinball 's Mary Shelley's Frankenstein lets the player choose the game theme from either the movie soundtrack or Edgar Winter's rock anthem "Frankenstein".
Stern Pinball 's Harley Davidson games play instrumental versions of "Born to Be Wild" and "Bad to the Bone".
Ghostbusters Pinball plays an instrumental version of the theme song throughout the game. though the montage music from the first movie kicks in during multiball.
The main theme for Maverick The Movie is Clint Black 's "A Good Run of Bad Luck".
Last Action Hero plays "Big Gun" by AC/DC, "Angry Again" by Megadeth , and "Real World" by Queensr�che .
Dutch Pinball's The Big Lebowski includes songs from the actual movie soundtrack, including Bob Dylan�s "The Man in Me," Kenny Rogers' "Just Dropped In," and Santana's "Oye Como Va."
Game of Thrones features the title theme from the television series.
Professional Wrestling
Pro Wrestling This Week, a syndicated wrestling program in the late 1980's with Gordon Solie and Joe Pedicino, used the intro to the Eddie Murphy hit "Party All the Time" (Which was also the theme for Knoxville, TN's Continental Championship Wrestling).
Heck, lots of local Pro Wrestling shows used well-known songs as their themes. WWE used to use Michael Jackson 's "Thriller", the Pointer Sisters' "Jump", and later Animotion's "Obsession" as themes. And Memphis' CWA Promotion used a techno version of "Also Sprach Zarathustra."
WWE has used several "real" hard-rock and heavy-metal songs as theme tunes for their various programs, including Marilyn Manson's "The Beautiful People" and Papa Roach's "To Be Loved". When they don't use a real song, they often use a Thematic Theme Tune recorded by a popular artist (such as Smackdown's theme, "Rise Up" recorded by Drowning Pool, and Raw's former theme, "Across the Nation" by Union Underground)
This was pretty much the case for most wrestlers' entrance themes, until the music industry started cracking down on "unauthorized use" of copyrighted music and demanding royalties. After that, in all but a few exceptions (Ex. Hulk Hogan shelled out of his own pocket for the rights to "Voodoo Child"), organizations either switched to a Suspiciously Similar Song version of songs ( Sting 's late run WCW music was Metallica 's "Seek And Destroy" with the serial numbers filed off), original tunes, or public domain ("Macho Man" Randy Savage 's use of "Pomp And Circumstance").
Speaking of public domain entrance music... for most of his career throughout multiple promotions, Ric Flair has used the opening "Dawn" section of Richard Strauss' Also sprach Zarathustra, best known for its use in 2001: A Space Odyssey . See the "Real Life" folder for another notable use of the tune.
Examples in the mid-1980s WWF included Survivor 's "Eye of the Tiger" for Hogan, Queen 's "Another One Bites the Dust" for the Junkyard Dog , Cyndi Lauper's "Girls Just Want to Have Fun" for Lauper's protege Wendi Richter, and Bruce Springsteen's "Born in the USA" for the U.S. Express (Mike Rotunda and Barry Windham , real-life brothers-in-law). The first few WrestleMania events also used real songs, including Phil Collins and Phillip Bailey's "Easy Lover" for the first WrestleMania, and Aretha Franklin's "Who's Zoomin' Who" for WrestleMania III. Also, "Ravishing" Rick Rude used "The Stripper" by David Rose as his entrance theme during his "chippendale" gimmick.
The biggest exception would be ECW , who continued to use real songs as entrance themes as part of their image as an "outlaw organization". Even their TNN/SpikeTV theme counted (White Zombie's "More Human Than Human").
CM Punk started using "Cult of Personality" by Living Colour during the "Summer of Punk" in Ring Of Honor and eventually returned to using that, with people in the industry remarking that since Vince McMahon hates paying music royalties, it meant Punk got exactly what he wanted to re-sign for the company.
One of Hulk Hogan 's early WWF theme's was an instrumental version of Bonnie Tyler's "Ravishing".
Video Games
Many Rhythm Games live on this trope. Ranging from Konami's Bemani entries to Sega's maimai to Andamiro's Pump It Up to Namco's Taiko Drum Master to even Nintendo's Donkey Konga . Pop a coin in and/or press start and chances are there are at least a few songs in the game lifted from Anime or J Pop (or in Andamiro's case, K Pop ). Pop'n Music, maimai and Taiko Drum Master in particular are excellent examples of the trope, with a rich repertoire of Anime themes and J Pop music in their list.
An inevitable trope for Licensed Games . Usually the game will at least use the show's theme song (or in the case of a movie, the Award Bait Song ) for the opening theme. If it's based on a movie, well, expect the other songs and scores from the movie to be used in the game as well.
Both Twisted Metal : Black and Conflict: Vietnam used "Paint it Black" by The Rolling Stones .
The use of "Paint it Black" in Conflict: Vietnam might have been intentional, to promote a mood similar to and as a Shout-Out to Tour of Duty .
Burnout Paradise uses Guns N' Roses ' "Paradise City" in all its glory.
Burnout CRASH! uses "Crash" by The Primitives.
Perfect Dark Zero uses real songs by Morisson Poe for its opening and ending themes; "Glitter Girl (Evil Side)" and "Pearl Necklace", respectively. The Nightclub Stakeout mission features Kepi & Kat's "Limelight".
Cool Spot used The Surfaris' "Wipe Out" as its opening theme.
Urban Chaos: Riot Response used Metro Riot's "Modern Romance" as its intro and main menu music. The riff is fitting, but the lyrics are about STDs and rejecting love.
Here's a somewhat obscure one: Did you know that the main theme from Frogger is the original Japanese opening theme from the anime Rascal The Raccoon ? See for yourself here.
Naturally, this one wouldn't have been obscure to Japanese kids who watched the cartoon, but since the show's theme was changed for international release, it went completely unnoticed even in other countries where the show aired.
Frogger plays the Japanese folk tune Inu No Omawarisan when starting. Again, this is an obscure song outside of Japan. However, it also play Yankee Doodle and Camptown Races, both which are much more recognized worldwide.
Additionally, among the little jingles that play when you safely guide the frogs to their homes, three of them are snippets of other anime themes. They are "Oshiete" from Heidi, Girl of the Alps, "Hana no Ko Lunlun", from the show of the same name (split into two jingles), and "Ore wa Arthur" from Moero Arthur: Hakuba no Ouji.
Rock 'N Roll Racing , as the name suggests, used a number of actual classic rock songs: George Thorogood's "Bad to the Bone", Black Sabbath's "Paranoid", Deep Purple's "Highway Star", Henry Mancini's "Peter Gunn" (also used in Spy Hunter), and Steppenwolf's "Born to be Wild". Admittedly, since it was an SNES game, they were instrumental arrangements, but they were arrangements that pushed the SNES' sound chip to its limits (largely thanks to Tim Follin's sound programming).
Even more impressive was that he did this without the manual, and actually did a better job than the people who developed the program Tim used. When Shigeru Miyamoto heard it he wanted to know how it was done.
The Genesis version added Golden Earring's Radar Love.
The Need for Speed series had many theme songs. The first time a theme song was used was in Hot Pursuit 2 with two songs by Hot Action Cop: "Goin' Down on It" and "Fever for the Flava".
Underground 1, uses "Get Low" by Lil Jon and The Eastside Boyz and Ying Yang Twins as its theme song.
Underground 2 uses "Riders on the Storm (Fredwreck Remix)" by Snoop Dogg and The Doors as its theme song.
Most Wanted 2005 has two theme songs: "Nine Thou (Grant Mohrman Superstars Remix)" by Styles of Beyond, and a specifically made song, "Shapeshifter" by Celldweller and Styles of Beyond.
Carbon has as theme song "Bounce" by Dynamite MC.
ProStreet didn't have a specific theme song, but many of the most recognizable songs in the game were made by Dutch musician Junkie XL. The most known of these songs is "Castellated Nut", as it had an appearance in World, thanks to the Mitsubishi Eclipse ELITE.
Undercover, like ProStreet, didn't have a specific theme song, but by far the most recognizable songs of the soundtrack are Combichrist's remix of "Never Wanted To Dance" by Mindless Self Indulgence and "The Mark Has Been Made" by Nine Inch Nails .
Shift had as theme song "Kalemba Wegue Wegue" by Buraka Som Sistema and Pongolove.
Nitro had as theme song "Code of the Road" by Danko Jones.
Hot Pursuit 2010 had "Edge of the Earth" by 30 Seconds to Mars .
Shift 2: Unleashed had "Night of the Hunter", also by 30 Seconds to Mars as its theme song.
Most Wanted 2012 had "Butterflies & Hurricanes" by Muse .
Rivals has "Troublemaker" by Haezer, and "Lootin' in London" by RDGLDGRN.
Finally, the 2015 reboot has "Night Riders" by Major Lazer, Travi$ Scott, 2 Chainz, Pusha T, and Mad Cobra.
Fat Princess has, of course, "Baby Got Back" by Sir Mix-a-Lot , which is heard as the credits song.
SSX Tricky uses "It's Tricky" by Run-D.M.C. .
The arcade game Bomb Jack uses the ending theme from Spoon Oba-san (the anime version of Mrs Pepperpot ) as the first round theme. The second round theme is The Beatles ' "Lady Madonna."
The C64 version likewise used Magnetic Fields Part II, and it's sequel used the ThunderCats (1985) theme.
When you get an extra life in the arcade game Mr. Do! , the round (or "scene" as the case may be) is cleared and you see an intermission with the Astro Boy theme playing in the background.
Every FIFA game since Road to World Cup '98 has had a soundtrack of popular contemporary music including one of these.
"Getting Away with Murder" by Papa Roach from Mech Assault 2.
With "Right Now" by Korn being used for the final boss.
It's become somewhat of a tradition in the Borderlands series for each game to have one of these.
Borderlands uses Cage the Elephant's "Ain't No Rest For The Wicked" as the game theme in both the opening video and commercial trailers. It fits the setting quite well, and is quite the Ear Worm to boot. Champion's "No Heaven" is also used in one of the trailers and during the end credits.
Borderlands 2 uses "Short Change Hero" by The Heavy in its opening and the same band's other recognizable song, "How You Like Me Now?", in the credits.
Borderlands: The Pre-Sequel! uses "Black Dragon" by The Vines for it's opening and "What Makes A Good Man" by The Heavy for it's credits.
Each episode of Tales from the Borderlands uses a different song for it's opening and credits theme.
Zer 0 Sum uses "Busy Earnin'" by Jungle.
Atlas Shrugged uses "Kiss the Sky" by Shawn Lee's Ping Pong Orchestra.
Catch a Ride uses "Pieces of the People We Love" by The Rapture.
Escape Plan Bravo uses "To the Top" by Twin Shadow.
Vault of the Traveler uses "Retrograde" by James Blake for its intro, and "My Silver Lining" by First Aid Kit for its credits.
inFAMOUS features Silent Melody
by Working For a Nuclear Free City.
The two trailers for the third game in the series - inFAMOUS: Second Son - heavily feature Dead Sara's cover of Nirvana's Heart-Shaped Box. Not surprising, considering the game is the first to be set in a real city: Seattle.
Similar to Borderlands 2 , Knack also uses How You Like Me Now? in it's credits.
Omega Boost has this in spades: The Japanese release features "Shade" by Feeder, in US, "Otsegolation" by Static-X, and in Europe, "Fly" by Loudmouth. And this is just the openings. It has three diferent endings as well: "Dip in the pool" by Ismeel (apparently a Japanese Enka), "Dreamer" by Cast, and "The Road" by Loudmouth.
Although in the AUS version they only used Dreamer for some reason. Plus it seems to be a recording of the song specifically for the game, when you listen to it from the cd's and so forth it sounds completely different.
The American version of R-Type Final uses "Piano Smasher" by the Blue Man Group as its credits theme.
Scarface: The World is Yours features a version of "Burning Inside" by Ministry as its theme song for the movie-style opening credits.
A number of Bitmap Brothers games in the late 80s and early 90s used music from Rhythm King artists:
Xenon 2 Megablast used "Megablast (Hip Hop On Precinct 13)" by Bomb the Bass.
Magic Pockets used "Doin' The Do" by Betty Boo.
Not many people were aware that the opening theme for Gods , Into the Wonderful, was written independently from the game. It was originally meant for the Nation XII's album Electrofear.
Tony Hawk : RIDE which brought the series out with a musical bang with The Meters' "Cissy Strut".
Bayonetta also uses remixes of "Fly Me To The Moon", and the song usually only plays whenever the title character starts kicking a lot of ass.
The sequel uses "Moon River", in keeping with the moon theme.
The Gran Turismo series releases in Japan tended to open up with a variation of an original piece called "Moon Over the Castle". The European releases, however, have opened up with "Everything Must Go" by Manic Street Preachers, "My Favorite Game" by The Cardigans, "Just A Day" by Feeder and "Reason Is Treason" by Kasabian respectively.
GT 2's use of "My Favorite Game" by The Cardigans counts as a bit of Fridge Brilliance considering that the name of the album the song came from is also called Gran Turismo and the song itself was about how much the band loved playing the first game on their bus while on tour.
The US version of Gran Turismo 4 uses a choral version of Moon Over The Castle, followed by Van Halen's "Panama". It also has a techno remix of Moon Over The Castle.
GT 3 used "Are You Gonna Go My Way" and "Again" by Lenny Kravitz for its opening and ending themes, respectively.
GT 5 instead, in the American and European releases, used "Planetary (GO!)" by My Chemical Romance .
GT 6 uses, instead, an original song: "All My Life" by Daiki Kasho.
In the Forza series:
Motorsport 2 had "Rockstar (Jason Nevins Remix)" by N.E.R.D.
Motorsport 3 had "Tick Tick Boom" by The Hives .
Motorsport 4 had "It Starts" by Alex Metric.
Horizon has "Language" by Porter Robinson.
Horizon 2 has "Nocturne" by Keeno. Forza Horizon 2 Presents Fast & Furious uses "Get Low" by Dillon Francis and DJ Snake.
Horizon 3 features "Ingrid Is A Hybrid" by Dusky.
Wolfenstein 3D uses "Horst Wessel Lied", the Nazi national anthem, as its theme tune.
Sled Storm, at least the PS1 version, used Rob Zombie's "Dragula" (Hot Rod Herman remix).
The first version of the arcade game Pengo features the late 60's-early 70's electronic instrumental "Popcorn" which was famously (though not originally) recorded by a group called "Hot Butter" in 1972. A later version used an original composed tune.
"Popcorn" was also used as the background music for the Shareware PC game Digger (itself a clone of Dig-Dug).
In Parappa The Rapper , the intro to the fourth stage plays a slightly slow-tempo snippet of "Tijuana Taxi" by Herb Alpert and the Tijuana Brass. It can be heard after the "I gotta believe" part during the part where the announcer announces Cheap Cheap the Cooking Chicken (Parappa's opponent in this stage).
The rock band Journey got their own video game during The Golden Age of Video Games , which consists entirely of these (in electronic form; this is an important point). Moreover, a tape drive in the machine plays an edited, looped version of "Separate Ways (Worlds Apart)" (not an electronic rendition, but the real song) during the bonus stage.
The SNK arcade game TNK III uses "The Yellow Rose of Texas" for its opening theme, and part of "When Johnny Comes Marching Home" for the Game Over jingle.
Ace Combat 5: The Unsung War used Puddle of Mudd 's "Blurry" in the trailer and over the end credits.
The English-language versions of Final Fantasy XIII use Leona Lewis' "My Hands" in the trailer, and during the final cutscene and end credits.
Taito's Wild Western uses Stan Jones' "Ghost Riders in the Sky" for its main theme. Which in turn, is a a Suspiciously Similar Song version of the public domain song "When Johnny Comes Marching Home".
Both the Medal of Honor 2010 Continuity Reboot and Gundam Extreme Vs. use "The Catalyst" by Linkin Park ; the band has noted themselves as being both video game players and Gundam fans, hence why they let Electronic Arts and Namco Bandai go ahead.
An obscure arcade game by Midway called Domino Man uses Scott Joplin's Maple Leaf Rag as its main theme.
Which was also used in speaker bleep form in the DOS pseudo-3D Pac-Man clone 3-Demon, along with "The Entertainer".
It also appeares in the Pinball game The Champion Pub .
The Iron Helix used the Xorcist song of the same name. The rest of the soundtrack was also by Peter Stone .
Call of Duty: Black Ops uses Eminem 's "Won't Back Down" as its theme.
All of the canonical Fallout games have this: "Maybe" by the Ink Spots for the original , "A Kiss to Build a Dream On" by Louis Armstrong for Fallout 2 , "I Don't Want to Set the World on Fire" by the Ink Spots for Fallout 3 , "Blue Moon" sung by Frank Sinatra (originally by Richard Rodgers and Lorenz Hart) for Fallout: New Vegas , and "The Wanderer" by Dion for Fallout 4 .
Fallout 3 and Fallout: New Vegas feature "radio stations" one can listen to; in each, there's a "news station" that features "announcements" related to the player's progress through the game, but features real music in between announcements (in Fallout 3, Galaxy News Radio plays mostly 1940s "pop" while Enclave Radio plays mainly American patriotic standards; in Fallout New Vegas, New Vegas Radio plays 1950's songs while Mojave Music and Black Mountain Radio play country/western songs. Old World Blues adds the Mysterious Broadcast, which plays jazz and, you guessed it, blues.)
The MSX and NES/Vs. versions of The Goonies video game feature Cyndi Lauper's "The Goonies R Good Enough" from the movie in question.
Wizard Of Wor used the "Danger Ahead" portion of the Dragnet theme to open each stage. If the player is able to shoot the Worluk, the "DOUBLE SCORE DUNGEON" screen will appear, and the fifth note of the theme will play.
Both the arcade and NES versions of Punch-Out!! note As well as the arcade version's sequel Super Punch-Out (not to be confused with the Super NES game). use the " Look Sharp/Be Sharp March
" by Mahlon Merrick for the opening theme, and the character's themes are all based on real folk songs from their countries of origin (although this part only happens in the NES version).
Though it should be obvious, each of the Rock Band games has one of the songs from the game play during the opening cutscene from each iteration. The original Rock Band had "Highway Star" by Deep Purple , Rock Band 2 had a rerecording of "Hello There" by Cheap Trick , and Rock Band 3 has "Break On Through (To the Other Side)" by The Doors . In addition, both Green Day Rock Band and The Beatles Rock Band had mashups of several songs by each respective band, and Lego Rock Band used "Grace" by Super Grass .
Jet Set Radio Future had a remix of "Concept of Love" by Hideki Naganuma, as well as a soundtrack mostly comprised of remixes from the first game.
Primal uses 16Volt's "And I Go" for the theme music, along with instrumental versions and edits of other 16Volt songs for the game's soundtrack.
Inverted in the case of Silent Hill 2 . One of the songs from the game, "Promise (Reprise)" was used by the Philadelphia Eagles' splash page
on their official website.
In a crossover with Public Domain Soundtrack , the original Mario Bros. used the first phrase of Mozart's "Eine Kleine Nachtmusik" for its game start jingle.
Spy Hunter had the theme from "Peter Gunn" as its theme, which was then updated into "The Spy Hunter Theme" by Saliva for the PS2/XBOX installment. The sequel to the PS2/XBOX game had "Dark Carnival", a Bond-esque tune by Vanessa Carlton.
Enter the Matrix used Evanescence 's "Going Under" as its credits theme.
Subverted with Sonic And Sega All Stars Racing . In the DS version, part of the credits was accompanied by "Into the Wind" by Crush 40 , which was off of their album Thrill of the Feel when they were known as Sons of Angels (that is, before they got busted for using another band's name. Also, in both versions, the Ending Theme , "So Much More..." by British pop singer Bentley Jones, was released on a later EP of the same name.
The opening theme and the Final Boss battle's soundtrack of NecroVisioN , is "Preliator" by Globus.
Going by the trailers, Duke Nukem returns to kick some alien ass to the tune of The Prodigy 's aptly-named song, Invaders Must Die.
The first Homeworld game had the titular progressive rock song from Yes as the credits theme, to great effect due to how closely the lyrics match the game's central theme.
Yes wrote the song because they really, really liked the premise of the game, and the devs asked them if they could use it.
In an unusual subversion, Mass Effect 's use of "M4 (Part II)" from Faunts as credits theme is what catapulted the group into fame in the first place.
Another Faunts song, "Das Malefitz", is used for Mass Effect 3 's closing credits.
An in-universe example: the romantic theme for Mass Effect 3 is called I Was Lost Without You
. In the Citadel DLC for the game, Shepard and Ta li watch Fleet and Flotilla, the romantic theme for the movie is the same tune.
Similarly, from the same DLC, Liara plays "Vigil" from Mass Effect on the piano when she visits Shepard's apartment.
Putty used the Joe 90 theme song as its opening theme.
Legacy of Kain : Soul Reaver used "Ozar Midrashim" by Information Society, from their 1997 album Don't Be Afraid.
Speed Punks uses "Travelling Without Moving" by Jamiroquai as its opening theme.
Phantom Dust prominently features classical music mixed into an ambient-industrial tone, to fit the mood of the game.
Benzaie 's Hardcorener uses the arranged version of "Roar of the Twin Dragons" by Kazuhiro Hara and Nobuhito Tanahashi from the album Double Dragon II: The Revenge.
All of Brad Jones ' current shows use Theme Tunes from 1980s TV shows:
The Pierre Kirby episodes - "Jet Set" by Alphaville
Kung Tai Ted - The Master (but not "Master Ninja Theme Song"!)
The Big Box - Automan
Brad Tries... - Newhart ''
80's Dan - Probably the most obscure of all, this one is from a James D Parriot/Universal cop show called Hawaiian Heat . It ran on ABC in 1984 and flopped horribly.
Brad and Jerrid - Bay City Blues, another extremely obscure one, and one of many TV shows from NBC's infamous "no-hitter" year of 1983-84 where none of their new fall shows lasted a full season.
That Dude in the Suede 's theme songs are all Real Song Theme Tunes.
They're Having An Evangelion Moment! - Unknown Song.
Animénia - How Do You Have Your Tea? by Urbantramper
AMV Heaven - Smack My Bitch Up by The Prodigy
Fandom Stranger - Return of the Phantom Stranger by Rob Zombie . When it was Anime Weirdness, it used Let�s Fighting Love by DVDA
Suede Played has Airbrushed
A Prairie Home Companion uses a version of "Tishomingo Blues" with rewritten lyrics. Nobody really seems to remember the original.
The original 1970s-80s run of the show opened with Garrison Keillor singing Hank Snow's "Hello Love", a #1 country hit in 1974.
The CBC Radio international affairs program Dispatches uses "What It Is" by Mark Knopfler.
Likewise the CBC show As It Happens , syndicated in the US on PRI, uses "Curried Soul" by Moe Koffman.
Conservative talk radio seems to like this trope.
Rush Limbaugh uses the instrumental parts of "My City Was Gone" by the Pretenders as his theme.
Dr. Laura used "New Attitude" by Patti LaBelle as an opening theme.
At different times, Sean Hannity has used "Independence Day" (Let Freedom Ring) by Martina McBride and "Courtesy of the Red, White and Blue (The Angry American)" by Toby Keith .
Mark Levin uses the instrumental riff from "Somewhere I Belong" by Linkin Park . He also uses it as his closing theme, with Ray Charles ' "America the Beautiful" immediately preceding it on Fridays only.
The late-night paranormal/conspiracy radio show Coast to Coast AM uses "Chase", Giorgio Moroder 's instrumental theme from the movie Midnight Express , as its opening theme. Its closing theme is "Inca Dance", an instrumental by jazz/world music/New Age group Cusco.
Jean Shepherd opened and closed each episode of his long-running local New York radio show with "Bahn Frei" by Austrian composer Eduard Strauss.
The theme song for most The Hitchhiker's Guide to the Galaxy media is "Journey of the Sorcerer" by The Eagles . It appeared as the opening theme for the television and radio programs and appears in the scene introducing the titular guide in the 2005 film adaptation .
According to The Other Wiki , the reason "Journey of the Sorcerer" was chosen was because Douglas Adams wanted a theme song that was both futuristic-sounding and suggestive of a traveler at the same time. Adams felt that the fact that a banjo was among the instruments used to make this song gave it an "on the road, hitchhiker-esque feel".
Formula One 's theme is Fleetwood Mac 's The Chain
, when shown on the BBC - a song that has always been somewhat of an unofficial theme for the sport.
ESPN employs this trope during sports coverage. The network used "Superwoman" by Alicia Keys for the 2008 WNBA season, and Aloe Blacc's "I'm the Man" for the 2014 NFL Draft.
Many sports teams use existing songs as "fight songs" and entrance themes:
The University of Tennessee uses "Rocky Top" by The Osborne Brothers as its unofficial fight song. It's far better known than UT's official one.note "Down the Field"
Jazz standard "Tiger Rag" (AKA "Hold That Tiger") is used by multiple schools with the "Tiger" nickname, including Auburn, Clamson, LSU, Missouri and Princeton.
The "Tiger Rag" isn't the only existing song that LSU uses. It also obtained the rights to the Broadway tune "Hey, Look Me Over", gave it new lyrics, and calls its version "Hey, Fightin' Tigers". As in the case of "Rocky Top" and Tennessee, it's not the official fight song,note that would be "Fight for LSU" but is at least as well-known.
Another Broadway tune, "Step to the Rear", was given new lyrics by the University of South Carolina's head football coach and athletic director at the time, Paul Dietzel, and became the school's official fight song as "The Fighting Gamecocks Lead the Way".
Another example from South Carolina: During the pregame at home football games, the Gamecocks enter the field to the "Dawn" section of Also sprach Zarathustra (another use was mentioned in the "Professional Wrestling" folder above).
The University of Wyoming adopted the 1912 tune "Ragtime Cowboy Joe" as an unofficial school song in 1961. It went on to become one of two official fight songs, and is now the Cowboys' and Cowgirls' only official fight song.
One of the most famous sporting uses of "Enter Sandman" by Metallica is as the entrance music for Virginia Tech's football team at home games.
"Eye of the Tiger" by Survivor is used by the University of Memphis.
The New England Patriots use Ozzy Osborne's "Crazy Train" as their home entrance music.
The Chicago Bulls have long used The Alan Parsons Project 's instrumental "Sirius" as their entrance theme.
The Detroit Pistons used the opening instrumental riff from "The Final Countdown" by Europe as their entrance theme for many years.
The New York Knicks use "Come with Me", Puff Daddy's contribution to the American Godzilla remake.
This was played with in a commercial
for the Visa Check Card. The Pittsburgh Steelers come marching out on the football field to the sweet sound of Lovin' You by Minnie Riperton. Then a flashback shows why: a member of the stadium's sound crew is at a record store attempting to buy a CD of "Who Let The Dogs Out" with a personal check, but is turned down for lack of ID.
In an inversion of the trope, the British football team Everton (based in Liverpool) traditionally uses the theme music from the TV series Z Cars , which was set in Liverpool.
This trope isn't limited to teams. Major League Baseball regularly uses popular songs as entrance music for batters and closers (i.e., relief pitchers who are normally brought in to end games). Perhaps the most famous use of this was the New York Yankees' use of "Enter Sandman" as entrance music for now-retired closer Mariano Rivera.
It's also not limited to entrance music...
For example, after every home football game at West Virginia University (and at many other Mountaineers games and other WVU events), the band will play John Denver's "Take Me Home, Country Roads", long an unofficial state song and since 2014 one of several official state songs. At football games, the team will sing the song and invite the crowd to join in. (Denver himself performed the song at the 1980 opening game for the Mountaineers' current stadium.)
Some baseball teams play popular songs as rally songs during the seventh-inning stretch. One notable example is the Baltimore Orioles' use of another Denver song, "Thank God I'm a Country Boy". (Notably, shortly before his death in 1997, Denver showed up to dance on top of the Orioles' dugout during the playing of the song.)
A few visual effects and logo branding companies will utilize this trope for their reels (especially if there's more than one), normally editing the song down while they're at it:
| i don't know |
From which country does Budvar lager originate? | Home - Budějovický Budvar, n.p.
Home
1
Maturation Time
It takes a while to brew a good beer, and even longer to brew a great one. Budweiser Budvar lager acquires its mellow flavour and mild to moderate bitterness during the 90 days it spends maturing in our cool lager cellars.
3
Only the Best Ingredients
The exceptional character and consistent quality of Budweiser Budvar results from the emphasis we place on using only the best ingredients.
2
Protected Geographical Indication
Budweiser Budvar is never brewed on licence, but only in its place of origin. Consumers can be sure that every drop of their favourite beer was brewed in only one place in the world – České Budějovice.
4
Genuinely Czech Beer
The beer produced in the Budvar Brewery in České Budějovice can justifiably boast the title ‘Genuine Czech Beer’, which is, has always been and will always be our nation’s gold.
Other products
Budweiser Budvar, N.C.
Budweiser Budvar Brewery has been one of the most successful food processing enterprises in the Czech Republic in the long term. Founded in 1895 under the name of the “Czech Joint-Stock Brewery”, it brewed its first batch on 7th October 1895.
| Czech Republic |
Who was the English scientist who invented the light bulb independently of Thomas Edison in 1878? | Story of Czechvar Beer - Czechvar
Story of Czechvar Beer
Coming to you
from the Heart of Europe
Good beer has been brewed in Bohemia since time immemorial. Therefore, when founding the city České Budějovice in Bohemia (Czech Republic) in 1265, the Czech king Přemysl Otakar II did not fail to also grant to its burghers the brewing rights, i.e., the right for malting, brewing, storing and selling beer at their homes. In the following centuries, the local beer became so famous because of its quality that it gained loyal customers in imperial and royal courts.
In the course of the centuries, small home breweries were disappearing and the beer was brewed in even larger facilities. on 15 April 1895, Český akciový pivovar was founded, whose current successor, B.B.N.P. brewery, carries on the local brewing tradition.
Czechvar
...Combination of Two Words
Beer production in the new brewery started on 7 October 1895. By the next September, the brewery produced its first 51,100 hectolitres of beer, which has successfully preserved, throughout the 19th and the 20th century and until the present time, all its excellent traditional taste and properties. All of this quality is coming to you now with the beer named Czechvar. the name Czechvar is a combination of two words – „Czech“ and „pivovar“ (in English "brewery"). It is a symbolic name of a beer coming to you from the Czech lands, from a city famous for its beer.
České Budějovice
...City of Beer
Throughout the year, České Budějovice is a city of beer. During the daytime, new hectolitres of the beverage are produced there, somewhat hidden in the tumult of everyday life, to be shipped to close and faraway destinations. But if you are lucky to be in the metropolis of České Budějovice region, enjoy its hospitality and discover the home of the Czechvar beer.
Brewery tours
If you are interested in learning how a traditional craft lager Czechvar is brewed, take a guided tour of the B.B.N.P. brewery. more
| i don't know |
According to Greek mythology, who was punished in the underworld by being placed in a pool of water and afflicted with a raging thirst with the waters receding every time he tried to drink? | GL3001 by Te Aho o Te Kura Pounamu - issuu
issuu
te akoranga puÄ waitanga
classical studies
gl3001 Mythology – Background Greek and Roman Gods, Heroes and the Trojan War ncea level 3
2014/1
classical studies ncea level 3
Expected time to complete work This work will take you about 8 hours to complete. You will work towards the following standards: Achievement Standard AS9138 Classical Studies (Version 1) Demonstrate understanding of the lasting influences of the classical world on other cultures across time. Level 3, Internal Assessment 6 Credits In this booklet you will focus on these learning outcomes: •• understanding the Greek gods, the Greek heroes, the Trojan War, the Gods of Rome and the Aeneid. You will continue to work towards this standard in booklets GL3002 and GL3003.
Copyright © 2013 Board of Trustees of Te Aho o Te Kura Pounamu, Private Bag 39992, Wellington Mail Centre, Lower Hutt 5045, New Zealand. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means without the written permission of Te Aho o Te Kura Pounamu.
© te ah o o te k u ra p ou n am u
contents I
The importance of the Trojan War in the myth cycle
VI
The gods of Rome and the Dei Consentes
VII The Aeneid and its part in the myth cycle VIII Answer guide
Š te ah o o t e k ur a p o un a m u
GL3001
how to do the work When you see:
Your teacher will assess this work.
Check your answers.
You will need: •• pen and paper. Resource overview As you work through the booklets you should complete each activity and check it yourself from the Answer guide at the end of the booklet.
Copyright © 2014 Board of Trustees of Te Aho o Te Kura Pounamu, Private Bag 39992, Wellington Mail Centre, Lower Hutt 5045, New Zealand. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means without the written permission of Te Aho o Te Kura Pounamu. 2
GL3001
© te ah o o te k u ra p ou n a mu
i
Understand the categorisation of myths and the broad framework employed to understand them.
learning intention In this lesson you will:
•• examine the ways myths are categorised and placed in a framework for understanding them.
introduction
The Greeks saw myths in a historical context, stretching from the time of creation to the Trojan War and the borders of history.
what is a myth?
The word myth comes from the Greek mythos which originally meant ‘speech’ and then later came to mean ‘fable’ or ‘legend’. In this booklet we define the word myth as a story of religious or supernatural nature, which seeks to explain or rationalise one or more aspects of the world or a society. This definition distinguishes the word myth from its everyday meaning, which basically refers to any unreal, untrue or imaginary story. It is important to realise that all myths were at some stage actually believed to be true by the societies that used the myth. A myth is also distinctly different from an allegory or parable which is a story deliberately made up to illustrate some moral point but which has never been assumed to be true by anyone. Some myths describe some actual historical event, but have been embellished and refashioned by various storytellers over time so that it is impossible to tell what really happened. For example, while there was a city of Troy we are not certain about the details of the Trojan War, which is considered the final part of the Greek mythological cycle.
the purpose of mythology
Broadly speaking, myths and mythologies seek to explain the universe and all that is in it. In this respect they have a similar function to science or religion and history in modern societies. Systems of myths have provided a background that explains the origins of things so they work as historical framework for societies that have lacked the more sophisticated knowledge that is now provided by modern science.
creation myths
Creation myths provide an explanation of the origin of the universe. They are an important part of most mythological systems. Creation myths often talk about primal gods and animals, titanic struggles between opposing forces, or the death and/or dismemberment of these gods or animals as the means for the creation of the universe.
© te ah o o t e k ur a p o un a m u
GL3001
what is a myth?
explanation of natural events
Mythologies also seek to explain everyday natural things or phenomena. The god Apollo drove his fiery chariot which illuminated everything and gave him the title ‘Helios’ (sun god) Apollo, and this provided an explanation of the rising of the sun each day. It also explained why it progressed across the sky and gave a reason for its setting in the evening. Similarly, the Māori of New Zealand attributed the morning dew to the tears of the god Rangi (Heaven) for the goddess Papa (Earth) from whom he was separated. This class of myth is sometimes called a nature myth.
explanation of human events and practices
Myths are also often used to explain human institutions and practices as well. For example, the Greek hero Pelops was reputed to have started the Olympic Games after Poseidon helped him win the hand of Hippodameia in a chariot race. This type of myth seeks to explain the beginnings of things and is called finding its etiological base. It seeks to account for some human institution through a myth.
god-centred myths
Another class of myth is the god-centred myth. As theos is the Greek word for god, this is called the theogenic myth. This sets out to find out the relationships between various gods and other mythical beings that are mentioned in previously existing myths. Theogenic myths are thus secondary in their purpose, setting out to provide a reinforcement or framework for an existing system of myths. The best known example of this is the Theogeny of Hesiod which explains the creation of the world, the war of the god and the titans, and the creation of the heroes. It should not be thought that the functions of myths as outlined above are mutually exclusive. For example, creation myths by their very nature are usually theogenic as well. Myths can serve many purposes. They are a rich resource for the enjoyment of all mankind and have been a source of inspiration for writers and artists throughout time. Although they might seem fantastic and unreal to our modern eyes, this should not prevent us from enjoying them. Uranus — Gaea Cronus — Rhea Hestia
Hades
Aphrodite © te ah o o te k u ra p ou n a mu
what is a myth?
what are the messages of myths?
It is impossible to find any single reason for the origin of myths, and thus the messages they carry vary. To summarise, here are some of the reasons why the Greek myths may have come into being: •• They explain the origins of the world. In the next chapter we will trace these origins from Chaos to Zeus. •• Nature myths explain obvious phenomena such as day and night, the cycle of the seasons, rain, storms, earthquakes or eclipses. To the Greeks all such events were caused by the gods. •• Some myths explain and support existing customs or rituals. All societies have structures and rituals concerned with birth, marriage, death, the conservation of property and the family, the treatment of women, the maintenance of crop and herd fertility, and other areas vital to that society. Many of these are explained in myths – the gods did this or demand that, so it must be right. •• Some myths may reflect human dreams and wishes. This is perhaps the most controversial theory, and we leave it to you to think about. Does the story of Oedipus reflect men’s secret desires to get rid of their tyrannical father and marry the first woman they ever loved, namely their mother? Do the countless tales of Zeus and other gods raping females – goddesses, nymphs, women – reflect men’s preoccupation with sex? Do stories like that of Narcissus, who wasted away and died because he couldn’t stop looking at his own reflection, represent the self-love of a certain type of person? And, very simply, do the tales of heroes reflect every man’s desire to be superman?
what kind of society produces myths?
Most cultures have myths, and their origins are almost always to be found in a time when writing was not generally used or was nonexistent, when belief in the gods was genuine, and when there were no means of scientifically explaining natural phenomena. People believed all events had a divine origin, and mythical tales were the main means of passing on beliefs and instructions from one generation to the next. Because communication was verbal and not written, myths changed and developed over generations, often becoming very complex. There was no single correct version and, as we shall see, variations in detail did not worry storytellers or their audience. 1A
Why were myths created? What purposes do they serve? List as many reasons and purposes as you can think of. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
Halicarnassus
what is a myth?
The map shows the Aegean sea, and the four areas important in the development of Greek religion and myth: 1. The coast of Asia Minor, on the right of the map, with its major city Troy. 2. The Cycladic islands. 3. Crete, south of Greece, at the bottom of the map. 4. Mainland Greece, which can be subdivided into: •• the Peloponnese (the southern peninsula) •• Attica and Boetia (the central region) •• Thessaly and Macedonia (the northern land bridge to Europe).
historical background to greek mythology the stone age inhabitants of the aegean: pre-3000 bce
By the end of the New Stone Age (Neolithic Era), around 3000 BCE, all these areas were inhabited by people with a similar way of life and probably similar language and ethnic origins. They actively worshipped spirits – mainly female – to ensure the fertility of crops, animals and human beings, and tried to placate destructive spirits – mainly male – to avoid storms, shipwreck, earthquakes and similar disasters.
the early bronze age: 3000–2000 bce
From 3000 BCE, techniques of working metal gradually spread through these lands and islands of the Aegean sea and bronze tools and weapons were widely used. Around 2500 BCE a flourishing civilisation began to develop in most areas, worshipping a general fertility goddess (Mother or Earth goddess). Around 2000 BCE, was a general upheaval on the Asian mainland resulted in a number of different peoples moving westward. The Cycladic islands received a fairly civilised group of settlers who brought the advanced technique of making pottery on the fast wheel – a useful skill soon adopted in Crete and Greece. Asia Minor received the people who would, in several hundred years’ time, be defeated at Troy by the Greeks. The Greek mainland also suffered several waves of invaders who came down the Greek peninsula from the north, rather than by sea. These new folk were less culturally advanced than the inhabitants they defeated. They were a warlike people, strongly patriarchal and worshippers of mainly male divinities who lived not in the earth but on the mountaintops and who ruled the skies. Homer called these people the Achaeans, and scholars use this name to distinguish them from later invaders. They were also the first to speak the language which would one day be Greek.
© te ah o o t e k ur a p o un a m u
GL3001
what is a myth?
the middle bronze age: 2000–1450 bce
The island of Crete does not seem to have been occupied by invaders at this time, and its civilisation progressed without interruption. Around 2000 BCE there seems to have been a dramatic increase in its trade and wealth and the first large palaces were built at a number of sites, the largest at Knossos. No walls were needed to protect these settlements, which suggests that a powerful fleet enforced security as well as trading with countries all around the Mediterranean. The result was a brilliant and apparently peaceful civilisation with a high degree of skill in arts and crafts. We usually call it ‘Minoan’ after the legendary king Minos. The Minoans worshipped many gods, but the greatest was the mother goddess who ensured the fertility of the earth.
the late bronze age: 1450–1100 bce
Mycenaean civilisation was now dominant in the Mediterranean, reaching its peak around 1300 BCE. It was a basically unstable society, with a large parasitic nobility which preferred to seize the wealth of others in warfare rather than to create its own. According to Homer’s account of the Trojan war, describing a Greek hero as a ‘sacker of cities’ was paying him a great compliment.
the dark ages: 1100–800 bce
During this time another group of Greek-speaking people, the Dorians, took advantage of the general confusion to move down through Greece, eventually settling in the Peloponnese and Crete. To get away from them, many mainland Greeks migrated eastward to the west coast of Asia Minor and the islands near it. The Dorians had developed fewer skills than the Achaean Greeks, and as in 2000 BCE the progress towards civilisation was set back several hundred years.
the creation of greek myths However, it was during these years that Greek mythology was largely created. The art of writing was also lost. Instead, those recalling the past developed the skills of creating, memorising and retelling stories aloud over many generations. These storytellers wove together their ideas about the origins of the world and humankind, their beliefs about the gods of the sky and the goddesses of the earth, and their memories of a glorious past. They took the ideas, beliefs, folk-tales and memories from all parts of the Greek world, adding and changing details as they pleased to suit their audiences.
when were greek myths written down?
Greek myths were free to flourish in all their many versions until writing became general again in the seventh century BCE. Even then they were not set down in full or in final versions, as Greek writers for several centuries tended to use only small parts of the full mythology or simply made allusions to the stories everyone knew. Thus Homer’s two great poems, the Iliad and the Odyssey, tell a very small part of the stories of Troy.
8
© te ah o o te k u ra p ou n a mu
what is a myth?
In Classical times, powerful states such as Athens or Sparta added or changed small details of the old myths to reflect glory on their ancestors. But by the fourth century the myths were no longer living, developing stories, and after this time Hellenistic and Roman writers told the tales in the forms we have today. You need to be aware as you read that myths can vary greatly in details, and this never bothered the Greeks, who simply adopted whichever version they wanted. Draw a time line of events between 3000 BCE and 0 CE (Current Era) which were relevant to the development of Greek myths. Check your answers.
jan gould
1B
what do the terms classical and hellenistic refer to? In general the period between the end of the Dark Ages and the defeat of the Persian invasion of Greece in 490–89 is called the Archaic (early) period. The Classical period extends from the end of the Persian Wars to the death of Alexander the Great in 323. Alexander conquered a vast empire, extending Greek culture over the eastern Mediterranean and Asia Minor. The civilisation which flourished after his death is called Hellenistic. Finally, the Greek-speaking lands were engulfed by the growing power of Rome from the second century BCE onwards, becoming part of the Roman Empire.
Š te ah o o t e k ur a p o un a m u
GL3001
what is a myth?
how has greek mythology come to new zealand?
The Romans had very little mythology of their own, and by and large took over the Greek myths without much alteration. The European countries most influenced by Rome absorbed Greek myths as part of their cultural heritage. Some European countries have myths, legends and folk tales of their own, but much of New Zealand’s cultural heritage comes from England, which has almost no mythology – king Arthur and his Knights of the Round Table being a rare example. In English literature and art, Classical mythology was part of the public school curriculum in terms of Greek and Latin. Among this small percentage of the population there was a great awareness of its aspects.
what other mythologies can be found in new zealand?
te kura
New Zealanders of English descent may lack a mythology of their own, but Welsh and Irish myths are both rich and complex. New Zealanders of other origins – such as Polynesian, Scandinavian or Indian – may know something of their homelands’ extensive mythologies. And New Zealand is extremely lucky to have preserved Māori myths, which are complex, fascinating and truly indigenous. As you read, you may be interested to compare Greek myths with any other myth cycles you know.
10
© te ah o o te k u ra p ou n a mu
ii
Wave pattern
the greek gods and their functions learning outcome
Understand the Greek Gods, their functions and relationships to each other, and their importance in the eyes of man.
learning intention In this lesson you will:
•• examine the Greek gods and their functions and relationships that gave them an importance in the eyes of man.
introduction
The ancient Greeks had varied ideas about the origins of the world, and about the gods and goddesses which first inhabited that world.
what were greek divinities like?
Originally, the Greeks thought of their gods as spirits inhabiting land, sea or sky. Eventually some came to be much more important than others, and whenever the Greeks met a similar god worshipped by another people, they simply considered it the same god as their own under another name. Their own sky god was Zeus, and it was easy to equate him with the Roman sky god Jupiter or the Egyptian god Ammon. The important gods were anthropomorphic – that is, of human shape, though they were able to change shape if they pleased. Minor spirits were often only partly human – Pan and the satyrs of the woodland were partly horse or goat. The gods were not only human in shape, but also had human personalities. They were larger in size, more beautiful, powerful and, of course, immortal – but in a moral sense they were no better than human beings. The idea of a god or the gods being virtuous and worrying about whether humans lived good or evil lives did not really develop until the Classical period, well after the creation of the myths. The gods were not ‘good’, and can in no way be equated with the Christian idea of a supremely good God. Neither, however, were they evil, like the idea of Satan. They simply did as they pleased, exercising power without responsibility, and as far as humans were concerned they might be friendly, indifferent, or actively hostile. Moreover, their attitude could change at any time. As the gods were responsible for causing every event, humans had to try to make them friendly rather than otherwise, and this is the main point of Greek rituals. The Greeks offered their gods sacrifices, gifts and prayers, firstly to avoid offending them and secondly to win active support. A virtuous life got you nowhere, since disasters often overtook the good while the evil person might flourish. Even frequent offerings to the gods were no guarantee of favour, but it was the best an ordinary human could do. The gods were believed to cause everything that happened but they were, in fact, free to tinker only with minor details. Some things were unchangeable, like human mortality. The general scheme of things was laid down by Fate, which, for example, decreed that Troy must fall to the Greeks. But the gods could change small details. Should the siege of Troy last six months? Ten years? Twenty years? Should a hero die there or at a later date? The gods were responsible for the ‘fine print’ and this meant humans must honour them constantly.
© te ah o o t e k ur a p o un a m u
GL3001
the greek gods and their functions
greek gods
People paid honour to the gods or goddesses who could influence whatever area they were active in – to Poseidon for a safe sea voyage, Demeter for a good grain harvest, Hera for safe pregnancy and childbirth, or possibly to some small local spirits who might be helpful. All gods had their place and their sphere of influence, and humans were free to honour whom they pleased – though gods could be very offended if they were ignored. People were also free to believe what they pleased, as there were no sacred writings and no dogma which must be believed. Belief in the gods was required, but little more. Thus, there were no warring religious sects in the Greek world, and there was a notable tolerance of other peoples’ beliefs. Finally, we consider nowadays that a person’s religion is a personal and private matter, but in the Greek world it was mainly a state affair, with public worship to ensure the good of the whole community.
the creation myths
The gods of the Greeks were very similar to human beings, and one indication of this is the fact that they did not create the world. It is not really clear, however, just how the world did come into existence. Here is one story. In the beginning there was Chaos, a great void or ‘nothingness’. Somehow Mother Earth, Gaea, emerged from Chaos, as did Darkness (Erebus) and Night. Some say Eros (Love) also emerged from Chaos, while others say he was born from Night. In any case, he was an early creation, for without Eros there would have been no new life. Gaea gave birth to Oceanus, which then surrounded her with his waters. Her next child was Uranus, the Heavens or Sky, who showered her with fertile rain so she bore grass, trees, flowers, insects, birds and animals. Gaea and Uranus also produced a number of children called the Titans – Cronos was the most important of these – and a rather strange collection of giants and monsters, such as the Cyclopes, who will appear later. Uranus was a tyrannical, jealous father. He refused to let his children be born, enclosing them inside Mother Earth. Gaea was angry and persuaded her youngest son, the Titan Cronos, to attack his father in revenge. Cronos used a flint sickle to castrate his father, hurling the severed parts away from him. Drops of blood fell on Earth, who promptly gave birth to more giants, as well as the Furies who would in the future avenge crimes of matricide, patricide and perjury. It is not clear what happened to Uranus, but he now disappears from the scene to be replaced by his son Cronos. Cronos mated with his sister Rhea, also a child of Gaea and Uranus, but fearing a prophecy that he would be overthrown by one of his children he swallowed each of Rhea’s children at birth. Rhea eventually tired of this and when her sixth child, Zeus, was born she gave Cronos a stone to swallow, and entrusted the baby to Mother Earth and some nymphs to rear in a cave on Mt Dicte in Crete.
12
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
what happened to rhea’s children?
Eventually Zeus grew to manhood among the shepherds on Mt Ida on Crete, and then managed to give his father a drink which made him vomit up his swallowed siblings. Hestia, Demeter, Hera, Hades and Poseidon emerged unhurt and fully grown, to join their brother in a war against Cronos and his brother Titans. The war lasted 10 years, until Zeus released some of Earth’s children, the Cyclopes, who had been imprisoned deep in the earth by their father Uranus. The Cyclopes gave Zeus the thunderbolt, Poseidon his trident (a large fork) and Hades a helmet of darkness, and eventually the Titans were defeated and imprisoned in Tartarus.
thomas hope
The stories of Zeus’ childhood are many – how his cradle was hung on a tree so Cronos could not find him in heaven, in earth or in the sea; how he ate honey and was suckled by the goat-nymph Amaltheia, whose image he set among the stars as Capricorn and whose skin was worn by his daughter Athene; and how the sons of Rhea, the Curetes, shouted and clashed their spears against their shields to drown Zeus’ crying so Cronos wouldn’t find him.
Zeus.
Zeus later had to defeat other children of Gaea, the giants and Typhon, a winged serpentman. Eventually he overcame all opposition, including Gaea herself, and set himself up on Mt Olympus to rule the earth and sky, while his brothers took other kingdoms – Poseidon the sea and Hades the underworld. The battle with the giants was frequently represented in classical Greek sculpture.
zeus – king of the gods
Zeus was the greatest god to the Greeks, lord of the sky and controller of the weather. He was also lord of the earth and of humankind, connected with all human activities. In Greek art he is usually shown as a large, bearded, middle-aged male figure. Often he holds his thunderbolt and his aegis (shield), which terrified his enemies when shaken. Apart from these early battles, most of the stories in which Zeus is the central character are concerned with his love affairs. As the Greeks were monogamous he could have only one legal wife, and this was his sister Hera who at first wanted nothing to do with him. Eventually he visited her as a bedraggled cuckoo, and when she took pity on him and nursed him to warm him, he regained his true shape, raped her and shamed her into marrying him. Unfortunately for Hera, Zeus considered himself above all laws – including the bonds of marriage – and his seductions of other females were endless.
© te ah o o t e k ur a p o un a m u
GL3001
13
the greek gods and their functions
One of the earliest of these was Metis, the wise Titaness, who turned into many shapes to avoid Zeus but was finally caught and raped. An Oracle declared that if Metis were made pregnant a second time she would bear a son who would depose Zeus, just as Zeus had deposed Cronos, and Cronos Uranus. So Zeus swallowed Metis to get rid of her, but he could not get rid of the child she was carrying. One day Zeus had a raging headache and to ease it Hephaestus opened his skull with an axe. From the opening sprang his daughter, Athene, fully grown and fully armed. She inherited the power of her father and the wisdom of her mother, and we shall hear much more of her. Zeus also raped his mother Rhea and his sister Demeter, the goddess of corn. (As a result, Demeter gave birth to Persephone.) The Titanesses Mnemosyne (Memory), Maia and Leto respectively bore his daughters the nine Muses, his son Hermes, and the twins Artemis and Apollo. Mortal women he seduced include Semele, mother of Dionysus; Europa, mother of Minos, Rhadamanthos and Sarpedon; Alcmene who bore Heracles; Leda, the mother of Helen and Polydeuces; and Danae, who bore Perseus.
why did zeus have so many affairs?
One suggestion is that Zeus reflects the relative power of male and female at the time the myths evolved. Zeus himself represents the ultimate male fantasy of irresponsible lust. He could rape whom he pleased without suffering any ill consequences. Whereas most men are restricted in the indulgence of lust by the consequences, clearly the supreme god could do and did do what men could only dream about. It is also noticeable that most acts of sex involved rape. The Greeks were not so puritanical as to believe that women couldn’t – or even shouldn’t – enjoy sex, but all relationships in the myths had to begin with rape to establish male power over the female. The goddesses Athene and Artemis remained virgins, not because sex was immoral but in order to remain powerful. These goddesses spent their time in the traditional male occupations of warfare and hunting, which were highly valued, and had no regrets at being deprived of the female occupations of bearing and raising children. Like the men of the time, they probably rated such occupations as of little value. Myths also make it clear that the act of sex outside marriage involves shame only for the female, even when she has no choice. This is another clear reflection of the values of the society which created the myths.
historical events? Another suggestion is that the deeds of Zeus represent certain historical events. For example, the long battle between Zeus and the Titans represents the conflict between the invading Achaeans and the original inhabitants of Greece, who worshipped the female spirits responsible for its fertility. Zeus was, of course, victorious over all opposition, including Mother Earth and her offspring. Thus, many of the stories of Zeus reflect how the sky god conquered the local earth goddesses and their priestesses. By raping Rhea, Zeus took control of agriculture; by swallowing Metis he took over her wisdom; by marrying Hera he reduced the powerful and muchloved mother goddess of Argos to a scheming jealous shrew, unable to put up with or curb her husband’s infidelities. Women still prayed to Hera for help in things which were important to them – marriage, conception, safe childbirth, the health of their children – but the lower status of the goddess reflects a male view of the world. 14
GL3001
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
Another historical reason for Zeus’ many affairs was the desire of important families in Greece to claim a divine ancestor. Thus, details were inserted into myths centuries later.
hera – queen of the gods Hera is not a pleasant figure in Greek mythology. Her children by Zeus were Ares, Hebe and Hephaestus. She features in a number of myths, particularly the tale of Troy, and is noted for the persecution of the unfortunate females seduced by Zeus. These tales will be told later in this booklet.
Demeter was another child of Rhea and Cronos, best known as the fertility goddess of the cornfield. She belongs to the earlier religion, but was ‘put in her place’ by her brothers. Zeus raped her and fathered Persephone (also called Kore). Poseidon also raped her, taking the form of a stallion when she became a mare to escape him. Finally, her third brother, Hades, kidnapped her beloved daughter with Zeus’ knowledge, and when Demeter discovered this she forbade the crops to grow and the trees to bear fruit until Persephone was restored to her. The human race was in danger of starving and prayed to Zeus for help. He sent his messenger, Hermes, to Hades, begging him to let Persephone go, and it was agreed she could leave if she had not tasted the food of the dead. However, Hades tricked Persephone into eating a pomegranate and refused to let her go. At last a compromise was reached, and Persephone spent half the year with Hades as his queen and half the year with her mother.
thomas hope
demeter – goddess of corn and fertilit
Demeter
This myth explains the seasons, and the time Persephone spent in the underworld represents winter. In historical times, a corn puppet was buried in autumn and dug up in spring when it was sprouting, so corn was promptly sown as ‘the maiden returned to the arms of her mother’. Demeter was told what had happened to Persephone by Triptolemos, prince of Eleusis. When her daughter was restored to her, Demeter rewarded Triptolemos by giving him a chariot drawn by serpents, a wooden plough and seed corn, and told him to travel all over the world teaching humankind the art of agriculture. Though she does not feature in many myths, Demeter was a most important goddess wherever grain was grown. Eleusis was the centre of her worship. Here, her followers celebrated the Eleusinian Mysteries which reenacted the rape and return of Persephone, and promised immortality to the initiates.
hestia The third daughter of Rhea and Cronos was Hestia, goddess of the hearth and home. She took no part in any wars or disputes. When rival gods fought to marry her she vowed to remain a virgin to keep the peace on Olympus. Eventually she left Olympus to allow Dionysus to take her place there. She seems a sweet, kindly goddess, but lacks personality among the more flamboyant deities.
© te ah o o t e k ur a p o un a m u
GL3001
the greek gods and their functions
thomas hope
poseidon – god of the sea
Poseidon.
We have already met Poseidon, son of Rhea and Cronos, as lord of the sea and as seducer of his sister Demeter in the form of a horse. He was often associated with horses and it is suggested he was originally connected with those who introduced the horse into Greece. He was married to the sea nymph Amphitrite, who resented his many infidelities. When he was courting the beautiful nymph Scylla, the jealous Amphitrite threw magic herbs into the unfortunate sea nymph’s bathing water, turning her into a monster with the heads of six dogs. One of Poseidon’s offspring was the one-eyed giant Polyphemos, whom we will meet, along with Scylla, in the tale of the sea-faring Odysseus. Poseidon was obviously a major deity for the sea-going Greeks, representing the wild, untamed ocean, but he also played a special part in the mythology of Athens. He competed with Athene for the domination of Attica, and it was agreed that the winner should be the one who gave Athens the more valuable gift. Poseidon struck the rock of the Acropolis, and a salt water spring immediately came out of the rock. However, Athene created an olive tree beside the spring and won the competition. The mark of Poseidon’s trident, the salt water spring, and Athene’s olive tree, can still be seen by the temple known as the Erectheum on the Acropolis of Athens today. Poseidon did not like the decision, but to placate him the women of Athens, who had voted in favour of Athene, were deprived of the vote, and men were forbidden to bear their mother’s names as they had previously done. This is clearly a myth giving divine sanction to a lowering of the status of women.
16
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
hades – god of the underworld The other brother of Zeus and Poseidon was Hades, ruler of the underworld, who carried off the beautiful Kore/Persephone as his queen. He figures in very few stories, and is a remote, grim figure, but not a figure of evil. All humans must die and all must pass into Hades’ Kingdom. To get there, souls must cross the river Styx on the ferryboat of the grim old god Charon, and pass the three-headed dog Cerberus. There they are judged not by Hades but by Zeus’ sons, Minos, Rhadamanthos and Aeacus. After judgement the good go to Elysium or Paradise, while the evil go to Tartarus where they are tormented by the Furies. Some myths tell how most people, neither completely good nor bad, drink the waters of forgetfulness from the river Lethe and are reborn to live another life. It was of little use to pray to Hades, who was unwilling to let anyone go from his kingdom, and who seldom visited the upper world himself. As well as the six children of Rhea and Cronos, Greek myths tell of many other divinities, major and minor.
the gods of olympus
In the north of Greece in the area known as Thessaly, a range of mountains was topped by Mt Olympus, 2917 m high and the highest peak in Greece. Here, worshippers imagined that Zeus had his home, and here too lived his siblings and their children. Altogether 12 gods lived on Mt Olympus, the most powerful of the immortals, spending their days feasting, quarrelling and making love, and occasionally leaving Olympus to interfere in the affairs of humankind. The Olympians were like humans in their loves and hates, their bickering and attempts to get their own way, and in their individual characters. But they were unlike humans in being larger, extraordinarily beautiful (with one exception), more powerful, immortal, and totally lacking in morality and responsibility. The Olympians were ruled by Zeus, and consisted of Hera, Demeter, Athene, Aphrodite, Ares, Hermes, Apollo, Artemis and Hephaestus. Hestia was originally one of the 12, but later resigned her place to Dionysus. Poseidon was also considered an Olympian, though he spent more time in his own realm of the sea than as his brother’s guest. Their other brother Hades seldom left his own dark kingdom, and was not counted among the Olympian 12.
© te ah o o t e k ur a p o un a m u
GL3001
the greek gods and their functions
te kura
athene – goddess of wisdom and war
Athene born from Zeus’ head.
The most formidable female deity on Mt. Olympus was Pallas Athene who was born from the head of Zeus after he had swallowed her mother, Metis the Wise. Athene was warlike and wise. She was also, rather oddly, the patron of crafts and skills, particularly the female work of spinning and weaving. It seems likely she was an ancient pre-Greek goddess but her story was retold to make her the daughter of Zeus and so establish the superior power of the father god. She was certainly his favourite child, and their relationship is remarkably free of the quarrels and jockeying for power seen so much on Olympus. Her stories are almost totally free of the unkind deeds and petty revenges of the other gods, and she is usually a helper of heroes, especially Heracles and Odysseus, and of humankind in general. She was the patron of Athens, the greatest and most artistically productive city of Classical Greece, and it is suspected that the Athenians ‘tidied up’ any stories which showed their goddess in a bad light. Athene remained a virgin goddess to avoid submission to any male. At one stage she was attacked by Hephaestus, who believed he deserved a reward for assisting at her birth. Athene simply vanished, and Hephaestus’ sperm fell upon the earth. Poor Gaea promptly gave birth to the boy Erichthonius, who was reared by Athene and became king of Athens. He promoted her worship, and in Classical times the Acropolis of Athens was crowned by the Parthenon, the finest temple in Greece, dedicated to Athene, and also by the Erectheum, a temple dedicated partly to Erichthonius.
18
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
One tale of Athene as patron of spinning and weaving places her in competition with a princess of Lydia named Arachne. Arachne unwisely boasted her skills were greater than those of Athene, who appeared as an old woman and warned the princess to be a little more modest about her deeds. Arachne refused to be warned, and Athene challenged her to a contest. The tale varies over whether Athene produced the finest work, or displayed divine anger when Arachne won the contest. In any event, Arachne hung herself, either in shame or fear, and the goddess turned her into a spider – hence the modern zoological name arachnid for spider. Athene features in many stories, particularly those of Troy. The Trojan prince Paris preferred the beauty of Aphrodite to that of Athene and Hera in the contest which caused the Trojan War, and the goddesses angrily helped the Greeks until Troy was totally destroyed. Athene also always helped those who were clever – one of her favourites was the clever Greek hero Odysseus, to whom she gave the idea of building the wooden horse used to capture Troy. Athene is normally shown dressed in armour and is often accompanied by snakes or her favourite bird, the owl.
In Greek mythology goddesses were not allowed to be as promiscuous as gods. The exception was the goddess of love and beauty, Aphrodite, who is always shown as young and lovely. Her birth is unclear. An old myth says she was born out of the foam created when Cronos flung the severed genitals of his father Uranus into the sea. This meant she pre-dated Zeus, so to make her subordinate to him a later myth makes her his daughter by an obscure figure, Dione. Her bird is the dove, which is supposed to be particularly amorous, and she possessed a magic girdle (belt) which made males love whoever wore it. Hera is said to have borrowed the girdle from time to time when she wanted something from Zeus. Aphrodite is usually attended by Eros, who is sexual love personified, and stories sometimes make him her son, sometimes her attendant who was in fact as old as Earth herself. In early myths he is a beautiful and dangerous youth, but in Hellenistic times he became the chubby little ‘cupid’ with arrows of romantic love.
istock
aphrodite – goddess of love
Aphrodite.
Aphrodite had the ability to make anyone fall in love, and this applied to the gods and even Zeus himself. Her power worried Zeus, and he insisted she marry Hephaestus, the only ugly god, to keep her under control. Aphrodite, however, much preferred the handsome Ares, god of war, and a late story tells how Hephaestus made a bronze net which fell over the two lovers when they were in bed together.
© te ah o o t e k ur a p o un a m u
GL3001
19
the greek gods and their functions
Aphrodite had many other love affairs. In one tale she competed with Persephone for the beautiful youth Adonis. They had agreed to share him, but when Aphrodite cheated and kept Adonis, Persephone complained to Ares, who took the form of a wild boar and killed Adonis as a rival. Another affair with more important consequences was Aphrodite’s seduction of the handsome Trojan prince Anchises. Anchises could not resist talking of the affair, and Zeus angrily threw a thunderbolt at him. Aphrodite deflected the bolt but Anchises was a cripple for the rest of his days. The son of Aphrodite and Anchises was the Trojan hero Aeneas, who was to play a major part in Roman mythology.
ares – god of war The god Ares was never very important to the Greeks. There were so many other aspects of life apart from war, and so many other deities who were skillful warriors, that a god dedicated only to war was rather unnecessary. Moreover, Ares wasn’t a very effective war god. He submitted, like everyone else, to Zeus, Athene defeated him more than once, and even the half-mortal Heracles sent him flying back to Olympus for safety. Ares lacks personality and he features in very few tales as a leading character. He was the legitimate son of Zeus and Hera, the lover of Aphrodite, and he enjoyed war for its own sake, changing sides without a care to increase slaughter and destruction.
hephaestus – the blacksmith Hephaestus is a more interesting character. He was the son of Zeus and Hera, though one version of his birth makes him the son of Hera alone. Angry at the birth of Athene, Hera tried to equal her husband by bearing a child wholly her own, but the baby was so ugly she threw him from Olympus into the sea, where he was raised by sea nymphs. Here he practised the metal-working crafts which were his speciality, producing such lovely jewellery that he was invited back to Olympus. He brought a beautiful throne for his mother, but when she sat on it the gift proved to be a trap and she was unable to move. Eventually Dionysus, the god of wine, made Hephaestus drunk and brought him back to release Hera. The return of Hephaestus to Olympus, seated on a donkey and accompanied by dancing drunken satyrs, was a favourite subject of Greek artists. As a divine metal worker Hephaestus was most useful, making thunderbolts for Zeus, and armour for the hero, Achilles, son of the sea nymph Thetis who had rescued him as a baby. The only ugly Olympian, he was always laughed at by the beautiful divinities for his lameness, his ugliness and his slow wits. However, he was a popular god in Greek towns as a patron of craftsmen like himself.
hermes – messenger of the gods One god who does have plenty of personality is the god of rogues, Hermes. On the day he was born (to Maia by Zeus), he left his cradle and went out to steal some cattle from his brother Apollo. Apollo searched for his missing beasts, but the crafty Hermes had made them shoes of bark and grass so they would leave no recognisable tracks. Eventually Apollo reached Maia’s cave, and she was indignant that her innocent babe, lying in his cradle, should be accused of theft. However, Apollo found the skins of two cows Hermes had killed, and complained to Zeus. Eventually Hermes confessed and agreed to return the cattle, but produced a lyre he had made from the shell of a tortoise. Apollo was enchanted by the sweetness of its music, and gave Hermes the cattle in exchange. Hermes then created a reed pipe, and was persuaded to exchange it for Apollo’s golden staff which made him the god of all herdsmen and shepherds. 20
GL3001
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
Zeus was amused by the story, and made Hermes his messenger. Since Hermes agreed to stop telling lies, but thought that always telling the truth might be rather too hard, Zeus also made him the god of commerce and treaties. Finally Hermes was made the patron of travellers, and was given a herald’s staff with white ribbons, winged sandals to carry him swiftly round the world, and a hat to protect against the rain and sun. He is usually shown as a young man, wearing his hat and sandals and not much else, and he always takes a great interest in human affairs. One of his main tasks was to lead the souls of the dead down into the underworld. Despite this, he remains a cheerful, likeable, mischievous rogue.
apollo – god of reason and civilisation The stories of Apollo reflect the different origins of Greek myths and their tendency to develop over centuries. In some ways Apollo is the most representative god of Greek civilisation, presiding over music, poetry, philosophy, astronomy, medicine and science. He stands for moderation in all things, knowledge and the rule of law. However, the stories about him include the usual violent rapes and barbarous killings, such as the massacre of Niobe’s innocent children. Apollo was also the god of prophecy, and his chief oracle was at Delphi. Here he killed the serpent Pytho, the agent of Mother Earth, and shared the sanctuary with Dionysus. Apollo was the father of the healer Asclepius. Asclepius brought a dead man back to life, an act which could have robbed Hades of all his subjects. Hades complained to Zeus, who killed Asclepius with a thunderbolt, thus provoking a quarrel with Apollo. Apollo features in many stories, and is always shown as a handsome, beardless young man, carrying a lyre, or the bow and arrows which were his favourite weapons.
artemis – huntress goddess
thomas hope
The mother of Apollo was the female Titan Leto, who was persecuted by Hera. She gave birth to twins, Artemis and Apollo, who henceforth protected their mother from injury and insult – something Zeus usually failed to do for the females he seduced. Artemis became a mighty huntress, armed with bow and arrows, but also acted somehow as mistress and protector of wild animals. Like Athene she remained a virgin, and insisted that her female companions also be virgins. When Zeus seduced one of her nymphs, Callisto, in the guise of Artemis herself, the goddess was so angry she turned the unfortunate female into a bear. For once Zeus came to the rescue and placed Callisto in the sky in the form of the constellation of the Great Bear, Ursa Major. On another occasion a hunter, Actaeon, happened to see Artemis as she was bathing and in revenge the goddess turned him into a stag, to be torn to pieces by his own hounds. It was dangerous to offend Artemis.
Artemis – goddess of the hunt.
© te ah o o t e k ur a p o un a m u
GL3001
21
the greek gods and their functions
In eastern countries Artemis was worshipped as a fertility goddess, which suggests she was originally a pre-Greek mother goddess, and in later times she was a patron of safe and easy childbirth – despite her ignorance of sex or childbirth. She also had some status as a moongoddess, while her brother as Phoebus Apollo was a sun-god.
dionysus – god of wine and drama The last Olympian is perhaps the most interesting and dangerous character of all, who almost came to a sticky end before he was born. This is Dionysus, god of wine, fertility and drama. His mother was the mortal woman Semele, who was tricked by the jealous Hera into demanding to see her lover in his real shape. When Zeus appeared to her as a flash of lightning, Semele was burnt to death but Zeus rescued his son and inserted him in his own thigh, from which Dionysus was eventually born a second time. His foster mother Ino, sister of Semele, was driven mad by Hera, and Dionysus eventually grew up in the care of the wood nymphs of Mt Nysa in Boetia. When Dionysus grew up he went wandering all over the world, including Egypt and India, accompanied by his tutor Silenus and an army of satyrs and maenads (wild women). Eventually he returned to Greece. Dionysus was cruel to those who opposed him. Typical was the fate of king Pentheus of Thebes. When he refused to honour Dionysus and put him in prison, the god persuaded the king to go into the mountains and spy on the women of Thebes who were revelling with Dionysus’ maenads. Pentheus was seen and torn to pieces by the wild women, including his own mother. On another occasion, Dionysus was captured by pirates who planned to sell him as a slave. He raised a vine which curled around mast and sails, changed the oars into serpents and himself into a lion. The terrified sailors jumped overboard and were changed into dolphins, all except the pilot who had recognised the captive as a god. Next Dionysus married Ariadne, daughter of king Minos of Crete whom Theseus had abandoned on the island Naxos. Finally he rescued his mother Semele from the Kingdom of the Dead and then took his place on Olympus. Some say he took the place of Hestia, who was glad to leave the noisy wrangling of her family, and knew she would be welcome anywhere on earth. 2A
1. Select the 10 points about Greek divinities which you think most important. 2. How did the religion of the ancient Greeks differ from Christianity? Select up to five differences you think important. 3. Draw a family tree to show the descent of Zeus from Chaos. Include the following names: Chaos, Gaea, Erebus, Night, Eros, Oceanus, Uranus, the Titans, the Cyclopes, Rhea, Cronos, the Giants, the Furies, Hestia, Demeter, Hera, Hades, Poseidon, Zeus and Typhon. Check your answers.
22
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
dionysus continued: On vases and in Greek art in general, Dionysus is often shown bearded. Later in Roman art he became a plump, girlish youth. Dionysus was probably an eastern fertility god to begin with, and though a latecomer to the Olympian scene he was one of the most popular and most feared of gods. He was worshipped in wild drunken revels and his followers, mostly women, are said to have wandered the wild mountainous countryside, immune to heat and cold, tearing animals to pieces. We find him on works of art, and also as the god of drama. He is often shown with trails of vine leaves, accompanied by maenads, and by satyrs – male figures who are part human, part animal.
minor gods
As well as the major gods we have already listed, Greek mythology had an amazingly large range of minor divinities. Here are some of them. The Moirae or Fates: the Greeks thought a person’s life was measured by a length of thread. The thread of life was spun on Clotho’s spindle, measured by Lachesis with her rod, and snipped by Atropos’ shears. Some claim Zeus could alter a person’s fate, but others say he is subject to these three terrible old women, and must abide by their decisions. The Eumenides or Furies: these three female divinities were named Alecto, Tisiphone and Megaera, and were born from Mother Earth and the blood of Uranus. They avenged family crimes such as matricide and patricide, and also tormented evil men in the ‘Hell’ of the underworld, Tartarus. Their true name was the Erinnyes, but the Greeks called them the Eumenides, the kindly ones, to try to avoid bad luck which might be brought by speaking their real names. Atlas: a leader of the Titans against Zeus and his allies, he was punished by having to carry the sky on his shoulders. Eventually he gained relief from his burdens when Perseus turned him into stone with the head of the gorgon Medusa.
bridgeman
Pan: the son of Hermes and a nymph, he had horns, a beard, tail and goat legs. He lived in the woods and pastures of Arcadia in the Peloponnese, where he guarded flocks, herds and beehives, and took part in the revels of the local nymphs. He was a lazy, easy-going spirit who loved his afternoon nap and if awakened would terrify those who disturbed him with a sudden loud cry – hence the expression ‘panic’. He invented the pan pipes, and had the gift of prophecy, which Apollo learnt from him. In more recent literature Pan has sometimes been equated with evil, specifically with Christian Satan, because of his half-human half-goat form, but like all Greek gods he was friendly or unfriendly, not evil. Pan. © te ah o o t e k ur a p o un a m u
GL3001
23
the greek gods and their functions
Tyche: her name means chance and she decides the fortune, good or bad, of all mortals. She is quite irresponsible, heaping wealth on some, while keeping others poor or depriving them of their wealth. There is no justice in the distribution of luck, so the Greek explained it in this fashion. Nemesis: if people boast of what they possess or have done, they are pursued and cut down to size by the ancient, slow but remorseless goddess Nemesis. Hebe: the daughter of Zeus and Hera, Hebe personifies eternal youth. She features in very few tales, but was originally cup-bearer to the gods – that is, she carried around the nectar at their endless feasts. Eventually Zeus fell in love with the handsome youth Ganymede, son of the king of Troy, and carried him off to wait on him at Olympian banquets instead. Hebe was finally married off to the hero Heracles when he joined the Olympians after his death.
bridgeman
Prometheus: this Titan created men, and then stole Zeus’ fire to help them. Zeus was very angry, and punished man by creating woman. He made a beautiful creature called Pandora, and gave her a box containing disease, old age, vice, violence and other evils. Pandora opened the box out of curiosity and released all these ills on mankind. This tale sounds rather like Eve and the apple in the garden of Eden, another story where women are blamed for the evil deeds of men.
Prometheus.
Prometheus also tricked Zeus by appearing to share a sacrificed ox between gods and men. However, he made an attractive parcel of the bones and fat and a less good-looking parcel of the meat. Zeus chose the bones. From that time on, when men sacrificed to the gods the immortals were given the bones and fat while humans ate the meat at the feast – an excellent example of a myth justifying a ritual. 24
GL3001
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
Zeus, however, was furious and he had Prometheus chained to a mountain. Every day an eagle came and fed on his liver, while at night the liver regrew so his punishment seemed eternal. Eventually, Zeus relented and released Prometheus. He was only just in time, as he had in mind to seduce the sea nymph Thetis. Prometheus knew a prophecy that Thetis would bear a son much greater than his father, which would have meant a son who would have overthrown Zeus. So Zeus married Thetis off to the mortal Peleus in a great ceremony which all the gods were invited to except the goddess Eris (Discord or Strife), but she came anyway. 2B
List the six children of Rhea and Cronos, and by each name write up to three sentences naming each one’s area of influence and the main points in their story. Check your answers.
Š te ah o o t e k ur a p o un a m u
GL3001
Attic cup, 400 BCE
learning outcome
Understand the Greek heroes and their functions and relationships to each other and their importance in the eyes of man.
learning intention In this lesson you will:
•• examine the Greek heroes and their functions and relationships that gave them an importance in the eyes of man.
introduction
As well as tales of the Olympian gods, the Greeks told many stories of the heroes – those half-gods who faced great dangers and difficulties, sometimes winning, sometimes losing, but never giving up. By far the greatest of these was Heracles.
heracles
The legends of Heracles come from many different sources, since he was a popular figure in most Greek states. The versions vary and even contradict each other, but here are the main ‘facts’. Zeus seduced mortal women by appearing to them in the form of whatever they loved most. As Alcmene of Thebes was a virtuous wife, Zeus took the form of her husband Amphitryon. Hermes held back the sun-god so the night Zeus spent with Alcmene was as long as three normal nights. The result was Heracles, who nearly came to an early end when Amphitryon decided to burn poor Alcmene to death because she had been unfaithful. Zeus sent a storm to put out the fire and told Amphitryon to behave himself and care for Zeus’ son, so Heracles received a good education in warfare, boxing, archery and similar essential training for his future. He soon showed his strength. When the angry Hera sent two snakes to destroy him as an infant, he hopped out of his cradle and strangled them both. When he grew up, Hera drove Heracles mad for a short time. In this condition he murdered his wife and children and for punishment agreed to perform 12 ‘labours’ or great tasks for Eurystheus, king of Tiryns. Zeus promised that when the 12 labours were over Heracles would be rewarded with immortality. Here are the 12 labours of Heracles: 1. He killed the Nemean lion, an enormous animal whose skin could not be harmed by iron, bronze or stone. Heracles chased it into its cave and strangled it. Then he skinned it using one of its own razor-sharp claws, and afterwards wore the skin with the head as a helmet. 2. Next he slew the Hydra of Lerna, a monster with a dog-like body, a poisonous breath and many snaky heads which regrew when cut off. Heracles used fire to prevent new heads growing while he cut or bashed with his club all heads in turn, including one which was immortal. He then dipped his arrows in the dead monster’s blood which made them deadly.
26
© te ah o o te k u ra p ou n a mu
the greek heroes
Heracles slays the Hydra.
3. Heracles’ third labour was to capture the Ceryneian hind, a deer sacred to Artemis. Heracles hunted the animal for a year until it was exhausted, then captured it unhurt. 4. Next Heracles was ordered to capture the wild boar on Mt Erymanthus. On the way he was entertained by the centaur Pholos, but unfortunately had to fight off other centaurs, attracted and maddened by the smell of wine. He drove them off, despite a rainstorm which loosened the string of his bow. (Nothing in Greek mythology happens by chance, and this storm is a good example – it was sent by the cloud Nephele, the grandmother of the centaurs.) Unfortunately, a ‘good’ centaur, Cheiron, Heracles’ old friend, was wounded in the knee by one of Heracles’ poisoned arrows. Being immortal he could not die, and went back to his cave howling in agony. At last Zeus let him hand on his immortality (to Prometheus, after Zeus had forgiven him) and Cheiron was able to find relief from his pain in death. Heracles’ host Pholus was also an unfortunate victim. He picked up one of the poisoned arrows in curiosity then dropped it on his foot, wounding himself and dying instantly. After this, the capture of the boar was quite simple – the hero drove it into a deep snow drift. But when he took it back to Tiryns, king Eurystheus was so frightened he leapt into a huge jar for safety. 5. Heracles’ fifth labour was to clean out the stables of king Augeias, which were piled high with the dung of many years. The hero did this in one day by diverting the river Alphaeus to run through the stables. 6. Next he had to get rid of the Stymphalian birds which lived in a marsh near Mt Cyllene. These creatures had beaks, claws and wings of bronze, and killed both men and flocks. Heracles couldn’t get to the birds because the marsh was too muddy to walk in but too solid for a boat. He was helped by Athene, who gave him a noisy bronze rattle, which startled the birds. When they flew up into the air he killed many with his arrows, and the rest fled.
© te ah o o t e k ur a p o un a m u
GL3001
27
the greek heroes
7. Heracles next went to Crete to capture a fire-breathing bull, which he took back to king Eurystheus. 8. In Thrace, four savage man-eating mares were running wild and doing great damage. After capturing the mares, Heracles also captured their owner, the cruel Diomedes, and fed him to his own animals. The well-fed mares were now easily harnessed to a chariot and driven away. 9. king Eurystheus now commanded Heracles to fetch the golden girdle of Hippolyte, queen of the Amazons, for his daughter Admete. The Amazons were an imaginary tribe of warrior women who lived near the Black Sea and obviously fascinated the Greeks, because they showed them frequently in art. There are many versions of how Heracles stole the girdle. Some say he killed the queen and took it, or received it as a love gift or as part of a ransom price. 10. Heracles’ tenth labour was the theft of the cattle of Geryon, a man – monster with three upper torsos and heads all joined at the waist. He lived somewhere in the far west beyond the straits of Gibraltar with his beautiful red cattle. On the way Heracles built two pillars on either side of the straits of Gibraltar, and shot Geryon with a poisoned arrow. He then drove the cattle back to Greece. A Roman version of the story has him turning right too soon after crossing the Alps and travelling the length of Italy – only when he reached Sicily did he realise he’d taken the wrong road. In Italy he was welcomed on the site of Rome by king Evander. Evander had built a settlement there, and nearby Heracles killed a firebreathing monster named Cacus, who had dared to steal some of his cattle. 11. For his eleventh task Eurystheus sent Heracles to gather apples from the golden apple tree which had been Mother Earth’s wedding present to Hera. This tree was in a garden in northwest Africa, guarded by the daughters of Atlas, the Hesperides. Heracles asked Atlas to fetch the apples for him, offering to hold up the heavens while he did so. But the Titan liked his freedom, and suggested that if Heracles would wait there a little longer he’d take the apples to Eurystheus himself. Suspecting the Titan might never return, Heracles agreed but asked Atlas to take back the heavens while he adjusted his lion-skin to act as a shoulder pad. Easily fooled, Atlas did so, and Heracles picked up the apples and left. This rare example of the hero using brain rather than brawn suggests that he was prompted by Athene. On the way home Heracles crossed Libya, where he killed the giant Antaios. This son of Mother Earth grew stronger whenever he touched his mother, and so Heracles had to keep him off the ground. Holding him high in the air, he squeezed the giant to death. Also on this trip Heracles killed the bird which tormented Prometheus, and arranged for him to take over Cheiron’s immortality, so the centaur could end his pain in death. 12. Heracles’ last and most difficult labour was to capture the fearsome dog Cerberus and bring him up from the underworld, a task which probably represents his overcoming his own mortality. He dragged Cerberus through the darkness of the underworld up to the light, and also rescued his friend Theseus, whom you’ll read about later.
28
© te ah o o te k u ra p ou n a mu
the greek heroes
Heracles was involved in many more adventures. Though they may seem monotonous to us, with their repetition of murder, theft and pillage, they were very popular among the Greeks. Here are some reasons why: •• Heracles’ deeds were linked to all parts of Greece. All states could claim him as a hero and tell his tales •• he was the superhero – strong, brave and always successful in the end, thus fulfilling men’s dreams of what they would be like if they could •• he represented mankind striving against misfortune, danger and finally death. Heracles took another wife, called Deianira, after rescuing her from a centaur named Nessus who had threatened to rape her. As Nessus was dying, he told Deianira to take some of his blood, and if Heracles was unfaithful to her to smear the blood on his clothing, as this would keep him faithful. When Deianira grew tired of Heracles’ many infidelities and feared she would be replaced with another wife, she put the blood on Heracles’ shirt. Of course Nessus had been lying, and the poison began to eat the hero’s flesh. In agony he tried to kill himself on a funeral pyre, which Zeus struck with a thunderbolt. Heracles mortal body was burnt up, and his immortal spirit was taken to Olympus. Hera finally became reconciled with Heracles and gave him her daughter Hebe. Heracles is always shown in art with his lion-skin and club. Sometimes he also carries a bow and arrows. He appears in many tales using great strength, often aided by Athene. Later stories still stress his strength but also tell of his stupidity and his huge appetite. 3A
1. List the 12 labours of Heracles. 2. Explain in your own words why he was so popular a figure among the Greeks. Try to add some ideas of your own. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
jason and the argonauts
bridgeman
One expedition Heracles featured in briefly was a voyage by a group of heroes to the Black Sea to bring back a golden fleece. They journeyed in a ship called the Argo, and therefore are called the Argonauts. The fleece originally came from a legend about a golden ram, which was possibly a memory of how early inhabitants of Thrace used sheepskins to trap the gold found in their streams.
Jason and the Argonauts.
Our story, however, begins in Thessaly, where a certain Pelias killed his brother and took the throne. He killed all likely enemies but failed to kill his nephew Jason, the true heir to the throne, and one of the few heroes who was not a son of Zeus. Jason was brought up in the care of the wise centaur Cheiron. When he grew up Jason returned to claim his kingdom, winning the favour of both Hera and Athene on the way. However, Pelias tricked Jason into going off to fetch the Golden Fleece. He told him that the country was afflicted by a curse which would not be lifted until the fleece was regained, and promised he would hand over the throne on Jason’s return. In fact, Pelias hoped he would die on the way. Many heroes volunteered to accompany Jason, some probably being later additions reflecting the desire of great families to claim an Argonaut as an ancestor.
30
Š te ah o o te k u ra p ou n a mu
the greek heroes
Heracles joined, but left the expedition early when water-nymphs captured his beautiful young lover Hylas. Others you will hear mentioned in other tales were Castor and Polydeuces, Peleus the father of Achilles, and the musician Orpheus. They left Greece in the Argo and sailed to the Black Sea with many adventures on the way. When they reached Colchis, king Aietes, who had the Golden Fleece, did not want to give it up. But he was afraid to refuse the Argonauts outright, so he set them a challenge first: they had to plough a large field using two bulls to pull the plough, and sow the field with dragons’ teeth. The catch was that the bulls were made by Hephaestus out of bronze and breathed fire, and each dragon’s tooth sprouted into a fully armed warrior. Jason passed the test with the help of Aietes’ daughter Medea, since Hera had made her fall in love with the handsome hero. Medea was a mistress of magic, and when her father planned to attack the Argonauts to keep the fleece, she led Jason to the oak tree where the fleece hung and she put the dragon on guard to sleep. Jason seized the fleece and fled with Medea and all his crew on the Argo. When Aietes followed them, Medea killed her young brother and threw his severed limbs and body on the sea. As she expected, her father paused to gather the pieces of his dead son and so the Argonauts escaped. They had many adventures on the way home, and of course when they arrived home Pelias refused to hand over the kingdom to Jason. So Medea tricked Pelias’ daughters into killing their father by persuading them that they could bring him back to life as a young man. The citizens refused to accept Jason as ruler because of Medea’s deed, and the couple went to Corinth, where Jason decided to divorce Medea and marry the king’s daughter. The outraged Medea sent the unfortunate princess a gown which burnt both her and her father to death. To complete her revenge, she killed her sons by Jason, and fled to Athens. There she married the king, but was forced to flee after being caught trying to poison Theseus, the king’s son. The myth is vague about what finally happened to her, but Jason came to a miserable end. As an exile and outcast, he wandered from place to place, until one day he returned to his ship, the old Argo, and was killed by its prow breaking off and falling on him.
© te ah o o t e k ur a p o un a m u
GL3001
31
the greek heroes
perseus and the gorgon medusa Another well-known hero was Perseus, best known for cutting the head off the gorgon Medusa. His mother was Danae, only child of Acrisius, king of Argos. Because of a prophecy that he would be killed by a grandchild, Acrisius locked his daughter away in a dungeon. But Zeus came to her in a ‘shower of gold’, which some interpret as money but which is much more likely to be a ray of golden sunlight, if you think of what a person imprisoned in an enclosed room might long for most.
The gorgon was Medusa, once a beautiful woman who had roused the lust of Poseidon. He had seduced her in a temple sacred to Athene, and the angry goddess blamed the victim and turned her into a hideous monster with snakes for hair and a gaze which turned those looking at her to stone.
istock
In any case, Danae gave birth to Perseus, and Acrisius, not daring to kill his daughter himself, shut her and the baby in a box and set it adrift on the sea. It floated to the island Seriphos, where king Polydectes took the pair into his home. He tried to marry Danae but Perseus, who grew up very quickly, protected his mother. To get rid of Perseus, Polydectes tricked him into going on a quest to fetch the gorgon’s head.
Perseus and Medusa.
Perseus, like Jason, was lucky in having divine support. Athene, who clearly had a weakness for heroes, gave him a shield polished like a mirror, while Hermes provided winged sandals, a sickle to cut the head off, and a bag to carry it in. After several adventures Perseus arrived in North Africa and, using the shield as a mirror, cut off Medusa’s head, stuffing it in the bag while looking the other way. As he flew home he spotted a beautiful woman chained to a rock on the seashore. This was Andromeda, who was about to be sacrificed to a sea monster because her mother Cassiopeia had boasted she was as beautiful as the sea nymphs. Perseus used the gorgon’s head to turn the monster to stone and took Andromeda as his bride. But a former suitor arrived with armed followers to claim Andromeda, and Perseus was forced to turn them all to stone and flee. When he arrived back in Seriphos with Andromeda, Perseus found his mother had taken refuge in a temple and Polydectes was trying to starve her into submitting to him. Perseus promptly used Medusa’s head to save her. He then returned to Argos, where he accidentally killed his grandfather with a discus, while taking part in games. Some say he then became king of Argos, while others say he founded Mycenae not far away. Unlike many heroes, Perseus seems to have had a happy end. Medusa’s head finished up on Athene’s shield and is regularly shown there by artists. 32
GL3001
© te ah o o te k u ra p ou n a mu
iv
Attic vase, 520 BCE
learning outcome
Understand the Greek heroes and their functions and relationships to each other and their importance in the eyes of man.
learning intention In this lesson you will:
•• examine the Greek heroes and their functions and relationships that gave them an importance in the eyes of man.
introduction
Very few heroes managed to live happily ever after and many of them came to a very unhappy end.
the adventures of theseus
A major hero of Athens was Theseus, who claimed both Poseidon and Aegeus, king of Athens, as his father. Once when Aegeus was travelling he stopped at Troezen in the house of the king, and spent the night in the bed of princess Aithra. He then left his sword and sandals concealed under a heavy rock. He told Aithra if she bore a son Aegeus would acknowledge him when he could lift the rock and claim the sword and sandals. When Theseus was 16, he lifted the rock and set out to Athens to meet his father. However, he decided he would make a better impression on his father if he achieved some great deeds on the way, so travelled the dangerous coastal route from Troezen to Athens. On the way he got rid of the following problems: •• Periphetes, who battered passers-by with a great club. Theseus killed him with his own club and kept it from then on •• Sinis tied victims to the tops of two pine trees bent to the ground and then released the trees to fly up and tear them apart. Theseus killed him the same way •• a giant sow which was ravaging the farmland was killed •• Sciron made passers-by wash his feet and then kicked them over the cliff to a man-eating turtle below. He suffered the same fate at Theseus’ hands •• Cercyron, a powerful wrestler, was crushed by Theseus •• Procrustes fitted people to his bed either by stretching them or chopping part of them off. Theseus killed him by fitting him to his own bed. In Athens, he found his father had married Medea the sorceress (see chapter IV), who instantly knew who Theseus was and tried to poison him before he could claim the throne ahead of her own children. But her scheme was discovered and she hastily left Athens. Theseus killed a few relatives who were making things difficult for his father, and got rid of a wild bull on the plain of Marathon. He then began his most famous deed. Athens had to pay tribute each year to Minos, king of Crete, as payment for the death of Minos’ son Androgeos, whom the Athenians had killed. The tribute was seven young women and seven young men to be sacrificed to a monster with a man’s body and a head of a bull, called the Minotaur. Theseus volunteered to be one of the 14, and on arriving in Crete set about killing the minotaur.
© te ah o o t e k ur a p o un a m u
GL3001
33
more greek heroes
He was helped by Ariadne, daughter of Minos, who had fallen in love with him. She gave him a sword and a ball of thread to find his way in and out of the maze where the monster lived. Theseus killed the minotaur and fled by ship with Ariadne and the young Athenians. For no clear reason, he left her asleep on the island of Naxos, but she was soon rescued by the god Dionysus who promptly married her. Theseus sailed on to Athens but he forgot to change the sails of his boat from black, signifying mourning, to white, as his father had asked him to do to show he was still alive. Aegeus was watching for the boat at Cape Sounion, the southernmost tip of Attica, and when he saw the black sails he thought his son was dead. In his grief he threw himself into the sea, which was called the Aegean after him. Theseus became king, and joined all the settlements of Attica into a single state with Athens as its capital. He defeated an invasion by the Amazons, whose queen Hippolyte he married. He went to the wedding of his friend Peirithous the Lapith to Laodameia. There he helped defeat the Centaurs, who got drunk and attempted to carry off the bride and other female guests.
bridgeman
These two battles – Greeks versus Amazons and Lapiths versus Centaurs – are often shown in Greek art. Both symbolise the victory of civilisation, represented by the Greeks, over the barbarism of the Amazons and Centaurs. Moreover, in sculpture the topics allow neat alternation of male/female figures or human/centaur figures.
Theseus and the Minotaur.
© te ah o o te k u ra p ou n a mu
more greek heroes
Theseus had an unhappy end to his life. He cursed his son Hippolytus because he believed Hippolytus had seduced Theseus’ wife Phaedra. By the time he found out the truth, Hippolytus was dead, killed as his chariot horses panicked when they were frightened by a sea monster. Next, he and Peirithous abducted the young Helen of Sparta, who was rescued by her brothers Castor and Polydeuces. Then Theseus and Peirithous went down to the underworld to try to carry off Persephone. Hades politely asked them to sit down, but when they did their flesh stuck to the chairs. When Heracles came down to get Cerberus (chapter IV) he pulled Theseus free, but Theseus left much flesh behind and was in pain till he died. When he returned to Athens, Theseus found someone else was now king, and he was forced into exile, to die a wretched death on the island of Scyros. The tale of Theseus is an interesting mixture of old and new, fact and fiction. The tale of the minotaur and the tribute of young Athenians may well be a memory of a time Knossos had power over mainland cities – before 1450 BCE. The unification of Attica was a fact also, but happened some hundreds of years after the story of Theseus evolved, and it was probably fifth century Athenian propaganda to make it Theseus’ deed. In fact, many of Theseus’ exploits are very similar to those of Heracles, and it seems likely Classical Athens wanted a hero of its own who could rival the greatest of the Greeks. Unfortunately, Theseus never quite made it!
aithra
Aithra, mother of Theseus, features briefly in the tale of Helen and Troy. When Castor and Polydeuces rescued Helen after her abduction by Theseus, they took Aithra back to Sparta as a slave. Aithra accompanied Helen to Troy as a maid servant, and when Troy fell was rescued by her grandsons and taken back to freedom in Athens. 4A
1. Jason, Perseus and Heracles each went to fetch something in the course of their labours. What are some of the essential ingredients of a quest story? Why are they told? Write two or three sentences discussing this. 2. Name one or two modern quest stories. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
daedalus and icarus
bridgeman
Another mythical figure connected with the tales of Theseus is the great Athenian inventor Daedalus. He had to flee Athens when he killed his nephew out of jealousy because the boy had invented the jagged-tooth saw. Daedalus fled to Crete, where Minos made him welcome. However, Minos had offended Poseidon by not sacrificing a special bull, and Poseidon took revenge by getting Aphrodite to cause Minos’ wife Pasiphae to have an unnatural lust for the bull. Daedalus built a hollow cow for Pasiphae to hide herself in to satisfy her lust, and the result was the minotaur. Daedalus then built the maze or labyrinth in which the minotaur was kept, and gave Ariadne the ball of string for Theseus to use to get in and out of the maze.
Daedalus and Icarus.
Minos was angry with Daedalus for interfering in his family affairs and imprisoned him and his son Icarus in the labyrinth, but Daedalus made wings for them to escape. Unfortunately, Icarus was carried away with the thrill of flying and climbed too high and too close to the sun. The wax which held his wing feathers in place melted and he fell into the sea and drowned. Poor Icarus remains a warning for mortals not to aspire to things beyond their reach.
bellerophon and pegasus
The fate of our next hero also carries this message. Young Bellerophon tamed the beautiful winged horse Pegasus, and on its back he killed the fearsome monster the Chimaera, which was part lion, part goat and part serpent. But after a number of deeds he became too ambitious and tried to ride Pegasus up to Olympus. Zeus sent a gadfly to sting Pegasus, who reared suddenly and threw Bellerophon to his death.
36
Š te ah o o te k u ra p ou n a mu
more greek heroes
niobe
Another story which involves a human being displaying fatal pride is that of Niobe. She was the daughter of Tantalus, whom we will hear more of next chapter. She had many children: most stories say seven daughters and seven sons. She was so proud of her children that she mocked Leto for producing only two. Unfortunately, quality counted more than quantity, since Leto’s two children were Artemis and Apollo, who at once took steps to avenge the insult to their mother. Apollo found the boys hunting on Mt Cithaeron and shot them down one by one, while Artemis went to Thebes where the girls were spinning in the palace and shot them with her deadly bow and arrows. For nine days and nights Niobe wept over the bodies, and eventually Zeus took pity on her and turned her into a pillar of stone, from which water continued to flow.
the hunt for the calydonian boar
Another story, the hunt for the Calydonian boar, involves a number of heroes we have already met, and some new ones. The leader of the hunt was Meleager, whose mother was told by the Fates at his birth that he would live only till a branch, at that minute smouldering on the fire, burnt away. She hastily took the branch off the fire and hid it. Meleager grew up to be a fearless fighter. When his father offended Artemis by not including her in his yearly sacrifices to the 12 Olympian gods, Meleager headed the expedition to kill the huge boar Artemis had sent to ravage the land. Many heroes joined in, including Castor and Polydeuces, Jason, Peleus, Theseus and his friend Peirithous the Lapith, and the woman Atalanta. Her father had not wanted a female child and exposed her at birth on the mountainside where she was suckled by a bear. Under the protection of Artemis she grew up to be a swift and deadly hunter and a resolute virgin. The aggressive male heroes strongly objected to hunting with a woman, but Meleager had fallen in love with Atalanta and insisted she be included. After much feasting, the expedition moved off, but the heroes were each so eager to win for themselves the glory of killing the beast they failed to work as a team and normal hunt discipline was ignored. Several hunters were killed, some by the boar and some by other hunters. Most legends say Atalanta drew first blood with an arrow behind the boar’s ear, while Meleager finished it off. At once he skinned the beast and presented its pelt to Atalanta, but this deeply offended his uncles, who claimed they should have been given the skin. Meleager killed two of them on the spot and two more uncles later in civil war. His mother was angry at the news of her brothers’ deaths, and promptly threw the fatal branch on the fire, thus killing her son. Atalanta was at last acknowledged by her father, who tried to marry her off, but she stalled her suitors by insisting they must beat her in a race to win her – if they lost they died. Finally the crafty Melanion asked Aphrodite for help. She gave him three golden apples, and each time Atalanta forged ahead he tossed down an apple which she stopped to pick up. Thus Melanion won the race and a bride, but their domestic bliss did not last long. The pair offended Zeus by making love in an area sacred to him, and were turned into lions.
© te ah o o t e k ur a p o un a m u
GL3001
castor and polydeuces (the dioskouroi)
thomas hope
Castor was the son of Leda and Tyndareus of Sparta, while his twin Polydeuces was Leda’s son by Zeus. They had many adventures together, such as the quest for the Golden Fleece, rescuing their sister Helen from Theseus, and carrying off the daughters of Leucippus. Eventually the mortal Castor died, and his brother offered to take his place in the underworld for six months each year so Castor could spend that time alive. Zeus was so touched by this that he placed the brothers in the heavens as the constellation Gemini.
Castor and Polydeuces.
tales of thebes
Another great group of myths concerns the city of Thebes, but there is only room to touch on them briefly here. On the coast of Asia Minor a young woman was playing with her companions on the beach one day when a beautiful bull appeared. When she was unwise enough to climb on its back, the bull took off and swam with her across the sea. The bull, of course, was Zeus, and the unfortunate maiden was Europa, mother of Minos, Rhadamanthos and Sarpedon of Crete – but that’s another story. However, Europa’s brothers went hunting for her all around the Mediterranean, and one of them, Cadmus, was told by an oracle to found Thebes. The great-grandson of Cadmus, Laius, was told that if he begot a son, he would be killed by that son. So when his wife Jocasta gave birth to a baby boy, the child was cast out on the mountainside to die, with a spike driven through his ankles. This gave him his name, Oedipus (swollen foot). The child was rescued by shepherds and brought up by the king and Queen of Corinth as their own son. When he grew up, Oedipus heard a prophecy that he would kill his father and marry his mother, so he fled Corinth, thinking he was leaving his parents behind. He travelled towards Thebes, killing an elderly man in a quarrel on the road.
38
© te ah o o te k u ra p ou n a mu
more greek heroes
When he reached Thebes he found the king had recently disappeared and the city was terrified by a sphinx – a winged lion with a woman’s head. Oedipus destroyed the sphinx by answering her riddle, and became king by marrying the queen. Thus, without realising it he had fulfilled the prophecy by killing his father, the traveller, and marrying his mother, the queen Jocasta. Eventually the truth was revealed and queen Jocasta killed herself, while Oedipus stabbed his eyes to render himself blind and went into exile. His children by Jocasta were to have no happier fates. His sons killed each other over who should rule Thebes, and his daughter Antigone was buried alive for daring to bury one of her brothers against the orders of Creon, Jocasta’s brother who had taken control at Thebes. Creon’s life ended in misery too when his son Haemon, betrothed to Antigone, killed himself, and his wife also committed suicide. There are many other characters in the Theban myths, such as Teiresias the blind prophet, but they are too numerous to mention here.
orpheus
A very popular myth involves a figure for once not famous for strength and killing. The greatest musician of ancient times was Orpheus, son of Apollo and the muse Calliope. He is the archetypal poet and the archetypal musician and can be seen as the embodiment of ‘art’ in its widest sense. His playing of the lyre and his singing were so charming that animals stopped to listen, and rocks and trees would move closer to hear him. He married the beautiful wood nymph Eurydice, who died of a snake bite on the day of their wedding.
bridgeman
Orpheus was so grieved he decided to go down into the underworld to regain her. His music charmed away all difficulties, even melting the hard heart of Hades. He agreed to let Eurydice return to the upper world, provided Orpheus did not look behind him on his way back from the underworld. But at the entrance to the underworld Orpheus made his fatal error of looking behind, only to see his beloved fading forever. Orpheus was inconsolable, and eventually was torn to pieces by some maenads, female followers of Dionysus.
Orpheus and Eurydice.
© te ah o o t e k ur a p o un a m u
GL3001
39
more greek heroes
This myth is very old, but in classical times Orpheus was still important as a religious figure. Because he had journeyed to the underworld and returned, he was a central figure in Orphic mysteries, rituals concerned with death and salvation. There were similar rituals called Eleusinian mysteries and Dionysian mysteries, based on the idea that Persephone and Dionysus were connected with both the lower and upper worlds. No one knows exactly what the rituals were. They remain mysteries, but those initiated into the rituals believed they would live forever in Elysium, the paradise of the underworld.
pride and punishment
You have read a number of myths where humans are punished by the gods for being presumptuous, for aiming for things beyond the reach of humanity. This fault is called hubris, a term meaning great insolence, wantonness or pride. Humans should aim at sophrosyne, or moderation and self-control, and this is a clear message from many tales. Otherwise the gods would punish them directly, or eventually Nemesis would catch up with them. Moderation in all things was a Greek ideal, and ‘nothing to excess’ was inscribed on the walls of Apollo’s temple at Delphi to give this message to all who came there to consult his oracle. 4B
What lessons are to be learned from the myths of Daedalus, Bellarophon, Niobe, the Calydonian boar hunt, Castor and Polydeuces, Oedipus and Orpheus? Check your answers.
40
© te ah o o te k u ra p ou n a mu
v
Pompeii – Villa of the Mysteries
the importance of the trojan war in the myth cycle learning outcome
Understand the Trojan War and its importance in the myth cycle.
learning intention In this lesson you will:
•• examine the Trojan War and its importance in the myth cycle.
introduction
The Trojan War was the most widely known event in the ancient world, and it is still the bestknown part of Greek mythology. In fact, it belongs to both myth and legend, because the story is probably based on fact, but the details are invented and belong to myth.
the trojan war – when, where and why Thrace
The Trojan War took place a generation after the quest for the Golden Fleece, and many of the Argonauts were fathers of heroes who fought at Troy. The tales of the war and its immediate aftermath are the last in Greek mythology, which reflects the end of the Mycenaean world within a hundred years of Troy’s destruction. The chief opponents were Troy, a rich city situated on Black the narrow straits leading to the Black Sea, and Mycenae, the leading city in Greece. Since the Sea downfall of Minoan Crete some 200 years earlier, Mycenaean civilisation had flourished, and many Greek cities sent ships and soldiers to fight against Troy.
Macedonia
© te ah o o t e k ur a p o un a m u
GL3001
41
the importance of the trojan war in the myth cycle
The mythical reason for the war was the abduction of Helen of Sparta by Paris of Troy. The real reason, if the Trojan War really did take place, was probably a plundering raid to obtain metal and other loot, or the desire to wipe out a trading rival. Scholars disagree on the date but 1250 BCE is widely accepted as well as being easy to remember. Our story begins at the wedding of Thetis and Peleus, when Eris, goddess of discord, threw a golden apple inscribed ‘For the Fairest’ among the guests. Zeus said only a mortal could be an unbiased judge, so Hermes took the apple and the three competitors – Hera, Athene and Aphrodite – to Mt Ida near Troy where Paris, son of king Priam of Troy, was tending cattle. Paris chose Aphrodite and as a reward for his choice, Aphrodite made Helen fall in love with him and sail back with him to Troy. Helen’s husband, Menelaos of Sparta, called on his brother Agamemnon of Mycenae to help him win back his wife. Agamemnon in turn summoned allies from all the Greek states, and sailed to Troy.
helen
When Zeus fell in love with Leda, wife of king Tyndareos of Sparta, he knew she loved the beautiful white swans of the River Eurotas near her home, so took the form of a swan to seduce her. Leda was pregnant to her husband at the time and produced two sets of twins, with one child in each set fathered by Zeus and one by Tyndareos. Her children were •• semi-divine Helen and mortal Clytemnestra •• semi-divine Polydeuces and mortal Castor. You read about Castor and Polydeuces in chapter IV, and will read about Clytemnestra, wife of Agamemnon, later this chapter. Helen was very beautiful and had many suitors hoping to marry her for her beauty, and also because her husband would become king of Sparta. Tyndareos was uneasy about the quarrelling his final choice of a husband might create, and on Odysseus’ advice made all Helen’s suitors promise to defend the chosen husband against anyone resenting his good luck. Menelaos was Tyndareos’ choice, so when Paris stole Helen away to Troy all Helen’s former suitors were bound to help get her back.
menelaos and agamemnon
These brothers came from a family cursed by violence and treachery. The founder of the family was Tantalus, father of the unfortunate Niobe. Tantalus offended the gods by inviting them to a feast at which he served them the flesh of his son Pelops in a stew. He was punished for this crime by being confined in Tartarus and suffering perpetual hunger and thirst. The story places him in a pool of water which recedes whenever he tries to drink, while above his head hang delicious fruits which the wind blows out of his reach when he tries to eat them. His punishment gives us the English word ‘tantalising’.
42
© te ah o o te k u ra p ou n a mu
the importance of the trojan war in the myth cycle
The gods brought Pelops back to life again and he is best remembered for winning his wife Hippodameia by defeating her father Oinomaos in a chariot race. Pelops bribed Oinomaos’ charioteer to tamper with his master’s chariot, and as well as killing his prospective father-in-law by treachery, Pelops drowned the charioteer rather than give him the promised bribe. The next generation continued the same violence and treachery. The best-known children of Pelops and Hippodameia were Atreus and Thyestes, who fought over the kingship of Mycenae. Thyestes and his son Aigisthos succeeded by murdering Atreus, but Atreus’ sons Agamemnon and Menelaos eventually reclaimed the throne, killed Thyestes and drove Aigisthos into exile. Menelaos married Helen and became king of Sparta. Agamemnon ruled Mycenae and took for his wife Helen’s sister Clytemnestra, murdering her first husband and child. Clytemnestra and Agamemnon had two daughters, Iphigenia and Electra, and a son, Orestes. When Helen was taken by Paris, the Greek fleet gathered at Aulis to sail to Troy but could not leave. Agamemnon had angered Artemis by boasting he was as good a hunter as she was, so Artemis kept the wind blowing in the wrong direction. A human sacrifice was needed, so Agamemnon sent for his eldest daughter, Iphigenia, pretending he was going to marry her to Achilles. Instead, she was sacrificed and the fleet sailed. While Agamemnon was absent at Troy, Aigisthos returned from exile and found the angry Clytemnestra very willing to become his lover and plan revenge whenever Agamemnon should return.
achilles
Clytemnestra had willingly sent her unfortunate daughter to Aulis because her proposed bridegroom, Achilles, was the greatest of all the Greek heroes who fought at Troy. Achilles was the son of Thetis and Peleus, at whose wedding Eris had begun all the trouble with her apple, ‘For the Fairest’. The legends somewhat telescope time because not only was Achilles old enough to fight at Troy, but his son Neoptolemos was also old enough to fight there and kill Priam, king of Troy. Achilles was invincible in battle because Thetis had dipped him as an infant in the underworld river Styx, but her fingers prevented the waters from reaching the ankle she held him by. This was the only part of him which could be injured – his ‘Achilles heel’ – and Paris wounded him here with a poisoned arrow shortly before the Trojan War ended. Achilles was a typical Homeric hero, strong and brave, but also brutal and selfish towards enemies and allies alike. When offered the choice between a long, quiet life or a short glorious one he chose the second option. 5A
What caused the Trojan War? Write half to one page, outlining the real reasons for the war and the reasons given in mythology. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
the importance of the trojan war in the myth cycle
thomas hope
odysseus
Odysseus.
Another hero associated with Troy is Odysseus, king of Ithaca. One of the unsuccessful suitors for Helen, he eventually married Penelope, and had to leave her and their infant son Telemachus when he went to Troy. He did not want to go and pretended to be mad to avoid it, ploughing the seashore and sowing it with salt. However Palamedes, one of the group which came to summon him to Troy, placed Odysseus’ baby Telemachus in front of the plough, forcing Odysseus to stop to avoid killing his son. Thus he showed he was not mad because an insane person would have continued to plough. Odysseus never forgot that Palamedes was responsible for him going to Troy, and as we shall see in the next chapter, he eventually took revenge. If you read about Odysseus in Homer’s poem the Odyssey, you have the story of the brave, resourceful hero fighting colossal odds to get home to his beloved wife and to rid his home of her unwelcome suitors. But if you read the Iliad or any other legends directly associated with Troy, you meet a very different picture. Odysseus is very brave and endlessly cunning and inventive, but he is also the rather nasty person who smashes out the brains of Hector’s infant son, frames Palamedes for treachery, and tries to stab his friend, Diomedes, so he can grab all the credit for stealing a statue of Athene, the Palladium, from Troy. All Homeric heroes were brave and strong, but they also tended to be rather stupid. Odysseus stands out for his quick mind, and he was probably the most feared and hated of all the Greeks. Moreover, he had one very formidable ally. The goddess Athene favoured him because of his cunning, and also helped him and all the Greeks at Troy because she resented Paris’ slight to her beauty. Hera also hated the Trojans for the same reason, and helped the Greeks whenever possible.
44
© te ah o o te k u ra p ou n a mu
the importance of the trojan war in the myth cycle
the trojans
At the time of Troy’s destruction it was ruled by the elderly king Priam and queen Hecuba or Hecabe. They had many children, and here is a description of those important in the tale of Troy. Paris: when Hecabe was pregnant with Paris, she dreamed she gave birth to a blazing torch, whose flames set all Troy on fire. Priam consulted his son, Aesacus, who was an interpreter of omens, and was told that the child would be the ruin of Troy and should be killed. Some days later Aesacus declared, ‘The royal Trojan who gives birth to a child today must be killed, and so must her offspring.’ Priam promptly killed his sister, Cilla, who gave birth to a child that morning. Later in the day Hecabe produced Paris, and Priam was urged by the various seers in Troy to destroy him. But the king gave the task to his shepherd, who exposed the baby on Mt Ida where it was suckled by a she-bear. Later Paris was rescued and reared by the same shepherd. He grew up to be outstandingly handsome, intelligent and athletic, but not much is ever said about his courage. His weapon was the bow and arrow, which was regarded as a coward’s weapon as it did not bring the fighter into hand-to-hand combat. As a herdsman Paris enjoyed watching bulls fighting, and promised a golden crown to any bull which could beat his own champion bull. As a joke, the god Ares turned himself into a bull. When Paris without hesitation awarded him the crown, this fair dealing was observed by the gods on Olympus, and thus Hermes chose him to judge the goddesses’ beauty contest. Each goddess offered Paris a tempting bribe. Hera promised to make him lord of all Asia and the richest man alive, while Athene offered him wisdom and victory in war. But Aphrodite promised him the most beautiful woman in the world, Helen of Sparta, for his wife, and won the prize. So Hera and Athene plotted how to gain revenge and actively worked to help the Greeks destroy Troy. Not long afterwards, Paris attended some funeral games given by Priam and easily won contests in boxing and running. When Priam’s sons were enraged at being defeated and decided to kill the unknown Paris, the old shepherd who had reared Paris ran to Priam and told him this was his lost son. Priam welcomed the news and celebrated the discovery with feasting and sacrifices. When his seers warned him that Paris should be slain at once, or Troy would fall, Priam is said to have answered, ‘Better that Troy should fall than that my wonderful son should die.’ A short time later Paris visited Sparta and was welcomed by Menelaos, Helen’s husband. Aphrodite carried out her promises, and the infatuated Helen happily sailed with Paris back to Troy. Here she was welcomed because of her divine beauty, and Priam vowed that Troy would never let her go. Paris was killed by an arrow before Troy fell. Cassandra: Apollo fell in love with her, and offered her the gift of prophecy if she would become his mistress. Cassandra first agreed, then refused. The gift of a god, once given, cannot be taken away, but it can be altered, and Apollo placed on her the curse of never having her prophecies believed. Cassandra predicted the doom of Troy for years, but was never believed.
© te ah o o t e k ur a p o un a m u
GL3001
45
the importance of the trojan war in the myth cycle
Cassandra’s fate was as tragic as that of all the Trojan women. The main Greek leader, Agamemnon, did not respect her virginity, as Apollo had, but took her as part of his war booty. By the time he reached Mycenae, Cassandra had borne him twins, and all three were murdered along with Agamemnon by his wife Clytemnestra and her lover Aegisthus. Cassandra predicted her death and that of Agamemnon – but as usual this was in vain. Creusa: she was married to Aeneas, son of Aphrodite and Anchises. She died during the sack of Troy, but her son Ilus escaped with his father Aeneas. They sailed eventually to Italy, to become the ancestors of the Roman race. Thus, through Creusa the blood line of the royal house of Troy was preserved. Deiphobos: he was the unfortunate man who married the beautiful Helen after Paris’ death. On the night of the sack of Troy, the Greeks caught him unawares in bed, and the vengeful husband, Menelaos, was not content merely to kill Deiphobos, but cut off his nose, ears, and presumably other prominent parts of his body. Hector: the greatest of the Trojan warriors, who could only be killed by the mightiest Greek warrior, Achilles. Hector’s death is told in Homer’s Iliad. Previously he had slain Achilles’ friend, Patroclus, and stripped him of his armour, the usual practice of Homeric heroes to prove that they had ‘made their kill’. But the armour really belonged to Achilles, and when Achilles came out to avenge his friend’s death he found Hector dressed in his own armour, which made him angrier than ever. He killed Hector, and instead of accepting a large payment for the body so that it could be properly buried, as was the custom, the uncivilised Achilles dragged the body round the walls of Troy every day behind his chariot. Eventually Priam persuaded him to exchange the body for an enormous amount of gold. Hector’s wife, Andromache, became the slave of Achilles’ son Neoptolemos, while their infant son Astynax was thrown from the walls of Troy and killed. Helenos: warrior and prophet, he also was carried off by Neoptolemos, who gave him Andromache as his wife. They settled in Epirus in northwest Greece and made ‘a little Troy’. They were visited by Aeneas, to whom Helenos prophesied his (Aeneas’) future wanderings. Troilus and Polyxena: these were children of Hecabe and Priam, rulers of Troy. It was said Troy would not fall if Troilus reached the age of 20, so Achilles undertook to end his life. When the young Trojans went out of Troy to get water from a fountain, Achilles ambushed them and killed Troilus. Achilles fell in love with Polyxena, who escaped back to Troy. He showed his affection by demanding as he died that she be sacrificed at his tomb. When Troy fell and Polyxena was captured she was killed to appease Achilles’ spirit, which was complaining that he wasn’t sharing in the spoils of the looted city.
46
© te ah o o te k u ra p ou n a mu
the importance of the trojan war in the myth cycle
sources of the tales of troy – the iliad and the odyssey
The fall of Troy was the most famous event in the ancient world and is told or referred to by many ancient writers. Our oldest source is the epic poems of Homer, the Iliad and the Odyssey. The Mycenaean civilisation collapsed within a century of the fall of Troy and soon only the memories of former glory remained. These memories were used as the raw material for poems composed and sung by minstrels, who could not read and write, to an equally illiterate audience, on occasions such as a feast or religious festival. The Iliad and the Odyssey belong to the eighth century BCE (remember Troy fell in 1250, the middle of the thirteenth century BCE) and are the final versions of songs which had been passed on orally for several centuries. No doubt there were many such poems, but only these two have survived in their full and polished form. They tell only small parts of the long tale of Troy. The Iliad describes an incident in the tenth year of the siege of Troy by the Achaeans. (Homer does not call them Greeks, which was the name used by the Romans centuries later. The Greeks called themselves Hellenes.) Agamemnon takes away from Achilles his female captive Briseis, so Achilles sulks and refuses to fight the Trojans. However, when his friend Patroclus is killed by Hector, Achilles goes berserk. He kills Hector and mutilates the body, but eventually agrees to ransom it to Hector’s father Priam for a huge price. The Odyssey tells of the return of the Achaeans to their homes after the fall of Troy, and in particular describes the homecoming of Odysseus.
the aeneid
Most heroes of Troy died defending their city, but one who survived was Aeneas, son of Aphrodite, who left the burning city carrying his aged and crippled father Anchises on his back. One version says he was seen by Agamemnon, who was so touched by Aeneas’ devotion to his father that he let them go safely. Aeneas was one of many Trojan heroes and not very important in Homer’s tales, but after Homer’s time stories about Aeneas grew. With a group of Trojan men and women, he wandered the Mediterranean for seven years. They finally settled in Italy and intermarried with the Italian peoples. Centuries later their descendants founded and inhabited Rome. In the first century BCE, the Roman poet Vergil wrote a poem called the Aeneid about the adventures of Aeneas. He used the works of many other writers which have long since disappeared, and the Aeneid is another major source for the tales of Troy. 5B
Draw the following family trees: 1. The family of Achilles. Include Peleus, Thetis, Achilles, Neoptolemus. 2. The family of Odysseus. Include Odysseus, Penelope, Telemachus. 3. The family of Paris. Include Priam, Hecabe, Paris, Cassandra, Creusa, Helenos, Deiphobos, Hector, Astynax, Ilus. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
the gods of rome and the dei consentes learning outcome
Understand the Gods of Rome and their relationship with the Greek gods.
learning intention In this lesson you will:
•• examine the Gods of Rome and their relationship with the Greek gods.
introduction
In ancient Rome, the 12 major gods were called the Dei Consentes – the Roman Council. The Dei Consentes was created around 200 BCE or so, after Hannibal had beaten the Romans badly in the north. Hannibal had not yet made it to Rome, but he was targeting Rome, and the Romans knew it. The Roman Senate called on the Roman Collegia, the professors and teachers in Rome, and asked for advice. The Collegia thought about it and came back with an idea. They suggested the problem was that Rome needed to present a special public display honoring the top 12 gods, along with a special feast. The Roman Senate decided that was a sound idea. They named this Roman council of 12 gods the Dei Consentes (Agreed Gods of Rome). They ordered six couches to be set up in public, and ordered their top artists to create sculptures of 12 god heads – no bodies, just heads. These sculptures were displayed in public on the couches in pairs – Jupiter and Juno, Neptune and Minerva, Mars and Venus, Apollo and Diana, Vulcan and Vesta, Mercury and Ceres – six couches, 12 gods, but no Pluto. In Roman mythology, Pluto was not a member of the Council of 12, the Dei Consentes, but Vulcan was. Hannibal never made it to Rome, so the people believed that this display created in the honour of the Council of Gods – the top 12 gods – and they believed that it worked. It saved Rome. This set the pattern, the Romans believed that if Rome was threatened the Dei Consentes, the 12 most powerful gods in the heavens, would defend Rome. This belief was essential to the way you view the Romans and their gods. The Romans believed in many different gods and goddesses. For everything imaginable they had a god or goddess in charge. Mars, for example, was the god of war. This meant he was good at fighting and it meant that he had most of all the soldiers at heart. A Roman soldier would hence most likely pray to Mars for strength in battle. But Minerva was the goddess of wisdom, intelligence and learning. Not many soldiers would ask her for help. The Romans indeed had hundreds of different gods. This entire collection of all their gods was called the Pantheon.
48
© te ah o o te k u ra p ou n a mu
thomas hope
the gods of rome and the dei consentes
Selecting a sacrifice.
a strange mix
The Romans gods were from a strange mixture of influences. Before Rome became a big city, the area around it, called Latium, was settled by superstitious villagers, the Latins, who believed in many gods and spirits. As Rome grew into a city and began to become more powerful it came into contact with the Greeks, who had a complex Pantheon of their own. It seems that the Roman gods were a mix of those two main influences: Latin and Greek. In many cases the Romans found there was a Latin and a Greek god for one and the same thing. They tended to take the two and make them one. So for example, Vulcan was the old Latin god of fire. The Greeks had a god called Hephaestus, who was very similar, and so the Romans just mixed the two together and made them one. Paintings or statues of Vulcan generally showed him as a blacksmith, like the Greek Hephaestus, but his name still was the Latin Vulcan.
In Roman religion every household had its own personal spirits which protected it. The lares were the spirits of the family’s ancestors. And the penates were kind spirits who guarded the larder. Little figurines of these spirits were kept in a small household shrine, called the lararium. The spirits would be worshipped by the family on special days. Bits of food or wine might be sacrificed to them.
Š te ah o o t e k ur a p o un a m u
bridgeman i
Statuette of a lar holding a cornucopia. GL3001
49
the gods of rome and the dei consentes
new gods, new religions
With the vast size of the empire, there was of course many new gods from distant civilizations which the Romans learnt about. Romans didn’t tend to think that only their gods were the right ones. If they heard of other peoples’ gods they would think that these were real gods who watched over other parts of the world and whom they had simply not yet heard about. And so as they learned about these new gods, new temples were built to these new arrivals in the Roman pantheon.
the dei consentes jupiter – reigned supreme According to ancient Roman myth, Jupiter was the king of all the gods. Jupiter had two brothers and three sisters. When Saturn, their father, died, the boys – Jupiter, Neptune and Pluto – divided the world up between themselves. Jupiter took all of the heavens, Neptune took the sea, and Pluto took the underworld. Each was quite content with their selection. One of the differences between the Greek and Roman myths is that in Greek mythology, Zeus was controlled in part by the Fates. His was also an elected position – he could have been ousted by the other gods, not that they ever managed it. But Jupiter, the Roman god, was the god supreme. He ruled heaven and earth and all life. Jupiter listened to his various advisors – especially the other gods who made up the Council of 12. He might even assign one of the other gods to make a decision, but the final word was his. Like the Greek god Zeus, Jupiter had a very jealous wife – Juno. He also had a great many children. Jupiter was very fond of all his children.
juno
Juno’s temples were mostly in Rome. Every March 1st there was a big festival in ancient Rome to honour Juno. It was a very serious affair. Roman women were serious about their goddess. Although the Romans enjoyed the Greek myths about queen Hera, they treated some of these myths with a ‘not much truth in them really, but aren’t they fun’ kind of attitude.
50
GL3001
thoman hope
Juno was married to Jupiter. She was the queen of all the gods, and also the goddess of marriage. In Greek myth, Hera often behaves as a dangerously jealous, petty queen of the heavens, who is not nice at all and spends a great deal of her time getting even, whether the slights are imagined or real. But in Roman mythology Juno was the beloved goddess of marriage, worshipped as a housewife and mother and matron. Although Juno watched over all Roman women, her special concern was Roman married women.
Juno Lucina.
© te ah o o te k u ra p ou n a mu
the gods of rome and the dei consentes
neptune Neptune was the Lord of the Sea. His brothers were Jupiter – the king of all the gods – and Pluto, the king of the underworld. Neptune was confident and good looking. He had deep blue eyes and streaming green hair. Neptune was very powerful. He could raise his hand and a new island would appear! People were terrified of Neptune, especially those who lived in coastal towns. The ancients built temples to honour Neptune. They brought special gifts to the temple every day, hoping to keep him happy. Sometimes it worked. Sometimes it didn’t. Neptune as god of the sea was known as a very uncertain god.
mars Mars was the son of Jupiter and Juno. Nobody liked him much, not the gods and not the mortals. Mars was tall and handsome, but also mean and self-centred. His sidekick, Discordia, the spirit of disagreement, travelled everywhere with him. They carried four lesser spirits along as well – the spirits of Pain, Panic, Famine and Oblivion. In Roman mythology, Mars did not care who won or lost a battle. He just liked to see bloodshed. Most of the other gods stayed as far away from Mars as possible. He only caused trouble.
mercury Mercury was the youngest son of Jupiter. Even as young boy, Mercury was incredibly mischievous. He stole Venus’ girdle. He borrowed Diana’s arrows. He played with Mars’ spear without permission. But he was so charming and fun and funny that he was forgiven every time. He was the universal favorite of all the gods. Even as a baby, Jupiter could tell that Mercury was going to be fun to have around. He liked his son Mercury very much. Jupiter wanted Mercury to have an important job in the world of the Greek gods. Mercury was fast on his feet and very clever, so Jupiter decided he would make a wonderful messenger. Things were always going on in the mythical world. The job of messenger to the gods allowed Mercury to have the inside material on just about everything. It is no wonder that there are probably more myths that include Mercury than any other god. The other gods trusted Mercury. Mercury had true warmth. He was playful enough to be interesting. He was very bright and very loyal, the best negotiator in the world, and he was always working on deals to get himself and others out of trouble.
© te ah o o t e k ur a p o un a m u
GL3001
the gods of rome and the dei consentes
apollo and diana
Diana was very different from her brother. It took a lot to get Apollo angry – he was usually gentle and full of warmth – but Diana was nearly always cold and pitiless. The only thing Diana loved besides her family were her floppy-eared dogs. Diana was the goddess of the hunt and of the moon.
Apollo.
thoman hope
Apollo and Diana were twins. They were the magical children of Jupiter and Latona. Both adored their mother, about whom Apollo was especially protective. Apollo was the god of the sun, of music, and of light. His twin sister Diana was the goddess of the moon and the hunt.
minerva Minerva was born without a mother. Her father was the mighty Jupiter, king of all the gods, and Minerva was born directly out of Jupiter’s head. According to legend, Jupiter’s head was hurting and Vulcan used his axe to split it open and out came Minerva fully dressed. Jupiter loved all his children, but if he had to pick a favorite, it would probably have been Minerva, the goddess of wisdom. Minerva was a powerful force, and one of the deities who made up the Dei Consentes, the Roman Council of 12 gods.
vesta Vesta was the goddess of hearth and home. She was Jupiter’s sister. She had three famous brothers, actually – Jupiter, Neptune and Pluto. She also had two very famous sisters – Juno, queen of the gods, and Ceres, queen of the harvest. You would think there would be lots of myths about such an important goddess, but there are not a lot of myths about Vesta. Still, she was quite important to the women in ancient times. Every day, when the women gathered in the central courtyard of their homes to do their sewing and cooking, they knew that Vesta was keeping watch over them. Vesta was not, perhaps, as important a goddess in ancient Rome as she was as Hestia in ancient Greece. Roman women had far more freedom, especially under the Empire. But both Roman and Greek women took comfort in Vesta. Vesta held a seat on the Roman Council of 12 gods, the Dei Consentes.
bacchus – god of wine Bacchus was the god of wine. He was accompanied by Maenads, or wild dancing women, who carried the thyrsus – a staff of giant fennel, covered with ivy leaves, with a pine cone on top. Bacchus was also the god of the theatre, since the first plays in Greece were performed in his honour. There were tragedies, serious stories about heroes and gods, and comedies, which laughed at politicians and were less than flattering for the people concerned!
52
© te ah o o te k u ra p ou n a mu
the gods of rome and the dei consentes
venus – goddess of love Venus was born in the sea and first came to shore at Cyprus, floating on a scallop shell. Like the Greeks, the Romans had a myth about the Trojan War. There was a Golden Apple with ‘For the Fairest’ written on the side. Venus, Juno and Minerva all wanted it. They decided to let a man, Paris, judge between them, but they were all so beautiful that he couldn’t make his mind up. So Juno said she would make him powerful. Minerva said she would make him wise. Venus offered him Helen, the most beautiful woman in the world. He chose Venus – and Helen. Unfortunately Helen was married to someone else, and when Paris carried her off to his home at Troy, her husband came with his allies to get her back. Paris and all his family were killed and Troy was destroyed. One of the few Trojans to survive the Trojan War was Aeneas, the son of Venus. He went to Italy, and was the ancestor of the Romans.
cupid – son of venus Cupid was the mischievous little god of love. His weapon was a bow, and anyone hit by one of his arrows fell madly in love. Cupid once scratched himself with one of his own arrows by mistake while looking at a woman called Psyche, falling in love with her. He knew that his mother Venus would be angry, so he hid Psyche away and told her that she must never try to look at him. Psyche thought that she had been captured by a hideous monster and, of course, couldn’t resist taking a peep. She was enchanted by the first sight of her handsome husband and, while playing with his arrows, scratched herself. This had the same effect as it had on Cupid, and the two were now desperately in love with each other. Discovering the love affair, Venus drove Psyche away. Psyche had many adventures before she was allowed to stay with Cupid, and Venus became reconciled to being a mother-in-law!
ceres
Ceres was the Earth goddess and goddess of corn. She carried the cornucopia, a horn full of vegetables and fruit. Her daughter was Persephone. Pluto fell in love with Persephone, and carried her off to the Underworld. Ceres searched everywhere, but couldn’t find her. Eventually Ceres refused to let the plants grow any more, and everyone begun to die of hunger. So Pluto admitted he had Persephone, but said she could only go back home if she had eaten none of the food of the Dead. Persephone was so sad at being kept underground that she had eaten almost nothing, but she had eaten six seeds from a pomegranate. This meant that she could go home, but had to return to her husband for six months every year. When this happens, Ceres stops everything growing, and winter comes.
vulcan Vulcan was the smith of the gods, and made Jupiter’s thunderbolts. His forge was in the heart of Mt Etna the volcano that dominated Sicily. Once, he made Jupiter angry, and Jupiter threw him out of Heaven. Vulcan fell to Earth and broke both legs, which made him lame.
© te ah o o t e k ur a p o un a m u
GL3001
53
the gods of rome and the dei consentes
pluto – not a member of the dei consentes Pluto and Jupiter and Neptune were three very powerful gods. They were also brothers. Way back when their father, the might Saturn, died, and the brothers first divided up the world, Jupiter took the sky, Neptune took the sea, and Pluto took the underworld. In time, Jupiter became the king of all the gods. Neptune married happily. As for Pluto, he was quite was content, living in the Underworld. Pluto was NOT the lord of death. His job was to run the Underworld. He was a good ruler. Parts of the Underworld, where heroes dwelled after they died, were very nice. Other parts were not so nice, and these were for people who were not good during their lifetime. You might think Pluto would be terribly lonely, surrounded by the souls of the dead, but he wasn’t. Unless they were in a lot of trouble with the gods, souls were only in Hades for a set period of time before they were reborn and sent back to earth. Additionally, Pluto had visitors. His brother Jupiter visited, as did his nephews Apollo, Mercury, and Mars. As well, Pluto came up to the surface now and then, if he had to be on Mount Olympus for a meeting of the gods or something. The thing was, Pluto preferred the Underworld. It was home. Pluto had everything he needed. He had an invisible helmet, which he liked very much. He had a golden chariot, which was his pride and joy. Eventually, he fell in love with the beautiful Persephone and the final arrangement was that she spent half the year with him and the other half the year above ground. 6A
1. Outline the historical reason for the existence of the Dei Consentes. 2. Name them. 3. Where were they found in Rome? Check your answers.
list of gods Greek Name Roman Name Zeus / Jupiter Hera / Juno Poseidon / Neptune Athena / Minerva Ares / Mars Aphrodite / Venus Apollo / Apollo Artemis / Diana Hephaestus / Vulcan Hermes / Mercury Demeter / Ceres Hestia / Vesta who resigned, to be replaced by Dionysus / Bacchus
54
© te ah o o te k u ra p ou n a mu
vii
the aeneid and its part in the myth cycle learning outcome
Understand the new myth of Rome was different to the Homeric myth.
learning intention In this lesson you will:
•• examine the Aeneid and understand its relationship to the Roman state.
background to the aeneid
The poet Virgil wrote the Aeneid – the great national epic poem of ancient Rome. It is considered an important literary work in Western civilization which has influenced countless other important books such as Dante’s Divine Comedy. (see GL3002.) Ovid mentions Aeneas in his Metamorphoses (see GL3002) and it is these works indicate that Aeneas survived the Trojan War. The story did for ancient Rome what the Iliad and the Odyssey did for ancient Greece. Virgil built his epic on aftermath of the Trojan War, but took the story in a new direction by weaving an after-the-fact account of the creation of Rome while expressing the essence of Roman culture to Romans themselves. The Aeneid was based on the Iliad and also Ovid’s Metamorphoses by expanding the story of a minor character known as Aeneas. Virgil assumed that his readers knew the basic outline of the Iliad and Odyssey. In the Iliad, Aeneas was a minor character mentioned briefly in book 20 in which the sea-god Poseidon prophesied that Aeneas would survive the burning of Troy and become the founder of a new city. But the Iliad did not specify which city this would be. Virgil used this ambiguity to determine that the city to be founded by Aeneas’ descendants would be, in fact, Rome. There is no substantial written historical evidence to assert the truth of this, although there were some accounts by Greek writers in the fifth century BCE that Aeneas’ new city was Rome. According to stories about the Trojan War, some of which have not survived but they’re alluded to, Aeneas was the son of a Trojan named Anchises and the goddess Aphrodite or as she was known in Rome, the goddess Venus. He survived Troy’s fall and fled to Italy where he married the princess Lavinia and founded the city Lavinium; and Aeneas’ son Ascanius founded the neighboring Italian city of Alba Longa. GL3005 and GL3006 focus on the Aeneid and you can read the epic in depth at that point. This happened approximately eight-hundred to a thousand years prior to writing the Aeneid, and it allowed Virgil to establish Aeneas as a ‘founder’ of Rome, even though there is another myth of the founding of Rome which describes the battle between two brothers (Romulus and Remus), that also caused the city to be founded. The Romulus and Remus legend has Romulus killing Remus around 753 BCE and then inviting others to join him in his new city. They then abducted Sabine women for their wives to enable the population growth of the city of Rome.
© te ah o o t e k ur a p o un a m u
GL3001
55
the aeneid and its part in the myth cycle
In essence, Virgil doesn’t contradict the Romulus and Remus origin story, but finds a way to have both stories co-exist along a timeline of history, and repeats the pattern of the city’s founding. Virgil deliberately fabricated this historical myth on a structure often parallel to the Iliad and Odyssey, and it focused on different themes such as leadership, the relation of the individual to the state, the struggle between desire and duty, the power of fate, and the changing power and influence of gods, particularly the Roman gods Juno, Venus and Jupiter. For the Romans, it quickly became a textbook for students to learn about their culture and their language. Furthermore, it reflected a new synthesis of Greek and Latin culture. The Aeneid is not only a personal epic about Aeneas, his suffering and his trials, but also about the role of the gods and a hymn of praise to Rome and the future of the Roman people. The poem begins: I sing of arms and the man, he who, exiled by fate, first came from the coast of Troy to Italy, and to Lavinian shores – hurled about endlessly by land and sea, by the will of the gods, by cruel Juno’s remorseless anger, long suffering also in war, until he founded a city and brought his gods to Latium: from that the Latin people came, the lords of Alba Longa, the walls of noble Rome. Muse, tell me the cause: how was she offended in her divinity, how was she grieved, the Queen of Heaven, to drive a man, noted for virtue, to endure such dangers, to face so many trials? Can there be such anger in the minds of the gods? Translated by A. S. Kline © 2002 All Rights Reserved This work may be freely reproduced, stored, and transmitted, electronically or otherwise, for any non-commercial purpose.
origins of the aeneid
Virgil was a well-educated Roman poet who lived around the time of Augustus Caesar. At the time, the Roman Republic had dissolved into essentially a military dictatorship led by Augustus Caesar. The work was commissioned indirectly by Emperor Augustus Caesar via an intermediary named Maecenas. Virgil wrote the Aeneid in dactylic hexameter using rhymes positioned strategically to juxtapose key concepts. But while trying to perfect the last phases of his manuscript, he died on a sea voyage. While dying, he requested that his unpublished manuscript be burned, but Augustus ordered it preserved and the manuscript survived. It rapidly became popular in the Roman Empire. But there are indications in the text of inconsistencies and unresolved issues which might have been addressed if Virgil had completed his epic, and places where the hexameters were incomplete.
56
© te ah o o te k u ra p ou n a mu
the aeneid and its part in the myth cycle
the epic that explains the greatness of rome
We learn very early in the text what will happen. We know it will have to happen because the king of the gods says so to his favourite goddess Venus (also known as Cytherea) and the rest of the epic is showing us how it happens. Bk I: 257–296 Jupiter’s Prophecy Don’t be afraid, Cytherea, your child’s fate remains unaltered: You’ll see the city of Lavinium, and the walls I promised, and you’ll raise greathearted Aeneas high, to the starry sky: No thought has changed my mind. This son of yours (since this trouble gnaws at my heart, I’ll speak, and unroll the secret scroll of destiny) will wage a mighty war in Italy, destroy proud peoples, and establish laws, and city walls, for his warriors, until a third summer sees his reign in Latium, and three winter camps pass since the Rutulians were beaten. But the boy Ascanius, surnamed Iulus now (He was Ilus while the Ilian kingdom was a reality) will imperially complete thirty great circles of the turning months, and transfer his throne from its site at Lavinium and mighty in power, will build the walls of Alba Longa. Here kings of Hector’s race will reign now for three hundred years complete, until a royal priestess, Ilia, heavy with child, shall bear Mars twins. Then Romulus will further the race, proud in his nurse the she-wolf’s tawny pelt, and found the walls of Mars, and call the people Romans, from his own name. I’ve fixed no limits or duration to their possessions: I’ve given them empire without end.
bridgeman
Translated by A. S. Kline © 2002 All Rights Reserved This work may be freely reproduced, stored, and transmitted, electronically or otherwise, for any non-commercial purpose.
Aeneas would go to Italy and his son Ascanius, named Iulus – would become a mighty power.
© te ah o o t e k ur a p o un a m u
GL3001
the aeneid and its part in the myth cycle
similarities and differences with virgil’s and homer’s epics.
A comparison of Virgil’s Aeneid, and Homer’s Odyssey will help to show the different aspects of Roman and Greek cultures. However, Virgil did not imitate, he gave a new meaning to the works that he borrowed and added his own thoughts and opinions that expressed and explained Roman life to the rest of the world. The Aeneid is not only a personal epic about Aeneas, but also exaltation and beautification of Rome and the future of the people. There is a greater emphasis placed upon the founding of Rome rather than the actual adventure of Aeneas. Virgil’s epic shows that he had a great admiration and pride in Rome and its people. Homer used the story of the Odyssey to express the qualities of the hero and the place of revenge in a hero’s life.
what is distinctly roman about the aeneid?
Throughout the epic we learn the importance of fate and destiny. Aeneas is driven by fate, but in the Odyssey there is only the occasional reference.
Gods: the portrayal of the gods is much different in both epics. The gods are involved on a daily basis with all aspects of life in the Aeneid, whereas in the Odyssey they come and go but tend to be there at crucial times.
thomas hope
Women: the portrayal of women is distinctly different in both epics. In the Odyssey, women had a greater amount of freedom. We see Penelope questioning Odysseus about his bed although she remained at all times remaining a model wife. She had greater freedom of action but it was made clear that she stayed ‘chaste’ and she slept with the women in the large ‘women’s section’ of the palace. In the Aeneid, Dido breaks her tie to her dead husband (assisted by the gods), while Aeneas’ bride-tobe in Italy is acknowledged only by name, she is given no part to play at all other than a dutiful and mute wife.
Aeneas’ mother – Venus.
Heroism: the ideals of heroism are distinctly different in both epics – we see Odysseus as a trickster, Homeric heroes have a tendency to be kill-first and ask questions later, but Aeneas, as he matures, becomes more diplomatic and considered in everything he does. Father/son relationship: the father/son relationship is strong in the Odyssey, but absolutely paramount in the Aeneid. Aeneas flees Rome with his elderly father over his shoulder and his son taken by the hand.
58
© te ah o o te k u ra p ou n a mu
the aeneid and its part in the myth cycle
Role of the individual: the relationship of the individual to the state and the struggle between desire and duty were clearly Roman themes. The Greeks were heroes who put themselves and their own households first. However, the Romans were encouraged to do their duty and if necessary lay down their lives for the good of the state. There are a number of other points, but from these you can see that Virgil wanted to ensure that the qualities of a good Roman were part of his key character. 7A
Outline two or three things that Jupiter promises will happen in his scroll of destiny. Check your answers.
Š te ah o o t e k ur a p o un a m u
GL3001
59
viii answer guide i. what is a myth? 1A
Reasons myths were created and the purposes they serve include: •• to explain the origins of the world •• to explain the happenings of nature •• to explain and justify existing customs and rituals •• to reflect human dreams and wishes.
1B
3000 BCE – Bronze Age begins. 2500 BCE – Fertility Goddess worshipped. 1450 BCE – Invasion of mainland Greece by Achaeans. 1250 BCE – Minoan civilisation in Crete flourishes. 1100 BCE – Mother/earth goddess still supreme. 1050 BCE – Minoan civilisation destroyed. Mycenaean civilisation flourishes. 1000 BCE – Troy sacked. All mainland Mycenaean centres destroyed. Invasion of Dorians. Writing lost. Myths created and retold orally. 800 BCE – Homer composed the Iliad and Odyssey. 500 BCE – Writing now in general use. Myths written down. Details changed or added by powerful states. 400 BCE – Hellenistic and Roman writers write down stories in the versions we have today.
ii. the greek gods and their functions 2A
1. Important points about Greek divinities might include: •• there were large numbers of them •• some were more important than others •• they were usually of human shape •• they had human appetites, desires and failings •• they were larger, more beautiful, more powerful than humans •• in a moral sense they were no better than humans •• they were immortal •• they didn’t care whether humans were good or not •• they only required worship from their followers •• they weren’t evil •• to humans they might be friendly, indifferent or hostile •• they caused everything that happened
60
© te ah o o te k u ra p ou n a mu
answer guide
•• they could tinker with minor details •• fate decided the general scheme of events. You may have thought of others, which your teacher will check. 2. Differences between the religion of the ancient Greeks and Christianity: Greeks Christians many gods
one god
answer guide
2B
Hestia: goddess of hearth and home. Sweet, kindly nonentity. Gave place on Olympus to Dionysus. Demeter: goddess of corn and fertility. Her daughter Persephone’s abduction by Hades explains seasons of the year. Eleusinian mysteries celebrated in their honour. Hera: goddess of marriage, childbirth and ‘women’s affairs’. Resented husband’s infidelity. Hades: god of the underworld, ruler of the dead. Poseidon: god of the sea, contender with Athene for power in Athens. Zeus: supreme god over gods and humans. Noted for numerous love affairs.
iii. the greek heroes 3A
1. The 12 labours of Heracles were: i. killing the Nemean lion ii. killing the Hydra of Lerna iii. capturing the Ceryneian hind iv. capturing the Erymantheian boar v. cleaning out the Augeian stables vi. killing/driving away the Stymphalian birds vii. capturing the Cretan bull viii. taming the mares of Diomedes ix. fetching the girdle of Hippolyte x. stealing the cattle of Geryon xi. gathering the golden apples of Hera xii. kidnapping Cerberus. 2. Heracles represented the ideal man in an age which put physical strength and courage first. He was always successful despite great odds, and everyone loves a winner. He could feature in tales set in almost every part of Greece, and in fact in almost every land in the Mediterranean, so every state could relate a story about ‘when Heracles visited here’. As you may have thought of other reasons, your teacher will check your work.
iv. more greek heroes 4A
1. A quest story involves a hero or heroes, setting out to do something or to find something of value far away. There must be many difficulties along the way and even when the goal is reached, so that the ‘questers’ must pass many tests of courage and ingenuity. They are told because people enjoy adventure stories which have a purpose. 2. Tolkein: Lord of the Rings. Terry Brooks: Sword of Shannara. David Eddings: Belgariad and Malloreon.
62
© te ah o o te k u ra p ou n a mu
answer guide
4B
Daedalus Daedalus brought misery to others by his inventions and finally to himself. His son Icarus flew too high, which a mortal must not do, and paid the price. Bellerophon He also flew too high, and Zeus ‘cut him down to size’ and killed him. The lesson here is that if you get too ambitious, the gods will destroy you. Niobe She boasted she was superior to Leto because she had more children. Leto’s children were infinitely more powerful and killed all Niobe’s children. Lesson: quality is more important than quantity. Don’t presume to be superior or even to equal a god. The Calydonian boar hunt All the hunters were anxious to kill the boar, and competed rather than co-operated. Thus a number were killed. Lesson: sometimes co-operation is preferable to competition. Castor and Polydeuces When mortal Castor died, semi-divine Polydeuces offered to spend half the year dead so his brother could live during that time. Zeus set them both in the sky. Lesson: sometimes even the gods are touched by devotion. Oedipus His parents and he both tried to escape from the prophecy that he would kill his father and marry his mother, but in vain. Lesson: you cannot avoid your fate. Orpheus When his wife died, he used the power of his music to win her back from the underworld, but lost her again when he broke a promise not to look back. Lesson: the power of love and beauty is very great.
v. the importance of the trojan war in the myth cycle 5A
The war originated from a quarrel between the goddesses Athena, Hera and Aphrodite, after Eris, the goddess of strife and discord, gave them a golden apple, sometimes known as the Apple of Discord, marked ‘for the fairest’. Zeus sent the goddesses to Paris, who judged that Aphrodite was the ‘fairest’ and should receive the apple. In exchange, Aphrodite made Helen – the most beautiful of all women and wife of Menelaus – fall in love with Paris, who took her to Troy. Agamemnon, king of Mycenae and the brother of Helen’s husband Menelaus, led an expedition of Achaean troops to Troy and besieged the city for ten years because of Paris’ insult. After the deaths of many heroes, including the Achaeans Achilles and Ajax, and the Trojans Hector and
© te aho o t e k ur a p o un a m u
GL3001
63
answer guide
Paris, the city fell to the ruse of the Trojan Horse. The Achaeans slaughtered the Trojans (except for some of the women and children whom they kept or sold as slaves) and desecrated the temples, thus earning the gods’ wrath. Few of the Achaeans returned safely to their homes and many founded colonies in distant shores. The Romans later traced their origin to Aeneas, one of the Trojans, who was said to have led the surviving Trojans to modern-day Italy. Other reasons for the war: the ancient Greeks thought that the Trojan War was a historical event that had taken place in the thirteenth or twelfth century BCE, and believed that Troy was located in modern-day Turkey near the Dardanelles. Many scholars believe that there is a historical core to the tale, though this may simply mean that the Homeric stories are a fusion of various tales of sieges and expeditions by Mycenaean Greeks during the Bronze Age. Those who believe that the stories of the Trojan War are derived from a specific historical conflict usually date it to the twelfth or eleventh centuries BCE, when the city was sacked because of the fact that it was a rich city situated on the edge of an agricultural plain, and that the city gained considerable wealth from both land and sea trading. 5B
1. The family of Achilles. Zeus
Aegina
Ilus
vi. the gods of rome and the dei consentes 6A
1. The Dei Consentes was created around 200 BCE, after Hannibal had beaten the Romans badly in the north. Hannibal had not yet made it to Rome, but he was targeting Rome, and the Romans knew it. The Roman Senate called on the Roman Collegia, the professors and teachers in Rome, and asked for advice. The Collegia thought about it and came back with an idea. They suggested the problem was that Rome needed to present a special public display honoring the top twelve gods, along with a special feast. 2. The Dei Consentes were: Jupiter–Juno, Neptune–Minerva, Mars–Venus, Apollo–Diana, Vulcan–Vesta and Mercury–Ceres. 3. The gilt statues stood in the Forum in Rome.
vii. the aeneid and its part in the myth cycle 7A
Jupiter’s scroll of Fate The direction and destination of Aeneas’ course are preordained, and his various sufferings and glories in battle and at sea over the course of the epic merely postpone this unchangeable destiny. Some of the things that are foretold include: he will wage war in Italy, establish laws, build city walls, reign in Latium; his son Iulus will become a mighty power; he will build the walls of Alba Longa and the greatness will have no end.
© te aho o t e k ur a p o un a m u
GL3001
reading on mythology A book of myths
Roger Lancelot
The God beneath the Sea
Leon Garfield & Edward Blishen
Hamlyn
© te ah o o te k u ra p ou n a mu
acknowledgements Every effort has been made to acknowledge and contact copyright holders. Te Aho o Te Kura Pounamu apologises for any omissions and welcomes more accurate information. Chapter header designs; Principal Greek gods diagram; Rangi and Papa illustration; Hydra of Lerna illustration; Athene born from Zeus’ head illustration, all © Te Aho o Te Kura Pounamu, Wellington, New Zealand. Photos: The Gods of Olympus, trompe l’oeil from the Sala dei Giganti, 1528 (fresco), Giulio Romano, BEN 78594; Sweet, piercing sweet was the music of Pan’s pipe, from The Story of Greece by Mary Macgregor, 1st edition 1913, Walter Crane (1845–1915), Private Collection, Stapleton Collection, STC 306486; Prometheus Bound, 1889, Briton Riviere (1840–1920), Ashmolean Museum, University of Oxford, UK, AMO 100593; Jason and the Argonauts, 1925, Arther C. Michael (1903–1928), Private Collection, The Stapleton Collection, STC 308566; ‘Theseus caught him by the horns’, from The Heroes Medici, Sir William Russell Flint (1880–1969), Private Collection, IL 370415; Icarus, Roger Payne, Private Collection, © Look and Learn, LAL 337365; Orpheus and Eurydice, George Federic Watts (1817–1904), Private Collection, Photo © Christie’s Images, CH 378277; Statuette of Lar, deity of the home and family, 1st century (bronze), Roman/Ashmolean Museum, University of Oxford, UK, AMQ 117704; Aeneas Fleeing Troy, Girolamo Genga (1476–1551), Pinacoteca Nazionale, Italy, Alinari, ALG 157981; all from The Bridgeman Art Library, London, UK. Used by permission.
Photo: British Museum pediment © Jan Gould, Wellington, New Zealand. Used by permission. Illustrations: Zeus; Demeter; Poseidon; Artemis; Castor and Polydeuces; Odysseus; Selecting a sacrifice; Juno Lucina; Apollo; Aeneas’ mother – Venus; from Costumes of the Ancients, by Thomas Hope, Chatto and Windus, London, 1875. Public domain. Photos: Aphrodite of Rhodes, 3945310; Perseus and Medusa, 11990561, both from iStock International Inc., Canada. Used by permission. Maps: Greece and the Mediterranean; Troy, © Te Aho o Te Kura Pounamu, Wellington, New Zealand. Extracts: Aeneid by Virgil; Jupiter’s Prophecy, Bk 1: 257–296, both from Virgil: The Aeneid Book I, translated by S. Kline © 2002. Extract only.
© te ah o o t e k ur a p o un a m u
GL3001
67
self-assessmentGL3001 Fill in the rubric by ticking the boxes you think apply for your work. This is an opportunity for you to reflect on your achievement in this topic and think about what you need to do next. It will also help your teacher. Write a comment if you want to give your teacher more feedback about your work or to ask any questions. Fill in your name and ID number. Student name:
Not yet attempted
Place of Trojan war in myth cycle understood
Place of Aeneid in myth cycle understood
Please place your comments in the relevant boxes below. Student comment
Functions of Gods understood
Place of Trojan war in myth cycle understood
Place of Aeneid in myth cycle understood
Any further student comments.
Š te ah o o te k u ra p ou n am u
Understood most
Very confident in my understanding
Contact your teacher if you want to talk about any of this work. Freephone 0800 65 99 88 teacher use only Please find attached letter Teacher comment
Š te ah o o te k u ra p ou n am u
cover sheet – gl3001 students – place student address label below or write in your details. Full Name ID No. Address (If changed)
authentication statement I certify that the assessment work is the original work of the student named above.
Signed
| Tantalus |
In the English translations of the 'Asterix' comics, what is the name of the village bard who jumps up at any chance to sing and play his lyre? | GL3001 by Te Aho o Te Kura Pounamu - issuu
issuu
te akoranga puÄ waitanga
classical studies
gl3001 Mythology – Background Greek and Roman Gods, Heroes and the Trojan War ncea level 3
2014/1
classical studies ncea level 3
Expected time to complete work This work will take you about 8 hours to complete. You will work towards the following standards: Achievement Standard AS9138 Classical Studies (Version 1) Demonstrate understanding of the lasting influences of the classical world on other cultures across time. Level 3, Internal Assessment 6 Credits In this booklet you will focus on these learning outcomes: •• understanding the Greek gods, the Greek heroes, the Trojan War, the Gods of Rome and the Aeneid. You will continue to work towards this standard in booklets GL3002 and GL3003.
Copyright © 2013 Board of Trustees of Te Aho o Te Kura Pounamu, Private Bag 39992, Wellington Mail Centre, Lower Hutt 5045, New Zealand. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means without the written permission of Te Aho o Te Kura Pounamu.
© te ah o o te k u ra p ou n am u
contents I
The importance of the Trojan War in the myth cycle
VI
The gods of Rome and the Dei Consentes
VII The Aeneid and its part in the myth cycle VIII Answer guide
Š te ah o o t e k ur a p o un a m u
GL3001
how to do the work When you see:
Your teacher will assess this work.
Check your answers.
You will need: •• pen and paper. Resource overview As you work through the booklets you should complete each activity and check it yourself from the Answer guide at the end of the booklet.
Copyright © 2014 Board of Trustees of Te Aho o Te Kura Pounamu, Private Bag 39992, Wellington Mail Centre, Lower Hutt 5045, New Zealand. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means without the written permission of Te Aho o Te Kura Pounamu. 2
GL3001
© te ah o o te k u ra p ou n a mu
i
Understand the categorisation of myths and the broad framework employed to understand them.
learning intention In this lesson you will:
•• examine the ways myths are categorised and placed in a framework for understanding them.
introduction
The Greeks saw myths in a historical context, stretching from the time of creation to the Trojan War and the borders of history.
what is a myth?
The word myth comes from the Greek mythos which originally meant ‘speech’ and then later came to mean ‘fable’ or ‘legend’. In this booklet we define the word myth as a story of religious or supernatural nature, which seeks to explain or rationalise one or more aspects of the world or a society. This definition distinguishes the word myth from its everyday meaning, which basically refers to any unreal, untrue or imaginary story. It is important to realise that all myths were at some stage actually believed to be true by the societies that used the myth. A myth is also distinctly different from an allegory or parable which is a story deliberately made up to illustrate some moral point but which has never been assumed to be true by anyone. Some myths describe some actual historical event, but have been embellished and refashioned by various storytellers over time so that it is impossible to tell what really happened. For example, while there was a city of Troy we are not certain about the details of the Trojan War, which is considered the final part of the Greek mythological cycle.
the purpose of mythology
Broadly speaking, myths and mythologies seek to explain the universe and all that is in it. In this respect they have a similar function to science or religion and history in modern societies. Systems of myths have provided a background that explains the origins of things so they work as historical framework for societies that have lacked the more sophisticated knowledge that is now provided by modern science.
creation myths
Creation myths provide an explanation of the origin of the universe. They are an important part of most mythological systems. Creation myths often talk about primal gods and animals, titanic struggles between opposing forces, or the death and/or dismemberment of these gods or animals as the means for the creation of the universe.
© te ah o o t e k ur a p o un a m u
GL3001
what is a myth?
explanation of natural events
Mythologies also seek to explain everyday natural things or phenomena. The god Apollo drove his fiery chariot which illuminated everything and gave him the title ‘Helios’ (sun god) Apollo, and this provided an explanation of the rising of the sun each day. It also explained why it progressed across the sky and gave a reason for its setting in the evening. Similarly, the Māori of New Zealand attributed the morning dew to the tears of the god Rangi (Heaven) for the goddess Papa (Earth) from whom he was separated. This class of myth is sometimes called a nature myth.
explanation of human events and practices
Myths are also often used to explain human institutions and practices as well. For example, the Greek hero Pelops was reputed to have started the Olympic Games after Poseidon helped him win the hand of Hippodameia in a chariot race. This type of myth seeks to explain the beginnings of things and is called finding its etiological base. It seeks to account for some human institution through a myth.
god-centred myths
Another class of myth is the god-centred myth. As theos is the Greek word for god, this is called the theogenic myth. This sets out to find out the relationships between various gods and other mythical beings that are mentioned in previously existing myths. Theogenic myths are thus secondary in their purpose, setting out to provide a reinforcement or framework for an existing system of myths. The best known example of this is the Theogeny of Hesiod which explains the creation of the world, the war of the god and the titans, and the creation of the heroes. It should not be thought that the functions of myths as outlined above are mutually exclusive. For example, creation myths by their very nature are usually theogenic as well. Myths can serve many purposes. They are a rich resource for the enjoyment of all mankind and have been a source of inspiration for writers and artists throughout time. Although they might seem fantastic and unreal to our modern eyes, this should not prevent us from enjoying them. Uranus — Gaea Cronus — Rhea Hestia
Hades
Aphrodite © te ah o o te k u ra p ou n a mu
what is a myth?
what are the messages of myths?
It is impossible to find any single reason for the origin of myths, and thus the messages they carry vary. To summarise, here are some of the reasons why the Greek myths may have come into being: •• They explain the origins of the world. In the next chapter we will trace these origins from Chaos to Zeus. •• Nature myths explain obvious phenomena such as day and night, the cycle of the seasons, rain, storms, earthquakes or eclipses. To the Greeks all such events were caused by the gods. •• Some myths explain and support existing customs or rituals. All societies have structures and rituals concerned with birth, marriage, death, the conservation of property and the family, the treatment of women, the maintenance of crop and herd fertility, and other areas vital to that society. Many of these are explained in myths – the gods did this or demand that, so it must be right. •• Some myths may reflect human dreams and wishes. This is perhaps the most controversial theory, and we leave it to you to think about. Does the story of Oedipus reflect men’s secret desires to get rid of their tyrannical father and marry the first woman they ever loved, namely their mother? Do the countless tales of Zeus and other gods raping females – goddesses, nymphs, women – reflect men’s preoccupation with sex? Do stories like that of Narcissus, who wasted away and died because he couldn’t stop looking at his own reflection, represent the self-love of a certain type of person? And, very simply, do the tales of heroes reflect every man’s desire to be superman?
what kind of society produces myths?
Most cultures have myths, and their origins are almost always to be found in a time when writing was not generally used or was nonexistent, when belief in the gods was genuine, and when there were no means of scientifically explaining natural phenomena. People believed all events had a divine origin, and mythical tales were the main means of passing on beliefs and instructions from one generation to the next. Because communication was verbal and not written, myths changed and developed over generations, often becoming very complex. There was no single correct version and, as we shall see, variations in detail did not worry storytellers or their audience. 1A
Why were myths created? What purposes do they serve? List as many reasons and purposes as you can think of. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
Halicarnassus
what is a myth?
The map shows the Aegean sea, and the four areas important in the development of Greek religion and myth: 1. The coast of Asia Minor, on the right of the map, with its major city Troy. 2. The Cycladic islands. 3. Crete, south of Greece, at the bottom of the map. 4. Mainland Greece, which can be subdivided into: •• the Peloponnese (the southern peninsula) •• Attica and Boetia (the central region) •• Thessaly and Macedonia (the northern land bridge to Europe).
historical background to greek mythology the stone age inhabitants of the aegean: pre-3000 bce
By the end of the New Stone Age (Neolithic Era), around 3000 BCE, all these areas were inhabited by people with a similar way of life and probably similar language and ethnic origins. They actively worshipped spirits – mainly female – to ensure the fertility of crops, animals and human beings, and tried to placate destructive spirits – mainly male – to avoid storms, shipwreck, earthquakes and similar disasters.
the early bronze age: 3000–2000 bce
From 3000 BCE, techniques of working metal gradually spread through these lands and islands of the Aegean sea and bronze tools and weapons were widely used. Around 2500 BCE a flourishing civilisation began to develop in most areas, worshipping a general fertility goddess (Mother or Earth goddess). Around 2000 BCE, was a general upheaval on the Asian mainland resulted in a number of different peoples moving westward. The Cycladic islands received a fairly civilised group of settlers who brought the advanced technique of making pottery on the fast wheel – a useful skill soon adopted in Crete and Greece. Asia Minor received the people who would, in several hundred years’ time, be defeated at Troy by the Greeks. The Greek mainland also suffered several waves of invaders who came down the Greek peninsula from the north, rather than by sea. These new folk were less culturally advanced than the inhabitants they defeated. They were a warlike people, strongly patriarchal and worshippers of mainly male divinities who lived not in the earth but on the mountaintops and who ruled the skies. Homer called these people the Achaeans, and scholars use this name to distinguish them from later invaders. They were also the first to speak the language which would one day be Greek.
© te ah o o t e k ur a p o un a m u
GL3001
what is a myth?
the middle bronze age: 2000–1450 bce
The island of Crete does not seem to have been occupied by invaders at this time, and its civilisation progressed without interruption. Around 2000 BCE there seems to have been a dramatic increase in its trade and wealth and the first large palaces were built at a number of sites, the largest at Knossos. No walls were needed to protect these settlements, which suggests that a powerful fleet enforced security as well as trading with countries all around the Mediterranean. The result was a brilliant and apparently peaceful civilisation with a high degree of skill in arts and crafts. We usually call it ‘Minoan’ after the legendary king Minos. The Minoans worshipped many gods, but the greatest was the mother goddess who ensured the fertility of the earth.
the late bronze age: 1450–1100 bce
Mycenaean civilisation was now dominant in the Mediterranean, reaching its peak around 1300 BCE. It was a basically unstable society, with a large parasitic nobility which preferred to seize the wealth of others in warfare rather than to create its own. According to Homer’s account of the Trojan war, describing a Greek hero as a ‘sacker of cities’ was paying him a great compliment.
the dark ages: 1100–800 bce
During this time another group of Greek-speaking people, the Dorians, took advantage of the general confusion to move down through Greece, eventually settling in the Peloponnese and Crete. To get away from them, many mainland Greeks migrated eastward to the west coast of Asia Minor and the islands near it. The Dorians had developed fewer skills than the Achaean Greeks, and as in 2000 BCE the progress towards civilisation was set back several hundred years.
the creation of greek myths However, it was during these years that Greek mythology was largely created. The art of writing was also lost. Instead, those recalling the past developed the skills of creating, memorising and retelling stories aloud over many generations. These storytellers wove together their ideas about the origins of the world and humankind, their beliefs about the gods of the sky and the goddesses of the earth, and their memories of a glorious past. They took the ideas, beliefs, folk-tales and memories from all parts of the Greek world, adding and changing details as they pleased to suit their audiences.
when were greek myths written down?
Greek myths were free to flourish in all their many versions until writing became general again in the seventh century BCE. Even then they were not set down in full or in final versions, as Greek writers for several centuries tended to use only small parts of the full mythology or simply made allusions to the stories everyone knew. Thus Homer’s two great poems, the Iliad and the Odyssey, tell a very small part of the stories of Troy.
8
© te ah o o te k u ra p ou n a mu
what is a myth?
In Classical times, powerful states such as Athens or Sparta added or changed small details of the old myths to reflect glory on their ancestors. But by the fourth century the myths were no longer living, developing stories, and after this time Hellenistic and Roman writers told the tales in the forms we have today. You need to be aware as you read that myths can vary greatly in details, and this never bothered the Greeks, who simply adopted whichever version they wanted. Draw a time line of events between 3000 BCE and 0 CE (Current Era) which were relevant to the development of Greek myths. Check your answers.
jan gould
1B
what do the terms classical and hellenistic refer to? In general the period between the end of the Dark Ages and the defeat of the Persian invasion of Greece in 490–89 is called the Archaic (early) period. The Classical period extends from the end of the Persian Wars to the death of Alexander the Great in 323. Alexander conquered a vast empire, extending Greek culture over the eastern Mediterranean and Asia Minor. The civilisation which flourished after his death is called Hellenistic. Finally, the Greek-speaking lands were engulfed by the growing power of Rome from the second century BCE onwards, becoming part of the Roman Empire.
Š te ah o o t e k ur a p o un a m u
GL3001
what is a myth?
how has greek mythology come to new zealand?
The Romans had very little mythology of their own, and by and large took over the Greek myths without much alteration. The European countries most influenced by Rome absorbed Greek myths as part of their cultural heritage. Some European countries have myths, legends and folk tales of their own, but much of New Zealand’s cultural heritage comes from England, which has almost no mythology – king Arthur and his Knights of the Round Table being a rare example. In English literature and art, Classical mythology was part of the public school curriculum in terms of Greek and Latin. Among this small percentage of the population there was a great awareness of its aspects.
what other mythologies can be found in new zealand?
te kura
New Zealanders of English descent may lack a mythology of their own, but Welsh and Irish myths are both rich and complex. New Zealanders of other origins – such as Polynesian, Scandinavian or Indian – may know something of their homelands’ extensive mythologies. And New Zealand is extremely lucky to have preserved Māori myths, which are complex, fascinating and truly indigenous. As you read, you may be interested to compare Greek myths with any other myth cycles you know.
10
© te ah o o te k u ra p ou n a mu
ii
Wave pattern
the greek gods and their functions learning outcome
Understand the Greek Gods, their functions and relationships to each other, and their importance in the eyes of man.
learning intention In this lesson you will:
•• examine the Greek gods and their functions and relationships that gave them an importance in the eyes of man.
introduction
The ancient Greeks had varied ideas about the origins of the world, and about the gods and goddesses which first inhabited that world.
what were greek divinities like?
Originally, the Greeks thought of their gods as spirits inhabiting land, sea or sky. Eventually some came to be much more important than others, and whenever the Greeks met a similar god worshipped by another people, they simply considered it the same god as their own under another name. Their own sky god was Zeus, and it was easy to equate him with the Roman sky god Jupiter or the Egyptian god Ammon. The important gods were anthropomorphic – that is, of human shape, though they were able to change shape if they pleased. Minor spirits were often only partly human – Pan and the satyrs of the woodland were partly horse or goat. The gods were not only human in shape, but also had human personalities. They were larger in size, more beautiful, powerful and, of course, immortal – but in a moral sense they were no better than human beings. The idea of a god or the gods being virtuous and worrying about whether humans lived good or evil lives did not really develop until the Classical period, well after the creation of the myths. The gods were not ‘good’, and can in no way be equated with the Christian idea of a supremely good God. Neither, however, were they evil, like the idea of Satan. They simply did as they pleased, exercising power without responsibility, and as far as humans were concerned they might be friendly, indifferent, or actively hostile. Moreover, their attitude could change at any time. As the gods were responsible for causing every event, humans had to try to make them friendly rather than otherwise, and this is the main point of Greek rituals. The Greeks offered their gods sacrifices, gifts and prayers, firstly to avoid offending them and secondly to win active support. A virtuous life got you nowhere, since disasters often overtook the good while the evil person might flourish. Even frequent offerings to the gods were no guarantee of favour, but it was the best an ordinary human could do. The gods were believed to cause everything that happened but they were, in fact, free to tinker only with minor details. Some things were unchangeable, like human mortality. The general scheme of things was laid down by Fate, which, for example, decreed that Troy must fall to the Greeks. But the gods could change small details. Should the siege of Troy last six months? Ten years? Twenty years? Should a hero die there or at a later date? The gods were responsible for the ‘fine print’ and this meant humans must honour them constantly.
© te ah o o t e k ur a p o un a m u
GL3001
the greek gods and their functions
greek gods
People paid honour to the gods or goddesses who could influence whatever area they were active in – to Poseidon for a safe sea voyage, Demeter for a good grain harvest, Hera for safe pregnancy and childbirth, or possibly to some small local spirits who might be helpful. All gods had their place and their sphere of influence, and humans were free to honour whom they pleased – though gods could be very offended if they were ignored. People were also free to believe what they pleased, as there were no sacred writings and no dogma which must be believed. Belief in the gods was required, but little more. Thus, there were no warring religious sects in the Greek world, and there was a notable tolerance of other peoples’ beliefs. Finally, we consider nowadays that a person’s religion is a personal and private matter, but in the Greek world it was mainly a state affair, with public worship to ensure the good of the whole community.
the creation myths
The gods of the Greeks were very similar to human beings, and one indication of this is the fact that they did not create the world. It is not really clear, however, just how the world did come into existence. Here is one story. In the beginning there was Chaos, a great void or ‘nothingness’. Somehow Mother Earth, Gaea, emerged from Chaos, as did Darkness (Erebus) and Night. Some say Eros (Love) also emerged from Chaos, while others say he was born from Night. In any case, he was an early creation, for without Eros there would have been no new life. Gaea gave birth to Oceanus, which then surrounded her with his waters. Her next child was Uranus, the Heavens or Sky, who showered her with fertile rain so she bore grass, trees, flowers, insects, birds and animals. Gaea and Uranus also produced a number of children called the Titans – Cronos was the most important of these – and a rather strange collection of giants and monsters, such as the Cyclopes, who will appear later. Uranus was a tyrannical, jealous father. He refused to let his children be born, enclosing them inside Mother Earth. Gaea was angry and persuaded her youngest son, the Titan Cronos, to attack his father in revenge. Cronos used a flint sickle to castrate his father, hurling the severed parts away from him. Drops of blood fell on Earth, who promptly gave birth to more giants, as well as the Furies who would in the future avenge crimes of matricide, patricide and perjury. It is not clear what happened to Uranus, but he now disappears from the scene to be replaced by his son Cronos. Cronos mated with his sister Rhea, also a child of Gaea and Uranus, but fearing a prophecy that he would be overthrown by one of his children he swallowed each of Rhea’s children at birth. Rhea eventually tired of this and when her sixth child, Zeus, was born she gave Cronos a stone to swallow, and entrusted the baby to Mother Earth and some nymphs to rear in a cave on Mt Dicte in Crete.
12
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
what happened to rhea’s children?
Eventually Zeus grew to manhood among the shepherds on Mt Ida on Crete, and then managed to give his father a drink which made him vomit up his swallowed siblings. Hestia, Demeter, Hera, Hades and Poseidon emerged unhurt and fully grown, to join their brother in a war against Cronos and his brother Titans. The war lasted 10 years, until Zeus released some of Earth’s children, the Cyclopes, who had been imprisoned deep in the earth by their father Uranus. The Cyclopes gave Zeus the thunderbolt, Poseidon his trident (a large fork) and Hades a helmet of darkness, and eventually the Titans were defeated and imprisoned in Tartarus.
thomas hope
The stories of Zeus’ childhood are many – how his cradle was hung on a tree so Cronos could not find him in heaven, in earth or in the sea; how he ate honey and was suckled by the goat-nymph Amaltheia, whose image he set among the stars as Capricorn and whose skin was worn by his daughter Athene; and how the sons of Rhea, the Curetes, shouted and clashed their spears against their shields to drown Zeus’ crying so Cronos wouldn’t find him.
Zeus.
Zeus later had to defeat other children of Gaea, the giants and Typhon, a winged serpentman. Eventually he overcame all opposition, including Gaea herself, and set himself up on Mt Olympus to rule the earth and sky, while his brothers took other kingdoms – Poseidon the sea and Hades the underworld. The battle with the giants was frequently represented in classical Greek sculpture.
zeus – king of the gods
Zeus was the greatest god to the Greeks, lord of the sky and controller of the weather. He was also lord of the earth and of humankind, connected with all human activities. In Greek art he is usually shown as a large, bearded, middle-aged male figure. Often he holds his thunderbolt and his aegis (shield), which terrified his enemies when shaken. Apart from these early battles, most of the stories in which Zeus is the central character are concerned with his love affairs. As the Greeks were monogamous he could have only one legal wife, and this was his sister Hera who at first wanted nothing to do with him. Eventually he visited her as a bedraggled cuckoo, and when she took pity on him and nursed him to warm him, he regained his true shape, raped her and shamed her into marrying him. Unfortunately for Hera, Zeus considered himself above all laws – including the bonds of marriage – and his seductions of other females were endless.
© te ah o o t e k ur a p o un a m u
GL3001
13
the greek gods and their functions
One of the earliest of these was Metis, the wise Titaness, who turned into many shapes to avoid Zeus but was finally caught and raped. An Oracle declared that if Metis were made pregnant a second time she would bear a son who would depose Zeus, just as Zeus had deposed Cronos, and Cronos Uranus. So Zeus swallowed Metis to get rid of her, but he could not get rid of the child she was carrying. One day Zeus had a raging headache and to ease it Hephaestus opened his skull with an axe. From the opening sprang his daughter, Athene, fully grown and fully armed. She inherited the power of her father and the wisdom of her mother, and we shall hear much more of her. Zeus also raped his mother Rhea and his sister Demeter, the goddess of corn. (As a result, Demeter gave birth to Persephone.) The Titanesses Mnemosyne (Memory), Maia and Leto respectively bore his daughters the nine Muses, his son Hermes, and the twins Artemis and Apollo. Mortal women he seduced include Semele, mother of Dionysus; Europa, mother of Minos, Rhadamanthos and Sarpedon; Alcmene who bore Heracles; Leda, the mother of Helen and Polydeuces; and Danae, who bore Perseus.
why did zeus have so many affairs?
One suggestion is that Zeus reflects the relative power of male and female at the time the myths evolved. Zeus himself represents the ultimate male fantasy of irresponsible lust. He could rape whom he pleased without suffering any ill consequences. Whereas most men are restricted in the indulgence of lust by the consequences, clearly the supreme god could do and did do what men could only dream about. It is also noticeable that most acts of sex involved rape. The Greeks were not so puritanical as to believe that women couldn’t – or even shouldn’t – enjoy sex, but all relationships in the myths had to begin with rape to establish male power over the female. The goddesses Athene and Artemis remained virgins, not because sex was immoral but in order to remain powerful. These goddesses spent their time in the traditional male occupations of warfare and hunting, which were highly valued, and had no regrets at being deprived of the female occupations of bearing and raising children. Like the men of the time, they probably rated such occupations as of little value. Myths also make it clear that the act of sex outside marriage involves shame only for the female, even when she has no choice. This is another clear reflection of the values of the society which created the myths.
historical events? Another suggestion is that the deeds of Zeus represent certain historical events. For example, the long battle between Zeus and the Titans represents the conflict between the invading Achaeans and the original inhabitants of Greece, who worshipped the female spirits responsible for its fertility. Zeus was, of course, victorious over all opposition, including Mother Earth and her offspring. Thus, many of the stories of Zeus reflect how the sky god conquered the local earth goddesses and their priestesses. By raping Rhea, Zeus took control of agriculture; by swallowing Metis he took over her wisdom; by marrying Hera he reduced the powerful and muchloved mother goddess of Argos to a scheming jealous shrew, unable to put up with or curb her husband’s infidelities. Women still prayed to Hera for help in things which were important to them – marriage, conception, safe childbirth, the health of their children – but the lower status of the goddess reflects a male view of the world. 14
GL3001
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
Another historical reason for Zeus’ many affairs was the desire of important families in Greece to claim a divine ancestor. Thus, details were inserted into myths centuries later.
hera – queen of the gods Hera is not a pleasant figure in Greek mythology. Her children by Zeus were Ares, Hebe and Hephaestus. She features in a number of myths, particularly the tale of Troy, and is noted for the persecution of the unfortunate females seduced by Zeus. These tales will be told later in this booklet.
Demeter was another child of Rhea and Cronos, best known as the fertility goddess of the cornfield. She belongs to the earlier religion, but was ‘put in her place’ by her brothers. Zeus raped her and fathered Persephone (also called Kore). Poseidon also raped her, taking the form of a stallion when she became a mare to escape him. Finally, her third brother, Hades, kidnapped her beloved daughter with Zeus’ knowledge, and when Demeter discovered this she forbade the crops to grow and the trees to bear fruit until Persephone was restored to her. The human race was in danger of starving and prayed to Zeus for help. He sent his messenger, Hermes, to Hades, begging him to let Persephone go, and it was agreed she could leave if she had not tasted the food of the dead. However, Hades tricked Persephone into eating a pomegranate and refused to let her go. At last a compromise was reached, and Persephone spent half the year with Hades as his queen and half the year with her mother.
thomas hope
demeter – goddess of corn and fertilit
Demeter
This myth explains the seasons, and the time Persephone spent in the underworld represents winter. In historical times, a corn puppet was buried in autumn and dug up in spring when it was sprouting, so corn was promptly sown as ‘the maiden returned to the arms of her mother’. Demeter was told what had happened to Persephone by Triptolemos, prince of Eleusis. When her daughter was restored to her, Demeter rewarded Triptolemos by giving him a chariot drawn by serpents, a wooden plough and seed corn, and told him to travel all over the world teaching humankind the art of agriculture. Though she does not feature in many myths, Demeter was a most important goddess wherever grain was grown. Eleusis was the centre of her worship. Here, her followers celebrated the Eleusinian Mysteries which reenacted the rape and return of Persephone, and promised immortality to the initiates.
hestia The third daughter of Rhea and Cronos was Hestia, goddess of the hearth and home. She took no part in any wars or disputes. When rival gods fought to marry her she vowed to remain a virgin to keep the peace on Olympus. Eventually she left Olympus to allow Dionysus to take her place there. She seems a sweet, kindly goddess, but lacks personality among the more flamboyant deities.
© te ah o o t e k ur a p o un a m u
GL3001
the greek gods and their functions
thomas hope
poseidon – god of the sea
Poseidon.
We have already met Poseidon, son of Rhea and Cronos, as lord of the sea and as seducer of his sister Demeter in the form of a horse. He was often associated with horses and it is suggested he was originally connected with those who introduced the horse into Greece. He was married to the sea nymph Amphitrite, who resented his many infidelities. When he was courting the beautiful nymph Scylla, the jealous Amphitrite threw magic herbs into the unfortunate sea nymph’s bathing water, turning her into a monster with the heads of six dogs. One of Poseidon’s offspring was the one-eyed giant Polyphemos, whom we will meet, along with Scylla, in the tale of the sea-faring Odysseus. Poseidon was obviously a major deity for the sea-going Greeks, representing the wild, untamed ocean, but he also played a special part in the mythology of Athens. He competed with Athene for the domination of Attica, and it was agreed that the winner should be the one who gave Athens the more valuable gift. Poseidon struck the rock of the Acropolis, and a salt water spring immediately came out of the rock. However, Athene created an olive tree beside the spring and won the competition. The mark of Poseidon’s trident, the salt water spring, and Athene’s olive tree, can still be seen by the temple known as the Erectheum on the Acropolis of Athens today. Poseidon did not like the decision, but to placate him the women of Athens, who had voted in favour of Athene, were deprived of the vote, and men were forbidden to bear their mother’s names as they had previously done. This is clearly a myth giving divine sanction to a lowering of the status of women.
16
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
hades – god of the underworld The other brother of Zeus and Poseidon was Hades, ruler of the underworld, who carried off the beautiful Kore/Persephone as his queen. He figures in very few stories, and is a remote, grim figure, but not a figure of evil. All humans must die and all must pass into Hades’ Kingdom. To get there, souls must cross the river Styx on the ferryboat of the grim old god Charon, and pass the three-headed dog Cerberus. There they are judged not by Hades but by Zeus’ sons, Minos, Rhadamanthos and Aeacus. After judgement the good go to Elysium or Paradise, while the evil go to Tartarus where they are tormented by the Furies. Some myths tell how most people, neither completely good nor bad, drink the waters of forgetfulness from the river Lethe and are reborn to live another life. It was of little use to pray to Hades, who was unwilling to let anyone go from his kingdom, and who seldom visited the upper world himself. As well as the six children of Rhea and Cronos, Greek myths tell of many other divinities, major and minor.
the gods of olympus
In the north of Greece in the area known as Thessaly, a range of mountains was topped by Mt Olympus, 2917 m high and the highest peak in Greece. Here, worshippers imagined that Zeus had his home, and here too lived his siblings and their children. Altogether 12 gods lived on Mt Olympus, the most powerful of the immortals, spending their days feasting, quarrelling and making love, and occasionally leaving Olympus to interfere in the affairs of humankind. The Olympians were like humans in their loves and hates, their bickering and attempts to get their own way, and in their individual characters. But they were unlike humans in being larger, extraordinarily beautiful (with one exception), more powerful, immortal, and totally lacking in morality and responsibility. The Olympians were ruled by Zeus, and consisted of Hera, Demeter, Athene, Aphrodite, Ares, Hermes, Apollo, Artemis and Hephaestus. Hestia was originally one of the 12, but later resigned her place to Dionysus. Poseidon was also considered an Olympian, though he spent more time in his own realm of the sea than as his brother’s guest. Their other brother Hades seldom left his own dark kingdom, and was not counted among the Olympian 12.
© te ah o o t e k ur a p o un a m u
GL3001
the greek gods and their functions
te kura
athene – goddess of wisdom and war
Athene born from Zeus’ head.
The most formidable female deity on Mt. Olympus was Pallas Athene who was born from the head of Zeus after he had swallowed her mother, Metis the Wise. Athene was warlike and wise. She was also, rather oddly, the patron of crafts and skills, particularly the female work of spinning and weaving. It seems likely she was an ancient pre-Greek goddess but her story was retold to make her the daughter of Zeus and so establish the superior power of the father god. She was certainly his favourite child, and their relationship is remarkably free of the quarrels and jockeying for power seen so much on Olympus. Her stories are almost totally free of the unkind deeds and petty revenges of the other gods, and she is usually a helper of heroes, especially Heracles and Odysseus, and of humankind in general. She was the patron of Athens, the greatest and most artistically productive city of Classical Greece, and it is suspected that the Athenians ‘tidied up’ any stories which showed their goddess in a bad light. Athene remained a virgin goddess to avoid submission to any male. At one stage she was attacked by Hephaestus, who believed he deserved a reward for assisting at her birth. Athene simply vanished, and Hephaestus’ sperm fell upon the earth. Poor Gaea promptly gave birth to the boy Erichthonius, who was reared by Athene and became king of Athens. He promoted her worship, and in Classical times the Acropolis of Athens was crowned by the Parthenon, the finest temple in Greece, dedicated to Athene, and also by the Erectheum, a temple dedicated partly to Erichthonius.
18
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
One tale of Athene as patron of spinning and weaving places her in competition with a princess of Lydia named Arachne. Arachne unwisely boasted her skills were greater than those of Athene, who appeared as an old woman and warned the princess to be a little more modest about her deeds. Arachne refused to be warned, and Athene challenged her to a contest. The tale varies over whether Athene produced the finest work, or displayed divine anger when Arachne won the contest. In any event, Arachne hung herself, either in shame or fear, and the goddess turned her into a spider – hence the modern zoological name arachnid for spider. Athene features in many stories, particularly those of Troy. The Trojan prince Paris preferred the beauty of Aphrodite to that of Athene and Hera in the contest which caused the Trojan War, and the goddesses angrily helped the Greeks until Troy was totally destroyed. Athene also always helped those who were clever – one of her favourites was the clever Greek hero Odysseus, to whom she gave the idea of building the wooden horse used to capture Troy. Athene is normally shown dressed in armour and is often accompanied by snakes or her favourite bird, the owl.
In Greek mythology goddesses were not allowed to be as promiscuous as gods. The exception was the goddess of love and beauty, Aphrodite, who is always shown as young and lovely. Her birth is unclear. An old myth says she was born out of the foam created when Cronos flung the severed genitals of his father Uranus into the sea. This meant she pre-dated Zeus, so to make her subordinate to him a later myth makes her his daughter by an obscure figure, Dione. Her bird is the dove, which is supposed to be particularly amorous, and she possessed a magic girdle (belt) which made males love whoever wore it. Hera is said to have borrowed the girdle from time to time when she wanted something from Zeus. Aphrodite is usually attended by Eros, who is sexual love personified, and stories sometimes make him her son, sometimes her attendant who was in fact as old as Earth herself. In early myths he is a beautiful and dangerous youth, but in Hellenistic times he became the chubby little ‘cupid’ with arrows of romantic love.
istock
aphrodite – goddess of love
Aphrodite.
Aphrodite had the ability to make anyone fall in love, and this applied to the gods and even Zeus himself. Her power worried Zeus, and he insisted she marry Hephaestus, the only ugly god, to keep her under control. Aphrodite, however, much preferred the handsome Ares, god of war, and a late story tells how Hephaestus made a bronze net which fell over the two lovers when they were in bed together.
© te ah o o t e k ur a p o un a m u
GL3001
19
the greek gods and their functions
Aphrodite had many other love affairs. In one tale she competed with Persephone for the beautiful youth Adonis. They had agreed to share him, but when Aphrodite cheated and kept Adonis, Persephone complained to Ares, who took the form of a wild boar and killed Adonis as a rival. Another affair with more important consequences was Aphrodite’s seduction of the handsome Trojan prince Anchises. Anchises could not resist talking of the affair, and Zeus angrily threw a thunderbolt at him. Aphrodite deflected the bolt but Anchises was a cripple for the rest of his days. The son of Aphrodite and Anchises was the Trojan hero Aeneas, who was to play a major part in Roman mythology.
ares – god of war The god Ares was never very important to the Greeks. There were so many other aspects of life apart from war, and so many other deities who were skillful warriors, that a god dedicated only to war was rather unnecessary. Moreover, Ares wasn’t a very effective war god. He submitted, like everyone else, to Zeus, Athene defeated him more than once, and even the half-mortal Heracles sent him flying back to Olympus for safety. Ares lacks personality and he features in very few tales as a leading character. He was the legitimate son of Zeus and Hera, the lover of Aphrodite, and he enjoyed war for its own sake, changing sides without a care to increase slaughter and destruction.
hephaestus – the blacksmith Hephaestus is a more interesting character. He was the son of Zeus and Hera, though one version of his birth makes him the son of Hera alone. Angry at the birth of Athene, Hera tried to equal her husband by bearing a child wholly her own, but the baby was so ugly she threw him from Olympus into the sea, where he was raised by sea nymphs. Here he practised the metal-working crafts which were his speciality, producing such lovely jewellery that he was invited back to Olympus. He brought a beautiful throne for his mother, but when she sat on it the gift proved to be a trap and she was unable to move. Eventually Dionysus, the god of wine, made Hephaestus drunk and brought him back to release Hera. The return of Hephaestus to Olympus, seated on a donkey and accompanied by dancing drunken satyrs, was a favourite subject of Greek artists. As a divine metal worker Hephaestus was most useful, making thunderbolts for Zeus, and armour for the hero, Achilles, son of the sea nymph Thetis who had rescued him as a baby. The only ugly Olympian, he was always laughed at by the beautiful divinities for his lameness, his ugliness and his slow wits. However, he was a popular god in Greek towns as a patron of craftsmen like himself.
hermes – messenger of the gods One god who does have plenty of personality is the god of rogues, Hermes. On the day he was born (to Maia by Zeus), he left his cradle and went out to steal some cattle from his brother Apollo. Apollo searched for his missing beasts, but the crafty Hermes had made them shoes of bark and grass so they would leave no recognisable tracks. Eventually Apollo reached Maia’s cave, and she was indignant that her innocent babe, lying in his cradle, should be accused of theft. However, Apollo found the skins of two cows Hermes had killed, and complained to Zeus. Eventually Hermes confessed and agreed to return the cattle, but produced a lyre he had made from the shell of a tortoise. Apollo was enchanted by the sweetness of its music, and gave Hermes the cattle in exchange. Hermes then created a reed pipe, and was persuaded to exchange it for Apollo’s golden staff which made him the god of all herdsmen and shepherds. 20
GL3001
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
Zeus was amused by the story, and made Hermes his messenger. Since Hermes agreed to stop telling lies, but thought that always telling the truth might be rather too hard, Zeus also made him the god of commerce and treaties. Finally Hermes was made the patron of travellers, and was given a herald’s staff with white ribbons, winged sandals to carry him swiftly round the world, and a hat to protect against the rain and sun. He is usually shown as a young man, wearing his hat and sandals and not much else, and he always takes a great interest in human affairs. One of his main tasks was to lead the souls of the dead down into the underworld. Despite this, he remains a cheerful, likeable, mischievous rogue.
apollo – god of reason and civilisation The stories of Apollo reflect the different origins of Greek myths and their tendency to develop over centuries. In some ways Apollo is the most representative god of Greek civilisation, presiding over music, poetry, philosophy, astronomy, medicine and science. He stands for moderation in all things, knowledge and the rule of law. However, the stories about him include the usual violent rapes and barbarous killings, such as the massacre of Niobe’s innocent children. Apollo was also the god of prophecy, and his chief oracle was at Delphi. Here he killed the serpent Pytho, the agent of Mother Earth, and shared the sanctuary with Dionysus. Apollo was the father of the healer Asclepius. Asclepius brought a dead man back to life, an act which could have robbed Hades of all his subjects. Hades complained to Zeus, who killed Asclepius with a thunderbolt, thus provoking a quarrel with Apollo. Apollo features in many stories, and is always shown as a handsome, beardless young man, carrying a lyre, or the bow and arrows which were his favourite weapons.
artemis – huntress goddess
thomas hope
The mother of Apollo was the female Titan Leto, who was persecuted by Hera. She gave birth to twins, Artemis and Apollo, who henceforth protected their mother from injury and insult – something Zeus usually failed to do for the females he seduced. Artemis became a mighty huntress, armed with bow and arrows, but also acted somehow as mistress and protector of wild animals. Like Athene she remained a virgin, and insisted that her female companions also be virgins. When Zeus seduced one of her nymphs, Callisto, in the guise of Artemis herself, the goddess was so angry she turned the unfortunate female into a bear. For once Zeus came to the rescue and placed Callisto in the sky in the form of the constellation of the Great Bear, Ursa Major. On another occasion a hunter, Actaeon, happened to see Artemis as she was bathing and in revenge the goddess turned him into a stag, to be torn to pieces by his own hounds. It was dangerous to offend Artemis.
Artemis – goddess of the hunt.
© te ah o o t e k ur a p o un a m u
GL3001
21
the greek gods and their functions
In eastern countries Artemis was worshipped as a fertility goddess, which suggests she was originally a pre-Greek mother goddess, and in later times she was a patron of safe and easy childbirth – despite her ignorance of sex or childbirth. She also had some status as a moongoddess, while her brother as Phoebus Apollo was a sun-god.
dionysus – god of wine and drama The last Olympian is perhaps the most interesting and dangerous character of all, who almost came to a sticky end before he was born. This is Dionysus, god of wine, fertility and drama. His mother was the mortal woman Semele, who was tricked by the jealous Hera into demanding to see her lover in his real shape. When Zeus appeared to her as a flash of lightning, Semele was burnt to death but Zeus rescued his son and inserted him in his own thigh, from which Dionysus was eventually born a second time. His foster mother Ino, sister of Semele, was driven mad by Hera, and Dionysus eventually grew up in the care of the wood nymphs of Mt Nysa in Boetia. When Dionysus grew up he went wandering all over the world, including Egypt and India, accompanied by his tutor Silenus and an army of satyrs and maenads (wild women). Eventually he returned to Greece. Dionysus was cruel to those who opposed him. Typical was the fate of king Pentheus of Thebes. When he refused to honour Dionysus and put him in prison, the god persuaded the king to go into the mountains and spy on the women of Thebes who were revelling with Dionysus’ maenads. Pentheus was seen and torn to pieces by the wild women, including his own mother. On another occasion, Dionysus was captured by pirates who planned to sell him as a slave. He raised a vine which curled around mast and sails, changed the oars into serpents and himself into a lion. The terrified sailors jumped overboard and were changed into dolphins, all except the pilot who had recognised the captive as a god. Next Dionysus married Ariadne, daughter of king Minos of Crete whom Theseus had abandoned on the island Naxos. Finally he rescued his mother Semele from the Kingdom of the Dead and then took his place on Olympus. Some say he took the place of Hestia, who was glad to leave the noisy wrangling of her family, and knew she would be welcome anywhere on earth. 2A
1. Select the 10 points about Greek divinities which you think most important. 2. How did the religion of the ancient Greeks differ from Christianity? Select up to five differences you think important. 3. Draw a family tree to show the descent of Zeus from Chaos. Include the following names: Chaos, Gaea, Erebus, Night, Eros, Oceanus, Uranus, the Titans, the Cyclopes, Rhea, Cronos, the Giants, the Furies, Hestia, Demeter, Hera, Hades, Poseidon, Zeus and Typhon. Check your answers.
22
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
dionysus continued: On vases and in Greek art in general, Dionysus is often shown bearded. Later in Roman art he became a plump, girlish youth. Dionysus was probably an eastern fertility god to begin with, and though a latecomer to the Olympian scene he was one of the most popular and most feared of gods. He was worshipped in wild drunken revels and his followers, mostly women, are said to have wandered the wild mountainous countryside, immune to heat and cold, tearing animals to pieces. We find him on works of art, and also as the god of drama. He is often shown with trails of vine leaves, accompanied by maenads, and by satyrs – male figures who are part human, part animal.
minor gods
As well as the major gods we have already listed, Greek mythology had an amazingly large range of minor divinities. Here are some of them. The Moirae or Fates: the Greeks thought a person’s life was measured by a length of thread. The thread of life was spun on Clotho’s spindle, measured by Lachesis with her rod, and snipped by Atropos’ shears. Some claim Zeus could alter a person’s fate, but others say he is subject to these three terrible old women, and must abide by their decisions. The Eumenides or Furies: these three female divinities were named Alecto, Tisiphone and Megaera, and were born from Mother Earth and the blood of Uranus. They avenged family crimes such as matricide and patricide, and also tormented evil men in the ‘Hell’ of the underworld, Tartarus. Their true name was the Erinnyes, but the Greeks called them the Eumenides, the kindly ones, to try to avoid bad luck which might be brought by speaking their real names. Atlas: a leader of the Titans against Zeus and his allies, he was punished by having to carry the sky on his shoulders. Eventually he gained relief from his burdens when Perseus turned him into stone with the head of the gorgon Medusa.
bridgeman
Pan: the son of Hermes and a nymph, he had horns, a beard, tail and goat legs. He lived in the woods and pastures of Arcadia in the Peloponnese, where he guarded flocks, herds and beehives, and took part in the revels of the local nymphs. He was a lazy, easy-going spirit who loved his afternoon nap and if awakened would terrify those who disturbed him with a sudden loud cry – hence the expression ‘panic’. He invented the pan pipes, and had the gift of prophecy, which Apollo learnt from him. In more recent literature Pan has sometimes been equated with evil, specifically with Christian Satan, because of his half-human half-goat form, but like all Greek gods he was friendly or unfriendly, not evil. Pan. © te ah o o t e k ur a p o un a m u
GL3001
23
the greek gods and their functions
Tyche: her name means chance and she decides the fortune, good or bad, of all mortals. She is quite irresponsible, heaping wealth on some, while keeping others poor or depriving them of their wealth. There is no justice in the distribution of luck, so the Greek explained it in this fashion. Nemesis: if people boast of what they possess or have done, they are pursued and cut down to size by the ancient, slow but remorseless goddess Nemesis. Hebe: the daughter of Zeus and Hera, Hebe personifies eternal youth. She features in very few tales, but was originally cup-bearer to the gods – that is, she carried around the nectar at their endless feasts. Eventually Zeus fell in love with the handsome youth Ganymede, son of the king of Troy, and carried him off to wait on him at Olympian banquets instead. Hebe was finally married off to the hero Heracles when he joined the Olympians after his death.
bridgeman
Prometheus: this Titan created men, and then stole Zeus’ fire to help them. Zeus was very angry, and punished man by creating woman. He made a beautiful creature called Pandora, and gave her a box containing disease, old age, vice, violence and other evils. Pandora opened the box out of curiosity and released all these ills on mankind. This tale sounds rather like Eve and the apple in the garden of Eden, another story where women are blamed for the evil deeds of men.
Prometheus.
Prometheus also tricked Zeus by appearing to share a sacrificed ox between gods and men. However, he made an attractive parcel of the bones and fat and a less good-looking parcel of the meat. Zeus chose the bones. From that time on, when men sacrificed to the gods the immortals were given the bones and fat while humans ate the meat at the feast – an excellent example of a myth justifying a ritual. 24
GL3001
© te ah o o te k u ra p ou n a mu
the greek gods and their functions
Zeus, however, was furious and he had Prometheus chained to a mountain. Every day an eagle came and fed on his liver, while at night the liver regrew so his punishment seemed eternal. Eventually, Zeus relented and released Prometheus. He was only just in time, as he had in mind to seduce the sea nymph Thetis. Prometheus knew a prophecy that Thetis would bear a son much greater than his father, which would have meant a son who would have overthrown Zeus. So Zeus married Thetis off to the mortal Peleus in a great ceremony which all the gods were invited to except the goddess Eris (Discord or Strife), but she came anyway. 2B
List the six children of Rhea and Cronos, and by each name write up to three sentences naming each one’s area of influence and the main points in their story. Check your answers.
Š te ah o o t e k ur a p o un a m u
GL3001
Attic cup, 400 BCE
learning outcome
Understand the Greek heroes and their functions and relationships to each other and their importance in the eyes of man.
learning intention In this lesson you will:
•• examine the Greek heroes and their functions and relationships that gave them an importance in the eyes of man.
introduction
As well as tales of the Olympian gods, the Greeks told many stories of the heroes – those half-gods who faced great dangers and difficulties, sometimes winning, sometimes losing, but never giving up. By far the greatest of these was Heracles.
heracles
The legends of Heracles come from many different sources, since he was a popular figure in most Greek states. The versions vary and even contradict each other, but here are the main ‘facts’. Zeus seduced mortal women by appearing to them in the form of whatever they loved most. As Alcmene of Thebes was a virtuous wife, Zeus took the form of her husband Amphitryon. Hermes held back the sun-god so the night Zeus spent with Alcmene was as long as three normal nights. The result was Heracles, who nearly came to an early end when Amphitryon decided to burn poor Alcmene to death because she had been unfaithful. Zeus sent a storm to put out the fire and told Amphitryon to behave himself and care for Zeus’ son, so Heracles received a good education in warfare, boxing, archery and similar essential training for his future. He soon showed his strength. When the angry Hera sent two snakes to destroy him as an infant, he hopped out of his cradle and strangled them both. When he grew up, Hera drove Heracles mad for a short time. In this condition he murdered his wife and children and for punishment agreed to perform 12 ‘labours’ or great tasks for Eurystheus, king of Tiryns. Zeus promised that when the 12 labours were over Heracles would be rewarded with immortality. Here are the 12 labours of Heracles: 1. He killed the Nemean lion, an enormous animal whose skin could not be harmed by iron, bronze or stone. Heracles chased it into its cave and strangled it. Then he skinned it using one of its own razor-sharp claws, and afterwards wore the skin with the head as a helmet. 2. Next he slew the Hydra of Lerna, a monster with a dog-like body, a poisonous breath and many snaky heads which regrew when cut off. Heracles used fire to prevent new heads growing while he cut or bashed with his club all heads in turn, including one which was immortal. He then dipped his arrows in the dead monster’s blood which made them deadly.
26
© te ah o o te k u ra p ou n a mu
the greek heroes
Heracles slays the Hydra.
3. Heracles’ third labour was to capture the Ceryneian hind, a deer sacred to Artemis. Heracles hunted the animal for a year until it was exhausted, then captured it unhurt. 4. Next Heracles was ordered to capture the wild boar on Mt Erymanthus. On the way he was entertained by the centaur Pholos, but unfortunately had to fight off other centaurs, attracted and maddened by the smell of wine. He drove them off, despite a rainstorm which loosened the string of his bow. (Nothing in Greek mythology happens by chance, and this storm is a good example – it was sent by the cloud Nephele, the grandmother of the centaurs.) Unfortunately, a ‘good’ centaur, Cheiron, Heracles’ old friend, was wounded in the knee by one of Heracles’ poisoned arrows. Being immortal he could not die, and went back to his cave howling in agony. At last Zeus let him hand on his immortality (to Prometheus, after Zeus had forgiven him) and Cheiron was able to find relief from his pain in death. Heracles’ host Pholus was also an unfortunate victim. He picked up one of the poisoned arrows in curiosity then dropped it on his foot, wounding himself and dying instantly. After this, the capture of the boar was quite simple – the hero drove it into a deep snow drift. But when he took it back to Tiryns, king Eurystheus was so frightened he leapt into a huge jar for safety. 5. Heracles’ fifth labour was to clean out the stables of king Augeias, which were piled high with the dung of many years. The hero did this in one day by diverting the river Alphaeus to run through the stables. 6. Next he had to get rid of the Stymphalian birds which lived in a marsh near Mt Cyllene. These creatures had beaks, claws and wings of bronze, and killed both men and flocks. Heracles couldn’t get to the birds because the marsh was too muddy to walk in but too solid for a boat. He was helped by Athene, who gave him a noisy bronze rattle, which startled the birds. When they flew up into the air he killed many with his arrows, and the rest fled.
© te ah o o t e k ur a p o un a m u
GL3001
27
the greek heroes
7. Heracles next went to Crete to capture a fire-breathing bull, which he took back to king Eurystheus. 8. In Thrace, four savage man-eating mares were running wild and doing great damage. After capturing the mares, Heracles also captured their owner, the cruel Diomedes, and fed him to his own animals. The well-fed mares were now easily harnessed to a chariot and driven away. 9. king Eurystheus now commanded Heracles to fetch the golden girdle of Hippolyte, queen of the Amazons, for his daughter Admete. The Amazons were an imaginary tribe of warrior women who lived near the Black Sea and obviously fascinated the Greeks, because they showed them frequently in art. There are many versions of how Heracles stole the girdle. Some say he killed the queen and took it, or received it as a love gift or as part of a ransom price. 10. Heracles’ tenth labour was the theft of the cattle of Geryon, a man – monster with three upper torsos and heads all joined at the waist. He lived somewhere in the far west beyond the straits of Gibraltar with his beautiful red cattle. On the way Heracles built two pillars on either side of the straits of Gibraltar, and shot Geryon with a poisoned arrow. He then drove the cattle back to Greece. A Roman version of the story has him turning right too soon after crossing the Alps and travelling the length of Italy – only when he reached Sicily did he realise he’d taken the wrong road. In Italy he was welcomed on the site of Rome by king Evander. Evander had built a settlement there, and nearby Heracles killed a firebreathing monster named Cacus, who had dared to steal some of his cattle. 11. For his eleventh task Eurystheus sent Heracles to gather apples from the golden apple tree which had been Mother Earth’s wedding present to Hera. This tree was in a garden in northwest Africa, guarded by the daughters of Atlas, the Hesperides. Heracles asked Atlas to fetch the apples for him, offering to hold up the heavens while he did so. But the Titan liked his freedom, and suggested that if Heracles would wait there a little longer he’d take the apples to Eurystheus himself. Suspecting the Titan might never return, Heracles agreed but asked Atlas to take back the heavens while he adjusted his lion-skin to act as a shoulder pad. Easily fooled, Atlas did so, and Heracles picked up the apples and left. This rare example of the hero using brain rather than brawn suggests that he was prompted by Athene. On the way home Heracles crossed Libya, where he killed the giant Antaios. This son of Mother Earth grew stronger whenever he touched his mother, and so Heracles had to keep him off the ground. Holding him high in the air, he squeezed the giant to death. Also on this trip Heracles killed the bird which tormented Prometheus, and arranged for him to take over Cheiron’s immortality, so the centaur could end his pain in death. 12. Heracles’ last and most difficult labour was to capture the fearsome dog Cerberus and bring him up from the underworld, a task which probably represents his overcoming his own mortality. He dragged Cerberus through the darkness of the underworld up to the light, and also rescued his friend Theseus, whom you’ll read about later.
28
© te ah o o te k u ra p ou n a mu
the greek heroes
Heracles was involved in many more adventures. Though they may seem monotonous to us, with their repetition of murder, theft and pillage, they were very popular among the Greeks. Here are some reasons why: •• Heracles’ deeds were linked to all parts of Greece. All states could claim him as a hero and tell his tales •• he was the superhero – strong, brave and always successful in the end, thus fulfilling men’s dreams of what they would be like if they could •• he represented mankind striving against misfortune, danger and finally death. Heracles took another wife, called Deianira, after rescuing her from a centaur named Nessus who had threatened to rape her. As Nessus was dying, he told Deianira to take some of his blood, and if Heracles was unfaithful to her to smear the blood on his clothing, as this would keep him faithful. When Deianira grew tired of Heracles’ many infidelities and feared she would be replaced with another wife, she put the blood on Heracles’ shirt. Of course Nessus had been lying, and the poison began to eat the hero’s flesh. In agony he tried to kill himself on a funeral pyre, which Zeus struck with a thunderbolt. Heracles mortal body was burnt up, and his immortal spirit was taken to Olympus. Hera finally became reconciled with Heracles and gave him her daughter Hebe. Heracles is always shown in art with his lion-skin and club. Sometimes he also carries a bow and arrows. He appears in many tales using great strength, often aided by Athene. Later stories still stress his strength but also tell of his stupidity and his huge appetite. 3A
1. List the 12 labours of Heracles. 2. Explain in your own words why he was so popular a figure among the Greeks. Try to add some ideas of your own. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
jason and the argonauts
bridgeman
One expedition Heracles featured in briefly was a voyage by a group of heroes to the Black Sea to bring back a golden fleece. They journeyed in a ship called the Argo, and therefore are called the Argonauts. The fleece originally came from a legend about a golden ram, which was possibly a memory of how early inhabitants of Thrace used sheepskins to trap the gold found in their streams.
Jason and the Argonauts.
Our story, however, begins in Thessaly, where a certain Pelias killed his brother and took the throne. He killed all likely enemies but failed to kill his nephew Jason, the true heir to the throne, and one of the few heroes who was not a son of Zeus. Jason was brought up in the care of the wise centaur Cheiron. When he grew up Jason returned to claim his kingdom, winning the favour of both Hera and Athene on the way. However, Pelias tricked Jason into going off to fetch the Golden Fleece. He told him that the country was afflicted by a curse which would not be lifted until the fleece was regained, and promised he would hand over the throne on Jason’s return. In fact, Pelias hoped he would die on the way. Many heroes volunteered to accompany Jason, some probably being later additions reflecting the desire of great families to claim an Argonaut as an ancestor.
30
Š te ah o o te k u ra p ou n a mu
the greek heroes
Heracles joined, but left the expedition early when water-nymphs captured his beautiful young lover Hylas. Others you will hear mentioned in other tales were Castor and Polydeuces, Peleus the father of Achilles, and the musician Orpheus. They left Greece in the Argo and sailed to the Black Sea with many adventures on the way. When they reached Colchis, king Aietes, who had the Golden Fleece, did not want to give it up. But he was afraid to refuse the Argonauts outright, so he set them a challenge first: they had to plough a large field using two bulls to pull the plough, and sow the field with dragons’ teeth. The catch was that the bulls were made by Hephaestus out of bronze and breathed fire, and each dragon’s tooth sprouted into a fully armed warrior. Jason passed the test with the help of Aietes’ daughter Medea, since Hera had made her fall in love with the handsome hero. Medea was a mistress of magic, and when her father planned to attack the Argonauts to keep the fleece, she led Jason to the oak tree where the fleece hung and she put the dragon on guard to sleep. Jason seized the fleece and fled with Medea and all his crew on the Argo. When Aietes followed them, Medea killed her young brother and threw his severed limbs and body on the sea. As she expected, her father paused to gather the pieces of his dead son and so the Argonauts escaped. They had many adventures on the way home, and of course when they arrived home Pelias refused to hand over the kingdom to Jason. So Medea tricked Pelias’ daughters into killing their father by persuading them that they could bring him back to life as a young man. The citizens refused to accept Jason as ruler because of Medea’s deed, and the couple went to Corinth, where Jason decided to divorce Medea and marry the king’s daughter. The outraged Medea sent the unfortunate princess a gown which burnt both her and her father to death. To complete her revenge, she killed her sons by Jason, and fled to Athens. There she married the king, but was forced to flee after being caught trying to poison Theseus, the king’s son. The myth is vague about what finally happened to her, but Jason came to a miserable end. As an exile and outcast, he wandered from place to place, until one day he returned to his ship, the old Argo, and was killed by its prow breaking off and falling on him.
© te ah o o t e k ur a p o un a m u
GL3001
31
the greek heroes
perseus and the gorgon medusa Another well-known hero was Perseus, best known for cutting the head off the gorgon Medusa. His mother was Danae, only child of Acrisius, king of Argos. Because of a prophecy that he would be killed by a grandchild, Acrisius locked his daughter away in a dungeon. But Zeus came to her in a ‘shower of gold’, which some interpret as money but which is much more likely to be a ray of golden sunlight, if you think of what a person imprisoned in an enclosed room might long for most.
The gorgon was Medusa, once a beautiful woman who had roused the lust of Poseidon. He had seduced her in a temple sacred to Athene, and the angry goddess blamed the victim and turned her into a hideous monster with snakes for hair and a gaze which turned those looking at her to stone.
istock
In any case, Danae gave birth to Perseus, and Acrisius, not daring to kill his daughter himself, shut her and the baby in a box and set it adrift on the sea. It floated to the island Seriphos, where king Polydectes took the pair into his home. He tried to marry Danae but Perseus, who grew up very quickly, protected his mother. To get rid of Perseus, Polydectes tricked him into going on a quest to fetch the gorgon’s head.
Perseus and Medusa.
Perseus, like Jason, was lucky in having divine support. Athene, who clearly had a weakness for heroes, gave him a shield polished like a mirror, while Hermes provided winged sandals, a sickle to cut the head off, and a bag to carry it in. After several adventures Perseus arrived in North Africa and, using the shield as a mirror, cut off Medusa’s head, stuffing it in the bag while looking the other way. As he flew home he spotted a beautiful woman chained to a rock on the seashore. This was Andromeda, who was about to be sacrificed to a sea monster because her mother Cassiopeia had boasted she was as beautiful as the sea nymphs. Perseus used the gorgon’s head to turn the monster to stone and took Andromeda as his bride. But a former suitor arrived with armed followers to claim Andromeda, and Perseus was forced to turn them all to stone and flee. When he arrived back in Seriphos with Andromeda, Perseus found his mother had taken refuge in a temple and Polydectes was trying to starve her into submitting to him. Perseus promptly used Medusa’s head to save her. He then returned to Argos, where he accidentally killed his grandfather with a discus, while taking part in games. Some say he then became king of Argos, while others say he founded Mycenae not far away. Unlike many heroes, Perseus seems to have had a happy end. Medusa’s head finished up on Athene’s shield and is regularly shown there by artists. 32
GL3001
© te ah o o te k u ra p ou n a mu
iv
Attic vase, 520 BCE
learning outcome
Understand the Greek heroes and their functions and relationships to each other and their importance in the eyes of man.
learning intention In this lesson you will:
•• examine the Greek heroes and their functions and relationships that gave them an importance in the eyes of man.
introduction
Very few heroes managed to live happily ever after and many of them came to a very unhappy end.
the adventures of theseus
A major hero of Athens was Theseus, who claimed both Poseidon and Aegeus, king of Athens, as his father. Once when Aegeus was travelling he stopped at Troezen in the house of the king, and spent the night in the bed of princess Aithra. He then left his sword and sandals concealed under a heavy rock. He told Aithra if she bore a son Aegeus would acknowledge him when he could lift the rock and claim the sword and sandals. When Theseus was 16, he lifted the rock and set out to Athens to meet his father. However, he decided he would make a better impression on his father if he achieved some great deeds on the way, so travelled the dangerous coastal route from Troezen to Athens. On the way he got rid of the following problems: •• Periphetes, who battered passers-by with a great club. Theseus killed him with his own club and kept it from then on •• Sinis tied victims to the tops of two pine trees bent to the ground and then released the trees to fly up and tear them apart. Theseus killed him the same way •• a giant sow which was ravaging the farmland was killed •• Sciron made passers-by wash his feet and then kicked them over the cliff to a man-eating turtle below. He suffered the same fate at Theseus’ hands •• Cercyron, a powerful wrestler, was crushed by Theseus •• Procrustes fitted people to his bed either by stretching them or chopping part of them off. Theseus killed him by fitting him to his own bed. In Athens, he found his father had married Medea the sorceress (see chapter IV), who instantly knew who Theseus was and tried to poison him before he could claim the throne ahead of her own children. But her scheme was discovered and she hastily left Athens. Theseus killed a few relatives who were making things difficult for his father, and got rid of a wild bull on the plain of Marathon. He then began his most famous deed. Athens had to pay tribute each year to Minos, king of Crete, as payment for the death of Minos’ son Androgeos, whom the Athenians had killed. The tribute was seven young women and seven young men to be sacrificed to a monster with a man’s body and a head of a bull, called the Minotaur. Theseus volunteered to be one of the 14, and on arriving in Crete set about killing the minotaur.
© te ah o o t e k ur a p o un a m u
GL3001
33
more greek heroes
He was helped by Ariadne, daughter of Minos, who had fallen in love with him. She gave him a sword and a ball of thread to find his way in and out of the maze where the monster lived. Theseus killed the minotaur and fled by ship with Ariadne and the young Athenians. For no clear reason, he left her asleep on the island of Naxos, but she was soon rescued by the god Dionysus who promptly married her. Theseus sailed on to Athens but he forgot to change the sails of his boat from black, signifying mourning, to white, as his father had asked him to do to show he was still alive. Aegeus was watching for the boat at Cape Sounion, the southernmost tip of Attica, and when he saw the black sails he thought his son was dead. In his grief he threw himself into the sea, which was called the Aegean after him. Theseus became king, and joined all the settlements of Attica into a single state with Athens as its capital. He defeated an invasion by the Amazons, whose queen Hippolyte he married. He went to the wedding of his friend Peirithous the Lapith to Laodameia. There he helped defeat the Centaurs, who got drunk and attempted to carry off the bride and other female guests.
bridgeman
These two battles – Greeks versus Amazons and Lapiths versus Centaurs – are often shown in Greek art. Both symbolise the victory of civilisation, represented by the Greeks, over the barbarism of the Amazons and Centaurs. Moreover, in sculpture the topics allow neat alternation of male/female figures or human/centaur figures.
Theseus and the Minotaur.
© te ah o o te k u ra p ou n a mu
more greek heroes
Theseus had an unhappy end to his life. He cursed his son Hippolytus because he believed Hippolytus had seduced Theseus’ wife Phaedra. By the time he found out the truth, Hippolytus was dead, killed as his chariot horses panicked when they were frightened by a sea monster. Next, he and Peirithous abducted the young Helen of Sparta, who was rescued by her brothers Castor and Polydeuces. Then Theseus and Peirithous went down to the underworld to try to carry off Persephone. Hades politely asked them to sit down, but when they did their flesh stuck to the chairs. When Heracles came down to get Cerberus (chapter IV) he pulled Theseus free, but Theseus left much flesh behind and was in pain till he died. When he returned to Athens, Theseus found someone else was now king, and he was forced into exile, to die a wretched death on the island of Scyros. The tale of Theseus is an interesting mixture of old and new, fact and fiction. The tale of the minotaur and the tribute of young Athenians may well be a memory of a time Knossos had power over mainland cities – before 1450 BCE. The unification of Attica was a fact also, but happened some hundreds of years after the story of Theseus evolved, and it was probably fifth century Athenian propaganda to make it Theseus’ deed. In fact, many of Theseus’ exploits are very similar to those of Heracles, and it seems likely Classical Athens wanted a hero of its own who could rival the greatest of the Greeks. Unfortunately, Theseus never quite made it!
aithra
Aithra, mother of Theseus, features briefly in the tale of Helen and Troy. When Castor and Polydeuces rescued Helen after her abduction by Theseus, they took Aithra back to Sparta as a slave. Aithra accompanied Helen to Troy as a maid servant, and when Troy fell was rescued by her grandsons and taken back to freedom in Athens. 4A
1. Jason, Perseus and Heracles each went to fetch something in the course of their labours. What are some of the essential ingredients of a quest story? Why are they told? Write two or three sentences discussing this. 2. Name one or two modern quest stories. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
daedalus and icarus
bridgeman
Another mythical figure connected with the tales of Theseus is the great Athenian inventor Daedalus. He had to flee Athens when he killed his nephew out of jealousy because the boy had invented the jagged-tooth saw. Daedalus fled to Crete, where Minos made him welcome. However, Minos had offended Poseidon by not sacrificing a special bull, and Poseidon took revenge by getting Aphrodite to cause Minos’ wife Pasiphae to have an unnatural lust for the bull. Daedalus built a hollow cow for Pasiphae to hide herself in to satisfy her lust, and the result was the minotaur. Daedalus then built the maze or labyrinth in which the minotaur was kept, and gave Ariadne the ball of string for Theseus to use to get in and out of the maze.
Daedalus and Icarus.
Minos was angry with Daedalus for interfering in his family affairs and imprisoned him and his son Icarus in the labyrinth, but Daedalus made wings for them to escape. Unfortunately, Icarus was carried away with the thrill of flying and climbed too high and too close to the sun. The wax which held his wing feathers in place melted and he fell into the sea and drowned. Poor Icarus remains a warning for mortals not to aspire to things beyond their reach.
bellerophon and pegasus
The fate of our next hero also carries this message. Young Bellerophon tamed the beautiful winged horse Pegasus, and on its back he killed the fearsome monster the Chimaera, which was part lion, part goat and part serpent. But after a number of deeds he became too ambitious and tried to ride Pegasus up to Olympus. Zeus sent a gadfly to sting Pegasus, who reared suddenly and threw Bellerophon to his death.
36
Š te ah o o te k u ra p ou n a mu
more greek heroes
niobe
Another story which involves a human being displaying fatal pride is that of Niobe. She was the daughter of Tantalus, whom we will hear more of next chapter. She had many children: most stories say seven daughters and seven sons. She was so proud of her children that she mocked Leto for producing only two. Unfortunately, quality counted more than quantity, since Leto’s two children were Artemis and Apollo, who at once took steps to avenge the insult to their mother. Apollo found the boys hunting on Mt Cithaeron and shot them down one by one, while Artemis went to Thebes where the girls were spinning in the palace and shot them with her deadly bow and arrows. For nine days and nights Niobe wept over the bodies, and eventually Zeus took pity on her and turned her into a pillar of stone, from which water continued to flow.
the hunt for the calydonian boar
Another story, the hunt for the Calydonian boar, involves a number of heroes we have already met, and some new ones. The leader of the hunt was Meleager, whose mother was told by the Fates at his birth that he would live only till a branch, at that minute smouldering on the fire, burnt away. She hastily took the branch off the fire and hid it. Meleager grew up to be a fearless fighter. When his father offended Artemis by not including her in his yearly sacrifices to the 12 Olympian gods, Meleager headed the expedition to kill the huge boar Artemis had sent to ravage the land. Many heroes joined in, including Castor and Polydeuces, Jason, Peleus, Theseus and his friend Peirithous the Lapith, and the woman Atalanta. Her father had not wanted a female child and exposed her at birth on the mountainside where she was suckled by a bear. Under the protection of Artemis she grew up to be a swift and deadly hunter and a resolute virgin. The aggressive male heroes strongly objected to hunting with a woman, but Meleager had fallen in love with Atalanta and insisted she be included. After much feasting, the expedition moved off, but the heroes were each so eager to win for themselves the glory of killing the beast they failed to work as a team and normal hunt discipline was ignored. Several hunters were killed, some by the boar and some by other hunters. Most legends say Atalanta drew first blood with an arrow behind the boar’s ear, while Meleager finished it off. At once he skinned the beast and presented its pelt to Atalanta, but this deeply offended his uncles, who claimed they should have been given the skin. Meleager killed two of them on the spot and two more uncles later in civil war. His mother was angry at the news of her brothers’ deaths, and promptly threw the fatal branch on the fire, thus killing her son. Atalanta was at last acknowledged by her father, who tried to marry her off, but she stalled her suitors by insisting they must beat her in a race to win her – if they lost they died. Finally the crafty Melanion asked Aphrodite for help. She gave him three golden apples, and each time Atalanta forged ahead he tossed down an apple which she stopped to pick up. Thus Melanion won the race and a bride, but their domestic bliss did not last long. The pair offended Zeus by making love in an area sacred to him, and were turned into lions.
© te ah o o t e k ur a p o un a m u
GL3001
castor and polydeuces (the dioskouroi)
thomas hope
Castor was the son of Leda and Tyndareus of Sparta, while his twin Polydeuces was Leda’s son by Zeus. They had many adventures together, such as the quest for the Golden Fleece, rescuing their sister Helen from Theseus, and carrying off the daughters of Leucippus. Eventually the mortal Castor died, and his brother offered to take his place in the underworld for six months each year so Castor could spend that time alive. Zeus was so touched by this that he placed the brothers in the heavens as the constellation Gemini.
Castor and Polydeuces.
tales of thebes
Another great group of myths concerns the city of Thebes, but there is only room to touch on them briefly here. On the coast of Asia Minor a young woman was playing with her companions on the beach one day when a beautiful bull appeared. When she was unwise enough to climb on its back, the bull took off and swam with her across the sea. The bull, of course, was Zeus, and the unfortunate maiden was Europa, mother of Minos, Rhadamanthos and Sarpedon of Crete – but that’s another story. However, Europa’s brothers went hunting for her all around the Mediterranean, and one of them, Cadmus, was told by an oracle to found Thebes. The great-grandson of Cadmus, Laius, was told that if he begot a son, he would be killed by that son. So when his wife Jocasta gave birth to a baby boy, the child was cast out on the mountainside to die, with a spike driven through his ankles. This gave him his name, Oedipus (swollen foot). The child was rescued by shepherds and brought up by the king and Queen of Corinth as their own son. When he grew up, Oedipus heard a prophecy that he would kill his father and marry his mother, so he fled Corinth, thinking he was leaving his parents behind. He travelled towards Thebes, killing an elderly man in a quarrel on the road.
38
© te ah o o te k u ra p ou n a mu
more greek heroes
When he reached Thebes he found the king had recently disappeared and the city was terrified by a sphinx – a winged lion with a woman’s head. Oedipus destroyed the sphinx by answering her riddle, and became king by marrying the queen. Thus, without realising it he had fulfilled the prophecy by killing his father, the traveller, and marrying his mother, the queen Jocasta. Eventually the truth was revealed and queen Jocasta killed herself, while Oedipus stabbed his eyes to render himself blind and went into exile. His children by Jocasta were to have no happier fates. His sons killed each other over who should rule Thebes, and his daughter Antigone was buried alive for daring to bury one of her brothers against the orders of Creon, Jocasta’s brother who had taken control at Thebes. Creon’s life ended in misery too when his son Haemon, betrothed to Antigone, killed himself, and his wife also committed suicide. There are many other characters in the Theban myths, such as Teiresias the blind prophet, but they are too numerous to mention here.
orpheus
A very popular myth involves a figure for once not famous for strength and killing. The greatest musician of ancient times was Orpheus, son of Apollo and the muse Calliope. He is the archetypal poet and the archetypal musician and can be seen as the embodiment of ‘art’ in its widest sense. His playing of the lyre and his singing were so charming that animals stopped to listen, and rocks and trees would move closer to hear him. He married the beautiful wood nymph Eurydice, who died of a snake bite on the day of their wedding.
bridgeman
Orpheus was so grieved he decided to go down into the underworld to regain her. His music charmed away all difficulties, even melting the hard heart of Hades. He agreed to let Eurydice return to the upper world, provided Orpheus did not look behind him on his way back from the underworld. But at the entrance to the underworld Orpheus made his fatal error of looking behind, only to see his beloved fading forever. Orpheus was inconsolable, and eventually was torn to pieces by some maenads, female followers of Dionysus.
Orpheus and Eurydice.
© te ah o o t e k ur a p o un a m u
GL3001
39
more greek heroes
This myth is very old, but in classical times Orpheus was still important as a religious figure. Because he had journeyed to the underworld and returned, he was a central figure in Orphic mysteries, rituals concerned with death and salvation. There were similar rituals called Eleusinian mysteries and Dionysian mysteries, based on the idea that Persephone and Dionysus were connected with both the lower and upper worlds. No one knows exactly what the rituals were. They remain mysteries, but those initiated into the rituals believed they would live forever in Elysium, the paradise of the underworld.
pride and punishment
You have read a number of myths where humans are punished by the gods for being presumptuous, for aiming for things beyond the reach of humanity. This fault is called hubris, a term meaning great insolence, wantonness or pride. Humans should aim at sophrosyne, or moderation and self-control, and this is a clear message from many tales. Otherwise the gods would punish them directly, or eventually Nemesis would catch up with them. Moderation in all things was a Greek ideal, and ‘nothing to excess’ was inscribed on the walls of Apollo’s temple at Delphi to give this message to all who came there to consult his oracle. 4B
What lessons are to be learned from the myths of Daedalus, Bellarophon, Niobe, the Calydonian boar hunt, Castor and Polydeuces, Oedipus and Orpheus? Check your answers.
40
© te ah o o te k u ra p ou n a mu
v
Pompeii – Villa of the Mysteries
the importance of the trojan war in the myth cycle learning outcome
Understand the Trojan War and its importance in the myth cycle.
learning intention In this lesson you will:
•• examine the Trojan War and its importance in the myth cycle.
introduction
The Trojan War was the most widely known event in the ancient world, and it is still the bestknown part of Greek mythology. In fact, it belongs to both myth and legend, because the story is probably based on fact, but the details are invented and belong to myth.
the trojan war – when, where and why Thrace
The Trojan War took place a generation after the quest for the Golden Fleece, and many of the Argonauts were fathers of heroes who fought at Troy. The tales of the war and its immediate aftermath are the last in Greek mythology, which reflects the end of the Mycenaean world within a hundred years of Troy’s destruction. The chief opponents were Troy, a rich city situated on Black the narrow straits leading to the Black Sea, and Mycenae, the leading city in Greece. Since the Sea downfall of Minoan Crete some 200 years earlier, Mycenaean civilisation had flourished, and many Greek cities sent ships and soldiers to fight against Troy.
Macedonia
© te ah o o t e k ur a p o un a m u
GL3001
41
the importance of the trojan war in the myth cycle
The mythical reason for the war was the abduction of Helen of Sparta by Paris of Troy. The real reason, if the Trojan War really did take place, was probably a plundering raid to obtain metal and other loot, or the desire to wipe out a trading rival. Scholars disagree on the date but 1250 BCE is widely accepted as well as being easy to remember. Our story begins at the wedding of Thetis and Peleus, when Eris, goddess of discord, threw a golden apple inscribed ‘For the Fairest’ among the guests. Zeus said only a mortal could be an unbiased judge, so Hermes took the apple and the three competitors – Hera, Athene and Aphrodite – to Mt Ida near Troy where Paris, son of king Priam of Troy, was tending cattle. Paris chose Aphrodite and as a reward for his choice, Aphrodite made Helen fall in love with him and sail back with him to Troy. Helen’s husband, Menelaos of Sparta, called on his brother Agamemnon of Mycenae to help him win back his wife. Agamemnon in turn summoned allies from all the Greek states, and sailed to Troy.
helen
When Zeus fell in love with Leda, wife of king Tyndareos of Sparta, he knew she loved the beautiful white swans of the River Eurotas near her home, so took the form of a swan to seduce her. Leda was pregnant to her husband at the time and produced two sets of twins, with one child in each set fathered by Zeus and one by Tyndareos. Her children were •• semi-divine Helen and mortal Clytemnestra •• semi-divine Polydeuces and mortal Castor. You read about Castor and Polydeuces in chapter IV, and will read about Clytemnestra, wife of Agamemnon, later this chapter. Helen was very beautiful and had many suitors hoping to marry her for her beauty, and also because her husband would become king of Sparta. Tyndareos was uneasy about the quarrelling his final choice of a husband might create, and on Odysseus’ advice made all Helen’s suitors promise to defend the chosen husband against anyone resenting his good luck. Menelaos was Tyndareos’ choice, so when Paris stole Helen away to Troy all Helen’s former suitors were bound to help get her back.
menelaos and agamemnon
These brothers came from a family cursed by violence and treachery. The founder of the family was Tantalus, father of the unfortunate Niobe. Tantalus offended the gods by inviting them to a feast at which he served them the flesh of his son Pelops in a stew. He was punished for this crime by being confined in Tartarus and suffering perpetual hunger and thirst. The story places him in a pool of water which recedes whenever he tries to drink, while above his head hang delicious fruits which the wind blows out of his reach when he tries to eat them. His punishment gives us the English word ‘tantalising’.
42
© te ah o o te k u ra p ou n a mu
the importance of the trojan war in the myth cycle
The gods brought Pelops back to life again and he is best remembered for winning his wife Hippodameia by defeating her father Oinomaos in a chariot race. Pelops bribed Oinomaos’ charioteer to tamper with his master’s chariot, and as well as killing his prospective father-in-law by treachery, Pelops drowned the charioteer rather than give him the promised bribe. The next generation continued the same violence and treachery. The best-known children of Pelops and Hippodameia were Atreus and Thyestes, who fought over the kingship of Mycenae. Thyestes and his son Aigisthos succeeded by murdering Atreus, but Atreus’ sons Agamemnon and Menelaos eventually reclaimed the throne, killed Thyestes and drove Aigisthos into exile. Menelaos married Helen and became king of Sparta. Agamemnon ruled Mycenae and took for his wife Helen’s sister Clytemnestra, murdering her first husband and child. Clytemnestra and Agamemnon had two daughters, Iphigenia and Electra, and a son, Orestes. When Helen was taken by Paris, the Greek fleet gathered at Aulis to sail to Troy but could not leave. Agamemnon had angered Artemis by boasting he was as good a hunter as she was, so Artemis kept the wind blowing in the wrong direction. A human sacrifice was needed, so Agamemnon sent for his eldest daughter, Iphigenia, pretending he was going to marry her to Achilles. Instead, she was sacrificed and the fleet sailed. While Agamemnon was absent at Troy, Aigisthos returned from exile and found the angry Clytemnestra very willing to become his lover and plan revenge whenever Agamemnon should return.
achilles
Clytemnestra had willingly sent her unfortunate daughter to Aulis because her proposed bridegroom, Achilles, was the greatest of all the Greek heroes who fought at Troy. Achilles was the son of Thetis and Peleus, at whose wedding Eris had begun all the trouble with her apple, ‘For the Fairest’. The legends somewhat telescope time because not only was Achilles old enough to fight at Troy, but his son Neoptolemos was also old enough to fight there and kill Priam, king of Troy. Achilles was invincible in battle because Thetis had dipped him as an infant in the underworld river Styx, but her fingers prevented the waters from reaching the ankle she held him by. This was the only part of him which could be injured – his ‘Achilles heel’ – and Paris wounded him here with a poisoned arrow shortly before the Trojan War ended. Achilles was a typical Homeric hero, strong and brave, but also brutal and selfish towards enemies and allies alike. When offered the choice between a long, quiet life or a short glorious one he chose the second option. 5A
What caused the Trojan War? Write half to one page, outlining the real reasons for the war and the reasons given in mythology. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
the importance of the trojan war in the myth cycle
thomas hope
odysseus
Odysseus.
Another hero associated with Troy is Odysseus, king of Ithaca. One of the unsuccessful suitors for Helen, he eventually married Penelope, and had to leave her and their infant son Telemachus when he went to Troy. He did not want to go and pretended to be mad to avoid it, ploughing the seashore and sowing it with salt. However Palamedes, one of the group which came to summon him to Troy, placed Odysseus’ baby Telemachus in front of the plough, forcing Odysseus to stop to avoid killing his son. Thus he showed he was not mad because an insane person would have continued to plough. Odysseus never forgot that Palamedes was responsible for him going to Troy, and as we shall see in the next chapter, he eventually took revenge. If you read about Odysseus in Homer’s poem the Odyssey, you have the story of the brave, resourceful hero fighting colossal odds to get home to his beloved wife and to rid his home of her unwelcome suitors. But if you read the Iliad or any other legends directly associated with Troy, you meet a very different picture. Odysseus is very brave and endlessly cunning and inventive, but he is also the rather nasty person who smashes out the brains of Hector’s infant son, frames Palamedes for treachery, and tries to stab his friend, Diomedes, so he can grab all the credit for stealing a statue of Athene, the Palladium, from Troy. All Homeric heroes were brave and strong, but they also tended to be rather stupid. Odysseus stands out for his quick mind, and he was probably the most feared and hated of all the Greeks. Moreover, he had one very formidable ally. The goddess Athene favoured him because of his cunning, and also helped him and all the Greeks at Troy because she resented Paris’ slight to her beauty. Hera also hated the Trojans for the same reason, and helped the Greeks whenever possible.
44
© te ah o o te k u ra p ou n a mu
the importance of the trojan war in the myth cycle
the trojans
At the time of Troy’s destruction it was ruled by the elderly king Priam and queen Hecuba or Hecabe. They had many children, and here is a description of those important in the tale of Troy. Paris: when Hecabe was pregnant with Paris, she dreamed she gave birth to a blazing torch, whose flames set all Troy on fire. Priam consulted his son, Aesacus, who was an interpreter of omens, and was told that the child would be the ruin of Troy and should be killed. Some days later Aesacus declared, ‘The royal Trojan who gives birth to a child today must be killed, and so must her offspring.’ Priam promptly killed his sister, Cilla, who gave birth to a child that morning. Later in the day Hecabe produced Paris, and Priam was urged by the various seers in Troy to destroy him. But the king gave the task to his shepherd, who exposed the baby on Mt Ida where it was suckled by a she-bear. Later Paris was rescued and reared by the same shepherd. He grew up to be outstandingly handsome, intelligent and athletic, but not much is ever said about his courage. His weapon was the bow and arrow, which was regarded as a coward’s weapon as it did not bring the fighter into hand-to-hand combat. As a herdsman Paris enjoyed watching bulls fighting, and promised a golden crown to any bull which could beat his own champion bull. As a joke, the god Ares turned himself into a bull. When Paris without hesitation awarded him the crown, this fair dealing was observed by the gods on Olympus, and thus Hermes chose him to judge the goddesses’ beauty contest. Each goddess offered Paris a tempting bribe. Hera promised to make him lord of all Asia and the richest man alive, while Athene offered him wisdom and victory in war. But Aphrodite promised him the most beautiful woman in the world, Helen of Sparta, for his wife, and won the prize. So Hera and Athene plotted how to gain revenge and actively worked to help the Greeks destroy Troy. Not long afterwards, Paris attended some funeral games given by Priam and easily won contests in boxing and running. When Priam’s sons were enraged at being defeated and decided to kill the unknown Paris, the old shepherd who had reared Paris ran to Priam and told him this was his lost son. Priam welcomed the news and celebrated the discovery with feasting and sacrifices. When his seers warned him that Paris should be slain at once, or Troy would fall, Priam is said to have answered, ‘Better that Troy should fall than that my wonderful son should die.’ A short time later Paris visited Sparta and was welcomed by Menelaos, Helen’s husband. Aphrodite carried out her promises, and the infatuated Helen happily sailed with Paris back to Troy. Here she was welcomed because of her divine beauty, and Priam vowed that Troy would never let her go. Paris was killed by an arrow before Troy fell. Cassandra: Apollo fell in love with her, and offered her the gift of prophecy if she would become his mistress. Cassandra first agreed, then refused. The gift of a god, once given, cannot be taken away, but it can be altered, and Apollo placed on her the curse of never having her prophecies believed. Cassandra predicted the doom of Troy for years, but was never believed.
© te ah o o t e k ur a p o un a m u
GL3001
45
the importance of the trojan war in the myth cycle
Cassandra’s fate was as tragic as that of all the Trojan women. The main Greek leader, Agamemnon, did not respect her virginity, as Apollo had, but took her as part of his war booty. By the time he reached Mycenae, Cassandra had borne him twins, and all three were murdered along with Agamemnon by his wife Clytemnestra and her lover Aegisthus. Cassandra predicted her death and that of Agamemnon – but as usual this was in vain. Creusa: she was married to Aeneas, son of Aphrodite and Anchises. She died during the sack of Troy, but her son Ilus escaped with his father Aeneas. They sailed eventually to Italy, to become the ancestors of the Roman race. Thus, through Creusa the blood line of the royal house of Troy was preserved. Deiphobos: he was the unfortunate man who married the beautiful Helen after Paris’ death. On the night of the sack of Troy, the Greeks caught him unawares in bed, and the vengeful husband, Menelaos, was not content merely to kill Deiphobos, but cut off his nose, ears, and presumably other prominent parts of his body. Hector: the greatest of the Trojan warriors, who could only be killed by the mightiest Greek warrior, Achilles. Hector’s death is told in Homer’s Iliad. Previously he had slain Achilles’ friend, Patroclus, and stripped him of his armour, the usual practice of Homeric heroes to prove that they had ‘made their kill’. But the armour really belonged to Achilles, and when Achilles came out to avenge his friend’s death he found Hector dressed in his own armour, which made him angrier than ever. He killed Hector, and instead of accepting a large payment for the body so that it could be properly buried, as was the custom, the uncivilised Achilles dragged the body round the walls of Troy every day behind his chariot. Eventually Priam persuaded him to exchange the body for an enormous amount of gold. Hector’s wife, Andromache, became the slave of Achilles’ son Neoptolemos, while their infant son Astynax was thrown from the walls of Troy and killed. Helenos: warrior and prophet, he also was carried off by Neoptolemos, who gave him Andromache as his wife. They settled in Epirus in northwest Greece and made ‘a little Troy’. They were visited by Aeneas, to whom Helenos prophesied his (Aeneas’) future wanderings. Troilus and Polyxena: these were children of Hecabe and Priam, rulers of Troy. It was said Troy would not fall if Troilus reached the age of 20, so Achilles undertook to end his life. When the young Trojans went out of Troy to get water from a fountain, Achilles ambushed them and killed Troilus. Achilles fell in love with Polyxena, who escaped back to Troy. He showed his affection by demanding as he died that she be sacrificed at his tomb. When Troy fell and Polyxena was captured she was killed to appease Achilles’ spirit, which was complaining that he wasn’t sharing in the spoils of the looted city.
46
© te ah o o te k u ra p ou n a mu
the importance of the trojan war in the myth cycle
sources of the tales of troy – the iliad and the odyssey
The fall of Troy was the most famous event in the ancient world and is told or referred to by many ancient writers. Our oldest source is the epic poems of Homer, the Iliad and the Odyssey. The Mycenaean civilisation collapsed within a century of the fall of Troy and soon only the memories of former glory remained. These memories were used as the raw material for poems composed and sung by minstrels, who could not read and write, to an equally illiterate audience, on occasions such as a feast or religious festival. The Iliad and the Odyssey belong to the eighth century BCE (remember Troy fell in 1250, the middle of the thirteenth century BCE) and are the final versions of songs which had been passed on orally for several centuries. No doubt there were many such poems, but only these two have survived in their full and polished form. They tell only small parts of the long tale of Troy. The Iliad describes an incident in the tenth year of the siege of Troy by the Achaeans. (Homer does not call them Greeks, which was the name used by the Romans centuries later. The Greeks called themselves Hellenes.) Agamemnon takes away from Achilles his female captive Briseis, so Achilles sulks and refuses to fight the Trojans. However, when his friend Patroclus is killed by Hector, Achilles goes berserk. He kills Hector and mutilates the body, but eventually agrees to ransom it to Hector’s father Priam for a huge price. The Odyssey tells of the return of the Achaeans to their homes after the fall of Troy, and in particular describes the homecoming of Odysseus.
the aeneid
Most heroes of Troy died defending their city, but one who survived was Aeneas, son of Aphrodite, who left the burning city carrying his aged and crippled father Anchises on his back. One version says he was seen by Agamemnon, who was so touched by Aeneas’ devotion to his father that he let them go safely. Aeneas was one of many Trojan heroes and not very important in Homer’s tales, but after Homer’s time stories about Aeneas grew. With a group of Trojan men and women, he wandered the Mediterranean for seven years. They finally settled in Italy and intermarried with the Italian peoples. Centuries later their descendants founded and inhabited Rome. In the first century BCE, the Roman poet Vergil wrote a poem called the Aeneid about the adventures of Aeneas. He used the works of many other writers which have long since disappeared, and the Aeneid is another major source for the tales of Troy. 5B
Draw the following family trees: 1. The family of Achilles. Include Peleus, Thetis, Achilles, Neoptolemus. 2. The family of Odysseus. Include Odysseus, Penelope, Telemachus. 3. The family of Paris. Include Priam, Hecabe, Paris, Cassandra, Creusa, Helenos, Deiphobos, Hector, Astynax, Ilus. Check your answers.
© te ah o o t e k ur a p o un a m u
GL3001
the gods of rome and the dei consentes learning outcome
Understand the Gods of Rome and their relationship with the Greek gods.
learning intention In this lesson you will:
•• examine the Gods of Rome and their relationship with the Greek gods.
introduction
In ancient Rome, the 12 major gods were called the Dei Consentes – the Roman Council. The Dei Consentes was created around 200 BCE or so, after Hannibal had beaten the Romans badly in the north. Hannibal had not yet made it to Rome, but he was targeting Rome, and the Romans knew it. The Roman Senate called on the Roman Collegia, the professors and teachers in Rome, and asked for advice. The Collegia thought about it and came back with an idea. They suggested the problem was that Rome needed to present a special public display honoring the top 12 gods, along with a special feast. The Roman Senate decided that was a sound idea. They named this Roman council of 12 gods the Dei Consentes (Agreed Gods of Rome). They ordered six couches to be set up in public, and ordered their top artists to create sculptures of 12 god heads – no bodies, just heads. These sculptures were displayed in public on the couches in pairs – Jupiter and Juno, Neptune and Minerva, Mars and Venus, Apollo and Diana, Vulcan and Vesta, Mercury and Ceres – six couches, 12 gods, but no Pluto. In Roman mythology, Pluto was not a member of the Council of 12, the Dei Consentes, but Vulcan was. Hannibal never made it to Rome, so the people believed that this display created in the honour of the Council of Gods – the top 12 gods – and they believed that it worked. It saved Rome. This set the pattern, the Romans believed that if Rome was threatened the Dei Consentes, the 12 most powerful gods in the heavens, would defend Rome. This belief was essential to the way you view the Romans and their gods. The Romans believed in many different gods and goddesses. For everything imaginable they had a god or goddess in charge. Mars, for example, was the god of war. This meant he was good at fighting and it meant that he had most of all the soldiers at heart. A Roman soldier would hence most likely pray to Mars for strength in battle. But Minerva was the goddess of wisdom, intelligence and learning. Not many soldiers would ask her for help. The Romans indeed had hundreds of different gods. This entire collection of all their gods was called the Pantheon.
48
© te ah o o te k u ra p ou n a mu
thomas hope
the gods of rome and the dei consentes
Selecting a sacrifice.
a strange mix
The Romans gods were from a strange mixture of influences. Before Rome became a big city, the area around it, called Latium, was settled by superstitious villagers, the Latins, who believed in many gods and spirits. As Rome grew into a city and began to become more powerful it came into contact with the Greeks, who had a complex Pantheon of their own. It seems that the Roman gods were a mix of those two main influences: Latin and Greek. In many cases the Romans found there was a Latin and a Greek god for one and the same thing. They tended to take the two and make them one. So for example, Vulcan was the old Latin god of fire. The Greeks had a god called Hephaestus, who was very similar, and so the Romans just mixed the two together and made them one. Paintings or statues of Vulcan generally showed him as a blacksmith, like the Greek Hephaestus, but his name still was the Latin Vulcan.
In Roman religion every household had its own personal spirits which protected it. The lares were the spirits of the family’s ancestors. And the penates were kind spirits who guarded the larder. Little figurines of these spirits were kept in a small household shrine, called the lararium. The spirits would be worshipped by the family on special days. Bits of food or wine might be sacrificed to them.
Š te ah o o t e k ur a p o un a m u
bridgeman i
Statuette of a lar holding a cornucopia. GL3001
49
the gods of rome and the dei consentes
new gods, new religions
With the vast size of the empire, there was of course many new gods from distant civilizations which the Romans learnt about. Romans didn’t tend to think that only their gods were the right ones. If they heard of other peoples’ gods they would think that these were real gods who watched over other parts of the world and whom they had simply not yet heard about. And so as they learned about these new gods, new temples were built to these new arrivals in the Roman pantheon.
the dei consentes jupiter – reigned supreme According to ancient Roman myth, Jupiter was the king of all the gods. Jupiter had two brothers and three sisters. When Saturn, their father, died, the boys – Jupiter, Neptune and Pluto – divided the world up between themselves. Jupiter took all of the heavens, Neptune took the sea, and Pluto took the underworld. Each was quite content with their selection. One of the differences between the Greek and Roman myths is that in Greek mythology, Zeus was controlled in part by the Fates. His was also an elected position – he could have been ousted by the other gods, not that they ever managed it. But Jupiter, the Roman god, was the god supreme. He ruled heaven and earth and all life. Jupiter listened to his various advisors – especially the other gods who made up the Council of 12. He might even assign one of the other gods to make a decision, but the final word was his. Like the Greek god Zeus, Jupiter had a very jealous wife – Juno. He also had a great many children. Jupiter was very fond of all his children.
juno
Juno’s temples were mostly in Rome. Every March 1st there was a big festival in ancient Rome to honour Juno. It was a very serious affair. Roman women were serious about their goddess. Although the Romans enjoyed the Greek myths about queen Hera, they treated some of these myths with a ‘not much truth in them really, but aren’t they fun’ kind of attitude.
50
GL3001
thoman hope
Juno was married to Jupiter. She was the queen of all the gods, and also the goddess of marriage. In Greek myth, Hera often behaves as a dangerously jealous, petty queen of the heavens, who is not nice at all and spends a great deal of her time getting even, whether the slights are imagined or real. But in Roman mythology Juno was the beloved goddess of marriage, worshipped as a housewife and mother and matron. Although Juno watched over all Roman women, her special concern was Roman married women.
Juno Lucina.
© te ah o o te k u ra p ou n a mu
the gods of rome and the dei consentes
neptune Neptune was the Lord of the Sea. His brothers were Jupiter – the king of all the gods – and Pluto, the king of the underworld. Neptune was confident and good looking. He had deep blue eyes and streaming green hair. Neptune was very powerful. He could raise his hand and a new island would appear! People were terrified of Neptune, especially those who lived in coastal towns. The ancients built temples to honour Neptune. They brought special gifts to the temple every day, hoping to keep him happy. Sometimes it worked. Sometimes it didn’t. Neptune as god of the sea was known as a very uncertain god.
mars Mars was the son of Jupiter and Juno. Nobody liked him much, not the gods and not the mortals. Mars was tall and handsome, but also mean and self-centred. His sidekick, Discordia, the spirit of disagreement, travelled everywhere with him. They carried four lesser spirits along as well – the spirits of Pain, Panic, Famine and Oblivion. In Roman mythology, Mars did not care who won or lost a battle. He just liked to see bloodshed. Most of the other gods stayed as far away from Mars as possible. He only caused trouble.
mercury Mercury was the youngest son of Jupiter. Even as young boy, Mercury was incredibly mischievous. He stole Venus’ girdle. He borrowed Diana’s arrows. He played with Mars’ spear without permission. But he was so charming and fun and funny that he was forgiven every time. He was the universal favorite of all the gods. Even as a baby, Jupiter could tell that Mercury was going to be fun to have around. He liked his son Mercury very much. Jupiter wanted Mercury to have an important job in the world of the Greek gods. Mercury was fast on his feet and very clever, so Jupiter decided he would make a wonderful messenger. Things were always going on in the mythical world. The job of messenger to the gods allowed Mercury to have the inside material on just about everything. It is no wonder that there are probably more myths that include Mercury than any other god. The other gods trusted Mercury. Mercury had true warmth. He was playful enough to be interesting. He was very bright and very loyal, the best negotiator in the world, and he was always working on deals to get himself and others out of trouble.
© te ah o o t e k ur a p o un a m u
GL3001
the gods of rome and the dei consentes
apollo and diana
Diana was very different from her brother. It took a lot to get Apollo angry – he was usually gentle and full of warmth – but Diana was nearly always cold and pitiless. The only thing Diana loved besides her family were her floppy-eared dogs. Diana was the goddess of the hunt and of the moon.
Apollo.
thoman hope
Apollo and Diana were twins. They were the magical children of Jupiter and Latona. Both adored their mother, about whom Apollo was especially protective. Apollo was the god of the sun, of music, and of light. His twin sister Diana was the goddess of the moon and the hunt.
minerva Minerva was born without a mother. Her father was the mighty Jupiter, king of all the gods, and Minerva was born directly out of Jupiter’s head. According to legend, Jupiter’s head was hurting and Vulcan used his axe to split it open and out came Minerva fully dressed. Jupiter loved all his children, but if he had to pick a favorite, it would probably have been Minerva, the goddess of wisdom. Minerva was a powerful force, and one of the deities who made up the Dei Consentes, the Roman Council of 12 gods.
vesta Vesta was the goddess of hearth and home. She was Jupiter’s sister. She had three famous brothers, actually – Jupiter, Neptune and Pluto. She also had two very famous sisters – Juno, queen of the gods, and Ceres, queen of the harvest. You would think there would be lots of myths about such an important goddess, but there are not a lot of myths about Vesta. Still, she was quite important to the women in ancient times. Every day, when the women gathered in the central courtyard of their homes to do their sewing and cooking, they knew that Vesta was keeping watch over them. Vesta was not, perhaps, as important a goddess in ancient Rome as she was as Hestia in ancient Greece. Roman women had far more freedom, especially under the Empire. But both Roman and Greek women took comfort in Vesta. Vesta held a seat on the Roman Council of 12 gods, the Dei Consentes.
bacchus – god of wine Bacchus was the god of wine. He was accompanied by Maenads, or wild dancing women, who carried the thyrsus – a staff of giant fennel, covered with ivy leaves, with a pine cone on top. Bacchus was also the god of the theatre, since the first plays in Greece were performed in his honour. There were tragedies, serious stories about heroes and gods, and comedies, which laughed at politicians and were less than flattering for the people concerned!
52
© te ah o o te k u ra p ou n a mu
the gods of rome and the dei consentes
venus – goddess of love Venus was born in the sea and first came to shore at Cyprus, floating on a scallop shell. Like the Greeks, the Romans had a myth about the Trojan War. There was a Golden Apple with ‘For the Fairest’ written on the side. Venus, Juno and Minerva all wanted it. They decided to let a man, Paris, judge between them, but they were all so beautiful that he couldn’t make his mind up. So Juno said she would make him powerful. Minerva said she would make him wise. Venus offered him Helen, the most beautiful woman in the world. He chose Venus – and Helen. Unfortunately Helen was married to someone else, and when Paris carried her off to his home at Troy, her husband came with his allies to get her back. Paris and all his family were killed and Troy was destroyed. One of the few Trojans to survive the Trojan War was Aeneas, the son of Venus. He went to Italy, and was the ancestor of the Romans.
cupid – son of venus Cupid was the mischievous little god of love. His weapon was a bow, and anyone hit by one of his arrows fell madly in love. Cupid once scratched himself with one of his own arrows by mistake while looking at a woman called Psyche, falling in love with her. He knew that his mother Venus would be angry, so he hid Psyche away and told her that she must never try to look at him. Psyche thought that she had been captured by a hideous monster and, of course, couldn’t resist taking a peep. She was enchanted by the first sight of her handsome husband and, while playing with his arrows, scratched herself. This had the same effect as it had on Cupid, and the two were now desperately in love with each other. Discovering the love affair, Venus drove Psyche away. Psyche had many adventures before she was allowed to stay with Cupid, and Venus became reconciled to being a mother-in-law!
ceres
Ceres was the Earth goddess and goddess of corn. She carried the cornucopia, a horn full of vegetables and fruit. Her daughter was Persephone. Pluto fell in love with Persephone, and carried her off to the Underworld. Ceres searched everywhere, but couldn’t find her. Eventually Ceres refused to let the plants grow any more, and everyone begun to die of hunger. So Pluto admitted he had Persephone, but said she could only go back home if she had eaten none of the food of the Dead. Persephone was so sad at being kept underground that she had eaten almost nothing, but she had eaten six seeds from a pomegranate. This meant that she could go home, but had to return to her husband for six months every year. When this happens, Ceres stops everything growing, and winter comes.
vulcan Vulcan was the smith of the gods, and made Jupiter’s thunderbolts. His forge was in the heart of Mt Etna the volcano that dominated Sicily. Once, he made Jupiter angry, and Jupiter threw him out of Heaven. Vulcan fell to Earth and broke both legs, which made him lame.
© te ah o o t e k ur a p o un a m u
GL3001
53
the gods of rome and the dei consentes
pluto – not a member of the dei consentes Pluto and Jupiter and Neptune were three very powerful gods. They were also brothers. Way back when their father, the might Saturn, died, and the brothers first divided up the world, Jupiter took the sky, Neptune took the sea, and Pluto took the underworld. In time, Jupiter became the king of all the gods. Neptune married happily. As for Pluto, he was quite was content, living in the Underworld. Pluto was NOT the lord of death. His job was to run the Underworld. He was a good ruler. Parts of the Underworld, where heroes dwelled after they died, were very nice. Other parts were not so nice, and these were for people who were not good during their lifetime. You might think Pluto would be terribly lonely, surrounded by the souls of the dead, but he wasn’t. Unless they were in a lot of trouble with the gods, souls were only in Hades for a set period of time before they were reborn and sent back to earth. Additionally, Pluto had visitors. His brother Jupiter visited, as did his nephews Apollo, Mercury, and Mars. As well, Pluto came up to the surface now and then, if he had to be on Mount Olympus for a meeting of the gods or something. The thing was, Pluto preferred the Underworld. It was home. Pluto had everything he needed. He had an invisible helmet, which he liked very much. He had a golden chariot, which was his pride and joy. Eventually, he fell in love with the beautiful Persephone and the final arrangement was that she spent half the year with him and the other half the year above ground. 6A
1. Outline the historical reason for the existence of the Dei Consentes. 2. Name them. 3. Where were they found in Rome? Check your answers.
list of gods Greek Name Roman Name Zeus / Jupiter Hera / Juno Poseidon / Neptune Athena / Minerva Ares / Mars Aphrodite / Venus Apollo / Apollo Artemis / Diana Hephaestus / Vulcan Hermes / Mercury Demeter / Ceres Hestia / Vesta who resigned, to be replaced by Dionysus / Bacchus
54
© te ah o o te k u ra p ou n a mu
vii
the aeneid and its part in the myth cycle learning outcome
Understand the new myth of Rome was different to the Homeric myth.
learning intention In this lesson you will:
•• examine the Aeneid and understand its relationship to the Roman state.
background to the aeneid
The poet Virgil wrote the Aeneid – the great national epic poem of ancient Rome. It is considered an important literary work in Western civilization which has influenced countless other important books such as Dante’s Divine Comedy. (see GL3002.) Ovid mentions Aeneas in his Metamorphoses (see GL3002) and it is these works indicate that Aeneas survived the Trojan War. The story did for ancient Rome what the Iliad and the Odyssey did for ancient Greece. Virgil built his epic on aftermath of the Trojan War, but took the story in a new direction by weaving an after-the-fact account of the creation of Rome while expressing the essence of Roman culture to Romans themselves. The Aeneid was based on the Iliad and also Ovid’s Metamorphoses by expanding the story of a minor character known as Aeneas. Virgil assumed that his readers knew the basic outline of the Iliad and Odyssey. In the Iliad, Aeneas was a minor character mentioned briefly in book 20 in which the sea-god Poseidon prophesied that Aeneas would survive the burning of Troy and become the founder of a new city. But the Iliad did not specify which city this would be. Virgil used this ambiguity to determine that the city to be founded by Aeneas’ descendants would be, in fact, Rome. There is no substantial written historical evidence to assert the truth of this, although there were some accounts by Greek writers in the fifth century BCE that Aeneas’ new city was Rome. According to stories about the Trojan War, some of which have not survived but they’re alluded to, Aeneas was the son of a Trojan named Anchises and the goddess Aphrodite or as she was known in Rome, the goddess Venus. He survived Troy’s fall and fled to Italy where he married the princess Lavinia and founded the city Lavinium; and Aeneas’ son Ascanius founded the neighboring Italian city of Alba Longa. GL3005 and GL3006 focus on the Aeneid and you can read the epic in depth at that point. This happened approximately eight-hundred to a thousand years prior to writing the Aeneid, and it allowed Virgil to establish Aeneas as a ‘founder’ of Rome, even though there is another myth of the founding of Rome which describes the battle between two brothers (Romulus and Remus), that also caused the city to be founded. The Romulus and Remus legend has Romulus killing Remus around 753 BCE and then inviting others to join him in his new city. They then abducted Sabine women for their wives to enable the population growth of the city of Rome.
© te ah o o t e k ur a p o un a m u
GL3001
55
the aeneid and its part in the myth cycle
In essence, Virgil doesn’t contradict the Romulus and Remus origin story, but finds a way to have both stories co-exist along a timeline of history, and repeats the pattern of the city’s founding. Virgil deliberately fabricated this historical myth on a structure often parallel to the Iliad and Odyssey, and it focused on different themes such as leadership, the relation of the individual to the state, the struggle between desire and duty, the power of fate, and the changing power and influence of gods, particularly the Roman gods Juno, Venus and Jupiter. For the Romans, it quickly became a textbook for students to learn about their culture and their language. Furthermore, it reflected a new synthesis of Greek and Latin culture. The Aeneid is not only a personal epic about Aeneas, his suffering and his trials, but also about the role of the gods and a hymn of praise to Rome and the future of the Roman people. The poem begins: I sing of arms and the man, he who, exiled by fate, first came from the coast of Troy to Italy, and to Lavinian shores – hurled about endlessly by land and sea, by the will of the gods, by cruel Juno’s remorseless anger, long suffering also in war, until he founded a city and brought his gods to Latium: from that the Latin people came, the lords of Alba Longa, the walls of noble Rome. Muse, tell me the cause: how was she offended in her divinity, how was she grieved, the Queen of Heaven, to drive a man, noted for virtue, to endure such dangers, to face so many trials? Can there be such anger in the minds of the gods? Translated by A. S. Kline © 2002 All Rights Reserved This work may be freely reproduced, stored, and transmitted, electronically or otherwise, for any non-commercial purpose.
origins of the aeneid
Virgil was a well-educated Roman poet who lived around the time of Augustus Caesar. At the time, the Roman Republic had dissolved into essentially a military dictatorship led by Augustus Caesar. The work was commissioned indirectly by Emperor Augustus Caesar via an intermediary named Maecenas. Virgil wrote the Aeneid in dactylic hexameter using rhymes positioned strategically to juxtapose key concepts. But while trying to perfect the last phases of his manuscript, he died on a sea voyage. While dying, he requested that his unpublished manuscript be burned, but Augustus ordered it preserved and the manuscript survived. It rapidly became popular in the Roman Empire. But there are indications in the text of inconsistencies and unresolved issues which might have been addressed if Virgil had completed his epic, and places where the hexameters were incomplete.
56
© te ah o o te k u ra p ou n a mu
the aeneid and its part in the myth cycle
the epic that explains the greatness of rome
We learn very early in the text what will happen. We know it will have to happen because the king of the gods says so to his favourite goddess Venus (also known as Cytherea) and the rest of the epic is showing us how it happens. Bk I: 257–296 Jupiter’s Prophecy Don’t be afraid, Cytherea, your child’s fate remains unaltered: You’ll see the city of Lavinium, and the walls I promised, and you’ll raise greathearted Aeneas high, to the starry sky: No thought has changed my mind. This son of yours (since this trouble gnaws at my heart, I’ll speak, and unroll the secret scroll of destiny) will wage a mighty war in Italy, destroy proud peoples, and establish laws, and city walls, for his warriors, until a third summer sees his reign in Latium, and three winter camps pass since the Rutulians were beaten. But the boy Ascanius, surnamed Iulus now (He was Ilus while the Ilian kingdom was a reality) will imperially complete thirty great circles of the turning months, and transfer his throne from its site at Lavinium and mighty in power, will build the walls of Alba Longa. Here kings of Hector’s race will reign now for three hundred years complete, until a royal priestess, Ilia, heavy with child, shall bear Mars twins. Then Romulus will further the race, proud in his nurse the she-wolf’s tawny pelt, and found the walls of Mars, and call the people Romans, from his own name. I’ve fixed no limits or duration to their possessions: I’ve given them empire without end.
bridgeman
Translated by A. S. Kline © 2002 All Rights Reserved This work may be freely reproduced, stored, and transmitted, electronically or otherwise, for any non-commercial purpose.
Aeneas would go to Italy and his son Ascanius, named Iulus – would become a mighty power.
© te ah o o t e k ur a p o un a m u
GL3001
the aeneid and its part in the myth cycle
similarities and differences with virgil’s and homer’s epics.
A comparison of Virgil’s Aeneid, and Homer’s Odyssey will help to show the different aspects of Roman and Greek cultures. However, Virgil did not imitate, he gave a new meaning to the works that he borrowed and added his own thoughts and opinions that expressed and explained Roman life to the rest of the world. The Aeneid is not only a personal epic about Aeneas, but also exaltation and beautification of Rome and the future of the people. There is a greater emphasis placed upon the founding of Rome rather than the actual adventure of Aeneas. Virgil’s epic shows that he had a great admiration and pride in Rome and its people. Homer used the story of the Odyssey to express the qualities of the hero and the place of revenge in a hero’s life.
what is distinctly roman about the aeneid?
Throughout the epic we learn the importance of fate and destiny. Aeneas is driven by fate, but in the Odyssey there is only the occasional reference.
Gods: the portrayal of the gods is much different in both epics. The gods are involved on a daily basis with all aspects of life in the Aeneid, whereas in the Odyssey they come and go but tend to be there at crucial times.
thomas hope
Women: the portrayal of women is distinctly different in both epics. In the Odyssey, women had a greater amount of freedom. We see Penelope questioning Odysseus about his bed although she remained at all times remaining a model wife. She had greater freedom of action but it was made clear that she stayed ‘chaste’ and she slept with the women in the large ‘women’s section’ of the palace. In the Aeneid, Dido breaks her tie to her dead husband (assisted by the gods), while Aeneas’ bride-tobe in Italy is acknowledged only by name, she is given no part to play at all other than a dutiful and mute wife.
Aeneas’ mother – Venus.
Heroism: the ideals of heroism are distinctly different in both epics – we see Odysseus as a trickster, Homeric heroes have a tendency to be kill-first and ask questions later, but Aeneas, as he matures, becomes more diplomatic and considered in everything he does. Father/son relationship: the father/son relationship is strong in the Odyssey, but absolutely paramount in the Aeneid. Aeneas flees Rome with his elderly father over his shoulder and his son taken by the hand.
58
© te ah o o te k u ra p ou n a mu
the aeneid and its part in the myth cycle
Role of the individual: the relationship of the individual to the state and the struggle between desire and duty were clearly Roman themes. The Greeks were heroes who put themselves and their own households first. However, the Romans were encouraged to do their duty and if necessary lay down their lives for the good of the state. There are a number of other points, but from these you can see that Virgil wanted to ensure that the qualities of a good Roman were part of his key character. 7A
Outline two or three things that Jupiter promises will happen in his scroll of destiny. Check your answers.
Š te ah o o t e k ur a p o un a m u
GL3001
59
viii answer guide i. what is a myth? 1A
Reasons myths were created and the purposes they serve include: •• to explain the origins of the world •• to explain the happenings of nature •• to explain and justify existing customs and rituals •• to reflect human dreams and wishes.
1B
3000 BCE – Bronze Age begins. 2500 BCE – Fertility Goddess worshipped. 1450 BCE – Invasion of mainland Greece by Achaeans. 1250 BCE – Minoan civilisation in Crete flourishes. 1100 BCE – Mother/earth goddess still supreme. 1050 BCE – Minoan civilisation destroyed. Mycenaean civilisation flourishes. 1000 BCE – Troy sacked. All mainland Mycenaean centres destroyed. Invasion of Dorians. Writing lost. Myths created and retold orally. 800 BCE – Homer composed the Iliad and Odyssey. 500 BCE – Writing now in general use. Myths written down. Details changed or added by powerful states. 400 BCE – Hellenistic and Roman writers write down stories in the versions we have today.
ii. the greek gods and their functions 2A
1. Important points about Greek divinities might include: •• there were large numbers of them •• some were more important than others •• they were usually of human shape •• they had human appetites, desires and failings •• they were larger, more beautiful, more powerful than humans •• in a moral sense they were no better than humans •• they were immortal •• they didn’t care whether humans were good or not •• they only required worship from their followers •• they weren’t evil •• to humans they might be friendly, indifferent or hostile •• they caused everything that happened
60
© te ah o o te k u ra p ou n a mu
answer guide
•• they could tinker with minor details •• fate decided the general scheme of events. You may have thought of others, which your teacher will check. 2. Differences between the religion of the ancient Greeks and Christianity: Greeks Christians many gods
one god
answer guide
2B
Hestia: goddess of hearth and home. Sweet, kindly nonentity. Gave place on Olympus to Dionysus. Demeter: goddess of corn and fertility. Her daughter Persephone’s abduction by Hades explains seasons of the year. Eleusinian mysteries celebrated in their honour. Hera: goddess of marriage, childbirth and ‘women’s affairs’. Resented husband’s infidelity. Hades: god of the underworld, ruler of the dead. Poseidon: god of the sea, contender with Athene for power in Athens. Zeus: supreme god over gods and humans. Noted for numerous love affairs.
iii. the greek heroes 3A
1. The 12 labours of Heracles were: i. killing the Nemean lion ii. killing the Hydra of Lerna iii. capturing the Ceryneian hind iv. capturing the Erymantheian boar v. cleaning out the Augeian stables vi. killing/driving away the Stymphalian birds vii. capturing the Cretan bull viii. taming the mares of Diomedes ix. fetching the girdle of Hippolyte x. stealing the cattle of Geryon xi. gathering the golden apples of Hera xii. kidnapping Cerberus. 2. Heracles represented the ideal man in an age which put physical strength and courage first. He was always successful despite great odds, and everyone loves a winner. He could feature in tales set in almost every part of Greece, and in fact in almost every land in the Mediterranean, so every state could relate a story about ‘when Heracles visited here’. As you may have thought of other reasons, your teacher will check your work.
iv. more greek heroes 4A
1. A quest story involves a hero or heroes, setting out to do something or to find something of value far away. There must be many difficulties along the way and even when the goal is reached, so that the ‘questers’ must pass many tests of courage and ingenuity. They are told because people enjoy adventure stories which have a purpose. 2. Tolkein: Lord of the Rings. Terry Brooks: Sword of Shannara. David Eddings: Belgariad and Malloreon.
62
© te ah o o te k u ra p ou n a mu
answer guide
4B
Daedalus Daedalus brought misery to others by his inventions and finally to himself. His son Icarus flew too high, which a mortal must not do, and paid the price. Bellerophon He also flew too high, and Zeus ‘cut him down to size’ and killed him. The lesson here is that if you get too ambitious, the gods will destroy you. Niobe She boasted she was superior to Leto because she had more children. Leto’s children were infinitely more powerful and killed all Niobe’s children. Lesson: quality is more important than quantity. Don’t presume to be superior or even to equal a god. The Calydonian boar hunt All the hunters were anxious to kill the boar, and competed rather than co-operated. Thus a number were killed. Lesson: sometimes co-operation is preferable to competition. Castor and Polydeuces When mortal Castor died, semi-divine Polydeuces offered to spend half the year dead so his brother could live during that time. Zeus set them both in the sky. Lesson: sometimes even the gods are touched by devotion. Oedipus His parents and he both tried to escape from the prophecy that he would kill his father and marry his mother, but in vain. Lesson: you cannot avoid your fate. Orpheus When his wife died, he used the power of his music to win her back from the underworld, but lost her again when he broke a promise not to look back. Lesson: the power of love and beauty is very great.
v. the importance of the trojan war in the myth cycle 5A
The war originated from a quarrel between the goddesses Athena, Hera and Aphrodite, after Eris, the goddess of strife and discord, gave them a golden apple, sometimes known as the Apple of Discord, marked ‘for the fairest’. Zeus sent the goddesses to Paris, who judged that Aphrodite was the ‘fairest’ and should receive the apple. In exchange, Aphrodite made Helen – the most beautiful of all women and wife of Menelaus – fall in love with Paris, who took her to Troy. Agamemnon, king of Mycenae and the brother of Helen’s husband Menelaus, led an expedition of Achaean troops to Troy and besieged the city for ten years because of Paris’ insult. After the deaths of many heroes, including the Achaeans Achilles and Ajax, and the Trojans Hector and
© te aho o t e k ur a p o un a m u
GL3001
63
answer guide
Paris, the city fell to the ruse of the Trojan Horse. The Achaeans slaughtered the Trojans (except for some of the women and children whom they kept or sold as slaves) and desecrated the temples, thus earning the gods’ wrath. Few of the Achaeans returned safely to their homes and many founded colonies in distant shores. The Romans later traced their origin to Aeneas, one of the Trojans, who was said to have led the surviving Trojans to modern-day Italy. Other reasons for the war: the ancient Greeks thought that the Trojan War was a historical event that had taken place in the thirteenth or twelfth century BCE, and believed that Troy was located in modern-day Turkey near the Dardanelles. Many scholars believe that there is a historical core to the tale, though this may simply mean that the Homeric stories are a fusion of various tales of sieges and expeditions by Mycenaean Greeks during the Bronze Age. Those who believe that the stories of the Trojan War are derived from a specific historical conflict usually date it to the twelfth or eleventh centuries BCE, when the city was sacked because of the fact that it was a rich city situated on the edge of an agricultural plain, and that the city gained considerable wealth from both land and sea trading. 5B
1. The family of Achilles. Zeus
Aegina
Ilus
vi. the gods of rome and the dei consentes 6A
1. The Dei Consentes was created around 200 BCE, after Hannibal had beaten the Romans badly in the north. Hannibal had not yet made it to Rome, but he was targeting Rome, and the Romans knew it. The Roman Senate called on the Roman Collegia, the professors and teachers in Rome, and asked for advice. The Collegia thought about it and came back with an idea. They suggested the problem was that Rome needed to present a special public display honoring the top twelve gods, along with a special feast. 2. The Dei Consentes were: Jupiter–Juno, Neptune–Minerva, Mars–Venus, Apollo–Diana, Vulcan–Vesta and Mercury–Ceres. 3. The gilt statues stood in the Forum in Rome.
vii. the aeneid and its part in the myth cycle 7A
Jupiter’s scroll of Fate The direction and destination of Aeneas’ course are preordained, and his various sufferings and glories in battle and at sea over the course of the epic merely postpone this unchangeable destiny. Some of the things that are foretold include: he will wage war in Italy, establish laws, build city walls, reign in Latium; his son Iulus will become a mighty power; he will build the walls of Alba Longa and the greatness will have no end.
© te aho o t e k ur a p o un a m u
GL3001
reading on mythology A book of myths
Roger Lancelot
The God beneath the Sea
Leon Garfield & Edward Blishen
Hamlyn
© te ah o o te k u ra p ou n a mu
acknowledgements Every effort has been made to acknowledge and contact copyright holders. Te Aho o Te Kura Pounamu apologises for any omissions and welcomes more accurate information. Chapter header designs; Principal Greek gods diagram; Rangi and Papa illustration; Hydra of Lerna illustration; Athene born from Zeus’ head illustration, all © Te Aho o Te Kura Pounamu, Wellington, New Zealand. Photos: The Gods of Olympus, trompe l’oeil from the Sala dei Giganti, 1528 (fresco), Giulio Romano, BEN 78594; Sweet, piercing sweet was the music of Pan’s pipe, from The Story of Greece by Mary Macgregor, 1st edition 1913, Walter Crane (1845–1915), Private Collection, Stapleton Collection, STC 306486; Prometheus Bound, 1889, Briton Riviere (1840–1920), Ashmolean Museum, University of Oxford, UK, AMO 100593; Jason and the Argonauts, 1925, Arther C. Michael (1903–1928), Private Collection, The Stapleton Collection, STC 308566; ‘Theseus caught him by the horns’, from The Heroes Medici, Sir William Russell Flint (1880–1969), Private Collection, IL 370415; Icarus, Roger Payne, Private Collection, © Look and Learn, LAL 337365; Orpheus and Eurydice, George Federic Watts (1817–1904), Private Collection, Photo © Christie’s Images, CH 378277; Statuette of Lar, deity of the home and family, 1st century (bronze), Roman/Ashmolean Museum, University of Oxford, UK, AMQ 117704; Aeneas Fleeing Troy, Girolamo Genga (1476–1551), Pinacoteca Nazionale, Italy, Alinari, ALG 157981; all from The Bridgeman Art Library, London, UK. Used by permission.
Photo: British Museum pediment © Jan Gould, Wellington, New Zealand. Used by permission. Illustrations: Zeus; Demeter; Poseidon; Artemis; Castor and Polydeuces; Odysseus; Selecting a sacrifice; Juno Lucina; Apollo; Aeneas’ mother – Venus; from Costumes of the Ancients, by Thomas Hope, Chatto and Windus, London, 1875. Public domain. Photos: Aphrodite of Rhodes, 3945310; Perseus and Medusa, 11990561, both from iStock International Inc., Canada. Used by permission. Maps: Greece and the Mediterranean; Troy, © Te Aho o Te Kura Pounamu, Wellington, New Zealand. Extracts: Aeneid by Virgil; Jupiter’s Prophecy, Bk 1: 257–296, both from Virgil: The Aeneid Book I, translated by S. Kline © 2002. Extract only.
© te ah o o t e k ur a p o un a m u
GL3001
67
self-assessmentGL3001 Fill in the rubric by ticking the boxes you think apply for your work. This is an opportunity for you to reflect on your achievement in this topic and think about what you need to do next. It will also help your teacher. Write a comment if you want to give your teacher more feedback about your work or to ask any questions. Fill in your name and ID number. Student name:
Not yet attempted
Place of Trojan war in myth cycle understood
Place of Aeneid in myth cycle understood
Please place your comments in the relevant boxes below. Student comment
Functions of Gods understood
Place of Trojan war in myth cycle understood
Place of Aeneid in myth cycle understood
Any further student comments.
Š te ah o o te k u ra p ou n am u
Understood most
Very confident in my understanding
Contact your teacher if you want to talk about any of this work. Freephone 0800 65 99 88 teacher use only Please find attached letter Teacher comment
Š te ah o o te k u ra p ou n am u
cover sheet – gl3001 students – place student address label below or write in your details. Full Name ID No. Address (If changed)
authentication statement I certify that the assessment work is the original work of the student named above.
Signed
| i don't know |
Which singer had a top five hit in June 2010 with 'Not Afraid'? | Eminem Discography - Albums by Rapper Eminem
Eminem Discography
By Henry Adaso
Updated November 29, 2015.
Eminem is a prolific rapper with a rich and diverse discography. He has released some great albums ( Marshall Mathers LP , Slim Shady LP) and a few stinkers (Encore) over the course of his career. Hey, they can't all be daisies, right?
Anyway, dive in for an annotated list of Eminem's albums.
Eminem - Infinite.
• Eminem - 'Infinite' (1996)
Before the Dr. Dre hits and the Grammy awards, Eminem was just another raw talent with a pipe dream. Infinite captured the Detroit rapper in his essence: hungry, focused, raw. Infinite surely gave Em a launching pad to show and prove.
Top Tracks: "Infinite," "313," "Never Far"
continue reading below our video
What Do Movie Ratings Mean?
© Aftermath/Interscope Records
• 'The Slim Shady LP' (1999)
A white MC from Detroit? Unflinching paeans to drugs and violence? The task before Eminem seemed illogical at first, but he turned trials into trophies within one year of arriving on the mainstream scene. Complaints about his "evil" music failed to stifle the album's success, as The Slim Shady LP went on to sell over 5 million copies. We have this manic slice of dysfunction to thank for most of Eminem's best songs.
Top Tracks: "Role Model," "Guilty Conscience"
A year after he made a big splash in the industry, Eminem returned with yet another masterpiece in The Marshall Mathers LP. Em's sophomore effort helped cement his status as one of the most exciting artists of the new millennium.
Top Tracks: "The Way I Am," "Stan" More »
© Interscope Records
• 'The Eminem Show' (2002)
By the time The Eminem Show arrived, Em was now splitting time between the recording booth and the boards. Despite this newfound penchant for beatmaking, this album showed very little dropoff in the lyrics department. Em continued his tradition of throwing darts at detractors, this time taking on Canibus on "Square Dance" and Jermaine Dupri on "Say What You Say."
Top Tracks: "White America," "Till I Collapse"
Eminem - Encore. © Aftermath/Interscope Records
• 'Encore' (2004)
While Encore generated applause for its political candidness on one hand, Eminem drew criticism for imbuing that album with his increasingly cartoonish lyrics on the other. Even though it spawned gems like the plodding political punch, "Mosh," and the introspective "Yellow Brick Road," it was still considered a disappointment by Eminem's standards.
Top Tracks: "Mosh," "Yellow Brick Road"
• 'Eminem Presents The Re-Up' (2006)
This is the one most Eminem fans would love to forget. On The Re-Up, Eminem surrounded himself with the budding talent on his Shady Records roster. But the artists are soon relegated to watchdogs, and then, proxies -- trying to do what Eminem cannot: appear in control. Eminem experiments with emo-rap for most of the album, screaming and scrambling lyrics with unfounded verve and precise lunacy.
© Aftermath/Interscope Records
• Eminem - 'Relapse' (2009)
Eminem finally lifted his 5-year moratorium on solo albums with the release of Relapse . Eminem 's narratives are too familiar, but his method of delivering them has evolved. There are fake accents, unique rhyme sequences and vocal cadences here ("Soon as the flow starts, I compose art like the ghost of Mozart").
Top Tracks: "Deja Vu," "Medicine Ball" More »
© Aftermath/Interscope Records
• Eminem - 'Recovery' (2010)
Recovery is unlike any of Eminem's previous studio albums. Lacking the skits, traditional guests, and goofball lead singles that characterized The Slim Shady LP through Relapse, Recovery is Eminem coming to terms with his own legacy, shedding the tired formulas that marked his previous albums and attempting to reassert his place in the pantheon of the hip-hop elite.
Top Tracks: "Not Afraid," "No Love" More »
© Shady Records/Interscope
• The Marshall Mathers LP 2 (2013)
In November 2013, Eminem released a sequel to the widely cherished Marshall Mathers LP. In the buildup to MMLP2's release, Eminem stressed that MMLP2 wasn't going to be a follow-up to The Marshall Mathers LP. "There won't be continuation of songs or anything like that," he told Rolling Stone. MMLP2, it turns out retained most of the familiar themes from Em's earlier masterpiece. More »
| Eminem |
Which singer had a top five hit in June 2010 with 'All The Lovers'? | Record-Breakers and Trivia - everyHit.com
>>> But what's the longest word in a lyric?
Word featuring in most titles
The word "The" features in more hit titles than any other word (2506). Runner-up, a long way behind is "You" (1489) (as of w/e 11th Oct 2003)
Word starting most titles
The word "I" starts more hit titles than any other word (644). Then it's "Love" (234), "Don't" (219) and "You" (214) (as of w/e 11th Oct 2003)
Least Different Letters Making Up An Artist - Title Combination
U2 - "One" (5 characters). This uses a number so it could be argued that the real record-holders are ABC - "SOS" and Moby - "Go" (both 6 letters). However, "Doop" by Doop has just 3 different letters! Least different letters for a non eponymous single is 4 for Abba - "SOS."
Palindromic Title by a Palindromic Artist
"SOS" by Abba is the only palindromic hit song by a palindromic artist.
The Vowel-Free Titles: The following are the only titles of four letters or more to be vowel free (excluding numeric titles like "1999"):
Crash Test Dummies - "Mmm Mmm Mmm Mmm"
Julian Cope - "Try Try Try"
Blackout - "Mr DJ"
Pop Will Eat Itself - "RSVP"
Fall Out Boy - "Thnks Fr Th Mmrs"
Alphabetically First and Last Words In Titles
Alphabetically, the first word to appear in any song title is, somewhat obviously, "A"; it has appeared in several hundred titles. More obscure though, alphabetically speaking, the last word to appear in any title is "Zululand" (in King Kurt's 1983 hit, "Destination Zululand").
Least Different Words Used For Multi-Worded Titles:
Excluding single-worded titles, Destiny's Child are the only act to have three Top 40 hits and use no more than three different words in them; "No No No" (no. 5, 1998), "Bills, Bills, Bills" (no. 6, 1999), and "Jumpin' Jumpin'" (no. 5, 2000)
Biggest Name-Droppers:
Two groups have managed to take six girls' names into the Top 40:
The Everly Brothers: "Wake Up Little Susie" (1957), "Claudette" (1958), "Take A Message To Mary" (1959), "Poor Jenny" (1959), "Cathy's Clown" (1960), and "Lucille" (1960).
The Bachelors: ""Charmaine" (1963), "Diane" (1964), "Ramona" (1964), "Marie" (1965), "Hello Dolly" (1966) and "Marta" (1967). Thanks to chart guru Jon Kutner who points out that the Bachelors have a seventh if we include "Walk With Faith In Your Heart"!
Lyrical Connections Between Successive Number 1s
A favourite question in pop quizzes goes something like this:
"Which is the only record to have been knocked off the no.1 spot by a record whose title can be found in the lyric of the first song?"
The 'classic' answer is "Bohemian Rhapsody" by Queen. It contains the famous "mamma mia, mamma mia, mamma mia let me go" line. In January 1976, it was replaced at the top of the chart by none other than Abba's "Mamma Mia".
But a more striking (and more bizarre) answer arises from 1959 when Emile Ford & The Checkmates' "What Do You Want To Make Those Eyes At Me For" unseated Adam Faith's "What Do You Want" from number one. It's particularly odd as, during the transition, the tracks tied for the top spot and shared the position for one week!
But there are other examples, albeit less dramatic (ie. one-word titles), of this phenomenon:
In 1958, The Kalin Twins made no. 1 with "When". It replaced The Everly Brothers at the top; both tracks on their double A-Side "All I Have To Do Is Dream" and "Claudette" contained the word "When."
Two years later Anthony Newley made no. 1 with "Why". It replaced Michael Holliday's "Starry Eyed" at no. 1; the opening line of that song is "Why am I so starry eyed?"
In 1988, The Pet Shop Boys made no. 1 with "Heart". It replaced Aswad's "Don't Turn Around" at no. 1 (which contains the lines "Don't worry about this heart of mine" and "Coz you're gonna see my heart breaking").
The most recent example was seen in 2000. Madonna made no. 1 with "Music". It replaced Spiller's "Groovejet (If This Ain't Love)" at no. 1 (which contains the line "While we are moving, the music is soothing").
There are two instances of the reverse of this phenomenon - a track being toppled from no.1 by another which contains its full title in the lyric:
In 1960, Anthony Newley's "Why" was topped from no.1 by Adam Faith's "Poor Me" which contained "Why oh why do voices say to me, sit and cry, that this was meant to be."
In 1975, Telly Savalas "If" was topped from no.1 by The Bay City Rollers "Bye Bye Baby" which opened with the line "If you hate me after what I say."
Here's a interesting sub-category; Lyrical Prophecy Of Topping The Chart
On 15th Nov 1980, Blondie's "The Tide Is High" reached number 1. It included the line, "I'm gonna be your number one." It was knocked off the top spot on 29th Nov by Abba's "Super Trouper" which includes the line "feeling like a number one."
Most Popular Title For A Top 40 Single
Songs entitled "Angel" and "Crazy" have each made the Top 40 in 12 completely different tracks (ie. different tune / lyrics; not different versions of the same song).
Runners-up are: "I Believe" (10) and "Stay" (9).
The full list is here .
First Self-Penned Number 1
Mantovani's "Cara Mia" (July 1954; the 20th no. 1); it was composed by Mantovani and Bunny Lewis (under pen names Tulio Trapani and Lee Lange respectively).
Not until the 43rd Number 1 was an act entirely responsible for writing its own chart-topper; The Dreamweavers' "It's Almost Tomorrow" (March 1956).
Over twenty-eight years later Steveie Wonder became the first artist ever to write, produce and entirely perform a Number 1 ("I Just Called To Say I Love You", Sep 1984).
Eponymous Number Ones
When Mr. Blobby went to number one with "Mr Blobby" in 1993 it was the first time in 41 years of chart history that an eponymously title song achieved this feat. However, less than four months "Doop" hit number one by a band called Doop!
Hits In Most Languages
German pop/dance trio Sash! are the only act to have hits in four different languages. In 1997/8 they made the Top 40 with "Encore Une Fois" (in French), "Ecuador" (in Spanish), "Stay" and others (in English) and "La Primavera" (in Italian). Furthermore, though Sash's 1999 hit "Colour The World" was ostensively sung in English, it contained African lyrics by Nigerian vocalist Dr Alban and Finish singer Inka!
Petula Clark is the only British act to have hits in three languages; "Casanova" in German, "Ya Ya Twist" and "Chariot" in French and a host of others in English.
One group has graced the charts with hits in three languages. Kraftwerk had success with "Autobahn" (in their native German), "Tour De France" (French), five other Top 40 titles in English and one bilingual ("Expo 2000" mixed German and English).
Most Expletives
The Super Furry Animals 1996 hit "The Man Don't Give A..." contained 49 expletives; a record for a Top 40 single. The most for a solo hit is 33 in Eamon's 2004 track "F**k It (I Don't Want You Back)." This single also holds the record for most expletives in a chart-topper. The 'award' for most profanities in a hit by a female artist goes to Frankee whose 2004 number 1 "F.U.R.B. (F U Right Back)" (an answer song to Eamon's) contained 22 swear words.
Biggest Hit By A Non-Human Artist
In terms of chart success, this coverted title goes to The Archies for "Sugar Sugar" which spent 8 weeks at number 1 in 1969 (and stayed in the Top 40 for 22 weeks).
Created for mass consumption by bubblegum-pop genius Don Kirshner (the man who gave us the Monkees), the Archies existed on television as an animated series based on the comic book characters of the same name. The voices behind the singing cartoon characters were vocalists Ron Dante, Toni Wine and Andy Kim.
The biggest-selling single by a non-human group is "Teletubbies Say Eh-Oh" by The Teletubbies (1997, 1.1 million copies).
The biggest-selling single by a non-human soloist(!) is "Can We Fix It?" by Bob The Builder (year 2000, 1.0 million).
The Weirdness Of Blur's "Song 2"
The track "Song 2" was track 2 on the album "Blur". It was single 2 to be released from the album. It reached number 2 in the chart - and was just 2 minutes long!
Position-dodging
The Eurythmics have had 9 top ten hits. No two songs have peaked at the same position. The only position they have failed to achieve is No. 7 (they also have one number 11 hit and one number 12 hit, too!)
Most Graceful Retreat From Number 1
In chart history, four singles haven fallen from the Number 1 spot by one position for four consecutive weeks (ie. No. 1 to No. 2 to 3, 4, 5). They are:
Dickie Valentine - "Finger Of Suspicion" (1954) [1-2-3-4-5-5-4-9-17]
Tommy Edwards - "It's All In The Game" (1958) [1-2-3-4-5-4-8-11-15-27]
Michael Jackson - "You Are Not Alone" (1995) [1-2-3-4-5-7-9-13-25-30-31]
Eminem - "The Real Slim Shady" (2000) [1-2-3-4-5-7-8-10-11-15-23-33-38]
The following singles managed to 'double' their fall from the top for four consecutive weeks:
Chicago - "If You Leave Me Now" (1976) [1-2-4-8-16-16-28-30-39]
Ian & The Blockheads - "Hit Me With Your Rhythm Stick" (1978) [1-2-4-8-16-21]
Abba - "The Winner Takes It All" (1980) [1-2-4-8-16-30]
Wet Wet Wet - "Love Is All Around" (1994) [1-2-4-8-16-21-35- 39]
The record for languishing at No. 2 on the way out (for 8 weeks!) goes to:
Johnnie Ray - "Such A Night" (1954) [1-2-2-2-2-2-2-2-2-3-7-7-9-10-12]
Most 'Impressive' Symmetrical Chart Careers For A Title
Ten records in history have experienced symmetrical chart careers of four weeks (none has a longer symmetrical career). Of these, only four climbed as far as the top 30. They are:
Gloria Estefan - "Get On Your Feet" (1989) [34-23-23-34]
The Beloved - "The Sun Rising" (1989) [37-26-26-37]
Re-Flex - "The Politics Of Dancing" (1984) [34-28-28-34]
Eric Clapton - "Wonderful Tonight (live)" (1991) [35-30-30-35]
Artist 'Lapping' Himself
During the time Bryan Adams hit "(Everything I Do) I Do It For You" was at number one, his follow up single, "Can't Stop This Thing We Started", not only entered the chart, but climbed to number 12, fell down the chart and disappeared from the chart altogether.
First Chart Has-Been
Jane Wyman was the first chart act to completely disappear from the chart, never to return. 12th Dec 1952 was her second and final week on the chart singing 'Zing A Little Zong' with Bing Crosby.
When Was The Last Time...?
... there were no entries in the Top 10:
In March 2006, a new chart rule enabled download sales to count towards a single's chart position the week prior to the title being available in a 'hard' form (eg. CD). As download sales represented a relatively low proportion of overall sales at the time, this led to the return of a phenomenon which had been in decline for many years; titles entering the charts below their peak position and climbing! In w/e 29th April 2006 there were no new entries inside the Top 10, the first time that this had happened for more than four years. This looks set to become a more regular occurrence as it was repeated on the weeks ending 13th May, 8th July, 19th Aug, 2nd Sep, 30th Sep, 2nd Dec 2006 as well as 27th Jan, 10th Feb, 24th Feb, 3rd Mar, 17th Mar, 7th Apr, 5th May, 2nd June, 30th June, 28th July, 22nd Sep, 13 Oct, 17 Nov, 8th Dec 2007, 12th Jan, 2nd Feb, 1st Mar, 8th Mar, 15th, 29th Mar, 26th April, 10th May, 1st Jun, 29 Nov 2008, 31st Jan, 28th Mar, 11th Apr, 16th May 2009. We're going to discontinue this listing soon if this trend continues as it's getting out of hand!
More impressively, on week ending 29th Nov, the highest new entry was at no. 29 (Christian Falk featuring Robyn - "Dream On", though Snow Patrol's "Run" re-entered one place higher). It is rare for the entire upper half of the Top 40 to be devoid of new entries. The previous instances were 26th Apr 2008 when the highest new entry was at no. 25 (Goldfrapp, "Happiness") and 10th Feb 2007, when Kasabian entered at no. 22 with "Me Plus One". Before that, we have to go back to 1994 to find a Top 20 free of debuting singles (outside of the Festive period of course).
The 19th Aug 2006 chart not only featured no new entries into the Top 10, but also no "download-to-physical" climbers, making it doubly unusual.
Moreover, on the week ending 21st Apr 2007, the entire top 10 was a rearrangement of the previous week's top 10 (i.e. no songs climbing into, entering, or falling out of the top 10). This also happened on w/e 16th May 2009.
Throughout the 80s and 90s the number of "high new entries" grew rapidly as record companies became more focussed in targeting chart sales periods for dramatic debut positions. It was then rare (away from Christmas / New Year) to find a Top 10 with no new entries.
The last occurrence of this prior to the aforementioned download rule was w/e 9th Feb 2002 (highest new entry that week; "Dance For Me" by Mary J Blige at number 13).
More than seven years before that, in June 1994, there was a very rare new-entry-free Top 20, "Move Your Body" by Anticapella being the highest debutant at number 21. (NB: this excludes charts inside the festive season when it is usual for the chart to be somewhat stagnant.)
... a single climbed back up to number one:
Occasionally tracks drop from the number one spot and then do a 'U'- turn. Latest to do this was Shakira featuring Wyclef Jean with "Hips Don't Lie." It had topped the chart for w/e 8th July 2006, then being displaced for a total of three weeks by Lily Allen's "Smile" (2 weeks) and McFly's "Don't Stop Me Now / Please Please" (1 week). On w/e 5th Aug 2006 Shakira and Wyclef Jean reclaimed the no. 1 position. Prior to this, Eric Prydz had returned to the top with "Call On Me" in Oct 2004.
... a single spent more than X weeks at number one::
The last single to spend 5 or more weeks at number one was: Duffy - "Mercy" (Feb - Mar 2008) [5 weeks at no. 1] The last single to spend 6 or more weeks at number one was: Leona Lewis - "Bleeding Love" (Nov - Dec 2007) [7 weeks at no. 1]
The last single to spend 8 or more weeks at number one was: Rihanna featuring Jay-Z - "Umbrella" (May - July 2007) [10 weeks at no. 1]
The last single to spend 11 or more weeks at number one was: Wet Wet Wet - "Love Is All Around" (June-Sep 1994) [15 weeks at no. 1]
The last single to spend 16 or more weeks at number one was: Bryan Adams - "(Everything I Do) I Do It For You" (July-Nov 1991) [16 weeks at no. 1 - most ever consecutively.]
The last single to spend 17 or more weeks at number one was: Frankie Laine - "I Believe" (Apr-Sep 1953) [18 weeks at no. 1 - though in three separate spells at the top.]
More information .
... the Top 5 were all New Entries:
The most recent occurrence of the entire top 5 consisting of New Entries was w/e 29th Jan 2005. The previous occasion was w/e 13th Nov 2004; the fact attracted considerable attention as all five of the incumbents were American artists (in descending order: Eminem, Destiny's Child, Britney Spears, Christina Aguilera featuring Missy Elliott, Usher) - a first. The first instance of all Top 5 singles being New Entries was w/e 31st Oct 1998 (Cher, George Michael, U2, Culture Club, Alanis Morissette).
On just two occasions (w/e 15th Apr 2000 and w/e 29th Jan 2005) the entire top 6 were debutantes.
... the Top 5 were all non-movers:
The week with most successive non-movers (excluding Christmas weeks) was in July 1955 when the whole Top 7 remained unchanged. Since then, only the whole of the Top 6 has ever remained static - on four occasions (9th July 1955, 8th April 1961, 30th May 1981 and 8th March 2008).
Top 7 : 9th July 1955
Top 6 : 8th March 2008
1
H Two O featuring Platnum
What's It Gonna Be
Cherry Pink And Apple Blossom White
4
Basshunter ft DJ Mental Theo
Now You're Gone
Where Will The Baby's Dimple Be?
Most New Entries In The Top 40
On w/e 17th May 1997, the Top 40 chart contained a record-breaking twenty new entries (of which only one was a climber from further down the chart). The week ending 5th March 2005 also introduced us to nineteen 'pure' new entries, this time with no climbers.
Most New Entries In The Top 10
There have been seventeen occasions in chart history when seven titles of the Top 10 have been New Entries to the Top 40. The first such occurrence was w/e 19th April 1997. The top 10 looked like this:
Top 10 : 19th April 1997
1
| i don't know |
Richard Dodderidge were the Christian names of which English novelist, born in 1825? | R.D. Blackmore biography
R.D. Blackmore (1825–1900), English novelist and fruit grower wrote Lorna Doone (1869)
Biography:
With his elder brother Henry (1824–1875), Blackmore spent much of his childhood in the lush and pastoral "Doone Country" of Exmoor, Devon, and along the Badgworthy Water (where there is now a memorial stone in Blackmore's honour) and among the future fictional Doone Valley's towering hills. The severe and remote rocky areas of Devon provided protection for many fugitives at the time where justice was swift and penalties harsh. Blackmore would hear of many tales of highway robbery and murder among illiterate half-wild men living on the edge of survival.
Richard Doddridge Blackmore was born 7 June 1825 at the vicarage in Longworth, Berkshire County, son of the Reverend John Blackmore (1794–1858). His mother, Anne Basset Knight (1794–1825) died of typhus when Richard was a mere three months old and so he was raised by his aunt Mary Francis Knight. They lived on the rugged and remote North Shore of the Bristol Channel near Glamorgan though young Richard travelled south often to visit his father and paternal grandfather in Devon. By 1832 he was living with his father again after he had married his second wife, Charlotte Ann Platt in 1831.
He started his education at Squire’s Grammar School in South Molton, Devon, then went on to the same school his father had attended, Blundell's School, during which he lived in the village for the week and would go home on Sundays. One of the boys he lodged with would later become archbishop of Canterbury. In the harsh and narrow circumstances he experienced the severe discipline and corporal punishment that some say later led to his epilepsy, though Blackmore does not make Blundell's out to be so monstrous in Lorna Doone. The grammar school gave him a solid background for his career as a man of letters and he won a scholarship for Exeter College, Oxford, earning a degree in the Classics in 1847. He became a Barrister of the Middle Temple in 1852 but never practiced due to his epilepsy.
Without his father's knowledge, R.D. Blackmore married Lucy Maguire (1822?–1888), daughter of a laundress and a Roman Catholic, on 8 November 1853 at Holy Trinity Church, London. Lucy would later become a member of the Church of England. They would not have their own children but did adopt Eva, a niece of Lucy's. The Classics Master taught Latin and Greek at Wellesley House grammar school for a time, before, owing to an inheritance left him by his uncle the Rev. H.H. Knight of Neath in 1860, he and Lucy moved to rural Teddington, built "Gomer House" named after his beloved dog and planted an orchard.
Never losing touch of his classicist education, he became an avid horticulturist and farmer of apples and pears while working on translations of Horace and Virgil. He wrote essays, articles and stories on the subject of fruit growing. One in particular, The farm and fruit of old: a translation in verse of the first and second georgics of Virgil, by a market gardener (1862) would prove to be a significant step in his becoming an author of fiction. From 1883 he was a member of the Royal Horticultural Society. Blackmore published many of his first works of verse under the pseudonym Melanter (Greek for ‘more black’) including Poems by Melanter (1853), Epullia (1855), and The Bugle of the Black Sea (1855), about the Crimean War. His first novel, with poetic imagery and autobiographical narrative was Clara Vaughan (1864), which was followed by Cradock Nowell (1866), first serialised in Macmillan's Magazine.
His fruit business never really a success, Blackmore finally earned some acclaim for his historical romance that blends fact and fiction, Lorna Doone. It is set in 17th century Exmoor during the reign of Britain's Charles II. Young farmer John Ridd vows revenge on the Doone clan, "the awe of all Devon and Somerset, outlaws, traitors, murderers", who killed his father when he was a child. The Doones are based on the real Doone family of Scotland who had been disinherited by the Stuarts for a time. The chivalrous Ridd unexpectedly falls in love with and sets out to rescue the tragically fated heroine Lorna from her terrorising family. Blackmore masters the dialect of his characters and masterfully paints an endearing and enduring depiction of his favourite county, Devon. It is a classic tale complete with love, murder, revenge, and a cliff-hanger ending. There were a number of movie and television versions produced.
In 1875, Henry John Turberville, Blackmore's brother died, apparently of cyanide poisoning. Blackmore published a number of books in the 1870s including The Maid of Sker (1872), Alice Lorraine (1875), Cripps the Carrier (1876), and Erema, set in California. Blackmore's novels resonate with historical relevance and sympathetic observation of Nature, surely inspired by nostalgia of his youthful days exposed to Her harsh extremes and his life as rural farmer. Plagued by ill health for many years, in January 1888 Lucy Blackmore died. Thereinafter Blackmore's nieces Eva and Adalgisa would live with and care for him. The same year Lucy died he started Kit and Kitty: a Story of West Middlesex (1890) which would bear the mark of his grief. Mary Anerley (1880), Christowell (1882) and his Naval tale based on the Napoleonic wars, Springhaven (1887) followed.
Blackmore was a rather jolly looking fellow with a bald pate, sporting a great flowing white beard. It is said he was prone to moodiness though his friends and correspondents were many including Thomas Hardy and others in America. Richard Doddridge Blackmore died on 20 January 1900. He is buried in Teddington Cemetery alongside Lucy. From his Memorial tablet at Exeter Cathedral: "He added Christian courtesy, and the humility of all thoughtful minds, to a certain and grand glorious gift of radiating humanity."
1-800-235-4105
| R. D. Blackmore |
Although not the state capital, which is the largest city in Nebraska? | R.D. Blackmore biography
R.D. Blackmore (1825–1900), English novelist and fruit grower wrote Lorna Doone (1869)
Biography:
With his elder brother Henry (1824–1875), Blackmore spent much of his childhood in the lush and pastoral "Doone Country" of Exmoor, Devon, and along the Badgworthy Water (where there is now a memorial stone in Blackmore's honour) and among the future fictional Doone Valley's towering hills. The severe and remote rocky areas of Devon provided protection for many fugitives at the time where justice was swift and penalties harsh. Blackmore would hear of many tales of highway robbery and murder among illiterate half-wild men living on the edge of survival.
Richard Doddridge Blackmore was born 7 June 1825 at the vicarage in Longworth, Berkshire County, son of the Reverend John Blackmore (1794–1858). His mother, Anne Basset Knight (1794–1825) died of typhus when Richard was a mere three months old and so he was raised by his aunt Mary Francis Knight. They lived on the rugged and remote North Shore of the Bristol Channel near Glamorgan though young Richard travelled south often to visit his father and paternal grandfather in Devon. By 1832 he was living with his father again after he had married his second wife, Charlotte Ann Platt in 1831.
He started his education at Squire’s Grammar School in South Molton, Devon, then went on to the same school his father had attended, Blundell's School, during which he lived in the village for the week and would go home on Sundays. One of the boys he lodged with would later become archbishop of Canterbury. In the harsh and narrow circumstances he experienced the severe discipline and corporal punishment that some say later led to his epilepsy, though Blackmore does not make Blundell's out to be so monstrous in Lorna Doone. The grammar school gave him a solid background for his career as a man of letters and he won a scholarship for Exeter College, Oxford, earning a degree in the Classics in 1847. He became a Barrister of the Middle Temple in 1852 but never practiced due to his epilepsy.
Without his father's knowledge, R.D. Blackmore married Lucy Maguire (1822?–1888), daughter of a laundress and a Roman Catholic, on 8 November 1853 at Holy Trinity Church, London. Lucy would later become a member of the Church of England. They would not have their own children but did adopt Eva, a niece of Lucy's. The Classics Master taught Latin and Greek at Wellesley House grammar school for a time, before, owing to an inheritance left him by his uncle the Rev. H.H. Knight of Neath in 1860, he and Lucy moved to rural Teddington, built "Gomer House" named after his beloved dog and planted an orchard.
Never losing touch of his classicist education, he became an avid horticulturist and farmer of apples and pears while working on translations of Horace and Virgil. He wrote essays, articles and stories on the subject of fruit growing. One in particular, The farm and fruit of old: a translation in verse of the first and second georgics of Virgil, by a market gardener (1862) would prove to be a significant step in his becoming an author of fiction. From 1883 he was a member of the Royal Horticultural Society. Blackmore published many of his first works of verse under the pseudonym Melanter (Greek for ‘more black’) including Poems by Melanter (1853), Epullia (1855), and The Bugle of the Black Sea (1855), about the Crimean War. His first novel, with poetic imagery and autobiographical narrative was Clara Vaughan (1864), which was followed by Cradock Nowell (1866), first serialised in Macmillan's Magazine.
His fruit business never really a success, Blackmore finally earned some acclaim for his historical romance that blends fact and fiction, Lorna Doone. It is set in 17th century Exmoor during the reign of Britain's Charles II. Young farmer John Ridd vows revenge on the Doone clan, "the awe of all Devon and Somerset, outlaws, traitors, murderers", who killed his father when he was a child. The Doones are based on the real Doone family of Scotland who had been disinherited by the Stuarts for a time. The chivalrous Ridd unexpectedly falls in love with and sets out to rescue the tragically fated heroine Lorna from her terrorising family. Blackmore masters the dialect of his characters and masterfully paints an endearing and enduring depiction of his favourite county, Devon. It is a classic tale complete with love, murder, revenge, and a cliff-hanger ending. There were a number of movie and television versions produced.
In 1875, Henry John Turberville, Blackmore's brother died, apparently of cyanide poisoning. Blackmore published a number of books in the 1870s including The Maid of Sker (1872), Alice Lorraine (1875), Cripps the Carrier (1876), and Erema, set in California. Blackmore's novels resonate with historical relevance and sympathetic observation of Nature, surely inspired by nostalgia of his youthful days exposed to Her harsh extremes and his life as rural farmer. Plagued by ill health for many years, in January 1888 Lucy Blackmore died. Thereinafter Blackmore's nieces Eva and Adalgisa would live with and care for him. The same year Lucy died he started Kit and Kitty: a Story of West Middlesex (1890) which would bear the mark of his grief. Mary Anerley (1880), Christowell (1882) and his Naval tale based on the Napoleonic wars, Springhaven (1887) followed.
Blackmore was a rather jolly looking fellow with a bald pate, sporting a great flowing white beard. It is said he was prone to moodiness though his friends and correspondents were many including Thomas Hardy and others in America. Richard Doddridge Blackmore died on 20 January 1900. He is buried in Teddington Cemetery alongside Lucy. From his Memorial tablet at Exeter Cathedral: "He added Christian courtesy, and the humility of all thoughtful minds, to a certain and grand glorious gift of radiating humanity."
1-800-235-4105
| i don't know |
In which town is the University of Ulster based? | University of Ulster - Detailed information - Admission - Tuition
University of Ulster
• Association of Commonwealth Universities (ACU)
• Universities UK
University of Ulster (UU) - public higher education institution in United Kingdom.
University of Ulster - Description
Ulster University is a large, diverse and modern institution with over 25,000 students and 3,000 staff. The University has ambitious development plans, notably the expansion of the Belfast City campus to open in 2018, accommodating students and staff currently based in Belfast and Jordanstown in a stunning 21st century building. With four campuses across Northern Ireland, Ulster University is deeply embedded in every aspect of the region’s life and work.
Bachelor - University of Ulster
Ulster University is a large, diverse and modern institution with over 25,000 students and 3,000 staff. The University has ambitious development plans, notably the expansion of the Belfast City campus to open in 2018, accommodating students and staff currently based in Belfast and Jordanstown in a stunning 21st century building. With four campuses across Northern Ireland, Ulster University is deeply embedded in every aspect of the region’s life and work. At the Coleraine campus, course provision is broad – biomedical sciences, environmental science and geography, psychology, business, the humanities and languages, film and journalism, travel and tourism, teacher training and computing are among the campus strengths. The Belfast campus provision spans an increasing and exciting range of subjects including architecture, hospitality, Irish language, event management, photography and digital animation. Magee teaching strengths include business, computing, nursing, Irish language and literature, social sciences, law, psychology, peace and conflict studies and the performing arts - with plans to expand computing and engineering provision on this campus over the next few years. The Jordanstown campus has a strong profile in engineering, built environment, social sciences, business, law, communication and academic disciplines relating to the science and coaching of sport.
Location on map - University of Ulster
Universities related to University of Ulster
Universities in this city
Admission process in University of Ulster
We guide admission of applicants to this educational institution whilst managing the entire enrollment process.
Data Relevance. You can search and find lots of online information which is behind the times. This disorients applicants since outdated materials may result in failure to apply for international education. Enrollment failure may refer to such errors as wrongly completed application form, or a letter of reference. We are routinely involved in process of applicant enrollment at educational institutions all around the world and we hold the most recent information on all nuances of enrollment at particular universities.
Guaranteed Assignment. When applying to top-rated universities abroad, you compete with the most talented students from different countries. As per the statistical data, less than 10% applicants are selected which says on the extremely high challenges. In view of that, prior to arrange an interview with you, you have to show your relevance by submitting well prepared and completed package of application documents to submit to the Admission Board and the more accurate you adhere to instruction, the higher are chances for admission. We know how the winning package of documents looks like and with us you have all chances to succeed.
We Save Your Time that you can more effectively use to enhance your language skills or prepare to exams. As the official agent of most educational institutions abroad, we will help you avoid never ending retrieval of information and wrong unnecessary steps, employing tried and tested practices to search for academic programs and winning enrollment strategies.
We Save Your Money. We are able to offer the most qualified education even at the restrained budget. We will develop the enrollment and training strategy for you that helps to significantly save the total cost of education. Addressing to us, you have the highest chances to obtain additional funding sources.
Full mentoring service includes the services as follows:
Professional consultation regarding education abroad;
Selection of the university and the program abroad;
Preparation of the application documents;
Diploma and transcript translation;
| Coleraine |
Although not the state capital, which is the largest city in New Mexico? | Ulster University | Undergraduate | Top Universities
Ulster University
UNDERGRADUATE DOMESTIC FEES
8,000 USD - 10,000 USD
Ulster University is a large, diverse and modern institution with over 25,000 students and 3,000 staff. The University has ambitious development plans, notably the expansion of the Belfast City campus to open in 2018, accommodating students and staff currently based in Belfast and Jordanstown in a stunning 21st century building. With four campuses across Northern Ireland, Ulster University is deeply embedded in every aspect of the region’s life and work. At the Coleraine campus, course provision is broad – biomedical sciences, environmental science and geography, psychology, business, the humanities and languages, film and journalism, travel and tourism, teacher training and computing are among the campus strengths. The Belfast campus provision spans an increasing and exciting range of subjects including architecture, hospitality, Irish language, event management, photography and digital animation. Magee teaching strengths include business, computing, nursing, Irish language and literature, social sciences, law, psychology, peace and conflict studies and the performing arts - with plans to expand computing and engineering provision on this campus over the next few years. The Jordanstown campus has a strong profile in engineering, built environment, social sciences, business, law, communication and academic disciplines relating to the science and coaching of sport.
Rankings, stats & media
| i don't know |
In which town is the University of Surrey based? | University of Surrey World University Rankings | THE
Working here
Wonderful things happen here
The University of Surrey is one of the UK’s top professional, scientific and technological universities. Named as The Times and Sunday Times University of the Year 2016, Surrey has a world-class profile and a leading reputation in teaching and research.
Since 2000, our estate has been transformed through a £400 million building development and improvement programme – including £130 million on student accommodation , £36 million on Surrey Sports Park , £16 million on the new Library and Learning Centre and £4.5 million on the Ivy Arts Centre.
The University of Surrey is a research-led institution pursuing learning, scholarship and research, and advancing and disseminating knowledge.
The University is committed to working closely with its students, business, government and civil society to transition knowledge to the benefit of humanity.
Campus and location
The University of Surrey’s beautiful campus offers students the best of both worlds. Our safe, self-contained student community is just ten minutes’ walk from Guildford town centre, named the eighth best place to live in the UK in the Halifax Quality of Life Survey 2015.
It takes just 34 minutes to reach London from Guildford station. Whether heading up for a show, a sightseeing tour, a night on the town or a spur-of-the-moment day trip, Guildford is an ideal base for exploring the city.
See what our students think of our campus and take a look around .
Rankings
In recent years, Surrey has established itself as a top-ten university in major national university league table rankings .
Employability
We’re proud of our excellent track record for graduate employability . Our Careers Service is available to all Surrey students. Our experts can advise on graduate jobs, further study, graduate schemes and internships.
Global Opportunities
Internationalisation permeates all that we do at Surrey, contributing significantly to our mission to solve global challenges, lead research and innovation, and fuel generations of students with a spirit of curiosity and a desire to improve the world we live in.
We encourage students to take advantage of our international connections and explore the world
International Support
With students from over 120 different countries, we’re proud to be one of the most culturally-diverse universities in the UK. Specialist staff in our International Office are here to help your throughout the application process – from advising on choosing the right course to applying for a visa and preparing for your first few weeks at Surrey.
Research
University of Surrey research is addressing this century’s most pressing challenges, fuelling students with a spirit of curiosity and drive to improve the world. In the 2014 Research Exercise Framework (REF), 98 per cent of our research outputs were rated to be world-leading, internationally excellent or internationally recognised in terms of originality, significance and rigour.
Facilities
Surrey won the award for Best University Facilities at the WhatUni Student Choice Awards 2015. We have invested heavily into our facilities including £36 million into our Sports Park and £16 million into the new Library and Learning Centre.
Surrey Sports Park is one of Europe’s leading sports venues and the home of Team Surrey. Whether you’re a complete beginner or an established player, you’ll be welcomed into our friendly sporting community.
| Guildford |
At the 2008 Beijing Olympics, in which athletics events were the men's gold medal won by the Kenyan Wilfred Bungei and the women's gold medal won by the Kenyan Pamela Jelimo? | Study your two or three year LLB in the UK at the University of Surrey | University of Surrey - Guildford
Guildford
Watch our film
Study your two or three year LLB in the UK at the University of Surrey
At the University of Surrey Canadian applicants can choose from our two-year accelerated LLB Law (JD Pathway) if you have a degree already, or a three-year LLB – no LSAT or LNAT is required for either degree.
Based in historic Guildford, England, on the doorstep of London, the University of Surrey offers you an international study experience that will be challenging, enriching and provide a pathway to your legal career.
Read our Canadian ambassador and LLB JD Pathway student Sophie’s blog to find out what life at Surrey is really like.
Upcoming events in Canada
Montreal: Saturday 28 January, 1-3pm, Hall (H) Building, room H 429, Concordia University, 1455 de Maisonneuve West., Montreal, Québec
Toronto: Study and Go Abroad Fair, Sunday 5 March, 1-5pm, Metro Convention Centre, North Building, 255 Front Street West, Toronto
We offer two options: a two-year LLB Law (JD Pathway), or a three-year LLB.
LLB Law (JD Pathway) (two years)
Specifically designed for Canadian students, our two-year accelerated JD Pathway Programme is available to those who already have an undergraduate degree (in any subject).
This programme also includes an optional module that introduces fundamental notions and issues of Canadian Constitutional law. The lectures and tutorials present the historical context of the Canadian Constitution and its development, the sources of constitutional law, the amending procedure, judicial review, Canadian Federalism, the Charter of Rights and Freedoms and its application, and Rights of Aboriginal Peoples.
If you have any questions about the JD Pathway programme or studying Law at Surrey please feel free to get in touch with our Programme Director, Dr Sabrina Germain who will be happy to help.
LLB (three years)
Our three-year LLB is designed for students who do not already have an undergraduate degree. It covers all the required courses for a law qualifying degree, plus optional modules.
More information on our three-year LLB can be found via the LLB program page .
Download brochure
Scholarships and Funding
We will offer up to four £3,000 Canadian LLB Scholarships, applicable for September 2017 entry. The award is for each year of the programme providing you progress normally on your programme (if periods of the programme need to be repeated this will not be eligible for the scholarship).
To qualify for the scholarship students must:
Be international fee paying students
Meet the minimum entry criteria for the two-year or three-year LLB and include any transcripts
Have applied for a place on an LLB program with the University of Surrey by January 6th 2017 (18:00 GMT)
Complete and submit the Canadian LLB Scholarship application form by January 6th 2017 (18:00 GMT)
Download our scholarship application form:
Scholarships_T&Cs_2017.pdf
Professional Training placements
Surrey is one of the only law schools in the UK to offer a Professional Training placement program . This involves spending a year – usually your third – working in industry, thereby extending your program by a year.
The University works with over 2,300 partner organisations in the UK and abroad. In recent years, students have worked in destinations like Brussels and Paris , and in organisations ranging from solicitors’ offices and local authority legal departments to nongovernmental organisations and corporations.
Recent Law students at Surrey have enjoyed placements in organisations such as:
• National Centre for Domestic Violence
• Slater and Gordon
Find out more about our professional training year options.
Entry requirements
Entry for the two-year LLB requires you to have an undergraduate degree. Bachelors or Bachelors with Honours degree where pass mark is 50%: grades of 70%, B- or 3 out of 4 GPA required, if the pass mark is 60%: grades of 75%, B- or 3 out of 4 GPA required.
Entry requirements for the three year LLB vary by province but we typically require 75% in 5-6 grade 12 courses:
Alberta, Manitoba, New Brunswick, Newfoundland, North West Territories, Nova Scotia, Prince Edward Island, Saskatchewan – 75 per cent in five Grade 12 subjects
British Columbia, Yukon - 75 per cent in five Grade 12 subjects
Ontario – 75 per cent in six Grade 12 subjects
Québec - Diplôme d'études collégiales (DEC) pass
A pass in Grade 11 Secondary School Diploma Maths and English can be considered GCSE equivalent across all provinces.
No LSAT or LNAT is required.
Term dates
The academic year in the UK is slightly different to Canada:
• Autumn term: October to mid-December
• Winter term: Mid-January to the end of March
• Spring term: May and June (review and final exams)
Studying at the School of Law
The School of Law at the University of Surrey provides a stimulating and supportive environment for your study.
Members of our academic staff have international reputations and are experienced legal practitioners, providing consultancy to law firms, governments, non-governmental organisations and businesses around the world.
The School of Law has an outstanding reputation for events and extracurricular activities, and has recently welcomed Lord Neuberger, President of the UK Supreme Court who delivered a guest lecture. From the academic activities like mooting competitions, to the pro bono dinner, the law ball and the student-run Law Society, life at the School stretches far beyond your program.
Teaching
Teaching is delivered as a blend of lectures and tutorials. Lectures are usually presented in larger lecture theatres, with students then required to prepare a series of questions for a one hour tutorial in that subject.
Interactive tutorials are delivered every week, which is twice as often as most other law schools in the UK. Combine this with our small teaching groups of around eight students and you know you’ll be getting personal attention for your education.
Our Canadian connections
The School of Law has strong connections with Canada, including a Canadian alumni chapter and academic staff from the country. We have a range of activities planned for Canadian alumni, which will be of a real benefit for our new graduates in terms of networking.
There’s even a local hockey team – the Guildford Flames:
The Guildford Flames
Although ice hockey may seem more synonymous with countries like Canada and the United States, the sport has been played and enjoyed in the United Kingdom since the beginning of the twentieth century. The Great Britain men’s national ice hockey team achieved worldwide success when they won Gold at the 1936 Winter Olympics, and the passion that exists for ice hockey in the UK has been undeniable ever since.
Here at the University of Surrey we are lucky to share our home town of Guildford with ice hockey team the Guildford Flames. The Flames, since joining the English Premier League, have won four league championships, four Premier Cups and a playoff title, making them a force to reckon with in the world of British ice hockey.
The Flames were founded in 1992, and their inaugural season began in October of that same year. With the Guildford Spectrum not yet completed, the team trained at Slough and played their home games at Alexandra Palace until their new home ice was ready.
The Flames played on the Spectrum’s Olympic sized ice rink for the first time on 23 January 1993. That first game at their new home resulted in a blaze of glory fitting to a team with such a fiery name. They won that first match on their home ice and Andy Sparks scored the first goal at the Spectrum. Following their win, the team leapt to top of the Conference – a position they held onto for the entirety of the season.
The Guildford Flames also have a strong connection with the Canadian National Hockey League and several world-class Canadian players have worn the Guildford Flames Jersey. During the 04/05 Canadian NHL lockout, Canadian ice hockey stars David Oliver and Jamie McLennan transferred to Guildford and took the team from strength to strength.
Currently, the Guildford Flames regularly compete on a national level, under the mentoring of Head Coach Paul Dixon and Team Captain David Longstaff.
Students wanting to experience the Guildford Flames in action, and all the excitement of an ice hockey match, can buy tickets to watch them play at Guildford Spectrum , a short ten minute drive from Stag Hill campus.
Life at Surrey
Based on a beautiful lakeside campus and blessed with fantastic facilities, the University of Surrey is a vibrant, safe environment in which to live and learn. Discover more about our campus , take a virtual tour , or explore the £36 million Surrey Sports Park .
Guildford
The University of Surrey sits in bustling Guildford , in the heart of South East England.
Offering a vibrant blend of entertainment, culture and history, Guildford was named as one of 2014’s Best Places to Live in Britain by The Sunday Times. Just ten minutes’ stroll from campus, the town is an attractive, affluent and appealing location in which to live and work.
Culturally, Guildford offers plenty to enjoy – from the £26 million G Live entertainment venue to a range of festivals throughout the year. As well as offering over 100 places to eat, drink and be merry, the town is home to a range of cinemas, theatres, galleries, parks, sports facilities and even its own hockey team, the Guildford Flames.
Beyond Guildford
What’s more, the historic, diverse, vibrant delights of London are easily accessible – just 34 minutes’ train journey from Guildford station. And the UK’s two largest international airports – Heathrow and Gatwick – are both less than 35 minutes’ drive away.
Your return to Canada
After attaining your LLB you will need to apply to the National Accreditation Committee (NCA) for accreditation to practice law in Canada, which will include sitting a number of exams.
Please note that the information provided here is a guideline only and subject to the NCA’s review of each individual’s file.
In detail:
For your UK LLB to be accredited in Canada the NCA advises that you will need to graduate with at least a 50% overall average grade (a 2:2 in the UK) with no modules under 45%.
For students who complete the two-year LLB Law (JD Pathway), you are likely to be required to complete a minimum of 7 NCA exams upon your return.
For students who complete the three-year LLB, with less than two years university education before law school you are likely to be required to complete at least 7 NCA exams during your assessment.
For students who complete the three-year LLB but have at least two years university education before law school you are likely to be required to complete a minimum of 5 exams upon your return to Canada.
The 5 minimum NCA exams are:
Foundations of Canadian Law
Sophie Luesby.jpg
Sophie Luesby
“In 2018 I will be heading back home and taking an accreditation course. After that I am hoping to work for the Ministry of Health, Health Canada, Environment Canada or some other branch of the Canadian government.”
Read more .
Shawn Ashley
"Surrey’s high-calibre lecturers from across Europe and state-of-the-art facilities have made for an extremely rewarding time. The pragmatic approach to teaching gives you the opportunity to get your hands dirty while minimizing the gap between academia and real-world execution. Located just outside London, it’s the perfect mix of exposure to the big city as well as rural English living, sights, and culture."
Kelsy Hejjas
"I was drawn to the University of Surrey because of its outstanding international reputation, excellent ranking in the league tables and vibrant international student population. The University provides a truly international education; at Surrey you will have the opportunity to work with students and teachers from around the world. With emphasis on the practical application of learning and lectures from industry professionals, I felt both prepared and excited to start working after graduation."
Zuzana Palovic
"The University of Surrey offers wonderful opportunities for Canadian students, not only to study abroad, but to thrive in an international academic environment. The University will exceed your academic and lifestyle expectations, with your rigorous coursework being balanced by a supportive staff and serene campus landscape. Set amongst the Surrey Hills, the location provides ample room for reflection and rejuvenation between your classes and deadlines. Surrey is a student-focused, modern, vision-orientated University that is going places.I am so happy to be part of the ride."
Alex Morton
"I am from a small town called Cannington in Ontario, Canada, and I am currently studying my MBA here at the University of Surrey. I have been a Professional Ice hockey player for the past six years and the reason I chose to come to Surrey was because of everything I read about online and studying in the UK has always been something I wanted to do. The sports park was also a big plus. Training and being able just to go shoot a ball around has kept me sane during each semester and kept me active. I have even helped out Surrey’s local team, the Guildford Flames, in their training, but have retired from ice hockey early in order to focus on my studies."
| i don't know |
Which 18th century clergyman is considered the founder of Methodism? | Methodism | religion | Britannica.com
Methodism
Twenty-five Articles of Religion
Methodism, 18th-century movement founded by John Wesley that sought to reform the Church of England from within. The movement, however, became separate from its parent body and developed into an autonomous church . There were roughly 15 million Methodists worldwide at the turn of the 21st century.
John Wesley, statue at Wesley Church, Melbourne.
Adam Carr
History
Origins
John Wesley was born in 1703, educated in London and Oxford, and ordained a deacon in the Church of England in 1725. In 1726 he was elected a fellow of Lincoln College at Oxford, and in the following year he left Oxford temporarily to act as curate to his father, the rector of Epworth. Wesley was ordained a priest in the Church of England in 1728 and returned to Oxford in 1729. Back in Oxford, he joined his brother Charles and a group of earnest students who were dedicated to frequent attendance at Holy Communion , serious study of the Bible , and regular visitations to the filthy Oxford prisons. The members of this group, which Wesley came to lead, were known as Methodists because of their “methodical” devotion and study.
In 1735, at the invitation of the founder of the colony of Georgia, James Edward Oglethorpe , both John and Charles Wesley set out for the colony to be pastors to the colonists and missionaries (it was hoped) to the Native Americans. Unsuccessful in their pastoral work and having done no missionary work, the brothers returned to England conscious of their lack of genuine Christian faith. They looked for help to Peter Böhler and other members of the Church of the Brethren, who were staying in England before joining Moravian settlements in the American colonies. John Wesley noted in his Journal that at a Moravian service on May 24, 1738, he “felt” his “heart strangely warmed”; he continued, “I felt I did trust in Christ , Christ alone, for salvation; and an assurance was given me that He had taken away my sins, even mine, and saved me from the law of sin and death.” Charles Wesley had reported a similar experience a few days previously.
Similar Topics
West Bank
The originally German-speaking Evangelical United Brethren Church , itself a union of the Church of the United Brethren in Christ and the Evangelical Church , was united with The Methodist Church in 1968 to form the United Methodist Church . Women were given limited clergy rights in 1924 and were accepted for full ordination in 1956. In 1980 the United Methodist Church elected its first woman bishop, and it has elected more since.
Canada
Methodism was introduced into Canada by preachers from the United States and later reinforced by British Methodists. In 1874 The Methodist Church of Canada became autonomous; it went on to negotiate a union with other Canadian nonepiscopal churches to form the United Church of Canada in 1925. An independent Methodist presence in Canada essentially ended with ratification of the union; Canadian Methodists joined the new church , which drew from the traditions of its constituent members to establish the basic beliefs and practices of the new church.
Teachings
Methodism is marked by an acceptance of the doctrines of historical Christianity; by an emphasis on doctrines that indicate the power of the Holy Spirit to confirm the faith of believers and to transform their personal lives; by an insistence that the heart of religion lies in a personal relationship with God; by simplicity of worship; by the partnership of ordained ministers and laity in the worship and administration of the church; by a concern for the underprivileged and the improvement of social conditions; and (at least in its British form) by the formation of small groups for mutual encouragement and edification.
All Methodist churches accept the Scriptures as the supreme guide to faith and practice. Most welcome the findings of modern biblical scholarship, though the fundamentalist groups among them do not. The churches follow the historical creeds and believe that they are part of the tradition of the Protestant Reformation . They emphasize the teaching of Christian perfection, interpreted as “perfect love,” which is associated with John Wesley , who held that every Christian should aspire to such perfection with the help of the Holy Spirit.
Methodist churches affirm infant baptism . They also regularly receive the sacrament of the Lord’s Supper, in which they believe Christ to be truly present, though they have no precise definition of the manner of his presence. They believe that they are integral parts of the one, holy, catholic, and apostolic church and that their ministers are true ministers of Word and sacrament in the church of God .
Worship and organization
Patterns of service
Methodist worship everywhere is partly liturgical and partly spontaneous. The general pattern was established by John Wesley, who regularly used the Anglican Book of Common Prayer (which he adapted for use in the United States) and conducted services that included extemporaneous prayer. This tradition continued in British Methodism into the 20th century, when it underwent change. The practice of Anglican morning prayer was eliminated first, and during the Liturgical Movement , when Roman Catholic and Protestant churches revised their liturgies, Anglican Holy Communion was dropped. The Liturgical Movement also influenced the Methodist Service Book (1975) and The Methodist Worship Book (1999) in Britain and, in the United States, the Book of Worship (1965), the Ordinal (1980), and the United Methodist Hymnal, subtitled The Book of United Methodist Worship (1988). The reforms provided new opportunity for congregational participation. The Sunday service, or Holy Communion, restores the traditional fourfold pattern—the offering of bread and wine, the thanksgiving, the breaking of the bread, and the sharing of the elements. Nonliturgical services, which constitute the majority, claim to be spontaneous but are not. In British but not in American Methodism, many services are conducted by lay preachers.
Hymns are important in all branches of Methodism. The most important hymns of British Methodism are those of Charles Wesley , which are mingled with many contemporary hymns as well as those from other traditions. In Hymns and Psalms (1983), certain changes were made to eliminate overtones that Methodists considered sexist. American books contain fewer hymns by Wesley.
Polity
In the churches of the British tradition, the annual Conference is the supreme authority for doctrine, order, and practice. All ministers have equal status, but the president and secretary of the Conference, the chairmen of districts, the secretaries of divisions, and superintendents exercise special duties. District affairs are regulated by Synods, circuits by Circuit Meetings, local societies by Church Councils.
The American tradition is episcopal; the bishops are elected by the Jurisdictional Conferences, which, like the General Conference, meet every four years. Each diocese has an annual Conference and District Conferences, each with its superintendent. The dioceses are combined into five jurisdictions that cover the country. A minister is ordained first a deacon, then an elder.
There are Methodist churches in most European countries. Those in Italy and Portugal are of English origin, those in Germany of mixed English and American origin. Methodist churches in the rest of Europe are derived from American Methodism, though they exhibit many similarities in spirituality to the English type.
Missions
The ceaseless travels of Thomas Coke were the beginning of the British Methodist missionary tradition. The first area where missions took root was the West Indies; then came Sierra Leone and southern Africa . The Gold Coast , French West Africa , and Nigeria received missionaries not much later, though the climate in many parts of Africa took a toll on missionary lives.
In India there were very few converts until about 1880, when many thousand low-caste Indians in the south joined the Methodist and other churches. In China , missionary work had a checkered career. Although there were mass movements there, the last missionary left China in 1949, when the communists came to power on the mainland. In Australia the Methodist Church began in 1815 and, like the Methodist Church in South Africa , became independent before the end of the 19th century. After World War II the missionary churches became autonomous; only a few small churches remain under the control of the Overseas Division of the British church. Most of the autonomous churches combined with other churches in their countries; for example, the Church of South India , which has been in existence since 1947, includes Anglicans, Methodists, Congregationalists, and Presbyterians.
American Methodists have been equally enthusiastic missionaries, and their greater resources have carried them over still larger areas of the globe. North India, Mexico, most of Latin America , Cuba, Korea, Japan, Taiwan, and many parts of Africa possess Methodist churches of the American tradition. The movement toward autonomy took place more slowly in these areas than in the British sphere of influence. The General Conference of the United Methodist Church makes plans for fraternal relations among the newly independent churches.
Methodism - Student Encyclopedia (Ages 11 and up)
The brothers John and Charles Wesley were sons of an Anglican clergyman (see Wesley). In 1728 John became a priest, and the following year he and Charles were both at Oxford University. They became members of a club of devout students who pledged themselves to regular Bible reading, attendance at Holy Communion, and visitation of prisoners in the local jails. Their carefully ordered pattern of life earned them the derisive name of Methodists from their fellow students. Their group was also humorously called the Holy Club, the Bible Bigots, and other uncomplimentary names.
Article Contributors
| John Wesley |
Which Robert Zemeckis film was the highest-grossing film worldwide of 1985? | Historical Introduction to Methodism in the Isle of Man
Story of Primitive Methodism
" of 1904/5.
Originally a Methodist was a member of a religious society, founded in Oxford in 1729 by the brothers John and Charles Wesley (1703-91 and 1707-1788). This society had the object of promoting piety and morality within the Anglican church. However the Enthusiasm (i.e. fanactism or religious hysteria) of these members, and especially the Calvinism of the followers of George Whitfield (1714-1770) did not fit well with the more rational and decorous Georgian Churchmen. After much debate, and disagreement with the Established Church the Methodists became a independent sect from 1836.
This is not the place, nor am I qualified, to consider the theological arguments behind Methodism - see the readable discussion in Davies which being published by the Epworth press may be considered as possessing the Methodist Imprimatur. John Wesley has been the subject of virtually countless biographies and studies. A recently published review of Methodist Theology by Thomas Langford provides a readable and succinct modern view of his theology - Wesley was not a deep theoretical theologian and it was often left to others to rescue him from some inconsistencies. He was however a great practical theologian. Wesley was very much of his time, interested in many things, including medicine, being shaped both by, and by his opposition of, the eighteenth century enlightenment view of the perfectibility of Man. "Wesley forthrightly emphasised original sin and the destitute character of human life" - he fought against a world increasingly questioning of authority, especially that claiming to be supernatural, and also one which was starting to see tremendous social upheavals. The original rules of Wesley's bands are included in Grindrod's Compendium of 1842.
Manx History
The first Methodist preacher arrived in 1758 but decided there was little probability of doing any considerable good while the whole island was a nest of smugglers. It was left to John Crook, sent by Liverpool Methodists in 1775, to have any real effect. His second visit in 1776 provoked some decided opposition, especially from Bishop Richmond who issued, in Moore's words an intolerant and violent pastoral letter to the clergy demanding that they expel any Methodists from their parish. However several of the clergy, and the Governor were more friendly towards him. In 1778 the Island was entered as a separate circuit with John Crook and Robert Dall appointed as preachers for a three year period. Wesley himself visited in 1777 and again in 1781 by which time there were some 1600 members on the Island. It was Wesley, who thanks to his support of the English position in the American war of Independence was in good political standing, managed to defuse some of the persecution of Crook.
Primitive Methodism arrived on the Island in 1822 and quickly established many meeting places and chapels. A brief history of the early days is given by Petty in 1859 and a fuller history by Curry in 1906/7. By the time of the census the Wesleyans appealed more towards the better-off working and lower middle class whilst the 'Prims' tended to be a working class, and in Man stronger in the south than the north of the Island, though for both Douglas was numerically their main strength (e.g. the Prims drew 30% of their total congregations in Douglas whereas this was only 18% of the Wesleyan) .
The Manx New Connection arrived late on the Island and played virtually no part. See report in MMHSoc No17 .
Although there were at least two earlier false starts, the start of Methodism on the Island dates from c.1775 - almost a generation later than in most other parts of the British Isles.
The 225 years of Manx Methodism falls neatly, though somewhat simplistically, into three periods
(a) early growth: 1775-1850 -covering the rise of both Wesleyan, from 1775, and Primitive Methodism from 1825. This period also spans the years of tension and conflict within Wesleyan Methodism following the death of John Wesley and the 'papacy' of Jabez Bunting. 1851 is a convenient termination date for the period, the never repeated Religious Census of that year provides a snapshot of chapel attendance and a comparison with other denominations.
(b) mature period: 1850-1925, in which Methodists had significant impact on both Island politics and culture.
(c) decline: 1925-date, the effect of WW1 in reducing both numbers (especially male Sunday School teachers) and religious conviction, the union of Wesleyan and Primitive connexions in 1932 after which the smaller chapels started to be closed; and the post WW2 situation in which membership declined, especially from the mid 60s after which membership plummeted. Union with Anglicanism, agreed to by the Methodist Conference, failed to gain sufficient votes in Convocation in 1972 and left both parties somewhat confused as to future directions.
Early Days
The Rev John Meriton, 1672-1753, who, it is conjectured, was invited to Douglas by Rev Philip Moore in 1740 is generally counted as the first connection of the Island with Methodism - referred to by John Wesley as 'from the Isle of Man' and a friend of Charles Wesley, he played some role in the early days at the London Foundry. Kissack could find no obvious reason why he came to the Island or that he had any influence here. After what was possibly some scandal over finances he disappears from Wesley's attention though Charles Wesley composed a funeral hymn on his death.
The next known connection is the accidental landing during a voyage from Whitehaven to Liverpool, in 1758, of John Murlin, known as the Weeping Prophet from his style of preaching. From his journal we learn "We were carried to the Isle of Man where we stayed for a week. The second evening I preached in a large barn but on Sunday it could not contain all the people who would hear, and I was obliged to preach abroad.... the people behaved well...." However he must have made little lasting effect, excusing any further attempt as wasted effort whilst the Island was a nest of smugglers, and it is nearly 20 years later that we learn of the next, and ultimately successful, attempt to preach Methodism in the Island.
In 1775 the Liverpool District found enough resources to support one of their members, John Crook then 33 years old, to mission the Island for a six-month period. Crook left a diary of his time here from March 1775 - the usual mixture of elation and despair found in most missionary journals e.g. in Douglas "I preached an hour and a half, but the people were scarcely satisfied : they still wanted to hear more..." but he was obviously troubled by hecklers, especially a Presbyterian coppersmith whose "word doth act as a canker" and elsewhere "I find the work is abundantly more arduous than I at first conceived ; otherwise, I fancy I should not have taken it in hand; but the Almighty withheld the sight of its difficulty from me".
The political situation in the Island had changed enormously between 1758 and 1775 - in 1765 the British Government, in a relatively successful attempt to stop the 'running trade', had forced the sale of the Regalities from the Athol Lords to the Crown. The economic effect of this on the Island is still a matter of debate - certainly several of the non-Manx traders panicked and pulled out of he Island after selling up cheaply. Woods writing in 1808 writes "Many persons being by its failure thrown out of employment, emigrated to America; some went to sea; some engaged themselves in the fisheries; and others turned attention to the cultivation of the ground. To exchange an irregular and idle life for one of constant activity- and industry is no easy achievement: the waste lands and short crops evince how much remains to be done"
Crook, often styled 'Apostle of the Manx' by later Methodists, concentrated on Castletown but raised a class in Peel and another in Douglas - Ramsey appeared somewhat hostile towards him. He was obviously extremely popular as when, in August 1775, he was accepted by Conference as a full Travelling Preacher and stationed off the Island, letters were written to John Wesley asking that he be moved to Whitehaven from which he could again visit the Island. Meanwhile the Island societies had been placed under Whitehaven from where the Travelling Preachers took it in turn to spend one month in turn on the Island. Crook returned in the May of 1776 to find that Castletown and Douglas had prospered but that encouragement was needed at Peel - in the June we read of him staying there and sending deputies to Castletown and Douglas "to help the weaker brethren by prayer and exhortation" of these deputies he writes " After some time, others arose, who have all been also useful, especially by speaking in Manks."
This last quote brings up two related topics - the role of Local Preachers (these early helpers were better described as exhorters) and that of the Manx language. Although a Manx translation of Mathew's Gospel had been printed in a limited edition in 1748, the first edition of the New Testament in Manx appeared in 1763 , the Old Testament some 9 years later and the complete Bible in 1775. However even by 1807 the Rev T. Stephen stated that the number of extant Bibles and New Testaments were less than 800 of each. Rev Hugh Stowell writing in 1809, in support of a proposed SPCK reprint said that two thirds of the population read, speak and understand Manx much better than English and that third of the population spoke only Manx. The relative paucity of these Manx translations would indicate that they may have had less effect than W.T.Radcliffe and R. Kissack thought - nowhere in his journal does Crook refer to the availability of these Manx Scriptures Although Castletown and Douglas would be expected to have relatively large English speaking populations Peel was always considered the most Manx of the towns so it is a little surprising that the English speaking Crook enjoyed so much success there. Only a few years later in the minutes for Jan 1781 we read (in the Q & A format adopted from the English Conference)
Q: As it is very observable that the public are in general, getting better acquainted with the nature of Doctrines than formerly, what method would be best to assist our Manx Brethren in this respect
A: Might it not be requisite our brethren should acquaint their brethren, if English Preachers, what text they wish to have explained or to have their sentiments, manner or methods so explained or corrected as may make them appear to better advantage and make them more unexceptionally useful in public. This if duly attended to may be productive of very salutary effects both to the preachers and to the public.
Thus it would appear that one key role of these early LPs was to accompany the Travelling, or as usually termed, English Preachers.
Crook would appear to have devoted most of his exertions towards the poor for at several points in his journal we read similar comments such as this "I am by no means fond of having either clergymen, or gentlemen about me, since I know right well, if we endeavour to please them, the poor will have little benefit, and if we pay no regard to them, they will be offended. But I think it the best way to be on the safe side, that is, to preach in such a manner as, if possible, to benefit the poor ; for it is to these that the gospel is preached with most success." It would appear that these poor were not unchurched for when Crook worried that he was thought of going beyond conventional doctrine "in order to shew the people that I did not, in these things, go beyond the bounds of the church, I read to them, this evening, the homily on salvation and all seemed to give great attention"
However by this time Crook was attracting large congregations and enthusiasm was beginning to appear "I preached in a field near Mr. C.'s and we had a precious season. One person was so struck under the word, that he fell down as if he had been shot, and many more were much affected. We then set off for Peel, where I found the town, all in an uproar about the extraordinary emotions on the people's minds..." It was now that organised opposition began to appear - especially in Douglas where it was instigated by the Rev Philip Moore, Master of Douglas Grammar School and curate of St Mathew's. Philip Moore, a young prodigy of Bishop Wilson who had played a leading role in the translation of the Manx Scriptures, had been led to believe that Crook was preaching Calvinist doctrines. Here Moore may have been misled by reports from England for although Wesley had strongly disagreed with Whitefield on these grounds, they had managed after an initial break to keep friendly personal relations and indeed, at Whitefield's dying wish Wesley had preached his funeral oration in 1770. However Calvinist doctrines were difficult to extirpate, especially amongst new converts, Wesley noted that "the doctrines of Justification and Salvation by Faith are grievously abused by many Methodists".
Crook writes of being subject to all sorts of aggression "A great outcry was raised against the swaddlers, as the preachers were then designated, and they were often dangerously entreated, and almost every where met with the most scurrilous abuse. Mud, rotten eggs, stones, &c., were thrown at them without the least mercy or regard, and these devoted servants of the Lord Jesus and of mankind, 'of whom the world was not worthy,' were often covered with dirt and filth. Many who heard them seemed almost torn with rage and would interrupt them with all sorts of questions and observations, several of them frequently exclaiming, 'Ta breg ayns dty veeal'-It's a lie in thy mouth-allowed to be one of the most insulting and offensive sayings in the language." These disturbances seemed centred on Douglas " more so than in all other parts of the island put together" - Kissack suggests that a root cause was the identification of Crook with the new English administration - the Act of Revestment (or in Manx 'Yn Chialg Vooar' - the great cheat) was not popular with most Manx.
Bishop Hildesley had died in 1772 and was replaced by the first of a long sequence of poor and ineffective Bishops. The first of these Bishop Richmond issued his notorious anti-Methodist directive to the Clergy in July 1776 in which "unordained, unauthorised and unqualified persons from other countries" who had been "preaching, teaching publickly and maintaining Conventicles" with their "crude, pragmatic and inconsistent, if not blasphemous extemporary effusions of these pretenders to the true religion". Such persons were to be excluded from the church. Richmond appears to ignore the differences between Manx and English laws - the English act strongly regulating preaching did not apply to the Island though Island laws did require parochial schoolmasters (of whom several later became Methodist) to be licenced by the Bishop. Crook wrote to Wesley informing him of these attacks, Wesley, the well connected politician, advised him to stay on the Island but not to provoke his opponents. However in his reply, which was obviously intended to be 'leaked' to the civil powers, he writes " Violent methods of redress are not to be used, till all other methods fail. I know pretty well the mind of Lord Mansfield, and of one that is greater than he. But if I appealed to them, it would bring much expense and inconvenience on Dr. M-- and others. I would not willingly do this" a lightly veiled threat of intervention from London. This obviously had the desired effect as Crook recounts (presumably at second hand via the Governor's wife who was a Methodist supporter) that the Governor indicated to Dr Moore that "he would suffer no one to be persecuted for his religion, adding, I Sir, I bear the sword here.'"
That violent methods of 'self defence' had been resorted to is obvious from Crook's comments "Some of our young friends, who had more zeal than knowledge, could hardly be restrained from giving the adversaries advantage against the good cause in which we were engaged by their imprudent conduct" - also "In Baldwin, a poor idiot armed not with a common stick, but with a weapon more resembling a hedge-stake, was in the habit of placing himself near the preacher, and it was at the peril of anyone venturing to molest him"
However the physical attacks seemed to have died down within a few months; there is no mention of them in the Circuit Minute Book (from 1778) and by 1781 we learn of the wider dissemination of Methodist teaching (previous quote).
In 1788 George Holder was appointed to the Island as his first appointment and the first of three such appointments - his wife has left a diary in which we read:
" We soon had many friends to welcome us. But everything was new and strange to me. The people,-their manners,-language; I neither knew yes nor no in their tongue. In the evening we went to hear a Manx preacher, and I was struck with surprise at seeing the people flock to chapel."
Methodist Organisation
At this point it is probably best to review the organisational structure of the Methodists as they had developed by about the time of Wesley's death.
Travelling Preachers, Circuits and Districts.
Travelling Preachers (TP), initially termed assistants (to John Wesley) and later Ministers, were appointed to a locality in which a number of Societies were established. Initially the Travelling Preacher would visit each society in turn - hence the term 'Circuit' for the appointment. Preachers stayed in a given circuit for two years (later extended to three) though newly entered Preachers may only stay for one year before finding a better appointment.
This gives one of the major structural differences between the Established Church (and its parent the Roman Catholic Church) with its beneficed vicars attached for an indefinite period to their parish church and responsible for conducting all services there, and the Chapel arrangement in which chapels are grouped into circuits, provide a nucleus of Local Preachers nearly all of whom would be in full-time employment, supplemented by a few Travelling Preachers.
The choice of Preacher for the circuit was the job of Conference (an annual gathering of delegated Travelling Preachers) though the details would be delegated to a Stationing Committee. Circuits could put in a request for certain Preachers or object to others but the authority lay with Conference (more on this later). One Preacher in each circuit would be appointed Superintendent. Circuits would also be grouped into Districts with each District controlled by a Chairman - these District meetings would provide judicial control between Conferences.
The Island became a circuit in 1778 (part of Liverpool District), in 1798 split into two Circuits - Douglas with Castletown and Ramsey with Peel. Judging from minutes of the 'Manx Conference' this North/South split appears to have been undertaken on an experimental basis in the flush of an apparent high growth rate of members. Resources were split equally between the two circuits though Northside was intrinsically poorer. Within a year or two as numbers plummeted back to what appears to be their norm, several expressed disquiet and blamed the fall in numbers on the spilt but the two circuits remained (as in so much of Manx life the North-South division is an accepted norm)
In 1805 the Island Circuits were separated from Liverpool and the Island formed a single District.
Societies
The base unit was thus the Society established in some locality, initially by the travelling Preachers and later by organic growth allowing daughter societies to separate from the parent. As Wesley's rules put it 'each society is divided into smaller companies, called classes, according to their respective places of abode' - each class, or band, would be led by a Class Leader and have around 12 members (though actual numbers could vary widely depending on ability and charisma of the Class Leader). Some members may even be appointed class leaders with no class - they had to recruit their own! The duties of this Class Leader included
To see each person in his class, once a week at least, in order
To inquire how their souls prosper;
To advise, reprove, comfort, or exhort, as occasion may require ;
To receive what they are willing to give, towards the support of the Gospel :
Besides collecting the weekly 1d offering (plus the quarterly 1s) the Class Leader would liase with the Travelling Preachers so that sick members would be visited etc. The Superintendent has the task of ensuring that each class was visited regularly by a Travelling Preacher - the classes had to be met at least once a quarter for the members to be given their Ticket which confirmed their continuing membership of a Society.
Leaders' Meetings
All Class Leaders were to meet at least once a quarter, which Leaders' Meeting, chaired by the Superintendent Minister, was the governing body for that Society. Each society would also have a Society Steward whose job included looking after Class money and the Society finances in general. Circuit Stewards would also perform a similar financial oversight role for the circuit.
A key role of these Leaders Meetings was to find the money to pay the Travelling Preachers - who in some cases they may not have wanted, and certainly had little say in their appointment.
Local Preachers
Class members who felt drawn towards becoming Local Preachers would according to the rules and regulations approach the Superintendent who would examine him (women preachers were never encouraged though tolerated by non-Wesleyans - but more on this later) and if satisfied the Superintendent would suggest his name to the existing Local Preachers. As Grindrod put it in 1842 "There are but few positive laws relating to this useful class of officers recorded in our Minutes. Much of the discipline by which they are governed, and especially that by which they are admitted into office, is determined by common usage." Legally the Superintendent could veto a suggestion coming from the LPs' meeting and suggest names for consideration but could not force acceptance. Judging from a few comments in minute books of the LPs meeting several prospective Manx LPs were approached by existing LPs rather than vice-versa. Assuming that they were acceptable then they would spend a period (generally six months) 'on trial' before being fully accredited or as generally said 'on plan'.
Plans
A characteristic feature of Methodism is the provision of a 'Plan' . The plan is in essence no more than a diary of appointments for the group of preachers working within a certain circuit - in practice they are considerably complex than this and cover more than just the Sunday services.
Quite when the first plan, as such, was drawn up is not known for certain; Wesley himself had drawn up a weekly preaching plan for the London preaching places and preachers in 1754. Leary dates the first mention of a plan to a letter by John Wesley dated 16 February 1780 requesting that Christopher Hopper, one of his assistants at Colne furnish him with a copy of the 'plan' and implying that Hopper had been the originator of such plans within the Colne Society. Certainly in Wesley's journal entry for 8 June 1781, re his second visit to the Island, he states of the Local Preachers: "They speak either Manx or English, and follow a regular plan, which the assistant gives them monthly".
These plans, originally designed for the convenience of the Preachers, were at some time started to be printed and made available for members to buy. The earliest printed Manx plan to survive is that of April-June 1813, which was issued in facsimile form, as a fund-raising effort, in 1898. The earliest Primitive plan to survive is that of July-Sep 1824 (i.e. within a year of the first Primitive missioning).
At the head of the list are the travelling preachers - in Manx Wesleyan plans these are generally indicated by Surname alone whereas Local Preachers are given by Initial and Surname. The Primitives were somewhat more democratic in not distinguishing them by style, though travelling preachers still headed the list. However there is a manuscript copy of a plan for 1800 for preaching stations in the North of the Island - interestingly names are written in full except for Travelling Preachers are indicated by 'EP' (English Preacher).
Local Preachers are ranked in order of seniority (i.e. how long they have been L.P.s) in the plan - they could lose some of this seniority, to 'be sunk', by missing appointments or other misdemeanors, more serious breaches of course meant that they were expelled.
Chapels and Trustees
The plan assumes some regular preaching stations - originally these would be farmhouse kitchen or barns in the country and rented rooms in the towns. Although Methodism started as a 'ginger group' within Anglicanism it was not long before it started to build its own meeting places or Chapels - the first of these is generally said to be the Horsefair Rooms in Bristol opened in 1739. Wesley often preached out of doors but the Conference strongly encouraged indoor preaching (which avoided some potential problems under English law) and progressively placed stronger emphasis on buildings set aside for preaching. Thus by the time Methodism spread to the Island it was the usual practice for societies to build chapels for their meetings. The first Methodist chapel was opened in Peel, according to Rosser in 1777, with he next being Kirk Lonan in 1780 - Thomas Street Douglas came in 1787. By 1800 there were around 15 Wesleyan Chapels and on the 1813 circuit plan 67 meeting places were listed, of which 54 were specially built chapels.
The legal owners of this chapel would be the Trustees - as Grindrod expresses it: "They hold. the public property in trust for the use and enjoyment of the Conference, according to our general rules and usages, and have no power to appoint Ministers, to officiate in the chapels of which they are Trustees," Wesley was very insistent that although the chapels were built and paid for by local Societies it was Conference who would determine who could preach in them. Sometimes this was expressed in the jibe "The chapels are ours - the debts are yours". This control over the usage of chapels was controlled by requiring them to be settled by a model deed which expressly limited who could preach and the functions to which the chapel could be applied - the so-called 'Methodistically Settled' chapels. The Trustees would generally be men of good standing both in the Society and also in the wider community as legally they would be responsible for debts etc. There was a difference between Manx and English law which allowed Manx trusteeships to be passed down to heirs as property rights - certainly the Primitive Methodists ran into some problems with unsympathetic inheritors and engineered a law through Tynwald in 1906, to avoid these problems.
As Sunday Schools were added to many chapels they too had to have their own trustees.
There were however some chapels built and owned by individuals which were never settled - Thomas Lewin's Chapel appears on Wesleyan Plans under his name.
Official Roles
As can be seen from the discussion of the structural arrangements, there were many opportunities for lay involvement from Class Leaders and Local Preachers on the spiritual side through to Stewards and Trustees on the secular. To those roles could be added the great number of Sunday School Teachers - Currie estimated that if all offices were held singly then every other Methodist would be an office holder. Even though in many societies certain people would occupy many roles, it was still an excellent mechanism by which relatively uneducated people with low social status could gain both self-esteem as well as practice in 'political' organisation. Certainly this experience spilt over into early English industrial unionism which, if not led by Methodist officials, adopted Methodist arrangements. In Man the second generation Primitive Methodists were the driving force behind many of the social changes around the turn of the century.
Dissent within Methodism
During Wesley's lifetime he kept a tight control on the organisation; however following his death there arose several dissenting groups - the first being the Methodist New Connexion of 1797 which though similar to Wesleyan Methodism adopted a much more pronounced Congregationalist stance. The MNC though strong in the North of England had no presence on the Island until the late 19th Century when they 'missioned' the Island and built Derby Road Church which however closed within 20 years . The more important dissent was that of the Primitive Methodists, often disparagingly referred to as Ranters, which was caused basically by enthusiastic members not wishing to toe the more conservative 'party line'. Dissent was caused by the decision of Conference to forbid 'camp meetings' in which large numbers of followers assembled in an isolated spot for a day and a night revival meeting. In many ways this decision was wise considering the suspicion in which the Methodists were beginning to be regarded by Authority, and the possibility of these meetings becoming seditious, together with reports from America of loose behaviour in such camps. The proponents of these camps, Bourne and Clowes, thus separated from Wesleyan Methodism in 1810 and, mostly due to the organisational ability of Bourne, prospered.
All these groups differed little in terms of theology (though the PMs were often more prone to biblical fundamentalism) - the differences were in the polity or organisational structure. Wesley's authoritarian structure has been put down to his original High Tory leanings with their belief in the divine right of Kings and his fear of any looser control. His background as an ordained priest of the Church of England encouraged him to separate the laity from the 'ordained ministry' as seen in the travelling preachers. Wesley effectively broke with the Established Church when he ordained preachers for work in America but did not 'ordain' any for work in the British Isles thinking that the Methodists would be also members of the Established Church. Wesley's Model Deed on which chapels were to be settled carefully removed the right of Trustees (the legal owners of the Chapel) from control of the Pulpit, placing this power initially in his own hands and, after his death, in that of Conference controlled by the 'Legal Hundred'. Wesley thus left the Methodists an ambiguous legacy of assent to the Established Church in terms of an ordained ministry yet an alternative network of chapels and a highly controlled set of 'ordained' Preachers with the two grades of 'Assistants' and 'Helpers', and 'Bishops' in the form of superintendents.
Many adherents from earlier dissent had joined the Methodists and wanted to cut all ties with the Establishment; also many clergy, like Bishop Richmond, were intolerant of a sect within a church. Within a few years of Wesley's death it became impossible to reconcile these two components. It was Thomas Coke in the few years after Wesley's death who established the supremacy of the Conference with its London based secretariat and all important Book Room. It was this organisation that was taken over by Jabez Bunting by the mid 1830's and who controlled the Wesleyan organisation, very much as a 'Methodist Pope' for some 25 years.
Both the MNC and the PMs disagreed with the separation of laity and ministry and gave equal roles to each - the PM's had explicit rules as to the composition of Conference requiring the ratio of laymen to ministers to be 2:1. Contrast this with the Wesleyans who allowed no lay representation at Conference until 1876.
Manx Wesleyan Methodism - the first 50 years.
Membership figures for the Weslyans can be found in Rosser (up to 1848) and are plotted below:
Note the very high growth needed to reach some 2,000 members within 8 years of the start - assuming that membership was restricted (as it should be) to those over 14 then around 1 in 10 of the adult population was a member by the end of the 18th Century. As a comparison the London circuit (the largest) had 2,950 members at Wesley's death in 1791. By the time of the split from Whitehaven in 1781 the Manx numbers were already some 1500, about five times those of the parent circuit which had been established for many years. Apart from the blip at the end of the 1790's reported membership remained at around the 2,500 number for some 50 years. The jump in the early 1830's was due to panic at the arrival of the cholera epidemic.
Whether these numbers were genuine and exactly what happened to cause the doubling of members at the turn of the century is not clear. The sudden growth has been put down to a mission by Mr Graa of Whitehaven but a more critical judgement of both may be overoptimistic reporting by the class leaders. Reported membership always dropped with the arrival of a new preacher. Rosser suggests some of the drop of membership may be explained by the poverty of the country folk - especially when it comes to paying in the quarterly shilling.
"Owing to the peculiar circumstances of this island--the inhabitants in the country parts using chiefly the Manx language ; and being thinly scattered through the mountain districts ; and few of them possessing much of this world's goods, they have a strong reluctance to meet the preacher at the regular quarterly visitation. The preachers have uniformly regretted this circumstance, but have generally submitted in such cases to write the tickets and entrust them to the care of the leaders : some preachers, however, especially on first going into the island, have positively refused to act upon this plan, and have returned only those classes, the members of which have been willing to meet them for the renewal of their tickets ; and this has sometimes occasioned a very serious apparent decrease".
This is collaborated by John Mercer though here he hints at a much more 'congregational' arrangement than was countenanced by Methodist rules:
I allude to the manner of giving tickets to the country societies. About the year 1797 or 1798 there was a great revival through the whole island. Several hundreds joined the Society. And as the preachers never visited them but on the weekdays, and were accustomed to hold their meetings till twelve or one o'clock in the morning, there was no time to give tickets: consequently they were given to the Leaders to give to their respective classes. This laid the foundation of one of the greatest evils which ever happened to Methodism in the Isle of Man. For though the preachers one after another attempted to give tickets to the country Societies year after year, yet it was labour in vain, as not one in ten of them attended to receive them. And this was the case with many of the Leaders as well as the members. So that the preachers, not knowing what to do, added to the evil by giving tickets to the Leaders who were present for their absent members, and leaving tickets for those Leaders who were absent, without either seeing their class papers, or knowing the number of members in their classes. By these means I may safely say that every part of discipline, in the country societies, fell to the ground. This caused a separation between the preachers and the Societies, and hundreds of them knew not their preachers from other men, unless they happened to meet them on the road, and guessed that they were English preachers because they had saddle baggs under them. The weekly and quarterly collections were very little attended to, and hundreds looked on the travelling preachers as a burden because they were now and then asked for something to support them. Most of the preachers would complain of the existing evils; and if one now and then had resolution enough to attempt to reform them, he was sure to be opposed by some or other of those who ought to have come forward to his help. When I came to Douglas Circuit in 1813 I found things in this deplorable state.
Relationship with the English preachers may well have been fraught from the beginning -
The preachers here in general are pious, and lovers of discipline; and will, I believe, respect the English that are so too.
[letter from Mr Brown to Wesley 1781]
Crook instituted a 'Conference of Manx and English Preachers' - the title apparently placing the Manx Local Preachers on a par with the English Travelling Preachers - an equality that was never recognised in Wesleyan Methodism. For this he was soundly criticised by John Mercer in his 1820 missive to Jabez Bunting
"He established good order in all the Societies; and had everything among them as regular as clockwork. However he set up one rule, which in my opinion has been, and still is, a great evil. I mean his giving so much power into the hands of the Local Preachers. He began by meeting them regular every Quarter, but instead of giving it the simple and proper name of Local Preachers' Meeting he gave it the high sounding name of Manks Conference, and adopted most of the phraseology used in the Minutes of the English Conference. But the evil did not consist so much in the name, as in the nature of that meeting. For instead of attending to the simple business of a Local Preachers' Meeting, they also transacted the business of the Quarterly Meeting too, and I may say almost everything which belongs to the Leaders' Meeting. And at last grew to such a height of despotism, that no man, however well qualified, must be a Circuit Steward but a local preacher. The above particulars have been a source of much grief to many of the travelling preachers, and of much contention between them and the Local Preachers. Mr. Lumb was the first who atacked their mixed system with any degree of success; for which daring attempt he brought on a paper war between himself and the Local Preachers, which was carried on with great spirit by both parties and ended in an appeal to the conference. Most of the preachers who followed Mr. Lumb have been doing a little towards pulling down this stronghold. So that through mercy we have so far succeeded as to get the Leaders' Meeting and the Quarterly Meeting raised up again as a separate concern from the Local Preachers' Meeting. And in Douglas Circuit [we] have prevailed so far as to get a man for one of the Circuit Stewards who is not a Local Preacher. And if the travelling preachers would be unanimous, and every one attend to his proper work, I have no doubt but this part of Methodism might be redeemed. "
Economic conditions worsened in the 1820's and 1826/7 saw the start of mass emigration to Ohio.. Work on emigration manifests showed that in 1827 at least the Manx travelled in large groups of families which indicated some form of community organisation. At least two Local Preachers emigrated in these parties - one of them, John Sayle a senior LP in the Ramsey Circuit, was placed at the head of the list indicating some authority within his group
The growth of available seats slacken during this period
Although more chapels were opened, most were small - the majority of available seats were in the towns, especially Douglas. From the 1830's many earlier chapels were enlarged or rebuilt - often the older chapel then serving as the Sunday School.
Travelling Preachers
These and their wives and children had to be supported by 'quarterage' raised from members though Conference could allot some funds. Thus poorer circuits were loath to accept married preachers with many children to support and many ambitious preachers would avoid the poorer circuits. Not for nothing could John Mercer write to Jabez Bunting in 1820 "For as you have travelled upward of twenty years in the richest of the rich circuits, and I have travelled upward of nineteen in the poorest of the poor circuits".
The number of stationed preachers on the island, initially 3 until the split to form circuits when 4 were stationed, which was increased to 5 from c.1812 though Mercer was angling for 6.
Of these one in each circuit would be relatively experienced but the others were almost always newly entered preachers of which the Island received many more than its due share. Few of these stayed more than a year - their youth, inexperience and lack of Manx must have put them at a disadvantage when it came to 'controlling' the local preachers - hence Mercer's barbed comment " And if the travelling preachers would be unanimous, and every one attend to his proper work, I have no doubt but this part of Methodism might be redeemed." John Mercer was certainly the driving force for most of the decade before 1820; born Farndale Yorkshire, in 1770 he became a Methodists LP in 1794 and a Travelling Preacher in 1800. He first came to the Island in 1802, the next year he married, at Kirk Onchan, Jane Simpson (widow, nee Quayle) of Douglas He and his wife farmed Ballarobin in Malew and are reported as giving the land for Kerrowkeil Chapel. Presumably it was farmed by tenants though a William Mercer, possibly his son became a LP in 1835 but had to remove from the Island in 1836; John Mercer died at Birstal, 26 Jan 1839, aged 68. This Manx connection may explain his choice of circuits, all of which were in Northern England, before he returned to the Island in 1812-20, for most of which time he was Chairman of the District. In his note to Jabez Bunting he describes the Island circuits as so heavily burdened with chapel debts that none can afford to pay any extra towards preachers support. In particular Ramsey, "itself only like a country village in point of size" with "about one hundred in society and most of them very poor", could only afford to pay the single preacher's board and to pay 3/9d per week to the married man! Apparently the lodging for the single preacher was provided free by one of the families but they removed from the place in 1819 thus placing an additional burden on the circuit and thus adding to its debt.
Judging from his letter and from minuted notes he re-organised the district onto a sounder financial basis as well as improving the spiritual side (only under his charge do we read of religious discussions at the LPs meetings).
Although the travelling preachers were supposed to spread themselves around the circuit it soon became the norm for them to preach the Sunday services only in the main towns.
Manx Language
Possibly the Methodists arrived a generation too late to save the Manx Language in the way that the Welsh Calvinist Methodists provided a home for Welsh. Certainly the Manx language had its brief flowering during the last quarter century of the 18th century; even though Wesley had depreciated the use of Manx, a small committee produced a very acceptable translation of many of Wesley's and Watt's hymns.
The entries from the 'Manx Conference Minutes' make interesting reading:
1788
Question How are we to act with respect to the introduction of New Manx Hymns amongst us for the future
Answer: have number and page announced
Q: Have we been diligent in learning our People to sing English Hymns
A No it hath been disregarded. How shall we proceed to amend this. Let an English hymn or part of one, be sung in every manx class
1794
Q: As our printed Manx Hymn book is grown old among our people what shall we do in this case to revive their minds
A it is agreed that a Manks H B shall be printed, if there should be any gain it shall go to the use of this circuit. If any loss the circuit shall make it up
Thus it would appear that explicit action was needed to force English on the Manx speaking societies; presumably before 1788 the hymns sung would be those familiar from the services of the established church. Even as late as 1848 the majority of LPs were listed as Manx preachers - the younger ones tended to be English preachers
Local Preachers
A.W. Moore's comments (Manx Worthies)
"We regret that we have been able to find out so little about the early Manx Wesleyan local preachers, of whom Wesley said:" I never saw in England so many stout, well-looking preachers together. If their spirit be answerable to their look, I know not what can stand before them."
" How strange! ' as the late Thomas Kelly remarks, " notwithstanding we have had Manx Methodists second to none in philanthropy and piety that so little has been written of them "
Some 260 Wesleyan LPs can be recognised (though not all identified!) over the 75 years; and about 120 PM LPs over the 25 year period. One immediate difference from the Wesleyan LPs is the greater fraction of non-Manx names - the Cumberland miners who came over to establish Foxdale and Laxey mining brought their Primitive Methodism with them.
Arrival of the Primitive Methodists
The Primitive Methodists arrived in 1823 - as for the Wesleyans over half a century earlier the mission was underwritten by an English circuit - this time Bolton who sent over Butcher.
Robert Faragher (himself by then a PM LP having been expelled from the Wesleyans) writing in 1850 correctly gets the right tone of popular patronisation.
And lastly we have the services in aid of the poor and despised Ranters and their Missions. It may, perhaps, induce some parties to throw them a crumb, when we state that some six or seven-and-wenty years ago, one of their Missionaries found his way to this Island by a fishing boat, landed at Port St Mary [sic usually taken as Derbyhaven], and there began to preach Jesus and the resurrection. He travelled from parish to parish, and from town to town throughout the Island, where he was ridiculed by some, persecuted by others and followed by a few - and those, as a matter of course, were the poor and despised among men. Months and years rolled along, and old Butcher and his help mate Nanny, as he called her, continued to sing and pray from place to place - God working with them by mighty signs ; and there are yet in this Island who look back with delight and satisfaction to the infant days of Primitive Methodism in the Isle of Man
Dissent within the Ranks
The 1830's saw yet more agitation within the Wesleyans as the travelling preachers became more clerical and the centralising power of conference dominated over local circuits making ever increasing demands for more money. A dispute over the installation of an organ in a Leeds chapel was the spark that provoked the Protestant Methodists who joined with the followers of Samuel Warren, another critic of the centralising power, to form the Wesley Methodist Association in 1832. Further disputes with the all powerful Jabez Bunting led to the expulsion of James Everett in 1849 who formed the short lived Wesley Methodist Reformers (merged with WMA in 1857). Some of these dispute spilt over to the Island with the expulsion of John Cain in 1835 and again in 1850's to give a short lived reform sect under Francis Ward, ironmonger, and one time Wesleyan travelling preacher. Robert Faragher writing in his Mona's Herald devoted considerable editorial space to this dissent and, as would have been expected of him, was in favour of the reformers.
Reaction of the Established Church
Bishop Wilson, 1698-1755, and his successor Bishop Hildesley, 1755-1772, were men of high calibre - Bishop Wilson managed to keep church discipline going in the Island for many years after it had effectively died in England though he had some determined opposition from the civil authorities. The requirement for incumbents to preach in Manx also virtually restricted the choice of clergy to local Manx born and Wilson organised suitable training. Although the Athols who inherited the Lordship of Man in 1736 had got off to a good start in the appointment of Bishop Hildesley who oversaw the translation of the Bible into Manx, subsequent Bishops were of much lower calibre and the church sank in esteem. Hildesley's successor Richmond, 1773-80, was much disliked by his clergy and under him church discipline rapidly failed; as we have seen he was also strong in opposition to the rapidly growing Methodists. Bishop Mason who followed him was also strongly opposed but died suddenly after a short three years in office. The next 29 years were under Bishop Crigan, supposedly appointed as a stopgap whilst the Duchess of Athol waited for her son, Lord George Murray, to reach the canonical age for appointment as Bishop (the Murrays were notorious for nepotism) - after a brief period as Archdeacon of Man, Murray was given St Davids but died in 1803 (he did however had one claim to fame as inventor of the visual semaphore system adopted by the telegraph link between London and the ports). Crigan's health suddenly improved on the Island and although a pleasant and well liked person he made no impact and the church drifted - his task was certainly not eased by the constant strife between his patron the Duke of Athol, appointed Governor in chief in 1798 and the House of Keys. The following appointment of the young (24 year old!) Bishop George Murray - the nephew of the 4th Duke of Athol was a disaster, as Bishop Murray attempted to take tithes on all green crops including the all important potato crop. This provoked riots in 1825 and he left for Rochester in 1827. The English Crown had by then acquired the rights of appointment and appointed Bishop Ward who realising that accommodation in the churches was inadequate commenced on a round of church building. A copy of a letter of Bishop Ward [nd but c.1830]sums up the situation as he found it:
When B. Wilson died four score years ago there was scarcely chapel room for the people, at least not enough; they were then 20,000. There has been scarcely a church built or enlarged since and now the population is 50,000 souls.
The consequence of this neglect is dilapidated churches and not enough room for a sixth part of the people.
You may easily conceive the consequences of this. Schism has crept in, John Wesleys Methodism has sprung up. But such is the attraction and veneration of the people for the church and her ordinances, retaining still a tincture of the Wilson school, that as soon as the church bell rings on the Sabbath they shut up their meeting houses and repair to the church.
As many of them are in sympathy and they never receive the sacrament but in church. So that I know as soon as I can provide churches for them they will return to the true faith.
Most of these churches were designed by John Welch who described his employer:
An ordinary man, with the common tact and generalship of the world, would have acquired immortality by half this amount of beneficial labour properly applied; but strange to say, this ecclesiastical Hercules, who sows churches and ministers over the country as Deucalion would sow teeth, is scarcely thanked for what he has done.
The 1835 Commission on the Church of England recommended that the ancient diocese of Sodor and Man be merged with Carlisle on the death of Bishop Ward and this was passed into law by Westminster. A determined action by Bishop Ward and friends saw this part of the bill repealed Subsequent Bishops stayed but short periods, often using the relatively poor diocese as a stepping stone to richer livings elsewhere.
Bishop Shirley
The Methodist Conference had finally declared itself non-conformist in 1826 At the grass roots links between Methodists and the Established Church remained strong for much longer than in England. H.R. Oswald (a Presbyterian) writing in the 1830's says:
The Manx Methodists of his [Bishop Murray's] time could not be termed non-conformists, for, till very lately, none of them went as far to separate themselves entirely, but were regular attendants at the Divine service of the Establishment, and respected all her ordinances.
Multiple attendance, especially in rural areas, at both Chapel and Parish Church would appear to have been quite common and continued until much later in the century - many chapels choosing times of service so as not to clash with those of the Parish Church (see for example the times of service in the rural Wesleyan chapels). The anonymous diary of a Wesleyan Local Preacher covering the years 1826/8 indicates that even though he attended class and preached or exhorted close on every evening he still attended the Parish Church. He also attended the Primitive Methodist chapel when a known good (or a female) preacher was planned. Even as late as 1841a letter to Mona's Herald (8 June 1841) could say "The Rector of Andreas has changed the hour of evening service from 3 to 6 which has raised a great deal of dismay among the Wesleyans whose service is at the same hour." The writer agreed with the change but mainly for the convenience of a free Sunday afternoon in summer! Ellie Shimmin, writing of Ballaugh in the 1850's could say "We had service at eleven in the morning, and three in the afternoon. There was no service at night ,so we went to the Methodist Chapel at six o'clock. A service was also held in the Methodist Chapel at two o'clock in the afternoon, and, if we had a short service, we all went to another service at Church; we were all friendly".
Sunday Schools
In 1851 returns are available from 35 Wesleyan, 17 Primitive and 1 Wesleyan Reform Chapels. Chapel returns were 59W + 26PM thus about 60-66% of chapels ran a S/S.
The number of Sunday Scholars on the rolls were 4260 students on roll (2759 attended) of these about 50% (2111) were on roll at some day school. They were supported by some 1044 teachers (581 m : 463 f) all of course unpaid - presumably these worked in shifts.
Most SSs were supported by collections generally at some Sunday School Anniversary Sermon.
Situation in 1851
1851 saw the first, and last, religious census held in the UK (and Man); I have discussed these results in detail elsewhere. Although it appears straight forward to just take the reported attendance at services this will overestimate the actual numbers of adherents due to multiple attendance. The adopted formula is based on that used by Horace Mann in presenting the original returns. The following table summarises the town and parish situation:
Influence on the Manx
Whether one agrees with Margaret Killip that Methodism was "an institution that combined a great influence on the life of the Island with an almost complete lack of understanding of and disregard for its traditions." [Killip1975], a sentiment that appeared to be shared in some respects by T.E.Brown " Then comes Methodism, and sweeps everything into the drag net of theological jargon. What chance had the wayside flowers A thing unheard of in the history of any other country we have no love song, no war song, except in obscure, precarious fragments. Nothing that expresses the heart of the people. Poor souls, they loved, even if they did not fight But love and hate alike went down beneath the Ecclesiastical harrows." [ Mannin v9 p522 ] or with the Rev Radcliffe[Radcliffe1895] that it was necessary to correct the deeply degraded moral condition of the Manx following the easy money days of "smuggling" and the depression following the Act of Revestment - it is true to state that Methodism has had a major impact on the Manx. Probably around an eighth of the populace were associated with the chapel in its heyday, though many had a shared allegiance with the established church.
Conclusion
Maybe the final word on the role Methodism has played can rest with Robert Faragher as expressed in his review of Rosser's History of Wesleyan Methodism (1848)
What has Methodism done in the Isle of Man ? Go ask our Sunday Scholars and their teachers, who and what they had been without it. Ask our benevolent and charitable institutions whence they sprung ; or our friendly societies who gave them the first impulse.
Methodism we say, with the greatest propriety, has changed the moral condition on man ; it has laid the foundation of many useful institutions; and is blessing thousands of our present population. Nevertheless, we fear the simplicity, sincerity, and untiring zeal of early Methodism are almost unknown amongst us. There is too much conformity to the world, in manner, dress, conversation, and conduct ; too much love of mammon and the distinctions of life ; for it is the conscientious conviction of our mind that there is much room still for improvement; and that if a second John Wesley should arise, he would find almost as much work and need of reform in this our day, - even amongst his own followers - as did the great reformer of the eighteenth century amongst the members of the Church of England.
A brief guide to Methodist chapels.
References + credits
Moore, drawing heavily on an earlier work by Rosser, gives a brief history setting Methodism within the social history of the Island.
[Davies1985]: Davies, Rupert R. 'Methodism' 3rd Ed Epworth Press (ISBN 0-7162-0280-8) 1983
[Kissack1995]: Kissack R. 'The Contribution of Methodism to the Culture of the Isle of Man' published by Manx Methodist Historical Society
[Killip1975]: Killip, Margaret 'The Folklore of the Isle of Man'
[Moore1900]: Moore, A.W. 'A History of the Isle of Man Vol 2' 1900 (reprinted 1977 and 1992 by Manx Museum ISBN 0-901106-33-x)pp 674-681
| i don't know |
What was the name of the nurse who worked during the Crimean War and became known as 'The Black Florence Nightingale'? | Mary Seacole
[ Victorian Web Home —> Victorian Political History —> Victorian Social History —> Crimean War ]
ary Seacole and Florence Nightingale were contemporaries noted for their nursing care of soldiers during the Crimean War. Nightingale is still a well-known historical figure, but Seacole was soon forgotten. One author asked, 'Why is it then that the sands of history seem to have buried Mary Seacole in favour of Miss Nightingale and others when her deeds were in many ways equally noble?' Mrs. Seacole was a Jamaican healer or 'doctress' with expertise in tending victims of cholera and yellow fever epidemics. When the Crimean War began, Mrs. Seacole went to London and volunteered her services as a nurse to the War Office, other military agencies, and Florence Nightingale's nursing group. She was told by all that her services were not needed. She went to the Crimea at her own expense and worked steadfastly to care for the sick and wounded, often going onto the battlefield to aid the fallen. She became quite well known in the Crimea and back in England. Her autobiography, The Wonderful Adventures of Mrs. Seacole in Many Lands, was published in 1857 and was very popular for a while. Then Mrs. Seacole faded from public attention for almost 100 years. In the 1970's Mrs. Seacole was rediscovered and has become a symbol for Black nurses, civil rights groups, and the women's liberation movement. Almost every article available compares her with Florence Nightingale and suggests that Mrs. Seacole was pushed aside and soon forgotten because she was Black. In this paper I will discuss Mary Seacole's life and works in light of the time period in which she lived, the comparisons made between Seacole and Nightingale, and the body of literature that has been written about her.
Mary Jane Seacole (n�e Grant), by Albert Charles Challen, oil on panel, 1869, NPG 6856; with thanks to the NPG. ©National Portrait Gallery, London.
Twenty-five years ago, it would have been difficult to find many people who recognized the name of Mary Seacole except for a few nurses in her home country of Kingston, Jamaica. However, there was a time when she was quite famous in England as well as in the Caribbean. Mary Seacole is rather an elusive figure because she never held any 'official' appointments nor did she leave behind a large body of written works. Mary published her very popular autobiography in 1857. In addition, there were a few articles about her actions in the Crimean War published in the London Times, Punch, and the Illustrated London News. On her death in 1881, the Times and the Manchester Guardian paid tribute to a woman whose personal courage and contribution to the Crimean campaign had won her wide admiration (Alexander, 1981). In time, the people who knew of her work died and the fame she earned for her work with the sick and wounded in the Crimea as well as all she did in the Caribbean to help with victims of yellow fever, cholera, dysentery, and other tropical diseases, faded from memory. There were, of course, a few people in Jamaica who remembered because Mary Seacole was one of their most famous citizens. I did an extensive literature search to find out more about the woman who is now being called another Florence Nightingale, the Black Florence Nightingale, and the first nurse practitioner. I will start with some illustrations from Mary Seacole's autobiography as background material and then discuss some of the articles that have been written about her since she was 'rediscovered.' All references to Mrs. Seacole's autobiography will refer to the Alexander & Dewjee reprint edition.
Almost everything known about Mary Seacole is to be found in her autobiography entitled Wonderful Adventures of Mrs. Seacole in Many Lands which was originally published in London in 1857 and reprinted in 1984. She reveals very little personal information about herself. Her childhood and family life is summarized in six pages. She was born Mary Ann Grant in Kingston, Jamaica in 1805. Her mother was a free Black woman and her father was a Scottish soldier stationed in Kingston. Slaves were not freed in the British West Indies until 1834 so Mary occupied a middle ground; not a slave but still subject to the prejudices against Blacks. Mary was a mulatto or Creole. On the first page of her book, she described herself: 'I am a Creole, and have good Scotch blood coursing in my veins' (Alexander, 1984). Mary's mother was a well-known herbalist or 'doctress' in Kingston. She ran a boarding house for invalid British soldiers and their families. Mary seems to have had frequent contact with military doctors and keenly observed what they did to treat their patients. By the time she was twelve, she was helping her mother take care of patients. She claimed she inherited her energy and ambition from her Scottish father and her medical skills from her mother. She married a Mr. Seacole in 1836 but he was a sickly man and soon died. In her book, Seacole only refers to him as Mr. Seacole but various sources give his name as Edwin Horatio Seacole. Two main points are emphasized throughout her book — she loved to travel and she had a strong interest in medicine and serving the sick. While she was still young, she made two trips to England and lived there for a total of three years.
After she became a widow, Mary established her own boarding house and began to care for her own patients. She gained a reputation as a skilled nurse and doctress. In 1850 cholera swept the island of Jamaica and more than 31,000 people died. Mary worked with doctors as a fledgling nurse, gaining first hand knowledge of the disease and developed a medicine that produced remarkable results (King, 1974). Since there were no formal nursing education programs yet, she was as well qualified as anyone to call herself a nurse. She observed the illness and studied what worked and what didn't. Ever restless, Mary traveled to Panama to visit her brother and opened a boarding house in Cruces. Panama was in a state of upheaval at the time and sanitary conditions were extremely bad. That, combined with the hot, humid weather, made Panama a breeding ground for all types of tropical diseases. Soon after Seacole's arrival, cholera broke out in Cruces. There was no doctor but the residents were reluctant to accept her help at first because she was black and she was a woman. However, they were soon forced to seek her aid. She worked night and day until the crisis was over and was credited with saving many lives. She said the disease was contagious but that wasn't the usual belief for quite awhile. She also felt that cleanliness, fresh air, and good food were important even though those ideas weren't commonly accepted. She was very observant and wanted to know the mechanisms involved in cholera. Finally, she did her one and only autopsy on a child who had died of cholera because she wanted to see what was going on inside the body of victims. She received much acclaim and praise for her work in Cruces. Americans living in Panama called her an angel of mercy, but some of the Americans provoked her to wrath because of their racist remarks and bad attitudes about Blacks. While in Cruces, she made a statement that illustrates the driving force in her life: 'And wherever the need arises — on whatever distant shore — - I ask no higher or greater privilege than to minister to it' (Alexander, 1984, p. 78). She moved on to Cuba and was so effective in caring for their cholera victims that she became known as 'the yellow woman from Jamaica with the cholera medicine.' Mrs. Seacole moved back to Kingston and was there in 1853 when a severe yellow fever epidemic struck Jamaica. Once again she worked tirelessly in treating the sick.
Mrs Seacole's Hotel in the Crimea. Source: Fronispiece, Seacole.
When war broke out in the Crimea, some of the units from Jamaica were sent there to fight. Reporters such as Times correspondent, William H. Russell, sent back regular reports on the horrible conditions for the sick and wounded. Of the 20,000 British soldiers who lost their lives in the war, 3000 died in battle and the remaining 17,000 from diseases. Florence Nightingale was recruited to organize and train nurses to work in the military hospitals of the Crimea. When news of the situation in the Crimea reached Mary Seacole, she was convinced that her experience with tropical diseases was vital to Britain's war efforts (Alexander, 1981). Mary was very attached to her 'boys' from Jamaica and wanted to join the regiments she knew from Kingston in Sebastopol. Armed with glowing letters of recommendation from military doctors in Jamaica, Seacole arrived in London in the autumn of 1854. First, she applied to the War Office for the post of hospital nurse because in her own words she said, 'knowing that I was well fitted for the work, and would be the right woman in the right place' (Alexander, 1984, p. 123). The War Office ignored her offer. Then she applied at various military offices and with Florence Nightingale's organization. In spite of a great shortage of suitable women to go to the Crimea as nurses, she was turned down by all. Finally, bitterly disappointed that no one seemed to want the help she was freely offering, Mary wrote in her autobiography:
Doubts and suspicion rose in my heart for the first and last time, thank Heaven. Was it possible that American prejudices against colour had some root here? Did these ladies shrink from accepting my aid because my blood flowed beneath a somewhat duskier skin than theirs (Alexander, 1984, p. 126)?
Mary shed a few tears of grief that all the officials doubted her ability, but then her determination came to the fore and she decided she would go to the Crimea at her own expense. She said, 'if the authorities had allowed me, I would willingly have given them my services as a nurse; but as they declined them, should I not open an hotel for invalids in the Crimea in my own way?' (Alexander, 1984, p. 126). One of her guiding principles was that bureaucracy should not deter the cause of service (Marshall-Burnett, 1981). In partnership with Thomas Day, a distant connection of her late husband, she acquired a stock of food and medicine and left for Turkey as a sutler. She set up a store and boarding house about two miles from Balaclava which she called The British Hotel. Her purpose was to establish an eating establishment and comfortable quarters for sick and convalescent officers. The lower floor was a restaurant and bar and the upper floor was similar to a hospital. Throughout her career, Mrs. Seacole was an astute businesswoman. Her boarding houses provided for her personal expenses and financed her medical work. She was very generous in serving others, but she also expected to be paid for her services. She worked in her boarding house by day and then volunteered with Florence Nightingale in the evening. She began a medical practice working with the 'ranks' or enlisted men who did not want to go to the hospitals for any reason. She soon held the position in camp as doctress, nurse, and 'mother.' In her book she uses many letters she received in appreciation for her care. Her fame increased even more when she was seen tending the wounded on the battlefields even as the battle was still taking place. She became a familiar sight in her colorful garb such as her 'yellow dress and blue bonnet with red ribbons and her famous medical bag' (Alexander, 1981, p. 45). She regularly loaded her bags of provisions on one mule and her black bag of 'medical equipment', lint, bandages, needle and thread on a second mule, and made her way to the scene of battle. When Sebastopol fell on September 8, 1855, Mrs. Seacole got a pass that allowed her to be the first woman to enter Sebastopol so she could pass out refreshments and tend to the injured. The soldiers began to call her the 'black Nightingale.' Even though she was praised highly by the soldiers, she was never given any official recognition or reward by the military. When the war ended abruptly in 1856, Mrs. Seacole was left with a lot of expensive supplies that she could not sell at a fair price so she suffered a great financial loss. After she returned to England she had to declare bankruptcy. High-ranking officers and others who knew of her work in the Crimea started a fund for her and staged a four-day benefit to help her financially. Despite very large crowds at the benefit, Seacole received very little money. Due to poor planning and the financial problems of the Royal Surrey Gardens, the profit was about £233 after expenses were paid. Though her heroism in the Crimea went unheralded by the government, Mary Seacole had won the admiration, respect, and love of many of the English people. The British weekly, Punch, wrote a glowing tribute to her in a poem entitled 'A Stir for Seacole' which was published December 6, 1856 and Times correspondent, William H. Russell mentioned her in some of his news reports and later wrote the introductory preface to her autobiography. Among other flattering comments, he said:
I have witnessed her devotion and her courage; I have already borne testimony to her services to all who needed them. She is the first who has redeemed the name of 'sutler' from the suspicion of worthlessness, mercenary baseness, and plunder; and I trust that England will not forget one who nursed her sick, who sought out her wounded to aid and succour them and who performed the last offices for some of her illustrious dead (Alexander, 1857/1984, Preface).
Mary's book was very well received and profitable. In 1867 another fund was established which had the backing of Queen Victoria . The goal of her supporters was 'to place her beyond the reach of want' (Alexander, 1984, p. 34). Long after the war ended, the government awarded her the Crimea Medal for services rendered the sick and injured (Carnegie, 1984). The Times reported that she received four medals but didn't specify what they were. An obituary article in the Daily Gleaner of Jamaica dated June 9, 1881, stated that Mrs. Seacole received 'English, French, Russian and Turkish decorations.' The latter years of Mrs. Seacole's life were divided between Jamaica and England. Mary died in Paddington, London on May 14, 1881. Her estate was valued at something over £2600. The Times and Manchester Guardian published obituaries in recognition of her services even though she had been out of the public eye for 25 years. After that, Mary Seacole faded from memory.
During my literature review on Mary Seacole, I found a few references about her in Jamaica in 1905, 1911, 1932 and 1934. In a 1951 radio broadcast, Adolphe Roberts said, 'posterity will remember a Jamaican, who although she may not be counted among the world's 'greats', certainly had one of the kindest hearts that ever beat in a human breast' (Roberts, 1951).
The first serious attempt to restore her place in history was in 1954, the centenary of the Crimean War. In that year, the Jamaican General Trained Nurses' Association (now the Jamaican Nurses' Association) decided to name their Kingston headquarters the Mary Seacole House when it was built. Later a residence hall at the University of the West Indies was named for her, and then a ward in the Kingston Public Hospital. No recognition of any significance occurred in Britain until 1973.
On November 20, 1973 there was a special ceremony of reconsecration at Mary Seacole's grave. Miss Elsie Gordon, former editor of the Nursing Mirror found a slip of paper in an old copy of Mrs. Seacole's autobiography that she had purchased in a London book shop. This piece of paper helped Gordon locate Mary Seacole's grave in St. Mary's Roman Catholic Cemetery in Kensal Green. Prior to this, no one knew where she was buried (Gordon, 1975). The ceremony was due to the combined efforts of the British Commonwealth Nurses' War Memorial Fund and the Lignum Vitae Club, a Jamaican women's group based in London, and the support of the Jamaican Nurses' Association (U.K.). Mrs. Seacole's crumbling headstone was restored. This ceremony received coverage in newspapers and several nursing journals. In 1980, a touring exhibition called 'Roots in Britain' occasioned many requests for further information on Mary Seacole. Due to this revived interest, a memorial service was held on May 14, 1981 to mark the centenary of her death. This commemorative service has now become an annual event. The response was so strong that a decision was made to reprint Wonderful Adventures of Mrs. Seacole in Many Lands in 1984. The editors of the reprint, Ziggi Alexander and Audrey Dewjee added several pages of research to their introduction which greatly expanded the information available on Mrs. Seacole and her autobiography. In a review of the book, Clive Davis remarked that 'A cottage industry is beginning to develop around the exploits of 'Mother Seacole', a Jamaican Creole who became a Victorian celebrity for her work as a nurse in the Crimean War and then sank into obscurity for the next hundred years or so' (Davis, 1984).
As her story became better known, Mrs. Seacole was turned into a symbol or rallying point for minority nurses, feminists, and nurses who felt the current system of nursing was too restrictive. Black nurses began to complain of the racism in the National Health Service and used Mary Seacole's words to express their feelings of anger and rejection: 'Did they shrink from accepting my aid because it flowed from a somewhat duskier skin than theirs' (Alibhai, 1988). The question of why Florence Nightingale became so famous that she is still remembered today while Mrs. Seacole received little recognition began to appear with more regularity. One asked, 'Why is it then that the sands of history seem to have buried Mary Seacole in favour of Miss Nightingale and others when her deeds were in many ways equally noble' (Bassett, 1992). Nurses who were interested in what is now called advanced practice nursing pointed out that Seacole's practice and conduct was of great significance to the genesis and history of nursing. It is true that Mary Seacole did nurse but her practice was far broader — diagnosis, prescription, preparation of herbals and pharmaceutical medicine, a little minor surgery, and doing a postmortem on a cholera victim to learn more about the effects of cholera. Hopefully she will eventually have her own place in history instead of being 'a black Nightingale' (Pollitt, 1992). Seacole has also been called a nurse practitioner, independent practitioner, or advanced practice nurse because she performed a number of nursing and medical activities without direct supervision from a doctor. In fact, many doctors felt threatened by her ideas on cleanliness, good ventilation, nourishing food, and the separation of patients with contagious diseases. Furthermore, she financed her own practice due to her shrewd business skills in owning and managing her boarding houses and in being a sutler during the Crimean War.
A recurring theme in almost every article about Mary Seacole is the comparison of Florence Nightingale and Mary Seacole. Florence Nightingale still has great name recognition all over the world while Mary Seacole was known for perhaps 30 years and then forgotten. They both served in the Crimean War and both did everything within their power to relieve the suffering of the sick and wounded soldiers. Florence Nightingale was white and had the backing and support of the British government. Mary Seacole was a middle aged Creole from Jamaica — a British colony. She volunteered her services as a nurse and had the credentials to show that she was very experienced in working with diseases such as cholera, yellow fever and dysentery. She was told by all that her services weren't needed even though that was blatantly untrue. Therefore, she went at her own expense. As many of the articles about her claim, racism in the Victorian society of her day was undoubtedly the major reason for her rejection. However, some of the articles seem to infer that, somehow, it was all Florence Nightingale's fault. One article stated, 'she had to compete with Florence Nightingale whose work was well established. Florence Nightingale was in a position to achieve what she wanted, how she wanted, and she was also a woman who wished to do it alone
Florence Nightingale saw Mary as an independent, strong willed rival' (Iveson-Iveson, 1983, p. 45). One wonders why there was a need for competition since there was enough work to keep any number of nurses busy. One of Florence Nightingale's major goals was to make nursing a respectable profession. Nurses often had a very bad reputation for being sloppy, drunken women who weren't much better than prostitutes. Image was just as important then as it is now. Along came Mrs. Seacole, a colonial from Jamaica. By her own admission, Mary was rather flamboyant — a very colorful and picturesque character who liked to dress in conspicuous colors like red and yellow, and wear hats or bonnets decorated with a lot of red ribbons. She obviously didn't fit the image. Mrs. Seacole was ahead of her time in more ways than one!
Another dubious charge is that, 'In many ways she stands head and shoulders above Florence Nightingale, for whereas Florence performed only an administrative role away from the front line, Mrs. Seacole was in the thick of things and did not hesitate to go to the battlefield itself in her desire to alleviate suffering and to comfort the dying' (Iveson-Iveson, 1984, p. 36).
The manner of their service was drastically different. Even before she went to the Crimea, Nightingale knew that surmounting the bureaucratic problems of the army's medical services and establishing a female nursing group which authorities and medical men alike could respect was going to be more important than any individual patient care she might do. Nightingale gained her reputation by the organization of nursing services during the Crimean War. After the war she worked tirelessly to improve public health and raise the status of nursing. The result of the introduction of women nurses into the British Army was no small matter in the history of nursing and was a testimony to her tremendous public support in forcing the antagonistic military hierarchy to accept a female with authority into their ranks. She also experienced prejudice and resentment from doctors and the military establishment. Nightingale is being criticized for not doing more, for not being more progressive, etc. but she took on the establishment years before women could even vote. Mrs. Seacole's strength seemed to be more in hands-on activities such as direct patient care. She was an entrepreneur who was able to use her skills as a merchant to finance her medical and nursing practice. It is probably true that Mrs. Seacole had more practical experience, especially with tropical diseases. However, both administrative and hands-on care are necessary for the effective delivery of health care. Both women made a great contribution to the history of nursing in their own way and, hopefully, there is room for both of them.
Mrs. Seacole's autobiography has generated several articles which analyze it as a travel book. It was unique for women to travel freely and alone in Victorian times. Some have even questioned that she really wrote the book herself. The assumption seems to be that a Black woman from the colonies wouldn't have been able to write such a book. However, many of the freeborn Blacks seem to have been quite well off and educated. Seacole's book is written in a lively, racy manner that is easy to read. Her caustic wit and optimistic attitude are very engaging. It is ironic that most of the articles about Mrs. Seacole claim she was overlooked because she was a victim of Victorian racism, but in her book, she frequently makes derogatory remarks about Blacks, Creoles, Catholics, and the Irish. Inevitably, she points out that thankfully, she doesn't have whatever bad habits these other people have. She was also a name dropper but reviewers seem to feel she did that mostly to promote her book by giving her story validity. She didn't say much about slavery in her own country or Britain's role in it, but she did sharply criticize Americans and their treatment of Blacks. She stressed her Scottish heritage and referred to herself as a yellow woman or a person with yellow skin rather than being black. In her book she presents herself as a rational observer of people and events happening around her. She was obviously writing for a white, British audience since they would be the ones to buy her book, the purpose of which was to rescue her from her financial problems. Mrs. Seacole's autobiography may seem like an interesting travel adventure on the first read but when one remembers the slavery issue and her rather ambiguous role as a free Black woman in Victorian society, it is obvious that she was walking a rather fine line in writing the book at all.
In answer to the question of why Florence Nightingale was revered in her time and still remembered today while Mary Seacole was soon forgotten, racism and Victorian prejudices were probably the primary cause. One could also ask, what is the nature of greatness?
To be recorded by official institutions, an individual or event must at some stage be deemed to be of particular value to society. The notion of 'greatness' is a highly subjective one, governed by considerations of race, class and gender, and by a person's or event's place within our affections (Okokon, 1998).
History is written by those in power at the time. Once Mrs. Seacole's supporters and admirers died, there was no one to keep her name alive. On the other hand, Florence Nightingale had a school named after her and left behind a large body of literature including her Notes on Nursing which was almost a bible for nursing well into the 1900s. These things helped to perpetuate her memory. It was a strange coincidence that these two women who were motivated by the same need to serve were contemporaries. Unfortunately for Mary Seacole, Florence Nightingale fitted the Victorian idea of a heroine better than she did. One could ask whether it is more important to be a doer or a thinker, or in this case, an administrator or a bedside nurse. Mary Grant Seacole rose about the barriers of racial prejudice and demonstrated determinism, compassion, and caring and is a fitting role model for both blacks and non-blacks. There is much to admire in both of these women who had different roles in nursing but the same goal. Although forgotten for many years, Mrs. Seacole has been rediscovered.
References
Alexander, Z. & Dewjee, A. (Eds.). Wonderful adventures of Mrs. Seacole in many lands. Bristol, England: Falling Wall Press, 1984.
Alibhai, Y. 'Black Nightingales'. New Statesman and Society, 1, 26-27. 1988
Bassett, C. 'Mary Seacole: The forgotten founder'. Nursing Standard, 6, 44-45. 1992
Carnegie, M. E. 'Black nurses at the front'. American Journal of Nursing, 84, 1250-1252. 1984
Davis, C. 'Mary Seacole'. [Review of the book Wonderful adventures of Mrs. Seacole in many lands]. New Statesman, 107, 39. 1984
Gordon, J. E. 'Mary Seacole — A forgotten nurse heroine of the Crimea'. Midwife, Health Visitor & Community Nurse, 11, 47-50. 1975.
Iveson-Iveson, J. 'The forgotten heroine'. Nursing Mirror, 157, 44-47. 1983
Iveson-Iveson, J. 'A pin to see a peep show'. Nursing Mirror, 158, 36. 1984
King, A. 'Mary Seacole, Part I: A matter of life
' Essence, 4, 32. 1974
Okokon, S. Black Londoners, 1880 — 1990. Phoenix Mill, Gloucestershire: Sutton Publishing, 1998.
Pollitt, N. 'Forgotten heroine'. Times Educational Supplement, n. 3965, 33. 1992
Roberts, A. Mary Seacole. Radio Jamaica Broadcast for U. C. W. I. Kingston. Aug. 2 1951.
Seacole, Mary. The Wonderful Adventures of Mrs. Seacole in Many Lands. London: James Blackwood, 1857 (available offsite on Project Gutenberg, here ).
| Mary Seacole |
The Haber Processis a reaction to nitrogen and hydrogen in order to produce which gas? | Florence Nightingale (1820 — 1910)
Florence Nightingale (1820 — 1910)
[ Victorian Web Home —> Victorian Political History —> Victorian Social History —> Crimean War ]
Section of the Crimean War memorial . Click on the image for a larger view.
Florence Nightingale was born on 12 May 1820 at the Villa La Columbaia in Florence; she was named after the city of her birth. Her father, William Edward Nightingale (1794-1874), was son of William Shore, a Sheffield banker. When Nightingale came of age on 21 February 1815 he inherited the Derbyshire estates at Lea Hurst and Woodend in Derbyshire from, and assumed the surname of Peter Nightingale, his mother's uncle. On 1 June 1818 he married Frances Smith, a strong supporter of the abolition of slavery . They had two daughters, Parthenope and Florence. "Parthe" was given the classical name of Naples where she was born.
Florence Nightingale was brought up at Lea Hall; in 1825 the family moved to Lea Hurst which Nightingale had just built. In 1826 he also bought Embley Park, in Hampshire and in1828 he became High Sheriff of the county. The family invariably spent the summer at Lea Hurst and the winter at Embley Park, occasionally visiting London. Florence Nightingale had a broad education and came to dislike the lack of opportunity for females in her social circle. She began to visit the poor but became very interested in looking after those who were ill. She visited hospitals in London and around the country to investigate possible occupations for women there. However, nursing was seen as employment that needed neither study nor intelligence; nurses were considered to be little less than prostitutes at that time.
Nightingale's hospital visits began in 1844 and continued for eleven years. She spent the winter and spring of 1849-50 in Egypt with family friends; on the journey from Paris she met two St. Vincent de Paul sisters who gave her an introduction to their convent at Alexandria. Nightingale saw that the disciplined and well-organised Sisters made better nurses than women in England. Between 31 July to 13 August 1850, Nightingale made her first visit to the Institute of Protestant Deaconesses at Kaiserswerth. The institute had been founded for the care of the destitute in 1833 and had grown into a training school for women teachers and nurses. Her visit convinced Nightingale of the possibilities of making nursing a vocation for ladies. In 1851 she spent four months at Kaiserswerth, training as a sick nurse. When she returned home, she undertook more visits to London hospitals; in the autumn of 1852 she inspected hospitals in Edinburgh and Dublin. In 1853 she accepted her first administrative post when she became superintendent of the Hospital for Invalid Gentlewomen.
Florence Nightingale Receiving the Wounded at Scutari — 1856 — The Mission of Mercy by Jerry Barrett. Click on thumbnail for larger picture.
In March 1854 the Crimean War broke out and the reports of the sufferings of the sick and wounded in the English camps created anger in Britain. William Russell, The Times' correspondent, described the terrible neglect of the wounded, and pointed to the differences between the facilities provided for British and French soldiers. He asked: ‘Are there no devoted women among us, able and willing to go forth to minister to the sick and suffering soldiers of the East in the hospitals of Scutari? Are none of the daughters of England, at this extreme hour of need, ready for such a work of mercy? Must we fall so far below the French in self-sacrifice and devotedness?’ (The Times, 15 and 22 September 1854).
Nightingale offered her services to the War Office on 14 October but her friend Sidney Herbert — the Secretary for War — already had written to her, suggesting that she should go out to the Crimea. Herbert said that she would 'have plenary authority over all the nurses and ... the fullest assistance and co-operation from the medical staff'. He also promised 'unlimited power of drawing on the government for whatever you think requisite for the success of your mission'.
Nightingale embarked for the Crimea on 21 October with thirty-eight nurses: ten Roman Catholic Sisters, eight Anglican Sisters of Mercy, six nurses from St. John's Institute, and fourteen from various hospitals; Mr. and Mrs. Bracebridge, also went with her. Nightingale refused the offer of service by Mary Seacole . They reached Scutari on 4 November — the eve of the battle of Inkerman . Nightingale's official title was ‘Superintendent of the Female Nurses in the Hospitals in the East’; but she came to be known generally as ‘The Lady-in-Chief.’
Florence Nightingale [in hospital, advising] by Arthur George Walker, R.A. 1861-1936. Bronze. Part of the Crimean War Memorial located at the junction of Lower Regent Street and Pall Mall, London.
Her headquarters were in the barrack hospital at Scutari, a huge, filthy place where infection was rife. Stores had not got beyond Varna or had been lost at sea . Descriptions from Nightingale and her nurses give some idea of the conditions there:
There were no vessels for water or utensils of any kind; no soap, towels, or clothes, no hospital clothes; the men lying in their uniforms, stiff with gore and covered with filth to a degree and of a kind no one could write about; their persons covered with vermin . . .
We have not seen a drop of milk, and the bread is extremely sour. The butter is most filthy; it is Irish butter in a state of decomposition; and the meat is more like moist leather than food. Potatoes we are waiting for, until they arrive from France . . .
The military and medical authorities at Scutari viewed Nightingale's intervention as a reflection on themselves. Many of her own volunteers were inexperienced, and the behaviour of the orderlies was offensive to the women. However, before the end of 1854, Nightingale and her nurses had brought the Scutari hospital into better order. The relief fund organised by The Times sent out stores; other voluntary associations at home were helpful. In December forty-six more nurses went to the Crimea. Nightingale quickly established a vast kitchen and a laundry; she looked after the soldiers' wives and children, and to provided daily necessities for them. She was on her feet for twenty hours a day and her nurses were also overworked; however, she was the only woman whom she allowed to be in the wards after eight at night, when the other nurses' places were taken by orderlies. The wounded men called her ‘The Lady of the Lamp.’ Longfellow tried to express the feelings for Nightingale in his poem, Santa Filomena .
Florence Nightingale [[at hospital door as wounded soldiers arrive] by Arthur George Walker, R.A. 1861-1936. Bronze. Part of the Crimean War Memorial located at the junction of Lower Regent Street and Pall Mall, London.
Early in 1855, because of the defects in the sanitation system, there was a great increase in the number of cases of cholera and of typhus fever among Nightingale's patients. Seven of the army doctors and three of the nurses died. Frost-bite and dysentery from exposure in the trenches before Sevastopol made the wards fuller than before. There were over 2000 sick and wounded in the hospital and in February 1855 the death-rate rose to 42%. The War Office ordered the sanitary commissioners at Scutari to carry out sanitary reforms immediately, after which the death-rate declined rapidly until in June it had fallen to 2%.
In May 1855 Nightingale visited the hospitals at and near Balaclava along with Mr. Bracebridge and Alexis Soyer . Nightingale fell ill from Crimean fever and she was dangerously ill for twelve days. Early in June she returned to Scutari and resumed her work there. In addition to her nursing work she tried to provide reading and recreation rooms for the men and their families. In March 1856 she returned to Balaclava and remained there until July when the hospitals were closed. She returned to England privately in August 1856, in a French ship. She entered England unnoticed and went home to Lea Hurst.
In September 1856 Nightingale visited Queen Victoria at Balmoral and told the Queen and Prince Albert about everything that 'affects our present military hospital system and the reforms that are needed'. In November 1855 a Nightingale fund had been set up to found a training school for nurses. This was the only recognition of her services of which Nightingale would approve. By 1860, £50,000 had been collected and the Nightingale School and Home for Nurses was established at St. Thomas's Hospital . Nightingale's health and other occupations prevented her from accepting the post of superintendent but she watched the progress of the new institution with practical interest. She was able to use her experiences in the Crimea for the benefit of the nursing profession.
She settled in London and lived the retired life of an invalid, although she spent a great deal of time offering advice and encouragement through her writing and also verbally. In 1857 she issued an exhaustive and confidential report on the workings of the army medical departments in the Crimea and in 1858 she published Notes on Matters affecting the Health, Efficiency and Hospital Administration of the British Army. In 1858 a Commission was appointed to inquire into the sanitary condition of the army: it set a high value on her evidence. In 1859 an army medical college was opened at Chatham and the first military hospital was established in Woolwich in 1861. During the American Civil War and the Franco-Prussian War of 1870-71 her advice was sought by the respective governments. Nightingale was involved in establishing the East London Nursing Society (1868), the Workhouse Nursing Association and National Society for providing Trained Nurses for the Poor (1874) and the Queen's Jubilee Nursing Institute (1890).
When the Indian Mutiny broke out in 1857 Nightingale offered to leave for India immediately if there was anything she could do. Her services were not required but she became interested in the sanitary condition of the army and people there. From her work, a Sanitary Department was established in the Indian government. She became familiar with many facets of Indian life and demanded that there should be improvements in health and sanitation there. She did not visit India. She wrote papers on the causes of famine, the need of irrigation and the poverty of the people of India. In 1890 she contributed a paper on village sanitation in India. Her book, Notes on Nursing first appeared in 1860 and was reprinted many times during in her lifetime.
She received was the Order of Merit in 1907 and in 1908 she was awarded the Freedom of the City of London. She had already received the German order of the Cross of Merit and the French gold medal of Secours aux Blessés Militaires. On 10 May 1910 she was presented with the badge of honour of the Norwegian Red Cross Society. Nightingale died in South Street, Park Lane, London, on 13 August 1910 at the age of ninety and was buried on 20 August in the family plot at East Wellow, Hampshire. An offer of burial in Westminster Abbey was refused by her relatives. Memorial services took place in St. Paul's Cathedral and Liverpool Cathedral, among many other places.
Related Material
| i don't know |
Who was given the nickname 'the American Moses' after leading the Mormon Pioneers to Utah? | Brigham Young - American Moses
by | Jul 8, 2008 | Past Leader Bios | 0 comments
Brigham Young—American Moses
Brigham Young, second Prophet and President of The Church of Jesus Christ of Latter-day Saints (which church is often misnamed the “Mormon Church”), ranks among the most influential and important historical figures, not just in Mormon history, but also in American history.
Biography of Brigham Young
Early Life
Brigham Young was born on June 1, 1801, in Whitingham, Vermont, to John and Abigail Young. His father was a revolutionary war veteran. After marrying Abigail, John Young settled in Massachusetts and then moved to Vermont shortly before Brigham Young was born. The ninth of twelve children, Brigham was born into a life full of work. He later commented that his early life was filled with toil and work, which left him no opportunities for education. While he had only eleven days of formal schooling, his parents taught him to read, and Young maintained a love of reading all his life.
His family moved to central New York when he was a boy and, in 1815, his mother, Abigail, who had long suffered from tuberculosis, died. John Young remarried a widow named Hannah Brown some time later. Brigham, however, decided that he needed to work for his own livelihood then and moved out at age 15. He moved to Auburn, New York, where he became an apprentice, and later master, carpenter, painter, and glazier.
In 1823, Young moved to Port Byron, New York, where he worked as a painter and carpenter and where, on October 5, 1824, he married Miriam Work. The couple then joined a local Methodist congregation. After four years, Young moved his new family to Oswego, New York, on Lake Ontario. There he joined a group of religious seekers. These seekers were part of a movement in nineteenth-century America of men and women (in study groups) searching the Bible themselves, trying to discover the truth. Later that year, Brigham’s family moved again to Mendon, New York. Miriam gave birth soon after the move and contracted tuberculosis. She became an invalid, and Young was required to take total control of the household, not only working as a carpenter and painter, but also caring for his wife and children. He made a rocking chair for his wife and, every morning, he carried her to it so she could look outside. Later, he would carry her back to bed.
Conversion to Mormonism
During his time in Mendon, Brigham Young worked hard at his trade and, even today, many items built by Brigham Young, including houses, remain in Mendon. In 1830, a young man named Samuel Smith, brother of Joseph Smith , came to Mendon to preach about the newly founded Church, the Church of Christ , or Mormon Church. Smith left a copy of the Book of Mormon with Brigham’s brother, Phineas, who read it, passed it to his father, John Young, who gave it to his daughter, who finally gave it to Brigham. Brigham was intrigued, but cautious. He had grown disillusioned with the denominations of his day and continued to read the Bible on his own. For two years he carefully studied the Book of Mormon and put it to every test he could devise. He studied the Bible as well. Finally, in early 1832, a young Mormon missionary gave a humble testimony of the Book of Mormon in Brigham’s presence. Brigham later said that this humble testimony entered like fire into his bones, and he knew the truth. He and his family, including his brothers, were baptized in spring of 1832. Miriam was baptized, too, but died several months thereafter from tuberculosis. Brigham immediately began preaching the restored Gospel of Jesus Christ in the regions around Mendon. He left his children in the care of Heber C. Kimball, a fellow convert in Mendon, during these missionary excursions.
After Miriam ’s death in September 1832, Brigham went to Kirtland, Ohio, to meet Joseph Smith, the Prophet. In that first encounter, he prayed with gathered Mormons in Kirtland and was the first person in the Mormon Church to speak in tongues . Brigham was assigned to go on a mission to Canada early in 1833, and upon his return, he learned that Joseph Smith was asking the Mormons to gather together. Brigham was asked to lead the Mormons living in and around Mendon to Kirtland. He did so, and was reunited with his family. During this gathering, he met Mary Ann Angell, a convert from New York who had joined the Church in Rhode Island. On February 14, 1834, the pair were married in Kirtland.
Call to Leadership
In the summer of 1834, Brigham Young and Joseph Young, one of his brothers, participated in Zion’s Camp , the march to help the driven and oppressed Mormons living in Missouri. Though the expedition was unable to do anything more than comfort them, Brigham later said that this experience was among the greatest learning experiences of his life. Shortly after the return of Zion’s Camp, Brigham Young was called to be a member of the Quorum of the Twelve Apostles . Over the next few summers, Brigham Young alternated his time between summers going on missions throughout the United States and Canada, and the rest of year where he helped with constructing the Kirtland Temple . As a glazier and carpenter, he was particularly responsible for the windows of the temple.
His rise in prominence among the leaders of the Church caused him some problems, when in 1836 and 1837, some in the Church rebelled against Joseph Smith and denounced him as a fallen prophet. Brigham’s loyalty to Joseph Smith caused some to threaten his life, too, and he was forced to flee from Kirtland. When the Church moved to Missouri, Young went too, and helped lead the Mormons to Caldwell County, Missouri, where the Mormons were settling. This new home was very temporary, as conflict erupted between the Mormons and their neighbors who viewed them as a threat, a belief which many Mormons unfortunately stoked by banding together for protection and forming militias.
The governor issued the infamous “Extermination Order” in October 1838, and the Mormons were forced out on pain of death. Joseph and other leaders were imprisoned, leaving Brigham Young temporarily in charge. He organized the several thousand Mormons and drafted the “Missouri Covenant” which pledged everyone to assist each other until the last Mormon was safely out. The exodus was made more dangerous and difficult because it was carried out during the bitterly cold winter months. They succeeded, and by early 1839, the Mormons were becoming established in their new home, Nauvoo, Illinois. Joseph was released from prison in April of 1839 and helped select the location of the new city.
In 1839, Brigham Young began building his new house in Nauvoo, but soon left on another mission, this time to England. He left, even though many, including himself and members of his family, were extremely sick. This mission of the Quorum of the Twelve Apostles was the first foreign mission of the Mormon Church. Traveling was difficult because of illness, but they at last reached England in April of 1840. Before his return, nearly 8,000 people would be baptized in England while Brigham Young presided. He oversaw the printing of the Book of Mormon in England, as well as hymnals, thousands of tracts, and a newspaper, The Millennial Star. He also established an organization that would help Mormons emigrate to America.
Upon his return, a revelation was given through the Prophet Joseph Smith concerning Brigham. It said:
Dear and well-beloved brother, Brigham Young, verily thus saith the Lord unto you: My servant Brigham, it is no more required at your hand to leave your family as in times past, for your offering is acceptable to me. I have seen your labor and toil in journeyings for my name. I therefore command you to send my word abroad, and take especial care of your family from this time, henceforth and forever. Amen (Doctrine and Covenants 126:1-3).
Except for one small trip in 1844, Brigham Young did not go on long missions as he had done nearly every year since learning about Mormonism, but rather remained with his family and became one of the great leaders of the Mormon Church. In Nauvoo, he oversaw outgoing missionaries and still spent parts of his summers preaching in areas near Nauvoo. He was part of the many important revelations and teachings that came during this period and was tested greatly in his faith. In early 1842, he was one of the first to participate in the Mormon temple ceremony and later he was among the first to be introduced to polygamy , or plural marriage as the Mormons called it. Brigham later recalled that he was horrified when he first learned about polygamy and even wished to die for a time, but later he came to realize that it was a commandment from God. Brigham would ultimately marry many women and father 56 children.
Mormon Exodus
Peace did not last long in Nauvoo. While Brigham Young and other leaders left for missions in early 1844, Joseph Smith remained behind. On June 27, 1844, Smith was murdered in Carthage Jail. Brigham Young and the other Apostles could not get back until early August. On August 8, 1844, a meeting was held to decide who should succeed Joseph Smith. Some tried to claim the leadership, but Brigham Young spoke reminding the Mormons that the Quorum of the Twelve Apostles had been charged by Joseph before his death with leading the Mormon Church and held all the keys to the restored priesthood . The assembly agreed and the work went on.
The second Mormon temple was completed by December, 1845. Mob violence, however, forced the Mormons to prepare to leave. The first group left in February of 1846, crossing the frozen Mississippi river. Before going, most Mormons took part in the Mormon temple ceremonies . They also signed the “Nauvoo Covenant” which committed the Mormons to assist one another in the planned exodus to the west.
Spring was muddy, and the Mormons trudged with difficulty over the soggy Iowa trails, reaching what they called Winter Quarters in Nebraska by fall. Approximately 16,000 Mormons were scattered throughout Iowa and Nebraska. At this time the U.S. army requested 500 men to help fight the Mexican War. The Mormons would receive much needed money in exchange for this loss of men, and it was Brigham Young who had the prophetic foresight to see the potential good. These men, the Mormon Battalion would have their own, fascinating trek west.
During the winter they organized into companies and in early April, 1847, Brigham Young and the first 148 Mormon Pioneers began the trek west for Utah. This company arrived in the Salt Lake Valley on July 24, 1847. The small colony began planting crops and preparing homes for the next wave. Young and others returned to help guide the next companies. The December after returning, Brigham Young was sustained as second President of the Mormon Church. By 1850, most of the 16,000 Saints were settled in the Rocky Mountains.
The Utah War and the Mountain Meadows Massacre
The Missouri Compromise created the Utah Territory in 1850, and Brigham Young was appointed as governor by U.S. President Millard Fillmore. The early 1850s were devoted to settling the territory and building homes. In 1853, Mormons began building the Salt Lake Temple. Young established the Perpetual Emigration Fund which provided funds to immigrating Mormons, who then repaid what they could once they were established. The money was then loaned to the next pioneer. The Mormons established colonies for harvesting everything from cotton to ore to fruit.
In 1856, Mormon leaders grew concerned about laxity in religious matters among the Mormons and started the Mormon Reformation that stressed re-baptism and hence recommitment to the Gospel, and created the system of Home Teaching pairs of Elders oversee the welfare of assigned families. At the same time, federally appointed judges and officials, who often insulted and harassed the Mormons, were ejected from the state. They returned to Washington to report that the territory was in rebellion against the United States. As no railroad or telegraph existed, the only news came by other travelers or couriers. President Buchanan, believing the reports, cut off all mail supply to Utah, removed Young from the governorship (but did not inform him) and sent an army of 5,000 men to quell the supposed rebellion.
The Utah War, as it came to be known, was not much of a war. No battles were fought. In July 1857, Mormons returning from the east reported an army was coming. Brigham Young, fearing that this was another attempt to oust the Mormons as had been done in Missouri and Illinois, refused to leave this time. The Mormons evacuated Salt Lake City and posted militias in the canyons leading to Utah. Determined to avoid bloodshed, the militias were only permitted to harass and delay the army. This they did by burning grass and scattering horses. The tactics worked. The army could not enter until early 1858, by which time cooler heads on both sides prevailed. Brigham Young stepped down as governor, to be replaced by Alfred Cummings, and the army settled west of Salt Lake at Camp Floyd, where they remained until the Civil War.
The only tragic incident in the Utah War was the so-called Mountain Meadows massacre in September of 1857. In the midst of the renewed zeal of the Reformation and the heightened tensions caused by the invading army and murder in Arkansas of a favorite son, Mormon settlers and Piute Indians in southern Utah attacked and massacred a traveling company of settlers from Arkansas and Missouri. Letters sent by Brigham Young warning the Mormons to leave these settlers alone came too late (See “Shining New Light on the Mountain Meadows Massacre” for more information about Brigham Young and the massacre). After the massacre, Mormons, fearful that another army would be sent if the incident became widely known, stayed silent for many years. Ultimately, one of the leaders, John D. Lee, was executed for his involvement.
The Mormons in Utah
Brigham Young did not let the tragic events of 1857 keep him from moving forward with the work of establishing Utah and building up the Mormon Church. In 1861, Brigham Young and the Mormon Church helped establish the transcontinental telegraph. He contracted with the Union Pacific and Central Pacific railroads to have Mormons help finish the transcontinental railroad and later he oversaw the construction of spur lines throughout Utah and Idaho. In the 1860’s the Mormons, under Young’s direction, established cooperatives to help produce sugar, cotton, wool, iron, and so on. They also established cooperative stores to facilitate exchanging the goods.
Young loved education. The Mormon Church under his direction established schools for every grade level including three colleges. In 1850, the University of Deseret, later the University of Utah, was established as a co-education school. In 1875 the Brigham Young Academy, later Brigham Young University was established in Provo. In 1877, the Brigham Young College was built in Logan, Utah. It was shut down in 1926 and all students, staff, and equipment were combined with Utah State University. President Young also built Mormon temples . Though he never lived to see the Salt Lake Temple finished, he did oversee the dedication of the St. George Temple in 1877. Other temples in Manti and Logan, both in Utah, were begun. Overall, the 1860s and most of the 1870s were much more peaceful. Colonization and immigration continued. By the time of Brigham Young’s death in 1877, there were more than 115,000 Mormons, 70,000 of whom immigrated to Utah under Young’s leadership.
Brigham Young’s Family
Brigham Young refused to discuss the private details of his family life. He had in his lifetime 26 wives, and 56 children by 16 of those wives. He took good care of his family and was not considered dictatorial or autocratic by them. He even granted a couple of divorces to his wives. Beyond those 26, Brigham young married other women, with whom he did not cohabitate (See Polygamy for a more detailed account of the various types of polygamous marriages). Young married these women to support them and their children financially. Brigham Young and his brothers built several homes in Utah, including the famous Lion House . He also had homes in Logan and St. George where he stayed while visiting the Mormon congregations throughout the territory.
Brigham Young’s Death
In April of 1877, Brigham Young oversaw the dedication of the St. George Temple. He reintroduced the fullness of the Mormon temple ceremonies there. He returned to Salt Lake in poor health. From his office he continued to guide the Church with written statements. That summer he worked to refine the organization of the Church and harmonize its many disparate organizations. On August 29, 1877, the “Lion of the Lord,” so called because of his fearlessness in proclaiming the truth, died at age 76. He was interred on his property in Salt Lake City.
Brigham Young’s Legacy
Brigham Young is one of the most important figures in Mormon and American history . Under his leadership the Mormon Church grew from 26,000 to over 115,000 members. Nearly 100,000 of those lived in Utah, Idaho, Arizona, Nevada, and Wyoming in one of the over 400 settlements founded under his guidance. He assisted in completing both the transcontinental telegraph and railroad and established a railroad system throughout Utah, Idaho, and Wyoming. He directed the immigration of 70,000 people to the Rocky Mountains, and even parts of Colorado and California. By trade he was a carpenter, painter, and glazier, and practiced these crafts all his life, building many of his own homes and most of his furniture, which exhibit his high degree of craftsmanship. He oversaw large-scale irrigation projects that rendered farmable large tracts of Idaho, Arizona, and Utah. He established cooperatives that produced everything from cotton to iron, and directed the creation of the first incorporated department store in the world, ZCMI. An organizational genius with a gift for leadership, he served two terms as governor of Utah, and spent nearly 30 years as President of the Mormon Church.
His proudest accomplishment, no doubt, was his family, about which he was reluctant to speak, considering it a personal matter between himself, his family, and his God. Polygamy is often associated with him and he is the most famous polygamist in Mormon history, even though his predecessor, Joseph Smith , introduced the doctrine. Young, while he defended the doctrine as divine, would not discuss the private details of his life with others, but his 56 children considered him a devoted, caring father. He was also an advocate for women’s right to vote (Utah gave women the right to vote in 1870), and to obtain education. He ensured that the women of his own family had opportunities to go to college. While he himself had only eleven days of formal schooling, he read widely and established three co-educational colleges before his death. He advocated freedom to practice one’s religion, peaceful relations with one’s neighbors, and the importance of serving others. He also cared deeply about nature and would not stand by and see it be abused by thoughtless men.
Brigham Young is often considered controversial by those who misunderstand him. He has had many nicknames, “American Moses,” “Lion of the Lord,” and even “the most married man in America.” To Mormons, he is one of the greatest prophets ever to have lived. While remembered most often for his practical deeds, he was also a great teacher and delivered hundreds of orations in his life on everything from the best way to reprimand children, to the nature of God. Among Mormons he is considered one of the greatest Prophets of the Most High.
Submit a Comment
| Brigham Young |
The name of which foodstuff, made by coagulating Soya milk, means 'bean curd' in Japanese? | Brigham Young - Mormonism, The Mormon Church, Beliefs, & Religion - MormonWiki
4 Links
Brigham Young--American Moses
Brigham Young, second President of The Church of Jesus Christ of Latter-day Saints , better known as the Mormon Church , ranks among the most influential and important historical figures not just in Mormon, but also in American history. He is called the "American Moses" because of his leadership of the "Mormon Exodus" to the western territories. Even the Lord associated him with Moses, and called the pioneers moving westward the "Camp of Israel." (See Doctrine and Covenants 136 .)
Biography of Brigham Young
Early Life
Brigham Young was born on June 1, 1801 , in Whitingham, Vermont, to John and Abigail Young. His father was a revolutionary war veteran. After marrying Abigail, John Young settled in Massachusetts. The family moved to Vermont shortly before Brigham Young was born. The ninth of twelve children, Brigham was born into a life full of work. He later commented that his early life was filled with toil and work, which left him no opportunities for education. While he had only eleven days of formal schooling, his parents taught him to read, and Young maintained a love for reading all his life.
His family moved to central New York when he was a boy, and in 1815 his mother, Abigail, who had long suffered from tuberculosis, died. Some time later, John Young married a widow named Hannah Brown. Brigham, however, decided that he needed to work for his own livelihood now and moved out at age 15. He moved to Auburn, New York where he became an apprentice, and later master carpenter, painter, and glazier.
In 1823 Young moved to Port Byron, New York, where he worked as a painter and carpenter and where on October 5, 1824 , he married Miriam Work. The couple then joined a local Methodist congregation. After four years, Young moved his new family to Oswego, New York, on Lake Ontario, where he joined a group of religious seekers, a movement in nineteenth-century America of men and women searching the Bible themselves in study groups trying to discover the truth. Later that year they moved again to Mendon, New York. Miriam gave birth soon after the move and contracted tuberculosis. She became a virtual invalid and Young was required to take total control of the household, not only working as a carpenter and painter, but also caring for his wife and children. He made a rocking chair for his wife, and every morning he carried her to it where she could look outside. Later he would carry her back to bed.
Conversion to Mormonism
During his time in Mendon, Brigham Young worked hard at his trade. Even today, many items built by Brigham Young, including houses, remain in Mendon. In 1830 a young man named Samuel Smith, brother to Joseph Smith , came to Mendon to preach about the newly founded Church, the Church of Christ , or Mormon Church . Smith left a copy of the Book of Mormon with Brigham’s brother, Phineas, who read it, and passed it to his father, John Young. John Young gave it to his daughter, who finally gave it to Brigham. Brigham was intrigued, but cautious. He had grown disillusioned with the denominations of his day and continued to read the Bible on his own. For two years he carefully studied the Book of Mormon and put it to every test he could find. He studied the Bible as well. Finally, in early 1832, a young Mormon missionary gave a humble testimony of the Book of Mormon in Brigham’s presence. Brigham later said that this humble testimony entered like fire into his bones and he knew the truth. He and his family, including his brothers, were baptized in spring of 1832 . Abigail was baptized, too, but died several months thereafter from tuberculosis.
Brigham immediately began preaching the restored Gospel of Jesus Christ in the regions around Mendon. He left his children in the care of Heber C. Kimball , a fellow convert in Mendon, during these missionary excursions.
After Miriam’s death in September 1832 , Brigham went to Kirtland, Ohio, to meet Joseph Smith , the Prophet . In that first encounter, he prayed with gathered Mormons in Kirtland and was the first person in the Mormon Church to speak in tongues. Brigham was assigned to go on a mission to Canada early in 1833 and upon his return he learned that Joseph Smith was asking the Mormons to gather together. Brigham was asked to lead the Mormons living in and around Mendon to Kirtland. He did so and was reunited with his family. During this gathering, he met Mary Ann Angell, a convert from New York who had joined the Church in Rhode Island. On February 14, 1834 , the pair were married in Kirtland.
Rise to Leadership
In the summer of 1834 , Brigham Young and Joseph Young, one of his brothers, participated in Zion's Camp , the march to help the driven and oppressed Mormons living in Missouri. Though the expedition was unable to do anything more than comfort them, Brigham later said that this experience was among the greatest learning experiences of his life. Shortly after the return of Zion’s Camp, Brigham Young was called to be a member of the Quorum of the Twelve Apostles . Over the next few summers, Brigham Young alternated his time between going on missions throughout the United States and Canada during the summer months, and helping with the construction of the Kirtland Temple the rest of the year. As a glazier and carpenter, he was particularly responsible for the windows of the temple.
His rise in prominence among the leaders of the Church caused him some problems when in 1836 and 1837 , some in the Church rebelled against Joseph Smith and denounced him as a fallen prophet. Brigham’s loyalty to Joseph Smith caused some to threaten his life, too, and he was forced to flee from Kirtland. When the Church moved to Missouri , Young went too, and helped lead the Mormons to Caldwell County, Missouri where the Mormons were settling. Peace in this new home did not last long, as conflict erupted between the Mormons and their neighbors, who viewed them as a threat, a belief which many Mormons unfortunately stoked by banding together for protection and forming militias.
The governor issued the infamous “Extermination Order” in October 1838 , and the Mormons were forced out under threat of death. Joseph and other leaders were imprisoned, leaving Brigham Young temporarily in charge. He organized the several thousand Mormons and drafted the “Missouri Covenant,” which pledged everyone to assist each other until the last Mormon was safely out of the state. They succeeded, and by early 1839 , the Mormons were getting established in their new home, Nauvoo , Illinois. Joseph was released from prison in April of 1839 and helped select the new city.
Brigham Young's home in Nauvoo, 2000 Chad Nichols, MormonImages.com
In 1839 , Brigham Young began building his new house in Nauvoo, but soon left on another mission, this time to England. He left, even though many, including himself and members of his family, were sick. This mission of the Quorum of the Twelve Apostles was the first foreign mission of the Mormon Church. Traveling was difficult because of illness, but they at last reached England in April of 1840 . Before his return, nearly 8,000 people would be baptized in England while Brigham Young presided. He oversaw the printing of the Book of Mormon in England, as well as hymnals, thousands of tracts, and a newspaper, The Millennial Star. He also established an organization that would help Mormons emigrate to America.
Upon his return, a revelation was given through the Prophet Joseph Smith concerning Brigham. It said:
Dear and well-beloved brother, Brigham Young, verily thus saith the Lord unto you: My servant Brigham, it is no more required at your hand to leave your family as in times past, for your offering is acceptable to me. I have seen your labor and toil in journeyings for my name. I therefore command you to send my word abroad, and take especial care of your family from this time, henceforth and forever. Amen. (Doctrine and Covenants 126:1-3)
Except for one small trip in 1844 , Brigham Young did not go on long missions as he had done nearly every year since learning about Mormonism, but rather remained with his family and became one of the great leaders of the Church. In Nauvoo, he oversaw outgoing missionaries and still spent parts of his summers preaching in areas near Nauvoo. He was part of the many important revelations and teachings that came during this period and was tested greatly in his faith. In early 1842 , he was one of the first to participate in the Mormon temple ceremony, and later he was among the first to be introduced to polygamy , or plural marriage as the Mormons called it. Brigham later recalled that he was horrified when he first learned about polygamy and even wished to die for a time, but later he came to realize that it was a commandment from God. Brigham would ultimately marry many women and father 56 children.
Mormon Exodus
Peace did not last long in Nauvoo. While Brigham Young and other leaders left for missions in early 1844 , Joseph Smith remained behind. On June 27, 1844 , Smith was murdered in Carthage Jail . Brigham Young and the other Apostles could not get back until early August. On August 8, 1844, a meeting was held to decide who should succeed Joseph Smith . Some tried to claim the leadership, but Brigham Young spoke reminding the Mormons that the Quorum of the Twelve Apostles had been charged by Joseph before his death with leading the Church. The assembly agreed and the work went on.
The Nauvoo temple was completed by December, 1845 . Mob violence, however, forced the Mormons to prepare to leave. The first group left in February of 1846 , crossing the frozen Mississippi river. Before going, most Mormons took part in the Mormon temple ceremonies . They also signed the “Nauvoo Covenant” which committed the Mormons to assist one another in the exodus .
Spring was muddy and the Mormons trudged with difficulty over the soggy Iowa trails, reaching what they called Winter Quarters in Nebraska by fall. Approximately 16,000 Mormons were scattered throughout Iowa and Nebraska. At this time the U.S. army requested 500 men to help fight the Mexican War. The Mormons would receive much needed money in exchange for this loss of men. Brigham Young prophesied that the money would be of great help with the trek west, and that if the volunteers were faithful, none would be injured during the time of their service. These men, the Mormon Battalion , were destined to have their own fascinating trek west.
During the winter the Mormon pioneers organized into companies, and in early April, 1847 , Brigham Young and the first 148 Mormon Pioneers began the trek west for Utah. This company arrived in the Salt Lake Valley on July 24, 1847 . President Young said, “I directed Brother Woodruff to turn the carriage half way round so that I could have a look at a portion of the Salt Lake Valley. The Spirit of light rested upon me, and hovered over the valley, and I felt that there the Saints would find protection and safety; and that darkness which had rested over every place where we had been in the States vanished altogether.” (Condensed manuscript history of Brigham Young)
The small colony began planting crops and preparing homes for the next wave of immigrants. Young and others returned to help guide the next companies. The December after returning, Brigham Young was sustained as second President and Prophet of the Mormon Church. By 1850 , most of the 16,000 Saints were settled in the Rocky Mountains.
The Utah War and the Mountain Meadows Massacre
The Missouri Compromise created the Utah Territory in 1850 , and Brigham Young was appointed as governor. The early 1850s were devoted to settling the territory and building homes. In 1853 , Mormons began building the Salt Lake Temple. Young established the Perpetual Emigration Fund, which provided funds to immigrating Mormons, who then repaid what they could once they established themselves. The money was then loaned to the next pioneer. The Mormons established colonies for harvesting everything from cotton to ore to fruit.
In 1856 , Mormon leaders grew concerned about laxity in religious matters among the Mormons and started the Mormon Reformation, stressing re-baptism and hence recommitment to the Gospel. They also created the system of Home Teaching , where members look out for one another. At the same time, federally appointed judges and officials, who often insulted and harassed the Mormons, were ejected from the state. They returned to Washington to report that the territory was in rebellion against the United States. As no railroad or telegraph existed, the only news came through travelers or couriers. President Buchanan, believing the reports, cut off all mail supply to Utah, removed Young from the governorship (but did not inform him), and sent an army of 5,000 men to quell the supposed rebellion.
The Utah War , as it came to be known, was not much of a war. No battles were fought. In July 1857 , Mormons returning from the east reported an army was coming. Brigham Young, fearing that this was another attempt to oust the Mormons as had been done in Missouri and Illinois, refused to leave this time. The Mormons evacuated Salt Lake City and posted militias in the canyons leading to Utah. Determined to avoid bloodshed, the militias were only permitted to harass and delay the army. This they did by burning grass and scattering horses. The tactics worked. The army could not enter until early 1858 , by which time cooler heads on both sides prevailed. Brigham Young stepped down as governor, to be replaced by Alfred Cummings, and the army settled west of Salt Lake at Camp Floyd, where they remained until the Civil War.
The only tragic incident in the Utah War was the so-called Mountain Meadows massacre [1] in September of 1857. In the midst of the renewed zeal of the Reformation and the heightened tensions caused by the invading army, Mormon settlers and Piute Indians in southern Utah attacked and massacred a traveling company of settlers from Arkansas and Missouri. Letters sent by Brigham Young warning the Mormons to leave the settlers alone came too late (See “Shining New Light on the Mountain Meadows Massacre” for more information about Brigham Young and the massacre). After the massacre, Mormons, fearful that others would attack them, stayed silent for many years. Ultimately one of the perpetrators, John D. Lee, was executed for his involvement.
The Mormons in Utah
Brigham Young did not let the tragic events of 1857 keep him from moving forward with the work of establishing Utah and building up the Mormon Church. In 1861 , Young helped establish the transcontinental telegraph. He contracted with the Union Pacific and Central Pacific railroads to have Mormons help finish the transcontinental railroad, and later he oversaw the construction of spur lines throughout Utah and Idaho. In the 1860’s the Mormons, under Young’s direction, established cooperatives to help produce sugar, cotton, wool, iron, and other goods. They also established cooperative stores to facilitate exchanging the goods.
Young loved education. The Mormon Church under his direction established schools for every grade level including three colleges. In 1850 , the University of Deseret, later the University of Utah, was established as a co-education school. In 1875 the Brigham Young Academy, later Brigham Young University was established in Provo. In 1877 , the Brigham Young College was built in Logan, Utah. It was shut down in 1926 and all students, staff, and equipment were combined with Utah State University.
President Young also built temples. Though he never lived to see the Salt Lake Temple finished, he did oversee the dedication of the St. George Temple in 1877 . Other temples in Manti and Logan, both in Utah, were begun.
Overall, the 1860s and most of the 1870s were much more peaceful. Colonization and immigration continued. By the time of his death in 1877 , there were more than 115,000 Mormons, 70,000 of whom immigrated to Utah under Young’s leadership.
Brigham Young’s Family
The "Beehive House," one of Young's homes in Salt Lake City. c2002 Brigham Young University. All rights reserved.
Brigham Young refused to discuss the private details of his family life. He had in his lifetime 26 wives and 56 children by 16 of those wives. He took good care of his family and was not considered dictatorial or autocratic by them. He even granted a couple of divorces to his wives. Beyond those 26, Brigham Young married other women, with whom he did not cohabit (See Polygamy for a more detailed account of the various types of polygamous marriages). Young married these women to support them and their children financially, as there were many more female converts to the Church than male.
Brigham Young and his brothers built several homes in Utah, including the famous Lion House . He also had homes in Logan and St. George, where he stayed while visiting the Mormon congregations throughout the territory.
Brigham Young’s Death
In April of 1877 , Brigham Young oversaw the dedication of the St. George Temple. He reintroduced the fullness of the Mormon temple ceremonies there. He returned to Salt Lake in poor health. From his office he continued to guide the Church with written statements. That summer he worked to refine the organization of the Church and harmonize its many disparate organizations. On August 29, 1877 , the “Lion of the Lord,” so called because of his fearlessness in proclaiming the truth, died at age 76. He was interred on his property in Salt Lake City.
Brigham Young’s Legacy
Brigham Young represents Utah in Statuary Hall.
Brigham Young is one of the most important figures in Mormon and American history. Under his leadership the Mormon Church grew from 26,000 to over 115,000 members. Nearly 100,000 of those lived in Utah, Idaho, Arizona, Nevada, and Wyoming in one of the over 400 settlements founded under his guidance. He assisted in completing both the transcontinental telegraph and railroad and established a railroad system throughout Utah, Idaho, and Wyoming. He directed the immigration of 70,000 people to the Rocky Mountains, and even parts of Colorado and California. By trade he was a carpenter, painter, and glazier, and practiced these crafts all his life, building many of his own homes and most of his furniture, which exhibit his high craftsmanship. He oversaw large-scale irrigation projects that rendered fertile large tracts of Idaho, Arizona, and Utah. He established cooperatives which produced everything from cotton to iron, and directed the creation of the first incorporated department store in the world, ZCMI . An organizational genius with a gift for leadership, he served two terms as governor of Utah and served nearly 30 years as President and Prophet of the Mormon Church.
His proudest accomplishment, no doubt, was his family, about which he was reluctant to speak, considering it a personal matter between himself, his family, and his God. Polygamy is often associated with him, and he is the most famous polygamist in American history, even though his predecessor, Joseph Smith , introduced the doctrine. He was an advocate for women’s right to vote (Utah gave women the right to vote in 1870 ), and to obtain education. He ensured that the women of his own family had opportunities to go to college. While he himself had only eleven days of formal schooling, he read widely and established three co-educational colleges before his death. He advocated freedom to practice one’s religion, peaceful relations with one’s neighbors, and the importance of serving others. He also cared deeply about nature and would not stand by and see it be abused by thoughtless men.
Brigham Young is often considered controversial by those who misunderstand him. He has had many nicknames, “American Moses,” “Lion of the Lord,” and even “the most married man in America.” To Mormons, he is one of the greatest prophets ever to have lived. While remembered most often for his practical deeds, he was also a great teacher and delivered hundreds of orations in his life on everything from the best way to reprimand children, to the nature of God. Among Mormons he is considered one of the greatest Prophets of the Most High.
| i don't know |
In which country is Potsdam, the site of the famous conference after World War II? | Potsdam Conference | World War II | Britannica.com
World War II
Harry S. Truman
Potsdam Conference, (July 17–August 2, 1945), Allied conference of World War II held at Potsdam , a suburb of Berlin. The chief participants were U.S. President Harry S. Truman , British Prime Minister Winston Churchill (or Clement Attlee , who became prime minister during the conference), and Soviet Premier Joseph Stalin .
Overview of the Potsdam Conference.
Contunico © ZDF Enterprises GmbH, Mainz
Winston Churchill, Harry Truman, and Joseph Stalin during the Potsdam Conference.
Encyclopædia Britannica, Inc.
The conferees discussed the substance and procedures of the peace settlements in Europe but did not attempt to write peace treaties. That task was left to a Council of Foreign Ministers . The chief concerns of the Big Three, their foreign ministers, and their staffs were the immediate administration of defeated Germany , the demarcation of the boundaries of Poland , the occupation of Austria , the definition of the Soviet Union’s role in eastern Europe, the determination of reparations, and the further prosecution of the war against Japan . The amity and good will that had largely characterized former wartime conferences was missing at Potsdam , for each nation was most concerned with its own self-interest, and Churchill particularly was suspicious of Stalin’s motives and unyielding position.
World War II: Potsdam
The Potsdam Conference’s Declaration on Germany stated, “It is the intention of the Allies that the German people be given the opportunity to prepare for the eventual reconstruction of their life on a democratic and peaceful basis.” The four occupation zones of Germany conceived at the Yalta Conference were set up, each to be administered by the commander-in-chief of the Soviet, British, U.S. , or French army of occupation. Berlin , Vienna , and Austria were also each divided into four occupation zones. An Allied Control Council made up of representatives of the four Allies was to deal with matters affecting Germany and Austria as a whole. Its policies were dictated by the “five Ds” decided upon at Yalta: demilitarization, denazification, democratization , decentralization, and deindustrialization. Each Allied power was to seize reparations from its own occupation zones, although the Soviet Union was permitted 10–15 percent of the industrial equipment in the western zones of Germany in exchange for agricultural and other natural products from its zone.
Similar Topics
| Germany |
Which is the largest nerve in the human body? | Germany Relaxa Schlosshotel Cecilienhof
Single rooms: 110–141 euros
Double rooms: 140–222 euros
Suites from 215–262 euros
Rates include tax and service
Open: all year
Getting there
Potsdam is about 25 km southwest of Berlin. The S-Bahn line #7 will take you to Potsdam.
What to do
Nearby: palaces and gardens of Sanssousi Park; golf; hiking; horseback riding; Filmpark Babelberg; Berlin
Weddings
Yes. Inquire hotel for details.
The hotel has closed for extensive renovation. It is expected to reopen in 2018.
When people come out to visit the amazing complex of Potsdam’s Sanssousi Park, they don’t realize that they can spend the night in one of the parks most historic palaces.
The hotel operates in only a small part of the palace; the rest is open to the public for day visits.
Walking paths lead from the hotel through gentle woods and along two lakes. And with the English country manor design, you think you’re somewhere in the UK and not Germany.
Spacious guest rooms have views of either the park or the lake. Individually decorated, they are comfortable and attractive. The wedding suite features a large canopied bed.
You can dine either in an elegant, candlelight dining room or on an outdoor garden terrace when the weather is fine.
Something special
Location, location location...Cecilienhof is part of Potsdam’s Sanssousi Park, a UNESCO World Heritage site.
| i don't know |
Who stars as the title character in Ridley Scott's 2010 film 'Robin Hood'? | First Trailer and Pictures from Ridley Scott's 'Robin Hood' - ComingSoon.net
December 15, 2009
SHARE
A bootleg version of this Robin Hood trailer showed up late last night but the swiftness with which Universal took it down from YouTube led me to believe the official version would be online soon and sure enough here it is via Apple along with the first three photos from the film.
Robin Hood is directed by Ridley Scott and Russell Crowe stars as the title character as the film chronicles the life of an expert archer, previously interested only in self-preservation, from his service in King Richard’s army against the French. Upon Richard’s death, Robin travels to Nottingham, a town suffering from the corruption of a despotic sheriff and crippling taxation, where he falls for the spirited widow Lady Marion (Cate Blanchett), a woman skeptical of the identity and motivations of this crusader from the forest. Hoping to earn the hand of Maid Marion and salvage the village, Robin assembles a gang whose lethal mercenary skills are matched only by its appetite for life. Together, they begin preying on the indulgent upper class to correct injustices under the sheriff.
William Hurt, Mark Strong, Mark Addy, Oscar Isaac and Max von Sydow also star. The film hits theaters on May 14, 2010.
I have added the trailer directly below and the photos can be viewed right here .
You can also watch the trailer in high definition at Apple .
| Russell Crowe |
Who stars as the title character in Mike Newell's 2010 film 'Prince Of Persia: The Sands Of Time'? | “And So the Legend Begins”Ridley Scott’s Robin Hood | Tor.com
“And So the Legend Begins”Ridley Scott’s Robin Hood
Fri Jan 3, 2014 12:00pm 46 comments
I wanted to like Ridley Scott’s Robin Hood so much more than I did.
There are so many elements of the movie that I think are really clever, especially how Scott uses actual historical events to create a new plot for the familiar characters. Gone are tropes like the archery contest, dueling Little John on a bridge, wooing Marian from afar, and a climactic jail break.
In their place is the story of Robin Longstride, an archer returning from the Crusades, who impersonates a dead knight in the hopes of a free trip to England and maybe a small payday. But Robin impersonates the wrong knight, Sir Robert of Loxley, bringing him face to face with the new King John. Things get more complicated when, taking a page from The Return of Martin Guerre , Loxley’s father convinces Robin to continue the charade so that Loxley’s widow, Marian, can retain her lands. Now Robin, a thief at heart, finds himself responsible for a town, and in conflict with the local tax collector, the Sheriff of Nottingham.
That sounds like a pretty good Robin Hood plot, yeah? Unfortunately, it’s only the B plot. Because the A plot is “The Shockingly Bloody History of the Magna Carta, Oh And Also There Is Robin Hood.”
That’s right, Robin is relegated to a subplot in his own movie, so we can focus on King John’s best friend Godfrey(!). Godfrey, in the employ of Prince Philip of France(!!), leads a battalion of French soldiers around England, abusing peasants in the name of John, hoping to stir the northern barons into open rebellion. Both John and the barons are happy to go to war with each other, until Robin rides in with news of an impending French invasion(!!!) and a copy of the Magna Carta, which his dad wrote twenty years ago(!!!!). John agrees to sign, the barons choose not to rebel, and then they all go and beat up the French.
Oh! And then John declares Robin an outlaw and Robin escapes to Sherwood Forest, which means the whole two and half hour movie is an unnecessary and unnecessarily complicated origin story for Robin Hood. When the last title card came up,“And So The Legend Begins,” I actually started swearing at the screen.
It was awkward.
The movie’s not just a waste of your time, but also a waste of a fantastic cast. From Russell Crowe on down, the acting is pretty great, especially Cate Blanchett as a badass, no-nonsense Lady Marian. Scott’s direction does a great job of contrasting the carefree humor of Robin and his men with the brutal violence and grim living conditions around them. The music and cinematography are beautiful. But it’s all in service of a plot that takes too long to tell a story I don’t care about at all.
That’s why I personally dislike Scott’s Robin Hood more than Prince of Thieves. Prince of Thieves is objectively a worse movie, but it’s obviously bad so I don’t get invested in it. Robin Hood, on the other hand, is so close to being a great movie, but it’s really ruined by its terrible plot. And that’s disappointing.
Robin Hood
I really like Crowe’s take on Robin Hood. He’s a lot more dour than the Flynn/Bedford/Elwes carefree version, but he earns his gloominess as a soldier returning from war. He’s scarred. He’s tired. He’s lost any faith he ever had that his war was just, or his king divinely chosen. And yet he’s still capable of being happy, when he’s joking with his men, or flirt/fighting with Marian, or, in the movie’s one nod to Robin being a thief, robbing the hell out of a stagecoach.
The downside to Crowe’s Robin is that, like Costner, he’s plagued by daddy issues. At first he’s disdainful of his father’s low profession. Then he’s told his father was a 12th century prototype for John Locke who believed in the equality of all men, a fact Robin conveniently forgot about due to a bout of trauma induced amnesia. Suddenly Robin is plagued with doubt about whether he can live up to his father’s example. Spoiler, he can.
The Merry Men
The Merry Men are delightful, and again, I wish they had more screen time. Kevin Durand , who usually plays menacing goofball villains, plays Little John with a little more goofiness and a little less menace. Will Scarlett, so named for his red hair, is a lady’s man that paraphrases John Nash’s dating advice from A Beautiful Mind (“Start with the homely on the left.”) And Allan A’Dayle is played by Alan Doyle , frontman for Canadian folk-rock band Great Big Sea, which, wonderfully, turns this dark story into an honest to goodness musical.
Their collective interaction with Robin is a delightful. They’re not his army, or his employees, but his friends, and it shows. They don’t respect him or defer to him, but they do follow him simply because he usually has a good idea as to what to do next. They seem to genuinely like each other, and that’s fun to watch.
Rounding out the group, in another moment of perfect casting, is Mark Addy as Friar Tuck: former soldier, bee keeper, mead brewer, and the one who actually convinces Robin to start straight up robbing tax collectors. While he spends most of the movie as a pacifist, Tuck does take out a group of French soldiers by locking them in a church and throwing in a hive of bees. Because Tuck don’t shiv.
And, in another clever idea, the rest of the Merry “Men” are actually children, feral orphans who have taken to Sherwood Forest like the Lost Boys, with Marian as their Wendy and, eventually, Robin as their Peter Pan. The design of these children is great. Spooky when they first show up in handstitched scarecrow masks, but sickly and hungry once we see them in daylight.
Marian
Cate Blanchett’s Lady Marian is absolutely the high point of the movie, and if the whole film could’ve been redone entirely from her perspective, the film would have won all the Oscars.
She’s phenomenal as the emotionally tough head of the Loxley household. She works the fields with her servants. She hunts with arrows, pulls goats out of the mud, chases off thieves. Bluntly told her husband is dead, she allows herself only a moment to mourn, because she has work to do.
Blanchett’s Marian is no sexless princess in a tower. She wasn’t a maid when she married Sir Robert and she explicitly says her wedding night was “short but sweet.” She doesn’t want to, but she can’t help checking out the hot man who’s shown up at her doorstep to replace her husband. (It would be great if the film had not fetishized her sexuality at all, but apparently we couldn’t get through the finale without one rape threat. At least this time Marian stabs her own way out of it.)
Her relationship with Robin is also well done. It’s not a romantic love at first sight or a balcony climbing wooing past the tower guards. They actually develop a real relationship over time, from a tense sham marriage of convenience (he gets to live like a lord, she gets to keep her lands, but they sleep on opposite sides of their room), to a level of mutual respect, as he sees how intelligent and capable she is, and she sees how involved and caring he is. When they go off to live in Sherwood in the end, it’s not the climactic escape of a couple kept apart by circumstance, but the logical next step in their growing love.
The Bad Guys
Part of the problem with the film is that it doesn’t really have that many bad guys.
King John is there, played by Oscar Isaac as an almost exact recreation of Joaquin Phoenix’s performance as Commodus in Gladiator. He’s an interesting character, half an insecure dickwad in the Sir Peter Ustinov vein—giving a reward only to immediately take it back as taxes; worrying that his mother preferred his brother to himself; wearing a crown to big for his head—and half reasonable guy—Richard did bankrupt the country to fund his crusade; marrying the princess of France is not a betrayal of his country, but a way of securing a peace treaty and begetting offspring; he does ride into battle.
He would have made an interesting, complicated antagonist for Robin, but the film only puts them in direct conflict seconds before the end. The whole “teaming up to beat up the French” might have been fun if we had seen Robin and John fighting each other first, but instead we have this story where Robin prevents a civil war and helps John retain his country, and the John turns on Robin because… well, because John’s a dick.
The Sheriff’s there too, played by a completely wasted Matthew Macfadyen . 2011’s terrible/wonderful The Three Musketeers shows Macfadyen can swashbuckle with the best of them, but here he just shows up to be a cowardly braggadocio, hit on Marian, and then run away when the French army shows up.
Which leaves Mark Strong’s Godfrey as the only real villain of the piece. Unfortunately, for all that John is conflicted and interesting, Godfrey is just evil. He betrays his friend and king for basically no reason. He kills Sir Robert. And he kills Sir Robert’s blind dad. And he leads an army on a raping pillaging scheme across England. And he’s a bald man with a horrifying Joker scar, so he looks like a monster. Maybe if Strong had played the part for pure camp, as Rickman did, or there was another, actually sympathetic villain, Godfrey’s pure evil could have worked. But instead he’s just a man we want to see dead, and then he dies.
Richard and the Crusades
One thing I loved about Robin Hood is that it portrayed Richard as a fat, vain, violent man whose Crusade was basically a campaign of pillaging from England to Jerusalem and back. Richard is not a great man and his return to England will not magically restore everything to good. History only remembers him that way that because certain forces, like Richard’s mother Elinore of Aquitane, begin rehabilitating Richard’s image immediately upon his death.
I love the idea of Robin opposing King John rather than Prince John because it’s both more historically accurate (John did become king, so he wasn’t arrested, exiled, or killed during Richard’s reign) and it redefines Robin’s fight as against the idea of “the divine right of kings,” not against this particular false king in favor of that true one.
Robin Hood still doesn’t deal with the religious and racial intolerance at the heart of the Crusade, but, you know what, this goddamn film is complicated enough as is.
The Ending
Honestly, even if it didn’t take two hours of nothing happening to get to, the ending still might have killed this movie for me, because it’s terribly unheroic. Instead of ending on an epic jailbreak against the odds, Robin Hood ends with the English slaughtering the French invasion fleet—after Robin tortures the location of the fleet out of a French soldier by firing arrows into him (ugh).
Nothing about this battle makes the English look good. They outnumber the French fleet, and have the higher ground. Maybe if they had given the French a chance to surrender and turn around, they could have come across as chivalrous and merciful. Instead they slaughter the French. Are we supposed to root for them?
The bright spot of the ending is that Marian rides into battle with Robin, charging into the fight to take out Godfrey, who at this point has killed her husband and her father-in-law, and led an army to pillage her town. She has a very personal vendetta against this man, so, of course, she get’s knocked out so Robin can save her and kill the villain in her place. Because misogyny.
And then King John declares Robin an outlaw. And then there’s a fun scene in which Robin helps the Sheriff hang his own wanted poster by firing an arrow into it. And then there’s a title card saying “The Legend Begins” and I start barfing everywhere.
Drinking Game
This is a two drink movie at most. Scott is conscious to avoid most of the Robin Hood tropes—Robin’s not even called “Robin Hood” until the last scene. However, the plot is so complicated, and jumps around from location to location, that you’ll do most of your drinking from exposition conveyed through text.
Steven Padnick is a freelance writer and editor. By day. You can find more of his writing and funny pictures at padnick.tumblr.com .
| i don't know |
Which country became the world's first black republic upon independence in 1804? | 200 years of independence for Haiti - first black republic -a nation created by former slaves
<MAP NAME="boxmap-p14"><AREA SHAPE="RECT" COORDS="37, 588, 126, 600" HREF="http://rcm.amazon.com/e/cm/privacy-policy.html?o=1" ><AREA COORDS="0,0,10000,10000" HREF="http://www.amazon.com/exec/obidos/redirect-home/crawfurd00-20" ></MAP><img src="http://rcm-images.amazon.com/images/G/01/rcm/160x600.gif" width="160" height="600" border="0" usemap="#boxmap-p14" alt="Shop at Amazon.com">
200 years of independence for Haiti
A brief summary of Haitian history leading to the first nation created by former African slaves 200 years ago.
The first black republic
The first black republic is only 200 years old. For the first time an army of slaves defeated the oppressors and a new state was born. January 1st 2004 Haiti celebrated 200 years of independence.
Rebellion among slaves happened frequently in all the slave-colonies but the rebels very seldom succeeded to gain anything but more misery.
Haiti (St. Domingue as the colony in the Caribbean was then called) was one of the richest colonies in the world producing mainly coffee and sugar. And as most other colonies in the 18th and 19th century it was completely dependent on the work of slaves imported from Africa. Christopher Columbus arrived in 1492. First Spanish and then French people made plantations started importing slaves in great numbers.
Revolution
News of the French revolution in 1789 affected the political climate for everybody on the island. The white farmers started discussing the possibility of independence from France, but too late they realised that also their black slaves could have dreams of “freedom, equality and brotherhood”.
In August 1791 an uprising against the French farm-owners started among the slaves in Haiti. There was a clear majority of black slaves in the population and at first they had no problems in taking over control. Plantations were destroyed and many whites were killed or forced to flee from the island. French, Spanish, and English troops came aid. They were fighting each other for control but they all agreed the main aim: to prevent black domination in a former colony.
François Toussaint L'Ouverture, the grandson of an African chief, became the military leader of the former slaves. Toussaint remained in charge in the following many years of frequent battles, but in 1802 he was captured by French forces and later died in a French prison.
Independence
With the French arrival a revolution started once again and when it was finally over, an army of black slaves had their victory against the army of Napoleon. On January 1st 1804, Jean-Jacques Dessalines, an African-born ex-slave could declare Haiti independent. It was the first black republic in the world and the first country in the Western hemisphere to abolish slavery completely.
As word got around the black population in Haiti became inspiration for Africans in the rest of the world.
Haiti today
The historical events 200 years ago are well worth remembering, but unfortunately the story of Haiti since then has been very unstable and far from glorious. Officially Haiti is a republic with an elected government, but ruling today is Jean-Bertrand Aristide who has turned out to be a dictator of almost same level as the infamous François “Papa Doc” Duvalier. Aristide came to power in 1994 with the help of US troops. Jean-Claude "Baby Doc" Duvalier escaped with a fortune to live a happy life in southern France. Most Haitians and the outside world celebrated the return of Aristide and had high hopes for a democratic future of the Country. All started well, but within a few years he lost interest in improving living conditions for his people and most human rights where violated. There are many reasons for the change in Aristide. Some of them are probably personal paranoia and others were the pressure from first of all the US and French governments, trying to push forward with their own political motives. When Aristide refused to do as he was told the outside world answered with economic embargos on Haiti and a landslide had started.
Aristide won the 2000-elections with 92 percent of the votes. Obviously the ballots were fixed and as a result Haiti lost even more of the international support and aid. Today Aristide used the 200-years anniversary for his own political motives, but the nation of Haiti today could hardly be described as free and there was not much to celebrate for its 7.5 million inhabitants. Torture, murders, political violence, gang-wars and violation of most other human rights are taking place every day. In public speeches Aristide talked about love to the people and the common struggles of the black race –but he was completely out of touch with his own people -and only relied on hired (white) mercenaries from the US.
Writers and intellectuals in Haiti protested strongly against the use of the historical events for political propaganda in a democracy that was about to collapse completely. Many of these protestors was arrested and imprisoned without any legal rights. Two famous reporters were gunned down in 2000 and people close to the government obscured investigations. In the end of 2003 demonstrations against the Aristide-regime took place almost daily. Police forces controlled directly from the presidential palace were hitting hard on any signs of uprising.
Aristide leaves Haiti
In the end of February riots increased in Haiti and different rebel groups finally forced Aristide to leave Haiti with the help (or force) of US miltary forces. He is currently in exile in the Central-African Republic. The situation in Haiti is currently chaotic and uncertain because of the many different groups of rebels who are probably not better rulers than Aristide himself.
Earthquake
In 2008 a number of tropical storms kills almost 800 people in Haiti, but in January 2010 is should get even worse for the hard tried nation. The worst earthquake in more than 200 years hits the island with an epicenter near the capital Port-Au-Prince. More than 230.000 people died in the earthquake! Infrastructure and nearly everything else got a final blow, leaving Haiti in chaos and making the relief aid even more difficult. Help form the outside world is urgently needed.
Links to donation pages for the major Danish aid-organisations currently working in Haiti:
| Haiti |
What is the name of the mother of the puppies in the Disney film 'One Hundred And One Dalmatians'? | Haitian Revolution (1791-1804) | The Black Past: Remembered and Reclaimed
Haitian Revolution (1791-1804)
Back to Online Encyclopedia Index
Image Ownership: Public Domain
The Haitian Revolution has often been described as the largest and most successful slave rebellion in the Western Hemisphere. Slaves initiated the rebellion in 1791 and by 1803 they had succeeded in ending not just slavery but French control over the colony. The Haitian Revolution, however, was much more complex, consisting of several revolutions going on simultaneously. These revolutions were influenced by the French Revolution of 1789, which would come to represent a new concept of human rights, universal citizenship, and participation in government.
In the 18th century, Saint Dominigue, as Haiti was then known, became France's wealthiest overseas colony, largely because of its production of sugar, coffee, indigo, and cotton generated by an enslaved labor force. When the French Revolution broke out in 1789 there were five distinct sets of interest groups in the colony. There were white planters—who owned the plantations and the slaves—and petit blancs, who were artisans, shop keepers and teachers . Some of them also owned a few slaves. Together they numbered 40,000 of the colony’s residents. Many of the whites on Saint Dominigue began to support an independence movement that began when France imposed steep tariffs on the items imported into the colony. The planters were extremely disenchanted with France because they were forbidden to trade with any other nation. Furthermore, the white population of Saint-Dominique did not have any representation in France. Despite their calls for independence, both the planters and petit blancs remained committed to the institution of slavery.
The three remaining groups were of African descent: those who were free, those who were slaves, and those who had run away. There were about 30,000 free black people in 1789. Half of them were mulatto and often they were wealthier than the petit blancs. The slave population was close to 500,000. The runaway slaves were called maroons; they had retreated deep into the mountains of Saint Dominigue and lived off subsistence farming. Haiti had a history of slave rebellions; the slaves were never willing to submit to their status and with their strength in numbers (10 to 1) colonial officials and planters did all that was possible to control them. Despite the harshness and cruelty of Saint Dominigue slavery, there were slave rebellions before 1791. One plot involved the poisoning of masters.
Inspired by events in France, a number of Haitian-born revolutionary movements emerged simultaneously. They used as their inspiration the French Revolution’s “Declaration of the Rights of Man.” The General Assembly in Paris responded by enacting legislation which gave the various colonies some autonomy at the local level. The legislation, which called for “all local proprietors...to be active citizens,” was both ambiguous and radical. It was interpreted in Saint Dominigue as applying only to the planter class and thus excluded petit blancs from government. Yet it allowed free citizens of color who were substantial property owners to participate. This legislation, promulgated in Paris to keep Saint Dominigue in the colonial empire, instead generated a three-sided civil war between the planters, free blacks and the petit blancs. However, all three groups would be challenged by the enslaved black majority which was also influenced and inspired by events in France.
Led by former slave Toussaint l’Overture , the enslaved would act first, rebelling against the planters on August 21, 1791. By 1792 they controlled a third of the island. Despite reinforcements from France, the area of the colony held by the rebels grew as did the violence on both sides. Before the fighting ended 100,000 of the 500,000 blacks and 24,000 of the 40,000 whites were killed. Nonetheless the former slaves managed to stave off both the French forces and the British who arrived in 1793 to conquer the colony, and who withdrew in 1798 after a series of defeats by l’Overture’s forces. By 1801 l’Overture expanded the revolution beyond Haiti, conquering the neighboring Spanish colony of Santo Domingo (present-day Dominican Republic ). He abolished slavery in the Spanish-speaking colony and declared himself Governor-General for life over the entire island of Hispaniola.
At that moment the Haitian Revolution had outlasted the French Revolution which had been its inspiration. Napoleon Bonaparte, now the ruler of France, dispatched General Charles Leclerc, his brother-in-law, and 43,000 French troops to capture L’Overture and restore both French rule and slavery. L’Overture was taken and sent to France where he died in prison in 1803. Jean-Jacques Dessalines , one of l’Overture’s generals and himself a former slave, led the revolutionaries at the Battle of Vertieres on November 18, 1803 where the French forces were defeated. On January 1, 1804, Dessalines declared the nation independent and renamed it Haiti. France became the first nation to recognize its independence. Haiti thus emerged as the first black republic in the world, and the second nation in the western hemisphere (after the United States) to win its independence from a European power.
Sources:
| i don't know |
What is the more common name for the bone with the medical name Calcaneum? | Calcaneus | Definition of Calcaneus by Merriam-Webster
\-nē-ˌī\ play
: a tarsal bone that in humans is the large bone of the heel—called also heel bone, os calcis
Illustration of calcaneus
Nglish: Translation of calcaneus for Spanish speakers Britannica.com: Encyclopedia article about calcaneus
Seen and Heard
What made you want to look up calcaneus? Please tell us where you read or heard it (including the quote, if possible).
| Heel |
David Platt left Aston Villa to join which Italian football club in 1991? | Calcaneus Bone Anatomy, Definition & Function | Body Maps
Your message has been sent.
OK
We're sorry, an error occurred. We are unable to collect your feedback at this time. However, your feedback is important to us. Please try again later.
Close
Calcaneus
Located within the foot, the calcaneus is also known as the heel bone. It is situated in the back of the foot, just below the talus, tibia, and fibula bones of the lower leg. Of all of the bones in the foot, the heel bone is the largest.
The calcaneus has a unique design and structure. At the front, the heel bone features many curves to accommodate the talus and the many different tarsal bones, which lead to the metatarsals and phalanges that make up the front of the foot and toes. The back of the heel bone is not as complex, featuring a tuberosity and a medial process — landmark areas of the bone where muscles attach.
The calcaneus provides insertion points for the abductor hallucis and the abductor digiti minimi muscles. At the back of the heel, the Achilles tendon inserts into the rough area located on the superior (upper) side. This fibrous connective tissue, as well as other ligaments and muscles, is necessary for standing, walking, and running. As such, a broken or fractured calcaneus will make these movements difficult.
| i don't know |
In the novel by Robert Louis Stevenson, what is the name of the ship that sails to 'Treasure Island'? | What is the resolution in Treasure Island? | eNotes
What is the resolution in Treasure Island?
bullgatortail | High School Teacher | (Level 1) Distinguished Educator
Posted on
November 29, 2011 at 10:57 AM
The resolution of Robert Louis Stevenson's Treasure Island comes in the final chapter (Chapter XXXIV - And Last). Keeping a close eye on the three surviving mutineers, the men took the better part of a week transporting the gold to the Hispaniola. Leaving the mutineers a cache of supplies, the ship set sail for "the nearest port in Spanish America." On the first night there, Long John Silver disappeared for good--with a bag of coins worth "three or four hundred guineas." Adding a few new crew members, the Hispaniola set sail for Bristol, and the men safely returned to England--wealthier and wiser men.
Sources:
poetrymfa | College Teacher | (Level 3) Educator
Posted on
July 24, 2016 at 5:54 PM
The resolution can be found in Part VI (or "Captain Silver") of Robert Louis Stevenson's Treasure Island. After the climactic discovery that the treasure cache is empty and that Gunn had moved the treasure to his cave, the men spend a few days loading the treasure onto the ship. Before sailing back home, they unload the last three mutinous sailors, leaving them behind with supplies and ammunition. In need of more crew members, the ship docks at a port, and Silver makes his escape with a bag of coins in tow. Regardless, the ship sails back to Bristol, where the men divide the treasure and resume their lives. Although Jim realizes that there is more wealth to be found on Treasure Island, he is firm that he is unwilling to go on another trip to find it; apparently, one swashbuckling adventure was quite enough!
like 0 dislike 0
| Hispaniola |
Who did Bulawayo born Charlene Wittstock marry earlier this month? | Character List
Character List
Jim Hawkins Twelve- or thirteen-year-old boy, an innkeeper's son. Jim is the novel's protagonist and chief narrator.
Mr. and Mrs. Hawkins Jim's parents.
Billy Bones ("the captain") An old sailor; a pirate.
Dr. David Livesey Local physician and district magistrate; Livesey is a minor narrator in Chapters 16–18.
Black Dog Billy Bones' old shipmate; another pirate.
Pew A blind beggar; another pirate.
Mr. Dance A revenue officer, tax collector.
Squire John Trelawney A country squire; a wealthy man who finances the trip to Treasure Island.
Tom Redruth Trelawney's gamekeeper.
Hunter Another of Trelawney's servants.
Joyce Another of Trelawney's servants, apparently the valet who takes care of his clothes and grooming aids.
Long John Silver A Bristol tavern-keeper; ship's cook; another pirate.
Captain Alexander Smollett The new captain of the Hispaniola, the ship Trelawney has bought.
Mr. Arrow First officer of the Hispaniola; a drunkard.
Abraham Gray An honest seaman who is carpenter's mate on the Hispaniola.
Tom An honest seaman who defies Silver; Silver kills him.
Alan A third honest seaman who is killed by the pirates.
Job Anderson The boatswain (officer in charge of the deck crew, anchors, boats, and so on) on the Hispaniola; a pirate.
Israel Hands The coxswain (officer in charge of the ship's main boat and usually acting as its helmsman or steersman) on the Hispaniola; another pirate.
Tom Morgan, George Merry, O'Brien, Dick (and nine more unnamed) Crewmen on the Hispaniola; all are pirates and mutineers.
Ben Gunn The "man of the island," who has been marooned there three years before; a reformed pirate.
| i don't know |
In which city can you visit the Sultan Ahmed Mosque, also known as the Blue Mosque? | Architecture
About Blue Mosque
The Blue Mosque (Called Sultanahmet Camii in Turkish) is an historical mosque in Istanbul. The mosque is known as the Blue Mosque because of blue tiles surrounding the walls of interior design.Mosque was built between 1609 and 1616 years, during the rule of Ahmed I. just like many other mosques, it also comprises a tomb of the founder, a madrasa and a hospice.Besides still used as a mosque, the Sultan Ahmed Mosque has also become a popular tourist attraction in Istanbul.
Besides being tourist attraction, it's also a active mosque, so it's closed to non worshippers for a half hour or so during the five daily prayers.
Best way to see great architecture of the Blue Mosque is to approach it from the Hippodrome. (West side of the mosque) As if you are non-Muslim visitor, you also have to use same direction to enter the Mosque.
Please ignore and avoid people who offer you to enter mosque without queue up. Those people mostly will try to sell you something and take you to the some shopping place. Best way is to line up and enter Mosque just like other tourists. Don't worry if line looks very long, it will move very fast for sure.
How to Visit Blue Mosque ?
Tourists always wonder how to visit Blue Mosque.There is also many other questions such as if there is any entrance fee,dress code, where to put my shoes etc.Here below is the answers of all these simple questions...
1) Plan your visit to the Sultanahmet area of Istanbul, so that you better arrive mid morning. Pray happens five times a day with the first call to prayer at sunrise and the last one at nightfall.The mosque closes for 90 minutes at each pray time.Avoid visiting a mosque at pray time (Especially Midday praying on Friday) or within a half hour after the ezan is chanted from the Mosque minarets.
2) Before step in to Mosque, take off your shoes and put in plastic bags provided at the entrance(Free of Charge). This is required of all persons as part of Muslim tradition when entering a mosque. There is also no charge to enter the Blue Mosque.
3) If you are women wear a head covering when entering to Blue Mosque.Head coverings are available at the Blue Mosque entrance for free. Place the fabric cover on top of your head with equal portions hanging on both sides.
Take one side and wrap it around your neck, tossing it behind your back with covering your shoulders. Don't cover your face, the covering is meant to hide your hair only.
4) When you are inside the mosque, remain quiet and don't use flash photography.Since this is a place of worship, avoid staring or taking picture of those who are praying.Visit the mosque respectfully and quietly.At the Mosque exit, you can put used plastic bags in designated bin bags and return head covers to duty staff.
5) You can do donation to help maintain the Mosque at the exit door.It is not compulsory, but if you make donation you will get the official receipt for it.
| Istanbul |
In which year did Hurricane Katrina strike New Orleans? | Blue Mosque - Mosque in Istanbul - Thousand Wonders
Wikipedia | Google | Google Images | Flickr
Blue Mosque - Blue Mosque. Photo by Pedro Szekely
The six slim minarets and cascading domes of the Sultan Ahmed Mosque, also known as the ‘Blue Mosque’, are evidently visible in Istanbul ’s skyline. The construction and building of this mosque was actually an idea of Sultan Ahmed which is the reason why it’s named after him. Hagia Sophia , another great architectural achievement stands next to the Blue Mosque in Istanbul’s main square; you can visit them both in one day to decide which is the most impressive structure.
History of the Blue Mosque
The mosque was made-to-order by Sultan Ahmed I when he was just nineteen-years-old. The construction started in 1609 and took a total of seven years to complete; it has been a place of worship for Muslims for the past almost four centuries. The mosque is built near Hagia Sophia, over the site of the Byzantine imperial palace and the ancient hippodrome, the mosaics of which can also be seen in the nearby Mosaic Museum. In the complex of buildings around the mosque are a madrasa, a hospice and the tomb of Sultan Ahmed.
Sultan Ahmed I signed a peace treaty with the Habsburg Monarchy in November 1606, ending a 15 year long war with the city. Returning to Istanbul, then known as Constantinople, he decided to build a grand mosque to bolster the image of the Ottoman Dynasty which was tottering for the previous half a century. The Sultan was only 17 years of age when he sanctioned the project.
Blue Mosque - Blue Mosque. Photo by Dennis Jarvis
The mosque is designed by the architect, Mehmet Agha, however Sultan Ahmed also assisted in its work as he was very anxious to complete his magnificent creation. veral buildings of the byzantine era were razed to make way for the mosque, among them the erstwhile palace of the Byzantine Emperors. The construction of the mosque clearly indicates the influence of Byzantine designs combine with Islamic Architecture. Mehmet Agha was a pupil of the great architect, Mimar Sinan
, and the quest for grandeur in the size of the mosque illustrates the masters approach. Unfortunately, Agha died just a year, at the young age of 27, after his magnificent mosque was completed. You can visit his grave during your trip to the mosque as he is just buried outside the mosque with his family.
The original building of the mosque included a hospital, a madrasa
, a primary school, a Han, an imaret, a market, and the founder’s tomb. By the 19th century, most of these buildings were worn out.
Interior of the blue mosque. . Photo by Miguel Virkkunen Carvalho
Things to See at the Blue Mosque
The beautiful six minarets of the Blue Mosque can be seen from a long distance, and this makes it unique from all the other mosques as all the other mosques only have four, two, or one minaret. According to an account, the architect was directed by the Sultan to make gold (altin) minarets, which were misinterpret by him as the 6 (alti) minarets.
Whatever the cause may be for this unique feature of it, its 6 minarets caused quite a stir and dishonor, as the Al-Haram Mosque in Makkah (the holiest in the world) also had six minarets. Due to this issue, the Sultan sent his architect to Makkah to have this problem solved by adding a 7th minaret.
Another striking feature of mosque’s exterior is its beautifully arranged cascade domes which looks as if it's spilled down from the great central dome. To add to further visual rhythm, there are arcades that run beneath its each dome. Even though the external is not blue, the name “Blue Mosque” is given to the mosque due to the blue tiles inside it.
The west entrance is the main entrance which is decorated beautifully and worth experiencing. However, for the perseverance of mosque’s sacredness, non-worshipers are made to use the Northern entrance. There are symbolic chains that hang from this gate which encourage everyone to bow their heads upon entering, including the Sultan, who used to do it on his horseback.
The high ceiling from inside is lined with 20,000 blue tiles, giving the name ‘Blue Mosque’ to it. These tiles present excellent examples of the 16th-century Iznik design, trees, abstract patterns, and the old tiles feature flowers. The overall effects make for the most beautiful sights in Istanbul. These Iznik tiles can be seen on the North Wall, just above the main entrance and in the galleries. The rest of the tiles that have got a less delicate design were made in Kütahya
.
The 260 windows, once filled with the 17th century stained glass, lit up its interior. Today, the glass is unfortunately replaced with the inferior replicas.
During the summertime, various sound and light shows are organized in the park. The Sultan Ahmed Mosque occupies a focal point in the city tours, combined with various monumental museums and buildings in the vicinity.
The mosque minarets present a classic Turkish architectural example. You can reach the balconies through the spiral stairs and from these balconies, the believers are called to prayer five times a day, each day using loudspeakers.
In Islam, Muslims are required to pray five times a day. When the believers hear the prayer call from the minarets, they perform their ablutions (washing) before saying their prayers. The Friday prayers (noontime) and the prayers on other important holidays are performed collectively in the mosque.
The Imam takes lead and chants verses from the Quran in the communal prayers. There are separate praying areas for men and women. The central area is reserved for men only while women take place in either the galleries or behind them. The highlight of this Turkish mosque is that even during the most crowded days, the congregation can see the mihrab
easily.
The mihrab (a niche in the wall that indicates the direction of Mecca to the faithful) inside the mosque, is made of ornately carved and sculpted from marble with an inscribed panel above it. Next to the mihrab is the minbar, a platform or a pulpit from where the imam of the mosque preaches to the congregation. The floors of the mosque are covered with carpets and the space is designed with such detail that even when the mosque is crowded, every worshiper can see and hear the imam. The royals had access to the mosque from the eastern side with a royal kiosk and two retiring rooms.
Inside the blue mosque. Photo by Abraham Puthoor
Visiting the Sultan Ahmed Mosque
Although visitors to the mosque are allowed free entry, the timings of entry are restricted because of the five prayers a day that Muslims conduct in the mosque. The first call to prayer is before dawn and the last is at dusk. It is best to reach the Sultan Ahmet area as early as possible in the mornings. The mosque is best entered from the western side where there is a hippodrome. Non-Muslims are only allowed entry from this side.
All visitors are required to dress conservatively and remove their footwear prior to entering the mosque. Women are required to cover their hair with a scarf. Plastic bags for tucking the shoes in and scarves are provided free of cost at the entrance. The used plastic bags can be disposed of in bins kept at the exits. Within the mosque, silence has to be maintained and using of flash lights is banned. Visitors can also make donations when leaving the mosque and official receipts are issued.
Festival and Events
A historical narrative and a light show is arranged during the summers at the Blue Mosque in the evening time at 9 PM. The commentaries are given in various languages such as English, Turkish, German, and French on various evenings.
Staying and Things to Do in Istanbul
Istanbul is well connected by air to most cities in the world. Visas for US and most EU citizens are available on arrival at the airport. Getting about the city is also easy with plenty of buses, metro, trams, and taxis. There are many hotels within walking distance of the Blue Mosque and a tourist can choose from prices ranging from $ 50 USD to luxurious five-star hotels. Istanbul is a cauldron of cultures and the choice of food is amazing. There are plenty of bars and tea gardens too.
With the Hagia Sophia, once a cathedral, converted into a mosque and now a museum located close to the mosque, a tourist will probably have enough to do for a day.
Among the other places of interest in Istanbul are the Topkapi Palace, built in the second half of the 15th century and the residence of Ottoman Sultans for nearly 400 years. The Hippodrome of Constantine and the Suleymaniye Mosque along with the Blue Mosque, Hagia Sophia, and the Topkapi Palace are all classified as World Heritage Sites by UNESCO, showcasing the heritage of the city since the past 1,500 years. There are also the centuries-old Chora Church and the fascinating Grand Bazaar in the old market.
Do you see any omissions, errors or want to add information to this page? Sign up .
Author: Khadija. Last updated: Sep 12, 2014
Pictures of Blue Mosque
| i don't know |
The 'Whale Shark' is the largest living fish. What is the most common name of the second largest, also a shark? | Rhincodon typus :: Florida Museum of Natural History
Whale Shark. Photo © Jeremy Stafford-Deitsch
Rhincodon typus
These sharks are recognizable not just for being the largest fish in the sea, growing longer than 40 feet, but also for their unique pattern of blue-gray to brown coloration with white spots centered between pale horizontal and vertical stripes. They are filter feeders, often swimming near the surface of the open sea, gulping in water and filtering everything from plankton and fish eggs, to crustaceans and schooling fish, to occasional larger prey like squid or tuna. Despite their size, they are considered harmless to humans, and will often interact docilely with divers to the extent of allowing the divers to grab on to a fin and hitch a ride.
Order - Orectolobiformes
Species - typus
Common names
Whale shark, basking shark, and whaleshark are common names in the English language used to refer to this fish. Other common names include bagea ni oka, bahiri (Gela), chagrin (French), dámero (Spanish), jinbeizame (Japanese), pez dama (Spanish), rauhhai (German), rekin wielorybi (Polish), requin baleine (French), thimingal sura (Tamil), tiburon ballena (Spanish), tubarão baleia(Portuguese), tuki-tuki (Visayan), tuko (Tagalog), vaame (Swahili), walhai (German), walvishaai (Afrikaans), yaak (Khmer), and yu paus (Malay).
Importance to Humans
A diver swims along with a juvenile whale shark. Photo © Jeff Trotta
In the past, the whale shark has been of little interest to man. At present, commercial fisheries for whale sharks are limited, but may expand from an increased demand for food products. In Taiwan approximately 100 whale sharks are taken annually. The whale shark meat fetches a high price in this country, and this fact has stimulated larger harvests over the last years. Fishing for this shark also occurs in the Philippines, particularly in the Visayas and Mindanao areas, providing food for the local fishing communities. Whale shark fins are sold in the Orient, especially in the Hong Kong. Occasionally whale sharks are captured accidentally along the coast of India. Sometimes the flesh is eaten and the liver oil is utilized for waterproofing wooden fishing boats and other appliances, for the manufacture of shoe polish and as a treatment for some skin diseases. The processing of whale shark fins has also been reported in India. Often the whale shark is used as an indicator of waters rich in plankton-feeding fish that will, in turn, attract more valuable species such as tuna. Whale sharks have been kept in aquaria in Japan, but their large size and specialized diet precludes this species from being mainstream aquarium species. In a few locations where the presence of whale sharks appears to be predictable, they are increasingly targeted by commercial tourist operations.
Danger to Humans
Generally considered harmless. However, there have been a few cases of whale sharks butting sportfishing boats, possibly after being provoked. Usually the sharks are more at risk from being struck accidentally by vessels whilst basking or feeding on the surface.
Conservation
Whale shark embryo, 350 mm, from the Gulf of Mexico courtesy Garrick (Proceedings U.S. National Museum)
Some biological characteristics, such as large size, slow growth, late maturation and extended longevity, probably limit recruitment and make whale sharks susceptible to overexploitation. These characteristics also suggest that populations are slow to recover from any overfishing. The whale shark is listed as "Vulnerable" with the International Union for Conservation of Nature and Natural Resources (IUCN), a global union of states, governmental agencies, and non-governmental organizations in a partnership that assesses the conservation status of species. The whale shark is listed by the AFS (American Fisheries Society) as conservation dependent (reduced but stabilized or recovering under a continuing conservation plan) in both the U.S. Atlantic and the Gulf of Mexico. However, it is considered not at risk in the Gulf of California. In the Maldives and Philippines there is legislation banning all fishing for whale sharks. This protection was introduced because of the possible serious impact that the fishery may be making on whale shark stocks.
The predictable occurrence of whale sharks in a few localities, such as in Western Australia, has led to the development of an expanding tourism industry. In this area the whale shark is a protected species and its tourism has been managed through a system of controls, including the licensing of a limited number of operators tours. In addition, there have been calls from conservation-minded divers worldwide to refrain from riding, chasing, or in any way harassing any large marine animals, including whale sharks. Recently, some observations made on the Ningaloo Reef's whale sharks provided the information that regular diving is a normal behavior of these sharks and not an avoidance reaction during contact with humans. However, the natural variability in whale shark abundance and distribution, the reasons for aggregations at some areas, and the carrying capacity of the industry are still unknown. Consequently, evidence of any impact is difficult to obtain and interpret.
Geographical Distribution
World distribution map for the whale shark
The whale shark has a very widespread distribution, occurring in all tropical and warm temperate seas, except in the Mediterranean. It occurs throughout the Atlantic Ocean, from New York through the Caribbean to central Brazil and from Senegal to the Gulf of Guinea. It also occurs in the Indian Ocean, throughout the region, including the Red Sea and the Arabian Gulf. In the Pacific Ocean it is found from Japan to Australia, off Hawaii, and from California to Chile.
Habitat
In contrast to most sharks from the same order (Orectolobiformes), which are benthic (live on or near the bottom) species, the whale shark is a pelagic (open sea) species. Studies reveal that this shark prefers warm waters, with surface temperature around 21-30º C, marked by high primary productivity (much plankton). It is often seen offshore but commonly comes close inshore, sometimes entering lagoons or coral atolls.
The whale shark is thought to be highly migratory but currently there is no direct evidence to support this hypothesis. Their movements might be related to local productivity and they are often associated with schools of pelagic fish that are probably feeding on the same prey organisms.
A whale shark cruises at the surface accompanied by opportunistic remoras (Echeneis sp.). Photo © Jeremy Stafford-Deitsch
Different geographic locations appear to be preferred at various times of the year. Whale sharks alternatively may undertake either fairly localized or large-scale transoceanic migrations, the movements governed by the timing and location of production pulses and possibly by breeding behavior. Seasonal migrations have been postulated for various areas but more information is needed to confirm these patterns. Each March and April, whale sharks are known to be aggregate on the continental shelf of the central western coast of Australia, particularly in the Ningaloo Reef area. A study was done in this area to provide information on the short-term movements and behavior of this species of shark. Whale sharks are thought to migrate to Ningaloo Reef each year to take advantage of the high zooplankton (microscopic animals) concentrations associated with large-scale coral spawning events occurring during the March and April full moons. A few whale sharks were tracked and some behavioral observations were made while snorkeling in the area. The reaction of the sharks to snorkellers varied between ignoring them to slowly diving. At times when water was flowing out from the reef lagoon, possibly transporting potential prey outside the reef, the tracked sharks swam in large circles adjacent to passes in the reef. The whale sharks also made numerous dives throughout the observation period. It appears that these movements, up and down through the water column, were associated with feeding. Whale sharks have smaller livers than most sharks and could conceivably control their buoyancy by swallowing some air as do the sand tiger sharks (Ondontaspis taurus).
Whale sharks were also observed near La Paz, Mexico. Researchers reported that when these sharks were not feeding at the surface, they swam practically without the head turning, gulping, and rhythmical opening and closing of the gill slits, seen during feeding behavior. The mouth was held slightly open, and the skin over the gill openings was quivering as water flowed steadily out the gill slits in the typical ventilation of pelagic sharks. Generally, whale sharks are encountered singly but loose aggregations of over 100 animals have been seen, which suggests that schooling activity does occur. Scientists do not know whether sexual segregation, either locally or geographically, occurs.
Whale shark (Rhindodon typus). Illustration courtesy FAO, Species Identification and Biodata
Distinguishing Characteristics
1. Back and sides marked with unique checkerboard pattern of light spots and transverse bars
2. Head is broad and flat with a short snout
3. Mouth is near the tip of snout
4. Sides have three prominent ridges
Biology
Distinctive Features
A streamlined body and a depressed, broad, and flattened head characterize the whale shark. The mouth is transverse, very large and nearly at the tip of the snout. Gill slits are very large, modified internally into filtering screens. The first dorsal fin is much larger than the second dorsal fin, and set rearward on body. The two lobed caudal fin (tail) is semi-lunate in adults; in small juveniles the upper lobe is considerably longer than the lower lobe. The whale shark has a unique "checkerboard" color pattern of light spots and stripes on a dark background.
Whale shark showing coloration pattern. Photo © Keri Wilk
Coloration
Whale sharks are greyish, bluish or brownish above, with an upper surface pattern of creamy white spots between pale, vertical and horizontal stripes. The belly is white. The function of the distinctive pattern of body mark is unknown. Many bottom-dwelling sharks have bold and disruptive body markings that act as camouflage through disruptive coloration. The whale shark's markings could be a result of its evolutionary relationship with bottom dwelling carpet sharks. Distinctive markings in a pelagic species could be linked to social activities such as postural displays and recognition processes. Another possibility is that these pigment patterns could be an adaptation for radiation shielding, important in a species that may spend a significant proportion of time in surface waters possibly exposed to high levels of ultraviolet radiation.
Whale shark dentition (top, Photo © Cathleen Bester), and (bottom) A) Portion of upper dentary band (about 2.5x), B) top and C) lateral view of a single upper tooth (about 9x). Illustrations courtesy Bigelow & Schroeder,1948, FNWA
Dentition
Teeth minute, about 300 rows in each jaw. An individual tooth has a single, hooked cusp. Teeth appear to play no role in feeding.
Dermal Denticles
The whale shark has unique denticles (tooth-like scales structures), each with an extremely strong central keel, no lateral keels, and a tri-lobed rear margin. It would appear that the denticles are hydrodynamically important in its pelagic lifestyle.
Size, Age & Growth
The whale shark is the largest living fish. Maximum size is thought to be 20m. The smallest free-living individuals are from 55cm (21.7 inches) long. Sexual maturity in both sexes may not occur until the sharks are over 9m in length. Age estimates for whale sharks are as high as 60 years, but no one really knows how long this species lives.
Food Habits
Whale sharks feed on wide variety of planktonic (microscopic) and nektonic (larger free-swimming) prey, such as small crustaceans, schooling fishes, and occasionally on tuna and squids. Also, phytoplankton (microscopic plants) and macroalgae (larger plants) may form a component of the diet. Unlike most plankton feeding vertebrates, the whale shark does not depend on slow forward motion to operate its filtration mechanism. Rather, it relies on a versatile suction filter-feeding method, which enables it to draw water into the mouth at higher velocities than these dynamic filter-feeders, like the basking shark. This enables the whale shark to capture larger more active nektonic prey as well as zooplankton aggregations. Therefore, the whale shark may be more dependent on dense aggregations of prey organisms. The denser filter screens of this shark act as more efficient filters for short suction intakes, in contrast to the flow through systems of basking shark. Whale sharks are always seen feeding passively in a vertical or near vertical position with the head at or near the surface.
Dermal denticles from in front of and a bit below the first dorsal fin (top), Illustrations A) Lateral and apical views of dermal denticle (about 75x), B) dermal denticles (about 35x) Images courtesy Garrick (Proceedings U.S. National Museum). Illustrations, and Bigelow & Schroeder, 1948, FNWA
The whale shark feeds actively by opening its mouth, distending the jaws and sucking. Than it closes its mouth and the water flow out its gills. During the slight delay between closing the mouth and opening the gill flaps, plankton may be trapped against the dermal denticles lining the gill plates and pharynx. The fine sieve-like apparatus, a unique modification of the gill rakers, forms an obstruction to the passage of anything but fluid, retaining all organisms above 2 to 3mm in diameter. Practically nothing but water goes through this sieve. Individuals have also been observed coughing, a mechanism that is thought to be employed to clear or flush the gill rakers of accumulated food particles. Whale sharks move their heads from side to side, vacuuming in seawater rich in plankton, or aggressively cut swathes through schools of prey. Groups of individuals have been observed feeding at dusk or after dark. The density of plankton probably is sensed by the well-developed nostrils, located on either side of the upper jaw, on the leading edge of the terminal mouth. The frequent turns may keep the whale sharks in the denser parts of the plankton patches, searching and scanning when an olfactory cue weakens on one side or the other. The whale shark's small eyes are located back on the sides of the head. Because of this, vision may play a much smaller role than olfaction in directing the head turns during surface feeding. One live whale shark pup removed from its dead mother was maintained in captivity in Japan. It did not eat for the first 17 days, even though it swam constantly. This suggests that the pup had substantial stores of endogenous (stored) energy.
Reproduction
Historically, there was great scientific debate about the mode of development of whale sharks. It was unclear whether it is oviparous (egg cases expelled from the female's body and hatched on the sea floor) or ovoviviparous (egg cases hatching in the mother's uteri, with the female giving birth to live young). Finally in 1995, an 11-meter female whale shark was harpooned off the eastern coast of Taiwan and 300 fetal specimens, ranging in length from 42 to 63cm, were taken from the two uteri. This discovery proved that the species is a live bearer, with an ovoviviparous mode of development. The egg-capsules of this whale shark were amber colored, with a smooth texture, and possessed a respiratory fissure (opening) on each side. The sex ratio was approximately 1:1. It would appear that female whale sharks give birth as they feed in the rich waters of the Kuroshio Current. It is also apparent that the southeast waters off Taiwan are an important birthing area during summer months. It is believed that the young measure 21.7-25.2 inches (55-64 cm) total length at birth.
A whale shark opens its mouth, bringing in plankton-rich water. Photo © Werner Mischler
Predators
A juvenile specimen was found in the stomach of a blue shark (Prionace glauca). Another specimen was found in the gut contents of a blue marlin (Makaira nigricans).
Parasites
Many parasitic copepods were found on the lining of the pharynx of a small (60cm total length) whale shark from Taiwan.
Taxonomy
The whale shark was first described and named by Andrew Smith in 1828, based on a specimen harpooned in Table Bay, South Africa. Historically, there have been many synonyms (alternative scientific names) for family, genus and species names. The first scientific printing of the genus name appeared as Rincodon, despite Smith's desired name of Rhineodon. However, in 1984 the International Commission on Zoological Nomenclature suppressed previous generic variations in favor of genus name Rhincodon, and the family name Rhincodontidae. Others generic names formerly used includeRhiniodon and Rhineodon and the family names Rhiodontidae and Rhineodontidae. Systematically, Rhincodontidae is placed in the order Orectolobiformes, which also includes families such as Ginglymostomatidae (nurse sharks) and Orectolobidae (wobbegongs). The interrelationships between these families are based on anatomical and morphological similarities.
Synonyms for the whale shark in past scientific literature include Rhinodon typicus Müller & Henle 1839, Rhinodon typicusSmith 1845, Micristodus punctatus Gill 1865, and Rhinodon pentalineatus Kishinouye 1901.
Rhincodon typus is derived from the Greek words "rhyngchos" = rasp and "odous" = tooth. The species name is translated as type.
Prepared by: Carol Martins & Craig Knickle
| Basking shark |
Who painted 'Going To The Match' a painting of a crowd on its way to Burnden Park, Bolton? | Whale Sharks - Whale Shark Pictures - Whale Shark Facts - National Geographic
School
Did you know?
The largest whale shark ever measured was 40 feet (12.2 meters) long; however, the species is thought to grow even bigger.
Size relative to a bus:
As the largest fish in the sea, reaching lengths of 40 feet (12 meters) or more, whale sharks have an enormous menu from which to choose. Fortunately for most sea-dwellers—and us!—their favorite meal is plankton. They scoop these tiny plants and animals up, along with any small fish that happen to be around, with their colossal gaping mouths while swimming close to the water's surface.
Feeding
The whale shark, like the world's second largest fish, the basking shark, is a filter feeder. In order to eat, the beast juts out its formidably sized jaws and passively filters everything in its path. The mechanism is theorized to be a technique called “cross-flow filtration,” similar to some bony fish and baleen whales.
The whale shark's flattened head sports a blunt snout above its mouth with short barbels protruding from its nostrils. Its back and sides are gray to brown with white spots among pale vertical and horizontal stripes, and its belly is white. Its two dorsal fins are set rearward on its body, which ends in a large dual-lobbed caudal fin (or tail).
Population
Preferring warm waters, whale sharks populate all tropical seas. They are known to migrate every spring to the continental shelf of the central west coast of Australia. The coral spawning of the area's Ningaloo Reef provides the whale shark with an abundant supply of plankton.
Although massive, whale sharks are docile fish and sometimes allow swimmers to hitch a ride. They are currently listed as a vulnerable species; however, they continue to be hunted in parts of Asia, such as the Philippines.
| i don't know |
Which 'Doctor Who' was assisted by 'Zoe Herriot' played by Wendy Padbury and 'Jamie McCrimmon' played by Frazer Hines? | BBC NEWS | In Pictures | In pictures: Doctor Who's assistants
In pictures: Doctor Who's assistants
1 of 12
Billie Piper is to follow in a long line of actors who have travelled through time with Doctor Who - including two early assistants Vicki, played by Maureen O'Brien, and Steven Taylor (right), played by future Blue Peter presenter Peter Purves.
2 of 12
Another companion was Jamie McCrimmon, played by Frazer Hines - who went on to star in soap opera Emmerdale. Jamie was rescued from the battle of Culloden in 1746 by the second doctor, Patrick Troughton.
3 of 12
Deborah Watling starred as Victoria Waterfield, who also travelled with Troughton. The daughter of a Victorian scientist, she became orphaned when the Daleks killed her father.
4 of 12
A librarian who was attacked by the Cybermen, Zoe Herriot, played by Wendy Padbury, was highly intelligent but inexperienced.
5 of 12
The Brigadier (Nicholas Courtney, centre) headed the United Nations Intelligence Taskforce, while Jo Grant (Katy Manning) trained as a spy and was assigned to UNIT.
6 of 12
| Patrick Troughton |
What was the first name of 'D.I. Stanhope' played by Brenda Blethyn in a recent ITV series? | Doctor Who
Production: GB, 1963-89, 1996, 2005-
Cast: William Hartnell, Patrick Troughton, Jon Pertwee, Tom Baker, Peter Davison, Colin Baker, Sylvester McCoy, Paul McGann, Cristopher Eccleston, David Tennant, Matt Smith.
Doctor Who is the most long-running SF show of ever. Also longer than � Star Trek �, which stopped for about 10 years, while Doctor Who lasted for 26 years, tried to re-start a first time in 1996, and finally in 2005 new episodes were regularly shot and 4 new season have already been released.
In the first 60s BBC had already produced good SF series. The first was �The time machine� in 1949 (which surely inspired the Doctor�), and the top was reached with � Quatermass �.
As often happens, the idea was born from a simple need: BBC needed something new for Saturday afternoon, a day usually reserved to sport and music programs. At first they thought to broadcast again the old �Flash Gordon� of the 30s, played by Buster Crabbe (always good, but a little out of date), but finally it was decided to create a new show.
Producer Sidney Newman decided it would have been a children�s program, and with instructing purposes: the stars would have been time travelers and would have met the historical characters of all ages, and the historical environment and the facts
should have been accurate.
The male lead would have been a teacher (not by chance); the female lead another teacher (idem); then a young girl, their pupil (idem again); and finally an old man, of alien origins, who would have driven, as he could, the time machine. In a nutshell, at the beginning the Doctor was nearly the less important character, a piece of environment. To give him a name, BBC writers tried a lot of names on pieces of paper during a dinner, until the definitive name was found.
Quite unusual the look of the time machine: in the exterior looked like an old police phone box, because it had a mechanism which could disguise it in any place it landed. But the interior was in a different dimension, so it was as large as a castle�
In the first episode the chameleon circuit broke down, so the exterior was stuck as
a police box.
Format was that of �mini-series�: every episode had 2, 4, 6 or more parts of 25� each, broadcasted weekly with a �cliffhanger� in the final to ensure the return of viewers the next week (the same system of soap-operas).
The first episode was aired on November 23, 1963. The title was �An unearthly child�, and was referred to the unusual acknowledge of the young girl, the Doctor�s nephew, and to the enquiries of her teachers. The result was a voyage in the TARDIS (Time And Relative Dimensions In Space, the time machine), which landed in year 100,000 b.C.
USA president Kennedy had just been killed, and TV was full of news about that, so the firs airing of the show was not particularly noticed. But a surprise was
coming.
One of the writers was Terry Nation who, as a second episode, wrote a story about a far planet named Skaro, where the Thals, a peaceful race of humans, was menaced by a race of mutants closed in metallic vehicles: the Daleks.
Daleks were secretly built by a manufacturer, and transported to BBC studios while people looked at them with curiosity (and someone nearly walked into a wall). When the episode was broadcasted, the reaction was immediate. As first Sidney Newman became furious, because that was the cheap science fiction with bug-eyed-monsters he absolutely wanted to avoid. But thousands of enthusiastic letters arrived, and viewing figures had jumped higher and higher. The programs director wondered if Daleks would have scared children, but his sons ran around with
baskets on their heads shouting �Exterminate! Exterminate!�. An epic success had been achieved.
Historical episodes were not left behind, anyway. The Doctor met Marco Polo (a memorable episode), the Aztecs, Robespierre, Napoleon, Nero and Wyatt Earp (the OK Corral gunfighter), together with new alien races and new encounters with the Daleks.
The show went on nearly without interruptions, new episodes were aired for 12 months in a year, (in the 80s, a season would have last for 3-4 months). The younger actors of the cast felt the need for different job.
So in the second season Susan (Carole Ann Ford), the Doctor�s nephew, decided to remain in the 22nd century Earth, having fallen in love with a boy
who fought the Daleks, and a little later his two teachers used a Dalek time machine to go back to their age. The Doctor found always new companions becoming the real star of the show.
Actor William Hartnell, who played the Doctor, was at the end of his career, and really would have gone on with the programme, but his health was too poor and did not allow him. It was more and more difficult for him to read the scripts, and was running out of his energies.
He was said he was not forced to remain, but he did not want to be responsible of the programme�s end. The only solution was going on with a different actor, but a way to justify that had to be found.
The first idea was a �plastic surgery�, then they thought to a �machine to change
faces� (which was seen in �The celestial toymaker�), then the right idea came: the Doctor was an alien, so his life cycle made him regenerate his body when he grew too old.
So Patrick Troughton was engaged and, at the beginning of fourth season (October 1966) there was the first regeneration, which allowed William Hartnell to leave the show.
The episode was �The tenth planet�, and a new evil alien race appeared. They were similar to the Daleks but with better movements (lots of people wondered how could Daleks walk on stairs�): the cybermen. After having defeated the cybermen, the Doctor collapses on the floor and starts to regenerate.
With some efforts, William Hartnell could be the Doctor again later: in 1973, for the programme�s tenth anniversary, he appeared in the episode �The three Doctors� together with Patrick Troughton and John Pertwee (who had to carry almost the whole episode on their shoulders, anyway).
For a big misfortune, some of the first Doctor�s episodes (and most of the second�s) have been lost: only 18 of 29 have survived, but BBC has tried to find them in other countries television networks archives.
Hammer film made two cinema movies from the first Doctor�s adventures: �Doctor Who and the Daleks�(from �The Daleks�), and �Daleks: Invasion Earth 2150 A.D.� (from �The Dalek invasion of Earth�), and Peter Cushing played the Doctor.
When 46 years old Patrick Troughton was asked to be the Doctor, his first answer
was �no�. Until then William Hartnell had been the sole Doctor, it looked rather unconceivable another actor in the role, and Troughton was afraid to be considered as an intruder by viewers. But BBC executives insisted for days and days, until he surrended.
The show was successful, but figures were lowering, and a strong injection of energy was needed, thanks to a younger actor. As seen above, the change happened at the beginning of the fourth season and, to maintain the habit, the new Doctor had to face immediately and again the Daleks.
William Hartnell wore 19th century clothes, Troughton had a black jacket, chequered trousers and a bow tie. The Doctor was always eccentric, and the second often played a pipe (especially when he forgot a line�). In that
moment the Doctor�s companions were Ben Jackson (Michael Craze), a sailor, and Polly Lopez (Anneke Wills). Then there was a change, and the ultimate companions became Jamie McCrimmon (Frazer Hines), a scottish piper, and Zoe Herriot (Wendy Padbury), a girl who lived in a space station invaded by cybermen.
Zoe entered in the last episode of fifth season, and that caused a particular situation: Zoe asked to travel in the TARDIS, and the Doctor showed her a mental projection of what was going to face� allowing a repeat of previous episodes, while waiting for the new season. Like the first Doctor, also the second was produced continuously, and a repeat of old episodes looked like a shame (in the following years it would have become usual).
During the fifth season appeared a character who would have become very popular:
colonel Alistair Lethbridge-Stewart, an army officer who collaborated with the Doctor to stop another alien menace, and decided to found a military organisation to prevent alien invasions, the U.N.I.T. (United Nations Intelligence Taskforce).
In 1969 men were about to land on the Moon, and that changed people�s point of view about space travel. Some thought it would have been more difficult to write believable science fiction, and anyway, after three years, also the second Doctor seemed to have lost his appeal on viewers, so Troughton decided it was time to leave.
Jon Pertwee was found as the third Doctor, and the second had a great ending: forced to call the time lords for help (he had always run away from them), was captured and prosecuted (and for the first time the Doctor�s origins were known). Jamie and Zoe were sent back to their times, forgetting all about the Doctor, and he
was condemned to a forced regeneration and exiled on Earth, having forgotten all about the TARDIS use.
Jon Pertwee became the most popular and most long-running Doctor before Tom Baker.
Moreover, the third Doctor was in colour, and all episodes started to be kept in the archives (in fact, until the 80s video-tapes were very expensive, so after 10 years they were often cancelled and re-used�).
The third Doctor was dressed as a dandy, with velvet suits, lace shirts and bow ties. In his first adventure he met a new race of enemies: the Autons, plastic robots sent by the Nestenes aliens.
Autons were defeated thanks also to the help of brigadier Lethbridge-Stewart,
who entered in the regular cast (and, at first, did not believe that man was the Doctor he knew�).
Due to his exile on Earth, the Doctor became UNIT�s scientific advisor, and could have a laboratory and a vintage yellow car named Bessie (later used also by Tom Baker). He had also a young assistant: Liz Shaw (Caroline John).
Since then most of the Doctor�s adventures took place on Earth, facing aliens, monsters and mad scientists, except for some voyages on other planets authorized by the Time Lords.
In the 8th season there were some changes. First of all there was a new assistant, Jo Grant (Katy Manning). Then entered a new enemy, a renegade Time Lord, the Master. The Master was created upon a simple idea: an enemy who was the exact
nemesis of the Doctor, as prof. Moriarty with Sherlock Holmes. To play the Master Roger Delgado was choosen. He initially had tried to become the Doctor, but the casting heads thought he was suitable for the Master: with his satanic beard, he was really perfect. During the same season, also the Daemons appeared.
The 10th season started with �The Three Doctors�. The Doctor saved the Time Lords from a big danger, and so he received an amnesty and could use the TARDIS again. At the end of the season, Jo marries a young scientist and leaves the UNIT, so at the beginning of the next season the Doctor finds a stowaway in the TARDIS: journalist Sarah Jane Smith (Elisabeth Sladen). In that episode (The time warrior) appear the Sontarans. Of course in the third Doctor�s adventures there had been also returns of the Daleks and the Cybermen.
The third Doctor also showed for the first time his famuos �ultrasonic screwdriver�, a device which could open or dismount everything.
During the 10th season a very nasty thing happened: Roger Delgado�s death in a car crash, while he was reaching the set. Pertwee was very sad about that. Moreover, UNIT stories�share was lowering, while Pertwee liked them very much although they were becoming rather ripetitive.
The viewing figures were the best of ever, but Pertwee decided to leave the programme. After five years of success, the depart of the most pupular Doctor was a very bad new for BBC heads, and they were really afraid it would have been impossible to repeat a similar hit. But then came Tom Baker�
Tom Baker became the ultimate Doctor: the most popular of ever and the most long-lived (seven seasons).
Until then, the record belonged to Jon Pertwee, and replacing him was a serious problem. Several actors were screened, but there were always problems: someone wanted to sign the scripts, someone did not want to tie himself to the Doctor, and someone was tied to another character and thought it would have been impossible to be regarded as the Doctor. Finally, someone suggested Tom Baker, and his eccentric manner seeemed perfect for the Doctor (later, someone said that perhaps Baker really �was� the Doctor!).
Baker was introduced to press on February 16, 1974, and meanwhile his first season pre-production started.
The fourth Doctor look was similar to Parisian painters of the 20s, with a soft hat and the famous 10 ft scarf: the costume maker had a huge quantity of various colour wool and used it all, and when the result was seen they thought to keep it, because was really funny. A little accident occurred while filming �The Sontaran experiment�: Baker fell down and broke his clavicle, so needed a stand-in for some scenes.
In the next season there was the last UNIT story, and there wouldn�t have been any more until the seventh Doctor. In �Pyramids of Mars� the Doctor had to disguise himself as a mummy, and the director wanted Baker to really wear the mummy costume, because watchers would have recognized his walking mode: Baker was not convinced, but he did.
The fourth Doctor�s viewing ratings increased every day, and Tom Baker took it
seriously: often he went in hospitals to visit ill children (who obviously called him �Doctor�), and was very careful to avoid drinking or smoking in public.
In the 15th season a very original companion appeared: K9, a cute mechanic dog voiced by John Leeson.
For his 5th season (the 16th of the whole programme), the Doctor had a woman of his race as a companion: Romana, a �Time Lady� played by Mary Tamm. But in the last episode of that season appeared actress Lalla Ward, and was going on with Baker so well that, being Mary Tamm unavailable for another season, Romana regenerated and Lalla Ward had the role (and married Baker in 1980).
During the 17th season there was an uncompleted episode (the only one in 26 years): �Shada�, which was not completed for a BBC strike. The episode was
released years later for home video, completed with a narration by Tom Baker.
Ratings started to lower in 1980: the fourth Doctor had perhaps lasted too much despite his popularity, and Baker too was tired.
�Logopolis� was the fourth Doctor�s last episode on TV, and Baker made other appearences on radio or audio adventures.
He mantained his popularity, and when there were voices around about his return in a movie (together with Vincent Price) which was never made, fans sent all their savings for help: a huge labour was needed to send back the money and to prevent similar events in the future.
Creating the fifth Doctor was a particularly difficult task: a replacement for Tom Baker was needed, and the show�s crisis had begun, and would have led to the (temporary)
end eight years later.
This time was harder than replacing Jon Pertwee, and very odd ideas came out, like regenerating the Doctor as a woman. Finally sexism took over, and there was Peter Davison (real name Peter Moffatt) ready. As previously happened, Davison was surprised to be cast as the Doctor: he could not understand how he would have fit in the part, seeming too young for it (he was 29, in fact).
In a certain way, the fifth looks as the less eccentric of the Doctors, and his victorian cricket player clothes look quite �normal�, but maybe this gave him his success: Davison looked like an idealist, absent minded but genial professor.
Writers introduced a quite unusual companion in the TARDIS: Turlough (Mark
Strickson), a saboteur who was waiting for the right moment to get rid of the
Doctor. Turlough�s disturbing presence went on for about two seasons, and this surely helped to mantain the audience�s interest. Anyway, fifth Doctor�s popularity could have gone on and grow, but at beginning of 21st season Davison made clear he did not want to go on. Luckily, in the previous season appeared an actor who looked perfect for the role, Colin Baker (no relations with Tom), and thew fifth Doctor regenerated towards the end of 21st season, on March, 1984.
When was introduced to press as the sixth Doctor, Colin Baker was full of enthusiasm, saying he wanted to last even more than his predecessor Tom Baker. But, sadly, everything went wrong.
The first cause of all the sixth Doctor�s problem was always the same: the
show was declining, and neither Peter Davison�s good ratings were similar to the golden ages.
First of all, the sixth Doctor was very unstable, often almost crazy and sadic, totally different from his previous incarnations. Sometimes was violent too: after his regeneration tried to strangle his companion Peri (a very memorable event), and often he was seen aiming a gun or a knife. Going on, his predecessors were eccentric but, in a certain way, elegant: Colin Baker�s orange costume made him nearly look like a clown, in an odd contrast with his behaviour. And, following the purpose of a change at all costs, the format too had changed: no more episodes in 2,4, or 6 parts of 25�, but 2 or 3 parts of 45�, altering suspence and pace of the stories.
Production�s costs were always high, and ratings were not brilliant, so there was the first, unexpected interruption of the programme. Since the Jon Pertwee era a six months pause between two seasons was absolutely normal, but this time 22nd season ended on March 1985, and nothing new was aired until September 1986! In a nutshell, a season was skipped. The Doctor�s fans protested with letters, phone calls and campaigns to save the show. But BBC was considering costs and benefits.
Then the last chance was tried: a long-running episode in 14 parts, titled �The trial of a Time Lord�, which was the 23rd season. To be sure, the 25� traditional format came back. But this time too something did not work.
The Doctor was tried by the Time Lords for his companion Peri�s death, and
there was a new companion, Melanie (Bonnie Langford). This time it was Melanie who did not appeal the viewers. She became unpopular quite like the sixth Doctor, and a long time later some magazines describe her as �one of the biggest disasters of TV science fiction�. Ratings went down, and Colin Baker paid for all.
Assuming, with some reasons, to be not guilty for his Doctor�s end, Baker talked straight to the press, and got rather annoyed when asked to shoot the regeneration scene: in fact he refused, not in spite of BBC but because he was searching for new scriptures and couldn�t remain engaged to film five minutes� The job was completed by the papers which misunderstood or gave wrong interpretations of his interviews�
While searching for the seventh Doctor, all was in a mess: there was no replacement, no script, and budget was lowering. Sylvester McCoy (real name Patrick Kent-Smith) was choosen: he had previously worked in children�s programmes and was as eccentric as the Doctor had to be.
At first they made him try Colin Baker�s costume, but size was too different and so a new costume was made. A cream jacket (later it became brown), a straw hat, a jumper with question marks, two-coloured shoes and an umbrella. The seventh Doctor was rather silent, often playing with his hat and umbrella (like Charlot), but also watchful, ready for action in case of troubles. Stories became darker (see, for example, �Ghostlight�), but his companion was still Melanie, for viewers dislike.
Colin Baker was not available for the regeneration, so McCoy had to wear a wig and a costume which made him look like Baker, and was shot from behind while the TARDIS crashed and he fell on the floor, dying. Melanie turned the Doctor�s face, and it was McCoy�s. The usual scene of clothes choice followed, and for a while also Tom Baker�s clothes and scarf were seen.
At the end of 24th season there was a nice surprise: at last Melanie remained on a planet, and was replaced by a teen-ager girl named Ace. Played by Sophie Aldred, Ace was quite different from all the previous women of the show: she was very brave, she did not scream, drove a motorbike and was skilled with explosives. Differently from Melanie, Ace became one of the
most popular companions of ever. But ratings did not raise anyway.
Viewers were no more interested in science fiction, and BBC did not want to go on, not on its own.
So, a year before the end of McCoy�s contract, at the end of �Survival� the Doctor was seen walking to the TARDIS together with Ace�
Since then, BBC tried to find a co-producer, the 30 years anniversary was incredibly missed in 1993, and in 1996 a TV-movie was released, the Doctor played by McCoy (for only some minutes) and then Paul McGann.
The movie, simply titled �Doctor Who�, was a try to introduce the character to USA viewers (with Universal�s backing, absolutely necessary to start the show again). But the Doctor was �too british�, and the attempt to please
both british and american audience obtained the opposite effect.
So the movie had no sequels, at least on TV: being Paul McGann officially the eigth Doctor, appeared on books or audio CD dramas, as the other Doctors did before.
Finally, while all seemed ended forever, the surprise: in year 2005 the Doctor came back on the screen, with new episodes and a new actor (Cristopher Eccleston). And, more surprisingly, audience too has come back, in fact new season have been released with a tenth Doctor (David Tennant).
This time writers have made a big job, mantaining the original premise, changing from the �miniseries� to complete episodes of 60�, with more
actual (and dark) stories, updating all what could have been necessary without regrets for the past. Only a strange fact: it is not clear where has the eigth Doctor gone, the new season begins with the ninth Doctor and nobody knows why he has regenerated.
There are also two spin-offs: �Torchwood� (�Doctor Who��s anagram!), an organisation which fights alien invasions (very original idea, anyway�) and �Sarah Jane adventures�, where a middle aged (as Elizabeth Sladen now is) Sarah Jane Smith has to face misteries and aliens: something similar was already tried in 1981, with a 90� special titled �K9 and company: a girl�s best friend�, where Sarah met the Doctor�s robotic pet.
200 stories, 702 episodes (684 of 25�, 16 of 45�, 2 of 90�, 41 of 60', 253 b/w, 449 colour)
First Doctor (William Hartnell, 1963-66)
First season
| i don't know |
Which war is the setting for Hemingway's novel 'For Whom The Bell Tolls'? | Books of The Times
Books of The Times
FOR WHOM THE BELL TOLLS
By Ernest Hemingway.
ll that need be said here about the new Hemingway novel can be said in relatively few words. "For Whom the Bell Tolls" is a tremendous piece of work. It is the most moving document to date on the Spanish Civil War, and the first major novel of the Second World War.
As a story, it is superb, packed with the matter of picaresque romance: blood, lust, adventure, vulgarity, comedy, tragedy. For Robert Jordan, the young American from Montana, the lust and adventure are quickly drowned in blood. The comedy, as in other Hemingway fiction, is practically indistinguishable from the vulgarity, which in this case is a rich and indigenous peasant brand. The tragedy is present and only too plain; the bell that began tolling in Madrid four years ago is audible everywhere today.
Robert Jordan is a partizan attached to the Loyalist forces. He is neither a professing Communist nor a professional soldier, but a college instructor who happened to be in Spain on sabbatical leave. During the three or four days covered by the story, he hides out in Franco-controlled territory, into which he has been sent by headquarters to dynamite a strategic mountain bridge.
He doesn't hide out alone; as prearranged, he has made contact with a certain guerrilla band operating from a cave high in the Sierra de Guadarrama. He meets two women there, one middle-aged and as tough and blasphemous as any man, the other young and frightened, her hair still short because the Falangists shaved it off after they shot her parents and rampaged through her native town.
He meets the saturnine Pablo, who sits in the cave half drunk and mumbles, "Thou wilt blow no bridge here." He meets old Anselmo, who helps him blow it in the end, and Primitivo, Fernando, Augustin and several more. Once he meets El Sordo, who lives with his band on another ridge some miles way. "Listen to me," El Sordo explains, "we exist here by a miracle. By a miracle of laziness and stupidity of the Fascists which they will remedy in time. Of course we are very careful and we make no disturbance in these hills."
But Robert Jordan has come to make a disturbance. He must make it if the Loyalist drive out of Madrid toward Segovia is to have a chance to succeed.
Mr. Hemingway has always been the writer, but he has never been the master that he is in "For Whom the Bell Tolls." The dialogue, handled as though in translation from the Spanish, is incomparable. The characters are modeled in high relief. A few of the scenes are perfect, notably the last sequence and an earlier one when Jordan awakes to the sound of a horse thumping along through the snow. Others are intense and terrifying, still others gentle and almost pastoral, if here and there a trifle sweet.
It is fourteen years since "The Sun Also Rises" and eleven since "A Farewell to Arms." More than three hundred years ago John Donne said, "No man is an Iland, intire of it selfe; every man is a peece of the Continent, a part of the maine. * * * And therefore never send to know for whom the bell tolls; it tolls for thee." Mr. Hemingway has taken this text and, out of his experiences, convictions and great gifts, built on it his finest novel.
| Spanish Civil War |
By what one word name is Portuguese footballer Luis Carlos Almeida da Cunha known? | SparkNotes: For Whom The Bell Tolls: Plot Overview
For Whom The Bell Tolls
Ernest Hemingway
Context
Character List
For Whom The Bell Tolls opens in May 1937, at the height of the Spanish Civil War. An American man named Robert Jordan, who has left the United States to enlist on the Republican side in the war, travels behind enemy lines to work with Spanish guerrilla fighters, or guerrilleros, hiding in the mountains. The Republican command has assigned Robert Jordan the dangerous and difficult task of blowing up a Fascist-controlled bridge as part of a larger Republican offensive.
A peasant named Anselmo guides Robert Jordan to the guerrilla camp, which is hidden in a cave. Along the way, they encounter Pablo, the leader of the camp, who greets Robert Jordan with hostility and opposes the bridge operation because he believes it endangers the guerrilleros’ safety. Robert Jordan suspects that Pablo may betray or sabotage the mission.
At the camp, Robert Jordan meets Pilar, Pablo’s “woman.” A large, sturdy part-gypsy, Pilar appears to be the real leader of the band of guerrilleros. A rapport quickly develops between Robert Jordan and Pilar. During the course of the evening, Robert Jordan meets the six other inhabitants of the camp: the unreliable Rafael, feisty and foul-mouthed Agustín, dignified Fernando, old Primitivo, and brothers Andrés and Eladio. The camp also shelters a young woman named Maria, whom a band of Fascists raped not long before. Robert Jordan and Maria are immediately drawn to each other.
Robert Jordan and Anselmo leave the camp to scout out the bridge. When they return, Pablo publicly announces that neither he nor his guerrilleros will help blow up the bridge. Pilar and the others disagree, however, so Pablo sullenly gives in. Privately, Rafael urges Robert Jordan to kill Pablo, but Pilar insists that Pablo is not dangerous. That night, Maria comes out to join Robert Jordan as he sleeps outside. They profess love for each other and make love.
The next morning, Pilar leads Robert Jordan through the forest to consult with El Sordo, the leader of another band of guerrilleros, about the bridge operation. They take Maria along. El Sordo agrees to help with the mission, but both he and Robert Jordan are troubled by the fact that the bridge must be blown in daylight, which will make their retreat more difficult. On the way back to Pablo’s camp, Robert Jordan and Maria make love in the forest. When they catch up with Pilar, Maria confesses to Pilar that the earth moved as they made love. Pilar, impressed, says that such a thing happens no more than three times in a person’s lifetime.
Back at the camp, a drunken Pablo insults Robert Jordan, who tries to provoke Pablo, hoping to find an excuse to kill him. Pablo refuses to be provoked, even when Agustín hits him in the face. When Pablo steps away for a few minutes, the others agree that he is dangerous and must be killed. Robert Jordan volunteers to do it. Suddenly, Pablo returns and announces that he has changed his mind and will help with the bridge. Later that night, Maria comes outside to sleep with Robert Jordan again. They talk about their feeling that they are one person, that they share the same body.
In the morning, Robert Jordan wakes up, sees a Fascist cavalryman, and shoots him, awakening the camp. After breakfast, the group hears sounds of a fight in the distance, and Robert Jordan believes that the Fascists are attacking El Sordo’s camp. Agustín and Primitivo want to aid El Sordo, but Robert Jordan and Pilar know that it likely would be useless.
The scene shifts to El Sordo’s hill, which a group of Fascists is assaulting. El Sordo’s men play dead and manage to shoot the Fascist captain, but several minutes later, Fascist planes bomb the hilltop and kill everyone in El Sordo’s band. The ranking Fascist officer orders the beheading of all the corpses of El Sordo’s men.
The guerrilleros at Pablo’s camp, having heard the planes bomb El Sordo’s hill, feel glum as they eat lunch. Robert Jordan writes a dispatch to the Republican command recommending that both the bridge operation and the larger offensive be canceled, for the Fascists are aware of the plan and the operation will not succeed. He sends Andrés to deliver the dispatch to the headquarters of General Golz, a Republican leader. Maria again joins Robert Jordan in his sleeping bag that night, and they fantasize about their future life in Madrid.
Meanwhile, in Madrid, Robert Jordan’s friend, a Russian journalist named Karkov, learns that the Fascists know about the offensive the Republicans have planned for the next day. Karkov worries about Robert Jordan.
At two in the morning, Pilar wakes Robert Jordan and reports that Pablo has fled the camp with some of the explosives that were meant to blow the bridge. Though furious at first, Robert Jordan controls his anger and plans to carry out the operation anyway, with fewer explosives. He wakes up Maria, and as they make love, they feel the earth move again. Pablo suddenly returns just before dawn, claiming that he left in a moment of weakness. He says that he threw the explosives into the river but felt great loneliness after doing so. He has brought back five men with their horses from neighboring guerrilla bands to help. The fighters take their positions.
The scene shifts to Andrés, who has been traveling through the night to deliver Robert Jordan’s dispatch to General Golz. Crossing into Republican territory, Andrés is slowed when several suspicious but apathetic officers question him. When Andrés and his escort finally near Golz’s headquarters, a politician named André Marty suspects that they are Fascist spies and orders them arrested. Robert Jordan’s friend Karkov hears about the arrests and uses his influence to free the men. Robert Jordan’s dispatch finally reaches Golz but arrives too late. The Republican offensive already has begun and can no longer be stopped.
As dawn breaks, Robert Jordan and Anselmo descend on the bridge, shoot the Fascist sentries, and plant the explosives. Pilar arrives and says that Eladio has been killed, while Fernando, fatally wounded, must be left behind. When Robert Jordan detonates the explosives, the bridge falls, but shrapnel from the blast strikes Anselmo and kills him. Pablo emerges from below, saying that all five of his men are dead. Agustín accuses Pablo of shooting the men for their horses, and Pablo does not deny it.
As the group crosses the road in retreat, a Fascist bullet hits Robert Jordan’s horse, which tramples on Robert Jordan’s left leg, breaking it. Knowing that he must be left behind, Robert Jordan says goodbye to Maria, saying that he will be with her even if she goes. Pilar and Pablo lead Maria away.
Alone, Robert Jordan contemplates suicide but resolves to stay alive to hold off the Fascists. He is grateful for having lived, in his final few days, a full lifetime. For the first time, he feels “integrated,” in harmony with the world. As the Fascist lieutenant approaches, Robert Jordan takes aim, feeling his heart beating against the floor of the forest.
More Help
| i don't know |
The four bases of DNA are usually referred to by letters. A, C and T are three. Which is the fourth letter? | DNA, genes and chromosomes — University of Leicester
A human being has 20,000 to 25,000 genes located on 46 chromosomes (23 pairs). These genes are known, collectively, as the human genome.
Chromosomes
Eukaryotic chromosomes
The label eukaryote is taken from the Greek for 'true nucleus', and eukaryotes (all organisms except viruses, Eubacteria and Archaea) are defined by the possession of a nucleus and other membrane-bound cell organelles.
The nucleus of each cell in our bodies contains approximately 1.8 metres of DNA in total, although each strand is less than one millionth of a centimetre thick. This DNA is tightly packed into structures called chromosomes, which consist of long chains of DNA and associated proteins. In eukaryotes, DNA molecules are tightly wound around proteins - called histone proteins - which provide structural support and play a role in controlling the activities of the genes. A strand 150 to 200 nucleotides long is wrapped twice around a core of eight histone proteins to form a structure called a nucleosome. The histone octamer at the centre of the nucleosome is formed from two units each of histones H2A, H2B, H3, and H4. The chains of histones are coiled in turn to form a solenoid, which is stabilised by the histone H1. Further coiling of the solenoids forms the structure of the chromosome proper.
Each chromosome has a p arm and a q arm. The p arm (from the French word 'petit', meaning small) is the short arm, and the q arm (the next letter in the alphabet) is the long arm. In their replicated form, each chromosome consists of two chromatids.
Chromosome unraveling to show the base pairings of the DNA
The chromosomes - and the DNA they contain - are copied as part of the cell cycle, and passed to daughter cells through the processes of mitosis and meiosis.
Read more about the cell cycle, mitosis and meiosis
Human beings have 46 chromosomes, consisting of 22 pairs of autosomes and a pair of sex chromosomes: two X sex chromosomes for females (XX) and an X and Y sex chromosome for males (XY). One member of each pair of chromosomes comes from the mother (through the egg cell); one member of each pair comes from the father (through the sperm cell).
A photograph of the chromosomes in a cell is known as a karyotype. The autosomes are numbered 1-22 in decreasing size order.
Karyotype of a human male
Prokaryotic chromosomes
The prokaryotes (Greek for 'before nucleus' - including Eubacteria and Archaea) lack a discrete nucleus, and the chromosomes of prokaryotic cells are not enclosed by a separate membrane.
Most bacteria contain a single, circular chromosome. (There are exceptions: some bacteria - for example, the genus Streptomyces - possess linear chromosomes, and Vibrio cholerae, the causative agent of cholera, has two circular chromosomes.) The chromosome - together with ribosomes and proteins associated with gene expression - is located in a region of the cell cytoplasm known as the nucleoid.
The genomes of prokaryotes are compact compared with those of eukaryotes, as they lack introns, and the genes tend to be expressed in groups known as operons. The circular chromosome of the bacterium Escherichia coli consists of a DNA molecule approximately 4.6 million nucleotides long.
In addition to the main chromosome, bacteria are also characterised by the presence of extra-chromosomal genetic elements called plasmids. These relatively small circular DNA molecules usually contain genes that are not essential to growth or reproduction.
| G |
On which canal is 'Neptune's Staircase', the longest staircase lock in the UK? | See A Full Screen Of DNA Code
DNA is an enormous double-stranded, twisted molecule densely coiled around molecular beads of histone protein to form a chromosome. A strand of DNA from a human chromosome is a very long series of coded messages called genes. Sections of DNA composed of about 1000-1500 bases represent genes. Each gene is composed of many thousands of letters called bases. Unlike the English alphabet of 26 letters, there are only four possible DNA bases: A, T, C & G. In order for the cell to decipher the DNA strand, the bases must be read in groups of three letters called base triplets or codons. It is also important to start reading on the correct letter of the base sequence where the first codon of the gene begins. Since there are four different possibilities for each base of a codon, the total number of DNA codons is 43 or 64. Some codons represent "punctuation marks" marking the beginning or the end of a gene message. The following sequence of letters is meaningless unless you start on the fourth letter and read it in groups of three letters:
LSH|THEMANANDBOYARESAD = THE MAN AND BOY ARE SAD
Technically, the previous sequence of letters is called a cipher, a method of transforming text in order to conceal its meaning. Ciphers were commonly used during times of warfare. A telegram was sent to Tokyo from the Japanese consulate in Honolulu on the evening before the attack on Pearl Harbor. It reported on the ships of the U.S. Fleet that were in port. The telegram was written in a cipher in which the words were run together and the letters grouped into blocks of 5:
The following DNA sequence must also be read in groups of three bases. You must start reading on the second codon because the first codon (AUG) means start:
AUG|AATCGCATACTAAGACAG = AAT CGC ATA CTA AGA CAG
If one base in the DNA sequence becomes altered or changed due to a point mutation, the entire meaning of the message is changed. For example, change the last C to a T:
AATCGCATACTAAGATAG
This is essentially the same as changing the last S in the above letter sequence to a B. Now the last word is BAD rather than SAD:
THEMANANDBOYAREBAD
International Morse Code
In the following example, a mutation in a word sequence is compared with the International Morse Code. If the code for S (3 dots) is changed to a dash + 3 dots, the letter B is represented. The addition of one dash changes the meaning of the entire message. A base substitution in a DNA sequence can change the meaning of an entire gene, resulting in an incorrect amino acid sequence and a faulty protein. This can be a critical mutation, particularly if the protein happens to be a vital enzyme.
Garbled Message
A One-Letter Substitution (Point Mutation) In A Sentence
Like a point mutation in DNA, a one-letter substitution in a word can sometimes completely change the meaning of the sentence. This is especially true when speaking or writing in another language. In a store in Costa Rica I discovered that had no Costa Rican currency called colones, only U.S. dollars. In my meager attempt to speak Spanish to the clerk, I told her that I had no "cojones," inadvertently subsititing a "j" for an "l." When she replied: "I am sorry for you," I knew that my sentence was corrupted. In a vulgar translation, I essentially told the woman that I had no testicles! In this case, a one letter substitution (mutation) completely changed the meaning of the sentence.
2. Mutations Causing Tumors In Animals
When cells divide abnormally they often develop into tissue masses called tumors. Tumors can be produced throughout the body and they can be malignant or benign. Malignant tumors are often referred to as cancers. Some human cancers are caused by viruses, such as certain forms of the herpes virus that causes cervical cancer. Most cancers are neoplastic tumors caused by mutations in the DNA of cells. These mutations interfere with the cell's ability to regulate and limit cell division. Dormant cells enter the M-phase of the cell cycle and begin to divide out of control. Mutations that activate cancer-causing oncogenes or repress tumor-suppressor genes can eventually lead to tumors. Cells have mechanisms that repair mistakes in their DNA; however, mutations that affect repair enzymes may cause tumors to form. One of the best examples of the latter mechanism is a basal cell carcinoma.
Excessive exposure to UV radiation from the sun can cause mutations in undifferentiated basal keratinocytes (basal cells) of the epidermis. The specific mutation is called a thymine dimer within the DNA molecule. In normal DNA, the pyrimidine base thymine only pairs with the purine base adenine. When two adjacent thymine bases bond together this causes an abnormal configuration or "kink" in the DNA. Healthy cells can recognize and repair this mistake by excision repair enzymes. In some animals the mutation is repaired by DNA photolyase enzymes that clip out (cleave) the dimer. People with a genetic propensity for skin cancers may have insufficient repair enzymes due to mutations that repress the genes for these repair mechanisms. Although malignant basal cell carninomas generally do not metastasize, they may slowly invade deep layers of the skin and adjacent tissue and eventually be quite destructive. The following image shows the invasive growth of a basal cell carcinoma (technically a morpheaform bcc) that required the removal of about 1/3 of the author's nose. Unlike the nodule growth form of some basal cell carcinomas, the morpheaform bcc proliferates into deeper tissue with aggressive, tentacle-like branches. In addition to an increased number and density of dark-staining basal cells, the latter type of skin cancer produces a proliferation of fibroblasts within the dermis and an increased collagen deposition (sclerosis) that resembles a scar. The tumor appears as a whitish, waxy, sclerotic plaque that rarely ulcerates. It does not form noticeable scabs as in other skin cancers. On the surface of the author's ala (side of nose), this carcimoma resembled a small, concave scar; however, it had grown extensively into surrounding tissue. Although the sun is the vital energy source for all life on earth, it can also be a potent carcinogen.
On a positive note for sun exposure, synthesis of vitamin D, a vitamin essential to human biological function, begins with activation of a precursor molecule in the skin by UV rays. Enzymes in the liver and kidneys then modify the activated precursor and finally produce calcitrol, the most active form of vitamin D. During most of the year, a few hours per week of sun exposure to the face and arms is sufficient to meet the body's requirement for the activated calcitrol precursor. In general, fair-skinned people live in northern latitudes with lower light intensity compared with dark-skinned people of the tropical latitudes. Dark skinned people produce greater concentrations of melanin which protects their skin from harmful rays of the sun. Basal cell carcinomas are rare in Blacks and Asians, compared with fair-skinned Whites. It has been suggested that fair-skinned people of northern latitudes might have a slight advantage in synthesizing vitamin D, especially during months of the year in regions with reduced light intensity.
View An Excellent McGraw-Hill Video About Thymine Dimers
3. Simple Analogy Between A Chromosome & Floppy Disk:
A simple comparison between a doubled eukaryotic chromosome (composed of two chromatids) and an ordinary floppy disk. Genes are stored as sections of nucleotides along the twisted, double-stranded DNA ladder which makes up each chromatid. In a sense, genes are like information files stored on the magnetic layer of a floppy disk. In this example, the entire chromosome could be compared with a floppy disk or CD.
4. Biological Viruses vs. Computer Viruses
1. Animal and plant viruses are macromolecular units composed of DNA or RNA surrounded by an outer protein shell. They have no membrane-bound organelles, no ribosomes (organelle site of protein synthesis), no cytoplasm (living contents of a cell), and no source of energy production of their own. They do not exhibit autopoiesis--i.e. they do not have the self-maintenance metabolic reactions of living systems. Viruses lack cellular respiration, ATP-production, gas exchange, etc. However, they do reproduce, but at the expense of the host cell. Like obligate parasites, they are only capable of reproduction within living cells. In a sense, viruses hijack the host cell and force it to produce more viruses through DNA replication and protein synthesis. Outside of their host cells, viruses can survive as minute macromolecular particles. Infectious human viruses can be dispersed though the air (airborne viruses causing influenza and colds) or body fluids (HIV virus). Epidemic viruses (such as HIV & hepatitis B) that are passed from person to person via sexual conjugation are remarkably similar to computer viruses. Unfortunately in humans there is no resident antivirus program to alert you of a potential infection, or to quickly scan your body and delete the invader once it has entered your system. Humans must rely on their amazing antibody and cell-mediated immune response, one of the most complex and remarkable achievements in the evolution of living systems.
Poison Oak: A Cell Mediated Immune Response
2. Computer viruses are generally executable files that copy information to various sectors of your hard drive. Like human viruses, computer viruses replicate automatically by attaching to host software or disk sectors on your computer, usually without your knowledge. Boot viruses dwell in the boot sector of the hard drive or floppy disk that carries them. These execute as your computer starts or whenever your computer reads information from an infected floppy disk. Once they copy themselves into your computer's memory, they can then spread to other disks or other computers on a network, each time leaving copies of themselves that can repeat the cycle. Viruses often target files with certain extensions, often attacking Microsoft data and template files. [Perhaps the cleaver creators of these viruses have a malicious vendetta against the Microsoft monopoly.] In recent years, some very sophisticated viruses have been developed which combine both file-infecting and boot sector-infecting features. Just as certain strains of HIV can alter their protein shell so they are unrecognizable to your immune system, some computer viruses are able to disguise their code from your antivirus software. Human viruses are spread by the exchange of body fluids and extremely infectious airborne strains. Some of the most obnoxious modern computer viruses are spread very rapidly through the Internet, often as executable e-mail attachments.
Worms are independent virus programs that send themselves around the Internet and launch themselves silently on computers of unsuspecting victims. Trojan horses are malicious programs that appear to be a useful application, such as a screen saver, handy utility or a nifty game. Once executed they can make a computer vulnerable to hackers or even destroy critical files on the hard drive. Like the immune system of animals (including T-cells, B-cells and antibodies), antivirus software identify potential viruses and destroy them before they spread rampantly throughout the infected computer's boot sectors and hard drive. Updating the antivirus dat files is like maintaining up-to-date vaccinations and booster innoculations against new viral strains. Unfortunately, in humans there is no way to back up your entire healthy body data and then simply restore it when you become infected.
5. Protein Synthesis Sample Quiz
In the above diagram you are given the following:
1. A single strand of 24 DNA bases representing a gene. The gene starts with the base C and ends with the base C.
2. 14 Transfer RNA (T-RNA) molecules, each consisting of an amino acid (abbreviated by 3 letters within a box), and the base triplet of the corresponding anticodon (outside of the box).
3. The abbreviation and proper spelling of each amino acid.
The objectives of this sample quiz:
From left to right, indicate the proper arrangement of the eight amino acids of a polypeptide determined by this sequence of 24 DNA bases. Remember that this problem involves two steps: 1. Transcription and 2. Translation:
Transcription: Construct a strand of Messenger RNA (M-RNA) from the initial gene sequence. Remember that C in DNA becomes G in M-RNA, G in DNA becomes C in M-RNA, A in DNA becomes U in M-RNA, and T in DNA becomes A in M-RNA.
The M-RNA strand should have the following RNA base sequence:
GGUAUUGCUUAUAAUCACCUAGAG
Translation: Match up the anticodons of the T-RNA with the codons of the M-RNA. It might be easier to first divide the M-RNA base sequence into base triplets or codons (3 letter sequences):
GGU-AUU-GCU-UAU-AAU-CAC-CUA-GAG
The anticodon CCA from the above chart matches up to the complementary codon GGU, making Gly (glycine) the first amino acid in the polypeptide. The anticodon UAA matches up to the codon AUU, making Iso the second amino acid in the polypeptide. The following shows the completed polypeptide with the correct order of amino acids corresponding with the initial DNA base sequence:
The relationship between DNA, M-RNA, T-RNA and each amino acid of the completed polypeptide is shown in the following table:
DNA
Cloverleaf Model Of Transfer RNA
Mutation: Assume that the initial DNA strand was treated with nitrous acid (HNO2), oxidizing all the cytosine bases (C) and converting them into uracil bases (U). DNA does not normally contain uracil (U). This mutation in DNA will now have the following base sequence:
UUATAAUGAATATTAGTGGATUTU
The M-RNA strand made from this mutant DNA strand containing U instead of C will have the following base sequence:
AAU-AUU-ACU-UAU-AAU-CAC-CUA-AAA
The following shows the completed polypeptide with the correct order of amino acids that correspond with the mutant strand of DNA. Note that three amino acids (shown in pink) are different from the original polypeptide made from the original DNA strand. They are different because the codons changed as a result of the substitution of U (uracil) for C (cytosine). In three places along the strand, a different T-RNA anticodon matched up with the altered codons.
The relationship between the mutant DNA, M-RNA, T-RNA and each amino acid of the completed polypeptide is shown in the following table:
Mutant DNA
A Simplified Explanation For Jumping Genes And
Their Effect On The Striped Kernels Of Indian Corn
The reddish streaks on these corn grains are caused by transposons.
Grains of Indian corn come in different colors, such as purple, yellow and white. Sometimes the individual grains are purple with white streaks or mottling. This mottling effect defies Mendel's basic principles of genetics because individual grains may be multicolored rather than a single color. The movement of transposons on chromosomes may result in colored, non-colored and variegated grains that do not fit traditional Mendelian ratios based solely on chromosome assortment during meiosis and random combination of gametes. The explanation for this phenomenon involves "jumping genes" or transposons, and earned Dr. Barbara McClintock the prestigious Nobel Prize in Medicine in 1983 for her life-long research on corn genetics.
Transposons are genes that move from one location to another on a chromosome. In the pigmented aleurone layer of corn grains, the position of transposons may inhibit or block pigment production in some cells. For example, if the transposon moves to a position adjacent to a pigment-producing gene, the cells are unable to produce the purple pigment. This results in white streaks or mottling rather than a solid purple grain. The duration of a transposon in this "turned off" position affects the degree of mottling. If the pigmentation gene is turned off long enough by a transposon, the grain will be completely unpigmented. The reddish-purple patterns caused by transposons may be blotches, dots, irregular lines and streaks.
The reddish streaks on these corn grains are caused by transposons.
The following illustration shows how grain color in Indian corn may be affected by transposons. The different cards represent a linear sequence of genes on a chromosome. The ace of spades represents a transposon that moves to different positions on the chromosome. The jack of diamonds represents the gene for purple pigmentation in the corn grain. When the transposon (ace of spades) moves to a position adjacent to the gene for pigmentation (jack of diamonds), the pigmentation gene is blocked and no purple is synthesized (white area):
When the transposon (ace of spades) moves away from the gene for pigment production (jack of diamonds), the production of purple pigment is resumed (continuous purple area). In this example the gene for pigment production (jack of diamonds) is not adjacent to a transposon (ace of spades):
When a transposon moves to different positions within cells of the corn kernel, the coloration gene is "turned on" or "turned off" depending on whether it lands in a position adjacent to the pigmentation gene. Transposons may also have a profound effect on embryonic development and tumor formation in animal cells. Oncogenes (genes that cause tumors) may be activated by the random reshuffling of transposons to a position adjacent to the oncogene. Transposons may also be useful in genetic engineering with eukaryotic cells, by splicing in transposons to activate certain genes. The implications from Barbara McClintock's discovery of transposons may be far-reaching and as significant as Watson and Crick's discovery of the structure of DNA.
Federoff, N.V. 1984. "Transposable Genetic Elements in Maize."
Scientific American Volume 250 (Number 6): 84-98.
8. Introns and Exons
In eukaryotic cells, the initial messenger RNA (M-RNA) transcribed from the DNA (gene) is modified (shortened) before it leaves the nucleus. Sections of the M-RNA strand called introns are removed, and the remaining portions called exons are spliced together to form a shortened (edited) strand of mature M-RNA that leaves the nucleus and travels to the ribosome for translation into protein. Perhaps the deleted sections (introns) were needed by our ancestors, but are no longer necessary. In fact, this hypothesis was actually utilized in an episode of Star Trek: The Next Generation. In this episode the crew was reverting back to their ancestral state because their introns were reactivated.
9. The Human Genome
A genome may be defined as all of the functional genes in an organism, including haploid and diploid organisms, and viruses. Total genomic DNA includes genes of the nucleus, nucleolus and cytoplasmic organelles, including chloroplasts and mitochondria. Polyploid organisms also have one genome. For example, a tetraploid plant has one tetraploid genome composed of four haploid sets of chromosomes. The mule genome is composed of one set of donkey chromosomes and one set of horse chromosomes. A lichen genome is composed of the DNA from two symbiotic organisms that live together in one body, the photosynthetic alga (photobiont) and heterotrophc fungus (mycobiont). The Human Genome Project is a worldwide endeavor to map the DNA base sequence of every gene in the human genome. As of February 2001, the total number of functional genes is considerably less than expected, about 30,000 genes per cell compared with previous estimates of 100,000 genes per cell. It has been estimated that a human somatic cell contains about 5 billion base pairs. If the average gene contains 1500 bases, then 30,000 functional genes is only about one percent of the total DNA per cell.
Cottonwood Tree Has More Genes Than A Human?
Although DNA sequences for all the genes in some animal species have be published, relatively few plant genomes have been mapped. According to Gerald Tuskan of Oak Ridge National Laboratory, Tennessee, the black cottonwood (Populus trichocarpa) genome has now been determined. His team identified more than 45,000 putative protein-coding genes. The human genome, by comparison, is thought to contain 20,000 to 30,000 functional genes. In this comparison, the morphological complexity of an organism is certainly not reflected by the number of genes. Knowing the genome of a tree like the black cottonwood may be very benefical to an energy-demanding world. It may enable researches to manipulate biochemical pathways in the tree to make a better renewable biofuel source. For example, black cottonwoods already grow and resprout very quickly in a small space. Researchers could make the trees contain a higher proportion of cellulose to lignin, which is easier to convert into sugars and ethanol.
Tuskan, G., et al. 2006. Science 313: 1596 - 1604.
DNA & Human Genome Links:
National Human Genome Research Institute
10. Transgenic Plants: Plants With Foreign Genes
Like tumorous growths, some galls can be very destructive to the host plant. In fact, crown gall (caused by the bacterium Agrobacterium tumefaciens) can cause serious damage to orchard trees. Crown galls are especially interesting because the plasmids of this bacterium (small, circular DNA molecules) contain genetic information that may become incorporated into the nuclear DNA of the infected host cells. These plasmids are referred to as tumor-inducing or Ti plasmids. The Ti plasmid DNA contains genes which cause the host cells to divide uncontrollably. In a sense, the plasmids are like floppy disks containing files or "genes" which are loaded into the host DNA. This explains why these "plant tumors" continue to grow even when the bacteria are eliminated. Ti plasmids are a powerful tool for genetic engineering in plants because the tumor-inducing genes can be replaced with beneficial genes. Agrobacterium tumefaciens containing genetically-engineered (recombinant DNA) plasmids can then be used to transfer the beneficial genes into the host DNA of an infected plant. For example, bacterial genes for insecticidal proteins have been transferred into tomato plants, resulting in transgenic plants that are resistant to ravenous lepidopteran larvae. The protein toxin actually kills the caterpillars feeding on the plant.
Massive crown gall at the base of an adventitious stem of an apple tree. Note the enlarged swellings on the roots. This plant disease is caused by the soil bacterium (Agrobacterium tumefaciens).
Read About Genetically Engineered Tomatoes
The Ti plasmid technique with Agrobacterium tumefaciens as a vector has also been used to introduce a gene into transgenic plants that is resistant to the herbicide Roundup�. This popular herbicide used for weed control blocks a single target enzyme essential to plants for the production of aromatic amino acids. Without aromatic amino acids the plant essentially starves to death after a few weeks. The transgenic plants are resistant to Roundup� because they contain a gene from a Salmonella bacterium that produces a mutant form of the target enzyme that is not blocked by this herbicide. Transgenic plants containing this Salmonella gene and modified target enzyme are immune to Roundup� and still produce the vital aromatic amino acids. Although extremely toxic to plants, Roundup� does not block amino acid enzymes in animals. In fact, aromatic amino acids in people, such as phenylalanine, are among the eight essential amino acids that are not synthesized in cells and consequently must come from our diet.
Another species of bacteria (Bacillus thuringiensis) also referred to as BT, has natural insecticidal properties. This common soil bacterium produces proteins that are especially toxic to alkaline insect stomachs, but not to the acidic stomachs of mammals. These BT proteins have been found to be remarkably effective against a wide range of caterpillars and worms, including peach tree borers, European corn borers, cotton boll worms, cabbage worms and loopers, tomato and fruit hornworms, tent caterpillars, fall webworms, leaf miners, alfalfa caterpillars, leaf rollers, gypsy moth larvae and cankerworms.
According to T.D. Brock and M. T. Madigan (Biology of Microorganisms, 1988), Bacillus thuringiensis forms a crystalline protein during sporulation called a parasporal body. The toxic component of the crystalline body is delta endotoxin. BT bacteria are readily mass-produced by commercial companies and are sold in the form of a stable wettable dust containing millions of spores and crystalline bodies (or just the crystalline toxin). When a caterpillar ingests any plant tissue with BT spores and crystals on it, the delta endotoxin causes deterioration of the intestinal lining and paralysis of the insect's gut. In addition, the bacteria quickly become active and invade the host causing lethal septicemia (blood poisoning due to pathogenic bacteria in the bloodstream).
The use of fungal and bacterial spores as microbial insecticides is becoming an increasingly popular method of "biological control." Advocates of this method of insect control maintain that it is safer and more effective than traditional nonspecific poisons (biocides) that kill many life forms. In addition, the lethal biocides enter the food chain and become concentrated along successive trophic levels, a serious condition known as "biological magnification."
Another potent tool used in genetically modified (GM) plants is the cauliflower mosaic virus (CaMV) 35S promoter. [The promoter is a short sequence of DNA that defines the start of a gene, the direction of transcription, and the strand of DNA to be transcribed. It is one component of an operon, a group of structural and regulating genes that functions as a single unit. Transcription begins when the enzyme RNA polymerase attaches to the promoter.] The CAMV promoter is used in many GM plants because it is more powerful than other promoters, is active in both angiosperms and gymnosperms, and is not greatly influenced by the environment or tissue type. The presence of CaMV promoter DNA in food crops is evidence of transgenic contamination. Other genetic sources of transgenic contamination include DNA sequences from Agrobacterium tumefaciens and Bacillus thuringiensis.
11. Genetically Modified Organisms (GMOs)
In the everchanging world of biotechnology, the genes for BT proteins have now been isolated and introduced into the DNA of corn plants (Zea mays), tomatoes (Lycopersicon esculentum) and potatoes (Solanum tuberosum). One of the transgenic corn hybrids, called "starlink corn," produces a toxic BT insecticide in its tissues that is lethal to corn borers and other destructive insect pests. Genetically modified (transgenic) food plants (GM plants) have become a controversial issue in recent years, especially in Europe. Many people are very concerned about the potential dangers of altering the genomes of food plants. For example, the transgenic starlink corn was originally designed as animal food, but due to human error it inadvertently got into corn tortilla shells used for human consumption. As of winter 2001, many people are afraid to eat corn chips and other corn products, because of their concern over BT insecticides in the corn. Another concern about transgenic plants containing BT insecticides is that they may be toxic to beneficial insects. For example, it has been shown that pollen from these plants is lethal to the larvae of monarch butterflies, particularly if it lands on nearby milkweeds which the larvae feed upon. The widespread destruction of beneficial insects could be very detrimental to animals that feed on these insects, and could upset the complex food web of an ecosystem. Since corn is wind pollinated, there is also the possibility of BT genes being inadvertently transferred to other varieties of corn plants. This could theoretically contaminate the genomes of other corn plants, including Mexican teosinte, the ancestral corn that provides the natural genetic reservoir for all the hundreds of varieties of modern corn. According to S. Nelson (The SeedHead News, Spring 2002), transgenic DNA (GM corn) was recently found among samples of native corn landraces in the mountains of Oaxaca, Mexico. Whether all these concerns can be substantiated by rigorous scientific investigation remains to be seen.
The genes of sterile transgenic crops, such as bananas, are not as likely to escape into the environment through seeds or pollen. Because edible bananas do not produce seeds, new groves are planted from cuttings of existing stock; however, this asexual propagation also spreads diseases and pests, such as the black sigatoka fungus, nematodes and weevils. Modern tissue culture methods will allow existing strains to be reared in a disease-free environment resulting in clean planting stock. Genes from other banana strains can also be inserted into existing stock to produce disease resistant, transgenic strains.
See Hybrid Parthenocarpic (Seedless) Bananas
12. DNA "Gee Whiz" Trivia
DNA is such an amazing molecule that it makes great material for "gee-whiz" trivia. Although some of the trivia presented here are based on facts, I have also included some fantastic propositions and preposterous mathematical projections that are impossible to observe, difficult (if not impossible) to prove, and beyond the scope of genuine trivia.
A single human nucleus five micrometers in diameter (0.005 mm) contains 46 chromosomes (2 haploid sets). When completely uncoiled this amounts to an estimated six feet of DNA. With an average of 60 trillion cells per person, this amounts to 68 billion miles of DNA; enough DNA to stretch to the sun and back 365 times or 140,000 round trips to the moon. If the nucleus were enlarged to five feet in diameter, the uncoiled DNA in one nucleus would extend 46 miles, about one mile per chromosome. Each gene would be about five to ten feet long.
The amount of DNA stored in a single human nucleus invisible to the naked eye is enormous. In terms of printed information using a 26 letter Roman alphabet and 12 characters per inch, this information represents about 500 volumes of Encyclopedia Brittanica. All this is stored in a microscopic nucleus five micrometers in diameter (smaller than a human red blood cell). A computer chip is gigantic by comparison and stores much less data.
If a human cell contains five billion base pairs, this represents 45,000,000,000 or 103,000,000,000 different possible base sequences. This astronomical number has three billion digits and would fill about one million pages on a computer printout (12 cpi). This incredible number helps to explain the enormous diversity of life forms on earth, from viruses and bacteria to complex plants and people, all genetically programmed by DNA. Flowering plants alone range from tiny wolffias less than one millimeter long to huge eucalyptus trees over 100 meters tall.
If all the DNA in ten human nuclei were enlarged to a full-sized continuous ladder, it could reach more than 30 million miles, or from the earth to the planet Mars:
13. Using RNA Interference (RNAi) to Turn Off Genes
RNA Interference (RNAi) is a promising technique used to "silence" or "turn off" genes. RNAi may be described as a type of gene therapy that takes advantage of an intermediate step between DNA and protein in the cytoplasm of cells. It involves a complementary "antisense" strand of RNA that binds to a "sense" strand of messenger RNA (M-RNA) transcribed from a target gene in the nucleus. This triggers the natural degradation of the "sense" strand of M-RNA, thereby blocking the translation of this particular M-RNA at the ribosome. In RNAi, double-stranded RNAs (called dsRNAs) that are complementary to known M-RNAs are introduced into a cell to specifically block and destroy a particular M-RNA. There are many potential uses for this type of gene therapy in medicine, particularly involving deleterious recessive genes causing diseases in people. RNAi is also useful in determining exactly which of the thousands of M-RNAs control the thousands of expressed genetic characteristics of plants and animals. This is analogous to turning off individual circuit breakers of a house to determine which circuits and rooms are controlled by specific breakers.
| i don't know |
Who voiced 'Dougal' in the 2005 film 'The Magic Roundabout'? | Sprung! The Magic Roundabout (2005) - IMDb
IMDb
There was an error trying to load your rating for this title.
Some parts of this page won't work property. Please reload or try later.
X Beta I'm Watching This!
Keep track of everything you watch; tell your friends.
Error
Sprung! The Magic Roundabout ( 2005 )
The Magic Roundabout (original title)
1h 25min
A group of friends embark on a dangerous journey in an effort to imprison their oppressor -- the evil wizard ZeeBad.
Directors:
a list of 48 titles
created 21 May 2011
a list of 39 titles
created 13 Apr 2012
a list of 27 titles
created 04 Aug 2013
a list of 41 titles
created 03 Jul 2014
a list of 29 titles
created 6 months ago
Title: Sprung! The Magic Roundabout (2005)
5.3/10
Want to share IMDb's rating on your own site? Use the HTML below.
You must be a registered user to use the IMDb rating plugin.
Edit
Storyline
Dougal, a shaggy, candy-loving puppy, embarks on a dangerous journey with a group of friends in an effort to imprison their oppressor -- the evil ice sorcerer Zeebad (Zebedee's evil twin). The world is placed in mortal danger as Zeebad wants to freeze everything there is; Dougal and his friends must recover three diamonds in order to stop him. Written by Anthony Pereyra {[email protected]}
Things Are About To Get Hairy.
Genres:
2 February 2005 (France) See more »
Also Known As:
Sprung! The Magic Roundabout See more »
Box Office
$793,677 (UK) (4 February 2005)
Gross:
Did You Know?
Trivia
A number of character have dialogue that references previous roles. Robbie Williams' Dougal states he likes Florence as he "offers her protection" a line from his song "Angels". See more »
Goofs
When Dylan is supposed to be playing guitar for Ermintrude's concert, he nearly falls asleep before coming round and starting to play and sing 'You Really Got Me' by The Kinks however Dylan is playing an acoustic guitar whereas the music has clearly got an electric guitar and not an acoustic one playing, this is particularly noticeable during his solo at the start of the song. See more »
Quotes
Ermintrude : Surely it's only a short hop for such a brave bunny.
Dylan : More like a long drop for a dumb rabbit.
See more »
Crazy Credits
During the credits in the American version, live action footage is shown of the actors doing the voices of the characters. See more »
Connections
Written & Performed by Andrea Remanda and Scaramanga X
Published by The Weinstein Company
(United Kingdom) – See all my reviews
My friends dragged me to see this with them for a joke. The cinema was full of kids and I was really embarrassed! But I definitely don't regret seeing it.
The plot was, unfortunately, the weakest part of the movie. It was just so Saturday-morning-cartoonish (complete with evil twins, magic diamonds and walking skeletons) that anyone in the cinema over the age of nine is unlikely to be interested. But anyone under that age will be delighted from start to finish.
It's the cast and music that really did it for me. Robbie Williams, despite his complete lack of experience as an actor, pulls off his role as Dougal with natural skill and emotion, which is pleasantly surprising. Jim Broadbent and Joanna Lumley seem to have great fun in their roles (as Brian the snail and Ermintrude the cow respectively) and Bill Nighy, well, lets just say there's no one else in the world who could've done Dylan the drug-addled bunny like he did ("no way man! I'm in, like, a higher state of unconsciousness..."). Kylie Minogue did well enough, but she only has about three lines. Tom Baker and Sir Ian Mackellen also seemed to enjoy giving very camp performances as the arch rival jack-in-the-boxes Zebedee and Zeebad (though Sir Ian sounded a little too much like Gandalf). The music, which seems to include vocal performances from Kylie and Robbie, is fantastic and well above average for a kids film today. If you've seen the film, I think you'll agree the soundtrack is a must-buy! But still, it's not all great. The plot is full of gaping holes, and while it mostly works with a very young audience in mind, the jokes aimed at adults are not laugh-out-loud funny, they just raise a knowing smile. There are some rather strange movie references too. It features references to Pulp Fiction, LoTR, and The Matrix (courtesy of some unexpected kung-fu fighting on Dylan's part) and I'll be damned if I saw a Dragon Ball Z reference in there! (Watch the scene where Zebad fights Zebedee for the first time - then again maybe it was just cheesy...) I never saw enough of the original 5 minute episodes to be a fan, but really, it seems very different from the original, so old-time fans may be disappointed, or maybe they'll appreciate seeing their old favourites in some new action-packed situations. It's up to them.
Yes, it falls flat in MANY places, but it's also got a childish, endearing charm that may make you wish you were seven again.
10 of 13 people found this review helpful. Was this review helpful to you?
Yes
| Robbie Williams |
Which comedienne and actress has written a novel 'A Tiny Bit Marvellous' about a family called 'Battle'? | The Magic Roundabout
The Magic Roundabout
Certificate: u
Synopsis
The Seventies children's favourite featuring slothful dog Dougal, stoner rabbit Dylan and springy Zebedee gets a special effects spin and beefed up story for the big screen.
Directors
Jim Broadbent
Review
Viewers of a certain age will remember The Magic Roundabout as an inconsequential yet strangely compulsive five-minute children's TV snippet.
The slightly surreal story of a Dougal the dog, big-booted Florence and Ermintrude the Cow occupied that twilight zone before mum and dad came in to watch the news.
Thirty years later the residents of that charming otherworld find themselves beefed up by state-of-the-art computer imagery and voiced by a gang of Hollywood A-listers.
Extended to feature length, much of the comforting scale of the original is unavoidably lost but, thanks to a sensitive script, the characters shine through.
Zebedee, with vocal duties taken by Ian McKellen, is a sort of Gandalf on industrial springs who is pitched against evil alter-ego Zeebad (Tom Baker).
They're both determined to get their hands on three mystical diamonds that either ensure everything is sunny and rosy... or condemn the world to a new ice age.
When Florence (Kylie Minogue) is encased in a frozen-over Magic Roundabout, her pals must set off to discover the sparklers... but they are in a race with nasty Zeebad.
Dougal, voiced by an engaging Robbie Williams, Ermintrude (Lumley), spaced out rabbit Dylan (Bill Nighy) and shy snail Brian (Jim Broadbent) hit the road.
After Zebedee is condemned to an icy coffin, they have to live on their own wits with transport provided by Lee Evans' eager-to-please Train.
At first thought, the idea of extending the five-minute oddity to a full movie seemed a bit like grafting the plot of Lord of the Rings onto Hector's House.
However, it's surprisingly successful - the characters are constantly fed the sort of comedy lines that work for both children and adults alike.
So we have numerous references to Dylan's "recreational habits" - apparently he's a big fan of grass - while gentler comedy (little Brian's awkward adoration of Ermintrude) will leave the nippers enchanted.
The trio of directors have embraced the spirit of the original (voiced by Emma Thompson's later father) and embellished it in splendid looking style with thoroughly contemporary dialogue.
That's a roundabout way of saying it's really rather good.
Tim Evans
| i don't know |
Yelena Bonner who died last month was the wife of which Soviet dissident and physicist, winner of the 1975 Nobel Peace Prize? | Yelena Bonner obituary | World news | The Guardian
Yelena Bonner obituary
Valiant human rights activist and widow of Soviet dissident Andrei Sakharov
Yelena Bonner addressing the European parliament during the award ceremony of the Sakharov Prize in 2008. Photograph: Vincent Kessler/Reuters
Sunday 19 June 2011 11.57 EDT
First published on Sunday 19 June 2011 11.57 EDT
Share on Messenger
Close
Now that the battles fought by the dissident movement and by the thousands of individuals who voiced their opposition to the Soviet state have been swallowed up by the larger events of history, only a few names will be recalled. Yelena Bonner's will be one of them. She and her husband, Andrei Sakharov, symbolised – within the Soviet Union and throughout the west – the strength and courage of those opposed to state socialism. Bonner, who has died aged 88, was often portrayed merely as the wife of the Soviet Union's most famous dissident scientist, but her history as an activist was as lengthy as her husband's. Her determination, organisational skills and often fiery temper consistently drew attention to human rights issues.
Sakharov and Bonner were a team, bound together by the conviction that freedom of conscience was a prerequisite of any civilised state and that east and west should move towards reconciliation. This conviction helped them survive the ordeals of surveillance, harassment, arrest and internal exile.
The two first met in the autumn of 1970 outside a courtroom in Kaluga, central Russia , where a scientist, Revolt Pimenov, and a puppet-theatre actor, Boris Vail, were on trial for distributing the samizdat human rights journal Chronicle of Current Events. Sakharov had already achieved worldwide attention for publishing his essay Reflections on Progress, Peaceful Coexistence and Intellectual Freedom, in the New York Times in 1968, but Bonner was the practical and already experienced organiser of the group – it was she who found rooms for both the defendants and the observers of the trial.
Like Sakharov, Bonner came from the Soviet elite. Unlike the brilliant physicist, who was recruited straight from university to the team that developed the Soviet Union's first hydrogen bomb and then became the youngest member of the Soviet Academy of Sciences, Bonner had seen the brutality behind Stalin's Soviet Union early on.
She was born in Merv (now Mary), a town in Turkmenistan , the eldest child of Bolshevik revolutionaries, who named her Lusia. Her father, Georgy Alikhanov, was first secretary of the Armenian central committee and her mother, Ruth Bonner, was a committed party activist. Yelena's earliest years were spent in Chita in the Soviet far east, where her father had been sent after a political falling out with Grigory Zinoviev, a leading member of the politburo. The family then moved to Leningrad, where they lived among the city's Bolshevik elite.
At one stage, they had a flat in a house where Sergei Kirov, secretary of the Leningrad party, also lived. In her second book of memoirs, Mothers and Daughters (1991), Bonner recalled being taken out by Kirov in his car and standing on the dais with him at an official demonstration. It was the murder of Kirov in 1934 that signalled the beginning of the Terror and Stalin's purge of the old Bolshevik cadres. By 1937 the family were living in Moscow, where, some time before the winter of 1938, during the first wave of the Terror, Bonner's father was arrested and shot.
Her mother was arrested as the wife of an enemy of the people and sentenced to 10 years in a labour camp. Bonner herself was taken to the "big house", the secret police headquarters in Leningrad, for questioning. She remained in Leningrad to be brought up by her grandmother. When she was eligible for her internal passport she discovered that her parents had failed to register her birth. Free to chose her own name, she picked her mother's surname and Yelena after the heroine of Turgenev's novel On the Eve.
When the Soviet Union was invaded in June 1941, Bonner volunteered for the Red Army's hospital trains, becoming head nurse. The after-effects of a shell attack that October, which left her temporarily blinded, led to her being invalided out of the medical corps in early 1945. She returned to Leningrad and in 1947 was accepted as a student at the city's medical institute. After graduating, she specialised in paediatrics. She met her first husband, Ivan Semyonov, at medical school and they had two children, Tanya and Alexei. In the 1950s Bonner spent six months working in Iraq for the Soviet ministry of health and contributed articles to medical newspapers, as well as to literary journals.
In 1965, after her first marriage had fallen apart, Bonner moved into her mother's flat in Moscow. Her upbringing had seemed conventional enough: childhood membership of the Komsomol, followed by an application for full party membership after her parents had been rehabilitated in 1954. However, the fate of her family and friends and her Jewish/Armenian parentage – which made her politically suspect to the authorities – encouraged Bonner in her scepticism of the officially presented party line. The crushing of the 1968 Prague uprising marked for her, as for many dissidents of her generation, the beginning of her questioning of the basis of the Soviet state. Gradually, she moved into dissident circles, although it was not until 1972 that she renounced her party membership.
Bonner and her mother introduced Sakharov to the wider dissident movement. As he wrote in his memoirs, it was she who "taught me to pay more attention to the defence of individual victims of injustice". Their flat became a clearing house for those involved in the Helsinki Group, the human rights group set up to monitor Soviet violations of the Helsinki Accords, and for groups fighting for the rights of Christians, ethnic minorities and of Soviet Jews who wanted to emigrate to Israel.
When Sakharov's children complained to him about his increasingly vocal opposition to the Soviet state, as well as about his friendship with Bonner so soon after his first wife's death from cancer, he moved into the Bonners' flat. He and Bonner married in 1972.
With Aleksandr Solzhenitsyn 's expulsion from the Soviet Union in 1974, they became the central focus of the dissident movement. Sakharov went on his first hunger strike in 1974, during Richard Nixon's visit to Moscow, to publicise the plight of political prisoners.
That winter, Bonner's eyesight – already damaged by her wartime injury, thyroid problems and glaucoma – deteriorated sharply and she was warned that, without an operation available only in the west, she would go blind. While she was in Italy in 1975 recovering from the eye operation, Bonner heard of Sakharov being awarded a Nobel peace prize , and she remained in the west to attend the prizegiving ceremony and to deliver her husband's Nobel lecture that December.
The KGB had now resorted to sending the couple obscene pictures and photographs of dismembered corpses through the post, and accusing Bonner in particular of being a "money-grubbing Jew" who had married Sakharov for his privileged position. Despite such harassment, the couple continued to highlight the plight of political and religious dissenters in Leonid Brezhnev's stagnant Soviet state. Sakharov's position as a state scientist and Bonner's status as an Invalid Veteran of the Great Patriotic War prevented the KGB from attacking them too openly. But their friends and fellow human-rights activists were picked off the streets, given summary trials and exiled or imprisoned. The Sakharovs, both in poor health, remained at liberty to speak, write and give interviews to foreign correspondents. However, at the start of 1980, after the Soviet invasion of Afghanistan, Sakharov's open call for an international boycott of the Moscow Olympics led to his arrest.
Sakharov was stripped of his awards and exiled to Gorky (now Nizhny Novgorod) by decree. Bonner remained free to travel between Moscow and Gorky, give interviews and publicise her husband's plight. She was Sakharov's lifeline to the outside world. She was, as Sakharov put it, "always a doer" and refused to stop her activities because of her husband's arrest. But the strain immediately began to affect Bonner's health. Stripsearched on a train on her way back from Gorky in the winter of 1982 and left to find her way back to Moscow alone, she suffered her first heart attack the following spring and another more severe one a year later.
Then, in 1984, she too was arrested, charged with slandering the Soviet state, sentenced and exiled to Gorky. Bonner's health deteriorated further and Sakharov went on hunger strike on three occasions to demand that she be allowed to travel to the west for treatment. Finally, in 1986, she was allowed to travel abroad for heart surgery. She took with her a volume of memoirs of their internal exile, which appeared as Alone Together in the same year.
The release of Bonner and Sakharov from their exile came suddenly and unexpectedly. One day an engineer turned up at the flat in Gorky to install a telephone. The following morning they received their first telephone call. It was from Mikhail Gorbachev, telling them they were free to return to Moscow. Their release was one of the most tangible signs that glasnost had begun.
Although some of Gorbachev's policies seemed close to fufilling demands made by the dissidents of the 1970s, the Sakharovs continued to dissent from the official party line. They were instrumental in forming the unofficial organisation Memorial, set up to campaign for the rehabilitation of political prisoners. In 1989 Sakharov was elected to the Congress of People's Deputies and during its first session criticised Gorbachev for refusing to relinquish the Communist party's monopoly on power. On 14 December that year, after a particularly tense session of the congress, during which Gorbachev had demanded Sakharov sit down, he returned home and told his wife that he had work to prepare for the next day's session. In the morning she found him dead from a heart attack.
Bonner, grief-stricken, had to face Yevgeny Primakov, one of Gorbachev's aides, who wanted to give the former dissident a state funeral. She also had to endure the row that had erupted when the congress did not honour Sakharov with a day's recess. In distress, Bonner shouted to waiting reporters from the flat where her husband's corpse still lay: "You all worked hard to see that Andrei died sooner, by calling us from morning to night, and never leaving us to our life and work. Be human beings. Leave us alone."
When Gorbachev appeared at the funeral and asked her if there was anything he could do, she requested that Memorial should be registered as an official organisation. Many reformist politicians rushed to her side. Boris Yeltsin was not slow to show his support of her ideas, but Bonner distrusted politicians wanting to use Sakharov's memory for their own ends. In early 1991, when Gorbachev, also a Nobel peace prize winner, crushed a pro-independence demonstration in Vilnius, the capital of Lithuania , with force, she requested that Sakharov's name be removed from the list of laureates. Later the same year she spoke to the crowd outside the White House, the Russian parliament building, in support of Yeltsin during the abortive coup.
As the Soviet Union fell apart, Bonner continued working to support human rights and democracy. By 1996, she was calling for democrats not to vote for Yeltsin in the presidential elections; the war in Chechnya had dashed her hopes for him as a democratic leader. She became an outspoken critic of Yeltsin's successor Vladimir Putin , and last year was among the prominent signatories of a petition calling for his resignation.
Bonner divided her time latterly between Russia and Boston, Massachusetts, where her son and daughter, who survive her, had lived since the 1970s, and where she died.
• Yelena Georgievna Bonner, human rights activist, born 15 February 1923; died 18 June 2011
| Andrei Sakharov |
'Hev Yew Gotta Loight Boy?' is the most famous song recorded by Allan Smethurst. How was he known on stage? | Bonner's Heart Problems Given Top Priority - latimes
YOU ARE HERE: LAT Home → Collections
Bonner's Heart Problems Given Top Priority
December 06, 1985 |DON A. SCHANCHE | Times Staff Writer
ROME — Soviet dissident Yelena Bonner met privately with Italian Prime Minister Bettino Craxi on Thursday and then prepared to fly to Boston for medical consultations over her severe heart problems.
Bonner, 62, wife of dissident physicist Andrei D. Sakharov, drove to Rome on Thursday afternoon from the medieval hill town of Siena, where a leading Italian eye specialist urged her to seek treatment for her heart before undergoing cataract surgery in his clinic.
"It is not the moment for her to consider an (eye) operation," said Dr. Renato Frezzotti, who treated her for glaucoma in 1975 and 1977. He examined her again in 1979 on her last visit to the West before she was sentenced to internal exile with her husband in the closed Soviet city of Gorky.
Sakharov, 64, winner of the 1975 Nobel Peace Prize, recently ended a six-month hunger strike that was staged to force Soviet authorities to allow Bonner to seek medical treatment in the West.
Visa Extension Advised
Frezzotti said he urged the dissident physician to take care of her heart problems first, then seek an extension of her 90-day exit visa from the Soviet Union so that she can return to Siena for the cataract operation on her left eye and treatment of glaucoma in both eyes.
The eye specialist implicitly criticized the neglect of Bonner's medical problems in the Soviet Union. He said she needs to be examined "every three or four months, not every six years" to prevent a worsening of the glaucoma that could lead to blindness. The eye condition dates from war wounds and a concussion that Bonner suffered as a Soviet army nurse in 1941.
Bonner's son, Alexei Semyonov, and son-in-law, Yefrem Yankelevich, said here that she suffered two major heart attacks, one in 1983 and another last May, and may require coronary bypass surgery. They said she will see an unnamed Boston cardiologist soon after she reaches the United States, probably this weekend.
The prominent Soviet human rights activist reached Rome from Moscow on Monday and was reunited with Semyonov and Yankelevich, husband of her daughter, Tatiana, all of whom live in Newton, Mass., a suburb of Boston. The two men refused to confirm reports that they and Bonner will fly to the United States today.
According to Semyonov, Bonner cabled her husband, still living in internal exile in Gorky, when she arrived in Rome but has not yet received a reply. He said she will try to telephone him when she reaches Boston.
Officials at Craxi's Chigi Palace office said Bonner had asked to see the prime minister privately to thank him for helping her to gain the exit visa. Tatiana Yankelevich met with Craxi last spring, and the Italian leader subsequently saw Soviet leader Mikhail S. Gorbachev in Moscow and urged that Bonner be allowed to come to Italy.
The two met in Craxi's office with only an interpreter present while Semyonov and Yankelevich waited with reporters in the open courtyard of the ornate 17th-Century palace in central Rome.
Recalling that she had met Craxi on an earlier trip to Italy in 1975, when he was a rising Socialist Party leader, Bonner quipped, "The only thing that has changed since then is that he has become premier and I have become a criminal."
Five-Year Sentence
Sakharov has been in internal exile since 1980, when he angered authorities by condemning the Soviet invasion of Afghanistan. He had numerous conflicts with the Kremlin earlier as a result of his and Bonner's outspoken protests against Soviet human rights abuses. Bonner was sentenced to five years in internal exile 19 months ago for her human rights activities.
MORE:
| i don't know |
Tripoli in Libya is often known as Western Tripoli to distinguish it from the second largest city in which other country? | Tripoli, Libya - The Full Wiki
The Full Wiki
More info on Tripoli, Libya
Wikis
Tripoli, Libya: Wikis
Advertisements
Note: Many of our articles have direct quotes from sources you can cite, within the Wikipedia article! This article doesn't yet, but we're working on it! See more info or our list of citable articles .
Related top topics
This article is about the capital of Libya. For the Lebanese city of the same name, see Tripoli, Lebanon . For the Crusader State, see County of Tripoli . For other uses, see Tripoli (disambiguation) .
Tripoli
طرابلس Trābles
Top: That El Emad Towers, Middle: Green Square, Bottom left: Marcus Aurelius Arch, Bottom right: Souq al-Mushir – Tripoli Medina.
Seal
Location of Tripoli within Libya, on the continent of Africa.
Country Libya Sha'biyah Tripoli Sha'biyah Government - Head of the People's Committee Abdullatif Abdulrahman Aldaali Area - Total 400 km2 (154.4 sq mi) Elevation 81 m (266 ft) Population (2005) - Total 1,682,000 - Density 4,205/km2 (10,890.9/sq mi) Time zone EET ( UTC+2 ) - Summer ( DST ) not observed ( UTC+2 )
Tripoli ( Arabic : طرابلس Ṭarābulus
pronunciation
(help·info)
; derived from "Τρίπολη"; the Greek word for "three cities" in Greek : Τρίπολις Tripolis) is the largest and capital city of Libya .
Tripoli has a population of 1.69 million[citation needed]. The city is located in the northwest of the country on the edge of the desert, on a point of rocky land projecting into the Mediterranean Sea and forming a bay. Tripoli was founded in the 7th century BC by the Phoenicians , who named it Oea. [2]
Tripoli is the largest city, the principal sea port , and the largest commercial and manufacturing centre in Libya . It is also the site of Al-Fateh University . Due to the city's long history, there are many sites of archaeological significance in Tripoli. The climate is typical Mediterranean, with hot, dry summers, cool winters and some modest rainfall.
"Tripoli" may also refer to the shabiyah (top-level administrative division in the current Libyan system), Tripoli District .
Contents
Advertisements
Early history
The city was founded in the 7th century BC, by the Phoenicians , who named it "Oea". They were probably attracted to the site by its fine natural harbor, flanked on the western shore by the small, easily defendable peninsula , on which they established their colony. The city then passed into the hands of the rulers of Cyrenaica (a Greek colony on the North African shore, east of Tripoli, halfway to Egypt ). It was wrested away from the Greeks by the Carthaginians , like Tripoli, another Phoenician colony.
By the later half of the 2nd century BC it belonged to the Romans , who included it in their province of Africa , and gave it the name of Regio Syrtica. Around the beginning of the 3rd century AD , it became known as the Regio Tripolitana, meaning "region of the three cities", namely Oea (i.e. modern Tripoli), Sabratha and Leptis Magna . It was probably raised to the rank of a separate province by Septimius Severus , who was a native of Leptis Magna.
In spite of centuries of Roman habitation, the only visible Roman remains, apart from scattered columns and capitals (usually integrated in later buildings), is the Arch of Marcus Aurelius from the 2nd century AD. The fact that Tripoli has been continuously inhabited, unlike e.g. Sabratha and Leptis Magna, has meant that the inhabitants have either quarried material from older buildings (destroying them in the process), or built on top of them, burying them beneath the streets, where they remain largely unexcavated.
There is evidence to suggest that the Tripolitania region was in some economic decline during the 5th and 6th centuries, in part due to the political unrest spreading across the Mediterranean world in the wake of the collapse of the Roman empire, as well as pressure from the invading Vandals .
Like the rest of North Africa, it was conquered by the Muslims early in the 8th century. Following the conquest, Tripoli was ruled by dynasties based in Cairo , Egypt , first the Fatimids , and later the Mamluks .
1500s–1800s
In 1510, it was taken by Don Pedro Navarro, Count of Oliveto for Spain , and, in 1523, it was assigned to the Knights of St. John , who had lately been expelled by the Ottoman Turks from their stronghold on the island of Rhodes . Finding themselves in very hostile territory, the Knights enhanced the city’s walls and other defences. Though built on top of a number of older buildings (possibly including a Roman public bath), much of the earliest defensive structures of the Tripoli castle (or "Assaraya al-Hamra", i.e. the "Red Castle") are attributed to the Knights of St John.
Having previously combated piracy from their base on Rhodes, the reason that the Knights were given charge of the city was to prevent it from relapsing into the nest of Barbary pirates as it had been prior to the Spanish occupation. The disruption the pirates caused to the Christian shipping lanes in the Mediterranean had been one of the main incentives for the Spanish conquest of the city.
Historic map of Tripoli by Piri Reis
The knights kept the city with some trouble until 1551, when they were compelled to surrender to the Ottoman Turks, led by Turgut Reis . Turgut was also buried in Tripoli after his death in 1565. His body was taken from Malta , where he had fallen during the Ottoman siege of the island, to a tomb in the mosque he had established close to his palace in Tripoli. The palace has since disappeared (supposedly it was situated between the so called “Ottoman prison” and the arch of Marcus Aurelius ), but the mosque, along with his tomb, still stands, close to the Bab Al-Bahr gate.
After the capture by the Ottoman Turks, Tripoli once again became a base of operation for Barbary pirates. One of several Western attempts to dislodge them again was a Royal Navy attack under John Narborough in 1675, of which a vivid eye-witness account has survived. [3] Effective Ottoman rule during this period (1551–1711) was often hampered by the local Janissary corps. Intended to function as enforcers of local administration, the captain of the Janissaries and his cronies were often the de facto rulers.
In 1711 Ahmed Karamanli , a Janissary officer of Turkish origin, killed the Ottoman governor, the " Pasha ", and established himself as ruler of the Tripolitania region. By 1714 he had asserted a sort of semi-independence from the Ottoman Sultan, heralding in the Karamanli dynasty . The Pashas of Tripoli were expected to pay a regular tributary tax to the Sultan, but were in all other aspects rulers of an independent kingdom. This order of things continued under the rule of his descendants, accompanied by the brazen piracy and blackmailing until 1835, when the Ottoman Empire took advantage of an internal struggle and re-established its authority.
The Ottoman province (vilayet) of Tripoli (including the dependent sanjak of Cyrenaica ) lay along the southern shore of the Mediterranean Sea between Tunisia in the west and Egypt in the east. Besides the city itself, the area included Cyrenaica (the Barca plateau), the chain of oases in the Aujila depression, Fezzan and the oases of Ghadames and Ghat , separated by sandy and stony wastelands.
The Barbary Wars
Tripoli Harbour during the Tripolitan War
In the early part of the 19th century, the regency at Tripoli, owing to its piratical practices, was twice involved in war with the United States. In May 1801, the pasha demanded an increase in the tribute ($83,000) which the US government had been paying since 1796 for the protection of their commerce from piracy under the 1796 Treaty with Tripoli . The demand was refused, and a naval force was sent from the United States to blockade Tripoli.
The First Barbary War dragged on for four years. In 1803, Tripolitan fighters captured the US frigate Philadelphia and took its commander, Captain William Bainbridge , and the entire crew as prisoners. The Philadelphia was turned against the Americans and anchored in Tripoli Harbour as a gun battery. The following year, US Navy Lieutenant Stephen Decatur led a successful nighttime raid to retake and burn the ship. Decatur's men set fire to the Philadelphia and escaped.
The most colorful incident in the war was the expedition undertaken by William Eaton with the object of replacing the pasha with an elder brother living in exile, who had promised to accede to all the wishes of the United States. Eaton, at the head of a crew of 500 US Marines, Greek, Arab and Turkish Mercenaries, marched across the desert from Alexandria , Egypt and with the aid of American ships, succeeded in capturing Derna . Soon afterward, on June 3, 1805, peace was concluded. The pasha ended his demands and received $60,000 as ransom for the Philadelphia prisoners under the 1805 Treaty with Tripoli .
In 1815, in consequence of further outrages and due to the humiliation of the earlier defeat, Captains Bainbridge and Stephen Decatur , at the head of an American squadron, again visited Tripoli and forced the pasha to comply with the demands of the United States. See Second Barbary War .
Later history
Tripoli Cathedral and "the Fiat centre in Tripoli" (Meydan al Gaza'ir) during the 1960s
In 1835, the Ottomans took advantage of a local civil war to reassert their direct authority. After that date, Tripoli was under the direct control of the Sublime Porte . Rebellions in 1842 and 1844 were unsuccessful. After the occupation of Tunisia by the French (1881), the Ottomans increased their garrison in Tripoli considerably.
Italy had long claimed that Tripoli fell within its zone of influence and that Italy had the right to preserve order within the state. [4] Under the pretext of protecting its own citizens living in Tripoli from the Ottoman Government, it declared war against the Ottomans on September 29, 1911, and announced its intention of annexing Tripoli. On October 1, 1911, a naval battle was fought at Prevesa , Greece, and three Ottoman vessels were destroyed. By the Treaty of Lausanne , Italian sovereignty was acknowledged by the Ottomans, although the Caliph was permitted to exercise religious authority.
Tripoli was nominally controlled by Italy until 1943. Afterwards it was governed by British forces until independence in 1951.
On 15 April 1986 US Air Force and Navy planes bombed Tripoli and Benghazi . President Ronald Reagan justified the attacks by claiming Libya was responsible for terrorism directed at the USA, including the bombing of La Belle discothèque in West Berlin ten days before.
United Nations sanctions against Libya were lifted in 2003, which is expected to increase traffic through the Port of Tripoli and have a positive impact on the city's economy.
Law and government
The old medina in Central Tripoli; There are 29 Local People's Congresses within the city boundaries.
The city of Tripoli and its surrounding suburbs all lie within the Tripoli sha'biyah (district). In accordance with Libya's Jamahiriya political system, Tripoli comprises Local People's Congresses where, in theory, the city's population discuss different matters and elect their own people's committee; At present there are 29 Local People's Congresses. In reality, the revolutionary committees severely limit the democratic process by closely supervising committee and congress elections at the branch and district levels of governments, Tripoli being no exception.
Tripoli is sometimes referred to as the de-facto capital of Libya. This is because none of the country's ministries are actually located in the capital. Even the National General People's Congress is held annually in the city of Surt and not the capital. As part of a radical decentralisation programme undertaken in September 1988, all General People's Committee secretariats ( ministries ), except those responsible for foreign liaison ( foreign affairs ) and information, were located away from Tripoli. According to diplomatic sources, the former Secretariat for Economy and Trade was moved to Benghazi ; the Secretariat for Health to Kufra ; and the remainder, excepting one, to Surt, Col. Gaddafi's birthplace. In early 1993 it was announced that the Secretariat for Foreign Liaison and International Co-operation was to be moved to Ras Lanouf.
Geography and climate
A dust storm, making its way from the Sahara to Western Libya, passes over Tripoli.
Al Saaha Alkhadhraa (The Green Square), located in the city centre is mostly landscaped with palm trees as is much of Tripoli.
Tripoli lies at the western extremity of Libya close to the Tunisian border, on the continent of Africa. Over a thousand kilometers separate Tripoli from Libya's second largest city, Benghazi. Coastal oases alternate with sandy areas and lagoons along the shores of Tripolitania for more than 300 kilometers.
Until 2007, the " Sha'biyah " included the City, its suburbs and their immediate surroundings. In older administrative systems and throughout history, there existed a Province (" muhafazah "), State (" wilayah ") or City-state with a much larger area (though not constant boundaries), which is sometimes mistakenly referred to as Tripoli but more appropriately should be called Tripolitania .
As a sha'biyah, Tripoli borders the following sha'biyat:
Az Zawiyah – west
The dominant climatic influences in Tripoli, a coastal lowland city, are Mediterranean . The city enjoys warm summers and mild winters with an average July temperature of between 22 °C (72 °F ) and 29 °C (84 °F). In December temperatures have reached as low as 1 °C (34 °F), but the average remains at between 9 °C (48 °F) and 18 °C (64 °F). The average annual rainfall is less than 400 millimetres (15.7 in), but can be very erratic. [5]
For example, epic floods in 1945 left Tripoli under water for several days, but two years later an unprecedentedly severe drought caused the loss of thousands of head of cattle. Deficiency in rainfall is no doubt reflected in an absence of permanent rivers or streams in Tripoli as well as an absence throughout the entire country. The allocation of limited water is considered of sufficient importance to warrant the existence of the Secretariat of Dams and Water Resources, and damaging a source of water can be penalized by a heavy fine or imprisonment.
The Great Manmade River , a network of pipelines that transport water from the desert to the coastal cities, supplies Tripoli with its water. [6] The grand scheme was initiated by Gaddafi in 1982 and has had a positive impact on the city's inhabitants.
Tripoli is dotted with public spaces, but few fit under the category of large city parks . The Green Square located near the waterfront is scattered with palm trees , the most abundant plant used for landscaping in the city. Tripoli zoo, located south of the city centre, is a large reserve of plants, trees and open green spaces and is the country's biggest zoo.
Climate data for Tripoli
Winter
Economy
Panorama of Tripoli Central Business District as of June 2009; Tripoli is currently undergoing a construction boom.
The That El-Emad Towers, where many Libyan and International companies have offices.
Tripoli is one of the main hubs of Libya's economy along with Misurata . It is the leading centre of banking , finance and communication in the country and is one of the leading commercial and manufacturing cities in Libya. Many of the country's largest corporations locate their headquarters home offices in Tripoli as well as the majority of international companies.[citation needed]
Major manufactured goods include processed food , textiles , construction materials, clothing and tobacco products. Since the lifting of sanctions against Libya in 1999 and again in 2003, Tripoli has seen a rise in foreign investment as well as an increase in tourism. Increased traffic has also been recorded in the city's port as well as Libya's main international airport, Tripoli International .[citation needed]
The city is home to the Tripoli International Fair , an international industrial, agricultural and commercial event located on Omar Muktar Street. One of the active members of the Global Association of the Exhibition Industry (UFI), located in the French capital Paris , the international fair is organised annually and takes place from the 2nd to the 12th of April. Participation averages around 30 countries as well as more than 2000 companies and organisations.[citation needed]
Since the rise in tourism and influx of foreign , there has been an increased demand for hotels in the city. To cater for these increased demands, the Corinthia Bab Africa Hotel located in the central business district was constructed in 2003 and is the largest hotel in Libya. Other high end hotels in Tripoli include the Al Waddan Intercontinental and the Tripoli Radisson Blu Hotel as well as others. [8]
Companies with head offices in Tripoli include Afriqiyah Airways and Libyan Airlines . [9] [10]
Tourism
Emhemmed Elmgharief Street in central Tripoli has some of the best examples of Italianate colonial architecture in Tripoli.
The city's old town is still unspoilt by mass-tourism, though it is increasingly being exposed to more and more visitors from abroad, following the lifting of the UN embargo in 2003. However, the walled medina retains much of its serene old-world ambience. The Assaraya al-Hamra (the Red Castle), a vast palace complex with numerous courtyards, dominates the city skyline and is located on the outskirts of the medina. There are some classical statues and fountains from the Ottoman period scattered around the castle.
The Gurgi and Karamanli mosques, with their intricate decorations and tilework, are examples of the artistic skills of local craftsmen. Just outside the Gurgi mosque is the Arch of Marcus Aurelius , the only surviving Roman monument in the city. More and more palaces (especially from the Karamanli period) are also being restored and opened to the public. The basic street plan of the medina was laid down in the Roman period when the walls were constructed as protection against attacks from the interior of Tripolitania , and are considered well planned, possibly better than modern street plans. In the 8th century a wall on the sea-facing side of the city was added.
Three gates provided access to the old town: Bab Zanata in the west, Bab Hawara in the southeast and Bab Al-Bahr in the north wall. The city walls are still standing and can be climbed for good views of the city. The Bazaar is also known for its traditional ware; fine jewellery and clothes can be found in the local markets. The Jamahiriya Museum , a fine modern facility located in the Red Castle, is Libya's national museum. It houses many artefacts from the country's Roman and Greek periods, including treasures from the World Heritage sites at Leptis Magna and Sabratha , as well as politically motivated displays such as the Volkswagen Beetle car driven by Gadaffi in the 1960s.
Colleges and universities
The largest university in Tripoli, Al Fateh University , is a public university providing free education to the city's inhabitants. Private universities and colleges have also begun to crop up in the last few years.
Universities in Tripoli include:
Al Fateh University – The largest and most important university in Tripoli
Al Fateh University for Medical Sciences – It includes the following faculties: Medicine, Pharmacy, Dentistry and nursing (which was previously a small institute).
| Lebanon |
Which of the 'English Classic' horse races is run over a distance of one mile, six furlongs and one hundred and thirty two yards? | Tripoli : Wikis (The Full Wiki)
The Full Wiki
Note: Many of our articles have direct quotes from sources you can cite, within the Wikipedia article! This article doesn't yet, but we're working on it! See more info or our list of citable articles .
Related top topics
This article is about the capital of Libya. For the Lebanese city of the same name, see Tripoli, Lebanon . For the Crusader State, see County of Tripoli . For other uses, see Tripoli (disambiguation) .
Tripoli
طرابلس Trābles
Top: That El Emad Towers, Middle: Green Square, Bottom left: Marcus Aurelius Arch, Bottom right: Souq al-Mushir – Tripoli Medina.
Seal
Location of Tripoli within Libya, on the continent of Africa.
Country Libya Sha'biyah Tripoli Sha'biyah Government - Head of the People's Committee Abdullatif Abdulrahman Aldaali Area - Total 400 km2 (154.4 sq mi) Elevation 81 m (266 ft) Population (2005) - Total 1,682,000 - Density 4,205/km2 (10,890.9/sq mi) Time zone EET ( UTC+2 ) - Summer ( DST ) not observed ( UTC+2 )
Tripoli ( Arabic : طرابلس Ṭarābulus
pronunciation
(help·info)
; derived from "Τρίπολη"; the Greek word for "three cities" in Greek : Τρίπολις Tripolis) is the largest and capital city of Libya .
Tripoli has a population of 1.69 million[citation needed]. The city is located in the northwest of the country on the edge of the desert, on a point of rocky land projecting into the Mediterranean Sea and forming a bay. Tripoli was founded in the 7th century BC by the Phoenicians , who named it Oea. [2]
Tripoli is the largest city, the principal sea port , and the largest commercial and manufacturing centre in Libya . It is also the site of Al-Fateh University . Due to the city's long history, there are many sites of archaeological significance in Tripoli. The climate is typical Mediterranean, with hot, dry summers, cool winters and some modest rainfall.
"Tripoli" may also refer to the shabiyah (top-level administrative division in the current Libyan system), Tripoli District .
Contents
Advertisements
Early history
The city was founded in the 7th century BC, by the Phoenicians , who named it "Oea". They were probably attracted to the site by its fine natural harbor, flanked on the western shore by the small, easily defendable peninsula , on which they established their colony. The city then passed into the hands of the rulers of Cyrenaica (a Greek colony on the North African shore, east of Tripoli, halfway to Egypt ). It was wrested away from the Greeks by the Carthaginians , like Tripoli, another Phoenician colony.
By the later half of the 2nd century BC it belonged to the Romans , who included it in their province of Africa , and gave it the name of Regio Syrtica. Around the beginning of the 3rd century AD , it became known as the Regio Tripolitana, meaning "region of the three cities", namely Oea (i.e. modern Tripoli), Sabratha and Leptis Magna . It was probably raised to the rank of a separate province by Septimius Severus , who was a native of Leptis Magna.
In spite of centuries of Roman habitation, the only visible Roman remains, apart from scattered columns and capitals (usually integrated in later buildings), is the Arch of Marcus Aurelius from the 2nd century AD. The fact that Tripoli has been continuously inhabited, unlike e.g. Sabratha and Leptis Magna, has meant that the inhabitants have either quarried material from older buildings (destroying them in the process), or built on top of them, burying them beneath the streets, where they remain largely unexcavated.
There is evidence to suggest that the Tripolitania region was in some economic decline during the 5th and 6th centuries, in part due to the political unrest spreading across the Mediterranean world in the wake of the collapse of the Roman empire, as well as pressure from the invading Vandals .
Like the rest of North Africa, it was conquered by the Muslims early in the 8th century. Following the conquest, Tripoli was ruled by dynasties based in Cairo , Egypt , first the Fatimids , and later the Mamluks .
1500s–1800s
In 1510, it was taken by Don Pedro Navarro, Count of Oliveto for Spain , and, in 1523, it was assigned to the Knights of St. John , who had lately been expelled by the Ottoman Turks from their stronghold on the island of Rhodes . Finding themselves in very hostile territory, the Knights enhanced the city’s walls and other defences. Though built on top of a number of older buildings (possibly including a Roman public bath), much of the earliest defensive structures of the Tripoli castle (or "Assaraya al-Hamra", i.e. the "Red Castle") are attributed to the Knights of St John.
Having previously combated piracy from their base on Rhodes, the reason that the Knights were given charge of the city was to prevent it from relapsing into the nest of Barbary pirates as it had been prior to the Spanish occupation. The disruption the pirates caused to the Christian shipping lanes in the Mediterranean had been one of the main incentives for the Spanish conquest of the city.
Historic map of Tripoli by Piri Reis
The knights kept the city with some trouble until 1551, when they were compelled to surrender to the Ottoman Turks, led by Turgut Reis . Turgut was also buried in Tripoli after his death in 1565. His body was taken from Malta , where he had fallen during the Ottoman siege of the island, to a tomb in the mosque he had established close to his palace in Tripoli. The palace has since disappeared (supposedly it was situated between the so called “Ottoman prison” and the arch of Marcus Aurelius ), but the mosque, along with his tomb, still stands, close to the Bab Al-Bahr gate.
After the capture by the Ottoman Turks, Tripoli once again became a base of operation for Barbary pirates. One of several Western attempts to dislodge them again was a Royal Navy attack under John Narborough in 1675, of which a vivid eye-witness account has survived. [3] Effective Ottoman rule during this period (1551–1711) was often hampered by the local Janissary corps. Intended to function as enforcers of local administration, the captain of the Janissaries and his cronies were often the de facto rulers.
In 1711 Ahmed Karamanli , a Janissary officer of Turkish origin, killed the Ottoman governor, the " Pasha ", and established himself as ruler of the Tripolitania region. By 1714 he had asserted a sort of semi-independence from the Ottoman Sultan, heralding in the Karamanli dynasty . The Pashas of Tripoli were expected to pay a regular tributary tax to the Sultan, but were in all other aspects rulers of an independent kingdom. This order of things continued under the rule of his descendants, accompanied by the brazen piracy and blackmailing until 1835, when the Ottoman Empire took advantage of an internal struggle and re-established its authority.
The Ottoman province (vilayet) of Tripoli (including the dependent sanjak of Cyrenaica ) lay along the southern shore of the Mediterranean Sea between Tunisia in the west and Egypt in the east. Besides the city itself, the area included Cyrenaica (the Barca plateau), the chain of oases in the Aujila depression, Fezzan and the oases of Ghadames and Ghat , separated by sandy and stony wastelands.
The Barbary Wars
Tripoli Harbour during the Tripolitan War
In the early part of the 19th century, the regency at Tripoli, owing to its piratical practices, was twice involved in war with the United States. In May 1801, the pasha demanded an increase in the tribute ($83,000) which the US government had been paying since 1796 for the protection of their commerce from piracy under the 1796 Treaty with Tripoli . The demand was refused, and a naval force was sent from the United States to blockade Tripoli.
The First Barbary War dragged on for four years. In 1803, Tripolitan fighters captured the US frigate Philadelphia and took its commander, Captain William Bainbridge , and the entire crew as prisoners. The Philadelphia was turned against the Americans and anchored in Tripoli Harbour as a gun battery. The following year, US Navy Lieutenant Stephen Decatur led a successful nighttime raid to retake and burn the ship. Decatur's men set fire to the Philadelphia and escaped.
The most colorful incident in the war was the expedition undertaken by William Eaton with the object of replacing the pasha with an elder brother living in exile, who had promised to accede to all the wishes of the United States. Eaton, at the head of a crew of 500 US Marines, Greek, Arab and Turkish Mercenaries, marched across the desert from Alexandria , Egypt and with the aid of American ships, succeeded in capturing Derna . Soon afterward, on June 3, 1805, peace was concluded. The pasha ended his demands and received $60,000 as ransom for the Philadelphia prisoners under the 1805 Treaty with Tripoli .
In 1815, in consequence of further outrages and due to the humiliation of the earlier defeat, Captains Bainbridge and Stephen Decatur , at the head of an American squadron, again visited Tripoli and forced the pasha to comply with the demands of the United States. See Second Barbary War .
Later history
Tripoli Cathedral and "the Fiat centre in Tripoli" (Meydan al Gaza'ir) during the 1960s
In 1835, the Ottomans took advantage of a local civil war to reassert their direct authority. After that date, Tripoli was under the direct control of the Sublime Porte . Rebellions in 1842 and 1844 were unsuccessful. After the occupation of Tunisia by the French (1881), the Ottomans increased their garrison in Tripoli considerably.
Italy had long claimed that Tripoli fell within its zone of influence and that Italy had the right to preserve order within the state. [4] Under the pretext of protecting its own citizens living in Tripoli from the Ottoman Government, it declared war against the Ottomans on September 29, 1911, and announced its intention of annexing Tripoli. On October 1, 1911, a naval battle was fought at Prevesa , Greece, and three Ottoman vessels were destroyed. By the Treaty of Lausanne , Italian sovereignty was acknowledged by the Ottomans, although the Caliph was permitted to exercise religious authority.
Tripoli was nominally controlled by Italy until 1943. Afterwards it was governed by British forces until independence in 1951.
On 15 April 1986 US Air Force and Navy planes bombed Tripoli and Benghazi . President Ronald Reagan justified the attacks by claiming Libya was responsible for terrorism directed at the USA, including the bombing of La Belle discothèque in West Berlin ten days before.
United Nations sanctions against Libya were lifted in 2003, which is expected to increase traffic through the Port of Tripoli and have a positive impact on the city's economy.
Law and government
The old medina in Central Tripoli; There are 29 Local People's Congresses within the city boundaries.
The city of Tripoli and its surrounding suburbs all lie within the Tripoli sha'biyah (district). In accordance with Libya's Jamahiriya political system, Tripoli comprises Local People's Congresses where, in theory, the city's population discuss different matters and elect their own people's committee; At present there are 29 Local People's Congresses. In reality, the revolutionary committees severely limit the democratic process by closely supervising committee and congress elections at the branch and district levels of governments, Tripoli being no exception.
Tripoli is sometimes referred to as the de-facto capital of Libya. This is because none of the country's ministries are actually located in the capital. Even the National General People's Congress is held annually in the city of Surt and not the capital. As part of a radical decentralisation programme undertaken in September 1988, all General People's Committee secretariats ( ministries ), except those responsible for foreign liaison ( foreign affairs ) and information, were located away from Tripoli. According to diplomatic sources, the former Secretariat for Economy and Trade was moved to Benghazi ; the Secretariat for Health to Kufra ; and the remainder, excepting one, to Surt, Col. Gaddafi's birthplace. In early 1993 it was announced that the Secretariat for Foreign Liaison and International Co-operation was to be moved to Ras Lanouf.
Geography and climate
A dust storm, making its way from the Sahara to Western Libya, passes over Tripoli.
Al Saaha Alkhadhraa (The Green Square), located in the city centre is mostly landscaped with palm trees as is much of Tripoli.
Tripoli lies at the western extremity of Libya close to the Tunisian border, on the continent of Africa. Over a thousand kilometers separate Tripoli from Libya's second largest city, Benghazi. Coastal oases alternate with sandy areas and lagoons along the shores of Tripolitania for more than 300 kilometers.
Until 2007, the " Sha'biyah " included the City, its suburbs and their immediate surroundings. In older administrative systems and throughout history, there existed a Province (" muhafazah "), State (" wilayah ") or City-state with a much larger area (though not constant boundaries), which is sometimes mistakenly referred to as Tripoli but more appropriately should be called Tripolitania .
As a sha'biyah, Tripoli borders the following sha'biyat:
Az Zawiyah – west
The dominant climatic influences in Tripoli, a coastal lowland city, are Mediterranean . The city enjoys warm summers and mild winters with an average July temperature of between 22 °C (72 °F ) and 29 °C (84 °F). In December temperatures have reached as low as 1 °C (34 °F), but the average remains at between 9 °C (48 °F) and 18 °C (64 °F). The average annual rainfall is less than 400 millimetres (15.7 in), but can be very erratic. [5]
For example, epic floods in 1945 left Tripoli under water for several days, but two years later an unprecedentedly severe drought caused the loss of thousands of head of cattle. Deficiency in rainfall is no doubt reflected in an absence of permanent rivers or streams in Tripoli as well as an absence throughout the entire country. The allocation of limited water is considered of sufficient importance to warrant the existence of the Secretariat of Dams and Water Resources, and damaging a source of water can be penalized by a heavy fine or imprisonment.
The Great Manmade River , a network of pipelines that transport water from the desert to the coastal cities, supplies Tripoli with its water. [6] The grand scheme was initiated by Gaddafi in 1982 and has had a positive impact on the city's inhabitants.
Tripoli is dotted with public spaces, but few fit under the category of large city parks . The Green Square located near the waterfront is scattered with palm trees , the most abundant plant used for landscaping in the city. Tripoli zoo, located south of the city centre, is a large reserve of plants, trees and open green spaces and is the country's biggest zoo.
Climate data for Tripoli
Winter
Economy
Panorama of Tripoli Central Business District as of June 2009; Tripoli is currently undergoing a construction boom.
The That El-Emad Towers, where many Libyan and International companies have offices.
Tripoli is one of the main hubs of Libya's economy along with Misurata . It is the leading centre of banking , finance and communication in the country and is one of the leading commercial and manufacturing cities in Libya. Many of the country's largest corporations locate their headquarters home offices in Tripoli as well as the majority of international companies.[citation needed]
Major manufactured goods include processed food , textiles , construction materials, clothing and tobacco products. Since the lifting of sanctions against Libya in 1999 and again in 2003, Tripoli has seen a rise in foreign investment as well as an increase in tourism. Increased traffic has also been recorded in the city's port as well as Libya's main international airport, Tripoli International .[citation needed]
The city is home to the Tripoli International Fair , an international industrial, agricultural and commercial event located on Omar Muktar Street. One of the active members of the Global Association of the Exhibition Industry (UFI), located in the French capital Paris , the international fair is organised annually and takes place from the 2nd to the 12th of April. Participation averages around 30 countries as well as more than 2000 companies and organisations.[citation needed]
Since the rise in tourism and influx of foreign , there has been an increased demand for hotels in the city. To cater for these increased demands, the Corinthia Bab Africa Hotel located in the central business district was constructed in 2003 and is the largest hotel in Libya. Other high end hotels in Tripoli include the Al Waddan Intercontinental and the Tripoli Radisson Blu Hotel as well as others. [8]
Companies with head offices in Tripoli include Afriqiyah Airways and Libyan Airlines . [9] [10]
Tourism
Emhemmed Elmgharief Street in central Tripoli has some of the best examples of Italianate colonial architecture in Tripoli.
The city's old town is still unspoilt by mass-tourism, though it is increasingly being exposed to more and more visitors from abroad, following the lifting of the UN embargo in 2003. However, the walled medina retains much of its serene old-world ambience. The Assaraya al-Hamra (the Red Castle), a vast palace complex with numerous courtyards, dominates the city skyline and is located on the outskirts of the medina. There are some classical statues and fountains from the Ottoman period scattered around the castle.
The Gurgi and Karamanli mosques, with their intricate decorations and tilework, are examples of the artistic skills of local craftsmen. Just outside the Gurgi mosque is the Arch of Marcus Aurelius , the only surviving Roman monument in the city. More and more palaces (especially from the Karamanli period) are also being restored and opened to the public. The basic street plan of the medina was laid down in the Roman period when the walls were constructed as protection against attacks from the interior of Tripolitania , and are considered well planned, possibly better than modern street plans. In the 8th century a wall on the sea-facing side of the city was added.
Three gates provided access to the old town: Bab Zanata in the west, Bab Hawara in the southeast and Bab Al-Bahr in the north wall. The city walls are still standing and can be climbed for good views of the city. The Bazaar is also known for its traditional ware; fine jewellery and clothes can be found in the local markets. The Jamahiriya Museum , a fine modern facility located in the Red Castle, is Libya's national museum. It houses many artefacts from the country's Roman and Greek periods, including treasures from the World Heritage sites at Leptis Magna and Sabratha , as well as politically motivated displays such as the Volkswagen Beetle car driven by Gadaffi in the 1960s.
Colleges and universities
The largest university in Tripoli, Al Fateh University , is a public university providing free education to the city's inhabitants. Private universities and colleges have also begun to crop up in the last few years.
Universities in Tripoli include:
Al Fateh University – The largest and most important university in Tripoli
Al Fateh University for Medical Sciences – It includes the following faculties: Medicine, Pharmacy, Dentistry and nursing (which was previously a small institute).
| i don't know |
In which part of the body is the 'Sural Nerve'? | Sural Nerve Entrapment Explained | | Chronic Body Pain
Foot Pain
Sural Nerve Entrapment Explained
Before we can discuss what sural nerve entrapment is, you really should know what the sural nerve is and what it does.
The sural nerve is also referred to as the short saphenous nerve. It is the sensory nerve located in the lower leg. This nerve lies very close to the short saphenous vein, which is a major vein located in the calf.
The sural nerve can begin from just behind the knee to just below the ankle. This particular nerve is often used for nerve grafts and biopsies.
The sural nerve begins and the juncture of the lateral and medial sural cutaneous nerves. In most individuals, this typically occurs very low in the leg- even at or below the ankle in some cases.
On the other hand, in a few individuals, the sural nerve can begin as high as behind the knee. , in some individuals, the sural nerve is actually simply a continuation of the medial sural cutaneous nerve.
This nerve travels down an individual’s calf just below the surface of the skin, passing close to the Achilles tendon and then ending in the space between the heel and the bony bump on the outside of the ankle, known as the lateral malleolus.
It actually continues into the foot, reaching the little toe- but once it passes the ankle, it is given a different name- the lateral dorsal cutaneous nerve.
The sural nerve conveys sensory information regarding the lower calf and outer foot to the brain- damage to this nerve can result in extreme pain in the leg or foot.
However, if damage does occur, it can be treated by removing part of the nerve. Of course, removal of a portion of the nerve can result in numbness in the ankle and side of the foot- but the nearby nerves will grow in to compensate, which restores most of the feeling to the area.
Due to the fact that the sural nerve is just below the skin and it’s basically not important to essential bodily functioning, it is often used when a nerve biopsy is necessary.
To perform a biopsy, the surgeon will inject a local anesthetic and then, using the short saphenous vein to guide him/her, will locate the sural nerve and then remove a piece about an inch long.
The wound will then be stitched closed and then covered with gauze moistened with saline. The sample will then be placed under a microscope and examined for evidence of nerve disorders.
Additionally, this nerve is often chosen to be used in nerve grafts. This is where a piece of the nerve will be taken out and transplanted into an area where nerves have been damaged.
The donor piece will be spliced with the existing nerve to restore muscle functioning and sensation. This procedure is commonly used to restore the feeling in damaged limbs.
The sural nerve is being transplanted more often into the pelvic area after prostate surgery to restore any lost sexual functioning.
Sural Nerve Neuropathy
Though the sural nerve is not necessarily essential to bodily functioning, it is still a nerve, and just like other bodily tissues, can experience disease and/or trauma.
The sural nerve is a peripheral nerve, meaning that it serves to communicate with the brain and spinal cord. Sural nerve damage is a subtype of peripheral neuropathy.
There are some important characteristics of sural nerve damage related to the functioning and the anatomy of the involved structures.
Types of Neurons and Related Anatomy
Nerve cells, also referred to as neurons are divided into three major categories:
Sensory
Motor
Interneurons
The sensory neurons pick up the sensory signals and then take them to the spinal cord and the brain. On the other hand, the motor neurons take commands from the spinal cord and the brain and carry them to the muscles or glands to tell them what to do.
However, no matter what their primary function, all neurons have the same specific structural components:
Cell body
Axon
Dendrites
The cell body holds the nucleus and is the center of the metabolism of the neuron. The axon is a very long fiber of nerve that carries the signals away from the cell body.
The dendrites are short projections that carry the signals that are coming into the cell. The axon is often covered by a myelin sheath.
Types of Peripheral Neuropathy
Basically a nerve is a corded bundle of axons. There are a few forms of neuropathy:
Mono-neuropathy
Poly neuropathy
Mono-neuropathy is basically a neurological disorder that is caused by a single nerve malfunctioning. However, when several of the nerves become dysfunctional at the same time, it is referred to as polyneuropathy.
Experts have agreed that widespread peripheral neuropathy, also referred to as polyneuropathy, very often involves the sural nerve in some way. However, true mono-neuropathy, or isolated sural neuropathy is a very rare condition.
Causes of Sural Nerve Neuropathy
One study that was featured in “Muscle and Nerve” clinical journal claims that trauma is the most common reason for sural nerve neuropathy.
Possible causes of trauma include fracture of the ankle, sprained ankle, stripping of veins, surgery of the knee, running for long distances, laceration of the ankle, gunshot to the ankle and external compression.
Experts claim that compression could be due to tears of the calf muscle or overgrowth of the muscles.
Some other causes of sural nerve neuropathy include: blood vessel inflammation, also referred to as vasculitis; biopsy of the sural nerve; diabetes; and ganglion cysts.
Due to the fact that the sural nerve is so close to the surface of the skin, it makes it much more likely to become injured due to compressions on the skin and the fact that most injuries occur on the surface of the skin.
Signs and Symptoms of Sural Nerve Neuropathy
Nerve damage- and the signs and symptoms of that nerve damage- can actually occur anywhere on the sural nerve. Sural nerve neuropathy often means that the individual will experience pain and other abnormal sensations in the skin of the ankle and foot, including tingling and numbness.
In most cases, these feelings will be much worse in the evenings and at night- even to the point of causing disruptions in sleep.
Some of the other common symptoms of sural nerve neuropathy include shooting spasms, burning, hypersensitivity to the area, pain, numbness, and even weakness in the area surrounding the nerve.
An individual with sural nerve neuropathy may also experience a reduction in motor functioning.
Diagnosing Sural Nerve Neuropathy
There are several different diagnostic procedures used to diagnose peripheral neuropathy, including sural nerve neuropathy.
Neurological testing
Nerve/skin biopsies
Imaging
However, you should be aware that isolated sural neuropathy is often much more challenging to diagnose than other forms of peripheral neuropathy and will also require additional testing including an electro-physiologic evaluation.
Treatment of Sural Nerve Neuropathy
Surgical release has been claimed to be the best possible treatment for sural nerve neuropathy that is due to compression or entrapment of the sural nerve.
Sural nerve neuropathy that is connected with problems with the ankle may also require some physiotherapy, reconstruction, or bracing.
Basically, just as with any other disorder, the key to managing sural nerve neuropathy is to control or even get rid of the causes by treating the underlying disease and addressing any behaviors that could be causing or contributing to further damage to the nerve.
Nerve Entrapment and Athletes
Very often, athletes will complain of having leg pain and problems. Typically, these conditions are due to entrapment of the sural nerve or even other peripheral nerves.
Of course, we all know that leg pain caused by exercise is a very common condition and has lots of different apparent causes.
In many cases, leg pain that is caused by exercising is due to many different reasons, and can be localized or can be a great distance from the pain site.
Once a physician has ruled out things such as musculoskeletal problems, vascular problems, and even compartment syndrome problems, the symptoms of nerve entrapment should come into play as a potential cause of the leg pain.
Non-neural Causes of Leg Pain
There are several different non-neural reasons an individual could experience leg pain. They are as follows:
Shin Splints
The term shin splints actually covers a variety of disorders that could be a result of leg pain caused by exercising. In the beginning, “shin splints” were thought to be a result of an injury to the tibialis posterior tendon. Other conditions involving overuse have also been wrongly called “shin splints,” such as:
Compartment syndrome
Tibialis anterior strain
Tibial stress fracture
Due to the fact that the above conditions have totally different causes, the term “shin splints” is not a very useful term. Instead, the physician should seek to find and address the specific condition that is present.
Muscle Strain
You may not know this, but you can actually damage your muscles by overstretching them. The muscle that is most often injured due to overstretching is the tibialis anterior, in front of the shin.
Symptoms of a muscle strain are as follows: acute pain in the muscle where the tear is, swelling, and inflammation. Once the swelling has reduced, you should treat this condition by stretching and strengthening the muscle that is affected. However, make sure to stop when you’re experiencing pain.
Tendonopathy
Tendonopathy is a condition in which microtears in the tendon result in inflammation in the surrounding tissue. This is another “overuse” injury that is most often caused from excessive repetitive movements, mostly overstretching a muscle.
When it comes to the leg muscles, the one that is most often affected is the tibialis posterior, usually due to repeated hyperpronation.
Symptoms of Tendonopathy include swelling, pain, and a “crunchy” feeling, or palpable crepitus on the tendon during contraction of the muscle.
The pain will typically happen at the beginning and just following exercise. When beginning treatment, painful activities should be stopped and you should start taking anti-inflammatories.
Of course, you should be aware that you should not cease all activities and completely rest because tendons truly do heal much more effectively when they are given mild loading.
Once the pain and inflammation have reduced, the affected tendon should be strengthened and stretched.
Medial Tibial Stress Syndrome
One of the natural consequences of weight bearing is bone bending. Of course, the wider bones are much more resistant to bending than the narrower ones and therefore, that makes them much less likely to become injured.
Repetitively bending bones causes a long bone to widen its cross section by causing the cells to lay down new bone.
If the intensity of training increases during this process, the cells of the bone are not able to keep up with the growth and therefore the area will begin to experience inflammation.
This particular injury could also be made much worse by simultaneously and repetitively pulling the muscles of the periosteum.
With this injury, the area this is most likely to become affected is the lower half of the medial tibia, where the cross section of the bone is the most narrow.
Signs and symptoms of this condition include pain during weight bearing activities- especially running, as well as tenderness. In some cases, you may notice redness, warmth, and even swelling.
Treatment for this condition is full rest from painful activities, slowly and gradually returning to normal training. You should not be strengthening or stretching your muscles while experiencing symptoms.
Tibial Stress Fracture
A tibial stress fracture is an incomplete crack in the tibia when repetitively putting a load on the bone has decreased its ability to support the load.
This condition is much more likely to occur in specific sports such as with long-distance running. Once a tibial stress fracture has been diagnosed, an individual should completely rest for at least 15 days from weight bearing activities.
Though it is very uncommon, an individual who does not rest could experience spontaneous complete fractures. In most cases, a tibial stress fracture will heal in about four to eight weeks.
However, lesions on the front of the bone could actually take several months to heal and could end up requiring grafting or electrical stimulation. It is very common for a tibial stress fracture to reoccur.
Chronic Exertional Compartment Syndrome
Chronic exertional compartment syndrome is an overuse condition that is a result of tight fascia around the muscles, producing symptoms during training and up to around 15 minutes after training.
In most cases, this condition is characterized by a tightness in the rear lower leg, as well as feeling of pins and needles. The diagnosis can get a confirmation by using pressure testing after an individual exercises.
Often, the individuals describe the pain as a cramping feeling. There may also be some muscle tears present.
In some cases, a physician will recommend using elective fasciotomy in order to release the fascia and therefore reduce the pressure.
This condition should not be confused with acute compartment syndrome, as the latter is a medical emergency that can happen after being hit in the lower leg directly.
Popliteal Artery Entrapment Syndrome
This is an extremely uncommon condition that is found among young individuals involved in sports that have a signs and symptoms of restricted blood flow to their lower leg.
These indications are pain, paresthesia , and pallor. This condition is due to intensity of exercise and drops away very quickly upon cessation.
Upon a post-exercise examination, a physician will most likely find arterial bruits, which is sounds of local blood flow using a stethoscope, and diminished or even an absent pulse.
Compression could possibly happen at the start of the medial head of plantaris or gastrocnemius due to the artery taking the wrong course.
Surgically removing the structure causing the compression is usually suggested as an effective treatment.
Nerve Entrapment Syndromes
The term “peripheral nerve entrapment” refers to the mechanical irritation in which a specific peripheral nerve becomes injured in an anatomical location that is vulnerable.
Nerve entrapments cause a disturbance in the functioning of the nerve. Nerve entrapment could possibly occur at any site due to tissue damage, including tumors, hematomas, or fractures.
There are several sites which the peripheral nerves are in confined spaces and therefore at a much greater risk of becoming compressed.
Physicians treating these conditions must also think about other causes of nerve entrapment including hereditary, inflammatory, degenerative, metabolic, and vascular diseases because these can also cause local nerve damage.
Factors that can predispose an individual for developing nerve compression are repetitive actions that involve the extremity that is affected, RA, tenosynovitis, alcoholism, acromegaly, amyloidosis, mucopolysaccharidosis, diabetes, gout, deficiency in vitamin B, alteration in fluid balance, and even trauma.
In some cases, a nerve entrapment will seem very similar to compartment syndrome, Tendonopathy, and even arterial entrapment. Individuals experiencing this condition will often describe the pain as shooting and sharp.
The condition can involve any combination of nerves. The best way to diagnose a nerve entrapment condition is to obtain a detailed history and performing a detailed, focused exam.
The best time to test individuals for nerve entrapment is after they have exercised. The area should be carefully examined and if possible, palpate the nerve along its course to identify the site of the entrapment or injury.
Of course, spinal and central problems must be addressed first and physicians should consider using diagnostic nerve blocks.
Saphenous Nerve Entrapment
Anatomy of saphenous nerve
This is where the sensory branch of the femoral nerve goes down into the canal known as the adductor canal and then goes through the fascia over the Sartorius and then travels along the long saphenous vein.
The two main branches of the saphenous nerve are the infrapatellar, which is located near the knee and the descending which is located near the inner end of the tibia bone.
Damage or entrapment of this nerve can be involved in conditions or injuries such as direct trauma, bursitis, and even MCL injuries.
Additionally, damage can occur during surgery such as a hamstring graft to treat reconstruction of the ACL or even surgery to treat varicose veins.
Individuals experiencing saphenous nerve entrapment will most often have knee pain , especially after working out their quadriceps. The pain could also be present at night and could be a burning pain.
Treatment for saphenous nerve problems include injections of medications or even destruction and/or removal of the infrapatellar ranches of the nerve.
Sural Nerve Entrapment
This is a very rare cause of pain related to exercise, but still can occur. Compression due to various reasons such as mass lesions, ganglia, scar tissue, thrombophlebitis, and even surgical trauma can cause sural nerve entrapment/problems.
Symptoms of this condition are very similar, if not identical, to those related to Achilles Tendonopathy. The nerve will be irritated much higher up and is often accompanied by a very small muscle hernia. Additionally, another symptom of this condition is post-exercise numbness.
Physicians prefer to treat this condition conservatively, with surgery working best only when a specific point of sural nerve entrapment has been pointed out.
| Lea Green railway station |
Which Australian state capital lies on the Swan River? | Sural region | definition of sural region by Medical dictionary
Sural region | definition of sural region by Medical dictionary
http://medical-dictionary.thefreedictionary.com/sural+region
su·ral re·gion
[TA]
the muscular swelling of the back of the leg below the knee, formed chiefly by the bellies of the gastrocnemius and soleus muscles.
[so̅o̅′rəl]
Etymology: L, sura, calf of the leg
the calf of the leg. It is formed by the bellies of the gastrocnemius and soleus muscles.
su·ral re·gion
(sūr'ăl rē'jŭn) [TA]
The muscular swelling of the back of the leg below the knee, formed chiefly by the bellies of the gastrocnemius and soleus muscles.
Synonym(s): calf .
Patient discussion about sural region
Q. I have just developed a pain in my calf - feels like it clicks when I walk, and is a sharp pain I first noticed this problem this morning. As I stepped out of my car, I felt a sharp pain in my left calf, and it has gone worse as the day has gone on. No pain until I walk.
A. hmmm...now as i think of it- fatman's answer seems more logical. but usually people can tell the difference between strained muscle and other stuff. if it was just a pulled muscle he would have thought of it and naturally massage the area. no?
| i don't know |
The forces of which king won the Battle of the Boyne? | Williamite War in Ireland - The Battle of the Boyne
25,000 men
Battle of the Boyne Summary:
In the wake of the Glorious Revolution of 1688, the deposed Catholic King James II sought to regain the thrones of England and Scotland. Arriving in Ireland, he took command of the 25,000-man Jacobite army and began planning his next move. Included in his army were 6,000 French soldiers who had been sent by King Louis XIV to aid the Jacobite cause. Alerted to James' action, Protestant King William III began assembling forces to drive his adversary from Ireland. Landing at Carrickfergus in June 1690, with 16,000 men, William quickly linked up with the Duke of Schomberg who led a force of 20,000.
With this combined army, William began moving south towards Dublin.
Rather than oppose William's march in the rough country around Newry, James assumed a defensive position along the south bank of the River Boyne, approximately 30 miles north of Dublin. On July 11, William and his men arrived at the Boyne and began scouting the Jacobite positions. While doing so, William was slightly wounded by enemy artillery fire. Making camp at the village of Tullyallen, William devised a plan which called for a sweeping flanking maneuver to the west, while he pinned the Jacobites in place near the fords at Oldbridge.
At 6:00 AM the next morning, William dispatched Count Meinhard Schomberg, the duke's son, west with 10,000 men and orders to cross the Boyne at Roughgrange. From there they were to march east and strike James in the flank and rear. After marching the six miles, Count Schomberg found that the ford at Roughgrange was held by Irish dragoons led by Neil O'Neill. Approaching the ford, Schomberg's men were attacked by O'Neill's troopers. Beating off their charge, Schomberg's troops successfully crossed the river. Receiving news that Williamite forces had crossed at Roughgrange, James dispatched 17,000 men to the area.
As James' men reached Roughgrange they discovered that a deep ravine prevented them from attacking Schomberg's men. Conversely, the ravine blocked Schomberg's advance. As a result, these two forces played no further part in the battle. To the east, William began his assault on James' position around 9:00 AM. At Oldbridge, the attack was led by William's elite Dutch Blue Guards who waded across the river. Despite heavy musket fire from the Jacobite troops, William's men were able to obtain a foothold on the south bank and captured the village of Oldbridge.
Reinforced, the Williamite infantry continued to press their advance. In an effort to block their progress, James began a series of counterattacks near Oldbridge. After his infantry was repulsed, he elected to send his cavalry forward. Halting, the Williamite troops were able to break the cavalry charges, though the Duke of Schomberg was killed in the fighting. Around noon, William led a force of 3,500 men across the Boyne at Drybridge, near Drogheda. With William approaching on their flank, the Jacobites fell back from Oldbridge and assumed a new position near Donore.
Attacking, William's men were forced the Jacobites to retreat after about thirty minutes of fighting. Retreating to Duleek, James reunited with the troops he had sent to Roughgrange. With the battle lost, they began withdrawaling west towards the Shannon. Effectively screened by their cavalry, they were able to escape unmolested.
Aftermath:
The victory at the Boyne cost William approximately 750 killed and wounded, while the Jacobites suffered around 1,500. Continuing his march, William entered Dublin two days later. Fearing that his cause was lost, James departed the army and made for Duncannon. From there he embarked for France, never to return to the British Isles. His army was ultimately besieged at Limerick and forced to surrender the following year. The triumph at the Boyne marked the first major victory for the League of Augsburg over the forces of Louis XIV and his allies. In Ireland, the Boyne marked the turning point of the Williamite war and assured British and Protestant dominance over the country for the next two centuries. For this reason, the battle has assumed significant sectarian importance within the country.
Selected Sources
| William III |
'Alfred Jingle' and 'Serjeant Buzfuz' appear in which Dickens novel? | The Language Journal: Orangemen’s Day – Celebrating the Battle of the Boyne Day of Ireland
Wednesday, July 11, 2012
Orangemen’s Day – Celebrating the Battle of the Boyne Day of Ireland
Though one of the most famous holidays in Ireland is St. Patrick’s Day, one of the most historically significant is Orangemen’s Day, which is commemorated on the 12th of July. Orangemen’s Day is celebrated in Northern Ireland each year to remember the glorious victory in the Battle of Boyne.
King William III at the Battle of the Boyne, 1 July 1690
Brief history
The Battle of the Boyne dates back to the 17th century. On July 1, 1690, the Catholic King James fought against the Protestant King William across the River Boyne. This is located near Drogheda at Ireland’s eastern coast.
William won the battle, resulting in the Protestant rule in Ireland as well as in England. This is one of the most significant and most well-known battles in British-Irish history.
Outwardly, some say that it is a battle with its roots in religion since it was waged between two kings who belonged to two different churches. However, others see it as a sectarian and ethnic conflict.
Jacobites
For the Jacobites, it was a battle for Irish sovereignty. The forces under King James numbered 25,000, comprised 19,000 Irish Catholics and 6,000 French forces.
The daughter of James was actually married to William, who at that time was the Prince of Orange, who also happened to be a Protestant.
Williamites
On the other hand, for the Williamites, it was about keeping the English rule in Ireland, as well as the continuation of Protestant interests in the country. William III of Orange led 36,000 troops to battle. They were aided by Danish mercenaries as well as Dutch and English soldiers.
When Prince William won, he became known as King William III.
Not actually on July 12
The date of July 1 in the Julian calendar is the equivalent of July 11 in the Gregorian calendar. The switch of the calendar happened in 1752 and it is the calendar we use today. However, the holiday is celebrated every July 12. It is said that the reason for this is because the Orange orders were quite suspicious of the accuracy of the Gregorian calendar, so they opted to use the corrected date of July 12, rather than July 11. In Northern Ireland, it is a bank holiday or a non-working holiday. If the 12th falls on a weekend, the next closest Monday is declared a bank holiday instead.
Many names
This particular day is called many things. Orangemen’s Day is the most popular, but it can also be abbreviated to Orange Day. Because it’s celebrated on the 12th of July, it is also called The Glorious Twelfth, or more simply, The Twelfth.
Celebrations
There are many activities that form part of the festivities. First, it is a national non-working holiday, allowing people to participate in the different events. The celebrations kick off with a giant bonfire on the eve of the Twelfth. This is a family friendly gathering that is widely attended by Protestants in the country.
The March
Orangemen Parade in Armagh
Walks or marches are the most common activity done during this day. This often starts at the Orange Hall and makes its way through the town. The participants wear dark suits. Those who wish to stick to the classic form wear black bowler hats along with white gloves. However, this is not as common today, especially during warm weather.
Collarettes made from a long thin piece of orange colored cloth that is draped around the neck forming a V shape at the front are worn. Most of the marches are organized by Lodges of the Orange Order and so the wearer is identified with the badge from the lodge that he belongs to. There are also participants who use a ceremonial sword as part of the day’s attire. For the women who participate in the marches, they wear formal attire, since a standard dress code has not been established as it has for the men.
Lambeg drums
Orangemen also use tin whistles and march to accordions as well as lambeg drums in honor of King William III’s historical victory. The cities are also decorated with street murals showing King Billy riding his white mare as he crosses the Boyne River.
The participants of the marches also carry flags depicting their beloved King Billy on his white steed. British flags also are used to decorate the streets.
There are also contests held, especially lambeg drumming. The massive lambeg drum also happens to be one of the loudest acoustic instruments in the world, along with the bagpipe.
Church service is often part of the celebration, as well as speeches by important and high ranking individuals belonging to the Orange Order.
A tense past
Unfortunately, these celebrations have also been marred by violence, especially since Northern Ireland is comprised of a population wherein half are Catholics and the other half are Protestants. Much of the tension stems from the Catholics who are against the Protestant celebrations.
Some celebrations can get out of hand. At times, Catholic symbols are burned during the bonfires. Raising of certain flags can also offend other groups. Then there are those who imbibe too much to drink and get too rowdy. There are also instances wherein some masked gunmen have been known to fire shots in the air as a show of strength. Environmentalists complain about the pollution massive bonfires can cause the atmosphere.
There is also the image that the Orange Order is seen as a sectarian and a supremacist group. The political coloring of the celebration is another reason for some of the tensions that have risen from past festivities.
Fortunately today, the celebration is being seen as a cultural celebration, often bringing in many tourists to the country. In fact, in Belfest, the celebration is called Orangefest.
Around the world
Today, Orangemen’s Day is celebrated in various parts of the world. There are celebrations by Protestants in the United Kingdom, New Zealand and Canada, as well as anywhere there are Orange lodges.
Photo Credits:
| i don't know |
Which pop group comprised John Gorman, Roger McGough and Mike McGear? | The Scaffold | Liverpool Music
Liverpool Music
Share Tweet
The Scaffold consisted of Roger McGough, Mike McGear (Mike McCartney, brother of the ex-Beatle Paul McCartney) and John Gorman.
The three members were brought together through a shared love of music, poetry and comedy and proceeded to write and compose original material often parodying elements of real life whilst covering some of their favourite Liverpool songs.
Lily the Pink
The band was initially signed to EMI and enjoyed notable chart success on the subsidiary label Parlophone in their 1960’s heyday with songs such as Lily the Pink (#1) and Thank U Very Much (#4).
However as the band were not musicians first, session artists needed to be brought in to supplement the group.
Such luminaries as Graham Nash (Hollies, Crosby, Stills and Nash), Elton John and Jack Bruce (Cream) were brought in to supplement the vocals of McGough, McGear and Gorman, and with the various session musicians they employed, the band completed four albums featuring songs generally composed by McGear, reciting of McGough’s poetry and performances of Gorman’s comedy.
The first, the self titled The Scaffold, appeared in 1968 whilst L the P was released again on the Parlophone label in 1969.
In 1970 the band featured in their own television series made for children called “Score With The Scaffold” and in 1972 made a 30 minute musical production for television called Plod.
The musical was filmed on location in Liverpool and displayed the bands diversity.
The groups EMI contract ended in 1973 and the trio signed with Island Records where their first release Liverpool Lou reached #7 in the UK singles charts.
The album Fresh Liver was also released in 1973 but the band were soon parting ways with Island and joining up with fellow creatives including Neil Innes (Monty Python, The Rutles) and Adrian Henri (The Liverpool Scene, The Mersey Sound).
New Band, New Members
This new band had numerous members (even featuring Keith Moon on drums at one performance) and derived its name from the first letter of the surnames of its original members Gorman – Roberts – Innes – McGough – McGear – Stanshall spelling GRIMMS.
The Grimms were a group made up of, at one point, ten members and released three albums together between 1973 and 1976.
The Grimms’ second album Rockin’ Duck received warm critical praise but the band failed to capitalise on this as a conflict between Mike McGear and Brian Patten (in which Patten punched McGear) and resulted in McGear leaving the group.
Bronze records label
In 1976 the band reformed on the Bronze records label to tour and did so for the next two years before splitting in 1977.
The band have since reformed for one-off gigs and appearances and contributed a track for Liverpool – The Number Ones Album, celebrating the cities musical heritage in its European Capital of Culture year.
Search for:
| Scaffolding |
Which Scottish racing driver scored one point on his Formula One debut at the 2011 Australian Grand Prix, racing for the Force India team? | Roger McGough — Free listening, videos, concerts, stats and photos at Last.fm
high-speed
Roger McGough, born November 9th 1937, is a Liverpudlian poet who first gained recognition in the sixties as part of the "Mersey Sound" group of poets. He formed Scaffold with Mike McGear and John Gorman, who had a number one hit in 1968 with Lily The Pink. He was also involved in the film Yellow Submarine, and in the Beatles spoof, All You Need Is Cash, documenting the life of imaginary band The Rutles. In 1978 Roger released a musical… read more
| i don't know |
What is the first name of the brother of the Duchess of Cambridge, who read the lesson at her wedding? | Duchess of Cambridge 'getting over severe morning sickness', says brother - Telegraph
Kate Middleton
Duchess of Cambridge 'getting over severe morning sickness', says brother
James Middleton says sister Kate's condition improving after being taken ill again while expecting second child with Prince William
James Middleton wants to be the best uncle possible to Prince George Photo: Rex Features/ PA
By Agency
2:38PM GMT 12 Nov 2014
The Duchess of Cambridge’s brother has revealed that his sister is now getting over her severe morning sickness as he described how he wants to be the "cool uncle" to Prince George.
James Middleton said that he wanted to be the "fun" relative who spoiled the newest member of the royal family.
He revealed that his sister’s dog Lupo was actually a wedding present from him to her and Prince William on their marriage.
He also said that his sister is improving after being taken ill again whilst expecting her second child.
Mr Middleton said: "She’s better. It’s not unknown she’s suffering from acute morning sickness, fortunately I think she’s on the mend."
Related Articles
Pippa Middleton filmed dancing in Wyoming
07 Nov 2014
He appeared on US TV to launch his new sweet company, Boomf, which allows people to print personalised messages or photos of marshmallows.
He told ABC’s Good Morning America that he still remembers his sister’s wedding fondly.
He said: "The most wonderful thing about that wedding which will stay with me forever was that although billions were watching, it felt like a family wedding.
"I suffered most of my life with dyslexia and for the reading I felt absolutely terrified.
"My little treat for them was to give them a puppy and Lupo was their gift."
Asked by presenter Amy Robach about the birth of Prince George , he agreed it was "surreal".
More ABC US news | ABC Health News
He said: "The most wonderful thing is everybody was celebrating with us, becoming an uncle and my parents becoming grandparents. They were all so excited.
"I still see Prince George as my nephew and want to be the best uncle possible. Like any uncle I want to be the cool uncle, I want to be the fun uncle, what shall we get him for Christmas this year, how can we stand out…
"...I think there’s a long way to go to be a cool uncle. I’m trying to be as best as I can."
Mr Middleton added that he has not yet figured out what to get Prince George yet for Christmas.
He said the Middletons were a "really close family" and he and his sister "speak on the phone all the time", or meet up for coffee or a Sunday roast.
Asked about Boomf, Mr Middleton described himself as "Wonka in chief" and said that he wanted it to be "fun".
He said: "We take a lot of the magic from Willy Wonka."
Lupo the dog with Prince William, Catherine Duchess of Cambridge and Prince George
His co-founder, Andy Bell, said they chose the name because "if you're trying to get a marshmallow to speak that would be the first word it said".
The Duchess and Prince Williams are rumoured to be visiting New York next month for a few days.
Mr Middleton said that he had "heard that too", but did not know their diary plans.
US TV appears to be engaged in an arms race to sign the Middletons - Mr Middleton’s sister Pippa is rumoured to be in talks to be a special correspondent for NBC.
| James Cancer Hospital |
In which Asian country is the 'Plain of Jars', the site of thousands of megalithic jars? | Royal baby: Catherine gives birth to a girl - CNN.com
Photos: Princess Charlotte of Cambridge
The Duchess released two photos of Charlotte taken at Anmer Hall in Norfolk, eastern England.
Hide Caption
2 of 21
Photos: Princess Charlotte of Cambridge
Britain's Prince William and Catherine, Duchess of Cambridge, pose with their two children, Prince George and Princess Charlotte, at Charlotte's christening on Sunday, July 5. Charlotte is fourth in line to the British throne, behind Prince Charles, William and her big brother.
Hide Caption
Photos: Princess Charlotte of Cambridge
Catherine poses with Charlotte after the christening.
Hide Caption
Photos: Princess Charlotte of Cambridge
Prince William and his son pose for a photo after Charlotte's christening.
Hide Caption
5 of 21
Photos: Princess Charlotte of Cambridge
This family photo was taken after the christening. In the front row, from left, are Prince William, Prince George, Duchess Catherine, Princess Charlotte and Queen Elizabeth II. In the back row, from left, are Catherine's father, Michael Middleton; her sister, Pippa Middleton; her brother, James Middleton; her mother, Carole Middleton; Prince Charles; Camilla, Duchess of Cornwall; and Prince Philip.
Hide Caption
Photos: Princess Charlotte of Cambridge
Princess Charlotte is pushed in her pram as she leaves the church after her christening.
Hide Caption
Photos: Princess Charlotte of Cambridge
Prince George looks at his sister after the christening.
Hide Caption
Photos: Princess Charlotte of Cambridge
Catherine carries Charlotte as they arrive at church for the christening.
Hide Caption
Photos: Princess Charlotte of Cambridge
The royal family arrives for the christening.
Hide Caption
10 of 21
Photos: Princess Charlotte of Cambridge
Royal watchers might recognize Prince George's outfit. It's very similar to the one worn by his father, Prince William, when he visited his newborn brother, Prince Harry, on September 16, 1984. Prince William is on the left in the photo above. Prince George is on the right.
Hide Caption
Photos: Princess Charlotte of Cambridge
The royal family arrives for the christening.
Hide Caption
12 of 21
Photos: Princess Charlotte of Cambridge
Princess Charlotte is seen with her big brother, Prince George, for the first time in a photo released by Kensington Palace on Saturday, June 6.
Hide Caption
13 of 21
Photos: Princess Charlotte of Cambridge
William and Catherine present their newborn princess, Charlotte Elizabeth Diana, as they leave St. Mary's Hospital in London on Saturday, May 2.
Hide Caption
Photos: Princess Charlotte of Cambridge
A close-up of the princess in the arms of her mother.
Hide Caption
15 of 21
Photos: Princess Charlotte of Cambridge
Princess Charlotte in her car safety seat, outside St. Mary's Hospital, on the day of her birth.
Hide Caption
Photos: Princess Charlotte of Cambridge
The prince and princess leave the hospital with their baby daughter.
Hide Caption
Photos: Princess Charlotte of Cambridge
William and Catherine and their newborn princess wave to the media.
Hide Caption
Photos: Princess Charlotte of Cambridge
Well-wishers gather and take photos as the royals leave the hospital.
Hide Caption
19 of 21
Photos: Princess Charlotte of Cambridge
Prince William and his son wave as they visit the hospital after the announcement of the princess' birth.
Hide Caption
20 of 21
Photos: Princess Charlotte of Cambridge
An easel is placed in the forecourt of Buckingham Palace in London to announce the birth of the princess.
Hide Caption
1 of 34
Photos: Will and Kate's royal family
Catherine, the Duchess of Cambridge, Prince George and Prince William talk with U.S. President Barack Obama at Kensington Palace in London on Friday, April 22. Obama visited the royals during his global tour, with stops in Saudi Arabia, Britain and Germany.
Hide Caption
2 of 34
Photos: Will and Kate's royal family
Prince George gets a boost from some foam blocks for a special family photo. The portrait, featuring the four generations of the House of Windsor, was commissioned by the Royal Mail and will be featured on a series of stamps to commemorate the Queen's 90th birthday.
Hide Caption
3 of 34
Photos: Will and Kate's royal family
Britain's Prince William and Catherine, Duchess of Cambridge pose for a photo with their children, Princess Charlotte and Prince George in the French Alps on Thursday, March 3.
Hide Caption
4 of 34
Photos: Will and Kate's royal family
Britain's Prince William poses with Catherine, the Duchess of Cambridge, and their children, Prince George and Princess Charlotte, during a family Christmas photo released on Friday, December 18.
Hide Caption
5 of 34
Photos: Will and Kate's royal family
Princess Charlotte plays with a stuffed dog in this photo taken by her mother in early November.
Hide Caption
Photos: Will and Kate's royal family
William and Catherine pose with their children at Charlotte's christening in July.
Hide Caption
7 of 34
Photos: Will and Kate's royal family
Princess Charlotte is seen with her big brother for the first time in a photo released by Kensington Palace in June.
Hide Caption
Photos: Will and Kate's royal family
William and Catherine present their newborn daughter as they leave a London hospital in May.
Hide Caption
Photos: Will and Kate's royal family
In March, William and Catherine visit a center dedicated to community learning in London.
Hide Caption
10 of 34
Photos: Will and Kate's royal family
The royal family celebrates Prince George's first birthday with a trip to the Natural History Museum in July 2014.
Hide Caption
11 of 34
Photos: Will and Kate's royal family
The royal family waves to a crowd before boarding a plance in Wellington, New Zealand, in April 2014. They went on a three-week tour of Australia and New Zealand.
Hide Caption
12 of 34
Photos: Will and Kate's royal family
The royal couple attends the Tusk Conservation Awards at the Royal Society in London in September 2013.
Hide Caption
13 of 34
Photos: Will and Kate's royal family
William and Catherine start an ultra marathon in Holyhead, Wales, in August 2013. It was Catherine's first public appearance since the birth of Prince George.
Hide Caption
14 of 34
Photos: Will and Kate's royal family
The couple are pictured with their newborn boy, Prince George, in 2013. The new parents released two family photographs taken by Michael Middleton, Catherine's father.
Hide Caption
15 of 34
Photos: Will and Kate's royal family
The Duke and Duchess and their newborn son depart St. Mary's Hospital in London in July 2013.
Hide Caption
16 of 34
Photos: Will and Kate's royal family
In June 2013, William, Catherine and Prince Harry arrive at Westminster Abbey for a celebration marking the 60th anniversary of Queen Elizabeth II's coronation.
Hide Caption
17 of 34
Photos: Will and Kate's royal family
In April 2013, Harry, Catherine and William make magic on the set used to depict Diagon Alley in the "Harry Potter" films.
Hide Caption
18 of 34
Photos: Will and Kate's royal family
The couple attends a St. Patrick's Day parade as they visit Aldershot, England, in March 2013.
Hide Caption
19 of 34
Photos: Will and Kate's royal family
In September 2012, the couple drank coconut milk from a tree that Queen Elizabeth II planted decades ago in the South Pacific nation of Tuvalu.
Hide Caption
20 of 34
Photos: Will and Kate's royal family
Catherine and William celebrate during cycling events at the Olympic Games in London in August 2012.
Hide Caption
21 of 34
Photos: Will and Kate's royal family
The Queen, William and Catherine stand on the balcony of Buckingham Palace during the finale of the Queen's Diamond Jubilee celebrations in June 2012.
Hide Caption
22 of 34
Photos: Will and Kate's royal family
As part of their charity work, the couple attended a "healthy living cookery session" in London in December 2011.
Hide Caption
23 of 34
Photos: Will and Kate's royal family
The newly married royal couple watches a rodeo demonstration at a government reception in Calgary, Alberta, in July 2011.
Hide Caption
Photos: Will and Kate's royal family
Catherine shovels soil during a tree-planting ceremony in Ottawa in July 2011.
Hide Caption
25 of 34
Photos: Will and Kate's royal family
You can feel the love as the happy couple attends a Snowbirds air show during Canada Day celebrations in July 2011.
Hide Caption
26 of 34
Photos: Will and Kate's royal family
U.S. President Barack Obama and first lady Michelle Obama meet with the royal couple at Buckingham Palace in May 2011.
Hide Caption
27 of 34
Photos: Will and Kate's royal family
The newlyweds walk hand in hand from Buckingham Palace the day after their wedding in April 2011.
Hide Caption
28 of 34
Photos: Will and Kate's royal family
After their wedding on April 29, 2011, the couple drove from Buckingham Palace to Clarence House in a vintage Aston Martin.
Hide Caption
29 of 34
Photos: Will and Kate's royal family
William and Catherine kiss on the balcony of Buckingham Palace after their wedding ceremony in London.
Hide Caption
30 of 34
Photos: Will and Kate's royal family
The pair returned to their alma mater in St. Andrews, Scotland, in February 2011. They launched a fundraising campaign for a new scholarship.
Hide Caption
31 of 34
Photos: Will and Kate's royal family
The couple poses for photographers to mark their engagement in November 2010. Catherine received the engagement ring that belonged to William's late mother, Diana.
Hide Caption
32 of 34
Photos: Will and Kate's royal family
The couple cheers on the English rugby team during the Six Nations Championship match in London in February 2007.
Hide Caption
| i don't know |
Which city, also the title of a Kipling poem, is the second largest in Myanmar (Burma)? | Mandalay
A Choice of Kipling�s Verse by T.S.Eliot (1941)
The Works of Rudyard Kipling, Wordsworth Poetry Library
The Theme
A British soldier, now discharged and back in London, looks back with nostalgia at his life in Burma with sunshine and a charming girl in terms which Le Gallienne, although an enthusastic patron of the music-halls, described in his review of Barrack-Room Ballads, as: 'perfect of their kind though made of the very refuse of language. later observing that the very best of them is �Mandalay�. [quoted by Charles Carrington p. 342.] >
This, like �The Grave of the Hundred Head� , was inspired by Kipling�s visit to Burma on his way home to England in 1889. He and his friends the Hills embarked at Calcutta, bound for London via America where the Hills would spend their leave. They made an unscheduled stop at Moulmein on the coast of Burma, where elephants, pagodas, tinkling bells, and a beautiful Burmese girl left a deep impression on Kipling. :
When I die I will be a Burman, with twenty yards of real King�s silk, that has been made in Mandalay, about my body, and a succession of cigarettes between my lips. I will wave the cigarette to emphasise my conversation, which shall be full of jest and repartee, and I will always walk about with a pretty almond-coloured girl who shall laugh and jest too, as a young maiden ought. She shall not pull a sari over her head when a man looks at her and glare suggestively from behind it, nor shall she tramp behind me when I walk: for these are the customs of India. [From Sea to Sea, p. 221 line 19]
Charles Carrington, in his edition of Barrack-Room Ballads (Methuen 1974, p. 162), describes the poem as: 'Perhaps the favourite among the 'Barrack-Room Ballads', written to a popular waltz tune, set to music as a tenor song, and long since passed into folklore ... Recently it has been copied by Bertolt Brecht.'
The haunting words of �Mandalay� would become as much-travelled as their author. And surely only the pedantic would quarrel with the improbable siting of the dawn as it �comes up like thunder outer China �crost the Bay�.
See Harry Ricketts (p. 121) for an excellent account of the visit to Burma. See also Meryl Macdonald (p. 49).
Historical background
For the historical background to the poem one cannot do better than read George Webb's address to the Royal Society for Asian Affairs on 16 June 1983, on "Kipling's Burma, A Literary and Historical Review" , which we have reproduced for this Guide. It was reprinted in the Kipling Journal in KJ 301/25 & KJ 302/10 .
As George Webb explains, after a dispute with the Burmese Goverment, heightened by its clandestine dealings with the French, Lotd Dufferin, the Viceroy of India, despatched an ultimatum:
Meanwhile he prepared an expeditionary force in Lower Burma: 9000 fighting men, 3000 followers, 67 guns, 24 machine-guns. The ultimatum was offensively rejected. War followed. In November 1885 the great paddle-steamers, crowded with troops, thrashed up-river. Before they could reach Mandalay it surrendered. Burmese resistance had crumbled.
British occupation and annexation followed.
287/55 Frank Sinatra�s recording- see Mattinson on our website and David Alan Richards p. 708.
Some other critical responses
Bonamy Dobr�e (p. 212.) discusses this and other pieces written shortly after Kipling�s return to London in 1889, in which he compares the weather unfavourably with the sunshine of India:
�.the popular �Mandalay� of June 1890, well-known, perhaps, as it is set to rousing, singable tunes�.. Probably his greatest successes in verse at this early period were the poems abut private soldiers, notably in Barrack-Room Ballads, where he used the Tommies� vernacular�
Charles Allen (p. 307), however, writing in 2007, is very conscious that tastes have changed in the hundred and twenty years since the Barrack-Room Ballads were written:
The shock-value of �Danny Deever�, �Tommy� and the best of the Barrack-Room Ballads has faded over the years - and the rest have not aged well. �Mandalay� now sounds almost maudlin. Kipling� cockneyfication seems contrived and the racial insensitivities containrd in such poems as �Gunga Din�, �Loot� and �Fuzzy Wuzzy are embarrassing, even when taken in context, which is Kipling giving voice to the Victorian working man.
For more on Kipling and Burma see:
the reports in From Sea to Sea Volume 1, letters II, III, and IV
Eight articles in the Kipling Journal : 070/13, 090/09,151/21, 219/12. 237/52, 242/10, 301/25, 302/10
Notes on the Text
[Title] Mandalay The main commercial centre of what was known as 'Upper Burma', the last royal capital, and the second largest city of present-day Myanmar. 445 miles (716 km) north of Rangoon (now Yangon) on the east bank of the Irrawaddy River. See From Sea to Sea Letter II (p.217, line 4.)
[Verse 1] Moulmein Also spelt 'Mawlamyine", a seaport of southern Myanmar.
Pagoda a Buddist temple of characteristic shape. See From Sea to Sea Letter II (p. 218, line 28.)
lookin� lazy at the sea 'lookin� eastward at the sea' in the original version but corrected by Kipling when it was pointed out to him that Moulmein had no view of the sun rising over the Bay of Bengal, still less over China. See the notes below on the Chorus.
palm-trees family Arecaceae, including the familiar cocoa-nut palm characteristic of hot climates.
[Chorus]
As Kipling later observed:
Had I opened the chorus of the song with `Oh' instead of 'On the road,' etc., it might have shown that the song was a sort of general mix-up of the singer's Far-Eastern memories against a background of the Bay of Bengal as seen at dawn from-a troop-ship taking him there. But ` On ' in this case was more singable than `Oh.' That simple explanation may stand as a warning. [Something of Myself, p. 222.)
That one should not take poetry too literally [Ed.]
the old flotilla The Irrawaddy Flotilla Company formed in 1865 to ferry troops up and down this great river. British-owned, the company operated until the 1940s. At its peak in the late 1920s, it was the largest fleet of river boats in the world. (A flotilla is 0a fleet of small vessels.)
In From Sea to Sea Letter II (p. 219, line 26.) Kipling writes: 'the steamers of the Irrawaddy Flotilla lay like black-backed gulls upon the water.'
The company later began carrying passengers, rice, government stores, and mail from Rangoon to Prome and, in 1868, to Bhamo.
Can�t you �ear their paddles chunkin� the paddle-wheels which propel the vessel (housed in the curved paddle-boxes on either side amidships) make a characteristic sound as they revolve.
flyin�-fishes Exocoetidae, a family of marine fish, with the ability to glide through the air for 50 metres or so to escape predators.
An' the dawn comes up like thunder outer China 'crost the Bay! As Sir George Engle (and many other readers) has pointed out in KJ 272 , the city of Mandalay is 400 miles north of Moulmein, and a good 200 miles inland from the coast up the Irrawaddy River. Moulmein (also spelt 'Mawlamyine') is on the west coast of Burma, but in neither place does the dawn come up out of China, since the Chinese border lies some 500 hundred miles - 800 km - away from Moulmein to the north-east across mountains and jungle.
[Verse 2]
yaller yellow
Supi-yaw-let or Supayalat (the spelling varies.) (1859-1925) the last queen of Burma, who reigned in Mandalay 1878�1885. See Kim p. 9 line 20, and Whitehead p. 140.
Theebaw Thibaw Min the last King of Burma, deposed by the British in November 1885.
Succeeding to the throne at the age of nineteen he massacred some eighty of his relations in order to secure his position on the throne. See George Webb.
whackin� a Londoner's rendering of 'whacking' which here means large � usually expressed as 'whackin� great'.
white cheroot an open-ended cigar, probably with a wrapper made from the leaf of a betel nut palm.
Gawd Budd 'God Buddha', the British soldier's idea of Buddhism, which is based on the teachings of Siddhartha Gautama, commonly known as the Buddha, in the 5th Century BC. See Kim p. 9 line 20, and Whitehead , p.140.
[Verse 3]
rice-fields rice is grown in flooded 'paddy-fields' which have mist over them at times.
banjo probably a Burmese stringed instrument, played with the hand, similar to the guitar. See KJ 253/49.
�Kulla-lo-lo� kal� is Burmese for foreigner or stranger; thus the expression means 'hullo stranger'.
steamers Steamships.
hathis pilin� teak Hathi is the Hindi for elephant, and is used as the name of the chief of the elephants in The Jungle Books.
Here they are employed stacking timber on the dock-side, ready for export.
For more on elephants, see �Toomai of the Elephants� and others in The Jungle Book, and �My Lord the Elephant� in Many Inventions; also the verse �Muncipal�.
Teak (Tetona grandis) is a tropical hardwood used in shipbuilding and furniture.
[Verse 4]
the Bank The Bank of England, an important landmark where six roads meet in the City of London.
the ten-year soldier an experienced man of long service.
spicy garlic smells the typical aroma of spices, vegetation (and perhaps a whiff of sewage) that reminded Kipling of his childhood when he returned to India as a young man. See Something of Myself, p. 39, and �The Edge of the East� in Letters of Travel (1892-1913) . p. 34.
[Verse 5]
outer out of.
Chelsea a pleasant mainly residential area of south-west London
Strand at that time the centre of the night-life of London. Kipling lived nearby in Villiers Street off the Strand by Charing Cross Station, in rooms which are the scene of several stories.
Law ! A Londoner's rendering of 'Oh Lord !'
[Verse 6]
East of Suez a phrase coined by Kipling to describe the countries of Asia. Philip Mallett (p. 63) observes: To be ... east of Suez is to find relief from English weather and English morality.
Ten Commandments In Christian tradition the rules for conduct in life handed down by God to Moses and the Israelites. (Exodus,20)
awnings canvas canopies spread above the deck to provide shade from the sun.
[J McG./J.R.]
| Mandalay |
MGY is the Chapman Code for which historic Welsh county? | Mawlamyine, Southern Burma | Inside Burma Tours
Inside Burma Tours
Order or download our brochure
Explore our brochure for amazing Burma holiday inspiration.
Order a printed version
Mawlamyine
Erstwhile colonial capital and home of Kipling's fabled �Old Moulmein Pagoda�, Mawlamyine is now the fourth-largest city in Burma and capital of Mon State � yet still manages to look and feel like little more than a sleepy port town.
“Looking out over the town to the river beyond from the Kyaikthanlan Pagoda, it's easy to imagine "Old Moulmein" in the days of empire”
Tom Weston, Sales Director
Despite his celebrated connection with Burma, Kipling only spent a few brief days in the country on his way home from a posting in India. One of his two stops in 1889 was at the former British colonial capital of Moulmein, a strategic port town in southeastern Burma now known as Mawlamyine.
This visit, though fleeting, was to give inspiration to Kipling's most popular and recognised writing on Burma: the poem Mandalay. The poem opens at "Old Moulmein Pagoda", and describes a British ex-soldier's nostalgia for the exoticism of Burma - in particular a Burmese girl he remembers fondly.
Modern Mawlamyine is perhaps more of a backwater than in Kipling's day, but the city still holds a faded colonial charm, enhanced by its picturesque riverside setting and the lush, wooded hills topped with golden stupas that surround the town. Few visitors make it this far south, so as you climb the steps to the great Kyaikthanlan Pagoda overlooking the town, it is easy to imagine yourself an explorer in an earlier era.
| i don't know |
At which course is the 'Prix de Diane', the French 'Oaks' run? | Prix de Diane (French Oaks) Preview – UK Horse Racing: Race Cards, Form Tools and Tips
/in Big Race Previews - Longchamp Arc Weekend | geegeez.co.uk , Horse Racing Blog - News & Info | geegeez.co.uk /by Matt Bisogno
Prix de Diane (French Oaks) Preview
Whilst Royal Ascot claims the international racing headlines this week, France prepares for its own version of the Royal Meeting when it stages the 167th running of the Prix de Diane on Sunday at Chantilly, writes Nigel Howard.
This spectacular meeting is the one time in the racing calendar when the French manage to embrace everything the sport has to offer. With the weather set to be fine, the place will be awash with picnickers in their fancy hats and summer finery, watching the female classic generation strutting their stuff on the track.
La Cressonniere bids for a second French Classic
Run over 2100 meters (1m2½f), this year’s renewal will see sixteen runners go to post from four different nations. The Directeur du l’Hippodrome, Mathieu Vincent, predicts some rain over the next couple of days but is hoping for good or good-to-soft ground come race day.
With Jean-Claude Rouget carrying all before him in this year’s Classics, it will come as no surprise to find that he once again holds the strongest hand for the home team. He fields three, including LA CRESSONNIERE, already a Classic winner thanks to her pillar-to-post victory in the Prix d’Essai des Pouliches at Deauville in May. That was a brave performance and she remains unbeaten.
By La Havre, who has already sired a winner of this race in the form of Avenir Certain in 2014, out of a Galileo mare, it is possible that she will improve again for this step up in trip. Add to this her indifference to underfoot conditions and it becomes perfectly clear why she is one of the market leaders. Her part-owner Gérard Augustin-Normand remains supremely confident after he saw his Almanzor stride to victory in the French Derby two weeks ago. She has obvious claims.
The Pau-based handler also fields the very likable JEMAYEL who bounced right back to her best in the Normandy sunshine when she landed the Group 1 Prix Saint-Alary at Deauville earlier in the month. That 1m2f contest saw her defeat CAMPROCK, who re-opposes and who was favourite on the day.
The daughter of Myboycharlie, trained by Mme Pia Brandt, was previously unbeaten, yet all her victories were achieved on a softer surface. It is likely that she did not appreciate hearing her hooves rattle at Deauville and indeed the trainer confirmed, stating that any juice in the turf would be to her advantage. She stays and is a lively contender, especially if the heavens open before Sunday.
JEMAYEL meanwhile, a daughter of Lope de Vega, must also enter calculations. She too has proven her stamina but would seem to prefer good ground to show her best.
Rouget’s third candidate, ZGHORTA DANCE, is another daughter of Le Havre and she won the Group 3 Prix Vanteaux at this track at the end of May. Although she is obviously improving, on her previous start she was beaten by Magnanimem, a horse that could manage only fifth in the Prix Saint-Alary behind both JEMAYEL and CAMPROCK. On paper, therefore, she doesn’t look good enough.
Of twenty supplementary entries made over the last twenty-three years only two have converted, namely Valyra for the Aga Khan in 2012 and West Wind in the famous claret colours of Sheikh Mohammed in 2007. This year, two fillies have been supplemented - VOLTA for François-Henri Graffard and HIGHLANDS QUEEN for Yohann Gourraud.
The former was last seen bolting up over a mile in the Group 2 Prix de Sandringham here on Derby day. She took that event by four lengths and is clearly smart. Having stumped up the supplementary entry fee of €60,000, connections will be hoping that she can see out the extra two-and-a-half furlongs of this classic contest, although, being a daughter of speedy Siyouni, there must be some doubts.
Stamina issues are of little concern for HIGHLANDS QUEEN, who, on only her third career start, ran out a comfortable winner of the Group 3 Prix Cléopatre at Saint Cloud at the end of May. For her young trainer, ex-jockey Yohann Gourraud, this will be a first runner at Group 1 level and he has reported the daughter of Mount Nelson to be at the top of her game after she worked on the gallops at Chantilly on Tuesday. She remains relatively unexposed and the booking of William Buick catches the eye. She could go close.
Nicolas Clement, perhaps best known for training Saumarez to win the Arc in 1990, presents THE JULIET ROSE. This daughter of Monsun showed off her staying qualities with a pillar-to-post victory in the Group 3 PRIX DE ROYAUMONT over 1m4f at this track on Jockey Club day. She is therefore being asked to drop back in distance and her preference for being up with the pace suggests she will attempt to make this a true test of stamina. She is not without a chance and may make the frame.
ARMANDE finished third in that race and although the daughter of Sea The Stars didn’t get the clearest of runs, the feeling is that Andre Fabre will have to wait at least another year before lifting his fifth Prix de Diane trophy.
As talented a bunch of fillies as the home team might represent, this year’s race risks being dominated by a formidable challenge from across La Manche.
John Gosden, winner of the race last year with Star of Seville, must have enjoyed watching Even Song romp home in the Group 2 Ribblesdale Stakes at Royal Ascot on Thursday as his representative, SWISS RANGE, had that filly five lengths back in third when she easily landed the Listed Pretty Polly Stakes at Newmarket in May. After that victory, Gosden immediately named the Diane as her primary target and with Frankie Dettori in the irons the daughter of Zamindar has an outstanding chance.
Aiden O’Brian has yet to lift this French classic but he must be more than hopeful as he fields both BALLYDOYLE and COOLMORE, two daughters of the remarkable stallion, Galileo. BALLYDOYLE comes into the race on the back of a fine run in the English 1000 Guineas, beaten only three and a half lengths by the mighty Minding. She is already a Group 1 winner here in France having triumphed as a juvenile in the Prix Marcel Boussac over a mile at Longchamp on Arc day. She tackles this trip for the first time but her breeding suggests that she will have little trouble staying the extra two-and-half furlongs required here. COOLMORE would seem to be well held on current form and has no doubt been declared to ensure a truly run race for her more fancied stable companion.
With a large field of unexposed fillies lining up for this Classic contest, there is every hope that a new equine star will be unveiled on Sunday. The feeling is that BALLYDOYLE is the horse to beat having already shown her wellbeing this year in the English Guineas and that this step up in trip will be very much up her street.
It is equally hard not be impressed by the way SWISS RANGE won at Newmarket and the form of that race was clearly franked by the performance of Even Song at Royal Ascot on Thursday.
LA CRESSONNIERE is the obvious choice from the home team and as she carries an unbeaten record into the race her limits are still unknown. She too must have a fine chance.
Sadly, none of the above represent great value and perhaps a more sporting alternative would be the unexposed HIGHLANDS QUEEN who has won her last two starts with ease.
Best bet: HIGHLANDS QUEEN E.W. (generally available at 12-1)
Nigel Howard
| Chantilly |
In which part of the body is bile produced? | French Classic Double for La Cressonniere | BloodHorse.com
French Classic Double for La Cressonniere
Comment
Unbeaten La Cressonniere sealed a classic double June 19 when she captured the Prix de Diane Longines (Fr-I, French Oaks) at Chantilly.
The victress in the Poule d'Essai des Pouliches (Fr-I, French One Thousand Guineas) in May at Deauville, the daughter of Le Havre was brought from near the back of the field with a strong run. She took command nearing the furlong marker and went on to win by a half-length from Left Hand .
Ridden by Cristian Demuro for trainer Jean-Claude Rouget, La Cressonniere covered 2,100 meters (about 1 5/16 miles) in 2:09.45 on soft turf.
Prix de Sandringham (Fr-II) winner Volta finished third in the drama-filled race, but La Cressonniere avoided trouble with a wide outside run, winning for the seventh time from as many starts.
"She is incredible," Demuro told Racing Post. "I said to myself at one stage we were too far back, but I know her by heart and I knew she could do it."
Trouble began inside the final quarter-mile, when Armande clipped heels with Highlands Queen and fell in midpack, and Tierra Del Fuego was pulled up entering the home straight, Racing Post reported.
After a stewards' inquiry, sixth-place finisher Highlands Queen, ridden by William Buick, was deemed to have cause interference and was disqualified and placed last.
La Cressonniere provided Rouget his fourth French Oaks triumph. Earlier this month he captured the Prix du Jockey Club (Fr-I, French Derby) with Almanzor , and previously scored a French Derby/Oaks double in 2009 with Le Havre and Stacelita.
La Cressonniere is the second French Oaks/French Guineas winner for Le Havre following Avenir Certain in 2009.
Saturday's classic win marked the second top-level victory in three days for the trainer, who took the Coronation Stakes (Eng-I) with Qemah June 17 at Royal Ascot.
La Cressonniere is owned by Ecurie Antonio Caro and Gerard Augustin-Normand, also the owners of Almanzor. Bred in France by Franklin Finance, she is out of the Galileo mare Absolute Lady, a full sister to Monmouth Park stakes winner Paris Winds, who was group-placed in Ireland.
Tags
| i don't know |
In which Australian state is the city of Mount Isa, famous for its mineral deposits? | Copper - Mineral Fact Sheets - Australian Mines Atlas
Suggestions for Further Reading
Introduction
Copper (Cu) has a cultural significance as it was the first metal used by man (probably as early as 7000 BC). Neolithic man mined native copper and used it as a substitute for stone; its malleability enabled easy shaping of tools by beating it. Copper was smelted as early as 3500 BC at Timna in Israel. Its property of alloying with other metals (particularly tin) was discovered about 500 years later and heralded the Bronze Age, which started in southern Europe between 3000 and 2500 BC.
Although the manufacture of bronze tools largely fell into disuse with the onset of the Iron Age about 1000 BC, copper continued to be used for its other properties.
As one of only two coloured metals, its beauty makes it highly desirable for making ornaments and its resistance to corrosion makes it suitable for use in, or near the sea.
The growth of the copper industry has been intimately linked with the increasing use of electricity with electrical applications continuing to be the metal's principal use which can be attributed to two physical properties. It is an excellent electrical (and heat) conductor and is ductile enough to be drawn into wire and beaten into sheets without fracturing. Copper is used widely in plumbing components and is a major component of alloys, many of which are harder, stronger and tougher than their individual constituent elements.
Occurrence
The main ore mineral of copper in Australia (and worldwide) is chalcopyrite (CuFeS2). Bornite (Cu5FeS4), covellite (CuS) and chalcocite (Cu2S) are important sources in the world, and many ore bodies also contain some malachite (CuCO3.Cu(OH)2), azurite (Cu3(CO3)2.Cu(OH)2), cuprite (Cu2O), tenorite (CuO) and native copper. The sulphides, which yield most of the copper produced throughout the world, generally occupy the deeper parts of lodes which have not been exposed to weathering. Near the surface they are altered by oxidation and other chemical actions to the native metal, oxides and carbonates. These secondary copper minerals may form rich ore in the upper parts of many deposits, and, owing to their characteristic green or blue colour, even small amounts are easily seen in the rocks in which they occur.
Australian Resources and Deposits
Copper is widely distributed in Australia in rocks of Precambrian and Palaeozoic age (more than 250 million years old).
Australia's resources of copper are largely at the Olympic Dam copper-uranium-gold deposit in South Australia and the Mount Isa copper-lead-zinc deposit in Queensland. Other important copper resources are at the Northparkes copper-gold, CSA copper-lead-zinc and Girilambone copper deposits in New South Wales, the Ernest Henry, Osborne and Mammoth copper deposits and copper-gold deposits at Selwyn in Queensland and copper-zinc deposits at Golden Grove and the Nifty copper deposit in Western Australia.
Australia's main copper mining centres are in the Mount Isa/Cloncurry region of Queensland and at Olympic Dam in South Australia. The Mount Isa mine, which also produces large tonnages of lead, zinc and silver, currently is the largest copper producer in Australia and is one of the world's biggest underground mines. At Mount Isa, the copper ore bodies are separate from the lead-zinc-silver ore bodies, thus enabling independent production of the two ore types. Across Australia, relatively small amounts of copper are recovered as a by-product of silver-lead-zinc, nickel and gold mining.
Several important copper deposits have been discovered in the past 30 years. By far the largest of these is the copper-uranium-gold deposit discovered in 1975 at Olympic Dam where expanded annual production will soon surpass that at Mt Isa. Other important discoveries include the Northparkes copper-gold deposit (NSW) in 1977, Cadia copper-gold deposit (NSW) in 1993, Benambra copper-zinc deposit (Vic) in 1978, Scuddles (Golden Grove) copper-lead-zinc deposit (WA) in 1979, Selwyn gold-copper deposit (Qld) in 1980, Nifty copper deposit (WA) in 1983, Eloise copper-gold deposit (Qld) in 1988, Osborne copper-gold deposit (Qld) in 1990, Ernest Henry copper-gold deposit (Qld) in 1991, Tritton copper deposit (NSW) in 1995, and Ridgeway copper-gold deposit (NSW) in 1996.
Australia in the World
Australia has about 6% of the world's economic copper resources and is ranked third after Chile (25%) and the USA (16%). In production Australia is ranked fifth after Chile, USA, Indonesia and Canada.
Mining and Processing
Although large copper deposits are mined by open-cut methods in many of the major producing countries, most of the copper ore produced in Australia comes from underground mines.
At some Australian mines, the copper is leached from the ore to produce a copper-rich solution which is later treated to recover the copper metal. At the Mount Gordon mine (formerly Mammoth) at Gunpowder in Queensland the ore is first broken and set out on leach pads where it is dissolved by a sulphuric acid solution to leach out the copper. The copper-rich solution is then pumped to the solvent extraction plant to separate the copper as a copper complex. This is concentrated and the solution is passed to the electrowinning plant to recover the copper. The copper cathodes produced by electrowinning contain 99.99% copper which is suitable for electrical uses. This entire process, known as solvent extraction electrowinning (SX-EW), is used at other mines treating copper oxide ores, most notably at Girilambone and at Nifty.
The traditional method used at most mines involves the ore being broken and brought to the surface for crushing. The ore is then ground finely before the copper-bearing sulphide minerals are concentrated by a flotation process which separates the grains of ore mineral from the waste material, or gangue. Depending on the type of copper bearing minerals in the ore and the treatment processes used, the concentrate can contain between 25 and 57% copper. The concentrate is then processed in a smelter.
Smelters are operated at Mount Isa and Olympic Dam. Copper refineries are operated at Townsville, Olympic Dam and Port Pirie (a small refinery subsidiary to the large lead-zinc refinery). Various methods of smelting are used to convert the concentrates to copper metal. One method is to melt them with fluxes in a smelter furnace to produce copper matte, which is a mixture mainly of iron and copper sulphides usually containing 50 to 70% copper. The molten matte is poured into a converter, which contains more fluxes, and converted into blister copper, which is about 98 to 99% pure. The blister copper is tapped, further refined in an anode furnace and finally electrolytically refined to pure cathode copper.
At Olympic Dam the concentrate is flash-smelted directly to blister copper. In this process copper concentrate is fed into the smelter with oxygen-enriched air. The fine concentrate reacts or 'flashes' instantaneously as the sulphur fraction of the copper sulphides is burnt and becomes sulphur dioxide gas. Molten copper and slag fall to the hearth of the smelter. The slag forms a layer on the surface of the molten blister copper. The blister copper is removed periodically for further purifying in an anode furnace and electrolytically refined.
Copper is alloyed with other metals to give it special properties. Bronze is an alloy of tin and copper. The earliest bronzes were natural alloys derived from mineral deposits which also contained tin. Brass is an alloy of zinc and copper and is used extensively in marine applications because of its resistance to corrosion.
Uses
Copper is an excellent conductor of electricity. More than half of the copper consumed is used in electrical generators and motors, electrical power and lighting fixtures, electrical wiring, radio and television sets, computers and almost everything electrical. Copper also conducts heat well and is used for thin-walled copper tubing in air conditioning and refrigeration units, motor vehicle radiators, home heating systems, steam condensers etc. Copper's corrosion resistance and ease with which it can be joined make it suitable for plumbing fittings and water reticulation systems, automotive fuel lines, sea water desalination plants and hydraulic systems. The blue-green colour of treated timber is the result of copper naphthanate and copper-chrome-arsenate which have been introduced under pressure to help protect the wood from borers. Copper sulphate is used as a fungicide and as a trace element in fertilisers. Copper is used also for making coins and scientific instruments as well as in decorative applications.
Suggestions for Further Reading
Bester, G. (Ed) 1999 Register Of Australian Mining 1999/00, Resource Information Unit Ltd, Perth.
Blainey, G. 1960 Mines In The Spinifex - The Story Of Mount Isa Mines, Angus & Robertson, Sydney.
Blainey, G. 1978 The Rush That Never Ended: A History Of Australian Mining, 3rd edition, Melbourne University Press, Melbourne.
| Queensland |
Alexander Hamilton the first United States Secretary of the Treasury died on July 21st. 1804 after a duel with the Vice President the previous day. Who was the Vice President? | Cities in Australia, Australia Cities Map
Hobart Map
Australia is divided into six states and two mainland territories. The states in Australia are New South Wales, Queensland, South Australia, Tasmania, Victoria, and Western Australia.
Australia's mainland territories are the Australian Capital Territory and the Northern Territory. Each of the states and territories is headquartered at its own capital city.
The capital of Australia is Canberra, which is located in the Australian Capital Territory in southeastern Australia. Canberra has a population of about 367,000, making it the largest inland city in the country, but the eight largest city in all. Canberra covers an area of 814 square kilometers (314 square miles).
The most populous city in Australia is Sydney, which is the capital of New South Wales. Sydney is home to about 4.6 million people, in an area of about 12,144 square kilometers (4,689 square miles). Sydney is a major cultural center of Australia, as the location of the Sydney Opera House, a thriving art scene, and cultural events and festivals.
Melbourne, the capital of Victoria, is the second largest city in Australia with a population of about 4.1 million. The area of Melbourne is about 8,806 square kilometers (3,400 square miles), and it is called Garden City. Melbourne is often considered the cultural capital of Australia, with the headquarters of the country's film and television industry, and major sports and arts center.
Brisbane is Queensland's capital, and the third largest city in Australia with a population of 2.1 million. Brisbane covers an area of 5,949 square kilometers (2,297 square miles) along the east coast of the continent.
Perth is situated in Western Australia and is the largest city and capital of the state. Perth has a population of 1.8 million people living in its metropolitan area, which covers 5,386 square kilometers (2,079 square miles).
The fifth largest city in Australia is Adelaide, the South Australian capital. Adelaide's population numbers about 1.2 million and an area of 1,827 square kilometers (705 square miles).
Cairns in Queensland and Darwin, the capital of the Northern Territory are other important cities in Australia.
Some of the important Australian cities include:-
ACOD~20130205
| i don't know |
Which former Basketball star was known as 'Wilt the Stilt'? | Black History Month Fast Facts: Wilt Chamberlain « 101.9 AMP Radio
7 Feb 1997: Former Los Angeles Laker Wilt Chamberlain addresses the media at a press conference before the NBA All-Star Game at the Renaissance Hotel in Cleveland, Ohio. Mandatory Credit: Brian Bahr /Allsport
(Photo Credit: Brian Bahr /Allsport)
All month long in February, 102 JAMZ is celebrating Black History Month! There have been many legendary basketball players in our history but do you know who Wilt Chamberlain is?
Wilt Chamberlain (also known as Wilt the Stilt) was a professional NBA basketball player from 1959-1973. Chamberlain played for teams such as The Philadelphia 76ers, Philadelphia Warriors, Los Angeles Lakers, and the Harlem Globetrotters.
In his early years, Wilt Chamberlain did not take a interest in basketball. His preference was originally track and field. By age 10, Wilt grew to a height of 6 feet, 10 inches and eventually turned to basketball. In his high school years he averaged 31 points per game and led his team to a championship against his rivalry high school.
Wilt later went on to play college basketball at Kansas University where he would play on the freshman and varsity teams averaging between 40-52 points and 20-30 rebounds per game.
Chamberlain wanted to play professional basketball before graduating college but the league would not permit players to enter the NBA without finishing their studies, so Chamberlain joined the Harlem Globetrotters in 1958.
Wilt went on to play for the the Philadelphia Warriors, Philadelphia 76ers, and Los Angeles Lakers earning him several NBA all-time records and an MVP title.
Wilt Chamberlain passed away in 1999 however his legacy left him being the first professional basketball player to earn 100 points in a single game during 1961 and the first player to score 30,000 points in the NBA making him one of the greatest basketball players of all time!
| Wilt Chamberlain |
Of which magazine is Rachel Johnson the editor? | Washingtonpost.com: Basketball Legend Chamberlain Dies at 63
Washington Post Staff Writer
Wednesday, October 13, 1999; Page A1
Wilt Chamberlain, 63, a Herculean figure on the basketball court whose massive dimensions, intimidating personality and unprecedented point production helped him become a sports icon and cultural legend, died yesterday at his home in the Los Angeles area.
He was found by rescuers sent to his home in Bel-Air shortly after noon, and a fire department spokesman reported signs of a possible heart attack.
Standing 7-feet-1, strong, dexterous and determined, Chamberlain scored points and hauled in rebounds by the tens of thousands.
For a good dozen years starting in the late 1950s, he was one of the dominant figures of the National Basketball Association, helping the game grow in publicity and attention. A native of Philadelphia, he entered the league with the old Philadelphia Warriors, stayed with the team after it moved to San Francisco and was traded to the Philadelphia 76ers before ending his 14-year career with the Los Angeles Lakers in the early 1970s.
For years after he hung up his size-16 sneakers, he was known as an opinionated, quotable and sometimes controversial figure in the world beyond. He operated a restaurant, took part in civic and charitable activities and wrote at least three books. One of them created a stir when he boasted in it of having slept with 20,000 women.
Although he played in a sport that produced superstars on the order of Bill Russell (who was his contemporary and nemesis), Kareem Abdul-Jabbar (who later broke his career scoring record) and the almost mythical Michael Jordan, Chamberlain did not lack for supporters who believed that he was the NBA's all-time greatest star.
Ex-NBA great Elgin Baylor bows his head for a moment of silence for former teammate Wilt Chamberlain at Tuesday night's L.A. Clippers-Golden State Warriors preseason game. (Paul Sakuma - Associated Press)
Indeed, it was he who scored 100 points for the Philadelphia Warriors in a game against the New York Knicks on March 2, 1962, setting an NBA record that still stands. He led the league in scoring for seven seasons, retiring with 31,419 points. In his first year in the league, which was then still a stepchild of professional sports, he was credited with helping raise attendance by 23 percent.
He set a league record of 55 rebounds in a single game. In his career, on his way to becoming the league's most valuable player four times, he hauled in a total of 23,924 rebounds.
Strong and durable, he played 47 consecutive complete games in the 1961-62 season. Such was his control over his towering physique that he never fouled out of any of the 1,045 games in which he took the hardwood. In all, he held more than 50 league records.
"We've lost a giant of a man in every sense of the word," NBA commissioner David Stern said in a statement released last night. "The shadow of accomplishment he cast over our game is unlikely ever to be matched," Stern said.
"Wilt was so dominant that it was almost a joke to watch other players play against him," said Jerry West, an NBA great who played with the towering center late in Chamberlain's career. They were together on the 1971-72 Los Angeles Lakers squad that won the NBA championship.
"Wilt was unstoppable, no matter how many players you put on him," West was quoted as saying two years ago in a newspaper story. Despite his height, which some claimed might have actually been 7 feet 4 or even 7 feet 6, "he didn't just dunk the ball," West said.
A man described as capable of holding a bowling ball in his hand, palm down, Chamberlain probably could have dunked a basketball every time, West added. But, West said, "Wilt had a great fadeaway shot, and he could shoot it over anybody."
In college at the University of Kansas, while serving as the mainstay of the basketball team, he was also an outstanding track athlete. He reeled off head-turning times in the half mile and quarter mile, while almost reaching his own height in the high jump and doing well over 24 feet in the broad jump.
West said he didn't know if Chamberlain was indeed the NBA's greatest ever. "But you could certainly make a strong case in his favor," he told a Texas newspaper reporter. No less a figure than Larry Bird, the former Celtics star, has said he believed Chamberlain was the greatest.
Well-read and an avid debater, Chamberlain believed that the disparity in height between him and other players placed limits on his popularity. In what was said to be one of his favorite phrases, voiced with the acerbity that sometimes characterized his utterances, he remarked that "nobody roots for Goliath."
"I was a brash young man of color coming into a white societal sport and taking over � commanding and demanding," he told a newspaper interviewer. "Do you think I was liked for that? I don't think so."
Wilton Norman Chamberlain, who was also known as "Wilt the Stilt" and "The Big Dipper," went to high school in Philadelphia, where his astonishing feats prompted the Warriors owner to alter league rules so that he could get rights to Chamberlain years in advance.
He spent three years at Kansas, participating in a famous NCAA championship game in which his team fell by one point to North Carolina after three overtimes. Leaving school after three years, he spent a season with the Harlem Globetrotters before joining the Warriors, where he more than rewarded the team owner's patience.
During much of Chamberlain's playing career, Bill Russell and the Boston Celtics teams for which Russell starred were the league's champions. Critics of Chamberlain's accomplishments faulted him for not leading his team to more league titles. Russell won 11 championships in 13 years; Chamberlain won two.
Although Chamberlain's physical presence alone was formidable and his personality was intimidating to many, Russell was his friend, and knew his secret.
"He only had one flaw," Russell once told a Boston-area reporter. "He was a nice man. We'd beat up on him. He would never hurt anybody."
Speaking of that side of his character, Chamberlain once had this to say: "If that's considered a weakness, then I'm guilty."
Chamberlain was a lifelong bachelor who told the Associated Press in 1991 that "the women who I have been the most attracted to, the most in love with, I've pushed away the strongest.
"There are about five women I can think of I could have married. I cared for them a lot, but not enough to make a commitment."
© 1999 The Washington Post Company
| i don't know |
What nationality is the Manchester United footballer who wears the name 'Chicharito' on his shirt? | Javier Hernandez will have 'Chicharito' on back of No 14 shirt | Daily Mail Online
comments
Manchester United new boy Javier Hernandez will have 'Chicharito' on his shirt for the new season.
The Mexican striker enjoyed an impressive World Cup, with goals against France and Argentina, and he was also clocked as the fastest player of the tournament.
Quick to impress: Javier Hernandez
Hernandez, 22, was timed at running a top speed of 19.97 mph, which compares with Usain Bolt's average of 23 mph when he won Gold at the 2008 Olympics.
And United fans will see the speedy striker wearing the number 14 shirt next season, complete with his nickname - translated as 'Little Pea' next season.
The nickname stems from 'Big Pea' the name given to Hernandez's father, Hernandez Snr, because of his green eyes.
Unlucky 14: Alan Smith saw his United career hampered by injury
The shirt name is similar to the one last season at Birmingham City, where Christian Benitez had 'Chucho' on his shirt.
Hernandez will hope to enjoy more success than three previous holders of the No 14 shirt. Winger Zoran Tosic and midfielder Alan Smith were frozen out and then sold by boss Sir Alex Ferguson.
| Mexico |
In RNA the base Uracil replaces which of the four bases in DNA? | El Chicharito Hernández llega a alemania con el Bayer Leverkusen - YouRepeat
Add our chrome extension to repeat YouTube videos at the click of a button
El Chicharito Hernández llega a alemania con el Bayer Leverkusen
Choose your time range using the slider.
Start:
Use this link to share your repeat
GIF Creation Settings
Separate tags with commas or press enter (max 5 tags)
Quick GIF Create
Chicharito Hernández Pasa Reconocimiento Médico con Bayer Leverkusen
Javier Hernández Balcázar
Javier Hernández Balcázar is a Mexican footballer who plays as a forward for Premier League club Manchester United and the Mexican national team. Hernández plays with his nickname, Chicharito, on his shirt. He previously played for the Mexican club Guadalajara, before becoming the first Mexican player to join Manchester United. Hernández made his debut for Mexico in September 2009 in a match against Colombia. He has also represented them at the 2010 FIFA World Cup and the 2011 CONCACAF Gold Cup. He was the Gold Cup's top scorer with 7 goals and was named the most valuable player of the tournament. Hernandez is the joint third highest goalscorer of all-time for the Mexican national team.
Date of birth: June 1, 1988
Place of birth: Guadalajara
| i don't know |
Which of the wives of Henry VIII died last, in 1557? | Learn All About The Six Wives Of Henry VIII, Their Lives & Deaths | Historic Royal Palaces
Find out more about the lives (and deaths) of Henry VIII's six wives
Katherine of Aragon
Divorced
The first of Henry VIII's six wives, Katherine of Aragon (1485-1536) was a Spanish princess who was married to Henry for 18 years before he began divorce proceedings in his desperation to re-marry and produce a male heir.
Katherine had been pregnant six times but only one daughter, Princess Mary, later Mary I , had survived. Dying in 1536, Katherine wrote to Henry: 'Lastly, I make this vow, that mine eyes desire you above all things. Farewell.'
Anne Boleyn
Beheaded
The second of Henry VIII's six wives, Anne Boleyn (c1501-1536) was married to the King for only three years from 1533-1536.
Instead of the sought after male heir, Anne was pregnant with another princess, Elizabeth (later Elizabeth I ).
Anne was supported by religious reformers but was also hated by many at court. After a miscarriage, her fate was sealed and she was arrested (and later executed at the Tower of London) for adultery and incest.
Jane Seymour
Died
Jane Seymour (c1509-1537) was the third of Henry VIII's six wives and the only wife to provide the King with the much longed for son and male heir.
Having married Henry in May 1536, she gave birth to Prince Edward (later Edward VI) at Hampton Court Palace in 1537 but died soon afterwards.
Henry had his son but grieved: 'Providence has mingled my joy with the bitterness of the death of her who brought me this happiness.'
Anne of Cleves
Divorced
Anne of Cleves (1515-1557) was the fourth of Henry VIII's six wives and at 24 was half Henry's age when they married in January 1540.
Henry first saw Anne of Cleves in a painting by Hans Holbein but in the flesh, Henry found Anne unattractive and began pursuing one of her maids of honour, Catherine Howard.
After six months the marriage was annulled yet Anne remained in England and on good terms with Henry VIII. He commanded that she be treated as 'the king's sister'
Catherine Howard
Beheaded
Henry VIII's fifth wife was an alluring teenager named Catherine Howard (c1522-1542).
Married three weeks after his second divorce, rumours of Catherine's past and present love affairs reached a furious Henry. She was arrested at Hampton Court Palace and later taken to the Tower of London where she was beheaded in February 1542, aged about 21.
Kateryn Parr
| Anne of Cleves |
The epicentre of an earthquake in September last year (2010) was at Darfield, 25 miles west of which city in New Zealand? | Discover The Lives & Gruesome Deaths Of Henry VIII's Six Wives | Historic Royal Palaces
Find out more about the lives (and deaths) of Henry VIII’s six wives
Katherine of Aragon (1485-1536)
Divorced
- Katherine was a Spanish princess and the youngest daughter of King Ferdinand of Aragon and Queen Isabella of Castille.
- Katherine was married to Henry’s brother, Arthur, before she married Henry. However, Arthur caught a nasty disease and died soon after they were married.
- She was the first of Henry’s six wives and they were married for 24 years.
- Katherine had been pregnant six times but only one child survived. That child would grow up to be Queen Mary I.
- Henry wanted to divorce Katherine because he was desperate for a male heir to inherit the throne and he thought Anne Boleyn could provide him with one.
Anne Boleyn (1501-1536)
Beheaded
- Anne was Henry’s second wife and she was married to the King for only three years from 1533 -1536.
- Henry had married Anne in the belief that she would give birth to a son but she fell pregnant with another princess, Elizabeth I.
- Anne was liked by some people in the King’s court but hated by many others. After it was clear that she wasn’t going to produce a male heir, her fate was sealed and she was arrested.
- She was executed in 1536 for adultery and incest
Jane Seymour (1509 – 1537)
Died
- Jane was Henry’s third wife
- She was the only one of his six wives to have a son who would later become King Edward VI
- She died very soon after giving birth to Prince Edward
- She is the only one of Henry VIII’s queens to be buried with him at St George’s Chapel in Windsor
Anne of Cleves (1515-1557)
Divorced
- Anne was Henry’s fourth wife and she was only queen for a few months during the year of 1540.
- At 24, she was half Henry’s age when they got married.
- Henry first saw Anne in a painting by Hans Holbein but in the flesh he found her unattractive and began pursuing one of her maids of honour, Catherine Howard.
- Although the marriage only lasted for 6 months, Henry and Anne remained friends and he commanded that she be treated like ‘the king’s sister’
Catherine Howard (1522-1542)
Beheaded
- Catherine was Henry’s fifth wife and she was in her teens when she married him.
- Henry and Catherine were married three weeks after his second divorce but rumours of her past and present love affairs soon reached the furious king.
- She was arrested at Hampton Court Palace and later taken to the Tower of London where she was beheaded, aged about 21.
Kateryn Parr (1512-1548)
Survived
- Kateryn was the last of Henry’s six wives.
- Kateryn loved another man, Thomas Seymour, but knew that a proposal from the king could not be refused.
- She and Henry married at Hampton Court Palace in in 1543. She was 31 and he was 52.
- After Henry died in 1547 she was free to marry Thomas Seymour but she died 15 months later, aged 36, having given birth to their daughter.
Highlights
Fight Henry VIII
Have you got what it takes to wear armour and handle a weapon like a Tudor master?
| i don't know |
Which girl's name completes the title of the 1976 top ten hit by 'Sutherland Brothers & Quiver'; 'Arms Of ....'? | Sutherland Brothers & Quiver 1975 and 1976 | Vintagerock's Weblog
19 Sep
Sutherland Brothers & Quiver 1975 and 1976
Posted September 19, 2014 by vintagerock in Quiver , Sutherland Brothers , Sutherland Brothers and Quiver . Tagged: classic rock , concert , concerts , folk-rock , gig , music , pop , rock , rock n roll . Leave a Comment
Sutherland Brothers & Quiver 1975 and 1976
I was aware of The Sutherland Brothers and Quiver as two separate bands, and saw them both live a few times. I saw The Sutherland Brothers at the Lincoln and Reading festivals in 1972, and Quiver as support for T Rex, and at Sunderland Poly Wearmouth Hall. They were two very different bands. The Sutherland Brothers an acoustic fold duo, who had a great 1972 single “The Pie” and the song “Sailing” which was to become a massive hit when covered by Rod Stewart. Quiver were a folky rock band, led by excellent guitarist Tim Renwick, and did a great version of The Beatles “Saw Her Standing There”.
In late 1972 the two acts joined forces and became Sutherland Brothers and Quiver. This seemed to me to be a strange move at the time, but proved to be very sensible. They released an album “Dream Kid”, and the excellent title track was released as a single, which should have been a hit but sadly didn’t chart. The new band toured constantly; I saw them at the Reading Festival in 1974 and 1976, and at Sunderland Poly Wearmouth Hall on 5th December 1975.
In 1976 they released “Arms of Mary”, their biggest hit, which reached No. 5 in the UK singles chart. They headlined a major tour at the time, calling at Newcastle City Hall on 26th September 1976. Support came from Moon, a successful pub rock band. The success was to be short lived. Tim Renwick left the group in 1977 and by 1979 the Sutherland Brothers had parted company with Quiver, and returned to recording as a duo. Sutherland Brothers & Quiver were a very under-rated band. The combination of the Sutherland Brothers’ great songs, and the guitar-based rock music of Quiver was a powerful mixture. Their live performances were always excellent, and their music crossed and combined genres including pop, country, rock, reggae and folk. There was so much more to them than their rather middle of the road (MOR) hit “Arms of Mary” might suggest. Perhaps that was the problem; a fine band who were difficult to pigeon hole, and landed a MOR hit, which gave them an audience who didn’t fully appreciate the breadth and depth of their music. That, and the advent of punk, probably sealed their fate. Listen to “The Pie” or “Dream Kid”.
Rate this:
| Mary |
In which BBC psychological crime drama series does Idris Elba play the title character? | ��ࡱ� > �� � � ���� � � ���������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������� '` �� j bjbjLULU *� .? .? b �� �� �� � � � � � � � � T �A �A �A 8 �A 4 �A t h rN |B �B �B �B �B [C [C [C �M �M �M �M �M �M �M $ tO h �Q � N � [C WC WC [C [C N � � �B �B � ,N �L �L �L [C � � �B � �B �M �L [C �M �L �L � � �L �B pB 0V ��� �A 1J � �L �M BN 0 rN �L \R �K \R �L �L � \R � �M d [C [C �L [C [C [C [C [C N N �L [C [C [C rN [C [C [C [C h h h �. �3 � h h h �3 � � � � � � � ���� Shortly after the end of WFMU's 2011 fundraising Marathon, I began trying to think of an idea for a 2012 fundraising premium CD to encourage folks to pledge their financial support to the station. Something so amazing that it would reward our longtime supporters while bringing new ones into the fold. I truly believe in WFMU and feel it deserves the widest possible audience, so I felt like something special was called for. I decided that I had to offer something unique: a CD of all-new recordings made specifically for this project! The next step was to pick a theme, so there'd be some cohesion to the thing. The idea of revisiting great songs of the 1970s seemed perfect. I had no idea if I'd be able to round up enough tracks to fill a CD, but in April 2011 I began the process of contacting some of my favorite musicians to invite them to take part. The only rules were, A) pick a song that was a Top 40 hit somewhere on Earth at some point during the '70s, and B) record it with no irony. I made it a point to encourage a wide range of styles and approaches. I was, and am, completely flabbergasted and overwhelmed by the quantity of the responses and the quality of the music I received. Considering the caliber of the artists whom I asked to participate, I expected it be good. But I could not have foreseen it being absolutely perfect. It is inspiring to know that musicians appreciate and support freeform public radio. When I imagine the hours of effort that went into making these recordings, I am floored. I am indebted to all of the artists who participated�and to you, the listener, for supporting WFMU. 1. The Dahlmanns "Ring Ring" At the end of 2011, Norway's the Dahlmanns released their debut album All Dahled Up, which, along with their two recent EPs, established them as one of my new favorite bands. With Andre Dahlmann of the Yum Yums on guitar and vocals, and his wife Line Cecile Dahlmann on lead vocals, their infectious pop encompasses all of the elements necessary to make #1 hit records. The list of influences the band sites is particularly revealing: the Ramones, the Fleshtones, Paul Collins Beat, Amy Rigby, the Queers and Lucinda Williams. "Ring Ring" is the title song of ABBA's 1973 debut album, and was a Top 40 hit in eight countries. The lyrics were originally written in Swedish by ABBA's Benny and Bj�rn with the group's manager Stig Anderson, and subsequently translated into English by Neil Sedaka and Phil Cody. In Sweden, the original Swedish version reached #1 and the English translation peaked at #2. Check www.popdetective.com to pick up a CD by the Dahlmanns, or have a listen at www.myspace.com/thedahlmanns. - 2. Ray Mason Band "Come And Get Your Love" Recorded November 13th, 2011 Produced, engineered and mixed by Jim Weeks at Cloud Cuckooland, Northampton, MA Ray Mason � lead vocals, guitar (Silvertone), cowbell Tom Shea � lead guitar, backing vocals, cowbell Stephen Desaulniers � bass, backing vocals, cowbell Frank Marsh � drums, backing vocals, sleigh bells, cowbell with Jim Weeks � handclaps, backing Vocals Ray Mason has been playing music for 45+ years in northwest Massachusetts, and still keeps busy bringing his music to the people, pumping out great song after great song, and releasing great new albums, filled with rootsy pop gems, every few years. "Come and Get Your Love" (one of my absolute favorite '70s songs) was written by Redbone's singer/guitarist Lolly Vegas, and produced by Lolly and his bassist brother Pat Vegas. Redbone's single peaked at #5 on the Billboard Hot 100 chart in April 1974 and was Top 40 in nine countries. Check the show archives at www.wfmu.org for my interview with the colorful Pat Vegas for the whole story � and my interview with Ray Mason too. Ray and his band have hit the nail on the head here, recognizing what makes this amazing song tick, but making it their own. Their version is anchored by Ray's 1965 Silvertone, which adds the signature sonic element. Go buy one of Ray's many great albums, and see where he's playing next at www.raymason.com. - 3. Frank Lee Sprague "Can't Get Enough" Recorded and pre-mastered by Frank Lee Sprague at Wichita Falls Records Studios, North Hollywood Farms, California USA America's own Master of Merseybeat, Frank Lee Sprague, pays tribute to the Hollies (and maybe the Fab Four and James and Bobby Purify?) with his cover version of Bad Company's "Can't Get Enough." If this track doesn't bring a smile to your face, you don't have lips. Born in Wichita Falls, Texas and now based in L.A., Frank (a relative of Buddy Holly) made some great Sprague Brothers albums with his brother Chris, and some amazing solo records including Merseybeat (2004), Cavern (2005), and Merry Merseybeat Christmas (2006). Harmony, melody, guitar wizardry and Beatle energy � what more could you ask for? "Can't Get Enough" was written by Mick Ralphs, former Mott The Hopple member and guitarist for Bad Company, whose version was a #5 hit on the Billboard chart and #1 in Cashbox. You can hear the (excellent) Bad Company version hourly on any Classic Rock radio station. Visit www.frankleesprague.com for an in-depth look/listen to all that Frank Lee Sprague is up to � including his new single "I'll Never Leave You"/"Merseybeat" & check the archives for our two interviews! - 4. Bambi Kino "You're Sixteen" Mark Rozzo, Ira Elliot, Doug Gillard and Erik Paparozzi Comprised of members of internationally renowned bands such as Nada Surf, Cat Power, Maplewood and Guided by Voices, Bambi Kino resurrects the sound and spirit of the Hamburg-era Beatles by performing only songs that would have been in the Beatles' live set circa 1960! It is an amazing idea for a band � and this line-up makes the most of it. "You're Sixteen" was a #8 hit for Johnny Burnette, in December 1960, and a #1 hit for Ringo Starr in January 1974. It was written by Richard and Robert Sherman, who also wrote numerous songs for various Disney productions, including Mary Poppins and The Jungle Book, as well as "It's a Small World" and various hits for Annette Funicello. Get more info on Bambi Kino and check out their self-titled debut album (recorded at the Indra Club in Hamburg) at www.bambi-kino.com. - 5. Stevie Jackson & the Wellgreen "Rock Your Baby" Stevie Jackson - Guitar, Electric Sitar, Stylophone, Vocals Marco Rea - Bass, Keyboards, Gloc, Vocals Stu Kidd - Drums, Percussion, Vocals Engineered and Mixed by Marco Rea Glaswegian Stevie Jackson has been playing guitar, singing and writing #1 hit songs for Belle and Sebastian since they formed in 1996. Check the show archives for our 2007 chat. "Rock Your Baby" was written by Harry Wayne Casey (aka KC) and Richard Finch of KC and the Sunshine Band, in 1974 they produced George McCrae's version of the song, which was a #1 hit in both the U.S. and the U.K. It is one of fewer than 30 singles to have sold 10 million or more copies worldwide. "Rock Your Baby" also inspired the equally funky answer hit "Rockin' Chair," sung by George's then-wife Gwen McCrae. Stevie released his first solo album (I Can't Get No) Stevie Jackson in 2011; it's yours at www.steviejackson.net. - 6. The Bo-Keys featuring Percy Wiggins �Stuck in the Middle with You" Percy Wiggins � vocals Howard Grimes � drums Scott Bomar � bass Joe Restivo � guitar Al Gamble � keyboard Marc Franklin � trumpet Kirk Smothers � sax Recorded by Justin Hess at Electraphonic Recording Mixed by Scott Bomar at Electraphonic Recording Produced by Scott Bomar Memphis' Bo-Keys combine some of the city's best young musicians with some veteran players from the days when the city was churning out classic soul on labels like Hi and Stax. The band manages the neat trick of achieving the quintessential Memphis sound while still sounding contemporary. "Stuck in the Middle with You" was written by Gerry Rafferty and Joe Egan and originally a hit for their band Stealers Wheel, peaking in 1973 at #6 in the U.S. and #8 in the U.K. It was produced by Jerry Leiber and Mike Stoller. The Bo-Keys' second album, Got to Get Back, was released in June 2011. Get the lowdown at: www.thebokeys.com. - 7. Joe Pernice "It's Different for Girls" Recorded and performed by Joe Pernice Joe Pernice is a show favorite. He's carved out a niche of melancholy in the world of rock music with his unique voice and songwriting talent. His way with a song is evidenced here with his stark and striking take on "It's Different for Girls." Joe Pernice could sing the phone book effectively. Originating on the 1979 album I'm the Man, "It's Different for Girls" was Joe Jackson's biggest U.K. chart single, peaking at number five in the UK. When asked for an interview, Joe's manager told me to try again when Joe had a new record out, but I didn't bother. Once when I was a bartender, Joe stormed out of when I told him he could not smoke. Info about Joe Pernice, the latest Pernice Brothers album Goodbye, Killer and the recently reunited Scud Mountain Boys may be found at www.pernicebrothers.com. - 8. Yo La Tengo "I Saw The Light" Hoboken's Yo La Tengo has a long association with WFMU. Every year since 1996, the band has taken to the air during the station's Marathon to perform impromptu listener requests in exchange for donations to the station. A selection of those performances was compiled (by our very own Scott Schinder) on the CD Yo La Tengo Is Murdering the Classics. Close friend of the band Ira the K even covers the occasional WFMU fill-in shift: wfmu.org/playlists/IK. Todd Rundgren's "I Saw the Light" peaked at #16 on the Billboard Hot 100 and #36 on the U.K. singles chart in 1972. Todd has said, "I wrote this song in 15 minutes... it is such a string of clich�s that it just doesn't have lasting impact for me." Todd refused my interview request because 9AM (his time, in Hawaii) was "too early." Visit www.yolatengo.com for info and a generous helping of free audio downloads. - 9. Dennis Diken with Bell Sound "Love Grows (Where My Rosemary Goes)" Ed Alstrom � bass, Hammond B3 organ, piano, backing vocals Chris Bolger � guitars, backing vocals Dennis Diken � drums, lead vocals, backing vocals, percussion David Marks � rhythm guitar, hi-hat Eddie Brigati � backing vocals Susan Brigati � backing vocals Dave Amels � engineer Produced by Husky Team (Dennis Diken and Dave Amels) for Nun Bett-R Productions Recorded in NJ at Charlie Blood�s (Garfield), Nun Bett-R Studio (Wood-Ridge) and Alstrom's Basement (Pine Brook) special thanks to Sal Benanti, Traci Hrebeniuk, Vic Hrebeniuk and Carrie Marks You may know Dennis for his excellent fill-ins on the airwaves of WFMU, or maybe through his day job (his night job?) as the drummer of the much-loved New Jersey band The Smithereens. In 2002, Diken collaborated with Dave Amels (aka WFMU's D.A. the DJ) to form Husky Team, who released the instrumental album Christmas In Memphis. In 2009, Dennis' first solo album Late Music was released on Cryptovision Records. Dennis supplements his usual band here with with guest stars David Marks of the Beach Boys and Eddie Brigati of the Rascals! "Love Grows (Where My Rosemary Goes)" was written by Tony Macaulay and Barry Mason, who recorded it as Edison Lighthouse, with prolific session singer Tony Burrows providing the vocals. It reached #5 on U.S. pop chart, #3 in Canada, and #1 in Britain for five weeks in January and February 1970. For more info about busy Dennis Diken visit www.dennisdiken.com, and check out Dennis' radio show archives at wfmu.org/playlists/DI - 10. Paul Collins "Here Comes That Rainy Day Feeling" Paul Collins featuring Brian Halverson aka Power Pop Baby Face! Recorded, mixed and mastered at Cherry Bomb Studios Staten Island, NY Paul Collins is Power Pop royalty! From his groundbreaking work with the Nerves � which also included future Plimsouls frontman Peter Case and Jack "Hanging On The Telephone" Lee � to his influential Paul Collins Beat albums, Collins shows why he deserves the title of his latest album King of Power Pop! "Here Comes That Rainy Day Feeling" (Roger Cook/Roger Greenaway/Tony Macaulay) was a #15 U.S. hit for the Fortunes in 1971. Cook and Greenway also produced the Fortunes' previous hit "You've Got Your Troubles." In 2012, longtime friends and musical partners Paul Collins and Peter Case announced a reunion tour paying tribute to their respective bands The Nerves, The Breakaways, The Beat and The Plimsouls. Keep your eyes on thepaulcollinsbeat.com for a venue near you & check the archives for my interview with Paul! - 11. Shibboleth "Theme from The Rockford Files" Rich Martin � keyboards Don Cento � guitar James Driscoll - bass Recorded by Shibboleth, mixed by James Driscoll This Dallas, Texas-based instrumental band is a delight, effortlessly jumping from lounge to surf to jazz with a consistent emphasis on melody that holds it all together. Their two albums defy categorization, but they all fit into the #1 hit category. The Rockford Files theme was written by TV music veterans Mike Post and Pete Carpenter and released as a single under Post's name. It reached #10 on the Billboard Hot 100 in 1975, and won a Grammy award for Best Instrumental Arrangement. I'd love to know who played what on it � it is a mind-blowing record! See, hear and buy all things Shibboleth: www.goshibbolethgo.com - 12. Splitsville "How Deep Is Your Love" Matt Huseman - Vocals, guitar Tony Waddy - Guitar, Vocals Paul Krysiak - Bass, Keyboards, Vocals Brandt Huseman - Drums, Vocals With: "J.P." Joe Parsons - Drums, Percussion Produced by Paul Krysiak & Splitsville�at Paul�s living room in Baltimore, Maryland Additional engineering by Mike Becker�at CTRL-Z Studios in Denver, Colorado Harmonies, hooks, pop culture, power pop roots, and�energy are the trademarks of Baltimore-based Splitsville.�With five albums, one EP and two international compilations to their credit, Splitsville has developed an expertise in making addicting pop music! "How Deep Is Your Love� was written and performed by the Brothers Gibb and appeared on the soundtrack of the film�Saturday Night Fever. The single was a number three hit in the UK and Australia. In the United States, it topped the�Billboard�Hot 100 on 24 December 1977 (becoming the first of six consecutive US number-one Bee Gee hits) and stayed in the Top 10 for a then-record 17 weeks. This track is Splitsville�s first DIY recording since the 1994 debut, Splitsville USA. For more information, MP3s and where to buy Splitsville�s music, visit HYPERLINK "www.HYPERLINK "http://splitsville.com/"splitsville.com"www.HYPERLINK "http://splitsville.com/"splitsville.com - 13. Mike Viola "Lonely Boy" Produced, Arranged and Performed by Mike Viola, Victor Indrizzo, Sean Hurley at Barebones Studio Los Angeles CA Mike Viola is exploding with talent. He's also busy, putting out his own albums (including the new Electro De Perfecto), contributing songs to films like Walk Hard: The Dewey Cox Story and Get Him to the Greek, and producing and collaborating with a diverse list of artists, including Mandy Moore, L.E.O., the Major Labels, Tracy Bonham and Dan Bern. "Lonely Boy" was written and recorded by Andrew Gold in 1976 for his album What's Wrong with This Picture? In 1977, the single became a Top 20 hit in both the United States (#7) and the United Kingdom (#11). Gold passed away in June 2011. Check out all of Mike's activity at mikeviola.com, and check out the set he recently did on Pseu's excellent show (http://wfmu.org/playlists/shows/43209)! - 14. The Explorers Club "Don't Pull Your Love" Produced by Jason Brewer and Dave Ellis Engineered and mixed by Dave Ellis Kyle Polk � drums Jason Brewer - vocals, guitar Paul Runyon - vocals, organ, Rhodes Justin James - slide guitar, electric guitar Dave Ellis - vocals, bass, percussion Special Guest: Trey Cooper � piano The Explorers Club hails from Charleston, SC, via a time machine. Their recordings combine a seemingly impossible mix of influences, from the Beach Boys to Herb Alpert to the Wrecking Crew to James Bond to garage rock. The six-man band throws the kitchen sink at their fine original pop songs and end up with a contemporary take on the '60s. It's interesting that while so many bands have tried to recreate the charming chaos of garage rock, so few have tried to recreate the pristine pop of the 60s. "Don't Pull Your Love" was written by Brian Potter and Dennis Lambert, and recorded in 1971 by Hamilton, Joe Frank and Reynolds, whose single reached #4 on the Billboard Hot 100. It features former show guest Hal Blaine on drums, and a lead vocal that always reminded me of Elvis Presley. Sam and Dave covered the song the same year; their version reached #36 on the Billboard R&B chart. The Explorers Club's second album Grand Hotel was recently released to much acclaim. Find it at: www.explorersclubmusic.com. - 15. Jay Sherman-Godfrey "Couldn't Get It Right" Performed by Jay Sherman-Godfrey and Nancy Polstein. Recorded by JSG at Able Mobile Recording Lab. Another former program guest, Jay is a longtime fixture on the New York music scene. You may be familiar with his work as a member of the World Famous Blue Jays, his production and guitar work on Laura Cantrell's first two albums, or his stints with They Might Be Giants or Amy Rigby, but his recent solo recordings and his series of "virtual singles" (all #1 hits) also deserve your attention. I had assumed that the Climax Blues Band was a one-hit wonder from the U.S.A., but it turns out they were formed in Stafford, England in 1968 and have at least seventeen albums! Their "Couldn't Get It Right" was Top Ten in the U.S. and U.K. in 1976. Who knew? For more on Jay, check the archives for our interview, and visit AbleMobileRecordingLab.bandcamp.com and www.tinyurl.com/7tykgwb for the musical lowdown! - 16. The Minus 5 "Arms of Mary" Recorded by Scott McCaughey on December 6, 2011 at the Red Record Room in Portland, Oregon. Peter Buck -12-string guitar Scott McCaughey - all other sounds. The Minus 5 are an amorphous band headed by our hero Scott McCaughey, and usually containing former R.E.M. guitarist Peter Buck and other well-pedigreed friends. They make rock and roll music � and lots of it � from their home base in Portland, Oregon. Though not a hit in the U.S.A., "Arms of Mary" was a Top 40 hit in 1976 for the Sutherland Brothers and Quiver in seven countries. It's been covered a shocking number of times, including versions by Chilliwack, the Everly Brothers, Keith Urban, Piet Veerman, Leo Kottke and the New Pornographers. Visit www.facebook.com/theminus5 to keep tabs on the 5. - 17. Mike Doughty "Take Me Home, Country Roads" "It was just me and a stereo mic, so there's no recording info really." Mike Doughty is a singer/songwriter, former leader of Soul Coughing and former Knitting Factory doorman. He recently released the solo album Yes and Also Yes, and an amazing new book The Book of Drugs: A Memoir, in which he recounts his battles with addiction, the music business and the even weirder world of recovery. "Take Me Home, Country Roads" was written by John Denver, Taffy Nivert and Bill Danoff and first appeared on Denver's 1971 breakout album Poems, Prayers and Promises. The single went to #2 in the U.S., and remains one of Denver's most-covered songs. Check in with Mike at www.mikedoughty.com. - 18. Bucky "Band Of Gold" Joff - drums, vocals Simon - vocals, guitar Bucky's All the New Mistakes was my absolute favorite album a few years ago. It is a treasure, filled with to-the-point songs with catchy melodies, great lyrics and a unique point of view, all performed with ENERGY from this Bristol-based duo. Some of you might also remember that drummer Joff created the amazing illustrations for last year's award-deserving premium CD Music Is Freedom. "Band of Gold" was written by Holland�Dozier�Holland (under the pseudonym Edythe Wayne) and Ron Dunbar, and recorded by Freda Payne, whose version went to #3 in the U.S. and #1 in the U.K. in 1970. For a few weeks recently, the show's message boards were loaded with competing theories about what exactly is the cause of the marital trouble described in the song. Efforts to get Ms. Payne on the show to straighten things out have, thus far, not been fruitful. Please visit www.buckytheband.com to buy a CD, get some free MP3s and see some videos of one of my all time favorite bands! - 19. Eugene Edwards "I Hear You Knocking" Instruments and vocals performed by Eugene Edwards on September 22, 2011 Recorded at Humble Hill Studios, Eagle Rock, CA Mixed and pre-mastered by Dave Peterson at Wooly Mammoth II studios Eugene Edwards caught my attention when I got an earful of his 2005 debut album, My Favorite Revolution. It was, and remains, a breath of fresh air, with #1 hit influences from the likes of the Who, the Kinks, the Beatles, Squeeze and Elvis Costello worn proudly. "I Hear You Knocking" was written by New Orleans' Dave Bartholomew and Pearl King in 1955, the same year that Smiley Lewis' version reached #2 on the Billboard R&B chart. It's been covered a million times since then, its malleability a sign of how solid a song it is. Dave Edmunds' version reached #4 on the Billboard singles chart in 1971. The previous year, it took the coveted Christmas #1 slot in the U.K., where it topped the singles chart for six weeks. The L.A.-based Edwards' one-man-band version of this classic invokes the spirit of Bo Diddley, with a nod to both previous hit versions. Learn more about Eugene at www.eugeneedwards.com. - 20. Frank Bango "You Wear It Well" New York's Frank Bango took time out from the sessions for his fifth album Touchy/Feely to record this for us. While we wait patiently for the new release (due in mid 2012) we've got his previous four albums, all of which are excellent, to tide us over. "You Wear It Well" was written by Rod Stewart and Martin Quittenton (the same duo that co-wrote "Maggie May"), and Stewart's version appeared on his album Never A Dull Moment. The song was a worldwide hit in 1972, reaching #1 in the U.K. and #13 in the U.S. Frank speaks his mind and posts music, photos and updates at www.sincererecording.com. - 21. Wreckless Eric & Amy Rigby "The Guitar Man" "Amy played piano and treated Crumar Insta-Piano, Eric played bass and acoustic guitar, the Mini-pips Junior played itself and the electronic orchestrations were played by members of the cast. Something like that." Wreckless Eric and Amy Rigby both have long and amazing individual resumes. Both are songwriters after my own heart, with catalogs to back it up. Their first duo album Wreckless Eric & Amy Rigby was released in 2008. After some years living in France, they moved to the U.S.A. in the autumn of 2011. "The Guitar Man" was written by David Gates and was the title track of Gates' group Bread's 1972 album. It peaked at #11 on the Billboard Hot 100, as well as #1 on Billboard's Easy Listening chart. According to Eric, "We're working on a new album, I think it's going to be quite strange. " Chart their progress at www.amyrigby.com/wrecklessericamyrigby - 22. Chandler Travis Philharmonic "Right Back Where We Started From" Rikki Bates - drums Fred Boak - vocal Dan Brantigan - trumpet Mark Chenevert - clarinet Dinty Child - mandocello, vocal Keiichi Hashimoto - trumpet Bob Pilkington - trombone Keith Spring - keyboard John Styklunas - string bass Chandler Travis - guitar and vocal. Recorded at Harry's in Hyannis, Massachusetts by Chris Blood. Mixed by Rikki Bates, Chris Blood and Chandler Travis From his home base in Cape Cod, Massachusetts, Chandler Travis keeps busy playing in a number of bands including summertime favorites the Incredible Casuals and the nine piece Chandler Travis Philharmonic, whose live version of "Right Back Where We Started From" closes things out. The band's sound has been described as "alternative Dixieland," "omnipop," and it has been said that the band "might be the missing link between the Kinks and Sun Ra." If you've never seen them live, you must! "Right Back Where We Started From" was co-written by former Michael Shelley Show guest J. Vincent Edwards, who co-produced Maxine Nightingale's 1976 worldwide hit version (#2 in the U.S., #8 in the U.K.). Edwards and Nightingale were both alumni of the London production of Jesus Christ Superstar. For more of the story behind the original version, check the archives for the full interview: www.wfmu.org/michael. Visit www.chandlertravis.com for a look into Chandler's world. - A GRAND THANKS TO: -Steve McFarland for the package design and amazing Photoshop work on the front and back covers! -Thomas Placke for editing the perfect video! -Scott Anthony for mastering the project! -Rex for lending his voice talents to the commercials! -Scott Schinder for editing help, and so many excellent minutes! -You for your pledge to the 2012 WFMU Fund Raising Marathon! Michael Shelley 2012 � � � � L X e o x ~ � � � � � � � � � � z � � � � � � � �����������������������n] h�sz h* � CJ OJ QJ ^J aJ #h* � B*CJ OJ QJ ^J aJ ph #h { B*CJ OJ QJ ^J aJ ph )h�� h�� B*CJ OJ QJ ^J aJ ph ,h�� h { >*B*CJ OJ QJ ^J aJ ph )h�� h&y B*CJ OJ QJ ^J aJ ph ,h�� h { 6�B*CJ OJ QJ ^J aJ ph )h�� h { B*CJ OJ QJ ^J aJ ph � � � � 2 3 K L ^ _ ` a b � � � w x z { � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � j j �� � � � L | � � � � � � � � # $ � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � 7 8 � � � � X l m o p � � � ! /! 0! R! S! " " �# �# $ $ � � � � � � � � � � � � � � � � � � � � � � � � � � � � gd* � � � � � ! ! ! ! R! �# �# �# �# �# �# >$ G$ �' �' �( �( �) �) + + �, �, �- �- G/ H/ I/ ��������̷̠��̷̠�t̠̠̠̠�bP #hk� B*CJ OJ QJ ^J aJ ph #h { B*CJ OJ QJ ^J aJ ph )h�� h MY B*CJ OJ QJ ^J aJ ph ,h�� h&y 6�B*CJ OJ QJ ^J aJ ph ,h�� h { 6�B*CJ OJ QJ ^J aJ ph )h�� h&y B*CJ OJ QJ ^J aJ ph )h�� h { B*CJ OJ QJ ^J aJ ph h�sz h* � CJ OJ QJ ^J aJ h�sz CJ OJ QJ ^J aJ $ $ $ e$ f$ }$ �$ �$ �$ �$ �$ �$ �$ 1% a% y% z% �& �& �' �' �' �' �' �' !( "( H( I( q) � � � � � � � � � � � � � � � � � � � � � � � � � � � � � q) r) �* �* p+ q+ s+ t+ �+ �+ ]- ^- �. �. �. �. / / H/ I/ �/ �/ �/ 0 ,0 K0 L0 b0 c0 � � � � � � � � � � � � � � � � � � � � � � � � � � � � gdk� I/ �0 �0 s1 t1 �1 �1 �2 �2 �2 �2 o3 �3 7 17 �: �: z; �; �< �< �< �< �< �< �< �< = = -= ���î������s�������bQbQbQbQbQ hO&� h�� CJ OJ QJ ^J aJ hO&� hO&� CJ OJ QJ ^J aJ #hl � B*CJ OJ QJ ^J aJ ph ,h�� h { 6�B*CJ OJ QJ ^J aJ ph #h�x� B*CJ OJ QJ ^J aJ ph )h�� h { B*CJ OJ QJ ^J aJ ph )h�� hk� B*CJ OJ QJ ^J aJ ph #hk� B*CJ OJ QJ ^J aJ ph )hk� hk� B*CJ OJ QJ ^J aJ ph c0 �0 $1 s1 t1 u1 �3 �3 �4 �4 >5 ?5 A5 B5 x5 y5 �5 6 6 37 47 8 8 =9 >9 @9 A9 p9 q9 � � � � � � � � � � � � � � � � � � � � � � � � � � � � gdk� q9 �9 �9 �9 �9 �9 �9 �: �: < < V< W< Y< Z< �< �< �< �< �< = = 1= 2= �= �= �> Y@ � � � � � � � � � � � � � � � � � � � � � � � � � � � d �� 7$ 8$ H$ gd�� gdO&� -= 0= 1= 2= F? Z? �@ �@ �@ �@ ;A *B*CJ OJ QJ ^J aJ mH ph � sH @�j h�� h�� B*CJ OJ QJ U^J aJ mH ph sH :j h�� h�� B*CJ OJ QJ U^J aJ mH ph sH .h�� h�� 6�CJ OJ QJ ]�^J aJ mH sH 7h�� h�� 6�B*CJ OJ QJ ]�^J aJ mH ph sH 1h�� h�� B*CJ OJ QJ ^J aJ mH ph sH hO&� hR9 CJ OJ QJ ^J aJ h�� CJ OJ QJ ^J aJ hR9 CJ OJ QJ ^J aJ Y@ �@ uA wA xA �A �A B B eC fC UD VD �D �D �D �D $E %E ME pE qE �E �E �E �E F ;F � � � � � � � � � � � � � � � � � � � � � � � � � � � gd�� d �� 7$ 8$ H$ gd�� AA dA sA tA iB |B �B �B �B �B �C �C �H �H �I �I �I �I ,R
| i don't know |
Which war is the setting for 'Goodbye To All That' by Robert Graves? | Good-bye to All That by Robert Graves review – a timely reissue | Books | The Guardian
Good-bye to All That by Robert Graves review – a timely reissue
Graves's superbly sardonic memoir should be essential reading for the centenary of the first world war
A 'bitter leave-taking of England' … Robert Graves. Photograph: Alamy
Friday 16 May 2014 11.30 EDT
First published on Friday 16 May 2014 11.30 EDT
Share on Messenger
Close
Robert Graves 's superbly sardonic account of his childhood, schooling, the great war and his first marriage was written in just four months in 1929, when he was 33. It was his attempt at "a formal good-bye to you and to you and to you and to me and to all that". By then he had separated from his wife and was living with the American poet Laura Riding. The idea of a farewell to the past was hers. In 1957, when Graves re-edited the memoir, "the book's hidden mentor was effaced", as Andrew Motion says in the introduction to this timely reissue of the original edition. It is a remarkable book, a "bitter leave-taking of England" as Graves described it. He hated Charterhouse school , where he was mercilessly bullied: "I came near a nervous breakdown." He enlisted within days of the outbreak of war because he "dreaded" going up to Oxford. His vivid account of life and death in the trenches is haunting: "I kept myself awake and alive by drinking about a bottle of whisky a day." Seriously wounded (and reported dead), he found life back in Blighty almost as bad: "everyone was mad". Essential reading for the centenary of the first world war.
| World War I |
Which British mammal can be 'Field', 'Bank' or 'Water'? | Goodbye to All That by Robert Graves · OverDrive: eBooks, audiobooks and videos for libraries
Biography & Autobiography Nonfiction
In 1929 Robert Graves went to live abroad permanently, vowing 'never to make England my home again'. This is his superb account of his life up until that 'bitter leave-taking': from his childhood and desperately unhappy school days at Charterhouse, to his time serving as a young officer in the First World War that was to haunt him throughout his life.
It also contains memorable encounters with fellow writers and poets, including Siegfried Sassoon and Thomas Hardy, and covers his increasingly unhappy marriage to Nancy Nicholson. Goodbye to All That, with its vivid, harrowing descriptions of the Western Front, is a classic war document, and also has immense value as one of the most candid self-portraits of an artist ever written.
Canada, Australia, United Kingdom, Thailand
Format
Adobe EPUB eBook 2.4 MB
Robert Graves (Author)
Robert Graves was born in 1895 in Wimbledon. He went from school to the First World War, where he became a captain in the Royal Welch Fusiliers and was seriously wounded at the Battle of the Somme. He wrote his autobiography, Goodbye to All That, ...
| i don't know |
Which Victorian artist painted 'The Derby Day' in the 1850's? | Derby Day by William Powell Frith, RA
[ Victorian Web Home —> Visual Arts —> Victorian Painters —> William Powell Frith —> Paintings —> Next ]
Derby Day by William Powell Frith, RA. [Original 1858 in Tate Gallery, London] Signed and dated 1893-94. 102.3 x 234.4 cm. City Art Galleries, Manchester. According to the museum site, "This version replicates a Royal Academy exhibit of 1858. It was commissioned by James Gresham of Stretford and was thought by Frith to be better than his original." The museum's entry further explains:
Derby Day was an established day out by the 1850s. The crowds of thousands came from all social classes for the colourful entertainments as much as the race. Frith's first visit to Epsom Downs was in 1856, when he was taken in by a thimble-rigging gang. A team of these con-men can be seen on the left. The Victorians were fascinated by phrenology, the reflection of social types in facial characteristics. This partly accounts for the success of and other crowd scenes by Frith and his followers.
Related Material
| William Powell Frith |
Which Eugene O'Neill play takes place from around 8:30 am to midnight in August 1912 at the seaside Connecticut home of the 'Tyrone' family? | Painting in US beach house could fetch $800,000
Painting in US beach house could fetch $800,000
JILL LAWLESS - Associated Press
Pin it
Share
In this image made available by Christie's London of "Derby Day" by William Powell Frith. The Victorian painting that hung in a family's unlocked New England beach house for half a century could fetch 500,000 pounds ($800,000) when it is sold next month, Christie's auction house said Tuesday Nov. 15, 2011. "Derby Day" is an early version of one of the era's most famous paintings William Powell Frith's teeming, picaresque image of the crowds at an 1850s horse race, from a rich family in their carriage to a prostitute and a fortune teller. (AP Photo/Christie's) EDITORIAL USE ONLY
More
LONDON (AP) — A long-lost Victorian painting that hung in a family's unlocked New England beach house for half a century could fetch 500,000 pounds ($800,000) when it is sold next month, Christie's auction house said Tuesday.
"The Derby Day" is an early version of one of the era's most famous pictures — William Powell Frith's teeming, picaresque image of the crowds at an 1850s horse race, from a rich family in their carriage to gamblers, acrobats and prostitutes.
The finished painting hangs in the Tate Britain gallery in London. The 15-by-35 inch (39 centimeter by 91 centimeter) oil-on-canvas sketch being sold by Christie's is Frith's first complete version of the scene.
Peter Brown, Christie's director of Victorian pictures, said the rediscovery of the oil sketch was "immensely exciting."
It had been hanging in a modest New England beach house for decades before a friend of the owner suggested it might be worth something. Christie's won't be more specific about the location because the owner wants to remain anonymous.
Brown said the vendor, who is in his 60s, believes his parents bought the painting some time before World War II, when Victorian art was often dismissed as garish and sentimental.
"It's a testament to the change in fortunes of Victorian pictures over the last century that these things could have been acquired very cheaply indeed in the '30s, '40s and '50s," said Brown.
Since the 1970s, critical opinion has changed, and works by the best Victorian artists are coveted by collectors.
Frith, one of the era's most successful painters, specialized in busy scenes of daily life, and his subjects ranged from beachgoers to railway stations to royal weddings.
"The Derby Day" was so popular when first exhibited in 1858 that a special rail was installed at the Royal Academy in London to hold back the crowds.
"It's really a novel in paint and would have been read as such by the Victorian picture-going public," Brown said.
The painting goes on sale Dec. 15 in London, with an estimate of 300,000 pounds to 500,000 pounds ($477,000 to $800,000).
Reblog
| i don't know |
Who played 'Tony Wilson' in the 202 film '24 Hour Party People'? | 24 Hour Party People (2002) - IMDb
IMDb
There was an error trying to load your rating for this title.
Some parts of this page won't work property. Please reload or try later.
X Beta I'm Watching This!
Keep track of everything you watch; tell your friends.
Error
24 Hour Party People ( 2002 )
R |
In 1976, Tony Wilson sets up Factory Records and brings Manchester's music to the world.
Director:
From $2.99 (SD) on Amazon Video
ON DISC
a list of 46 titles
created 25 Jan 2011
a list of 44 titles
created 30 May 2011
a list of 23 titles
created 05 Mar 2012
a list of 24 titles
created 26 Jan 2013
a list of 37 titles
created 9 months ago
Title: 24 Hour Party People (2002)
7.4/10
Want to share IMDb's rating on your own site? Use the HTML below.
You must be a registered user to use the IMDb rating plugin.
1 win & 13 nominations. See more awards »
Photos
A profile of Ian Curtis, the enigmatic singer of Joy Division whose personal, professional, and romantic troubles led him to commit suicide at the age of 23.
Director: Anton Corbijn
Five friends spend one lost weekend in a mix of music, love and club culture.
Director: Justin Kerrigan
A chronological account of the influential late 1970s English rock band.
Director: Grant Gee
Morbid biographical story of Sid Vicious, bassist with British punk group the Sex Pistols, and his girlfriend Nancy Spungen. When the Sex Pistols break up after their fateful US tour, ... See full summary »
Director: Alex Cox
Director Michael Winterbottom (Northam) attempts to shoot the adaptation of Laurence Sterne's essentially unfilmable novel, "The Life and Opinions of Tristram Shandy, Gentleman."
Director: Michael Winterbottom
Edit
Storyline
Manchester 1976: Cambridge educated Tony Wilson, Granada TV presenter, is at a Sex Pistols gig. Totally inspired by this pivotal moment in music history, he and his friends set up a record label, Factory Records, signing first Joy Division (who go on to become New Order) then James and the Happy Mondays, who all become seminal artists of their time. What ensues is a tale of music, sex, drugs, larger-than-life characters, and the birth of one of the most famous dance clubs in the world, The Hacienda - a mecca for clubbers as famous as the likes of Studio 54. Graphically depicting the music and dance heritage of Manchester from the late 70's to the early 90's, this comedy documents the vibrancy that made Mad-chester the place in the world that you would most like to be. Written by IGB
The unbelievably true story of one man, one movement, the music and madness that was Manchester.
Genres:
Rated R for strong language, drug use and sexuality | See all certifications »
Parents Guide:
20 September 2002 (USA) See more »
Also Known As:
24 ores gemates rock See more »
Filming Locations:
£265,428 (UK) (5 April 2002)
Gross:
Did You Know?
Trivia
The movie was shot on video and then processed in post production to give it the look of film See more »
Goofs
The Haçienda's last night of operation wasn't a rave night as seen in the film. It was actually a performance by the English space rock band Spiritualized. The building was used for two parties after the club officially closed. See more »
Quotes
[first lines]
Tony Wilson : Is it a bird? Is it a plane? No, it's the latest craze sweeping the Pennines, and I've got to be honest, I'd rather be sweeping the Pennines right now.
Written by Paul Klein, Joe Stone and Lawrence Julian
Published by Chrysalis Music Ltd
Performed by DSK
Worth multiple viewings and a little homework
24 June 2003 | by DestroyTheFives
– See all my reviews
I get the general sense from reading some of the reviews that people didn't like this movie because it didn't provide any instant gratification or personal meaning. That's probably true for people who don't know Joy Division, New Order, or the Happy Mondays, but I think it's totally unfair to discredit this film on a basis of a lack of prior knowledge. Many great films and novels aren't great because you get them on the first try, and I think that this movie follows the same path. If you didn't like it the first time, take a look at an old Tony Wilson interview or a concert tape of Joy Division and you will instantly see the quality production and acting that went into this film. Ian Curtis/Joy Division are portrayed with an eerily haunting accuracy (down to the instruments they play, which are rumoured to be the originals from the late 1970s) and you can tell that the cast really did their homework. The concert scenes are spectacularly energetic, the sets (especially the Hacienda) are ripped right out of the time period. Comic relief isn't overlooked, as the dry humour of Steve Coogan and the rest of the cast is pursued to the dime. The unscripted dialogue is also quite good, which is another indication of the actors' homework. This movie is worth the time: it details a very important time and place in pop music history that is often overlooked in the wake of much larger, more commercialized scenes. Rave and post-punk may be fading today, but one need only take a look at the charts to see its influence. Go out and get this movie, learn a little about it, and you will be impressed.
57 of 69 people found this review helpful. Was this review helpful to you?
Yes
| Steve Coogan |
'The Devil Rides Out' is the second book of autobiography of which Birkenhead born comedian and TV presenter? | 24 Hour Party People - Blue Monday - YouTube
24 Hour Party People - Blue Monday
Want to watch this again later?
Sign in to add this video to a playlist.
Need to report the video?
Sign in to report inappropriate content.
Rating is available when the video has been rented.
This feature is not available right now. Please try again later.
Uploaded on May 28, 2007
John Simm, Ralf Little and Tim Horrocks perform Blue Monday as New Order in 24 Hour Party People. Split screen with Steve Coogan as Tony Wilson talking about the cost of the single's sleeve.
Category
| i don't know |
What was the name of the peace protester who camped in Parliament Square for many years, who died last month? | Brian Haw: Anti-war protester who camped in Parliament Square dies, aged 62 | Daily Mail Online
comments
Brian Haw has died during treatment for lung cancer
An anti-war campaigner who spent ten years camped outside the Houses of Parliament has died of lung cancer.
Brian Haw, 62, set up his ramshackle site in June 2001 as a one-man protest against British military action in Iraq and, later, Afghanistan.
He became a familiar face to MPs and a hero to civil rights campaigners, but his tent and collection of horrific pictures of war victims, accompanied by slogans such as ‘baby killers’, offended many.
But Mr Haw and his followers fought off all legal attempts to remove the camp from Parliament Square, although he was limited in the hours he could use a megaphone to attack government policies.
It began as a response to economic sanctions and British and American bombing raids on Iraq, but his angry messages daubed on hand-written posters grew after the invasion of Afghanistan and Iraq.
This month he marked ten years living on the square.
The protester died in Germany on Saturday where he had been receiving treatment.
Yesterday his devastated family paid tribute to the father of seven, releasing this statement: ‘It is with deepest regret that I inform you that our father, Brian, passed away this morning.
Scroll down for video
Persistent protest: Mr Haw kept up his campaign for more than a decade, marking the tenth anniversary of his camp just three weeks ago
HAW'S BATTLES IN COURT TO STOP HIS CAMP BEING MOVED ON
Sucessive attempts to move Brian Haw frim his makeshift camp failed afterthe High court said it would be a breach of his human rights.
In 2002, Westminster City Council tried to prosecute Mr Haw for causing an obstruction, but the case was thrown out after it was ruled that camp banners did not impede the public.
And even when politicians amended the law to outlaw unlicensed protests, Mr Haw was able to keep up his campaign thanks to a legal loophole.
In the 2005 general election Mr Haw stood as a candidate in the Cities of London and Westminster in order to further his campaign.
He won 298 votes, making a speech against the ongoing presence of UK troops in Iraq at the declaration of the result.
Last year, bailiffs moved on a number of other protest groups from Parliament Square Gardens, but again Mr Haw escaped eviction because he was camped on the pavement, not the lawn.
He was also arrested last year when police carried out security sweeps in the area ahead of the Queen's Speech.
And in April Mr Haw faced another battle when officials tried to evict the huddle of tents, tarpaulin and placards - described by some as 'an eyesore' - ahead of the wedding of Prince William and Kate Middleton at nearby Westminster Abbey.
‘As you know he was battling lung cancer, and was having treatment in Germany.
‘He left us in his sleep and in no pain, after a long, hard fight.’
Supporters and MPs flocked to Twitter to pay tribute.
The Speaker’s wife, Sally Bercow posted a number of Tweets, saying: ‘Sad to hear Brian Haw has died.
‘His peace camp in Parly Sq was a good thing (in my humble opinion-- many here would beg to differ).’
She added: ‘Hoping Westminster Council might put up a blue plaque: Brian Haw, peace campaigner, lived here 2001 - 2011.’
Haw was the son of a soldier who was one of the first to enter the Bergen-Belsen concentration camp after it was liberated from the Nazis.
Haw spent time in the merchant navy and worked as a carpenter, but his evangelical Christian faith drove him to seek out suffering.
He visited Northern Ireland during the Troubles and travelled to the killing fields of Cambodia.
Haw also worked with troubled youngsters in Redditch, Worcestershire where he lived with his wife Kay and their seven children.
Haw told journalists that he had left his family to campaign for other families suffering in war zones.
‘I want to go back to my own kids and look them in the face again, knowing that I’ve done all I can to try and save the children of Iraq and other countries who are dying because of my Government’s unjust, amoral, fear- and money-driven policies,’ he said.
Anti-establishment: Mr Haw's political position often led to run-ins with the law
‘These children and people of other countries are every bit as valuable and worthy of love as my precious wife and children.’
In his long fight against the Government, Haw became a beacon for civil rights campaigners.
In April 2002 Westminster City Council began legal action to remove him under the Highways Act, but the case never came to court.
The council later limited the hours he could use a megaphone to attack Government policies.
In 2005 the Serious Organised Crime and Police Act restricted the right to protest in designated areas within 1km of the Houses of Parliament
But the High Court ruled that Haw could apply to the police for permission to continue his demonstration.
High-profile support: Although many politicians condemned Mr Haw's tactics, he did win the backing of veteran Labour MP Tony Benn (left)
This was granted - but only with a series of conditions limiting the size of his protest site.
In 2006 police seized 90 per cent of Haw’s placards overnight on the grounds that he had breached these restrictions.
However, a judge later found that there was no case to answer.
This year the Greater London Authority successfully got permission to evict Haw from the grass area at the centre of Parliament Square.
Westminster Council is due later this year to go to court to try to get the demonstrators moved off the pavement too.
His protest was immortalised in January 2007 when former Turner Prize nominee Mark Wallinger recreated his camp at the Tate Britain gallery.
Haw also won a Channel 4 News award for Most Inspiring Political Figure in 2007.
Determined: Mr Haw pictured in the early days of his one-man campaign
Yesterday his collection of bleak war photos remained untouched.
Fellow members of the Parliament Square Peace Campaign said his legal battles had taken a toll on his health.
They released this statement: ‘Brian showed great determination and courage during the many long hard years he led his Peace Campaign in Parliament Square, during which it is well documented that he was relentlessly persecuted by the authorities which eventually took its toll on his health.
‘Parliament, the police, and courts etc, should forever be ashamed of their disgraceful behaviour towards Brian.’
| Brian Haw |
Who reached number seven in the charts in 1994 with his cover version of 'Led Zepplin's', 'Stairway To Heaven'? | Pennie R Quinton
Pennie Quinton is a freelance journalist based in East London.
Brian Haw left his work and family to set up camp and campaign in front of the British parliament building, in a colourful - and often noisy - demonstration against the killing of children in through sanctions and war [GALLO/GETTY]
On Sunday June 19, 2011, Brian Haw died peacefully in his sleep following a long fight against lung cancer.
Brian's death ends his decade-long challenge to the British establishment and his constant reminder to Members of Parliament and civil servants entering the Houses of Parliament in London of the brutal effects on ordinary people of economic sanctions and wars in Iraq and Afghanistan.
On June 2, 2001, Brian Haw left his wife and seven children and his work as a carpenter to live day and night outside parliament, to focus attention on the devastating impact of the economic sanctions on Iraq and the plight of children born with birth defects attributed to the use of depleted uranium munitions in the 1991 Gulf war.
An unrelenting campaign
Brian endured threats, violence and abuse for the duration of his protest. "I want to go back to my own kids and look them in the face again," he wrote in 2002, "knowing that I've done all I can to try and save the children of Iraq and other countries who are dying because of my government's unjust, amoral, fear- and money-driven policies. These children and people of other countries are every bit as valuable and worthy of love as my precious wife and children."
In 2003, when the UK and US commenced their war against Iraq, Brian began fasting and praying with other protesters who joined him in sleeping rough in Parliament Square. Laws were drafted and passed attempting to remove Brian - but he manage to remain.
Member of Parliament John McDonnell recalls how, with fellow-MP Tony Benn, he acted as a character witness for Brian during his many appearances in court, including some brought by the Metropolitan Police on accusations of aggression and assault. "Brian was bearing witness to the horrendous war crimes in Iraq, reminding MPs of their own guilt," McDonnell says. "He was always willing to engage in debate but was continually harassed by the state. He remained a pacifist and a true democrat. Argument and debate were the only tools that he would use in his fight against injustice. He won repeatedly in court against the police."
A formidable presence
Watch Al Jazeera's report on the death of one of the most recognisable figures in the British anti-war movement
"Brian was in the British tradition of protest against great injustices," McDonnell adds, "alongside the long-term picket outside the South African embassy against Apartheid."
Jeremy Corbyn MP says Haw "single-handedly managed to irritate the British establishment simply by his presence in Parliament Square, every day reminding MPs of their preference for lies and deceit regarding Iraq and Afghanistan over the truth that British weapons and arms have destroyed thousands of innocent lives".
Rikki Blue is an independent film-maker who covered many of the protests and events that spiralled out of Brian's long struggle to remain in Parliament Square. He recalls that Brian "always worried about the kids. Everything that is wrong about war is that innocents die - and the biggest symbol of innocence are children."
"Brian demanded that the world stops killing kids." Blue expands: "He was such an angry man but when he smiled it was like the heavens opened. He suffered so much persecution and violence during his time in the square - but nothing could shake his belief that killing kids is wrong."
Emma Sangster, of the Voices in the Wilderness campaign against sanctions in Iraq, recalls how she first met Brian ten years ago: "Initially he had just three little placards - but he created a space where people could learn about the world in a way that was very formative before he was beleaguered by all the legal pressures from the laws especially drafted to get rid of him."
The authorities' determination to remove him became more entrenched but, Sangster says, "truth was stranger than fiction in the ways he managed to survive and remain. In 2002 he won the case that made his protest lawful: he stood his ground but he was under lots of pressure day after day".
A likeable figure
"In 2004," Sangster recalls, "I took my newborn son to meet Brian at a vigil at Downing Street. It was very special. Brian had great affection for my son Tom as well as all the children he met in Parliament Square."
Sanger concludes:
His legacy will be one of inspiration that people can stand up as individuals against the great wrongs. That was his message and it went all over the world. He was iconic, inspired by the Christian tradition of people who stand up and speak out: this was what drove him during the early period of his protest and is what I remember him most for.
Milan Rai, an author and editor of Peace News also pays tribute: "We first met Brian while holding our Friday vigils in Parliament Square on the Iraq sanctions. We used to enjoy speaking with him and supporting him."
Rai added:
[He became] a symbol for people in Britain who treasured him for speaking out against the lies that were told about the invasion of Iraq. He became a channel for people's anger. Brian was motivated by a very deep love of children: he felt so fiercely about the plight of the children in Iraq, he was going to stand up for those children as if they were his own. He was a man of uncompromising principles who touched a chord.
In 2004, I filmed Brian Haw welcoming US peace campaigner Cindy Sheehan, whose son had been killed in Iraq. Brian and Cindy threw their arms around each other and wept over the grim images of mutilated children arranged over Brian's protest display. They both kept saying, "see what they are doing to the kids, see what they are doing to the kids". Crowds of people followed them to the Prime Minister's residence at 10 Downing Street, where they continued to protest for the rest of the day.
After the first year of his protest Brian had amassed a large number of placards denouncing US and British bombing of Iraq: the local authority, Westminster City Council, went to court to end the vigil. The judge, Mr Justice Gray declined, finding that:
This application raises questions as to the interaction between the right and the duty of a local authority to remove obstructions from its highways on the one hand, and the right of the individual citizen to use those highways to exercise his or her right to freedom of expression on the other hand … I am not satisfied in the circumstances of this case that there is any pressing social need to interfere with the display of placards so as to protect the right of others to pass and re-pass [the highway].
'God sends good judges'
One significant aspect of the case was an individual's right under Article 10 of the European Convention on Human Rights, which guarantees freedom of speech. Mr Justice Gray added that he was "not persuaded" the defendant's placards could be considered advertising. "Looking at the issue of reasonableness in the round and taking account of the duration, place and purpose and the effect of the obstruction, as well as the fact that the defendant is exercising his Convention right," Mr Justice Gray came to the conclusion "that the obstruction for which the defendant is responsible is not unreasonable: I decline to grant the injunction".
After the ruling, Brian raced outside the courts and embraced a Buddhist monk and nun who had held a vigil outside the Royal Courts of Justice and told them: "God sends us good judges." He pointed to pictures of sick Iraqi children, declaring: "This has been hidden from our people for so long. This is an abomination. If the people knew what is being done in their name in Iraq, they would be horrified." Asked how long he would continue his protest he said: "As long as it takes. When do you give up on the kids?"
With the death of Brian Haw, London has lost one its most unusual and distinctive landmarks. Anyone who passed the Houses of Parliament could hardly miss him. Another indicator of his wide impact was Britain's most coveted art award, the Turner Prize, being won by Mark Wallinger for rebuilding Brian's Parliament Square protest in the Tate Britain gallery.
John McDonnell MP now plans to put a resolution (an "Early Day Motion") before the Houses of Parliament calling for the erection of "a monument to Brian Haw that celebrates peace, rather than celebrating war - as do many of London's great monuments".
Source: Al Jazeera
| i don't know |
Who was the star of the 1937 film 'Oh, Mr. Porter !'? | Oh Mr. Porter! - 1937(Full Movie) - YouTube
Oh Mr. Porter! - 1937(Full Movie)
Want to watch this again later?
Sign in to add this video to a playlist.
Need to report the video?
Sign in to report inappropriate content.
The interactive transcript could not be loaded.
Loading...
Rating is available when the video has been rented.
This feature is not available right now. Please try again later.
Published on Aug 8, 2012
Starring Will Hay as William Porter, this is one of Hay's most highly rated comedy films. An inept man tries to run a station in a backwards part of Northern Ireland, and ends up running into a gang of criminals! A good, clean comedy with lots of TRAINS.
Copyright: none, public domain mark 1.0.
Category
| Will Hay |
What was the middle name of the architect Edwin L. Lutyens? | Reel Streets
Will Hay - Oh Mr. Porter! / Convict 99 [DVD] [1938]
If you have any information regarding this film, any of the stills, or even better, some NOW shots click here.
We are always looking for more help with identifying these filming locations and would be grateful for any positive identifications, snippets or references you can offer about these movie making locations.
To view the now location shot, just mouseover the filming location still.
Stills with a red border do not have a now shot.
Oh, Mr Porter!
omp001. William Porter (Will Hay) as a wheeltapper at the start of the film. Members of the Britmovie Forum identify this location as Hertford North station, Hertfordshire.
omp001n. And it certainly looks like Hertford North station. (PW)
(Modern Photo Added: 17-04-2016)
Oh, Mr Porter!
omp002. After his promotion to Station Master, Porter arrives at Buggleskelly. Cliddesden railway station, Station Road, Cliddesden, Hampshire.
omp002n. Establishing shot angle for Buggleskelly Station, looking northeast (Station Road, Cliddesden, Hampshire). Simon Mills.
(Modern Photo Added: 11-10-2012)
Oh, Mr Porter!
omp003. The Signalbox at Buggleskelly. Cliddesden, Hampshire. The station was on the Basingstoke & Alton Light Railway and closed in 1932.
omp003n. Location of signal box and level crossing, Buggleskelly Station, looking north (Station Road, Cliddesden, Hampshire). Simon Mills
(Modern Photo Added: 11-10-2012)
Oh, Mr Porter!
omp004. Porter attempts to open the crossing gates as Jeremiah Harbottle (Moore Marriott) and Albert Brown (Graham Moffatt) look on. Cliddesden, Hampshire.
omp004n. Location of level crossing gate, Buggleskelly Station, looking north (Station Road, Cliddesden, Hampshire). Simon Mills
(Modern Photo Added: 11-10-2012)
Oh, Mr Porter!
omp007. Porter climbs onto the sails of Terling Windmill, Mill Lane, Terling, Essex.
omp007n. Restoration of the Grade II listed Smock mill to what is now a residence did not include sails to repeat such antics. (RL)
(Modern Photo Added: 19-05-2014)
omp008. One-Eyed Joe's windmill. Terling Windmill, Essex.
omp008n. The interesting history of the mill can be found in Wikipedia. (RL)
(Modern Photo Added: 19-05-2014)
Oh, Mr Porter!
omp009. Porter, Harbottle and Brown drive the excursion train with the gun runners on board. Cliddesden.
omp009n. Location of signal box and level crossing, Buggleskelly Station, looking south (Station Road, Cliddesden, Hampshire). Simon Mills
(Modern Photo Added: 11-10-2012)
Oh, Mr Porter!
omp010. The end of the line for the gun runners . . . and the train. John Gravett identifies this as Basingstoke Good Yard. (RL)
. . . 10 filming location stills : 9 now location shots
| i don't know |
"The line ""Jennifer Eccles had terrible freckles"" from the 'Scaffold's', 'Lily The Pink' refers to the single 'Jennifer Eccles' which was a hit for which group?" | The Scaffold – Lily The Pink | iPhone-Free-Ringtones
The Scaffold – Lily The Pink
Leave a comment »
Lily The Pink
“Lily the Pink” is a modification of the older folk song “The Ballad of Lydia Pinkham”, and the modifications were not extensively due to The Scaffold – for example a similar version was the unofficial regimental song of the Royal Tank Corps, at the end of World War II.
“Lily the Pink” was a surprise hit for The Scaffold, becoming the Christmas #1 in the UK singles chart for four weeks, in December 1968 for the UK comedy group. Another version of the song was also a minor hit in North America for The Irish Rovers from the Decca LP release Tales to Warm Your Mind in 1969, at a time when covers were released almost as soon as the originals.
The Scaffold’s version of the song had famous help – Elton John and Graham Nash of The Hollies contributed with backing vocals and Jack Bruce (of Cream) played the bass guitar. It also has a number of in-jokes which were largely missed by listeners. The line Mr Frears has sticky out ears refers to film director Stephen Frears who had earlier worked with The Scaffold. The line Jennifer Eccles had terrible freckles refers to the single “Jennifer Eccles” by The Hollies, remembering that Graham Nash of The Hollies adds backing vocals to the song.
This song has become part of the folk community and has been performed live by The Brobdingnagian Bards and other Celtic-style folk and folk artists.
If you wish to Donate to help me keeping this website alive you are more than welcome and is very much appreciated
Share this:
This entry was posted on February 5, 2012 at 6:11 pm. You can follow any responses to this entry through the RSS 2.0 feed. You can leave a response , or trackback from your own site.
| The Hollies |
What is the name of Liam Gallagher's new band, whose first album is 'Different Gear, Still Speeding'? | Lily the Pink (song) - WOW.com
Lily the Pink (song)
from the album L. The P.
Released
File:Lily The Pink.ogg
"Lily the Pink" is a 1968 song released by the UK comedy group the Scaffold . It is a modernisation of an older folk song titled "The Ballad of Lydia Pinkham ". The lyrics celebrate the "medicinal compound" invented by Lily the Pink, and, in each verse, chronicle some extraordinary cure it has effected.
Contents
6 External links
The Scaffold version
The Scaffold's record, released in November 1968, became No. 1 in the UK Singles Chart for the four weeks encompassing the Christmas holidays that year. [1] [2]
Backing vocalists on the recording included Graham Nash (of the Hollies ), Elton John (then Reg Dwight), and Tim Rice ; [1] while Jack Bruce (of Cream ) played the bass guitar . [3]
The lyrics include a number of in-jokes . For example, the line Mr Frears has sticky out ears refers to film director Stephen Frears who had worked with the Scaffold early in their career; while the line Jennifer Eccles had terrible freckles refers to the song " Jennifer Eccles " by the Hollies , Graham Nash's former band. [3]
Covers and derivative versions
Another version of the song, released a few months after the Scaffold's by the Irish Rovers , became a minor hit for North American audiences in early 1969. At a time when covers were released almost as soon as the originals, the release from the Rovers' Tales to Warm Your Mind Decca LP became a second favorite behind " The Unicorn ".
The song has since been adopted by the folk community. It has been performed live by the Brobdingnagian Bards and other Celtic-style folk and folk artists.
The song was successfully adapted into French by Richard Anthony in 1969: this version described humorously the devastating effects of a so-called panacée (universal medicine).
Earlier folk song
Label from a box of Lydia Pinkham 's medicine
The U.S. American folk (or drinking) song on which Lily the Pink was based is generally known as "Lydia Pinkham" or "The Ballad of Lydia Pinkham". It has the Roud number 8368. [4] The song was inspired by Lydia E. Pinkham's Vegetable Compound , a well-known herbal-alcoholic patent medicine for women. Supposed to relieve menstrual and menopausal pains, the compound was mass-marketed in the United States from 1876 onwards.
The song was certainly in existence by the time of the First World War . F. W. Harvey records it being sung in officers' prisoner-of-war camps in Germany , and ascribes it to Canadian prisoners . [5] According to Harvey, the words of the first verse ran:
Have you heard of Lydia Pinkum,
And her love for the human race?
How she sells (she sells, she sells) her wonderful compound,
And the papers publish her face?
In many versions, the complaints which the compound had cured were highly ribald in nature. During the Prohibition era (1920–33) in the United States , the medicine (like other similar patent medicines) had a particular appeal as a readily available 40- proof alcoholic drink, and it is likely that this aided the popularity of the song. A version of the song was the unofficial regimental song of the Royal Tank Corps during World War II . [3]
See also
| i don't know |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.