Datasets:
ivrejchik
/
medmcqa-benchmark

Dataset card Data Studio Files Community
2
question
stringlengths
1
1.57k
options
listlengths
4
4
answer
int64
-1
2
A child scratches his hand with a pen. A red wheel appears which persists for 30 minutes. What would be the diagnosis?
[ "Contact urticaria", "Dermographism", "Pressure urticaria", "Atopy" ]
0
Ideal contraceptive for a couple who are living separately in two cities and meets only occasionally:-
[ "Barrier methods", "OCPs", "IUCD", "Inj. DMPA" ]
-1
Which of the following is malignant intraocular tumor of children: September 2010
[ "Retinoblastoma", "Rhabdomyosarcoma", "Melanoma", "Chloroma" ]
-1
The concept of One Stage Full Mouth Disinfection has been put forth to prevent
[ "Adhesion of microorganisms", "Proliferation of microorganisms", "Translocation of microorganisms", "Bacterial invasion" ]
1
For extraction of mandibular molar, anesthesia is given to act on:
[ "Inferior alveolar nerve", "Buccal nerve", "Lingual nerve", "Masseteric nerve" ]
-1
After tonsillectomy, secondary haemorrhage occurs
[ "Within 24 hours", "After 2 weeks", "5-10 post operative days", "After a month" ]
1
Treatment for scabies is
[ "Erythromycin", "Benzene hexachloride", "Piperazine", "Thiabendazole" ]
0
All the following manifestations suggest the development of lymphoma is sjogren syndrome except:
[ "High C4 Complement Levels", "Leucopenia", "Purpura", "Cryoglobulinemia" ]
-1
1729. A 28 yr old female presented with malaise and generalised weakness since 6 month. Her appetite Is reduced and she has giddiness and palpitations on and off. There was no organomegaly. Laboratory Study showed normochromic to hypochromic anaemia and MCV-80. What Is the diagnosis
[ "Thalassemia minor", "Iron deficiency anaemia", "Chronic malaria", "Folate deficiency" ]
0
According to WHO, exclusive breast milk is given upto –
[ "6 months", "4 months", "8 months", "10 months" ]
-1
The skin overlying the region where a venous "cut-down" is made to access the Great saphenous vein is supplied by -
[ "Femoral nerve", "Sural nerve", "Tibial nerve", "Superficial peroneal nerve" ]
-1
Ketocanozole is useful in all except -
[ "T. cruris", "T.versicolor", "T.capitis", "T.corpoiris" ]
1
'Second gas effect' is exerted by which of the following gas when co-administered with halothane:
[ "Nitrous oxide", "Cyclopropane", "Nitrogen", "Helium" ]
-1
Mount Fuji sign is a feature of
[ "Fahr's disease", "Acute bleed", "Chronic bleed", "Tension pneumocephalous" ]
2
After falling on the pavement, a 72-year-old woman is found to have a fracture of the radius and ulna (Colles' fracture). What is true of this fracture?
[ "The fall occurs on the dorsum of the wrist.", "Open reduction is most commonly indicated.", "Younger men are generally affected.", "The distal radial metaphysis is displaced dorsally." ]
2
Identical twins may not have :
[ "Same DNA finger", "Same finger print pattern", "Same blood group", "Same HLA system" ]
0
Denominator of infant mortality rate is?
[ "Per live birth", "per 100 live births", "Per 1000 live births", "Per lakh live births" ]
1
Increased ventilation at sta of exercise is due to?
[ "Stretch receptors", "Proprioceptors", "Pain receptors", "T PCO" ]
0
A 19-year-old woman presents to the clinic for evaluation of primary amenorrhea. Her physical examination is normal, and she has female sex characteristics and breast development. The only abnormality is the absence of body hair. Among other investigations she also has genetic testing that reveals an XY chromosome pattern. Which of the following mechanisms is most likely to explain her phenotypic pattern and amenorrhea?
[ "estrogen receptor defect", "excess hormone production", "androgen receptor defect", "decreased hormone production" ]
1
Epitheliod granulomatous lesions are found in all of the following disease except
[ "TB", "Sarcoidosis", "Berylliosis", "Pneumocystis carinii" ]
2
Which of the following is not an extra aicular feature of Rheumatoid ahritis?
[ "Weight loss", "Pleural effusion", "Conjunctivitis", "Proteinuria" ]
2
Vitamin required for hydroxyproline to proline conversion:
[ "Vitamin C", "Vitamin E", "Pvrodoxal PO4", "Biotin" ]
-1
Bone with a bone appearance is seen in
[ "Osteogenesis imperfecta", "Osteopetrosis", "Scurvy", "Rickets" ]
0
In pancreatic scanning radio-isotope used is
[ "Se75", "Cr51", "I131", "Tc99" ]
-1
UV radiation -
[ "Prevents formation of Pyrirnidine dimmers", "Stimulates formation of Pyrimi dine dimmers", "Purine dimmers", "None" ]
0
A 41/2- year-old girl always had to wear warm socks even is summer season. On physical examination, it was noticed that she had high blood pressure and her femoral pulse was weak as compared to radial and carotid pulse. a chest radiograph showed remarkable notching of ribs along with their lower borders. This was due to -
[ "Femoral artery thrombosis", "Coarctation of aorta", "Raynaud's disease", "Takayasu's arteritis" ]
0
Which wall of hea is enlarged first in a patient with mitral stenosis ?
[ "Left atrium", "Right atrium", "Left ventricle", "Right ventricle" ]
-1
This x-ray is suggestive of
[ "Tetralogy of fallot", "TAPVC", "Tricuspid atresia", "Ebstein's anomaly" ]
-1
40-year-old male presents with fever and abdominal pain and diagnosed with HIV and TB. How will you give treatment?
[ "ATT and AIDS treatment simultaneously", "First ATT and then A", "ATT only", "First A and then ATT" ]
0
A 40 year old male brought to the emergency room with a stab injury to the chest.On examination pt is found to be hemodynamically stable. The neck veins are engorged and the hea sounds are muffled .The following statements are true for this pt except ?
[ "Cardiac tamponade is likely to be present", "a) Immediate emergency room thoracotomy should be done.", "Echocardiogram should be done to confirm pericardial blood", "The entry wound should be sealed with an occlusive dressing" ]
0
A one month old infant with a congenital cardiac lesion shows increased sweating during feeding. Which of the following is the sure sign of congestive cardiac failure in this infant?
[ "Basal crepitations", "JVP", "Pedal oedema", "Liver enlargement" ]
2
In which of the following conditions postmortem caloricity may be seen in death due to -
[ "Massive haemorrhage", "Cyanide poisoning", "Corrosive poisoning", "Septicemia" ]
2
All of the following are true about Ondansetron except?
[ "Drug of choice for chemotherapy induced vomiting", "Dopamine antagonist", "5HT3 antagonist", "Acts on CTZ" ]
0
Tyrosine kinase inhibitors are first line treatment in:
[ "Gastrointestinal stromal tumors", "Receptor mediated neuroendocrine tumors", "Breast cancer", "Renal cell carcinoma" ]
-1
The expression of the following oncogene is associated with a high incidence of medullary carcinoma of thyroid:
[ "p 53", "Her 2 neu", "RET proto oncogene", "Rb gene" ]
1
For polymerase chain reaction which of the following is not required
[ "TAQ polymerase", "d-NTP", "Dideoxynucleotides", "Magnesium" ]
1
Which of the following is a part of secondary granules in neutrophils?
[ "Cathepsin G", "Lactoferrin", "Defensin", "Myeloperoxidase" ]
0
All of the following are features of Mobiz type I block except -
[ "Constant PR interval", "Normal QRS morphology", "Regular atrial rhythm", "Atrial rate - ventricular rate" ]
-1
The best indicator for a potential explosiveness of plague outbreak is-
[ "Total flea index", "Cheopis index", "Specific percentage of fleas", "Burrow index" ]
0
A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels. Skin biopsy specimen was taken.
[ "Clotting disorder", "Septic emboli", "HSP", "Uicarial vasculitis" ]
1
All of the following structures are at risk of damage in anterior cranial fossa fracture, EXCEPT?
[ "Ethmoid sinus", "Facial nerve", "Olfactory bulb", "Roof of nose" ]
0
Functions of basal ganglia include
[ "Gross motor", "Skilled movements", "Emotions", "Maintenance of equilibrium" ]
0
Who described that P. intermedia is responsible for pregnancy gingivitis?
[ "Loesche", "Kornman", "Both", "None" ]
1
Which of the following is true about the main respiratory control neurons?
[ "image_question", "image_question", "image_question", "image_question" ]
2
Swelling of deep lobe of parotid gland presents as swelling in:-
[ "Parapharyngeal space", "Cheek", "Temporal region", "Below the ear" ]
-1
Which of the following is not a parameter in Bishop's score: March 2009
[ "Cervical consistency", "Station of head", "Position of head", "Cervical length" ]
1
Which of the following is primary prevention -
[ "Screening test", "Early diagnosis", "Use of mosquito net", "Restoration of lost function" ]
1
The closest speaking space was suggested by:
[ "Pound", "McGrane", "Neswonger", "Silverman" ]
2
The safest initial approach to open airway of patient with maxillofacial trauma is:
[ "Head tilt-chin tilt", "Jaw thrust technique", "Head lift-neck lift", "Heimlich procedure" ]
-1
Absolute contraindication for IUCD is/ are
[ "Puerperal sepsis", "Current STD", "Uterine anamoly", "All the above" ]
2
Which of the following complications is currently the major limitation to the long-term success of cardiac transplantation?
[ "Allograft rejection", "Graft aeriosclerosis", "Graft atherosclerosis", "Oppounistic infections" ]
0
Infliximab -
[ "CD 20 antagonist", "1L6 antagonist", "Chimeric antibody against TNF alpha", "Chimeric antibody against Her2-neu" ]
1
Which of the following ovarian tumors is most radiosensitive -
[ "Carcinoid", "Dysgerminoma", "Serous Cystadenocarcinoma", "Brenner tumor" ]
0
Preserved in manchester operation: September 2009
[ "Full length of cervix", "Competency of os", "Feility", "Menstruation" ]
2
Red Color on color doppler suggests?
[ "Aerial Blood", "Venous Blood", "Flow towards the transducer", "Flow Away from the transducer" ]
1
Causes of death in drowning are all except : March 2009
[ "Vagal hyperactivity", "Asphyxia", "Ventricular fibrillation", "Laryngospasm" ]
-1
Chloroquine is useful in
[ "Discoid lupus erythematous", "Rheumatoid ahritis", "Infectious mononucleosis", "All of the above" ]
2
Pulp chambers and root canals in deciduous teeth:
[ "Wide and deep", "Shallow and narrow", "Wide and narrow", "Shallow and wide" ]
2
Length of lower esophageal sphincter -
[ "1-2 cm", "3-4cm", "1-2 mm", "3-4 mm" ]
0
A 52-year-old man presents to the eye clinic with painless vision loss of his right eye. He describes the visual loss as a gradual progression from blurry to total blackout over the past two hours. He has no history of prior visual problems. Past medical history is significant for a myocardial infarction three years ago. The patient takes 70mg of aspirin daily. Vital signs are normal. Physical examination reveals 20/20 vision of the left eye but no vision in the right eye. Extraocular muscles are intact. The neurologic examination is normal. The cardiac examination reveals an S4 hea sound. At the molecular level, which of the following components is essential for the first step of the visual cascade?
[ "11-cis-retinal", "All-cis-retinal", "All-trans-retinal", "Meta-rhodopsin ll" ]
-1
In ESI programme central, state, Govt. Employee contribute to the fund. Employer's contribution is -
[ "5.75%", "4.75%", "3.75%", "2.75%" ]
0
Random is Randomization Implies
[ "Unequal and known chances", "Equal and known chances", "Unequal and unknown chances", "Equal and unknown chances" ]
0
The net diffusion of water from one solution of water from one solution through a semipermeable membrane to another solution containing a lower concentration of water is termed
[ "filtration", "diffusion", "osmosis", "brownian motion" ]
1
Reaction due to lysis of bacterial cell wall &necrotic cell product ?
[ "Ahus reaction", "Serum sickness", "Jerish herheximer reaction", "Infectious mononucleosis-ampicillin reaction" ]
1
Tonsillectomy is indicated in -
[ "Acute tonsillitis", "Aphthous ulcers in the pharynx", "Rheumatic tonsillitis", "Physiological enlargement" ]
1
All of the following are contraceptive implants except :
[ "Norplant", "Implanon", "Jadelle", "Mesigyna" ]
2
Which of the following is best to sterilize heat labile solutions?
[ "Dry heat", "Autoclave", "Membrane filtration", "Pasteurization" ]
1
Atherosclerosis is due to
[ "HDL receptor defect", "Apo protein E deficiency", "Decreased LDL activity", "Decreased lipoprotein lipase" ]
0
Characteristics of glycoprotein -a) Protein linked with glycosidic bondb) Core proteinc) Sugar residues are long in carbohydrate portion of glycoproteind) Participate in cell surface recognition
[ "b", "c", "ac", "ad" ]
2
Serological examination of a patient shows positive for anti gliadin antibodies. It is characteristic of the following condition:
[ "Tropical sprue", "Whipple's disease", "Celiac disease", "Intestinal lymphoma" ]
1
Tamoxifen causes ?
[ "Osteoporosis", "Endometrial hyperplasia", "Ovarian cancer", "Decreased triglyceride level" ]
0
Sigmund Freud gave various defense mechanisms. Which of the following is not a mature defense mechanism?
[ "Humor", "Projection", "Asceticism", "Altruism" ]
0
Which which laser is used in the management of after cataract
[ "Argon", "Krypton", "Nd-YAG", "Excimer" ]
1
True about Glomus- jugulare tumour - a) Most common in male b) Arises from non- chromaffin cells c) Lymph node metastasis seen d) Multicentric e) Fluctuating tinnitus and conductive type of hearing loss seen
[ "acde", "abc", "bde", "bcde" ]
1
Most common neonatal disorder screened is:
[ "Neonatal hypothyroidism", "Neonatal hypehyroidism", "Hemoglobinopathies", "Congenital Dislocation of Hip" ]
-1
Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?
[ "A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain", "A mutation in the stop codon resulted in elongation of the b-chain", "A point mutation resulted in the inseion of a stop codon in the b-chain", "A two base pair addition resulted in the elimination of a stop codon in the b-chain" ]
2
All the following aeries supply the Sternocleidomastoid except
[ "Superior Thyroid aery", "Posterior auricular aery", "Occipital aery", "Suprascapular aery" ]
0
Comedons are characteristics of:
[ "Acne vulgaris", "Acne rosasea", "SLE", "d. Adenoma sebaceum" ]
-1
A patient with primary Sjogren syndrome treated with tear replacement for symptomatic relief notes continued parotid swelling for the last 3 months. She also has enlarged posterior cervical lymph nodes. Evaluation shows leukopenia and low C4 complement levels. What is the most likely diagnosis?
[ "Amyloidosis", "Chronic pancreatitis", "HIV infection", "Lymphoma" ]
2
Which of the following drug used in the Management of Pulmonary Hypeension acts by inhibiting Phosphodiesterase enzyme?
[ "Epoprostenol", "Bosentan", "Nifedipine", "Sildenafil" ]
2
Energy requirement for pregnant women doing moderate physical activity with body weight 55 kg
[ "2280", "2580", "2730", "2630" ]
0
An alcoholic patient with history diabetic nephropathy and liver failure is posted for open abdomen surgery. The most appropriate muscle relaxant in this patient is:
[ "Cisatracurium", "Rocuronium", "Vecuronium", "Rapacuronium" ]
-1
Vertibular Schwannoma, spinal cord astrocytoma, meningioma are seen in
[ "Tuberous sclerosis", "Neurofibromatosis - 1", "Von Hippel - lindeu syndrome", "Neurofibromatosis - 2" ]
2
Aspirin is associated with-
[ "Reye’s syndrome", "Sjogren syndrome", "Reitersvnderome", "None of above" ]
-1
Definitive diagnosis of acute pancreatitis is done by-
[ "Lipase", "S. alkaline phosphatase", "Increased Ca++", "Hyperglycemia" ]
-1
A 25 year old person sustained injury in right eye. He developed right comeal opacity following the injury. Left eye was already having poor vision. Corneoplasty of right eye was done and vision was restored. Medicolegally such injury is labelled as :
[ "Grievous", "Simple", "Dangerous", "Serious" ]
-1
Mechanism of action of tacrolimus is ?
[ "Inhibition of transcription of IL 2", "Inhibition of translation of IL 2", "Inhibition of calcineurin", "Both 'a' and 'c'" ]
2
Detoxication of drugs is controlled by
[ "Cytochrome", "Cytochrome p450", "Cytochrome", "Cytochrome A" ]
0
Homonymous hemianopia with sparing of pupillary reflexes Is a feature of lesions of
[ "Lateral geniculate body", "Optic radiations", "Visual coex", "All of the above" ]
2
The most impoant action of beta-blockers in glaucoma is :
[ "Membrane stabilizing effect", "Refinal neuron protecting effect", "Decrease in the production of aqueous humor", "Pupillary constriction" ]
1
A 6 year old girl is easily distracted in class and exhibits poor scholastic performance. Seizures are precipitated by hyperventilation. What is the probable diagnosis?
[ "Myoclonic seizures", "Absence seizures", "Atonic seizures", "Myoclonia" ]
0
Inheritence of ichthyosis vulgaris is :
[ "X linked dominant", "X linked recessive", "Autosomal dominant", "Autosomal recessive" ]
1
The following antibiotic accentuates the neuromuscular blockade produced by pancuronium:
[ "Streptomycin", "Erythromycin", "Penicillin G", "Chloramphenicol" ]
-1
Biosynthesis of glucuronic acid requires the
[ "Oxidation of UDP glucose", "Oxidation of glucose 6-phosphate", "Oxidation of 6-phophoguconate", "Oxidanation of glucose" ]
-1
All nerves pass thorugh greater sciatic notch except ?
[ "Superior gluteal nerve", "Inferior gluteal nerve", "Sciatic nerve", "Obturator nerve" ]
2
Steroids are useful in treating Tuberculosis patient with-
[ "Endobronchial tuberculosis", "Tuberculous osteomyelitis", "Lymphadenitis", "Pneumonia" ]
1
Intravascular hemolysis occurs in:
[ "Hereditary spherocytosis", "Autoimmune haemolytic anemia", "Paroxysmal nocturnal hemoglobinuria", "Thalassemia" ]
1
Graveyard of ENT surgeon
[ "Pyriform Fossa", "Bucco Labial sulcus", "Tonsilolingual sulcus", "Peritonsillar space" ]
1
Compression of a nerve within the carpal tunnel products inability to
[ "Abduct the thumb", "Adduct the thumb", "Flex the distal phalanx of the thumb", "Oppose the thumb" ]
-1
The main difference between composite and amalgam as restorative material is:
[ "Occlusal wear", "Durability", "Retention", "Manipulation" ]
-1