text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the improved detection procedure of this invention can be utilized to detect a broad range of trace organic analytes using a non - selective fiber coating or a selective sample of organic analytes using a selective fiber coating . the improved procedure can be utilized with any organic solvent carrier dissolved or extracted sample from any environment , such as outdoor in nature or in industrial process streams or the like . thus , the term environmental sample is meant to include a trace organic compound - containing sample from any environment . the spme device for carrying out the improved process of this invention is described in the aforementioned pct publication wo 91 / 15745 the disclosure of which has been incorporated herein by reference thereto . such a spme device is available from supelco inc . of bellefonte , pa ., and need not be described further . the improved procedure of this invention is particularly useful in detection of trace or ultratrace amounts of semivolatile organic analytes such as pesticides , herbicides , polychlorinated biphenyl compounds and polynuclear aromatic hydrocarbon compounds , especially at ppb , ppt and ppq levels . the matrix exchange , whereby ( 1 ) a suitable amount of water is added to organic solvent carrier matrix of the test sample containing the trace organic analytes and ( 2 ) the organic solvent carrier matrix is removed to provide the aqueous carrier matrix based detection sample , can be accomplished by any suitable means of removing the solvent , generally by evaporation of the organic solvent carrier utilizing a rotary evaporator or a kuderna - danish evaporator or the like or by membrane separation or the like . once the organic solvent carrier matrix has been replaced by an aqueous carrier matrix , a typical spme extraction and detection procedure can be conducted on the aqueous carrier matrix based detection sample containing trace organic analytes . after extraction of the trace organic analytes on the spme device fiber , the trace organic analytes are desorbed from the fiber in a suitable high resolution instrument such as a gas chromatograph ( gc ) with a mass spectrophotometer ( ms ), an electron capture detector ( ecd ) or a flame ionization detector ( fid ) or the like . desorption can be accomplished by any suitable method , usually by direct heating , laser desorption , or conductive heating , for example microwave desorption or by the curie point magnetic hysteresis method . this invention is particularly useful for the detection of trace and ultratrace amount of semivolatile organic analytes , i . e . organic analytes having a boiling point at least about 25 ° c . higher , preferably about 50 ° c . or more higher than the organic solvent carrier matrix into which they have been extracted from the environmental sample . the time the fiber is contacted with the aqueous matrix or a confined headspace above the aqueous matrix will vary but will generally range from about 1 minute to 30 minutes or more depending on the analytes being detected , the system and the device employed . direct spme of trace organic analytes from extraction solutions in which the analytes are dissolved in solution carrier matrices that are predominantly or completely organic solvents is demonstrated to result in poor , unsatisfactory results due to the overwhelming presence of the organic solvent carrier preventing extraction of the trace organic analytes by the following example . a spme silica fiber of a supelco spme device , which fiber is coated with 7 μm of poly ( dimethylsiloxane ), was inserted for seven minutes into a test sample solution containing 1 ppb of each of the following eighteen pesticides in 1 ml hexane carrier matrix . ______________________________________aldrin endosulfan iα - bhc endosulfan iiβ - bhc endosulfan sulfateγ - bhc endrinδ - bhc endrin aldehyde4 , 4 &# 39 ;- ddd endrin ketone4 , 4 &# 39 ;- dde heptachlor4 , 4 &# 39 ;- ddt heptachlor epoxidedieldrin methoxychlor______________________________________ after removal of the spme fiber from the hexane carrier matrix , the fiber was inserted into the injection port of a gas chromatograph equipped with an electron capture detector , with thermal desorption conducted for trace pesticides and the resulting chromatogram , shown in fig1 was obtained . this chromatogram is quite similar to a reference chromatogram as shown in fig2 for a similar spme extraction of hexane solvent alone . thus , instead of the trace pesticides , the impurity peaks of hexane are shown as the major peaks in the chromatogram of fig1 . the advantageous improvement of this invention is demonstrated in the following example of matrix exchange of the test sample solution of comparative example 1 followed by spme extraction and detection . a test sample solution identical to comparative example 1 having 1 ppb of the 18 pesticides in 1 ml hexane solvent carrier matrix was provided and to this 1 ml of purified deionized water was then added to generate a two - phase mixture . the hexane solvent was then removed using a rotary evaporator under vacuum . water bath at ambient temperature was used . this concentration process was stopped shortly after a homogeneous aqueous carrier based matrix solution was obtained as a detection sample . spme was then conducted by inserting into the aqueous carrier based detection sample , for ten minutes , a spme silica fiber coated with 7 μm poly ( dimethylsiloxane ). after removal of the spme fiber from the aqueous carrier matrix detection sample , the fiber inserted into the injection port of a gas chromatograph with thermal desorption for trace pesticides and the resulting chromatogram , shown in fig3 was obtained . the matrix exchange step has resulted in greatly enhanced , superior detection sensitivity such that pesticide peaks are readily detected . using the unique matrix exchange of this invention , organic solvent carrier matrices are exchanged to water or predominantly aqueous carrier matrices such that spme extraction and detection of trace organic analytes in these resulting solutions give superior sensitivity enhancement . therefore , the analyte enrichment power of common techniques such as liquid - liquid extraction can be successfully combined with spme . the following example describes one of these combined procedures . a first stage of analyte enrichment by liquid - liquid extraction is performed according to a modified epa 608 procedure . sodium chloride ( 100 grams ) was dissolved in 1 liter of water sample containing the following listed fourteen semivolatile pesticides at 50 to 300 parts per trillion ( ppt ) levels to provide an environmental sample for analysis . ______________________________________ chromato - chromato - gram gram peak no . peak no . ______________________________________aldrin , 50 ppt 6 dieldrin , 100 ppt 10α - bhc , 50 ppt 1 endosulfan i , 100 8β - bhc , 50 ppt 2 pptγ - bhc , 50 ppt 3 4 , 4 &# 39 ;- ddt , 300 ppt 14δ - bhc , 50 ppt 4 endosulfan sulfate , 134 , 4 &# 39 ;- ddd , 300 12 300 pptppt endrin , 100 ppt 114 , 4 &# 39 ;- dde , 100 9 heptachlor , 50 ppt 5ppt heptachlor epoxide , 7 50 ppt______________________________________ this homogeneous solution was placed in a separatory funnel and extracted with 60 ml of methylene chloride . this methylene chloride extraction was repeated two additional times . the methylene chloride extracts were combined and concentrated to approximately 1 ml on a rotary evaporator under vacuum . this concentrated solution was transferred to a 10 ml flask for the matrix exchange . gas chromatography / mass spectrometry analysis of this concentrate failed to detect any pesticides ; only solvent and two phthalate contaminants were identified from the resulting chromatogram , shown in fig4 . next , the matrix exchange step of this invention is carried out . to the methylene chloride extracts was added 2 ml of 5 % sodium chloride in water to produce a two - phase mixture . this two - phase mixture was concentrated to a homogeneous aqueous solution using a rotary evaporator under vacuum . half of the resulting solution was transferred to a 1 . 5 ml vial . a spme silica fiber , which is coated with 7 μm of poly ( dimethylsiloxane ), was inserted into the homogeneous aqueous solution for 15 minutes . after removal of the spme fiber from the homogeneous aqueous solution the fiber was inserted into an injection port of a gas chromatography equipped with a mass spectrometer with thermal desorption conducted for the fourteen trace semivolatile organic pesticides and the resulting chromatogram , shown in fig5 positively identified all fourteen pesticides with good signal - to - noise ratios . a detailed portion of the chromatogram in fig5 is shown in fig5 a identifying the fourteen pesticide peaks . endosulfan sulfate ( no . 13 ) and 4 , 4 &# 39 ; ddt ( no . 14 ) coelute with an impurity peak . for comparison , to show the enhanced detection sensitivity , direct spme extraction of a 5 % sodium chloride aqueous solution containing the aforementioned 14 semivolatile pesticides at 10 to 60 ppb levels and subsequent gas chromatography / mass spectrometry analysis was conducted . analysis showed detection sensitivity of the fourteen pesticides as shown by the resulting chromatogram , fig6 . however , coupling of this spme extraction procedure with other known sample enrichment procedure such as liquid - liquid extraction as shown in example 3 demonstrates that improved detections sensitivity of more than 200 - fold ( fig5 ) can be obtained compared to similar , direct spme extraction of pesticides in aqueous matrices . this powerful combination of spme enables chlorinated pesticides at sub - parts per trillion levels using gas chromatograph with electron capture detector . the chromatogram in fig7 clearly demonstrates good detection of fourteen pesticides at 0 . 5 to 3 ppt . for comparison , the background chromatogram for matrix , reagents , solvents and the spme device itself is shown in fig8 . the superior , greatly enhanced detection sensitivity obtained from the combination of common organic solvent sample enrichment techniques , such as liquid - liquid techniques , with spme enables reduced usage of sample , reagents and solvents yet still provides sufficient sensitivity in analysis which can result in significant material and time savings . with the foregoing description of the invention , those skilled in the art will appreciate that modifications may be made to the invention without departing from the spirit thereof . therefore , it is not intended that the scope of the invention be limited to the specific embodiments illustrated and described . | 6 |
the dial 2 represented in fig1 comprises a substrate plate 10 , generally made of brass or of another metal and designed to supply a mechanical support to the construction . the substrate plate 10 is completely or partially covered by a semi - transparent layer 20 chosen according to the aesthetic effect one wishes to achieve . in a preferred construction embodiment , the semi - transparent layer 20 is constituted of a sheet of natural mother - of - pearl of 0 . 4 mm thickness . it is however possible to use other semi - transparent or translucent materials , such as a coat of varnish , lacquer , stained or matted glass , acrylic resin or epoxy or any other semi - transparent plastic resin . the thickness of the semi - transparent layer 20 can also vary according to the effect sought and the material chosen . for the construction of the dial 2 , the substrate plate 10 and the semi - transparent layer 20 are first cut out , embossed , stamped or machined according to the desired shape and size . during this step , the holes 51 necessary for the wheels and staffs of the hands as well as the apertures 54 for the date indicator , if required , are made in the substrate plate 10 and in the semi - transparent layer 20 . on the rear side 22 of the semi - transparent layer 20 , blind hollows 35 are made whose bottom is arranged in the direction of the visible side 21 of the semi - transparent layer 20 . the hollows 35 are then filled with a phosphorescent pigment of the desired color . the present invention allows use of several phosphorescent , luminescent or fluorescent materials , but one will preferably use high - performance non - radioactive phosphorescent pigments , for example super - luminova ® pigments commercialized by luminova sa . once the hollows 35 are filled , a coat 25 of colored varnish is applied to the rear side 22 of the semi - transparent layer 20 . the function of the coat 25 is to give a shade of color to the dial 2 and to seal the pigment 32 to protect it from humidity . the color of the coat of varnish 25 and that of the pigment 32 are chosen so as to blend in normal lighting conditions , when the intrinsic luminosity of the pigment 32 is too weak to be perceived . in darkness , the light generated by the pigment 32 shines through the layer 20 and allows the silhouette of the hollow 35 to be seen , as a luminous image 61 on an obscure background , as can be seen in fig3 . once application of the coat of varnish 25 has been completed , the semi - transparent layer 20 is fastened onto the substrate plate 10 to form the dial 2 . in the subsequent manufacturing phases , the upper side 21 of the dial 2 is polished and optionally provided with indexes 56 and / or other functional or decorative elements that are applied , glued , riveted , serigraphed , transferred , painted or realized through any other method . the luminous intensity of the image 61 depends on the thickness of the layer of pigment 32 and on the thickness d of semi - transparent matter 20 which the light emitted by the pigment 32 must pass through . it is consequently important that the hollows 35 be made with the greatest precision as any local variation of the thickness d will result in a considerable variation of luminous intensity because of the considerable absorption of light by the mother - of - pearl or the semi - transparent material . according to the manufacturing requirements and to the chosen material , the hollows 35 can be made by machining or selective chemical attack or by any other method . in another embodiment of the inventive dial , represented in fig2 , a layer of luminescent pigment 32 is applied by serigraphy , tampography , manually or by any other application method on the rear side 22 of the semi - transparent layer 20 and then covered by the protective layer 25 . this embodiment is very well suited to dials in which the thickness of the semi - transparent layer 20 is particularly thin . in a later embodiment of the inventive dial , also adapted to thin semi - transparent layers 20 , the blind hollows 35 are open in the substrate plate 10 and filled with the luminescent pigment 32 . the coat of colored varnish 25 can in this case be applied to the rear side 22 of the semi - transparent 20 or to the substrate plate 10 . | 6 |
the present invention provides both a method and an apparatus for treating the surface of a substrate . substrates which may be treated by use of the present invention may include a semiconductor substrate , for example a silicon wafer , a photo mask , a flat panel display , a glass component , or any substrate with a surface requiring cleaning , planarizing , or oxidizing in a controlled fashion . the surface treatment presented by the invention may include chemically oxidizing the surface and / or foreign matter contained on the surface by use of ozone ; it may include oxidation of foreign matter contained on the surface coupled with cleaning the surface ; it may include the oxidation of the surface followed by the planarization of that surface , and it may also include the oxidation the surface followed by both a cleaning and planarizing treatment . the cleaning process may include laser steam cleaning , liquid spray cleaning , or chemical bath cleaning , or any other suitable cleaning method . the invention presents an apparatus for carrying out this treatment process . the apparatus includes at least two distinct chambers . the two chambers include an ozone generation chamber and a substrate surface treatment chamber . an additional treatment and / or generation chamber may be used , depending on the process requirements . in the generation chamber , ozone ( o 3 ) is produced from an oxygen source using an optical energy source such as an ultraviolet ( uv ) light beam . optical condensing means disposed along the optical path are used to focus the light beam to a focal point at ( or near ) which location ozone is generated from the oxygen contained in the generation chamber . the generation of ozone in this manner is a clean process , compared with the generation of ozone by use of high voltage across metallic electrodes . the generation of ozone by use of high voltage metallic electrodes often produces metal ion contaminants within the ozone generated . such metal ion contamination is undesirable on a substrate , especially on a semiconductor substrate where metal ion contamination can cause device failure . the apparatus for the present invention also provides a method for withdrawing the generated ozone in a first stream from the generation chamber and transporting it into the treatment chamber . the generated ozone may be mixed with another stream before or after it is delivered to the treatment chamber . in the treatment chamber , the substrate surface is processed first by being exposed to ozone , which can oxidize the substrate surface and foreign material contained on the surface . this ozone treatment may completely remove some foreign material , and , by oxidation , will render other foreign matter more easily removable in subsequent processing . after the oxidation , or “ pre - treatment ,” is complete , the substrate surface is further treated . the subsequent treatment procedure may comprise both a physical component using the light source and a chemical component using a liquid and / or gas source which has been delivered to the treatment chamber and includes the generated ozone . in a preferred embodiment the optical source used to produce the ozone in the generation chamber is the same optical source which extends into the treatment chamber and is used as the laser or ultraviolet light component of the surface treatment . the various embodiments of the present invention may be understood by reference to the following drawings . fig1 shows a beam 1 which provides optical energy . the optical source from which beam 1 emanates may be a laser or uv light source capable of producing ozone at a focal point along the optical path 9 . in a preferred embodiment an excimer laser at 193 nm may be used as the optical source . as shown in fig1 beam 1 is focused to a focal point 3 along the optical axis 8 . ozone is generated at ( and around ) the focal point 3 . various known optical condensing means may be used to focus the beam to a focal point 3 . examples of optical condensing means include a relay system , a keplerian telescope , and a multi - facet homogenizer . a keplerian telescope is depicted in fig1 . beam 1 from the laser / uv source is directed into a spherical or cylindrical lens 2 whereby a focal point 3 is generated at the focal length of the lens 2 . at and around the focal point 3 , ozone is generated and captured within an enclosure surrounding the optical system — the generation chamber . an aperture stop 4 may be used to constrain the optical light bundle directed to the optical element 5 which may also be a cylindrical or spherical lens . the second lens 5 allows for the beam to provide energy to the work surface 6 of the substrate 11 . in a preferred embodiment the ratio of the focal lengths of the first lens 2 and the second lens 5 is approximately 4 : 1 to develop a thin rectangular beam of light at the work surface 6 of approximately four inches by 0 . 125 inches . numerous optical configurations may be used to achieve the desired goal of both generating ozone and providing a light beam component at the work surface 6 . the embodiment depicted in fig1 is just one example . in a preferred embodiment , the configuration of the optical systems may be chosen to achieve the most uniform beam and energy density at the work surface , while simultaneously producing a sufficient supply of ozone in the generation chamber . fig1 a shows an alternative embodiment of the optical system depicted in fig1 . fig1 a includes a quartz window 7 between the optical condensing means and the work surface 6 . the quartz window allows for transmission of the light energy beam . an anti - reflective coating common to the optics industry may be added to the quartz plate to minimize the attenuation during transmission of the beam . this configuration may be used in the embodiment wherein the same optical source is used to perform both the ozone generation in the generation chamber and the substrate surface treatment in the treatment chamber . if the quartz plate is not perpendicular to the incident light beam , an optical compensator , such as a slightly angled lens or another quartz plate , may be used to correct for any abberation of the transmission light beam . fig2 shows a side view of the present invention according to a preferred embodiment having two chambers . the treatment chamber 10 is the chamber in which the substrate is treated . the generation chamber 12 is the chamber where ozone is generated . in the generation chamber 12 , a light source 14 produces a beam 44 which provides optical energy . the source 14 may be adjusted to produce light energy sources of various intensities and configurations . the optical source may be a laser or other uv source . as depicted in fig1 and 1a , optical condensing means are disposed along the optical path 9 to focus the beam 44 to focal point 16 at which ozone will be generated . in an alternative embodiment ( not shown ), the light source may be positioned outside of the generation chamber and a quartz window or other light permeable member may provide for transmission of the beam into the generation chamber . the ozone generated at the focal point 16 within the generation chamber 12 is produced from an atmosphere including oxygen . the atmosphere may be ambient air , or it may include an oxygen containing gas stream 18 delivered to the chamber from a gas source 17 which includes oxygen . the oxygen source stream 18 may include oxygen with a number of other carrier or diluent gases such as nitrogen or a noble gas . the ozone produced in the generation chamber is withdrawn from the generation chamber in a first stream 20 exiting the generation chamber . the means for withdrawing the generated ozone out of the generation chamber may include gas tubing or conduit 24 . the ozone generation process may be regulated by regulating means . generation chamber atmospheric measuring device 56 senses the atmospheric conditions within the chamber . these conditions include the concentration of ozone and oxygen within the generation chamber 12 . measuring device 56 provides this information to atmospheric control means 58 which controls the gas flow 18 into generation chamber 12 by controlling valve 59 which regulates the amount of gas transported into the generation chamber , depending on processing needs . first stream 20 which contains the generated ozone may also include other diluent or carrier gases from the generation chamber such as n 2 or a noble gas depending on processing conditions and the oxygen source , or may be purely ozone . the first stream 20 may be delivered to the process chamber 10 in various manners , with or without prior mixing with another gas or vapor or liquid . in one embodiment , with valves 32 and 30 closed , the first stream containing ozone 20 , is delivered to the treatment chamber 10 through tube or conduit 26 and opened valve 31 , whereby the stream is introduced into the chamber at a point not proximate to the substrate surface to be treated . in an alternative embodiment , valves 31 and 32 are closed while valve 30 is open so that first stream 20 is delivered to treatment chamber 10 at a point proximate to the substrate surface . in another alternative embodiment valve 31 may be closed and valves 30 and 32 may be opened . in this embodiment , the first stream 20 may be mixed with a second stream 34 at the junction 29 of gas tubing members 24 and 46 . the second stream 34 may be a liquid , a gas , or it may be a liquid which is vaporized by the use of heating coils 36 to produce a vapor at the point 29 where the two streams mix . the second gas source 33 of the second stream 34 may include other inert or reactive constituents . these constituents may include noble gasses , n 2 , water , hcl , hf , nh 3 , helium , ipa , or di water . the particular constituent or constituents selected depends on the processing needs and other parameters . in the preferred embodiment , the ozone - containing stream 20 is mixed with deionized water vapor provided by the heating of second stream 34 . the two streams combine at junction 29 to form a gaseous mixture 54 which is transported via tubing member 28 to the substrate surface . the point of delivery 39 may be configured so that it is proximate to the substrate surface being treated , as depicted in fig2 . in the preferred embodiment , the mixture 54 of di water vapor and the ozone - containing stream are delivered proximately to the substrate surface . in an alternate embodiment the point of delivery 39 may be chosen so that it is not proximate to the surface being treated . in another embodiment the mixing between stream 20 and second stream 34 may take place after both have been introduced into the treatment chamber 10 . with valve 30 closed and valves 32 and 31 open , the first stream 20 enters the treatment chamber 10 through tube 26 at point of delivery 37 . the second stream 34 is delivered into the chamber through tube 28 at point of delivery 39 . the point of delivery 39 may again be chosen to be near the substrate surface being treated or may be remote from the surface . in this embodiment , the mixing of the two streams takes place within the treatment chamber 10 . substrate holder 38 holds the substrate 48 within the treatment chamber 10 . the substrate holder 38 may include a chilling element or a heating element depending on the processing treatment so desired . if a chiller is used , a condensate 41 may form on the surface of the substrate from the vapors delivered from tube member 28 to the surface through port 47 which may be a diffuser , nozzle or other orifice at the point of delivery 39 . in the preferred embodiment , the mixture of di water vapor and ozone forms a condensate 41 at the surface . the substrate holder 38 may also include movement means for moving the substrate holder during processing ( surface treatment ) in a known manner . the substrate surface 40 may contain foreign , contaminating material . in the semiconductor processing industry , the surface of a substrate to be treated may be a silicon wafer with an integrated circuit being fabricated onto it . within the semiconductor industry , organic contaminating matter is commonly found on the surface of the substrate , especially due to residual photoresist which may be hardened due to aggressive processing conditions . this is particularly true when the photoresist residual on the substrate surface has been hardened by an ion implantation or plasma etching process . while organic contaminants are common , other contaminants may be present such as metals , silicon , oxides , and minerals . each type of contaminant may require different treatment conditions for most efficient removal . the ozone containing stream 20 or mixture 54 first treats the surface 40 of the substrate 48 by oxidizing matter on the substrate surface 40 . the “ pre - treatment ,” or oxidation , of foreign matter on the surface makes some matter easier to be subsequently removed . such is the case for organic contaminants , such as residual photoresist . alternatively , this oxidation of foreign matter may completely remove the material from the surface 40 . with the foreign matter contained on the substrate now oxidized ( the “ pre - treatment ” complete ), the subsequent treatment processing may now take place . the subsequent processing may include the cleaning and / or planarizing of the surface 40 . cleaning may include laser steam cleaning , cleaning by use of liquid spray , or cleaning within a chemical bath . each type of cleaning requires different conditions for efficient treatment . cleaning is accomplished using both chemical cleaning processes and physical processes . light energy can be used to physically decompose foreign matter such as organics . the light energy source 44 used at the substrate surface 40 in the treatment chamber 10 may be the same light beam 44 as used in the generation chamber 12 to generate ozone . in a preferred embodiment , a solid light permeable member 52 ( e . g ., a quartz plate ) disposed between the two chambers , allows for transmission of a laser beam 44 between chambers . in an alternative embodiment , an optical compensator may replace the quartz plate to correct for any abberations induced and to allow transmission , while retaining ozone generation . in a preferred method for treating the substrate , the substrate holder 48 is moved relative to the laser by use of movement means in a known way , so that the laser sweeps across the substrate surface for steam cleaning . in another preferred method for cleaning , the light source ( feature 14 of fig2 ) may include means such as a rotating mirror or a galvanometer , for moving the beam 44 with respect to a stationary substrate . processing conditions may be chosen to maximize cleaning efficiency for the particular substrate and foreign material being removed . in an alternate embodiment , the processing conditions may be chosen so that the transported ozone , which may be in combination with other carrier or diluent inert gases , reacts more aggressively with the surface to planarize the substrate surface being treated . in yet another embodiment , all three processes may take place : oxidation followed by the cleaning and / or planarizing treatment of the surface . conditions within the treatment chamber 10 may be monitored and controlled to produce the desired surface treatment . a measuring device 42 may be used to measure a plurality of treatment chamber conditions , including the vapor concentration . the measuring device 42 provides information to control means 50 which may control the flow of first stream 20 and the flow of the second stream 34 by means of regulating and modulating means which control gas delivery into the treatment chamber . ozone gas stream regulating and modulating means 22 regulates and modulates the flow of stream 20 ; second stream regulating and modulating means 23 regulates and modulates the flow of second stream 34 , and both modulating means are responsive to control means 50 . by monitoring and regulating the gas delivery to the treatment chamber , the gas mixture concentration requirements may be maintained , and the process conditions at the site on the surface being treated may be controlled to produce the desired treatment . fig3 shows the optical control means which controls light energy in the treatment process as well as the focal point produced by the optical condensing means used in the generation process . optical control means 77 is responsive to inputs from both the measuring device 42 ( as also depicted in fig2 ) and generation chamber atmospheric measuring device 56 ( also as depicted in fig2 ). regulating means 79 , 81 , and 83 are responsive to the optical control means 77 . based on the process conditions , and the conditions for the desired treatment processes , the optical control means 77 may be used to control the optics to maximize ozone generation at the focal point 3 , or , alternatively , the energy distribution and beam density achieved in the treatment chamber at surface 6 . the optical control means 77 may be responsive to real time changes within the treatment chamber and within the generation chamber so that regulating means 79 , 81 , and 83 may regulate the optical source so that the process of ozone generation and the process of surface treatment may be alternately maximized during the simultaneous production of ozone and treatment of a substrate surface . in addition to the optical control means described in conjunction with fig3 the settings within the light source ( feature 14 of fig2 ) may also be varied to produce the light beam characteristics to achieve the desired ozone production or surface treatment needs . such settings , or set of parameters , of a light source , and the manipulation of such settings to achieve the desired light beam characteristics , are well - known in the art . fig4 shows an alternative embodiment of the two chamber apparatus containing a treatment chamber 10 and a generation chamber 12 . in this alternate embodiment two distinct optical energy sources are produced by two light sources 60 and 62 . within the generation chamber 12 , light source 60 provides a beam 64 which by way of optical condensing means is focused to focal point 68 where the ozone is generated . this source 60 may provide a laser or other uv light source capable of producing ozone . a second light source 62 positioned within the treatment chamber 10 provides a separate beam 66 as an optical energy source which is used in surface treatment . the beam 66 typically used for surface treatment will be a laser . in an alternative embodiment ( not pictured ) either optical source 60 or 62 may be situated outside of the generation chamber and the treatment chamber . the substrate 48 may be introduced into the treatment chamber by a substrate loading means ( also not depicted ). the substrate loading means may provide for automated loading , and may further comprise substrate unloading means . thus , the introduction of the substrate to the treatment chamber may be done manually , automatically , or continuously . the substrate loading means may further include movement means 70 , which provide for motion of the substrate relative to the optical energy source , during the treatment process . this will allow for the optical beam to sweep across the substrate surface during processing . fig5 shows an alternative embodiment of the two chamber apparatus including a generation chamber 12 and a treatment chamber 10 . in the embodiment depicted in fig5 the first stream containing ozone 20 is delivered into the process chamber by means of gas tubing or conduit 72 . the second stream 34 is delivered into the treatment chamber by use of gas tubing or conduit 74 . in this alternative embodiment gas tubings 72 and 74 are distinct and are not connected . in this embodiment no mixing may occur prior to the introduction of the two streams to the treatment chamber where the streams are intermixed . the previous embodiments were shown to illustrate some of the various embodiments of the present invention and are not intended to limit the scope nor the spirit of the present invention . the method of ozone generation at the focal point of the optical energy source may be carried out in a number of manners . the oxygen source from which the ozone is produced may be delivered to the generation chamber in a number of manners with a number of additional components or it may comprise ambient air . the means for withdrawing and delivering the generated ozone from the generation chamber to the treatment chamber may take many forms . a second stream may be added to the ozone containing stream , or it may not be utilized . the mixing location and method may be varied . the treatment carried out within the treatment chamber may include oxidation , cleaning , planarization , or any combination of the three . the invention may include one light source for carrying out both processes , or it may include more than one . although illustrated and described herein with reference to certain specific examples , the present invention is nevertheless not intended to be limited to the detail shown . rather , various modifications may be made to the details within the scope and range of equivalence of the claims and without departing from the spirit of the invention . such modifications include , for example , various embodiments of the apparatus configuration , the treatment process , the gas or liquid transporting means , the mixing points , the applications for different substrates , the means for regulating and controlling the conditions in the generation chamber , the conditions in the treatment chamber , and the optical energy source used . the scope of the present invention is expressed by the appended claims . | 1 |
the present invention is directed to a process for heat recovery at the high - boilers column ( s ) ( often also called “ dce column ”) of that plant component within a vce complex that is dedicated to the distillative purification of dce . de 34 40 685 a1 already proposed in this regard that the vapor from the top of this column be mechanically compressed and used for heating the selfsame column . however , it is energetically more favorable to operate the high - boilers column at a sufficient pressure and / or temperature that the overhead stream ( vapor ) from the column is suitable for implementing heat recovery measures . on the other hand , the overhead temperature of the column must not be so high as to cause the product ( feed dce ) to be damaged by decomposition . de 35 19 161 a1 describes a process for purifying dce , in which a distillation column is operated in such a way that a temperature at the top of 125 - 180 ° c . results . the gaseous dce discharged at the top of this column is passed through heat exchangers which serve to heat dce - containing product streams . the dce condensed in the heat exchangers is then returned to the column and is partly discharged as purified product and reused . the process described increases the energy efficiency of the plant considerably . nevertheless , the total thermal energy present in the overhead product cannot be utilized , but instead the dce stream condensed in the heat exchangers has to be actively cooled . it would be desirable for the heat content of the overhead product from the high - boilers column , which has hitherto not been utilized , also to be able to be used for heating plant components . it transpired that , surprisingly , the high - boilers column can be operated at overhead temperatures between about 120 - 150 ° c ., preferably between 127 and 135 ° c ., without any damage to the product being observed . for this , the high - boilers column is operated under superatmospheric pressure , for example in the range from 2 . 7 to 5 . 3 bar absolute and the vapors thus generated are used to obtain low - pressure steam which is used for indirect heating of components of the dce plant or of components of the downstream vcm plant and / or pvc plant . in the indirect heating of plant components of the dce plant , the vcm plant and / or the pvc plant , it has been found that the entire useable heat content of the vapors from the high - boilers column ( s ) can be utilized by producing low - pressure steam . the generation of low - pressure steam is also preferred for heating physically further - removed heatsinks for safety reasons . the generation of low - pressure steam from the vapors from a high - boilers column operated under superatmospheric pressure in a dce plant has hitherto not been described . the present invention provides a process for production of vinyl chloride by thermal cleavage of 1 , 2 - dichloroethane in a vinyl chloride complex incorporating a distillative purification of 1 , 2 - dichloroethane comprising at least one high - boilers column in which substances boiling higher than 1 , 2 - dichloroethane are removed and incorporating an optionally attached polyvinyl chloride plant , said process involving the measures of a ) operating the high - boilers column at overhead temperatures between 120 - 150 ° c ., and b ) using at least part of the overhead stream from the high - boilers column to obtain thermal energy used in heatsinks of a plant component dedicated to producing 1 , 2 - dichloroethane , and / or in heatsinks of a downstream plant component dedicated to producing vinyl chloride , and / or in heatsinks of a downstream plant component dedicated to producing polyvinyl chloride , with c ) the overhead stream being used for indirect heating of heatsinks by using at least part of the overhead stream from the high - boilers column to generate low - pressure steam and returning the overhead stream into the high - boilers column following condensation with or without supercooling and using the low - pressure steam for heating selected parts of the plant . for the purposes of the present description , low - pressure steam is steam which typically has a temperature in the range from 115 to 145 ° c ., preferably from 118 to 130 ° c . the overhead stream is used for indirect heating of heatsinks by using at least part of the overhead stream from the high - boilers column to generate low - pressure steam , for example in a heat exchanger such as an evaporator , and returning the overhead stream into the high - boilers column following condensation with or without supercooling and using the low - pressure steam for heating selected parts of the plant . this method is preferable for heating plant components far removed from the high - boilers column , for example for heating heatsinks in a downstream vcm plant and / or a downstream pvc plant . any type of common heat exchanger can be used for the indirect heating of heatsinks . particular preference is given to heat exchanger types which enable heat to be transferred at particularly low temperature differences between the hot side and the cold side . very particular preference here is given to falling - stream evaporators , plate - type heat exchangers , coil - type heat exchangers or tube - bundle heat exchangers , the latter being fitted with tubes specifically suitable for heat exchange at low temperature differences ( e . g ., “ high - flux ” tubes from honeywell uop , houston tex ., usa ). suitable and preferred heatsinks in a plant complex for vcm / pvc production are : dewatering column ; low - boilers column or dce stripper ; vacuum column ; boiler feed water devolatilizer ; stripping column for removing dce from wastewater ; and stripping column for purifying ( removing hcl ) vinyl chloride . apparatuses for removing residual monomer ( vcm ) from pvc , specifically a predevolatilizing device and a downstream devolatilizing column ; stripping column for removing vcm from wastewater ; apparatus for drying pvc powder ; and apparatus for heating batch water for the polymerization reaction . the process according to the invention is distinguished by the fact that the indirect heating of heatsinks is carried out with low - pressure steam generated from the overhead stream from the high - boilers column of the dce plant . preference is given to a process for production of vinyl chloride and polyvinyl chloride wherein the bottom product from the high - boilers column has a dce content of 90 - 97 wt %. in a preferred process variant , the dce purified by distillation in the high - boilers column is used without further treatment for the thermal dissociation to form vinyl chloride . the operation of the high - boilers column and of the attached heat exchangers can surprisingly be carried out without interruption for a long time . thus , uninterrupted operation for from 6 to 24 months is quite possible without cleaning of these plant components being necessary during this time . the invention further provides a process in which the high - boilers column is operated without interruption for from six to twenty - four months . the invention also provides apparatus for production of vinyl chloride by thermal cleavage of 1 , 2 - dichloroethane in a vinyl chloride complex incorporating a distillative purification of 1 , 2 - dichloroethane and an optionally attached polyvinyl chloride plant , said apparatus comprising the elements a ) at least one high - boilers column in the plant component dedicated to the distillative purification of 1 , 2 - dichloroethane where substances boiling higher than 1 , 2 - dichloroethane are removed , b ) at least one heat exchanger which is connected to the high - boilers column and into which at least part of the overhead stream from the high - boilers column is conveyed to be condensed and optionally supercooled therein to obtain heat by generating low - pressure steam and then to be returned into the high - boilers column , and c ) at least one heatsink of a component plant for production of 1 , 2 - dichloroethane and / or in an attached component plant for production of vinyl chloride and / or in an attached component plant for production of polyvinyl chloride , into which the low - pressure steam generated in heat exchanger b ) is conveyed for heating purposes . the heatsinks used in the parts of the vcm complex and / or of the pvc plant are preferably the apparatuses described above . the process of the present invention or the apparatus of the present invention provides a distinct improvement in the energy balance of the plant complex . | 1 |
fig1 schematically shows an apparatus 1 comprising a vacuum treatment chamber 2 and a u - shaped electrode 6 for accommodating the hollow bodies 4 to be treated . as can be seen in fig4 , the u - shaped electrode 6 extends over an angle of about 220 °. the u - shaped electrode 6 is horizontally arranged along a circular path in the vacuum treatment chamber 2 . the vacuum treatment chamber 2 has positioned therein a plurality of tubular counter electrodes 8 that during plasma treatment project into the interior of a respective hollow body 4 . furthermore , there is provided a means for conveying the hollow bodies 16 in the form of a rotor in the vacuum treatment chamber 2 so as to move the hollow bodies 4 relative to the u - shaped electrode 6 in such a manner that the hollow bodies 4 are moved along a circular path through the interior of the u - shaped electrode 6 . the apparatus 1 comprises two separate pump systems or suction devices 12 and 14 . pump system 12 generates a vacuum ( p 1 ) in the vacuum treatment chamber 2 ; pump system 14 generates a vacuum ( p 2 ) in the hollow bodies 4 . the pressure ( p 2 ) is at least 10 to 2000 times lower than the pressure ( p 1 ). to be more specific , pressure ( p 2 ) is about 2 pa , and pressure ( p 1 ) about 3000 pa . during plasma treatment a sucking out of the hollow body 4 is continuously carried out via pump system 14 . the u - shaped electrode 6 is electrically connected to the generator 10 and is electrically isolated from the housing of the treatment chamber 2 . the generator 10 is arranged outside the vacuum treatment chamber and its housing is grounded . the generator can produce an electrical alternating voltage between the u - shaped electrode 6 and the also grounded tubular counter electrode 8 . an electromagnetic field in the high - frequency range is thereby generated in the interior of the u - shaped electrode 6 . the electromagnetic field is in the khz to mhz range , particularly in the range of 1 khz to 100 mhz . the generator output is e . g . 20 kw . the generator 10 may consist of a plurality of individual generators , e . g . of four generators with 5 kw each . in the apparatus conventional holding and transporting systems can be used for holding or transporting the hollow bodies 4 ( not shown ). the grippers are preferably electrically isolated from the housing mass so as to prevent any plasma between the grippers and the u - shaped electrode . fig2 shows an enlarged section of the apparatus 1 , which illustrates a u - shaped electrode 6 into which a hollow body 4 is immersed . a tubular counter electrode 8 is positioned inside the hollow body 4 . the hollow body 4 is sealed in gas - tight fashion relative to the interior of the vacuum treatment chamber 2 via a sealing device 22 . the sealing device 22 is combined with a valve 24 which is opened during plasma treatment , so that a suction of the hollow bodies 4 by the pump system 14 to reach pressure p 2 can be performed . in an alternative embodiment , the valve connection , i . e . the valve 24 and the sealing device 22 , is rotatable so that the containers 4 are rotated during coating . this permits a particularly uniform plasma treatment . the side walls of the u - shaped electrode 6 are arranged in parallel with the tubular counter electrode 8 . the distance of the tubular counter electrode 8 from the side walls of the u - shaped electrode 6 is substantially the same . as a result , a uniform electromagnetic field can be generated in the interior of the u - shaped electrode 6 , so that a plasma treatment of the hollow bodies 4 that is as uniform as possible can be carried out . fig3 shows in detail the design of the tubular counter electrode 8 . the outer diameter of the tubular counter electrode 8 is about 10 mm . the tubular counter electrode 8 is a hollow tube and comprises a multitude of openings 18 through which the process gases can be introduced into the interior of the hollow body 4 . the diameter of the openings 18 is about 0 . 3 mm . along the longitudinal axis of the tubular counter electrode 8 seven openings 18 are provided ; along the transverse axis four are provided at one level at an angle of 90 °, so that the tubular counter electrode 8 comprises a total of 28 lateral openings 18 . the distance of the openings 18 along the longitudinal axis is between about 8 - 25 mm . the distance of the openings 18 along the longitudinal axis is irregular in such a way that the distance between the openings towards the electrode end and the container bottom , respectively , is decreasing . in addition one or more further openings 18 are provided at the lower end of the tubular electrode 8 . due to this distribution of the openings 18 the input of process gases can be set such that a uniform plasma treatment is achieved throughout the hollow body , and an efficient , fast and inexpensive procedure is possible . the length of the tubular counter electrode 8 is adapted to the height of the hollow body 4 . the distance between the bottom of the hollow body 4 and the lower end of the tubular counter electrode 8 is not more than about 50 mm . at larger distances a uniform plasma treatment cannot be guaranteed for the reason that the electromagnetic field is no longer uniform . the length of the tubular counter electrode 8 can be adjusted in a variable way in that the tubular counter electrode 8 is shifted relative to the sealing device 22 . this permits a variable , efficient and inexpensive design of the apparatus 1 because the length of the tubular counter electrode 8 can be adapted easily and rapidly to different lengths of the hollow body 4 . furthermore , the tubular counter electrode 8 comprises a mounting unit 19 for mounting on the sealing device 22 . the mounting unit 19 is configured such that the tubular counter electrode 8 can be exchanged via a screw - type or plug - type unit in a fast and efficient way . an adaptation to different lengths of the hollow body 4 is possible through the exchange of the tubular counter electrode 8 . a further advantage is the fast and simple exchangeability for reasons of maintenance . the tubular counter electrode 8 consists essentially of an electrically conductive material , particularly copper or special steel , and it is connected in an electrically conductive way via the generator 10 to the u - shaped electrode 6 . the interior of the tubular counter electrode 8 accommodates a bar magnet ( not shown ) consisting of a cobalt / samarium alloy . the tubular counter electrode 8 comprises a removable sleeve 20 via which the magnet can be exchanged . the magnet extends in its length from the end of the tubular electrode up to the region in which the hollow body diameter becomes smaller . due to the magnet the plasma is changed such that the electrode is not coated and a particularly efficient procedure is thus possible . furthermore , a uniform plasma treatment is guaranteed . fig4 shows a design of the apparatus 1 in a top view . the apparatus 1 comprises an airlock device 36 for introducing the hollow body 4 into the vacuum treatment chamber 2 . furthermore , the apparatus 1 comprises an inlet star 30 and an outlet star 28 for the transfer of the hollow bodies 4 to a rotor 16 . the rotor 16 serves to move the hollow bodies 4 relative to the u - shaped electrode 6 while the plasma treatment is carried out . the hollow bodies 4 are moved via the lifting curves 34 and 32 from the level of the inlet star 30 and outlet star 28 to the level of the u - shaped electrode 6 . fig7 shows the apparatus 1 once again as a sectional drawing . the hollow bodies 4 are connected to the rotor 16 via a mounting device ( not shown ). this is done via so - called neck handling , i . e . the mounting is carried out via the hollow body neck . such mounting / handling systems are known from the prior art . fig5 shows an alternative embodiment of the apparatus 1 , in which the u - shaped electrode 6 is subdivided in the form of segments , so that four segments 6 a - d are formed . the presence of this u - shaped electrode 6 that is subdivided into segments has the advantage that the power needed for generating an appropriate electromagnetic field on the u - shaped electrode 6 in relation to the tubular counter electrodes 8 is reduced , so that a particularly efficient and inexpensive procedure is possible . in the apparatus i a method can be carried out as follows : a multitude of hollow bodies 4 are continuously introduced via an airlock device 36 into the vacuum treatment chamber 2 in which a vacuum ( p 1 ) is produced via the suction device 12 . the hollow bodies 4 are transferred via an inlet star 30 to a rotor 16 . the hollow bodies 4 are moved in a circle through the rotation of the rotor 16 . through a lifting curve 34 and with the progress of the rotary operation one hollow body each is guided over a counter electrode 8 , so that the tubular counter electrode 8 is oriented into the interior of the hollow body 4 . at the same time the hollow bodies 4 are introduced at least in part into the inner portion of a u - shaped electrode 6 through the lift / rotational movement . the hollow bodies 4 are pressed against a sealing device 22 through the lifting operation , whereby a gas - tight sealing of the inner portion of the hollow body is achieved relative to the vacuum treatment chamber 2 . this opens a valve 24 , so that a vacuum ( p 2 ) is generated via the suction device 12 in the interior of the hollow body 4 and a continuous sucking operation is performed . subsequently , process gases are introduced via the openings 18 of the tubular counter electrode 8 into the interior of the hollow bodies 4 . the generator 10 , which is connected to the u - shaped electrode 6 in an electrically conductive way , now generates an electromagnetic field relative to the grounded tubular counter electrode 8 within the inner portion of the u - shaped electrode 6 . with the progressing rotation of the rotor 16 the hollow bodies 4 are moved through said electromagnetic field and a plasma is generated in the interior of the hollow bodies . this means that the plasma treatment of the hollow bodies 4 takes place while the hollow bodies 4 are positioned in the inner portion of the u - shaped electrode and are moved relative to the u - shaped electrode . after the plasma treatment a downward movement of the hollow bodies 4 is carried out via a lifting curve 32 . the sealing device 22 is thereby opened and the valve 24 is closed , so that pressure ( p 1 ), which prevails in the vacuum treatment chamber 2 , is set in the interior of the hollow bodies . with the progressing rotary movement the hollow bodies exit out of the inner portion of the u - shaped electrode 6 , and the tubular counter electrodes 8 are removed by the downward movement out of the interior of the hollow bodies . the plasma in the interior of the treated hollow bodies 4 is thereby extinguished . subsequently , the hollow bodies 4 are transferred from the rotor 16 to an outlet star 28 and ejected out of the vacuum treatment chamber 2 . it is possible with the method to generate plasma in a multitude of hollow bodies 4 with a single u - shaped electrode 6 . due to the presence of the electromagnetic field across the whole inner portion of the u - shaped electrode 6 an action of the plasma on each individual hollow body for a long period of time is guaranteed also during the relative movement of the hollow bodies 4 . as a result , no individual chambers are needed as all of the hollow bodies positioned inside the apparatus are located in the same u - shaped electrode . this provides for a particularly efficient and inexpensive procedure because the introduction of the hollow bodies 4 into a multitude of individual chambers can be dispensed with . the pressure is set such that pressure ( p 2 ) in the interior of the hollow bodies 4 is at least 10 to 2000 times smaller than the pressure in the vacuum treatment chamber 2 ( p 1 ). this ensures that the plasma treatment takes place exclusively in the interior of the hollow bodies 4 . this has the advantage that the interior of the hollow bodies is exclusively treated . this means that the place of the plasma treatment can be controlled in an efficient way , whereby an efficient , energetically advantageous procedure is made possible . the frequency of the electromagnetic field is in the high - frequency range , preferably in the khz to mhz range , particularly in the range of 1 khz to 100 mhz . this permits a particularly efficient and inexpensive procedure . in an alternative embodiment of the procedure according to fig5 , a hollow body is treated with different plasmas in the course of the plasma treatment . this is achieved in that the u - shaped electrode 6 a - d is built up in the form of segments , and different electromagnetic fields in terms of field strength and / or frequency are thereby generated . this has the advantage that in the course of the plasma treatment of a hollow body within the u - shaped electrode 6 the hollow body 4 passes through different electromagnetic fields due to the relative movement with respect to the u - shaped electrode 6 , thereby making the plasma treatment different . the process gases are added into the hollow body through the openings 18 , which are positioned along the longitudinal axis of the tubular counter electrode 8 . the simultaneous addition of the process gases via a number of openings 18 has the advantage that the process gases are added into the hollow bodies 4 in such a way that a uniform and particularly efficient plasma treatment is possible . especially in the case of a plasma coating process a layer thickness that is as uniform as possible can thereby be achieved . this permits an efficient , fast and inexpensive procedure . the tubular counter electrodes 8 are heated while the plasma treatment is performed . this has the advantage that particularly in the case of a plasma coating process no layer is deposited on the surface of the tubular counter electrode 8 , or layer deposition is considerably reduced . the tubular counter electrode 8 is heated due to the use of high - frequency energy without active heating elements or the like because due to the plasma operation the electrodes are here heated . the temperature of the tubular counter electrode 8 is in the range of not more than 100 ° c . when the method is carried out . the advantage of such a heating must particularly be seen in the fact that the openings 18 are not coated or are less strongly coated during plasma coating and a uniform gas input is thereby possible according to the disclosure over a long period of time . hence , an efficient and inexpensive procedure is possible because maintenance , i . e . an exchange of the rod - shaped electrode 8 , is not needed or is only needed to a minor extent . the apparatus i serves to carry out a plasma treatment method used for hollow bodies 4 and particularly a pecvd process for inside coating with a siox layer 5 . alternatively , a dlc layer may also be deposited . a coated hollow body is shown in fig6 . | 2 |
polymers prepared according to this invention have a recurring structure expressed by the following formula ( 1 ): ## spc1 ## wherein t 1 , t 2 , t 3 and t 4 are substituents which will be described below . the polymers are important high molecular materials having excellent thermal , mechanical , electrical and chemical properties . the catalyst used in this invention is a basic , manganese chelate compound represented by the following formula ( 2 ): ## spc2 ## wherein r 1 stands for ethylene , hexamethylene , and o - phenylene groups , q stands for a hydrogen atom or a hydrocarbon group , r stands for a hydrogen atom , a hydrocarbon group , a hydrocarbon - oxy group , a halogen atom , an amino group , and a stands for a ethylene diamine . it has already been disclosed in l . h . vogt , h . l . finkbeiner et al . &# 34 ; journal of organic chemistry &# 34 ;, ( 34 ) ( 2 ), 273 ( 1969 ) that chelate compounds formed by substituting the cobalt atom of the &# 34 ; salcomine &# 34 ; compound by manganese , iron , nickel or copper , exhibit no activity under conditions where the &# 34 ; salcomine &# 34 ; can oxidize and condense phenols . therefore , it is impossible to anticipate that the basic manganese chelate compound of this invention will exhibit a very high activity for oxidative condensation of phenols . hence , this invention substantially advances the art . in the practice of this invention , it is preferred that the basic manganese chelate compound to be used act sufficiently stable under conditions for oxidative condensation of phenols , which will be detailed below . in view of such stable action , it is preferred that r 1 in the above formula ( 2 ) not be a group having too long a chain ( for example , decamethylene group and the like ), because such a long chain group reduces the stability of the catalyst . further , in case r is a highly hydrophilic atom or atomic group ( for example , sulfonic acid group and the like ), the solubility of the basic manganese chelate compound in organic solvents is lowered substantially . thus , r as such highly hydrophilic atom or atomic group should be avoided . the attainment of the highly active state of the chelate compound depends , it is thought , on the atomic group represented by a in the above formula . as described above , a is ethylene diamine . examples of r 1 , q , r and a in formula ( 2 ), giving especially preferred basic manganese chelate compounds are ; ethylene , hexamethylene and o - phenylene groups as r 1 ; hydrogen atom and methyl group as q ; hydrogen atom , chlorine atom , methyl group and methoxy group as r ; and ethylene diamine as a . typical examples of preferred chelate compounds are ethylene diamine complexes , of n , n &# 39 ;- ethylene - bis ( salicylidene iminate ) manganese , n , n &# 39 ;- ethylene - bis ( 3 - methoxysalicylidene iminate ) manganese and n , n &# 39 ; - ortho - phenylene - bis ( 5 - chlorosalicylidene iminate ) manganese . processes for synthesis of the basic manganese chelate compounds to be used in this invention have been known in the art . for instance , they are usually synthesized by reacting under heat , a manganese salt , an amine , and salicyl aldehyde or its derivative with ethylene diamine in an organic solvent or water , or by forming a schiff base in advance by subjecting a diamine and salicyl aldehyde or its derivative to hydrating condensation and then reacting it with a manganese salt and ethylene diamine in a solvent . by these synthesis methods , the basic manganese chelate compounds are obtained in the form of solids or catalytic solutions . the amount of catalyst used varies , depending upon the reaction conditions ( such as temperature , kind of solvent , solvent composition , pressure and other factors ) and on the degree of polymerization desired in the resulting polymer . thus , it is impossible to specify in a generalized simple manner the amount of catalyst to be used . however , good results are generally obtainable when the catalyst is used in an amount of 0 . 1 mole % or more based on the phenol , which will be detailed below . the japanese patent publication 22154 / 70 , wherein is disclosed a method of using chelate compounds of the &# 34 ; salcomine &# 34 ; type , teaches that in continuous polymerization it is advantageous to use higher concentrations of catalysts , up to 10 mole percent , whereas in the process of this invention , using continuous polymerization , it is sufficient that the catalyst be used in such a low concentration as below 10 mole % to 0 . 1 mole percent , and preferably 1 to 3 mole percent . thus , higher productivity is attained in the process of this invention . phenols to be used in this invention have the following general formula ( 1 ) ## spc3 ## wherein x stands for hydrogen , and t 1 , t 2 , t 3 , t 4 and t 5 stand for at least hydrogen atom , a hydrocarbon group , and / or a hydrocarbon - oxy group , said groups being free of aliphatic tertiary alpha - carbon atom . specific examples of t 1 , t 2 , t 3 , t 4 and t 5 include hydrogen , atoms , and methyl , ethyl , propyl , propenyl , phenyl , methoxy , ethoxy , phenoxy , groups , etc . as typical examples of the above formula phenols there are o - cresol , 2 , 6 - dimethylphenol , 2 , 6 - diethylphenol , 2 , 6 - dimethoxyphenol , 2 , 6 - dipropenylphenol , 2 , 6 - diphenylphenol , 2 , 4 , 6 - trimethylphenol , 3 - methoxyphenol , and the like . they may be used singly or in admixtures of two or more . in practicing this invention , it is not always necessary to use a solvent . however , in the absence of a solvent , the viscosity of the reaction mixture increases with advance of the reaction and hence , diffusion of oxygen as an oxidant , which will be described below , is inhibited , with the result that a polymer of a high degree of polymerization cannot be readily obtained . moreover , re - dissolving and precipitating steps are required for recovering the catalyst from the resulting polymer . for these reasons , the method which does not use a solvent is of little significance from the commercial viewpoint . it is preferable to practice the process with use of a solvent . almost any organic solvent may be used in this invention . more specifically , there may be used aromatic and substituted aromatic hydrocarbons such as benzene , toluene , xylene , anisol , chlorobenzene , dichlorobenzene , bromobenzene , nitrobenzene and benzonitrile ; ketones such as acetone and methylethylketone ; esters such as ethyl acetate and amyl acetate ; alcohols such as methanol , ethanol , propanol , isopropanol and butanol ; halogenated hydrocarbons such as chloroform , methylene chloride , 1 , 2 - dichloroethane , methyl chloroform , 1 , 1 , 2 - trichloroethane and 1 , 1 , 2 , 2 - tetrachloroethane ; ethers such as tetrahydrofuran and dioxane ; and amides such as dimethyl formamide , dimethyl acetamide and hexamethyl phosphoamide . some of the aforementioned solvents do not dissolve well the basic manganese chelate compound used as the catalyst or the resulting polyphenylene oxide . in this case , the reaction is allowed to advance at the catalyst concentration determined by the solvent , or a polymer which comes to have a degree of polymerization determined by the solvent forms a separate phase in the reaction mixture . for example , although the catalyst is not sufficiently dissolved in benzene , upon addition of the starting phenol the reaction system becomes homogeneous and the catalyst precipitates in the form of solids with the advance of the reaction , while the polymer is obtained in a state dissolved in benzene . accordingly , in such a case , it is possible to recover the catalyst by filtering the reaction mixture and to restore the catalyst to its original state . however , these procedures are complex and not preferred . thus , it is especially preferred to use various solvents in the form of admixtures . good results are obtained by employing a combination of an aromatic or substituted aromatic hydrocarbon or halogenated hydrocarbon which is a good solvent for the polymer , with an alcohol or other solvent which is a good solvent for the catalyst and can also act as a diluent for water formed by the reaction . if such combination is employed , since an alcohol does not dissolve the polymer , when the polymer comes to have a degree of polymerization determined by the composition of the mixed solvent , it forms a separate phase and precipitates in the form of particles . when such separate phase is formed , a degree of polymerization does not , or hardly does , increase in the known catalyst systems . for example , in the case of a copper - amine complex , even if an alcohol is used in combination with a good solvent for the polymer , the degree of polymerization of the precipitated polymer does not increase when it is allowed to stand still in the reaction system for a long time ( see comparative example 7 ). again in the case of a catalyst of the &# 34 ; salcomine &# 34 ; type , the above - mentioned patent disclosing the catalyst suggests that a polymer having a certain degree of polymerization is obtained by forming a separate phase , and it is readily presumed that the degree of polymerization hardly changes in the polymer which has formed such separate phase . in contrast , surprisingly , it has been unexpectedly found that in case the catalyst of this invention is used , the polymer which has already formed a separate phase still undergoes continuously , the oxidizing coupling reaction and is converted promptly to a polymer of a high molecular weight . in view of the fact that the degree of increase in the degree of polymerization is very conspicuous , the inventors concluded that at the above stage , the oxidizing coupling reaction at the polymer head ( phenol end ) and at the polymer tail ( phenyl end ) dominates over the quinol - ether equilibrium reaction . this phenomenon makes it possible to obtain a polymer of a very high degree of polymerization within a short time and with use of a small quantity of catalyst . this is a prominent feature of this invention . although the resulting polymer contains a very small amount of catalyst , since the catalyst is very easily soluble in an alcohol , it can be readily removed from the polymer . thus , advantageously , the resulting polymer is substantially free of impurities . the reaction liquor , from which the polymer has been separated , is incorporated with a fresh catalyst corresponding to the catalyst which accompanied the polymer and was excluded , and then is subjected to treatment with a dehydrating agent which will be described below , following which steps the starting phenol is added thereto and the polymerization is again conducted . addition of a basic substance such as amines , diamines , amides , is effective in increasing the reaction rate , thereby further heightening the molecular weight of the polymer and elevating the selectivity of the oxidation reaction . use of such basic substances is not always necessary , howeve , because the catalyst of this invention is highly active and exhibits a high selectivity of the oxidation reaction . in case such basic substance is used , it is advantageous to use it in an amount of at least 1 / 2 mole per mole of the catalyst . however , it is preferred to use it in not too great an amount ( for example , in an amount similar to the reaction solvent ), because the lowering in the reactivity is likely to occur because the basic substance exhibits a higher coordination to the manganese chelate compound than to the starting phenol . the reaction temperature should be determined , depending on the reaction rate and the selectivity of the reaction . it is generally preferred to conduct the reaction at temperatures not exceeding 100 ° c . at higher temperatures , the reaction rate may be heightened but side reactions such as formation of quinones are readily caused to occur . moreover , the reaction should not be conducted at termperatures exceeding the boiling point under the reaction conditions of the solvent used , because boiling of the solvent prevents the dissolution of oxygen into the reaction liquor , which will be described below . the use of a dehydrating agent inhibits the deactivation of the catalyst ( oxidation to manganese dioxide and conversion to an inactive chelate ) and brings about good results . generally , as the dehydrating agent there may be used molecular sieve , alumina , silica gel and the like . as the oxidant , there may be used oxygen , air and oxygen diluted with an inert gas . in general , use of oxygen establishes a reaction system exhibiting a maximum reaction rate . in case easy control of the reaction is desired , it is preferable to use diluted oxygen . although reacting oxygen under high pressure contributes to increasing the reaction rate , since the catalyst of this invention is sufficiently active , such high pressure is not absolutely necessary . the termination of the reaction may be known from substantial stopping of consumption of oxygen and / or of stopping of heat generation . according to this invention , since the intended polymer having a high degree of polymerization can be obtained within a short time , use of a large quantity of amine is not required , and no deactivitation of the catalyst is brought about . this invention will now be described in further detail with reference to actual examples . 2 . 0 gm ( 0 . 05 mole ) of sodium hydroxide was dissolved , under heat , into 122 gm ( 1 . 0 mole ) of 2 , 6 - dimethylphenol , and the mixture was added to 2200 gm of 1 , 2 - dichloroethane . after 32 . 5 gm ( 0 . 1 mole ) of &# 34 ; salcomine &# 34 ; had been added to the mixture , oxygen was introduced thereinto at 30 ° c . upon initiation of the reaction , the temperature was elevated . the temperature increase was controlled by cooling so that the temperature of the reaction system was maintained at 30 ° c . after the introduction of oxygen had been continued for 1 hour , the reaction mixture was filtered , and the filtrate was poured into 20 liters of hydrochloric acid - containing methanol to precipitate the polymer . the precipitated polymer was recovered by filtration , washed with methanol , and dried in vacuo at 110 ° c . the amount of polymer obtained was 55 . 9 gm ( yield being 45 . 8 %), and the intrinsic viscosity of the polymer was 0 . 18 ( calculated from the viscosity measured in chloroform at 25 ° c . the same shall apply hereinafter ). when the above reaction was repeated by increasing the amount of sodium hydroxide to 4 . 0 gm , 49 . 7 gm of a polymer having an intrinsic viscosity of 0 . 18 was obtained , the yield being 40 . 7 %. from the foregoing , it is seen that the increase in amount of sodium hydroxide used does not produce improvement . the procedure of comparative example 1 was repeated on a scale of 1 / 122 by employing a reactor equipped with a gas buret filled with oxygen , and the rate of oxygen absorption ( reaction rate ) was measured . the change in the ratio of amount of absorbed oxygen to maximum amount of absorbed oxygen is shown in table 1 . also see fig1 for graphic comparison . table 1______________________________________reaction ratio of absorbed oxygentime amount of absorbed amount to maximum amount ( minutes ) oxygen ( ml ) of absorbed oxygen (%) ______________________________________0 0 . 0 0 . 01 21 . 5 15 . 72 . 5 68 . 5 50 . 05 107 . 2 78 . 310 128 . 6 94 . 020 134 . 0 98 . 630 137 . 0 100 . 0______________________________________ in case polyphenylene oxide is formed by the oxidizing coupling of a phenol , the necessary and sufficient amount of oxygen for the reaction is 1 / 2 mole of the phenol . in this comparative example , however , during the reaction time of 30 minutes , oxygen was absorbed in an amout of 136 % of the theoretical amount . this fact indicates that in this comparative example , side reaction were caused to occur . the amount of oxygen which is theoretically absorbable for complete reaction without side reactions is readily calculated by a worker in the art using ordinary rules of chemical formula calculations and need not be repeated herein . the reaction was carried out in the same manner as in comparative example 1 without employing sodium hydroxide . more specifically , after 122 gm ( 1 . 0 mole ) of 2 , 6 - dimethylphenol had been dissolved in 2200 gm of 1 , 2 - dichloroethane and 32 . 5 gm ( 0 . 1 mole ) of &# 34 ; salcomine &# 34 ; had been added to the solution , oxygen was passed into the mixture at 30 ° c . the temperature of the reaction system was raised gradually , but it was maintained at 30 ° c by cooling . during the above procedure there was formed 3 , 3 &# 39 ;, 5 , 5 &# 39 ;- tetramethyldiphenoquinone . after 5 hours had passed , the reaction mixture was filtered , and the filtrate was poured into 20 liters of methanol containing 2 liters of hydrochloric acid but precipitation of a polymer was not observed . the amount of diphenoquinone obtained was 12 . 3 gm , the yield being 10 . 1 %. instead of the 1 , 2 - dichloroethane solvent there was employed a mixed solvent of 1 , 2 - dichloroethane and methanol . more specifically , 2 . 0 gm ( 0 . 05 mole ) of sodium hydroxide was dissolved in 610 ml of methanol , and 1220 ml of 1 , 2 - dichloroethane and 122 gm ( 1 . 0 mole ) of 2 , 6 - dimethylphenol were added to the solution . after addition of 32 . 5 gm ( 0 . 1 mole ) of &# 34 ; salcomine &# 34 ; oxygen was passed into the mixture . the catalyst was homogeneously dissolved in the reaction mixture . after the reaction had been continued for about 18 minutes , the polymer began to precipitate from the reaction liquor . after one hour &# 39 ; s reaction the reaction product was recovered by filtration . the amount of the precipitated polymer was 20 . 5 gm ( yield being 16 . 8 %) and the intrinsic viscosity of the polymer was 0 . 56 . the filtrate was poured into 10 liters of hydrochloric acid and methanol to precipitate a low molecular weight polymer soluble in the filtrate . the amount of the resulting polymer was 6 . 2 gm ( yield being 5 . 1 %) and the intrinsic viscosity of the polymer was 0 . 07 . comparative example 4 was repeated on a scale of 1 / 122 by employing a reactor equipped with a gas buret filled with oxygen , and the oxygen absorbing rate was measured . the results are shown below in table 2 . see also fig1 for comparison of results with invention example 2 . table 2______________________________________reactiontime amount of absorbed ratio to maximum amount ( minutes ) oxygen ( ml ) of oxygen absorbed (%) ______________________________________0 0 01 14 . 5 7 . 82 . 5 34 . 0 18 . 35 81 . 2 43 . 610 131 . 0 70 . 315 167 . 6 89 . 920 180 . 1 96 . 830 186 . 2 100 . 0______________________________________ also in this comparative example , oxygen was absorbed in an amount corresponding to 183 . 4 % of the theoretical amount absorbable without side reactions . thus , it indicated strongly that side reactions had occured . 7 . 0 gm ( 0 . 07 mole ) of cuprous chloride was dissolved in 554 gm ( 7 . 0 moles ) of pyridine , and then 91 . 5 ml of benzene and 915 ml of methanol were added to the solution . after addition of 122 gm ( 1 . 0 mole ) of 2 , 6 - dimethylphenol , oxygen was passed into the mixture at 30 ° c . after 5 minutes , the polymer began to precipitate . small amounts of polymers precipitated at reaction times of 20 minutes , 40 minutes , 60 minutes and 120 minutes , respectively , were sampled . the intrinsic viscosity of each sample polymer was determined from the viscosity measured in chloroform at 25 ° c . the viscosity of each of the polymers sampled at the above reaction times was 0 . 143 and no increase of the molecular weight was observed . 32 . 1 gm of n , n &# 39 ; - ethylene - bis ( salicylidene iminate ) manganese was added to 2 . 5 liters of 1 , 2 - dichloroethane and 122 gm of 2 , 6 - dimethylphenol was added thereto . oxygen was passed into the mixture under agitation while maintaining the temperature at 30 ° c . after three hours had passed , introduction of oxygen was stopped , and the reaction mixture was poured into methanol containing hydrochloric acid , but there was no polymer obtained . the above experimental results show that when a compound of formula ( 2 ) given above has no group s , it cannot be a catalyst for the oxidative condensation of phenols . this result confirms the results reported in journal of organic chemistry , 34 ( 2 ), 273 ( 1969 ). into a mixed liquor of 500 ml of methanol and 500 ml of pyridine was dissolved 12 . 5 gm of manganese chloride tetrahydrate , and 50 gm of 2 , 6 - dimethylphenol was further added thereto . oxygen was passed into the mixture under agitation at 50 ° c . after 10 hours had passed , the reaction mixture was poured into 2 liters of methanol containing 20 ml of hydrochloric acid , but precipitation of a polymer was not observed . 10 ml of methanol containing 0 . 124 gm of manganese chloride and 0 . 213 gm of sodium methoxide was added to 60 ml of nitrobenzene , and the mixture was agitated for 5 minutes while passing oxygen therethrough . 30 ml of nitrobenzene containing 40 gm of 2 , 6 - dimethylphenol was added to the above solution . oxygen was passed through the mixture at 40 ° c under agitation . in about 130 minutes from the addition of 2 , 6 - dimethylphenol , the equivalent amount of oxygen was absorbed . when additional three hours had passed , absorption of oxygen was not detected any more . the reaction mixture was poured into methanol containing a small amount of hydrochloric acid . the resulting precipitate was separated by filtration , washed and dried to obtain a white polymer of an intrinsic viscosity of 0 . 35 in a yield of 86 . 4 %. 38 . 1 gm ( 0 . 1 mole - 10 mole %, based on the monomer ) of a complex of n , n &# 39 ;- ethylene - bis ( salicylidene iminate ) manganese with ethylene diamine was added to 2 . 5 liters of benzene . the mixture was heated so that the temperature was maintained at 30 ° c . then , 122 gm ( 1 mole ) of 2 , 6 - dimethylphenol was added to the mixture . oxygen was passed through the mixture under agitation . since generation of heat was caused , the cooling was effected so that the temperature was maintained at about 30 ° c . after 15 minutes had passed the introduction of oxygen was stopped . the reaction mixture was immediately filtered . the benzene solution was poured into 5 . 0 liters of a methanol solution containing 2 liters of hydrochloric acid to precipitate a white polymer . the precipitated polymer was washed with methanol and dried to obtain a polymer having an intrinsic viscosity of 0 . 480 ( as measured in chloroform at 25 ° c , the same being applicable hereinbelow . ), and the yield was 94 . 8 %. example 1 was repeated on a scale of 1 / 122 by employing a reactor equipped with a gas buret filled with oxygen . the oxygen absorbing rate was measured . the results are given below in table 3 . also see for graphic comparison fig1 . as shown in the below table , in this example 2 , unlike in comparative example 2 or 5 , oxygen was absorbed in an amount corresponding to about 101 % of the theoretical amount , namely , almost in the equivalent amount . thus , it is seen that very little , if any , side reactions occurred in this example 2 . table 3______________________________________reactiontime amount of absorbed ratio to maximum amount ( minutes ) oxygen ( ml ) of oxygen absorbed (%) ______________________________________0 0 01 24 . 0 23 . 52 49 . 8 48 . 83 74 . 6 73 . 04 89 . 5 87 . 75 99 . 7 97 . 610 101 . 3 99 . 515 102 . 0 99 . 820 102 . 2 100 . 030 102 . 2 100 . 0______________________________________ the reaction was carried out under the same conditions as in example 1 by employing instead of benzen as in example 1 , the same amount of nitrobenzene . as a result , there was obtained a polymer having an intrinsic viscosity of 0 . 598 in an yield of 90 . 5 %. the reaction was carried out under the same conditions as in example 1 , except instead of benzene , the same amount of 1 , 2 - dichloroethane was used . as a result , there was obtained a polymer having an intrinsic viscosity of 0 . 565 in an yield of 92 . 1 %. 38 . 1 gm ( 0 . 1 mole - 10 mole % based on the monomer ) of a complex of n , n &# 39 ;- ethylene - bis ( salicylidene iminate ) manganese with ethylene diamine was dissolved in 10 liters of methanol and 1 . 5 liters of benzene was added thereto . after 122 gm of 2 , 6 - dimethylphenol ( 1 mole ) was added to the mixture while maintaining the temperature at 30 ° c . oxygen was introduced while cooling to keep the reactor at about the 30 ° c temperature . after 4 minutes from the initiation of introduction of oxygen , the polymer began to precipitate . since generation of heat was barely observed after 10 minutes had expired from time of introduction of the oxygen , the supplying of oxygen was stopped and the reaction mixture was then filtered . the resulting crude polymer was washed with methanol containing hydrochloric acid and then with methanol , followed by drying . as a result there was obtained a polymer having an intrinsic viscosity of 0 . 860 and in an yield of 90 . 0 %. in this example , although the reaction time was shorter than in comparative example 5 , a polymer of higher intrinsic viscosity was obtained in an higher yield . 7 gm ( 0 . 018mole - 1 . 8 mole % based on the monomer ) of a complex of n , n &# 39 ;- ethylene - bis ( salicylidene iminate ) manganese with ethylene diamine was dissolved in 0 . 6 liter of methanol and 1 . 2 liters of benzene was added thereto . subsequent procedures were conducted as in example 5 , and a polymer was thus obtained having an intrinsic viscosity of 0 . 785 in an yield of 93 . 6 %. 7 gm ( 0 . 02 mole - 2 mole % based on the monomer ) of a n , n &# 39 ;- ethylene - bis ( salicylidene iminate ) manganese with methoxide was used . the reaction was carried out in the same way as in example 6 , to obtain a polymer having an intrinsic viscosity of 0 . 876 in an yield of 96 . 1 %. example 6 was repeated by employed as a catalyst 8 gm ( 0 . 018 mole - 1 . 8 mole % based on the monomer ) of a complex of n , n &# 39 ;- hexamethylene - bis ( salicylidene iminate ) manganese with ethylene diamine . as a result there was obtained a polymer having an intrinsic viscosity of 0 . 713 in an yield of 92 . 3 %. example 6 was repeated by employing as a catalyst 8 gm ( 0 . 019 mole - 1 . 9 mole % based on the monomer ) of a complex of n , n &# 39 ;- phenylene - bis ( salicylidene iminate ) manganese with ethoxide . as a result there was obtained a polymer of an intrinsic viscosity of 0 . 665 in an yield of 91 . 6 %. example 6 was repeated by employing as a catalyst 8 . 8 gm ( 0 . 02 mole - 2 mole % based on the monomer ) of a complex of n , n &# 39 ;- ethylene - bis ( 3 - methoxysalicylidene iminate ) manganese with ethylene diamine . a polymer was thus obtained , having an intrinsic viscosity of 0 . 860 and an yield of 96 . 9 %. example 6 was repeated by employing as a catalyst 9 gm ( 0 . 02 mole - 2 mole % based on the monomer ) of a complex of n , n &# 39 ;- ethylene - bis ( 5 - chlorosalicylidene iminate ) manganese with ethylene diamine . a polymer was obtained having an intrinsic viscosity of 0 . 792 and an yield of 93 . 2 %. in 0 . 6 liter of methanol were dissolved 3 . 7 gm ( 0 . 015 mole - 1 . 5 mole % based on the monomer ) of manganese acetate tetrahydrate , 4 . 0 gm ( 0 . 015 mole ) of n , n &# 39 ;- ethylene - bis ( salicylidene imine ) and 0 . 9 gm ( 0 . 015 mole ) of ethylene diamine . then , 1 . 8 gm ( 0 . 045 mole ) of sodium hydroxide was dissolved in the resulting solution to form the complex of n , n &# 39 ;- ethylene - bis ( salicylidene imine ) manganese with ethylene diamine , and 122gm ( 1 mole ) of 2 , 6 - dimethylphenol was further added thereto . oxygen was passed through the mixture while maintaining the temperature at 30 ° c . when 20 minutes had elapsed from introduction of oxygen , the oxygen supply was turned off . subsequent procedures were conducted in the manner of example 6 . a polymer was obtained having an intrinsic viscosity of 0 . 996 in an yield of 94 . 6 %. in 0 . 6 liter of methanol were dissolved 3 . 7 gm ( 0 . 015 mole - 1 . 5 mole % based on the monomer ) of manganese acetate tetrahydrate , 4 . 0 gm ( 0 . 015 mole ) of n , n &# 39 ; ethylene - bis ( salicylidene imine ). then 1 . 2 gm ( 0 . 03 mole ) of sodium hydroxide was dissolved in the resulting solution , and 0 . 3 liter of methanol containing 0 . 8 gm ( 0 . 015 mole ) of sodium methoxide was added thereto to form a complex of n , n &# 39 ;- ethylene - bis ( salicylidene imine ) manganese with ethylene diamine and 1 . 2 liters of benzene were added and then 122 gm ( 1 mole ) of 2 , 6 - dimethyl phenol was further added thereto . oxygen was supplied through the mixture while maintaining the temperature at about 30 ° c . thereafter , subsequent procedures similar to example 6 were conducted . a polymer was thus obtained , having an intrinsic viscosity of 1 . 12 in an yield of 91 . 8 %. 7 gm ( 0 . 018mole - 1 . 8 mole % based on the monomer ) of a complex of n , n &# 39 ;- ethylene - bis ( salicylidene iminate ) manganese with ethylene diamine was added to a mixed solvent of 1 . 2 liters of benzene and 0 . 6 liter of methanol , followed by addition of 4 . 2 gm ( 0 . 03 mole ) of tetramethylene diamine . then , 122 gm ( 1 mole ) of 2 , 6 - dimethylphenol was added to the mixture and oxygen was passed through the mixture under agitation , while maintaining the temperature at about 30 ° c . subsequent steps were conducted in the same manner as in example 6 . a polymer was obtained having an intrinsic viscosity of 0 . 631 and an yield of 90 . 2 %. in 0 . 6 liter of methanol were dissolved 3 . 35 gm ( 0 . 0125 mole - 1 . 25 mole % based on the monomer ) of n , n &# 39 ;- ethylenebis ( salicylidene imine ) and 3 . 05 gm ( 0 . 0125 mole ) of manganese acetate tetrhydrate . then 1 . 52 gm ( 0 . 038 mole ) of sodium hydroxide and 0 . 75 gm ( 0 . 0125 mole ) of ethylene diamine were dissolved in the solution . thus , methanol solution of ethylene diamine complex of n , n &# 39 ;- ethylene - bis ( salicylidene imine ) manganese was prepared . thereafter , 122 gm ( 1mole ) of 2 , 6 - dimethylphenol was added to the solution and oxygen was passed through the resulting solution , while maintaining the temperature at about 30 ° c . sampling was conducted during the reaction . at each sampling time , the intrinsic viscosity of the sample polymer was measured . it was found that in this example , unlike in comparative example 6 , the degree of increase in the intrinsic viscosity of the polymer was very conspicuous even though only a small amount of manganese was used , namely 1 . 25 mole % based on the 2 , 6 - dimethylphenol . the results are shown in below table 4 . see also fig2 for graphic comparison . table 4______________________________________reaction time ( minutes ) intrinsic viscosity______________________________________23 0 . 3325 0 . 5329 0 . 7233 0 . 9240 1 . 13______________________________________ 3 . 81 gm ( 0 . 01 mole % to 10 mole % based on the monomer ) of a complex of n , n &# 39 ;- ethylene - bis ( salicylidene iminate ) manganese with ethylene diamine was dissolved in 0 . 1 liter of methanol and 0 . 15 liter of benzene was added to the solution and the resulting mixture was agitated . then , 0 . 1 mole of a phenol indicated in the following table 5 , was added to the mixture . thereafter , oxygen was passed through the mixture from a gas buret , while maintaining the temperature at about 30 ° c . when absorption of oxygen was not observed any more , the reaction was stopped . the reaction mixture was poured into oxygen containing methanol to precipitate solids completely . the resulting precipitate was washed with methanol and dried . results of polymerization of phenols are shown in the below table 5 . table 5__________________________________________________________________________examplephenols polymersno . kind amount ( mole ) yield (%) intrinsic viscosity__________________________________________________________________________16 2 , 6 - diethylphenol 0 . 1 91 0 . 7618 o - cresol 0 . 1 80 0 . 4419 2 , 6 - dimethylphenol 0 . 08 92 0 . 95o - cresol 0 . 02__________________________________________________________________________ the foregoing description is intended only to be illustrative of the principles of this invention . numerous modifications and variations thereof , would be evident to a worker in the art . all such modifications and variations are intended to be and are to be considered within the spirit and scope of this invention . | 2 |
in the following description , numerous specific details are set forth to provide a thorough understanding of the present invention . however , it will be obvious to those skilled in the art that the present invention may be practiced without such specific details . in other instances , well - known circuits have been shown in block diagram form in order not to obscure the present invention in unnecessary detail . for the most part , details concerning timing considerations and the like have been omitted inasmuch as such details are not necessary to obtain a complete understanding of the present invention and are within the skills of persons of ordinary skill in the relevant art . refer now to the drawings wherein depicted elements are not necessarily shown to scale and wherein like or similar elements are designated by the same reference numeral through the several views . an invention that alleviates the problem of cycle resources stolen from a data processor by asynchronous accesses from a second processor in a data processor system will now be described in detail . refer now to fig1 in which is depicted data processor system 100 in accordance with one embodiment of the present invention . data processor system 100 is a multiprocessor system . one processor of data processor system 100 is data processor 101 . in one embodiment of the invention , data processor 101 may be a digital signal processor ( dsp ). operations of data processor 101 are driven by system clock signal 121 . a second clock signal , an interrupt clock signal 131 , is also provided to data processor 101 . interrupt clock 131 is used as a scheduling basis for the data tasks running in data processor 101 . in one embodiment of the present invention , system clock signal 121 may run from one to three orders of magnitude faster than interrupt clock signal 131 . however , it would be understood by one of ordinary skill in the art that system clock signal 121 and interrupt clock signal 131 may have any speed provided only that the speed of interrupt clock signal 131 is less than the speed of system clock signal 121 . arbitration logic circuitry 104 mediates the access to system memory 107 . arbitration logic circuitry 104 communicates with system memory 107 via memory bus 127 . data processor 101 communicates with system memory 107 through arbitration logic circuitry 104 . data processor 101 is connected to arbitration logic circuitry 104 via system bus 124 . arbitration logic circuitry 104 also mediates the access to system memory 107 by other processors requiring access to system memory 107 . data processor system 100 includes one or more additional processors , processor a 102 through processor n 152 where n represents a predetermined number of processors . processor a 102 through processor n 152 communicate with arbitration logic 104 through interface bus 122 . in one embodiment of the present invention , one of processor a 102 through processor n 152 may be a host processor . operations of processor a 102 through processor n 152 which require access to system memory 107 necessitate one of processor a 102 through processor n 152 stealing system cycle resources from data processor 101 . during intervals of time in which any one of processor a 102 , processor b 142 through processor n 152 is stealing cycle resources from data processor 101 , arbitration logic circuitry 104 holds data processor 101 , that is , causes instruction execution by the data processor to be stopped , by asserting data hold signal 134 . processor a 102 , processor b 142 , . . . , processor n 152 are permitted to steal cycle resources at a predetermined maximum rate called the &# 34 ; pacing counter threshold .&# 34 ; the pacing counter threshold is defined by the maximum number of system cycles that processor a 102 through processor n 152 , in the aggregate , are permitted to steal in an interval of time determined by the period of interrupt clock signal 131 . during a cycle resource access by any one of processor a 102 through processor n 152 , cycle steal pacing counter 105 accounts for system clock cycles . in such a time interval , cycle steal pacing counter 105 is enabled by arbitration logic circuitry 104 issuing an enable signal thereto . cycle steal pacing counter 105 receives system clock 121 and accumulates system clock cycles so long as cycle steal pacing counter 105 is enabled by arbitration logic circuitry 104 . cycle steal pacing counter 105 also receives interrupt clock signal 131 . at the end of an interrupt clock signal 131 period , cycle steal pacing counter 105 resets . thus , the maximum count contained in cycle steal pacing counter 105 represents , in any particular interval of interrupt clock signal 131 , the rate of cycle resource steals by processor a 102 through processor n 152 per unit of time determined by the period of interrupt clock signal 131 . the maximum cycle allocation per interval of interrupt clock signal 131 should be smaller than the size of cycle steal pacing counter 105 . the contents of cycle steal pacing counter 105 are used to limit cycle resource accesses by processor a 102 through processor n 152 . the contents of cycle steal pacing counter 105 are provided to processor a 102 through processor n 152 via pacing counter content bus 115 . processor a 102 through processor n 152 may read the value of the contents of cycle steal pacing counter 105 . reading the value of the contents of cycle steal pacing counter 105 does not cause data processor 101 to be held , nor does it affect the value of the contents of cycle steal pacing counter 105 itself . the contents of cycle steal pacing counter 105 may be accessed by an external device through either i / o mapping or memory mapping . when i / o mapping is used to access the value , a register is accessed . when memory mapping is used to access the value , the contents of cycle steal pacing counter 105 are mapped to a memory location in a corresponding one of processor a 102 through processor n 152 . when that memory location is accessed , the contents of cycle steal pacing counter 105 are then accessed . software running on processor a 102 through processor n 152 then manages the stealing of cycle resources by processor a 102 through processor n 152 by reading the value stored in cycle steal pacing 105 in an external register or an internal memory space . the use of software for performing such read operations is well known in the data processing art and , therefore , will not be described in greater detail . in one embodiment of the present invention employing a single access approach , the software running on processor a 102 through processor n 152 reads the contents of cycle steal pacing counter 105 before each access by one of processor a 102 through processor n 152 . the value of the contents of cycle steal pacing counter 105 is then compared to the pacing counter threshold value . if the value of the contents of cycle steal pacing counter 105 is less than the pacing counter threshold value , that processor , of processor a 102 through processor n 152 , seeking access continues with the access operation . otherwise , that processor of processor a 102 through processor n 152 seeking access , continues to read the value of the contents of cycle steal pacing counter 105 or performs other tasks until the value of the contents of cycle steal pacing counter 105 is reset to zero by the action of interrupt clock signal 131 , described hereinabove . it should be noted that it is possible for accesses to data processing resources to not result in a cycle steal operation . when a cycle is not stolen , cycle steal pacing counter 105 is not incremented . in another embodiment of the present invention employing a block access approach , one of processor a 102 through processor n 152 seeks access to system cycle resources in order to read or write a block of data values to system memory 107 . in such an embodiment , processor a 102 through processor n 152 reduces the number of input / output ( i / o ) operations for transfer by reading the contents of cycle steal pacing counter 105 at the beginning of the block transfer , and calculating the worst case number of accesses into system memory 107 before the contents of cycle steal pacing counter 105 must be checked again . this calculation is done by subtracting the value of the contents of cycle steal pacing counter 105 from the pacing counter threshold value . the result of this calculation is used as a loop count . at the end of the loop , that processor , of processor a 102 through processor n 152 , accessing system cycle resources again reads the value of the contents of cycle steal pacing counter 105 , and repeats the process just described . so long as the value of the contents of cycle steal pacing counter 105 is less than the pacing counter threshold value , that processor , of processor a 10 through processor n 152 , accessing system cycle resources may continue its accesses to system cycle resources . otherwise , that processor , of processor a 102 through processor n 152 , accessing system cycle resources must wait and continue to poll cycle steal pacing counter 105 or perform other tasks until the value of the contents of cycle steal pacing counter 105 is reset to zero . this process is repeated until the entire block of data values is transferred . it should be noted that data processor system 100 may include hardware ( h / w ) interface 106 for coupling ancillary hardware devices ( not shown in fig1 ) to data processor system 100 . in data processor system 100 , cycle steal counter 105 is depicted as being incorporated in arbitration logic circuitry 104 . however , it would be understood by one of ordinary skill in the art that other embodiments of the present invention might implement cycle steal counter 105 as structure standing separate from arbitration logic circuitry 104 . one such embodiment is illustrated in fig2 . referring now to fig2 in which is depicted data processor system 200 , in accordance with another embodiment of the present invention . as described hereinabove , operations of data processor 201 are driven by system clock signal 221 , and interrupt clock signal 231 is used as a scheduling mechanism for the data tasks running in data processor 201 . similarly , arbitration logic circuitry 204 mediates accesses to system memory 207 by devices requiring access thereto . arbitration logic circuitry 204 communicates with system memory 207 via memory bus 227 . data processor 201 communicates with system memory 207 through arbitration logic circuitry 204 . data processor 201 communicates with arbitration logic circuitry 204 via system bus 224 . arbitration logic circuitry 204 also mediates the access to system memory 207 by another processor requiring access to system memory 207 . in the embodiment depicted in fig2 data processor system 200 includes host processor 202 which can gain access to system memory 207 via arbitration logic circuitry 204 . host processor 202 communicates with arbitration logic circuitry 204 through host interface 203 . information is transmitted between host interface 203 and host processor 202 via host interface bus 222 . in one embodiment , host interface bus 222 may be an industry standard architecture ( isa ) bus . in another embodiment , host interface bus 222 may be a peripheral component interconnect ( pci ) bus . it would also be understood by one of ordinary skill in the art that any other standard interface bus may also be used . host interface circuitry 203 is coupled to arbitration logic circuitry 204 via host interface system bus 223 . operations of host processor 202 which require access to system memory 107 necessitate host processor 202 stealing system cycle resources from data processor 201 . during such cycle steal events , the operation of data processor system 200 is as described hereinabove with respect to data processor system 100 , the embodiment depicted in fig1 . cycle steal pacing counter 205 receives system clock 221 and accumulates system clock cycles so long as cycle steal pacing counter 205 is enabled by arbitration logic circuitry 204 . cycle steal pacing counter 205 also receives interrupt clock signal 231 . at the end of an interrupt clock signal 231 period , cycle steal pacing counter 205 resets . the contents of cycle steal pacing counter 205 are used to limit cycle resource accesses by host processor 202 . the contents of cycle steal pacing counter 205 are provided to host processor 202 via pacing counter content bus 215 , host interface 203 and host interface bus 203 . software running on processor host processor 202 then manages the stealing of cycle resources by host processor 202 . one embodiment of the present invention may employ the single access approach described hereinabove . another embodiment may employ the block access approach also described hereinabove . in data processor system 200 , system memory 207 is shown as an integrated system memory . however , it would be understood by an artisan of ordinary skill that other embodiments of the present invention may employ other system memory architectures . one such embodiment is depicted in fig3 . referring now to fig3 in which yet another embodiment of the invention , data processor system 300 is illustrated . data processor system 300 employs a so - called harvard architecture , having data memory 307 and instruction memory 308 . harvard architectures are well - known in the data processing arts and , therefore will not be described in greater detail . arbitration logic 304 communicates with data memory 307 via data memory bus 327 , and communicates with instruction memory 308 via instruction memory bus 328 . data processor 301 accesses data memory 307 via arbitration logic 304 through system data bus 324 . access to instruction memory 308 by data processor 301 via arbitration logic circuitry 304 , is through system instruction bus 325 . it would be understood by one of ordinary skill in the art , that in all other respects the operation of data processor system 300 is the same as in the other embodiments heretofore described . moreover , it would also be understood by one of ordinary skill in the art that other embodiments of the present invention may employ the structures illustrated herein in different combinations . for example , the harvard architecture memory of data processor system 300 in fig3 may appear in an embodiment of data processor system 100 depicted in fig1 . an artisan of ordinary skill would understand that all such variations would constitute embodiments of the present invention . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . | 6 |
as shown in fig2 an engine air cleaner inlet tube , 16 , according to the present invention is intended to be used in conjunction with an automotive engine , 14 , having an air supply tube , 20 , fed by an air cleaner , 18 , which in turn receives air from an air cleaner inlet tube , 16 . air cleaner inlet tube 16 is mounted to a wall , 32 , of the vehicle &# 39 ; s engine compartment , which has a circular aperture , 38 , formed therein . an engine air cleaner inlet tube according to the present invention has an entry section including a generally spherical or hemispherical chamber for receiving air from outside the engine compartment . this hemispherical chamber is illustrated as item 22 in fig2 and 3 . a venturi section , 26 , having a circular cross section , extends radially from hemispherical chamber 22 . the diameter of the venturi increases with the distance from throat 40 . this allows the venturi to control the transmission of induction noise arising from the vehicle &# 39 ; s air intake system . as shown in fig3 a discharge angle , d , may be measured as the angular displacement of venturi section 26 from a reference line which is parallel to the direction of initial airflow and which passes through the center of the entry to generally hemispherical chamber 22 ( see arrow 5 of fig3 ). angle d is a measure of the orientation of venturi 26 with respect to the mounting plane of air inlet tube 16 . fig6 illustrates air inlet restriction plotted against airflow for an air cleaner inlet tube according to the present invention shown as a family of curves a , and for a similarly sized , conically shaped venturi entrance having a 45 ° angle bend from the entrance portion of the venturi to its longest portion . the curve a representing the highest level of restriction was obtained with an inlet tube according to the present invention using an angle d of 60 °. the curve a representing the lowest level of restriction was obtained with an inlet tube according to the present invention using an angle d of 0 °. curve b was generated using a conical shaped venturi entrance having a discharge angle of only 45 °. accordingly , it is easily seen that a generally spherical entry section according to the present invention will allow increased airflow at lower flow restriction than would be expected with other types of devices . the prior art air inlet tube shown as item 12 in fig1 has at least two major deficiencies . first , air entering the tube must move along flow paths having multiple , grossly differing , radii , and this will cause turbulence and disrupt the flow , thereby increasing the pressure drop . second , if it is desired to reorient the discharge angle of the prior art device shown in fig1 the flow will change significantly because air does pass through different flow paths . the restriction to flow of prior art tube 12 will exceed the restrictions shown for the family of curves &# 34 ; a &# 34 ; in fig6 . if discharge angle d of an air inlet tube 16 according to the present invention is changed , the family of curves a of fig6 will apply for discharge angles of up to 60 °. fig3 and 5 clearly show that for a considerable range of discharge angle , the airflow path remains substantially unchanged . this is significant because automotive engineers frequently need to relocate components within engine compartments . if such relocation necessitates the reconfiguration of the air inlet tube , the present invention allows the discharge angle to be modified without significantly changing the performance characteristic of the inlet tube . this is beneficial because the burden of recalibrating the engine control to handle altered airflow will be obviated . as shown in fig3 air cleaner inlet tube 16 is mounted to wall 32 of the vehicle &# 39 ; s engine compartment by means of flange 28 and gasket 30 . air cleaner inlet tube 16 picks up air through aperture 38 formed in wall 32 . because aperture 38 is circular , the flow area into inlet tube 16 generally exceeds the area for the inlet tube shown in fig1 at an equivalent package space . upon entering the air cleaner inlet tube , the air first passes through cylindrical lead element 24 and then into generally spherical chamber 22 . lead element 24 allows the air to smoothly flow into chamber 22 . this smooth flow is aided by gasket 30 , which allows the air to pass without having to negotiate stepped wall surfaces . if desired , a flange ( not illustrated ) may be rolled inwardly from wall 32 so as to form a side wall for aperture 38 . in any event , gasket 30 serves not only to prevent the infiltration of underhood air which has been heated by engine 14 into inlet tube 16 , but also prevents mechanical contact of inlet tube 16 with wall 32 . after flowing through generally hemispherical chamber 22 , air passes through throat 40 and into venturi section 26 . the illustrated venturi section has been found to function effectively as a noise attenuator without excessive pressure drop if an included angle of approximately 6 ° is formed by diametrically opposite wall sections of the venturi . those skilled in the art will appreciate in view of this disclosure that the length of venturi section 26 is tunable so as to permit at least partial recovery of the pressure lost because of venturi throat 40 . and , although not illustrated , a side branch resonator or helmholtz resonator could be added to venturi section 26 to further attenuate induction noise . it will be appreciated further that the diameter of venturi throat 40 may be sized so as to attenuate noise in a particular frequency . after flowing through venturi section 26 , air passes through exit section 46 coupled to venturi section 26 , and then the air flows into air cleaner 18 . the profile of non - circular discharge orifice 34 , which comprises a part of exit section 46 , is illustrated in fig4 . those skilled in the art will appreciate in view of this disclosure , however , that the size and shape of the discharge orifice 34 may be adapted to the needs of the engine air inlet system at hand . while the invention has been shown and described in its preferred embodiment , it will be clear to those skilled in the art that many changes and modifications may be made thereto without departing from the scope of the invention . for example , although the air cleaner inlet tube according to the present invention is of unitary construction , a component according to this invention could be made of various modules assembled into a completed assembly . | 5 |
known port extension functionality refers to processing performed by a network analyzer to correct the delay resulting from the extension of a port of the network analyzer to a dut using , for example , a test fixture . known port extension applies a relatively simple linear model of phase response of a test fixture to correct measurement data in real - time during operation of a network analyzer . known port extension functionality does not account for loss introduced by the test fixture . specifically , the amplitude response of a test fixture is substantially more complicated than the linear model used for phase compensation and , hence , known port extensions are not capable of applying known amplitude correction techniques to measurement data in real - time . some representative embodiments provide port extension functionality in a network analyzer to correct for the amplitude response of a test fixture . specifically , some representative embodiments employ a formula that models loss introduced by a test fixture as a function of frequency . after measurement data is obtained by the network analyzer , the port extension functionality applies a gain to an s - parameter in proportion to the loss defined by the formula and parameters associated with the respective port connection ( s ) to the test fixture . because a suitable formula can be employed to generate the gain , the port extension functionality can apply the loss compensation in real - time . specifically , numerically intensive error matrices need not be applied . accordingly , the loss compensation can be applied concurrently with the occurrence of analyzer sweeps and the display of resulting spectral data . the particular fitting formula is preferably selected to represent the expected loss function of the transmission line used to model the characteristics of the test fixture . in one representative embodiment , the following formula is used to model the loss associated with a network analyzer / test fixture set - up : where f is frequency and a , b , and c are constants . the parameter c is the loss at dc and the parameters a and b can be determined by suitably processing measurement data associated with the test fixture . for pure coaxial lines in air , this loss function follows almost ideally a square - root loss curve . for cables with dielectrics , the loss curve is steeper than a square - root function and , for microstrip lines , the loss versus frequency characteristic can be nearly a linear function . accordingly , the preceding formula follows each of the transmission line models relatively closely . in another representative embodiment , the following formula is used to model the loss associated with a network analyzer / test fixture set - up : where f is frequency and a , b , and c are constants . the parameter c is the dc loss and parameters a and b may be determined by suitably processing measurement data associated with the test fixture . in some representative embodiments , the loss compensation is directly controlled by the user . for example , the user may directly input values for parameters a , b , and c using a graphical user interface ( gui ). alternatively , the user may enter the loss at one or several frequency points into gui 600 , as shown in fig6 , via controls 601 and 602 . software operating on the network analyzer may automatically calculate parameters a and b algebraically as will be discussed herein below . one benefit of enabling a user to change the loss compensation applied through port extension functionality is that the user may view the effect of changes as measurement data is obtained and displayed by the network analyzer in real - time . in other representative embodiments , the parameters of the formula used to calculate the gain factors are determined in an autonomous manner by the network analyzer . specifically , a stimulus signal is successively provided to multiple ports of a network analyzer and reflection measurements are made on each of the multiple ports . the reflection measurements are used to estimate the loss associated with the test fixture through each port . additionally , the coaxial - to - pcb connection of the test fixtures frequently exhibits relatively poor impedance matching . a poor impedance match will result in significant ripples when the open standard is used to obtain the reflection measurements . also , coupler / bridge directivity may introduce ripples in reflection measurements . accordingly , some representative embodiments estimate the losses associated with multiple ports of a network analyzer coupled to a test fixture by suitably processing amplitude response values associated with multiple frequencies . referring now to the drawings , fig1 depicts a flowchart for operation of a network analyzer according to one representative embodiment . in one representative embodiment , the flowchart is implemented using suitable software instructions or code executed by a processor of the network analyzer . in other embodiments , integrated circuitry may be alternatively or additionally employed to implement a portion of the flowchart or the entire flowchart . in step 101 , a short standard or an open standard is selected for subsequent measurements . the short standard refers to an ideal electrical connection having unity reflection with 180 degrees of phase shift . measurements under the short standard typically obtain the response of the test fixture set - up when a suitable test kit component is inserted within the test fixture . the open standard refers to an unterminated transmission line . the open standard is measured by omitting placement of any element within the test fixture and , hence , the circuit path is “ open .” the selection of the standard may occur by receiving suitable input from the user of a network analyzer through a graphical user interface ( gui ) or other interface . any other suitable reflection standard can be used if the amplitude versus frequency response of the fixture is known or can be assumed . in step 102 , a port of the network analyzer is selected for calibration . in one representative embodiment , a suitable software loop selects a respective port by iteratively stepping through each port available on the device . alternatively , the user may manually select the port through a gui or other interface . in step 103 , a signal is generated on the selected port . in step 104 , reflection measurements are made on the selected port . in step 105 , the measurements are processed to determine the response across a frequency span . in step 106 , the response data is stored for subsequent processing . in step 107 , a logical comparison is made to determine whether there are additional ports to be tested . if so , the process flow returns to step 102 . in step 108 , a logical comparison is made to determine whether to repeat the process for the other standard . if the logical comparison is true , the process flow returns to step 102 to perform the process using the other standard . in step 109 , the parameters of the loss formula are calculated and used to calibrate the port extension functionality of the network analyzer . in some representative embodiments , the parameters a , b , and c associated with equations ( 1 ) and ( 2 ) are determined algebraically using a relatively small number of measurement points . for example , for equation ( 1 ), the parameter c is determined from the measurement data as the loss at dc and the parameters a and b are determined as follows : a =( l 1 f 2 − l 2 f 1 )/( f 2 f 1 1 / 2 − f 1 f 2 1 / 2 ), equation ( 3 ) b =( l 1 f 2 1 / 2 − l 2 f 1 1 / 2 )/( f 1 f 2 1 / 2 − f 2 f 1 1 / 2 ), equation ( 4 ) where l 1 , f 1 , and l 2 , f 2 are the first and second losses and frequencies associated with the losses , respectively . in equations ( 3 ) and ( 4 ), the loss is represented in db . if there is a dc offset ( c is non - zero ), then l1 = loss1 - c and l2 = loss2 - c , where loss1 and loss2 are the losses determined by the measurement data at the respective frequencies . for equation ( 2 ), the parameter c is determined from the measurement data as the loss at dc and the parameters a and b are determined as follows : a = exp {( ln ( f 2 ) ln ( l 1 )− ln ( f 1 ) ln ( l 2 ))/( ln ( f 2 )− ln ( f 1 )} equation ( 5 ) b = ln ( l 1 / l 2 )/ ln ( f 1 / f 2 ) equation ( 6 ) where l 1 , f 1 , and l 2 , f 2 are the first and second losses and frequencies associated with the losses , respectively . in another embodiment , equation ( 2 ) is used to generate the loss compensation values while only values a and c are calculated using equation ( 5 ) and the dc loss respectively . parameter b is set to 0 . 5 . this produces gain compensation that changes with the square root of frequency which closely models the loss of an ideal , lossy air - filled transmission line in which the loss is caused primarily by the “ skin effect .” in another representative embodiment , the dc loss is assumed to be negligible and parameter c is omitted or set to zero . in alternative embodiments , the loss parameters may be stored as a factor to be multiplied by a delay term . specifically , a standard delay or custom delay is selected through an interface of the network analyzer . the loss factors are then scaled by the selected delay thereby making the loss a function of the delay . the benefit of relating the loss to the delay in this manner is to adapt the loss between multiple test fixtures that have common properties and differ only in the length from ports to the dut interface ( s ). fig2 depicts amplitude response 201 , phase response 202 , and delay response 203 associated with reflection measurements of a test fixture using the open standard according to one representative embodiment . the responses associated with the open standard may be used as a directed normalization of the correct trace when testing of duts occurs . however , as seen in fig2 , responses 201 - 203 exhibit ripple . the ripples in responses 201 - 203 are indicative of errors caused by the poor source match ( the coaxial - to - pcb connection ) of the measurement system and the open response . it is possible to appreciably mitigate the source match contribution by employing an average of the open standard and the short standard . however , in some test situations , it is not readily practical to perform measurements using the short standard and only open standard measurements are applied . some representative embodiments process the measurement data obtained from the open standard to mitigate the errors generated by the poor source match of the test system . in some embodiments , a polynomial curve fitting algorithm or a line fitting algorithm may be applied to the amplitude response obtained from the measurement data to model the loss presented by a test fixture . the use of a polynomial or other suitable formula results in less sensitivity to ripple caused by the poor source match associated with the test fixture . for example , the measurement data associated with a test fixture and generated using the open standard can be fitted to equation ( 1 ) by taking a change of variables such that g = f 1 / 2 thereby giving : loss ( g 2 )= a · g + b · g 2 + c . after transforming the equation through the change in variables , a polynomial fitting algorithm may be applied to determine appropriate values for a and b . typically , polynomial fitting algorithms calculate values a and b to minimize an error metric between the resulting polynomial and the measurement data . such polynomial fitting algorithms are known in the art . in another embodiment , equation ( 2 ) can be transformed into a form that enables an application of a line fitting method to be applied . the log of each side can be taken as follows : log ( loss ( f )− c )= log ( a )+ b · log ( f ). the fitting method may be applied by taking the log of the loss data ( after offsetting by c ) and the log of frequency . the y - intercept of the fitted line can be mapped to a and the slope to b . typical line fitting methods may be employed such as the least squares method . fig3 depicts a graph of measurement data 301 and polynomial fitted curve 302 to the measurement data according to one representative embodiment . the measurement data 301 was obtained by measurements of a test fixture using the open standard . curve 302 results from fitting equation ( 1 ) to the measurement data 301 using a polynomial fitting algorithm . as seen in fig3 , curve 302 closely approximates the measurement data 301 while omitting ripples . accordingly , when curve 302 is used to generate amplitude compensation values for measurements of duts , the processed measurement values will exhibit a relatively high degree of accuracy . because a function is used to model the loss presented by the test fixture , it is possible that a particular frequency may be scaled by a factor that is greater than the loss presented by the test fixture . accordingly , it is possible that the amplitude response associated with that frequency may be greater than one for certain testing procedures . some known tests are used to determine whether a device is unstable by detecting whether the amplitude response at certain frequencies is greater than one . to prevent the loss compensation from causing a properly functioning device from failing such a test , a relatively small offset may be applied to ensure that the amplitude response of the test fixture after application of loss compensation is always less than one . fig4 depicts a flowchart for automatically calibrating a network analyzer and using the calibrated network analyzer to perform measurements of a dut according to one representative embodiment . in one representative embodiment , the flowchart is implemented using suitable software instructions or code executed by a processor of the network analyzer . in other embodiments , integrated circuitry may be alternatively or additionally employed to implement a portion of or the entire flowchart . in step 401 , measurement data of a test fixture using the open standard is obtained for the ports of the network analyzer . in step 402 , a line fitting method or a polynomial fitting method is applied to the measurement data to calculate parameters for the loss formula . in step 403 , the network analyzer is calibrated by storing the calculated loss parameters . in step 404 , measurement data of a dut is obtained . in step 405 , gain values are calculated using the appropriate parameters . for example , suppose that the measurement values of interest are s 12 measurements ( i . e ., a stimulus signal is applied to port one and the output signal from port two is measured ). the parameters for port one and for port two are retrieved . for each frequency of interest , a first gain value is calculated using the parameters for port one and a second gain value is calculated using the parameters for port two . the gain values are then applied to the measurement data . using the s 12 example , the amplitude measurement values are multiplied by the previously mentioned first and second gain values . in step 407 , the processed measurement values are stored and / or output as appropriate ( e . g ., used to display an amplitude response of the dut on the screen of the network analyzer ). fig5 depicts a block diagram of network analyzer 500 according to one representative embodiment . network analyzer 500 includes typical elements common to network analyzers . for example , network analyzer 500 includes processor 504 to control the operations of network analyzer 500 . network analyzer 500 further includes memory 505 to store measurement data for processing . network analyzer 500 includes display 501 for presenting measurement data , user interfaces , and / or the like and user controls 502 to enable user control over the operations of network analyzer 500 . network analyzer 500 includes multiple coaxial or other ports 503 to generate signals for application to a dut and to receive signals from a dut during test operations . network analyzer 500 includes suitable logic to apply port extension functionality to compensate for loss associated with a test fixture and logic for automatically calibrating the port extension functionality . for example , non - volatile memory 506 may be used to store software instructions or code that define the operations of network analyzer 500 . non - volatile memory 506 includes signal processing algorithms 509 that perform spectral analysis of measurement data . signal processing algorithms 509 include loss compensation module 510 according to one representative embodiment . loss compensation module 510 implements the application of gain to measurement data according to port extension functionality . specifically , loss compensation module 510 retrieves appropriate parameters from port extension settings 507 . compensation module 510 uses the retrieved parameters to calculate gain values on a frequency dependent basis . non - volatile memory 506 further includes port extension calibration module 508 that measures reflection signals from ports 503 and automatically calculates port extension settings 507 after processing of the measurement data . | 6 |
the present invention provides a unique polymeric support system that enables convenient and versatile synthesis of oligonucleotides . the polymeric support system of the present invention comprises a polymeric support and a primer having one or more oxidizable substituents . a selective oxidation of these oxidizable substituents causes a direct cleavage of the primer or , in the alternative , permits an indirect cleavage of the primer resulting in the release of the synthesized oligonucleotide from the polymeric support . the discovery of this polymeric support system is of particular significance . the polymeric support system of the present invention enables one to synthesize oligonucleotides which require little further purification . in addition , this polymeric support system may be used to facilitate the immobilization of either oligonucleotides or polynucleic acids which possess regions complementary to the oligonucleotide synthesized on the support . the oligonucleotide or polynucleic acid thus immobilized may be either detected using various specific detection methods or recovered for further study . the many applications of the present invention will be apparent to one skilled in the art . a wide range of polymer supports can be used as the polymeric support of the present invention . the preferred polymer supports include polystyrenes , crosslinked polystyrenes , cross - linked polyamino acids , polyethyleneglycol , co - polymers of vinyl acetate and n - vinyl pyrrolidone , as well as other polyolefins , polyesters , polyamides , polyacrylates , polymethacrylates , metal oxides , clays , various glasses and grafts using combinations of any of these supports . the polymeric supports of the present invention may be soluble or insoluble ; preferably , however , they are insoluble . in addition , they are stable under the reactive conditions employed and contain the necessary reactive groups on their surfaces to effectuate covalent bonding of the primer to the support . while many supports are acceptable for purposes of implementing the invention disclosed herein , polymeric supports with large surface areas consisting of a great number of bonding sites in proportion to weight are most preferred . the reactive groups on the surface of the polymer permit the primer to be covalently bonded to the polymeric support . reactive groups that are commonly used for such purposes are hydroxyl , carboxyl and amino groups . for instance , the polymer support may be provided with a terminal carboxyl functionality which will then react with hydroxyl or amino groups of the primer . alternatively , the polymer support can be provided with amino or hydroxyl groups which will then react with carboxyl groups of the primer . for example , groups containing carboxylate functionalities can be attached to amino groups on a solid support in the presence of an appropriate condensing agent such as dicyclohexylcarbodiimide ( dcc ). a primer containing a primary or an aryl amine can be covalently attached to the support through condensation of the amine with the carboxylate function to form an amide . in an analogous fashion , an acid halide may be reacted with amine containing primers to form amides . alternatively , the primer may possess an acid halide and the support may contain the amine function . there are many other methods of attaching the primer to the support . these alternatives include grignard condensations , ether linkage formations , freidel - craft alkylations , secondary amine formations , mercury salt and olefin condensations . one of ordinary skill in the art , however , can readily determine an appropriate polymeric support for a particular synthesis as well as the appropriate means for linking the primer to the polymeric support ( p . hodge and d . c . sherrington , polymer supported reactions in organic synthesis , john wiley & amp ; sons , new york , 1980 ). prior to using primerized support systems for oligonucleotide synthesis , reactive groups on both the support and the primer must be protected in order to prevent side reactions which will decrease the yield of the oligonucleotide . in the case of the primer this is most easily accomplished by converting reactive amines to amides , and esterifying the alcohols with the exception of the one which will participate in chain initiation . both of these reactions take place with acid anhydrides ( such as acetic anhydride in pyridine ), as well as acid chlorides and other acylating agents . protection of reactive groups on the support is dependent upon the support employed . reactive groups on may be protected will be apparent to one of ordinary skill in the art . ( reese , c . b ., tetrahedron 34 : 3143 - 3179 ( 1978 ) and t . w . greene , protective groups in organic synthesis , john wiley & amp ; sons , new york , 1981 .) the primer of the present invention may be embodied in many separate forms . all of these separate embodiments , however , have one feature in common : in each embodiment , the primer possesses one or more oxidizable substituents . selectively oxidizing these substituents , without disrupting any other bonds of the primer or oligonucleotide , either directly or indirectly releases the desired oligonucleotide from the polymeric support . by utilizing a primer possessing one or more oxidizable substituents , the present invention eliminates the necessity , in the present state of the art , of fabricating eight different initiated supports . the preferred oxidizable substituents of the present invention are hydroxyl , alkenyl , primary amine and secondary amine groups . fig1 , 4 , 5 and 6 , corresponding to the preferred embodiments , demonstrate which oxidizable groups are preferred at particular bonding sites . however , these drawings are merely intended to be illustrative of the various primer structures in accordance with the present invention . one having ordinary skill in the art will appreciate that the structures portrayed , and particularly the cyclic structures , are inherently flexible such that they may have several different embodiments without departing from the spirit and scope of the present invention . in the presently most preferred embodiment , the oxidizable substituent is a ribonucleoside . the ribonucleoside is linked to the polymeric support through its base . the first nucleotide of the oligonucleotide to be synthesized is condensed onto the ribonucleoside and is linked to the ribonucleoside by means of a phosphate bridge between the 5 &# 39 ; position of the ribonucleoside and the 3 &# 39 ; position of the first nucleotide . there are other preferred embodiments of the present invention where it is not necessary to protect and deprotect the oxidizable substituents of the primer in order to facilitate the oxidative cleavage of the synthesized oligonucleotide from the polymeric support . fig3 and 7 are illustrative of those embodiments of the present invention wherein the oxidizable substituent is an alkenyl bond . the oxidizing agent of the present invention cleaves the primer molecule at the site of the alkenyl bond . thus , it is not necessary to proceed with steps ( c ) and ( f ) of the oligonucleotide synthesis method of the present invention since there are no oxidizable substituents in these embodiments which will undergo side reactions during the oligonucleotide synthesis step . once again , one having ordinary skill in the art will appreciate that fig3 and 7 are inherently flexible and are intended to be illustrative of preferred embodiments of the present invention . the primer of this unique support system allows chain elongation in either the 3 &# 39 ; or 5 &# 39 ; direction and is suitable for synthesizing all desired oligonucleotides . synthesis may be conducted by many means , including the phosphite and phosphotriester methods . by way of example , oligonucleotides may be synthesized in accordance with those methods described in m . d . matteucci and m . h . caruthers , synthesis of deoxyoligonucleotides on a polymer support , journal of the american chemical society , vol . 103 , no . 11 , 1981 and m . j . gait et al ., rapid synthesis of oligodeoxyribonucleotides iv . improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates , nucleic acids research , vol . 8 no . 5 , 1980 . the primers of the present invention may be linear or cyclic in their structure . in addition , these primers may be cleaved in one of two ways : either directly or indirectly . in a direct cleavage , the oxidation serves to cleave the primer such that the synthesized oligonucleotide is released from the support in one chemical reaction . in some situations , however , a portion of the primer remains attached to the oligonucleotide . at this point the oligonucleotide may be treated with an effective base to remove the remaining primer portion from the oligonucleotide . in an indirect cleavage , oxidation in conjunction with treatment by an effective base serves to eliminate the synthesized oligonucleotide from the support . in a preferred embodiment of the present invention , a cyclic primer contains one or more oxidizable groups which are proximal to the phosphate of the formed oligonucleotide . after oxidation , treatment with an appropriate base eliminates the oligomer from the support . fig1 and 3 are illustrative of this embodiment of the invention . in another preferred embodiment of the present invention , a cyclic primer contains oxidizable groups located at its point of attachment with the support . in this case oxidation cleaves the oligomer and a portion of the primer from the support . upon treatment with an appropriate base , the residual portion of the primer may be removed from the oligomer . fig4 is illustrative of this embodiment of the invention . in a third embodiment , a linear primer contains a single oxidizable group proximal to the phosphate of the synthesized oligomer . simultaneous with or subsequent to oxidation , treatment with an appropriate base cleaves the oligomer from the support . fig5 is illustrative of this embodiment of the invention . in a fourth embodiment of the present invention , a linear primer may contain two or more adjacent oxidizable groups . upon oxidation , this arrangement permits direct cleavage of the oligomer from the support . fig6 and 7 are illustrative of this embodiment . again , an appropriate base may be used to cleave the residual portion of the primer from the oligomer . while there are several positional relationships between the oxidizable function and the initiation site for oligonucleotide synthesis with respect to any particular primer , an orientation with the oxidizable function in the γ position to the phosphate is preferred for the subsequent removal of primer moiety from the synthesized oligonucleotide following cleavage from the polymeric support . one having ordinary skill in the art will appreciate that the oligonucleotide synthesis method of the present invention is still effective where the oxidizable function is in a position other than γ to the phosphate . however , the preferred embodiments of the present invention permit a more convenient synthesis of the desired oligonucleotide . removal of the protecting groups on the oxidizable substituents may be necessary before the cleavage of the synthesized oligonucleotide from the polymeric support . fig1 , 4 , 5 and 6 are illustrative of this embodiment of the present invention . deprotection is accomplished by procedures that are known to one having ordinary skill in the art . t . w . greene , protective groups in organic synthesis , john wiley & amp ; sons , new york , 1981 . the synthesized oligonucleotide is directly or indirectly released from the polymeric support by a selective oxidation of the oxidizable substituents of the primer . this cleavage results in a yield of oligonucleotide that is substantially quantitative . for a direct cleavage , a selective oxidation comprises treating the oligonucleotide with an effective oxidizing agent . if any portions of primer remain attached to the oligonucleotide after its release from the polymeric support , these remaining portions may be removed by treatment with an effective base . in a direct cleavage , it is preferred that the carbonyl group that results from oxidation be γ to the phosphate of the synthesized oligomer . this embodiment ensures that the application of the base will be effective in cleaving the remaining portions of the primer from the synthesized oligonucleotide . otherwise , there are embodiments of the present invention wherein treatment with the effective base will not result in complete removal of the residual primer from the oligomer . however , one having ordinary skill in the art will appreciate that these remaining portions of primer may be removed in many instances , through alternate procedures , depending upon the particular chemistry of the residual primer moiety ( t . w . greene , protective groups in organic synthesis , john wiley & amp ; sons , new york , 1981 ). for an indirect cleavage , a selective oxidation comprises treating the oligonucleotide with an effective oxidizing agent accompanied by a simultaneous or subsequent treatment with an effective base . an effective oxidizing agent for both the direct and indirect cleavages comprises a mild oxidizing agent which will select for the desired cleavage sites and not for other reactive groups on the oligomer . in a presently preferred embodiment , the effective oxidizing agent is selected from the group consisting of periodate , permanganate , dichromate , manganese dioxide , and lead tetraacetate . most preferably , periodate is the effective oxidizing agent . for indirect cleavages , the effective base cooperates with the effective oxidizing agent to cleave the primer . an effective base for indirect cleavages comprises bases such as piperidine , pyridine , morpholine , ammonium hydroxide , sodium hydroxide and bases that form schiff bases with aldehydes . preferably , an effective base for indirect cleavages is a base that forms schiff bases with aldehydes , such as aniline , methylamine , ethylamine , n - propylamine , and ammonia . most preferably , the effective base for indirect cleavages is aniline , ammonium hydroxide , or n - propylamine . for direct cleavages , the effective base used to remove any portions of primer remaining attached to the released oligonucleotide comprises mild bases . in a preferred embodiment , the effective base for direct cleavage is dilute sodium hydroxide , ammonium hydroxide , piperidine , or n - propylamine . most preferably , the effective base used in conjunction with a direct cleavage is piperidine . in the most preferred embodiment of the present invention , the oxidizable substituent of the primer is a ribonucleoside and the first nucleotide of the oligoncleotide to be synthesized is linked to the ribonucleoside via the 5 &# 39 ; position of the ribonucleoside . fig1 a is a reaction scheme which illustrates this embodiment of the present invention . where r 1 & amp ; r 2 = oh and r 3 & amp ; r 4 = h , r 1 & amp ; r 2 would correspond to the 2 &# 39 ; and 3 &# 39 ; hydroxyls of a ribose ring in fig1 a . during oligonucleotide synthesis , the 2 &# 39 ; and the 3 &# 39 ; position of the ribonucleoside are blocked . the oligonucleotide is cleaved from the polymeric support by first deblocking the 2 &# 39 ; and 3 &# 39 ; hydroxyl groups . the oligonucleotide is then released from the polymeric support by a selective oxidation which indirectly cleaves the primer . the effective oxidizing agent is periodate and the effective base is aniline , ammonium hydroxide , or n - propylamine . alternatively , the oligonucleotide may be first treated with periodate , followed by treatment with aniline , ammonium hydroxide , or n - propylamine , or the oligonucleotide may be treated simultaneously with periodate and aniline . the synthesized oligonucleotide is then recovered using standard techniques . removal of the protecting groups on the oligomer may be undertaken either before or after the oxidative cleavage of the synthesized oligonucleotide from the support . in the situation where it is desired to remove the protecting groups before cleavage , sodium hydroxide or ammonium hydroxide may be used to remove the protecting groups on the bases . where methyl or trichloroethyl are the protecting groups on phosphorus , the preferred reagents for deprotection are ammonium hydroxide or thiophenoxide . tributylphosphine is the preferred reagent for the removal of 2 , 2 , 2 - trichloro - 1 , 1 - dimethylethyl as the protecting group on phosphorus . where o - chlorophenol and p - chlorophenol are the protecting groups on phosphorus , oximates such as benzyloximate and pyridinaldoximate may be employed as the preferred deprotecting agents in accordance with those methods delineated in m . j . gait et al , rapid synthesis of oligodeoxyribonucleotides iv . improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates , nucleic acids research , vol . 8 , no . 5 , 1980 . there are situations where it may be desirable to cleave the synthesized oligomer from the polymeric support before the removal of the protecting groups on the oligomer . the protecting groups may be removed in accordance with those procedures described in t . w . greene , protective groups in organic synthesis , john wiley & amp ; sons , new york , 1981 . this aspect of the present invention has utility where the primer does not require prior deprotection for oxidative cleavage or in those cases where protecting groups can be removed under very mild conditions . the polymeric support system and oligonucleotide synthesis method of the present invention have particular utility in facilitating oligonucleotide hybridization techniques . the support of the present invention may be used as an oligonucleotide hybridization affinity system wherein , after deprotection of the synthesized oligonucleotide ( step f ), it may be hybridized with complementary polynucleic acids . in some instances , it may be desired to recover the complementary polynucleic acid that becomes hybridized to the synthesized oligonucleotide . in the most preferred embodiment of the present invention , the complementary hybridized dna or rna may be conveniently and quantitatively recovered upon elution . another preferred embodiment permits the quantitative recovery of the entire duplex by the oxidative cleavage of the primer from the polymeric support in accordance with the method of the present invention . in this embodiment , the protecting groups on the synthesized oligonucleotide and on the oxidizable substituents of the primer are removed before hybridization . once hybridization has been accomplished , treatment of the oxidizable substituents of the primer with an effective oxidizing agent , followed by treatment with a mild base , effectuates the release of the duplex from the polymeric support . one having skill in the art will appreciate the convenience with which hybridization products may be recovered by employing the techniques described herein . in other cases , it may be desired merely to detect the presence of the hybridized complementary polynucleic acid , without actually removing it from the support . in this situation , several detection methods are possible , all of which are well known in the art . one such detection method employs a hybridization probe that is complementary to a portion of the already hybridized polynucleic acid . this hybridization probe is by definition an oligonucleotide or polynucleic acid . if the complementary polynucleic acid did in fact hybridize to the synthesized oligonucleotide , then the hybridization probe will hybridize to the polynucleic acid on the support . the hybridization probe is labeled in some manner so that its presence on the already hybridized polynucleic acid after the second hybridization can be detected . labeling techniques commonly include radiolabeling , fluorescent labeling , reporter group labeling for interaction with a protein mediated detection system , color generation and light generation . a protein mediated detection system might also be used directly . one skilled in the art will also appreciate other methods by which the hybridization probe may be labeled for later observation after the second hybridization , or alternate methods by which the hybridized complementary polynucleic acid can be detected , such as detection with specific antibodies . the present invent ion is illustrated by , but not limited to , the following examples . synthesis of adenosine - n 6 - dodecylamine attached to a methacrylate polymer a solution of 6 - chloropurineriboside ( 287 mg .) and dimethoxytritylchloride ( 350 mg .) in anhydrous pyridine ( 1 ml ) was kept at room temperature . after 1 . 5 hours an aliquot checked by tlc analysis on silica showed that the reaction was better than 95 % complete . the mixture was then poured on ice - nacl and extracted with ch 2 cl 2 . the organic layer was washed repeatedly with aqueous nacl , then dried over na 2 so 4 and evaporated in vacuo . the residual foam was finally dissolved in benzene and lyophilized . a mixture of ( i ) and 1 , 12 - diaminododecane ( 2 g .) in anhydrous toluene ( 14 ml ) was kept at 100 ° c . for 20 min . before it was added dropwise to hexane ( 150 ml ) with vigorous stirring . the precipitate which formed in hexane was collected by centrifugation , then dissolved in ch 2 cl 2 , and the organic solution briefly extracted with aqueous koh ( 0 . 05m ). the organic layer was dried over na 2 so 4 and evaporated until dry . subsequently , the solid residue was dissolved in warm toulene . after removing a small amount of insoluble material , the dissolved material was precipitated by dropwise addition of excess hexane . the white precipitate which formed was collected by centrifugation , washed with hexane and dried in vacuo . the yield was 524 mg . as a fine powder . amberlite cg50 ( 100 - 200 wet mesh ) was thoroughly washed with aqueous 0 . 1m hcl , then with 0 . 15m hcl in 30 % aqueous methanol , followed by washings with methanol , acetone , chloroform and ether . the resulting powder was dried in vacuo over p 2 o 5 . a mixture of pretreated amberlite ( 1 g .) and carbonyldiimidazole ( 660 mg .) in dimethylformamide ( dmf ) ( 5 ml ) was shaken for 4 hours at room temperature . the activated amberlite was washed free of excess carbonyldiimidazole with dmf before it was suspended in a solution of ( ii ) in dmf ( 6 ml ) and triethylamine ( 0 . 5 ml ). the mixture was then heated to 80 ° c . for 1 hour with stirring . the unreacted carboxyl groups were capped by activating them with carbonyldiimidazole and dimethylamine in dmf ( 3 . 5 ml ) followed by shaking for 1 hour at room temperature . the resin was filtered off , then washed with acetone and ether . the dry powder was suspended in a mixture of acetic anhydride ( 4 ml ) and anhydrous pyridine ( 10 ml ). after 24 hours the resin was filtered off , carefully washed with acetone followed by ether , and dried . dimethoxytrityl release indicated that the primer density was between 50 - 100 microequivalents per gram . the nucleoside 5 -( 3 - amino - propenyl )- uridine was synthesized according to the procedure described in ruth et al , j . org . chem ., 43 : 2870 ( 1978 ) and dissolved in 1 : 1 methanol / dioxane ( 200 mls ). 3 . 6 grams of chloromethylstyrene beads ( biobeads xs - 1 , 1 . 25 mmoles of chlorine / gram of bead ) were added followed by swirling in a rotary shaker at 200 rpm for 30 hours at 65 ° c . the support was then filtered and washed successively with tetrahydrofuran , water , methanol and tetrahydrofuran before drying under high vacuum for one hour . tetrahydrofuran ( 40 mls ) and triethylamine ( 15 mls ) were added next followed by swirling at 200 rpm for one hour at 50 ° c . the support was then filtered , washed successively with water , methanol , chloroform and ether , and dried under high vacuum for 8 - 18 hours at room temperature . ten percent acetic anhydride in pyridine ( 1 : 9 , 20 ml / gram of resin ) and dimethylaminopyridine ( 2 mg / gram of resin ) were added to the dried resin followed by swirling for one hour at 40 ° c . after cooling , the liquid phase was decanted and the resin was washed successively with pyridine , chloroform and methanol before being lyopholized for 8 - 18 hours . pyridine in concentrated ammonium hydroxide ( 1 : 1 , 200 ml / gram of resin ) was then added with swirling for 4 hours at 37 ° c . upon evaporation to dryness under reduced pressure , a small amount of pyridine was added and the resin was once again evaporated to dryness . fifteen mls of pyridine / gram of resin was then added , together with 80 mgs of dimethoxytrityl chloride / gram of resin , and the mixture was swirled for 3 hours at 70 ° c . the resin was then filtered , washed successively with chloroform , methanol and ether , and briefly vacuum dried . twenty percent acetic anhydride in pyridine ( 10 mls / gram of resin ) was then added and swirled for 8 - 18 hours at 37 ° c . finally , the resin was filtered , washed successively with pyridine , chloroform and ether , and dried under vacuum for 8 - 18 hours at room temperature . dimethoxytrityl releases indicated that the primer density was between 10 - 50 microequivalents / gram . a mixture of polyacrylmorpholide resin ( vega biochemicals - catalogue no . 18964 ) ( 1 . 95 g ) and 1 , 12 - diaminododecane ( 2 g .) in 12 . 5 ml of freshly distilled glycol was heated under n 2 at 180 ° c ., with simultaneous stirring , for 20 hours . the resin was collected by centrifugation and then thoroughly washed sequentially with methanol , 10 % acetic acid - methanol ( 1 : 1 ), methanol - triethylamine , methanol , and finally ether . the resin was dried in vacuo yielding 1 . 61 g . of a fine yellowish power . an aliquot tested with picrylsulfonate in borate buffer ( ph 9 . 7 ) turned a strong orange color , indicating a good substitution of morpholine by the diamine . a mixture of the above resin ( 860 mg . ), 5 &# 39 ;- dimethoxytrityl - 6 - chloropurineriboside ( 470 mg . ), anhydrous toluene ( 5 ml ) and triethylamine ( 300 microliters ) was heated at 60 °- 70 ° c ., with stirring , for 20 hours . the resin was collected by centrifugation , then washed sequentially with toluene , methanol - triethylamine , methanol and ether . after drying the resin in vacuo , it was suspended in pyridine ( 6 ml ) and acetic anhydride ( 1 . 5 ml ) and shaken for 8 - 18 hours . the resin was then washed with pyridine , pyridine - water , methanol , acetone and ether . quantitation of the dimethoxytrityl removal with 2 . 6 % trichloroacetic acid in chloroform indicated that the primer density was 20 microequivalents / gram . once the oligomers have been synthesized on the primer - support system through the utilization of standard techniques , they may be easily removed using a combination of either periodate and ammonium hydroxide or periodate and aniline . when methyl is used as the phosphate protecting group , the support bound oligomer - primer is first incubated for 8 - 18 hours at 50 ° c . in concentrated ammonium hydroxide . this procedure removes all the blocking groups including those on the cis - diol . after washing the support bound oligomer - primer with appropriate solvents , including water , acetone and dichloromethane , the oligomer is oxidized by incubation ( 30 minutes - several hours ) in 0 . 05m sodium periodate / 0 . 05m sodium acetate ( ph 5 . 0 - 7 . 3 ). after washing with water , concentrated ammonium hydroxide is added and the mixture is then incubated for several hours at room temperature . the oligomer obtained is nearly free of contaminating species upon filtration , followed by washing with water and 50 % ethanol . after lyophilization to remove the water , ammonium hydroxide and ethanol , the desired oligomer is purified further by standard procedures . alternatively , after the incubation in sodium periodate / acetate , the oligomer may be removed by incubation with aniline ( ph 5 . 0 ) for several hours . the oxidative removal of the synthesized oligonucleotide from the support may be carried out either before or after deprotection of the reactive groups on the oligomer and support . as a test of the cleavage procedure , a monomeric unit of 5 &# 39 ;- dimethoxytrityl - n - benzoyl - 2 &# 39 ;- deoxcytidine was coupled to the polymethacrylate support ( example 1 ) of the present invention . using standard phosphomonochlorodite chemistry ( mateucci , m . d . and caruthers , m . h ., tetrahedron letters , 21 : 719 - 722 [ 1980 ]), 12 mls of a 20 mm solution of the activated nucleoside in acetonitrile / 4 % 2 , 6 - lutidine was added to 533 mgs of the support . after completion of the oxidation step , the support was washed successively with acetone , dichloromethane , water , acetone , dichloromethane and ether followed by air drying . the following procedures were followed in order to recover the monomer from the support . initially , the monomer was treated with concentrated ammonium hydroxide for 8 - 18 hours at 50 ° c . after washing with ammonium hydroxide , acetone and dichloromethane followed by drying under a stream of nitrogen , a mixture of 0 . 05m sodium acetate and 0 . 05m sodium periodate ( 10 mls , ph 7 . 2 ) was added and the entire mixture was incubated for a period of 24 hours at room temperature . upon washing with water , acetone , and dichloromethane followed by drying under nitrogen , concentrated ammonium hydroxide ( 10 mls ) was added and the mixture was once again incubated for 24 hours at room temperature . after a final washing with ammonium hydroxide , the monomer was recovered in good yield from the support . for this particular procedure , a slightly elevated ph was employed during the periodate oxidation in order to prevent the loss of the dimethoxytrityl group which was used for quantitation . synthesis of 5 &# 39 ;- dimethoxytrityl - 2 &# 39 ;, 3 &# 39 ; diacetyladenosine - n 6 - caproic acid attached to a teflon / copolymer graft the following example represents the most preferred embodiment of the present invention . 5 &# 39 ;- dimethoxytrityl - 6 - chloropurineriboside was prepared as described in example i . 5 &# 39 ;- dimethoxytrityl - 6 - chloropurineriboside ( 3 . 0 g , 5 m mole ) was then reacted with 6 . 75 g , ( 52 m mole ) 6 - aminocaproic acid in acetonitrile ( 30 ml ) , n - ethyldiisopropylamine ( 8 ml ) and h 2 o ( 25 ml ) at 80 ° c . for 15 hours to produce the 5 &# 39 ;- dimethoxytrityladenosine - n 6 - caproic acid salt . the product was purified by chromatography on a silica column and eluted with a linear gradient of methanol ( 0 - 20 %) in chloroform containing 2 % triethylamine . after evaporation of the solvent followed by evaporation from a small amount of pyridine , the syrupy 5 &# 39 ;- dimethoxytrityl adenosine - n 6 - caproic acid salt was acetylated in anhydrous pyridine ( 50 ml ) using acetic anhydride ( 10 ml ) for 24 hours at room temperature in the dark . the product , 5 &# 39 ;- dimethoxytrityl - 2 &# 39 ;, 3 &# 39 ;- diacetyl adenosine - n 6 - caproic acid triethylamine salt , was isolated by pouring the reaction mixture on ice , extracting the organic phase with dichloromethane and drying the dichloromethane phase with anhydrous sodium sulfate , followed by rota - evaporation of the solvent . the residual syrup was dissolved in 80 mls of toluene and the desired compound precipitated by the addition of 420 mls hexane . after filtration and air drying , the product yield was 2 . 62 g ( 2 . 4 m moles ). the 5 &# 39 ;- dimethoxytrityl - 2 &# 39 ;, 3 &# 39 ;- diacetyl adenosine - n 6 - caproic acid triethylamine salt ( 0 . 62 g , 0 . 56 m moles ) was reacted with 1 . 04 g ( 5 m moles ) dicyclohexylcarbodiimide and 0 . 54 g ( 4 m moles ) 1 - hydroxybenzotriazole in acetonitrile ( 20 ml ) and anhydrous pyridine ( 4 ml ) at 20 ° c . for four hours in order to form the active ester at the caproic acid site . a teflon wool / copolymer grafted support ( 9 . 18 g ) which contained alkylamine groups eight atoms in length was added and the mixture incubated for 19 hours at 20 ° c . the support was washed with acetonitrile methanol containing 2 % triethylamine , methanol and ether in order to remove any uncoupled nucleosides . unreacted amine groups on the support were then capped with excess acetic anhydride ( 5 ml ) and n - ethyldiisopropylamine ( 2 ml ) in 50 mls pyridine for two hours at 20 ° c . with shaking . after washing with acetonitrile , methanol and ether , the dimethoxytrityl content of the support indicated that the primer density was approximately 30 microequivalents per gram . the synthesis of ( dtp ) 15 using the 5 &# 39 ;- dimethoxytrityl 2 &# 39 ;, 3 &# 39 ;- diacetyladenosine - n 6 - caproic acid teflon / copolymer graft support ( tef i ) an oligomer 15 thymidines in length was synthesized on 0 . 105 g of the tef i support with a biosearch sam one dna synthesizer using the modified triester chemistry of efimov ( v . a . efimov , nuc . acid res ., 10 , 6675 ( 1982 )). once synthesis was complete , the phosphate protecting groups were removed with tetramethylguanidine and pyridinealdoxime in acetonitrile according to standard procedures ( reese , c . b . and yan kui , y . t ., chem . comm . 802 ( 1977 )) . the base protecting groups were then removed by incubation with concentrated nh 4 oh at 55 ° c . for five hours . these deprotection procedures also removed the 2 &# 39 ; and 3 &# 39 ; protecting groups on the adenosine . the support bound oligomer was then treated with 0 . 05m naio 4 in 0 . 02m na 2 hpo 4 , ( ph = 7 . 2 ) containing 20 % acetonitrile for three hours in the dark . after washing in h 2 o , the oligomer was cleaved from the support with a mixture of 5 % n - propylamine and 10 % acetonitrile in 1m triethylammonium bicarbonate ( 2 - 3 hours ). upon filtration and washing the support with a mixture of water and ethanol , the oligomer containing supernatant was evaporated to dryness in the presence of a small amount of tributylamine . hplc analysis with a unimetrics rp - 8 column eluted with a linear gradient of 3 - 30 % acetonitrile ( over 60 min .) in 0 . 025m ammonium acetate , ph = 7 . 1 gave a major peak at approximately 54 min . which is consistent with a 5 &# 39 ;- dimethoxytrityl ( dtp ) 15 . the authenticity of the material was confirmed by removing the dimethoxytrityl group with 80 % acetic acid , kinasing the oligomer with 32 p atp by standard procedures ( johnson , r . a . and walset , t . f ., adv . in cyclic nucleotide res ., volume 10 , edited by g . brooker , p . greengard and g . a . robison , raven press , new york , 1979 ) and electrophoresing the radiolabeled oligomer on a 20 % polyacrylamide gel by standard procedures ( maniatis , t ., fritsch , e . f . and sambrook , j ., molecular cloning , cold spring harbor laboratory , 1982 ). after autoradiography , the oligomer was shown to be virtually a single spot with the mobility of ( dtp ) 15 . synthesis of adenosine - n - 6 - dodecylamine attached to a teflon / copolymer graft support ( tef ii ) a teflon wool / copolymer graft containing carboxyl groups on its surface was used . the linker - am carboxyl moieties on the support , which were 15 atoms in length , were activated by incubating 2 . 5 g of support with 675 mg ( 5 m mole ) 1 - hydroxybenzotriazole and 1 . 13 g ( 5 . 4 m mole ) dicyclohexyl - carbodiimide in a mixture of acetonitrile ( 50 mls ) and pyridine ( 10 ml ). after incubating three hours , 1 . 2 g of 5 &# 39 ;- dimethoxytrityladenosine - n 6 - dodecylamine prepared as in example 1 was added and the mixture shaken for 18 hours at room temperature . dimethylamine ( 1 . 5 g , 33 m moles ) in 10 mls dimethylformamide was then added and incubated for one hour at room temperature in order to convert unreacted active esters to dimethylamides . after washing the support with acetonitrile , methanol and ether , the 2 &# 39 ; and 3 &# 39 ; hydroxyl groups on the adenosine were capped with a mixture of 6 mls ( 64 m mole ) acetic anhydride and 750 rags ( 6 m mole ) dimethylaminopyridine in 40 mls anhydrous pyridine followed by incubating for three hours at room temperature . acetyl chloride ( 2 mls , 28 m moles ) was then added and the incubation continued for one hour . the support was washed with acetonitrile , methanol and ether . the yield was 2 . 6 g and dimethoxytrityl release indicated that the tef ii support had a primer density of 85 microequivalents per gram . the addition of 5 &# 39 ;- dimethoxytrityl - 3 &# 39 ;-( p - chlorophenylphosphate )- 5 &# 39 ;-( methyl - 14 c ) thymidine to a tef ii support and its cleavage from the support an appropriate radiolabeled thymidine nucleotide was obtained , condensed onto the tef ii support of example 7 and selectively cleaved from the support . this procedure verified the selective cleavage aspects of the support . 5 &# 39 ;- dimethoxytrityl - 3 &# 39 ;-( p - chlorophenyl phosphate )- 5 -( methyl - 14 c ) thymidine was prepared as follows . cold thymidine ( 122 mg , 0 . 5 m moles ) was combined with 5 -( methyl - 14 c ) thymidine ( approximately 95 μci / μmole , dissolved in water , lyophilized and dried over phosphorous pentoxide . the 14 c - thymidine mixture was then dissolved in 4 ml anhydrous pyridine and evaporated to 2 ml . dimethoxytrityl chloride ( 170 mg , 0 . 5 m mole ) was then added and allowed to incubate for one hour at room temperature . the reaction mixture was then poured into ice and extracted into dichloromethane . the dichloromethane phase was dried over sodium sulfate , filtered and roto - evaporated to a gum . the gum was recrystallized at 0 ° c . from boiling benzene containing 2 . 5 % triethylamine . the crystals were washed with cold benzene / cyclohexane ( 2 : 1 ) and dried in vacuo . the yield was 270 mg ( approximately 0 . 5 m mole ) and the radio - labeling gave 16100 cpm / o . d . at 267 nm . the 14 c labeled 5 &# 39 ;- dimethoxytrityl thymidine was stored as a stock solution in 1 ml of anhydrous pyridine . the 14 c labeled thymidine analogue was then phosphorylated by combining 245 mg ( 1 m mole ) p - chlorophenyl dichlorophosphate in 1 . 2 ml anhydrous pyridine , 18 . 5 μl h 2 o and adding 400 μl of the 5 &# 39 ;- dimethoxytrityl - 5 -( methyl - 14 c ) thymidine stock , which was dissolved in pyridine . after 30 min . at room temperature , approximately 10 ml of 1m triethylammonium bicarbonate was added and the organic phase extracted 3 times with ethyl acetate . the organic phase was back extracted with an aqueous nacl solution and dried over sodium sulfate . the organic phase was then filtered , evaporated to dryness , and lyophilized from dioxane which contained a trace of triethylamine . the lyophilized material was dissolved in 3 ml anhydrous pyridine and stored at 4 ° c . thin layer chromatography on silica gel plates using 10 % methanol in chloroform containing 2 % triethylamine as the eluting solvent indicated that the product was chromatagraphically pure . scintillation counting indicated that there was 11 . 5 μci of material present . forty - one micromoles of the 14 c labeled thymidine analogue were condensed with 50 mgs of the tef ii support using the modified triester method of efimov ( v . a . efimov , nuc . acid res ., 10 , 6675 ( 1982 )) . the deprotecting and cleavage steps disclosed in example 5 were then carried out and the nucleotide release monitored by the release of 14 c at each step . the results are summarized as follows : ______________________________________ % . sup . 14 c % . sup . 14 cstep on support in solution______________________________________before nh . sub . 4 oh 100 0deblockingafter nh . sub . 4 oh 97 3 ( 50 ° c ., 20 hrs . ) after periodate 96 1oxidationafter selective 18 78base cleavage______________________________________ this example verifies that upon oxidation followed by base treatment , the selective cleavage site splits as desired . utilization of a polymethacrylate support system to synthesize a dna hybridization affinity column to illustrate a practical application of the present invention , a polymethacrylate support system has been effectively utilized as a sequence specific affinity support for nucleic acid separations . a polymethacrylate support was synthesized in accordance with the procedures described in example 1 . the support contained 78 microequivalents / gram of the nucleoside primer as determined by dimethoxytrityl release . dry resin ( 350 mg ) was packed into a column measuring 6 mm × 30 mm . the column was fitted into a bio logicals dna / rna synthesizer which was modified such that all steps were programmable . nucleosides were added sequentially using a modified version of the standard phosphomonochloridite chemistry ( matteucci , m . d . and caruthers , m . h ., tetrahedron letters 21 : 719 - 722 [ 1980 ]). modifications to this standard procedure included : 1 ) capping unreacted 5 &# 39 ; hydroxyl groups with a mixture of 5 % n , n - dimethylaminopyridine , 17 . 5 % acetic anhydride , 28 . 2 % tetrahydrofuran and 49 . 3 % 2 , 6 - lutidine ; and 2 ) removing the dimethoxytrityl groups with 4 % dichloroacetic acid in chloroform . using this modified procedure , 400 micromoles of a 30 mm solution of the appropriate phosphomonochlorodite were reacted with the support for each nucleotide addition . the sequence synthesized was polymethacrylateprimer - 3 &# 39 ; d ( ttttgaaataggta ) 5 &# 39 ;. once the oligonucleotide synthesis had been completed , the base blocking groups were removed by reacting the support bound dna with concentrated ammonium hydroxide for 8 - 18 hours at 50 ° c . after extensive washing with water and 1m sodium chloride , the resin was dried and the terminal dimethoxytrityl groups were quantitated at 2 . 3 micromoles of bound oligonucleotide per gram of resin . in order to evaluate the usefulness of the affinity hybridization support , two sequences of dna were synthesized using identical phosphite chemistry . however , the standard base cleavable silica support was used ( matteucci , m . d . and caruthers , m . h ., tetrahedron letters 21 : 719 - 722 [ 1980 ]). one of these sequences was a 14 mer which was complementary to the affinity hybridization support , i . e ., 5 &# 39 ;- d ( aaactttatccatc ) 3 &# 39 ;. the other sequence was a 17 mer which was not complementary to the affinity hybridization support , i . e ., 5 &# 39 ;- d ( ggaatattcccccaggc ) 3 &# 39 ;. both of these dna sequences were labeled with 32 p - atp at the 5 &# 39 ; end by standard procedures and purified on a polyacrylamide gel ( richardson , c . c ., proc . nat &# 39 ; l . acad . sci ., 54 : 158 [ 1965 ] and maxam , a . and gilbert , w ., methods of enzymology , 65 : 449 [ 1979 ]). the 14 mer and 17 mer sequences were tested for their ability to hybridize with the affinity support . this was done by incubating the dna sequences with the affinity support for two hours at 25 ° c . in the presence of a buffer consisting of 1m sodium chloride , 10 mm tris buffer , and l mm edta at a ph of 7 . 6 . sequences which did not hybridize were washed away with fifteen one - half ml aliquots of the buffer just described . the hybridized oligonucleotide sequences were then eluted with water . in evaluating this comparative procedure , 30 % of the 14 mer sequence and less than 5 % of the 17 mer sequence were found to bind to the affinity column . the new and improved polymeric support system for the synthesis of oligonucleotides , in accordance with the present invention , satisfies a long existing need in the art for a versatile polymeric support system that permits a convenient and quantitative release of all synthesized oligomers from a single type of polymeric support while maintaining a tolerance to mildly acidic and mildly basic reaction conditions . it will be apparent from the foregoing that , while particular forms of the invention have been illustrated and described , various modifications can be made without departing from the spirit and scope of the invention . accordingly , it is not intended that the invention be limited except as by the appended claims . | 2 |
the following description is presented in the context of a particular application . it is to be understood that the principles defined herein may be applied to other embodiments without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the particular embodiment shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . fig1 illustrates a single pass , four color electrostatographic printing machine 8 which , as is subsequently described , incorporates the principles of the present invention . the printing machine 8 includes a charge retentive surface in the form of an active matrix ( amat ) photoreceptor 10 which has a photoreceptive surface and which moves in the direction indicated by the arrow 12 . photoreceptor movement is brought about by mounting the photoreceptor about a drive roller 14 and two tension rollers , the rollers 16 and 18 , and then rotating the drive roller 14 via a drive motor 20 . as the photoreceptor moves each part of it passes through each of the subsequently described process stations . for convenience , sections of the photoreceptor , referred to as image areas , are identified . an image area is a part of the photoreceptor which is operated on by the various process stations so as to produce a developed image . while the photoreceptor may have numerous image areas , since each image area is processed in the same way a description of the processing of one image area suffices to explain the operation of the printing machine . as the photoreceptor 10 moves a first image area passes a first corona generating corotron 22 , a second image area passes a second corona generating corotron 24 , a third image area passes a third corona generating corotron 26 , and a fourth image area passes a fourth corona generating corotron 28 . each of the corotrons charge their associated image areas to a relatively high and substantially uniform potential , for example about − 500 volts . while the image areas are described as being negatively charged , they could be positively charged if the charge levels and polarities of the other relevant sections of the printing machine 8 are appropriately changed . it is to be understood that power supplies , which are not shown , power the various corotrons and the other devices which are subsequently described as required so that they can perform their intended functions . after passing the corotrons the first , second , third , and fourth charged image areas are exposed , respectively , by laser based raster output scanners 30 , 32 , 34 , and 36 . each of the raster output scanners is in accordance with the ros system 100 illustrated in fig2 subsequently described . the various raster output scanners each sweep a modulated laser beam across their image areas in a fast scan direction as the photoreceptor 10 advances in the direction 12 . each raster output scanner thereby exposes its image area with a light representation of a different color of image . for example , the raster output scanner 30 might expose the first image area with a light representation of a black image , the raster output scanner 32 might expose the second image area with a light representation of a cyan image , the raster output scanner 34 might expose the third image area with a light representation of a yellow image , and the raster output scanner 36 might expose the fourth image area with a light representation of a magenta image . the light representations are derived from laser current drive signals applied to the raster output scanners 30 , 32 , 34 , and 36 , via , respectively , laser drive current lines 38 , 40 , 42 , and 44 , from the controller 46 . the controller 46 receives and processes both video information and a start of scan signal ( or signals ) to produce the laser current drive signals for the various scanners . the video information contains a digital representation of a composite image that is to be produced ; that video information can be from any of a number of sources , including a computer , a facsimile machine or a raster input scanner . the start of scan signal informs the controller that the laser beams are at predetermined positions . by decoding the video information into laser current drive signals , and by synchronizing the application of the laser current drive signals to the various scanners with the positions of the laser beams as they scan across the image areas , the desired latent images can be produced upon the image areas . after passing their associated scanners the exposed first , second , third , and fourth image areas are developed , respectively , at first , second , third , and fourth development stations , the station 60 , 62 , 64 , and 66 . the first development station 60 advances negatively charged toner of a first color ( black ) onto the first image area , the second development station 62 advances negatively charged toner of a second color ( cyan ) onto the second image area ; the third development station 64 advances negatively charged toner of a third color ( yellow ) onto the third image area ; and the fourth development station 66 advances negatively charged toner of a fourth color ( magenta ) onto the fourth image area . the development material is attracted to the less negative sections of the image areas and repelled by the more negative sections . the result is four toner images on the photoreceptor 10 . after being developed the toned image areas sequentially advance to a transfer station 70 . using any of a number of well known techniques the various toner images are placed in a superimposed registration so as to produce a desired composite image . that composite image is then permanently affixed to a substrate 72 . after their toner layer is transferred to the transfer station 70 the image areas are cleaned of residual toner and other debris at a cleaning station 80 . the image areas are then ready to produce another latent image . the foregoing has generally described a single pass , four color electrophotographic printer which , like other devices , is suitable for incorporation of the present invention . that invention relates to facet tracking within the raster output scanners . reference is now made to fig2 wherein there is illustrated , in a simplified form , a raster output scanner 100 which is in accord with the principles of the present invention . the raster output scanner includes an electronically adjustable , variable wavelength semiconductor diode 102 , which in the raster output scanner 100 is a distributed bragg reflector laser , which outputs a laser beam 104 . the laser diode is video modulated by video data from the controller 46 ( see fig1 ) and by an electronic signal , assumed to be a voltage but a current may be preferred in practice , from a source 106 . the source receives from the controller information related to the start of scan position of the laser beam . the laser beam 104 passes through a wavelength dispersive element 108 onto a facet 110 of a polygon 111 . the wavelength dispersive element is a transmissive diffraction grating , but other types of wavelength dispersive elements , such as reflective diffraction gratings , or plastic or glass prisms , may be preferred in a given application . it is assumed that the polygon rotates in the direction of the arrow 112 . it should be noted that the laser beam &# 39 ; s optical path is greatly simplified . in practice , beam focusing optical elements would be placed in the optical path both before the polygon and after so as to focus the laser beam into a relatively small spot on the facet 110 and , subsequently , into a relatively small spot on the photoreceptive surface . depending upon the particular application , other optical functions might also be achieved by those optical elements . however , since those elements are well known they are not shown in fig2 to avoid confusion . in accordance with the principles of the present invention the wavelength of the semiconductor diode is adjusted such that the wavelength dispersive element causes the laser beam to track the moving polygon facet during the scan line time interval . that is , at least during the time period in which the spot on the photoreceptive surface is tracing a scan line in an image area , voltage induced wavelength changes in the laser beam cause the wavelength dispersive element to vary the angle at which light leaves that element such that the spot on the rotating facet moves with the changing position of the facet and such that that spot remains substantially locked in its position on the facet . fig2 illustrates the principle described above by showing both the laser beam from the wavelength dispersive element and the polygon at two different times , once with dashed lines , i . e ., the laser beam 104 ′ and the polygon 111 ′, and once with solid lines . it is assumed that the dashed lines represent the laser beam and the polygon at an earlier time than that of the solid lines . at that earlier time the voltage applied to the semiconductor diode 102 is at a first voltage . that first voltage causes the wavelength of the laser beam to be at a first wavelength . the interaction of the laser beam at that first wavelength causes the wavelength dispersive element to deflect the laser beam 104 ′ onto the facet 110 ′ such that a spot is produced at about the center of a facet . as the facet rotates the voltage applied to the semiconductor diode changes such that the wavelength of the laser beam changes such that the interaction of the laser beam with the wavelength dispersive element varies the deflection of the laser beam such that the laser beam remains fixed on the center of the facet . for example , at the second time , a second voltage applied to the semiconductor diode causes the laser beam 104 to have a wavelength such that the wavelength dispersive element causes the deflection of the laser beam to be such that the laser beam is fixed on the center of the facet 110 . fig3 graphically illustrates idealized interactions of the voltage source , the laser beam wavelength , and the polygon position . it is assumed that the x axis shows a period of time which corresponds to two scan line time intervals . at the start of the first scan interval time interval the voltage applied to the semiconductor diode is assumed to be zero . at this voltage the laser diode produces a minimum wavelength , the laser beam is minimally deflected by the wavelength dispersive element , and a facet spot is centered on a facet . as the polygon rotates the voltage applied to the semiconductor laser increases , causing the laser wavelength to increase , which causes the deflection angle to increase so as to maintain the facet spot on the center of the facet . this interaction continues until the polygon rotates to end of the first scan line . at that time the voltage from the voltage source drops to zero , and the laser beam wavelength and the deflection angle return to their minimum positions . at this time a facet spot is formed at the center of another facet and the process repeats . again , the interactions illustrated in fig3 are idealized . in practice the interactions will probably be much more complex , possibly non - linear , and likely temperature and / or material dependent . of particular note , linearizing of the scan line to maintain pixel to pixel uniformity may be required in practical systems . as noted , the semiconductor laser 102 is a distributed bragg reflector laser . other types of lasers which emit laser beams having wavelengths which can be electronically adjusted are also known in the prior art . reference to wavelength tunable lasers may be found in u . s . pat . no . 5 , 204 , 694 , issued to andrews on apr . 20 , 1993 ; in u . s . pat . no . 5 , 208 , 456 , issued to appel et al . on may 4 , 1993 ; in u . s . pat . no . 5 , 204 , 523 , issued to appel et al . on apr . 20 , 1993 ; in the citations found in those united states patents ; and in numerous other patent and non - patent references . others who are skilled in the applicable arts will recognize numerous modifications and adaptations of the illustrated embodiment which will remain within the principles of the present invention . indeed , practical implementations of the present invention are believed to be numerous and diverse . for example , using a distributed bragg reflector laser with a grating surface emitting region and / or spherical beam collimating elements , and / or spot position feedback control may prove beneficial in a given application . therefore , the present invention is to be limited only by the appended claims . | 7 |
a nuclear magnetic resonance apparatus of the type which can be operated by the method disclosed herein is schematically shown in fig1 . the apparatus includes coils 1 , 2 , 3 and 4 for generating a fundamental magnetic field b 0 in which an examination subject 5 is disposed . the coils 1 through 4 are operated by a fundamental field power supply 11 . the apparatus also includes gradient coils for generating independent orthogonal magnetic field gradients in the x , y and z directions as indicated at 6 . for clarity , only gradient coils 7 and 8 are shown in fig1 . the coils 7 and 8 in combination with an opposite pair of identical gradient coils generate the x - gradient . identical y - gradient coils ( not shown ) are disposed parallel to each other above and below the examination subject 5 . identical z - gradient field coils are disposed parallel to each other at the head and feet of the examination subject 5 at right angles relevant to the longitudinal axis of the subject 5 . the apparatus further includes a high - frequency coil 9 for generating and measuring the nuclear magnetic resonance signals . the coils 1 , 2 , 3 , 4 , 7 , 8 and 9 surrounded by the dashed line 10 represent the actual examination instrument in which the patient is disposed . as mentioned above , a fundamental field power supply 11 is provided for the fundamental coils , and a gradient power supply 12 is provided for the gradient coils . the measuring coil 9 is connected to a process control computer 17 through a signal amplifier 14 or through a high - frequency transmitter 15 , depending upon the operating mode . the computer 17 generates signals for constructing a visible image on a display 18 . the components 14 and 15 form a high - frequency transmitter / receiver unit 16 , and a switch 19 enables switching from a transmitting mode to a receiving mode . one embodiment for an operating method for the apparatus shown in fig1 in accordance with the principles of the present invention is shown in fig2 . the pulse sequences generated by the high - frequency transmitter 15 and the gradient field power supply 12 ( which is switched ) are shown in fig2 . as used herein , a scan includes all pulses which are required for measuring a line in the fourier space and for restoration of the spin condition which existed before the scan . in the example shown in fig2 a scan begins with excitation of the nuclei in period i for a duration t by means of a selective high - frequency pulse ( the slice selection gradient g z being switched on ) having a flip angle ( 0 °& lt ; α ≦ 90 °). in the following period ii a de - phasing of the nuclear magnetization with respect to a defined spatial direction takes place by connecting a projection gradient - g r having the vector components - g x and - g y for a duration of approximately t / 2 . the projection gradient - g r is switched on approximately half as long as during the high - frequency excitation . in the subsequent periods iii and iv ( duration approximately t ), the projection gradient is switched on with an opposite sign ( g r ) which initiates bringing the spin moments back into phase . during the periods iii and iv , the nuclear magnetic resonance signal emitted by the excited slice is simultaneously read out . the projection gradient g r thus remains switched on twice as long as previously . any de - phasing which occurred in period iv is reversed in period v to an in - phase condition by means of a following projection gradient - g r , again reversed in polarity . additionally , a slice selection gradient - g z is switched on during period ii , and a slice selection gradient + g z is switched on during period v . the de - phasing events which occur within the slice thickness in the z - direction during the period i are thereby corrected . because these processes are not influenced by the switching times of the projection gradient , the switching times for the projection gradient and for the slice selection gradient can overlap . a high - frequency pulse having a flip angle - α ( 0 °& lt ; α ≦ 90 °) given a negatively switched slice selection gradient initiates the next scan period vi . during the next scan , the same procedures and sequence occur as in the preceding scan , but using an opposite operational sign for the slice selection gradient and with a modified value of the projection gradient . the entire sequence is continued until the projection gradient has rotated by 180 °. given a standard gradient strength of 3 mt / m , the high - frequency pulse lasts approximately 5 msec , the read - out time last approximately 5 msec , and the two periods ii and v in combination also lasts approximately 5 msec . the above steps are repeated n r times , therefore n r projections are obtained . a projection is thus obtained every 15 msec . given n r = 180 projections , measuring times of 2 . 7 seconds are obtainable . before beginning the actual data registration , it may be necessary to register a few projections under no - load conditions in order to set the dynamic equilibrium condition . image reconstruction is accomplished by known methods of filtered back - projection . a pulse sequence is shown in fig3 in accordance with the principles of the present invention which can be used in connection with the 2d - fourier reconstruction method . in this method , as is known , the nuclear magnetic resonance signals are always read out with the use of only one gradient field , for example , the x - gradient . it is therefore also referred to as the read - out gradient . n points of the nuclear resonance signal are read out . the steps are repeated n y times with the direction of the phase - coding gradient being changed by a selected amount for successive repetitions until n r scans are recorded . using known 2d - fourier reconstruction techniques , an image having n y × n points is generated . the location information of the signal regarding the other spatial direction ( such as the y - direction ) is achieved by impressing a phase response which differs from scan to scan with a variable y - gradient ( phase - coding gradient ). in this method as well as in the previously described method , the pulse sequence and gradient sequence are highly symmetrical . another embodiment of the method is shown in fig4 for producing multi - slice exposures . in this embodiment , a phase response dependent upon the z - coordinate is impressed during the time period ii of the precessing nuclear spin . this phase response is impressed with the assistance of an additional slice gradient which is successively varied from scan to scan . as a result , the excited state can be resolved into n z sub - slices ( images ) in a subsequent 3d - fourier reconstruction ( given n z switching stages for g z ), each sub - slice or image having n y × n x points . if non - ideal conditions are present in a nuclear magnetic resonance apparatus for exposure in accordance with the described methods , it may be preferable to depart from the otherwise required high degree of symmetry of the high - frequency and gradient pulse sequences . this may be preferably under the following conditions . if , for example , due to the alternating switching of the slice selection gradients , different eddy currents for positive and negative amplitudes are generated , and a 2d - reconstruction method is employed , this can be expressed in a line structure of the register data of the fourier space ( even and odd lines appearing with different intensities ). in order to suppress the multiple image appearing after the image reconstruction due to the line structure , the sequence can be modified such that the slice selection gradient exhibits the same switching behaviour for all fourier lines ( all scans ). strip structures in the data of the registered fourier space which appear due to the interference of two echo centers shifted in the read - out direciton can be eliminated by bringing the centers into coincidence by suitable adjustment of the pre - dephasing of the projection gradient or of the read - out gradient by modification of the time integral in the period ii . in other instances it may be preferable to switch the slice selection gradient and / or the projection or read - out gradient in the time span v . the shift of the dynamic equilibrium condition occurring due to the lack of these gradient pulses may result in deterioration of the image which is less than the interfering factors which may potentially occur due to the switching of these gradients . inhomogeneities of the fundamental field which may be present , shift the dynamic equilibrium in such a manner that the flip angle of the high - frequency pulse , alternating in operational sign , is not necessarily required for maintaining the equilibrium . a corresponding pulse sequence always having the same operational sign of the flip angle accordingly does not result in a substantial signal loss . although modifications and changes may be suggested by those skilled in the art it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art . | 6 |
a container 100 according to one embodiment of the present disclosure is shown in fig1 to fig6 . fig1 and fig2 illustrate a perspective view of a container 100 in its closed position and open position , respectively , with respect to one embodiment of the present disclosure . as embodied herein and as shown in fig1 and fig2 , the container 100 comprises a hollow base 101 and a cap 102 . the hollow base 101 is elongated along a central longitudinal axis x . the cap 102 holds a solid product p . in a preferred embodiment , the container 100 is formed from the acrylonitrile butadiene styrene ( abs ) material . in an alternate embodiment , the container 100 can be formed from any other suitable polymeric material or any other option available . in a preferred embodiment , the container 100 is of substantially cylindrical shape . in an alternate embodiment , the container 100 can be made of any shape such as square , circular , oval , spherical or oyster shape etc . as shown in fig3 , the cap 102 holding the solid product p is configured to rotate inside the hollow base 101 . the hollow base 101 is elongated along a central longitudinal axis x . the cap 102 is mounted on the hollow base 101 and is capable of rotating about an axis c substantially perpendicular to the central longitudinal axis x . the cap 102 can be rotated through 180 degree in one direction about the axis c to open the container 100 and through 180 degree in opposite direction about the axis c to close the container 100 . it would not be beyond the scope of the present disclosure that the cap 102 can be turned through less than or greater than 180 degree in one direction to expose the solid product p from a top end of the hollow base 101 to bring the container 100 to an open position and can be turned through less than or greater than 180 degree in reverse direction to enclose the solid product p within the hollow base 101 to bring the container to a closed position . as shown in fig3 to fig6 , the container 100 includes a hollow base 101 and a cap 102 . the cap 102 comprises a support member 104 which secures a solid product p to the cap 102 . the hollow base 101 comprises a side wall 106 , an open top end 108 and a bottom end 110 . the bottom end 110 is closed . according to other embodiment , the bottom end 110 may be open and can also be used to store another product . the cap 102 comprises a closed end 112 , an open end 114 and a rim 116 at the open end 114 . the cap 102 is pivotally mounted on the side wall 106 near the top end 108 of the hollow base 101 so that the cap 102 can be rotated inside the hollow base 101 . the cap 102 is provided with a diametrically opposed pair of rotation means on an outer surface of the rim 116 of the cap 102 . in one embodiment and as shown in fig4 and 5 , rotation means of the cap 102 includes a diametrically opposed pair of lugs / pins / protrusions 118 on an outer surface of the rim 116 which are configured to be disposed within a corresponding pair of apertures / holes 120 present in the side wall 106 near the top end 108 of the hollow base 101 to allow the cap 102 to rotate / turn within the hollow base 101 . the cap 102 also comprises a lip 150 on the outer surface of the rim 116 which can be grasped by a user &# 39 ; s hand to turn the cap 102 within the hollow base 101 . the cap 102 is further provided with at least one guiding means to guide the rotation of the cap 102 within the hollow base 101 . in one embodiment and as shown in fig4 and 5 , the guiding means of the cap 102 includes a pair of lugs / pins / protrusions 122 on the outer surface of the rim 116 of the cap 102 which are configured to travel in a pair of corresponding semicircular grooves 124 provided on an inner surface 126 of the side wall 106 near the top end 108 of the hollow base 101 . the lugs / pins / protrusions 122 travel in corresponding semicircular grooves 124 in the side wall 106 of the hollow base 101 to allow the cap 102 to rotate through 180 degree in one direction to open the container 100 and through 180 degree in opposite direction to close the container 100 . it would not be beyond the scope of the present disclosure that the grooves 124 can be of any shape that allows the cap 102 to rotate through more than 180 degrees or less than 180 degrees . the guiding means further help to prevent extraction / removal of the cap 102 from the hollow base 101 , in a case where the container 100 falls out of user &# 39 ; s hand or during transport of the cosmetic container 100 from one place to another . the cap 102 is also provided with at least one locking means to prevent the accidental movement of the cap 102 from the closed position to the open position or vice versa . in one embodiment and as shown in fig4 and 5 , the locking means of the cap 102 includes two diametrically opposed pairs of grooves 128 on an outer surface of the rim 116 of the cap 102 which engage with the corresponding pairs of protrusions 130 provided on an inner surface 126 near the top end 108 of the side wall 106 of the hollow base 101 . it would not be beyond the scope of present disclosure that the locking means of the cap 102 include two diametrically opposed pairs of projections on an outer surface of the rim 116 of the cap 102 which engage with the corresponding pairs of grooves provided on an inner surface 126 near the top end 108 of the side wall 106 of the hollow base 101 . the support member 104 is attached to the open end 114 of the cap 102 . as shown in fig4 - 6 , the support member 104 comprises an outer skirt 132 and an inner skirt 134 , wherein the outer skirt 132 comprises a projection 136 on its outer surface which engages with corresponding annular groove 138 present on an inner surface of the open end 114 of the cap 102 . the outer skirt 132 also comprises at least one cut out 140 for providing flexibility to the outer skirt 132 so that the support member 104 can be easily fitted into the cap 102 . it would not be beyond the scope of present disclosure that the support member 104 can be attached to the open end 114 of the cap 102 by various attachment means like screw thread , snap fit and the like . further , the solid product p is attached to the support member 104 of the cap 102 . as shown in fig4 and 6 , the support member 104 comprises a support surface for gripping / holding the solid product p , the support surface comprises a plurality of apertures 149 . the plurality of apertures 149 may be of any shape selected from circular , oval , rectangular , square , triangular , polygonal and the like . the support surface may be in form of plurality of ribs 142 separating the plurality of apertures 149 for gripping / holding the solid product p . according to an embodiment , the plurality of ribs 142 is arranged radially or laterally or in any other suitable manner such that the plurality of apertures 149 is defined between adjacent ribs 142 . in various embodiments of the disclosure , the support surface may be a flat surface or a raised surface wherein the raised surface can be a domed surface or a surface of any other shape . further , the support surface may be a smooth surface or have surface irregularities . as shown in fig4 and 6 , the support surface comprises a central portion 146 and a plurality of mutually spaced elongated ribs 142 radiating outwardly there from to an inner surface 144 of the inner skirt 134 . the central portion 146 further comprises a gripping post 148 integrally connected to the central portion 146 . the gripping post 148 projects above the level of inner skirt 134 . the gripping post 148 is provided to pull the support member 104 out from a mould ( not shown in the drawings ) used for making the solid product p . it would not be beyond the scope of present disclosure that the gripping post 148 is provided on any other part of the support member 104 . also , it would not be beyond the scope of present disclosure that the plurality of ribs 142 may be arranged laterally or in any other suitable manner for gripping / holding the solid product p . as for example , the ribs 142 may be arranged in grid form wherein each of the plurality of ribs 142 may have two opposing ends attached to the inner surface 144 of the inner skirt 134 . according to another embodiment of the present disclosure , the support member 104 may include a plurality of protrusions ( not shown ) extending downwardly from a bottom surface of ribs 142 toward the hollow base 101 for providing additional support to solid product p . the solid product p can be attached to the ribs 142 in the inner skirt 134 of the support member 104 according to the methods known in the art . according to a method employed in the present disclosure for attaching the solid product p to ribs 142 , the support member 104 is first placed on a concave shaped mold or a mould of any other shape ( not shown in the drawings ) which is then filled by pouring a hot liquid product through the apertures / spaces 149 between the ribs 142 . then the mold filled with the hot liquid product is cooled by passing through a cooling chamber . as a result of cooling , the liquid product solidifies into a solid product p and gets attached to the ribs 142 of the support member 104 . now , the support member 104 carrying the solid product p can be pulled out of the mold by using the gripping post 148 . the shape of the mould can vary depending upon the required shape of the solid product p like flat shape , square , rhombus , circular , dome and the like . further , according to another embodiment , the product in the mold can be further compressed by applying pressure with a pressing disk having a shape complementary to the support surface of the support member . during use , the user holds the hollow base 101 of the container 100 with a hand and opens the container 100 by turning the cap 102 in one direction around the transverse axis c by applying a force with a thumb on the lip 150 of the cap 102 . as the force is applied on the lip 150 , the cap 102 turns through 180 degree within the hollow base 101 to expose the solid product p . now , the cap 102 rests in the open position as shown in fig2 with the help of locking means , wherein the locking means are in the form of grooves 128 in the cap 102 , which engage with the corresponding protrusions 130 on the inner surface 126 of the side wall 106 of the hollow base 101 . the user applies the solid product p by holding the hollow base 101 and after using the solid product p , the user closes the container 100 by turning the cap 102 in opposite direction around the transverse axis c by applying a force with a thumb on the lip 150 . as the force is applied on the lip 150 , the cap 102 again turns through 180 degree in opposite direction within the hollow base 101 to enclose the solid product p within the hollow base 101 . now , the cap 102 rests in the closed position as shown in fig1 , with the help of locking means in the form of grooves 128 in the cap 102 which engage with the corresponding protrusions 130 on the inner periphery 126 of the side wall 106 of the hollow base 101 . the container 100 of the present disclosure may be used to deliver a wide variety of consumer and industrial products related to cosmetic , skin care , hair care , oral care , personal care , pharmaceutical , wound care , orally administrable products , home - care or adhesives . various examples of the products where the container 100 of the present disclosure could be used are but not limited to cheek blush , cheek plumping cake , lip plumping solid product , lip balm , temporary hair colors , hair care , skin care , foundation and the like . while the foregoing is directed to embodiments of the present disclosure , other and further embodiments of the disclosure may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow . | 0 |
referring to the drawing , shown therein is a portion of a gate station wherein incoming gas at high pressure in a pipeline 12 has its volume measured by a meter 14 and then has its pressure dropped to a lower outlet pressure for subsequent distribution through a pipeline 16 . during normal operation , the valve 18 is open and the valve 20 is closed . accordingly , the gas in the pipeline 12 passes through the meter 14 , through the valve 18 , through a pressure regulator valve 22 and into the outlet pipeline 16 . the manually operated gate valves 24 and 26 are normally open and are only closed for emergency or maintenance purposes . when it is desired to calibrate the meter 14 , the valve 18 is closed and the valve 20 is opened so that after passing through the meter 14 , the gas flows through the pipeline 28 , through the sonic nozzle 30 , mounted in accordance with the afore - referenced co - pending patent application , and through the pipeline 32 to the pipeline 16 . at the same time , the valve 34 is opened , allowing gas to flow through the bypass line 36 . the pipeline 36 is fed into a pressure vessel 42 , within which there is disposed a meter 44 . the inlet 46 of the meter 44 is open to the interior of the pressure vessel 42 and the outlet 48 of the meter 44 exits the pressure vessel 42 through a pipe 50 . the gas in the pipe 50 is still at a high pressure . a small sonic nozzle 52 , operated at critical flow conditions , controls the volumetric flow rate through the meter 44 . there must be sufficient pressre drop to obtain critical flow . a computer 60 is provided to perform the calculations according to this invention , as will be described in full detail hereinafter . the computer receives as its inputs volume flow information from the meters 14 and 44 , as well as pressure and temperature inputs provided by sensors at various points along the gas flow . the computer 60 also controls the operation of the solenoid valve controlled valves 18 , 20 , 30 and 34 . in accordance with this invention , use is made of the following relationship for gas flow through the sonic nozzle 30 , which can be derived from equation ( 1 ) under the assumptions that flow is one dimensional through the nozzle 30 ( i . e ., all fluid properties are uniform over any cross section ) and that an isentropic process is involved in flow through the nozzle 30 : q n is the volume flow rate upstream of the nozzle 30 ; c d is the coefficient of discharge of the nozzle 30 , which takes into account the frictional effects generally confined to the boundary layer ; z n is the supercompressibility factor of the gas flowing into the nozzle 30 ; and t n is the temperature of the gas upstream of the nozzle 30 . the percent accuracy of the meter 14 , when all of the gas passing therethrough also passes through the nozzle 30 , is given by the following equation : ## equ1 ## where : p m t n z n / p n t m z m is the standard gas law correction between the meter 14 and the nozzle 30 . the above equation may be reduced to ## equ2 ## in the foregoing equation ( 4 ), the quantities q m , t , p m , p n , t n and t m may be measured and the quantities z m , c d , a t , and c *√ r must be determined . the first item that will be determined is the quantity c * z n √ r . since the same gas flows through the meter 14 and the nozzle 30 at substantially the same pressure , then z m = z n . furthermore , this quantity is independent of the size of the nozzle . accordingly , a small nozzle 52 may be utilized in determining the quantity c * z n √ r . for that small nozzle 52 , equation ( 2 ) becomes a ts is the area of the throat of the small nozzle 52 ; v 1 is the volume measured by the meter 44 ; and what is measured then is v 1 , t 2 and t ns . accordingly , ## equ3 ## the only unknown in the above equation ( 6 ) is the coefficient of discharge - throat area factor c ds a ts . this factor is predetermined by using a known gas ( preferably nitrogen ) at various high pressures into a bell prover . from the gas laws it is known that where the subscript &# 34 ; b &# 34 ; refers to the bell and the subscript &# 34 ; ns &# 34 ; refers to the small nozzle 52 and p , v , t and z refer to pressure , volume , temperature and supercompressibility , respectively . the volume v ns passing through the nozzle equals the volume flow rate ( q ns ) times time ( t ). thus , it can be shown that : therefore , ## equ4 ## since the gas in the bell is the same as the gas flowing through the nozzle and they are at the same pressure , z b = z ns and from equation ( 9 ), one can derive ## equ5 ## since all the properties of nitrogen are well known and have been well documented in the literature , the quantity z b c *√ r is known . accordingly , since the other quantities on the right side of equation ( 10 ) are easily measured , the coefficient of discharge - throat area factor c ds a ts is now determined . referring now back to equation ( 3 ), it can be assumed that the supercompressibility of the gas at the meter 14 is the same as at the nozzle 30 . therefore , z m = z n and the percent accuracy equation becomes ## equ6 ## substituting in equation ( 6 ), the percent accuracy equation then becomes ## equ7 ## the only terms in equation ( 12 ) that may not be known or measured are the coefficient of discharge - throat area factors for the sonic nozzle 30 . but for smaller nozzles , these are readily predetermined by the method described above using the bell prover or other measurement and mathematical techniques for larger size nozzles . accordingly , the accuracy of the meter 14 may be determined . there has thus been disclosed an improved method for determining the accuracy of a gas measurement instrument . it is understood that the above - described embodiment is merely illustrative of the application of the principles of this invention . numerous other arrangements and methods may be devised by those skilled in the art without departing from the spirit and scope of this invention , as defined in the appended claims . | 6 |
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention which may be embodied in other specific structures . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . turning now to the figures , fig1 depicts an embodiment 100 of a system according to the present invention . the system 100 generally includes an identification interface 110 communicatively coupled with a gaming device 130 and / or a server 150 , which themselves are in communication . the identification interface 110 may be a magnetic card reader 112 , such as a reader compatible with iso / iec 7813 standard ( and standards referenced therein ). compatible with the identification interface 110 is an identification device 120 , such as a magnetic stripe card 122 , a radio frequency identification ( rfid ) fob or tag 124 , or even a biometric identifier , such as a finger print 126 . respective identification interfaces 110 are known in the art . where a card reader 112 is used as the identification interface 110 , the reader 112 is preferably capable of reading at least one of track 1 data , track 2 data , and track 3 data , from a magnetic stripe 123 on the card 122 . while various information may be stored on the card 122 , at least a primary account number is included , the account number being unique with respect to all account numbers stored on the server 150 . preferably , only a primary account number is stored on the card 122 , while other information associated with the account number is stored on the server 150 . such data arrangement may improve security by minimizing the information stored on and accessible from the device 120 . thus , the identification device 120 serves as a physical activation device to be used according to the methods described herein . the identification interface 110 is in communication with the gaming device 130 and / or the server 150 . the gaming device 130 generally has a central processing unit 132 or motherboard , which contained within a cabinet 134 . the central processing unit 132 controls a visual output display 136 ( e . g ., lcd , which may comprise a capacitive touch screen ) and receives input from a user input interface 138 , which preferably includes a plurality of buttons 140 . the central processing unit 132 includes hardware and software for controlling the gaming unit 130 and facilitating the functionality herein described . a communications interface 142 is also included , preferably in the cabinet 134 , which allows the gaming device 130 to communicate 152 with the server 150 . the communication 152 may be wired ( e . g ., universal serial bus ( usb ), ethernet ) or wireless ( e . g ., wifi ( ieee 802 . 11 ), bluetooth ), and the server 150 may be located within the cabinet 134 , but is preferably located at the same building or site location 160 as the gaming device 130 . the server 150 may communicate with a plurality of gaming devices 130 at the location 160 over a local area network ( lan ) or wide - area network ( wan ), which may be wired or wireless . as indicated above , the server 150 preferably stores information associated with a primary account number , such as that represented by magnetically encoded data on a card , by an rfid circuit , or by a biometric identifier . the server 150 preferably stores the primary account number , and associates with that account number such information as one or more of a person &# 39 ; s name , personal identification number ( pin or security code ), location point balance , player credit balance , and an incentive bonus increase rate ( or tick rate ). a game play incentive program may be implemented using systems according to the present invention . an incentive method may utilize the software and hardware of the gaming devices 130 and the server 150 to create a location point balance accounting related to game play at a particular location 160 , which may include game play at a plurality of gaming devices 130 at the location 160 . use of the system 100 generally includes enrollment of an identification device 120 ( e . g ., creation of an account ), verification of an identification device ( e . g ., sign - on ), game play , and points or credits management . to enroll an identification device 120 , a person receives the device 120 , such as by requesting one from an owner / operator of a location 160 , or through the use of a vending machine at the location 160 . the identification device 120 has a primary account number that has not heretofore been used at the location 160 or is not at present being used at the location 160 . the person uses the identification device 120 in conjunction with the respective identification interface 110 coupled to a gaming device 130 of their choice . for example , a magnetic card 122 is swiped through a card reader 112 . the reader 112 conveys or provides the primary account number that was read from the card stripe 123 to the server 150 , either directly or through the gaming device 130 . if the account number has not been previously registered on the server 150 at the location 160 , one or more data entry renderings can be displayed on the display 136 , requiring user input from the person / player . various fields of data may be required or optional , including the person &# 39 ; s name ( first name and / or last name ), telephone number , e - mail address , etc . the data may be entered by the person through the display 136 ( e . g ., touchscreen ) or through one or more buttons 140 or other user input mechanisms . the screen 136 may display a full keyboard , such as a qwerty keyboard , for data entry . information entered by the person may be confirmed and accepted ( e . g ., by electing to “ save ” or “ accept ” the information after reviewing it for accuracy and editing as desired ). the person may then be presented with an alpha and / or numeric keypad for establishing a personal identification number ( pin ) or password . while the pin could be written to a magnetic card 122 , all information entered by the person is preferably transferred to the server 150 and associated with the primary account number in a datastore . an account is thus created on the server 150 , including at least the primary account number and pin / password , and then the server creates fields to be associated with the primary account number , including at least a location point balance and a player credit balance . an an incentive bonus increase rate ( or “ tick ” rate ) field may also be included . verification of an identification device ( e . g ., sign - on ) is undertaken when a person wishes to associate game play with their account having been previously created . when associated game play is desired , a person uses his or her identification device 120 in conjunction with the respective identification interface 110 coupled to a gaming device 130 of their choice . for example , a magnetic card 122 is swiped through a card reader 112 . the reader 112 conveys or provides the primary account number that was read from the card stripe 123 to the server 150 , either directly or through the gaming device 130 . if the account number is not recognized by the server 150 , then the enrollment process , described above , is executed . if the account number is recognized by the server 150 , the person may be prompted to enter a pin / password for verification . upon entry of an incorrect pin / password , conventional error handling may be undertaken , such as splash screen ( s ) and / or additional sign on attempts . optionally , an account may be locked upon a certain number of incorrect pin / password entries within a predetermined amount of time ( e . g ., three incorrect pin / password entries in ten minutes ). with reference also to fig2 , upon entry of a correct pin / password , the gaming device 130 displays normal game play according to its software , with some additional functionality displayed , including a first point value ( e . g . displayed as a number of points , as representative “ dollars ”, etc .) comprising a location point balance ( e . g ., credit pool balance ) 210 and a player credit balance ( e . g ., player credits ) 230 . other functionality options or information may be displayed such as account access and the person &# 39 ; s name . the location point balance consists of all points earned at the respective location 160 according to the “ tick ” methodology described herein . this point balance may be initially seeded with some value ( e . g ., $ 10 . 00 or 1000 points ) when the person first obtains the identification device . credits must be used for game play . credits may be added for game play by the person , such as by inserting money into the gaming device 130 by using cash , coins , or even a credit card , which will increase the player credit balance . additionally or alternatively , credits may be transferred preferably automatically at pseudo - random intervals from the location point balance to be used for game play . during game play , the player credit balance 230 increases and decreases according to the rules of the game . however , the location point balance 210 is incremented according to a predetermined calculation during the game play . for instance , the location point balance may be incremented according to a particular percentage rate ( or “ tick ” rate or tr ) multiplied by the number of credits played during game play ( e . g ., about 0 . 05 % to about 5 % of credits played , and more preferably about 0 . 25 % to about 1 % of credits played ). the tick rate may be displayed on the display 136 as a number , or more preferably a graphic 250 , such as a thermometer or needle gauge . the tick rate may be static or variable for a given game play session . for instance , a static tick rate may increment the location point balance linearly throughout a game play session ( e . g ., for the entire time a person is signed in with a respective primary account number and associated pin / password ), such as a static rate of 0 . 5 % of credits played . this static tick rate may be adjusted before and / or after a game play session according to a predetermined calculation . for example , the tick rate may be increased for persons that play a minimum amount of credits during a game session or over some predetermined time period , or decreased for persons that do not play a predetermined number of credits , either per game session or over a predetermined time period of minutes , hours , days , weeks , or months . additionally or alternatively , the tick rate may adjust during a game session , in which case the graphic 250 ( e . g ., thermometer or gauge ) may change ( e . g ., color or shape change ) to indicate a change in the tick rate . for instance , the tick rate may increase with the number of credits played by the person , or it may increase or decrease by a certain event happening within the game . the tick rate may have a floor value and / or a ceiling value for any game session , such as about 0 . 25 % to about 1 . 0 %. thus , the modified location point balance lpb mod is calculated from the previous location point balance lpb prev as follows : where tickrate is the incentive bonus increase rate associated with the primary account number of the person , the creditsplayed is the amount of credits played for a particular game attempt or played collectively over some predetermined time or over some predetermined number of game plays , and the gamebonus may be a random , pseudo - random , or predetermined bonus amount of points to be awarded , if any . the tick rate may be decreased , such as after a particular number of bonus game plays , or by some other methodology , such as if a minimum amount of player credits are not banked at the end of a game session ( as described below ). during game play , some credits may be automatically transferred from the location point balance to the player credit balance . the transferred credits are subtracted from the location point balance total and are automatically transferred to the player credit balance , which are available for continued play , collection and / or banking , or a combination thereof , as determined by the person . the amount of automatically transferred credits may be a random , pseudo - random , or predetermined static or variable percentage of the location point balance . when an amount of the location point balance is transferred to the player credit balance , the gaming device 130 may display a special screen message to the person indicating that they have been awarded a certain number of credits . before , during or after game play , while signed in , a player may manage his or her player credit balances by banking or collecting the credits . a player may elect to bank player credits for future use at the location . the player may elect to collect credits , at which time , a ticket may be printed so that the player may redeem the credits at the location 160 , such as for prizes or food , drink , or service discounts . the player has the option to bank or collect some or all of the player credit balance . if the entire player credit balance is collected by the player , the tick rate may be decreased , or even reset to an initial value . if the entire player credit balance is banked by the player , then that balance remains associated with the active primary account number for use on a gaming device 130 at some future time . if the player wants to collect only a portion of the player credit balance , then the player may select or enter a number credits to collect , and the remainder will be banked . a player may then sign - off of the game session , or sign - off may occur automatically after a predetermined time of inactivity , in which case all of the player credit balance will be automatically banked . the location point balance is preferably preserved as associated with the primary account number on the server after sign - off . the foregoing is considered as illustrative only of the principles of the invention . furthermore , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described . for instance , the precise location of the player credit balance and the location point balance when same are modified is of no consequence . that is , whether the balances are modified directly in the datastore accessible to the server or a copy of them is made locally on a gaming device , then modified , then rewritten to the datastore , both methodologies are envisioned . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . | 6 |
a watermark decoder detects a watermark in a suspect signal by computing evidence of watermark signal attributes in the suspect signal . the watermark signal attributes used in detection may be referred to as a calibration or synchronization signal ( hereafter referred to as “ calibration signal ”). the calibration signal may be watermark signal attributes that correspond to message symbols embedded in a watermark . for example , a watermark message may include a “ signature ” of one or more symbols known to the decoder . in the process of encoding the signature , a watermark encoder modifies a host media signal to compute a composite signal with signal attributes of the signature . to detect the watermark in a suspect signal , a detector analyzes the suspect signal to find evidence of the signature . in this case , the calibration signal corresponds to the attributes of the composite signal used to encode the signature . the calibration signal may also be an orientation watermark . to encode the orientation mark , the watermark encoder modifies the host signal to compute a composite signal with signal attributes of the orientation signal . to detect the watermark , a detector analyzes a suspect signal to find evidence of the orientation signal . in this case , the calibration signal corresponds to the orientation signal . both a message signature and an orientation signal may be embedded in a host signal . some watermark signals may perform a dual function of encoding a signature and an orientation signal ( e . g ., a watermark signal acts as a signature and an orientation signal ). the following description uses the term “ calibration signal ” to broadly encompass watermark signal attributes used to identify a watermark in a suspect signal . unless specified otherwise , the calibration signal should be construed to encompass watermark message symbols and / or an orientation signal used to detect a watermark . to detect a watermark in a suspect signal , a detector computes quantitative evidence of the calibration signal . one form of evidence is a detection value indicating the extent to which a portion of the suspect signal has attributes that match those of the calibration signal . one such measure is a correlation value that quantifies the correlation between the calibration signal and a portion of the suspect signal . another measure is the extent to which the known signature matches a signature computed from the suspect signal . in the process of detecting a watermark in a suspect signal , the detector may analyze several portions of the suspect signal . in many watermark systems , a key specifies where a watermark is located in an unmodified watermarked signal . however , the decoder does not know whether there is a watermark in a suspect signal . moreover , transformation of the composite signal may degrade the watermark and alter its orientation in a suspect signal . for many applications , the detector must search for the presence of a watermark and determine its orientation . this process is sometimes referred to as synchronization . the synchronization process varies depending on the type of host and watermark signal . in images , the orientation of the watermark may change due to transformations of the host image ( e . g ., geometric transforms , spatial frequency transforms , phase transforms etc .). in audio , the location of the watermark may also change due to transformations ( e . g ., temporal shifting or scaling due to up - sampling or down - sampling , frequency shifting , phase shifting , etc .). in video signals , the location of the watermark may change due to these and other transformations . because these transforms may alter a watermark , the detector analyzes several different portions of the suspect signal to find evidence of it . a watermark key may help guide the analysis around certain portions of the suspect signal . each of these portions has one or more orientation parameters that define a location ( and / or orientation ) in the suspect signal . in an audio sequence , the portion might be a time window or range of frequencies within an audio segment . in an image , the portion may be a two - dimensional spatial area or range of frequencies . to simplify the discussion , these portions of the suspect signal and their corresponding orientation parameter ( or parameters ) are generally referred to as candidates . the detector may compute a detection value for each candidate . then , based on these detection values , the detector may assess whether a watermark is present , and the strength of the watermark . fig1 illustrates a process for detecting a watermark in a suspect signal . the detector identifies candidates in the suspect signal ( 100 , 102 ). a watermark key may be used to locate the candidates . used in the watermark encoder to embed the calibration signal , the key generally specifies the location of the calibration signal in an unmodified marked signal . the detector then computes a detection value for the candidates ( 104 ). next , it determines how to direct further detector actions based on the detection values ( 106 ). the detection value may be an absolute measure derived from a single candidate . alternatively , it may be relative measure , computed by evaluating the detection value of one or more candidates relative to other candidates . the detector may implement different actions based on evaluation of the detection values . one action is to reject the suspect signal as being un - marked . another action is to use the detection measures to refine initial detection results . one way to refine the initial detection result is to select additional candidates that may increase the likelihood of accurate detection of a watermark and / or recovery of a message embedded in it . in short , the detector may use the detection values to focus detector resources on portions of the suspect signal that show promising evidence of a watermark and / or its calibration signal . fig2 illustrates an example embodiment of a watermark detector that uses detection values to reject unmarked signals and to direct further detection actions . in this example , the detector correlates the calibration signal ( or attributes of it ) with the suspect signal ( 200 , 202 ). in performing the correlation process , the detector may use a watermark key to select initial portions of the suspect signal expected to contain a watermark . for example , the key may specify that the calibration signal has been encoded into marked signals in a particular spatial or temporal location in some given transform domain . the correlation process ( 202 ) computes correlation values for candidate portions of the suspect signal that exhibit some evidence of the calibration signal ( 204 ). a variety of correlation methods may be employed , including , for example general matched filtering . each candidate may be defined by one or more orientation parameters that describe its location and orientation within the suspect signal . the correlation values for each candidate are absolute detection values . next , the detector computes relative detection values based on the detection values calculated previously from the suspect signal ( 206 ). one example of a relative detection value is a ratio of a top absolute detection value to one or more lesser detection values . the detection process may repeat , iteratively refining candidates by adjusting their orientation parameters . in this case , there may be several sets of absolute detection values , and corresponding relative detection values for each set . after the detector has computed detection values , it uses those values to control further detection actions . one action is to screen and reject un - marked signals ( including un - marked portions of a signal , or portions where a watermark has been degraded ) ( 208 ). another action is to use promising detection values ( e . g ., those values falling within a desired range or exceeding a limit ) to direct further detection operations on the suspect signal ( 210 ). the cited application provides an example of this action where orientation parameter candidates associated with top detection values are refined to improve detection and watermark message recovery . these types of actions can be used in detectors for different types of signals , including still image , audio and video signals . fig3 illustrates an example embodiment of a watermark detector in which the calibration signal is in the form of a signature . in this example , the detector begins by evaluating candidates in the suspect signal ( 300 ). as in the prior example , a watermark key may be used to specify an initial candidate location of a calibration signal , assuming that the suspect signal has been marked ( 302 ). using the key to identify a candidate location of a watermark , the detector attempts to decode the signature at the candidate location ( 304 ). even if the suspect signal has been watermarked , the signature may be degraded and / or geometrically transformed due to manipulation of the watermarked signal . next , the detector evaluates the decoded signature relative to the signature used in the encoder ( the expected signature ) ( 306 ). one way to evaluate the signature is to measure the similarity between the decoded signature and the expected signature . an example of this similarity measure is the percentage agreement computation in the cited application . the similarity measure is another example of a detection value associated with a particular candidate . another way to evaluate the presence of a signature in the suspect signal is to perform correlation between signal attributes of the one or more expected symbols and the suspect signal . in fact , some implementations use correlation to decode watermark message symbols . the extent of correlation provides a measure of similarity between an expected signature and a signature observed in the suspect signal . based on the detection value , the detector may reject the signal as being unmarked ( 308 ). for example , if the detection value falls below a limit ( either predetermined or adapted based on the suspect signal ), then the detector may conclude that the associated signal is unmarked . the detector may also quantify the extent of watermark degradation . for example , a low detection value represents significant degradation , while a high detection value represents minimal degradation . such detection values are useful in signal authentication or copy control applications where the extent of degradation is used , for example , to determine whether the suspect signal is authentic or to control use of the suspect signal ( e . g ., enable / prevent its transmission , playback , recording or copying ). the detector may also use the detection value to refine its search for a valid calibration signal ( 310 ). for example , when the detection values fall within certain limits , then they direct the detector to focus its attempt to synchronize with the calibration signal around the orientation parameter or parameters that yield such detection values . the cited application describes methods for computing detection values and using them to direct the actions of the detector . in one implementation , the detector performs multiple stages of detection . one form of calibration signal is an orientation signal . the detector performs correlation between an orientation signal and the suspect signal . based on the measure of correlation , the detector determines whether to reject the suspect signal . a detection value derived from the correlation is then used to make a decision whether to reject the suspect signal as un - watermarked , or to allow it to proceed to later detection stages . in a particular implementation in the cited application , an initial detection stage decides whether a watermark is present in a suspect image and , if so , provides estimates of orientation parameters to later detection stages . in other words , the initial detection stage acts as a classifier that discriminates between marked and unmarked images . the initial detection stage computes rotation and scale parameter candidates , and a measure of correlation for these candidates . it then determines whether to reject the suspect signal based on these measures of correlation . one test for screening unmarked signals is to compute a ratio of the top correlation value to other lesser correlation values for the candidates and then reject the signal as unmarked if the ratio does not exceed a limit . if the screen does not reject the suspect image , later detection stages refine the orientation parameter candidates by computing translation parameters ( i . e . the origin of the watermark ) and / or other parameters such as differential scale and shear . for the orientation parameter candidate , the detector computes correlation between the orientation signal and the suspect signal . this correlation can be computed in the spatial domain , the fourier magnitude domain , or some other transform domain . in some applications , the detection strategy can be improved by performing one or more additional tests on candidates to control further detector processing actions . one strategy , detailed below , uses a two stage test to reject un - marked images . this strategy uses both absolute and relative detection values . in experiments , this strategy rejects approximately 99 % of unmarked images at an initial detection stage . ideally , the initial detection stage should allow all watermarked images to proceed to later detection stages but reject all unmarked images . however , any practical classifier would accept some number of unmarked images ( false positives ) and reject some number of marked images ( false negatives ). the goal is to minimize both the false positives and the false negatives . fig4 illustrates an example of a screening strategy that achieves this goal . screen i — this screening strategy uses a detection metric based on relative detection values . correlation values corresponding to the top candidates are used to compute the relative detection value . in particular , the relative detection value is computed as a ratio of a top correlation value to one or more lesser correlation values or combination of lesser correlation values ( e . g ., an average of the next n best correlation values ). the detection value is compared to a pre - determined threshold t 1 . if the detection value exceeds t 1 , the detector proceeds to screen ii . if the detection value fails to exceed t 1 , the suspect image is labeled an unmarked image and further processing ceases . the correlation value may be computed in a variety of ways , depending on the nature of the orientation and suspect signals . for images , the correlation may be performed in one or more of the following domains : spatial , transform domain ( e . g ., fourier domain ), etc . in the case where the orientation signal is an array of impulse functions in the fourier domain , the detector preferably computes the correlation in the fourier domain . one measure of correlation analyzes the extent to which the impulse functions of the orientation signal are present in the fourier magnitude domain . this is a type of correlation strength and is referred to as fourier magnitude correlation ( fmc ). one way to compute the correlation strength in this context is to compute the dot product of the impulse functions of the orientation signal and the suspect signal in the fourier magnitude domain . the dot product is computed between the two signals after transforming the orientation signal to a candidate orientation ( e . g ., rotating and scaling it based on rotation and scale parameter candidates ). a related method is to perform an additional filtering process of the samples of the suspect signal in a neighborhood around the location of each impulse function and then summing the result of filtering around each impulse function location . this operation gives an indication of the extent to which the impulse functions are present in the suspect signal . the neighborhood can be defined in a variety of ways , including a square neighborhood of samples centered at the location of the impulse function , or a neighborhood defined along a line or lines through the impulse function ( e . g ., horizontal line , vertical line , or radial line through the origin of the coordinate space ). one such filtering operation is to divide the sample in the suspect signal at the impulse location by an average of neighboring samples . if the average value is zero , then the filter result is set to some constant value . in one implementation , the result of filtering at each impulse function location in the fourier magnitude domain is added to compute a measure of correlation . a number of variations to this filtering operation are possible . one such variation is to insert a thresholding function before adding the filtering results . one example is a thresholding process that subtracts a first constant from each filtered result , and then clips values greater than a second constant to that constant value . the result of the thresholding operation is summed to derive a measure of correlation strength . screen ii — in this screen , the correlation strength ( corresponding to the top candidate after fourier magnitude correlation ) is compared to a pre - determined threshold t 2 . if the correlation strength exceeds t 2 , then the suspect image is allowed to proceed to the later detection stages . if the correlation strength fails to exceed t 2 , the suspect image is labeled an unmarked image and rejected . empirical data shows that for unmarked images , whose correlation strength is high , the remaining correlation values are also comparatively high . therefore the resulting detection value is low . screen i is well suited to reject such unmarked images . most of the unmarked images that do make it beyond screen i have lower correlation strengths and are rejected by the second step . the combination of the two screens gives high rejection rates . the correlation strength is a useful figure of merit since it gives an approximate indication of how many orientation signal impulses ( out of the total number of impulses in the orientation signal ) were detected . its use as a measure of the strength of the orientation signal can provide a further metric useful in later stages of detection . a beneficial consequence of high rejection rates at an early detection stage is faster performance ( speed of detection ). higher rejection means that the detector can avoid additional processing of later detection stages , which may by more computationally complex . as a result , the mean performance times are reduced . the following points can be made about this two stage screening : 1 ) there are two screening stages to reject unmarked images . the first stage uses a metric based on a relative detection value . images that pass this test are subjected to an additional screen where the correlation strength is compared to a pre - determined threshold . images that do not exceed this threshold are rejected ; others proceed to the later detection stages . 2 ) the improved false positive rate means that the overall false positive statistics ( all stages combined ) improves commensurately . 3 ) the reduction in false positives translates into major performance improvements since very few ( approximately 1 %) of the unmarked images now reach the next stage of detection . in the cited application , additional stages used to refine the orientation parameter candidates ( e . g ., compute differential scale , shear , translation ) and to decode a watermark message can be avoided or can be made more efficient by focusing on candidates that are more likely to represent a valid , recoverable watermark signal . 4 ) the correlation strength can be used as a figure of merit for the orientation signal . 5 ) the method can be extended to more than two screens . 6 ) in some cases , the order of the screens may be important . for example , interchanging the order of screen i and screen ii may not provide good results . the order can be determined empirically using training data . 7 ) in each stage of detection , the detector can compute detection values based on one or more features of the suspect signal . then , using possibly independent detection values from these stages , the detector can combine these values in metrics for screening and refining orientation parameters . detection values may be considered independent if they are computed independently , rather than derived from each other . for example , a measure of correlation for an orientation signal in a watermark may be independent from a measure of similarity between expected and decoded message symbols from a watermark message . the detector may compute different measures of correlation in each stage and evaluate a metric that combines information from these correlation measures to get improved rejection of unmarked signals . the measures of correlation may be different in that they are computed in different domains ( e . g ., spatial , temporal , transform domains ), are based on different orientation parameters , are computed for different parts of the suspect signal , or are based on different attributes of the watermark . the features evaluated in each stage need not be measures of correlation . for example , one stage may evaluate the similarity between a decoded symbol or symbols from the suspect signal and symbol or symbols expected to be in a watermark message . a statistical analysis may be employed to indicate the likelihood that the decoded symbols represent expected symbols . based on the similarity measure and / or statistical likelihood , the detection stage provides a detection value that can be combined with a detection value derived from another detection stage . in sum , effective detection metrics may be constructed by combining information from different stages . these detection metrics can then be used to control detector action , such as rejected unmarked signals or focusing further detection on portion of the suspect signal that appear more likely to have a valid , recoverable watermark . having described the principles of my invention with reference to an illustrative embodiment , it should be apparent that the invention can be modified in arrangement and details without departing from such principles . accordingly , we claim as our invention all such embodiments as may come within the scope and spirit of the following claims , and equivalents thereto . to provide a comprehensive disclosure without unduly lengthening the specification , applicant incorporates by reference any patents and patent applications referenced above . the particular combinations of elements and features in the above - detailed embodiments are exemplary only ; the interchanging and substitution of these teachings with other teachings in this and the incorporated - by - reference patents / applications are also contemplated . | 7 |
in accordance with the invention , a data terminal arrangement schematically depicted in fig1 is suitable for displaying textual and graphic information in a home environment . this terminal arrangement is automatically configurable in either a bit synchronous or a character asynchronous format and allows a terminal user to receive and transmit data over standard telephone lines . the terminal arrangement automatically detects if a called database is operating in the bit synchronous or character asynchronous mode and then automatically configures its receiver and transmitter to communicate in the desired format . in general , implementing the terminal arrangement with an automatic synchronous / asynchronous detector is facilitated by requiring that the arrangement starts out configured in a default mode ( either bit synchronous or character asynchronous mode could be assumed ). a given number of the first few characters received from a called database are monitored for some identifiable sequence . receiving these characters in a given time , or having the given time lapse without the characters being received , determines the mode of operation thereby , and the receiver and transmitter are set up accordingly . operation of the arrangement thus centers around receiving a unique , identifiable sequence of characters sent out by the called database each time a new connection is established . such an identifiable sequence of characters is provided by a database operating in the bit synchronous format using the high level data link control ( hdlc ) protocol such as the viewtron ® system operated by viewdata corporation of america . such a database will always send out a minimum number of flag characters before connection is established . additional information is available from at & amp ; t technical reference operations systems network communications protocol specification bx . 25 , issue 3 , dated june 9 , 1982 , publication no . 54001 and international standards organization publications 3309 and 4355 . the received data is monitored by the terminal arrangement and the flag characters detected by a synchronous / asynchronous detector configured initially to operate in the character asynchronous mode . thus , the first few characters are received asynchronously and are compared to flag characters . if a match is found , proper operation is assumed to be in the bit synchronous format , and the receiver and transmitter are configured in the bit synchronous mode . otherwise , the character asynchronous format is assumed and the receiver and transmitter remain configured in the character asynchronous format . operation is also possible with a synchronous / asynchronous detector in a terminal arrangement configured with the bit synchronous mode as the default mode . when the called database is a character asynchronous database , the first few characters transmitted are usually some type of login prompt . with the terminal receiver starting up in the bit synchronous format , these first few characters are checked for flags and no match is found . the terminal receiver then switches to the character asynchronous mode . the first few characters received as the login prompt are held in a buffer until a determination of the communication format is made . at that time , if asynchronous operation is selected , the characters in the buffer ( i . e ., the login prompt ) can be sent to a video processor in the terminal arrangement for displaying on a screen or other output display means of the terminal arrangement . as earlier indicated , a steady stream of flag bytes are received by the terminal arrangement when establishing communications with a bit synchronous database . these flag bytes consist of a stream of six ones surrounded by a zero on each side . if the terminal receiver is operating in the character asynchronous mode , it inserts stop bits as necessary to guarantee that the customer receives properly framed characters with start and stop bits . in this system , properly framed transmissions consist of 10 bits ; a start bit ( logic 0 ), 8 data bits , and a stop bit ( logic 1 ). the least significant bit is always transmitted first . referring now in detail to fig1 there is shown a block diagram of the arrangement in accordance with the present invention . known in the art are a line relay 103 , a surge protection network 104 and a hybrid 105 which are shown to illustrate how the arrangement is operably connected to a central office over standard telephone tip and ring lines 101 and 102 . line relay 103 provides a means for locally connecting and disconnecting the arrangement as desired . the surge protection network 104 protects the arrangement against high voltage surges that might be inadvertently impressed on the telephone tip and ring line . and the hybrid 105 converts the balanced tip - ring signal from the tip and ring lines 101 and 102 into both a receive line signal and transmit line signal on lines 106 and 107 respectively . the transmit and receive signals connect to a modem 120 that is comparable in general operation to a data set 212a presently available from at & amp ; t technologies , incorporated . modem 120 , differs in specific operation , however , since it is arranged to couple data to and from a communications processor 130 with timing information which informs this processor 130 when the data is valid . both receive and transmit timing signals are provided to the communications processor 130 by the modem 120 so that the data transmission and reception are synchronized to the timing established by the database . timing signals for operation of the modem 120 are also provided from a reference clock 128 . receive timing signal on line 121 and transmit timing signal on line 122 both drive interrupt inputs on the communications processor 130 so that the data bits can be processed without delay . and a number of control lines 125 run between the communications processor 130 and the modem 120 to accomplish such miscellaneous tasks as receive signal detection , analog loopback , and link establishment . when the modem 120 receives a data bit from the telephone line , it makes this data bit available on line 123 to the communications processor 130 on a transition of the received timing signal on line 121 . similarly , the communications processor 130 when it has a transmit data bit to send over the telephone line , makes the transmit data bit available on line 124 when it sees a transition of the transmit timing signal on line 122 from the modem 120 . when an interrupt occurs , the communications processor 130 terminates a program currently being executed and executes either an interrupt service routine for the received data bit or an interrupt service routine for the transmit data bit , depending on whether the interrupt is occurring on the received timing signal line 121 or the transmit timing signal line 122 . in the operation of these interrupt service routines , the communications processor 130 either reads a data bit from the modem 120 or makes a data bit available to the modem 120 as appropriate . a single - chip microcomputer suitable for use as the communications processor 130 is available from intel corporation as part number 8051 and can be used with the proper programming . the communications processor in the present arrangement has internal memory but also uses external program memory contained in a read only memory ( rom ) 140 . external storage is also provided in a random access memory ( ram ) 150 . both the rom 140 and the ram 150 receive address information from the communications processor 130 over the 8 bit address bus 131 and also interface to the communications processor over the 8 bit address / data bus 132 . an address latch 135 provides temporary storage of the address information from the communications processor 130 provided over the address / data bus 135 since this bus is multiplexed with information for other circuitry being present thereon at different times . some of the memory in ram 150 is used as a receive data buffer for storing the data bits received from the database . the communications processor 130 and the above associated circuitry may be considered peripheral to a data terminal and may therefore interface to another processor or computer . in the present arrangement , the communications processor 130 is shown associated with an applications processor 160 which serves as the master or controlling processor and is suitably programmed for controlling a data terminal or the like . this application processor 160 could be part of a stand alone computer such as a personal computer or a microprocessor such as one available from intel corporation as part number 8088 . in addition to its other duties , the application processor has in the present arrangement the function of controlling the user interface which includes input from a keyboard and output in the form of a color video display on a cathode ray tube ( crt ). the applications processor 160 interfaces to the communications processor 130 through an interprocessor interface 170 . this interprocessor interface has a port for the address / data buses 132 and 162 from the communications processor 130 and applications processor 160 respectively . each processor provides read and write information to the interprocessor interface 170 and each processor receives an interrupt as appropriate from the interprocessor interface 170 . thus when one processor tries to access the other by reading or writing , the accessed processor receives an interrupt via the interprocessor interface 170 informing it that a transaction is to take place . the interrupted processor stops executing what ever program is then being worked on and either provides the data that is requested or accepts the data that is sent to it . in the operation of the arrangement in the asynchronous mode with a nominal speed of 1200 baud , the modem 120 allows a user to receive data at speeds ranging from 1170 to 1212 bits per second by using the ram 150 for buffer storage of the received data . if , for example , a remote database is transmitting data slightly faster than 1200 baud , a transmit buffer associated with a sending modem could occasionally delete a stop bit from the characters transmitted by the database . software in the communications processor 130 compensates for these missing stop bits by emulating a character - asynchronous receiver with missing stop bit insertion . that is , when the stop bit position is examined and is found to be a space ( 0 ) level rather than a mark ( 1 ) level , that bit is interpreted as the start bit of a new character . referring now to fig2 and fig3 there are two different examples showing how the character asynchronous receiver interprets a received flag byte . the first example shown in fig2 assumes that the first two bits received are 0 , 0 , and the second example shown in fig3 assumes that the first two bits received are either 1 , 1 or 0 , 1 or 1 , 0 . receiving different initial bits takes into account the possibility that the receiver may begin operation at an arbitrary point within the flag byte . the incoming bits are labeled in consecutive order from 1 to 50 with the bits that are interpreted as start and stop bits also being labeled . also shown are the locations where stop bits are inserted by the receiver , as well as the ascii characters and hex values received by the terminal . as illustrated in fig2 the received transmission begins with 0 , 0 . bit 1 is a zero and is interpreted as a start bit . the receiver counts out to bit 10 , where it expects to see a stop bit ( 1 ). however , bit 10 is received as a zero , so a stop bit is inserted between bits 9 and 10 . bit 10 is then interpreted as the start bit of a new character . the receiver again counts to the 10th received bit , and finds a 1 at bit position 19 . this is interpreted as a stop bit in the correct position . the receiver then looks for the next start bit ( 0 ), and finds it at bit 25 . after counting another 10 bits , it expects to see a stop bit ( 1 ), but instead finds a 0 at bit position 34 . the receiver then inserts a stop bit between bits 33 and 34 . bit 34 is then interpreted as the start bit of a new character . that character has its stop bit at bit position 43 . the process goes on as long as flag bytes are being received , yielding the ascii characters tilde ( hex 7e ) and question mark ( hex 3f ). thus , the received string becomes ˜?˜?˜? . . . . as illustrated in fig3 the received transmission begins with either a 1 , 1 0 , 1 or 1 , 0 . in either case , the first zero is interpreted as the start bit of the first character . the receiver expects to see a stop bit at bit position 10 , and indeed finds a 1 there . the next character begins with bit 16 , a start bit ( 0 ). the receiver expects to see a stop bit ( 1 ) at bit position 25 , but instead finds a ( 0 ) there . it then inserts a stop bit between bits 24 and 25 and interprets bit 25 as the start bit of a new character . the next stop bit is expected and is correctly received at bit position 34 . the next character begins with a start bit at bit positions 40 , and the receiver inserts a stop bit between bits 48 and 49 . the process again yields the ascii characters question mark ( hex 3f ) and tilde ( hex 7e ) in the order ?˜?˜?˜ . . . . it is seen that both examples of received transmissions shown in fig2 and 3 yield identical character strings , differing only by the starting character . the first few received characters are monitored for detection of this string , and if found , bit synchronous operation is selected for the duration of the terminal session . referring to fig4 there is a flowchart representation of the control functions performed by the communication processor 130 and associated circuitry of fig1 in determining the format of the received data transmission . the sequence in which these functions are performed is indicated by the flowchart and shown in sufficient detail to permit one skilled in the art to duplicate the circuitry of fig1 either by programming a microprocessor or by special purpose logic circuitry . whereas the flowchart shows specified characters for use in this application , it is readily apparent that it would be a simple matter to change to other characters for this same application . in order to minimize the effect of noise that might be present on a telephone line and yet keep the format determining software as simple as possible , the communications processor 130 is arranged to check for a minimum number &# 34 ; n &# 34 ; of the first characters received , which is set at 40 in this arrangement , for either the 3f or 7e value , and require 75 % of these characters &# 34 ; n &# 34 ; to match one of the two values . the format detection is achieved by initially configuring the receiver into the character - asynchronous mode in response to the communications processor 130 and waiting until either the 40 characters have been received or until a given period of time such as 5 seconds has elapsed from establishment of the modem connection . if the minimum number of characters necessary are received before the time limit expires , the receive buffer is searched for either of the characters from the characteristic sequence 3f / 7e described earlier herein . if at least 30 of the 40 characters match either 3f or 7e , the called database computer is assumed to be operating in the synchronous mode . the receiver and transmitter are switched to operate in the bit synchronous mode , the receive and transmit buffers are reconfigured for synchronous operation , and the synchronous link setup is begun . when the link setup is complete , the communications processor 130 informs the applications processor 160 that the database computer is operating in the synchronous mode . if an insufficient number of either of the two characters are found , or if the time limit expires before the minimum number of characters is received , the link is assumed to be asynchronous . the receiver , already in the asynchronous mode of operation , is left running and any characters received are passed to the applications processor 160 . the communications processor 130 also informs the applications processor 160 that the database computer is operating in the asynchronous mode . many variations of the basic arrangement are possible and may obviously be implemented by those skilled in the art without departing from the spirit and scope of the invention . for example in the present arrangement , the search for flags is arranged by looking at the first character received and searching forward in the receive buffer . once a synchronous transmitter begins sending flags , it is likely to continue for some minimum time before sending its first information packet . with this minimum time as a design consideration , an alternative embodiment may be arranged to start the search at the last flag character received and search backward . this would delay the testing of the first characters received ( those most likely to be the result of received noise ) for last , increasing the probability that they need never be checked . if such a minimum time could be assured from all databases , however , a decrease in the amount of time needed to determine the link mode is possible . | 6 |
please refer to fig2 to fig4 , fig2 is a layout diagram of the present invention eeprom device 100 . fig3 is a cross - sectional schematic diagram of the eeprom device 100 shown in fig2 . fig4 is a cross - sectional schematic diagram along line 4 - 4 ″ of the eeprom device 100 shown in fig2 . as shown in fig2 and fig3 , the present invention eeprom device 100 is disposed on a semiconductor wafer 101 . the semiconductor wafer 101 comprises a p - type silicon substrate 102 , a deep n - well ( dnw ) 103 disposed in the p - type silicon substrate 102 , and a p - well ( pw ) 104 disposed in the deep n - well 103 . the eeprom device 100 comprises a p - type memory cell 106 , an n - type select gate transistor 108 , and a p - type select gate transistor 112 . the memory cell 106 comprises a source region 114 and a drain region 116 disposed on a surface of the deep n - well 103 , and a channel region 118 between the source region 114 and the drain region 116 . both the source region 114 and the drain region 116 are p - type heavy doped regions , and the source region 114 is electrically connected to a source line ( sl ). the memory cell 106 further comprises a tunnel oxide layer 122 , a floating gate 124 , a dielectric layer 126 , and a control gate 128 . the tunnel oxide layer 122 is disposed on a top surface 123 of the deep n - well 103 , and the tunnel oxide layer 122 covers the channel region 118 . the floating gate 124 is disposed on a surface of the tunnel oxide layer 122 . the dielectric layer 126 covers the floating gate 124 . the control gate 128 is disposed on a surface of the dielectric layer 126 and the surface of the tunnel oxide layer 122 . the n - type select gate transistor 108 comprises a source region 132 , a drain region 134 , and a select gate ( sg ) 136 . the source region 132 of the n - type select gate transistor 108 is electrically connected to an erase bit line ( eb 1 ). the p - type select gate transistor 112 comprises a source region 138 , a drain region , and a select gate 142 . since the drain region of the p - type select gate transistor 112 is overlapped with the drain region 116 of the memory cell 106 , it is not specially marked . the source region 138 of the p - type select gate transistor 112 is electrically connected to a program bit line ( pb 1 ). because the select gates 136 , 142 and the floating gate 124 in the memory cell 106 are formed by etching a same polysilicon layer , a polysilicon layer 143 is shown on top of each of the select gates 136 , 142 in fig3 . when viewing along line 4 - 4 ″, the deep n - well 103 is disposed in the p - type silicon substrate 102 , and the p - well 104 is disposed in the deep n - well 103 . the tunnel oxide layer 122 is disposed on the p - type silicon substrate 102 . a polysilicon layer 125 used as the floating gate 124 is disposed on the tunnel oxide layer 122 . the dielectric layer 126 covers the polysilicon layer 125 used as the floating gate 124 . another polysilicon layer 129 used as the control gate 128 is disposed on the dielectric layer 126 and the tunnel oxide layer 122 , as shown in fig4 . in addition , the p - well 104 and the deep n - well 103 are isolated from each other by a shallow trench isolation 144 . by cross - referring fig2 , fig3 , and fig4 , it is very clear to see the polysilicon layers 146 disposed in pairs and in parallel , the heavy doped region used as the source region 132 of the n - type select gate transistor 108 disposed in the p - well 104 , the heavy doped region used as the source region 138 of the p - type select gate transistor 112 disposed in the deep n - well 103 , and the shallow trench isolations 144 used for isolating the p - well 104 and the deep n - well 103 in fig2 . it is worth noting that the shallow trench isolations 144 are not shown in fig3 in order to prepare the drawing more conveniently . please refer to fig5 , fig5 is a circuit diagram of the present invention eeprom device 100 . as shown in fig5 , the present invention eeprom device 100 comprises the p - type select gate transistor 112 , the n - type select gate transistor 108 , and the p - type memory cell 106 . the source region 138 of the p - type select gate transistor 138 is electrically connected to the program bit - line , and the source region 132 of the n - type select gate transistor 108 is electrically connected to the erase bit - line . the drain region 116 of the p - type memory cell 106 is electrically connected to the drain of the p - type select gate transistor 112 ( overlapping with the drain region 116 of the memory cell 106 ) and the drain region 134 of the n - type select gate transistor . the p - type select gate transistor 112 and the n - type select gate transistor 108 are electrically connected through the select gates 136 , 142 ( please refer to fig3 ), and the p - type memory cell 106 is simultaneously electrically connected to the p - type select gate transistor 112 and the n - type select gate transistor 108 due to the special layout shown in fig2 . please refer to fig6 , fig6 is an example table illustrating operation voltages of the present invention eeprom device 100 . as shown from fig3 to fig6 , a first positive potential ( such as + 8v ) is supplied to the control gate 128 such that the positive voltage is capacitively coupled to the floating gate 124 to build an electric field that transverses the tunnel oxide layer 122 , when the present invention eeprom device 100 performs programming . then a negative potential ( such as 8v ) is supplied to the select gate 142 of the p - type select gate transistor 112 to turn on the p - type select gate transistor 112 . when a negative program potential ( such as 6v ) is supplied to the program bit - line , the program potential is therefore passed to the drain region 116 of the p - type memory cell 106 through the turned - on p - type select gate transistor 112 . since a high positive potential difference exists between the control gate 128 and the drain region 116 , band - to - band tunneling ( btbt ) phenomenon thus occurs to generate electron - hole pairs at a junction of the drain region 116 of the p - type memory cell 106 . electrons in the electron - hole pairs are accelerated by the electric field in the depletion region to acquire sufficient energy to become hot electrons . the hot electrons then inject into the floating gate 124 to complete the band - to - band tunneling induced hot - electrons ( btbtihe ) program . when the present invention eeprom device 100 performs erasing , a second negative potential ( such as 8v ) is supplied to the control gate 128 first . then a second positive potential ( such as + 10v ) is supplied to the select gate 136 of the n - type select gate transistor 108 to turn on the n - type select gate transistor 108 . when a positive erase potential ( such as + 8v ) is supplied to the erase bit - line , the erase potential is passed to the drain region 116 of the p - type memory cell 106 through the turned on n - type select gate transistor 108 . since a high negative potential difference exists between the control gate 128 and the drain region 116 , and another high negative potential exists between the control gate 128 and the deep n - well 103 ( the deep n - well 103 is grounded through a terminal ), electrons stored in the floating gate 124 are affected by the electric field that transverses the tunnel oxide layer 122 . the electrons thus transverse the tunnel oxide layer 122 by fowler - nordheim tunneling mechanism to complete the fowler - nordheim erase . furthermore , when the present invention eeprom device 100 performs reading , a third positive potential ( such as + 3 . 3v ) is supplied to the source line electrically connected to the source region 114 of the p - type memory cell 106 . then a potential lower than the third positive potential ( such as + 1v ) is supplied to the program bit - line . at this time , since a potential difference exists between the source line and the program bit - line , electrons stored in the floating gate 124 will flow out to cause a current measurable at the terminal of the source line . oppositely , if there are no electrons stored in the floating gate 124 , the current higher than a specific value cannot be measured at the terminal of the source line the eeprom device according to the present invention utilizes the p - type eeprom cell to replace the prior art n - type eeprom cell . therefore , a p - type select gate transistor electrically connected to the program bit - line is utilized to perform the band - to - band tunneling induced hot - electrons program , and an n - type select gate transistor electrically connected to the erase bit - line is utilized to perform the fowler - nordheim tunneling erase . since the band - to - band tunneling induced hot - electrons phenomenon can generate a considerable current , the injection of hot electrons caused by band - to - band tunneling mechanism is faster than that caused by fowler - nordheim tunneling mechanism . program speed and program efficiency are thus greatly improved to eliminate the need of the tunnel window utilized in the prior art eeprom structure . when applying the present invention structure to a practical production line , byte - addressable eeprom products having high programming speed , low operation voltage , high reliability , and small size are fabricated once the high gate coupling ratio and the high quality of the tunnel oxide are maintained . compared to the prior art eeprom device and structure and method of operation , the present invention eeprom device utilizes the p - type eeprom cell to replace the n - type eeprom cell . in addition , a p - type select gate transistor electrically connected to the program bit - line is utilized to perform the band - to - band tunneling induced hot - electrons program , and an n - type select gate transistor electrically connected to the erase bit - line is utilized to perform the fowler - nordheim tunneling erase . due to the considerable current generated by the band - to - band tunneling induced hot - electrons phenomenon , the injection of hot electrons caused by band - to - band tunneling mechanism is faster than that caused by fowler - nordheim tunneling mechanism . program speed is therefore greatly improved . because of the obviously lifted program efficiency , the tunnel window , adapted in the prior art eeprom device structure , can be replaced by a common tunnel oxide layer in the present invention eeprom device structure . as a result , the problems of complex processing and raised cost incurred from misalignment , which usually occurs in the prior art , are avoided . the barrier to device shrinkage is not encountered . in addition , operation voltage is obviously lowered to expand the range of applicability under the industry stream of lightweight and small size . those skilled in the art will readily observe that numerous modifications and alterations of the device may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims . | 7 |
fig1 shows a block diagram of a first apparatus for the implementation of the method of the present invention . for measuring the phase of surface acoustic waves at a measuring point on the surface of a surface acoustic wave component owb , an interdigital transducer idw on the component owb is utilized for the emission of acoustic surface waves . this occurs with the use of a signal generator sg that excites the interdigital transducer idw via a power amplifier lv , exciting it with a sinusoidal voltage having the frequency fs and a phase φ . the alternating voltage at the metal electrodes of the transducer idw provides periodic deformation of the crystal surface by a piezoelectric effect , these periodic deformations then propagating on the surface wave component owb as acoustic waves having velocities between about 3000 m / s and 4000 m / s . the wave penetrates to a depth of about one wavelength into the crystal , whereby the deformation of the surface generally lies in the range between 0 . 1 and 10 angstroms by piezoelectric effect , the electro mechanical coupling again produces local surface potentials that can be detected in a reception transducer or can be scanned and detected with an electron beam pe by using a voltage contrast effect . this finely focused primary electron beam pe is preferably generated in the electron - optical column of a modified scanning electron microscope that essentially has an electron gun eq composed of a cathode , a wehnelt electrode and an anode , and a series of further magnetic lenses ( not shown in fig1 for reasons of clarity ) for beam shaping and focusing of the primary electron beam pe . the secondary electrons se generated at the respective measuring point in the piezoelectric crystal by the primary electrons pe emerge through the surface of the crystal and are accelerated via an extraction voltage in the direction of the detector dt composed , for example , of a collector , a scintillator and a light guide . the secondary electron current recorded in the detector dt and fluctuating due to the voltage contrast which is dependent on the potential at the measuring point is subsequently supplied to an evaluation circuit as . the secondary electron current is converted into an electrical signal ( voltage contrast signal ) in a photomultiplier pm in the evaluation circuit as and is amplified in a following pre - amplifier vv . for an improvement in the signal / noise relation , the secondary electron signal can be filtered out of the signal frequency by an adjustable band pass filter bp that is tuned to the signal frequency , and which is connected to an output of the pre - amplifier vv . for the control of its center frequency , the band pass filter is connected either to the signal generator sg or to an additional control unit , for example a computer . the phase φ of the filtered - out secondary electron signal is detected in the phase detector pd that is connected in circuit after the band pass bp . the phase detector pd needs a reference signal with the reference frequency that corresponds to the signal frequency f s which in this case is obtained from the signal generator sg . a lock - in amplifier or a phase - sensitive rectifier can be used as a phase detector . in this case , usually the band pass filter bp can then be eliminated in order to be able to execute the phase measurement with high sensitivity and precision , the phase φ is held constant at the phase detector pd . to that end , the phase of the drive signal at the interdigital transducer idw must be correspondingly modified by a feedback rk . the feedback signal is acquired by comparing the output signal u a of the phase detector pd to a reference value sw in a regulator r that is connected to an output of the phase detector pd . in the embodiment shown in fig1 the regulator r is composed of a comparator v for comparing the output signal u a of the phase detector to the reference value sw and for calculating a control difference , and is further composed of a feedback control amplifier rv . the reference value sw should be set such that the operating point on the characteristic curve of the phase detector pd is situated in the steepest region of this characteristic curve ( see fig3 ) since the greatest sensitivity and precision are thereby achieved . the control difference is then supplied to a feedback control amplifier rv ( having p or pi behavior ) and subsequently modifies , for example , the phase φ of the drive signal via the controllable phase shifter ps which is connected between signal generator sg and the power amplifier lv . instead of such a phase shifting , a frequency modulation or phase modulation of the signal generator sg can also be used since only the phase difference is critical . it is likewise possible to modify the frequency of the signal generator sg or the signal generator sg for a defined time period and to subsequently return to the reference value and to thus achieve a phase shift . this is particularly feasible for a computer - controlled apparatus . such an apparatus for phase shifting is already integrated in mass - produced fashion in some commercially obtainable generators such as , for example , models hp8656 and hp8642 manufactured by hewlett - packard co . the manipulated variable itself can then be used as measuring signal ms . however , in a somewhat more complicated fashion , the measuring signal ms can also be acquired by measuring the phase difference of the signal modulating the primary beam pe and the signal exciting the interdigital transducer idw . such a phase shifting or modulation can be implemented with extremely great precision over a broad frequency range . this is a significant advantage over prior art methods for phase measurement . with the use of a phase shifter ps , it is also possible to change the phase of the reference frequency supplied to the phase detector pd , which corresponds to the signal frequency f s . for the execution of the phase shifting an independent phase shifter is not absolutely necessary . a phase shifting can also be effected by a frequency or phase modulation . fig2 shows an alternative embodiment for the implementation of the method of the present invention . the circuit corresponds to the circuit of fig1 in terms of the essential points and corresponding reference characters from fig1 are used . a disadvantage of the circuit shown in fig1 is that the phase detection must occur at the signal frequency f s , which may vary in a very wide range of frequencies . therefore , it is advantageous to perform a conversion of the signal frequency f s to a fixed intermediate frequency f if , before the phase detection , as illustrated in the circuit shown in fig2 . the evaluation circuit as therefore contains a device for frequency conversion fc which is connected between the pre - amplifier vv and the phase detector pd . the device for the frequency conversion fc can contain a band pass filter for the filtering of the secondary electron signal with the signal frequency f s , and a following mixer with a voltage - controlled frequency oscillator . the band pass filter is connected to the signal generator sg , for changing its center frequency , analoguely as in the arrangement according to fig1 . during the frequency conversion , the phase of the secondary electron signal must be preserved , except for constant phase shifting . therefore , a synchronization with the signal generator sg is necessary . preferably , the intermediate frequency f if should be selected such that it can be obtained by a simple division or multiplication from a reference frequency f r of the drive signals of the signal generator sg . the mixer in the device for the frequency conversion fc is therefore connected to the signal generator sg , via a frequency divider or frequency multiplier fp . the phase detector pd is also supplied with a signal with the intermediate frequency f if as a reference signal , via the frequency divider or frequency mu fp . the frequency divider or frequency multiplier fp can be eliminated , if the reference frequency f r itself of the signal generator sg is selected as the fixed intermediate frequency f if . fig3 shows the output characteristic curve of a phase detector in which the function of the output voltage u a is presented as a function of the phase φ . as already indicated in fig1 most phase detectors have a cos φ characteristic that , however , can be linearized in a region l around the point φ = π / 2 . the output voltage is proportional to the phase difference within this approximately linear region l . at the same time , this region is the steepest portion of the characteristic curve . even small changes in the phase difference produce great changes in the output voltage u a of the phase detector pd . a measurement of the phase difference having extremely great sensitivity and , as a result thereof , also having great precision is therefore possible in this region . the function of the feedback rk in the apparatus of fig1 and in the apparatus of fig2 is to keep the operating point of the phase detector pd constant within the linear region l . measuring the phase outside of this linear region l is only possible with low sensitivity and , thus , with rather pronounced errors . the excitation of the surface waves need not necessarily be produced with an interdigital transducer idw . an excitation in a photoacoustic or electronacoustic manner is also possible . in the case of the electronacoustic activation , the waves are generated with a primary beam . the waves can then be detected either with a second primary beam , or with an interdigital transducer idw . in the case of the reception of the waves with an interdigital transducer no independent detector exists ( see k . jamonouchi et al : &# 34 ; exciting of surface acoustic waves using electron acoustic microscope &# 34 ;, jap journ . appl . phys . 23 , 1984 , p . 191 - 193 and h . p . feuerbaum et al &# 34 ; examination of surface acoustic wave components using a scanning electron microscope &# 34 ;, sem 1983 / 1 , p . 55 - 63 incorporated herein by reference ). the method disclosed here , can be transferred analoguely to all other phase measurements with an electron or laser probe . phase measurements of surface acoustic waves with the laser probe are described , for example , in the publications of h . engan , ieee transactions on sonics and ultrasonics 29 &# 34 ;, 1982 , page 281 and ieee transactions on sonics and ultrasonics 25 &# 34 ;, 1978 , page 372 , wherein voltage measurements in the frequency domain with an electron probe are known for example , in the german patent application nos . p 37 25 313 . 1 and p 37 25 355 . 7 , the arrangement also being used for phase measurement in accordance with the methods set forth herein . ( both publications and the german patent application nos . p 37 25 313 . 1 and p 37 25 355 . 7 are hereby incorporated by reference ). the invention is not limited to the particular details of the apparatus depicted and other modifications and applications are contemplated . certain other changes may be made in the above described apparatus without departing from the true spirit and scope of the invention herein involved . it is intended , therefore , that the subject matter in the above depiction shall be interpreted as illustrative and not in a limiting sense . | 6 |
generally speaking , the clutch - brake unit of the motor drive system of the present invention is an improvement over that disclosed in applicant &# 39 ; s u . s . pat . no . 3 , 614 , 999 , issued oct . 26 , 1971 , and incorporated by reference herein . referring in detail to the drawings and in particular in fig1 the motor drive system comprises an electric motor 10 operably associated with a clutch unit 12 at the drive shaft 14 of the motor 10 . the electric motor 10 is of the type where the motor shaft 14 acts to energize a clutch as sold under the trade name &# 34 ; demag transfer drive &# 34 ; by manne smann demag corporation of west germany . the electric motor 10 itself is comprised of external housing 16 within which is disposed an electrically energized rotatable member 18 having windings 20 surrounding it and an internal rotatable member 22 fixed to the drive shaft 14 of the motor 10 . a coil spring 24 connected on one end to annular ring 26 disposed within a groove 28 on the drive shaft and connected to an interior housing portion 30 at its opposite extreme biases the shaft 14 to the left as shown in fig1 away from the clutch unit 12 . the shaft 14 rides in suitable bearings 32 and 34 within the housing 16 . the clutch unit 12 includes an external annular housing 33 comprised of an external end wall 36 and an annular outer housing section 37 at the outer periphery thereof . within the housing 33 formed by wall 36 and section 37 is an interior housing 38 forming an oil chamber 39 , which housing 38 is comprised of a substantially annular section 40 and an end wall 42 . the drive shaft 14 of the motor 10 has a fan 43 comprised of blades 44 connected at the end 46 of the shaft 14 disposed within the outer housing 33 . the fan 43 is secured to an annular sleeve 48 by suitable bolt securing means 50 . the sleeve 48 is secured to the drive shaft 14 also by a suitable securing bolt 52 threaded into a threaded bore 53 at the end 46 of the shaft 14 . the outer periphery of the sleeve 48 includes a series of circumferentially spaced splines 54 . surrounding the sleeve 48 is an annular member 56 which has at its inner periphery thereof a series of circumferentially spaced splines 58 which engage the splines 54 of the outer periphery of the sleeve 48 so that slideable axial movement between the two sleeves may be accomplished while also providing engagement between the splines 54 and 58 to have the member 56 driven by the sleeve 48 via rotation of the motor drive shaft 14 . the annular sleeve 56 is associated with the interior housing wall 40 by a suitable ball bearing 60 . the annular sleeve 56 at its outer periphery thereof has a second set of circumferentially spaced splines 62 upon which a series of discs 64 can be disposed to permit relative axial movement but limit circumferential movement of the discs 64 . plates 66 are interweaved with the discs 64 and operably associated at their outer extremes with splines 68 disposed on an axially widened annular portion 70 of the output shaft 72 of the unit 12 . referring to both fig1 and 2 , the annular sleeve 56 is also a carrier for three pivoted transferring members 74 engaged with three pairs of flanges 76 , 78 circumferentially spaced about the circumference of the annular sleeve 56 . the pivoted transferring members 74 are pivotally secured to the flanges 76 , 78 by bolts 80 and nuts 82 , respectively . the pivoted transferring members 74 comprise an interior abutment portion 84 which contacts an extended annular portion 86 of the interior sleeve 56 which extended portion 86 moves axially with the movement of the drive shaft 14 of the electric motor 10 . due to the secured pivot point of the pivoted transferring member 74 , a second abutment portion 88 at the opposite end of each pivoted transferring member 74 will engage an annular transfer member 90 . the transfer member 90 abuts the stack of interweaved discs 64 and plates 66 . when moved in an axial direction by the second abutment portions 88 of the pivoted transferring members 74 , the annular transfer member 90 forces the discs 64 and plates 66 together against an annular stop 92 fixedly associated with the sleeve 56 at the other end of the stack . thus , movement of the drive shaft 14 of the electric motor 10 in a direction to the right as shown in fig1 moves the second abutment portions 88 of the toggle members 74 against the annular transfer member 90 to the left and engages the stack thereby engaging the drive shaft 14 with the output shaft 72 . in operation , once the electric motor 10 is energized , the drive shaft 14 will move approximately three millimeters to the right , as shown in fig1 with a force of approximately 220 pounds . this force will remain constant throughout the operation of the motor 10 and will force engagement of the clutch 12 at the stack of discs 64 and plates 66 to transfer power from the drive shaft 14 of the motor 10 to the output shaft 72 of the clutch 12 . once the motor 10 is turned off , the drive shaft 14 will move to the left three millimeters via the spring 24 and disengage the clutch 12 by pivotal movement of the pivoted transferring members 74 in a counterclockwise direction as shown in fig1 . at this point , the output shaft 72 is disengaged from the drive shaft 14 and the driven machine is no longer powered by the motor 10 . throughout operation of the motor 10 , the fan blades 44 cool the motor 10 by pulling air through passages 100 in the outer housing 33 of the clutch unit 12 . although only one such passage is shown in fig1 it is anticipated that a plurality of such passages , such as four in number , will be circumferentially spaced around the housing , and through which the fan 43 will pull air through the clutch unit 12 to cool the clutch unit 12 and also force air past the motor 10 to cool the motor 10 . it is anticipated that blocking off all but one of the passages 100 and attaching a blower unit to the remaining passage 100 will further effectuate the cooling process if necessary . although it is apparent that the preferred embodiment of the present invention is well calculated to provide the features and advantages stated above , it will be appreciated that the invention is susceptible to modification , variation , and change without departing from the proper scope or fair meaning of the appended claims . | 5 |
in order to facilitate understanding of the following description and examples which follow certain frequently occurring methods and / or terms will be described . the term &# 34 ; isolated &# 34 ; means altered &# 34 ; by the hand of man &# 34 ; from its natural state ; i . e ., if it occurs in nature , it has been changed or removed from its original environment , or both . for example , a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not &# 34 ; isolated &# 34 ;, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is &# 34 ; isolated &# 34 ;, as the term is employed herein . for example , with respect to polynucleotides , the term isolated means that it is separated from the nucleic acid and cell in which it naturally occurs . as part of or following isolation , such polynucleotides can be joined to other polynucleotides , such as dnas , for mutagenesis , to form fusion proteins , and for propagation or expression in a host , for instance . the isolated polynucleotides , alone or joined to other polynucleotides such as vectors , can be introduced into host cells , in culture or in whole organisms . introduced into host cells in culture or in whole organisms , such polynucleotides still would be isolated , as the term is used herein , because they would not be in their naturally occurring form or environment . similarly , the polynucleotides and polypeptides may occur in a composition , such as a media formulation ( solutions for introduction of polynucleotides or polypeptides , for example , into cells or compositions or solutions for chemical or enzymatic reactions which are not naturally occurring compositions ) and , therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein . the term &# 34 ; ligation &# 34 ; refers to the process of forming phosphodiester bonds between two or more polynucleotides , which most often are double stranded dnas . techniques for ligation are well known to the art and protocols for ligation are described in standard laboratory manuals and references , such as , for instance , sambrook et al ., molecular cloning , a laboratory manual , 2nd ed . ; cold spring harbor laboratory press , cold spring harbor , n . y . ( 1989 ). the term &# 34 ; gene &# 34 ; means the segment of dna involved in 4producing a polypeptide chain ; it includes regions preceding and following the coding region ( leader and trailer ) as well as intervening sequences ( introns ) between individual coding segments ( exons ). a coding sequence is &# 34 ; operably linked to &# 34 ; another coding sequence when rna polymerase will transcribe the two coding sequences into a single mrna , which is then translated into a single polypeptide having amino acids derived from both coding sequences . the coding sequences need not be contiguous to one another so long as the expressed sequences ultimately process to produce the desired protein . &# 34 ; recombinant &# 34 ; enzymes refer to enzymes produced by recombinant dna techniques ; i . e ., produced from cells transformed by an exogenous dna construct encoding the desired enzyme . &# 34 ; synthetic &# 34 ; enzymes are those prepared by chemical synthesis . a dna &# 34 ; coding sequence of &# 34 ; or a &# 34 ; nucleotide sequence encoding &# 34 ; a particular enzyme , is a dna sequence which is transcribed and translated into an enzyme when placed under the control of appropriate regulatory sequences . &# 34 ; plasmids &# 34 ; are designated by a lower case &# 34 ; p &# 34 ; preceded and / or followed by capital letters and / or numbers . the starting plasmids herein are either commercially available , publicly available on an unrestricted basis , or can be constructed from available plasmids in accord with published procedures . in addition , equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan . &# 34 ; digestion &# 34 ; of dna refers to catalytic cleavage of the dna with a restriction enzyme that acts only at certain sequences in the dna . the various restriction enzymes used herein are commercially available and their reaction conditions , cofactors and other requirements were used as would be known to the ordinarily skilled artisan . for analytical purposes , typically 1 μg of plasmid or dna fragment is used with about 2 units of enzyme in about 20 μl of buffer solution . for the purpose of isolating dna fragments for plasmid construction , typically 5 to 50 μg of dna are digested with 20 to 250 units of enzyme in a larger volume . appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer . incubation times of about 1 hour at 37 ° c . are ordinarily used , but may vary in accordance with the supplier &# 39 ; s instructions . after digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment . size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by goeddel et al ., nucleic acids res ., 8 : 4057 ( 1980 ). &# 34 ; oligonucleotides &# 34 ; refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized . such synthetic oligonucleotides have no 5 &# 39 ; phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an atp in the presence of a kinase . a synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated . &# 34 ; ligation &# 34 ; refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments ( maniatis , t ., et al ., id ., p . 146 ). unless otherwise provided , ligation may be accomplished using known buffers and conditions with 10 units of t4 dna ligase (&# 34 ; ligase &# 34 ;) per 0 . 5 μg of approximately equimolar amounts of the dna fragments to be ligated . unless otherwise stated , transformation was performed as described in sambrook and maniatis , molecular cloning : a laboratory manual , cold spring harbor laboratory , 1989 . in accordance with an aspect of the present invention , there are provided isolated nucleic acids ( polynucleotides ) which encode for the mature enzyme having the deduced amino acid sequence of fig1 ( seq id no : 6 ). in accordance with another aspect of the present invention , there are provided isolated nucleic acids ( polynucleotides ) which encode for the mature enzyme having the deduced amino acid sequence of fig2 ( seq id no : 8 ). the polynucleotides of this invention were originally recovered from a genomic gene library derived from two sources . the first , alcaligenes ( delaya ) aquamarinus , is a β - proteobacteria . it is a gram - negative rod that grows optimally at 26 ° c . and ph 7 . 2 . the second , microscilla furvescens , is a cytophagales ( bacteria ) isolated from samoa . it is a gram - negative rod with gliding motility that grows optimally at 30 ° c . and ph 7 . 0 . with respect to alcaligenes ( delaya ) aquamarinus , the protein with the closest amino acid sequence identity of which the inventors are currently aware is the microscilla furvescens catalase ( 59 . 5 % protein identity ; 60 % dna identity ). the next closest is a mycobacterium tuberculosis catalase ( katg ), with a 54 % protein identity . with respect to microscilla furvescens , the protein with the closest amino acid sequence identity of which the inventors are currently aware is catalase i of bacillus stearothermophilus , which has a 69 % amino acid identity . accordingly , the polynucleotides and enzymes encoded thereby are identified by the organism from which they were isolated . such are sometimes referred to below as &# 34 ; 64ca2 &# 34 ; ( fig1 and seq id nos : 5 and 6 ) and &# 34 ; 53ca1 &# 34 ; ( fig2 and seq id nos : 7 and 8 ). one means for isolating the nucleic acid molecules encoding the enzymes of the present invention is to probe a gene library with a natural or artificially designed probe using art recognized procedures ( see , for example : current protocols in molecular biology , ausubel f . m . et al . ( eds .) green publishing company assoc . and john wiley interscience , new york , 1989 , 1992 ). it is appreciated by one skilled in the art that the polynucleotides of seq id nos : 5 and 7 , or fragments thereof ( comprising at least 12 contiguous nucleotides ), are particularly useful probes . other particularly useful probes for this purpose are hybridizable fragments of the sequences of seq id nos : 5 and 7 ( i . e ., comprising at least 12 contiguous nucleotides ). with respect to nucleic acid sequences which hybridize to specific nucleic acid sequences disclosed herein , hybridization may be carried out under conditions of reduced stringency , medium stringency or even stringent conditions . as an example of oligonucleotide hybridization , a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45 ° c . in a solution consisting of 0 . 9 m nacl , 50 mm nah 2 po 4 , ph 7 . 0 , 5 . 0 mm na 2 edta , 0 . 5 % sds , 10 × denhardt &# 39 ; s , and 0 . 5 mg / ml polyriboadenylic acid . approximately 2 × 10 7 cpm ( specific activity 4 - 9 × 10 8 cpm / ug ) of 32 p end - labeled oligonucleotide probe are then added to the solution . after 12 - 16 hours of incubation , the membrane is washed for 30 minutes at room temperature in 1 × set ( 150 mm nacl , 20 mm tris hydrochloride , ph 7 . 8 , 1 mm na 2 edta ) containing 0 . 5 % sds , followed by a 30 minute wash in fresh 1 × set at ( tm less 10 ° c .) for the oligonucleotide probe . the membrane is then exposed to auto - radiographic film for detection of hybridization signals . stringent conditions means hybridization will occur only if there is at least 90 % identity , preferably at least 95 % identity and most preferably at least 97 % identity between the sequences . further , it is understood that a section of a 100 bps sequence that is 95 bps in length has 95 % identity with the 1090 bps sequence from which it is obtained . see j . sambrook et al ., molecular cloning , a laboratory manual , 2d ed ., cold spring harbor laboratory ( 1989 ) which is hereby incorporated by reference in its entirety . also , it is understood that a fragment of a 100 bps sequence that is 95 bps in length has 95 % identity with the 100 bps sequence from which it is obtained . as used herein , a first dna ( rna ) sequence is at least 70 % and preferably at least 80 % identical to another dna ( rna ) sequence if there is at least 70 % and preferably at least a 80 % or 90 % identity , respectively , between the bases of the first sequence and the bases of the another sequence , when properly aligned with each other , for example when aligned by blastn . the present invention relates to polynucleotides which differ from the reference polynucleotide such that the differences are silent , for example , the amino acid sequence encoded by the polynucleotides is the same . the present invention also relates to nucleotide changes which result in amino acid substitutions , additions , deletions , fusions and truncations in the polypeptide encoded by the reference polynucleotide . in a preferred aspect of the invention these polypeptides retain the same biological action as the polypeptide encoded by the reference polynucleotide . the polynucleotides of this invention were recovered from genomic gene libraries from the organisms identified above . gene libraries were generated from a lambda zap ii cloning vector ( stratagene cloning systems ). mass excisions were performed on these libraries to generate libraries in the pbluescript phagemid . libraries were generated and excisions were performed according to the protocols / methods hereinafter described . the polynucleotides of the present invention may be in the form of rna or dna , which dna includes cdna , genomic dna , and synthetic dna . the dna may be double - stranded or single - stranded , and if single stranded may be coding strand or non - coding ( anti - sense ) strand . the coding sequences which encodes the mature enzymes may be identical to the coding sequences shown in fig1 - 2 ( seq id nos : 5 & amp ; 7 ) or may be a different coding sequence which coding sequence , as a result of the redundancy or degeneracy of the genetic code , encodes the same mature enzymes as the dna of fig1 - 2 ( seq id nos : 6 & amp ; 8 ). the polynucleotide which encodes for the mature enzyme of fig1 - 2 ( seq id nos : 6 & amp ; 8 ) may include , but is not limited to : only the coding sequence for the mature enzyme ; the coding sequence for the mature enzyme and additional coding sequence such as a leader sequence or a proprotein sequence ; the coding sequence for the mature enzyme ( and optionally additional coding sequence ) and non - coding sequence , such as introns or non - coding sequence 5 &# 39 ; and / or 3 &# 39 ; of the coding sequence for the mature enzyme . thus , the term &# 34 ; polynucleotide encoding an enzyme ( protein )&# 34 ; encompasses a polynucleotide which includes only coding sequence for the enzyme as well as a polynucleotide which includes additional coding and / or non - coding sequence . the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments , analogs and derivatives of the enzymes having the deduced amino acid sequences of fig1 - 2 ( seq id nos : 6 & amp ; 8 ). the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non - naturally occurring variant of the polynucleotide . thus , the present invention includes polynucleotides encoding the same mature enzymes as shown in fig1 - 2 ( seq id nos : 6 & amp ; 8 ) as well as variants of such polynucleotides which variants encode for a fragment , derivative or analog of the enzymes of fig1 - 2 ( seq id nos : 6 & amp ; 8 ). such nucleotide variants include deletion variants , substitution variants and addition or insertion variants . as hereinabove indicated , the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in fig1 - 2 ( seq id nos : 5 & amp ; 7 ). as known in the art , an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution , deletion or addition of one or more nucleotides , which does not substantially alter the function of the encoded enzyme . also , using directed and other evolution strategies , one may make very minor changes in dna sequence which can result in major changes in function . fragments of the full length gene of the present invention may be used as hybridization probes for a cdna or a genomic library to isolate the full length dna and to isolate other dnas which have a high sequence similarity to the gene or similar biological activity . probes of this type preferably have at least 10 , preferably at least 15 , and even more preferably at least 30 bases and may contain , for example , at least 50 or more bases . in fact , probes of this type having at least up to 150 bases or greater may be preferably utilized . the probe may also be used to identify a dna clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promotor regions , exons and introns . an example of a screen comprises isolating the coding region of the gene by using the known dna sequence to synthesize an oligonucleotide probe . labeled oligonucleotides having a sequence complementary or identical to that of the gene or portion of the gene sequences of the present invention are used to screen a library of genomic dna to determine which members of the library the probe hybridizes to . it is also appreciated that such probes can be and are preferably labeled with an analytically detectable reagent to facilitate identification of the probe . useful reagents include but are not limited to radioactivity , fluorescent dyes or enzymes capable of catalyzing the formation of a detectable product . the probes are thus useful to isolate complementary copies of dna from other sources or to screen such sources for related sequences . the present invention further relates to polynucleotides which hybridize to the hereinabove - described sequences if there is at least 70 %, preferably at least 90 %, and more preferably at least 95 % identity between the sequences . ( as indicated above , 70 % identity would include within such definition a 70 bps fragment taken from a 100 bp polynucleotide , for example .) the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove - described polynucleotides . as herein used , the term &# 34 ; stringent conditions &# 34 ; means hybridization will occur only if there is at least 95 % and preferably at least 97 % identity between the sequences . the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode enzymes which either retain substantially the same biological function or activity as the mature enzyme encoded by the dna of fig1 - 2 ( seq id nos : 5 & amp ; 7 ). in referring to identity in the case of hybridization , as known in the art , such identity refers to the complementarity of two polynucleotide segments . alternatively , the polynucleotide may have at least 15 bases , preferably at least 30 bases , and more preferably at least 50 bases which hybridize to any part of a polynucleotide of the present invention and which has an identity thereto , as hereinabove described , and which may or may not retain activity . for example , such polynucleotides may be employed as probes for the polynucleotides of seq id nos : 5 & amp ; 7 , for example , for recovery of the polynucleotide or as a diagnostic probe or as a pcr primer . thus , the present invention is directed to polynucleotides having at least a 70 % identity , preferably at least 90 % identity and more preferably at least a 95 % identity to a polynucleotide which encodes the enzymes of seq id nos : 6 & amp ; 8 as well as fragments thereof , which fragments have at least 15 bases , preferably at least 30 bases , more preferably at least 50 bases and most preferably fragments having up to at least 150 bases or greater , which fragments are at least 90 % identical , preferably at least 95 % identical and most preferably at least 97 % identical to any portion of a polynucleotide of the present invention . the terms &# 34 ; fragment ,&# 34 ; &# 34 ; derivative &# 34 ; and &# 34 ; analog &# 34 ; when referring to the enzymes of fig1 - 2 ( seq nos . 6 & amp ; 8 ) means enzymes which retain essentially the same biological function or activity as such enzymes . thus , an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature enzyme . the enzymes of the present invention may be a recombinant enzyme , a natural enzyme or a synthetic enzyme , preferably a recombinant enzyme . the fragment , derivative or analog of the enzymes of fig1 - 2 ( seq id nos : 6 & amp ; 8 ) may be ( i ) one in which one or more of the amino acid residues are substituted with a conserved or non - conserved amino acid residue ( preferably a conserved amino acid residue ) and such substituted amino acid residue may or may not be one encoded by the genetic code , or ( ii ) one in which one or more of the amino acid residues includes a substituent group , or ( iii ) one in which the mature enzyme is fused with another compound , such as a compound to increase the half - life of the enzyme ( for example , polyethylene glycol ), or ( iv ) one in which the additional amino acids are fused to the mature enzyme , such as a leader or secretory sequence or a sequence which is employed for purification of the mature enzyme or a proprotein sequence . such fragments , derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein . the enzymes and polynucleotides of the present invention are preferably provided in an isolated form , and preferably are purified to homogeneity . the present invention also relates to vectors which include polynucleotides of the present invention , host cells which are genetically engineered with vectors of the invention and the production of enzymes of the invention by recombinant techniques . host cells are genetically engineered ( transduced or transformed or transfected ) with the vectors of this invention which may be , for example , a cloning vector such as an expression vector . the vector may be , for example , in the form of a plasmid , a phage , etc . the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters , selecting transformants or amplifying the genes of the present invention . the culture conditions , such as temperature , ph and the like , are those previously used with the host cell selected for expression , and will be apparent to the ordinarily skilled artisan . the polynucleotides of the present invention may be employed for producing enzymes by recombinant techniques . thus , for example , the polynucleotide may be included in any one of a variety of expression vectors for expressing an enzyme . such vectors include chromosomal , nonchromosomal and synthetic dna sequences , e . g ., derivatives of sv40 ; bacterial plasmids ; phage dna ; baculovirus ; yeast plasmids ; vectors derived from combinations of plasmids and phage dna , viral dna such as vaccinia , adenovirus , fowl pox virus , and pseudorabies . however , any other vector may be used as long as it is replicable and viable in the host . the appropriate dna sequence may be inserted into the vector by a variety of procedures . in general , the dna sequence is inserted into an appropriate restriction endonuclease site ( s ) by procedures known in the art . such procedures and others are deemed to be within the scope of those skilled in the art . the dna sequence in the expression vector is operatively linked to an appropriate expression control sequence ( s ) ( promoter ) to direct mrna synthesis . as representative examples of such promoters , there may be mentioned : ltr or sv40 promoter , the e . coli . lac or trp , the phage lambda p l promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses . the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator . the vector may also include appropriate sequences for amplifying expression . in addition , the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture , or such as tetracycline or ampicillin resistance in e . coli . the vector containing the appropriate dna sequence as hereinabove described , as well as an appropriate promoter or control sequence , may be employed to transform an appropriate host to permit the host to express the protein . as representative examples of appropriate hosts , there may be mentioned : bacterial cells , such as e . coli , streptomyces , bacillus subtilis ; fungal cells , such as yeast ; insect cells such as drosophila s2 and spodoptera sf9 ; animal cells such as cho , cos or bowes melanoma ; adenoviruses ; plant cells , etc . the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein . more particularly , the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above . the constructs comprise a vector , such as a plasmid or viral vector , into which a sequence of the invention has been inserted , in a forward or reverse orientation . in a preferred aspect of this embodiment , the construct further comprises regulatory sequences , including , for example , a promoter , operably linked to the sequence . large numbers of suitable vectors and promoters are known to those of skill in the art , and are commercially available . the following vectors are provided by way of example ; bacterial : pqe70 , pqe60 , pqe - 9 ( qiagen ), pbluescript ii ks ( stratagene ), ptrc99a , pkk223 - 3 , pdr540 , prit2t ( pharmacia ); eukaryotic : pxt1 , psg5 ( stratagene ) psvk3 , pbpv , pmsg , psvl sv40 ( pharmacia ). however , any other plasmid or vector may be used as long as they are replicable and viable in the host . promoter regions can be selected from any desired gene using cat ( chloramphenicol transferase ) vectors or other vectors with selectable markers . two appropriate vectors are pkk232 - 8 and pcm7 . particular named bacterial promoters include laci , lacz , t3 , t7 , gpt , lambda p r , p l and trp . eukaryotic promoters include cmv immediate early , hsv thymidine kinase , early and late sv40 , ltrs from retrovirus , and mouse metallothionein - i . selection of the appropriate vector and promoter is well within the level of ordinary skill in the art . in a further embodiment , the present invention relates to host cells containing the above - described constructs . the host cell can be a higher eukaryotic cell , such as a mammalian cell , or a lower eukaryotic cell , such as a yeast cell , or the host cell can be a prokaryotic cell , such as a bacterial cell . introduction of the construct into the host cell can be effected by calcium phosphate transfection , deae - dextran mediated transfection , or electroporation ( davis , l ., dibner , m ., battey , i ., basic methods in molecular biology , ( 1986 )). the constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence . alternatively , the enzymes of the invention can be synthetically produced by conventional peptide synthesizers . mature proteins can be expressed in mammalian cells , yeast , bacteria , or other cells under the control of appropriate promoters . cell - free translation systems can also be employed to produce such proteins using rnas derived from the dna constructs of the present invention . appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by sambrook et al ., molecular cloning : a laboratory manual , second edition , cold spring harbor , n . y ., ( 1989 ), the disclosure of which is hereby incorporated by reference . transcription of the dna encoding the enzymes of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector . enhancers are cis - acting elements of dna , usually about from 10 to 300 bp that act on a promoter to increase its transcription . examples include the sv40 enhancer on the late side of the replication origin bp 100 to 270 , a cytomegalovirus early promoter enhancer , the polyoma enhancer on the late side of the replication origin , and adenovirus enhancers . generally , recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell , e . g ., the ampicillin resistance gene of e . coli and s . cerevisiae trp1 gene , and a promoter derived from a highly - expressed gene to direct transcription of a downstream structural sequence . such promoters can be derived from operons encoding glycolytic enzymes such as 3 - phosphoglycerate kinase ( pgk ), α - factor , acid phosphatase , or heat shock proteins , among others . the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences , and preferably , a leader sequence capable of directing secretion of translated enzyme . optionally , the heterologous sequence can encode a fusion enzyme including an n - terminal identification peptide imparting desired characteristics , e . g ., stabilization or simplified purification of expressed recombinant product . useful expression vectors for bacterial use are constructed by inserting a structural dna sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter . the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to , if desirable , provide amplification within the host . suitable prokaryotic hosts for transformation include e . coli , bacillus subtilis , salmonella typhimurium and various species within the genera pseudomonas , streptomyces , and staphylococcus , although others may also be employed as a matter of choice . as a representative but nonlimiting example , useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pbr322 ( atcc 37017 ). such commercial vectors include , for example , pkk223 - 3 ( pharmacia fine chemicals , uppsala , sweden ) and pgem1 ( promega biotec , madison , wis ., usa ). these pbr322 &# 34 ; backbone &# 34 ; sections are combined with an appropriate promoter and the structural sequence to be expressed . following transformation of a suitable host strain and growth of the host strain to an appropriate cell density , the selected promoter is induced by appropriate means ( e . g ., temperature shift or chemical induction ) and cells are cultured for an additional period . cells are typically harvested by centrifugation , disrupted by physical or chemical means , and the resulting crude extract retained for further purification . microbial cells employed in expression of proteins can be disrupted by any convenient method , including freeze - thaw cycling , sonication , mechanical disruption , or use of cell lysing agents , such methods are well known to those skilled in the art . various mammalian cell culture systems can also be employed to express recombinant protein . examples of mammalian expression systems include the cos - 7 lines of monkey kidney fibroblasts , described by gluzman , cell , 23 : 175 ( 1981 ), and other cell lines capable of expressing a compatible vector , for example , the c127 , 3t3 , cho , hela and bhk cell lines . mammalian expression vectors will comprise an origin of replication , a suitable promoter and enhancer , and also any necessary ribosome binding sites , polyadenylation site , splice donor and acceptor sites , transcriptional termination sequences , and 5 &# 39 ; flanking nontranscribed sequences . dna sequences derived from the sv40 splice , and polyadenylation sites may be used to provide the required nontranscribed genetic elements . the enzyme can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation , acid extraction , anion or cation exchange chromatography , phosphocellulose chromatography , hydrophobic interaction chromatography , affinity chromatography , hydroxylapatite chromatography and lectin chromatography . protein refolding steps can be used , as necessary , in completing configuration of the mature protein . finally , high performance liquid chromatography ( hplc ) can be employed for final purification steps . the enzymes of the present invention may be a naturally purified product , or a product of chemical synthetic procedures , or produced by recombinant techniques from a prokaryotic or eukaryotic host ( for example , by bacterial , yeast , higher plant , insect and mammalian cells in culture ). depending upon the host employed in a recombinant production procedure , the enzymes of the present invention may be glycosylated or may be non - glycosylated . enzymes of the invention may or may not also include an initial methionine amino acid residue . antibodies generated against the enzymes corresponding to a sequence of the present invention can be obtained by direct injection of the enzymes into an animal or by administering the enzymes to an animal , preferably a nonhuman . the antibody so obtained will then bind the enzymes itself . in this manner , even a sequence encoding only a fragment of the enzymes can be used to generate antibodies binding the whole native enzymes . such antibodies can then be used to isolate the enzyme from cells expressing that enzyme . for preparation of monoclonal antibodies , any technique which provides antibodies produced by continuous cell line cultures can be used . examples include the hybridoma technique ( kohler and milstein , nature , 256 : 495 - 497 , 1975 ), the trioma technique , the human b - cell hybridoma technique ( kozbor et al ., immunology today 4 : 72 , 1983 ), and the ebv - hybridoma technique to produce human monoclonal antibodies ( cole et al ., in monoclonal antibodies and cancer therapy , alan r . liss , inc ., pp . 77 - 96 , 1985 ). techniques described for the production of single chain antibodies ( u . s . pat . no . 4 , 946 , 778 ) can be adapted to produce single chain antibodies to immunogenic enzyme products of this invention . also , transgenic mice may be used to express humanized antibodies to immunogenic enzyme products of this invention . antibodies generated against an enzyme of the present invention may be used in screening for similar enzymes from other organisms and samples . such screening techniques are known in the art , for example , one such screening assay is described in sambrook and maniatis , molecular cloning : a laboratory manual ( 2d ed . ), vol . 2 : section 8 . 49 , cold spring harbor laboratory , 1989 , which is hereby incorporated by reference in its entirety . the present invention will be further described with reference to the following examples ; however , it is to be understood that the present invention is not limited to such examples . all parts or amounts , unless otherwise specified , are by weight . an e . coli catalase negative host strain cat500 was infected with a phage solution containing sheared pieces of dna from alcaligenes ( deleya ) aquamarinus in pbluescript plasmid and plated on agar containing lb with ampicillin ( 100 μg / ml ), methicillin ( 80 μg / ml ) and kanamycin ( 100 μg / ml ) according to the method of hay and short ( hay , b . and short , j ., j . strategies , 5 : 16 , 1992 ). the resulting colonies were picked with sterile toothpicks and used to singly inoculate each of the wells of 96 - well microtiter plates . the wells contained 250 μl of sob media with 100 μg / ml ampicillin , 80 μg / ml methicillin , and ( sob amp / meth / kan ). the cells were grown overnight at 37 ° c . without shaking . this constituted generation of the &# 34 ; sourcegenebank &# 34 ;; each well of the source genebank thus contained a stock culture of e . coli cells , each of which contained a pbluescript plasmid with a unique dna insert . same protocol was adapted for screening catalase from microscilla furvescens . the plates of the source genebank were used to multiply inoculate a single plate ( the &# 34 ; condensed plate &# 34 ;) containing in each well 200 μl of sob amp / meth / kan . this step was performed using the high density replicating tool ( hdrt ) of the beckman biomek with a 1 % bleach , water , isopropanol , air - dry sterilization cycle in between each inoculation . each well of the condensed plate thus contained 4 different pbluescript clones from each of the source library plates . nine such condensed plates were prepared and grown for 16h at 37 ° c . one hundred ( 100 ) μl of the overnight culture was transferred to the white polyfiltronic assay plates containing 100 μl hepes / well . a 0 . 03 % solution of hydrogen peroxide was made in 5 % triton and 20 μl of this solution was added to each well . the plates were incubated at room temperature for one hour . after an hour , 50 μl of 120 mm 3 -( p - hydroxyphenyl )- propionic acid and 1 unit of horseradish peroxidase were added to each well and the plates were incubated at room temperature for 1 hour . to quench the reaction , 50 μl of 1 m tris - base was added to each well . the wells were excited on a fluorometer at 320 nm and read at 404 nm . a low value signified a positive catalase hit . in order to isolate the individual clone which carried the activity , the source genebank plates were thawed and the individual wells used to singly inoculate a new plate containing sob amp / meth / kan . as above the plate was incubated at 37 ° c . to grow the cells , and assayed for activity as described above . once the active well from the source plate was identified , the cells from the source plate were streaked on agar with lb / amp / meth / kan and grown overnight at 37 ° c . to obtain single colonies . eight single colonies were picked with a sterile toothpick and used to singly inoculate the wells of a 96 - well microtiter plate . the wells contained 250 μl of sob amp / meth / kan . the cells were grown overnight at 37 ° c . without shaking . a 100 μl aliquot was removed from each well and assayed as indicated above . the most active clone was identified and the remaining 150 μl of culture was used to streak an agar plate with lb / amp / meth / kan . eight single colonies were picked , grown and assayed as above . the most active clone was used to inoculate 3 ml cultures of lb / amp / meth / kan , which were grown overnight . the plasmid dna was isolated from the cultures and utilized for sequencing . dna encoding the enzymes of the present invention , seq id nos : 7 and 9 , were initially amplified from a pbluescript vector containing the dna by the pcr technique using the primers noted herein . the amplified sequences were then inserted into the respective pqe vector listed beneath the primer sequences , and the enzyme was expressed according to the protocols set forth herein . the 5 &# 39 ; and 3 &# 39 ; oligonucleotide primer sequences used for subcloning and vectors for the respective genes are as follows : __________________________________________________________________________5 &# 39 ; primer ccgagaattcattaaagaggagaaattaactatgaataacgcatccgctgac ecori ( seq id no : 1 ) - 3 &# 39 ; primer cggaaagcttttacgacgcgacgtcgaaacg hindiii ( seq id no : 2 ) __________________________________________________________________________ __________________________________________________________________________5 &# 39 ; primer ccgagaattcattaaagaggagaaattaactatggaaaatcacaaacactca ecori ( seq id no : 3 ) - 3 &# 39 ; primer cgaaggtaccttatttcagatcaaaccggtc kpni ( seq id no : 4 ) __________________________________________________________________________ the restriction enzyme sites indicated correspond to the restriction enzyme sites on the bacterial expression vector indicated for the respective gene ( qiagen , inc . chatsworth , calif .). the pqet vector encodes antibiotic resistance ( amp r ), a bacterial origin of replication ( ori ), an iptg - regulatable promoter operator ( p / o ), a ribosome binding site ( rbs ), a 6 - his tag and restriction enzyme sites . the pqet vector was digested with the restriction enzymes indicated . the amplified sequences were ligated into the respective pqet vector and inserted in frame with the sequence encoding for the rbs . the native stop codon was incorporated so the genes were not fused to the his tag of the vector . the ligation mixture was then used to transform the e . coli strain um255 / prep4 ( qiagen , inc .) by electroporation . um255 / prep4 contains multiple copies of the plasmid prep4 , which expresses the lad repressor and also confers kanamycin resistance ( kan r ). transformants were identified by their ability to grow on lb plates and ampicillin / kanamycin resistant colonies were selected . plasmid dna was isolated and confirmed by restriction analysis . clones containing the desired constructs were grown overnight ( o / n ) in liquid culture in lb media supplemented with both amp ( 100 ug / ml ) and kan ( 25 ug / ml ). the o / n culture was used to inoculate a large culture at a ratio of 1 : 100 to 1 : 250 . the cells were grown to an optical density 600 ( o . d . 600 ) of between 0 . 4 and 0 . 6 . iptg (&# 34 ; isopropyl - b - d - thiogalacto pyranoside &# 34 ;) was then added to a final concentration of 1 mm . iptg induces by inactivating the lad repressor , clearing the p / o leading to increased gene expression . cells were grown an extra 3 to 4 hours . cells were then harvested by centrifugation . the primer sequences set out above may also be employed to isolate the target gene from the deposited material by hybridization techniques described above . 1 ) u . s . pat . no . 5 , 439 , 813 , aug . 8 , 1995 , production of glyoxylic acid with glycolate oxidase and catalase immobilized on oxirane acrylic beads , anton , d . l ., wilmington , del ., dicosimo , r ., wilmington , del ., gavagan , j . e ., wilmington , del . 2 ) u . s . pat . no . 5 , 360 , 732 , nov . 1 , 1994 , production of aspergillus niger catalase - r , berka , r . m ., san mateo , calif ., fowler , t ., redwood city , calif ., rey , m . w ., san mateo , calif . 3 ) u . s . pat . no . 4 , 460 , 686 , jul . 17 , 1984 , glucose oxidation with immobilized glucose oxidase - catalase , hartmeier , w ., ingelheim am rhein , germany 4 ) u . s . pat . no . 5 , 447 , 650 , sep . 5 , 1995 , composition for preventing the accumulation of inorganic deposits on contact lenses , cafaro , d . p ., santa ana , calif . 5 ) u . s . pat . no . 5 , 362 , 647 , nov . 8 , 1994 , compositions and methods for destroying hydrogen peroxide , cook , j . n ., mission viejo , calif ., worsley , j . l ., irvine , calif . 6 ) u . s . pat . no . 5 , 266 , 338 , 1993 , cascione , a . s ., rapp , h . 7 ) patrick dhaese , &# 34 ; catalase : an enzyme with growing industrial potential &# 34 ; chimica oggia / chemistry today , january / february , 1996 . __________________________________________________________________________ # sequence listing - - - - ( 1 ) general information : - - ( iii ) number of sequences : 8 - - - - ( 2 ) information for seq id no : 1 : - - ( i ) sequence characteristics : ( a ) length : 52 nucl - # eotides - - ( b ) type : nucleic a - # cid - - ( c ) strandedness : sing - # le - - ( d ) topology : linear - - - - ( ii ) molecule type : dna - - ( xi ) sequence description : seq id no : - # 1 : - - ccgagaattc attaaagagg agaaattaac tatgaataac gcatccgctg ac - # 52 - - - - ( 2 ) information for seq id no : 2 : - - ( i ) sequence characteristics : ( a ) length : 31 nucl - # eic acid - - ( b ) type : nucleic a - # cid - - ( c ) strandedness : sing - # le - - ( d ) topology : linear - - - - ( ii ) molecule type : dna - - ( xi ) sequence description : seq id no : - # 2 : - - cggaaagctt ttacgacgcg acgtcgaaac g - # - # 31 - - - - ( 2 ) information for seq id no : 3 : - - ( i ) sequence characteristics : ( a ) length : 52 nucl - # eotides - - ( b ) type : nucleic a - # cid - - ( c ) strandedness : sing - # le - - ( d ) topology : linear - - - - ( ii ) molecule type : dna - - ( xi ) sequence description : seq id no : - # 3 : - - ccgagaattc attaaagagg agaaattaac tatggaaaat cacaaacact ca - # 52 - - - - ( 2 ) information for seq id no : 4 : - - ( i ) sequence characteristics : ( a ) length : 31 nucl - # eotides - - ( b ) type : nucleic a - # cid - - ( c ) strandedness : sing - # le - - ( d ) topology : linear - - - - ( ii ) molecule type : dna - - ( xi ) sequence description : seq id no : - # 4 : - - cgaaggtacc ttatttcaga tcaaaccggt c - # - # 31 - - - - ( 2 ) information for seq id no : 5 : - - ( i ) sequence characteristics : ( a ) length : 2262 nu - # cleotides - - ( b ) type : nucleic a - # cid - - ( c ) strandedness : sing - # le - - ( d ) topology : linear - - - - ( ii ) molecule type : oligonucleotide - - ( xi ) sequence description : seq id no : - # 5 : - - atg aat aac gca tcc gct gac gat cta cac ag - # t agc ttg cag caa aga 48 met asn asn ala ser ala asp asp leu his se - # r ser leu gln gln arg 5 - # 10 - # 15 - - tgc aga gca ttt gtt ccc ttg gta tcg cca ag - # g cat aga gca ata agg 96 cys arg ala phe val pro leu val ser pro ar - # g his arg ala ile arg 20 - # 25 - # 30 - - gag aga gct atg agc ggt aaa tgt cct gtc at - # g cac ggt ggt aac acc144 glu arg ala met ser gly lys cys pro val me - # t his gly gly asn thr 35 - # 40 - # 45 - - tcg acc ggt act tcc aac aaa gat tgg tgg cc - # g gaa ggg ttg aac ctg192 ser thr gly thr ser asn lys asp trp trp pr - # o glu gly leu asn leu50 - # 55 - # 60 - - gat att ttg cat cag caa gat cgc aaa tca ga - # c ccg atg gat ccg gat240 asp ile leu his gln gln asp arg lys ser as - # p pro met asp pro asp 65 - # 70 - # 75 - # 80 - - ttc aac tac cgt gaa gaa gta cgc aag ctc ga - # t ttc gac gcg ctg aag288 phe asn tyr arg glu glu val arg lys leu as - # p phe asp ala leu lys 85 - # 90 - # 95 - - aaa gat gtc cac gcg ttg atg acc gat agc ca - # a gag tgg tgg ccc gct336 lys asp val his ala leu met thr asp ser gl - # n glu trp trp pro ala 100 - # 105 - # 110 - - gac tgg ggg cac tac ggc ggt ttg atg atc cg - # t atg gct tgg cac tcc384 asp trp gly his tyr gly gly leu met ile ar - # g met ala trp his ser 115 - # 120 - # 125 - - gct ggc acc tac cgt att gct gat ggc cgt gg - # g ggc ggt ggt acc gga432 ala gly thr tyr arg ile ala asp gly arg gl - # y gly gly gly thr gly130 - # 135 - # 140 - - agc cag cgc ttt gca ccg ctc aac tcc tgg cc - # g gac aac gtc agc ctg480 ser gln arg phe ala pro leu asn ser trp pr - # o asp asn val ser leu 145 1 - # 50 1 - # 55 1 -# 60 - - gat aaa gcg cgc cgt ctg ctg tgg ccg atc aa - # g aag aag tac ggcaac 528 asp lys ala arg arg leu leu trp pro ile ly - # s lys lys tyr gly asn 165 - # 170 - # 175 - - aaa atc agc tgg gca gac ctg atg att ctg gc - # t ggc acc gtg gct tat576 lys ile ser trp ala asp leu met ile leu al - # a gly thr val ala tyr 180 - # 185 - # 190 - - gag tcc atg ggc tta cct gct tac ggc ttc tc - # t ttc ggc cgc gtc gat624 glu ser met gly leu pro ala tyr gly phe se - # r phe gly arg val asp 195 - # 200 - # 205 - - att tgg gaa ccc gaa aaa gat atc tac tgg gg - # t gac gaa aaa gag tgg672 ile trp glu pro glu lys asp ile tyr trp gl - # y asp glu lys glu trp210 - # 215 - # 220 - - ctg gca cct tct gac gaa cgc tac ggc gac gt - # g aac aag cca gag acc720 leu ala pro ser asp glu arg tyr gly asp va - # l asn lys pro glu thr 225 2 - # 30 2 - # 35 2 -# 40 - - atg gaa aac ccg ctg gcg gct gtc caa atg gg - # t ctg atc tat gtgaac 768 met glu asn pro leu ala ala val gln met gl - # y leu ile tyr val asn 245 - # 250 - # 255 - - ccg gaa ggt gtt aac ggc cac cct gat ccg ct - # g aga acc gca cag cag816 pro glu gly val asn gly his pro asp pro le - # u arg thr ala gln gln 260 - # 265 - # 270 - - gta ctt gaa acc ttc gcc cgt atg gcg atg aa - # c gac gaa aaa acc gca864 val leu glu thr phe ala arg met ala met as - # n asp glu lys thr ala 275 - # 280 - # 285 - - gcc ctc aca gct ggc ggc cac acc gtc ggt aa - # t tgt cac ggt aat ggc912 ala leu thr ala gly gly his thr val gly as - # n cys his gly asn gly290 - # 295 - # 300 - - aat gcc tct gcg tta gcc cct gac cca aaa gc - # c tct gac gtt gaa aac960 asn ala ser ala leu ala pro asp pro lys al - # a ser asp val glu asn 305 3 - # 10 3 - # 15 3 -# 20 - - cag ggc tta ggt tgg ggc aac ccc aac atg ca - # g ggc aag gca agcaac 1008 gln gly leu gly trp gly asn pro asn met gl - # n gly lys ala ser asn 325 - # 330 - # 335 - - gcc gtg acc tcg ggt atc gaa ggt gct tgg ac - # c acc aac ccc acg aaa 1056 ala val thr ser gly ile glu gly ala trp th - # r thr asn pro thr lys 340 - # 345 - # 350 - - ttc gat atg ggc tat ttc gac ctg ctg ttc gg - # c tac aat tgg gaa ctg 1104 phe asp met gly tyr phe asp leu leu phe gl - # y tyr asn trp glu leu 355 - # 360 - # 365 - - aaa aag agt cct gcc ggt gcc cac cat tgg ga - # a ccg att gac atc aaa 1152 lys lys ser pro ala gly ala his his trp gl - # u pro ile asp ile lys370 - # 375 - # 380 - - aag gaa aac aag ccg gtt gac gcc agc gac cc - # c tct att cgc cac aac 1200 lys glu asn lys pro val asp ala ser asp pr - # o ser ile arg his asn 385 3 - # 90 3 - # 95 4 -# 00 - - ccg atc atg acc gat gcg gat atg gcg ata aa - # g gta aat ccg acctat 1248 pro ile met thr asp ala asp met ala ile ly - # s val asn pro thr tyr 405 - # 410 - # 415 - - cgc gct atc tgc gaa aaa ttc atg gcc gat cc - # t gag tac ttc aag aaa 1296 arg ala ile cys glu lys phe met ala asp pr - # o glu tyr phe lys lys 420 - # 425 - # 430 - - act ttc gcg aag gcg tgg ttc aag ctg acg ca - # c cgt gac ctg ggc ccg 1344 thr phe ala lys ala trp phe lys leu thr hi - # s arg asp leu gly pro 435 - # 440 - # 445 - - aaa tca cgt tac atc ggc ccg gaa gtg ccg gc - # a gaa gac ctg att tgg 1392 lys ser arg tyr ile gly pro glu val pro al - # a glu asp leu ile trp450 - # 455 - # 460 - - caa gac ccg att ccg gca ggt aac acc gac ta - # c tgc gaa gaa gtg gtc 1440 gln asp pro ile pro ala gly asn thr asp ty - # r cys glu glu val val 465 4 - # 70 4 - # 75 4 -# 80 - - aag cag aaa att gca caa agt ggc ctg agc at - # t agt gag atg gtctcc 1488 lys gln lys ile ala gln ser gly leu ser il - # e ser glu met val ser 485 - # 490 - # 495 - - acc gct tgg gac agt gcc cgt act tat cgc gg - # t tcc gat atg cgc ggc 1536 thr ala trp asp ser ala arg thr tyr arg gl - # y ser asp met arg gly 500 - # 505 - # 510 - - ggt gct aac ggt gcc cgc att cgc ttg gcc cc - # a cag aac gag tgg cag 1584 gly ala asn gly ala arg ile arg leu ala pr - # o gln asn glu trp gln 515 - # 520 - # 525 - - ggc aac gag ccg gag cgc ctg gcg aaa gtg ct - # g agc gtc tac gag cag 1632 gly asn glu pro glu arg leu ala lys val le - # u ser val tyr glu gln530 - # 535 - # 540 - - atc tct gcc gac acc ggc gct agc atc gcg ga - # c gtg atc gtt ctg gcc 1680 ile ser ala asp thr gly ala ser ile ala as - # p val ile val leu ala 545 5 - # 50 5 - # 55 5 -# 60 - - ggt agc gta ggc atc gag aaa gcc gcg aaa gc - # a gca ggt tac gatgtg 1728 gly ser val gly ile glu lys ala ala lys al - # a ala gly tyr asp val 565 - # 570 - # 575 - - cgc gtt ccc ttc ctg aaa ggc cgt ggc gat gc - # g acc gcc gag atg acc 1776 arg val pro phe leu lys gly arg gly asp al - # a thr ala glu met thr 580 - # 585 - # 590 - - gac gca gac tcc ttc gca ccg ctg gag ccg ct - # g gcc gat ggc ttc cgc 1824 asp ala asp ser phe ala pro leu glu pro le - # u ala asp gly phe arg 595 - # 600 - # 605 - - aac tgg cag aag aaa gag tat gtg gtg aag cc - # g gaa gag atg ctg ctg 1872 asn trp gln lys lys glu tyr val val lys pr - # o glu glu met leu leu610 - # 615 - # 620 - - gat cgt gcg cag ctg atg ggc tta acc ggc cc - # g gaa atg acc gtg ctg 1920 asp arg ala gln leu met gly leu thr gly pr - # o glu met thr val leu 625 6 - # 30 6 - # 35 6 -# 40 - - ctg ggc ggt atg cgc gta ctg ggc acc aac ta - # t ggt ggc acc aaacac 1968 leu gly gly met arg val leu gly thr asn ty - # r gly gly thr lys his 645 - # 650 - # 655 - - ggc gta ttc acc gat tgt gaa ggc cag ttg ac - # c aac gac ttt ttt gtg 2016 gly val phe thr asp cys glu gly gln leu th - # r asn asp phe phe val 655 - # 660 - # 665 - - aac ctg acc gat atg ggg aac agc tgg aag cc - # g gta ggt agc aac gcc 2064 asn leu thr asp met gly asn ser trp lys pr - # o val gly ser asn ala 670 - # 675 - # 680 - - tac gaa atc cgc gac cgc aag acc ggt gcc gt - # g aag tgg acc gcc tcg 2112 tyr glu ile arg asp arg lys thr gly ala va - # l lys trp thr ala ser685 - # 690 - # 700 - - cgg gtg gat ctg gta ttt ggt tcc aac tcg ct - # a ctg cgc tct tac gca 2160 arg val asp leu val phe gly ser asn ser le - # u leu arg ser tyr ala 705 7 - # 10 7 - # 15 7 -# 20 - - gaa gtg tac gcc cag gac gat aac ggc gag aa - # g ttc gtc aga gacttc 2208 glu val tyr ala gln asp asp asn gly glu ly - # s phe val arg asp phe 725 - # 730 - # 735 - - gtc gcc gcc tgg acc aaa gtg atg aac gcc ga - # c cgt ttc gac gtc gcg 2256 val ala ala trp thr lys val met asn ala as - # p arg phe asp val ala 740 - # 745 - # 750 - - tcg taa - # - # -# 2262 ser - - - - ( 2 ) information for seq id no : 6 : - - ( i ) sequence characteristics : ( a ) length : 753 ami - # no acids - - ( b ) type : amino aci - # d - - ( d ) topology : linear - - - - ( ii ) molecule type : polypeptide - - ( xi ) sequence description : seq id no : - # 6 : - - met asn asn ala ser ala asp asp leu his se - # r ser leu gln glnarg 5 - # 10 - # 15 - - cys arg ala phe val pro leu val ser pro ar - # g his arg ala ile arg 20 - # 25 - # 30 - - glu arg ala met ser gly lys cys pro val me - # t his gly gly asn thr 35 - # 40 - # 45 - - ser thr gly thr ser asn lys asp trp trp pr - # o glu gly leu asn leu50 - # 55 - # 60 - - asp ile leu his gln gln asp arg lys ser as - # p pro met asp pro asp 65 - # 70 - # 75 - # 80 - - phe asn tyr arg glu glu val arg lys leu as - # p phe asp ala leu lys 85 - # 90 - # 95 - - lys asp val his ala leu met thr asp ser gl - # n glu trp trp pro ala 100 - # 105 - # 110 - - asp trp gly his tyr gly gly leu met ile ar - # g met ala trp his ser 115 - # 120 - # 125 - - ala gly thr tyr arg ile ala asp gly arg gl - # y gly gly gly thr gly130 - # 135 - # 140 - - ser gln arg phe ala pro leu asn ser trp pr - # o asp asn val ser leu 145 1 - # 50 1 - # 55 1 -# 60 - - asp lys ala arg arg leu leu trp pro ile ly - # s lys lys tyr glyasn 165 - # 170 - # 175 - - lys ile ser trp ala asp leu met ile leu al - # a gly thr val ala tyr 180 - # 185 - # 190 - - glu ser met gly leu pro ala tyr gly phe se - # r phe gly arg val asp 195 - # 200 - # 205 - - ile trp glu pro glu lys asp ile tyr trp gl - # y asp glu lys glu trp210 - # 215 - # 220 - - leu ala pro ser asp glu arg tyr gly asp va - # l asn lys pro glu thr 225 2 - # 30 2 - # 35 2 -# 40 - - met glu asn pro leu ala ala val gln met gl - # y leu ile tyr valasn 245 - # 250 - # 255 - - pro glu gly val asn gly his pro asp pro le - # u arg thr ala gln gln 260 - # 265 - # 270 - - val leu glu thr phe ala arg met ala met as - # n asp glu lys thr ala 275 - # 280 - # 285 - - ala leu thr ala gly gly his thr val gly as - # n cys his gly asn gly290 - # 295 - # 300 - - asn ala ser ala leu ala pro asp pro lys al - # a ser asp val glu asn 305 3 - # 10 3 - # 15 3 -# 20 - - gln gly leu gly trp gly asn pro asn met gl - # n gly lys ala serasn 325 - # 330 - # 335 - - ala val thr ser gly ile glu gly ala trp th - # r thr asn pro thr lys 340 - # 345 - # 350 - - phe asp met gly tyr phe asp leu leu phe gl - # y tyr asn trp glu leu 355 - # 360 - # 365 - - lys lys ser pro ala gly ala his his trp gl - # u pro ile asp ile lys370 - # 375 - # 380 - - lys glu asn lys pro val asp ala ser asp pr - # o ser ile arg his asn 385 3 - # 90 3 - # 95 4 -# 00 - - pro ile met thr asp ala asp met ala ile ly - # s val asn pro thrtyr 405 - # 410 - # 415 - - arg ala ile cys glu lys phe met ala asp pr - # o glu tyr phe lys lys 420 - # 425 - # 430 - - thr phe ala lys ala trp phe lys leu thr hi - # s arg asp leu gly pro 435 - # 440 - # 445 - - lys ser arg tyr ile gly pro glu val pro al - # a glu asp leu ile trp450 - # 455 - # 460 - - gln asp pro ile pro ala gly asn thr asp ty - # r cys glu glu val val 465 4 - # 70 4 - # 75 4 -# 80 - - lys gln lys ile ala gln ser gly leu ser il - # e ser glu met valser 485 - # 490 - # 495 - - thr ala trp asp ser ala arg thr tyr arg gl - # y ser asp met arg gly 500 - # 505 - # 510 - - gly ala asn gly ala arg ile arg leu ala pr - # o gln asn glu trp gln 515 - # 520 - # 525 - - gly asn glu pro glu arg leu ala lys val le - # u ser val tyr glu gln530 - # 535 - # 540 - - ile ser ala asp thr gly ala ser ile ala as - # p val ile val leu ala 545 5 - # 50 5 - # 55 5 -# 60 - - gly ser val gly ile glu lys ala ala lys al - # a ala gly tyr aspval 565 - # 570 - # 575 - - arg val pro phe leu lys gly arg gly asp al - # a thr ala glu met thr 580 - # 585 - # 590 - - asp ala asp ser phe ala pro leu glu pro le - # u ala asp gly phe arg 595 - # 600 - # 605 - - asn trp gln lys lys glu tyr val val lys pr - # o glu glu met leu leu610 - # 615 - # 620 - - asp arg ala gln leu met gly leu thr gly pr - # o glu met thr val leu 625 6 - # 30 6 - # 35 6 -# 40 - - leu gly gly met arg val leu gly thr asn ty - # r gly gly thr lyshis 645 - # 650 - # 655 - - gly val phe thr asp cys glu gly gln leu th - # r asn asp phe phe val 660 - # 665 - # 670 - - asn leu thr asp met gly asn ser trp lys pr - # o val gly ser asn ala 675 - # 680 - # 685 - - tyr glu ile arg asp arg lys thr gly ala va - # l lys trp thr ala ser690 - # 695 - # 700 - - arg val asp leu val phe gly ser asn ser le - # u leu arg ser tyr ala 705 7 - # 10 7 - # 15 7 -# 20 - - glu val tyr ala gln asp asp asn gly glu ly - # s phe val arg aspphe 725 - # 730 - # 735 - - val ala ala trp thr lys val met asn ala as - # p arg phe asp val ala 740 - # 745 - # 750 - - ser - - - - ( 2 ) information for seq id no : 7 : - - ( i ) sequence characteristics : ( a ) length : 2238 nu - # cleotides - - ( b ) type : nucleic a - # cid - - ( c ) strandedness : sing - # le - - ( d ) topology : linear - - - - ( ii ) molecule type : dna - - ( xi ) sequence description : seq id no : - # 7 : - - atg gaa aat cac aaa cac tca gga tct tct ac - # g tat aac aca aac act 48 met glu asn his lys his ser gly ser ser th - # r tyr asn thr asn thr 5 - # 10 - # 15 - - ggc gga aaa tgc cct ttt acc gga ggt tcg ct - # t aag caa agt gca ggt 96 gly gly lys cys pro phe thr gly gly ser le - # u lys gln ser ala gly 20 - # 25 - # 30 - - ggc ggc acc aaa aac agg gat tgg tgg ccc aa - # c atg ctc aac ctc ggc144 gly gly thr lys asn arg asp trp trp pro as - # n met leu asn leu gly 35 - # 40 - # 45 - - atc tta cgc caa cat tca tcg cta tcg gac cc - # a aac gac ccg gat ttt192 ile leu arg gln his ser ser leu ser asp pr - # o asn asp pro asp phe50 - # 55 - # 60 - - gac tat gcc gaa gag ttt aag aag cta gat ct - # g gca gcg gtt aaa aag240 asp tyr ala glu glu phe lys lys leu asp le - # u ala ala val lys lys 65 - # 70 - # 75 - # 80 - - gac ctg gca gcg cta atg aca gat tca cag ga - # c tgg tgg cca gca gat288 asp leu ala ala leu met thr asp ser gln as - # p trp trp pro ala asp 85 - # 90 - # 95 - - tac ggt cat tat ggc ccc ttc ttt ata cgc at - # g gcg tgg cac agc gcc336 tyr gly his tyr gly pro phe phe ile arg me - # t ala trp his ser ala 100 - # 105 - # 110 - - ggc acc tac cgt atc ggt gat ggc cgt ggt gg - # c ggt ggc tcc ggc tca384 gly thr tyr arg ile gly asp gly arg gly gl - # y gly gly ser gly ser 115 - # 120 - # 125 - - cag cgc ttc gcg cct ctc aat agc tgg cca ga - # c aat gcc aat ctg gat432 gln arg phe ala pro leu asn ser trp pro as - # p asn ala asn leu asp130 - # 135 - # 140 - - aaa gca cgc ttg ctt ctt tgg ccc atc aaa ca - # a aaa tac ggt cga aaa480 lys ala arg leu leu leu trp pro ile lys gl - # n lys tyr gly arg lys 145 1 - # 50 1 - # 55 1 -# 60 - - atc tcc tgg gcg gat cta atg ata ctc aca gg - # a aac gta gct ctggaa 528 ile ser trp ala asp leu met ile leu thr gl - # y asn val ala leu glu 165 - # 170 - # 175 - - act atg ggc ttt aaa act ttt ggt ttt gca gg - # t ggc aga gca gat gta576 thr met gly phe lys thr phe gly phe ala gl - # y gly arg ala asp val 180 - # 185 - # 190 - - tgg gag cct gaa gaa gat gta tac tgg gga gc - # a gaa acc gaa tgg ctg624 trp glu pro glu glu asp val tyr trp gly al - # a glu thr glu trp leu 195 - # 200 - # 205 - - gga gac aag cgc tat gaa ggt gac cga gag ct - # c gaa aat ccc ctg gga672 gly asp lys arg tyr glu gly asp arg glu le - # u glu asn pro leu gly210 - # 215 - # 220 - - gcc gta caa atg gga ctc atc tat gta aac cc - # c gaa gga ccc aac ggc720 ala val gln met gly leu ile tyr val asn pr - # o glu gly pro asn gly 225 2 - # 30 2 - # 35 2 -# 40 - - aag cca gac cct atc gct gct gcg cgt gat at - # t cgt gag act tttggc 768 lys pro asp pro ile ala ala ala arg asp il - # e arg glu thr phe gly 245 - # 250 - # 255 - - cga atg gca atg aat gac gaa gaa acc gtg gc - # t ctc ata gcg ggt gga816 arg met ala met asn asp glu glu thr val al - # a leu ile ala gly gly 260 - # 265 - # 270 - - cac acc ttc gga aaa acc cat ggt gct gcc ga - # t gcg gag aaa tat gtg864 his thr phe gly lys thr his gly ala ala as - # p ala glu lys tyr val 275 - # 280 - # 285 - - ggc cga gag cct gcc gcc gca ggt att gaa ga - # a atg agc ctg ggg tgg912 gly arg glu pro ala ala ala gly ile glu gl - # u met ser leu gly trp290 - # 295 - # 300 - - aaa aac acc tac ggc acc gga cac ggt gcg ga - # t acc atc acc agt gga960 lys asn thr tyr gly thr gly his gly ala as - # p thr ile thr ser gly 305 3 - # 10 3 - # 15 3 -# 20 - - cta gaa ggc gcc tgg acc aag acc cct act ca - # a tgg agc aat aacttt 1008 leu glu gly ala trp thr lys thr pro thr gl - # n trp ser asn asn phe 325 - # 330 - # 335 - - ttt gaa aac ctc ttt ggt tac gag tgg gag ct - # t acc aaa agt cca gct 1056 phe glu asn leu phe gly tyr glu trp glu le - # u thr lys ser pro ala 340 - # 345 - # 350 - - gga gct tat cag tgg aaa cca aaa gac ggt gc - # c ggg gct ggc acc ata 1104 gly ala tyr gln trp lys pro lys asp gly al - # a gly ala gly thr ile 355 - # 360 - # 365 - - ccg gat gca cat gat ccc agc aag tcg cac gc - # t cca ttt atg ctc act 1152 pro asp ala his asp pro ser lys ser his al - # a pro phe met leu thr370 - # 375 - # 380 - - acg gac ctg gcg ctg cgc atg gac cct gat ta - # c gaa aaa att tct cga 1200 thr asp leu ala leu arg met asp pro asp ty - # r glu lys ile ser arg 385 3 - # 90 3 - # 95 4 -# 00 - - cgg tac tat gaa aac cct gat gag ttt gca ga - # t gct ttc gcg aaagca 1248 arg tyr tyr glu asn pro asp glu phe ala as - # p ala phe ala lys ala 405 - # 410 - # 415 - - tgg tac aaa ctg aca cac aga gat atg gga cc - # a aag gtg cgc tac ctg 1296 trp tyr lys leu thr his arg asp met gly pr - # o lys val arg tyr leu 420 - # 425 - # 430 - - gga cca gaa gtg cct cag gaa gac ctc atc tg - # g caa gac cct ata cca 1344 gly pro glu val pro gln glu asp leu ile tr - # p gln asp pro ile pro 435 - # 440 - # 445 - - gat gta agc cat cct ctt gta gac gaa aac ga - # t att gaa ggc cta aaa 1392 asp val ser his pro leu val asp glu asn as - # p ile glu gly leu lys450 - # 455 - # 460 - - gcc aaa atc ctg gaa tcg gga ctg acg gta ag - # c gag ctg gta agc acg 1440 ala lys ile leu glu ser gly leu thr val se - # r glu leu val ser thr 465 4 - # 70 4 - # 75 4 -# 80 - - gca tgg gct tct gca tct act ttt aga aac tc - # t gac aag cgc ggcggt 1488 ala trp ala ser ala ser thr phe arg asn se - # r asp lys arg gly gly 485 - # 490 - # 500 - - gcc aac ggt gca cgt ata cga ctg gcc cca ca - # a aaa gac tgg gaa gta 1536 ala asn gly ala arg ile arg leu ala pro gl - # n lys asp trp glu val 505 - # 510 - # 515 - - aac aac cct cag caa ctt gcc agg gta ctc aa - # a aca cta gaa ggt atc 1584 asn asn pro gln gln leu ala arg val leu ly - # s thr leu glu gly ile 520 - # 525 - # 530 - - cag gag gac ttt aac cag gcg caa tca gat aa - # c aaa gca gta tcg ttg 1632 gln glu asp phe asn gln ala gln ser asp as - # n lys ala val ser leu535 - # 540 - # 545 - - gcc gac ctg att gtg ctg gcc ggc tgt gcg gg - # t gta gaa aaa gct gca 1680 ala asp leu ile val leu ala gly cys ala gl - # y val glu lys ala ala 550 5 - # 55 5 - # 60 5 -# 65 - - aaa gat gct ggc cat gag gtg cag gtg cct tt - # c aac ccg gga cgagcg 1728 lys asp ala gly his glu val gln val pro ph - # e asn pro gly arg ala 570 - # 575 - # 580 - - gat gcc acc gct gag caa acc gat gtg gaa gc - # t ttc gaa gca cta gag 1776 asp ala thr ala glu gln thr asp val glu al - # a phe glu ala leu glu 585 - # 590 - # 595 - - cca gcg gct gac ggc ttt aga aac tac att aa - # a ccg gag cat aaa gta 1824 pro ala ala asp gly phe arg asn tyr ile ly - # s pro glu his lys val 600 - # 605 - # 610 - - tcc gct gag gaa atg ctc gta gac cgg gcg ca - # g ctt ctg tcg ctt tcg 1872 ser ala glu glu met leu val asp arg ala gl - # n leu leu ser leu ser615 - # 620 - # 625 - - gca cca gaa atg act gct ttg gta ggc ggt at - # g cgt gta ctg ggc acc 1920 ala pro glu met thr ala leu val gly gly me - # t arg val leu gly thr 630 6 - # 35 6 - # 40 6 -# 45 - - aac tac gac ggt tcg cag cat gga gtg ttt ac - # a aat aag ccg ggtcag 1968 asn tyr asp gly ser gln his gly val phe th - # r asn lys pro gly gln 650 - # 655 - # 660 - - cta tcc aat gac ttc ttt gta aac ctg cta ga - # c ctc aac act aaa tgg 2016 leu ser asn asp phe phe val asn leu leu as - # p leu asn thr lys trp 665 - # 670 - # 675 - - cga gcc agc gat gaa tca gac aaa gtt ttt ga - # a ggc aga gac ttc aaa 2064 arg ala ser asp glu ser asp lys val phe gl - # u gly arg asp phe lys 680 - # 685 - # 690 - - act ggc gaa gta aag tgg agt ggc acc cgg gt - # a gac ctg atc ttc gga 2112 thr gly glu val lys trp ser gly thr arg va - # l asp leu ile phe gly695 - # 700 - # 710 - - tcc aat tcc gag cta aga gcc ctc gca gaa gt - # g tac ggc tgt gca gat 2160 ser asn ser glu leu arg ala leu ala glu va - # l tyr gly cys ala asp 715 7 - # 20 7 - # 25 7 -# 30 - - tct gaa gaa aag ttt gtt aaa gat ttt gtg aa - # g gcc tgg gcc aaagta 2208 ser glu glu lys phe val lys asp phe val ly - # s ala trp ala lys val 735 - # 740 - # 745 - - atg gac ctg gac cgg ttt gat ctg aaa taa - # - # 2238 met asp leu asp arg phe asp leu lys 750 - # 755 - - - - ( 2 ) information for seq id no : 8 : - - ( i ) sequence characteristics : ( a ) length : 745 ami - # no acids - - ( b ) type : amino aci - # d - - ( d ) topology : linear - - - - ( ii ) molecule type : - - ( xi ) sequence description : seq id no : - # 8 : - - met glu asn his lys his ser gly ser ser th - # r tyr asn thr asn thr 5 - # 10 - # 15 - - gly gly lys cys pro phe thr gly gly ser le - # u lys gln ser ala gly 20 - # 25 - # 30 - - gly gly thr lys asn arg asp trp trp pro as - # n met leu asn leu gly 35 - # 40 - # 45 - - ile leu arg gln his ser ser leu ser asp pr - # o asn asp pro asp phe50 - # 55 - # 60 - - asp tyr ala glu glu phe lys lys leu asp le - # u ala ala val lys lys 65 - # 70 - # 75 - # 80 - - asp leu ala ala leu met thr asp ser gln as - # p trp trp pro ala asp 85 - # 90 - # 95 - - tyr gly his tyr gly pro phe phe ile arg me - # t ala trp his ser ala 100 - # 105 - # 110 - - gly thr tyr arg ile gly asp gly arg gly gl - # y gly gly ser gly ser 115 - # 120 - # 125 - - gln arg phe ala pro leu asn ser trp pro as - # p asn ala asn leu asp130 - # 135 - # 140 - - lys ala arg leu leu leu trp pro ile lys gl - # n lys tyr gly arg lys 145 1 - # 50 1 - # 55 1 -# 60 - - ile ser trp ala asp leu met ile leu thr gl - # y asn val ala leuglu 165 - # 170 - # 175 - - thr met gly phe lys thr phe gly phe ala gl - # y gly arg ala asp val 180 - # 185 - # 190 - - trp glu pro glu glu asp val tyr trp gly al - # a glu thr glu trp leu 195 - # 200 - # 205 - - gly asp lys arg tyr glu gly asp arg glu le - # u glu asn pro leu gly210 - # 215 - # 220 - - ala val gln met gly leu ile tyr val asn pr - # o glu gly pro asn gly 225 2 - # 30 2 - # 35 2 -# 40 - - lys pro asp pro ile ala ala ala arg asp il - # e arg glu thr phegly 245 - # 250 - # 255 - - arg met ala met asn asp glu glu thr val al - # a leu ile ala gly gly 260 - # 265 - # 270 - - his thr phe gly lys thr his gly ala ala as - # p ala glu lys tyr val 275 - # 280 - # 285 - - gly arg glu pro ala ala ala gly ile glu gl - # u met ser leu gly trp290 - # 295 - # 300 - - lys asn thr tyr gly thr gly his gly ala as - # p thr ile thr ser gly 305 3 - # 10 3 - # 15 3 -# 20 - - leu glu gly ala trp thr lys thr pro thr gl - # n trp ser asn asnphe 325 - # 330 - # 335 - - phe glu asn leu phe gly tyr glu trp glu le - # u thr lys ser pro ala 340 - # 345 - # 350 - - gly ala tyr gln trp lys pro lys asp gly al - # a gly ala gly thr ile 355 - # 360 - # 365 - - pro asp ala his asp pro ser lys ser his al - # a pro phe met leu thr370 - # 375 - # 380 - - thr asp leu ala leu arg met asp pro asp ty - # r glu lys ile ser arg 385 3 - # 90 3 - # 95 400 - - arg tyr tyr glu asn pro asp glu phe ala as - # p ala phe ala lys ala 405 - # 410 - # 415 - - trp tyr lys leu thr his arg asp met gly pr - # o lys val arg tyr leu 420 - # 425 - # 430 - - gly pro glu val pro gln glu asp leu ile tr - # p gln asp pro ile pro 435 - # 440 - # 445 - - asp val ser his pro leu val asp glu asn as - # p ile glu gly leu lys450 - # 455 - # 460 - - ala lys ile leu glu ser gly leu thr val se - # r glu leu val ser thr 465 4 - # 70 4 - # 75 4 -# 80 - - ala trp ala ser ala ser thr phe arg asn se - # r asp lys arg glygly 485 - # 490 - # 495 - - ala asn gly ala arg ile arg leu ala pro gl - # n lys asp trp glu val 500 - # 505 - # 510 - - asn asn pro gln gln leu ala arg val leu ly - # s thr leu glu gly ile 515 - # 520 - # 525 - - gln glu asp phe asn gln ala gln ser asp as - # n lys ala val ser leu530 - # 535 - # 540 - - ala asp leu ile val leu ala gly cys ala gl - # y val glu lys ala ala 545 5 - # 50 5 - # 55 5 -# 60 - - lys asp ala gly his glu val gln val pro ph - # e asn pro gly argala 565 - # 570 - # 575 - - asp ala thr ala glu gln thr asp val glu al - # a phe glu ala leu glu 580 - # 585 - # 590 - - pro ala ala asp gly phe arg asn tyr ile ly - # s pro glu his lys val 595 - # 600 - # 605 - - ser ala glu glu met leu val asp arg ala gl - # n leu leu ser leu ser610 - # 615 - # 620 - - ala pro glu met thr ala leu val gly gly me - # t arg val leu gly thr 625 6 - # 30 6 - # 35 6 -# 40 - - asn tyr asp gly ser gln his gly val phe th - # r asn lys pro glygln 645 - # 650 - # 655 - - leu ser asn asp phe phe val asn leu leu as - # p leu asn thr lys trp 660 - # 665 - # 670 - - arg ala ser asp glu ser asp lys val phe gl - # u gly arg asp phe lys 675 - # 680 - # 685 - - thr gly glu val lys trp ser gly thr arg va - # l asp leu ile phe gly690 - # 695 - # 700 - - ser asn ser glu leu arg ala leu ala glu va - # l tyr gly cys ala asp 705 7 - # 10 7 - # 15 7 -# 20 - - ser glu glu lys phe val lys asp phe val ly - # s ala trp ala lysval 725 - # 730 - # 735 - - met asp leu asp arg phe asp leu lys 740 - # 745__________________________________________________________________________ | 0 |
referring now to the drawing , reference numeral 10 designates a greenhouse containing agricultural products 12 that absorb carbon dioxide during daylight hours and produce water vapor . at night , products 12 are quiescent . associated with greenhouse 10 is apparatus 14 according to the present invention . apparatus 14 comprises direct - contact brine dehumidifier 16 to which concentrated brine is supplied by a conduit 18 from brine reservoir 20 , and from which diluted brine is obtained by conduit 22 . dehumidifier 16 comprises a felt pad or mate of jute material that provides a large surface area over which the concentrated brine is fed to form a thin film of brine exposed to the air . thus , dehumidifier 16 operates as a thin film , direct - contact heat exchanger as described below . duct 24 contained within greenhouse 10 , and within which brine dehumidifier 16 is located , provides means for recirculating air in the greenhouse through the dehumidifier . specifically , duct 24 contains fan 26 which draws humid air in the greenhouse through the dehumidifier and causes the air to pass through heat exchanger or radiator 28 before the air is reintroduced into the greenhouse . boiler 30 , associated with brine reservoir 20 is heated by fuel burned in burner 32 which is connected to source 34 of fuel . diluted brine from conduit 22 is pumped , or flows by gravity , through counter - flow heat exchanger 36 and enters boiler 30 where it is regenerated by being heated . the boiler concentrates the diluted brine by evaporating water therefrom producing steam . conduit 22 carries the steam to valve 40 which selectively directs the steam into radiator 28 ( if the greenhouse must be heated ), or into water tank 42 when the heat in the steam must be stored for use at a later time . boiler 30 thus concentrates the diluted brine ; and the concentrated brine passes through heat exchanger 36 into brine reservoir 20 . the hot , concentrated brine produced by the boiler is cooled in heat exchanger 36 before being delivered to brine reservoir 20 ; and heat extracted from the concentrated brine is transfered to the incoming diluted brine . preferably , the fuel burned in burner 32 is liquified petroleum gas or natural gas in order to limit the products of combustion to carbon dioxide and water vapor . the products of combustion produced by the burned fuel associated with burner 30 are piped by a ductwork 44 into greenhouse 10 such that the products of combustion , namely carbon dioxide and water , are transfered into the greenhouse . during daylight hours , when the agricultural products such as flowers or vegetables are growing , they actively absorb carbon dioxide in the air in the greenhouse . the active agricultural products also give off water vapor which adds to the water vapor introduced into the greenhouse by the products of combustion . in the absence of steps to the contrary , an almost saturated condition will result ; and the purpose of brine dehumidifier 16 is to dehumidify the air within the greenhouse . additionally , dehumidifier 16 serves to increase the temperature of the air in the greenhouse in a manner explained below . effectively , dehumidifier 16 is designed to maintain a humidity within the greenhouse at a level below 85 %, and preferably between 80 and 85 %. as explained below , the humidity of the air will be a function of the concentration of brine in the dehumidifier , the effective area of the brine dehumidifier and the mass flow therethrough . if it is desirable , steam from boiler 30 can be introduced into heat exchanger 28 for purposes of further increasing the temperature in the air and in the greenhouse , or valve 40 can be selectively operated to direct the steam into water tank 42 . at night , when excess carbon dioxide is not needed in the greenhouse , the operation of boiler 30 can be suspended ; and the heat stored in water tank 42 as a consequence of daytim operation of the boiler to produce carbon dioxide . alternatively , the steam produced by the boiler can be directed into a network of pipes buried in the ground beneath the greenhouse thus storing the heat in the ground . when the greenhouse is based on hydrophonic operation , the steam produced by the boiler can be used to heat the liquids that are used in the hydrophonic process . dehumidifier 16 may be conventional in sense that it is a direct contact heat exchanger in which concentrated brine is applied to a felt , jute or paper mat as a thin film . alternatively , the mat may be a capillary web through which the brine flows slowly . the vapor pressure of concentrated brine is small as compared with the saturated vapor pressure of water at the same temperature . when concentrated brine is exposed to the air in the greenhouse , water vapor in the air condensers on the brine . the latent heat of condensation supplied to the brine during condensation of water vapor heats the brine film ; and the heated brine transfers its heat to the air flowing over the brine . this is an isentropic process in which the temperature of the brine remains substantially constant as the air is warmed and dried in passing through the dehumidifier . if the temperature in the greenhouse during the day is 27 deg . c ., and if the brine temperature is about 30 deg . c . both entering and leaving the dehumidifier , a flow rate of about 1 . 5 cu . m per hour per 1 , 000 sq . m of a greenhouse would be required in order to maintain a rate of humidity of about 84 % within the greenhouse . this arrangement provides about about 200 kwh per 1 , 000 sq . m . of greenhouse area of heating during daylight hours assuming that the brine concentration changes from about 50 % concentration to about 30 % concentration within the dehumidifier . at night , the flow rate of the brine can be reduced to a level that just keeps the mat wet . this would provide additional dehumidification at night . to obtain the high concentration brine , calcium chloride is the preferred salt ; but other salts such as magnesium or mixtures of salts can be used . dead sea and brine can also be used . the fuel required to regenerate the brine and provide carbon dioxide during the day would be about 10 kg / 1 , 000 sq . m . of greenhouse area which will provide about 10 hours of operation per day . in some environments , the operation can be carried out only for 3 to 4 hours during the day because the temperature within the greenhouse will become excessive so far as the agricultural products are concerned . this requires either the shutdown of the system or the introduction of outside air into the greenhouse . to provide suitable control over the operation of the system shown in fig1 duct 44 may be provided with an adjustable butterfly valve 48 for controlling the rate in which the products of combustion are admitted into greenhouse 10 and a suitable valve ( not shown ) may be provided in duct 24 and in the greenhouse itself for purpose of controlling the flow air into the duct and into the greenhouse respectively . the present invention is also usable in drying agricultural product , such as tobacco . in such case , the products of combustion are discharged directly to the atmosphere bypassing the enclosure . the heat in the steam produced during regeneration of the brine can be saved and used for drying the agricultural products - or used by the consumer . for example , if the drier requires a temperature of 73 deg . c . and a humidity of 77 %, the dehumidifier can deliver air at 88 deg . c . with a humidity of 25 %. to achieve this , the temperature of the concentrated brine entering the dehumidifier should be about 92 deg . c . the vapor pressure of brine of density 1 . 5 at this temperature is only about 20 % of the vapor pressure of water at this temperature . an airflow rate of only about 1 kg / sec of air will remove vapor at the rate of 7 gm / sec or 15kw of heat . fig2 is an embodiment of the invention by which a brine dehumidifier according to the present invention is used to dehumidify the air in a greenhouse and to extract and store sensible heat from the air during the day , and to give back the sensible heat to the air during the night for the purpose of heating the greenhouse . in this embodiment , regeneration of the brine is achieved on an annual basis using solar energy rather than a boiler . reference numeral 50 designates a greenhouse containing agricultural products 52 that produce water vapor during the day as indicated previously . duct 54 contains brine dehumidifier 56 through which air in the greenhouse is recirculated by reason of the operation of fan 58 . dehumidifier 56 is similar to dehumidifier 16 in the sense that concentrated brine contained in a reservoir 60 is applied to the dehumidifier such that the brine and humid air come into direct contact . by reason of the hygroscopic nature of brine , water vapor in the air in the greenhouse condenses on the brine diluting the same . during daylight hours when the temperature within the greenhouse is some 10 deg . c . higher than the temperature at night , a considerable amount of sensible heat contained in the air in the greenhouse is absorbed by the brine which increases in temperature . at the same time , the brine also absorbs the latent heat of condensation of the water vapor contained in the air . for example , if the temperature within the greenhouse during the day is about 27 deg . c . and the brine temperature at the inlet is about 25 deg . c ., a 5 deg . c . increase in the brine temperature to about 30 deg . c . can occur . with a flow rate of about 30 cu . m ./ h per 1 , 000 sp . m . of greenhouse area , about 1 , 200 kwh of heat will be removed from the air and stored in the brine . the heated , diluted brine is delivered to reservoir 60 . at night , when the temperature of the greenhouse drops by about 10 deg . c ., the temperature of the concentrated brine entering the dehumidifier will be about 30 deg . c . ; and in this case , the sensible heat from the brine is transfered to the air which is thus heated . about 5 deg . c . temperature drop of the brine will occur ; and diluted brine , at about 25 deg . c . is delivered to reservoir 60 . thus , at night , the brine will give up about the same amount of heat as was absorbed during the day . during the beginning of the winter season , the concentration of the brine may be about 50 %. after the winter season it would be diluted to about 30 %. this difference in salinity represents the latent heat of condensation made available for heating during nights of the winter ; and this heat must be restored to the brine in order to regenerate it . regeneration is achieved during the summer . reservoir 60 acts as an evaporator wherein the water vapor accumulated during the winter evaporates thereby concentrating the brine . the advantages and improved results furnished by the methods and apparatus of the present invention are apparent from the foregoing description of the various embodiments of the invention . various changes and modifications may be made without parting from the spirit and scope of the invention as described in the claims that follow . | 0 |
referring to fig1 a computer system 100 is shown which runs a system for creating an operating system independent environment for executing utility programs including a program for preserving the life span of a hard disk drive in a power managed computer . the computer system 100 , most appropriately a portable or laptop personal computer with respect to the power - managed aspects of the disclosed system , includes a processor 110 , a system rom 122 , a cache 124 , a memory controller 126 , a cmos clock nonvolatile ram 160 , and a system controller i / o trap 132 . these system components communicate via a cpu bus 128 which includes data , address and control lines . the memory controller 126 is also connected to a system random access memory ( ram ) 120 . the system controller i / o trap 132 interfaces the cpu bus 128 to a local bus 150 . the local bus 150 is connected to an i / o controller 134 which is connected to a hard disk drive 130 and various other input / output devices 140 . the cmos clock nonvolatile ram 160 , which is connected to the processor 110 via the cpu bus 128 , is typically utilized to store information even when power to the computer system 100 is interrupted . program instructions that make up the system for creating an operating system independent environment and utility programs including the program for preserving the life span of a hard disk drive in a power managed computer are stored in a storage device such as the hard disk drive 130 or the system rom 122 . the processor 110 , for example an x86 processor such as a 486 , pentium or pentiumpro processor , executes the computing operations of the computer system 100 . the processor 110 is connected to the system ram 120 via the memory controller 126 and the cpu bus 128 . the system controller i / o trap 132 connects the cpu bus 128 to the local bus 150 and is generally characterized as part of a system controller such as a pico power vesuvius or an intel ™ mobile triton chip set . system controller i / o trap 132 is programmed in a well - known manner to intercept a particular target address or address range , and , upon intercepting a target address , the system controller i / o trap 132 asserts an intercept signal indicating that processor 110 attempted to access the target address . the intercept signal is connected to an smi (&# 34 ; system management interrupt &# 34 ;) pin of the processor 110 to cause the processor 110 to enter a system management mode (&# 34 ; smm &# 34 ;). the hard disk drive 130 may be a permanent drive or a removable hard drive . similarly , the other input / output devices 140 may include one or more additional hard drives which may be permanent or removable drives . a removable drive configuration allows multiple users , each having an individual program and data base , to operate the computer system 100 . the removable drive configuration is also useful for allowing a single user to effectively increase the hard drive capacity of the computer system 100 . various types of hard drives , all of which are well known in the computer system arts , may be utilized for the hard disk drive 130 and the other input / output devices 140 , although small computer systems interface ( scsi ) and integrated drive electronics ( ide ) drives are exemplary of a useful type of drive . each scsi and advanced ide drive encodes unique drive identification information including a unique manufacturer identification number and a drive serial number which are advantageous , but not essential , to the operation of the program for preserving the life span of a hard disk drive in a power managed computer . the unique identification information is useful in some configurations of the program for specifically identifying the hard drive , monitoring the activity of that drive , and thereby preserving the life span of the drive . referring to fig2 a memory map 200 of a computer system shows a program memory 210 having a starting address of 0000h , a video memory 212 with a starting address of 0a00h and a bios memory 214 located at addresses 0f000h to 0ffffh . a basic input output system ( bios ) is the part of an operating system that customizes the operating system to a specific computer . the bios forms the lowest - level interface to common devices such as a system clock , hard disk and display , for example . in one mode of operation , the program code in the bios 214 operates by transferring operation identifiers and parameters to the cmos memory 160 and performing an input / output instruction that evokes a smi # signal . the smi # signal is a signal for activating a system management mode ( smm ) of operating . the system management mode ( smm ) software performs various control functions including power management functions under user control or system control . when a processor 110 recognizes a smi # signal on an instruction boundary , the processor 110 waits for all store operations to complete . the processor 110 then saves the processor register state to a region in memory called a system management ram ( smram ) space and begins to execute a smm handler routine . the smi # interrupt has a greater priority than debug exceptions and external interrupts so that smm processing preempts debug and external interrupt conditions . subsequent smi # and nonmaskable interrupt ( nmi ) requests are not acknowledged while the processor is operating in system management mode . system management mode ( smm ) processing is conventionally performed by a technique in which software routines write a defined pattern or code to a specific defined smi input / output i / o location . a pattern is defined to be suitably complex that an incorrect and unsuitable pattern is not inadvertently set . generally , the patterns encode a sufficient amount of operational information that this level of complexity is easily achieved . advantageously , the pattern coding is sufficiently specific to the precise bios operations invoked that the security of a secured operating system is not compromised while useful functions are allowed to operate which would otherwise be prohibited by the operating system . the writing of this pattern to the smi i / o location generates an smi # signal , evoking a system management mode interrupt . in &# 34 ; secured &# 34 ; operating systems such as windows nt ™, direct write operations to the smm i / o location are prohibited . this prohibition is enforced by the operating system which intercepts and emulates the i / o call . the operating system typically diverts the i / o instruction and information accompanying the instruction to an unknown location , fails to evoke the smi # interrupt or smm routine , and returns a failure code , perhaps informing that the addressed i / o location does not exist . thus , if an attempt is made to read data from the smm i / o location , a code is returned that apparently is an &# 34 ; empty bus notification &# 34 ; error code ( offh ). referring to fig3 a pictorial illustration of a memory map shows a logical structure of a system management mode ( smm ) ram . the processor 110 begins operating in smm upon receipt of an active signal is received on the smi # interrupt . the processor terminates smm operation only when software executes an explicit resume from system management mode ( rsm ) instruction . for smm , ram chips are intended to be mapped into the address space of system ram 120 between 30000h and 3ffffh . generally , smm ram 300 is mapped onto the system ram 120 as shown in fig3 . the lower 32 kbytes 310 between addresses 30000h and 37fffh are optional . address 3000 : 8000h is the address entry point of an smm handler which the processor 110 accesses upon receipt of every smi # interrupt . the 32 kbytes 312 between 3000 : 8000h and 3000 : fdffh are available for the program code and data used by an smi handler routine . these routines are well known in the art and include , for example , routines for saving the contents of memory to disk or for deactivating individual i / o devices 140 . the processor 110 also accesses addresses outside the 64 kbyte smm ram so that data outside the smm ram 300 are accessible while operating in smm . a cpu register dump 314 is adjacent to the smm program code and data memory 312 and includes 512 bytes . when the smi # interrupt is activated and smm begins operation , the processor 110 automatically , through operation of processor microcode rather than operating system software instructions , stores the cpu register dump 314 contents that are used for restoring the processor condition prior to the interrupt . thus , following an rsm instruction , the processor 110 continues functioning under the conditions at the point of the smi # occurrence . table i shows the organization of the register dump in smm ram . offsets are shown relative to the segment 3000h . table i______________________________________offset register offset register______________________________________fffch cr0 ffc4h trfff8h cr3 ffc0h ldtrfff4h eflag ffbch gsfff0h eip ffb8h fsffech edi ffb4h dsffe8h esi ffb0h ssffe4h ebp ffach csffe0h esp ffa8h esffdch ebx ff04h - reserved ffa7hffd8h edx ff02h halt auto restartffd4h ecx ff00h i / o trap restartffd0h eax fffch smm identificationffcch dr6 fef8h register dump baseffc8h dr7 fe00h - reserved fef7h______________________________________ in addition to the saved registers , the register dump also includes four control fields , specifically a halt auto reset ( offset ff02h ), a i / o trap restart ( offset ff00h ), an smm identification ( offset fefch ), and a register dump base ( offset fef8h ). the smm may be set up so that the smi # interrupts an i / o instruction . in particular , the smm may be set up so that an i / o instruction to a particular device , such as the hard disk drive 130 , generates an smi # interrupt . for example , by writing a value of ffffh into the i / o trap restart address ( offset ff00h ), the processor 110 executes the interrupted i / o instruction after a return from the smm interrupt service routine takes place through an rsm instruction . in this manner , one technique for i / o port trapping is achieved . the entry smm identification ( offset fefch ) indicates the revision level and the functional capabilities of the implemented smm . referring to fig4 a flow chart depicts a system management mode ( smm ) i / o disk control routine 400 which is activated by a system management interrupt ( smi #) and includes trapping of i / o accesses such as hard disk i / o accesses . in a smm setup step 410 , entry into the snm is controlled so that the interrupt ( smi ) is generated in response to an i / o request directed to a particular range of i / o addresses . an i / o calling program that controls disk i / o operations determines all of the parameters to be applied to a hardware disk controller to control the i / o functions . one of the parameters that is initialized is an smm timer which determines the elapsed time from the most recent hard disk access . for example , the timer is set to allow the smm to spin down the disk and thereby conserve energy and battery life . after all of the parameters are determined , in i / o request step 412 the i / o calling program issues a disk i / o command by writing the command to the hardware disk controller . after the disk i / o command is written , in wait step 414 the i / o calling program operation is suspended awaiting an smi trap event . when the smi trap event 416 occurs , the processor saves the current register state to system management ram ( smram ) space and begins to execute the smm handler . a smi servicing routine 420 reads from the hardware disk controller all of the parameters resulting from disk i / o operations . the smi trap handler 422 directs a drive i / o request to the proper location of the hard disk drive 130 , starts the drive and then exits out of the system management mode with the rsm ( return from system management mode ) instruction , allowing the virtual i / o operations to continue . referring to fig5 a flow chart shows actions performed by an smm routine controlling hard disk drive i / o operations in response to an illustrative sequence of events . in event 510 , the hard disk drive is accessed by the smm subsequent to i / o trapping of an instruction in program code such as , but not limited to , various read , write , write and verify , and seek instructions targeting data blocks , multiple blocks , blocks with error check and error correction ( ecc ) bytes and the like . the hard drive access is executed under control of the smm and sets the parameters applied to the disk control operation . the smm checks a hard disk power down enable flag ( not shown ) and if powering down of the hard disk is enabled , the timer of the elapsed interval from the most recent hard disk access is initialized to a predetermined value . for example the timer may be initialized to time fifteen seconds and invoke an smi # interrupt at the conclusion of the fifteen second interval . in this manner , the power management routines in the smm are ignored as a call to deactivate the drive essentially reports that the drive is deactivated but simply fails to actually deactivate the drive . in this example , the timer elapses by virtue of a time - out of the fifteen second interval , invoking the smi # interrupt event 512 . the smi # interrupt activates the smm in event 514 . the smm routine executes in event 516 in which the smm deactivates the hard drive and enables an smi # interrupt for performing i / o trapping of program code requesting a hard disk access . the smm performs an instruction such as an scsi start / stop instruction ( scsi command code 1bh ) which instructs a designated disk drive to move heads out of transport position and switch off a spindle motor ( not shown ) of the hard disk drive . the disk drive spins down in response to the start / stop command . in event 518 , a program call requesting a hard disk access occurs after a variable time interval and the hard disk i / o request is trapped using smm i / o trapping and an smi # interrupt occurs as event 520 . in response to the smi # i / o trapping interrupt 520 , the smm is activated in event 522 . the smm activates the hard disk drive in event 524 by executing , for example , a program 600 for preserving the life span of a hard disk drive . referring to fig6 a flow chart illustrates steps of the program 600 for preserving the life span of a hard disk drive which receives a request to activate the disk drive in step 610 . in activate hard drive step 612 , the smm activates the hard drive using the start / stop instruction ( scsi command code 1bh ) which sends a code to the hard drive to instruct the designated disk drive to move heads into the transport position and switch on a spindle motor ( not shown ) of the hard disk drive , thereby causing the disk drive to spin up . in step 614 , the program 600 for preserving the life span of a hard disk drive then increments a counter which accumulates the number of times the drive has been activated . the counter is located in different storages or memories in different embodiments or in different alternative pathways of the program 600 . logical blocks 616 and 618 implement a case statement classifying the hard drive into different classes according to the number of times the drive has been activated or spun up . logical block 616 compares the accumulated count to a first predetermined number of activations which is indicative of a &# 34 ; young &# 34 ; drive . if the hard drive is older than the young age , logical block 618 compares the accumulated count to a first predetermined number of activations which is indicative of an &# 34 ; intermediate age &# 34 ; drive . for a young hard drive , a young timer select block 620 sets a timer value that is selected by a user , the operating system or a combination of the user and operating system . the timer value is selected with a primary purpose of conserving energy and increasing the battery lifetime before recharging is required . for example , a fifteen second interval may be instituted as a time limit for an idle drive to be deactivated . for an intermediate age drive , an intermediate timer select block 622 sets a timer value that is dependent upon the age of the hard drive . typically a range of timer values are hard - coded into the software , selected by a user , selected by the operating system or selected by a combination of the user and operating system . the timer value is set with a primary purpose of conserving the life span of the hard drive and to prevent loss of data due to a hard drive failure . a particular timer value in the range of timer values is selected on the basis of the count of hard drive activations . for example , the interval may range from a thirty second interval to an interval on the order of hours in accordance with an advancing age of a hard drive . in some embodiments , information in addition to the count of hard drive activations may be taken into account in determining the spin down time interval . for example , a measure based on the number of hard drive i / o errors may also be considered . upon completion of either the young timer select block 620 or the intermediate timer select block 622 , a set timer step 624 sets an smm timer for timing out upon exceeding a preset elapsed interval from the most recent hard disk access . for a hard drive that is older than the intermediate age , old hard drive selection block 626 sets the hard disk power down enable flag which indicates that the hard drive is not to be deactivated through operation of the program 600 for preserving the life span of a hard disk drive . step 614 of the program 600 for preserving the life span of a hard disk drive accumulates a count of the number of times the drive has been activated . the counter is located in different storages or memories in different embodiments or in different alternative pathways of the program 600 . one exemplary storage location is a nonvolatile memory in the computer system 100 , such as the cmos ram 160 . a routine 700 for incrementing the counter stored in a nonvolatile memory in the computer system 100 is depicted in fig7 . in step 702 , the increment counter routine 700 reads the hard disk drive serial number from the hard disk drive 130 using a command such as the scsi inquiry command ( command code 12h ). the inquiry command transfers parameters of a target i / o device to the calling routine in a data - in phase . the inquiry parameters include a five byte header and additional information such as a manufacturer code , a model number , a revision or version number and a serial number . the target i / o device aborts the data - in phase when all parameters are transferred . the additional information is defined according to the type of device and the manufacturer specifications . in step 704 , the smm finds a matching serial number stored in the nonvolatile memory so that a correct counter in the nonvolatile memory is incremented . if the hard drive serial number does not match a serial number stored in the nonvolatile memory , a new storage cell in the nonvolatile memory is allocated to hold the new hard drive serial number and associated counter and the counter is set to a count of one . in read counter step 706 , smm reads the counter identified by the serial number read from the hard disk . in increment step 708 , the counter is incremented by one . in write count step 710 , the smm writes the incremented count back to the nonvolatile memory storage . one disadvantage of the routine 700 for incrementing the counter stored in a nonvolatile memory in the computer system 100 is that a removable disk operating on a different computer system will not have the power cycle count incremented so that the age data will not be accurate . a second exemplary storage location , which avoids this disadvantage , is a storage location on the medium of the hard disk drive 130 . for example , the count value may be stored within a utility area , such as a suspend - to - disk partition of the hard disk drive medium . the suspend - to - disk partition is used to store program code and data from the processor memory to the hard disk drive 130 , typically during a power interruption of the processor 110 . the operation of the processor 110 with respect to the suspend - to - disk partition is discussed in more detail in u . s . patent application ( attorney docket number m - 3442 us ) entitled &# 34 ; an operating system independent system for running utility programs in a defined environment &# 34 ;, invented by j . pearce et al , which is hereby incorporated by reference into the present application in its entirety . a routine 720 for incrementing the counter stored on the hard drive medium is shown in fig8 . in step 722 , the increment counter routine 720 reads a counter location storage on the hard disk medium using a command such as the scsi block read command ( command code 08h ). the read command instructs the target i / o device to read one or more blocks from the drive and to transfer the data in a data - in phase to the calling routine . in increment step 724 , the smm increments the counter by one . in write count step 726 , the smm writes the incremented count back to the counter location storage on the hard disk medium using a command such as the scsi block write command ( command code 0ah ). the write command instructs the target i / o device to receive one or more blocks from the calling routine in a data - out phase and writing the blocks to the medium . an advantage of the routine 720 for incrementing the counter stored on the hard drive medium is that the counter is incremented on a removable disk drive that operates in any computer system which implements the program 600 for preserving the life span of a hard disk drive . a third exemplary storage location is a storage within the hard disk drive 130 . in this example , the hard disk drive includes a storage such as a register for receiving special information . a routine 740 for incrementing the counter stored on the hard drive medium is shown in fig9 . in step 742 , the increment counter routine 740 reads a counter register on the hard disk using a special read from register command . in increment step 744 , the snm increments the counter by one . in write count step 746 , the smm writes the incremented count back to the hard disk register using a special write to register command . alternatively , the hard disk drive may include a counter and microcode that controls the counter to automatically increment whenever the power to the hard disk drive is activated . this hard drive is initiated to a zero count at the time of manufacture . a routine 760 for reading the counter is substituted for the increment counter step 614 of the program 600 for preserving the life span of a hard disk drive . the routine 760 for reading an automatically incrementing counter register is shown in fig1 . in step 762 , the read counter routine 760 reads the counter storage from the hard disk using a special read from register command . in store count step 764 , the smm stores the count in local storage for subsequent use . while the invention has been described with reference to various embodiments , it will be understood that these embodiments are illustrative and that the scope of the invention is not limited to them . many variations , modifications , additions and improvements of the embodiments described are possible . for example , the embodiments are described as systems which utilize the system management mode ( smm ) and bios to implement the power management functionality and the utility program for preserving the life span of a disk drive . in other embodiments , the system for preserving the life of a hard disk drive is implemented without invoking smm . also in other embodiments , the smm may operate without the bios to implement these functions . similarly , the bios alone may include program code attaining this functionality . in still other embodiments , other operating system or application routines may be used as a framework for performing these functions . in other embodiments , the number of hard drive age classifications , shown in the illustrative example to be three , may be increased or reduced and different actions may be taken in response to a particular classification . for example , some hard drive age classes may evoke a display on the screen indicative of a particular drive condition . | 8 |
referring to fig1 and 2 , one embodiment of a pipe joint is illustrated as being formed by mating bell and spigot portions . a bell portion 10 is connected to an end 12 of a polyethylene pipe 14 with reinforced , helically extending ribs 16 having a steel reinforcement strip 18 encased within rib sidewalls 20 , 22 and a rib cap 24 . the bell portion 10 is also formed of polyethylene material and includes an attachment part 30 with an outer surface 32 engaging the inner surface 34 of the pipe end 12 and a weld seal 35 , again of polyethylene , formed between the two . the bell part of the bell portion is formed by a radially outward extending wall 36 , a generally l - shaped transition 38 , a cylindrical part 40 and a frusto - conical part 42 . the cylindrical part 40 includes an encapsulated steel reinforcement band 44 and a number of annular strengthening ribs 46 a - 46 d located between the reinforcement and the frusto - conical part 42 . the spigot portion 50 is connected to an end 52 of a pipe 54 that is similar in configuration to pipe 14 . the spigot portion is also formed of polyethylene material and includes a connection part 56 with an outer surface 58 engaged with an inner surface 60 of pipe end 52 and a weld seal 62 , again of polyethylene , formed between the two . the outer surface of the spigot portion 50 includes spaced apart , solid pe ribs 64 , 66 of similar size with a smaller rib 68 positioned therebetween . a gasket 70 is located between the ribs and includes a lower slotted portion 72 that receives the smaller rib 68 . the spigot portion further includes an encapsulated steel reinforcement band 74 with an axial width that extends roughly from side 76 of rib 66 to side 78 of smaller rib 68 . in one embodiment , the bell portion 10 and spigot portion 50 may be formed together ( e . g ., via extrusion or molding ) with end portion 90 of the bell portion connected to end portion 92 of the spigot portion . in the case of extrusion , the two pieces can be separated either before or after being curved into a cylinder form . in the case of molding , the two pieces can be separated prior to attachment to respective pipe end portions . in another embodiment , the bell portion 10 and spigot portion 50 can be formed separately ( e . g ., each being extruded separately or molded separately ). in the latter case , the leg of the attachment part 30 of the bell portion may be formed as part of the profile extrusion , or the initial bell profile extrusion may lack the leg portion , which would be attached later as described below . considering an embodiment which the pieces are extruded separately . the bell portion is initially extruded as an elongate strip having the cross - section of the bell part ( i . e ., not including the pipe 14 ) of fig1 a , but with the steel reinforcement 44 not present . in this case , the layer of pe material 94 may be formed as a flap with one end 96 attached and another end 98 unattached enabling the flap to be opened . the open end of the flap faces away from the bell end . the elongate strip is then cut to length suitable for forming a bell portion of desired diameter . the cut strip is then rolled to appropriate diameter with suitable roll bending equipment such as that represented in fig3 . a preformed metal reinforcement ring of desired diameter is then placed within the space under the flap 94 ( e . g ., per the directional arrows 99 of fig4 a and 4b ), with the elongate strip 44 having been sized to result in a slight gap 100 at adjacent ends of the rolled strip ( e . g ., between ¼ ″ and 1 ″ or so ), to form a gapped bell structure 102 . as shown , the metal reinforcement strip 44 is a full cylinder and traverses the gap 100 of this structure . typically the metal reinforcement ( e . g ., steel ) may be a preformed , sized continuous cylinder ( e . g ., created by bending an elongate steel plate into a cylinder shape and joining the adjacent ends of the steel plate by butt welding , fasteners , crimping or other suitable means ). the gapped bell structure 102 is then placed in an overmold fixture and the plastic cylinder of the bell is completed via an overmold process ( e . g ., using the same material as the strip , preferably pe ) that fills the gap 102 with plastic in the same profile as the rest of the unit . at this point the flap 94 remains largely unsealed , though in the gap region 102 the reinforcement may be completely encased . referring to fig5 a , 5 b and 5 c an overmold assembly 120 is shown in isometric , side and front views , with the bell structure in place for overmolding , but with the exterior 122 and interior 124 overmold components in open position . the interior overmold component 124 is moved downward to close the assembly over the bell and then the plastic is injected for molding . once overmolding of the gap 100 is completed , the structure is placed in an extruder fixture that utilizes one or more nozzles to form a weld seal at end 98 of the flap while the bell structure is rotated past the nozzle of the fixture . full sealing of the flap results in a completed bell unit in which the steel reinforcement 44 is completely encased within the plastic of the bell wall . where the bell profile is initially formed lacking the leg of the attachment part 30 , the leg can be attached using a weld seal in the same fixture and step while the flap is being sealed . referring to fig6 a , 6 b and 6 c an extruder assembly 130 is shown in isometric to and side views , and includes a table / fixture 132 that supports and rotates the bell through a rotation assembly 134 mounted thereon . as shown , the table can be utilized to support and rotate multiple different diameters of bells or spigots for flap sealing . an extrusion system 136 is mounted alongside the fixture with nozzles positioned and oriented to seal the flap . a control unit 138 is provided for automatically controlling the operation of the extruder . it is recognized that the flap could also be sealed by a heat welding process . for example , heat welding could be achieved by initially forming the free end of the flap ( or a corresponding segment of the main bell body ) with a bead ( or other formation ) of sufficient plastic that could be melted ( e . g ., by a heater ) to bond the flap to the free end of the flap to rest of the bell . the completed bell unit can then be attached to a pipe . in this regard , referring back to fig1 a , the smaller diameter attachment part 30 of the bell unit is inserted within a pipe end and a suitable attachment fixture with nozzles may be used to form the weld seal 35 . in another embodiment ultrasonic or friction welding could be used to form the weld seal 35 . in the case of a bell profile that is molded rather than extruded , the initial molding may take the form of a complete cylinder ( i . e ., no gap ) of desired diameter with the flap 94 again having a free end . the reinforcement is inserted beneath the flap and the process proceeds in much the same manner described above using the co - extruder fixture and then attaching to a pipe end . the spigot portion may be formed in much the same way as the bell portion , using either extrusion or molding to form the profile with the rib 66 defining the end of an unsealed flap for receiving the reinforcement 74 . attachment of the spigot to the pipe end can also be completed in the same manner as with the bell portion . as a general rule , each length of pipe for a pipe system will be formed with one end having a bell portion 10 attached and the opposite end having a spigot portion 50 attached . multiple pipe lengths can then be connected end to end during a given installation , with spigot portions inserted into bell portions to provide a sealed connection . positioning sized cylindrical metal reinforcements within the wall of both the spigot portion and the bell portion in the region of the gasket aids in maintaining a desirable seal . the exact thickness and size of the various parts of any bell portion or spigot portion can be varied depending upon the structural requirements and intended diameter usage . a distinct profile could be provided for each pipe diameter . a single profile could be used for multiple diameters or diameters within a certain specified range . as noted above , the exact profile and dimensions of bell and spigot portions could vary . however , applicant has found the following exemplary dimensions ( provided in ranges in tables i and ii below ) to be both practical and advantageous . referring now to fig8 , an alternative embodiment of a pipe joint bell 200 is illustrated in partial cross - section . the bell 200 could be utilized in conjunction with the spigot structure of fig1 b , or another suitable spigot structure . bell 200 includes a frusto - conical end part 202 , a main cylindrical part 204 and a reduced diameter pipe connecting part 206 . cylindrical part 204 includes raised solid ribs 208 and 210 between which a steel , or other material , reinforcement ring 212 is placed , and an annular plastic strip 214 encases the steel ring 212 within the bell wall . to produce the bell of this embodiment , a primary bell portion , consisting of end part 202 at one end , main part 204 with external ribs 208 , 210 and downwardly projecting flange or leg 216 , is extruded together as an elongated strip . the extruded strip is then cut to length suitable for forming a bell portion of desired diameter . the cut strip is then rolled to the proper diameter . the rolled strip is then either overmolded or butt fused to form a completed ring . a metal reinforcement ring is then placed over the outer portion of the bell between the ribs 208 and 210 . in this regard , the metal reinforcement ring may be placed by initially wrapping a steel band and then butt welding the ends of the steel band to complete the reinforcement ring . the plastic ring 214 is then placed over the reinforcement , with side edges of the plastic ring sitting atop land areas of the ribs 208 , 210 . the plastic ring 214 may be preformed into a cylinder of desired diameter before placing it on the bell ring . a co - extrusion process is then used to seal the plastic ring to the ribs 208 , 210 , with a weld bead applied at locations 218 and 220 , completing the encasement of the reinforcement ring 214 . in order to connect the primary bell portion to a pipe , a secondary bell portion ( e . g ., the connecting part 206 ) is initially formed separately from the primary bell portion . in one implementation , the secondary part 206 is formed from the same extruded strip as that used for the spigot . the strip is cut to length and rolled to diameter and then either overmolded or butt - welded to form a complete cylinder . the unsealed end of the flap that would normally receive the spigot reinforcement is welded closed using an extrusion weld or heat weld , which could occur before or after the cylinder formation , eliminating the flap . the connecting part 206 , now formed as a separate ring structure , is then inserted within the end 230 of a pipe 232 . the connecting part 206 is tack welded in place to the pipe end ( e . g ., at the location 234 where rib 66 abuts the pipe end ). the formed primary bell portion is then placed over the connecting part 206 to position the leg 216 in the space between ribs 64 and 68 . in this regard , the primary bell portion may be angled to move the primary bell portion onto the end of the connecting part 206 , the upper part of the leg 216 placed between the ribs 64 and 68 and the lower part of the primary bell portion then allowed to drop downward and onto the end of the connecting part . centering spacers are then inserted into the annular space 236 between the radially exterior end of rib 64 and the radially inner surface of cylindrical part 204 . once the proper uniform spacing is achieved , the primary bell portion is tacked in place to the connecting part 206 ( e . g ., at the location 238 where rib 68 abuts against leg 216 ). the connecting part 206 is then permanently welded to the pipe end ( e . g ., by placing a continuous internal plastic weld bead or seal at the location 240 where the inside end of the connecting part 206 meets the inner surface of the pipe end 230 ). the centering spacers are removed and then the primary bell portion is permanently welded to the connecting part 206 ( e . g ., by placing a continuous internal plastic weld bead or seal within the annular space 236 . as shown in fig8 , the inside surface of the plastic ring 214 is spaced away from the external surface of the reinforcement ring . the purpose of providing this spacing is to account for the differing rates of thermal shrinkage as between the plastic ( e . g ., polyethylene ) and the metal reinforcement ( e . g ., steel ). in this regard , at colder temperatures the shrinkage rate of the plastic can be 10 times that of the steel and providing the spacing prevents the plastic ring 214 from shrinking so much that it wraps too tightly upon the steal reinforcement and ruptures or breaks . in one embodiment , the radial height h1 of the ribs 208 and 210 may be at least three times the radial thickness t1 of the reinforcement 214 . for example , reinforcement having a thickness of 40 - 75 thousands of an inch may be used in conjunction with ribs having a height of 150 to 250 thousands of an inch . in such case the radial thickness of the gap between the reinforcement and the plastic ring would generally be at least 1oo thousandths of an inch . referring now to fig9 and table iii below , the following exemplary dimensions have been found to be both practical and advantageous for the bell structure of fig8 . it is to be clearly understood that the above description is intended by way of illustration and example only and is not intended to be taken by way of limitation , and that changes and modifications are possible . for example , while fig8 illustrates one embodiment of a multi - piece bell structure , it is recognized that alternatives are possible , such as those shown in fig1 and 11 that do not rely upon the use of the spigot extrusion to form the connecting parts 206 ′ and 206 ″ of the bell . accordingly , other embodiments are contemplated and modifications and changes could be made without departing from the scope of this application . | 1 |
referring now to fig1 through 7 , there is shown a cartridge unloading device mounted on a first base 14 and a second base 16 . a barrel 18 is mounted on uprights 20 on base 14 , and upright 22 on base 16 . the barrel has a smooth bore 24 which is just sufficient in size to allow passage of the largest dimension of a cartridge to be disassembled . this relationship is clearly shown in fig3 through 5 . the barrel has a breech 26 which is sufficiently long to allow a cartridge to pass into the breech . behind the breech is a piston - like member 28 which is hollow and connected to a source of gas through tube 30 . the forward part of the piston 28 is provided with a sealing o ring 32 . at the opposite end the piston rod is pivoted to arm 34 which is connected to crank 36 actuated by motor 38 . motor 38 also carries cams 40 , 42 and 44 which operate switches 46 and which are connected by cable 48 to air valves ( not shown ) within the base 14 . compressed air is supplied to the valves through line 47 . mounted adjacent to the breech 26 is a magazine 58 adapted to hold a number of rounds 60 which are to be disassembled . feeder 62 , actuated by pneumatic cylinder 64 from air hose 66 , causes the rounds to be fed into the breech 26 one at a time . near the discharge end of barrel 18 , balls 68 have leaf springs 70 which tend to push the balls partway into the bore 24 . the function of these will be later explained . beyond the balls 68 is a chamfered shoulder 72 . the bore 74 beyond the shoulder is of reduced diameter . the barrel is open at 76 and air injection ports 78 are provided near the open end which are connected by means of tubing 80 to the air control valves in base 14 . the dimension of the reduced portion 74 corresponds with the body diameter 82 of a cartridge . member 22 serves as a support for the end of the barrel 18 , at the open end 76 and beyond this open end is a heavy steel plate 84 which serves as a safety precaution in the rare instance of a shell exploding . mounted below the opening 76 is a coarse screen 86 which leads to a closed chamber 88 having an access door 90 . the base 16 has a compartment 92 for receiving empty casings and a similar bin 94 for receiving extracted projectiles . rubber cushion 87 prevents damage to the extracted projectile . the overall operation of the device can now be described . as the motor rotates , crank 34 draws piston 28 to its extreme &# 34 ; out &# 34 ; position and cam 40 , acting through switch 46 , causes a pulse of air in line 66 which actuates cylinder 64 , allowing a single round to fall through the breech 26 . as the motor turns , piston 28 forces the cartridge beyond the breech and the sealing ring 32 seals the end of the barrel 18 . at this point , cam 42 causes a pulse of air through line 30 which causes the round 60 to be propelled through the barrel at a high rate of speed . as can be seen in fig3 the front end of the round is not supported so that it moves through the smooth bore at somewhat of an angle but as it approaches shoulder 72 , the balls 68 center the round as is shown in fig4 so that as the bullet starts entering the reduced chamber 74 it is perfectly centered . now , as the extraction rim of the round reaches shoulder 72 it will be suddenly stopped as is shown in fig5 while inertia will cause the bullet 83 and the powder 85 to continue . bullet 83 strikes plate 87 , falls off the screen 86 into the bin 94 , while the powder 85 falls through the screen 86 into the chamber 88 and it can be removed from the chamber by opening the door 90 . now a pulse of air passes through line 80 , controlled by cam 44 . this causes a blast of air through the lines 78 causing the spent case to fall into the bin 92 . thus , it will be seen that the action is entirely automatic and it is only necessary to load the magazine 58 from time to time . in some instances , it has been found that cases will be scratched during passage down the barrel . in this instance , the modification shown in fig8 and 9 can be employed to insure that the case will be handled in a very gentle manner . here , a hollow cylinder 90 is placed over the bullet 91 , and as can be seen in fig9 cylinder 90 has a diameter larger than the extraction rim 94 of the bullet . further , shoulder 96 is not tapered as was previously described but forms a flat surface mating with that of the cylinder 90 . since the extraction rim 94 is already in contact with cylinder 90 , there will be no relative movement when the cylinder hits the shoulder 96 . thus , any scratching which might take place would be between the shoulder 96 and the end of cylinder 90 and not between the cylinder and the end of the round . the operation is exactly as previously described except that the cylinders must be fitted over the rounds before they are placed in the magazine 58 and the cylinders and cartridge case are ejected together as is shown in dot / dash lines in fig9 . in fig1 through 12 , a simple hand - operated model of the device is shown which operates on exactly the same principle . here , a base 100 has arms 102 and 104 . arm 102 supports a bushing 106 having a tube 108 which can slide through busing 106 . tube 108 slides over rod 110 held to extension 112 on support 104 . tube 108 carries a latch 114 while a latch release 116 is provided on support member 102 . the cartridge holder generally designated 118 is slidably mounted on rod 110 and is biased by spring members 120 . the spring members 120 can be heavy rubber bands . cartridge holder 118 consists of two circular plates 119 and 126 . plate 119 has a plurality of holes 122 therein which are just of sufficient size to pass the body of a cartridge but to not pass the extraction rim . plate 126 has holes 130 which are of sufficient size to pass the entire cartridge . plates 119 and 126 can rotate relative to each other and spring 132 tends to hold the plates in any position in which they are placed . to operate the device , plate 126 is rotated so that its openings line up with the openings of plate 119 and cartridges are placed in these openings . plate 126 is then rotated to cover the cartridges and rod 108 is pulled as is shown in fig1 . when the release 116 contacts latch 114 , the plate 118 will slide down rod 110 propelled by the spring members 120 until the plate hits the extension 112 . plate 118 will come to a sudden stop and the projectiles and powder will be ejected as previously described . plate 126 can now be rotated , the empty cartridges removed , and the device reloaded for a repetition of the operation . although certain specific embodiments of the invention have been shown , it will be understood that many variations can be made in the exact structure shown without departing from the spirit of this invention . | 5 |
the embodiment , illustrated in fig1 - 4 , has a support frame 10 which is a flat base plate upon which the remaining structures may be mounted . a pair of independently operable , linear actuators 12 and 14 are mounted on the support frame 10 . each of the linear actuators 12 and 14 are independently connected to a microprocessor control circuit 16 so each may be independently operated by the control circuit 16 . the preferred actuators are preferably linear actuators and are preferably identical , and therefore only the linear actuator 14 is described in further detail . while a variety of linear actuators may be used , such as hydraulic rams , compressed air or pneumatic cylinders , or a rack and pinion , the preferred linear actuator comprises a lead screw 18 which is rotatably mounted to a pair of thrust bearings 20 and 22 , bolted to the support frame 10 . the lead screw 18 is preferably an acme screw and is drivingly connected to a controllable position motor , such as a conventional stepper motor 24 . as is known to those skilled in the art , a stepper motor is a controllable positioned motor and is actuated by pulses , each of which turn the motor through a preselected , angular displacement . therefore , the angular position of the motor is known by the number and polarity of the electrical pulses which have been applied to the motor . the preferred stepper motor provides 200 steps per 360 degrees of rotation , and can operate as high as 16 , 000 steps per second . the stepper motor is , therefore , easily and accurately controlled and provides a wide range of angular velocity . as will be apparent to those skilled in the art , a variety of other controllable position motors are available for use with the actuators in place of the stepper motors . for example , a dc motor , combined with a shaft encoder , can also be used . a variety of alternative position detector systems can also be applied to embodiments of the present invention . for example , a linear encoder could be utilized , positioning , for example , a series of phototransistors along and parallel to the path of each nut member 26 and by mounting a light emitting diode upon each nut member 26 to actuate the nearby photo transistor . a nut member 26 may be threadedly engaged on the lead screw 18 . a pair of rotatable wheels 28 and 30 are mounted to an axle to protrude downwardly from the nut member 26 and roll along the top surface of the support frame 10 . these wheels provide a bearing which prevent rotation of the nut member 26 and also support the vertically downward component of force applied to the nut member 26 . consequently , rotation of the stepper motor 24 in one direction , translates the nut member 26 in one direction along the support frame 10 , while rotation of the stepper motor in the opposite direction translates the nut member in the opposite direction . in both cases , the horizontal displacement is directly proportional to the algebraic total of the angular displacement of the stepper motor 24 . therefore , the number and polarity of the pulses applied to the stepper motors 24 and 25 determines the position of the nut members 26 and 27 . the two identical linear actuators 12 and 14 are independently operable along approximately parallel axes . a movable support platform 32 may be mounted to permit pivotal movement about two pivot axes . the first pivot axis for the support platform 32 may be the axis of a clevis pin 34 which extends through a clevis 36 to pivotally mount the clevis 36 to a support block 38 , which in turn may be fixed to the support frame 10 . the clevis 36 , support block 38 and clevis pin 34 together form a first hinge with a pivot axis which is preferably perpendicular to the parallel displacement paths of the linear actuators 12 and 14 and is approximately horizontal . a support axle 40 may be oriented perpendicularly to the clevis pin 34 and fixed to the clevis 36 . the axle 40 may be pivotally connected to support platform bearings 42 and 44 , which in turn are fixed to the support platform 32 so that the axis of the axle 40 provides a second axis about which the support platform 32 is free to pivot . consequently , the bearings 42 and 44 and pivot axle 40 , together with the clevis 36 , form a second hinge having a pivot axis substantially perpendicular to the first pivot axis through the clevis pin 34 . as a result of this mounting of the support platform 32 to the support frame 10 , the inclination or pitch of the support platform 32 may be varied about the axis of the clevis pin 34 to allow for such motions as dorsiflexion and plantar flexion . similarly , pivotal movement of the support platform 32 about the axis of the support axle 40 allows for roll of the support platform 32 to permit , for example , inversion and eversion of a foot 46 , supported on the support platform 32 . the foot is preferably held in place by a binding 64 . the support platform 32 may be drivingly linked to the linear actuators 12 and 14 by means of a pair of drive links 50 and 52 . each of the drive links includes a universal hinge at each of its ends , such as a ball joint , universal joint , flexible connecting shaft or any other kind of joint which allows free pivotal movement in all angles of direction about a central pivot point . for example , the drive link 50 is connected to the support platform 30 by a ball joint 53 and to the nut member 26 by a ball joint 54 . such a universal hinge or joint is necessary because roll of the support platform 32 about the axle 40 for inducing eversion and inversion will cause the upper ends of both drive links 50 and 52 to move back and forth relatively closer to and further from a central , vertical plane passing through the support axle 40 . in the operation of the preferred embodiment , actuation of the stepper motors 24 and 25 in the identical direction from the same initial position and for the identical displacement will vary only the inclination or pitch of the support platform 32 over a range of angles about the clevis pin 34 . the nut members 26 and 27 translate horizontally from left to right , as illustrated in fig3 to accomplish such motion as plantar flexion and dorsiflexion over a desired angular range . the angular limits over which the dorsiflexion and plantar flexion occur are determined by the linear displacement limits of the nut members 26 and 27 , which , in turn , are determined by the angular displacement of the stepper motors 24 and 25 . the roll motion for inducing inversion and eversion is a function of the difference between the linear displacements of one nut member from the other nut member along the parallel axes along which they reciprocate to provide different roll angles , as illustrated in fig5 and 6 . consequently , both inversion and eversion angles , as well as dorsiflexion and plantar flexion angles may be controlled and smoothly varied to provide a gentle rolling , pivoting movement by independently controlling , selecting and varying the linear positions of the nut members 26 and 27 . both of these motions may be simultaneously and smoothly blended by continuously displacing the nut members 26 and 27 along their respective lead screws 18 and 19 and simultaneously varying the difference between their displacements . while a variety of actuators , and particularly linear actuators , may be utilized with embodiments of the present invention , the lead screw and nut arrangement illustrated is preferred . it is simple , easily controlled , and , because of the mechanical advantage , combined with friction , forces exerted during use , for example by a foot on the support platform 32 , cannot be transmitted back to cause rotation of the lead screws 18 and 19 , although if necessary a stepper motor can be locked in place . the mathematical relationships relating the angular displacement of the stepper motors 24 and 25 to the pitch and roll of the support platform 32 will vary somewhat , depending on the particular embodiment of the invention which is constructed and may be determined by the application of well known principles of algebra , geometry and trigonometry or by testing to determine the particular relationship which may be used for controlling a preferred embodiment of the invention . it is desirable in some embodiments to initialize the control circuit for the particular embodiment before proceeding with motion of the support platform 32 . one manner of accomplishing this is to provide a pair of microswitches 60 and 61 , located , for example , at one end of the linear translation range for the nut members 26 and 27 . these microswitches are connected to the microprocessor control circuit 16 . typically , upon initial actuation of the microprocessor control circuit 16 , the stepper motors are rotated to translate the nut members into contact with their respective microswitches 60 and 61 . upon actuation of its microswitch , the associated nut member is stopped and when both are stopped , the microprocessor then may store in memory this initial position . thereafter the number of pulses and their polarity , which are applied to the stepper motors 24 and 25 , may be maintained in memory so that the microprocessor is continuously aware of the position of the nut members 26 and 27 . thereafter , the microprocessor drives the stepper motors 24 and 25 according to any desired control relationship to cause the nut members 26 and 27 to reciprocate back and forth along the lead screws 18 and 19 to obtain the desired motion of the support platform 32 . it should be apparent that embodiments of the present invention may be utilized beyond the field of physical therapy . the present invention may be used , for example , for supporting and varying the inclination and orientation of other types of work pieces . while certain embodiments of the present invention have been disclosed in detail , it is to be understood that various modifications may be adopted without departing from the spirit of the invention or scope of the following claims . | 0 |
fig1 shows a schematic construction of the image forming apparatus 10 provided with a fixing device according to the present invention . the image forming apparatus 10 is provided with an intermediate transfer belt 11 in the nearly center of the inside . the intermediate transfer belt 11 is supported on the outer circumference of rollers 12 a , 12 b and driven to rotate in the direction of arrow a . beneath the lower horizontal portion of the intermediate transfer belt 11 , four imaging units 13 y , 13 m , 13 c , 13 k corresponding to each color of yellow ( y ), magenta ( m ), cyan ( c ) and black ( k ) are disposed along the intermediate transfer belt 11 . inside the intermediate transfer belt 11 are disposed first transfer rollers 15 y , 15 m , 15 c , 15 k which are opposed to photosensitive drums 14 y , 14 m , 14 c , 14 k of the imaging units 13 y , 13 m , 13 c , 13 k via the intermediate transfer belt 11 . a second transfer roller 16 comes into contact with the part supported by the drive roller 12 a of the intermediate transfer belt 11 . the nip portion between the second transfer roller 16 and the intermediate belt 11 is a second transfer area 17 . in the paper path 18 on the down stream side of the second transfer area 17 , a fixing roller 19 and a press roller 20 are disposed . the press contact portion of the fixing roller 19 and the press roller 20 is a fixing nip area 21 . in the lower portion of the image forming apparatus 10 , four kinds of first , second , third and fourth paper feed portions 22 a , 22 b , 22 c , 22 d are provided . the first paper feed portion 22 a and the second paper feed portion 22 b are disposed up and down . the third paper feed portion 22 c and the fourth paper feed portion 22 d are disposed right and left below the second paper feed portion 22 b . the paper stacked and contained in each of the paper feed portions 22 a , 22 b , 22 c , 22 d is fed one by one from the upper most one to the paper passage 23 . a circulation passage 24 is formed on the side portion of the image forming apparatus 10 . the paper with one surface printed which switchbacks at a paper discharge roller 25 is conveyed downward through the circulation passage 24 and then conveyed upward again through the paper passages 23 , 18 in a state that the unprinted surface faces the side of the intermediate transfer belt 11 . a manual paper feed unit 26 is disposed below the circulation passage 24 . the paper fed from the manual paper feed unit 26 is conveyed upward through the paper passage 23 . numerals 27 y , 27 m , 27 c , 27 k denote toner cartridges for feeding toner of each color to the imaging units 13 y , 13 m , 13 c , 13 k . numeral 28 shows a control unit for controlling the imaging units 13 y , 13 m , 13 c , 13 k . next , brief operation of the image forming apparatus 10 having the above construction will be described . color print data obtained by reading an image at an image reading portion 29 or image data outputted from a personal computer or so is given a predetermined signal processing at the control unit 28 and transmitted to each of the imaging units 13 y , 13 m , 13 c , 13 k as image signals for each color of yellow ( y ), magenta ( m ), cyan ( c ) and black ( k ). in each of the imaging units 13 y , 13 m , 13 c , 13 k , a laser light modulated by the image signal is projected on the photosensitive drums 14 y , 14 m , 14 c , 14 k to form an electrostatic latent image . the latent image formed on each of the photosensitive drums 14 y , 14 m , 14 c , 14 k is developed by the respective developing unit to form a toner image of yellow , magenta , cyan , black on the photosensitive drums 14 y , 14 m , 14 c , 14 k . the toner images of yellow , magenta , cyan , black are superimposed and first transferred on the moving intermediate transfer belt 11 under the operation of the first transfer rollers 15 y , 15 m , 15 c , 15 k . the superimposed toner image formed on the intermediate transfer belt 11 reaches the second transfer area 17 as the intermediate transfer belt 11 moves . in the second transfer area 17 , the superimposed toner image is second transferred on a paper fed from the paper feed portions 22 a , 22 b , 22 c , 22 d or the manual paper feed unit 26 under the operation of the second transfer roller 16 . then , the paper on which the toner image is second transferred reaches the fixing nip area 21 . in the fixing nip area 21 , the toner image is fixed on the paper under the operation of the fixing roller 19 and the press roller 20 . the paper p on which the toner image is fixed is discharged on the discharge tray 7 through the discharge roller 25 . fig2 shows a detailed sectional view of a fixing device 31 according to a first embodiment of the present invention . the fixing device 31 comprises the fixing roller 19 , the press roller and an induction heating unit 30 . the fixing roller 19 is consist of a core 32 comprising a stainless steel pipe , a silicon sponge layer 33 covered on the core 32 and a fixing belt 34 attached on the silicon sponge layer 33 . the fixing belt 34 comprises an endless electrocast sleeve , silicon rubber and pfa tube covered on the sleeve . the press roller 20 is consist of a core 35 comprising a steel pipe , a silicon sponge layer 36 covered on the core 35 and a pfa tube 37 covered on the silicon sponge layer 36 . the induction heating unit 30 , as shown in fig3 , 4 , comprises a coil bobbin 38 , a magnetizing coil 39 and a core 40 . the coil bobbin 38 has a plate like shape that curves in a circular arc pattern along the outer surface of the fixing roller 19 so as to cover the substantially half surface of the fixing roller 19 and extends in the axial direction of the fixing roller 19 . an oblong or track shape of rib 41 extending in the longitudinal direction is formed on the middle of the outer surface of the coil bobbin 38 . as the coil bobbin 38 , liquid crystal polymer , pps ( polyphenylen sulfide ), peek ® ( trade mark of victrex plc ), or phenol resin can be used but is not limited to these . the profile tolerance of the outer surface of the coil bobbin 38 to the center of the fixing roller 19 is less than 0 . 4 . the profile tolerance is a difference between maximum and minimum of radius from the center of the fixing roller 19 at measurement positions that are provided at a predetermined pitch both in the longitudinal direction and the circumferential direction of the coil bobbin 38 . the magnetizing coil 39 is consisted of a litz wire comprising twisted and bound element wires . as shown in fig3 , the magnetizing coil 39 has a construction wound around the rib 41 of the coil bobbin 38 . the construction for attaching the magnetizing coil 39 will be described in detail hereinafter . considering that the litz wire receives heat transmission , the litz wire coated with heat resistant resin is preferably used . the core 40 comprises a plurality of magnetic bodies each of which has a bar like shape bended and extended in the circumference direction of the coil bobbin 38 . the magnetic bodies are disposed at a predetermined pitch in the longitudinal direction of the coil bobbin 38 and attached to the coil bobbin 38 to cover the outer surface of the magnetizing coil 39 . a method for attaching the magnetizing coil 39 onto the coil bobbin 38 will be described below . first , a winding jig not shown comprising a winding surface having the same shape as the outer surface of the coil bobbin 38 , a rib having the same shape as the rib 41 of the coil bobbin 38 , and a flange extending along the winding surface on both sides of the rib is prepared . using the winding jig , the litz wire is wound and heated so that the wound litz wire is self fusion bonded and held in the shape of the outer surface of the coil bobbin 38 to form the magnetizing coil 39 as shown in fig4 . then , as shown in fig5 ( a ), a heat resistant elastic adhesive 44 a is uniformly applied on the outer surface of the coil bobbin 38 . the magnetizing coil 39 is set on the coil bobbin 38 so that the rib 41 the coil bobbin 38 is inserted into the inner diameter portion of the magnetizing coil 39 . as shown in fig5 ( b ), the outer surface of the magnetizing coil 39 is uniformly pressed using a press jig 45 . thus , the magnetizing coil 39 follows and adheres in a contact state to the outer surface of the coil bobbin 38 . after that , the elastic adhesive 44 a is hardened so that the magnetizing coil 39 does not depart from the coil bobbin 38 . when the magnetizing coil 39 is removed from the magnetizing coil 39 , warpage due to residual stress is apt to occur . however , as the elastic adhesive 44 a is hardened during pressure using the pressure jig 45 , the warpage is corrected . a departure of less than 0 . 1 mm from the outer surface of the coil bobbin 38 of the magnetizing coil 39 is acceptable . subsequently , as shown in fig5 ( c ) , an elastic adhesive 44 b is applied on the outer surface of the magnetizing coil 39 and hardened , preventing the magnetizing coil 39 from raveling . lastly , as shown in fig5 ( d ), the core 40 is attached on the coil bobbin 38 . fig6 shows a sectional view of the induction heating unit by attaching the magnetizing coil 39 on the coil bobbin 38 as described above . the induction heating unit 30 comprises a layer of elastic adhesive 44 a provided on the outer surface of the coil bobbin 38 ; the magnetizing coil 39 provided on the layer of elastic adhesive 44 a , the magnetizing coil 39 wound beforehand following the attaching surface ; and a layer of elastic adhesive 44 b . in the conventional method for winding coil directly on a coil bobbin , it has been necessary to form the coil bobbin larger without any protrusions in order to prevent the coil during the wind from interfering with each part of the coil bobbin . on the other hand , in the present invention , as the magnetizing coil 39 wound beforehand by the winding jig is bonded to the coil bobbin , even if there is a protrusion in the vicinity of the attaching surface , the protrusion does not get in the way of attaching the coil . thus , in comparison with the conventional construction in which the coil is wound directly on the coil bobbin , the present invention is possible to downsize the device . the elastic adhesive 44 a , 44 b is necessary to have a heat resistance of at lest more than 180 ° c . also , it is important that the elastic adhesive 44 a , 44 b has rubber elasticity after hardening . in an example , rvt rubber ke3418 ( shin - etsu chemical co ., ltd .) was used . also , one - component system , two - component system and more than three - component system of silicon rubber , and ltv type , rtv type or htv type of silicon rubber can be used . the self fusion bonding of the magnetizing coil 39 is performed by fusion bonding the enamel layer on the surface of the litz wire at the temperature of 180 to 220 ° c . to hold the wire in the curved shape of the coil bobbin 38 . when using the induction heating unit 30 , it is necessary to set a margin of heating temperature in order to prevent the magnetizing coil 39 from being heated to a temperature of more than fusion - bonding temperature of the enamel layer . it is possible to cope with a speed up of the image forming apparatus 10 by air cooling the magnetizing coil 39 or whole of the induction heating unit 30 when the magnetizing coil 39 becomes more than fusion bonding temperature in use . as the coil bobbin 38 and the magnetizing coil 39 are different in thermal expansion coefficient , the difference of thermal expansion is caused due to the heat generated in use of the image forming apparatus 10 . however , the elastic adhesive 44 a allows the magnetizing coil 39 to follow the expansion of the coil bobbin 38 , absorbing the difference of thermal expansion . thus , departure of the magnetizing coil 39 would be never caused and accuracy of the distance between the magnetizing coil 39 and the fixing roller 19 that is a member to be heated could be ensured , reducing generation of noise due to slack of the magnetizing coil 39 . quantity of thermal expansion of the coil bobbin 38 and the magnetizing coil 39 when heating the induction heating unit 30 from normal temperature 20 ° c . to actual normal temperature 200 ° c . was calculated . where , material and linear thermal coefficient of the coil bobbin 38 and the magnetizing coil 39 of the induction heating unit 30 were as shown in table 1 and dimension in the axial direction were 360 mm . as a result , as shown in table 1 , difference of the quantity of the thermal expansion between the coil bobbin 38 and the magnetizing coil 39 was 1 . 4 mm . in the experiment , almost same result was obtained . the difference of the quantity of the thermal expansion between the coil bobbin 38 and the magnetizing coil 39 causes the coil bobbin 38 to warp . fig7 shows quantity of warpage ( curve of “▴” in the figure ) of the inner surface of the coil bobbin 38 of the induction heating unit 30 according to the present invention in which the elastic adhesive ( ke3417 ) was used for bonding the coil bobbin 38 and the magnetizing coil 39 and quantity of warpage ( curve of “ ” in the figure ) of the inner surface of the coil bobbin of conventional induction heating unit in which non - elastic adhesive was used . as clear from the figure , the quantity of warpage of the inner surface of the coil bobbin in the case that non - elastic adhesive was used was 0 . 7 mm . on the other hand , the quantity of warpage of the inner surface of the coil bobbin 38 in the case that elastic adhesive ( ke3417 ) was used according to the present invention was 0 . 2 mm . the warpage of the coil bobbin 38 causes the distance between the magnetizing coil 39 and the fixing roller 19 to change and affects the temperature distribution in the axial direction of the surface of the fixing roller 19 . fig8 shows temperature distribution ( curve of thick line in the figure ) of the fixing roller 19 of the induction heating unit 30 according to the present invention in which the elastic adhesive ( ke3417 ) was used for bonding the coil bobbin 38 and the magnetizing coil 39 and temperature distribution ( curve of thin line in the figure ) of the fixing roller of the conventional induction heating unit in which non - elastic adhesive was used . as clear from the figure , the temperature distribution of the surface of the fixing roller in the case that non - elastic adhesive was used as in the conventional unit was that both ends portion was higher by 7 ° c . than the center . on the other hand , the temperature distribution of the surface of the fixing roller 19 in the case that elastic adhesive ( ke3417 ) was used according to the present invention was substantially flat and had a maximum difference of 2 ° c . the difference of the quantity of thermal expansion between the coil bobbin 38 and the magnetizing coil 39 and the temperature change between the low - temperature time and the high - temperature time generate a “ creaking ” noise from the contact portion of the coil bobbin 38 and the magnetizing coil 39 . table 2 shows existence or nonexistence of the creaking noise of the induction heating unit 30 according to the present invention in which the elastic adhesive ( ke3417 ) was used for bonding the coil bobbin 38 and the magnetizing coil 39 and existence or nonexistence of the creaking noise of the conventional induction heating unit in which non - elastic adhesive was used . the test was performed by 5 minutes observation after endurance printing and entrusted to a tester . as clear from the table , in the case that non - elastic adhesive was used as in the conventional unit , the bonding was hard and the creaking noise was easily generated . the creaking noise began to occur from 24 hours endurance printing and occurred frequently at 1000 hours endurance printing . on the other hand , in the case that elastic adhesive ( ke3417 ) was used according to the present invention , no creaking noise was occurred even at 1000 hours endurance printing . fig9 is an exploded perspective view of an induction heating unit 30 a according to a second embodiment of the present invention . fig1 is a front view of the unit . in the induction heating unit 30 a , first demagnetizing coils 46 are provided on both ends portion of the magnetizing coil 39 and second demagnetizing coils 47 are provided on the first demagnetizing coils 46 . if the length of the magnetizing coil 39 corresponds to the maximum paper size a , the length of the first demagnetizing coil 46 is decided so that the length between the first demagnetizing coils 46 is substantially same as the paper size b smaller than the paper size a . similarly , the length of the second demagnetizing coil 47 is decided so that the length between the second demagnetizing coils 47 is substantially same as the paper size c smaller than the paper size b . the same method as the first embodiment can be adopted until the magnetizing coil 39 is attached on the coil bobbin 38 . the first demagnetizing coil 46 is wound using a winding jig in the same manner as the magnetizing coil 39 , heated and self fusion bonded and held in the shape of the outer surface of the magnetizing coil 39 that is an attaching surface . on the other hand , as shown in fig1 , an insulating sheet 48 a is set on an elastic adhesive 44 b applied in the magnetizing coil 39 . then , a heat resistant elastic adhesive 44 c is uniformly applied on the insulating sheet 48 a to bond the wound first demagnetizing coil 46 . the first demagnetizing coil 46 is uniformly pressed using a press jig and applied with an elastic adhesive 44 d . further , in the same manner , an insulating sheet 48 b , an elastic adhesive 44 e . the second demagnetizing coil 47 and an elastic adhesive 44 f are provided . the most upper surface is protected by a glass cloth tape , a heat resistant tape not shown . as the insulating sheet 48 a , 48 b , a nomex sheet ( made by nitto denko corporation ) is preferable but a polyimide sheet , a fluorine sheet or so is possible if insulation property and heat resistance are ensured . the induction heating unit 30 a comprises : a layer of elastic adhesive 44 a provided on the outer surface of the coil bobbin 38 ; the magnetizing coil 39 provided on the layer of elastic adhesive 44 a , the magnetizing coil 39 being wound beforehand following the attaching surface ; a layer of elastic adhesive 44 b provided on the magnetizing coil 39 ; an insulating sheet 48 a provided on the elastic adhesive 44 b ; a layer of elastic adhesive 44 c provided on the insulating sheet 48 a ; the first demagnetizing coil 46 provided on the layer of elastic adhesive 44 c , the first demagnetizing coil 46 being wound beforehand following the attaching surface ; a layer of elastic adhesive 44 d provided on the first demagnetizing coil 46 ; an insulating sheet 48 b provided on the elastic adhesive 44 d ; a layer of elastic adhesive 44 e provided on the insulating sheet 48 b ; the second demagnetizing coil 47 provided on the layer of elastic adhesive 44 e , the first demagnetizing coil 47 being wound beforehand following the attaching surface ; and a layer of elastic adhesive 44 f provided on the second demagnetizing coil 47 . in general , in the case that the paper size is small in comparison with the length of the fixing roller , when continuously passing the paper , fixing operation causes the heat to be drawn from the center portion of the fixing roller though which the small size of paper passes , reducing the temperature of the fixing roller . in order to compensate for this , control to increase the temperature of the fixing roller is performed . however , at the both ends portion through which no paper passes , the fixing operation does not cause decrease of temperature . thus , the temperature of the both ends increase in comparison with the center portion . so , in the induction heating unit 30 a of the second embodiment , switches for turning on and off current to the first demagnetizing coils 47 and the second demagnetizing coils 47 are closed in response to the paper size to generate a counter electromotive force in the demagnetizing coils 46 , 47 . thus , a reverse magnetic field is generated in a direction that change of the magnetic field from the magnetizing coil 39 is prevented , reducing the magnetic field generated from the magnetizing coil 39 at the portions that the demagnetizing coil 46 , 47 are disposed . as a result , it is possible to prevent increase of the temperature of the fixing roller 19 only at the range of demagnetizing coils 46 , 47 . as the first demagnetizing coils 46 and the second demagnetizing coils 47 are attached in the same manner as the magnetizing coil 39 , no warpage and no creaking noise occurs , enabling to obtain a uniform temperature distribution of the fixing roller 19 . also , error and decrease of paper passing speed due to temperature anomaly of the fixing roller 19 that are generated in the case that the demagnetizing rollers 46 , 47 are not used would not be caused . fig1 shows a temperature distribution of the fixing roller 19 before and after 1500 , 000 endurance printing by the image forming apparatus having the fixing device using the induction heating unit 30 a according to the second embodiment . as clear from the figure , the temperature distribution before and after the endurance printing was not remains unchanged . this shows that fixing quality can be ensured even after the endurance printing . although the present invention has been fully described by way of the examples with reference to the accompanying drawing , it is to be noted that various changes and modifications will be apparent to those skilled in the art . therefore , unless such changes and modifications otherwise depart from the spirit and scope of the present invention , they should be construed as being included therein . | 6 |
referring to fig1 , the apparatus has the following components : upper body tubular connection 1 ; upper ported housing 2 ; inner shifting sleeve 3 ; port isolation seals 4 ; upper internal polished bore 5 ; fluid communication ports 6 ; sleeve shear screw shoulder 7 ; shear screws 8 ; upper internal bore piston seals 9 ; intermediate internal polished bore 10 ; upper pressure testing port 11 ; upper atmospheric chamber 12 ; burst disk load nut 13 ; burst disk load ring 14 ; burst disk or chemically responsive barrier 15 ; intermediate internal bore piston seals and piston 16 ; sleeve lock ring retention groove 17 ; lower internal polished bore 18 ; lower atmospheric chamber 19 ; sleeve lock ring retainer 20 ; sleeve lock ring 21 ; body seals 22 ; body connection 23 ; body set screws 24 ; lower sleeve polished bore 25 ; lower pressure testing port 26 ; lower external rod piston seals 27 ; lower body 28 ; and lower body tubular connection 29 . the valve is run in open - hole cementable completions just above the float equipment . the valve is connected to the casing through the upper body tubular connection ( 1 ) at the top and the lower body tubular connection ( 29 ) at the bottom . the structural valve body is made - up of an upper ported housing ( 2 ) and lower body ( 28 ). pressure integrity of the valve is maintained with the body seals ( 22 ). the body set screws ( 24 ) keep the body connection threads ( 23 ) from backing out during installation . between the upper ported housing ( 2 ) and the lower body ( 28 ) is captured an inner shifting sleeve ( 3 ). the inner shifting sleeve ( 3 ) has several diameters that create piston areas that generate shifting forces to open the valve . the port isolation seals ( 4 ) located on the upper end of the inner shifting sleeve ( 3 ) and the upper internal bore piston seals ( 9 ) below the fluid communication ports ( 6 ) both act to isolate the inside of the valve during and after cementation . the larger intermediate internal bore piston seals ( 16 ) are used to drive down the inner shifting sleeve ( 3 ) along the lower internal polished bore ( 18 ) within the upper ported housing ( 2 ), once the burst disk ( 15 ) is ruptured . both sets of seals operate within their respective polished bores ( 5 , 10 ) within the upper ported housing ( 2 ). the lower external rod piston seals ( 27 ) located within the lower body ( 28 ) act to prevent cement from entering the lower atmospheric chamber ( 19 ) and wipe the outside diameter of the lower sleeve polished bore ( 25 ) during the opening of the valve . the inner shifting sleeve ( 3 ) also has a shoulder ( 7 ) that shears the shear screws ( 8 ) during the opening shift of the inner sleeve ( 3 ). an external sleeve lock ring retention groove ( 17 ) is located between the internal bore piston seals ( 16 ) and the lower sleeve polished bore ( 25 ) diameter . this recess will accept the sleeve lock ring ( 21 ) that is retained by the lock ring retainer ( 20 ) once the valve had fully opened . the sleeve lock ring ( 21 ) will prevent the inner shifting sleeve ( 3 ) from closing once the valve has fully opened . between the upper internal bore piston seals ( 9 ) and the intermediate internal bore piston seals ( 16 ) is created the upper atmospheric chamber ( 12 ) which contains air that can be independently tested through the upper pressure test port ( 11 ). between the intermediate internal bore piston seals ( 16 ) and the lower external rod piston seals ( 27 ) is created a lower atmospheric chamber ( 19 ) which also contains air that can be independently tested through a lower pressure testing port ( 26 ). a burst disk ( 15 ) is held into place within a port located on the outside of the inner shifting sleeve ( 3 ) by a load ring ( 14 ) and a load nut ( 13 ). the burst disk load nut ( 13 ) is sized to allow significant torque and load to be transferred into the burst disk ( 15 ) prior to installation of the inner shifting sleeve ( 3 ) within the valve . the valve is run on casing and cemented into place within the well . after cementation the valve is scraped with wiper dart prior to actuation . once the cement has set on the outside of the valve , it is ready to be opened with a combination of high hydrostatic and applied pressure . once the burst pressure is reached , the burst disk ( 15 ) opens the upper atmospheric chamber ( 12 ) to the applied pressure . this pressure acts on the piston area created by the upper internal bore piston seals ( 9 ) and the larger intermediate internal bore piston seals ( 16 ) and drives the inner shifting sleeve ( 3 ) down compressing the air within the lower atmospheric chamber ( 19 ) and opening the fluid communication ports ( 6 ) on the upper ported housing ( 2 ). once the inner shifting sleeve ( 3 ) is completely shifted and in contact with the upward facing shoulder on the lock ring retainer ( 20 ), the sleeve lock ring ( 21 ) falls into the sleeve lock retention groove ( 17 ) on the inner shifting sleeve ( 3 ) preventing the valve from subsequently closing . those skilled in the art will appreciate that the use of the rupture disc for piston access is simply the preferred way and generally more accurate than relying exclusively on shearing a shear pin . a pressure regulation valve can also be used for such selective access as well as a chemically responsive barrier that goes away in the presence of a predetermined substance or energy field , temperature downhole or other well condition for example , schematically illustrated by arrow 30 , to move the sleeve . chamber ( 12 ), once the rupture disc burst is under tubing pressure so wall flexure at that location is minimized . even before the rupture disc breaks the size of chamber ( 12 ) is sufficiently small to avoid sleeve wall flexing in that region . the use of a large boss to support the seal ( 16 ) also strengthens the sleeve ( 3 ) immediately above the chamber ( 19 ), thus at least reducing flexing or bending that could put sleeve ( 3 ) in a bind before it fully shifted . the slightly larger dimension of seal ( 27 ) than seal ( 4 ) that holds the sleeve ( 3 ) closed initially also allows a greater wall thickness for sleeve ( 3 ) near the chamber ( 19 ) to further at least reducing flexing or bending to allow the sleeve ( 3 ) to fully shift without getting into a bind . the piston ( 16 ) can be integral to the sleeve ( 3 ) or a separate structure . chamber ( 19 ) has an initial pressure of atmospheric or a predetermined value less than the anticipated hydrostatic pressure within sleeve ( 3 ). the volume of chamber ( 19 ) decreases and its internal pressure rises as sleeve ( 3 ) moves to open port ( 6 ). the above description is illustrative of the preferred embodiment and many modifications may be made by those skilled in the art without departing from the invention whose scope is to be determined from the literal and equivalent scope of the claims below . | 4 |
fig1 shows a portable power tool 10 according to the disclosure , which is in the form of a rotary and / or demolition hammer . the portable power tool 10 comprises a transmission 12 , a machine housing 14 and an inner housing 16 ( fig2 ) arranged inside the machine housing 14 , said inner housing being provided to receive a transmission element 18 of the transmission 12 . in this case , the transmission element 18 is mounted in a manner distributed between the inner housing 16 and the machine housing 14 . the transmission 12 comprises a percussion mechanism 36 for producing a percussive pulse . the transmission 12 is connected to a drive unit 36 ( not shown in more detail here ) that produces a drive torque . the percussive pulse of the percussion mechanism 36 and a rotation of an intermediate shaft of the percussion mechanism 36 , of a hammer tube of the percussion mechanism 36 and of a tool mount 40 of the portable power tool 10 are produced in a manner known to a person skilled in the art and so this is not described in more detail here . the tool mount 40 of the portable power tool 10 is arranged in a front region 42 of the portable power tool 10 and is provided to receive a tool 44 . on a side 46 remote from the front region 42 , the portable power tool 10 comprises a main handle 48 for actuating the portable power tool 10 and to introduce a force initiated by an operator to the portable power tool 10 . the portable power tool 10 is also executed with a detachable auxiliary handle 50 . in this case , the auxiliary handle 50 can be fastened in a detachable manner to the portable power tool 10 via a latching connection or other connections that appear to be practical to a person skilled in the art . the auxiliary handle 50 is arranged on the portable power tool 10 in the vicinity of the tool mount 40 so that the portable power tool 10 can be guided by the operator . a main extension direction 52 of the portable power tool 10 extends from the main handle 48 in the direction of the tool mount 40 . in this case , the main extension direction 52 extends parallel to a rotational axis 54 of the tool 44 located in the tool mount 40 and to a rotational axis 54 of the transmission element 18 in the form of a hammer tube . inside the transmission element 18 in the form of a hammer tube there are arranged a percussive pin , a striker and a hammer pin ( not illustrated in more detail here ) for transmitting the percussive pulse to the tool 44 . fig2 shows the portable power tool 10 according to the disclosure with the machine housing 14 opened . the machine housing 14 comprises a pot - like transmission housing 56 and a pot - like motor housing 58 . in the assembled state , the transmission housing 56 and the motor housing 58 are connected together in a connecting plane 60 such as to be separable in a manner known to a person skilled in the art . the connecting plane 60 extends perpendicularly to the rotational axis 54 of the tool 44 located in the tool mount 40 and to the rotational axis 54 of the transmission element 18 in the form of a hammer tube . the motor housing 58 is formed partially in one piece with the main handle 48 . furthermore , the drive unit 38 , which is in the form of an electric motor , ( not illustrated in more detail here ) is arranged inside the motor housing 58 . the inner housing 16 , which is arranged inside the transmission housing 56 in the assembled state of the transmission housing 56 , is provided to axially support the transmission element 18 in the form of a hammer tube . the transmission element 18 in the form of a hammer tube is mounted inside the inner housing 16 ( fig5 ) by means of a bearing element 66 in the form of a bearing bush 64 and of a bearing element 70 in the form of a ball bearing 68 . the bearing bush 64 is arranged in this case in an intermediate flange 30 of the portable power tool 10 , said intermediate flange 30 being arranged partially inside the mounted inner housing 16 . furthermore , the intermediate flange 30 has a supporting element 20 , 24 , which is provided to axially support the inner housing 16 . the supporting element 20 , 24 is formed in this case in one piece with the intermediate flange 30 . the inner housing 16 has a radial cutout 28 , which is provided to partially receive the supporting element 20 , 24 . furthermore , the inner housing 16 has grooves 72 for receiving the ball bearing 68 and the intermediate flange 30 , said grooves 72 extending in a circumferential direction 74 in the inner housing 16 . the circumferential direction 74 extends in a plane which extends perpendicularly to the rotational axis 54 of the tool 44 located in the tool mount 40 and to the rotational axis 54 of the transmission element 18 in the form of a hammer tube . as a result of interaction of peripheral regions 76 of the grooves 72 , the radial cutouts 28 in the inner housing 16 and the supporting element 20 , 24 , the inner housing 16 is supported on the intermediate flange 30 in the axial direction 62 . the transmission element 18 in the form of a hammer tube is supported axially on the inner housing 16 via the ball bearing 68 arranged in one of the grooves 72 in the inner housing 16 and one of the peripheral regions 76 of the grooves 72 . furthermore , the portable power tool 10 has a supporting element 20 , 24 , which penetrates partially through the inner housing 16 in a radial direction 22 . this supporting element 20 , 24 is configured in one piece with the supporting element 20 , 24 which is provided to axially support the inner housing 16 . in the assembled state of the machine housing 14 and the inner housing 16 , the supporting element 20 , 24 extends , starting from the intermediate flange 30 , in the direction of the transmission housing 56 through the cutout 28 in the inner housing 16 . the supporting element 20 , 24 has a free end 26 which is directed radially outward and bears against the transmission housing 56 in the assembled state of the portable power tool 10 . the transmission element 18 in the form of a hammer tube is supported radially on the machine housing 14 , in particular on the transmission housing 56 , in a manner uncoupled from the inner housing 16 . the intermediate flange 30 has a total of six supporting elements 20 , 24 , which are formed partially in one piece with the intermediate flange 30 . the inner housing 16 has in this case six cutouts 28 for receiving the six supporting elements 20 , 24 . the six supporting elements 20 , 24 are in this case arranged at an equal spacing in the circumferential direction 74 on the intermediate flange 30 . furthermore , the six cutouts 28 are likewise arranged at an equal spacing in the circumferential direction 74 on the inner housing 16 . however , it is also conceivable for more than six supporting elements 20 , 24 or fewer than six supporting elements 20 , 24 to be provided , depending on the requirements , and so a person skilled in the art will provide a number of supporting elements 20 , 24 and cutouts 28 that is practical for a particular requirement . fig3 shows a detail view of the mounted inner housing 16 of the portable power tool 10 according to the disclosure , wherein the transmission housing 56 has been removed . on a side 78 of the inner housing 16 that faces the tool mount 40 , the ball bearing 68 for mounting the transmission element 18 in the form of a hammer tube is arranged in one of the grooves 72 in the assembled state of the inner housing 16 . on this side 78 , the inner housing 16 has a cutout 80 , which is provided to receive a radial element 82 of the transmission housing 56 . the inner housing has a total of six cutouts 80 for receiving a radial element 82 . the radial element 82 is in the form of a radial extension 84 of the transmission housing 56 ( fig4 ). the radial extension 84 is arranged on an inner side 86 of the transmission housing 56 , said inner side 86 being directed toward the inner housing 16 in the assembled state of the transmission housing 56 . the transmission housing 56 has a total of six radial extensions 84 , which engage in each case in one of the six cutouts 80 in the inner housing 16 in the assembled state of the transmission housing 56 . however , it is also conceivable for more than six radial extensions 84 or fewer than six radial extensions 84 to be provided , depending on the requirements , and so a person skilled in the art will provide a number of radial extensions 84 and cutouts 80 that is practical for a particular requirement . the ball bearing 68 arranged in the inner housing 16 comprises an outer race 88 which bears against the radial extensions 84 in the assembled state of the transmission housing 56 . it is conceivable for damping means 87 to be arranged between the radial extensions 84 of the transmission housing 56 and the outer race 88 of the ball bearing 68 , said damping means 87 being provided to damp vibrations . by means of interaction between the outer race 88 of the ball bearing 68 and the radial extensions 84 of the transmission housing 56 , the transmission element 18 in the form of a hammer tube is supported radially on the transmission housing 56 . as a result , radial forces , which proceed from the transmission element 18 in the form of a hammer tube , are transmitted into the transmission housing 56 . the radial extensions 84 of the transmission housing 56 are inserted in the axial direction 62 into the cutouts 80 in the already mounted inner housing 16 when the transmission housing 56 is mounted . furthermore , the inner housing 16 has a bearing extension 90 which extends in a radial direction 22 . in the assembled state of the transmission housing 56 , the bearing extension 90 extends from the inner housing 16 in the direction of the transmission housing 56 . the bearing extension 90 is provided to receive a bearing element 94 in the form of a ball bearing 92 . to this end , the bearing extension 90 has a groove 96 , which extends in the circumferential direction 74 in the bearing extension 90 of the inner housing 16 . the ball bearing 92 is provided to mount a shaft 100 , in the form of an intermediate shaft 98 , of the transmission 12 . the intermediate shaft 98 is supported axially in this case by means of interaction between the ball bearing 92 and peripheral regions 102 of the groove 96 in the inner housing 16 . in order to radially support the intermediate shaft 98 , the bearing extension 90 has a cutout 104 , which is provided to receive a supporting element 106 of the transmission housing 56 . the bearing extension 90 has a total of three cutouts 104 ( fig4 ) and the transmission housing 56 comprises three supporting elements 106 , wherein in each case one cutout 104 receives one supporting element 106 . the supporting elements 106 of the transmission housing 56 are provided to radially support the intermediate shaft 98 via the ball bearing 92 . the supporting elements 106 of the transmission housing 56 are inserted in the axial direction 62 into the cutouts 104 in the bearing extension 90 of the already mounted inner housing 16 when the transmission housing 56 is mounted . the portable power tool 10 comprises two bearing planes 32 , 34 , a first bearing plane 32 and a second bearing plane 34 , in which the transmission element 18 in the form of a hammer tube is supported radially on the machine housing 14 in a manner uncoupled from the inner housing 16 . the two bearing planes 32 , 34 extend in this case perpendicularly to the rotational axis 54 of the tool 44 located in the tool mount 40 and to the rotational axis 54 of the transmission element 18 in the form of a hammer tube . the supporting elements 20 , 24 , a subregion of the intermediate flange 30 , the bearing bush 64 and a subregion of the transmission element 18 in the form of a hammer tube are arranged in the first bearing plane 32 in the assembled state of the machine housing 14 and the inner housing 16 . the radial extensions 84 of the transmission housing 56 , the ball bearing 68 and a subregion of the transmission element 18 in the form of a hammer tube are arranged in the second bearing plane 34 in the assembled state of the machine housing 14 and the inner housing 16 . fig4 shows a schematic sectional illustration of the machine housing 14 , in particular the transmission housing 56 , of the portable power tool 10 according to the disclosure . the radial extensions 84 of the transmission housing 56 are arranged in a plane 108 ( fig2 ), which extends perpendicularly to the rotational axis 54 of the tool 44 located in the tool mount 40 and to the rotational axis 54 of the transmission element 18 in the form of a hammer tube in the assembled state of the transmission housing 56 . furthermore , the radial extensions 84 are arranged at an equal spacing in the circumferential direction 74 in the plane 108 . the plane 108 forms the second bearing plane 34 of the portable power tool 10 in the assembled state of the transmission housing 56 . the supporting elements 106 of the transmission housing 56 are arranged in a plane 110 which extends parallel to the plane 108 ( fig2 ), in which the radial extensions 84 of the transmission housing 56 are arranged . in this case , the plane 110 , in which the supporting elements 106 are arranged , is arranged in the axial direction 62 in the direction of the main handle 48 in a manner spaced apart from the plane 108 , which has the radial extensions 84 of the transmission housing 56 . the plane 110 forms a third bearing plane 112 of the portable power tool 10 in the assembled state of the transmission housing 56 . the third bearing plane 112 comprises a subregion of the bearing extension 90 of the inner housing 16 , the supporting elements 106 , the ball bearing 92 of the intermediate shaft 98 and a subregion of the intermediate shaft 98 in the assembled state of the portable power tool 10 . fig5 shows the portable power tool 10 according to the disclosure with the inner housing 16 opened and the transmission housing 56 removed . the inner housing 16 is formed in a shell - like manner . in this case , the inner housing 16 comprises two inner housing half - shells 114 , 116 , which are connected together in a separable manner in a connecting plane . the connecting plane extends through the rotational axis 54 of the tool 44 located in the tool mount 40 and through the rotational axis 54 of the transmission element 18 in the form of a hammer tube . | 1 |
in accordance with the present invention , a front part of an inner surface of a toilet bowl or a bidet bowl is provided with a sheet - like element 10 composed of a transparent material . the element 10 can be molded into the body of the bowl . optical guides for example optical fibers 11 are connected with their one end to the inner surface of the element 10 in a well known means for providing an optical contact therebetween . the optical guides have such a diameter that its minimal number , uniform distribution and desired direction , they can receive light beams 12 from the whole area underneath a toilet seat or a lower part of a user &# 39 ; s body approximately in accordance with a contour of the line o . the optical guides are arranged so that each tapered light guide receives a light image from a desired partial area of the total area to be observed . the light guides extending from the panel 10 are provided with casings and bent so as to thereafter extend through the wall of the bowl toward the lower part . then the light guides are connected with a known converter 13 . the converter converts the light beams into an image to be projected to the screen 14 . as can be seen from the drawings , the screen is arranged in the central lower front part of the bowl . this is convenient for a person sitting on the toilet or bidet and most efficiently uses the space and area of the floor occupied by the bowl . the angle of inclination of the surface of the screen is selected so that the surface is perpendicular to the direction of the observation l of a person sitting on the bowl with the head lowered . in addition , the screen can be designed so that it can magnify the image , or for purpose it can be designed as a magnifying screen or provided with an additional magnifying element . a cartridge 15 with a bulb and a reflector for reflecting the lower part of the body through the transparent element 10 is arranged in the center of the front part of the bowl . in order to withdraw heat during the use of incandescent bulb , a louver grate 15 &# 39 ; closes a recess from the front and allows air circulation . a pipe 51 extends into the unit from above for supplying water for washing a bowl and air for drying after the use of spraying . air is heated in a unit 4 and supplied from the side through a pipe 64 as shown for example in fig1 , 3 ; and 11 , 12 of u . s . pat . no . 5 , 253 , 373 and fig1 , 3 , 17 of patent application ser . no . 08 / 273 , 450 . an outlet opening into the bowl is formed so that the stream enters along a tangent to the lower surface of the bowl as shown in fig2 . a drainage through a syphoning hydroclosure 16 to a draining system is arranged in the lower part of the bowl . a spray cartridge 56 &# 39 ; is located in the lower part under the seat and the direction of spraying is illustrated , wherein a handle of spray control is identified as 54 , and one of the spraying positions is identified as s . see fig1 . in order to operate the device in accordance with the present invention , the handle 57 on the unit 4 is turned by a user clockwise . in a first position of the handle , the handle turns on the supply air for drying . in the second position of the handle , the drying and the display are turned on . in the third position of the handle , only the display is turned on . simultaneously , the bulb is lit and the image appears on the screen . when the display is turned on during the use of liquid in the toilet bowl , drops of water can be on the surface of the panel 10 and they can distort the image to be transmitted . in order to eliminate this , the drying air supply is turned on as well . the stream of air supplied into the bowl flows along the inner surface of the bowl , reaches the surface of the panel 10 , and blows off water drops from it so as to dry the panel and to maintain a stable image on the screen . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in a toilet bowl or bidet , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 4 |
with reference to fig1 , a combined cycle power plant ( ccpp ) in accordance with an exemplary embodiment is indicated generally at 2 . ccpp 2 includes a gas turbomachine 4 fluidly coupled to a heat recovery steam generator ( hrsg ) 6 . gas turbomachine 4 includes a compressor portion 10 fluidly connected to a turbine portion 12 through a combustor assembly 14 . compressor portion 10 is also mechanically linked to turbine portion 12 through a common compressor / turbine shaft 16 . compressor portion 4 is also mechanically linked to a generator 18 and fluidly coupled to hrsg 6 . at this point it should be understood that while described as being associated with a steam turbine , ccpp 2 may form part of configurations including those that do not employ a steam turbine . it should also be understood that ccpp 2 includes an exhaust system ( not shown ). compressor portion 10 delivers compressed air to combustor assembly 14 to be mixed with fuel to form a combustible mixture . the combustible mixture is combusted within combustor assembly 14 to form hot gases that are delivered to turbine portion 12 through a transition piece ( not shown ). the hot gases expand through turbine portion 12 creating work that is employed to drive , for example , generator 18 . exhaust gases pass from turbine portion 12 to hrsg 6 . the exhaust gases pass in a heat exchange relationship with fluids in hrsg 6 . for example , the exhaust gases form steam that is used to drive a steam turbomachine ( not shown ). prior to combusting the combustible mixture , turbine portion 12 and hrsg 6 are purged of any combustible / gases that may ignite in regions of ccpp 2 not designed for combustion . in accordance with the exemplary embodiment , ccpp 2 includes an adaptive purge control system 40 . adaptive purge control system 40 includes a central processor unit 42 and a memory 44 that are configured to control a purge cycle in ccpp 2 . in accordance with one aspect of the exemplary embodiment , adaptive purge control system 40 controls the purge cycle such that purge flow ends substantially , simultaneously , with turbine portion 12 reaching firing speed as will be discussed more fully below . reference will now follow to fig2 in describing a method 100 of meeting a purge requirement for power plant 2 . initially , a purge flow speed is defined for turbine portion 12 as indicated in block 102 . purge flow speed may be held at a single speed , or may include varying turbine speed , wobulating turbine speed , or operating turbine 12 at different speed levels during purge . at this point a purge flow is initiated as indicated in block 104 and guided through turbine portion 12 and toward hrsg 6 as indicated in block 106 . in block 108 , a determination is made whether the purge flow has achieved a predetermined flow rate . the predetermined flow rate may vary from installation to installation and from location to location . if the purge flow rate is not at the predetermined level , the purge flow is allowed to build accordingly . once the predetermined flow rate has been achieved , adaptive purge flow system 40 monitors a cumulative flow volume passing toward hrsg 6 as indicated in block 120 . cumulative flow volume is monitored by using temperature and pressure values of the purge flow . in block 130 , a determination is made whether the cumulative flow volume is nearing a predetermined flow volume . the predetermined flow volume may vary from installation to installation . in some cases , the predetermined flow volume represents a number of volume exchanges for hrsg 6 . more specifically , hrsg 6 includes a defined internal volume . the predetermined flow volume would ensure that gases in the defined internal volume would be replaced one or more times . as indicated in block 140 , once the cumulative purge volume nears the predetermined flow volume , adaptive purge control system 40 causes a deceleration of turbine portion 12 from the purge speed to firing speed and determines a purge flow cut off point in block 150 . in accordance with the exemplary embodiment , adaptive purge control system 40 determines a purge flow cut off point that substantially coincide with turbine portion 12 reaching firing speed . in block 160 the purge flow is cut off and a determination is made in block 170 whether the purge flow cut off substantially coincides with turbine portion 12 reaching firing speed . if the purge flow cut off did substantially coincide with turbine portion 12 reaching firing speed , adaptive purge flow control system 40 stores the purge flow cut off point data in memory 44 as a positive result as indicated in block 180 . if the purge flow cut off did not substantially coincide with turbine portion 12 reaching firing speed , the purge flow cut off point is stored in memory 44 as a negative result as indicated in block 190 . adaptive purge flow control system 40 uses both the positive and negative results to adaptively determine future purge flow cut off points . alternatively , the purge flow cut off point could be set when a timer , activated when 8 % of base load flow is achieved , times out as indicated in block 200 . in general , the cumulative purge flow is based at least in part on a multiple of a total hrsg volume . at this point it should be understood that the exemplary embodiments describe a purge flow control system that “ learns ” or adapts to turbine speed and purge flow conditions to set a purge flow cut off point that substantially coincides with the turbine reaching firing speed . the purge flow is configured to remove potentially combustible gases from the turbine portion , the hrsg as well as any associated exhaust ducting prior to ignition of the turbomachine system . by substantially matching purge flow cut off with turbine firing speed , the purge flow control system enhances an overall operating efficiency of ccpp 2 . in addition , substantially matching purge flow cut off with firing speed allows for a more open inlet gas vane ( igv ) during purge , and for varying purge speeds , so as to reduce thermal stresses on the gas turbomachine and hrsg , lower costs associated with start up and decrease restart times . finally , it should be understood that the purge volume includes , in addition to a volume of the hrsg , a volume of any associated exhaust system . while the invention has been described in detail in connection with only a limited number of embodiments , it should be readily understood that the invention is not limited to such disclosed embodiments . rather , the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . additionally , while various embodiments of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description , but is only limited by the scope of the appended claims . | 5 |
the term “ 9 , 10 - anthraquinone ” as used herein refers to anthraquinone having the following chemical formula and numbering sequence : the 9 , 10 - anthraquinone compounds of the present invention may be substituted by the same or different amines at any available position , such as the 1 , 2 , 3 , 4 , 5 , 6 , 7 , and / or 8 position ( s ). preferably , the 9 , 10 - anthraquinone is substituted at the 1 , 4 , 5 and / or 8 position ( s ). examples of such compounds include , but are not limited to , the 1 -; 1 , 4 -; 1 , 4 , 5 -; 1 , 4 , 8 -; and 1 , 4 , 5 , 8 - substituted - 9 , 10 - anthraquinone compounds . in dyes used in the invention , the substituents are preferably monofunctional amines , optionally in combination with oxy - substituents . preferred precursor compounds are halo - or oxy - substituted - 9 , 10 - anthraquinone compounds . as used herein , the term “ oxy - substituted - 9 , 10 - anthraquinone compound ” refers to any 9 , 10 - anthraquinone compound having one or more additional carbonyl groups on one or both of the outer rings , for example , in the positions described above , and tautomers thereof . halo - substituted - 9 , 10 - anthraquinones have halo - substituents such as chloro - substitutents at the corresponding position ( s ). the term “ substituted - 9 , 10 - anthraquinone compound ” as used herein refers to any 9 , 10 - anthraquinone compound or reduced form thereof having one or more substituent groups on one or both of the outer rings , and tautomers thereof . one preferred class of these anthraquinone compounds is the 1 , 4 - oxy - substituted - 9 , 10 - anthraquinone compounds ( i . e ., carbonyl groups are on both of the 1 - and 4 - positions of one of the outer rings ). examples of 1 , 4 - oxy - substituted - 9 , 10 - anthraquinone compounds include leucoquinizarin and quinizarin . leucoquinizarin is the reduced form of quinizarin and has the following chemical formula ( i ): it is particularly preferred to use a mixture of quinizarin and leucoquinizarin . because quinizarin is less expensive than leucoquinizarin and also is available in a highly purified “ sublimed ” form ; the preferred molar ratio is in the range of about 1 to about 10 moles of quinizarin per mole of leucoquinizarin . suitable monofunctional amines include any monofunctional amine that is capable of being placed on the 9 , 10 - anthraquinone compound , for example by reacting with the oxy - substituted - 9 , 10 - anthraquinone compound , to make a suitable colorant or colorants . preferred monofunctional amines include but are not limited to aliphatic monoamines , aromatic monoamines , aliphatic / aromatic monoamines , fused ring system monoamines , polyoxyalkylenemonoamines , and hydroxyl / amino - containing compounds . examples of aliphatic monoamines include any aliphatic primary or secondary amine ( e . g ., a c 1 - c 22 , preferably c 12 - 18 and more preferably c 16 - 18 , or higher linear amine , any branched amine or any cyclic aliphatic amine ), such as mono - or di -: methyl amine , ethyl amine , ( n - and iso ) propyl amines , ( n -, iso -, and t -) butylamines , ( n -, iso -, t -, and the like ) pentyl amines , ( n -, iso - t -, and the like ) hexyl amines , cyclohexyl amines , ( n -, iso -, t -, and the like ) heptyl amines , ( n -, iso -, t -, and the like ) octyl amines , ( n -, iso -, t , and the like ) nonyl amines , ( n - and branched ) decyl amines , ( n - and branched ) undecyl amines , ( n - and branched ) dodecyl amines , ( n - and branched ) hexadecyl amines , ( n - and branched ) octadecyl amines , tallow amines , 2 , 3 - dimethyl - 1 - cyclohexylamine , piperidine , pyrrolidine , and the like . tallow amines are particularly preferred . examples of aliphatic / aromatic amines include aliphatic / aromatic compounds in which the amino group is attached to the aliphatic portion , such as benzyl amine or analogues with longer or additional alkyl chains , and aliphatic / aromatic compounds in which the amino group is attached to the aromatic portion , such as dodecylaniline or analogues with longer , shorter and / or additional alkyl chains . examples of fused ring monoamines include rosin amine , dehydroabietyl amine , dihydroabietyl amine , hydroabietyl amine , and the like , such as amine d ™ available commercially from hercules inc . of wilmington , del . examples of hydroxy / amino compounds include ethanol amine or aminopropyldiethylene glycol , commercially available from dixie chemical company of pasadena , tex . examples of polyoxyalkylenemonoamines include m - series jeffamines available commercially from huntsman chemical company of austin , tex ., and the like , such as r — o —( ch 2 — ch ( ch 3 )— o ) n — ch 2 — ch ( ch 3 )— nh 2 wherein r is a lower , such as c1 - 4 , alkyl and n is an integer . it should be noted that the condensation product of m - series jeffamines and the oxy - substituted - 9 , 10 - anthraquinone compounds would likely be a viscous liquid at room temperature . preferred mono functional amines are aliphatic monoamines , such as octadecyl and tallow amines . if leucoquinizarin , or a quinizarin / leucoquinizarin mixture , and a monoamine r — nh 2 are reacted together , the reaction products can be illustrated by the following chemical formulae ( iii ) and ( iv ): similarly , reaction of the following 9 , 10 - anthraquinone compounds with monoamines r — nh 2 under known reducing conditions produces the following reaction products : preferably , these reactions are carried out at temperatures where the amine is in a liquid state ( i . e ., at or above the melting point of the amine ) so that the amine can act as the initial solvent for the reaction and where the reaction product is also a liquid ( i . e ., at or above the melting point of the reaction product ) so that it can act as the solvent as the reaction proceeds toward completion . there is no particular upper limit on the reaction temperature so long as it is a temperature below the degradation point of the reactants and product ( s ). preferably , the reaction temperatures are from 60 ° c .- 200 ° c ., preferably 80 - 150 ° c ., more preferably 90 - 125 ° c . too high reaction temperatures should be avoided to prevent degradation of the reaction product or formation of by - products . this reaction can be carried out in conventional condensation reaction equipment . preferably , the reaction is conducted under an inert atmosphere at a temperature where a molten reaction mixture is formed until the reaction is complete . the inert atmosphere is used to prevent premature oxidation of any leuco component in the reaction mixture . the molar ratio of amine reactant to anthraquinone reactant is preferably approximately stoichiometric relative to the desired amine - substituted reaction product ( s ). the presence of residual amines in the reaction product is not advantageous . such excess amines tend to be reactive , and can be corrosive to materials with which the dye comes into contact , such as components of a printing machine . in addition , they tend to oxidize and cause discoloration of the ink or toner product . by using stoichiometric amounts of the amines under the conditions described above , these disadvantages are avoided at the same time that the costs of additional amine and the costs and delays of amine and / or solvent removal process steps are avoided . thus , for example , with quinizarin and / or leucoquinizarin , the molar ratio of amine reactant to anthraquinone reactant is preferably from about 0 . 5 : 1 to about 2 : 1 , such as from about 1 : 1 to about 2 : 1 . a molar ratio of about 2 : 1 favors the formation of a cyan colored dye ( which is mainly a diamine substituted - 9 , 10 anthraquinone ); a molar ratio of 1 . 5 : 1 favors a royal blue - colored dye ( which is a mixture of monoamine and diamine - substituted - 9 , 10 - anthraquinone ; a molar ratio of 1 : 1 favors the formation of a purple - colored dye ( which is mainly a monoamine substituted - 9 , 10 - anthraquinone ). colorant compounds of the present invention may be combined with other colorants in making an ink or toner composition . for example , it may be desirable for certain applications to combine the present colorant or colorants with one or more polymeric dyes as described in u . s . pat . no . 5 , 621 , 022 or conventional phase change ink colorants such as those described in u . s . pat . nos . 4 , 889 , 560 and 5 , 372 , 852 , which are hereby incorporated by reference in their entirety . furthermore , one or more anthraquinone colorants of the present invention ( either with or without other colorants present ) may be combined with conventional ink or toner particle components , including but not limited to toner resins , charge control agents , flow agents and the like and phase change ink carrier components such as amide waxes ( e . g ., tetra - amide compounds , hydroxyl - functional tetra - amide compounds , mono - amides , hydroxyl - functional mono - amides ), resinous components ( e . g ., urethane and urea resins , mixed urethane / urea resins ), tackifiers , toughening agents , hardeners , adhesion promoters , plasticizers , antioxidants , viscosity reducing agents such as those disclosed in u . s . pat . nos . 4 , 889 , 560 ; 4 , 889 , 761 ; 5 , 372 , 852 ; 5 , 621 , 022 ; 5 , 700 , 851 ; 5 , 750 , 604 ; 5 , 780 , 528 ; 5 , 782 , 966 ; 5 , 783 , 658 ; 5 , 827 , 918 ; and 5 , 830 , 942 , each of which is hereby incorporated by reference in its entirety , and the like . the preferred amounts of each colorant and its components will depend upon the particular end use application . for example , some colorants of the invention can be used alone in applications such as phase change ink printing , where they have a melting temperature and a viscosity at the jetting temperature that closely parallel those of other phase change inks ( e . g ., a viscosity of 11 - 13 cps at 140 ° c .). this can provide sharp images with a relatively low volume of ink , with various attendant benefits . on the other hand , they can also provide good coloration in amounts of one percent or less by weight with other ink or toner components . thus amounts such as 0 . 5 - 10 wt %, 1 - 5 wt . % or 1 - 2 wt . % are desirable for some applications . inks and toners of the invention may be used to form images in printing and xerographic processes as described above , and in other ways . for example , inks of the invention may be used as phase change inks in ink jet printing devices , wherein they are melted and droplets of them are ejected directly onto a substrate , or onto an intermediate transfer member such as a drum or belt and then transferred to a substrate . toner particles of the invention may similarly be electrostatically attracted to an imaging member such as a photoreceptor or the like and transferred directly or through an intermediate transfer member , and fused to the substrate by pressure and / or heat . the following examples are presented to illustrate the invention and to be illustrative of the formulations that can successfully be employed , without any intent to limit the invention to the specific materials , processes or structures employed . all parts and percentages are by weight and all temperatures are degrees celsius unless explicitly stated otherwise . to a 1000 ml four - neck resin kettle equipped with a trubore ™ stirrer and thermocouple - temperature controller , n 2 atmosphere , and vacuum adapter were added about 25 . 0 grams ( 0 . 103 moles ) of leucoquinizarin , 1 about 75 . 0 grams ( 0 . 313 moles ) of quinizarin , 2 and about 223 . 7 grams ( 0 . 831 moles ) of octadecyl amine 3 and stirred thoroughly . the mixture was carefully heated to 90 ° c . with n 2 atmosphere , at which time it became molten and agitation was begun . after 2 . 5 hours at 90 ° c ., n 2 addition was stopped , vacuum was introduced to the reaction vessel and the temperature was increased to 100 ° c . after 30 minutes the vacuum was removed and n 2 re - introduced , and the temperature was maintained at 100 ° c . for 1 hour . a sample was taken and an absorbance ratio at 600 and 650 ums measured , in toluene , using a perkin elmer lambda 2s uv / vis spectrophotometer . the ratio was less than the desired 0 . 90 and there was little to no absorbance in the 450 - 500 nm range . the n 2 atmosphere was removed and air ( containing o 2 ) was vigorously blown into the reaction vessel to ensure complete oxidation . after 2 hours the spectral strength and absorbance ratio were measured on a sample and indicated that the reaction was complete . the final product was a blue solid wax at room temperature characterized by the following physical properties : viscosity of about 10 . 8 cps as measured by a ferranti - shirley cone - plate viscometer at about 140 ° c ., and a spectral strength of about 20 , 900 milliliters · absorbance units per gram at lambda max as measured in toluene using a perkin elmer lambda 2s uv / vis spectrophotometer . the final product is believed to be the compound having the chemical formula iii shown above : 3 armeen 18d flk — octadecyl amine available from akzo nobel chemicals inc . of mccook , ill . to a 140 ml beaker equipped with a teflon ™ coated magnetic stir bar and placed in a silicone oil bath on a stirring hot plate were added about 12 . 1 grams ( 0 . 05 moles ) of leucoquinizarin , 1 about 12 . 0 grams ( 0 . 05 moles ) of quinizarin , 2 and about 40 . 4 grams ( 0 . 150 moles ) octadecyl amine 3 and stirred thoroughly . the mixture was carefully heated to 70 ° c . with n 2 atmosphere , at which time it became molten and agitation was begun . after 2 . 0 hours at 70 ° c ., the temperature was slowly increased to 115 ° c . over 1 hour and held for an additional hour . during this time samples were taken and diluted in toluene and measured in a uv / vis spectrophotometer to monitor reaction completion . n 2 addition was stopped , and an o 2 atmosphere introduced to the reaction vessel , and the temperature was increased to 140 ° c . after 2 hours at 140 ° c ., a sample was taken and an absorbance ratio at 600 and 650 nms measured , in toluene , using a perkin elmer lambda 2s uv / vis spectrophotometer . the ratio was 0 . 927 and there was little to no absorbance in the 450 - 500 range . the spectral strength of about 18 , 020 milliliters absorbance units per gram at lambda max was measured in toluene using a perkin elmer lambda 2s uv / vis spectrophotometer . the final product is believed to be two compounds with the chemical formulae of iii and iv above . 3 armeen 18d flk — octadecyl amine available from akzo nobel chemicals inc . of mccook , ill . to a 500 ml four - neck resin kettle equipped with a trubore ™ stirrer and thermocouple - temperature controller , vacuum adapter , and n 2 atmosphere were added about 30 . 0 grams ( 0 . 125 moles ) of quinizarin 2 and about 49 . 2 grams ( 0 . 183 moles ) octadecyl amine 3 and stirred thoroughly . the mixture was carefully heated to 80 ° c . with n 2 atmosphere , at which time it became molten and agitation was begun . at that time , about 12 . 2 grams ( 0 . 0504 moles ) of leucoquinizarin 1 were added over 30 minutes and the temperature was increased to 90 ° c . with a n 2 atmosphere maintained . after 40 minutes at 90 ° c . the temperature was increased to 100 ° c . after 1 hour at 100 ° c . the temperature was increased to 110 ° c . after about 7 hours at 110 ° c ., the n 2 atmosphere was removed and an o 2 atmosphere introduced . the heating was continued for about 3 hours . a sample was taken and an absorbance ratio at 602 and 561 nms measured , in toluene , using a perkin elmer lambda 2s us / vis spectrophotometer . the final product was a purple solid wax at room temperature characterized by the following physical properties : spectral strength of about 19 , 162 milliliters · absorbance units per gram at lambda max as measured in toluene using a perkin elmer lambda 2suv / vis spectrophotometer . the final product is believed to be the compound having the chemical formula iv above . 3 armeen 18d flk — octadecyl amine available from akzo nobel chemicals inc . of mccook , ill . cyan hybrid ink made from a hybrid ink base and cyan colored substituted anthraquinone dye in a stainless steel beaker were combined 345 . 6 grams of the molten reaction mixture from example 5 from u . s . ser . no . 09 / 023 , 366 , filed feb . 13 , 1998 , 123 . 5 grams of molten polywax pe850 1 ( 250 grams ), 8 . 3 grams of the cyan dye from example 1 and 24 . 3 grams of the urethane / urea resin from example 2 of u . s . pat . no . 5 , 830 , 942 as a viscosity adjuster . the materials were blended by stirring in a temperature controlled mantle for 2 hours at 125 ° c . the ink was then filtered through a heated ( 125 ° c .) mott apparatus ( available from mott metallurgical ) using a # 3 whatman filter paper at 15 psi . the filtered hybrid ink was poured into molds and allowed to solidify to form ink sticks . the final cyan ink product was characterized by following physical properties : viscosity of about 11 . 5 cps at 140 ° c . as measured by a ferranti - shirley cone - plate viscometer , and two melting points at about 91 ° c . and about 105 ° c . as measured by differential scanning calorimetry using a dupont 2100 calorimeter . the tg of this ink was not measured . the spectral strength of the ink was determined using a spectrophotographic procedure based on the measurement of the colorant in solution by dissolving the ink in butanol and measuring the absorbance using a perkin elmer lambda 2s uv / vis spectrophotometer . the spectral strength of the ink was measured as about 340 milliliters · absorbance units per gram at the lambda max of 647 nm . this ink was placed in a phaser 350 printer which uses an offset transfer printing process . the ink was printed using a print head temperature of 140 ° c ., a drum temperature of 60 ° c . and a paper preheat temperature of 60 ° c . the finished cyan prints were found to have the following cielab color values : 1 polywax pe850 - polyethylene wax available from baker petrolite co . of tulsa , okla . black hybrid ink made from a polycarbonate - modified hybrid ink base , blue colored substituted anthraquinone dye and commercial red and orange dyes in a stainless steel beaker were combined 135 grams of the polycarbonate - modified resin from example 11 of u . s . pat . application ser . no . 09 / 023 , 851 , 166 . 7 grams of polywax pe850 1 and 141 grams of s - 180 amide wax , 2 22 . 9 grams of the royal blue dye from example 2 , 1 . 03 grams of solvent red 195 3 dye and 2 . 28 grams of disperse orange 47 4 dye . the materials were melted by placing them in a 135 ° c . oven overnight , then blended by stirring in a temperature controlled mantle for 2 hours at 125 ° c . the ink was then filtered through a heated ( 125 ° c .) mott apparatus ( available from mott metallurgical ) using a # 3 whatman filter paper at 15 psi . the filtered hybrid ink was poured into molds and allowed to solidify to form ink sticks . the final black ink product was characterized by the following physical properties : viscosity of about 12 . 9 cps at 140 ° c . as measured by a ferranti - shirley cone - plate viscometer , and two melting points at about 91 ° c . and about 105 ° c . as measured by differential scanning calorimetry using a dupont 2100 calorimeter . the tg of this ink was not measured . the spectral strength of the ink was determined using a spectrophotographic procedure based on the measurement of the colorant in solution by dissolving the ink in butanol and measuring the absorbance using a perkin elmer lambda 2s uv / vis spectrophotometer . the spectral strength of the ink measured as about 1100 milliliters absorbance units per gram at the lambda max of 599 nm . this ink was placed in a phaser 340 printer which uses an offset transfer printing process . the ink was printed using a print head temperature of 140 ° c ., a drum temperature of 60 ° c . and a paper preheat temperature of 60 ° c . the finished black prints were found to have the following cielab color values . 1 polywax pe850 - polyethylene wax available from baker petrolite co . of tulsa , okla . 2 kemamide s - 180 - stearyl stearamide available from witco chemical company of memphis , tenn . 3 solvent red 195 - solvaperm red bb available from clariant gmbh , fra { overscore ( n )} kfurt , germany . 4 disperse orange 17 - macrolex orange r available from keystone inc ., chicago , ill . black hybrid ink made from a polycarbonate - modified hybrid ink base , blue colored substituted anthraquinone dye , violet colored substituted anthraquinone dye and commercial and orange dye in a stainless steel beaker were combined 135 grams of the polycarbonate - modified resin from example 11 of u . s . pat . application ser . no . 09 / 023 , 851 , 117 . 3 grams of polywax pe850 1 and 141 grams of s - 180 amide wax , 2 16 . 7 grams of the blue dye from example 2 , 8 . 3 grams of the violet dye from example 3 , and 2 . 72 grams of disperse orange 47 3 dye . the materials were melted by placing them in a 135 ° c . oven overnight , then blended by stirring in a temperature controlled mantle for 2 hours at 125 ° c . the ink was then filtered through a heated ( 125 ° c .) mott apparatus ( available from mott metallurgical ) using a # 3 whatman filter paper at 15 psi . the filtered hybrid ink was poured into molds and allowed to solidify to form ink sticks . the final black ink product was characterized by the following physical properties : viscosity of about 12 . 2 cps at 140 ° c . as measured by a ferranti - shirley cone - plate viscometer , and two melting points at about 91 ° c . and about 105 ° c . as measured by differential scanning calorimetry using a dupont 2100 calorimeter . the tg of this ink was not measured . the spectral strength of the ink was determined using a spectrophotographic procedure based on the measurement of the colorant in solution by dissolving the ink in butanol and measuring the absorbance using a perkin elmer lambda 2s uv / vis spectrophotometer . the spectral strength of the ink was measured as about 1182 milliliters * absorbance units per gram at the lambda max of 599 nm . this ink was placed in a phaser 340 printer which uses an offset transfer printing process . the ink was printed using a print head temperature of 140 ° c ., a drum temperature of 60 ° c . and a paper preheat temperature of 600c . the finished 1 polywax pe850 - polyethylene wax available from baker petrolite co . of tulsa , okl . 2 kemamide s - 180 - stearyl stearamide available from witco chemical company of memphis , tenn . 3 disperse orange 47 - macrolex orange r available from keystone inc ., chicago , ill . while the invention has been described above with reference to specific embodiments thereof , it is apparent that many changes , modifications , and variations can be made without departing from the inventive concept disclosed herein . accordingly , the spirit and broad scope of the invention is intended to embrace all such changes , modifications and variations that may occur to one reading the disclosure . all patent applications , patents and other publications cited herein are hereby incorporated by reference in their entirety . | 2 |
in exemplary embodiments , the systems and methods described include wafer bonding to create buried metal layers and metallic through - vias . the systems and methods described herein are implemented to reduce or eliminate chip modes , and in addition can provide cross - talk isolation between rf structures . it has been determined that existing chip modes can be reduced or eliminated by either quenching the mode by building metallic structures into the chip in order to disrupt the mode , or by isolating the structures in a faraday cage in order to shield the structures from the chip modes . incorporation of dielectrics into the fabrication sequence can lead to reduction in the coherence time of the qubits and should be avoided , as further described herein . as described herein , superconducting transmon quantum computing test structures often exhibit significant undesired cross - talk . for experiments with only a handful of qubits this cross - talk can be quantified and understood , and therefore corrected . as quantum computing circuits become more complex , and thereby contain increasing numbers of qubits and resonators , it becomes more vital that the inadvertent coupling between these elements is reduced or eliminated . the task of accurately controlling each single qubit to the level of precision required throughout the realization of a quantum algorithm is difficult by itself , but coupled with the need of nulling out leakage signals from neighboring qubits or resonators would quickly become impossible . for example in one realization of a superconducting qubit circuit used for quantum calculations , each qubit has four neighbors and operations between four different pairs . if there is poor isolation , then each qubit is potentially also talking to qubits one hop away , up to nine total qubits . in another example , each qubit is an oscillator with a resonating frequency , that ideally resonates indefinitely ( i . e ., has an ideal coherence ). for the case in which crosstalk occurs via chip modes , this communication is not nearest neighbor , but rather is non - local so that qubits which are widely separated can communicate with each other . correcting for this situation would quickly become intractable as the size of the quantum circuit increases . a second issue exists in that if the qubit communicates to chip modes , then each communication is an energy transfer that can de - phase or reduce amplitude of the resonant frequency ( i . e ., a reduction in t 1 and t 2 ). as such , there is a reduction in the coherence time of the qubit if it couples into a chip mode . in quantum computing , coherence times are preserved in order to perform proper calculations . in exemplary embodiments , the systems and methods described herein address these issues by selectively placing vias having metal fillings that are coupled to a buried metal surface . the locations of the vias are selected based on where modes of a subsequently fabricated qubit circuit will reside on a surface of the substrate in which the vias are disposed . in exemplary embodiments , modeling of the qubit circuit enables selection of locations of the vias . in operation , when the qubit circuit couples to chip modes , the modes conduct into the metal fillings and are shorted into the buried metal surface . thus the modes are killed . in exemplary embodiments , the modes have wavelengths longer than distances between the vias . in exemplary embodiments , the locations of the vias can also be selected to isolate individual devices in the qubit circuit , thereby placing vias around the devices so that modes are kept isolated between the vias and then shorted to the buried metal layer . several embodiments of implementation of metallic through - vias coupled with buried metal ground planes can be implemented to both quench chip modes and to isolate rf components from these modes . the systems and methods described herein provide improvement in qubit coherence as well as increased cross - talk immunity for rf devices on the chip . by implementing wafer bonding to create a buried metal layer , advantages of via methods are obtained with ground backplane to isolate key circuit components and in addition other advantages are opened up as well including the ability to pattern the back metal layer ( bml ) and also incorporate structures into the second wafer which can be used for addressing rf structures . several embodiments are now described . fig1 illustrates a flowchart of a method 100 for fabricating a chip - surface base onto which qubit circuits can be manufactured . the base provides chip mode isolation and cross - talk reduction through buried metal layers and through - vias . fig2 illustrates a first substrate 200 . at block 105 , the first substrate 200 is prepared for processing . in exemplary embodiments , the first substrate 200 is selected to reduce dielectric loss tangent at low temperatures . the first substrate 200 is also selected to be a material which can be etched selectively to the superconducting and dielectric material to be used for subsequent qubit circuit fabrication . for example , high resistivity si wafers may be implemented . fig3 illustrates the substrate 200 with etched vias 205 . at block 110 , the vias 205 are etched into the substrate . any suitable photolithography techniques can be implemented to pattern the vias 205 . in addition , any suitable etching techniques can be implemented including , but not limited to , plasma - enhanced chemical vapor deposition ( pecvd ) for insulator deposition . for example , a reactive ion etching ( rie ) for etching samples and spinners to coat silicon chips and wafers with lithographic resist may be used . in addition , any etch alignment features for latter processing can be performed at block 110 . fig4 illustrates the vias 205 filled with metal fillings 210 ( e . g ., a superconducting material such as but not limited to aluminum ( al )). at block 115 , the metal fillings 210 are deposited into the vias 205 . in exemplary embodiments , the lengths of the metal fillings 210 are in the range of 50 - 160 microns . the first substrate can be polished to ensure a flush surface and that the metal fillings 210 are exposed . fig5 illustrates the first substrate 200 with metal fillings 210 and a second substrate 220 . in exemplary embodiments , a metal layer 225 can be deposited on the second substrate 220 . a metal layer 201 can also be deposited on the first substrate 200 over the metal fillings 210 . at block 120 , the second substrate 220 is prepared . in exemplary embodiments , the second substrate 220 is selected to reduce dielectric loss tangent at low temperatures . for example , high resistivity si wafers may be implemented . the second substrate 220 is also selected to be a material which can be etched selectively to the superconducting and dielectric material to be used for subsequent qubit circuit fabrication . as described herein metal layers 201 , 225 can be deposited on one or both of the first and second substrates 200 , 200 respectively . the metal layers 201 , 225 are preferably the same material as the metal fillings 210 . fig6 illustrates the first and second substrates 200 , 220 bonded to one another . at block 125 the first and second substrates 200 , 220 are bonded together with a low - temperature anneal . at block 130 , the surface of the first substrate 200 is polished to fully expose the vias . subsequent fabrication , shone at block 135 , includes fabricating a qubit circuit 290 atop the first substrate , along with other resonators and top metallization . as described herein , the metal fillings 210 are positioned with the subsequent qubit circuit 290 in mind , and placed where the modes of the qubit circuit will reside . in this way , the metal fillings 210 conduct the modes and short the modes to the now buried metal layers 201 , 225 , thereby suppressing the modes from leaking to other qubit circuits . fig7 illustrates a flowchart of another method 700 for fabricating a chip surface base onto which qubit circuits can be manufactured . the base provides chip mode isolation and cross - talk reduction through buried metal layers and through - vias . fig8 illustrates a first and second substrate 800 , 820 . at block 705 , the first and second substrates 800 , 820 are prepared for processing . in exemplary embodiments , the first and second substrates 800 , 820 are selected to reduce dielectric loss tangent at low temperatures . the first and second substrates 800 , 820 are also selected to be a material which can be etched selectively to the superconducting and dielectric material to be used for subsequent qubit circuit fabrication . for example , high resistivity si wafers may be implemented . in exemplary embodiments , metal layers 801 , 825 can be deposited on the first and second substrates 800 , 820 respectively . as described herein metal layers 801 , 825 can be deposited on one or both of the first and second substrates 800 , 820 respectively . fig9 illustrates the first and second substrates 800 , 820 bonded to one another . at block 710 the first and second substrates 800 , 820 are bonded together with a low - temperature anneal . fig1 illustrates the substrate 800 with etched vias 805 . at block 715 , the vias 805 are etched into the substrate . any suitable photolithography techniques can be implemented to pattern the vias 805 . in addition , any suitable etching techniques can be implemented including , but not limited to , plasma - enhanced chemical vapor deposition ( pecvd ) for insulator deposition . for example , a reactive ion etching ( rie ) for etching samples and spinners to coat silicon chips and wafers with lithographic resist may be used . in addition , any etch alignment features for latter processing can be performed at block 715 . fig1 illustrates the vias 805 filled with metal fillings 810 ( e . g ., a superconducting material such as but not limited to aluminum and preferably the same material as the metal layers 801 , 825 ). at block 720 , the metal fillings 810 are deposited into the vias 805 . in exemplary embodiments , the lengths of the metal fillings 810 are in the range of 50 - 160 microns . at block 725 , the surface of the first substrate 800 is polished to fully expose the vias . subsequent fabrication includes fabricating a qubit circuit atop the first substrate , along with other resonators and top metallization . as described herein , the metal fillings 810 are positioned with the subsequent qubit circuit in mind , and placed where the modes of the qubit circuit will reside . in this way , the metal fillings 810 conduct the modes and short the modes to the now buried metal layers 801 , 825 , thereby suppressing the odes from leaking to other qubit circuits . it can be appreciated that an implementation of a combination of buried metal layers with connected vias form isolation cage for rf structures on chip surface . the systems and methods described herein have an absence of dielectrics in buried layers which prevent a reduction in coherence times . additional layers can be implemented to allow bonding ( i . e ., adhesion layers ). all metallization procedures described herein are patterned in order to isolate grounds and prevent mode coupling between devices . the methods described herein can include rie end - pointing on al coatings . in addition , the methods can include incorporation of wiring and structures into the bonding substrate wafer . this can be used for wiring between structures and provide access to the rf structures on the primary wafer . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one more other features , integers , steps , operations , element components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated the flow diagrams depicted herein are just one example . there may be many variations to this diagram or the steps ( or operations ) described therein without departing from the spirit of the invention . for instance , the steps may be performed in a differing order or steps may be added , deleted or modified . all of these variations are considered a part of the claimed invention . while the preferred embodiment to the invention had been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the invention first described . | 6 |
this invention will now be described in more detail , but it should be understood that this description is not be construed as limiting the invention in any way . here , a is a sugar residue . this sugar may be a monosaccharide , oligosaccharide or polysaccharide , but it is preferably a monosaccharide . examples of this monosaccharide are hexoses such as glucose , galactose and n - acetylglucosamine , and pentoses such as l - arabinoside and xylose , but aldopyranose is preferred . pyranoses may be α or β . examples of the aldopyranose are α - d - glucose , α - d - galactose , α - d - mannose , β - d - glucose , β - d - galactose , β - d - mannose , p - nitrophenyl - α - d - glucopyranoside , p - nitrophenyl - α - d - galactopyranoside , p - nitrophenyl - α - d - mannopyranoside , p - nitro phenyl - β - d - glucopyranoside , p - nitro phenyl - β - d - galactopyranoside and p - nitrophenyl - β - d - mannopyranoside . however , the aldopyranose is preferably glucopyranose or galactopyranose . the residue is a residue obtained by removing the hydrogen atom from any of the hydroxyl groups of the sugar , and preferably , is a residue obtained by removing the hydrogen atom from any of the hydroxyl groups bonded to the six - member ring of aldopyranose . r in the aforesaid chemical formula is an alkyl group . this alkyl group may be straight chain or branched , but straight chain is preferred . the number of carbon atoms is preferably 6 - 20 , but more preferably 10 - 20 . the hydrogelatinizer of this invention can solidify a large amount of water with a small amount of solid gelatinizer , and due to its ability to function as a water retention agent ( water retention agent for desert greenification or plant cultivation ), as a water absorbent ( pet tray urine absorber or physiological water absorber ) and as an alcohol - retaining agent since it also solidifies small amounts of alcohol components , it can solidify fuel solids , organic solvents and oils . it may be used as a household oil caking agent , heavy oil solidifying agent or organic effluent solidifying agent , and as it is a flexible material containing a large amount of water , it has potential application as a biological compatibility material , tissue / cell culture matrix , or biological material separator of proteins and nucleic acids . in the following examples , the gelatinizer of this invention was manufactured , and its agglomerating properties in water were analyzed by ef - tem ( transmission electron microscope with energy filter ) ( nakazawa , i . ; masuda , m . ; okada , y . ; hanada , t . ; yase , k . ; asai , m . ; shimizu , t . langmuir 1999 , 15 , 4757 . ), nmr , ft - ir and xrd . p - nitrophenyl - β - d - glucopyranoside ( tokyo chemical industries ) ( 250 mg ) was dissolved in a methanol / tetrahydrofuran mixed solvent ( 20 ml / 5 ml ), and 10 % palladium carbon ( 250 mg ) was added to this solution . hydrogen gas was introduced under a nitrogen gas atmosphere into the reaction solution at room temperature for 3 hours . the reaction mixture was filtered to remove palladium carbon , the filtrate was evaporated under vacuum , and solidified . this residue was purified by silica gel chromatography using a tetrahydrofuran / chloroform mixed solvent ( 1 / 1 , volume ratio ) as an eluant , and p - aminophenol - β - d - glucopyranoside was obtained . yield 80 - 90 %; 1 h - nmr ( 300mhz , dmso - d6 ): δ = 3 . 44 - 4 . 10 ( m , 6h ), 4 . 76 ( s , 2h ), 5 . 25 - 5 . 31 ( m , 3h ), 5 . 60 ( s , 1h ), 6 . 70 ( d , j = 9 . 0 hz , 2h ), 6 . 95 ( d , j = 9 . 0 hz , 2h ), 7 . 37 - 7 . 46 ( m , 5h ); ft - ir ( kbr ): ν = 3312 , 2909 , 1635 , 1510 , 1364 , 1217 , 1089 , 1005 , 1035 , 999 , 806 , 706 cm − 1 ; ms ( nba ): m / z : 360 [ m + h ] + ; elemental analysis calcd (%) for c 19 h 21 no 6 : c 63 . 50 , h 5 . 89 , n 3 . 90 ; found : c 63 . 18 , h 6 . 04 , n 3 . 78 . the p - aminophenol - β - d - glucopyranoside ( 250 mg ) thus obtained was dissolved in tetrahydrofuran ( 20 ml ), and lauroyl chloride ( 300 mg ) and triethylamine ( 1 . 0 g ) were added . the reaction mixture was refluxed for 5 hours . the reaction solution was filtered to remove solids , and the filtrate was evaporated under vacuum to give a dry solid . the residue was purified by silica gel chromatography using a tetrahydrofuran / chloroform mixed solvent ( 1 / 1 , volume ratio ) as an eluant , and dodecanoylaminophenol - β - d - glucopyranoside was thus obtained . yield 80 %; 1 h - nmr ( 300 mhz , cdcl 3 ): δ = 0 . 9 ( t , 3h ) , 1 . 5 - 3 . 0 ( m , 15h ), 3 . 50 - 4 . 13 ( m , 6h ), 4 . 76 ( s , 2h ), 5 . 25 - 5 . 31 ( m , 3h ), 5 . 63 ( s , 1h ), 6 . 70 ( d , j = 9 . 0 hz , 2h ), 6 . 98 ( d , j = 9 . 0 hz , 2h ), 7 . 30 ( d , 2h ) ; ft - ir ( kbr ): ν = 3340 , 2912 , 1630 , 1510 , 1364 , 1217 , 1089 , 1005 , 1035 , 999 , 806 , 706 cm − 1 ; ms ( nba ): m / z : 452 . 27 [ m + h ] + ; elemental analysis calcd (%) for c 24 h 37 no 7 : c 63 . 84 , h 8 . 26 , n 3 . 10 ; found : c 62 . 15 , h 8 . 37 , n 3 . 30 an identical procedure was performed using p - nitrophenyl - β - d - galactopyranoside ( tokyo chemical industries ) instead of p - nitrophenyl - β - d - glucopyranoside of example 1 , and p - aminophenyl - β - d - galactopyranoside was thus obtained . further , an identical procedure was performed using the p - aminophenyl - β - d - galactopyranoside obtained herein instead of the p - aminophenyl - β - d - glucopyranoside of example 1 , and dodecanoylaminophenol - β - d - galactopyranoside was thus obtained . yield 90 %; 1 h nmr ( 300 mhz , cdcl 3 ): δ = 0 . 9 ( t , 3h ), 1 . 5 - 3 . 0 ( m , 15h ), 3 . 50 - 4 . 13 ( m , 6h ), 4 . 76 ( s , 2h ), 5 . 25 - 5 . 31 ( m , 3h ), 5 . 63 ( s , 1h ), 6 . 70 ( d , j = 9 . 0 hz , 2h ), 6 . 98 ( d , j = 9 . 0 hz , 2h ), 7 . 30 ( d , 2h ); ft - ir ( kbr ): ν = 3340 , 2912 , 1630 , 1510 , 1364 , 1217 , 1089 , 1005 , 1035 , 999 , 806 , 706 cm − 1 ; ms ( nba ): m / z : 452 . 27 [ m + h ] + ; elemental analysis calcd (%) for c 24 h 37 no 7 : c 63 . 84 , h 8 . 26 , n 3 . 10 ; found : c 63 . 15 , h 8 . 25 , n 3 . 15 . the dodecanoylaminophenol - β - d - glucopyranoside and dodecanoylaminophenol - β - d - galactopyranoside ( 1 mg of each ) obtained in the above experiments were respectively weighed out into test tubes , and a mixed solvent of water ( 900 mg ) and methanol ( 100 mg ) was added . the mixture was heated to ensure complete dissolution . subsequently , it was gradually cooled , and left at room temperature for approximately 2 - 5 hours . a hydrated gel which did not collapse even when inverted , was obtained . the solvent was water ( including a small amount of methanol and ethanol ), methanol , ethanol , 1 - butanol , t - butanol , tetrahydrofuran , chloroform , dichloromethane , n - hexane , ethyl acetate , dimethylformamide or dimethyl sulfoxide . one of the aforesaid solvents was mixed in a test tube wherein the two types of gelatinizer prepared in the examples were sealed such that the concentration of gelatinizer was 0 . 1 - 3 . 0 wt %, and this mixture was heated until the solids dissolved . the resulting solution was cooled to 25 ° c . for one hour . the gelatinizer and solvent were introduced into a test tube capped by a diaphragm , and heated in the oil bath until the solids dissolved . this solution was cooled to 25 ° c . at this stage , the formation of a stable gel was observed for the solvents 1 - butanol , t - butanol , tetrahydrofuran , chloroform , dichloromethane , n - hexane , ethyl acetate , dimethylformamide , dimethyl sulfoxide and water , but it dissolved in the case of methanol and ethanol . it is extremely interesting that water containing a small amount of alcohol ( approximately 1 wt %, corresponding to 5000 or more molecules per molecule of gelatinizer ), was gelated by the gelatinizer of this invention at a concentration of 0 . 1 wt % or less . these results show that the gelatinizer of this invention is an amphoteric gelatinizer agent which works on both water and organic solvents . fig1 - 3 show ef - tem and sem images of an aqueous gel produced by the gelatinizer of this invention for the purpose of visually observing chiral aggregation produced by the sugar part . fig1 and fig3 are typical photographs of an aqueous gel produced by the gelatinizer of this invention . these photographs clearly show that this gelatinizer is formed of a 3 - dimensional network comprising creased fibres having a diameter of 20 - 500 nanometers . from the sem photograph ( fig3 ), it is clear that several ribbon - shaped structures are twisted together to form a left - handed spiral . further , from a tem analysis of the chiral aggregate , it is seen that the fibres are twisted spiral ribbons having a width of approximately 85 nanometers , a pitch of approximately 315 nanometers and length of several micrometers , and that this is specifically left - handed ( fig2 ). these spiral aggregates explain how , instead of a crystal stable to heat , a quasi - stable gel is formed . the 1 h - nmr measurement results for the aqueous gel produced by the gelatinizer of this invention provide further proof that this aqueous gel is a self - aggregate . as shown on the left in fig4 at 27 ° c ., aromatic peaks are observed for the gel phase of the aggregate at 7 . 43 ppm ( d , j = 8 . 61 hz , h b ( for h b , see chemical formula below ) and 7 . 38 ppm ( d , j = 8 . 61 hz , h a ( for h a , see chemical formula below )). due to heating , new peaks eventually appear at 7 . 60 ppm ( d , j = 8 . 61 hz , h b ) and 7 . 28 ppm ( d , j = 8 . 61 hz , h a ), and the peaks at 7 . 43 ppm and 7 . 38 ppm disappear . the difference in the chemical shifts of the aromatic protons h a , h b is probably due to π - π stacking and hydrogen bonding . this can be explained in view of the fact that the induction effect of the hydrogen bond is too large , and the shift of h a ( to higher field ) due to π - π stacking interactions cannot be cancelled out . an identical phenomenon was observed in the aromatic proton at the c - 1 position of the sugar part ( fig4 right ). the fact that different spectra were observed for aggregates and non - aggregates shows that chemical substitution is slower than the time scale of nmr . this is the first time stabilization of an aggregate by hydrogen bonding and π - π stacking interactions in the gel phase have been observed on a 1 h - nmr spectrum , and strongly supports the idea that aromatic units lead to increased structural strength and assist the formation of the aqueous gel . as it is extremely difficult and almost impossible to obtain useful information regarding intramolecular hydrogen bonding in an aqueous gel from ft - ir observations , the inventors obtained proof of intramolecular hydrogen bonding in a d 2 o system . the ft - ir spectrum of the aqueous gel incorporating deuterium is characterized by absorption bands at 1645 cm − 1 (— c ═ o , amide 1 ) and 1514 cm − 1 (— nh , amide ii ). further , ir bands were observed at 3398 cm − 1 (— oh ), 3298 cm − 1 (— nh ) and 1658 cm − 1 (— c ═ o ) with identical results in a cyclohexane gel . these results show that the amide groups in the aqueous gel not only form intramolecular hydrogen bonds in the gel phase , but confer a stronger hydrogen bonding effect than in a cyclohexane gel . recently , there have been several reports of x - ray crystallography techniques used to confirm molecular packing of the gelatinizer in the gel phase , and these are being used to clarify the gelatinizing mechanism of low molecular weight gelatinizers ( terech , p . ; weiss , r . g . chem . rev . 1997 , 3313 . : hanabusa , k . ; matsumoto , m . ; kimura , m . ; kakehi , a . ; shirai , h . j . colloid interface sci . 2000 , 224 , 231 . : abdallah , d . j . ; sirchio , s . ; weiss , r . g . langmuir 2000 , 16 , 7558 . : sakurai , k . ; ono , y . ; jung , j . h . ; okamoto , s . ; sakurai , s . ; shinkai , s . j . chem . soc ., perkin trans . 2 2001 , 108 .) . however , the relation between the molecular packing and physical gelatinizing properties of the gelatinizer molecules is still not well understood . the xerogel of this invention obtained from water by a freezing method gives a sponge - like aggregate , and it is not a typical crystal . from x - ray diffraction of the xerogel , the inventors obtained information regarding the type of molecular packing of the gelatinizer molecules in an ordered gel . the diffraction pattern of the xerogel of this invention shows a periodic diffraction peak ( fig5 ), and shows that this xerogel is actually aggregated in a lamellar structure . the intervals ( d ) of the aggregate obtained by the xrd method are approximately 2 . 90 nanometers , 1 . 46 nanometers and 0 . 97 nanometers . these are almost precisely in a ratio of 1 : 1 / 2 : 1 / 3 , are shorter than twice the molecular length of the gelatinizer ( according to the cpk molecular model , 2 . 45 nanometers ), and longer than one molecule . the peak at 2 . 90 nanometers observed in the xerogel , was observed also in the gel state ( fig6 ). these results strongly suggest that the aqueous gel of this invention has a bimolecular interdigitation film structure having a molecular film corresponding to the ( 100 ) plane of thickness 2 . 90 nanometers ( fig7 ). further , the wide angle x - ray diagram of the aqueous gel of this invention shows a series of sharp reflection peaks , which supports the hypothetical viewpoint that a regular lamellar high density packing is formed due to the interdigitation of hydrophobic interactions . this is the first example where a well - ordered two molecule layer forms an aqueous gel . from the results of xrd , ft - nmr and ft - ir , it is seen that the aqueous gel of this invention is stabilized by a combination of hydrogen bonds , π - π interactions and hydrophobic forces . | 2 |
in a preferred method of implementation , the oxygen and / or ozone molecules that are formed by recombination of the free radicals o . produced in said plasma are re - dissociated . it is thus possible to increase the density of uncharged active species that are distributed over the surface of the strip independently of the electric field , further improving the uniformity of the treatment . this re - dissociation may be carried out by means of uv radiation of suitable wavelength , which allows the ozone produced by recombination away from the cold arcs to dissociate into molecular oxygen and into the radical o . in another preferred method of implementation , a sinusoidal voltage , the frequency of which is between and 100 khz , is applied in order to initiate the discharge . indeed , this type of voltage results in the almost continuous presence of active species in the inter - electrode space , thereby making it possible to achieve high kinetic yields . in another preferred method of implementation , the energy dissipation in the discharge is less than 40 w / cm 2 and the voltage applied in order to initiate the discharge is less than 4 . 4 kv . the present inventors have in fact found that the inhibiting effects due to the polymerization of the oil are greater the higher the applied voltage and that the surface treatment is nonuniform . this is because the oxidation and elimination of the oil take place essentially at the point where the discharges impact on the strip , whereas the oil polymerizes away from these more intense glow channels . increasing the voltage across the terminals of the discharge results in an increase in the energy of the electrons that all the more easily initiate the polymerization of the oil . the process according to the invention may furthermore have the following features , individually or in combination : the voltage applied in order to initiate the discharge is sinusoidal ; the material is in the form of a running strip and the various steps of the process are carried out continuously by means of installations placed in succession along the path of the running strip ; one of the faces of the material is treated followed by the other ; the material to be treated is a metallic material , preferably a carbon steel ; and the process is carried out in order to degrease the surface of metallic materials , prior to a coating being deposited on this surface . a second subject of the invention consists of an installation which comprises at least one module comprising a treatment chamber , means for setting the pressure inside said chamber to a value between 10 mbar and 1 bar , means for making said grounded strip run through said chamber , a series of dielectric - covered electrodes placed so as to face that surface of said strip to be treated , these electrodes being connected to a sinusoidal high - voltage generator , means for supplying said chamber with gas and means for extracting from said chamber the gases resulting from the decomposition of the organic substance coating the strip . in a preferred embodiment , said installation comprises a succession of an even number of said modules , through which said strip runs in succession , exposing in turn one of its faces to the electrodes of said modules . in another preferred embodiment , said installation furthermore includes uv emission lamps placed between said electrodes . the invention will be illustrated by the description of two embodiments given by way of indication , but implying no limitation , with reference to the appended drawings in which : fig1 shows a schematic view of a treatment installation according to the invention ; fig2 shows a schematic view of a treatment installation according to the invention for a successive treatment of the two faces of a material in the form of a running strip ; fig3 a and 3b show two images of surfaces of strip treated in the presence of uv irradiation ( fig3 b ) and without said irradiation ( fig3 a ); fig4 demonstrates the increase in density of the oxygen radicals during the additional application of uv radiation at 253 nm ; fig5 shows the dependence of the oxygen radical density as a function of the intensity i of the current applied in the discharge ; fig6 shows the change in protective oil coating weight present on a strip as a function of the electron dose it / s which is applied to it ; and fig7 shows the auger electron spectrum of the surface of a strip degreased using a discharge involving an electron dose of 21 mc / cm 2 . fig1 shows a diagram of an installation according to the invention for implementing the process according to the invention , in order to treat a metal strip made for example of carbon steel . this installation comprises a module 1 consisting of a treatment chamber 2 in which there is a cooled roll 3 around which the metal strip 4 runs . the roll 3 and the strip 4 are grounded . pumps ( not shown ) allow the pressure inside this chamber 2 to be set to a value between 10 mbar and 1 bar . electrodes 5 a , 5 b , 5 c , 5 d , 5 e , 5 f and 5 g covered with a dielectric ( alumina ) are placed so as to face the strip 4 . these electrodes 5 a , 5 b , 5 c , 5 d , 5 e , 5 f and 5 g are connected to the high voltage supplied by a medium - frequency sinusoidal generator 6 ( the frequencies being between 10 and 100 khz ). the high - voltage electrodes 5 a , 5 b , 5 c , 5 d , 5 e , 5 f and 5 g are also cooled . in order to optimize the energy invested in the discharge , the fixing of the high - voltage electrodes 5 a , 5 b , 5 c , 5 d , 5 e , 5 f and 5 g allows the inter - electrode distance to be varied . the module also includes means for supplying said chamber with gas , and means for extracting from said chamber the gases resulting from the decomposition of the organic substance coating the strip 4 ( these means not being shown ). in this particular embodiment , uv lamps 7 a , 7 b , 7 c , 7 d , 7 e and 7 f are placed between the high - voltage electrodes 5 a , 5 b , 5 c , 5 d , 5 e , 5 f and 5 g so as , on the one hand , to allow the treatment at the discharge to be made uniform and , on the other hand , to allow the ozone , which is formed away from the inter - electrode volume , to dissociate . consequently , the strip 4 may continue to be degreased away from the inter - electrode space by the o . radicals coming from the dissociative absorption of the ozone induced by applying the additional uv ( 253 nm ) radiation . fig2 is a schematic representation of an installation according to the invention that comprises a succession of four modules 10 , 11 , 12 and 13 for carrying out a successive treatment of both faces of a running strip 14 . the four modules 10 , 11 , 12 and 13 are connected together via intermediate components housing the pumping set and the gas injection system , which ensures that the installation is exposed to the stream and therefore ensures that the treatment is uniform , despite the characteristics of the inhomogeneous discharge . trials were carried out on small - sized ( 20 to 25 cm 2 ) strips in static mode , these being coated with a protective oil ( tinnol 200 ® from quaker chemical ) as it was necessary to complete the degrease , in order to simulate a cleaning treatment before coating . the trials were carried out in a dielectric barrier reactor consisting of an electrode covered with a 0 . 7 mm layer of alumina and of a grounded metal electrode over which the strip to be treated is placed . the alumina - covered electrode was connected to the high voltage ( 350 to 4400 v ). the high voltage was delivered by a medium - frequency ( 3 to 30 khz ) sinusoidal generator . the two electrodes were equipped with a cooling system allowing them to remain at temperatures close to ambient temperature during operation of the plasma . the inter - electrode distance may be set between one millimeter and several tens of millimeters . two identical carbon steel strips , coated with a 186 mg / m 2 protective oil layer were treated . the other parameters were identical for the two treatments , namely : 200 mbar of oxygen ; 12 khz sinusoidal voltage ; 3 . 6 kv ; current : 30 ma ; inter - electrode distance : 5 mm . the strip treatments illustrated in fig3 a and 3b differ only by uv radiation being imposed in one case and not in the other . fig3 shows images of the surface of strips treated by a discharge initiated in just oxygen , with ( fig3 b ) and without ( fig3 a ) additional uv ( 253 nm ) irradiation . the dark areas correspond to the non - greased regions where the oil has polymerized . it may be seen that applying uv radiation in addition to the discharge results in less polymerization of the oil , thus allowing better cleaning , in a shorter time . applying uv radiation whose wavelength corresponds to the dissociative absorption of ozone results in the uniform presence of oxygen radicals on the surface of the strip that allow cold combustion of the oil . applying uv radiation in addition to the discharge results not only in a more uniform distribution of the oxygen radicals on the surface of the strip , but it also increases the density of the o radicals , all the discharge parameters ( voltage , frequency of application of the voltage , current , pressure and inter - electrode distance ) remaining constant . fig4 demonstrates the increase in density of the oxygen radicals during application of 253 nm uv radiation by means of optical emission spectroscopy ( oes ). the emission wavelength of the excited oxygen radicals lies at about 777 nm . this figure shows the intensity i 777 of the radiation at 777 nm as a function of time t . the various regions of the graph correspond to the following phases : zone a : no electrical discharge or uv radiation applied . the recorded intensity corresponds to the background noise ; zone b : an electric discharge has been applied in pure oxygen , without uv radiation being applied ; zone c : in addition to the electric discharge , uv radiation at 253 nm has been applied ; zone d : the uv radiation is maintained , but in the absence of electrical discharge ; and zone e : the uv radiation is stopped and the background noise returns . fig5 shows , using optical emission spectroscopy , that the density of active oxygenated species o . varies linearly with the intensity of the current applied in the discharge . the discharge currents plotted in this figure were varied both at constant voltage , by varying the rate of application of the v , and therefore varying the impedance of the dielectric , and at constant frequency by varying the voltage . this fig5 therefore shows that the density of active species depends only on the intensity of the discharge current and is not in any way influenced by the discharge voltage at constant current . this means that it is possible to obtain the same density of active species at power levels that differ only by the imposed voltage , the current remaining constant . however , it has been found that too high a voltage results in polymerization of the oil , which tends to inhibit the rate of oxidation of the organic residues present on the surface of the strip . in addition , industrial application requires the dissipation of a minimal energy density ( less than 40 w / cm 2 · s ) in the discharge . consequently , the discharge conditions needed for degreasing a strip are achieved by maximizing the current for a minimal imposed voltage . the influence of the power of the discharge at constant current on the rate of degreasing is demonstrated in the table below , which combines two tests carried out by varying the frequency of the applied sinusoidal current : it may therefore be seen that , at equal discharge current , and for an identical treatment time , the efficiency of the degreasing is better at lower voltage and therefore at lower power . a 20 cm 2 strip covered with 186 mg / m 2 of protective oil was treated by the process according to the invention . in the present case , the discharge was initiated in a stream of oxygen at a pressure of 350 mbar . the oxygen and / or ozone molecules formed from the recombined free radicals o . were not re - dissociated . fig6 shows the change in coating weight of protective oil present on the strip as a function of the electron dose it / s ( i . e . the electron current density multiplied by the treatment time ). application of the stream allows uniform treatment of the strip , which was confirmed by grazing - incidence infrared absorption spectroscopy ( irras ). fig7 shows the auger electron spectrum of the surface of the strip degreased using a discharge involving an electron dose of 21 mc / cm 2 . only the iron and oxygen peaks are present . the absence of a carbon peak around 273 ev confirms that the strip was completely degreased . | 7 |
referring now to the drawings , and in particular to fig1 thereof , therein illustrated schematically is a recycling oven , generally designated 10 , incorporating ( as illustrated in broken line ) the system of the present invention for rapid air temperature modification , generally designated 12 . in its conventional aspects , the recycling oven includes a cook chamber 20 wherein the food is cooked at least partially by hot air impingement , a blower 22 , a heat exchanger 24 disposed in a path 1 ( or other means for contributing heat to the air traversing path 1 ) and impingement tubes 26 ( or other apertures in the top of the cook chamber 20 ) for introducing streams of hot impingement air into the cook chamber 20 . while the blower 22 is illustrated as being intermediate the cook chamber 20 and the heat exchanger 24 , clearly it may be disposed elsewhere as well -- for example , intermediate the heat exchanger 24 and the impingement tubes 26 . it will be appreciated that the term &# 34 ; heat exchanger &# 34 ; is used broadly to include any means for directly or indirectly heating the air passing therethrough ( e . g ., using burners ). as the overall conventional configuration of a hot air recycling oven is well - known to those skilled in the oven art , further details thereof are not deemed necessary herein . turning now to the novel aspects of the present invention , the system for rapid air temperature modification is illustrated within the dotted line 12 . the system comprises a shell or air conduit having an inlet 32 for receiving a stream of air ( typically hot air which has been cooled somewhat in the cook chamber 20 ) and an outlet 34 for discharging a stream of air ( which enters the impingement tubes 26 for passage into the cook chamber 20 ). associated with the shell are a first path ( labeled path 1 ) and a second path ( labeled path 2 ) disposed intermediate the inlet 32 and the outlet 34 to guide independent streams of air through the shell . a heat exchanger or like heating means 24 is conventionally disposed in the first path for heating a stream of air passing through the first path . the heating means 24 heats the stream of air passing through the first path relative to the stream of air passing through the second path . the stream of air passing through the second path typically passes through a bypass 35 about the heating means 24 and is not intentionally heated at all , although it may receive some heat due to its proximity to the heating means 24 . a mixing chamber 36 is disposed adjacent and before the outlet 34 . the stream of air leaving the first path joins and mixes with the stream of air leaving the second path within the mixing chamber 36 so that a single thermally - uniformed stream of air passes through the outlet 34 . when the blower 22 is disposed in the cutlet 34 , it may also serve as the mixing chamber 36 for mixing the two streams of air . an adjustable baffle 40 is located adjacent to the entrances to the first and second paths in order to vary the ratio of the volumes of the air streams passing through the first and second paths -- e . g ., to selectively limit the volume of air passing through the second path . by controlling the volume of air passing through one path , the remaining volume of air is forced to pass through the other path . control means 42 are provided for adjusting the setting of the adjustable baffle 40 in response to variations in pertinent parameters of the cooking operation . the pertinent activity of the oven which is monitored by the control means 42 and provides the basis for adjustment to the baffle 40 is a change in the temperature of the cooking chamber 20 , a change in the predetermined temperature of the air leaving the outlet 34 or a combination thereof . more particularly , the control means 42 adjust the baffle 40 for maintaining the temperature of the air leaving the outlet 34 at a level according to a predetermined temperature . the control means 42 preferably operates according to two control loops . the first control loop is solely dedicated to maintaining the heat exchanger at a preset temperature higher than the cook chamber temperature . for most foods the preset temperature is about 600 - 850 ° f . but about 300 - 600 ° f . for baked goods . it should be readily apparent to one skilled in the art that alternatively , there may be cases in which the desirability of minimizing oven size and / or peak power input would dictate a smaller heat exchanger running at a higher temperature . in other words , a smaller heat exchanger running at a higher temperature ( e . g ., 1200 ° f .) could supply the same or a substantially larger amount of heat energy to the air passing through it as a larger heat exchanger running at a lower temperature ( e . g ., 650 ° f .). or , a heat exchanger operating at a higher temperature ( e . g ., 1200 ° f .) could be used to store energy for short periods of time to reduce the peak input power requirements of an oven ( e . g ., ( 850 - 850 ° f .). obviously since the preferred cook temperature is independent of the cook chamber size and heat exchanger operating temperature , the air bypass system discussed herein provides a specific means to accomplish delivery of the desired cook temperature , even from a smaller heat exchanger operating at a significantly higher temperature ( e . g ., 1200 ° f .). in a conventional recycling hot air impingement oven , sophisticated controls are necessary to maintain the heat exchanger at a preset temperature because the energy input to the heat exchanger must be varied as the air speed therethrough changes . varying air speed changes result in a varying volume of air within the heat exchanger for heating to a predetermined temperature . this problem is avoided by the present invention because the heat exchanger attempts to maintain a constant preset temperature and any necessary variation in the temperature of the air leaving the outlet 34 is achieved on a real time basis by a baffle or like means for varying the ratio of the volumes of the air streams passing into the first and second paths . of course , over time a resetting of the preset heat exchanger temperature may be required . the second control loop is solely dedicated to maintaining a constant temperature in the cooking chamber 20 , typically 300 to 550 ° f . ( preferably 520 ° f .) and hence at the outlet 34 . the second control loop is responsible for adjusting the baffle 40 to vary the ratio of the volumes of the air streams allowed to travel the two paths , while taking into account the cook settings -- e . g ., the blower speed and , in the case of a hybrid oven , the microwave energy level . preferably , the heat exchanger temperature maintained by the first control loop is set at a much higher level than the cooking chamber temperature , as the air passing therethrough ( and through the first path ) will be mixed with cooler recycled air from the second path prior to entrance to the cook chamber 20 . an advantage of this feature is that it permits the heat exchanger to have a relatively small amount of surface area , relying on the higher temperature of the heat exchanger to transfer the appropriate amount of heat to the passing air . once the heat exchanger reaches the desired temperature , it is left there and the temperature at the outlet 34 ( and hence the temperature in the cook chamber 20 ) is adjusted via the second control loop . as will be apparent to those skilled in the art , the present invention , utilizing a bypass to avoid passage through the heat exchanger , allows the recycling oven to maintain a closed loop -- that is , to avoid having to draw in substantial amounts of cool outside air . the closed loop system is advantageous because of its simple design which requires only a minimum of extra ducting with no additional blower . hence , there is an energy and cost saving associated with the present invention . furthermore , outside air would be far too cool to efficiently and economically reduce the air temperature within the cooking chamber to a lower level . thus , the present invention simply uses recycled air , which typically has lost approximately 100 - 150 ° f . during passage through the cooking chamber 20 , depending upon the heat losses in the oven and the amount of food placed in the oven ( the oven walls and food serving as heat sinks ). this recycled air is naturally at an ideal temperature level to rapidly facilitate a desired reduction in the temperature of the cooking chamber . typical recipes may require temperature drops in the oven of usually no more than 100 ° f ., and the present invention enables rapid temperature drops in the oven of up to 100 ° f ., typically 100 - 150 ° f . it will be recognized , however , that the walls of the oven 10 ( preferably formed of stainless steel ) act as a heat sink . the greater the heat sink effect , the higher the temperature swings possible on a real time basis because the oven walls remove more heat from the hot air stream . of course , on a relatively long term basis ( about 15 minutes ) the swings in the cooking chamber temperature may be greater and centered about a lower different temperature as the cooking chamber walls either absorb or release heat . it should be appreciated that the present invention does not exclude the possibility of using outside air , which is even cooler than the recycled air entering the inlet 32 , for such purposes as cooling the magnetrons of a hybrid oven , the control panel of the oven , or the exterior housing of the oven without substantially affecting the temperature of the recycled air . indeed , in those instances where a more rapid cooling of the recycled air is desired than can be achieved simply through use of the bypass , means may be provided ( not shown ) for introducing cool external air ( that is , ambient air from outside of the oven ) into the recycled air stream . this cool external air may be introduced either at the mixing chamber 36 , upstream of the mixing chamber 36 in the bypass ducting 35 or , less preferably , downstream of the mixing chamber 36 at the outlet 34 . if necessary , a blower or other means may be employed to ensure that the cool external air enters the stream of recycled air , which may be at a pressure greater than atmospheric . because the cooking chamber temperature may be rapidly varied according to the food products in the cooking chamber , the oven may be used to cook a wide range of food products , one after another , even when the different food products require widely different cook temperatures . in instances where the complete cooking of a food product is preferably performed at different temperatures at different points during the cook cycle , the ability to vary the cook temperature rapidly and without human intervention enables the finished product to be of high quality -- in many cases higher than the quality provided by fast food restaurants . for example , when a steak is &# 34 ; seared &# 34 ; and then moved to a lower temperature , that &# 34 ; human intervention &# 34 ; causes a higher quality product than had the steak been cooked from beginning to end without changing cook temperature . this is because the &# 34 ; searing &# 34 ; process seals in the juices inherent in the steak . the oven of the present invention delivers higher quality than might be possible in a food service operation where skilled labor is limited , because the oven of the present invention can modify the cook temperature and air velocities without &# 34 ; human intervention .&# 34 ; to summarize , the present invention provides , within a recycling hot air impingement oven , a system that is capable of rapidly modifying the air temperature , thereby enabling operations where a consumer can cook single entree portions of food within a limited period of time ( e . g ., 30 - 60 seconds ) depending upon the food type , volume and whether the food product is in a frozen , refrigerated or ambient state . the oven may rely on hot air impingement means alone for cooking or on hot air impingement means in concert with microwave cooking means , thereby to cook food products even more rapidly then with hot air impingement alone . because the temperature used for cooking the food products may be varied rapidly , the food products may be of at least the quality served at fast food restaurants and the oven may be used to cook a wide range of food products , one after another , but at a faster rate then without such a system . the system is safe , simple and economical to manufacture , use and maintain . now that the preferred embodiments of the present invention have been shown and described in detail , various modifications and improvements thereon will become apparent to those skilled in the art . accordingly , the spirit and scope of the present invention is to be construed broadly and limited only by the appended claims , and not by the foregoing specification . | 7 |
now , the present invention will be described in more detail with reference to examples . gluconolactonase used in the examples was extracted from beef liver and purified by the method of bailey et al . described in &# 34 ; archives of biochemistry and biophysics ,&# 34 ; vol . 192 , no . 2 , page 482 , 1979 . the specific activity of the purified gluconolactonase was 1 , 100 units / mg at 25 ° c . and ph = 7 . 5 ( one unit of activity is defined as the amount of d - glucono - δ - lactone required to hydrolyze 1μmol of gluconolactonase for one minute ). a layer of enzyme immobilized gel was formed on the gate region of a ph - isfet by a lift - off method described in the japanese patent application no . 59 - 209165 ( laid - open no . 61 - 88135 , published may 6 , 1986 ) table 1 shows the composition of a protein solution spin - coated . table 1______________________________________solution part by volume______________________________________30 wt % aqueous solution of bovine serum 3albumin30 wt % aqueous solution of god 310 wt % aqueous solution of gluconolactonase . sup . ( 1 ) 2 5 wt % aqueous solution of glutaraldehyde 2______________________________________ note : . sup . ( 1 ) gluconolactonase is dissolved in an aqueous solution of 10 mm of mgcl . sub . 2 . as a control , a comparative example of an enzyme immobilized gel was prepared by the same method as above except that the solution of gluconolactonase is replaced by a protein solution containing 10 mm of mgcl 2 . each layer of the enzyme immobilized gels prepared has a thickness of 1 μm . an enzyme immobilized gel was prepared on the gate region of a ph - isfet by a method described in &# 34 ; sensors and actuators ,&# 34 ; vol . 7 , page 233 . table 2 shows the composition of a protein solution prepared . table 2______________________________________solution part by volume______________________________________10 wt % aqueous solution of 12 - hydroxy methylmethacrylic acid20 wt % aqueous solution of god 110 wt % aqueous solution of gluconolactonase . sup . ( 1 ) 1 1 wt % aqueous solution of riboflavin 1 1 wt % aqueous solution of potassium 1persulfate______________________________________ note : . sup . ( 1 ) gluconolactonase is dissolved in an aqueous solution of 10 mm of mgcl . sub . 2 . a mixture having the composition was dropped on the gate wells on a ph - isfet . then , the above described is exposed to ultraviolet radiation to polymerize 2 - hydroxy methylmethacrylic acid to obtain an enzyme immobilized gel . as a control , a comparative example of an enzyme immobilized gel was prepared by the same method as above except that the solution of gluconolactonase is replaced by an aqueous solution containing 10 mm of mgcl 2 . each layer of the enzyme immobilized gels prepared has a thickness of 200 μm . the results of the response properties of the glucose sensors prepared are shown in fig1 and fig2 . the response of the glucose sensor is determined in a 20 mm ( n - 2 - hydroxyethylpiperazine - n &# 39 ;- 2 - ethanesulfonic acid - naoh ) buffer solution ( ph = 7 . 5 ) at 25 ° c . curve &# 34 ; a &# 34 ; in fig1 is a response curve of the glucose sensor prepared by example 1 according to the present invention , while curve &# 34 ; b &# 34 ; in fig1 is a response curve of the glucose sensor prepared by example 2 according to the present invention . fig2 shows response curves of the glucose sensors prepared by the comparative examples containing no gluconolactonase . curve &# 34 ; a &# 34 ; in fig2 corresponds to the curve &# 34 ; a &# 34 ; in fig1 while curve &# 34 ; b &# 34 ; in fig2 corresponds to the curve &# 34 ; b &# 34 ; in fig1 . from the comparison of fig1 and fig2 it was revealed that the out - put of glucose sensor having the gluconolactonase - containing god immobilized gel according to the present invention increases remarkably from 0 . 01 mm of the concentration of glucose , so that the glucose sensors according to the present invention can be used in a wide range of concentrations of glucose from 0 . 01 to 10 mm . to the contrary , the conventional glucose sensors having the god immobilized gel containing no gluconolactonase shown in fig2 do not produce satisfactory sensor out - put over about 0 . 1 mm of the concentration of glucose . | 2 |
the present invention relates to the treatment of lung diseases and prevention of epithelial cancer of the respiratory tract in an at - risk individual by administering by inhalation to the respiratory tract of the individual an aerosol comprising a therapeutically effective amount of at least one retinoid . the method provides delivery of the pharmaceutically active retinoid directly to the affected areas , thus increasing bioavailability and decreasing systemic toxicity . it will be recognized by persons skilled in the art that “ prevention ” of cancer is difficult to prove in the absolute sense because one cannot predict with certitude what will transpire in the future . thus , as used in the specification and claims of this application , the terms “ prevention ” or “ preventing ” refer to a reduction of the risk of contracting epithelial cancer , or to a delay in the onset of epithelial cancer . inhalation of pharmaceutically - active compositions is not a new concept , and various compounds used in asthma therapy and the like have been administered in this manner . the major advantage is site - specific drug delivery which often leads to reduced systemic drug levels . the avoidance of elevated serum and liver drug levels should enable long term therapy for cancer chemoprevention in high risk individuals , as well as persons with fibrotic lung disease . commonly , however , aerosols are formed from the active compounds solubilized in water . however , most retinoids of clinical interest , including all of the “ natural retinoids ” such as all - trans retinoic acid , 13 - cis retinoic acid and 9 - cis retinoic acid , are highly lipophilic and thus very insoluble in water . for this reason , conventional water - based formulations cannot be used for aerosol administration of these compounds . to make it possible to perform inhalation therapy using retinoids , it was therefore necessary to define a solvent system which ( 1 ) solubilized sufficient amounts of the retinoids to provide a pharmaceutically - useful dosage , i . e ., from about 0 . 1 to 5 . 0 mg / ml ; ( 2 ) provided a retinoid solution of sufficient stability to permit distribution of a product ; and ( 3 ) was substantially non - toxic in the amounts administered and thus suitable for administration to living patients . working towards this goal , we first looked at organic solvents . in the course of this investigation , we found that retinoids were only slightly soluble in ethanol or ethyl acetate . methylene chloride or chloroform provided adequate solubilization , but the potential toxicity of these materials argued against their use as carriers in an aerosol for use in inhalation therapy . next , because of a report that the solubility of retinol ( vitamin a ) in water could be increased by addition of modified beta cyclodextrin ( molecusol ®), we next tried to prepare aqueous solutions of all - trans retinoic acid using molecusol ® to enhance the solubility . solutions containing 45 % molecusol ® did in fact enhance the solubility of the all - trans retinoic acid to a useful level , but the resulting solution had a thick , syrupy consistency which was unsuited for use in the generation of an aerosol . similarly , efforts to solubilize all - trans retinoic acid in aqueous solution using phosphatidylcholine and phosphatidylethanolamine produced a viscous colloid which was unsuited for aerosol administration . we next tried to use salts of the retinoids to obtain a water - soluble product for aerosol generation . when all - trans retinoic acid is treated with ammonium hydroxide , a water - soluble ammonium salt is obtained . the ph of solutions of this salt is too high ( ph & gt ; 10 ), however , for direct administration as an aerosol . neutralization of the solution after dissolution of the retinoid led to the formation of a precipitate , both in the presence and absence of added beta cyclodextrin . thus , this approach also failed to produce an acceptable solution for use in generating an aerosol . because of the solubility of all - trans retinoic acid in halogenated hydrocarbon solvents , we next considered the solubility of retinoids in various chlorofluorocarbon propellants which have been used to deliver aerosolized solutions of other pharmaceutically - active compounds . all - trans retinoic acid was found to be only slightly soluble ( about 0 . 1 mg / ml ) in 1 , 1 , 2 - trichlorofluoroethane and only slightly more soluble ( 2 mg / ml ) in 2 , 2 - dichloro - 1 , 1 , 1 - trifluoroethane ( hcfc - 123 ). thus , as an initial matter , it did not appear that these solvents would be useful for producing solutions of retinoids for inhalation use . surprisingly , however , we found that the solubility of retinoids in chlorofluoro - carbon solvents could be significantly increased by the addition of alkylamines , particularly secondary , tertiary and quaternary alkylamines having alkyl groups containing from 2 to 8 carbon atoms such as trioctylamine , spermine , triethylamine or tetramethylammonium bromide , and that the resulting solutions were stable for periods of 5 days or longer , and could be solubilized by shaking . thus , one aspect of the present invention is a solution comprising a retinoid , a chlorofluorocarbon solvent , for example hcfc - 123 , hcfc - 134a or hcfc - 227 , and an alkylamine which is effective to solubilize the retinoid in the chlorofluorocarbon solvent . the solution preferably contains from 0 . 1 to 10 mg of the retinoid and 0 . 1 to 5 mg of the alkylamine , more preferably 1 to 2 mg of the retinoid and 0 . 1 to 0 . 5 mg of the alkylamine , per ml of solution . retinoids useful in the present invention include the “ natural retinoids ” as well as pharmaceutically acceptable salts and esters thereof . retinoids of particular interest in the present invention are all - trans retinoic acid , 13 - cis retinoic acid , 9 - cis retinoic acid , and salts and esters thereof . the alkylamine is suitably a charged or uncharged secondary , tertiary or quaternary amine , having alkyl groups of 2 to 8 carbon atoms . specific examples of suitable alkylamines include trioctylaimie , triethylamine , spermine and tetrabutylanmonium bromide . this solution is packaged in an inhaler effective to provide a metered dosage of from 50 to 500 μg , preferably about 100 μg , of retinoid per inhalation as shown generally in fig2 . such an inhaler is a combination of a container 1 and a dispenser assembly 2 . the dispenser assembly 2 is an open tubular construction which has an actuator portion 3 for receiving the container 1 , an oral tube 4 through which the retinoid is dispensed , and an actuator seat 5 which interacts with a metering valve 6 of the container 1 . when the container 1 is pressed downwards within the actuator portion 3 , the actuator seat 5 opens the metering valve 6 , releasing a dose of retinoid 7 from the container 1 , through an orifice 8 in the actuator seat 5 and out through the oral tube 4 . a suitable inhaler is a nasacort ® metered dose container . additional propellant material , for example butane , may be included within the inhaler . the inhaler is used to administer retinoids directly to the lungs of a patient at risk of epithelial cancer of the respiratory tract . patients in this category can be identified by behavioral characteristics . for example , individuals who are heavy smokers can be categorized as being at high - risk . alternatively , a more quantitative approach may be used . thus , the capacity to metabolize a small test dose of all - trans retinoic acid can be used as an indicator of risk , as described in u . s . patent application no . 07 / 885 , 130 filed may 18 , 1992 , which is incorporated herein by reference . the inhaler provides dosages of from 50 to 500 μg of retinoid per inhalation and is suitably used 1 to 5 times per treatment , with the treatment being repeated 1 to 3 times per day . a further format which can be used in accordance with the invention to administer an air - borne composition comprising a retinoid to an individual involves the use of a dry powder carrier . suitable carriers include those which are known to be useful in dry powder inhaler compositions especially the mono - saccharides such as fructose , manintol , arabinose , xylitol and dextrose ( glucose ) and their monohydrates , disaccharides such as lactose maltose or sucrose and polysaccharides such as starches , dextrins or dextrans . retinoids can be formulated into a dry powder with these carrier materials by coating the retinoid onto the surface of the carrier in a micronizer as described generally in u . s . pat . no . 5 , 376 , 386 which is incorporated herein by reference . dry powders containing retinoids are dispensed using known dry powder inhalers in amounts effective to provide dosages comparable to the solubilized formulations discussed above . the solubility of all - trans retinoic acid in various solvents was tested as shown in table 1 . maximum solubility was determined by weighing the residue remaining after evaporation of the solvent . to test the ability of alkylamines to enhance the solubility of all - trans retinoic acid in chlorofluorocarbons , solutions of the retinoids in various solvents with various amounts of amine stabilizers were prepared as shown in table 2 . to evaluate the bioavailability of retinoids delivered by inhalation , 100 μl of an aqueous solution containing 100 μg of all - trans retinoic acid was administered via intra - tracheal instillation to 3 sprague - dawley rats , each weighing approximately 200 g . one rat was then sacrificed at three time points : 1 , 6 and 24 hours after treatment . at the time of sacrifice , the chest cavity was opened , both lungs and trachea were removed en bloc , and the right and left lungs were separated by dissection . the liver was also removed , along with a sample of blood obtained by cardiac puncture . the blood sample was separated by centrifugation , and plasma plus each of the aforementioned tissues were frozen for later analysis . subsequently , the tissue was homogenized , and the homogenized tissue and plasma were extracted with ethanol . the retinoid content was assayed by hplc , and the results shown in table 3 were obtained . the biodistribution and pharmacokinetics of an inhaled formulation of all - trans retinoic acid were compared to both intra - tracheal and intravenous administration . anesthetized ( i . p . pentobarbitol 50 mg / kg ) male sprague - dawley rats weighing 300 to 700 grams were treated by administration of all - trans retinoic acid by inhalation , iv injection or intra - tracheal injection . inhaled and intra - tracheal injections were given through an endotracheal tube placed under direct vision over a guidewire as described by weksler et al ., j . appl . physiol . 76 : 1823 - 1825 ( 1994 ). iv doses were given by catheter injection via the right external jugular vein . for inhalation , all - trans retinoic acid was solublized in hydrofluorocarbon 123 using tetramethylamunonium hydroxide to a concentration of 5 mg / ml , and combined with hydrofluoroalkane 134a as propellant , for a final concentration of 1 . 5 mg per 1 . 475 grams of propellant solution . 21 grams of this solutions was packaged in a multidose inhaler that delivered 77 . 5 mg of product per dose , which resulted in 80 to 120 mg of all - trans retinoic acid per dose . an identical inhaler containing propellant mixture without drug was used as a control . when sprayed through the endotracheal tube , the test canister supplied 49 μg / dose . however , not all of this dose was absorbed by the rats due to escape through the nasal passages and back through the trachea . the actual amount of drug delivered to the lungs ( defined as the “ effective dose ” ) was calculated by delivering 10 doses through the aerosol delivery apparatus into a flask that contained 100 ml of isopropanol . this procedure was also repeated with an angiocatheter fitted to the apparatus . the catheter was subsequently rinsed with 10 ml of isopropanol , which was also collected . the three solutions were then assayed for all - trans retinoic acid concentrations in order to determine the amount of drug delivered through the apparatus , as well as any residual drug that was bound to the angiocatheter . we defined the area under the concentration times - time curve ( auc ) for animals who received intra - tracheal all - trans retinoic acid as 100 % effective dose delivery to the lung . the auc of the inhaled aerosolized drug was divided by the intra - tracheal auc in order to determine the percent effective dose . total absorption amounted to 1 - 2 % of the intended 250 μg dose . for injection , an aqueous solution of all - trans retinoic acid was prepared in 20 % ethanol , 10 % tween 20 and 1 mm nh 4 oh , for a final concentration of 1 ml all - trans retinoic acid per ml of solution . a mixture of 20 % ethanol and 10 % tween 20 served as a control . animals were grouped into three experimental groups and two control groups . the control groups received no treatment or a control inhalant containing no all - trans retinoic acid . animals in the groups receiving iv or intra - tracheal injections each received a single dose containing 250 μg all - trans retinoic acid . animals in the group treated with the multidose inhaler each received three doses for a total of 147 μg of all - trans retinoic acid . animals were sacrificed at 5 minutes and at 1 , 2 , 4 and 6 hours , and blood and liver and lung tissue were harvested for analysis by high performance liquid chromatography ( hplc ) and histology . in addition , animals receiving the inhalant were sacrificed at 24 hours post - treatment . [ 0034 ] fig3 a and 3b show the levels of all - trans retinoic acid found in the plasma and livers of animals in each of the three treatment groups . as shown , intra - tracheal injection and aerosol inhalation result in much lower levels of the compound in the liver ( fig3 b ). on the other hand , as shown in fig4 all three treatments resulted in prolonged levels of all - trans retinoic acid in the lungs where it is desired for therapeutic efficacy . clearance data from plasma and lung and liver tissue is summarized in table 4 . in animals who received the metered dose inhaler , lung concentrations of all - trans retinoic acid were highest at 5 minutes ( 99 ± 44 ng / gm of tissue ), followed by a slow decrease over the next 24 hours ( fig4 ). the calculated tissue half - life of the aerosolized drug in lung was 5 . 4 hours . animals who received intra - tracheal injections showed peak lung levels at 1 hour ( 5 , 767 ± 419 ng / gm ), which were maintained for approximately 6 hours . the lung tissue half - life ( t 1 / 2 ) was 17 . 7 hours by the intra - tracheal route . peak lung levels by the iv route were seen at 5 minutes ( 6 , 440 ± 1 , 865 ng / gm ) and disappeared with a half - life of 1 . 9 hours . the lung levels by the inhaled route were significantly lower than the intra - tracheal route at each time point ( p & lt ; 0 . 02 ); however , the difference from the iv route was only significant before the 2 hour post dosing time point . the lung auc , an indication of total drug delivery to an organ over time , for the intra - tracheal route was twice that of the iv route and 100 times that of the aerosolized route ( table 4 ). animals receiving aerosolized drug displayed peak plasma levels of 71 ± 31 ng / ml 1 hour after dosing , which was not significantly different from intra - tracheal administration at 1 hour ( 68 ± 44 ng / ml ) ( fig3 a ). by contrast , animals in the iv group displayed a characteristic plasma curve with a peak at 5 minutes ( 838 ± 56 ng / ml ) and a rapid decay ( t 1 / 2 = 0 . 4 hours ). differences between the iv and the other groups were significant up to 4 hours ( p & lt ; 0 . 05 ). animals in the inhaled drug group had peak liver levels of 112 ± 28 ng / gm 2 hours after dosing , whereas intra - tracheal injection produced peak liver levels of 753 ± 350 ng / gm at 5 minutes ( fig3 b ). both groups showed a slow decrease over 24 hours . in contrast , iv administration resulted in peak levels in liver at 5 minutes ( 4 , 258 ± 1 , 006 ng / gm ), which had rapidly decreased by 4 hours ( t 1 / 2 = 1 hour ). compared with iv injection , aerosolization and intra - tracheal injection of all - trans retinoic acid resulted in a significantly longer pulmonary half - life of the drug and lower peak serum concentrations than the same dose administered iv . as shown , the aerosol inhalation provided sustained levels of all - trans retinoic acid in the lungs with lower levels in the plasma compared to iv injections , thus offering the ability to use all - trans retinoic acid as a therapeutic agent with a reduction in systemic toxicity . histologic examination of lungs and traches showed no focal irritation attributable to the drug after single - dose administration . these results suggest that aerosolization of retinoids may offer a practical alternative to systemic oral administration for chemoprevention trials or treatment of lung diseases . the advantages of inhaled drug delivery are well - characterized . site - specific drug delivery is readily accomplished , and the portability of multi - dose inhalers , their ease of use , and reduced adverse effects should improve patient compliance . moreover , the avoidance of elevated serum and liver drug levels should further enable long term therapy for cancer chemoprevention in high risk ( by asymptomatic ) persons , as well as individuals with fibrotic lung disease . although the preferred embodiment of the method and products of the invention has been described above in some detail , it should be appreciated that a variety of embodiments will be readily apparent to one skilled in the art . the description of the method and products of this invention is not intended to be limiting to this invention , but is merely illustrative of the preferred embodiment . | 0 |
fig1 illustrates in a top view a connecting device according to the present invention , hereinafter referred to as a clamping device 10 . the clamping device 10 includes a housing 36 in which all the essential units are compactly arranged . illustrated as protruding to the right are lock bar claws 18 of an anchor unit 16 , which lock bar claws represent end portions of anchor elements 38 of the anchor unit 16 . the anchor elements 38 of the anchor unit 16 are arranged for displacement in the longitudinal direction of the housing 36 . in the illustration as shown , the anchor unit 16 assumes its non - locking state . in this state , the clamping connector 10 can be fixed to a post 12 in which the lock bar claws 18 are inserted in an opening 42 of the post 12 . by operating an actuation member 20 of a drive 14 the anchor elements 38 and along with them the lock bar claws 18 are axially pulled - in in the direction of the housing 36 . during this , they are simultaneously moved transversely to their axial movement direction , so that the lock bar claws 18 in the locking state grip behind a rim portion ( not illustrated ) of the opening 42 , thus fixing the clamping connector 10 to the post 12 . for detaching the clamping connector 10 from the post 12 the above operation is performed in the reverse order , wherein the anchor elements 38 are axially displaced in the longitudinal direction of the housing 36 towards the post 12 while simultaneously moving transversely in a way such that the same become positioned in substantially one plane ( see also fig2 ). in this state the clamping connector 10 can be detached from the post 12 . fig2 shows the clamping connector 10 according to fig1 in a sectional view along line ii - ii . it can be seen in this illustration that the lock bar claws 18 of the anchor elements 38 in the non - locking state as shown in fig2 are substantially in one plane and protrude from the housing 36 to the left . for achieving a good operation , the opening 42 of the post 12 is formed in a slot - like fashion so that the protruding lock bar claws 18 which are arranged in the position as shown in fig2 can be inserted in the opening 42 . when moving the clamping connector 10 into the locking state the anchor elements 38 are not only pulled towards the housing 36 but , as may described by way of fig2 , one of the lock bar claws 18 is moved upwardly and the other one downwardly so that the lock bar claws 18 can grip behind the rim of the opening 42 . to be able to perform this movement , guide pins 24 are arranged on the anchor elements 38 , which guide pins are guided in banana - like guide slideways 22 of side walls of the housing 36 . the guide pins 24 as well as the slideways 22 have the effect that with an axial displacement of the anchor elements 38 the lock bar claws 18 at the same time perform an upward or downward movement transversely to the axial displacement . the banana - like curvature of the guide slideway 22 is configured in such a way that a torque which is as uniform as possible is achieved on the actuation side . in the present case , the banana shape is designed in such a way that one third of the operation distance is substantially linear , while the remaining operation distance is curved . on an axis 50 of the housing 36 which also represents the longitudinal axis of the housing , the actuation member 20 is arranged which in the present case is devised as a bolt and forms the substantially centrally arranged drive 14 ( fig6 to 8 ). the drive 14 is illustrated in the fig6 to 8 . in this embodiment the drive 14 merely comprises a single actuation member 20 . on the operation side the actuation element 20 includes a torx recess 34 in which a corresponding wrench can be applied for operating the actuation element 20 manually by rotation . the drive 14 includes on the housing side a supporting portion 58 , by which it is supported for rotation on the housing 36 . further , an eccentrically arranged pin 54 which is formed substantially as a circular cylinder protrudes into the housing 36 . the pin 54 has a continuous groove 56 ( fig6 , 8 ). as it can be seen from fig2 , the pin 54 protrudes into an opening 28 formed by the anchor elements 38 . oppositely to the lock bar claws 18 on the other end in the region of the opening 28 a connecting pin 52 is arranged to which the two anchor elements 38 are coupled as regards mobility . for this purpose , the connecting pin 52 is not only connected to the anchor elements 38 but is additionally supported for displacement respectively in an elongated hole ( not further described ) arranged parallel to the axis 50 in a housing wall of the housing 36 , by the end portions thereof which are not further described . the connecting pin abuts on the groove of the pin 54 . this is achieved by the fact that a spiral spring 30 which is supported against an abutment supported by the housing 36 pushes against a spring support 40 of the anchor elements 38 . in the present case , for setting the prestressing of the spring , a set screw 64 is provided which is arranged in a threaded bore 62 . thereby the connecting pin 52 is permanently pressed against the pin 54 , whereby a coupling region 26 is established . the abutment 32 includes a set screw ( not further shown ) as an adjustable prestressing means by which the prestressing of the spiral spring 30 can be adjusted according to the needs . of course , also other suitable means may be provided for changing the prestressing of the spiral spring 30 . from fig2 it can be seen that as a result of rotating the actuation member 20 by an angle of & lt ; 90 ° the anchor elements 28 are already pulled into the housing 36 of the clamping connector 10 against the prestressing by the spiral spring 30 , through the connecting pin 52 as well as the pin 54 . when the actuation member 20 is rotated back , the coupling region 26 remains established because of the prestressing of the spring , and the connecting pin moves the clamping elements 38 towards the exit of the housing 36 as a result of the prestressing of the spring . this movement takes place until the maximum possible movement in this direction is reached which is predetermined by the cutting edge 56 of the pin 54 . although this cannot be seen in the figures , a marking is arranged adjacent to the torx recess 34 on the actuation member 20 , by which marking a locked condition of the clamping device 10 is indicated . in the present case this marking is provided as an arrow which in the opened condition points to a symbol “ open ” which is embossed adjacent to the actuation member 20 on the housing 36 . in the locked condition the arrow points to a further symbol corresponding to this condition , for instance “ closed ”. of course , also the symbols of locks or the like may be provided for indicating the respective condition . fig3 is an enlarged illustration of one of the anchor elements 38 . here a part of the opening 28 can be seen , while the other part of the opening 28 is formed by the second anchor element 38 . further , the region 26 can be seen in which the anchor element 38 includes a bulge ( not further described ) which is provided for receiving the connecting pin 52 . in the region of the lock bar claw 18 a further bulge is provided which serves to receive the guide pin 24 . on the lock bar claw 18 spikes 60 are arranged . fig4 shows a lateral view of the anchor element 38 according to fig3 . in the left part , the lock bar 18 can be seen which is joined by the bulge for the guide pin 24 . the bulge is closed by a clamping element 44 which is fixed to the anchor element by means of welded spots 48 . to provide for an appropriate fixation of the guide pin 24 in the recess of the anchor element 38 , the clamping element 44 includes a bulge 46 ( fig5 ). the bulge is thereby reduced of its inner diameter to such an extent that the guide pin 24 is fixed in the bulge . a similar fixation is provided also for the connecting element 52 ( fig4 ). the embodiment illustrated in the figures merely serves for explaining the invention and is not in any way limiting . | 5 |
as summarized above , the present invention relates to a method of welding porous tube ends , first by melting only the tube ends into a melt , conducting the melt radially outward , causing the melt to rest partially on the end face of the tube sheet , and allowing it to remain partially attached to the porous end that has not yet melted , then , while ensuring that the tube end is kept in molten condition by annular heating of the tube sheet in the circumferential area in which the melt of the tube end rests on the tube sheet , welding tube end and tube sheet together . the term &# 34 ; tubes &# 34 ; within the meaning of the invention includes all tubular bodies , as for example pipes , hoses , or hollow filaments . the cross - sectional shape of the tubes is not limited to circular cross sections ; the tubes can also have elliptical or polygonal , for example triangular , quadrangular , quadratic , pentagonal , or other , cross sections . the thickness of the tube walls resulting from the tubes outer and inner cross sections can be made equal or different along the circumference of the tubes . the tubes &# 39 ; outside and inside cross sections can have the same or different cross - sectional shapes . for example , a tube can have an outside cross section that is polygonal and an inner cross section that is circular or elliptical . also , the inside cross section of the tubes can have one or more continuous cavities . for example , a tube can have an outside cross section that is polygonal and an inner cross section which is circular or elliptical . also , the inside cross section of the tubes can have one or more continuous cavities . all synthetic polymers that can be thermowelded are suitable as materials for the tube ends and tube sheet . these polymers include primarily the thermoplastic polymers , as for example the fluoropolymers , polyethylenes , or polypropylenes . advantageously , the tube material and tube sheet material have the same or nearly the same melting point or melting range . it is especially advantageous for the tube ends and tube sheet to be made of thermoplastic polymers belonging to the same kind of polymer by virtue of their basic structure . the method incorporating the invention can be carried out by means of a specially shaped welding tool . the welding tool shall in any case not have a mandrel that extends into the tube end , since already because of heat radiation the tube end will be fused on the inside and will start flowing , so that the tube end can no longer be firmly attached to the tube sheet . furthermore , the contact surface of the tool must be formed in such a way that most of the melt that has been melted from the tube end will be carried away directly to the outside , so that the melt is effectively prevented from flowing into the tube end . only after a sufficient quantity of melt has been transferred to the end face of the tube end by means of the tool must the tool be allowed to act on the tube sheet as well in order also to melt the tube sheet in the vicinity of the melt , thereby finally producing the weld . the method of the invention will succeed eminently if the quantity of heat required for carrying out the method is fed intermittently . this can be accomplished in simple fashion by soldering the tube sheet by means of the welding tool and the major part of the melt is guided radially to the outside . the welding tool is then removed briefly so that excessive amounts of heat in the material of the melt are carried away to the ambient air . the melt is then pushed further radially outward by the same welding tool , after which the welding tool is removed again . when the welding tool is applied for the third time , the tube sheet , for example , can already be fused together in order to complete the welding between tube end and tube sheet . the welds made in accordance with the invention between porous tube ends and tube sheet have a strength that is greater than the strength of the tubes themselves . preferably , the tube end is cooled at least temporarily . by cooling the tube ends , which is advantageously carried out from the inside , the welding pauses during the discontinuous supply of heat can be reduced considerably . in order to cool the tube end , it is often sufficient to insert a metal pin into the end of the tube , whereby the metal pin preferably comes into contact with the inner wall of the porous tube end . if such a metal pin is given a conical shape , it can be introduced with a slight pressure into the tube end located in the tube sheet , so that the metal pin , by virtue of its conical shape , causes the tube end to be braced in the tube sheet and the tube end to be reliably attached to the tube sheet in the course of carrying out the method of the invention . advantageously , the tube ends are inserted into the tube sheet in such a way that they project beyond the tube sheet by an amount a , whereby a corresponds from one to four times the thickness of the tube end walls . it has also been found advantageous for the molten mass of the tube ends to be guided radially outward in such a manner that the melt rests in width b on the end face of the tube sheet , b corresponding approximately to 0 . 5 to 2 times the thickness of the tube end walls . referring now to fig1 tubes 1 are inserted with their tube ends 2 into tube sheet 3 and welded thereto in a manner not shown . in the following section , the method according to the invention will be described more fully with reference to detail x . in fig3 tube ends 4 project approximately two wall thicknesses beyond tube sheet 3 . as illustrated in fig4 a conical pin 5 may be advantageously inserted from the outside to hold tube ends 4 , resulting in the tube end 4 being braced in tube sheet 3 . conical metal pin 5 is provided with a shoulder 6 , which makes it easier to withdraw conical pin 5 after completion of the welding . in fig5 welding tool 7 is shown above the tube end 4 to be welded . welding tool 7 can be gripped holder 8 in a heating tool not shown . preferably , welding too is made of a metal which is a good heat conductor and which be provided with a coating that prevents adhesion at the at which it comes into contact with the material of the tube sheet 3 . the welding tool 7 has a circumferential 10 on its underside , especially suitable for carrying the welding according to the invention . in fig5 groove 10 is v - shaped . however , other cross - sectional may also be considered . the exact cross - sectional shape depends on the materials used for the tube ends and tube and can be optimized by simple tests . now , tool 7 is lowered to the point to be welded , so that the tube end is first fused on the inside and pressed downwardly by the special shape of groove 10 , and is then put down on the tube sheet . this condition is shown more clearly in fig6 in which the fused area is designated 12 . the flank of groove 10 is used to displace the melt 12 . as illustrated in fig7 if the welding tool is lowered further , the outer ring of groove 10 reaches tube sheet 3 , which is fused as well and the molten area 13 is shaped into the welded seam itself . fig8 shows a welded seam on a larger scale ( detail y in fig1 ). in this figure , the tube sheet is again denoted by 3 and the porous tube end by 4 . the outer surface of weld 13 has the contour of the welding tool used , while the area of fusion between the materials of tube sheet 3 and tube is located in the vicinity of dashed line 14 . the application of the welding tool to the tube sheet ( required for the separate heating of the tube sheet ) produces a circumferential notch 15 , which is typical of the process incorporating the invention , on the outer ring of welded seam 13 . the method according to the invention is suitable for producing very strong load - bearing welds between porous tubes and a tube sheet , and is preferably used for making microfilters , filters , dialyzers , blood oxygenators , and the like . | 1 |
while this invention is illustrated and described in preferred embodiments , the container lid and the sealing ring may be produced in many different configurations , sizes , forms and materials . referring now to the drawings , fig1 illustrates a sealable lid for a container constructed according to a preferred embodiment of the present invention . the sealable lid comprises a lid body 2 and a handle assembly 3 . the handle assembly 3 can be rotated around an axis a in order to seal or unseal the container . fig2 illustrated the sealable lid according to the present invention attached to a container 1 , which is substantially in the shape of a cuboid . the lid has a shape and size corresponding to an opening 101 defined by the top of the container 1 . the lid is loosely seated in the opening 101 of the container 1 . to seal the lid and the container 1 together , a user rotates the handle assembly 3 around an axis a from a second position to a first position . rotating the handle assembly 3 causes a sealing ring 7 ( fig3 ) inside the lid to expand and form a seal between the lid and the container 1 . the sealing ring 7 between the lid and the container 1 helps to preserve items , such as food items , stored in the container 1 . to remove the item stored in the container 1 , the user rotates the handle assembly 3 back to the second position to release the sealing ring 7 , causing the sealing ring 7 to return to its original non - compressed form , and thereby release the lid from the container 1 . the user now is able to easily remove the lid from the container 1 to access the contents of the container . the lid therefore allows a user to easily and quickly seal a container and alternatively to release the seal and remove contents from the container 1 . the illustrated embodiment shows the lid and the container 1 having a particular size and shape . however , it should be appreciated that the lid and the container 1 may have any suitable sizes and / or shapes to accommodate different storage items . referring to fig3 and 4 , the lid comprises a lid body 2 , which has a receiving chamber 201 and a hollow barrel 202 extending downwardly from the bottom of the receiving chamber 201 . the hollow barrel 202 is preferably cylindrical and has internal threads formed on its inner surface . on top of the lid body 2 there is a handle assembly 3 , which comprises a handle assembly 301 and a neck member 302 projecting downwardly from the bottom of the handle assembly 301 . the handle assembly 301 has an undercut portion 301 a and is received in the receiving chamber 201 of the lid body 2 . corresponding to the shape of the hollow barrel 202 of the lid body 2 , the neck member 302 is also preferably cylindrical and has outer threads on its outer surface , said outer threads cooperating with the inner threads on the inner surface of the hollow barrel 202 of the lid body 2 . the neck member 302 is displaceable between a first position where the neck member is engaged with a first section of the hollow barrel of the lid body and a second position where the neck member is engaged with or disengaged from a second section of the hollow barrel of the lid body . a vertical passage 302 a is provided through the handle assembly 301 and the neck member 302 . extending downwardly from the neck member 302 are two tabs 303 , placed opposite to each other on the circumference of the neck member 302 . now referring to fig3 , 5 and 6 , two locking plates 4 and 8 are recessed in the undercut portion 301 a of the handle assembly 301 , one above the other . each of the locking plates 4 and 8 has a window 401 and 801 formed therethrough in line with the hollow barrel 202 of the lid body 2 and the passage 302 a in the neck member 302 and the handle assembly 301 . each of the windows 401 and 801 in the locking plates 4 and 8 , as shown in fig7 , has two parallel straight edges and two opposite curved edges . a bulge 403 is formed on one of the curved edges of the window 401 in the locking plate 4 . a first spring 11 is provided horizontally between the two locking plates 4 and 8 . a spring holder 402 , 802 ( see fig7 ) is formed respectively on each of the locking plates 4 and 8 to accommodate the first spring 11 . a slide knob 404 , 804 is formed on each of the locking plates 4 and 8 , which is pushed inwardly to actuate to move the locking plates 4 and 8 to move in approximation with each other . still referring to fig3 , a handle cap 10 is provided on top of the locking plates 4 and 8 and secured to the handle assembly 301 through common means such as clamps . two rectangular holes 1001 ( see fig1 ) are formed in the handle cap 10 for the slide knobs 404 and 804 to extend through and slide therein . below the lid body 2 , there is a rotation stopper 5 , the shape of which is shown in fig8 . the rotation stopper 5 has an opening therethrough , and two blocks 501 extend inwardly opposite to each other from the inner wall surface of the opening of the rotation stopper 5 . the blocks 501 prevent the tabs 303 and thus in turn the handle assembly 3 from further movement after the handle assembly 3 is actuated to move to a predetermined position . in other words , the blocks 501 in cooperation with the tabs 303 limit the rotation of the handle assembly 3 by a range of 0 to 90 degrees . furthermore , a protrusion 502 is formed on the inner wall surface of the opening at each of two sides separated by the two blocks 501 , so that application of force on the handle assembly 3 is required to enable the respective tab to override the protrusion 502 , thereby allowing the handle assembly 3 to move . the rotation stopper 5 is secured to the bottom of the lid body 2 through screwing means 503 . alternatively , as shown in fig1 , the threaded outside of the neck member 302 has a plurality of longitudinal grooves 17 , and a pair of hooks 15 , 16 secured to the lid body 2 are provided , each hook having a hook head engagable with one of the plurality of longitudinal grooves 17 and movable from the one groove to the other by application of rotatory force on the handle assembly 3 , thereby allowing the handle assembly 3 to move . as shown in fig1 , the rotation stopper with the blocks 501 can also be provided in the form of a rectangular cover , which is secured to the bottom of the lid body 2 through screwing means 503 . at the bottom of the lid is a base plate 6 , on the top surface of which there is formed a central hub member 601 ( see fig1 ), which has inner threads on its inner surface . placed inside the central hub member 601 sequentially from bottom to top are a second spring 13 , a pressing rod 12 and a locking stud 9 . the locking stud 9 has a stud body 901 provided with a cavity 902 , and a flange 903 on top of the stud body 901 . the stud body 901 has threads on its outside surface , and is secured to the central hub member 601 through mating engagement with corresponding threads formed inside the central hub member 601 . the pressing rod 12 extends through the cavity 902 and is able to slide vertically relative to the locking stud 9 . the pressing rod 12 further comprises a widened bottom which presses against the second spring 13 and which limits itself within the central hub member 601 . the locking stud 9 extends through the hollow barrel 202 of the lid body 2 , the passage 302 a in the neck member 302 of the handle assembly 3 and the windows 401 and 801 of the locking plates 4 and 8 . in the original state , the flange 903 of the locking stud 9 rests on the locking plates 4 and 8 . thus , the base plate 6 is coupled to the handle assembly 3 . a sealing ring 7 is provided between the lid body 2 and the base plate 6 . the shape of the sealing ring 7 is shown in fig9 . the cross section of the sealing ring 7 comprises a horizontal part , a first oblique part extending upwardly and outwardly from an end of the horizontal part , a second oblique part in continuation of the first oblique part , said second oblique part extending upwardly and inwardly , and a vertical part in continuation of the second oblique part and extending upwardly . the vertical part is preferably made of plastics , so that the sealing ring 7 can be easily attached to the lid body 2 by inserting the vertical part into an annular slot formed on the edge of the lid body 2 . the horizontal part is secured to the edge of the base plate 6 through common means such as adhesive bonding . alternatively , as shown in fig1 , a plurality of apertures 701 are formed on the horizontal part of the sealing ring 7 , and a plurality of bulges 602 are provided perimetrically on the base plate 6 , such that the plurality of bulges 602 extend through the plurality of apertures 701 to thereby form a lock therebetween . preferably , a strengthening ring 14 is provided on the lid body 2 and of flute configuration for insertion of a top portion of the vertical part of the sealing ring 7 to create a better sealing effect . more preferably , the strengthening ring 14 has a first extension and a second extension extending from two opposite side walls of the flute , the first extension extends outwardly such that it is intimately in abutment against the lid body and the container , and the second extension extends inwardly such that it is in abutment with the bottom of the lid body . referring to fig1 a to 11c , the mechanism of sealing the container 1 by rotating the handle assembly 3 of the lid according to the present invention will now be elaborated . when the user wants to place and seal the lid over the container 1 , he rotates the handle assembly 3 around axis a from the second position to the first position . through the interaction between the outer threads of the neck member 302 of the handle assembly 3 and the inner threads of the hollow barrel 202 of the lid body 2 , the handle assembly 3 is lifted relative to the lid body 2 . as a result , because the base plate 6 is coupled to the handle assembly 3 as described above , the base plate 6 is also lifted , that is , brought towards the lid body 2 , compressing the sealing ring 7 , which is forced to bias towards and press against the wall 102 of the container 1 , thereby sealing the container ( fig1 c ). the container 1 can also be easily detached from the lid by simply rotating the handle assembly 3 back to the second position , which lowers the base plate 6 , releasing the sealing ring 7 to its un - compressed state ( fig1 b ). in the un - compressed state , the sealing ring 7 stays away at a small distance from the wall 102 of the container 1 , therefore allowing the lid to be removed from the container 1 with little effort . in addition to the ease of sealing and opening the container , the lid of the present invention has a further advantage of easy disassembly . referring to fig4 , the lid can be disassembled into two parts by simply pushing the two slide knobs 404 and 804 towards each other . this function is a result of the design of the shapes of the windows 401 and 801 in the locking plates 4 and 8 , as well as the shape of the flange 903 of the locking stud 9 ( see fig5 and fig6 ). the windows 401 and 801 in the locking plates 4 and 8 are only partially superimposed , and their relative positions define the superimposed area of the windows 401 and 801 . in the original state , the superimposed area is smaller than the size of the flange 903 of the locking stud 9 , which is the reason why the flange 903 of the locking stud 9 can rest on the locking plates 4 and 8 , coupling the base plate 6 to the handle assembly 3 . when the two slide knobs 404 and 804 are pushed towards each other , the superimposed area of the windows 401 and 801 becomes larger than the flange 903 of the locking stud 9 , allowing the locking stud 9 to be released from the handle assembly 3 , and therefore allowing the base plate 6 and the sealing ring 7 to be detached from the lid body 2 . as described above , a first spring 11 is provided between the locking plates 4 and 8 , pushing them away from each other all the time . this feature ensures that when the slide knobs 404 and 804 are not forced to come towards each other ( that is , when there is no intention to disassemble the lid 101 ), the flange of the locking stud 9 is safely kept above the locking plates 4 and 8 and the base plate 6 is safely coupled to the handle assembly 3 and the lid body 2 . also , when the user wants to re - assemble the lid 101 , the first spring 11 makes it possible to attach the base plate 6 to the lid body 2 by simply forcing the locking stud 9 upwardly through the windows 401 and 801 of the locking plates 4 and 8 . it should be noted that instead of a spring , any other suitable resilient means can be used to maintain the locking plates 4 and 8 to their original positions in place . for example , a tail - shaped resilient member can be formed integrally on each of the locking plates 4 and 8 and in abutment with the inner wall of the undercut portion 301 a of the handle 301 to play the same role as the first spring 11 . still another advantage of the lid of the present invention is that it can be disassembled only after the lid is removed from the container 102 , that is , only after the handle assembly 3 is rotated to the second position . this is a result of the shapes of the windows 401 and 801 of the locking plates 4 and 8 and the flange 903 of the locking stud 9 . with the handle assembly 3 in the second position , when the slide knobs 404 and 804 are pushed towards each other , the length of the superimposed area of the windows 401 and 801 of the locking plates 4 and 8 is increased in the direction parallel to the long edge of the flange 903 of the locking stud 9 , therefore allowing said flange 903 to be released . when the handle is in the first position , said superimposed area is elongated in a direction orthogonal to the long edge of the flange 903 of the locking stud 9 and is sized to restrain the flange 903 , therefore said flange 903 will not be released . this feature reduces the possibility of unintentional disassembling of the lid . the second spring 13 in a compressed state applies an upwardly pushing force on the pressing rod 12 , which in turn presses against the handle cap 10 . as a result , when the lid is assembled , there is a constant downward pressure from the handle cap 10 applied on the pressing rod 12 , which in turn applies a downward pressure on the second spring 13 and the base plate 6 . this constant downward pressure facilitates the detachment of the base plate 6 from the lid body 2 when the locking stud 9 is released from the handle assembly 3 . besides , as the locking stud 9 is secured to the base plate 6 through the threads in the central hub member 601 , a constant downward force is also applied on the locking stud 9 , increasing the pressure between the flange 903 of the locking stud 9 and the bearing locking plates 4 and 8 , which enforces the locking effect and makes the whole structure more stable . although two locking plates are provided in the above described embodiment , it is conceivable that one or more than two locking plates can be provided for the same purpose of the two locking plates described above . in the embodiment described above , the components of the lid and the container are preferably made of a polymer or plastic which can be washed and stored . preferably , the locking plates 4 and 8 , the neck member 302 and the rotation stopper 5 are made of polyoxymethylene ( pom ), while the handle cap 10 , the handle assembly 3 , the lid body 2 , the locking stud 9 , the pressing rod 12 and the base plate 6 are made of acrylonitrile butadiene styrene ( abs ). it should be appreciated however that the lid and the other components of the container may be made of any suitable material or materials . it should also be appreciated that the components of the container may be connected or manufactured in any suitable order other than that described above . while the present invention is described in connection with what is presently considered to be the most practical and preferred embodiment , it should be appreciated that the invention is not limited to the disclosed embodiment , and is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the claims . modifications and variations in the present invention may be made without departing from the novel aspects of the invention as defined in the claims , and this application is limited only by the scope of the claims . | 1 |
referring to the drawing , there is schematically shown a biological cell that contains a cell membrane 1 , a nuclear membrane 2 , a cytoplasma cp held between membrane 1 and 2 , and a nucleoplasma np held inside membrane 2 . a microelectrode 4 is introduced into the nucleoplasma and a reference microelectrode 5 is introduced into the cytoplasma . both microelectrodes 4 and 5 are metallic , are covered with glass , and have a maximum diameter of 0 . 5 microns . an electrode 3 disposed outside membrane 1 is connected by a shielded lead to a terminal 8 of a switch s 1 of the apparatus of the invention . electrode 5 is connected to a terminal 7 of the switch s 1 by a shielded lead 9 . electrode 4 is connected by a double shielded lead 6 to the input of the first stage 16 of the amplifier of the apparatus . the stage 16 of the amplifier and its attendant components are housed within a first , inner shield 54 . the remainder of the apparatus , with the exception of a signal processing equipment 52 and a recorder 53 are housed within connected compartments 36a - 36d of a second shield . as shown , shield 54 is not grounded , whereas shields 36a - 36d are grounded . the apparatus contained within the inner shield 54 and the outer shield section 36a , which is composed of the first amplifier stage 16 and its attendant components , is generally designated by the reference character a . the apparatus contained in shield section 36b , which is designated b , is composed of a matched pair of voltage follower amplifiers , connected in cascade , and in series with the amplifier stage 16 . the apparatus contained within shield section 36c , designated c , is an inversion cancelling circuit of offset voltage . the apparatus contained within shield section 36d , designated d , includes an amplifier stage 32 and its attendant components constituting an integrator with an adjustable time constant , and a multiplier 12 . the reference electrode 3 , disposed in the extracellular space outside and in the neighborhood of the cell membrane 1 , is selectively connected to the output terminal 13 of the electronic multiplier 12 or to ground by means of the two - pole switch s 1 the movable contactors of which are selectively shifted between their upper and lower positions by means of a solenoid 10 and a switch control 11 for selectively energizing and de - energizing the solenoid . when the contactors of switch s 1 are in their upper position , as shown in the drawing , and the microelectrode 4 is introduced into the nucleoplasma np , the biopotentials generated at the level of nuclear membrane 2 are exclusively measured . when the contactors of switch s 1 are in the lower position , the upper contactor connects the reference electrode 3 by way of the shielded lead therefrom to the terminal 8 of the switch s 1 and thence to the terminal 13 of the electronic multiplier 12 , so that the biopotentials can be simultaneously measured at the level of the cell membrane 1 and the nuclear membrane 2 . by advancing the microelectrode 5 introduced into the cytoplasma cp under microscopy control , and with the contactors of the switch s 1 in their lower position , the biopotentials supplied at the level of the cell membrane 1 can be measured . the double - shielded lead 6 from the electrode 4 is connected to the first or plus voltage follower input of the first amplifier stage 16 , the inner shield of lead 6 being connected to the shield 54 , and the outer shield of lead 6 being connected to the outer shield section 36a . amplifier 16 may be one sold under the designation &# 34 ; analog devices fet - input , ad515 l .&# 34 ; such amplifier 16 has a bias current as low as 75 femto amps . and an offset voltage below 1 . 0 mvolts . the output of amplifier 16 is connected by a wire 23 which extends through the shields 54 and 36a to the input (+ terminal ) of a second stage 37 of the amplifier located within section b of the apparatus . stage 37 will be described in detail hereinafter . a wire connects the wire 23 leading from amplifier 16 to the minus input terminal of such amplifier . the minus terminal - v of the power source is connected to the minus power input terminal of the amplifier 16 through a p - n - p transistor 15 , the collector of such transistor being connected to the terminal - v , the emitter of transistor 15 being connected to the minus power terminal of the amplifier 16 . the collector of the transistor 15 is also connected to the gate and to the source of a n - channel fet ( field effect transistor ) 26 , the base of transistor 15 being connected to the drain of the fet 26 . the drain of fet 26 is connected through series connected , similarly disposed zener diodes 25 and 21 to the source and gate of a second n - channel fet 19 . a condensor 24 is shunted across zener diode 25 , and a condensor 18 is shunted across zener diode 21 . the cathode of zener diode 21 is connected to the source and gate of fet 19 and to the base of an n - p - n transistor 17 , the emitter of which is connected to the plus power supply terminal of the amplifier 16 . the plus terminal of the power supply , + v is connected to both the collector of transistor 17 and to the drain of the n - channel fet 19 . because of the floating voltage source provided by the bipolar and monopolar transistors 15 , 17 and 19 , 26 , respectively , as well as the reaction by means of the zener diodes 21 and 25 in parallel with the condensers 18 and 24 , the reference point 22 , disposed between the zener diodes 21 and 25 , is isolated from the power supply (± v null point ), a constant voltage being supplied equal to and of contrary sign to the power of feeding terminals , plus and minus , of the amplifier 16 . the output of amplifier stage 16 is connected directly through wire 23 to the plus input terminal of a second stage 37 of the amplifier group , the output of stage 37 being directly connected to the plus input terminal of a third amplifier stage 38 . the output from stage 37 is also connected to the minus input terminal of stage 37 , the output of stage 38 being connected through a resistor 40 to the minus input terminal of stage 38 . the reference point 22 in unit a is connected through a wire 22 &# 39 ; to the output terminal 41 of the amplifier stage 38 . the amplifier stages 37 and 38 constitute a matched pair of cascade connected voltage followers which may be , for example , those sold under the trade designation &# 34 ; burr - brown 3500 mp matched pair mpic .&# 34 ; the amplifier stages 37 and 38 apply to the reference point 22 a voltage which equals the value of the potential applied to the input of the amplifier stage 16 , thus reducing the input capacity in the amplifier stage 16 by an approximate factor of ( 1 / a 1 + 1 / a 2 + 1 / a 3 ), and increasing the input resistance of amplifier stage 16 by a reciprocal of the same factor by which the capacity of stage 16 was reduced . a 1 , a 2 , a 3 are the open loop gains of the amplifier stages 16 , 37 , 38 , respectively . by the above - described means , and by the connection of the screen 54 as well as the inner screen of the cable 6 to the floating reference point 22 , and the outer screen of cable 6 to ground , as shown at the bottom of section 36d of the screen , there is obtained in the non - inverting input of amplifier stage 16 an input resistance higher than 10 13 ohms and an input capacity below 0 . 01 pico farads . opposed zener diodes 62 , disposed in unit d , to be described , prevents the latch - up of the amplifier 16 , 37 and 38 during the functioning commands of the sources of constant current , together with the coupling of the stabilized power supply ± v , which is disposed in unit c of the apparatus . connected to the minus input terminal 39 of the amplifier stage 38 is a wire 56 leading from the output terminal of unit c . unit c is a circuit for providing an offset voltage to cancel the voltage which appears on the amplifier chain 16 , 37 and 38 . such circuit applies to the minus terminal 39 of amplifier stage 38 a current that determines in the reaction resistance 40 a voltage contrary to the offset voltages that may appear at the output terminal 41 of the amplifier stage 38 . the unit c includes a power supply terminal + v which is connected to the emitter of a p - n - p transistor 50 the collector of which is connected to the source of a p - channel fet 49 , the gate of which is connected through a resistor 48 to a first end of the winding of a nulling potentiometer 47 . the anode of a diode 51 is connected to the voltage source + v , the cathode of diode 51 being connected to the gate of transistor 49 and the base of transistor 50 ; the collector of transistor 50 is connected to the source of a p - channel fet 49 . the negative terminal - v of the power source is connected to the emitter of an n - p - n transistor 44 , the collector of which is connected to the source of an n - channel fet 43 . the emitter of transistor 43 is connected through a resistor 46 to the second end of the winding of potentiometer 47 , the adjustable slider of which is connected to ground , as shown . terminal - v is also connected , to the base of transistor 44 through a diode 45 , the anode of diode 45 being connected to the gate of transistor 43 , the cathode of diode 45 being connected to the negative power terminal - v . the base of transistor 44 is connected to the gate of transistor 43 . the drains of transistors 43 and 49 are connected to a common wire 42 which is connected to the wire 56 leading to the negative input terminal 39 of the third amplifier stage 38 . by means of nulling potentiometer 47 , the differences between the outputs of the two sources of constant current in the unit c , converging to the point 42 , are closed in order to supply the current difference that flows through resistance 40 to neutralize the offset voltage described above . the neutralization circuit of the offset voltage assures a perfect equality between the potential applied to the input terminal of amplifier stage 16 and the potential from the floating null point 22 , thus to obtain a maximum input impedance at the input of the amplifier stage 16 . unit d includes an amplifier 32 which may be one sold under the trade designation &# 34 ; burr -- brown 3527 fet - input low drift ,&# 34 ; and an integrated electronic multiplier 12 , which may be one sold under the trade designation &# 34 ; analog devices ad 435 - j .&# 34 ; amplifier 32 and multiplier 12 together form an integrator with an adjustable time constant . a wire 57 connected to wire 56 is connected to ground through the above - described opposed zener diodes 62 the cathodes of which are connected . a resistor 35 is connected between wire 57 and the negative input terminal of the amplifier 32 . a condenser 34 interposed in a wire 59 extending between the negative input terminal of amplifier 32 and its output terminal 27 and the resistance 35 are the elements of the integrator with a fixed ( but adjustable ) time constant formed by means of the amplifier 32 . a resistance 33 is connected between ground and the positive input terminal of the amplifier 32 . the negative input terminal of amplifier 32 is connected by a wire 60 , in which a resistance 14 is interposed , to the output terminal 13 of the multiplier 12 . a first input x of the multiplier 12 is selectively connected by a switch s 2 to a terminal 27 connected to the output wire 27 &# 39 ; of the amplifier 32 when the movable contactor of switch s 2 is in its upper position , as shown in the drawing . when such contactor is in its lower position , the input terminal x of the multiplier 12 is connected to terminal 28 which in turn is connected to ground . a second input terminal y of multiplier 12 is connected through a terminal 29 to the movable slider 29 &# 39 ; of a potentiometer 31 . the winding of potentiometer 31 is connected between ground and the positive power supply terminal of the amplifier 32 . resistance 33 is established at a value that allows the maximum reduction of the polarization current in the amplifier 32 . multiplier 12 together with the resistance 14 forms the second reaction loop for the integrator with the amplifier 32 . because this reaction is multiplied by control voltage v c , greater than or equal to 0 , that is collected at the slider 29 &# 39 ; of the potentiometer 31 , the integrator time constant with the amplifier 32 is reduced . the result of this decrease is a time constant controlled by voltage v c existing between points 29 and 30 . the biological signals with a longer duration than the fixed time constant adjusted a priori by the value of v c are practically neutralized through the integration circuit and appears at the output terminal , but in antiphase with the biopotentials collected by the microelectrode 4 . because of this , there appear at the output terminal 41 of the preamplifier only those bioelectrical signals with a shorter duration than the time constant of the v c commanded integrator . the integration and neutralization circuit with the multiplier 12 and amplifier 32 can be inhibited by connecting the input x of the multiplier 12 to the ground terminal 28 by means of switch s 2 so that the reference electrodes 3 and 5 are connected to ground by the output impendance of multiplier 12 . the output from stage 38 of the preamplifier is led by way of terminal 41 , wire 57 , and a further wire 61 connected thereto to signal processing equipment 52 and thence to a recorder 53 or the like . although the invention is illustrated and described with reference to one preferred embodiment thereof , it is to be expressly understood that it is in no way limited to the disclosure of such a preferred embodiment , but is capable of numerous modifications within the scope of the appended claims . | 0 |
the following detailed description is merely exemplary in nature and is not intended to limit application and uses . furthermore , there is no intention to be bound by any theory presented in the preceding background or summary or the following detailed description . fig1 shows a conventional internal combustion engine 10 equipped with a turbocharger 20 . the internal combustion engine 10 is further conventionally equipped with a lubrication circuit 30 , which is only partially visible in the fig1 . the lubrication circuit 30 generally comprises an oil pump driven by the internal combustion engine 10 , which draws a lubricating oil from a sump and delivers it under pressure through a main oil gallery that is realized in the cylinder block 11 of the internal combustion engine 10 . the main oil gallery is connected via respective pipes to a plurality of exit holes for lubricating crankshaft bearings ( main bearings and big - end bearings ), camshaft bearings operating the valves , tappets , and the like . the oil pump , the sump , the main oil gallery as well as the pipes connecting the main oil gallery to the above mentioned exit holes are not shown , because they are of conventional kind and therefore widely known to the skilled man . the lubrication circuit 30 further comprises a feeding line 31 that hydraulically connects the main oil gallery of the cylinder block 11 to the turbocharger 20 , so as to lubricate the bearings of the rotating shaft connecting the compressor and the turbine of the turbocharger . the compressor , the turbine , the rotating shaft as well as the above mentioned bearings of the turbocharger 20 are not shown , because they are of conventional kind and therefore widely known to one of ordinary skilled in the art . in order to filter the lubricating oil to be fed into the turbocharger 20 , a lubricating oil filter assembly 40 is located in the feeding line 31 . the lubricating oil filter assembly 40 comprises a body 50 and a removable filter cartridge 60 coupled to the body 50 . as shown in fig2 , the body 50 is realized in a single casting comprising an oil inlet 51 , an oil outlet 52 and a cylindrical internal chamber 53 . the upper side of the chamber 53 is open to the exterior of the body 50 , while its lateral side is internally threaded . the oil inlet 51 communicates with the chamber 53 through a machined hole 54 that leads to the bottom side of the chamber 53 . the oil outlet 52 communicates with the chamber 53 through a rough channel 55 that leads to the lateral side of the chamber 53 . the removable filter cartridge 60 comprises a housing 61 containing a filter element 62 . the housing 61 is defined by a conventional banjo - bolt having an head portion 63 , a threaded stem 64 , and an internal chamber 65 communicating with the exterior of the housing 61 through an inlet 66 , realized in the bottom side of the stem 64 , and an outlet 67 , realized in the lateral side of the stem 64 . the filter element 62 has a cylindrical shape and is accommodated inside the internal chamber 65 of the housing 61 , so as to hydraulically separate the inlet 66 from the outlet 67 , with the aid of a gasket 68 . the stem 64 of the housing 61 is screwed into the chamber 53 of the body 50 , while the head portion 63 juts out from the body 50 . a gasket 69 is interposed between the head portion 63 and the body 50 , so as to guarantee the hermetical closure of the chamber 53 . as long as the removable filter cartridge 60 is coupled with the body 50 , the oil inlet 51 of the body 50 communicates with the inlet 66 of the housing 61 , while the oil outlet 52 of the body 50 communicates with the outlet 67 of the housing 61 . the body 50 further comprises an internal conduit 56 connecting the oil inlet 51 to the oil outlet 52 , bypassing the chamber 53 . the body 50 further accommodates a movable valve member 57 , in this case a valve ball , which is located in the conduit 56 , and a spring 58 , which pushes the valve member 57 against a valve seat 59 , so as to hermetically close the conduit 56 . the valve member 57 , the spring 58 and the valve seat 59 are arranged so that the pressure of the lubricating oil at the oil inlet 51 pushes the valve member 57 against the spring 58 , so as to open the conduit 56 . the spring 58 is preloaded by means of a plug 49 that is screwed into a threaded hole , through which the valve member 57 and the spring 58 are mounted into the conduit 56 . as shown in fig1 , the body 50 of the lubricating oil filter assembly 40 is fixed to a housing 21 of the compressor of the turbocharger 20 , by means of a bracket 22 . the feeding line 31 comprises a first rigid pipe 32 connecting the main gallery of the cylinder block 11 to the oil inlet 51 of the body 50 , and a second rigid pipe 33 connecting the oil outlet 52 of the body 50 to a lubricating oil inlet of the turbocharger 20 . in greater details , an extremity of the first rigid pipe 32 is connected to the main gallery of the cylinder block 11 by means of a conventional banjo fitting 34 , while the opposite extremity of the first rigid pipe 32 is brazed into the oil inlet 51 of the body 50 ( see fig2 ). similarly , an extremity of the second rigid pipe 33 is brazed into the oil outlet 52 of the body 50 , while the opposite extremity of the second rigid pipe 33 is connected to the lubricating oil inlet of the turbocharger 20 by means of another conventional banjo fitting 35 . during the operation of the internal combustion engine 10 , the lubricating oil flows in the feeding line 31 from the main oil gallery of the cylinder block 11 towards the turbocharger 20 , thereby passing inside the lubricating oil filter assembly 40 . as long as the filter element 62 is sufficiently clean , the pressure of the lubricating oil at the oil inlet 51 is unable to overcome the preload of the spring 58 , so that the valve member 57 keeps the conduit 56 closed . as a consequence , the lubricating oil is forced to flow through the filter element 62 . conversely , if a clogging of the filter element 62 occurs , the pressure of the lubricating oil at the oil inlet 51 increases and causes the valve member 57 to open the conduit 56 , so that the lubricating oil bypasses the filter element 62 , thereby reaching the turbocharger 20 anyway . as a matter of fact , the valve member 57 opens the conduit 56 once the pressure of the lubricating oil at the oil inlet 51 exceeds the preload of the spring 58 . a sensor 80 is provided for detecting the valve member 57 in opening position . subsequently , the removable filter cartridge 60 can be unscrewed from the body 50 , so as to allow the replacing of the clogged filter element 62 . fig3 and fig4 show a lubricating oil filter assembly 40 according to another embodiment of the invention , which is destined to be directly fixed to the cylinder block 11 of the internal combustion engine 10 . as a matter of fact , this lubricating oil filter assembly 40 differs from the preceding one only in that the body 50 comprises an hollow protruding nose 70 , which defines the oil inlet 51 and which is shaped so as to be directly inserted into an hole 12 of the cylinder block 11 , which leads into the main oil gallery . a gasket 71 is interposed between the protruding nose 70 and the hole 12 , so as to guarantee the hermetical closure of the main oil gallery . in the present embodiment , the feeding line 31 is defined by a single rigid pipe 36 having a first extremity brazed into the oil outlet 52 of the body 50 , and a second extremity connected to the lubricating oil inlet of the turbocharger 20 by means of the conventional banjo fitting 37 . in use , the lubricating oil filter assembly 40 according to the present embodiment operates the same way as that previously described . fig6 shows a lubricating oil filter assembly 240 according to another embodiment . the lubricating oil filter assembly 240 comprises an external housing 250 enclosing a removable filter cartridge 260 . the housing 250 comprises a cup - shaped body 251 and a bonnet 252 , which is screwed to the cup - shaped body 251 so as to define a closed internal chamber 253 , in which the removable filter cartridge 260 is accommodated . while the cup - shaped body 251 comprises an outlet 254 , the bonnet 252 comprises an inlet 255 coaxially aligned with the outlet 254 . both the inlet 255 and the outlet 254 communicate with the internal chamber 253 . the removable filter cartridge 260 comprises a body 261 and a filter element 262 associated to said body 261 . the body 261 has a cylindrical shape with a protruding flange 263 located at a first extremity . the body 261 further comprises an internal chamber 264 communicating with the exterior of the body 261 through an oil inlet 265 , realized at the first extremity of the body 261 , and an oil outlet 266 , realized at the opposite extremity of the body 261 , as clearly shown in fig7 . the filter element 262 has a cylindrical shape and is accommodated inside the chamber 264 of the body 261 , so as to hydraulically separate the oil inlet 265 from the oil outlet 266 , with the aid of a gasket 267 . the body 261 comprises an additional conduit 268 connecting the oil inlet 265 to the oil outlet 266 . the body 261 further accommodates a movable valve member 269 , in this case a valve ball , which is located in the conduit 268 , and a spring 270 , which pushes the valve member 269 against a valve seat 271 , so as to hermetically close the conduit 268 . the valve member 269 , the spring 270 and the valve seat 271 are arranged so that the pressure of the lubricating oil at the oil inlet 265 pushes the valve member 269 against the spring 270 , so as to open the conduit 268 . the spring 270 is preloaded by means of a plug 272 screwed into a threaded hole of the body 261 , through which the valve member 269 and the spring 270 are mounted inside the conduit 268 . the body 261 is inserted into the cup - shaped body 251 of the housing 250 , so as to be completely enclosed inside the internal chamber 253 , with the protruding flange 263 resting against the perimetrical edge of the opening of the cup shaped - body 251 . as long as the removable filter cartridge 260 is coupled with the housing 250 , the inlet 255 of the housing 250 communicates with the oil inlet 265 of the body 261 , while the outlet 254 of the housing 250 communicates with the oil outlet 266 of the body 261 . as shown in fig5 , the housing 250 of the lubricating oil filter assembly 240 is fixed to the housing 21 of the compressor of the turbocharger 20 , by means of a bracket 222 . the feeding line 31 comprises a first rigid pipe 232 connecting the main gallery of the cylinder block 11 to the inlet 255 of the housing 250 , and a second rigid pipe 233 connecting the outlet 254 of the housing 250 to the lubricating oil inlet of the turbocharger 20 . in greater detail , an extremity of the first rigid pipe 232 is connected to the main gallery of the cylinder block 11 by means of a conventional banjo fitting 234 , while the opposite extremity of the first rigid pipe 232 is inserted into the inlet 255 of the housing 250 . as shown in fig6 , this opposite extremity of the first rigid pipe 232 comprises a flange 235 that is interposed between an internal shoulder 273 of the bonnet 252 and the protruding flange 263 of the body 261 of the removable filter cartridge 260 . the first rigid pipe 232 is inserted into the inlet 255 of the housing 250 with a certain clearance , so that the bonnet 252 can axially move along the first rigid pipe 232 . when the bonnet 252 is screwed to the cup - shaped body 251 , the shoulder 273 presses the protruding flange 263 of the body 261 of the removable filter cartridge 260 between the flange 235 of the first rigid pipe 232 and the edge of the opening of the cup - shaped body 251 , so as to guarantee the hermetical closure of the housing 250 , eventually with the aid of a gasket . conversely , the second rigid pipe 233 has an extremity that is brazed into the outlet 254 of the housing 250 , and an opposite extremity that is connected to the lubricating oil inlet of the turbocharger 20 by means of another conventional banjo fitting 236 . during the operation of the internal combustion engine 10 , as long as the filter element 262 is sufficiently clean , the pressure of the lubricating oil at the inlet 255 is unable to overcome the preload of the spring 270 , so that the valve member 269 keeps the conduit 268 closed . as a consequence , the lubricating oil is forced to flow trough the filter element 262 . conversely , if a clogging of the filter element 262 occurs , the pressure of the lubricating oil at the inlet 255 increases and causes the valve member 269 to open the conduit 268 , so that the lubricating oil bypasses the filter element 262 , to thereby reaching the turbocharger 20 anyway . as a matter of fact , the valve member 269 opens the conduit 268 once the pressure of the lubricating oil at the inlet 255 exceeds the preload of the spring 270 . a sensor 280 is provided for detecting the valve member 269 in opening position . subsequently , the bonnet 252 of the housing 250 can be unscrewed from the cup - shaped body 251 , allowing the removable filter cartridge 260 to be removed , so as to replace the clogged filter element 262 with a clean one . fig8 and fig9 show a lubricating oil filter assembly 240 according to another embodiment , which differs from the last one , only in that the removable filter cartridge 260 , is replaced by a removable filter cartridge 360 having a different design . as shown in fig9 , the removable filter cartridge 360 comprises a body 361 containing a filter element 362 . the body 361 has a cylindrical shape with a protruding flange 363 located at a first extremity . the body 361 further comprises an internal chamber 364 communicating with the exterior of the body 361 through an oil inlet 365 , realized at the first extremity of the body 361 , and an oil outlet 366 , which is realized at the opposite extremity of the body 361 . the chamber 364 , the oil inlet 365 and the oil outlet 366 define a single conduit globally indicated as 368 . the filter element 362 is accommodated inside the chamber 364 of the body 361 , and is pushed by a spring 367 against a valve seat 369 so as to hydraulically close the oil inlet 365 with respect to the oil outlet 366 . the filter element 362 , the spring 367 and the valve seat 369 are arranged so that the pressure of the lubricating oil at the oil inlet 365 pushes the filter element 362 against the spring 367 , so as to open a passage 370 that hydraulically connects the oil inlet 365 to the oil outlet 366 . in particular , this passage 370 is provided by a clearance between the lateral side of the filter element 362 and the lateral surface of the chamber 364 . the body 361 is inserted into the cup - shaped body 251 of the housing 250 , so as to be completely enclosed inside the internal chamber , with the protruding flange 363 resting against the perimetrical edge of the opening of the cup - shaped body 251 . as long as the removable filter cartridge 360 is coupled with the housing 250 , the inlet 255 of the housing 250 communicates with the oil inlet 365 of the body 361 , while the outlet 254 of the housing 250 communicates with the oil outlet 366 of the body 261 . in this way , as long as the filter element 362 is sufficiently clean , the pressure of the lubricating oil at the inlet 255 is unable to overcome the preload of the spring 367 , so that the filter element 362 keeps the oil inlet 365 closed . as a consequence , the lubricating oil is forced to flow trough the filter element 362 . conversely , if a clogging of the filter element 362 occurs , the pressure of the lubricating oil at the oil inlet 355 increases and causes the filter element 362 to open the oil inlet 365 , so that the lubricating oil bypasses the filter element 362 , to thereby reaching the turbocharger 20 anyway . as a matter of fact , the filter element 362 works also as a valve member , which keeps the first opening 355 in direct communication with the second opening 356 , once the pressure of the lubricating oil at the oil inlet 355 exceeds the preload of the spring 367 . a sensor 380 is provided for detecting the filter element 362 in opening position . while at least one exemplary embodiment has been presented in the foregoing summary and detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration in any way . rather , the forgoing summary and detailed description will provide those skilled in the art with a convenient road map for implementing at least one exemplary embodiment , it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope as set forth in the appended claims and in their legal equivalents . | 5 |
referring now to the drawings where the illustrations are for the purpose of describing the preferred embodiment of the present invention and are not intended to limit the invention described herein , fig1 is a schematic diagram of the guard tour system 10 of the present invention utilizing mote networks . the guard tour system 10 , as illustrated , includes a client , shown generally by the numeral 12 , a server , shown generally by the numeral 14 , and a mote network , shown generally by the numeral 16 . the client 12 includes a web browser 18 capable of accessing the internet 20 . the server 14 includes an http server 22 , a data retrieval and analysis program 24 , a database 26 and mote network interface software 28 . the mote network 16 utilizes mote enabled readers 30 , 36 , 42 and 48 , each of which consists of a media reader 32 , 38 , 44 and 50 , respectively , capable of reading officer and incident identifiers that are used by the guard tour system 10 . the media readers 32 , 38 , 44 , and 50 are connected to motes 34 , 40 , 46 and 52 , respectively . officer and incident identifiers may be barcodes , magnetic stripes , rfid tags or other media or devices capable of containing the identifiers . the mote enabled readers 30 , 36 , 42 and 48 are placed at predetermined locations that guards visit along the guard patrol route . the motes 34 , 40 , 46 , 52 and 54 automatically establish a wireless connection with each other and with any pre - existing motes that are within communication range . the only requirement is that each mote 34 , 40 , 46 , 52 and 54 be within the communication range of at least one other mote in the network 16 . if locations that a guard must visit are further apart than the communication range of the motes 34 , 40 , 46 , 52 and 54 , additional motes can be placed so that each mote is within the communication range of at least one other mote . the centrally located server 14 or another computer is used to collect and analyze data from the mote network 16 . connection between the server 14 or other computer and the mote network 16 is via a wired or wireless connection to a mote 54 of the mote network 16 , utilizing a communication interface , which is present in all motes 34 , 40 , 46 , 52 and 54 . the mote to which this connection is made is known as the gateway mote , which may also have a reader attached thereto . the gateway mote can be any mote of the mote network 16 , but it is typically the mote that is in closest proximity to the server 14 or other computer used to collect and analyze data . mote network interface software 28 executing within the server 14 or other computer handles the interface with the mote network 16 . this software 28 is responsible for receiving guard tour data from the mote network 16 and storing the data in the database 26 . data stored in the database 26 by the mote network interface software 28 are immediately available to the data retrieval and analysis program 24 which is also executing within the server 14 or other computer . in a single user system , the program 24 would make guard tour data available directly to the user by means of reports and displays . in the system 10 illustrated in fig1 , such reports and displays are made available to multiple users by means of web browsers 18 which communicate with the server 14 by means of the internet 20 . http server software 22 executing within the server 14 handles the interface between the multiple web - based users and the data retrieval and analysis program 24 within the server 14 . it should be noted that different system architectures are possible , or even desirable , depending on the installation . for example , access for multiple users could be provided by a local or wide area network ( lan or wan ) instead of the internet 20 . similarly , the web browser 18 could be replaced with client software to access data via a lan or wan instead of the internet 20 directly from the database 26 or from the data retrieval and analysis program 24 . in another alternative for larger installations the http server software 22 , data retrieval and analysis program 24 , database 26 and mote network interface software 28 could each reside on separate computers . when the guard visits locations during the course of a tour , the guard reads his or her identifier using the mote enabled reader 30 , 36 , 42 , 48 . software within the mote 34 , 40 , 46 and 52 associated with the media reader 32 , 38 , 44 , 50 , respectively , provides a timestamp and an identifier unique to the mote enabled reader 30 , 36 , 42 , 48 , and its location . the guard identifier , mote enabled reader identifier , and timestamp are then transmitted via the mote network 16 to the server 14 or other computer where the data are stored in database 26 , as previously described . if incidents occur during the course of a guard &# 39 ; s patrol , the guard reads identifiers corresponding to the incidents using the nearest mote enabled reader 30 , 36 , 42 , 48 . software within the mote 34 , 40 , 46 , 52 associated with the media reader 32 , 38 , 44 , 50 , respectively , provides a timestamp and an identifier unique to the mote enabled reader 30 , 36 , 42 , 48 , and its location . the incident identifier , mote enabled reader identifier , and timestamp are then transmitted via the mote network 16 to the server 14 or other computer where the data are stored in the database 26 , as previously described . data that are stored in the database 26 are sufficient for the data analysis and retrieval program 24 to determine which guards visited each location and when each visit was made . incident data stored in the database 26 are sufficient for the data analysis and retrieval program 24 to determine which incidents occurred at or near each location and when each incident was reported . this information can be made available to users almost immediately while the guard is still at or near the last reported location . this availability of information has obvious advantages when compared with guard tour systems utilizing typical portable data collection devices . a schematic diagram of a typical mote 34 , 40 , 46 , and 52 is illustrated in fig2 . as shown , each mote 34 , 40 , 46 , and 52 is comprised of an integrated circuit 60 , a battery 62 and a power monitor 64 . the integrated circuit 60 includes a communication interface 66 , digital input / output ports 68 , a radio frequency transceiver 70 , a processor 72 , a sram 74 , a flash memory 76 , and a clock 78 . the flash memory 76 stores the operating system and associated programs of the mote , which are executed by the processor 72 utilizing the sram 74 and the clock 78 . the operating system and the associated programs monitor the digital input / output ports 68 and transmit corresponding data to the server 14 via the radio frequency transmitter 70 within the mote and antenna 80 . the operating system and associated programs also handle other functions such as relaying communications to and from other motes 34 , 40 , 46 , 52 and 54 of the mote network 16 , and providing output signals as appropriate to connected devices via the digital input / output ports 68 . the battery 62 provides power for the operation of the integrated circuit 60 and its associated circuitry . a power monitoring circuit 64 monitors battery condition and provides data indicating battery condition as an input to the digital input / output ports 68 which are monitored as previously described . if the mote involved is not mote 54 , the data indicating the battery condition is transmitted , to the server 14 via the radio frequency transmitter 70 within the mote and antenna 80 . if the mote involved is mote 54 , the data indicating the battery condition is transmitted to the server 14 via the communication interface 66 within the mote , as shown in fig3 . data from a media reader 32 , 38 , 44 , or 50 is inputted to the digital input / output ports 68 which are monitored by the operating system and associated programs of its mote , as previously described . the data are processed and time stamped by the operating system and associated programs of the mote using the clock 78 . the time stamped data are subsequently transmitted to the server 14 via the radio frequency transmitter 70 within the mote and antenna 80 if the mote involved is not mote 54 , as shown in fig2 . if the mote involved is mote 54 , the time stamped data are transmitted to the server 14 via the communication interface 66 within the mote , as shown in fig3 . the operating system and associated programs of the mote provide output signals as appropriate to the media reader 32 , 38 , 44 , or 50 indicating the success or failure of the read operation . depending on the design of the reader , this signal can cause the reader to illuminate an led or emit a sound to indicate a successful read to the guard on patrol . a schematic diagram of the gateway mote 54 is illustrated in fig3 . as shown and as previously described , the gateway mote 54 is identical to the other motes 34 , 40 , 46 , 52 , but it is also connected by a wired or wireless connection directly to the server 14 . the gateway mote 54 is the only mote of the mote network 16 with such a connection , and it is the mote through which all traffic of the mote network 16 is routed . certain modifications and improvements will occur to those skilled in the art upon reading the foregoing . it is understood that all such modifications and improvements have been deleted herein for the sake of conciseness and readability , but are properly within the scope of the following claims . | 7 |
the present invention is directed at an improved disc brake rotor 20 particularly one that includes a rotor hat 22 and at least one disc 24 as seen in fig1 - 3 ( with and without the groove feature respectively ). the disc may consist essentially of a single disc plate , as shown on the disc 24 of fig2 . it may also include a plurality of spaced apart disc plates , as in fig3 , which shows plates separated by a plurality of vanes 26 . the present invention seeks to improve on prior brake systems and particularly to change the natural frequency of the rotor so that it will fall within a predetermined target frequency . each natural frequency has an associated vibration mode shape , these mode shapes may be tangential ( e . g . in - plane ) or normal ( e . g . out - of - plane ) with respect to the friction surfaces of the disc 24 . this is accomplished by providing an improved rotor design having groove features located about the outer edge of the rotor disc and without the need to add a separate dampening band , or dampening insert , as in published u . s . application no . 2006 / 0076200 . thus , in service , the grooves of the invention herein are unfilled . additionally , this is accomplished while substantially avoiding rotor fatigue , maintaining acceptable rotor stiffness and increasing the heat dissipation potential of the rotor through increased surface area . it is contemplated that the disc 24 may consist essentially of a single solid disc or plate , as seen in fig1 - 2 , or it may include at least a pair of spaced apart plates connected by a plurality of vanes 26 as seen in fig3 . each plate 24 , whether used in a disc with single plate or a multiple plate / vane construction , may have an overall thickness of at least about 3 . 0 to 20 . 0 mm and will include a peripheral wall 28 . it is contemplated that the peripheral wall ( s ) 28 of the plate ( s ) 24 may have a generally flat profile about the 360 ° disc arc except in at least one predefined arc segment wherein there is at least one groove configuration defined therein . for embodiments that include plural plates separated by vanes , on multiple plate / vane constructions , it is contemplated that at least one if not more than one of the plates 24 will have at least one peripheral groove defined in at least one of the plates . generally , it is contemplated that a particular groove configuration is disposed about the peripheral wall in one or more multiple discrete groove segments . which may span the entirety of the peripheral wall , or only a portion . for example , separated by arc segments with a flat profile ( e . g . defined by the peripheral wall ), a different groove configuration , or any combination thereof . in one embodiment , there may be at least two groove arc segments , spaced about angularly equidistant from each other along the disc arc , and comprise at least about 7 . 5 ° of the 360 ° arc each . in another embodiment , there may be at least three groove arc segments , spaced about angularly equidistant from each other along the disc arc , and comprise at least about 5 . 00 of the 360 ° arc each . whether the groove segment is contained in a single area or in multiple areas ( e . g . two , three or more areas ) along the disc arc , it is preferable that the total grooved arc segment or segments comprise at least about 150 of the 360 ° arc , more preferably at least about 30 ° of the 360 ° arc , and most preferably at least about 600 of the 360 ° arc . in some instances , it is contemplated that the grooved arc segment may be located around the complete 360 ° of the peripheral wall 28 of the plate 24 . various groove configurations and locations within the peripheral wall 28 of the plate 24 may be employed . the profile of the groove can be a variety of differing shapes and sizes . as illustrative examples , in fig4 , the groove can have a square profile 30 , a triangular profile 32 , a rounded profile 34 , a stepped profile 36 , multiple grooves 38 with similar or differing profiles , or any combination thereof . the profile relative to the peripheral wall 28 can also include a portion with a flat side wall , an arcuate side wall , a flat bottom , an arcuate bottom , a portion substantially resembling a u - shape 40 , a portion substantially resembling a v - shape 42 , or any combination thereof . the depth of the groove g d , is measured from the outer edge of the peripheral wall moving towards the rotational axis of the disc to its deepest point . the preferable depth ranges from about 2 . 0 to 10 . 0 mm , more preferably from about 2 . 5 to 7 . 0 mm and even more preferably from about 3 . 0 to about 6 . 0 mm . depth of at least one of the grooves can also be calculable based upon the thickness of the disc 24 . for the present invention , it is believed that the greater the depth , the higher the natural frequency shift . although , a groove that is too deep can potentially cause undesirable stress and fatigue issues . in a preferred embodiment , the ratio of the disc thickness d t to the depth of at least one groove is from about 1 . 5 : 1 to 10 : 1 , even more preferably a ratio from about 1 . 75 : 1 to 5 : 1 , and most preferably from about 2 : 1 to 3 : 1 . the width of the groove g w , is measured as the maximum width of a given groove profile . the invention contemplates that the smaller the width of the groove , along with an appropriate groove depth , the higher potential for frequency separation and a higher stiffness response . the preferable width ranges from about 1 . 0 to 7 . 0 mm , more preferably from about 1 . 25 to 5 . 0 mm and even more preferably from about 1 . 5 to 4 . 0 mm . it is understood that these preferred ranges can vary as the overall thickness of the plate 24 vary from differing disc brake rotor designs . it is contemplated that the location of the groove , relative to the side walls of the plate 24 can be varied according to the needs of the overall disc brake system . in one embodiment , the groove can be placed generally near the middle of the peripheral wall 28 , thereby separating the disc plate periphery into opposing wall portions 44 of nearly equal thickness with a solid center portion ( e . g . where the groove is disposed ) in - between . in another embodiment , the groove is offset from the center in the peripheral wall 28 , thus producing opposing wall portions 44 of differing thickness ( e . g . a first opposing wall portion having one thickness and a second opposing wall portion having a second thickness ). this differing opposing wall thickness can also be accomplished by using any number of asymmetrical groove profiles , specifically where the asymmetry is calculated about the centerline of the given groove profile , for example as seen in fig4 h . in one preferred embodiment , the disc or plate 24 includes at least one groove configuration with a predetermined groove profile that is sufficient for a relative movement of an out of plane rotor mode frequency versus an in - plane rotor mode frequency by at least about 4 %, while substantially avoiding rotor fatigue . in another preferred embodiment , the disc brake rotor is a unitary structure that is cast to a near net shape including a predetermined groove profile located in the plate &# 39 ; s peripheral wall . subsequent post - casting processing may or may not be required . in yet another preferred embodiment , the disc brake rotor is machined from separate metallic stock pieces and assembled into a complete disc brake rotor , wherein the groove feature is formed by machining the groove profile into the plate 24 or plates which form the disc . in yet a further preferred embodiment , the disc brake rotor is constructed from a combination of machined and cast pieces and the groove feature can be formed by casting , machining , or any combination of these processes . in an illustrative example , shown in fig1 , a generally rectangular groove profile is included in the peripheral wall 28 of a single plate cast iron brake rotor . the groove profile has a groove depth g d of about 5 . 0 mm and a groove width g w of about 4 . 0 mm . the groove is located about the center of the peripheral wall 28 and its grooved arc segment circumscribes the entire plate 24 . in this same example the frequency response functions (“ frf ”) in both the out of plane and in - plane directions are measured prior to the addition of the groove feature and are shown as the “ baseline rotor ” line in fig5 , 6 , 7 and 8 . the groove profile is added to the rotor plate and the frequencies are measured again , shown as the “ grooved rotor ” line in fig5 , 6 , and 7 . the frequency shift for the out of plane mode ( the 10 th nodal diametrical mode , labeled as 10nd rotor mode ), referring to fig5 , is about 564 hz and the frequency shift for the 2 nd in - plane mode ( labeled 2 nd ipt mode ), referring to fig6 , is about 183 hz . referring to fig7 , the in - plane versus the out of plane modes show about an 872 hz separation , which represents an increase in separation of the two respective modes of about of 750 hz or about seven times that of the baseline rotor , baseline shown in fig8 . for the present invention , and illustrated in the above example , it is believed that the addition of the groove feature generally decreases the out of plane rotor mode frequency while increasing the in plane rotor mode frequency , thus creating one desirous effect of a larger separation between the respective frequency modes . a separation of up to ten times greater or more than compared with a rotor without the present invention . another desirous effect that is contemplated by the present invention is achieving a smaller separation between the respective frequency modes by use of the groove feature . generally it is known and understood that the environment that the disc brake rotor is located within is sometimes referred to as a corner module for a vehicle . this corner module generally includes ; a hub and bearing ; a caliper assembly ; and the rotor . a knuckle and or one or more suspension components ( e . g . a strut or arm ) may also be part of the corner module . without intending to be bound by theory , it is believed that certain of the noise that is overcome by the present invention is due to a vibration that results from a plurality of frequencies ( e . g ., at least a first frequency and a second frequency ) arising from one or more deformation modes of the rotor 20 . the invention thus contemplates a method for designing an automotive vehicle brake for reducing noise contributed by a brake rotor of an automotive vehicle , comprising the steps of identifying at least a first and a second frequency in at least one deformation mode for a rotor having a rotational axis and selectively introducing a groove feature ( as taught herein ) to the peripheral wall 28 of the disc 24 for achieving frequency shift of at least about 4 %. unless stated otherwise , dimensions and geometries of the various structures depicted herein are not intended to be restrictive of the invention , and other dimensions or geometries are possible . plural structural components can be provided by a single integrated structure . alternatively , a single integrated structure might be divided into separate plural components . the rotor hat 22 and the disc or plate 24 can be either a unitary structure or separate pieces that are assembled together . in addition , while a feature of the present invention may have been described in the context of only one of the illustrated embodiments , such feature may be combined with one or more other features of other embodiments , for any given application . it will also be appreciated from the above that the fabrication of the unique structures herein and the operation thereof also constitute methods in accordance with the present invention . the preferred embodiment of the present invention has been disclosed . a person of ordinary skill in the art would realize however , that certain modifications would come within the teachings of this invention . therefore , the following claims should be studied to determine the true scope and content of the invention . | 5 |
referring to fig1 to fig4 , a actuator 20 in accordance with a first embodiment of the present invention includes a gearbox 30 and a motor 40 . the gearbox 30 includes a gear housing 31 , a worm wheel 33 and a worm shaft 81 disposed in the gear housing 31 , and an output gear 34 . the output gear 34 rotates coaxially along with the worm wheel 33 . a worm is mounted on or formed with the worm shaft 81 and meshes with the worm wheel 33 . a bearing 35 is mounted in the gear housing 31 for supporting the worm shaft 81 . the motor 40 includes a stator 45 and a rotor 70 . the stator 45 includes a motor housing 51 , an end cover 53 mounted to one end of the motor housing 51 to enclose an opening of the motor housing 51 , permanent magnets ( not shown ) mounted to an inner surface of the motor housing 51 , a brush assembly and an end cover 61 mounted to another open end of the motor housing 51 . the rotor includes a rotor shaft 71 , a rotor core 73 and a commutator 75 fixed to the rotor shaft 71 , and rotor windings ( not shown ) wound around teeth of the rotor core 73 . the brush assembly includes a brush card or brush holder 56 and at least two brushes 57 supported by the brush holder 56 and arranged to make sliding contact the commutator 75 . bearings 55 , 59 are respectively mounted in the end covers 53 , 61 , for supporting the rotor shaft 71 . the rotor is rotatably mounted to the stator 45 through the bearings . rotating the rotor causes the worm shaft 81 to rotate coaxially with the rotor shaft 71 to achieve an output with reduced speed by means of the worm wheel 33 and the output gear 34 . in this embodiment , the motor housing 51 and the end covers 53 , 61 are made of an electrically conductive material . the end cover 61 forms a bearing seat or bearing holder for mounting of the bearing 59 . the bearing 59 is made of an electrically conductive material ( e . g . copper ). therefore , the rotor shaft 71 is electrically connected with the motor housing 51 through the bearing 59 and end cover 61 . as such , the motor housing 51 , end cover 53 , end cover 61 and rotor shaft 71 cooperatively define a closed chamber . the closed chamber acts as an electromagnetic shield which effectively prevents electromagnetic radiation produced by the brush assembly , rotor windings and commutator 75 inside the motor interfering with external devices . preferably , during use , the electromagnetic compatibility ( emc ) of the actuator 20 may be further increased by grounding of the motor 40 . in this embodiment , the brush assembly is located within the electromagnetic shield , such that the electromagnetic interference of the brush assembly with external devices during current reversal can be reduced or avoided . in this case , filtering elements such as capacitors or inductors that are mounted to the brush assembly are also located within the electromagnetic shield . referring to fig4 , in this embodiment , the end cover 61 includes a cover body 62 . the cover body 62 is recessed at a central portion to form an axially - extending cylindrical flange 64 . the cylindrical flange 64 forms the bearing seat . connecting tabs 66 extend outwardly from an outer edge of the cover body 62 . correspondingly , the motor housing 51 of the motor includes receiving portions 52 ( e . g . through holes , slots or notches ) that receive the connecting tabs 66 to achieve electrical connection between the motor housing 51 and the end cover 61 . the outer edge of the cover body 62 may also form a cutout 67 for engaging with the brush holder 56 of the brush assembly in a recess - protrusion engagement manner for facilitating positioning and mounting of the end cover 61 . in this embodiment , the bearing 59 is implemented as a sleeve bearing ( also referred to as oil - impregnated bearing ). while the rotor shaft 71 is not inference - fit within the inner hole of the sleeve bearing and there is a small clearance between the sleeve bearing and the rotor shaft 71 , it is noted , however , that the rotor shaft 71 is supported by and thus establishes electrical connection with the sleeve bearing 59 at any time . therefore , the implementation of the bearing 59 as the sleeve bearing does not affect the electrical connection between the rotor shaft 71 and the motor housing 51 . it is also to be understood that the bearing 59 may also be implemented as a rolling bearing such as a ball bearing . in this case , the rotor shaft 71 is interference - fit with an inner ring of the rolling bearing to establish the electrical connection therebetween . an electrical connection between the inner ring and an outer ring of the rolling bearing is established through rolling elements such as steel balls . the outer ring of the rolling bearing is interference - fit with the bearing seat of the end cover to establish an electrical connection therebetween . in this embodiment , the end cover 61 is made of electrically conductive material , which acts as a conductor electrically connecting the bearing 59 and the motor housing 51 . alternatively , the end cover 61 may be made of an insulating material ( e . g . plastic ), and the bearing 59 and motor housing 51 are electrically connected by an electrically conductive member mounted to the end cover 61 or an electrically conductive connecting layer ( e . g . a copper foil layer ) disposed over the end cover 61 . referring to fig3 , fig5 and fig1 , in this embodiment , the worm shaft 81 and rotor shaft 71 are made of a metal material . the worm shaft 81 and the rotor shaft 71 are coaxially connected through an insulating member 90 , such that the worm shaft 81 rotates along with the rotor shaft 71 . because the worm shaft 81 is electrically insulated from the rotor shaft 71 , conduction of the electromagnetic interference from the rotor shaft 71 to the worm shaft 81 is reduced or eliminated , thus further increasing the emc of the actuator . preferably , the location where the rotor shaft 71 is insulated from the worm shaft 81 is located outside the electromagnetic shield and close to the end cover 61 . as such , the electromagnetic shield is substantially closed , and most parts of the rotor shaft 71 is located within the electromagnetic shield . in this embodiment , one end of the rotor shaft 71 adjacent the worm shaft includes a flat portion for connecting with a reinforcement member 87 . the reinforcement member 87 has a through hole 88 at a central portion thereof for receiving the flat portion 72 . three projections 89 extend outwardly from a circumferential periphery of the reinforcement member 87 . one end of the worm shaft 81 close to the rotor shaft forms a connecting head 82 with a reduced outer diameter . multiple axial ribs 83 are formed on an outer periphery of the connecting head 82 . the insulating member 90 preferably is made of bakelite and is connected with the reinforcement member 87 and the connecting head 82 of the worm shaft to coaxially fix the rotor shaft 71 and the worm shaft 81 to each other . in this embodiment , the insulating member 90 includes a cylindrical main body 91 , three position - limiting blocks 95 at one side of the main body 91 , and an annular body 97 surrounding the three position - limiting blocks 95 . a connecting hole 93 is formed in a central portion of the main body 91 . the connecting head 82 of the worm shaft 81 is interference - fit in the connecting hole 93 . the ribs 83 on the outer periphery of the connecting head 82 reinforce the connection between the connecting head 82 and the main body 91 . the reinforcement member 87 is mounted in the annular body 97 of the insulating member 90 , with the three position - limiting blocks 95 of the insulating member 90 alternately arranged with the three projections 89 of the reinforcement member 87 for the transmission of the driving force . an outer circumferential surface of the annular body 97 is flush with an outer circumferential surface of the main body 91 , such that the insulating member 90 has a continuous smooth surface which reduces rotational resistance . in this embodiment , an axial length of the connecting head 82 of the worm shaft 81 is less than a depth of the connecting hole 93 of the main body 91 , such that a gap 98 is formed between the rotor shaft 71 and the worm shaft 81 ( fig1 ). this gap 98 ensures that the worm shaft 81 and the rotor shaft 71 are electrically insulated from each other . alternatively , as shown in fig1 , the main body 91 may have a bottom portion 99 at one end of the central connecting hole 93 adjacent the rotor shaft 71 . this bottom portion 99 is integrally formed with the insulating member 90 for isolating the rotor shaft 71 from the worm shaft 81 , thereby ensuring electrical isolation between the rotor shaft 71 and the worm shaft 81 . it is noted that the connecting head 82 of the worm shaft 81 should not be limited to the shape as described above . rather , any shape of the connecting head 82 is possible as long as it enables the coaxial rotation of the insulating member 90 and the worm shaft 81 . similarly , the end of the rotor shaft 71 close to the worm shaft is not intended to be limited to the structure having the flat portion 72 . it is also noted that the reinforcement member 87 is used mainly to reinforce the connection between the rotor shaft 71 and the insulating member 90 . therefore , the reinforcement member 87 may be omitted in another embodiment . in addition , the flat portion 72 of the rotor shaft 71 is used mainly to achieve torque transfer to prevent relative movement . therefore , the flat portion of the rotor shaft 71 may be replaced with another non - circular head such as a square head or a hexagonal head . it is also noted that the design of the insulating connection between the rotor shaft and worm shaft as shown in fig5 to fig7 may be also applied in another type of actuator . in the description and claims of the present application , each of the verbs “ comprise ”, “ include ”, “ contain ” and “ have ”, and variations thereof , are used in an inclusive sense , to specify the presence of the stated item or feature but do not preclude the presence of additional items or features . it is appreciated that certain features of the invention , which are , for clarity , described in the context of separate embodiments , may also be provided in combination in a single embodiment . conversely , various features of the invention which are , for brevity , described in the context of a single embodiment , may also be provided separately or in any suitable sub - combination . the embodiments described above are provided by way of example only , and various other modifications will be apparent to persons skilled in the field without departing from the scope of the invention as defined by the appended claims . | 7 |
referring to fig1 , a chemical mechanical polishing apparatus includes a rotatable platen 10 for supporting a polishing pad ( not shown ). in other respects , the cmp apparatus can be configured as described in u . s . pat . no . 5 , 738 , 574 , the entire disclosure of which is incorporated by this reference . the surface of the platen 10 can include an outer region 12 , a center region 14 , and a middle region 16 that lies in between the outer region 12 and center region 14 . in one implementation , the surface of the platen 10 can be shaped as a circle . the center 14 , middle region 16 , and outer 12 regions can represent radial regions of the circular surface , with the circular center region 14 being closest to the center , the annular outer region 12 being furthest from the center and the annular middle region 16 being between the annular outer 12 and the circular center 14 . the amount of pressure that the platen exerts against the polishing pad can vary among regions of the platen . a given region , for example , the middle region 16 , can exert more pressure than another region . the difference in pressure between regions can be implemented , for example , by varying the height of a given region relative to other regions of the platen . in one implementation , shown in fig2 , the platen 10 includes a base 22 that supports the center region 14 , middle region 16 and outer region 12 . in addition , the platen 10 includes an actuator 20 , such as an electric or pneumatic actuator , that can extend or contract to adjust the height of a portion of the platen . for example , the middle region 16 of the platen can be physically separable from the surrounding regions and can rest upon or be attached to the actuator 20 so that as the actuator 20 extends or contracts , the middle region 16 is raised or lowered accordingly . the actuator 20 can be connected by a control line 22 to unillustrated control elements , such as pneumatic or electronic controllers . the actuator 20 can be configured to position the middle region 16 such that the middle region 16 is elevated with respect to the adjacent regions 12 , 14 . the difference in height between the middle region 16 and the adjacent regions 12 , 14 can be increased or decreased by extending or contracting the actuator 20 . in another implementation , shown in fig3 a , the platen 10 includes a pneumatic support structure such as a pressurized chamber 30 . the chamber 30 can be located underneath the middle region 16 , which can be formed by a flexible membrane 34 that seals the pressurized chamber 30 . the edges of the flexible membrane 34 can be attached to the adjacent regions 12 , 14 of the platen 10 . the pressure within the chamber 30 can be created by forcing a fluid , typically a gas such as air , into or out of the chamber . as the pressure within the chamber 30 increases , the membrane 34 can become distended , rising the most near the center of the membrane 34 and rising less near the ends of the membrane 34 . the chamber 30 can be connected by tubing or passages 32 to unillustrated pressure control elements , such as valves , pumps , pressure lines , vacuum lines , and pressure regulators . alternatively , the pressure control elements can be located inside the platen . the chamber 30 is pressurized so that the pressure at the center of the membrane 34 is greater than the pressure at the adjacent regions 12 , 14 . the difference in pressure between the middle region 16 and the adjacent regions 12 , 14 can be adjusted by adjusting the amount of fluid in the chamber . in fig3 a , the membrane 34 is shown having a uniform thickness . alternatively , the membrane 34 can have portions of varying thickness . for example , one portion of the membrane can be thicker than another portion of the membrane , as depicted in fig3 b . in such cases , the thicker portion of the membrane rises less than the thinner portions of the membrane . the thicker portion of the membrane can be located radially outside or radially inside the thinner portion of the membrane . in yet another implementation , shown in fig4 a and 4b , the middle region 16 of the platen &# 39 ; s 10 surface contains a recess or groove 40 . the groove 40 is open at the top , but the placement of a polishing pad 42 over the platen 10 completely covers and seals the opening of the groove 40 to form a pressurizable chamber 44 . the polishing pad 42 needs to be sufficiently flexible that it will undergo some distortion in response to the pressure in the chamber 44 . the thickness and composition of the polishing pad 42 can affect the pad &# 39 ; s flexibility . also , the width of the groove 40 can affect the amount of pressure that is produced within the pressurized chamber 44 . in one implementation , the polishing pad is formed of a porous polyurethane material measuring 0 . 05 inches thick and the pad completely covers a groove that measures 0 . 1 inches wide . the level of pressure in the chamber 44 can be controlled , e . g ., by unillustrated pressure control elements , such as valves , pumps , pressure lines , vacuum lines , and pressure regulators that are connected to the chamber 44 by a passage or tubing 46 . changing pressure in the chamber 44 proportionally changes the force by which the portion of the polishing pad covering the groove is pressed against the substrate . the number of grooves , the location of each groove , and the location of the substrate relative to the grooves can be varied to produce different polishing profiles . for example , fig5 shows a single circular groove 50 located near the center of the platen 10 . a polishing pad ( not shown ) covers the groove 50 and a substrate 52 is positioned on top of the polishing pad such that only the edge portion of the substrate 52 overlaps with the groove 50 . with the groove 50 and the substrate 52 so positioned , more force can be exerted during polishing against the edge portion of the substrate 52 than against portions of the substrate which do not overlap with the groove 50 . although specific implementations have been described herein , those skilled in the art will recognize that the implementations disclosed herein may be changed without deviating from the scope of the invention . for example , instead of having a grooved surface , the platen can have a ridged surface formed by attaching a rigid ring to the surface of the platen . | 1 |
the present invention relates to substantially homogenous preparations of chemically modified proteins , and methods therefor . “ substantially homogenous ” as used herein means that the only chemically modified proteins observed are those having one “ modifier ” ( e . g ., dtpa , edta 2 , succinyl ) moiety . the preparation may contain unreacted ( i . e ., lacking modifier moiety ) protein . as ascertained by peptide mapping and n - terminal sequencing , one example below provides for a preparation which is at least 90 % modified protein , and at most 10 % unmodified protein . preferably , the chemically modified material is at least 95 % of the preparation ( as in the working example below ) and most preferably , the chemically modified material is 99 % of the preparation or more . the chemically modified material has biological activity . the present “ substantially homogenous ” monosuccinylated leptin , dtpa - leptin , and edta 2 - leptin preparations provided herein are those which are homogenous enough to display the advantages of a homogenous preparation , e . g ., ease in clinical application in predictability of lot to lot pharmacokinetics . as used herein , biologically active agents refers to recombinant or naturally occurring proteins , whether human or animal , useful for prophylactic , therapeutic or diagnostic application . the biologically active agent can be natural , synthetic , semi - synthetic or derivatives thereof . in addition , biologically active agents of the present invention can be perceptible . a wide range of biologically active agents are contemplated . these include but are not limited to hormones , cytokines , hematopoietic factors , growth factors , antiobesity factors , trophic factors , anti - inflammatory factors , and enzymes ( see also u . s . pat . no . 4 , 695 , 463 for additional examples of useful biologically active agents ). one skilled in the art will readily be able to adapt a desired biologically active agent to the compositions of present invention . such proteins would include but are not limited to interferons ( see , u . s . pat . nos . 5 , 372 , 808 , 5 , 541 , 293 , 4 , 897 , 471 , and 4 , 695 , 623 hereby incorporated by reference including drawings ), interleukins ( see , u . s . pat . no . 5 , 075 , 222 , hereby incorporated by reference including drawings ), erythropoietins ( see , u . s . pat . nos . 4 , 703 , 008 , 5 , 441 , 868 , 5 , 618 , 698 , 5 , 547 , 933 , and 5 , 621 , 080 hereby incorporated by reference including drawings ), granulocyte - colony stimulating factors ( see , u . s . pat . nos . 4 , 810 , 643 , 4 , 999 , 291 , 5 , 581 , 476 , 5 , 582 , 823 , and pct publication no . 94 / 17185 , hereby incorporated by reference including drawings ), stem cell factor ( pct publication nos . 91 / 05795 , 92 / 17505 and 95 / 17206 , hereby incorporated by reference including drawings ), and leptin ( ob protein ) ( see pct publication nos . 96 / 40912 , 96 / 05309 , 97 / 00128 , 97 / 01010 and 97 / 06816 hereby incorporated by reference including figures ). pct publication no . wo 96 / 05309 , published feb . 22 , 1996 , entitled , “ modulators of body weight , corresponding nucleic acids and proteins , and diagnostic and therapeutic uses thereof ” fully sets forth ob protein and related compositions and methods , and is herein incorporated by reference . an amino acid sequence for human ob protein is set forth at wo 96 / 05309 seq . id nos . 4 and 6 ( at pages 172 and 174 of that publication ), and the first amino acid residue of the mature protein is at position 22 and is a valine residue . the mature protein is 146 residues ( or 145 if the glutamine at position 49 is absent , seq . id no . 4 ). in addition , biologically active agents can also include but are not limited to insulin , gastrin , prolactin , adrenocorticotropic hormone ( acth ), thyroid stimulating hormone ( tsh ), luteinizing hormone ( lh ), follicle stimulating hormone ( fsh ), human chorionic gonadotropin ( hcg ), motilin , interferons ( alpha , beta , gamma ), interleukins ( il - 1 to il - 12 ), tumor necrosis factor ( tnf ), tumor necrosis factor - binding protein ( tnf - bp ), brain derived neurotrophic factor ( bdnf ), glial derived neurotrophic factor ( gdnf ), neurotrophic factor 3 ( nt3 ), fibroblast growth factors ( fgf ), neurotrophic growth factor ( ngf ), bone growth factors such as osteoprotegerin ( opg ), insulin - like growth factors ( igfs ), macrophage colony stimulating factor ( m - csf ), granulocyte macrophage colony stimulating factor ( gm - csf ), megakaryocyte derived growth factor ( mgdf ), keratinocyte growth factor ( kgf ), thrombopoietin , platelet - derived growth factor ( pgdf ), colony simulating growth factors ( csfs ), bone morphogenetic protein ( bmp ), superoxide dismutase ( sod ), tissue plasminogen activator ( tpa ), urokinase , streptokinase and kallikrein . the term proteins , as used herein , includes peptides , polypeptides , consensus molecules , analogs , derivatives or combinations thereof . in general , comprehended by the invention are pharmaceutical compositions comprising effective amounts of chemically modified protein , or derivative products , together with pharmaceutically acceptable diluents , preservatives , solubilizers , emulsifiers , adjuvants and / or carriers needed for administration . ( see pct 97 / 01331 hereby incorporated by reference .) the optimal pharmaceutical formulation for a desired biologically active agent will be determined by one skilled in the art depending upon the route of administration and desired dosage . exemplary pharmaceutical compositions are disclosed in remington &# 39 ; s pharmaceutical sciences ( mack publishing co ., 18th ed ., easton , pa ., pgs . 1435 - 1712 ( 1990 )). the pharmaceutical compositions of the present invention may be administered by oral and non - oral preparations ( e . g ., intramuscular , subcutaneous , transdermal , visceral , iv ( intravenous ), ip ( intraperitoneal ), intraarticular , placement in the ear , icv ( intracerebralventricular ), ip ( intraperitoneal ), intraarterial , intrathecal , intracapsular , intraorbital , injectable , pulmonary , nasal , rectal , and uterine - transmucosal preparations ). therapeutic uses of the compositions of the present invention depend on the biologically active agent used . one skilled in the art will readily be able to adapt a desired biologically active agent to the present invention for its intended therapeutic uses . therapeutic uses for such agents are set forth in greater detail in the following publications hereby incorporated by reference including drawings . therapeutic uses include but are not limited to uses for proteins like interferons ( see , u . s . pat . nos . 5 , 372 , 808 , 5 , 541 , 293 , hereby incorporated by reference including drawings ), interleukins ( see , u . s . pat . no . 5 , 075 , 222 , hereby incorporated by reference including drawings ), erythropoietins ( see , u . s . pat . nos . 4 , 703 , 008 , 5 , 441 , 868 , 5 , 618 , 698 , 5 , 547 , 933 , and 5 , 621 , 080 hereby incorporated by reference including drawings ), granulocyte - colony stimulating factors ( see , u . s . pat . nos . 4 , 999 , 291 , 5 , 581 , 476 , 5 , 582 , 823 , 4 , 810 , 643 and pct publication no . 94 / 17185 , hereby incorporated by reference including drawings ), stem cell factor ( pct publication nos . 91 / 05795 , 92 / 17505 and 95 / 17206 , hereby incorporated by reference including drawings ), and the ob protein ( see pct publication nos . 96 / 40912 , 96 / 05309 , 97 / 00128 , 97 / 01010 and 97 / 06816 hereby incorporated by reference including figures ). in addition , the present compositions may also be used for manufacture of one or more medicaments for treatment or amelioration of the conditions the biologically active agent is intended to treat . the principal embodiment of the method for making the substantially homogenous preparation of monosuccinylated protein comprises : ( a ) reacting a protein with 3 - 7 fold molar excess of succinic anhydride ; ( b ) stirring the reaction mixture 2 - 16 hours at 4 ° c . ; ( c ) dialyzing said mixture against 20 mm tris - hcl , ph 7 . 2 ; and ( d ) isolating said monosuccinylated protein . optionally , the method can comprise , just after step ( b ), the steps of : adding solid hydroxylamine to said mixture while maintaining the ph above 6 . 5 until said hydroxylamine is completely dissolved , followed by elevating the ph to 8 . 5 using 5 n naoh , followed by stirring said mixture another 1 - 2 hours at 4 ° c . the general process is shown schematically in example 1 . the principal embodiment of the method for making the substantially homogenous preparation of dtpa - protein comprises : ( a ) reacting a protein with 1 - 5 fold molar excess of dtpa ; ( b ) stirring the reaction mixture 2 - 16 hours at 4 ° c . ; ( c ) dialyzing said mixture against 20 mm tris - hcl , ph 7 . 2 ; and ( d ) isolating said dtpa - protein . the general process is shown schematically in example 1 . the principal embodiment of the method for making the substantially homogenous preparation of edta 2 - protein comprises : ( a ) reacting a protein with 0 . 5 - 5 fold molar excess of edta 2 ; ( b ) stirring the reaction mixture 2 - 16 hours at 4 ° c . ; ( c ) filtering said reaction mixture ; ( d ) concentrating said reaction mixture ; and ( e ) isolating said edta 2 - protein . the general process is shown schematically in example 1 . the following examples are offered to more fully illustrate the invention , but are not to be construed as limiting the scope thereof . example 1 describes the preparation of monosuccinylated leptin , monosubstituted dtpa - leptin monomers and dimers , and edta 2 - leptin monomers and dimers . example 2 describes the physiochemical characterization of the modified leptin species prepared in example 1 . example 3 describes the receptor binding studies performed on the modified leptin species prepared in example 1 . example 4 describes the solubility testing performed on the modified leptin species prepared in example 1 . example 5 describes the in vivo bioactivity studies performed on the modified leptin species prepared in example 1 . example 6 describes the injection site evaluation performed on the modified leptin species prepared in example 1 . this example describes the preparation of monosuccinylated leptin , monosubstituted dtpa - leptin monomers and dimers , and edta 2 - leptin monomers and dimers . the protein succinylation method of the present invention can be generally depicted as follows : recombinant human - methionyl - leptin ( rhu - met - leptin ) protein ( prepared as described in materials and methods , infra ) at 2 - 3 mg / ml in 20 mm nahpo 4 , ph 7 . 0 , was reacted with 3 - 7 fold molar excess of solid succinic anhydride ( sigma chemical , st . louis , mo . ), with a 5 fold molar excess preferred , and the reaction stirred 2 - 16 hours at 4 ° c . solid hydroxylamine ( sigma chemical , st . louis , mo .) is then added to the reaction while maintaining the ph above 6 . 5 . after the hydroxylamine has dissolved completely the ph is elevated to 8 . 5 using 5 n naoh and the reaction allowed to stir another 1 - 2 hours at 4 ° c . ( the hydroxylamine step may be omitted with a small decrease in yield ). finally , the reaction is dialyzed against 20 mm tris - hcl , ph 7 . 2 . the monosuccinylated rhu - met - leptin is isolated by anion exchange chromatography with a high performance sepharose q column ( pharmacia , piscataway , n . j .) in 20 mm tris , ph 7 . 2 , with a 0 - 0 . 5 m nacl gradient ( see fig1 ). the product is recognized in the eluant by an isoelectric shift of − 0 . 7 pi units observed with isoelectric focusing ( ief ) page using a 5 % polyacrylamide , ph 3 - 7 gel ( novex , inc ., san diego , calif .) ( fig2 ). final recovery of monosuccinylated rhu - met - leptin is typically 45 - 47 %. the dtpa modification method of the present invention can be generally depicted as follows : recombinant human - methionyl - leptin ( rhu - met - leptin ) protein ( prepared as described in materials and methods , infra ) at 2 - 3 mg / ml in 20 mm nahpo 4 , ph 7 . 0 , was reacted with a 1 - 5 fold molar excess of solid dtpa ( sigma chemical , st . louis , mo . ), with 2 - 3 fold molar excess preferred , and the reaction stirred 2 - 16 hours at 4 ° c . finally , the reaction is dialyzed against 20 mm tris - hcl , ph 7 . 2 . the dtpa modified rhu - met - leptin is isolated by anion exchange chromatography with a high performance sepharose q column ( pharmacia , piscataway , n . j .) in 20 mm tris , ph 7 . 2 , with a 0 - 0 . 5 m nacl gradient . alternatively , monomeric and dimeric forms of monosubstituted dtpa - rhu - met - leptin or rhu - met - leptin are separated by size exclusion chromatography on a sephacryl 100 column ( pharmacia , piscataway , n . j .) in pbs ( life technologies , grand island , n . y . )( see fig3 ). the products are recognized in the eluant by an isoelectric shift observed with the monomeric dtpa - leptin by isoelectric focusing ( ief ) page using a 5 % polyacrylamide , ph 3 - 7 gel ( novex , inc ., san diego , calif . )( fig2 ) or the mass increase of a crosslinked dimer observed with sds - page using a 4 - 20 % polyacrylamide gel ( novex , inc ., san diego , calif . )( see fig4 ). final recovery of dtpa - rhu - met - leptin dimer is approximately 30 %. the edta 2 modification method of the present invention can be generally depicted as follows : recombinant human - methionyl - leptin ( rhu - met - leptin ) protein ( prepared as described in materials and methods , infra ) at 2 - 3 mg / ml in 20 mm nahpo 4 , ph 7 . 0 , was reacted with a 0 . 5 - 5 fold molar excess of edta 2 ( aldrich chemical co ., milwaukee , wis .) either as a solid or dissolved in dmso , with 0 . 75 fold molar excess edta 2 in dmso preferred , and the reaction stirred 2 - 16 hours at 4 ° c . the reaction is then filtered through a 0 . 45 micron filter ( nalgene ), concentrated by stirred cell over 10 kda molecular weight cutoff membrane to ˜ 20 mg / ml and the monomeric and dimeric forms of monosubstituted edta 2 - rhu - met - leptin then separated by size exclusion chromatography on a sephacryl 100 column ( pharmacia , piscataway , n . j .) equilibrated in pbs ( see fig5 ). alternatively , the reaction may be purified by hydrophobic interaction chromatography using a high performance phenyl - sepharose column ( pharmacia , piscataway , n . j .) eluted with a 0 . 8 - 0 m ammonium sulfate gradient in 20 mm nahpo 4 , ph 7 . 0 . the products are recognized in the eluant by an isoelectric shift observed with the monomeric edta 2 - rhu - met - leptin by isoelectric focusing ( ief ) page using a 5 % polyacrylamide , ph 3 - 7 gel ( novex , inc ., san diego , calif .) ( fig2 ) or the mass increase of a crosslinked dimer observed with sds - page using a 4 - 20 % polyacrylamide gel ( novex , inc ., san diego , calif . )( fig4 ). final recovery of edta 2 - rhu - met - leptin dimer exceeds 50 %. this example describes the physiochemical characterization of the leptin conjugates prepared in example 1 . modification of succinyl - leptin , dtpa - leptin monomers and dimers , and edta 2 - leptin monomers and dimers was evaluated by a combination of peptide mapping of lys - c digests on reverse phase hplc , maldi - tof mass spectrometry and peptide sequencing . lys - c digests of unmodified leptin and the various modified leptins were performed by reaction of 100 μg of protein with 4 μg of endoproteinase lys - c ( boehringer mannheim ) in 50 mm tris - hcl , ph 8 . 5 ( 200 μl ) for four hours at room temperature . peptide maps of the various samples were generated by reverse phase hplc on a 4 . 6 × 250 mm , 5 μ c4 column ( vydak , hesperia , calif .) equilibrated in 0 . 1 % triflouroacetic acid ( tfa ) with elution over a 0 - 90 % acetonitrile gradient ( see fig6 - 8 ). as evidenced by the plots depicted in fig6 - 8 , only the n - terminal peptide ( m1 - k6 ) shows any change in retention time as a result of chemical modification . this result indicates that lysine at position 6 is unmodified and accessible to lys - c digestion and suggests that the chemical modification occurs at the α - amine of the n - terminus . n - terminal modification is further supported by efforts at n - terminal sequencing which indicate that the n - terminus is blocked ( data not shown ). mass determinations for succinyl - leptin and dtpa - and edta 2 - leptin dimers were made on a kompact maldi iv ( kratos , ramsey , n . j .) using a 12 pmol sample in a sinapinic acid matrix . each conjugate indicates a single chemical modification per molecule . in addition to the analysis above , the effects on the secondary structure of the succinyl - leptin was evaluated using circular dichroism spectroscopy . far - uv circular dichroism spectra of unmodified and succinylated leptin in phosphate buffered saline were collected using a 0 . 05 cm cell in a jasco j - 710 circular dichroism spectrophotometer ( jasco , tokyo , japan ). the spectra are depicted in fig9 and demonstrate that the secondary structure of succinylated - leptin is preserved . in sum , the example 2 data confirms the modification of succinyl - leptin , dtpa - leptin monomers and dimers , and edta 2 - leptin monomers and dimers at the n - terminus , as well as preservation of secondary structure with succinyl - leptin . this example describes the receptor binding studies performed on each of the leptin conjugates prepared in example 1 . each of the leptin conjugates prepared in example 1 was evaluated using an in vitro receptor binding assay which measures the relative affinity of leptin conjugates based on their ability to displace radiolabeled human leptin from a human leptin receptor expressed in immobilized cell membranes . as evidenced by the fig1 data , the chemically modified isoforms , succinyl -, dtpa -, and edta 2 - leptin each showed relative affinities for human leptin receptor equal to the unmodified leptin over the entire range of ligand binding (˜ 1 - 100 ng / ml ), with ed 50 &# 39 ; s of approximately 10 ng / ml . the example 3 data thus show that the monosubstituted succinyl - leptin , monosubstituted dtpa - leptin dimer , and edta 2 - leptin dimer demonstrate preservation of in vitro receptor binding activity as compared to unmodified leptin . this example describes the solubility testing performed on each of the leptin conjugates prepared in example 1 . the leptin conjugates were dialyzed into pbs then concentrated with centriprep concentrators , 10 kda molecular weight cutoff ( amicon ) to the point that precipitates were observed . the sample was clarified by centrifugation and the conjugate protein concentration in the supernatant determined . the samples were then kept at room temperature (≈ 22 ° c .) for 48 hours and at regular time points centrifuged and the conjugate protein concentration in the supernatant redetermined . the solubility of the conjugate protein in pbs is thus defined as the steady state protein concentration at room temperature observed in the supernatant after centrifugation ( see table 2 ). this example describes the in vivo bioactivity studies performed on the leptin conjugates prepared in example 1 . the described leptin conjugates were tested in both mouse and dog animal models to determine bioefficacy relative to the unmodified leptin . mice were injected daily for 5 - 7 days with monosubstituted succinyl - leptin , dtpa - leptin dimer , dtpa - leptin monomer and edta 2 - leptin dimer at dosages of 1 , 10 and 50 mg / kg body weight . bioefficacy was measured as a percentage weight loss from day 0 , normalized to the vehicle alone control and compared to the weight loss observed with the unmodified protein . all samples for dosages of 1 and 10 mg / kg were formulated in pbs at 0 . 2 and 2 . 0 mg / ml respectively . higher dosages were formulated in pbs at 20 - 50 mg / ml for the chemically modified forms , however the solubility limits of the unmodified leptin necessitated its formulation at high concentrations in a ph 4 acetate buffer . in addition dogs were injected with 0 . 05 , 0 . 15 and 0 . 5 mg / kg daily dosages of succinyl - leptin at 5 mg / ml over 28 days while monitoring weight loss followed by a recovery period . bioactivity , as judged by drug induced weight loss in animal models , for succinyl leptin was equivalent to the unmodified leptin in both dogs and mice ( fig1 ). similarly , both dtpa - leptin monomers and dimers and edta 2 - leptin dimers caused equivalent weight loss in mice as compared to the unmodified leptin ( fig1 & amp ; 12 ). the fig1 & amp ; 12 data show that the monosubstituted succinyl - leptin , monosubstituted dtpa - leptin monomers and dimers , and edta 2 - leptin dimer demonstrate preservation of in vivo bioefficacy as compared to unmodified leptin . this example describes the injection site evaluation performed on the leptin conjugates prepared in example 1 . tissue sections from the injection sites of three mice from each dosing group were examined histochemically . injection site pathology &# 39 ; s which were identified and scored were necrosis , suppurative ( mixed cell infiltrate composed of eosinophils and neutrophils ), mononuclear cells ( macrophages ), leptin precipitates ( characterized as either fine ppt . or large deposits / clumps ) and giant cells . each reaction was scored using the following grading system : the averaged sum of the scores for each animal were used to define an overall biocompatibility score using the following scoring key : 0 - 2 normal 3 - 5 minimal 6 - 10 mild 11 - 20 moderate 21 - 30 marked & gt ; 30 severe although high concentrations of succinyl - leptin were marginally soluble in pbs at ph 7 . 0 , for the purposes of injection site testing , samples of succinyl - leptin at 20 mg / ml remained soluble in pbs at ph 7 . 2 and at 50 mg / ml in pbs at ph 7 . 5 . table 3 shows the injection site evaluation comparing unmodified leptin at 50 mg / ml delivered in ph 4 . 0 , acetate buffer vs . monosubstituted succinyl - leptin at 50 mg / ml in ph 7 . 5 , pbs , after 7 days . as depicted in table 3 , monosubstituted succinyl - leptin , at high concentration dosages , showed improvement in every category of injection site pathology relative to the unmodified leptin , with the most dramatic improvement seen with the almost complete elimination of leptin precipitates and giant cells in the injection sites . table 4 shows the injection site evaluation comparing unmodified leptin at 43 mg / ml delivered in ph 4 . 0 , acetate buffer vs . monosubstituted succinyl - leptin at 43 mg / ml in ph 4 . 0 , acetate buffer , after 7 days . the table 4 data shows that , surprisingly , it was also observed that high concentrations of monosubstituted succinyl - leptin could be delivered in ph 4 , acetate buffer and still demonstrate the dramatic improvements in injection site reactions observed when monosubstituted succinyl - leptin was delivered in pbs . table 5 shows the injection site evaluation comparing unmodified leptin at 20 mg / ml delivered in ph 4 . 0 , acetate buffer vs . monosubstituted dtpa - leptin dimer at 20 mg / ml in pbs , after 7 days . table 6 treatment dose mg / kg volume ml necr . supp . mono . biocomp . precip score reaction acetate buf 0 100 0 0 . 25 1 0 3 minimal 0 100 0 0 . 5 1 0 4 minimal 0 100 0 0 . 5 1 0 4 minimal unmod . leptin 100 100 0 2 3 3 18 moderate 100 100 0 . 5 2 3 3 18 moderate 100 100 0 2 2 . 5 2 14 moderate pbs buffer 0 100 0 0 0 . 5 0 1 normal 0 100 0 0 . 25 0 . 25 0 1 normal 0 100 0 0 . 25 0 . 25 0 1 normal edta - lep dimer 100 100 0 1 . 5 2 0 9 mild 100 100 0 1 . 5 1 . 5 0 8 mild 100 100 0 . 5 2 . 5 3 0 16 moderate as depicted in tables 5 & amp ; 6 , dtpa - leptin dimers ( table 5 ) or edta 2 - leptin dimers ( table 6 ) can be administered to mice at high concentration in pbs demonstrating the same improvement in injection site pathology as observed with succinyl - leptin . these conjugates however , are substantially more soluble in ph 7 , pbs and thus provide for a more rugged formulation in this buffer . in sum , the example 6 data shows that the monosubstituted succinyl - leptin , monosubstituted dtpa - leptin monomers and dimers , and edta 2 - leptin monomers and dimers do not precipitate at the injection site when dosed at high concentrations , and importantly , demonstrate substantial improvement in the adverse injection site reactions observed with the unmodified leptin . the present recombinant human methionyl - leptin ( rhu - met - leptin ) may be prepared according to the above incorporated - by - reference pct publication , wo 96 / 05309 at pages 151 - 159 . for the present working examples , a rhu - met - leptin was used which has ( as compared to the amino acid sequence at page 158 ) a lysine at position 35 instead of an arginine , and an isoleucine at position 74 instead of an isoleucine . other recombinant human leptin proteins may be prepared according to methods known generally in the art of expression of proteins using recombinant dna technology . while the present invention has been described in terms of certain preferred embodiments , it is understood that variations and modifications will occur to those skilled in the art . therefore , it is intended that the appended claims cover all such equivalent variations which come within the scope of the invention as claimed . | 2 |
referring to fig1 and fig2 of the drawings , the peristaltic pump comprises an outer casing 10 , a center driving mechanism , at least two pressuring rollers 40 , a retainer 60 , and a flexible pump tube 90 . the outer casing 10 has a guiding channel 12 formed along an inner wall of the outer casing 10 and defines a circular path therealong , a center driving mechanism supported at a center portion of the outer casing 10 . there are pressuring rollers 40 spacedly and eccentrically supported at the outer casing 10 . the retainer 60 is used to retain and support the pressuring roller 40 . the flexible pump tube 90 made of silicon , which is adapted for allowing the liquid flowing therealong , has an operating portion extending along the guiding channel 12 of the outer casing 10 . accordingly , the pressuring rollers 40 are symmetrically and planetary supported at the outer casing in a radially movable manner . the center driving mechanism comprises a motor which drives a driving shaft 20 . a transmission unit 30 comprises a cylindrical driving element , wherein a pedal 33 protrudes out from an outer surface of the driving element , and a plurality of driving plates 501 , 502 , 503 , 504 , and 505 in an overlapped manner . according to the preferred embodiment of the present invention , there are five driving plates 501 - 505 . referring to fig3 of the drawings of the preferred embodiment , the first to fifth driving plates 501 - 505 are very similar in a circular structure . the third driving plate 503 , which is also regarded as a middle starting plate , has three peripheral indentions 5033 in an arc shape evenly formed at the circumferential edge of the third driving plate 503 . the center portion of the third driving plate 503 has a pedal slot 5035 . the third driving plate 503 has a predetermined diameter that the third driving plate 503 is adapted to push the pressuring roller 40 to substantially press against the pump tube 90 within the guiding channel 12 . the depth and shape of the peripheral indention 5033 of the third driving plate 503 should correspond to diameter size of the pump tube 90 so that the pump tube 90 is allowed to recover to its original shape when the pressuring roller 40 is engaged with the peripheral indention 5033 of the third driving plate 503 . in other words , the radius of the peripheral indention 5033 is slightly larger than the radius of the pressuring roller 40 so as to allow the pump tube 90 not being pressed within the guiding channel 12 when the pressuring roller 40 is located at the peripheral indention 5033 . accordingly , all five driving plates 501 - 505 have the same structure of the peripheral indentions . the difference between the five driving plates 501 - 505 is the size of the pedal slot . the arc length of the pedal slot 5035 of the third driving plate 503 is the same arc length of the pedal 33 such that the pedal 33 can be fitted into the pedal slot 5035 of the third driving plate 503 . in other words , the size and the shape of the pedal 33 of the transmission unit 30 is fitted right into pedal slot 5035 of the driving plate 503 . the third driving plate 503 is sandwiched between the identical second and fourth driving plates 502 , 504 , wherein the arc length of the pedal slot 5025 , 5045 of each of the second and fourth driving plates 502 , 504 is larger than the arc length of the pedal slot 5035 of the third driving plate 503 . preferably , arc length of the pedal slot 5025 , 5045 of each of the second and fourth driving plates 502 , 504 is additional 40 ° of the arc length of the pedal slot 5035 of the third driving plate 503 . in other words , the arc length of the pedal slot 5025 , 5045 of each of the second and fourth driving plates 502 , 504 is additional 40 ° extending at the operation direction , i . e . the rotational direction of each of the second and fourth driving plates 502 , 504 . the second , third , and fourth driving plates 502 , 503 , 504 are sandwiched between the identical first and fifth driving plates 501 , 505 . in other words , the first and fifth driving plates 501 , 505 are the two outer plates . the arc length of the pedal slot 5015 , 5055 of each of the first and fifth driving plates 501 , 505 is larger than the arc length of the pedal slot 5025 , 5045 of each of the second and fourth driving plates 502 , 504 . preferably , arc length of the pedal slot 5015 , 5055 of each of the first and fifth driving plates 501 , 505 is additional 80 ° of the arc length of the pedal slot 5035 of the third driving plate 503 . in other words , the arc length of the pedal slot 5015 , 5055 of each of the first and fifth driving plates 501 , 505 is 80 ° extending at the operation direction , i . e . the rotational direction of each of the first and fifth driving plates 501 , 505 . the transmission unit 30 is connected to the driving shaft 20 . the driving plates 501 - 505 are overlappedly combined together to engage with the transmission unit 30 that the pedal slots 5015 , 5025 , 5035 , 5045 , and 5055 are coaxially aligned with each other . the pedal 33 of the driving element engages the pedal slots 5015 , 5025 , 5035 , 5045 , 5055 of the driving plates 501 - 505 such that when the driving element is driven to rotate by the driving shaft 20 , the driving plates 501 - 505 are driven to rotate subsequently by the pedal 33 . the peripheral indentions as shown in fig3 all have sharp corners . fig4 illustrates an alternative mode of the peripheral indention wherein a corner of the peripheral indention 5033 of the third driving plate 503 can be modified as a round corner as shown by the dotted line which tangents out with the outer diameter of the driving plate 503 . the second and third driving plates 502 504 can follow the same modification as the third driving plate 503 to minimize the clearance of the driving plates 501 - 505 when the peripheral indentions of the driving plates 501 - 505 are misaligned to form an arc surface . this modification does not affect the operation of the invention . all driving plates 501 - 505 have the same thickness which their combined thickness is equal to the width of the pressuring roller 40 and is approximately equal to two times of the width of the pressured pump tube 90 . the pressuring roller 40 has a diameter of approximately 2 . 5 - 3 times of the depth of the pump tube 90 needed to be compressed . a width of the pressure roller 40 is approximately two times of the width of the compressed pump tube 90 . a retainer shaft 44 protrudes out from two sides of the pressuring roller 40 and engages within a retainer slot 66 of the retainer 60 so that the pressuring roller 40 can be supported firmly and its distance between the pump tube 90 and the driving plates 501 - 505 can be retained . according to the preferred embodiment of the present invention , the retainer 60 also helps to keep a predetermined distance between the pressuring rollers 40 but it does not affect the rotation and radial movement of them . accordingly , a movable connecting rod can be installed in between the pressuring roller 40 and the retainer 60 . a central axis of both sides of the pressuring roller 40 can be connected to an end of the connecting rod . this structural configuration does not affect the operation of the invention also . the outer casing 10 has the guiding channel 12 formed along the inner side of the peripheral wall of the outer casing 10 and defines the circular path therealong . according to the preferred embodiment of the present invention , the pump tube 90 is installed in a full spiral manner in the guiding channel 12 of the outer casing 10 . an installation space is required for inserting the pump tube 90 into the guiding channel 12 of the outer casing 10 . in other words , a width of the guiding channel 12 is approximately about two times the width of the compressed pump tube 90 when the pump tube 90 is pressed by the pressuring roller 40 along the guiding channel 12 . furthermore , the pump tube 90 is tangentially extended into the outer casing 10 at an entrance of the guiding channel 12 until the operating portion of the pump tube 90 is received along the circular path of the guiding channel 12 . in addition , the operating portion of the pump tube 90 is retained in an arc shape within the guiding channel 12 while the guiding portion of the pump tube 90 , i . e . extending from the operating portion thereof , is tangentially extended with respect to the outer casing 10 . therefore , the configuration of the pump tube 90 with respect to the outer casing 10 allows the liquid to flow in a maximized circular distance with respect to the circumference of the outer casing 10 such that when the pressuring rollers 40 substantially press against the pump tube 90 , the liquid is forced to flow along the arc - shaped operating portion of the pump tube 90 within the circular path at 120 ° so as to cancel the pulsation of the liquid within the pump tube 90 . if the peripheral wall of the outer casing 10 is too slippery , then the pump tube 90 might have a slight movement along the guiding channel 12 while in operation . a plate can be installed at an entrance or exit location of the pump tube 90 in the peripheral wall to limit the slight movement of the pump tube 90 along the guiding channel 12 . as an alternative , the peripheral wall of the guiding channel 12 can be formed as a rough surface to enhance the friction of the pump tube 90 against the peripheral wall so as to avoid the movement along the guiding channel 12 . the operation principle of the present invention is explained below in detail : in a release state when the driving shaft 20 is not rotating , the peripheral indentions of the all driving plates 501 - 505 are all aligned to each other so that a full arc indention surface is formed at the peripheral side of the combined driving plates 501 - 505 . the pressuring roller 40 can then be fitted to engage the peripheral indentions of the driving plates 501 - 505 at a position that the circumferential surface of the pressuring roller 40 is engaged with the indention surface of the driving plates 501 - 505 . the pump tube 90 can be installed now and there will not be any pressure exerted onto the operating portion of the pump tube 90 . when the driving shaft 20 starts to rotate in the operating direction , it will drive the transmission unit 30 to rotate as well . the pedal 33 of the driving element of the transmission unit 30 will first engage the pedal slot 5035 of the driving plate 503 because the pedal slot 5035 is the narrowest out of the five driving plates 501 - 505 and thus drive the driving plate 503 to rotate in the operating direction as well . once this motion starts , the peripheral indentions 5033 of the driving plates 501 - 505 will not be aligned to each other forming a full arc shape and thus disengage the peripheral indentions of the driving plates 501 - 505 from the pressuring roller 40 . at this point , the pressuring roller 40 is then forced to radially extend towards the peripheral wall of the outer casing 10 and thus exerts a pressure on the pump tube 90 . when the driving shaft 20 reaches a 40 ° rotation in the operating direction , the pedal 33 of the driving element of the transmission unit 30 will then engage the pedal slots 5025 , 5045 of the second and fourth driving plates 502 , 504 and thus drive the second and fourth driving plates 502 , 504 to rotate . when the driving shaft 20 rotates an extra 400 in the operating direction , the pedal 33 of the driving element of the transmission unit 30 will then engage the pedal slots 5015 , 5055 of the first and fifth driving plates 501 , 505 and thus drive the first and fifth driving plates 501 , 505 to rotate . at this moment , the peripheral indentions of each of the driving plates 501 - 505 will not be aligned and thus no indention or arc will be formed from the combined driving plate 501 - 505 . therefore , as long as the driving shaft 20 keeps rotating in the operating direction or does not rotating in a reverse direction until a predetermined degree of rotation , the peripheral indentions of the driving plates 501 - 505 will never be aligned with each other , thus the pressuring roller 40 will always be exerting pressure onto the operating portion of the pump tube 90 . following the procedure above , the fluid in the pump tube 90 will be forced to be pumped thus fulfilling to role of the peristaltic pump . when the machine is not in use , rotate the driving shaft 20 in the reverse direction less than 180 ° and the peripheral indentions of the driving plates 501 - 505 will be aligned on top with each other again . since the pump tube 90 itself is flexible and elastic in it self - nature , it will push back onto the pressuring roller 40 and thus forcing the pressuring roller to engage the aligned peripheral indentions of the driving plates 501 - 505 and the present invention to return to the release state . referring to fig2 of the drawings , the outer casing 10 further comprises an opening cover 80 which can be opened so as to make ease for the removal of the pump tube 90 and the center driving mechanism for repairing and such . referring to fig5 and fig6 of the drawings , using the same principle for operating the present invention , multiple pump tubes 90 can be used in the present invention . the pump tubes 90 can be installed inside the guiding channel 12 of the outer casing 10 in a similar manner as described above . multiple pump tubes 90 can be used as long as the pump tubes 90 are installed in a full circle manner around the peristaltic pump and have at least one of the pressuring rollers to be exerting pressure on the operating portion of the pump tube 90 . fig5 illustrates a configuration of the present invention using two pump tubes 90 . fig6 illustrates a configuration of the present invention using three pump tubes 90 . using the same principle for operating the present invention , for example , a combined total number of 3 and 7 pieces of driving plates will also work in the same manner as described in the preferred embodiment as well as long as they are symmetrically installed on each sides of the driving plate in the middle . it is even possible to use only two driving plates to carry out the function of a five pieces driving plates 501 - 505 as described in the preferred embodiment . thus , the driving plates 501 - 505 of the transmission unit 30 are not limited by their numbers as long as an angle of the pedal slot of the driving plate correlates to a desired situation . referring to fig7 of the drawings , an alternative of the driving plates 501 - 505 of the present invention is illustrated . using the driving plate 503 as example , the pedal slot 5035 can have a duplicated exact mirror feature of itself by rotating 1800 . therefore the pedal slot 5035 of the driving plate 503 is now double - sided . a similar principle modification is applied to the pedal 33 of the driving element of the transmission unit 30 so as to increase the contact area between the pedal 33 and pedal slot 5035 and thus creates a more stable and efficient rotation of the transmission unit 33 . referring to the preferred embodiment of the present invention , the pressuring roller 40 and the drifting shaft 20 are made of metallic materials . other parts are made of plexiglass . the peripheral wall of the guiding channel 12 of the outer casing 10 is lathed in a single cut from a two layer plexiglass . the entrance and exit location of the pump tube 90 can be milled from a milling machine and then the opening cover 80 of the outer casing 10 can be installed firmly thereon by screws . referring to fig8 of the drawings , the present invention can also be produced in mass production by a casting of industrial plastic and similar materials . the outer casing 10 can be split into an upper housing 17 and a lower housing 18 . in between the upper housing 17 and lower housing 18 , an edge 15 is defined at a joint area so that the upper housing 17 can be fittedly received inside the lower housing 18 and screws can be used to joint them . since multiple pump tubes 90 or different brand or material of pump tubes 90 can be used in the present invention , the flexible pump tube 90 can reflect a different pressure back on the pressuring roller 40 . the upper housing 17 and the lower housing 18 can now rotate concentrically in an independent manner so as to offer an option for tuning the angles or a routing route of installing pump tubes 90 into the guiding channel 12 of the outer casing 10 . | 5 |
in accordance with the invention , switching circuits form building blocks from which arbitrarily large switching topologies can be constructed . fig3 a and 3b show an example 300 of a switching circuit that can be used as a suitable building block . as shown in fig3 a , the switching circuit 300 includes first and second switching elements 310 and 312 . each switching element has a common point and first and second connection points . in response to a control signal , the common point can be selectively connected to either the first connection point or to the second connection point . the connection points of the first switching element 310 are connected one - to - one to the connection points of the second switching element 312 . preferably , connections between these points are made in inverse parallel ( i . e ., the first connection point of the first switching element is connected to second the connection point of the second switching element , and the second connection point of the first switching element is connected to the first connection point of the second switching element ). the common points of the first and second switching elements 310 and 312 form a first pair of nodes ( a and b ) of the switching circuit 300 . the two junctions formed by the joined connection points form a second pair of nodes ( 1 and 2 ) of the switching circuit 300 . thus constructed , the switching circuit 300 can be operated to assume either a through configuration or a cross configuration . fig3 a shows the through configuration . here , nodes a and b are respectively connected to nodes 1 and 2 . fig3 b shows the cross configuration , wherein nodes a and b are crossed enroute to nodes 1 and 2 — node a connects to node 2 and node b connects to node 1 . in the preferred embodiment , the first and second switching elements 310 and 312 are mechanical , form - c relays . preferably , these relays are identically constructed , so that they each respond to the same control signal by switching the same way . with the inverse parallel connection as shown , the switching circuit 300 can thus readily assume the through configuration for one state of a control signal and the cross configuration for another state of the control signal . although direct parallel connection of the relays &# 39 ; connection points ( first to first , second to second ) can also work , it defeats the convenience of using a single control signal ( or identical relays ) and thus is not preferred . preferably , the two switching elements 310 and 312 are provided in a single multi - relay package . for example , a dual form - c relay package can accommodate both relays for a complete switching circuit 300 . packages of greater than 2 relays each can also be used for multiple switching circuits 300 , to promote further miniaturization . connections between the connection points of the first and second switching elements are formed via conductive paths on a printed circuit board or other circuit substrate to which the package connects . signal integrity is maximized by making these traces as short as possible . alternatively , it may be possible to modify a conventional multi - relay package to include the connections between the connection points internally . internal connections would entail shorter connection paths between relays and thus would further improve signal integrity . fig3 c shows a symbol for the switching circuit 300 . the nodes ( a , b , 1 , and 2 ) designated in fig3 c correspond to like - named nodes in fig3 a and 3b . the arcs shown adjacent to nodes a and b designate the common points of the switching elements . this symbol is used in subsequent figures to indicate that nodes can be connected either directly ( a to 1 , b to 2 ) or crosswise ( a to 2 , b to 1 ). arbitrarily large switching topologies can be constructed using the switching circuit 300 as a basic 2 - by - 2 building block . to promote signal integrity , every node ( a , b , 1 , and 2 ) of any 2 - by - 2 building block must be connected to no more than one node of any other 2 - by - 2 building block . this constraint prevents the formation of simultaneous parallel connections at any node , and thus prevents the formation of stubs . fig4 a - 4c show different 4 - by - 4 switching circuits constructed from 2 - by - 2 building blocks . fig4 a shows the simplest arrangement , wherein four building blocks are connected in a square configuration . by using only through and cross configurations for the building blocks 410 , 412 , 430 , and 432 , any node x 1 through x 4 on the left can be connected to any node y 1 through y 4 on the right . for example , x 1 can be connected to y 1 by setting both building blocks 410 and 430 to through . as another example , x 1 can be connected to y 4 by setting both building blocks 410 and 432 to cross . although the arrangement of fig4 a can connect any node on the left to any node on the right , it cannot connect left nodes to right nodes in all possible combinations . in particular , this arrangement cannot simultaneously connect both nodes of any one building block on the left to both nodes any one building block on the right . thus , x 1 and y 1 cannot be connected when x 2 and y 2 are connected . similarly , x 1 and y 4 cannot be connected when x 2 and y 3 are connected . this limitation arises because the topology provides only one physical connection between each building block on the left and each building block on the right . fig4 b shows a somewhat more flexible 4 - by - 4 arrangement . the limitations describe above are partially overcome by adding building block 420 . with building block 420 set to the through configuration , both nodes for any one building block can be connected simultaneously to both nodes on the laterally opposing building block ( e . g ., x 1 can connect to y 1 at the same time that x 2 connects to y 2 ). note , however , that the limitation still applies to diagonally opposing nodes . with building block 420 in the cross configuration , each building block still has only one physical connection to its diagonally opposing neighbor . fig4 c overcomes this limitation as well and supports all possible combinations of simultaneous left - to - right connections . by setting one of the middle column of building blocks ( 420 and 422 ) to cross and the other of these building blocks to through , the arrangement effectively becomes that of fig4 b , and the limitation on simultaneous lateral connections is overcome . in addition , by setting both blocks 420 and 422 to cross , two nodes from any building block can be made to connect diagonally across the topology , thereby overcoming the limitation on simultaneous diagonal connections . the principles behind the 4 - by - 4 switching topologies of fig4 a - 4c can be applied more generally to produce 2n - by - 2n switching topologies , shown in fig5 a - 5c . these topologies have an analogous structure to the 4 - by - 4 topologies , but can be implemented on an arbitrarily large scale . fig5 a shows a 2n - by - 2n switching topology that is analogous in structure to the 4 - by - 4 switching topology of fig4 a . this 2n - by - 2n topology includes 4n - by - n units . the n - by - n units are constructed of building blocks ( i . e ., switching circuits 300 ) interconnected using the general rule stated above - such that no node of any building block connects to more than 1 node of all the other building blocks . for n = 2 , the n - by - n units each consist of a single building block , and the topology of fig5 a effectively degenerates to that of fig4 a . for n = 4 , the n - by - n units can each be any of the 4 - by - 4 units shown in fig4 a - 4c . larger units can be used as well , such as 8 - by - 8 units , 16 - by - 16 units , and so forth . the topology of fig5 a is similar to that of fig4 a in terms of its limitations . only half of the n nodes of each n - by - n unit on the left can be connected at one time across the topology to any n - by - n unit on the right , either laterally or diagonally . the topology of fig5 b partially overcomes this limitation by providing an additional n - by - n unit ( 520 ) at the crossover point ( similar to the way the topology of fig4 b partially solved a similar problem with unit 420 ). note that the switching limitations that applied to fig4 b can be overcome here if unit 520 can be made capable of connecting both pairs of n / 2 nodes on the left to both pairs of n / 2 nodes on the right , both laterally and diagonally . the topology of fig5 c is analogous to that of fig4 c and allows all 2n nodes at the left to connect in any possible combination to all 2n nodes at the right . the switching topologies described herein are essentially stub - free . the only evident stubs are within the relays or in the connections within the building blocks themselves ( i . e ., between the connection points of the switching elements 310 and 312 ). this lack of stubs preserves the integrity and bandwidth of electrical signals that are passed through these topologies . in addition , these gains in signal integrity are achieved without requiring large numbers of relays . even the largest 4 - by - 4 topology , shown in fig4 c , requires only 12 form - c relays . a full - crosspoint 4 - by - 4 matrix requires 16 relays , and tends to have relatively poor high - frequency performance due to the effects of stubs . reducing stubs in the full - crosspoint matrix requires the addition of many more relays . a preferred use of the switching topologies and methods disclosed herein is for routing test signals in automatic test systems . fig6 is a simplified block diagram of a portion of an automatic test system , wherein tester resources 610 are switchable via a switching system 612 to an interface 614 , such as be a test fixture , a probe board , or a socket . a uut 616 , such as a semiconductor device or a circuit board , is connected to the interface 614 to allow signals to pass between the tester and the uut . tester resources 610 can be selectively applied to different nodes of the uut by properly configuring the switching system 612 . tests can be conducted by routing a first tester resource through the switching system 612 to a lead of a uut , and monitoring the device &# 39 ; s response to the first tester resource via a second tester resource connected to the uut via the switching system . the device &# 39 ; s response determines whether the device is within specifications our outside of specifications . as is known , manufacturers of semiconductor devices commonly use automatic test systems to determine whether devices meet their requirements . testing devices early in the manufacturing process allows devices that fail their tests to be discarded before additional manufacturing costs are incurred . in addition , sorting devices into different categories based on test results allows manufacturers to sell devices having different performance at different prices . by integrating the switching topologies and methods disclosed herein into automatic test systems , improved signal integrity can be achieved while reducing the number of relays required . improved signal integrity allows devices to be tested to tighter tolerances , and thus allows good devices to be more readily distinguished from devices that fail to meet requirements . having described one embodiment , numerous alternative embodiments or variations can be made . for example , the switching elements 310 and 312 are preferably form - c relays . there are many other ways of constructing these elements , however . for instance , a pair of form - a can be connected together to provide essentially the same functionality as a single form - c relay . other types of relays or combinations of relays that can be made to perform essentially the same function can be used , as well . as described herein , the switching elements are preferably mechanical relays . the invention is not limited to implementations with mechanical relays , however . for example , micro - machined mem switches may be used in place of conventional mechanical relays . solid state switches may be used , as well . although the primary application of the invention is for switching electronic signals , the topologies and methods described herein are also applicable for switching optical signals . as described herein , the switching circuit 300 supports two configurations — through and cross . other configurations can be supported as well . for example , the switching circuit 300 can be made to support loopback by controlling the switching elements 310 and 312 independently , such as with separate control signals . by setting switching element 310 to the up position and setting switching element 312 to the down position ( or vice - versa ), node a can be looped back to node b . loopback is available only for nodes connected to the common points of the switching elements . node a can be looped back to node b , but node 1 cannot be looped back to node 2 . switching topologies can be constructed of building blocks with left - facing and / or right - facing common points to accommodate loopback of any particular nodes , as desired . note that the direction in which the common points face has no effect on the basic switching functionality of the building blocks — it only affects loopback functionality . through and cross configurations are the same left - to - right as they are right - to - left . although specific embodiments have been disclosed herein , they are presented for illustrative purposes to show examples of how the principles of the invention can be applied . accordingly , the disclosed embodiments should not be regarded as limiting the invention . the specific embodiments disclosed have all been square topologies ( n - by - n ). the invention is not limited to square topologies , however . rectangular topologies ( n - by - m ) may also be made . for instance , one can build an n - by - m topology , where n is greater than m , by building an n - by - n topology and removing building blocks not needed for the m dimension . the switching topologies have been described for use with testers that share resources . however , the invention is not limited to any particular type of tester and may be used in any testing - related switching context . therefore , while the invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention . | 7 |
internal combustion engine 10 comprising a plurality of cylinders , one cylinder of which is shown in fig1 , is controlled by electronic engine controller 12 . engine 10 includes combustion chamber 30 and cylinder walls 32 with piston 36 positioned therein and connected to crankshaft 13 . combustion chamber 30 communicates with intake manifold 44 and exhaust manifold 48 via respective intake valve 52 and exhaust valve 54 . exhaust gas oxygen sensor 16 is coupled to exhaust manifold 48 of engine 10 upstream of catalytic converter 20 . intake manifold 44 communicates with throttle body 64 via throttle plate 66 . throttle plate 66 is controlled by electric motor 67 , which receives a signal from etc driver 69 . etc driver 69 receives control signal ( dc ) from controller 12 . intake manifold 44 is also shown having fuel injector 68 coupled thereto for delivering fuel in proportion to the pulse width of signal ( fpw ) from controller 12 . fuel is delivered to fuel injector 68 by a conventional fuel system ( not shown ) including a fuel tank , fuel pump , and fuel rail ( not shown ). engine 10 further includes conventional distributorless ignition system 88 to provide ignition spark to combustion chamber 30 via spark plug 92 in response to controller 12 . in the embodiment described herein , controller 12 is a conventional microcomputer including : microprocessor unit 102 , input / output ports 104 , electronic memory chip 106 , which is an electronically programmable memory in this particular example , random access memory 108 , and a conventional data bus . the controller may further include a keep alive memory ( not shown ) for storing adaptive parameters . controller 12 receives various signals from sensors coupled to engine 10 , in addition to those signals previously discussed , including : measurements of inducted mass air flow ( maf ) from mass air flow sensor 110 coupled to throttle body 64 ; engine coolant temperature ( ect ) from temperature sensor 112 coupled to cooling jacket 114 ; a measurement of throttle position ( tp ) from throttle position sensor 117 coupled to throttle plate 66 ; a measurement of turbine speed ( wt ) from turbine speed sensor 119 , where turbine speed measures the speed of a torque converter output shaft , and a profile ignition pickup signal ( pip ) from hall effect sensor 118 coupled to crankshaft 13 indicating an engine speed ( n ). alternatively , turbine speed may be determined from vehicle speed and gear ratio . continuing with fig1 , accelerator pedal 130 is shown communicating with the driver &# 39 ; s foot 132 . accelerator pedal position ( pp ) is measured by pedal position sensor 134 and sent to controller 12 . in an alternative embodiment , where an electronically controlled throttle is not used , an air bypass valve ( not shown ) can be installed to allow a controlled amount of air to bypass throttle plate 62 . in this alternative embodiment , the air bypass valve ( not shown ) receives a control signal ( not shown ) from controller 12 . in another alternative embodiment , where a mass air flow sensor is not used , inducted mass air flow may be determined using a variety of computational methods . one example method , “ speed - density ”, computes inducted air mass based on engine speed and throttle position . as noted herein , during engine starting operation a portion of injected fuel may not be available for combustion due to fuel vaporization . this phenomenon may be referred to as “ lost fuel ” and can be significantly influenced by intake port surface temperature at start - up and fuel volatility ( vapor pressure and distillation properties ). other factors may influence “ lost fuel ”. these can include , but are not limited to , intake manifold pressure , barometric pressure ( altitude effects ), and deposits on the intake valves and intake port passages . further , lost fuel can significantly impact open - loop fueling precision and accuracy , and cause the observed open - loop air - fuel ratio to deviate from the desired target value . fig1 further illustrates via arrow 180 an example path where lost fuel may pass through the engine . fig2 shows an example trajectory of both a desired ( or commanded ) relative air - fuel ratio ( lambse ) at 210 and measured relative exhaust gas air - fuel ratio ( lambda ) at 212 during the first 15 seconds after an engine start . the difference between the open - loop commanded lambse and the measured exhaust gas air - fuel during the first 10 seconds of engine operation after start is primarily a result of lost fuel , and labeled as such in fig2 . as such , the profile of the commanded value 210 is purposefully modified to maintain the desired exhaust air - fuel ratio . in this example , a closed - loop exhaust gas oxygen feedback signal is provided by a fast light - off hego ( flo hego ) sensor 16 . stoichiometry ( lambda = 1 . 0 ) is the desired or target open - loop air - fuel ratio during the first 10 seconds of operation . the transition to closed - loop fueling starts after 10 seconds , and is shown as point a in fig2 . this event occurs upon completion of the hego sensor warm - up period . upon entering closed - loop control , lambse exhibits the classic closed - loop limit - cycle scheduling . initially , lambse integrates in one direction until the hego sensor switches , jumps back a specified amount and integrates in the opposite direction , then repeats . the completion of the first complete air - fuel ratio cycle 220 , or switching cycle , is denoted at point b of fig2 . further , additional cycles are also shown . in this example , the open - loop fueling correctly accounts for lost fuel , and provides approximately stoichiometry immediately prior to closed - loop operation . however , variations in lost fuel due to system aging , temperature , altitude , and other parameters can cause differences between the open - loop air - fuel ratios , as illustrated in fig3 . specifically , fig3 illustrates a lean open - loop fueling error . in this example , the commanded air - fuel ratio ( lambse ) trajectory is the same as fig2 . however , the measured exhaust open - loop air - fuel ratio is leaner than the desired stoichiometric target value ( 1 . 1 vs . 1 . 0 ). at the transition from open - loop to closed - loop fueling ( point c ), the feedback adjustment needs to compensate for approximately a 0 . 1 relative air - fuel ratio error . similarly , fig4 illustrates a rich open - loop fueling error . in this example , the commanded air - fuel ratio ( lambse ) trajectory is the same as fig2 . however , the measured exhaust open - loop air - fuel ratio is richer than the desired stoichiometric target value ( 0 . 9 vs . 1 . 0 ). at the transition from open - loop to closed - loop fueling ( point e ), the feedback adjustment needs to compensate for approximately a 0 . 1 relative air - fuel ratio error ( although in a direction opposite to that of fig3 ). in one example approach , it is possible to learn the above open - loop fueling errors ( e . g ., learn variations in lost fuel ) by monitoring the first one or more cycles of closed - loop air - fuel control after an engine start to adjust later open - loop cold start fueling . for example , in the example of fig3 , a correction of approximately 0 . 1 relative air - fuel ratio may be stored for those starting conditions ( e . g ., temperature , barometric pressure , shut - down time , engine speed , fuel type , alcohol content , etc .) so that during a subsequent start under similar conditions , the open - loop fueling injection amount or timing may be adjusted to better compensate for lost fuel effects . in some cases , this open - loop correction term may be highly temperature dependent and thus may be computed , stored and applied as a function of ambient temperature , air charge temperature ( act ), engine coolant temperature ( ect ), and / or cylinder head temperature ( cht ). in this way , conditions of the engine where the error is learned can be used to identify the appropriate correction for subsequent starts with similar conditions . similarly , an opposite fueling adjustment of 0 . 1 could be used for the conditions of fig4 . in this way , improved engine air - fuel ratio control may be achieved during engine starting when transitioning from open to closed loop operation . referring now to fig5 - 6 , example routines to provide fuel injection adjustment and adaptive lost fuel learning are described . specifically , fig5 provides an example cold - start idle adaptive ( cia ) algorithm that begins at 510 . next , at 512 , entry conditions are checked . example entry conditions requirements include whether the engine is in non - degraded run mode and that the calibratable cia software selection switch is not set in the by - pass position . if so , an immediate exit from the routine is made . otherwise , the routine continues to 514 to determine whether open - loop air - fuel control engine idling is present and whether any exception conditions are present . various open - loop exception conditions may be included , such as , for example , the following non - limiting examples : engine coolant temperature sensor ( ect ), cylinder head temperature sensor ( cht ), throttle position sensor ( tps ), mass air - flow sensor ( mafs ), electronic throttle control ( etc ), gear selector switch ( prndl ), clutch switch , fuel rail pressure transducer ( frpt ) faults or degradation ; if the engine is not idling or if an exception condition is present , the routine exit . otherwise , open - loop fueling is scheduled at 516 . the open - loop relative desired air - fuel ratio , lambse [ ], is computed by adding an adjusted open - loop adaptive correction term , cia_ofs [ ], to the open - loop exhaust lambda , lambse_exh [ ]. note that in v - type engine applications , the above parameters and associated error terms may be correlated on a per bank basis , and thus have unique values for each bank , indicated by brackets [ ], for example . continuing with fig5 , in 516 , the open - loop adaptive correction term , cia_ofs [ ], is multiplied by the ratio of kamrf [ ] to kamrf_cia_last [ ], where kamrf [ ] is the closed - loop adaptive air - fuel correction factor stored in keep - alive memory ( kam ) at the start , and kamrf_cia_last [ ] is the kamrf [ ] value stored in memory at the time when cia_ofs [ ] is computed ( see 542 ). in this way , it is possible to utilize closed - loop adaptive learning in order to compensate for air - fuel ratio offset errors that are caused by certain events or actions , which may occur subsequent to the completion of the cia algorithm . for example , consider a refueling event that occurs while the engine is fully warmed - up . if a significant quantity of fuel ( e . g ., more than ½ the tank capacity ) is replaced with a fuel that has an air - fuel stoichiometry vastly different from the fuel originally in the tank , a hego sensor will observe a change in the stoichiometric switching point . assuming that sufficient time at closed - loop operation follows this refueling event , the closed - loop air - fuel adaptation routine will detect and correct the offset error , and this will be reflected by a change to kamrf [ ]. multiplying cia_ofs [ ] by kamrf [ ] over kamrf_cia_last [ ] will further improve compensation for this air - fuel ratio change on the next cold - start . the routine then proceeds to 518 where the parameter , cia_ol_lambse [ ] is assigned the value of the most recently scheduled open - loop command lambse [ ]. at 520 , the entry conditions for closed - loop fueling are checked and , if not satisfied , the routine exits . otherwise , the routine proceeds to 522 where closed - loop fueling based upon exhaust gas oxygen sensor feedback is invoked using the typical limit - cycle method ( e . g ., pi control ). however , while such closed - loop control is used , the approach described herein may be used with various closed - loop control other than those that use limit - cycle exhaust gas oxygen feedback . for example , closed - loop fueling can be based on the exhaust air - fuel ratio feedback signal from a proportional - readout sensor , such as , a universal exhaust gas oxygen ( uego ) sensor . then , the routine proceeds to 524 to check for closed - loop idle operation and the presence of exception conditions . excluding those items that are specifically associated with open - loop operation , the exception conditions may be the same as those described in 514 , with the addition of certain exhaust gas oxygen ( ego / hego ) sensor related exception conditions , for example . these may include hego sensor degradation or faults and / or upstream ego monitor high frequency modulation . if the engine is not in closed - loop idle or an exception condition is present , the routine exits . however , in the example of ego / hego degradation or faults for v - engine applications in which there is a feedback sensor in each bank , the routine may still continue to provide adjustment and / or learning for a bank of cylinders with properly functioning sensors only . in still another example , should one bank have a degraded sensor , the routine may continue execution using feedback from the bank that has the functioning sensor to provide control and learning for both banks . such sensor substitution may be limited to conditions where the difference in air - fuel ratio between engine banks does not exceed a calibratable limit value prior to the ego / hego degradation in the one bank . continuing with fig5 , if the answer to 524 is yes , the routine continues to 526 where the limit cycle center ( average ), lamave [ ], for the closed - loop lambse is calculated . for example , the routine may determine the average value over a first cycle of closed - loop operation following open - loop fueling during an engine start . the first cycle used may be the first complete cycle of fueling oscillation during closed - loop control , and may begin after an initial correction , as shown in the above figures . also , while an average value may be used , various other parameters indicative of an average value or similar value may be used . further still , the averaging technique may vary depending on the type of sensor used for feedback control . for example , the averaging techniques for a switching ego / hego type sensor may be different than when a uego type sensor is used . next , at 528 , the routine determines whether a sufficient computational interval for lambda averaging has elapsed . as noted above , the averaging interval may be a first air - fuel limit cycle , or a first number of limit cycles , or may be based on a number of engine combustion cycles of a first one or more air - fuel limit cycles following commencement of closed - loop control , for example . the size of this interval may further be based on sensor characteristics , statistical significance , and other noise factors , and thus may be calibratable . if this calibratable interval has not been exceeded , the process returns to 524 ; otherwise , the routine proceeds to 530 . at 530 , the lambda ( fueling ) difference , cia_lam_diff [ ] at the transition point from open - loop to closed - loop fueling is calculated by subtracting the value of the last open - loop lambda command prior to going closed - loop , cia_ol_lambse [ ], from the averaged closed - loop lambda command , lamave [ ]. the routine then proceeds to 532 where the value of the open - loop lambda ( fueling ) error term at the transition from open - loop to closed - loop fueling , cia_lam_error [ ], is computed by subtracting the quantity , ( 1 − lam_ol_des [ ]), from the value of cia_lam_diff [ ] computed in 530 . lam_ol_des [ ] represents the desired or intended open - loop lambda command value just prior to the open - loop to closed - loop transition . lam_ol_des [ ] may be both calibration and engine temperature dependent . the routine next proceeds to 534 where the absolute value of the cia_lam_error [ ] calculation is compared to the absolute value of a calibratable error hysteresis dead - band term , cia_lam_error_hys . in this way , it is possible to mitigate potential oscillatory behavior of the control caused by very small error perturbations . if the value of cia_lam_error [ ] is less than ( within ) the hysteresis dead - band value , the process proceeds to 536 , where the cia_lam_error [ ] is assigned the stored lambda error value from the last execution of the routine , cia_lam_error_last [ ]. the process then proceeds to 542 . if the value of cia_lam_error [ ] is greater than ( outside ) the hysteresis dead - band value , the process proceeds to 538 . in 538 , a proportional , cia_p [ ], derivative , cia_d [ ], and integral , cia_i [ ], controller terms are computed . while this example uses pid control , various other control approaches may be used . continuing with the pid example , the proportional controller term , cia_p [ ], is the product of a proportional gain term , cia_gp [ ], and cia_lam_error [ ]. the derivative controller term , cia_d [ ], is the product of a differential gain term , cia_gd [ ], and the difference between the current lambda error value , cia_lam_error [ ] and the stored lambda error value from the last execution of the routine , cia_lam_error_last [ ]. the integral controller term , cia_i [ ], is the product of an integral gain term , cia_gi [ ], and the sum of the current lambda error value , cia_lam_error [ ] and the stored integral controller term value , cia_i_last [ ], from the last execution of the routine . note that , as mentioned above , the cold - start “ lost fuel ” effect , where a large portion of the injected fuel is not available in cylinder for combustion , may be influenced by intake port surface temperature at start - up and fuel volatility ( vapor pressure and distillation properties ). therefore , the values for the proportional , differential and integral gain terms may be at least partially dependent upon either engine coolant or cylinder head temperature ( ect or cht ), as well , as upon other conditions these conditions may include a partial dependence on barometric pressure ( altitude effects ). also , the dependencies may be either linear or non - linear . the routine then proceeds to 250 , where an open - loop adaptive offset , cia_ofs [ ], is computed by combining the proportional , derivative , and integral controller terms — cia_p [ ], cia_d [ ] and cia_i [ ]. at 542 , cia_lam_error_last [ ] is assigned the cia_lam_error [ ] value from either 532 or 536 , and stored in memory . cia_i_last [ ] is assigned the cia_i [ ] value from 538 , and stored in memory . cia_ofs_last [ ] is assigned the cia_ofs [ ] value from either 540 or 516 , and stored in memory . kamrf_cia_last [ ] is assigned the current value for kamrf [ ], and stored in memory . the cia_ofs [ ] value is further stored in memory . memory storage may be in the form of a single value , a two - dimensional transfer function ( ƒ of x ) value ; or a multi - dimensional look - up table value . the memory storage locations for the transfer function or look - up table are parameter dependent . these parameters may include , but are not limited to , engine operating temperatures ( ect or cht ) and / or barometric pressures . parameter dependency may be linear or non - linear . these stored values can then be used upon the next execution of the routine . finally , the routine exits . while fig5 shows one example routine , various alternative embodiments may be used . referring to fig6 , one example alternative is shown for calculating the cold idle adaptive proportional , integral and derivative controller terms . specifically , the routine uses similar acts up through 532 , but then continues to 610 where a delta lambda error term , cia_delta_lam_error , is computed by subtracting a calibratable error hysteresis dead - band term , cia_lam_error_hys from the cia_lam_error [ ] term . next , at 612 , the absolute value of the cia_lam_error [ ] is compared to the absolute value of a calibratable error hysteresis dead - band term , cia_lam_error_hys . if the calculated value of cia_lam_error [ ] is within the hysteresis dead - band value , the process proceeds to 614 , where the cia_delta_lam_error [ ] is assigned the stored delta lambda error value from the last execution of the routine , cia_delta_lam_error_last [ ]. the process then proceeds to 620 . otherwise , if the calculated value of cia_lam_error [ ] is outside the hysteresis dead - band value , the process proceeds to 616 . at 616 , a proportional , cia_p [ ], derivative , cia_d [ ], and integral , cia_i [ ], controller terms are computed . the proportional controller term , cia_p [ ], is the product of a proportional gain term , cia_gp [ ], and cia_delta_lam_error [ ]. the derivative controller term , cia_d [ ], is the product of a differential gain term , cia_gd [ ], and the difference between the current delta lambda error value , cia_delta_lam_error [ ] and the stored delta lambda error value from the last execution of the routine , cia_delta_lam_error_last [ ]. the integral controller term , cia_i [ ], is the product of an integral gain term , cia_gi [ ], and the sum of the current delta lambda error value , cia_delta_lam_error [ ] and the stored integral controller term value , cia_i_last [ ], from the last execution of the routine . again , the values for the proportional , differential and / or integral gain terms used in 616 may be at least dependent upon either engine coolant or cylinder head temperature ( ect or cht ), as well as , upon other conditions including a partial dependence on barometric pressure ( altitude effects ). also , the dependencies may be either linear or non - linear . the routine then proceeds to 618 , where the open - loop adaptive offset , cia_ofs [ ], is computed by combining the proportional , derivative , and integral controller terms — cia_p [ ], cia_d [ ] and cia_i [ ]. at 620 , cia_delta_lam_error_last [ ] is assigned the cia_delta_lam_error [ ] value from either 610 or 614 , and stored in memory . cia_i_last [ ] is assigned the cia_i [ ] value from 616 , and stored in memory . cia_ofs_last [ ] is assigned the cia_ofs [ ] value from either 618 or 516 , and stored in memory . kamrf_cia_last [ ] is assigned the current value for kamrf [ ], and stored in memory . the cia_ofs [ ] value is stored in memory , as previously described for 542 in fig5 . these stored values will then be used upon the next execution of the routine . finally , the routine exits . various advantageous elements are illustrated via the above routines , including the use of adaptive terms having integral and derivative terms , in addition to a proportional term , thereby providing improved learning . further , updating the adaptive term before adding it to the open - loop lambda term computed from the feedback execution of the open - loop a / f subroutine can provide improved response . this is accomplished by multiplying the adaptive term by the ratio of the kamrf [ ] ( the closed - loop adaptive air - fuel correction factor stored in keep - alive memory [ kam ]) at the start , and kamrf_cia_last [ ] ( the kamrf [ ] value stored in memory at the time when cia_ofs [ ] is computed ) before it is added to the normally computed open - loop lambda . also , the routine may suspend computation of the adaptive term while certain open - loop or closed - loop conditions are present , which can result in the introduction of unmetered air or fuel . these can include , but are not limited to , deceleration fuel shutoff ( dfso ), open - loop / closed - loop fuel vapor purge , and diagnostic self - tests , for example . computation of the adaptive term may also be suspended when certain sensor faults , failures and / or errors are present . as illustrated by the above example routines , various operations may be achieved to provide improved results . for example , returning to fig2 , at the time of transition from open - loop to closed - loop fueling control , i . e . point a , the most recent or last value for the open - loop fueling command is recorded by the routine and stored as the term , cia_ol_lambse . in this case , cia_ol_lambse would have a value of 1 . 0 . upon entering closed - loop control , lambse exhibits the classic closed - loop limit - cycle scheduling . initially , lambse integrates in one direction until the hego sensor switches , jumps back a specified amount and integrates in the opposite direction , then repeats . the lambse value may then be filtered over the first full period of limit - cycle operation in order to obtain an averaged value for lambse . this filtered value , lamave , may be determined at point b , where 1 . 0 is the value in this example . while this example uses only the first full cycle , additional cycles may be used under some conditions depending on sensor response characteristics . further , a second and / or other subsequent cycle or cycles may be utilized in lieu of the first cycle . once lamave and cia_ol_lambse have been determined , a difference term of the two values , cia_lam_diff , may be computed . the computed cia_lam_diff value is zero for this example , indicating that the initial open - loop fueling accurately approximated lost fuel , and thus no adjustment or adaptation for the present conditions is used . thus , in this example , where stoichiometry is the expected value for the open - loop air - fuel ratio immediately prior to closed - loop operation , the desired cia_lam_diff value should be zero . any deviation from this desired value of zero is considered a system error , cia_lam_error . the gain factors can then be applied to the system error , and proportional , derivative and / or integral controller terms are generated . as shown in fig5 - 6 , these are then combined to produce an open - loop adaptive fueling correction term , cia_ofs . cia_ofs is stored and subsequently used to offset the open - loop air - fuel commands during the open - loop fueling period on the next engine start . as noted above , in one example , the various terms used to compute cia_ofs , for example , the proportional , integral and differential gain multipliers , also have temperature and / or barometric pressure dependencies to more accurately account for temperature and / or altitude effects on lost fuel . further examples of operation provided by the above routines can be illustrated by returning to fig3 . again , fig3 illustrates a lean open - loop fueling error scenario . in this example , at the transition from open - loop to closed - loop fueling ( point c ), the cia_ol_lambse term has a value of 1 . 0 . at point d , the lamave is determined as described previously , but with a value of 0 . 9 in this example . after determining cia_ol_lambse and lamave , the difference of these two values , cia_lam_diff , is then computed . in the example shown , cia_lam_diff is assigned a value of − 0 . 1 , which is non - zero . since stoichiometry is the expected value for the open - loop air - fuel ratio immediately prior to closed - loop operation in this example , the desired cia_lam_diff value should be zero . therefore , after comparing the computed and desired cia_lam_diff , the system error , cia_lam_error , is equal to the computed cia_lam_diff , and has a value of − 0 . 1 . following the approach outlined herein , the cia_lam_error is used to generate the integral , proportional and derivative controller terms . these are combined to produce the open - loop adaptive correction term , cia_ofs , which is stored and used to offset the open - loop lambse commands during the open - loop fueling period on the next and subsequent cold - starts . the effect will be to reduce the exhaust gas air - fuel ratio error on these subsequent starts . further , corrective adaptation over subsequent starts will result in an open - loop exhaust air - fuel ratio trajectory that more closely follows the desired or ideal trajectory shown in fig2 . still another example of operation provided by the above routines can be illustrated by returning to fig4 . again , fig4 illustrates an air - fuel ratio error similar to fig3 , but in the opposite direction . cia_ol_lambse and lamave are computed at points e and f , respectively . note that the sign of the lambda difference parameter , cia_lam_diff , has changed , and , when used to generate an adaptive correction term , will shift the exhaust gas air - fuel ratio in the opposite or lean direction on subsequent engine starts . this example also assumes that stoichiometry is the expected value for the open - loop air - fuel ratio immediately prior to closed - loop operation . although the examples illustrated herein utilize stoichiometry ( lambda = 1 . 0 ) as the desired target air - fuel ratio at the end of the open - loop fueling period , this control methodology can also adaptively correct open - loop fueling errors for those applications where the desired target air - fuel ratio is either rich or lean of stoichiometry ( i . e . lambda & lt ; 1 . 0 or lambda & gt ; 1 . 0 ). further , for the examples in fig2 through 4 , a fast light - off hego ( flo hego ) sensor may be used to provide the closed - loop exhaust gas oxygen feedback signal . it should be noted that this control methodology can utilize the signals from various styles of feedback sensors , including those that can provide a direct reading of the exhaust gas air - fuel ratio , such as , the uego ( universal exhaust gas oxygen ) sensor . note that the control routines included herein can be used with various engine configurations , such as those described above . the specific routine described herein may represent one or more of any number of processing strategies such as event - driven , interrupt - driven , multi - tasking , multi - threading , and the like . as such , various steps or functions illustrated may be performed in the sequence illustrated , in parallel , or in some cases omitted . likewise , the order of processing is not necessarily required to achieve the features and advantages of the example embodiments described herein , but is provided for ease of illustration and description . one or more of the illustrated acts , steps , or functions may be repeatedly performed depending on the particular strategy being used . further , the described steps may graphically represent code to be programmed into the computer readable storage medium in controller 12 . it will be appreciated that the configurations and routines disclosed herein are exemplary in nature , and that these specific embodiments are not to be considered in a limiting sense , because numerous variations are possible . for example , the above technology can be applied to v - 6 , 1 - 4 , 1 - 6 , v - 8 , v - 10 , v - 12 , opposed 4 , and other engine types . the subject matter of the present disclosure includes all novel and nonobvious combinations and subcombinations of the various systems and configurations , and other features , functions , and / or properties disclosed herein . the following claims particularly point out certain combinations and subcombinations regarded as novel and nonobvious . these claims may refer to “ an ” element or “ a first ” element or the equivalent thereof . such claims should be understood to include incorporation of one or more such elements , neither requiring nor excluding two or more such elements . other combinations and subcombinations of the disclosed features , functions , elements , and / or properties may be claimed through amendment of the present claims or through presentation of new claims in this or a related application . such claims , whether broader , narrower , equal , or different in scope to the original claims , also are regarded as included within the subject matter of the present disclosure . | 5 |
fig1 illustrates the proposed torsional flexible connection . hub 111 is attached to one of the connected parts of the power transmission system . it is equipped with protruding blades ( ribs ) 112 which are uniformly spaced around the circumference . blades 112 are protruding in the radial direction from hub 111 , although they can extend in the axial direction as well . hub 113 is attached to the second of the connected parts of the power transmission system . it is equipped with protruding blades 114 which are uniformly spaced around the circumference with the same angular pitch and about the same axial width as blades 112 of hub 111 . blades 114 of hub 113 are interdigitated with blades 112 of hub 111 as it is seen in fig1 . as shown in fig1 hub 113 is surrounding hub 111 ; however , if the blades 114 are extended axially , hub 113 can be positioned closer to the axis o and thus would have a radius commensurable with the radius of hub 111 . side surfaces of blades 111 and 113 are radial , that is , their planes if extended , would contain axis o . as a result , each wedge - shaped chamber 115 and 116 formed by interdigitated blades 112 and 114 , would have its width proportional to radius of the circumference ( cylinder ) at which said width is measured . chambers 115 and 116 contain elastic torque - transmitting elements 117a , 117b , and 118a , 118b , respectively , having round or elliptical shape in the radial cross section ( elements of the round cross sectional shape are pictured in fig1 ). while only two torque - transmitting elements 117 , 118 are shown in each chamber 115 , 116 , respectively , their number can be larger depending on radial and angular dimensions of chambers 115 , 116 . the number of the torque - transmitting elements in torque - transmitting ( 115 in fig1 ) and idle ( 116 in fig1 ) chambers can be different depending on the chamber dimensions and design needs . if hub 111 is the driving one ( in the direction shown by arrow in fig1 ), there are sometimes advantages in making chambers 115 and 116 of different angular dimensions . in the design in fig1 the slightly larger angular dimension is shown for elements 118a , 118b . since chambers 115 and 116 are formed by radial planes , dimensions ( diameters d ) of elastic torque - transmitting elements between their points ( lines ) of contact with side surfaces of the respective blades are proportional to distances d from contact points to the axis o . for the elements 117a , 117b in fig1 a similar correlation can be written for the elements 118a , 118b . torque - transmitting elements 117 , 118 can be inserted in the respective chambers 115 , 116 with a preload , thus dimensions d 1 , d 2 are not necessarily the initial ( unloaded ) diameters of the respective torque - transmitting elements , although a better performance of the instant torsional flexible connection will be achieved if the relative compression deformation ( as percentage of their initial , unloaded , diameter ) of the elements due to the initial preload is the same for all elements occupying the same chamber . all the torque - transmitting elements occupying one chamber between the adjacent blades on two counterpart hubs represent one torque - transmitting flexible insert . if the flexible insert consists of separate torque - transmitting elements , such as 117a , 117b in fig1 their desired location is provided by the wedged shape of the chamber in which they are located ( 115 in fig1 ) or by other means such as a small amount of an adhesive at the contact areas between the torque - transmitting element and the side surfaces of the blades . an alternative means of location of the torque - transmitting elements comprising an insert is shown in fig1 for elements 118a , 118b . these elements have protrusions 119 , 120 , 121 which have much smaller cross sections than the respective elements 118a , 118b . thus , they do not contribute noticeably to torque transmission capabilities of the torque - transmitting elements , but only provide necessary radial restraint for elements 118a , 118b . protrusions 119 , 120 , 121 can be fabricated together with the elements , or can be attached to them by known joining techniques , such as gluing or welding . the protrusions can bind ( integrate ) the elements into an integrated flexible insert , or the individual elements with the appropriate protrusions are just contacting each other thus restraining their shifts within the chamber . widths of the blades , such as 112 and 114 in fig1 can be different from widths of the respective hubs , such as 111 and 113 in fig1 . in operation , driving hub 111 is forcing its protruding ribs 112 to compress elements 117a , 117b which transmit tangential forces to protruding ribs 114 of hub 113 or , for the reverse direction of rotation , to compress elements 118a , 118b . it is known , that static and dynamic stresses in both elastomeric and metal elements of similar shape but different ( scaled ) dimensions , as well as creep of elastomeric elements , depend on their relative deformation . chambers 115 which are housing flexible inserts composed of torque - transmitting elements 117a , 117b , are of such shape that elements 117a , 117b dimensioned as described above are experiencing the same relative compression deformation . accordingly , the elements would be characterized by , approximately , the same relative degree of creep and same rate of deterioration caused by static and dynamic stresses . this is quite different from known &# 34 ; spider &# 34 ; or &# 34 ; jaw &# 34 ; couplings , e . g ., ones described in u . s . pat . nos . 3 , 837 , 179 and 3 , 638 , 454 , in which cross sections of torque - transmitting legs of the flexible spiders located at different distances from the coupling axis are experiencing very different relative deformations . in such cases the most highly loaded segments of the torque - transmitting elements are those which are located at the farthest distance from the axis , and the segments which are closer to the axis are underloaded . the instant invention allows to fully utilize load ( torque ) carrying capacity of all the elements comprising the flexible inserts , thus resulting in minimization of dimensions for the torsional flexible connection . streamlined shape of the torque - transmitting elements allows to further enhance torque rating and / or allowable deformation of the connection since it is known that the elements having variable contact areas with the loading surfaces exhibit much lower creep and have much better fatigue resistance than the elements having a permanent wide surface contact ( e . g ., see b . s . lee , &# 34 ; study of shape effects on creep and load - deflection characteristics of elastomeric components &# 34 ;, phd thesis at wayne state university , 1991 , or m . l . kerr , r . schmidt , &# 34 ; a new elastomeric suspension spring &# 34 ;, sae paper 710058 , 1971 ). the streamlined elements ( e . g ., cylindrical elastomeric elements under radial loading ) also demonstrate a desirable strong nonlinearity of their load - deflection characteristic which improves dynamic characteristics of the proposed torsional flexible connection in case of torsional vibrations in the power transmission system . this nonlinearity also results in a reduced radial stiffness of the proposed torsional flexible connection at low magnitudes of the transmitted torque . since torques which are below their rated values are transmitted during most of the operational time of typical power transmission systems , this would result in reduced loads on the shaft bearings due to inevitable misalignments of the shafts connected by the proposed torsional flexible connection if it is used as a power transmission coupling . the torque - transmitting elements which are seen in fig1 from the axial view , can be designed in different embodiments . fig2 , 4 show some embodiments as cross sections a -- a of fig1 . fig2 shows torque - transmitting elements having the shape of round cylinders 118a , 118b extruded together with protrusions 119 , 120 , 121 . fig3 shows torque - transmitting elements having the shape of quasi - ellipsoids ( or ellipsoids ) 118a , 118b connected with protrusions 119 , 120 , 121 . obviously , other streamlined shapes such as tri - axial ellipsoids are also possible without changing the main concept of the instant invention . fig4 shows the flexible insert designed as a plurality of quasi - spherical or spherical torque - transmitting elements 118aa , 118ab , 118ac , 118ba , 119bb with protrusions 119a , 119b , 119c , 120a , 120b , 121a , 121b . all torque - transmitting elements 118ca and 118b in fig4 are connected by no - load carrying connections 122ab , b and 423 , thus integrating all flexible inserts and allowing to simplify initial assembly as well as change of flexible inserts in the field conditions . the torque - transmitting elements pictured in fig1 , 3 , 4 are of solid structure thus making elastomeric ( rubber - like ) materials the most suited for construction of these elements . hollow torque - transmitting elements of two alternative designs 517a , b and 518a , b in fig5 can be made of a rigid material such as metal . elements 517a , b have a spiral design which is associated with high damping induced by friction between the layers of the spirals . elements 518a , b have damping determined mostly by internal damping of their material and thus call for use of a high damping material ( e . g ., magnesium , nickel - titanium , fiber - reinforced composite , etc . ), or have to be used in cases when low damping is acceptable . hollow cylinders 518a , b can also be designed as helical coil springs , e . g . as per u . s . pat . no . 4 , 358 , 215 granted to this applicant . side surfaces of blades 512 and 514 in fig5 have smooth recesses 525a , b and 526a , b in the areas of contact with torque - transmitting elements 517a , b , and smooth recesses 527a , b and 528a , b in the areas of contact with torque - transmitting elements 518a , b . these recesses serve a dual role . they modify contact stresses / deformations of torque - transmitting elements 517 , 518 thus enhancing their load - transmitting capabilities and stiffnesses , and also retain the torque - transmitting elements in their proper places . the recessed shapes of blades 512 , 514 do not introduce additional manufacturing complications if hubs 511 , 513 are produced by extrusion . for clarity of the drawing , clearances are shown in fig5 between actually contacting surfaces of blades 512 , 514 and torque - transmitting elements 517 , 518 . fig6 shows an embodiment of instant invention in which all torque - transmitting elements are integrated by protrusions 619 , 620 , 621 and by connections 630 , 631 . such a design simplifies assembly / disassembly of the coupling , especially in the field conditions . it is obvious , that all or only some chambers created by interaction of the blades protruding from the connected hubs can be filled with the flexible inserts . fig7 shows application of the instant invention to provide a flexible torsional connection for a gear . other applications of this design can be envisioned for a pulley , for a sprocket , etc . in all such cases , while a specified torsional compliance is desirable , radial deformations between the rim and the hub must be restricted . the embodiment in fig7 has gear rim 732 machined on ( or attached to ) hub 713 . the torsional flexible correction between hub 111 and rim 732 ( or between blades 112 and 114 ) is provided by inserts 117 and 118 composed of torque - transmitting elements 117a , b and 118a , b , respectively and located in chambers 115 and 116 , respectively . metal - elastomer laminates 733 are installed with a small clearance or with a preload between the outermost surfaces of blades 112 and the inner surface of hub 113 . metal - elastomer laminates 734 are installed with a small clearance or with a preload between the innermost surfaces of blades 114 and the outer surface of hub 111 . one embodiment of metal - elastomer laminate 734 in fig7 is shown in fig8 which represents a cross sectional view b -- b of fig7 . laminates 734 consist of alternating , preferably thin , layers of elastomeric ( rubber - like ) material 835 and rigid material ( metal , rigid plastic , etc .) 836 secured between rigid covers 837 and 838 . embodiment in fig8 has contacting surfaces of blade 114 and cover 837 made tapered at the same ( but opposite ) small (&# 34 ; self - locking &# 34 ;) angle relative to the axis of the torsional flexible connection , and ends 839 and 840 of covers 837 and 838 protruding for the same length sideways . cover 847 has a hook - like attachment 841 . it is known ( e . g ., see e . rivin , &# 34 ; ultra - thin - layered rubber - metal laminates for limited travel bearings &# 34 ;, tribology international , 1983 , vol . 16 , no . 1 , pp . 17 - 25 ) that thin - layered metal - elastomer laminates combine very high stiffness in compression with low stiffness in shear . the compression stiffness can be further enhanced by the assembly preload , and compression - to - shear stiffness ratio can reach 100 - 5000 . thus , connecting two principal parts 111 and 113 by laminates 732 and 733 as shown in fig7 would provide high radial stiffness of the torsional flexible connection ( thus restraining the radial deformations ) without significantly increasing its torsional stiffness . by applying pressure simultaneously to outstanding ends 839 and 840 of covers 837 and 838 in fig8 and using the mechanical advantage of the tapered ( wedge - like ) connection between cover 837 and blade 114 , compression preload can be activated without shear deformation of the laminate . flat portion 841 of cover 837 may be useful for application of pressure during assembly . only one set of laminates -- external set 733 or internal set 734 in fig7 can be used for the radial stiffening of the torsional flexible connection , or both sets can be used simultaneously in the same design . the preferred minimal number of laminates in each set 733 and 734 required for a stable operation of the torsional flexible connection is three , with the laminates being preferably uniformly distributed in the circumferential direction , although a larger numbers of the laminates can be used . fig9 shows another embodiment of the flexible torsional connection for a gear , pulley , sprocket , etc . gear rim 732 integral with hub 713 has a torsionally flexible connection with hub 111 by inserts 117 and 118 located , respectively , in chambers 115 and 116 . the radial restraining action is provided by slender elements -- strips or bars 950 located in some of the chambers . the strips / bars are made of rigid material such as metals , composites , plastics . attachment of strip / bar 950 in fig9 to hubs 111 and 713 is via slots 951 , 952 in hubs 111 , 713 , respectively . the strip / bar can be fixed by known means , such as adhesive , or allowed to slide in one of the slots . in the latter case , if there are several strips / bars 950 around the circumference , the sliding will occur only to accommodate large torsional displacements between hubs 111 , 713 . concentricity of the hubs will be always maintained , thus representing the radially restraining action . it is readily apparent that the components of the torsionally flexible connection disclosed herein may take a variety of configurations . thus , the embodiments and exemplifications shown and described herein are meant for illustrative purposes only and are not intended to limit the scope of the present invention , the true scope of which is limited solely by the claims appended hereto . | 5 |
referring now to fig1 - 3 , in one specific embodiment , valve 10 is shown . broadly , this embodiment of valve 10 comprises top sub 12 connected to piston housing 20 which is connected to inner mandrel 30 and outer mandrel 40 . top sub 12 is connected to piston housing 20 , and piston housing 20 is connected to inner mandrel 30 and outer mandrel 40 , through any method or device known in the art such as through threads ( not shown ). gage ring 50 provides port 52 in fluid communication with piston chamber 54 so that fluid flowing from outside valve 10 through port 52 and into piston chamber 54 causes piston 56 to move downward ( i . e ., toward the right in the figures ). screen 53 is disposed over port 52 to restrict debris from entering port 52 and causing interference with the movement of piston 56 . piston 56 comprises upper end 57 , lower end 58 , and piston seals 59 . although piston 56 may comprise a circular , concentrically - disposed , sleeve - type piston , in the embodiment shown in the figures , piston 56 comprises a partial sleeve . downward movement , i . e ., to the right in the figures , of piston 56 is restricted by piston stop 60 shown as a restriction of the inner diameter of piston chamber 54 . similarly , upward movement , i . e ., to the left in the figures , of piston 56 is restricted by piston stop 61 shown as a separate component disposed on the wall of piston chamber 54 . piston mandrel 64 facilitates connection between piston 56 and upper coupling 66 . disposed between outer wall surface 32 of inner mandrel 30 and inner wall surface 42 of outer mandrel 40 is annulus 68 . disposed in annulus 68 is piston mandrel 64 secured to upper coupling 66 , which is operatively associated with a return member , shown in the embodiments of the figures as including spring 70 . spring 70 is disposed within sleeve 72 . spring stop or detent 74 provides a surface for compression of spring 70 . detent 74 is maintained against outer wall surface 32 of inner mandrel 30 , but is not secured to sleeve 72 or outer mandrel 40 . in one embodiment , detent 74 is maintained against outer wall surface 32 by the force generated by spring 70 pushing detent 74 into shoulder 75 . attachment member 67 , shown as a c - ring , is also operatively associated with upper coupling 66 to secure upper coupling 66 to sleeve 72 . in addition to spring 70 , return member can also comprise atmospheric chamber 73 . as a result , as upper coupling 66 moves downward , pressure within atmospheric chamber 73 becomes compressed or energized ( fig2 ) such that as the pressure below piston dissipates , the energized atmospheric chamber 73 urges piston 56 upward toward port 52 , i . e ., toward the “ run - in ” position or closed position ( fig1 ). in addition to being connected to upper coupling 66 at an upper end by attachment member 67 , sleeve 72 is connected at a lower end to lower coupling 76 . as shown in the specific embodiment of fig1 - 3 , upper coupling 66 is in a sliding engagement with outer wall surface 32 of inner mandrel 30 ; however , upper coupling 66 is not required to be in contact with outer wall surface 32 . similarly , in the specific embodiment of fig1 - 3 , lower coupling 76 is shown as not being in sliding engagement with outer wall surface 32 of inner mandrel ; however , lower coupling 76 can be placed in sliding engagement with outer wall surface 32 . the connection of sleeve 72 to both upper and lower couplings 66 , 76 causes movement of lower coupling 76 when piston 56 moves downward ( i . e ., to the right in the figures ). ported housing 80 is connected to lower coupling 76 . ported housing 80 includes port 82 and is maintained within annulus 68 by a threaded connection to lower coupling 76 . the force of return member , i . e ., spring 70 in the embodiment shown in the figures , acting against detent 74 and upper coupling 66 maintains ported housing 80 in the closed position ( fig1 a - 1b ). ported housing 80 can be a separate component as shown in the figures or can be a continuation of sleeve 72 , i . e ., formed as an integral component combining sleeve 72 and ported housing 80 . in addition , as shown in the embodiment of the figures , retainer 83 can be disposed at a lower end of ported housing 80 to facilitate sealing engagement of ported housing 80 with outer wall surface 32 of inner mandrel 30 . retainer member 84 , shown as a c - ring , is in sliding engagement with outer wall surface 32 of inner mandrel 30 . retainer member 84 facilitates maintaining seals 88 , 89 in place . seals 88 , 89 reduce fluid leakage between ported housing 80 and inner mandrel 30 . lower guide 86 is secured to outer wall surface 32 of inner mandrel 30 . as shown in fig3 , lower guide 86 has three grooves or slots 92 milled along outer wall surface 94 of lower guide 86 . slots 92 reduce the likelihood that sediment or other debris will collect in the void below ported housing 80 hindering the operation valve 10 . as shown in fig3 , slots 92 are milled longitudinally , however , slots 92 can be milled in any arrangement that permits fluid and debris to flow past lower guide 86 . for example , slots 92 can comprise one or more spiral - shaped slots . screen 90 is secured to lower guide 86 and outer mandrel 40 to restrict debris from entering ports 82 and 34 when valve 10 is in the opened position ( fig2 ) which could cause restriction of fluid flow from outside of valve 10 into bore 36 of inner mandrel 30 . snap ring 38 secured to outer wall surface 32 of inner mandrel 30 acts as a detent or stop to prevent lower coupling 76 and , thus , ported housing 80 from traveling along outer wall surface 32 of inner mandrel 30 past a certain point . the point at which lower coupling 76 is stopped by snap ring 38 is the point at which port 82 is aligned with port 34 , i . e ., when valve 10 is in its opened position ( fig2 ). in one specific operation of valve 10 , valve 10 is placed in a work string such as production string or other string of tubing ( not shown in fig1 ) and run - into a cased wellbore ( not shown in fig1 ). a lower packer or other wellbore barrier is set below valve 10 . completion fluid is then pumped down the wellbore annulus . as the pressure in the wellbore annulus increases due to the completion fluid being pumped into the wellbore annulus , the increased pressure enters piston chamber 54 and exerts a force on piston 56 . piston 56 is then moved away from port 52 causing the upper coupling 66 to move downward which , in turn , causes sleeve 72 and ported housing 80 to also move downward until port 82 is at least partially aligned with port 34 . upon partial alignment of port 82 with port 34 , the fluid pressure within the wellbore annulus is allowed to flow into bore 36 , thereby permitting drilling fluid that was previously disposed within the wellbore annulus to flow into the tubular string to be carried to the surface of the wellbore . as a result , the drilling fluid previously disposed in the wellbore is replaced with completion fluid . during movement of piston 56 , the return member , e . g ., spring 70 and / or atmospheric chamber 73 , become compressed or energized .” therefore , if the pressure within the wellbore annulus decreases , such as due to completion fluid no longer being pumped down the wellbore annulus , the compressed spring 70 and / or atmospheric pressure within atmospheric chamber 73 exerts a force against piston 56 that is greater than the hydrostatic pressure within piston chamber 54 . accordingly , the return member forces piston 56 to move toward port 52 to return it to its “ run - in ” position causing valve 10 to return to its closed position . thereafter , piston 56 is in position such that it can again move away from port 52 in response to a pressure increase within the wellbore annulus . thereafter , a barrier such as a packer , can be set above valve 10 to provide an isolated wellbore annulus . the isolation of the wellbore annulus also can be established by any other method or device known in the art such as by use of one or more wellbore barriers such as bridge plugs , valves , wellheads , the bottom of the wellbore , and the like . thereafter , in the event that the fluid contained within the isolated wellbore annulus expands , or the pressure within the isolated wellbore annulus increases , such as due to production operations being performed through the work string , the increased pressure enters piston chamber 54 and exerts a force on piston 56 . piston 56 is then moved away from port 52 causing the upper coupling 66 to move downward which , in turn , causes sleeve 72 and ported housing 80 to also move downward until port 82 is at least partially aligned with port 34 . upon partial alignment of port 82 with port 34 , the fluid pressure within the wellbore annulus is allowed to flow into bore 36 , thereby relieving pressure within the wellbore annulus . as a result , the pressure being exerted on the inner wall of the casing , or the inner wall of the formation , or the outer wall surface of the work string , is spread out and lessened , which decreases the likelihood of failure of any of the casing , the formation , or the work string , or any other wellbore component disposed in the isolated wellbore annulus . during movement of piston 56 , the return member , e . g ., spring 70 and / or atmospheric chamber 73 , become compressed or “ energized .” therefore , if the pressure within the isolated wellbore annulus decreases , such as due to a temperature decrease due to cessation of production operations through the work string or due to sufficient pressure being relieved from the wellbore annulus through port 82 and port 34 , the compressed spring 70 and / or atmospheric pressure within atmospheric chamber 73 exerts a force against piston 56 that is greater than the hydrostatic pressure within piston chamber 54 . accordingly , the return member forces piston 56 to move toward port 52 to return it to its “ run - in ” position causing valve 10 to return to its closed position . thereafter , piston 56 is in position such that it can again move away from port 52 in response to a pressure increase within the isolated wellbore annulus . it is to be understood that the invention is not limited to the exact details of construction , operation , exact materials , or embodiments shown and described , as modifications and equivalents will be apparent to one skilled in the art . for example , the piston may comprise a full sleeve instead of the partial sleeve shown in the figures . moreover , the return member may comprise belleville springs or any other type of return member . further , although one piston is shown in the embodiment of the figures , two or more pistons may be used . accordingly , the invention is therefore to be limited only by the scope of the appended claims . | 4 |
gas turbine engine systems and related methods involving vane - blade count ratios greater than unity are provided , several exemplary embodiments of which will be described . in this regard , an increased vane count could increase the probability that a temperature / ppr &# 39 ; s nonuniformity (“ hot and / or fuel - rich streak ”) will mix with cooler gases and , therefore , dissipate before propagating beyond the rotating blades of the first stage of the turbine . in some embodiments , the cooler gases used for dissipating such a hot streak are provided as cooling air , which is provided for film - cooling the vanes of the first turbine stage . in some embodiments , the vane and blade counts deviate from a nominal number so that overall parasitic drag and weight directly attributable to the vanes and blades are comparable to a gas turbine engine containing an equal number of vanes and blades . for example , in a first stage turbine design incorporating forty - eight ( 48 ) vanes and sixty - two ( 62 ) blades , the number of vanes could be increased to fifty six ( 48 + 8 = 56 ), whereas the number of blades could be decreased to fifty four ( 62 − 8 = 54 ). it should be noted that increasing the number of vanes can potentially enhance mixing of the gases departing the combustion section , thereby reducing the requirement for conservative cooling of downstream vanes . thus , an overall weight reduction may be achieved by reducing the requirements of cooling air in some embodiments . additionally , aerodynamic efficiency may be improved as an increased number of vanes can yield higher levels of unsteady flow in the downstream rotor passages . as such the formation of rotor passage secondary flow vortices and losses can be inhibited . referring now in detail to the drawings , fig1 is a schematic diagram depicting an embodiment of a gas turbine engine 100 . as shown in fig1 , engine 100 includes a compressor section 102 , a combustion section 104 and a turbine section 106 . notably , engine 100 is a turbofan although it should be noted that the concepts described herein should not be considered limited to use with gas turbine engines configured as turbofans . turbine section 106 incorporates multiple stages , each of which includes a set of stationary vanes and a corresponding set of rotating blades . in this regard , a first stage 108 of the turbine section includes a first set of vanes 110 and a first set of blades 112 . the first stage of the turbine section is located immediately downstream of the combustion section and immediately upstream of a second stage 114 of the turbine , which includes a second set of stationary vanes 116 . as shown in fig2 , blades 112 are located downstream of vanes 110 , whereas vanes 116 are located downstream of blades 112 . notably , downstream portions of the blades 112 define an exit plane 120 . notably , interaction of gas 122 flowing along the gas path defined by the vanes and blades causes combustion products to mix and complete a combustion reaction prior to traversing the exit plane of the first set of blades 112 . this is accomplished , at least in part , by providing a greater number of vanes 110 than there are blades 112 , i . e ., the vane - blade count ratio of the first turbine stage is greater than unity ( 1 ). in the embodiment of fig1 and 2 , vanes 110 and 116 incorporate film - cooling holes that direct cooling air for film - cooling the vanes . by way of example , vane 110 includes cooling holes 130 , and vane 116 includes cooling holes 132 . note that although the number of cooling holes in vane 110 exceeds the number of cooling holes in vane 116 , various other numbers and arrangements of cooling holes can be provided in other embodiments . because of work extraction in a first turbine stage , the temperature of gas is reduced at exit plane of that stage relative to the temperature at the entrance of the first vanes . as a result , for conventional turbine designs , cooling requirements for the downstream vanes are usually much lower than the cooling requirements for the first vanes . however , for high - fuel - to - air ratio turbine designs ( i . e ., designs that exhibit significant ppr concentrations at the inlet to the first stage ), the oxygen included in the cooling air provided in the first stage 108 completes the combustion reaction and can significantly increase the temperature of gas 122 temperature at exit plane 120 . the degree of circumferential and radial uniformity of this hot and / or fuel - rich streak temperature increase is a factor that should be considered for the cooling design of vanes 116 . if the hot and / or fuel - rich streaks are highly concentrated ( non - uniform temperature at station 120 ), then all of the vanes 116 should be designed to accommodate the hottest possible streak . however , if the hot and / or fuel - rich streaks are diffused by the first stage 108 ( a highly uniform temperature at station 120 ), then the vanes 116 can be designed to accommodate a lower peak temperature . this can result in a weight reduction of the gas turbine engine as lighter and / or fewer components associated with routing of the cooling air may be provided . in this regard , fig3 is a flowchart depicting an embodiment of a method for operating a gas turbine engine . as shown in fig3 , the method may be construed as beginning at block 302 , in which a gas turbine engine having a combustion section and a turbine stage is provided . notably , the turbine stage includes a first set of vanes and a first set of blades , with the first set of blades being located downstream from and adjacent to the first set of vanes . in block 304 , a combustion reaction is completed along a gas flow path prior to a plane defined by downstream portions of the first set of blades . in some embodiments , design of such a first stage incorporates , through the use of both cfd analysis and empirical correlations , any combination of ( a ) vane ( n )/ blade ( n ) ratio , ( b ) vane and / or blade film - cooling schemes or ( c ) vane and / or blade aerodynamic designs such that temperature and ppr &# 39 ; s nonuniformities at the exit plane of the turbine stage are reduced , e . g ., minimized or eliminated . fig4 is a flowchart depicting another embodiment of a method . specifically , the flowchart of fig4 involves a method for designing a gas turbine engine . that method may be construed as beginning at block 402 , in which a number ( n ) of vanes and a corresponding number ( n ) of blades for a turbine stage of a gas turbine engine are selected . in block 404 , the number of the vanes is increased by m . in block 406 , the number of blades is decreased by at least m such that the number of vanes of the turbine stage exceeds the number of blades of the turbine stage . in some embodiments , the turbine stage is a first turbine stage downstream of a combustor . a set of numerical experiments were conducted to quantify the impact of change in the number of first vanes on the temperature non - uniformity at the exit of a representative turbine stage . these simulations were conducted by changing the number of airfoils in the vane row while holding the airfoil count for the rotor row constant . the ratio of vanes to blades in these studies were 2 / 3 , 111 and 3 / 2 . the temperature at inlet to the stage was held constant at a typical combustor exit temperature value while the metal temperature for the vane was maintained at a constant value consistent with the airfoil durability requirements . the rotor airfoils and endwalls , however , were maintained at adiabatic wall temperatures . an unsteady 3 - d reynoldsaveraged - navier - stokes cfd code was used to conduct these simulations . results from these simulations indicated that the absolute temperature distortion at the exit of the rotor was about 60 %, 30 % and 16 % of the inlet distortion to the rotor , which was constant for the above three numerical experiments . these simulations clearly indicate that increasing the number of vanes relative to the blades enhances mixing between the hot and cold stream in the rotor passages . interrogation of numerical data from these simulations also indicated that the loss levels in the rotor passages were also reduced as the number of vanes was increased . in addition , increasing the number of vanes was also found to reduce the hot spot temperature on the rotor airfoil pressure side indicating that the cooling air in the rotor passages may also be favorably impacted by increased vane count . the preceding description is exemplary rather than limiting in nature . variations and modifications to the disclosed examples may become apparent to those skilled in the art that do not necessarily depart from the essence of this disclosure . thus , the scope of legal protection given to this disclosure can only be determined by studying the following claims . | 5 |
in the preparation of ethynylene - disilanylene copolymers , a 1 , 2 - diethynyldisilane monomer of the formula hc . tbd . c - sir 2 sir 2 c . tbd . ch , where r is an alkyl group or an aryl group of 1 - 10 carbon atoms , is placed into solution with a organometallic compound rm where r is either methyl , n - propyl , isopropyl , n - butyl , t - butyl , or other alkyl group ( with c & lt ; 6 ), and m is an alkaline element such as li , na , or k . preferably , nc 4 h 9 li ( nbuli ) is used . the rm is added to the monomer in either a hexane or tetrahydrofuran solution in a ratio ( by mol ®) of over 2 : 1 rm to monomer . as such , the monomer and rm solution is placed under nitrogen atmosphere at room temperature about 1 - 24 hours , thereby forming the dialkali metal reagent mc . tbd . csir 2 sir 2 c . tbd . cm . ( at this stage , the alkali metal reagent may be purified by recrystallization from a suitable solvent ( e . g ., n - hexane ) under inert conditions if the reagent is a solid .) in general , tetrahydrofuran is used as a solvent in each of the reactions in the method of the subject invention . however , other ethereal solvents , such as diethylether , di - n - butylether , dimethoxyethane , dioxanes , etc ., may also be used , as known in the art . the alkali metal reagent is treated with a solution of dichlorodisilane of the formula clsir &# 39 ; 2 sir &# 39 ; 2 cl ( r &# 39 ;= ch 3 , nc 4 h 9 , other alkyl group ( c & lt ; 10 ) or a phenyl group ( c 6 h 5 )) at 0 °- 70 ° c . for 1 - 24 hours under a nitrogen atmosphere . a representative 1 , 2 - dichlorodisilane , clsi ( ch 3 ) 2 si ( ch 3 ) 2 cl , may be obtained from specialty chemical manufacturers or it may be prepared from hexamethyldisilane ( ch 3 ) 3 sisi ( ch 3 ) 3 by mixing at 50 ° c .- 60 ° c . with 2 moles acetyl chloride and 2 moles aluminum chloride . after filtering , evaporating , and drying under vacuum , the polymer -- c . tbd . csir 2 sir 2 -- n is isolated . purification can be accomplished by reprecipitation from a suitable combination of solvents , for example , chloroform / isopropylalcohol or tetra - hydrofuran / ethyl alcohol , etc . the solvents are pumped off to leave a residue which is dissolved in chloroform , washed with an aqueous ammonium chloride solution , with water , and then dried over calcium chloride . in an alternate method of preparation of ethynylene - disilanylene copolymers of the subject invention , a grignard reagent may be used . in this method , the 1 , 2 - diethynyldisilane is treated with the grignard reagent in a solution of thf in a ratio of 2 moles of the grignard reagent for every 1 mole of the disilane . the grignard reagent may comprise methyl , ethyl , or other alkyl metallic halide such as ch 3 mgbr , ch 3 mgi , ch 3 ch 2 ch 2 mgcl , nc 4 h 9 mgcl , sec - c 4 h 9 mgcl and t - c 4 h 9 mgcl ; the preferred grignard reagent is ethyl magnesium bromide ( etmgbr ). other alkyl metallic halides may be used as grignard reagents , as known in the art . the disilane is treated with 2 moles of the grignard reagent ( in this example etmgbr ) in dry tetrahydrofuran at room temperature and / or under reflux for approximately 11 / 2 hours ( temperature = 0 °- 70 ° c .) to form the digrignard reagent brmgc . tbd . csir &# 39 ; 2 sir &# 39 ; 2 c . tbd . cmgbr . the digrignard reagent is then treated with a dichlorodisilane in a concentrated tetrahydrofuran solution at 0 °- 70 ° c . for 1 - 24 hours . tetrahydrofuran is then evaporated to leave a white solid which may be washed with aqueous ammonium chloride , alcohol , and then dried , to result in a polymer of -- c . tbd . csir 2 sir 2 ] n . as above , tetrahydrofuran is generally used as a solvent in each of the reactions in the method of the subject invention . however , other ethereal solvents , such as diethylether , di - n - butylether , dimethoxyethane , dioxanes , etc ., may also be used , as known in the art . it is important that the solution of the reaction mixture of the digrignard reagent and the dichlorodisilane be concentrated , in order to obtain a good yield of polymer . as is generally known to happen in polymerization reactions , the concentration of the reactants in the reaction mixture has a substantial effect on the resulting yield and chain length . thus , such concentration levels can be used to control these parameters ; dilute reaction solutions are , in general , to be avoided . 1 . 0 g ( 6 . 01 mmol ) of 1 , 2 - ethynyl - 1 , 1 , 2 , 2 - tetramethyldisilane ( hc . tbd . c -- si ( ch 3 ) 2 si ( ch 3 ) 2 -- c . tbd . ch was treated with 5 . 1 ml ( 12 . 7 mmol ) of 2 . 5m n - buli hexane solution ( purchased from aldrich chemical co ., inc .) in 30 ml of dry thf ( distilled from na /( c 6 h 5 ) 2 co ) at room temperature under n 2 atmosphere for 4 hours to form the dilithium reagent ( lic . tbd . c -- si ( ch 3 ) 2 si ( ch 3 ) 2 -- c . tbd . cli ). the dilithium reagent formed was treated with 1 . 13 g ( 6 . 01 mmol ) of 1 , 2 - dichloro - 1 , 1 , 2 , 2 - tetramethyldisilane ( cl ( ch 3 ) 2 sisi ( ch 3 ) 2 cl ) in 2 ml of thf and refluxed overnight under n 2 atmosphere . the solvent was pumped off to leave a pale yellow viscous wax . it was dissolved in 150 ml of chloroform ( chcl3 ), washed with aqueous ammonium chloride solution ( nh 4 cl aq ., 50 ml × 2 ) and then with 50 ml of water and dried over cacl 2 . the solution was filtered , evaporated , and dried under vacuum to leave about 1 . 4 g ( 87 %) of the crude polymer iii as slightly sticky solid . ## str1 ## the polymer can be purified by reprecipitation from ch 3 cl / isopropyl alcohol . the purified polymer has λmax = 240 nm in uv spectrum . the mw was 4600 , and m n = 2900 by gpc ( molecular weights are relative to a polystyrene standard . thf was used for eluent ). the ir spectrum shows ( almost ) no si -- h , si -- o -- si functional group . the melting point is 140 °- 157 ° c . 1 . 0 g ( 6 . 01 mmol ) of hc . tbd . c -- si ( ch 3 ) 2 si ( ch 3 ) 2 -- c . tbd . ch was treated with 6 . 3 ml ( i2 . 6 mmol ) of 2 . 0 m etmgbr in thf solution ( purchased from aldrich chemical co ., inc .) in 8 ml of dry thf at room temperature for 1 . 5 hours to form the digrignard reagent brmgc . tbd . c -- si ( ch 3 ) 2 si ( ch 3 ) 2 c . tbd . cmgbr . the digrignard reagent formed was then treated with 1 . 13 g ( 6 . 01 mmol ) of cl ( ch 3 ) 2 sisi ( ch 3 ) 2 cl in 1 . 5 ml of thf at room temperature overnight . the thf was pumped off to leave a white solid . it was washed with water ( 20 ml × 3 ), then ethanol ( 20 ml × 2 ), and dried under vacuum to leave about 1 . 3 g ( 81 %) of the crude polymer of compound iii as a white solid . after reprecipitation from chcl 3 / isopropyl alcohol , the purified polymer has λ max = 238 nm in the uv spectrum . mw = 10 , 000 , m n = 4000 . the ir spectrum shows ( almost ) no si -- h , si -- o -- si functional groups . 1 . 0 g ( 2 . 90 mmol ) of hc . tbd . c -- si ( nc 4 h 9 ) 2 si ( nc 4 h 9 ) 2 c . tbd . ch was treated with 3 . 75 ml ( 6 mmol ) of 1 . 6m nbuli hexane solution in 20 ml of dry thf at room temperature for 2 hours to form the dilithium reagent , which was then treated with 1 . 05 ( 2 . 8 mmol ) of cl ( nc 4 h 9 ) 2 sisi ( nc 4 h 9 ) 2 cl in 3 ml of thf at room temperature overnight . cl ( nc 4 h 9 ) sisi ( nc 4 h 9 ) 2 cl may be prepared as follows : 2 moles of nc 4 h9li hexane solution is slowly added to 1 mole of phenyl trichlorosilane ( c 6 h 5 sicl 3 ) in thf at - 78 ° c . and allowed to be mixed for eight hours . this results in ( c 6 h 5 )( nc 4 h 9 ) 2 sicl and small amounts of ( c 6 h 5 ) si ( nc 4 h 9 ) 3 which can be removed by fractional distillation . 1 mole of c 6 h 5 ( nc 4 h 9 ) 2 sicl was treated with 1 mole of lithium in thf at 0 ° c . the mixture is allowed to be mixed , warming to room temperature for 15 hours to give ( c 6 h 5 )( nc 4 h 9 ) 2 sisi ( nc 4 h 9 ) 2 ( c 6 h 5 ), which can be purified by distillation . hcl gas is introduced to ( c 6 h 5 )( nc 4 h 9 ) 2 sisi ( nc 4 h 9 ) 2 ( c . sub . 6 h 5 ) in benzene solution in the presence of a catalytic amount of aluminum chloride ( alcl 3 ), and allowed to react for 20 minutes , resulting in cl ( nc 4 h 9 ) 2 sisi ( nc 4 h 9 ) 2 cl , which can be purified by fractional distillation . the solvent was evaporated by pumping from the dilithium reagent / dichlorodisilane reaction mixture . to the residue was added 50 ml of hexane and 20 ml of aqueous nh 4 cl solution the organic layer was separated , washed , with aqueous nh 4 cl solution ( 30 ml × 2 ), with water ( 30 ml × 1 ), and dried over cacl 2 . the solution was filtered , evaporated , and dried over cacl 2 . the solution was filtered , evaporated , and dried under vacuum to have about 1 . 3 g ( 73 %) of the crude polymer as a pale yellow sticky solid set forth as compound iv below : ## str2 ## the reaction product can be purified by reprecipitation from thf / ethanol . it shows λ max = 244 m in uv spectrum ; mw = 10700 , m n = 3700 . the melting point is 64 °- 70 ° c . the ir spectrum shows no si -- h , si -- o -- si functional groups . table ii______________________________________properties of disilanylene - acetylene polymerscom - pound appearance mp (° c .) uv ( nm ) mw m . sub . n mw / m . sub . n______________________________________iii white solid 140 - 157 234 4600 2900 1 . 6 240iii white solid 232 10000 7000 1 . 4 239iv white sticky 64 - 70 213 10700 3700 2 . 9 solid 244iv white sticky 210 14800 3400 4 . 4 solid 243i clear viscous 214 ( sh ) 2800 1200 2 . 3 liquid 226 ( r ═ ch . sub . 3 , 240 ( sh ) r &# 39 ;═ nc . sub . 4 h . sub . 9 ) i clear viscous 215 ( sh ) 3400 1300 2 . 6 liquid 227 ( r ═ nc . sub . 4 h . sub . 9 , 239 ( sh ) r &# 39 ;═ ch . sub . 3 ) ______________________________________ in preparing the compounds described above for the exhibition of electroconductive properties , the process commonly referred to as doping was utilized . a wide variety of doping materials may suitably be employed to attain electrical conductivity of the compound . doping materials suitable for effecting an increase in the electrical conductivity of the polymers of the subject invention are generally electron acceptor dopants , including for example br 2 , icl , ibr , asf 5 , sbf 5 , cl 2 , hbr , bf 3 , bcl 3 , so 2 , so 3 , cl 2 , plf 3 , no 2 , hcn , icn , o 2 , sif 4 , no , c 2 h 2 , and transition metal carbonates , phosphine , and olefin derivatives . the preferred dopants are asf 5 or sbf 5 . in doping , the compounds are first prepared by the method of the subject invention . the compounds are contacted with the dopant which may take place in the vapor phase or in solution . in either case , doping is by uptake of the dopant molecules into the polymer structure , which occurs pursuant to a degree proportional to the dopant concentration and the contacting period . for example , the polymeric compounds , in solid form , may be contacted in solution by introduction of a gas for a contacting period ranging from a few seconds to over 24 hours to provide the desired degree of doping , and thereby provide the doped substance with a room temperature electroconductivity within the range of from about 10 - 1 to about 10 - 7 ohm - 1 cm - 1 . the doping procedure may be carried out by placing the copolymer in a solution of the dopant in an appropriate organic solvent inert to the copolymer , such as for example thf , hexane , or toluene . by trial and error , the length of time necessary to leave the copolymer in the solution is found which will obtain the desired degree of doping . at the completion of the doping , the doped material is removed from the solution and rinsed in an additional amount of the organic solvent to remove any residual doping solution therefrom . the excess solvent is pumped off by a vacuum and the conductivity may be measured in a manner known in the art . when the compounds of formulas i , ii , iii , and iv are separately heated to 1100 ° c . under an argon atmosphere , the resulting compound is sic . while the invention has been described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments and equivalents falling within the scope of the appended claims . | 2 |
the invention relates to a system comprising a watercraft that is collectively ( a ) designed to be operated by man or unmanned control ( b ) for high maneuverability and speed to enable quick interception of a large vessel ( c ) that can be securely fastened to the sides of the vessels once it is alongside the larger vessel and ( d ) that can change its configuration to provide a high hydrodynamic drag or side thrust surface upon command . the watercraft according to this invention can be of multiple designs . in one form , it can be a rigid structure which is shaped as a voluminous vessel as shown in fig1 a and 2 . the watercraft 10 includes a plurality of moveable hydraulic or gear motorised flaps 12 a , 12 b and 12 c provided at the lateral sides , at bottom of the watercraft 10 or at fore section of the watercraft 10 . each flap 12 is hinged joined to a frame structure 14 of the watercraft 10 and is secured to at least a hydraulic piston 16 or gears ( not shown ). fig1 b illustrates another embodiment of the watercraft 10 , wherein the flap 12 c is provided at the aft section of the watercraft 10 and 12 b is oriented in a vertical position at the bottom of the watercraft 10 . fig1 c illustrates yet another embodiment of the watercraft ( 10 ) according to the invention . a watercraft size is generally estimated to be about 30 metres long and 6 meters wide for the good speed , agility and maneuverability . fig3 illustrates a plan view of the watercraft 10 with moveable flaps 12 a at both sides of the watercraft 10 , enabling the watercraft 10 to be maneuvered to either sides of the sailing vessel . the watercraft 10 includes a plurality of internal ballast tanks 18 at the lower region of the watercraft 10 as illustrated in fig2 . the watercraft 10 further includes a plurality solenoid bank 20 . each solenoid bank 20 is mounted with the longitudinal axis of its shaft mounted widthwise of the watercraft 10 . the terminal edge of each solenoid bank 20 is in contact with the side walls of the watercraft 10 . referring to fig4 , the watercraft 10 further includes a plurality of means to discharge explosive 22 disposed at the tip of bolt 24 . the bolts 24 are mounted on preferably on each side hull 26 of the watercraft 10 and extend outside the hull upon command . a nut 31 with a collapsible sleeve 30 is provided at each of the bolt 24 . alternatively a quick acting nut and bolt can be secured to the terminal portion of the shaft extending outside the hull of the watercraft 10 . yet in another aspect of the invention , a mechanical clamping means is provided at the terminal portion of the shaft outside the hull of the watercraft 10 . the method of use of the watercraft 10 and other features of the watercraft 10 not hereinbefore described will be now described . during high speed maneuver , the watercraft 10 will be powered using its own self propelling propeller 28 . referring to fig7 , the watercraft 10 once deployed , will engaged the hijacked vessel 40 by traveling towards the bow of the hijacked vessel 40 . once aside the hijacked vessel 40 , or any vessel where direction of travel is to be altered by force , the watercraft 10 will position itself alongside the hijacked vessel 40 , preferably at the stern or bow side of the hijacked vessel 40 . in an alternate embodiment ( not shown ), the watercraft 10 as illustrated in fig1 b , once deployed will position itself with its aft section facing the direction of flow , i . e . in the opposite direction of the hijacked vessel 40 , preferably at the stern or bow side of the hijacked vessel 40 . referring to fig8 , when a large force is required to alter speedily the direction of the hijacked vessel 40 , for example , the hijacked vessel 40 is traveling at maximum cruise speed , the watercraft 10 is then partially submerged by opening up of its internal ballast tanks 18 , allowing seawater to flow . the activation of the ballast tanks 18 depends on the tonnage , cruise speed and the desired turning radius of the hijacked vessel 40 . during this time , the watercraft is maintained in close contact or proximity with the sidewall of the hijacked vessel 40 through the use of vectored propulsion . the vectored propulsion can be achieved by a system of thrust vectoring water jets 33 as illustrated in fig9 . the action of the water jets 33 will take the watercraft inwards towards the sidewall of the hijacked vessel 40 , so that the wall of the watercraft 10 is in contact with the wall of the hijacked vessel 40 . referring to fig1 , when the watercraft 10 reaches the desired section of the hijacked vessel 40 , an electromagnetic attraction between the watercraft 10 and the hijacked vessel 40 will be generated through powering up a series of heavy - duty solenoid banks 20 that are installed within the watercraft 10 . the electromagnetic force , generated by the plurality of solenoid banks 20 will temporarily secure the watercraft 10 to the hijacked vessel 40 at the desired location of the hijacked vessel 40 , preferably the stern side , to create the maximum moment arm for turning . all modern vessels have double hull design . as illustrated in fig1 , the hijacked vessel 40 having double hull vessel includes two independent hulls 42 , 44 , one inside the other , with the two hulls 42 , 44 spaced from one another and a common deck extending over the hulls . both hulls include watertight , pressure - resistant side walls and bottoms . the explosive tipped shaft only punctures the outer hull of the hijacked vessel 42 . while the two vessels are held together by electromagnetic force 46 , a system of explosive activated or quick acting mechanical bolts 24 held in the watercraft 10 are activated to create openings on the outer hull 42 of the hijacked vessel 40 , allowing fastening of bolt and nut to further secure the watercraft 10 to the hijacked vessel 40 . alternatively the vessels can be mechanically clamped . once mechanically fastened , the watercraft 10 is inseparable from the hijacked vessel 40 . referring to fig4 to 6 , the explosive - activated mechanical bolt 24 consists of an elongated shaft 25 extending from within the watercraft 10 through the side hull 26 of the watercraft 10 . the shaft 25 is secured in position by a bolt 27 on the inner wall of the watercraft 10 and a water sealant member 29 on the outside wall . the outside exposed section of the bolt includes a nut 31 with collapsible sleeve 30 . the shaft 25 includes a point of weakness 32 along its length and is connected to a motor ( not shown ). the explosive at the tip of the bolt can be detonated by a fuse initiated electronically upon command . the motor is powered by the onboard generator to provide a quick and powerful means of turning and tightening the bolt and nut . on triggering the explosive head 22 , an opening 34 is created on the outer hull 42 of the hijacked vessel 40 . the opening 34 is sufficient to accommodate the diameter of the shaft of bolt and nut 31 to go through . once the shaft 25 and nut 31 is inside the hijacked vessel &# 39 ; s hull , the bolt 24 is rotated by means of the motor secured to the shaft 25 as illustrated in fig5 . this rotational movement of the shaft tightens the nut 31 against the outer hull 42 of the hijacked vessel 40 and simultaneously the collapsible sleeve 30 of the bolt deforms and wedges onto the opening 34 created by the explosion . referring to fig6 , further rotation of the shaft 25 results in the shearing of the shaft 25 at the point of weakness 32 , resulting in the portion of the shaft 25 being detached free from the rest of the shaft 25 . once the watercraft 10 is securely attached to hijacked vessel 40 by the plurality of nuts and bolts described earlier , another series of maneuvers are put in action . the flaps 12 which may now partially or fully be submerged to create the optimum hydrodynamics drag or side thrust depending on the tonnage , cruise speed and the desired turning radius of the hijacked vessel . hydraulically or other electro - mechanically activated flaps 12 a , 12 b at the side and the bottom of the watercraft 10 respectively are pushed outwards by hydraulic pistons or gear means . the flap at the fore section 12 c is withdrawn towards the body of the watercraft ( see fig1 a ) to expose a large vertical wall 36 against the direction of flow . alternatively , the flap at the aft section of the watercraft 10 can be activated to form a vertical wall when the watercraft 10 deployed is traveling in the opposite direction of the travel of the hijacked vessel 40 ( see fig1 b ). the action of the flaps 12 a , 12 b , 12 c causes an instantaneous increase in the hydrodynamic drag or side thrust on one side of the hijacked vessel 40 . the amount of incremental drag can be varied by moving these flaps inward and outwards or left and right when the flap 12 b is oriented in a vertical position . thus the activation of the flaps 12 , forces the hijacked vessel 40 to change its course of direction , beyond the operation of the rudder of the hijacked vessel 40 . fig1 illustrates schematically the diversion of the path of the hijacked vessel 40 with the watercraft 10 secured to the hijacked vessel 40 . to steer the hijacked vessel 40 , one or more of such watercraft 10 can be deployed at one or both sides of the hijacked vessel 40 to steer and overpower the hijacked vessel 40 to the desired direction . the watercraft 10 carries with it the necessary equipment and system to operate the solenoid banks 20 , the motor to rotate the shaft 25 , the hydraulic flaps or the electro - mechanically activated flaps 12 and the ballast tank 18 . the navigation of the watercraft 10 can be done manually or by remote control . in another embodiment of the present invention , the watercraft 10 is equipped with a self protection system such as amour plated to protect the personnel or component onboard from small to medium armament fired from automatic rifle and rocket propelled grenade launcher . the personnel onboard can also evacuate from the watercraft via an escape capsule . in yet another embodiment of the present invention , mechanical drill rigs 50 can be used to drill through the hull of the hijacked vessel . upon successful puncturing the hull , the drilling rigs 50 can allow the drill rod to extend into the hull and wedged onto the web frame of the hijacked vessel . as the web frame of the vessel is the strongest part of the ship structure , the drilling rod can be used as structure for bolting the ship to the watercraft . it is estimated that for a vessel of length 276 m , 40 m wide with a design draft of 12 m and a tonnage of 73 , 000 metric ton traveling at 15 knots , the required flap for yawing is less than 5 m by 5 m . with the use of 4 drilling rods of diameter 100 mm each will be able to hold onto the vessel to cause the hijacked vessel to turn at a radius of 2 km . these drill rigs 50 can be modified from existing commercial drill rig that is being used for geo - technical or environmental exploration . the initial holding force required for the drilling operation can be provided by vacuum suction pads 52 . using vacuum pads 52 each with a suction capability of 1 . 4 ton ( eg anver vacuum pad pa1834 ), 30 of such pads will be sufficient for the operation . once the drills are wedged onto the wedge frame of the vessel , the pads can be used to stabilize the watercraft and help the drilling rod to adhere to the vessel when the flap is deployed . alternatively , larger number of smaller diameter drills can also be used to replace the 4 large diameter drills . 60 of such smaller conventional drill rig each with a diameter of 25 mm may be sufficient . as a typical estimate of the amount of force required for effectively yawing a hijacked vessel , for a vessel of a length of 276 m , 40 m wide with a design draft of 12 m and a displacement tonnage of 73 , 000 metric ton traveling at 15 knots , the required yawing moment to turn the vessel at a turning radius of 2 km is about 1 . 0 × 10 8 nm . with a flap 12 , 5 m by 5 m positioned at the stern of the hijacked vessel with a 45 degree angle of attack with respect to the flow stream will be sufficient . while this invention has been described in connection with specific embodiments thereof , it will be understood that it is capable of further modification ( s ). this application is intended to cover any variations uses or adaptations of the invention following in general , the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth . as the present invention may be embodied in several forms without departing from the spirit of the essential characteristics of the invention , it should be understood that the above described embodiments are not to limit the present invention unless otherwise specified , but rather should be construed broadly within the spirit and scope of the invention as defined in the appended claims . various modifications and equivalent arrangements are intended to be included within the spirit and scope of the invention and appended claims . therefore , the specific embodiments are to be understood to be illustrative of the many ways in which the principles of the present invention may be practiced . in the following claims , means - plus - function clauses are intended to cover structures as performing the defined function and not only structural equivalents , but also equivalent structures . for example , although a nail and a screw may not be structural equivalents in that a nail employs a cylindrical surface to secure wooden parts together , whereas a screw employs a helical surface to secure wooden parts together , in the environment of fastening wooden parts , a nail and a screw are equivalent structures . “ comprises / comprising ” when used in this specification is taken to specify the presence of stated features , integers , steps or components but does not preclude the presence or addition of one or more other features , integers , steps , components or groups thereof .” | 1 |
the present invention is a cat toilet with a mixed carbon filter to absorb and to dissipate the odor from the cat &# 39 ; s excrement . generally , the cat toilet comprises a box having a bottom , a top / lid and four sides . it has a portal entrance , which acts as an air intake as well as to provide an opening for the cat to pass in and out through . the cat toilet may have an airflow curtain at the portal entrance to provide privacy for the cat . furthermore , the cat toilet has an exhaust system , which is a motor / box fan assembly and a filter apparatus , which is connected to the top / lid of the box , and wherein the top / lid of the box is further connected to a cat toilet enclosure , containing a litter box and a most charming curtain , so that the cat can have privacy while using the litter box . the filter apparatus is modified to have a mixed carbon bed . the invention further includes damping means contained within the filtration system to regulate the amount of airflow from the cat toilet enclosure containing the litter box to the filter and then discharged back ( to the air outside of the box ) into the air of the interior of the pet owner &# 39 ; s house , clean and fresh to the smell . a fan , typically an electric fan , although a wind up fan could be used , is attached to the top / lid of the box of the cat toilet to cause air to flow through the portal entrance , past the damping means in the filtration system , and then discharged back ( to the air outside of the box ) into the air of the interior of the pet owner &# 39 ; s house , clean and fresh to the smell . it has been found useful to utilize camming means connected to the damping means and further attached to a microswitch which engages the fan , and wherein the damping means is adjusted to regulate the amount of air flow from inside the cat toilet enclosure to the filter , and then discharged back ( to the air outside of the box ) into the air of the interior of the pet owner &# 39 ; s house , clean and fresh to the smell . electrical wires are used as connecting means and are wired so as to run inside the tubing connecting the microswitch and the fan to a power source . the cat toilet enclosure preferably is designed with four walls , a bottom , a removable top , an entrance portal / door / opening with an air control curtain and a kitty litter tray . in the most preferred embodiment , the fan is a 12 - volt dc current fan having 0 . 13 amps . finally , it is considered that the damping means and fan could be configured so as to force air in only one direction on , rather than being bidirectional . the following detail is now provided in reference to the drawings . as shown in fig1 an on / off cammed damper control 1 is secured to one end of the box 32 of the cat toilet . exhaust port 2 has a faceplate prefereably made of styrene . a wire mesh screen 3 is disposed over the port . exhaust port 4 has a backing disc preferably made of styrene and a damping disc 5 preferably made of styrene . an exhaust port microswitch mounting disc 6 is mounted on the disc , and this mounting disc is also preferably made of styrene . the microswitch 7 can have a microswitch cam 8 , which is preferably made of styrene . an on / off cam 9 with a damper control shaft is installed for operation of the microswitch . a motor assembly 10 is connected to the control switch , which is preferably at least a 0 . 13 amp fan / motor assembly . the motor has a motor housing 11 , which utilizes a 12 volt , dc power supply cord 12 . the motor is mounted on a motor mounting disc 13 , which is preferably made of number 80 cross linked rubber . the motor housing is mounted to a filter port splicing ring 14 , wherein the ring is preferably an abs material . the assembly mounting flange disc 15 is used which is preferably made from styrene . the motor housing intake port disc 16 is mounted over the assembly mounting flange disc . the motor housing intake port is preferably formed using a disc of styrene . a donut gasket , preferably of closed cell foam 17 is used to mount the filter port housing 18 . the filter port housing has an offset locking notch 19 . the filter faceplate disc 20 has an exhaust port . a wire mesh screen 21 is disposed over the filter . a filter backing disc with exhaust port 22 is used with the filter . the filter material 23 is preferably a mixed carbon , zeolite clay and lime mixture . the filter is held in by a filter locking pin 24 . the sidewall intake port 25 is also covered by a wire mesh screen 25 a . the filter backing disc 26 is used with intake port 26 . a second wire mesh screen 27 is used . a filter faceplate disc and intake port 28 is used to hold the filter media housing 29 . the cat toilet room box 32 preferably has an entrance portal 33 which can be covered with brush hairs , a toilet box lid 30 and a filter assembly port 31 . an optional air control curtain 34 can be used with this invention . [ 0026 ] fig2 shows a different side view of the invention with the filter port and motor housing . in this view , an on / of cammed damper control 1 is secured to one end of the box 32 of the cat toilet . exhaust port 2 has a faceplate prefereably made of styrene . a wire mesh screen 3 is disposed over the port . exhaust port 4 has a backing disc preferably made of styrene and a damping disc 5 preferably made of styrene . an exhaust port microswitch mounting disc 6 is mounted on the disc , and this mounting disc is also preferably made of styrene . the microswitch 7 can have a microswitch cam 8 , which is preferably made of styrene . an on / off cam 9 with a damper control shaft is installed for operation of the microswitch . a motor assembly 10 is connected to the control switch , which is preferably at least an 0 . 13 amp fan / motor assembly . the motor has a motor housing 11 , which utilizes a 12 volt , dc power supply cord 12 . the motor is mounted on a motor mounting disc 13 , which is preferably made of number 80 cross linked rubber . the motor housing is mounted to a filter port splicing ring 14 , wherein the ring is preferably an abs material . the assembly mounting flange disc 15 is used which is preferably made from styrene . the motor housing intake port disc 16 is mounted over the assembly mounting flange disc . the motor housing intake port is preferably formed using a disc of styrene . a donut gasket , preferably of closed cell foam 17 is used to mount the filter port housing 18 . the filter port housing has an offset locking notch 19 . [ 0029 ] fig3 is a side view of the filter only . it comprises a filter faceplate disc , and exhaust port 20 , a wire mesh screen 21 , a filter backing disc , and exhaust port 22 , a carbon , zeolite , clay and lime mixture 23 , a filter locking pin 24 , a sidewall intake port 25 , and wire mesh screen 25 a , a filter backing disc , and intake port 26 , a wire mesh screen 27 , a filter faceplate disc , and intake port 28 , and a filter media housing 29 . air is drawn in through the laminated intake port assembly ( laminated intake port assembly comprises filter backing disc , and intake port 26 , wire mesh screen 27 and filter faceplate disc , and intake port 28 ; sheet glue is used between filter backing disc , and intake port 26 , and wire mesh screen 27 as well as between wire mesh screen 27 , and filter faceplate disc , and intake port 28 ) which is fixably attached to the filter media housing 29 . air is also drawn through the sidewall intake ports 25 , and wire mesh screen 25 a , up through the mixed carbon , zeolite , clay and lime 23 , and out through the fixably attached , laminated exhaust port assembly ( laminated exhaust port assembly comprises filter faceplate disc , and exhaust port 20 , wire mesh screen 21 and filter backing disc , and exhaust port 22 ; sheet glue is used between filter faceplate disc , and exhaust port 20 , and wire mesh screen 21 as well as between wire mesh screen 21 , and filter backing disc , and exhaust port 22 ) where it is discharged back into the air of the interior of the pet owner &# 39 ; s house , clean and fresh to the smell . [ 0030 ] fig5 shows a filter assembly mounted on the toilet from a front view . this figure illustrates the box 30 having a cat entrance portal 33 with an air control curtain 34 , a removable top / lid 30 , and top locking clamps 36 . in the preferred embodiment , a 110 volt ac / 12 volt dc transformer 35 is used to power the system which is high voltage residential ac current which transforms it to low voltage dc current so that the invention is pet safe . cat toilet enclosure 32 is a rectangular box big enough to accommodate a cat and kitty litter container , with four walls , a bottom , a removable attached top 30 , and air control curtain 35 for a cat to pass in and out through . in the preferred embodiment , the cat toilet has a removable top 30 for making the pet owner &# 39 ; s job of servicing and cleaning the cat toilet easier . additionally , top locking clamps 36 are metal clamps fixably attached to the rectangular box enclosure 32 , which are bent in a manner so as to clamp the removable top in place . the preferred manner to attach the top 30 to the box 32 is by fitted grooves . the perimeter of the base of the top 30 has an extended piece of plastic that securely fits in a groove at the perimeter of the uppermost part of the box 32 . the filtration system contains activated charcoal , zeolite , lime and clay . this filter assembly is removably attached to the toilet box lid at one end . there is an opening at the opposite end of a size to allow a cat to pass through . inside the large box there is litter tray filled with kitty litter pebbles . when the on / off , cam , and damper control knob 1 , is rotated , the shaft 9 rotates the damper 5 to the open position , and rotates the cam 8 to its flat lobe , the microswitch 7 is attached to the microswitch mounting disc 6 , is allowed to open , completing the electrical circuit which is supplied by a 110v ac to 12v dc transformer 35 to a 0 . 13 amp 12vdc fan 10 , which draws air in through the entrance portal 33 , and the air control curtain 34 at the front of the box 32 , across the litter tray , into the bottom intake port 28 , 27 , 26 , and the side intake port 25 of the filter , up through the filter body 29 and mixed carbon media 23 , out through the filter exhaust port 22 , 21 , 20 , this is where the donut gasket 17 seals the filter assembly to the filter port housing 18 with a filter locking pin 24 twistlocked into the filter port offset locking notch 19 , so that no air leaks going into the motor housing intake port 16 and up through the assembly mounting flange disc 15 , through the motor housing to filter port splicing ring 14 through the fan / motor mounting disc 13 , and into the fan / motor where it is pushed out and into the motor housing 11 , where it finally is discharged through the exhaust port assembly 2 , 3 , and 4 , which is on top of the complete assembly , fitted into the filter assembly port 31 at the top and back of the toilet room box lid 30 , which may be securely held in place by top locking clamps 36 or which may be securely held in place by fitted grooves , clean and fresh to the smell . there is also a 12vdc power supply , cord lock 12 . the damper can be closed and the fan / motor shut off when the filter is being serviced to avoid sucking up hair and lint , which will tangle , and foul the fan / motor . activated carbon removes the odors from the cat excrement , zeolite encapsulates the ammonia contained in the cat excrement , and the lime and clay help to neutralize the ph of the cat excrement . the cat toilet box top / lid 30 is removable for servicing and cleaning the litter tray . there can also be removably attached circular brush around the entrance portal for the removal of loose hair each time the cat goes in or out . having the litter tray enclosed in the toilet box , also helps prevent the excrement coated litter pebbles from being scattered throughout the pet owner &# 39 ; s room / house . the invention has been described in detail with particular reference to certain preferred embodiments thereof , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention . | 5 |
the invention is a tile or card matching game , wherein the object is for the players to find , from memory , pairs of cards with matching indicia . referring now to fig1 , the front ( face ) of a typical playing tile 10 is shown generally , with an indicium 12 . optionally , the face of the tile 10 also contains a characteristic icon 14 associated with the indicum 12 . this is used to add an additional strategy element to the game , which will be explained in more detail below . in the example shown in fig1 , the indicium 12 is a character named undula ™ from the cogno ® series of books and games from doublestar , llc of st . louis , mo . in the background , behind undula ™ is the characteristic icon , which in this example is a drawing of a blue planet , which has been designated “ cold planet ”— meaning undula ™ can only live on a cold planet . referring now to fig2 , the back of the tile 10 is designated as a coding area 16 . players are permitted to place a mnemonic code . the drawings show text and a symbol as codes , but , as will become apparent , any code can be used . the object of the code is to aid the player who placed the code to remember which indicium is on the front side thereof , while at the same time , not being too easily deciphered by competing players . in the example shown in fig2 , two codes 20 , 22 are shown . although , the drawings are in black - and - white , it should be understood that in the preferred embodiment each player is assigned a different color for his or her codes . thus , each player can know who wrote which codes . if the drawings were in color , it would be seen that code 20 is red , and code 22 is purple . hypothetical player 1 drew code 20 . the words “ loch ness ” are intended to remind the player that undula ™ is the indicium on the other side . those familiar with the cogno ® characters will understand that undula ™ is indigenous to water . hypothetical player 2 drew code 22 , which is a pictograph of an airplane . because undula ™ is the fastest creature in the universe , the jet plane ( being a fast mode of transportation ) is intended to remind player 2 of undula ™. in its most general form , the preferred embodiment is played as follows . a plurality of tiles 10 are arranged in a playing area , face down . the complete set of tiles comprises pairs of tiles with matching indicia 12 on the front thereof . only the coding region 16 of the tiles is exposed . game play is turn - based , with a player on his or her turn exposing one tile 10 . he or she then tries to find a tile 10 with a matching indicium 12 to the first . if the indicia 12 match , the player keeps the matching pair ( and in the preferred embodiment , is entitled to another turn ). if the indicia 12 do not match , the tiles 10 are returned to the playing area face down in the same location . the player then has the opportunity if he or she wishes to place a mnemonic code in the coding region 16 . in the preferred embodiment , the coding region 16 is a dry erase surface , and , as mentioned above , each player is given a dry erase marker of a unique color , so that each player knows which codes belong to which players . other coding devices are also possible . for instance , flexible members ( e . g . pipe cleaners ) of varying colors may be used by players to bend into coded shapes . in some variations , it is possible to give another player an opportunity to code one or both tiles 10 . in fact , in the preferred embodiment , the player to the right of the player whose turn it is , is permitted to code the first ( exposed ) tile 10 , while the player whose turn it is , is coding the second ( unexposed ) tile 10 . play then passes to the next player , who attempts to locate a matching pair in the same manner , by using his or her memory , his or her own codes , and / or any codes of opponents that he or she has deciphered ( or thinks that he or she has deciphered ). after all of the tiles have been matched , the player with the most sets of tiles 10 is declared the winner . players are not bound to keep a consistent coding schema . each player is entitled to change his or her coding schema as often as he or she wishes during a game , and may even place intentionally inconsistent codes to deceive his or her opponents . other variations of the preferred embodiment are possible to make game playing more interesting and to add additional strategic elements . in one such variation , characteristic icons 14 are included with each indicium . an indicator 18 , as shown in fig3 , is used to keep track of which characteristics are eligible for removal from game play . if a matching pair of tiles 10 is found , the player may only keep the pair if the characteristic associated with the indicia 12 is designated that turn . if the characteristic is not designated that turn , the tiles 10 must be replaced to the playing area the same as if the indicia 12 did not match . each time a pair of tiles 10 is removed , the indicator is changed to designate a new set of characteristics . as shown in fig3 , the indicator may simply be made of a card with icons representing the characteristics being indicated on that turn . to change the indicator , the card is simply flipped over . fig3 shows both sides of the indicator 18 . on side 1 , is a drawing of a blue planet , like the “ cold planet ” seen on the tile 10 of fig1 . on side 2 , is a drawing of an orange planet , representing a “ hot planet ”. thus , in the examples shown in the figures , if the indicator 18 was positioned with side 1 up , a player finding the two matching undula ™ tiles 10 could remove them from play . however , if side 2 of the indicator 18 was facing up , a player finding the two matching undula ™ tiles 10 would have to return them to the playing area because the characteristic associated with undula ™ ( cold planet ) does not match the characteristic on the indicator 18 ( hot planet ). in an alternative embodiment , the indicator 18 can change every turn . in another alternative embodiment , each player is given a pass ( or more than one ) at the beginning of the game which can be redeemed to change the indicator 18 out of sequence . when using the characteristics indicator 18 , certain indicia 12 are designated as wildcards — that is they have no associated characteristics . thus , these wildcard tiles 10 may be removed when matched regardless of the status of the indicator 18 . indicia may be shown as wild cards by displaying no characteristics icon 14 therewith . in yet another embodiment , the tiles 10 are not removed when matched . instead , the indicia 12 are arbitrarily ordered , and potentially numbers representing that order are located on the tiles 10 adjacent to the indicia 12 . the object in this alternative embodiment is to find three tiles 10 with consecutively ordered indicia 12 . in a subvariation thereof , a player who has found three consecutively ordered indicia 12 , may at his or her option select a fourth tile 10 seeking an indicium 12 that would extend the consecutive run ( either upward or downward ). if , however , he or she did not find a tile 10 that extended the run , all of the tiles 10 selected on the turn would have to be replaced . if the run were extended , he or she may optionally risk all of the tiles 10 again by selecting an additional tile 10 in a further attempt to extend the run , and so forth . in this subvariation , the winner is the player collecting the most tiles . the game may also be computerized . in a possible computer version , each player is located at a separate computer or terminal , connected by local area network ( lan ) or the internet . each tile is an abstract computerized object , which can be exposed to only one player by displaying the indicium associated with the tile on the screen of that player . the coding regions in this version would not be on the physical backs of tiles , but would be logically associated with tiles in a one - to - one correspondence . while the foregoing is directed to the preferred embodiments of the present invention , other and future embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims which follow . | 0 |
in accordance with the present invention , by using different source gases for the epitaxial growth , it is possible to grow sige layers at significantly lower temperatures than those employed in the prior art . the present invention utilizes halogermanes and silanes as the source gases in order to grow the sige layers at temperatures below 600 ° c . these gases replace the chlorosilanes and germanes of the prior art . in accordance with the present invention , sige layers are deposited using halogermanes and silanes as the precursor materials in accordance with the following chemical reaction equation . the deposition temperature for the above reaction is considerably lower than that required in the prior art as will be shown in the examples below . the halogermanes that can be utilized in the present invention include , but are not limited to , those having the following formula . x 4 - n geh n , where x is f , cl , br , or i , and n is 0 to 3 . specific examples that meet the above formula include chlorogermane , dichlorogermane , and trichlorogermane . in addition , halogermanes that can be used in the present invention include halodigermanes of the formula x 3 - m h m gegeh n x 3 - n , where x is f , cl , br , or i , m is 0 to 3 and n is 0 to 3 ; r 4 - n geh n , where r is a hydrocarbon group , and n is 0 to 3 ; and r 4 - n gex n , where r is a hydrocarbon group , x is f , cl , br , or i , and n is 1 to 3 . the method and means of the present invention also includes the optional addition of a further chlorine source , such as cl 2 or hcl . silanes that are useful in the method and means of the present invention include , but are not limited to , silane ( sih 4 ), disilane ( si 2 h 6 ), trisilane ( si 3 h 8 ), other higher order silanes , and organosilanes of the formula r 4 - n sih n , where r is a hydrocarbon group , and n is 0 to 3 . the present invention is also applicable to the selective epitaxial growth of sigec layers , for which a source of carbon must also be provided . in particular , the present invention can utilize any suitable carbon source , such as monomethylsilane ( ch 3 sih 3 ) and other organosilanes . because the halogermanes used in the present invention have a lower decomposition temperature than the hydrochlorosilanes of the prior art , the epitaxial deposition can be carried out at lower temperatures than those necessary for the prior art methods . in particular , the method and means of the present invention operates in a temperature range of 100 ° c . to 1000 ° c ., preferably 400 ° c . to 600 ° c . one advantage of the present invention is that the same selective epitaxial growth achieved by prior art methods , can still be accomplished , using the same hardware configurations . therefore , no addition capital cost will be incurred and because the heating requirements are less , lower process costs may be realized . further , the lower temperatures needed in accordance with the present invention reduce the risk of damage to under - layer and dopant profiles of the target wafers . in this light , standard epitaxial growth chambers can be used , such as the amat epi centura and epsilon 2000 asm cvd systems . these chambers may be configured and set up to operate in conjunction with cleaning chambers , capping layer deposition chambers , etc . the present invention is applicable to any standard epitaxial growth process , including ultra - high vacuum cvd ( uhv - cvd ), low - pressure cvd ( lpcvd ), reduced - pressure cvd ( rpcvd ), rapid thermal cvd ( rtcvd ), and molecular beam epitaxy ( mbe ) processes . further , the sige or sigec layers of the present invention may be grown on crystalline substrates , such as single crystalline silicon substrates , a silicon layer formed on an insulator ( soi ) substrate or layer , or selectively grown on silicon surfaces exposed through an amorphous surface such as a mask of sio 2 or si 3 n 4 . the following examples are provided to show results achieved by the method and means of the present invention , but are not intended to limit the scope of the present invention . a cvd chamber is baked and pumped down to base pressure below 10 − 6 torr . dichlorogermane ( geh 2 cl 2 ) and silane ( sih 4 ) are then delivered to the cvd chamber at a continuous rate between 1 sccm and 1000 sccm . a masked silicon wafer substrate present in the cvd chamber is heated to a temperature between 100 ° c . to 1000 ° c ., preferred 400 ° c . to 600 ° c . and the cvd chamber pressure is held between 1 mtorr and 10 torr . an epitaxial si 1 - x ge x ( x = 0 to 0 . 5 ) was selectively grown on exposed portions of the silicon wafer surface . in a similar process as described in example 1 , a carbon source such a methylsilane or hydrocarbon , is also delivered to the cvd chamber . an epitaxial layer of si 1 - x - y ge x c y ( x = 0 to 0 . 5 , y = 0 to 0 . 3 ) was selectively grown on exposed portions of the silicon wafer surface . in a similar process as described in example 1 , a relaxed and graded layer of si 1 - x ge x ( x = 0 to 0 . 5 ) was selectively grown on exposed portions of the silicon wafer surface . a strained silicon layer is then deposited on the relaxed si 1 - x ge x surface . it is anticipated that other embodiments and variations of the present invention will become readily apparent to the skilled artisan in the light of the foregoing description and examples , and it is intended that such embodiments and variations likewise be included within the scope of the invention as set out in the appended claims . | 7 |
embodiments of the present invention will be explained with reference to the accompanying drawings hereinbelow . [ 0031 ] fig4 a to 4 d are sectional views showing steps of a substrate cleaning method according to a first embodiment of the present invention respectively . for samples processed by four types of the chemicals or liquids of the chemicals and unprocessed samples , growth rates of insulating films on an underlying insulating film are compared to each other . first , as shown in fig4 a , a p - type silicon substrate ( semiconductor substrate ) 31 having a resistivity of 5 ωcm is prepared . then , as shown in fig4 b , the silicon substrate 31 is thermally oxidized at a temperature of 1100 ° c . in oxygen atmosphere to form a silicon oxide film ( underlying insulating film ) 32 of about 100 nm thickness on a surface of the silicon substrate 31 . with the above , a substrate 30 can be formed . then , as shown in fig4 c , the substrate 30 is cleaned by using cleaning chemicals or vapor of the chemicals . in the experiments , four types of the chemicals or vapors of the chemicals described in the following have been employed . more particularly , a first sample has been prepared as follows . in other words , as shown in fig7 a liquid 102 of chlorosulfonic acid ( so 2 cl ( oh )) has been filled in a flask 101 and then a liquid temperature has been held at a room temperature without heating . a nitrogen ( n 2 ) gas as a carrier gas has been passed through the liquid 102 of the chiorosulfonic acid ( so 2 cl ( oh )) via a pipe 103 and then introduced via a pipe 105 into a chamber 106 into which the substrate 30 has been loaded . then , the nitrogen gas including the chiorosulfonic acid has been sprayed onto a surface of the substrate 30 for thirty minutes . a temperature of the liquid 102 of chlorosulfonic acid ( so 2 cl ( oh )), as the case may be , may be increased by heating by means of a heater 104 . then , a second sample has been prepared by supplying vapor of sulfuric acid directly from a sulfuric acid bomb and then spraying it onto a surface of the to - be - processed substrate 30 for thirty minutes . then , third and fourth samples have been prepared as follows . the liquid of the chlorosulfonic acid of 30 cc has been filled in two beakers . the liquid temperature in one beaker is held at a room temperature , while the other beaker has been heated to hold the liquid temperature at 58 ° c . then , the substrates 30 have been immersed in respective chemicals for thirty minutes . for the sake of comparison , a fifth sample which is not treated by the cleaning chemicals or vapor of the chemicals has also been prepared . in all cases , the substrates 30 have been cleaned by the flowing pure water after the process has been completed and in turn dried by blowing the nitrogen gas respectively . next , under the conditions set forth in the following , as shown in fig4 d , another silicon oxide film ( insulating film ) 33 has been formed on the silicon oxide film 32 formed by thermal oxidation by virtue of the thermal cvd method using the following reaction gas given in a table 1 . the results are given in a table 2 . in table 2 , a notation “ growth rate ” signifies a growth rate of the silicon oxide film 33 , and a notation “ ratio to si ” signifies a ratio of the growth rate of respective samples to the growth rate obtained when the film is formed directly on the silicon substrate , shown in percentages . according to the results shown in table 2 , if surface treatment has been made by both the liquid or vapor of the chlorosulfonic acid , the growth rate has been equal to or higher than the growth rate obtained when the film is formed directly on the silicon substrate . as a result , the growth rate on the surface of the insulating film can be improved and therefore a throughput can also be improved . in addition , consumption of the chemicals a large amount of which is needed as the liquid can be reduced significantly by employing the vapor of the chemicals . in the above first embodiment , either the vapor or liquid of the chlorosulfonic acid or the vapor of the hydrochloric acid has been employed as the cleaning chemicals . however , in addition to only the vapor of sulfuric acid , only the vapor of nitric acid , or the mixed vapor of the vapor of sulfuric acid and the vapor of nitric acid , such vapor including at least any one of the vapor of sulfuric acid , the vapor of hydrochloric acid , and the vapor of nitric acid may be employed . [ 0047 ] fig5 a to 5 c are sectional views showing steps of a substrate cleaning method according to a second embodiment of the present invention respectively . first , as shown in fig5 a , a resist film 42 is formed on a silicon substrate ( semiconductor substrate ) 41 and then opening portions 43 are formed in the resist film 42 . then , the silicon substrate 41 is etched via the opening portions 43 by the dry etching using chlorine ( cl 2 ) to form grooves 44 each having a diameter of about 0 . 25 μm and a depth of 1 . 5 μm . next , as shown in fig5 b , the resultant structure is immersed in the ekc as the resist removing liquid to remove the resist . with the above steps , a substrate 40 can be prepared . at this time , the ekc liquid would remain in the grooves 44 . then , as shown in fig7 the liquid 102 of the chlorosulfonic acid ( so 2 cl ( oh )) has been filled in the flask 101 and then the liquid temperature has been held at a room temperature or the liquid temperature has been increased by being heated by the heater 104 . the nitrogen gas as the carrier gas has been passed through the liquid 102 of chlorosulfonic acid ( so 2 cl ( oh )) to thus form the nitrogen gas including the chlorosulfonic acid . then , such nitrogen gas has been introduced into the chamber 106 via the pipe 105 . then , the nitrogen gas including the chlorosulfonic acid has been sprayed onto a surface of the substrate 40 ( fig5 c ) in the chamber 106 . at that time , since the molecular chlorosulfonic acid can enter easily into the grooves 44 each having a narrow opening portion and a deep depth , it can react with the ekc attached onto the bottoms and sidewalls of the grooves 44 . hence , all ekc remaining on the bottoms and sidewalls of the grooves 44 can be removed easily . in the above second embodiment , the vapor of the chlorosulfonic acid has been employed as the cleaning chemicals . however , in addition to only the vapor of sulfuric acid , only the vapor of nitric acid , or the mixed vapor of the vapor of sulfuric acid and the vapor of nitric acid , the vapor including at least any one of the vapor of sulfuric acid , the vapor of hydrochloric acid , and the vapor of nitric acid may be employed . [ 0055 ] fig6 a to 6 d are sectional views showing steps of a substrate cleaning method according to a third embodiment of the present invention respectively . [ 0056 ] fig6 a is a sectional view showing a structure before wirings are formed on the substrate . in fig6 a , a reference 51 denotes a silicon substrate ( semiconductor substrate ); 52 , a silicon oxide film ( underlying insulating film ) formed by thermal oxidation ; 53 , a conductive film made of aluminum which is formed on the silicon oxide film 52 to have a thickness of 800 nm ; and 54 , a resist film formed on the conductive film to remain on wiring forming regions . first , as shown in fig6 b , the conductive film 53 is etched by using the resist film 54 as a mask to form a plurality of wirings 53 a each having a width of 0 . 5 μm at a distance 1 μm between adjacent wirings 53 a . then , as shown in fig6 c , a surface of the substrate 50 is cleaned by the vapor of the cleaning chemicals . in other words , as shown in fig7 the liquid 102 of the chlorosulfonic acid ( so 2 cl ( oh )) has been filled in the flask 101 , and then held at a room temperature or heated by the heater 104 . the nitrogen gas as the carrier gas has been passed through the liquid 102 of chlorosulfonic acid ( so 2 cl ( oh )) to thus form the nitrogen gas including the chlorosulfonic acid . then , the nitrogen gas including the chlorosulfonic acid has been sprayed onto a surface of the substrate 50 for two minutes . for the sake of comparison , a sample which is not treated by the cleaning . chemicals or the vapor of the chemicals has also been prepared . in all cases , the substrates 50 have been has been cleaned by the flowing pure water after the process and then dried by blowing the nitrogen gas . next , under the conditions set forth in the following , as shown in fig6 d , according to thermal oxidation by virtue of the thermal cvd method using the following reaction gas given in a table 3 , another silicon oxide film ( insulating film ) 55 has been formed to cover the wirings 53 a . sectional shapes of the insulating films obtained as above to cover the wirings have been compared to each other with reference to fig6 d and 2c . fig6 d is a sectional view showing the sample which has been formed and cleaned by the cleaning method according to the present invention , and fig2 c is a sectional view showing the sample which has been formed without treatment . according to the results , in the case where surface treatment has been carried out by the vapor of chlorosulfonic acid as shown in fig6 d , hollows of the concave portions between the wirings 53 a have been able to be made shallower in the sectional shape of the insulating film 55 to cover the wirings than the case where no treatment has been applied as shown in fig2 c . consequently , the conductive film serving as the upper wirings can be formed normally on the hollow portions on the surface of the insulating film 55 . also , since the depths of the hollow portions are shallow , the conductive film on the bottoms of the hollow portions can be removed clearly at the time when the conductive film once formed is to be patterned by etching . in the above third embodiment , the vapor of chlorosulfonic acid has been employed as the cleaning chemicals . however , in addition to only the liquid of chlorosulfonic acid , only the vapor of sulfuric acid , only the vapor of nitric acid , or the mixed vapor of the vapor of sulfuric acid and the vapor of nitric acid , the vapor including at least any one of the vapor of sulfuric acid , the vapor of hydrochloric acid , and the vapor of nitric acid may be employed . the silicon substrate has been employed as the semiconductor substrates 31 , 41 , 51 in the above first to third embodiments , but these substrates are not limited to the silicon substrate . in addition , the silicon oxide film formed by the thermal oxidation has been employed as the underlying insulating films 32 , 52 , but these underlying insulating films are not limited to the thermal silicon oxide film . sio 2 film , psg film , bsg film , bpsg film , and others formed by thermal cvd method , and other cvd method may be employed . the silicon oxide film has been employed as the insulating films 33 , 55 , but these insulating films are not limited to the silicon oxide film . moreover , the thermal cvd method using teos / o 3 has been employed as the method of forming the insulating films 33 , 55 , but the thermal cvd method using other reaction gas or other cvd method may be employed . for instance , the low pressure ovd method ( lpcvd method ) using an sih 4 — n 2 o reaction gas , the lpcvd method using a teos - o 2 reaction gas , the plasma - cvd method using the teos - o 2 reaction gas , or the plasma cvd method using an sih 4 — o 2 reaction gas may be applied . hence , the sio 2 film , the psg film , the bsg film , the bpsg film , or the like formed by these cvd methods may be employed . as discussed above , in the present invention , the surface of the substrate is exposed to either the vapor including at least any one of the vapor of sulfuric acid , the vapor of hydrochloric acid , and the vapor of nitric acid or the vapor of chlorosulfonic acid ( so 2 cl ( oh )). since the vapor is employed , molecular chemicals are ready to enter into the insides of the grooves each having the narrow width and the deep depth , so that they can achieve a noticeable effect of removing the contaminants . since the vapor is employed , consumption of the chemicals , a large quantity of which is needed as the liquid , can be extremely reduced . since the surface of the insulating film is treated by the liquid or vapor of the chlorosulfonic acid ( so 2 cl ( oh )) prior to film formation , the growth rate on the surface of the insulating film can be improved and also a throughput can be improved . since the surface of the substrate is treated by the liquid or vapor of the chlorosulfonic acid ( so 2 cl ( oh )) before the insulating film to cover the wirings is formed , contaminants on the underlying insulating film can be removed , otherwise the growth rate of the insulating film to the surface of the underlying insulating film can be put close to the growth rate of the insulating film to the surface of the silicon substrate . as a result , since the growth rate of the insulating film to the underlying insulating film in the concave portions between the wirings can be improved and thus hollows of the insulating film on the concave portions can be reduced as small as possible , the upper wirings can be formed regularly on the insulating film . | 8 |
an embodiment of the present invention will now be described in detail with reference to the accompanying drawings . like reference numerals and symbols denote like elements . fig1 illustrates a digital broadcast receiver that incorporates a recording / output apparatus according to an embodiment of the present invention . as indicated in fig1 , the digital broadcast receiver includes tuner decoding sections 101 , 102 , selectors 103 , 104 , separation / extraction sections ( e . g ., demultiplexers ) 105 , 106 , a clock reproduction section 107 , decoding sections ( e . g ., mpeg decoders ) 108 , 109 , a timestamp addition section 110 , a write section 111 , a recording medium ( e . g ., hard disc , memory , optical disc , or magnetooptical disc ) 112 , a read section 113 , a timestamp comparison / output section 114 , an ieee 1394 interface section 115 , a control section ( e . g ., cpu ( central processing unit )) 116 , and a user interface section ( including , for instance , a keyboard , mouse , remote controller , or other input device ; a video output or display device based on a crt ( cathode ray tube ), lcd ( liquid crystal display ), or pdp ( plasma display panel ); and an audio output device including a speaker ) 117 . tuner decoding section 101 receives a digital broadcast signal from a digital broadcast source provided by a broadcast station not shown via a satellite , terrestrial , cable , or other broadcast transmission network . this tuner decoding section 101 performs a tuning process and a wave detection process on a physical or virtual channel frequency that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 . then , the tuner decoding section 101 outputs to selector 103 an mpeg2 - ts ( that is , a digital broadcast signal ) that has been subjected to digital demodulation and error correction . selector 103 performs a 3 - input 1 - output selection process under the control of the control section 116 , and delivers the resulting output to separation / extraction section 105 . separation / extraction section 105 separates / extracts from an entered mpeg2 - ts a transport packet of a channel ( broadcast program ) that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 , and outputs the separated / extracted transport packet to the timestamp addition section 110 . this separation / extraction section 105 separates / extracts a video / audio pes ( packetized elementary stream ) or es ( elementary stream ) from a transport packet of a channel ( broadcast program ) that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 , and outputs the separated / extracted video / audio pes or es to decoding section 108 . then the separation / extraction section 105 extracts a pcr ( program clock reference ) from a transport packet of a channel ( broadcast program ) that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 , and outputs the extracted pcr to the clock reproduction section 107 . decoding section 108 receives the pes or es of video and / or audio from separation / extraction section 105 , compares the dts ( decoding time stamp ) or pts ( presentation time stamp ) of the pes or es with an stc count value fed from the clock reproduction section 107 , which will be described later , adjusts the decoding / display timing to achieve decoding , and outputs the decoded video and / or audio to the user interface section 117 . tuner decoding section 102 receives a digital broadcast signal from a digital broadcast source , which is provided by a broadcast station not shown , via a satellite , terrestrial , cable , or other broadcast transmission network . this tuner decoding section 102 performs a tuning process and a wave detection process on a physical or virtual channel frequency that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 . then , the tuner decoding section 102 outputs to selector 103 an mpeg2 - ts that has been subjected to digital demodulation and error correction . selector 104 performs a 3 - input 1 - output selection process under the control of the control section 116 , and delivers the resulting output to separation / extraction section 106 . separation / extraction section 106 separates / extracts from an entered mpeg2 - ts a transport packet of a channel ( that is , a broadcast program ) that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 , and outputs the separated / extracted transport packet to the timestamp addition section 110 . this separation / extraction section 106 separates / extracts a video / audio pes ( packetized elementary stream ) or es ( elementary stream ) from a transport packet of a channel ( broadcast program ) that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 , and outputs the separated / extracted video / audio pes or es to decoding section 109 . then , the separation / extraction section extracts a pcr ( program clock reference ) from a transport packet of a channel ( broadcast program ) that is specified via a remote controller or other user operating control on the user interface section 117 and the control section 116 , and outputs the extracted pcr to the clock reproduction section 107 . decoding section 109 receives the pes or es of video and / or audio from separation / extraction section 106 , compares the dts ( decoding time stamp ) or pts ( presentation time stamp ) of the pes or es with an stc count value fed from the clock reproduction section 107 , which will be described later , adjusts the decoding / display timing to achieve decoding , and outputs the decoded video and / or audio to the user interface section 117 . the user interface section 117 displays and / or plays the decoded video and / or audio with an output device ( the display device and / or audio output device ). the clock reproduction section 107 uses the pcr to reproduce a receiver system clock that is synchronized ( for frequency / phase matching ) with the system clock of a broadcast station &# 39 ; s encoding / multiplexing section , outputs the reproduced system clock to the timestamp addition section 110 and timestamp comparison / output section 114 , and outputs to decoding sections 108 and 109 the stc count value of an stc counter that operates in accordance with the reproduced system clock . the timestamp addition section 110 generates a timestamp by using a counter that operates in accordance with the system clock reproduced by the clock reproduction 107 , adds the timestamp to ( or embeds the timestamp into ) the transport packets separated / extracted by separation / extraction sections 105 and 106 , and outputs the transport packets to the write section 111 . the write section 111 performs a process for recording the transport packets , to which the timestamp is added by the timestamp addition section 110 , on the recording medium 112 . as a result , one stream having a plurality of timestamped transport packets , which contain the video data and / or audio data about a certain channel ( that is , a certain broadcast program ), is stored on the recording medium 112 as a single file or two or more separated data files . the timestamp is the time information about a timestamped transport packet . for example , the timestamp represents the time at which a transport packet was input from a separation / extraction section 105 , 106 to the timestamp addition section 110 , or the time difference from a reference transport packet ( e . g ., the preceding or leading transport packet ). this timestamp differs from a timestamp that is already included in a transport packet , such as a pts or dts . the read section 113 sequentially reads from the recording medium 14 a plurality of timestamped transport packets contained in a specified stream , and outputs the read transport packets to the timestamp comparison / output section 114 . the timestamp comparison / output section 114 compares the counter value of a counter that operates in accordance with the system clock reproduced by the clock reproduction section 107 with the timestamp of a timestamped transport packet read by the read section 113 . if the compared value and timestamp coincide with each other , the timestamp comparison / output section 114 deletes ( removes ) the timestamp from the timestamped transport packet and outputs the transport packet to the selectors 103 , 104 and the ieee 1394 interface section 115 . a d - vhs video deck ( not shown ) is connected to the ieee 1394 interface section 115 via an ieee 1394 ( e . g ., i . link ( registered trademark )) cable . the ieee 1394 interface section 115 receives transport packets from which timestamps were deleted by the timestamp comparison / output section 114 , and outputs the transport packets to the d - vhs video deck ( not shown ) via the ieee 1394 cable ( not shown ). further , the ieee 1394 interface section 115 receives transport packets that are input from the d - vhs video deck ( not shown ) via the ieee 1394 cable ( not shown ), and outputs the transport packets to the selectors 103 , 104 . alternatively , a separate communication interface section may be furnished in addition to or in place of the ieee 1394 interface section 115 for the purpose of transferring data to an external storage medium ( e . g ., d - vhs videotape or other magnetic tape ) in compliance with another communication interface such as a lan or wireless lan interface . the control section 116 is connected to various sections of the digital broadcast receiver via a bus section ( not shown ). the control section 116 controls the operation of the entire digital broadcast receiver , and performs various processes by receiving various instruction signals from the user via the remote controller or other control on the user interface section 117 and controlling various sections connected via the bus section ( not shown ) in compliance with the instruction signals . a typical process involving the mpeg2 - ts format has been described above . however , an operation can also be performed when the mpeg2 - ps ( moving picture experts group phase 2 — program stream ) format is used . when the mpeg2 - ps format is used , the clock reproduction section 107 reproduces the receiver system clock by using an scr ( system clock reference ). the configuration and operation of the clock reproduction section 107 will now be described in detail with reference to fig2 . as indicated in fig2 , the clock reproduction section 107 includes selectors 1071 , 1074 , a clock control section 1072 , a comparison section 1073 , an lpf ( low pass filter ) 1075 , a vcxo ( voltage controlled crystal oscillator ) 1076 , and an stc counter 1077 . selector 1071 performs a 2 - input 1 - output selection process under the control of the control section 116 . the pcrs separated / extracted by the separation / extraction sections 105 , 106 are input to selector 1071 . the pcr selected by selector 1071 is output to the comparison section 1073 and stc counter 1077 . when the pcr is input , the comparison section 1073 compares the value of the pcr with the stc count value of the stc counter 1077 , which will be described later , calculates the difference between the compared values , and outputs the calculation result to selector 1074 and clock control section 1072 . the clock control section 1072 records and stores the difference value calculated by the comparison section 1073 as a clock control value or calculates an average difference value and records and stores the average difference value as a control value . in compliance with instructions from the control section 116 , the clock control section 1072 outputs the recorded value to selector 1074 . selector 1074 performs a 2 - input 1 - output selection process under the control of the control section 116 . the inputs from the comparison section 1073 and clock control section 1072 are output to the lpf 1075 . the lpf 1075 receives an input signal from selector 1074 , smoothes the input signal by eliminating its high - frequency component , and outputs smoothed input signal to the vcxo 1076 . the vcxo 1076 oscillates , for instance , at a center frequency of 27 mhz , generates a clock whose oscillation frequency is controlled in accordance with the signal that was smoothed when the lpf 1075 eliminated its high - frequency component , and outputs the generated clock to the stc counter 1077 , timestamp addition section 110 , and timestamp comparison / output section 114 . the stc counter 1077 operates in accordance with the clock generated by the vcxo 1076 while using the pcr value fed from selector 1071 as an initial value . this counter 1077 outputs its count value to the comparison section 1073 and decoding sections 108 , 109 . when selector 1074 selects an output of the comparison section 1073 in a situation where the above configuration is employed , the clock reproduction section 107 employs a pll ( phase lock loop ) configuration . therefore , the pcr selected by selector 1071 can be used to reproduce a clock that is synchronized ( for frequency / phase matching ) with the system clock of a broadcast station &# 39 ; s encoding / multiplexing section . meanwhile , when selector 1074 selects an output of the clock control section 1072 , a clock can be generated in accordance with a clock control value that is recorded / stored in the clock control section 1072 . further , when the clock control value is generated and recorded while a digital broadcast is properly received , the clock generated in accordance with the control value is infinitely close to the system clock of a broadcast station &# 39 ; s encoding / multiplexing section in frequency . the configuration and operation of the timestamp addition section 110 will now be described in detail with reference to fig3 . as indicated in fig3 , the timestamp addition section 110 includes pcr acquisition sections 1101 , 1102 , counters 1103 , 1104 , and timestamp insertion sections 1105 , 1106 . pcr acquisition section 1101 checks transport packets separated / extracted by separation / extraction section 105 , acquires a transport packet that carries a pcr , and outputs the value of the pcr to counter 1103 . counter 1103 operates in accordance with the clock reproduced by the clock reproduction section 107 while using the pcr value acquired by pcr acquisition section 1101 as an initial value . this counter 1103 outputs its count value to timestamp insertion section 1105 . timestamp insertion section 1105 generates a timestamp in accordance with the count value fed from counter 1103 at the time when a transport packet separated / extracted by separation / extraction section 105 is input , adds the timestamp to ( or embeds the timestamp in ) the transport packet , and outputs the timestamped transport packet to the write section 111 . pcr acquisition section 1102 checks transport packets separated / extracted by separation / extraction section 106 , acquires a transport packet that carries a pcr , and outputs the value of the pcr to counter 1104 . counter 1104 operates in accordance with the clock reproduced by the clock reproduction section 107 while using the pcr value acquired by pcr acquisition section 1102 as an initial value . this counter 1104 outputs its count value to timestamp insertion section 1106 . timestamp insertion section 1106 generates a timestamp in accordance with the count value fed from counter 1104 at the time when a transport packet separated / extracted by separation / extraction section 106 is input , adds the timestamp to ( or embeds the timestamp in ) the transport packet , and outputs the timestamped transport packet to the write section 111 . the configuration and operation of the timestamp comparison / output section 114 will now be described in detail with reference to fig4 . as indicated in fig4 , the timestamp comparison / output section 114 includes timestamp deletion sections 1141 , 1142 , comparison / output sections 1143 , 1144 , counters 1145 , 1146 , and timestamp acquisition sections 1147 , 1148 . timestamp acquisition section 1147 acquires the timestamp value of a timestamped transport packet that was read by the read section 113 , and outputs the acquired timestamp value to counter 1145 . counter 1145 operates in accordance with the clock reproduced by the clock reproduction section 107 while using the timestamp value acquired by timestamp acquisition section 1147 as an initial value . this counter 1145 outputs its count value to comparison / output section 1143 . comparison / output section 1143 compares the counter value of counter 1145 against the timestamp of the timestamped transport packet read by the read section 113 . when the compared count value and timestamp agree with each other , comparison / output section 1143 outputs the timestamped transport packet to timestamp deletion section 1141 . timestamp deletion section 1141 deletes ( removes ) the timestamp from the timestamped transport packet fed from comparison / output section 1143 and outputs the transport packet , which is now without the timestamp , to selector 103 or ieee 1394 interface section 115 . timestamp acquisition section 1148 acquires the timestamp value of a timestamped transport packet that was read by the read section 113 , and outputs the acquired timestamp value to counter 1146 . counter 1146 operates in accordance with the clock reproduced by the clock reproduction section 107 while using the timestamp value acquired by timestamp acquisition section 1148 as an initial value . this counter 1146 outputs its count value to comparison / output section 1144 . comparison / output section 1144 compares the counter value of counter 1146 with the timestamp of the timestamped transport packet read by the read section 113 . when the compared count value and timestamp agree with each other , comparison / output section 1144 outputs the timestamped transport packet to timestamp deletion section 1142 . timestamp deletion section 1142 deletes ( removes ) the timestamp from the timestamped transport packet fed from comparison / output section 1144 and outputs the transport packet , which is now without the timestamp , to selector 104 or ieee 1394 interface section 115 . the structure of data handled in the digital broadcast receiver will now be described with reference to fig5 . in the digital broadcast receiver , the mpeg2 - ts to be input from tuner decoding sections 101 and 102 to separation / extraction sections 105 and 106 via selectors 103 and 104 is as indicated in fig5 a . a large number of transport packets having a predetermined number of bytes ( e . g ., 188 bytes ) are multiplexed in the mpeg2 - ts for use in digital broadcasting . each transport packet comprises a transport header ( hereinafter referred to as the ts header ) and a payload . in other words , the mpeg2 - ts includes a series of transport packets that correspond to digital video source and other video signals . the mpeg2 - ts makes it possible to multiplex and transmit a plurality of data including video and audio data . the ts header is provided with a field for storing a pid ( packet identification ) that identifies the payload in a transport packet . when a digital signal is to be played back , payloads having the same pid are first combined to extract desired data and play the extracted data . for example , when payloads having the same pid are combined with each other , a pes packet is obtained . particular information ( not shown ) is attached to the mpeg2 - ts to ensure that video and audio are played back with the timing predefined by a broadcast station or other broadcast source . the particular information includes a program time standard reference value that is named “ pcr ,” time management information for playback that is named “ pts ,” and time management information for decoding that is named “ dts .” the pcr is used to set the broadcast station &# 39 ; s standard time and effect calibration . it is embedded in the mpeg2 - ts for transmission . the pts is the information for indicating the playback timing . the dts is the information for indicating the decoding timing . the pts and dts are embedded in a pes header and transmitted . in the mpeg2 - ts described above , the transport packets for broadcast program ( channel ) a and the transport packets for broadcast program ( channel ) b are alternately arranged . when a separation / extraction section 105 , 106 into which the mpeg2 - ts is input selects a transport packet for broadcast program ( channel ) a and outputs it to the timestamp addition section 110 , the data structure is as indicated in fig5 b . in other words , when an mpeg2 - ts containing a plurality of transport packets is to be received , the transport packet of a certain broadcast program ( channel ) a is first received . the transport packet of the next broadcast program ( channel ) a is received after a packet interval ( that is , the length of unoccupied time ) for the transport packet of broadcast program ( channel ) b , which is removed without being extracted . any timestamp may be attached to the transport packet of this broadcast program ( channel ) a as far as it represents the information that indicates the packet interval for the transport packet of program ( channel ) a . for example , it may represent the time at which the timestamp addition section 110 received the transport packet of broadcast program ( channel ) a or the time difference between the instant at which the transport packet of broadcast program ( channel ) a ( or the transport packet of an earlier received , predetermined broadcast program ( channel ) a ) was received and the instant at which the timestamp addition section 110 received the transport packet of the next broadcast program ( channel ) a . fig5 c shows the data structure within the recording medium 112 that prevails when individual transport packets in a stream shown in fig5 c are timestamped and stored on the recording medium 112 . in other words , when the recording medium 112 stores a plurality of timestamped transport packets , there is no more physical interval between a certain timestamped transport packet and the next timestamped transport packet . the interval can be identified from the information indicated by the timestamp attached to a timestamped transport packet when the timestamp comparison / output section 114 reads a timestamped transport packet via the read section 113 . as is obvious from fig5 a to 5c , the present embodiment adds a timestamp , which has a predetermined data length , to a transport packet shown in fig5 b . as a result , the timestamped transport packet is larger in data size than the transport packet without a timestamp . however , it is not always necessary to add a timestamp to each transport packet . the timestamp may be provided in any manner as far as it defines a transport packet ( e . g ., a special timestamp may be embedded in a predefined field or any unoccupied field of a transport packet ). the digital broadcast receiver , which incorporates the recording / output apparatus described above , has a plurality of tuner decoding sections . therefore , the digital broadcast receiver is capable of simultaneously recording two channels ( broadcast programs ). in such an instance , the clock reproduction section 107 can generate a clock in accordance with a pcr that is multiplexed in an mpeg2 - ts for either of the digital broadcasts received by the plurality of tuner decoding sections . consequently , it is possible to reproduce a highly accurate receiver system clock that is synchronized ( for frequency / phase matching ) with the system clock of a broadcast station &# 39 ; s encoding / multiplexing section . since the reproduced system clock is used when the timestamp addition section 110 performs a process for recording and the timestamp comparison / output section 114 performs a process for playback , the packet intervals prevailing at the time of recording can be accurately reproduced at the time of playback . further , the reproduced system clock is also used when the decoding sections perform a decoding process . in other words , when either of the plurality of tuner decoding sections receives a digital broadcast in a situation where a plurality of processes are to be performed for recording , playback , or decoding , a highly accurate receiver system clock can be reproduced . with the reproduced system clock , it is possible to perform a plurality of recording , playback , or decoding processes . even if all digital broadcasts are halted so that no such broadcasts can be received , a clock can be generated in accordance with a clock control value prevailing at the time of digital broadcast reception that is recorded / stored in the clock control section 1072 . when the operation described above is performed , it is possible to generate a clock whose frequency is infinitely close to that of the system clock of a broadcast station &# 39 ; s encoding / multiplexing section , that is , a clock that meets the system clock accuracy requirements of the mpeg standard . this makes it possible to properly perform a plurality of recording / playback processes in relation to the recording / output apparatus or a plurality of decoding processes in the decoding sections 108 , 109 . when the present embodiment is described with reference to fig1 , it is assumed that the recording medium 112 is built in the digital broadcast receiver . however , an alternative is to use a removable recording medium that complies with the ivdr ( information versatile disc for removable usage ) standard . | 7 |
referring first to fig1 there is . shown an electronic watermark data insertion system to which the present invention is applied . the electronic watermark dacha insertion system shown includes a dct calculator 103 for extracting blocks 102 of 8 × 8 pixels from within a current image 101 which makes an object of insertion of electronic watermark data and performing dct ( discrete cosine transform ) calculation for the blocks 102 , a quantizer 104 for quantizing data outputted from the dct calculator 103 , a quantization table 105 for being referred to when the quantizer 104 performs quantization , an electronic watermark data insertion element 107 for inserting electronic watermark data 106 into data after quantization , and an encoder 113 for encoding data outputted from the electronic watermark data insertion element 107 to produce mpeg data 114 in which the electronic watermark data 106 are inserted and outputting the mpeg data 114 . the electronic watermark data insertion element 107 includes a partial average calculator 108 for calculating a partial average of three neighboring points of data outputted from th quantizer 104 in accordance with avg ( f ( i ))=(| f ( i − i )|+| f ( i )|+| f ( i + 1 )|)/ 3 , a multiplier 110 for multiplying outputs of the electronic watermark data 106 and the partial average calculator 108 for individual factors , another multiplier 111 for multiplying each factor of an output of the multiplier 110 by a constant 109 which is used to vary the size of the electronic watermark data to be inserted , and an adder 112 for adding an output of the multiplier 111 and the output of the quantizer 104 for individual factors . the electronic watermark data insertion element 107 performs calculation defined by the following expression ; where f ( i ) is the data outputted from the quantizer 104 , avg ( f ( i )) is the data outputted from the partial average calculator 108 , w ( i ) is the electronic watermark data 106 , the constant is the constant 109 , and i is the number of each factor after zigzag scanning of a block of 8 × 8 pixels . referring row to fig2 there is shown an electronic watermark data detection system to which the present invention is applied . the electronic watermark data detection system detects electronic watermark data inserted in an image by the electronic watermark data insertion system of fig1 described above . the electronic watermark data detection system includes a decoder 202 for decoding mpeg data 201 which make an object of detection of electronic watermark data , a dequantizer 203 for dequantizing data outputted from the decoder 202 , an inverse dct calculator 204 for performing inverse dct calculation for data outputted from the dequantizer 203 to obtain image data 205 and outputting the image data 205 , an electronic watermark data extractor 206 for extracting , from among data outputted from the decoder 202 , those data which are supposed to be electronic watermark data , an adder 209 for adding data in units of a block of 8 × 8 pixels outputted from the electronic watermark data extractor 206 for individual factors over one screen , and an inner product calculator 210 for calculating inner products of electronic watermark data 211 to be detected and data outputted from the adder 209 to obtain a statistical similarity 212 and outputting the statistical similarity 212 . the electronic watermark data extractor 206 includes a partial average calculator 207 for calculating a partial average of three neighboring points of data in units of a block of 8 × 8 pixels outputted from the decoder 202 in accordance with avg ( f ( i ))=(| f ( i − 1 )|+| f ( i )|+| f ( i + 1 )|)/ 3 , and a divider 208 for dividing data f ( i ) outputted from the decoder 202 by a partial average avg ( f ( i )) outputted from the partial average calculator 207 . the electronic watermark data extractor 208 performs calculation defined by the following expression ; where f ( i ) is the data outputted from the decoder 202 , avg ( f ( i )) is the partial average outputted from the partial average calculator 207 , w ( i ) is the data which are supposed to include electronic watermark data outputted from the electronic watermark data extractor 206 , and i is the number of each factor of a block of 8 × 8 pixels . in the following , operation for insertion and detection of electronic watermark data of the electronic watermark data insertion and detection systems described above with reference to fig1 and 2 is described in detail with reference to fig1 and 2 . a current image 101 is extracted for each block of 8 × 8 pixels by ordinary mpeg compression processing , and the dct calculator 103 performs dct calculation for the thus extracted data . data of frequency components obtained by the dct calculation of the dct calculator 103 are quantized with reference to the quantization table 105 by the quantizer 104 . the electronic watermark data insertion element 107 embeds electronic watermark data 106 into the data outputted from the quantizer 104 . in this instance , the electronic watermark data insertion element 107 performs processing equivalent to calculation of the following expression ; where i is the number of a factor of a frequency component of the block of 8 × 8 pixels , w ( i ) is the value of each factor of the electronic watermark data 106 , the constant is the constant 109 , f ( i ) is each of the factors of the 8 × 8 pixel block , avg ( f ( i )) is the average of absolute values of three neighboring factors , that is , (| f ( i − 1 )|+| f ( i )|+| f ( i + 1 )|)/ 3 , and f ( i ) is the new frequency component in which the electronic watermark data 106 are inserted . the encoder 113 encodes the data f ( i ) outputted from the electronic watermark data insertion element 107 by mpeg processing to produce mpeg data 114 in which the electronic watermark data 106 are embedded , first , mpeg data 201 which make an object of detection is subject to mpeg decoding by the decoder 202 . the data decoded by the decoder 202 are dequantized by ordinary mpeg decoding processing by the dequantizer 203 and inverse dct calculated by the inverse dct calculator 204 to produce reproduction image data 205 . the electronic watermark data extractor 206 extracts the data decoded by the decoder 202 , performs calculation of f ( i )/ avg ( f ( i )) and extracts those data which are supposed to be embedded electronic watermark data . here , f ( i ) is the frequency component of a decoded block of 8 × 8 pixels , and avg ( f ( i )) is the partial average ((| f ( i − 1 )|+| f ( i )|+| f ( i + 1 )|)/ 3 . the adder 209 calculates a sum total of the extracted data in units of 8 × 8 pixels outputted from the electronic watermark data extractor 206 for individual factors over one screen . after the sum totals of the extracted data of the one screen are calculated . the inner product calculator 210 calculates inner products of the sum totals and electronic watermark data 211 to be detected to produce a statistical similarity 212 and outputs the statistical similarity 212 . if the statistical similarity 212 is higher than a particular fixed value , then it is discriminated that electronic watermark data equivalent to the electronic watermark data 211 are embedded in the mpeg data 201 . in this instance , if the electronic watermark data 211 represent inhibition of duplication , then the reproduction apparatus in which the electronic watermark data detection system is incorporated can take such a countermeasure as to inhibit duplication of the image data 205 produced therein , referring now to fig3 there is shown another electronic watermark data insertion system to which the present invention is applied . the electronic watermark date insertion system includes a dct calculator 303 extracting blocks 302 of 8 × 8 pixels from within a current image 301 which makes an object of insertion of electronic watermark data and performing dct calculation for the blocks 302 , an electronic watermark data insertion element 305 for inserting electronic watermark data 304 into data for the dct transform has been performed , a quantizer 311 for quantizing data outputted from the electronic watermark data insertion element 305 , a quantization table 312 for being referred to when the quantizer 104 performs quantization and when the electronic watermark data insertion element 305 calculates a partial average , and an encoder 313 for encoding data outputted from the quantizer 311 and outputting mpeg data 314 in which the electronic watermark data 304 are embedded . the electronic watermark data insertion element 305 includes a partial average calculator 307 for calculating a partial average of data outputted from the dct calculator 303 with reference to the quantization table 312 , a multiplier 308 for multiplying the output of the partial average calculator 307 by the electronic watermark data 304 for individual factors , another multiplier 309 for multiplying the data outputted from the multiplier 308 by a constant a 306 which is used to vary the size of the electronic watermark data to be inserted , and an adder 310 for adding the data outputted from the dct calculator 303 and the data outputted from the multiplier 309 for individual factors . the electronic watermark data insertion element 305 thus performs processing equivalent to calculation of the following expression ; where f ( i ) is the data outputted from the dct calculator 303 , avg ( f ( i )) is the data outputted from the partial average calculator 307 , w ( i ) is the electronic watermark data 304 , the constant is the constant α 306 , and i is the number of a factor after the data outputted from the dct calculator 303 are zigzag scanned . here , the partial average calculator 307 in the electronic watermark data insertion element 205 performs , in order to calculate a partial average avg ( f ( i )) of three neighboring points of the data outputted from the dct calculator 303 , processing equivalent to calculation of the following expressions : v ( i − 1 )=| integral part of ( f ( i − 1 )/ q ( i − 1 ))× q ( i − 1 )| v ( i )=| integral part of ( f ( i )/ q ( i ))× q ( i )| v ( i + 1 )=| integral part of ( f ( i + 1 )/ q ( i + 1 ))× q ( i + 1 )| avg ( f ( i ))=( v ( i − 1 )+ v ( i )+ v ( i + 1 ))/ 3 referring now to fig4 there is shown another electronic watermark data detection system to which the present invention is applied . the electronic watermark data detection system detects electronic watermark data inserted by the electronic watermark data insertion system described above with reference to fig3 . to this end , it includes a decoder 402 for decoding mpeg data 401 which make an object of detection of electronic watermark data , a dequantizer 403 for dequantizing data outputted from the decoder 402 , an inverse dct calculator 404 for performing inverse dct calculation for data outputted from the dequantizer 403 to obtain image data 405 and outputting the image data 405 , an electronic watermark data extractor 406 for extracting , from among the data outputted froze the dequantizer 403 , those data which are supposed to be electronic watermark data and outputting the extracted data , an adder 409 for adding data in units of an 8 × 8 pixel block outputted from the electronic watermark data extractor 406 for individual factors over one screen , and an inner product calculator 410 for calculating inner products of data outputted from the adder 409 and electronic watermark data 411 to be detected to obtain a statistical similarity 412 and outputting the statistical similarity 412 . the electronic watermark data extractor 406 includes a partial average calculator 407 for calculating a partial average of three neighboring points of data in units of 8 × 8 pixel block outputted from the dequantizer 403 in accordance with avg ( f ( i ))=(| f ( i − 1 )|+| f ( i )|+| f ( i + 1 )|)/ 3 , and a divider 408 for dividing the data f ( i ) utputted from the dequantizer 403 by the partial average avg ( f ( i )) outputted from the partial average calculator 407 . here , f ( i ) is the frequency component of an 8 × 8 pixel block outputted from the dequantizer 403 , and i is the number of each factor after zigzag scanning of the 8 × 8 pixel block . the electronic watermark data extractor 406 performs calculation in accordance with the following expression : where f ( i ) is the data outputted from the inverse dct calculator 404 , avg ( f ( i )) is the partial average outputted from the partial average calculator 407 , and w ( i ) is the data outputted from the electronic watermark data extractor 406 and supposed to include electronic watermark data . in the following , operation for insertion and detection of electronic watermark data of the electronic watermark data insertion and detection systems described above with reference to fig3 and 4 is described in detail with reference to fig3 and 4 . a current image 301 is extracted for individual blocks 302 of 8 × 8 pixels by ordinary mpeg compression processing , and the dct calculator 303 performs dct calculation for the thus extracted data . the electronic watermark data insertion element 305 embeds electronic watermark data 304 into the data of frequency components obtained by the dct transform . in this instance , the electronic watermark data insertion element 305 performs processing equivalent to calculation of the following expression where i is the factor number after zigzag scanning of a block of 8 × 8 pixels . f ( i ) is the value of each coefficient obtained by the dct transform , w ( i ) is the value of each factor of the electronic watermark data 304 , and avg ( f ( i )) is the average of absolute values of three neighboring points of each factor . here , avg ( f ( i )) is calculated in accordance with the following expressions : v ( i − 1 )=| integral part of ( f ( i − 1 )/ q ( i − 1 ))× q ( i − 1 ) v ( i )=| integral part of ( f ( i )/ q ( i ))× q ( i )| v ( i + 1 )=| integral part of ( f ( i + 1 )/ q ( i + 1 ))× q ( i + 1 )| avg ( f ( i ))=( v ( i − 1 )+ v ( i )+ v ( i + 1 ))/ 3 the quantizer 311 refers to the quantization table 312 to perform quantization processing for the data outputted from the electronic watermark data insertion element 305 , and the encoder 313 performs encoding of the data outputted from the quantizer 311 to produce mpeg data 314 . first , mpeg data 401 which make an object of detection are subject to mpeg decoding processing by the decoder 402 . the data decoded by the decoder 402 are dequantized by ordinary mpeg decoding processing by the decoder 402 and inverse dct calculated by the inverse dct calculator 404 to produce image data 405 . the electronic watermark data extractor 406 extracts decoded data from the dequantizer 403 , performs calculation of f ( i )/ avg ( f ( i )) and extracts data supposed to be embedded electronic watermark data . here , f ( 1 ) is the value of each factor after zigzag scanning in units of an 8 × 8 pixel block outputted from the dequantizer 403 , and avg ( f ( i )) is the partial average (| f ( i − 1 )|+| f ( i )|+| f & lt ;( i + 1 )|)/ 3 . the adder 409 calculates sum totals of the extracted data in units of an 8 × 8 pixel block outputted from the electronic watermark data extractor 406 for individual factors over one screen . after the sum totals of the extracted data for one screen are calculated . the inner product calculator 410 calculates inner products of the sum totals and the electronic watermark data 411 to be detected to obtain a statistical similarity 412 and outputs the statistical similarity 412 . if the statistical similarity 412 is higher than a particular fixed value , then it is discriminated that electronic watermark data equivalent to the electronic watermark data 411 are embedded in the mpeg data 401 . in this instance , if the electronic watermark data 411 represent inhibition of duplication , then the reproduction apparatus in which the electronic watermark data detection system is incorporated can take such a countermeasure as to inhibit duplication of the image data 405 produced therein . having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit and scope of the invention as set forth herein . | 7 |
it is to be understood that the various embodiments of the present invention described herein may be utilized in various orientations , such as inclined , inverted , horizontal , vertical , etc ., and in various configurations , without departing from the principles of the present invention . the embodiments are described merely as examples of useful applications of the principles of the invention , which is not limited to any specific details of these embodiments . in the following description of the representative embodiments of the invention , directional terms , such as “ above ,” “ below ,” “ upper ,” “ lower ,” etc ., are used for convenience in referring to the accompanying drawings . in general , “ above ,” “ upper ,” “ upward ” and similar terms refer to a direction toward the earth &# 39 ; s surface along a wellbore , and “ below ,” “ lower ,” “ downward ” and similar terms refer to a direction away from the earth &# 39 ; s surface along the wellbore . fig1 is a schematic view of a well system including an embodiment of the invention positioned in a subterranean wellbore . a well system 10 is depicted having a wellbore 12 extending through a subterranean formation 14 , shown having casing 16 . the invention can be used in cased or uncased wells , vertical , deviated or horizontal wells , and for on - shore or off - shore drilling . a tubing string 18 is shown having a plurality of tubing sections 20 , a settable downhole tool 30 , a downhole force generator ( dfg ) assembly 40 , and a force multiplier assembly 50 . a mechanical linkage assembly 60 between the dfg and the downhole tool is provided for transferring the power generated by the dfg into longitudinal or rotary movement , such via a shaft , piston , sleeve , etc . the dfg assembly preferably includes a processor to operate the tool , measure environmental and tool parameters , etc . the settable downhole tools operable by dfg units are not described herein and are well known in the art . for ease of discussion , and by way of example , settable downhole tools such as settable tool 30 , shown as a packer , may be utilized in sealing and anchoring the tubing string at a downhole location . the packer has sealing elements 32 which may be set , along with slips , anchors , etc ., as is known in the art . fig2 is a cross - sectional schematic view of an exemplary booster - based , force - balanced setting tool assembly 100 according to an aspect of the invention . fig3 is a cross - sectional schematic view of an exemplary booster - based , force - balanced setting tool assembly according to fig2 in an actuated or set position . the figures are discussed in conjunction . the setting assembly 100 can be used in conjunction with any settable tool or tool requiring a mechanical movement in a downhole environment . the movement most frequently used is a linear axial stroke , in either direction . the embodiment of the setting assembly shown provides an axially upward movement of a selected stroke length . as those of skill in the art will recognize , other embodiments can provide a downward setting stroke . additionally , the setting assembly can be used to provide other types of mechanical motion , such as rotational , etc ., with appropriate mechanical parts to translate motion , as will be recognized by those of skill in the art . the embodiment is discussed in terms of a setting tool for use in linear actuation of a downhole tool , however , it is understood that the invention disclosed herein can be used in other types of tool assemblies and for providing non - axial motive force . the setting tool assembly 100 has an upper connector subassembly 102 , shown configured for connection at threads 104 to a sucker rod ( not shown ) or similar . it is understood that the upper connector can be selected for connection to a tool string , wireline , coiled tubing , etc . the upper connector 102 has lower threads at 110 which mate with the housing 108 of the control assembly . the control assembly 106 has a housing 108 , preferably a tubular body , connected to the upper connector sub 102 at threads 110 and connected at threads 112 to connector subassembly 130 . the control assembly 106 houses an electronic control module 114 having , in a preferred embodiment , a power source , such as batteries , an electric - powered timer or timing device , and indicators 118 for start - up and timer set values . the indicators can be led or other indicators as known in the art . the timer and battery packs are not discussed in detail and are known in the art . an electrical connector 116 is preferably provided for e - line start . it is also possible to provide electrical power via power line from the surface for signaling initiation , powering the initiator or actuator , etc . further disclosure regarding timers , batteries , etc ., can be found in the references incorporated herein . a hermetic connector 120 is positioned between the control module 114 and connector sub 130 to provide a hermetically sealed section for housing the control module . a connector subassembly 130 has a connector body 132 with a bore 134 defined therein and extending axially therethrough . the bore 134 houses communication lines , such as electrical wiring , necessary for transmitting a signal from the control module to the actuator 154 . the connector sub attaches to housing 108 at its upper end and to housing 142 at its lower end . a booster assembly 140 has a housing 142 attached at threads 144 to the connector sub 130 and at threads 146 to connector sub 180 . the booster assembly 140 defines a booster chamber 148 which is pre - charged with a pressurized fluid , preferably an inert gas to an actuation pressure . a charge port 151 and charging valve 150 are provided , with appropriate fluid passageways to the chamber , for supplying the pressurized gas to the chamber . in the embodiment shown , the charging valve and port are positioned in connector sub 180 , although they can be positioned in connector sub 130 or as part of the booster assembly 140 . positioned in the booster assembly is an initiator 154 , actuator retainer 152 , rupture disc 160 , and pin actuator 158 . the initiator 154 is electrically connected via wire extending from the actuator retainer 152 , through a conduit or similar which is in threaded connection to the passageway 134 of connector assembly 130 , and the control electronic control module 114 . the initiator is triggered by a small electrical charge . the actuator retainer 152 houses the initiator 154 . the rupture disc retainer and actuator guide 156 is mounted to the tool assembly , for example , to the connector assembly 180 , as shown , via threaded connection or similar . alternately , the retainer can be mounted to the housing , etc . the initiator 154 is positioned adjacent or proximate a rupture disc 160 that initially blocks fluid flow from the pressurized chamber . small , pyrotechnic initiators 154 are available from commercial vendors known in the art , such as sdi , inc . the pyrotechnic initiator utilizes a small amount of pyrotechnic material , triggerable by a low electrical charge , to drive a thruster pin 158 longitudinally into and rupturing the rupture disc . the pin is preferably hollow with a relief port on the stem such that if the disc fails to rupture after the pin has pushed through the disc , a fluid path is available through the pin . note that the pyrotechnic initiator does not provide the motive force for movement of the setting rod . the tool assembly is not a pyrotechnic setting tool . the initiator only provides motive force to move the pin actuator to rupture a rupture disc . the motive force for setting the tool is provided by the release of pressurized gas in the booster chamber . because such a low amount of force is required of the initiator , and such a small amount of chemical or pyrotechnic required to provide the force , the preferred pyrotechnic initiator is classified by dot and batf as a non - explosive for purposes of transportation and shipping . in addition to the preferred pyrotechnic initiator , other initiators can be used , preferably low - powered and classified as non - explosive . for example , such initiators include electrical , chemical , thermal , and other initiators . the initiators can open the pressurized chamber by opening , melting , dissolving , burning , etc ., a fluid barrier . further , the initiator can be used to power or actuate a variety of available actuators , such as a thruster pin , a check - valve , other valves , etc ., to open the pressurized chamber to fluid flow . power to trigger the initiator is provided from the battery pack or power source in the electronic control module 114 of the control assembly 106 . since the preferred initiator is small and requires low power to initiate , it is ideal for low - powered battery activation . with a small power requirement , the timer can be small and low power and included within the timer module ( e . g ., a single cfx battery from contour energy ; rated to 160 c and higher ). the timer module can be small and used for the various tools for the different setting tools . the small timer module can thermally insulated , for example , for use in higher temperature operations within the larger housings of the bigger setting tools . the timer module is preferably switch - selectable and can include an electrical start port for either e - line or a pressure / temperature switch . additional features could be added to the timer ( pressure , temperature , motion , etc . ), however , this would result in a larger electronics and battery assembly . the rupture disc 160 can be selected from those known in the art and alternative discs and rupture assemblies will be apparent to those of skill in the art . the disc can be made of ceramic , metal , plastic , etc . the disc can be ruptured , punctured , dissolved , melted , etc ., depending on the selected initiator and actuator . the preferred assembly utilizes a rupture disc which is physically punctured or broken by the extendable pin of the initiator . the rupture disc 160 initially blocks fluid flow from pressurized chamber 148 into passageway 184 of connector assembly 180 . in a preferred embodiment , the rupture disc is mounted to the housing , connector assembly or retainer 156 . the disc assembly is positioned in a bore 157 designed for that purpose in the connector assembly 180 . seals 161 are provided as necessary to facilitate assembly and fluid isolation . the retainer 156 provides and maintains positioning of the disc . upon rupture , fluid communication is provided between the pressurized chamber 148 and the passageway 184 through connector assembly 180 . the initiator assembly , in a preferred embodiment , is a thruster assembly for rupturing discs . actuator assemblies are commercially used by halliburton energy services , inc ., and disclosure regarding their structure and use can be found in the following , which are each hereby incorporated by reference for all purposes : u . s . pat . no . 8 , 235103 , to wright , issued aug . 7 , 2012 ; u . s . patent application publication no . 2011 / 0174504 , to wright , filed jan . 15 , 2010 ; and u . s . patent application publication no . 2011 / 0174484 , to wright , filed dec . 11 , 2010 ; u . s . patent publication no . 2011 / 0265987 , to wright , filed apr . 28 , 2010 ; and u . s . patent application serial no . pct / us12 / 53448 filed aug . 31 , 2012 , to fripp , et al . additional actuator assemblies are known in the art and will be understood by persons of skill in the art . additional actuator assemblies are known in the art and will be understood by persons of skill in the art . key components are the rupture disc , an electrical power source , and an electrically - initiated method of breaching the barrier disc . in the preferred embodiment , the electrical power source is a battery , and a thruster assembly is used to puncture the disc . connector assembly 180 is attached to a vent chamber assembly 190 , preferably by threaded connection to a vent chamber housing 192 . the vent chamber 194 defined within the vent chamber assembly contains fluid at hydrostatic pressure as it is open to fluid flow between the chamber and the exterior of the tool ( the wellbore ). one or more ports 196 provide fluid communication between chamber and exterior . a thick - walled tube 198 extends from the passageway 184 to a force - balance piston rod 216 , providing communication of the released pressurized gas from the pressurized chamber 148 to the piston passageway 218 . as piston rod 216 moves upward into the vent chamber , pressure is equalized in the vent chamber 194 as fluid flows out of the chamber through ports 196 . note that the setting section is force balanced by hydrostatic pressure acting on the power rod 230 from below , so the setting action is independent of hydrostatic pressure . a flow restrictor 164 is preferably positioned across the passageway 182 of the connector assembly 180 . the speed of setting is controlled by the flow restrictor . the flow restrictor can be positioned elsewhere along the flow path from the pressurized chamber to the piston head . flow restrictors and use thereof to control setting speed is known in the art . the flow restrictor can be a flow nozzle , orifice , plate , inflow control device , autonomonous inflow control device , tortuous path etc , as known in the art . a connector assembly 200 provides flow connection between the vent chamber assembly 190 and the force - balance piston assembly 210 . the connector assembly body 202 is threadedly attached to the vent chamber housing 192 and to a piston housing 212 . an axial passageway 204 is defined through the connector body , the piston rod 216 axially slidable therein . seals 206 are provided for sealing engagement between passageway wall and piston . further , rod - wipes 208 , or similar , are mounted to wipe the exterior surface of the piston as it moves through the passageway 204 . a piston assembly 210 is attached to the connector assembly 200 at housing 212 . the housing defines a piston chamber 214 which is divided into two spaces by piston head 220 . the chamber 214 is preferably at atmospheric pressure initially . piston rod 216 defines an axial passageway 218 therein providing fluid communication from the tube 198 to a passageway 222 through the piston head 220 . the piston rod 216 is mounted to the piston head 220 . a power rod 230 is attached to the lower end of the piston head 220 . appropriate porting 224 provides fluid communication from the passageway 218 of the piston rod to the chamber 214 below the piston head 220 . when pressurized gas is released from pressurized chamber 148 , the gas flows through the various passageways and tubes , through passageway 218 of the piston rod , through passageway 222 of the piston head 220 , and through porting 224 to the chamber 214 below the piston head . the pressurized gas forces the piston head upward . upward movement of the piston head causes piston rod 216 to slide upwardly through the connector assembly 200 and into vent chamber 194 . movement of the piston head also pulls power rod 230 upwardly through a bore 232 defined in the lower end of the piston housing sub 210 . appropriate seals 234 and wipers 236 can be employed . movement of the power rod , axially , provides the necessary motion to set ( or un - set ) the settable tool positioned below the setting assembly . the setting force is supplied by the pre - charged fluid in the booster chamber . carrying the setting force with a gas pre - charge means a large motor and battery arrangement , typical in many downhole force generators , is not required . the entire assembly is compact , reducing the overall length of the tool assembly . this can be important in negotiating long , deviated or horizontal wellbores . preferably , the length of the setting tool assembly is on the order of six feet for every eight inches of stroke . greater setting force can be provided by utilizing a force - multiplying piston having varying surface areas on either side of the piston head , as is known in the art . further disclosure relating to force - multiplier piston assemblies can be found , for example , in u . s . pat . pub . no . 2006 / 0076144 to shammai ; u . s . pat . pub . no . 2006 / 0022013 to gaudron ; u . s . pat . pub . no . 2003 / 0075339 to gano ; u . s . pat . no . 8 , 006 , 952 to wygnanski ; u . s . pat . no . 6 , 966 , 370 to cook ; u . s . pat . no . 7 , 000 , 705 to buyers ; each of which is incorporated herein by reference for all purposes . a person skilled in the art would , upon a careful consideration of the above description of representative embodiments of the invention , readily appreciate that many modifications , additions , substitutions , deletions , and other changes may be made to the specific embodiments , and such changes are contemplated by the principles of the present invention . accordingly , the foregoing detailed description is to be clearly understood as being given by way of illustration and example only , the spirit and scope of the present invention being limited solely by the appended claims and their equivalents . | 4 |
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for purposes of clarity , many other elements which are conventional in this art . those of ordinary skill in the art will recognize that other elements are desirable for implementing the present invention . however , because such elements are well known in the art , and because they do not facilitate a better understanding of the present invention , a discussion of such elements is not provided herein . the present invention will now be described in detail on the basis of exemplary embodiments . fig1 shows a block circuit diagram of an ir receiving unit in accordance with a first embodiment . the ir receiving unit has an fm demodulator 40 , a level detector 30 , a first low - pass 50 , a second low - pass 60 , a first high - pass 70 , a first rms detector 80 , a second high - pass 90 , a rectifier 100 , a third low - pass 110 , a third high - pass 120 , a second rms detector 130 , a decision logic unit 20 and a memory 10 . the receiver intermediate frequency is received both by the fm demodulator 40 and also the level detector 30 . the level detector 30 determines the signal strength ss or the rssi ( radio signal strength indicator ) and outputs that signal strength ss to the decision logic unit 20 . the output signal of the fm demodulator 40 is passed both to the first low - pass 50 and also to the second high - pass 90 . the limit frequency of the first low - pass represents the frequency f 1 . the output of the first low - pass 50 represents a dc voltage component of the carrier frequency dct . that signal is passed to the second low - pass 60 and the second high - pass 70 . the output signal of the second low - pass 60 represents a frequency mean value mwf . the limit frequency in that case is f 2 . the first high - pass 70 has a limit frequency of f 2 and the output signal of the high - pass 70 is passed to the first rms detector 80 . the output signal of the first rms detector 80 represents the variance of the frequency vf . the output signal of the second high - pass 90 with a limit frequency of at least 20 hz ( that is to say the lower limit of the audible range ) is passed to the rectifier 100 . the output signal of the rectifier 100 is passed to the third low - pass 110 and the third high - pass 120 . the output signal of the third low - pass 110 represents a mean value of the audio amplitude mwa . the output signal of the third high - pass 120 is passed to the second rms detector 130 . the output signal of the second rms detector 130 represents the variance of the audio amplitude va or dynamics . the mean value of the frequency mwf , the variants of the frequency vf , the mean value of the audio amplitude mwa , the variance of the audio amplitude va and / or the signal strength ss can be fed to the decision logic unit 20 . the decision logic unit 20 is also connected to a memory 10 . the decision logic unit 20 outputs a squelch signal rs as the output signal . the signal strength ss is thus derived directly from the receiver intermediate frequency signal if . the mean value of the rectified audio amplitude mwa represents a measurement of the mean volume of the reception signal . the variance of the dc voltage component of the demodulator va concerns the time fluctuations of the carrier frequency around the mean value and can thus give an indication of the stability of the received carrier frequency . the variance of the rectified audio amplitude is a measurement in respect of the time fluctuations in volume . the decision logic unit 20 checks whether the received signal strength ss is below or above a predetermined threshold . if the signal strength ss is below a predetermined threshold or if the carrier frequency fluctuates by a predetermined amount ( if the variance of the frequency is above a reference value ), then reception of an adequate signal is not possible . in such a case it can be assumed that the receiver is in the transition range of a plurality of transmitters or interference sources . if however the carrier frequency fluctuates within a predetermined amount and the variance is thus below a threshold value , it can be assumed that only a carrier frequency is being received . it can further be assumed that the received carrier frequency has a sufficient signal - to - noise ratio at the input of the receiver . in the case where there is a carrier frequency having adequate stability then the frequency can be determined by using the mean value of the frequency mwf . that frequency can be stored in the memory 10 and later used for tuning or re - establishing the received carrier frequency . if the audio amplitude is used for evaluation and the mean value of the audio amplitude mwa is above a predetermined threshold value then there can be an interference and the amplitude of the corresponding frequency deviation can be outside the specification . if the mean value of the amplitude mwa is below a predetermined threshold closer consideration may be necessary . if the variance of the audio amplitude is below a threshold then there can be little dynamics , that is to say the signal is not modulated or is little modulated . as an alternative thereto there can be a constant envelope curve . in that case however it is still necessary to determine whether there is a meaningful signal such as for example music or speech . if however the variance of the audio amplitude is greater than a predetermined threshold then there is sufficient dynamics there , that is to say there is a high degree of probability that the signal represents a meaningful signal such as for example music or speech . if the variance of the audio amplitude va is above a predetermined threshold then the reception signal is sufficiently modulated . if the frequency is stable and the frequency is within the admissible tolerances and the audio amplitude is within an admissible range and the dynamics are sufficiently high then a corresponding signal can be considered as meaningful and the corresponding carrier frequency can be stored in a memory so that the receiving unit can later fall back thereon . if the frequency is stable and the audio amplitude is within the admissible range and the carrier frequency is sufficiently close to the stored frequency then the received signal can also be selected . if a signal has been selected and the carrier frequency is slightly beside the stored carrier frequency then the stored frequency can be selected if the deviation takes place slowly in respect of time . when a signal has been selected or acknowledged as meaningful the squelch rs can then be enabled . in a further aspect of the present invention an ir receiving unit has a decision logic unit as described in the first embodiment . in that case however the decision logic unit does not serve exclusively to activate or deactivate a squelch but to determine whether there is a meaningful signal or not . based on the result , a part of the ir receiver can be controlled . for example a squelch can be controlled or a transmitter search procedure can be carried out . while this invention has been described in conjunction with the specific embodiments outlined above , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , the preferred embodiments of the invention as set forth above are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the inventions as defined in the following claims . | 7 |
referring to fig1 a starter assembly 10 is shown coupled to a flywheel 12 for starting engine 14 . starter assembly 10 has a pinion 18 extending from one end that is engaged to teeth on flywheel 12 which , in turn , is coupled to crankshaft 16 . when starter assembly 10 rotates , therefore , it rotates flywheel 12 and starts engine 14 . referring to fig2 and 3 , starter assembly 10 includes a mechanical diode 20 disposed within starter housing 22 between the starter motor ( not shown ) that is coupled to the leftmost end of shaft 23 and to starter pinion 18 . mechanical diode 20 couples torque generated by the starter motor to starter pinion 18 . mechanical diode 20 is configured as two substantially coaxial disks 24 , 26 having facing surfaces and a plurality of coupling plates 28 disposed therebetween . the coupling plates 28 transmit torque from disk 24 to disk 26 , and thence through starter pinion 18 to flywheel 12 to start engine 14 . disk 24 is fixed to the right end of shaft 23 and disk 26 is fixed to the left end of starter pinion 18 . needle bearings 27 support shaft 23 , and high speed bearings 30 support pinion 18 , keeping disks 24 and 26 in close coaxial alignment . a seal 32 is provided in housing 22 to seal against shaft 23 , thereby containing an oil bath ( not shown ) in chamber 33 that surrounds mechanical diode 20 . mechanical diode 20 runs in this oil bath , which lubricates coupling plates 28 and provides a hydrodynamic film to be discussed below . as best seen in fig5 and 6 , a plurality of recesses 34 are provided in disk 24 to house coupling plates 28 when plates 28 are disengaged . a spring 36 is disposed in each recess such that it applies an outward force against its corresponding plate 28 tending to cause plate 28 to pivot from a disengaged position ( fig6 ) to an engaged position ( fig5 ). disk 26 has a plurality of slots 38 that are configured to receive one end of plates 28 when plates 28 are in an engaged position . when disk 24 and disk 26 are at rest -- the typical relationship when starter assembly 10 is engaged -- coupling plates 28 are impelled to pivot outwardly from disk 24 toward disk 26 by the action of their respective springs 36 . when the starter motor begins to rotate , disk 24 moves with respect to disk 26 in the direction indicated by the arrow at the base of disk 24 in fig5 . at least one coupling plate 28 , forced outwardly toward disk 26 will enter a slot 38 ( fig5 ) and will apply a force against disk 26 . this force , since it is applied away from the center of rotation of disk 26 , applies a torque to disk 26 and causes it to rotate in the same direction and at the same speed as disk 24 . once engine 14 starts , disk 26 , driven by flywheel 12 , speeds up rapidly to a velocity greater than that of disk 24 . disk 26 overtakes disk 24 and coupling member 28 is pushed back into its recess 34 . as engine 14 gains more speed and the operator deenergizes the starter motor , the relative velocity of disk 26 with respect to disk 24 increases dramatically . this difference in velocity causes a hydrodynamic film to build up between disk 24 and disk 26 that lifts coupling plates 28 away from the surface of disk 26 , thus substantially reducing friction between coupling plates 28 and the facing surface of disk 26 . the springs 36 , which act to pivot plates 28 toward contact with disk 26 , are selected such that they will not force plates 28 through this hydrodynamically created film . in effect , coupling plates 28 float on an oil film generated by the rotation of disk 26 and do not wear substantially against disk 26 when the engine is running . fig7 and 8 illustrate another arrangement of the starter assembly that incorporates a different drive train between starter motor 42 and flywheel 12 . in this arrangement , as well as the arrangement of fig1 - 5 a starter motor is coupled to a flywheel using a mechanical diode . in the arrangement of fig7 and 8 , however , an additional gear train is disposed between mechanical diode 20 and starter motor 42 to allow the starter to be offset from pinion 18 and , if desirable , to change the relative rotational velocities of starter motor 42 with respect to pinion 18 . in this arrangement , the shaft 23 extending from starter motor 42 is not fixed directly to disk 24 , but is coupled to a spur gear 44 . gear 44 , in turn , is rotationally coupled to spur gear 46 which is supported by and rotates about intermediate shaft 48 . gear 46 , is rotationally coupled to gear 50 which is coupled to disk 24 . disk 24 , in turn , engages and cooperates with coupling plates 28 and disk 26 in the manner described above with regard to fig1 - 5 . disk 26 in turn is rotationally coupled to flywheel 12 to start the engine as described above with regard to fig1 - 5 . engine 14 is coupled to flywheel 12 , but is not shown in this figure for convenience . fig9 - 11 illustrate another arrangement of the present invention in which starter motor 42 is coupled to a flywheel 52 through a spur gear 54 and coupling plates 28 disposed between spur gear 54 and flywheel 52 . as in the previous examples of mechanical diodes , the coupling plates are disposed in recesses in gear 54 and have outwardly extending ends that engage corresponding grooves in flywheel 52 . also similar to the previous examples , gear 54 and flywheel 52 are coaxial . unlike the two previous arrangements , however , the mechanical diode in fig9 - 11 , rather than being disposed adjacent to the flywheel , is disposed coaxially with the flywheel . flywheel 52 and gear 54 have respective facing surfaces 58 and 60 that , together with coupling plates 26 disposed between surfaces 56 and 60 , form a mechanical diode . as in the previous example , and for the same purposes , recesses 34 and slots 38 are provided in surfaces 60 and 58 , respectively , to receive coupling plates 28 and to allow coupling plates 28 to transmit torque from gear 54 to flywheel 52 . in this arrangement , starter motor 42 drives motor shaft 64 which is coupled to pinion gear 62 . pinion gear 62 , in turn is rotationally engaged to gear 54 and drives it . surface 60 , coupling members 28 and surface 58 cooperate in the same manner as the mechanical diodes of the preceding figures to transmit torque to flywheel 52 . fig1 - 13 illustrate another arrangement of a starter assembly 66 in which the starter motor 42 is disposed at substantially a right angle from pinion 18 . as in the previous examples , the starter motor is coupled to the flywheel through the mechanical diode 20 , discussed in detail above . bevel gear 68 is coupled to shaft 70 of starter motor 42 . bevel gear 68 is rotationally coupled to bevel gear 72 which is fixed to a first end of shaft 74 such that a substantially right angle is formed between the axes of rotation of bevel gears 68 and 72 . the other end of shaft 74 is fixed to spur gear 76 which is rotationally engaged to internal spur gear 78 . shaft 74 is rotationally supported at one end by bearing 80 and by bearing 82 . pinion 18 is rotationally supported by bearing 84 and internal spur gear 78 is rotationally supported by bearing 86 . as in the example of fig2 a cavity 88 is formed by starter housing 90 surrounding disks 22 and 24 and coupling plates 28 that contains a lubricant for the creation of a hydrodynamic film as discussed above . the starter assembly of fig1 - 13 can be used in place of the starter assembly illustrated in fig1 to start engine 14 . thus , it should be apparent that there has been provided in accordance with the present invention a method and apparatus for starting an engine that fully satisfies the objectives and advantages set forth above . although the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , it is intended to embrace all such alternatives , modifications and variations that fall within the spirit and broad scope of the appended claims . | 5 |
the techniques discussed in greater detail below use bidirectional signaling as a way to deal with skew in distributed clock signals . in one of its most straightforward implementations , the method of bidirectional signaling uses two identical transmission networks running side by side , excited from opposite ends with the same clock signal . at each coordinate along the two networks , an observer detects two delayed versions of the transmitted signal traveling in opposite directions . the average skew of the two delayed signals is , however , independent of the position where the signals are detected , i . e ., it is a constant value regardless of location . the constant average skew is the time taken by the two signal versions propagating in opposite directions to arrive at the point where they meet . in the case of uniform networks , this point is in the middle of the networks . as a consequence of this property of the average skew , any number of signals along the transmission network regenerated with the average skew will be automatically synchronized . this property also applies to non - uniform transmission networks . the principle is more fully described in connection with fig1 - 3 . fig1 shows a single optical waveguide of length l . a light pulse that is introduced into the left end of the waveguide will propagate down the waveguide . for this example , it is assumed that the waveguide has uniform properties and so the pulse will travel along the waveguide with a constant velocity . note that at time , t 1 , the pulse will have traveled distance x and at time , t l , it will have traveled a distance l , the full length of the waveguide . these times represent the skew of the optical clock signal . obviously , the skew increases the further that the optical pulse must travel along the optical waveguide . de - skewing the signals detected at x and l relative to each other would require a delay element precisely matched to ( l - x ). now assume that there are two optical waveguides 10 and 12 constructed parallel to each other , both having the same properties and length l , as illustrated in fig2 . as before , a light pulse 14 introduced into the left side of optical waveguide 10 will propagate down the waveguide . its progress down the waveguide is represented by line 16 , which shows position along the horizontal axis as a function of time along the vertical axis . if an identical light pulse 18 is introduced into the opposite end of optical waveguide 12 , it will propagate in the opposite direction . its progress is represented by line 20 . if it is assumed that optical waveguides 10 and 12 are identical and have uniform properties , pulse 14 and pulse 18 will arrive at the midpoints of their respective waveguides , i . e ., location l / 2 , at precisely the same time , namely , t 0 . thus , both optical signals will have a skew of t 0 relative to their origins . if a detector is located in each waveguide at position x , which is closer to the beginning of optical waveguide 10 than to its end , then the two detectors will see the optical pulses in their respective waveguides arriving at different times . one detector will see pulse 14 arrive at time , ti , and the other detector , which is also at the same location in the other waveguide , will see pulse 18 arrive at a later time , t 2 . it will be the case , however , that the average skew for these two optical pulses will be equal to t 0 , i . e ., ½ ( t 1 + t 2 )= t 0 . moreover , this holds true for any location along the length of the waveguides . that is , the average skew is independent of the location x at which the two detectors are positioned . in addition , the average skew is proportional to the length , l , of the optical waveguides . thus , by referencing t 0 , it becomes possible to achieve zero - skew clock distribution along the waveguide . this , of course , takes advantage of the fact that the clock signal is a periodic signal in which case the objective is to get the phases of all generated local clock signals ( i . e ., the clocks generated at various points along the optical waveguide for local circuitry ) to be aligned with each other . in this case , we assume that a pulse is introduced into the waveguide every 2t 0 seconds . thus , the times that are shown in fig2 are referenced to the start of each new pulse . in practice , the clock with the average skew is generated at t 0 seconds after each successive pulse is introduced into waveguide . the resulting local clock signals will occur at t 0 , 3t 0 , 5t 0 , 7t 0 , etc . fig3 further illustrates what has just been described by showing the detection times of the two light pulses as a function of location along the waveguides . at position x = 0 , one optical detector will see the first pulse immediately and the other optical detector in the other waveguide will see the second pulse at a time 2t 0 later . at position x = l / 4 , the detector in one waveguide will see the first pulse at time t 0 / 2 and the detector in the other waveguide will see the second pulse at 3t 0 / 2 . a short distance before the middle of the waveguide , e . g . at x = ½l − δ , the two pulses will be right next to each other in time . then a short distance later , namely , at the midpoint x = l / 2 , the two pulses be detected at the same time , namely t 0 . as one moves further down the length of the optical waveguides the same relationships exist between the detection of the two pulses except the order in which they are detected is reversed . if the transmission networks are optical networks , the system is referred to as a bidirectional optical signaling ( bos ) system ; and if the transmission networks are electrical networks , the system is referred to as a bidirectional electrical signaling ( bes ) system . both cases are generally referred we have bidirectional signaling systems or bss . the method described above can be further generalized into a simple but powerful principle of signaling with a constant common - mode skew component . the described method of skew elimination using bidirectional signaling uses a circuit with two inputs and which can extract the average arrival time ( average skew ) of two signals that were applied on the two inputs . typically , these signals are pairs of pulses , each pair consisting of an early pulse applied at one input and a late pulse applied at the other input . in the case of optical transmission , the early and late pulses are current signals , which are generated by optical detectors and which will typically be very short in duration . naturally , since the average arrival time between the early pulse and the late pulse is earlier than the arrival time of the late pulse , a system extracting this average time from a single pair of pulses would be non causal and therefore unrealizable . however , if trains of early and late pulses of the same period are transmitted , as is the case with clock signals , it is possible to design circuits to extract the average time between the early pulse train and the late pulse train . such a circuit will be called an average time extractor or ate . referring to fig4 , an embodiment of an ate 40 contains : ( a ) module 40 to generate two internal pulse trains from the early and late input pulses ; and ( b ) a module 44 which includes two identical variable delay elements connected in series . the first internal pulse train is called the reference pulse ( rp ) pulse train and the second internal pulse train is called the calibrated pulse ( cp ) pulse train . the rp pulses are generated such that their duty cycle is a measure of the skew between the early and late input pulse trains . ate 40 also has a feedback control system 50 , which automatically adjusts the total delay through the two delay elements until the cp pulses and the rp pulses have identical widths . when this condition is accomplished , the skew of the pulses at the output of the first variable delay element is the average time skew of the input early and late pulses . ate circuit 40 automatically generates a clock pulse at the average time t 0 . thus , if such circuits are located at different positions along the waveguide they will all generate local clock signals having the same skew , namely , t 0 . the details of the structure and operation of this particular embodiment of the ate are as follows . ate 40 includes two optical detectors 52 and 54 , each one for detecting the optical pulses in a corresponding different one of the two waveguides . it also includes two set - reset flip flops 46 and 48 , each with a set line ( s ), a reset line ( r ), and an output ( q ). the output signals of detectors 52 and 54 , namely , in 1 and in 2 , respectively , control the operation of s - r flip - flops 46 and 48 . detector signal in 1 , indicating the arrival of the optical pulse in the first optical waveguide , drives the s input of both flip - flops 46 and 48 ; and detector signal in 2 , indicating the arrival of the optical pulse in the second optical waveguide , drives the r input of flip - flop 46 . two identical variable delay elements 60 and 62 , each introducing a variable delay of τ , are connected in series between the r and s inputs of flip - flop 48 . thus , the pulses of the in 1 signal that set flip - flop 48 will reset it after a delay of 2τ as it comes out of the other side of the two delay elements . the output signal for the circuit , namely , the skew corrected clock signal ( out ), is taken from the point at which the two delay elements 60 and 62 are connected to each other . this output signal is a copy of he in 1 pulse delayed by τ . during operation , flip - flop 46 outputs a train of reference pulses ( rp ) and flip - flop 48 outputs a train of calibrated pulses ( cp ). both trains of pulses rp and cp have a period equal to the period of the clock signal sent over the optical waveguides . the duration of the pulses in the rp train of pulses is equal to the delay between the pulses of the in 1 signal and the subsequent pulses of the in 2 signal ; whereas the duration of the pulses of the cp train of pulses is equal to the delay introduced by delay elements 60 and 62 , namely , 2τ . the delay elements may be implemented in any of a number of different well - known ways . for example , they could be implemented by cmos inverters ( or “ current - starved inverters ”) in which a current is used to drive a capacitance . feedback control system 50 of ate 40 is implemented by an integrator 66 , which has a positive input line 68 that is driven by cp sequence from the output of flip - flop 48 , a negative input line 70 that is driven by rp sequence from the output of flip - flop 46 , and it has an output that controls the delay of the two variable delay elements 60 and 62 . when there is a positive signal on both input lines 68 and 70 , the output of integrator 66 remains constant ; when there is a positive signal on input line 68 and a zero signal on input line 70 , the output of integrator 66 increases linearly as a function of time ; and when there is a positive signal on input 70 and a zero signal on input line 68 , the output of integrator 66 decreases linearly as a function of time . a simple way to implement feedback control system 50 is by using a precision charge pump that adds and subtracts charge from a capacitor proportionally to the widths of the pulses on rp and cp , respectively . so , the delay introduced by the variable delay elements will be proportional to the output signal from integrator 66 . in essence , the circuit sets the delay 2τ so that it equals the amount of time that separates the pulses on the two optical waveguides . it works as follows . assume that the outputs of both flop - flops 46 and 48 are zero and the output of integrator 66 is also zero ( so the delay introduced by the variable delay elements is fixed at whatever value had been previously established ). upon receiving the first pulse of the in 1 signal , both flip - flops 46 and 48 change state , outputting high signals on their output lines . since the inputs to integrator 66 at that point will continue to be equal , the output signal from integrator 66 remains fixed at whatever value existed previously ( assume it is zero ). delay module will cause the pulse of the in 1 signal to arrive at the reset line of flip - flop 48 at a time that is 2τ later . if we assume that 2τ is less than the time between the two pulses on the two optical waveguides , the delayed in 1 pulse will cause flip - flop 48 to reset at a time 2τ after it was set and before the arrival of the next pulse of the in 2 signal . when output of flop - flop 48 is reset , the signal to the positive input line 68 of integrator 66 will drop to zero while the signal on negative input line 70 of integrator 66 will remain high . since the signal on the negative input line is still high , the output of integrator 66 will begin to decrease , thereby causing the magnitude of the delay 2τ to increase . eventually , the next pulse of the in 2 pulse train will arrive and reset flip - flop 46 , causing its output to also fall to zero . at that time , both inputs of integrator 66 will be zero thereby causing its output remain constant at whatever value was established before flip - flop 46 was reset . as long as the later pulse of the in 2 pulse train arrives at a time that is greater than 2τ after the earlier pulse of the in 1 pulse train , the circuit will operate during each cycle to increase the value of 2τ until 2τ equals the delay between the two pulses of the in 1 and in 2 pulse trains . when 2τ reaches that value , both flip - flops 46 and 48 will be reset at precisely the same time and the output of integrator 66 will remain constant at whatever value is required to keep 2τ equal to the delay between the two pulse trains . at that point , delay module 44 outputs a version of the in 1 signal delayed by an amount equal to τ , which is exactly one half of the distance between the pulses of the in 1 and in 2 signals ( i . e ., the average of the times at which the two pulses are detected ). if we assume that 2τ is greater than the time separating the earlier pulse of the in 1 signal and the later pulse of the in 2 signal , the circuit works to decrease the value of 2τ until it again precisely equals the time separating the two pulse trains . fig5 shows an implementation of the above - mentioned integrator 66 . it includes a tri - state charge pump ( tscp ) 90 that charges / discharges a capacitor 92 . charge pump 90 is made up of : an xor gate 94 ; two and gates 96 and 98 connected in series between the output lines of flip - flops 46 and 48 ; and two current sources , namely up current source 100 and down current source 102 , connected in series between a supply voltage line 104 and ground 106 . current sources 100 and 102 are connected together at another common node 110 to which capacitor 92 is also connected . the output line from flip - flop 48 , which carries the cp pulse train , is connected to one input of xor gate 94 , the output line of flip - flop 46 , which carries the rp pulse train , is connected to the other input of xor gate 94 , and the output of xor gate 94 drives a common node 108 . the output line of flip - flop 48 is also connected to one input of and gate 96 , the output line from flip - flop 46 is connected to one input of and gate 98 , and the other input of each and gate 96 and 98 is connected together at common node 108 . the output of and gate 96 controls current source 100 and the output of and gate 98 controls current source 102 . the current supplied to capacitor 92 is equal to the sum of the currents supplied by the two current sources 100 and 102 to common node 110 . when the input signal to current source 100 is high , current source 100 sources a current i 0 into common node 110 and when the input signal to current source 100 is zero , it supplies no current to that node . current source 102 operates in a similar manner , except that it functions to sink current out of common node 110 . the truth table for the arrangement of xor gate 94 and two and gates 102 and 104 is as follows : tscp 90 operates as shown in fig6 a - c . if the pulse of cp pulse train stays on longer than the corresponding pulse of the rp pulse train ( see fig6 a ), indicating that the total delay introduced by delay elements 60 and 62 is too long , then up current source 100 pumps current 10 into capacitor 92 until flop - flop 48 is reset . this serves to reduce the delay introduced by delay elements 60 and 62 . this repeats each cycle until the total delay that is introduced by delay elements 60 and 62 is such that falling edges of the pulses of the cp and rp are aligned ( see fig6 c ). conversely , if the pulse of rp pulse train stays on longer than the corresponding pulse of the cp pulse train ( see fig6 b ), indicating that the total delay introduced by delay elements 60 and 62 is too short , then down current source 102 drains current i 0 out of capacitor 92 until flop - flop 48 is reset . this serves to increase the delay introduced by delay elements 60 and 62 . and as before , the repeats each cycle until the total delay that is introduced by delay elements 60 and 62 is such that falling edges of the pulses of the cp and rp are again aligned . there are other circuits that implement the same truth table . see for example the circuit of fig7 . in this circuit , an exnor gate 101 is used in place of xor gate 94 and a combination of an inverter 103 with a nor gate 105 is used in place of and gates 90 and 98 . the cp pulse train passes through one of the inverters 103 to drive an input of one of the nor gates 105 and the rp pulse train passes through the other inverter 103 to drive an input of the other nor gate 105 . the output of exnor gate 101 and the other inputs of the two nor gates 105 are connected at a common node . it is not essential that two optical waveguides be used . the principles presented above also work if only a single waveguide is used and light pulses are introduced into opposite ends of that single waveguide . in that case , the pulses are indistinguishable with regard to which pulse came from which direction . the ate circuit that was described above will treat the first detected pulse as a set pulse , the second detected pulse as a reset pulse , the third detected pulse as a set pulse , etc . however , it turns out that it does not matter whether the circuit can distinguish which pulse came from which end since the generated local clock will be either correct or 180 ° out of phase . this can be appreciated by examining fig8 , which shows the pulses being detected at various locations , x n , along the waveguide . in this example , an identical pulse is introduced into each end of the waveguide and to simplify the explanation it will be assumed that at any given time there are only two pulses on the line , one introduced into the near end of the waveguide ( x = 0 ) and the other introduced into the far end of the waveguide ( x = l ). as indicated , at location x = x 2 , which is close to the near end of the waveguide , the detector will at time t 1 see the first pulse , which is the pulse that was introduced into the near end of the waveguide , and it will see at a much later time t 2 the second pulse , which is the pulse that was introduced into the far end . the average time for those two pulses will be aligned with t 0 . at a later time , the next pulse that the ate sees will be at t 3 ( which equals 2t 0 + t 1 ). this next pulse will be treated as the set pulse in the ate circuit . then , at t 4 ( equal to 2t 0 + t 2 ), it will see the fourth pulse , which will be the reset pulse . the average time for those two pulses will be aligned with 3t 0 , so the generated local clock will have the same phase as the previously generated local clock . as illustrated in fig8 by the vertical dashed lines representing the average time between the two detected pulses , this will be true at any location along the waveguide . that is , the ates will generate local clocks all having the same skew ( i . e ., t 0 ). moreover , if the ate selects the “ wrong ” pulse as the first pulse ( i . e ., the set pulse ), this will only produce a phase error in the generated local clock of 180 °. this can be seen as follows . looking again at location x 2 assume that the ate treats the pulse at t 2 as the set pulse . then , the next detected pulse will be at time t 3 , which is a pulse that was introduced into the near end of the waveguide . as noted above , t 3 equals 2t 0 + t 1 . thus , the average time will be ½ ( t 2 + t 3 ), which will be aligned with 2t 0 . that is , ½ ( t 2 + t 3 )= ½ ( t 2 + t 1 + 2 t 0 )= ½ ( t 2 + t 1 )+ t 0 = 2 t 0 thus , the resulting local clock will be 180 ° out of phase and this error can be easily corrected by simply shifting its phase 180 °. another single line implementation is shown in fig9 . in this case , two parallel optical waveguides 250 and 252 are connected together at one end . thus , the in 1 pulse train that is introduced into waveguide 250 and when it reaches the far end of that waveguide it comes back on waveguide 252 , thereby becoming in 2 . the far end can be connected by a curved portion of waveguide , as suggested by the figure , or by any mechanism that reflects the in 1 signal back into waveguide 252 . there will be locations along the pair of waveguides ( e . g . waveguide # 1 and waveguide # 2 ) at which the two pulses occur very close to each other in time . at some point , the interval of delay between the two pulses will be too short for practical circuits to handle well . as a - consequence , operating near those locations may cause difficulty in maintaining a lock with low jitter . one solution is to measure the time delay in the reverse order , where it is closer to 2t 0 rather than to zero . that is , instead of using the pulse on waveguide # 1 as the set pulse ( or early pulse ) and the pulse on the other waveguide as the reset pulse ( or late pulse ), reverse the order and use the pulse on waveguide # 2 as the early pulse and the other pulse as the late pulse . fig1 a - b illustrate the problem and the solution . as shown in fig1 a , the clock pulses detected on waveguide # 1 are labeled in 1 and the clock pulses detected on waveguide # 2 are labeled in 2 . at this particular location , the in 2 pulse arrives very soon after the in 1 pulse , namely , 2d . if the pulse on waveguide # 1 is treated as the first pulse ( or the set pulse ), then the reference pulse ( rp ) and the calibration pulse ( cp ) that are generated will be relatively short . if the cp pulse becomes too short , it can be difficult to maintain a lock on the average time ( i . e ., d ). however , by reversing the roles of the pulses , this problem goes away . thus , by using the pulses detected on waveguide # 2 as the set pulses , the delay that is observed before the reset pulse arrives becomes much larger , namely , 2d ′ ( see fig1 b ). it should be readily apparent that d + d ′ is equal to t 0 , or half the period of the clock cycle . consequently , reversing the order in which the pulses are used to determine the average skew will result in a signal that is 180 ° out of phase with the signal that would be produced if the pulses were used in the opposite order . this phase difference can be easily corrected by simply changing the phase of the generated clock signal by 180 °. a circuit which automatically selects the pulse train that is to provide the early pulses is shown in fig1 . that is , if the pulses of in 1 and in 2 are as shown in fig1 a , the circuit will invert the connections to the optical waveguides to change the set / reset sequence to the one shown in fig1 b . this embodiment is a modification of the circuit shown in fig5 and the components that the two circuits have in common are numbered the same . those common elements include two set / reset flip - flops 46 and 48 , two identical variable delay elements 60 and 62 , a tri - state charge pump 90 , and a capacitor 92 . in addition , there are two switches 180 and 182 , the states of which are controlled by the voltage on a capacitor 184 . the voltage on the capacitor is , in turn , controlled by a simple charge pump 186 . switch 180 selects which of the two signals , in 1 or in 2 , will provide the early pulses and which will provide the late pulses ; and switch 182 selects which of the two outputs of flip - flop 46 , i . e ., q and q - bar , will provide the reference ( rp ) pulses to tri - state charge pump 90 . in essence , charge pump 186 in combination with capacitor 184 determines which of two time periods is longest , namely , the time period between a pulse of the in 1 signal followed by the next arriving pulse of the in 2 signal , or the time period between a pulse of the in 2 signal followed by the next arriving pulse of the in 1 signal . the circuit works as follows . assuming that the in 1 and in 2 signals are as shown in fig1 b , the q and q - bar outputs of flip - flop 46 are as indicated . the q output produces a pulse the duration of which is equal to the time between a pulse of the in 1 signal and the next following pulse of the in 2 signal . whereas , the q - bar output produces a pulse the duration of which is equal to the time between a pulse of the in 2 signal and the next following pulse of the in 1 signal . charge pump 186 , in effect , integrates these two signals to produce a net change in the charge of capacitor 184 that is proportional to icpx ( d 1 − d 2 ), where icp is the current supplied by the constant current sources within charge pump and d 1 and d 2 are defined in fig1 b . this drives the voltage on capacitor 184 to its maximum negative value ( e . g . equal to the supply voltage ) which , in turn , causes switch 180 to select the in 2 signal to provide the early pulse to flip - flop 48 and causes switch 182 to select the in 1 signal to provide the late or reset pulse ( i . e ., by selecting the q output of flip - flop 46 to provide the rp pulse for tri - state charge pump 90 ). if d 1 had been greater than d 2 , the opposite would have happened . that is , the voltage across capacitor 184 would have gone positive to its maximum value thereby causing switch 180 to select the in 1 signal to provide the early pulse to flip - flop 48 and causing switch 182 to select the in 2 signal to provide the late ( or reset ) pulse . of course , if the location along the waveguide is such that the two pulses ( i . e ., the in 1 pulses and the in 2 pulses ) arrive at basically the same times , possibly the more practical solution is to simply avoid doing average time extraction from those locations and just take the clock signal from the line . there are , of course , alternative approaches to implementing the ate circuit . for example , if we assume that the early pulse train is applied to one input and the late pulse train is applied to the other input , the ate can include internal means to generate a new pulse train ( an “ output pulse train ”) of the same period of the incoming pulses and which can be skewed between the early and late pulse trains under the control of an internal signal . the simplest way to accomplish this functionality is by using a variable delay to skew the early pulse train under the control of a dc voltage or current , as shown in fig1 . the ate circuit 110 shown in fig1 includes two s - r flip - flops 112 and 114 , an integrator 116 with positive and negative inputs , and a single variable delay element 118 . integrator 116 may be similar to previously described integrator 66 and tri - state charge pump 90 ( see fig4 a and 5 ). the early pulse , which is in the in 1 pulse train , sets flip - flop 112 and the late pulse , which is in the in 2 pulse train , resets flip - flop 114 . delay element 118 generates a delayed version of the early pulse and delivers it to both the reset input of flip - flop 112 and the set input of flip - flop 114 . the output ( ec ) of flip - flop 112 , referred to as the early - output ( eo ) pulse train , drives the positive input of integrator 116 and the output of flip - flop 114 , referred to as the output - late ( ol ) pulse train , drives the negative input of integrator 116 . by using the three pulse trains defined above ( i . e ., the incoming early pulse train ( in 1 ), the internally generated output pulse train ( out ) at the output of delay element 118 , and the incoming late pulse train ( in 2 )) ate 110 generates two additional pulse trains referred to as early - output ( eo ) pulse train and output - late ( ol ) pulse train . the feedback control system ( including integrator 116 ) automatically adjusts the skew of the output pulse train until the eo pulses and the ol pulses have identical widths . when this condition is accomplished , the output pulse train skew is the average time skew of the input pulse trains . stated differently , the pulses of the eo and ol pulse trains are generated such as to give an accurate measure of the skews between the respective pulse trains . in other words , this arrangement adjusts the amount of delay introduced by delay element 118 such that the points at which flip - flop 112 is reset and flip - flop 114 is set to be located in time midway between the early and late pulses . the details are as follows . the first pulse ( in 1 ) on the set input line of flip - flop 112 produces an up - transition of a new pulse at its output ( eo ). after a delay of d , the detected pulse of the in 1 signal resets flip - flop 112 and sets flip - flop 114 . at that point the output of flip - flop 112 falls to zero to define the end of the pulse that was generated at its output and flip - flop 114 produces an up - transition of a new pulse at its output ( ol ). finally , when the late pulse of the in 2 signal arrives , it resets flip - flop 114 to zero to define the end of the pulse that was generated at its output . during the duration of the pulse that occurs at the output of flip - flop 112 , when the output of flip - flop 114 is zero , integrator 116 begins to increase the value of the signal appearing at its output at a constant rate , r . as soon as the delayed pulse resets flip - flop 114 and sets flip - flop 114 , integrator 116 begins to decrease the signal appearing at its output at the same constant rate , r . the output of integrator 116 , without filtering , will be a saw - tooth waveform . but , as should be readily appreciated , if the duration of the pulse of the eo signal is longer than the duration of the pulse of the ol signal , then when the late pulse arrives , the signal at the output of integrator 116 will be at a value that is larger than it was when the early pulse arrived . similarly , if the duration of the pulse of the eo signal is shorter than the duration of the pulse of the ol signal , then when the late pulse arrives , the signal at the output of integrator 116 will be at a value that is smaller than it was when the early pulse arrived . a filter 120 at the output of integrator 116 filters this saw - tooth waveform from integrator 116 to generate a dc signal that controls the amount of delay introduced by variable delay element 118 . whenever the duration of the pulses of the eo signal are longer than the duration of the pulses of the ol signal , the dc value at the output of filter will increase , thereby causing the amount of delay that is introduced by variable delay element 118 to decrease . and similarly , whenever the duration of the pulses of the eo signal are shorter than the duration of the pulses of the ol signal , the dc value at the output of filter 120 will decrease , thereby causing the amount of delay that is introduced by variable delay element 118 to increase . thus , the circuit operates to make the duration of the pulses of the eo and ol signals identical , which in turn positions the pulses of the out pulse train a halfway between the pulses of the in 1 pulse train and the in 2 pulse train . note that the skew adjusted output signal of the ate circuits described above is a train of pulses having the same duration as the pulses received from the optical detector . in other words , they are short pulses . since short clock pulses can be difficult to use as clock signal , it may be desirable to generate a skew - corrected clock signal that has a 50 % duty cycle , i . e ., one with longer clock pulses . a generator circuit 150 that produces a 50 % duty cycle clock signal is shown in fig1 . generator circuit 150 includes two ate &# 39 ; s 152 and 154 , each with corresponding first and second input lines , and a s - r flip - flop 156 . both ates 152 and 154 operate as described above . however , the input signals for ate 154 are reversed in comparison to the input signals for ate 152 . that is , the pulses of input signal in 1 drive a first input line of ate 152 and the second input line of ate 154 ; while the pulses if input signal in 2 drive the second input line of ate 152 and the first input line of ate 154 . this means the early pulse for one ate is treated as the late pulse for the other ate . as indicated above , the result will be that the ate 152 will align its skew corrected output pulse train with a first reference time and ate 154 will align its skew corrected output pulse train with a second reference time that is one half of a period delayed from the first reference time . by using these two reference times to define the pulse of the generated clock sign ( e . g . the first reference time defining the up transition and the second reference time defining the down transition ), one automatically generates a 50 % duty cycle clock signal . the circuit works as follows . assume the pulse trains on the two waveguides are as shown in fig1 . at the selected location long the two waveguides , the pulses of the in 2 pulse train on line 2 are delayed by 2τ 1 relative to the pulses of the in 1 pulse train on line 1 . viewed from the other perspective , namely , the timing of the pulses of the in 1 pulse train relative to the timing of pulses of the in 2 pulse train , the pulses on line 1 are delayed by 2τ 2 relative to the pulses on line 2 . since the period of the clock signal is t 1 it is also true case that : as described above , once the circuits achieve their steady - state operation , the output clock signal from ate 152 will be delayed by τ 1 relative to the clock pulses of the in 1 pulse train and the output clock signal from ate 154 will be delayed by τ 2 relative to the clock pulses of the in 2 pulse train . the separation of these two pulses will be exactly t / 2 , as indicated in fig1 . the output signal of ate 152 drives the set input of flip - flop 156 and the output signal of ate 154 drives the reset input of flip - flop 156 . the pulses on the set input of flip - flop 156 will cause the output of flip - flop 156 to switch to high , where it will remain until the reset pulse is received , at which time it will drop back down to zero . thus , the output of flip - flop 156 will be a sequence of pulses that are of duration t / 2 , that have a period of t , and that are aligned with the average skew of the pulses of the in 1 and in 2 pulse trains . this is shown in the bottom graph of fig1 . another circuit that generates a 50 % duty cycle clock signal from the clock signal coming out of the ate is shown in fig1 a . it includes a set - reset ( s - r ) flip - flop 200 , a charge pump 202 , a filter capacitor 204 , and a variable delay element 206 . the output of the ate circuit ( not shown ) drives the set input of flip - flop 200 , and after passing through a delay element 206 , it then drives the reset input of flip - flop 200 . the q and q - bar outputs of flip - flip 200 drive corresponding inputs of charge pump 202 . in essence , charge pump 202 integrates the difference of the signals that appear on its two inputs . that is , if the signal on the positive input of charge pump 202 is one while the signal on the negative input is zero , charge pump will increase the signal on its output linearly as a function of time . if the signals on the two inputs are the same ( i . e ., both one or both zero ), charge pump 202 will hold its output at a fixed level . and , if the signal on the positive input of charge pump 202 is zero while the signal on the negative input is one , charge pump will decrease the signal on its output linearly as a function of time . capacitor 204 filters that output signal of charge pump 202 to produce a dc signal that will change slowly with respect to the period of the clock signal . the operation of the circuit is illustrated by the signaling diagrams shown in fig1 b . the clock pulse form the ate circuit sets flip - flop 202 causing its q output to go high . this output remains high until the reset pulse arrives at a later time determined by variable delay element 206 . at that time , the q output goes to zero and the q - bar output goes high . the q - bar output remains high until the next clock pulse from the ate circuit at which point the sequence just described repeats itself . d is less than ½t p , the duration of the q output pulse will be shorter than the duration of the q - bar output pulse and charge pump 202 will cause the voltage on capacitor 204 to decrease for as long as this condition exists . the drop in the voltage on capacitor 204 will , in turn , cause the delay introduced by variable delay element 206 to increase . finally , when d reaches ½t p , the output voltage from charge pump 202 will remain constant and the duty cycle of the signal appearing on the q output will be exactly 50 %. similarly , if d is greater than ½t p , the duration of the q output pulse will be longer than the duration of the q - bar output pulse and charge pump 202 will cause the voltage on capacitor 204 to increase for as long as this condition exits . when d reaches ½t p , the output voltage from charge pump 202 will remain constant and the duty cycle of the signal appearing on the q output will again be exactly 50 %. in other words , the stable operating point of the circuit exists when d = ½t p , which is the point at which the duty cycle of the signal on the q output is 50 %. in a bos where the maximum skew is less than one signal period , all ate generated output signals will be phase - aligned . if the maximum skew exceeds one signal period , a phase difference of 180 ° ( i . e ., a sign reversal ) between two ate - generated signals may arise . if the optical waveguides for distributing the clock signal are sufficiently long so the time it takes for a pulse to traverse the entire length of the waveguide is much larger than the period of the clock signal , there will be multiple clock pulses on each line at any given time . this is illustrated in fig1 . in this example , the time it takes to traverse the entire length of the optical waveguide is assumed to be t l and the period of clock signal is t c , which is shorter than t l . for the particular t l and t c selected in fig1 , there will be at least three clock pulses on each waveguide at any given time . as a consequence , there can be an error in the reference time extraction resulting from selecting the wrong second pulse . the source of the error is also illustrated in fig1 and can be understood as follows . the clock signal periodically introduces optical pulses into optical waveguide 10 . those pulses , which are illustrated by pulse ( n − 2 ) through pulse ( n + 2 ) on the left side of fig1 , are separated in time by the clock period , t c . assume that the time at which a pulse ( n ) is introduced into waveguide 10 is t = 0 . then , the movement of pulse n along waveguide 10 is represented by line 200 . it reaches location x 1 ( which is a distance x 1 from the beginning of waveguide 10 ) at time t 1 and it reaches location x 2 at later time t 2 . now assume a corresponding pulse , also identified in this drawing as a pulse ( n ), is introduced into the other end of waveguide 12 at the same time as pulse ( n ) is introduced into waveguide 10 . that corresponding pulse travels along waveguide 12 , as indicated by line 202 in the graph . pulse ( n ) introduced into waveguide 12 reaches location x 2 at a time t 4 which is later than the time t 2 at which the corresponding pulse ( n ) on waveguide 10 reached that same location . an ate circuit of the type previously described and located at x 2 generates a clock pulse that is aligned with t 0 ′, which is exactly half the distance between t 4 and t 2 , i . e ., t 0 ′= ½ ( t 4 − t 2 ). this is the correct reference time . however , in this example , an ate located at x 1 will not generate its clock pulse at the correct time . after that ate detects pulse ( n ) in optical waveguide 10 at time t 1 , the next pulse it detects in the other optical waveguide 12 will be pulse ( n − 1 ), not the corresponding pulse ( n ), and that will be at time t 3 . this is because multiple pulses are present on each waveguide at any given time and because the time it takes for a pulse introduced into waveguide 12 to reach location x 1 is greater than t c , the period of the clock signal . the ate at location x 1 is not able to determine which pulse detected on waveguide 12 is the one that corresponds to pulse ( n ) that was detected on waveguide 10 . it simply treats the next received pulse on waveguide 12 as the correct one and establishes the reference time accordingly . in this case , the reference time will be t 0 ″, which is ½ ( t 3 − t 1 ). as can be clearly seen in the graph , t 0 ″ is different from t 0 ′. if the ate at location xi were able to ignore pulse ( n − 1 ) on waveguide 12 and instead detect next pulse on waveguide 12 as the late pulse , which would be pulse ( n ) arriving at time t 5 , then the reference pulse would occur at ½ ( t 5 − t 1 ) which equals t 0 ′. in fact , the timing of the reference pulse that is generated by the ate is related to the correct reference pulse as follows : t 0 ″= ½ ( t 5 − t c − t 1 )= ½ ( t 5 − t 1 )− ½ t c = t 0 ′− ½ t c in other words , the reference pulse that is generated by the ate is delayed by one half the period of the clock cycle . by going through the analysis presented above , it should be easy to convince oneself that regardless of the location along the waveguides that the ate &# 39 ; s are located , the generated clock pulses will either be properly synchronized with the desired reference pulses for the system or will be out of phase with those pulses by 180 °. the phase ambiguity can be resolved with the approach illustrated in fig1 . in this system , the chip is partitioned into multiple local clocking regions 300 a - g and a master optical clock signal is distributed to the local regions over two waveguides 302 and 304 . for illustration purposes only , fig1 shows that there are seven local clocking regions but in practice there is likely to be many more . as previously described , the master optical clock signal is introduced into one end of waveguide 302 and it is introduced into the opposite end of waveguide 304 . in each local clocking region , there is an ate circuit 310 that generates a local electrical clock signal for that region based upon the two optical clock signals detected on the two waveguides . the local clocking regions are limited in size so that the maximum clock skew that will occur for the electrical clock signal generated for that region will be no greater than a predefined small amount , e . g . 10 %. the ate in one of the local clocking regions functions as a master ate 320 and the remainder of the ates function as slave ates . master ate 320 establishes the electrical clock signal with which the local clock signals in all of the other regions will be aligned . in the described embodiment , master ate 320 is located within a centrally located region relative to the distributed optical clock distribution signal , with approximately half of the other ates on one side and the remaining half on the other side . though locating the master ate near the midpoint of the clock distribution circuit is desirable , it could be located anywhere along the distribution paths of the optical clock signals . besides generating the local electrical clock signal , each ate 310 including master ate 320 also generates a synchronizing signal ( i . e ., synch signal ) on an output line ( or synch signal line ) 312 that communicates that signal to the next nearest downstream neighbor . the synch line is used to inform the nearest neighbor of the correct phase alignment for that nearest neighbor &# 39 ; s local clock signal . in the described embodiment , the synch signal is simply the local clock signal that the ate is generating for its local region . this could be taken directly from the ate in a dedicated line for that purpose or from the local clock signal distribution circuit for distributing the locally generated clock signal . master ate 320 , unlike the other ate &# 39 ; s , sends its synch signal to its two nearest neighbors , one on each side . based on that synch signal , the neighboring ate brings its clock signal into phase alignment with the clock signal of the master ate . each slave ate 310 , in turn , sends its synch signal ( i . e ., its locally generated clock signal ) to its next nearest downstream neighbor . based on the received synch signal , the neighboring ate brings its local clock signal into phase alignment with its upstream neighbor . as the correct phase information propagates outward from master ate 320 , all of the ates come into phase alignment with the clock signal that is being generated by the master ate . recall that the ates will generate local clock signals that are either in phase alignment with the local clock signal of the master ate or in phase opposition ( i . e ., 180 ° out of phase ) with the local clock signal of the master ate . this is a characteristic of the way the ates operate , as described above , and as illustrated in fig1 . thus , it becomes a simple matter to bring all ates into correct phase alignment . an ate need only compare its local clock signal to the local clock signal being generated by its upstream neighbor to determine whether its phase is correct or needs to be flipped to bring it into alignment . each ate includes circuitry ( not shown ) which examines the locally generated clock signal at the time that the pulse of the synch signal is received . if the locally generated clock signal is high , that indicates it is in alignment with the locally generated clock signal of upstream neighbor . on the other hand , if the locally generated clock signal is low , that indicates it is 180 ° out of phase with the locally generated clock signal of the upstream neighbor . in that case , the ate shifts the phase of its locally generated clock signal by 180 ° to bring it into phase with its neighbor . ( this can be accomplished in a number of ways including , for example , by simply reversing the order of the pulse signal streams so that in 2 provides the early pulse and in 1 provides the late pulse .) the correct alignment information will propagate outwards from the master ate ; and the local clock signals being generated by the slave ates will all fall into alignment with the clock signal being generated by the master ate . that is , each slave ate starting with the two closest to the master ate will use the received synch signal to align its local clock signal with that of the master and then will send the new synch signal to the next slave ate down the chain until the clock signals of all slave ates are aligned with that of the master ate . the circuit shown in fig1 also provides a way of eliminating the phase ambiguity . note that if the outputs of ates 152 and 154 are added ( e . g . using an or operation ) then the resulting pulse train is the combination of both pulse trains dll 1 and dll 2 shown in fig1 . that is , it is a pulse train having a frequency that is twice the frequency of in 1 or in 2 . as one can readily see , this eliminates any ambiguity that might result as described above . this is the equivalent of multiplying two sinusoidal clock signals , as described elsewhere herein . this technique works with pulses that are short compared to the half the transmitted clock period . thus , the resulting clock at twice the frequency does not have 50 % duty cycle . it is also possible , using a combination of the above - described techniques , to adjust the pulse to have ¼ of the original clock period and then add them as shown in fig1 to generate a final clock ( at twice the frequency ) but with a 50 % duty cycle . this is done by applying the dll 1 and dll 2 signals that are generated by ate 152 and 154 , respectively , as inputs to two other ates and then passing the results to flip - flop 156 . alternatively , after generating the non - 50 % duty cycle clock signal having twice the frequency , one can divide this clock signal back to the original frequency which will also produce the 50 % duty cycle . indeed , getting a 50 % duty cycle signal by ½ division turns out to be a very reliable and accurate way of doing it . another design for an ate circuit is illustrated in fig1 . like the previous described ate circuits , it includes two flip - flops 612 and 614 and an integrator 616 . but instead of using delay elements to generate the local clock signal , it uses a voltage controlled oscillator ( vco ) 618 , the frequency of which is controlled output of integrator 616 . the early pulse , which is established by the in 1 pulse train , sets flip - flop 612 , and the late pulse , which is established by the in 2 pulse train , resets flip - flop 614 . vco 618 generates a local clock signal which is fed back to the reset input of flip - flop 612 and the set input of flip - flop 614 . the output of flip - flop 612 , referred to as the early - clock pulse train ( ec ), drives the positive input of integrator 616 and the output of flip - flop 614 , referred to as the clock - late pulse train ( cl ), drives the negative input of integrator 614 . the rising edges of the local clock signal generated by vco 618 determine the relative widths of the pulses in the two pulses trains ec and cl . the feedback system ( including integrator 616 and a filter 620 ), which controls vco 618 , automatically adjusts the frequency of vco 618 so that the ec pulses and the cl pulses have identical widths . when this condition is achieved , the skew of the output pulse train ( i . e ., the generated local clock signal ) is the average of the skews of the input pulse trains in 1 and in 2 . the details of operation are as follows . referring to fig1 and 19 , the first pulse ( in 1 ) on the set input line of flip - flop 112 produces an up - transition of a new pulse at its output ( ec ). after a certain period of time , the rising edge of the local clock signal generated by vco 618 occurs . that resets flip - flop 612 , thereby defining the end of the pulse that was generated at its output , and it sets flip - flop 614 , thereby defining the beginning of the pulse that is generated at its output . the output of flip - flop 614 remains high until the next pulse of the in 2 pulse train occurs . at that point , the output of flip - flop 612 falls to zero defining the end of the pulse that was generated at its output and flip - flop 614 produces an up - transition of a new pulse on its output . when the late pulse of the in 2 signal arrives , it resets flip - flop 614 to zero to define the end of the pulse that was generated at its output . during the duration of the pulse that occurs at the output of flip - flop 612 , when the output of flip - flop 614 is zero , integrator 616 begins increasing the voltage at its output at a constant rate by , in essence , sourcing a constant current into a storage capacitor for the duration of the pulse on the positive input of integrator 616 . as soon as the rising edge of the local clock signal resets flip - flop 614 and sets flip - flop 614 , integrator 616 begins decreasing the voltage at its output by , in essence , sinking the same fixed current output the capacitor . without any filtering , the output of integrator 616 will be a sawtooth waveform . however , filter 620 , which has a time constant that is substantially longer than the period of the clock signal , averages this sawtooth waveform to produce a voltage that is the average of the output of integrator 618 . when the duration of the pulse in the ec pulse train is longer than the period of the pulse in the cl pulse train , the average value that is output by filter 620 increases thereby causing the frequency of the vco to increase . this , in effect , decreases the duration of the pulses of the ec pulse train and increases the duration of the pulses in the cl pulse train . similarly , when the duration of the pulse in the ec pulse train is shorter than the period of the pulse in the cl pulse train , the average value that is output by filter 620 decreases thereby causing the frequency of the vco to decrease . this , in effect , increases the duration of the pulses of the ec pulse train and decreases the duration of the pulses in the cl pulse train . when the duration of the pulses of the two pulse trains ec and cl are equal , the output of filter 620 remains constant . in other words , the circuit functions to move the period of the generated local clock signal to equal the period of global clock signal and it aligns its phase with the midpoint between one pulse of in 1 and the next occurring pulse of in 2 . with regard to the circuit of fig1 , it is to be noted that in addition to the stable operating point that was just described , there is a second stable operating point . the second stable operating point is illustrated by the signal timing diagrams shown in fig2 . it is characterized by a generated local clock signal that is 180 ° out of phase with the local clock signal that is generated in the example illustrated by fig1 . to see how this other operating point comes about assume again that the pulse on in 1 starts a new pulse of the ec pulse train as indicated in fig2 . this time , however , also assume that the next rising edge of the local clock signal does not occur until after the next pulse of the in 2 pulse sequence arrives . in that case , when the next rising edge of the clock signal occurs , it ends the pulse of the ec pulse train and begins a new pulse of the cl pulse train . this new pulse of the cl pulse sequence , however , will not end until the next reset pulse of the in 2 pulse train occurs , which is much later . in the meantime , a next pulse of he in 1 sequence will arrive to start a new pulse of the ec pulse train . for the rest of the time until the next pulse of the in 2 sequence arrives , the outputs of both flip - flops 612 and 614 will remain high . when the in 2 pulse arrives the pulse of the cl pulse train will end and soon thereafter , the rising edge of the local clock signal will arrive ending the pulse of the ec pulse train and starting a new pulse of the cl pulse train . integrator 616 looks at the difference of the signals at its two inputs . if the positive input is high while the negative input is low , the output of the integrator will rise ; if the positive input is low while the negative input is high , the output of the integrator will fall ; and if the positive input and the negative input are both high ( or both low ), the output of the integrator will remain constant . the difference signal , i . e ., ec - cl , appears as shown in fig2 . the circuit will adjust the period and phase of the local clock signal so that the rising edge of the locally generated clock signal will occur at the midpoint between a pulse of the in 2 sequence and the next occurring pulse of the in 1 sequence . it should be clear from the diagram for ec - cl when that occurs , the output of the integrator will remain constant and the circuit will be at a stable operating point . to eliminate one of the stable states , the circuit shown in fig2 is employed . in addition to the previously described circuitry , it also incorporates gating circuitry 628 which includes a set - reset flip - flop 630 and two and gates 632 and 634 . the in 1 pulse sequence drives set input of flip - flop 630 and the in 2 pulse sequence drives the reset input . the output of flip - flop 630 drives an input of each of and gates 632 and 634 . the ec pulse signal sequence drives the second input of and gate 632 and the cl pulse signal sequence drives the second input of and gate 634 . the outputs of and gates 632 and 634 drive corresponding inputs of integrator 616 . in essence , gating circuitry 628 prevents the ec and el signals from reaching integrator 616 , except during a period that lies between an in 1 pulse and the next occurring in 2 pulse . for all other times , namely the period between an in 2 pulse and the next occurring in 1 pulse , neither pulse sequence to reach integrator 616 . when the pulse of the in 1 sequence arrives , it sets flip - flop 630 thereby causing its output to go high . this , in turn , enables and gates 632 and 634 to pass whatever signal appears on their other input . when the in 2 pulse arrives , it resets flip - flop 630 thereby causing its output to go low which , in turn , disables and gates 632 and 634 and blocks the signals appearing on their other inputs to pass through to integrator 616 . for the arrangement shown in fig2 , the only stable operating point is the one shown in fig1 . the circuit can also include a switch 636 which reverses the inputs to flip - flop 630 . when inputs are reversed , the pulses of the in 2 sequence serve to set flip - flop 630 and the pulses of the in 1 sequence serve to rest flip - flop 630 . in that case , the stable operating point is the one shown in fig2 . note that the skew correction principles described herein are not restricted to only using pulse sequences as the clock signals . the principles also apply to periodic signals in general . if the periodic signal is sinusoidal , a particularly simple implementation exists for generating local clock signals that are all phase aligned . assume any sequential linear transmission system and excite it at one end with a sinusoidal excitation . the linearity condition ensures that in steady state , all signals at all nodes in the system are sinusoidal , albeit with different magnitudes and phases ( skews ). next consider a reference point ( any point ) in the system and define the phase at this point as the reference phase φ 0 . the signal at this reference point is α 0 sin ( ω 0 t + φ 0 ), where α 0 is the magnitude and ω 0 is the frequency . now consider two extra points in the system , one placed before the reference point and the other placed after the reference point . furthermore , choose these two extra points such that their respective phases are at equal “ electrical distance ” ( or equal “ optical distance ,” if using optical signals ) from the reference phase . that is , the first point has a signal : note that this is possible in any continuous transmission system even if it is non homogeneous . also , note that no restrictions are placed on δφ , which may be much larger than 2π . α 1 sin ( ω 0 t + φ 0 − δφ )× α 2 sin ( ω 0 t + φ 0 + δφ )= α 1 α 2 [ cos ( 2δφ )− cos ( 2ω 0 t + 2φ 0 )] ( 1 ) in other words , the simple multiplication of the signals at the two points at equal electrical distance ( length ) from the reference point yields a dc term α 1 α 2 cos ( 2δφ ) and a phase invariant term α 1 α 2 cos ( 2ω 0 t + 2φ 0 ) at twice the transmitted signal frequency . the dc term can be easily eliminated in practice through ac coupling and the remaining α 1 α 2 cos ( 2ω 0 t + 2φ 0 ) term provides a clock signal with a precise phase relationship to the reference phase . a circuit that implements this principle is shown in fig2 . it includes a multiplier circuit 700 that takes as its two inputs the detected first clock signal on line 1 ( i . e ., in 1 ) at point x and the detected second clock signal on line 2 ( i . e ., in 2 ) also at point x . relative to the midpoint of the waveguide , the detected first clock signal is shifted in phase by an amount − δφ and the detected second lock signal is shifted in phase by an amount + δφ . in other words , the two detected signal correspond to the signals discussed above , namely , α 1 sin ( ω 0 t + φ 0 − δφ ) and α 2 sin ( ω 0 t + φ 0 + δφ ). thus , multiplier produces as its output the product of these two signals , which as noted above includes a dc term and a term having twice the frequency of the clock signals . the circuit also includes a high pass filter 702 ( e . g . capacitor ) that removes the dc term leaving the local clock signal with a phase of 2φ 0 . the phase of this local clock signal will be the same regardless of where point x is located along the waveguides . thus , all points for which respective equally electrically - distant points exist with respect to the reference , can be synchronized by simple multiplication and dc removal operations . also note that using multiplication results in a local clock signal for which there will be no phase ambiguity . and this implementation which uses sinusoidal signals has the further advantages that it is very simple to implement and it requires no feedback . the clock signal distribution circuit may involve a combination of the bos and a bes techniques . the bos technique could be used to generate the local clock signals for the local regions , which might themselves be physically large areas in which the distributed electrical local clock signals exhibited significant skews . to address the skews within the large local regions , the bes techniques could be used . thus , the resulting circuit would be a hybrid in which both techniques were used : bos for large scale clock distribution and bes for local distribution . it should be understood that the parallel optical waveguides could be of any configuration that would be appropriate for distributing the clock signal to all of the required local clocking regions . in other words , they could be two straight - line waveguides , spirally arranged waveguides , or they could be laid out in a serpentine configuration . | 6 |
referring now to the drawings and specifically to fig1 a granular polysilicon handling system is generally indicated at 31 . the manufacture of granular polysilicon requires frequent product handling in a vertical direction . handling systems are typically comprised of a series of valves and pipes connecting multiple pieces of material handling equipment , including hoppers , portable vessels , and reactors . fig1 shows a schematic of such a system 31 . the schematic shows only the substantive components of the system 31 , removing several piping connections for simplicity . the granular polysilicon enters the system 31 through an inlet hopper 33 located at the top of the system . it then passes from the inlet hopper 33 through a non - contaminating gas - tight valve 41 of the present invention ( fig1 ). the non - contaminating gas - tight valve 41 will be described in detail below . in the overall handling system 31 , the valve 41 can isolate portions of the handling system so that granular polysilicon and gas cannot pass through the valve . below the gas - tight valve 41 , the granular polysilicon enters a vessel 43 for treatment of the granular polysilicon . the treated polysilicon then passes through another gas - tight valve 41 , finally entering an outlet hopper 47 ( fig1 ). referring now to fig2 a non - contaminating gas - tight valve of the present invention 41 is shown . the valve generally comprises an upper body 51 having an inlet 53 ( fig3 ) and a lower body 55 having an outlet 57 ( fig4 ). the upper body 51 has a lower annular flange 61 , and the lower body 55 has an upper annular flange 63 . the upper body 51 mounts on the lower body 55 such that the lower annular flange 61 abuts the upper annular flange 63 . an elastic sealing element 64 , such as an o - ring , fits between the upper and lower flanges 61 , 63 , forming a seal between the upper and lower bodies 51 , 55 ( fig2 ). the lower flange 61 contains a plurality of unthreaded bolt holes 65 while the upper flange 63 contains a plurality of threaded holes 67 . when the upper body 51 mounts on the lower body 55 , the unthreaded holes 65 match positions with the threaded holes 67 so that threaded studs 73 may be inserted downwardly through the upper body 51 and threaded into the lower body 55 . nuts 74 thread down over the threaded studs 73 and bear against the upper body 51 , holding the valve 41 together ( fig2 ). in the preferred embodiment , multiple threaded studs 73 and nuts 74 secure the upper and lower bodies 51 , 55 together . additionally , the upper body 51 and lower body 55 of the preferred embodiment are preferably formed from metal , such as stainless steel . other materials exhibiting adequate strength and rigidity characteristics may also be used without departing from the scope of the invention . the valve 41 is designed to control a flow of granular polysilicon within the handling system 31 and create a gas - tight seal within the system . the granular polysilicon is fed through the valve 41 by gravity . when the valve 41 is closed , no granular polysilicon flows through the valve . when the valve 41 is open , granular polysilicon will flow downward through the valve , entering the valve at the top of the upper body 51 and exiting the valve at the bottom of the lower body 55 . upon entering the valve 41 , the granular polysilicon passes through an upper body insert 75 ( fig2 , and 6 ). the upper body insert 75 is annularly shaped , fitting snugly within the mating cylindrical inlet 53 formed in the upper body 51 of the valve 41 . the upper body insert 75 has a passage 77 formed vertically through the insert ( fig5 ). the passage 77 is the first passage the granular polysilicon flows through as it travels through the valve 41 . the upper edge of the cylindrical passage is defined by a chamfer 79 . the upper body insert 75 should be constructed of a material that can direct large quantities of granular polysilicon into the valve 41 while minimizing the number of foreign particles contaminating the system due to wear of the insert . in the preferred embodiment , the upper body insert 75 is formed from single - crystal silicon so that any wear of the insert within the flow of granular polysilicon will only minimally contaminate the system 31 , since the particles created are single - crystal silicon of purity equivalent to that of granular polysilicon . after flowing through the upper body insert 75 , the granular polysilicon passes through an upper annular seat 85 , as shown in fig2 , and 8 . the upper annular seat 85 is generally ring - shaped . the seat 85 is received against an annular shoulder 87 formed in the upper body 51 . the seat 85 additionally has a frustoconical inlet face 89 , which is wider than the cylindrical passage 77 of the upper insert 75 , such that the granular polysilicon will flow from the upper insert through an opening 90 in the annular seat with little contact with the annular seat ( fig2 ). the seat 85 has a frustoconical outlet face 91 having two circumferential grooves 93 formed in its face ( fig7 and 8 ). the grooves 93 create a series of three circumferential ridges 95 . in addition , the innermost ridge 95 has a lip 97 , which extends laterally inwardly from the seat 85 , as discussed infra ( fig7 a ). below the upper annular seat 85 is the ball valve member 101 of the present invention , described in more detail below ( fig2 a , 9 - 11 ). the primary function of the upper annular seat 85 is to form a seal between the ball valve member 101 and the upper body 51 . in the preferred embodiment , the ball valve member 101 is a rotatable ball valve . the three circumferential ridges 95 of the annular seat 85 press against the ball valve member 101 , creating a tight seal between the valve and seat ( fig2 ). in the preferred embodiment , the annular seat 85 is formed from polytetrafluoroethylene so that the ball valve member 101 can move freely against the annular seat , while creating an adequate seal . referring now to fig9 - 11 , the ball valve member 101 has a cylindrical passage 103 through the valve , allowing the flow of granular polysilicon to pass through the valve ( fig1 ). in an open position ( as shown in fig2 ), the passage 103 is oriented vertically so that the granular polysilicon can pass through the ball valve member 101 . the ball valve member 101 is rotatable about a horizontal axis a ( fig2 ), which is perpendicular to the cylindrical passage 103 . when the ball valve member 101 rotates ninety degrees , the solid portion of the valve member entirely covers the opening 90 in the upper annular seat 85 , blocking the flow of granular polysilicon or gas through the valve 41 . as the ball valve member 101 rotates , the lip 97 wipes the surface of the valve member clean . the grooves 93 of the seat 85 allow for deformation of the outlet face 91 , so that the ridges can slightly deform during installation , conforming to the shape of the ball valve member 101 . when the ball valve member 101 rotates , excess granular polysilicon trapped between the valve member and ridges 95 can work into the grooves 93 , keeping the seal intact . the lip 97 presses firmly against the ball valve member , acting as a wiping element . in the preferred embodiment , the ball valve member 101 is manufactured from single - crystal silicon having a highly polished , mirror - like surface . single - crystal silicon is rigid enough to create a tight seal with the upper annular seat 85 . more importantly , the wiping action , working jointly with the mirror - like surface of the ball valve member 101 , inhibits wear by reducing the tendency of the granular polysilicon to stick to the valve member , which can increase wear on the seat 85 by rubbing against the seat as the valve member moves . any minimal wear of the ball valve member 101 will create single - crystal silicon particulate matter , which can be tolerated as a contaminant since the flow is granular polysilicon . accordingly , creating a ball valve member 101 of single - crystal silicon reduces the likelihood of harmful contaminants within the flow of granular polysilicon material . although single - crystal silicon is the preferred material for the valve member , it is envisioned that other materials such as silicon carbide , tungsten carbide , and silicon nitride may also be used without departing from the scope of the invention . because the ball valve member 101 must rotate within the body 51 , 55 , a valve rotation mechanism is required to move the valve member within the valve 41 . referring to fig9 and 10 , a section of the ball valve member 101 is not completely spherical , but rather has a first flat face 109 on one side of the valve member . an actuation chord 111 , having a second flat face 113 , fits against the first face 109 of the ball valve member 101 , completing the spherical shape of the valve member ( fig1 ). the first and second flat faces 109 , 113 each have four holes 115 in registration with each other ( fig9 - 12 ). four connecting pins 117 fit within the holes 115 of each face 109 , 113 thereby connecting the two faces together in a fixed orientation . the actuation chord 111 and connecting pins 117 are preferably formed from stainless steel . furthermore , a layer of adhesive material between the first face 109 and second face 113 holds the ball valve member 101 and actuation chord 111 together . in the preferred embodiment , the adhesive is an epoxy suitable for securing the ball valve member 101 valve to the actuation chord 111 . finally , the actuation chord 111 has a rectangular notch 123 formed in its curved face , as further described below . a ball valve stem 127 extends laterally from a side of the valve 41 for rotating the ball valve member 101 ( fig2 , and 14 ). the valve stem 127 is generally cylindrical in shape and designed to rotate along a central longitudinal axis a . the valve stem 127 passes through a cylindrical opening 129 formed within the lower body 55 ( fig2 and 4 ). the valve stem 127 rotates freely on a bearing 130 within the opening 129 and is sealed in the lower body 55 by a seal 131 and seal compression nut 133 ( fig2 ). an inner end of the valve stem 127 has a key 135 . the key 135 engages the rectangular notch 123 formed in the actuation chord 111 . as the valve stem 127 rotates about its longitudinal axis a , the key 135 presses against the notch 123 , causing the entire ball valve member 101 to rotate with the valve stem . by rotating the valve stem 127 , a user can control valve position and flow through the valve . between the valve stem 127 and the actuation chord 111 , a carrier 141 acts to carry a shield 149 ( fig2 - 17 ). the carrier 141 is generally conical in shape , having an arcuate interior wall 143 which mates with the chord 111 . the carrier 141 inhibits granular polysilicon from contaminating the interface between the key 135 and the actuation chord 111 , where it could increase wear . further , the exterior wall 145 of the carrier 141 is generally flat and includes an annular recess 147 formed about the edge to carry the shield 149 . the shield 149 fits between the carrier 141 and the upper and lower body 51 , 55 , within the annular recess 147 , to protect the stem assembly from dust and other particulate matter ( fig2 ). in the preferred embodiment , the carrier 141 and shield 149 are formed from polytetrafluoroethylene , although other materials exhibiting similar characteristics are also contemplated as within the scope of the present invention . downstream of the ball valve member 101 , the granular polysilicon passes through a lower annular seat 155 ( fig2 , and 19 ). like the upper annular seat 85 , the lower seat 155 is generally ring - shaped and presses against the ball valve member 101 . the seat 155 has a lower face 157 which rests against a shoulder 159 formed in the lower body 55 . the seat 155 has a frustoconical inlet face 161 having one circumferential groove 163 formed in its face ( fig1 ). this groove 163 is flanked by a pair of circumferential ridges 165 that extend from the frustoconical inlet face 161 . the circumferential ridges 165 of the lower annular seat 155 rest against the ball valve member 101 . the gas - tight valve can accommodate granular polysilicon that may slip past the seal between the upper annular seat 85 and the ball valve member 101 . an annular cavity 171 formed between the body 51 , 55 and the ball valve member 101 allows the granular polysilicon to pass through the valve 41 should some slip past the seat 85 . the excess granular polysilicon then passes by gravity to the lower portion of the cavity 171 . to that end , the lower annular seat 155 has a plurality of drain holes 173 formed therein . the drain holes 173 connect the cavity 171 to the central portion of the valve 41 . these drain holes 173 allow excess granular polysilicon to exit the cavity 171 . without these drain holes 173 , as with some previous valve designs , excess material can build up within the valve cavity 171 , causing the valve 41 to seize , wear , or fail . finally , the granular polysilicon passes through a lower body insert 177 ( fig2 , and 21 ). the lower body insert 177 is annular , fitting snugly within a mating cylindrical cavity formed in the lower body 55 of the valve 41 . the lower body insert 177 has a cylindrical passage 179 formed vertically through the insert . the cylindrical passage 179 is the last passage the granular polysilicon flows through as it travels through the valve 41 . the upper portion of the cylindrical passage 179 is defined by conical wall 181 , allowing the upper opening to be wider than the opening in the annular seat 155 or the ball valve member 101 . in the preferred embodiment , the lower body insert 177 is formed from single - crystal silicon so any insert wear creates particles within the flow of granular polysilicon that will not contaminate the system 31 because they are single - crystal silicon fragments . the valve 41 of the preferred embodiment is operable over a pressure range of between about full vacuum to about 517 kilo - pascals ( 75 pounds per square inch ). the use of stainless steel , polytetrafluoroethylene , and single - crystal silicon for valve parts allows the valve to function within the given pressure range . in addition , the valve parts are designed to allow adequate part clearance when they expand or contract due to environmental or process conditions . in view of the above , it will be seen that the several objects of the invention are achieved and other advantageous results attained . when introducing elements of the present invention or the preferred embodiment ( s ) thereof , the articles “ a ,” “ and “ the ,” and “ said ” are intended to mean that there are one or more of the elements . the terms “ comprising ,” “ including ,” and “ having ” are intended to be inclusive and mean that there may be additional elements other than the listed elements . as various changes could be made in the above without departing from the scope of the invention , it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . | 5 |
embodiments of the invention provide a combined submersible pump cable and air line . consequently , the air line benefits from being protected by one or more of the conductors , pvc sheathing , and / or pvc jacket of the submersible pump cable . by incorporating the pump cable and air line into one combined cable , embodiments of the invention provide additional convenience and increased protection to the air line compared to the conventional art . in the following detailed description , numerous exemplary embodiments of the invention will be described with reference to the attached figures . although the specification below may refer to “ an ”, “ one ”, “ another ”, or “ some ” embodiment ( s ) in several locations , this does not necessarily mean that each such reference is to the same embodiment ( s ), or that the feature described only applies to a single embodiment . fig1 is a perspective diagram illustrating a flat jacket submersible pump cable that is combined with an air line according to some embodiments of the invention . the submersible pump cable 100 includes four conductors 110 and one air line 130 . the conductors 110 may be composed of a single large copper wire or many small strands of copper wire twisted together . in alternative embodiments other metals may be used to form the conductors 110 . the conductors 110 are surrounded by pvc sheaths 120 that have ring - shaped cross sections . as shown in fig1 , the air line 130 may itself be a pvc sheath that has a ring - shaped cross section . the air line 130 defines a circular void 135 that runs the length of the air line 130 . the circular void 135 and the air line 130 together form the hollow tube that is used to measure the height of the water above the submersible pump . the submersible pump cable 100 also includes a flattened pvc jacket 140 that is disposed around the pvc sheaths 120 and the air line 130 . the pvc jacket 140 holds the pvc sheaths 120 and the air line 130 in a side by side , parallel configuration . although in these embodiments the air line 130 is positioned centrally among the conductors 110 , alternative embodiments may have the air line 130 in a different position relative to the conductors 110 and pvc sheaths 120 . consequently , according to the embodiments described above , a submersible pump cable 100 of the flat jacket type may also include an air line 130 within the pvc jacket 140 , thus providing additional durability to the air line 130 . additional convenience is provided because the air line 130 is incorporated into the submersible pump cable 100 , and the open end of the air line 130 is automatically positioned in a location that is in close proximity to the submerged pump . thus , a conventional pressure gauge may be attached to the upper end of the air line 130 without the hassle of making sure that the end of a conventional air line is positioned in close proximity to the submerged pump or properly secured to a conventional pump cable . fig2 is a perspective diagram illustrating a twisted submersible pump cable that is combined with an air line according to other embodiments of the invention . a submersible pump cable 200 includes four conductors 210 and one air line 230 . the conductors 210 may be composed of a single large copper wire or many small strands of copper wire twisted together . in alternative embodiments other metals may be used to form the conductors 210 . the conductors 210 are surrounded by pvc sheaths 220 that have ring - shaped cross sections . the air line 230 may itself be a pvc sheath that has a ring - shaped cross section . the air line 230 defines a circular void 235 that runs the length of the air line 230 . the circular void 235 and the air line 230 together form the hollow tube that is used to measure the height of the water above the submersible pump . in the embodiments illustrated in fig2 , the conductors 210 and their protective pvc sheaths 220 are twisted around the air line 230 , thereby protecting it from abrasion . this is the preferred embodiment . however , in alternative embodiments the air line 230 may be in a different position relative to the conductors 210 and pvc sheaths 220 . that is , instead of being centrally located among the twisted conductors 210 and pvc sheaths 220 , the air line 230 may itself be twisted together with the conductors 210 and sheaths 220 . consequently , according to the embodiments described above , a submersible pump cable 200 of the twisted type may also include an air line 230 centrally located among the twisted conductors 110 , thus providing additional durability to the air line 230 . additionally , since the air line 230 is now part of the submersible pump cable 200 , the open end of the air line 230 is automatically positioned in a location that is in close proximity to the submerged pump . thus , a conventional pressure gauge may be attached to the upper end of the air line 230 without the hassle of making sure that the end of a conventional air line is positioned in close proximity to the submerged pump or properly secured to a conventional pump cable . fig3 is a perspective diagram illustrating a flat jacket submersible pump cable 300 having a conductive air line 330 according to some other embodiments of the invention . referring to fig3 , the submersible pump cable 300 includes three conductors 310 and one conductive air line 330 . the conductors 310 may be composed of a single large copper wire or many small strands of copper wire twisted together . the conductors 310 are surrounded by insulating sheaths 320 that have ring - shaped cross sections . in some embodiments of the invention , the insulating sheaths 320 may be composed of pvc . the conductive air line 330 defines a circular void 335 that runs the length of the conductive air line . the circular void 335 and the conductive air line 330 together form the hollow tube that is used to measure the height of the water above the submersible pump . the conductive air line 330 may be composed of flexible copper tubing , or of some other conductive metal . thus , the conductive air line 330 is used to supply an electrical signal to the submersible air pump as well as to measure the height of the water above the air pump . the submersible pump cable 300 also includes a flattened insulating jacket 340 that is disposed around the insulating sheaths 320 and the conductive air line 330 . the insulating jacket 340 holds the insulating sheaths 320 and the conductive air line 330 in a side by side , parallel configuration . in some embodiments of the invention , the insulating jacket 340 may be composed of pvc . in alternative embodiments of the invention , one or more of the conductors 310 and its corresponding insulating sheath 320 may be replaced by another conductive air line 330 . the total number of conductors 310 and conductive air lines 330 present in the submersible pump cable 300 may be more or less than the embodiment illustrated in fig3 . according to other embodiments of the invention , a submersible pump cable may have a number of conductive air lines 330 and no conductors 310 / insulating sheaths 320 whatsoever . in the event that one of the conductive air lines 330 was ever damaged to the point where it ceased to effectively conduct current and / or hold air , an unused conductive air line 330 may be used . for example , for a conventional submersible pump that required four electrical connections and one air tube , a submersible pump cable consisting of six conductive air lines 330 would provide five spare air tubes and two spare electrical connections . fig4 is a perspective diagram illustrating another conductive air line 400 suitable for use with submersible pump cables according to still other embodiments of the invention . according to these embodiments , the conductive air line 400 consists of a conductive metal sheath 420 covering an air line 430 . in some embodiments , the air line 430 may be composed of plastic . the air line 430 defines a circular void 435 that runs the length of the air line . the circular void 435 and the air line 430 together form the hollow tube that is used to measure the height of the water above the submersible pump . in fig4 , the conductive metal sheath 420 is shown stripped off of the air line 430 for illustrative purposes . the conductive metal sheath 420 covering the air line 430 preferably consists of a conductive metal such as , e . g ., copper . the conductive metal sheath 420 is used to provide an electrical connection to an attached submersible pump ( not shown ). the conductive metal sheath 420 may increase the durability of the air line 430 by protecting it from abrasion . in alternative embodiments of the invention , the conductive metal sheath 420 may consist of a number of smaller , braided metal strands that surround the air line 430 . for example , the conductive metal sheath 420 may consist of a braided copper sheath surrounding the air line 430 . the conductive air line 400 may be incorporated into a flat jacket type submersible pump cable , for example , like the submersible pump cable 100 of fig1 . in this case the flat jacket type submersible cable will have a flattened pvc jacket that is similar to the pvc jacket 140 of fig1 . the pvc jacket further protects the conductive air line 400 and also prevents the conductive metal sheath 420 from being exposed to the surrounding liquid . in alternate embodiments , the conductive air line 400 may be incorporated into a twisted type submersible pump cable , for example , a twisted type submersible cable like the submersible pump cable 200 of fig2 . in this case the conductive air line 400 preferably has an additional insulative sheath ( not shown ) surrounding the conductive metal sheath 420 to further protect the air line 430 and also to prevent the conductive metal sheath 420 from being exposed to the surrounding liquid . fig5 is a cross - sectional diagram illustrating a twisted type submersible pump cable 500 having a conductive air line 550 according to still other embodiments of the invention . referring to fig5 , the submersible pump cable 500 includes three conductors 510 and one conductive air line 550 . the conductors 510 may be composed of a single large wire made of conductive metal , such as copper , or they may be composed of many smaller strands of conductive metal wire . the conductors 510 are surrounded by insulating sheaths 520 that have ring - shaped cross sections . in some embodiments of the invention , the insulating sheaths 520 may be composed of pvc . the conductive air line 550 defines a circular void 555 that runs the length of the conductive air line . the circular void 555 and the conductive air line 550 together form the hollow tube that is used to measure the height of the water above the submersible pump . the conductive air line 550 may be composed of flexible copper tubing , or of some other conductive metal . thus , the conductive air line 550 is used to supply an electrical signal to the submersible air pump as well as to measure the height of the water above the air pump . although not shown in fig5 , the conductive air line 550 and the conductors 510 / insulating sheaths 520 are twisted around each other , similar to the submersible pump cable 200 illustrated in fig2 . finally , an insulating jacket 560 surrounds the twisted conductive air line 550 and the insulating sheaths 520 to further protect the conductive air line 550 . in some embodiments of the invention , the insulating jacket 560 may be composed of pvc . similar to the embodiments of the invention described in fig1 and 2 , the embodiments described in fig3 , and 5 incorporate an air line directly into the submersible pump cable . having described several exemplary embodiments of the invention , it should be apparent that modifications and variations of the described embodiments that do not depart from the inventive concepts disclosed above will be obvious to those of skill in the art . for example , the flat jacket type of submersible pump cable and the twisted type of submersible pump cable described above are just two examples of submersible pump cables . other embodiments of the invention may include an air line together with another type of submersible pump cable . as yet another example , embodiments of the invention may also include more than one air line in the submersible pump cable . this would provide a backup air line if one of them became damaged or clogged . as another example , in the embodiments described above with respect to fig1 the protective pvc sheaths for the conductors had approximately the same diameter as the air line . in alternative embodiments , such as the embodiments described in fig2 , the diameter of the pvc sheaths may be smaller or larger than the diameter of the air line . as another example , the embodiments described above were assumed to be used in water pumping application . however , the embodiments described above may work equally well in applications where a liquid other than water is being pumped . finally , it should be apparent that even though the embodiments described above used copper conductors and pvc for the insulating material , alternative embodiments may use conductors of different metals and insulating material of different types . consequently , the scope of the invention should not be limited only to the embodiments described above , but to all embodiments as defined and encompassed by the attached claims . | 7 |
without limitation , some examples of the present invention will be described by way of illustration hereinafter . cholesterol ( 11 . 58 g , 30 . 00 mmol ), toluene ( 60 ml ), acetic anhydride ( 5 . 67 ml , 60 . 00 mmol ) and pyridine ( 1 ml , 12 . 41 mmol ) were placed in a reaction flask of 100 ml , magnetic stirred , heated to 114 ° c ., refluxed and reacted till no raw material is left . the reaction liquid was cooled , washed twice with 2 times amount of hydrochloric acid solution ( 0 . 10 %), washed twice with 2 times amount of saturated sodium chloride solution , washed twice with 2 times amount of distilled water , dried by anhydrous sodium sulfate , then subjected to vacuum distillation to recover toluene , finally a white solid ( 12 . 84 g ) was obtained . the yield is 100 . 0 %, and the hydrogen and carbon nmr spectra of compound 3 are as follows : 1 hnmr ( 500 mhz , cdcl 3 ): 0 . 68 ( s , 3h , h - 18 ), 0 . 86 ( d , 3h , j = 2 hz , h - 26 ), 0 . 87 ( d , 3h , j = 2 hz , h - 27 ), 0 . 91 ( d , 3h , j = 4 . 4 hz , h - 21 ), 1 . 02 ( s , 3h , h - 19 ), 2 . 03 ( s , 3h , h - 2 ′), 2 . 32 ( dd , 2h , h - 4 ), 4 . 60 ( m , 1 h , h - 3 ), 5 . 39 ( t , 1h , h - 6 ); 13 cnmr ( 500 mhz , cdcl 3 ): 36 . 6 ( c - 1 ), 31 . 9 ( c - 2 ), 74 . 0 ( c - 3 ), 39 . 7 ( c - 4 ), 140 . 0 ( c - 5 ), 122 . 7 ( c - 6 ), 28 . 2 ( c - 7 ), 31 . 8 ( c - 8 ), 50 . 0 ( c - 9 ), 38 . 1 ( c - 10 ), 21 . 0 ( c - 11 ), 37 . 0 ( c - 12 ), 42 . 3 ( c - 13 ), 56 . 1 ( c - 14 ), 24 . 3 ( c - 15 ), 27 . 8 ( c - 16 ), 56 . 7 ( c - 17 ), 11 . 9 ( c - 18 ), 19 . 3 ( c - 19 ), 35 . 8 ( c - 20 ), 18 . 7 ( c - 21 ), 36 . 2 ( c - 22 ), 23 . 8 ( c - 23 ), 39 . 5 ( c - 24 ), 28 . 0 ( c - 25 ), 22 . 6 ( c - 26 ), 22 . 8 ( c - 27 ), 170 . 6 ( c - 1 ′), 21 . 5 ( c - 2 ′). cholesteryl acetate ( 4 . 28 g , 10 . 00 mmol ), carbon tetrachloride ( 30 ml ) and nbs ( 1 . 78 g , 10 . 00 mmol ) were placed in a reaction flask of 50 ml , exposed to fluorescent light , refluxed at 74 ° c . and reacted till no raw material is left . the reaction liquid was cooled , subjected to air pump filtration , washed with a little amount of carbon tetrachloride , subjected to vacuum distillation to recover carbon tetrachloride , finally an orange - yellow , oil - like liquid was obtained . the orange - yellow , oil - like liquid was added to toluene ( 50 ml ) and 2 , 6 - dimethylpyridine ( 5 ml ), placed in a reaction flask of 100 ml , magnetic stirred , heated to 114 ° c ., refluxed and reacted till no raw material is left . the reaction liquid was cooled , washed twice with 2 times amount of hydrochloric acid solution ( 0 . 10 %), washed twice with 2 times amount of saturated sodium chloride solution , washed twice with 2 times amount of distilled water , dried by anhydrous sodium sulfate , then subjected to vacuum distillation to recover toluene , dissolved in absolute ethyl alcohol , subjected to repeated crystallization to obtain 3 . 54 g of a white solid , with a yield of 85 . 5 %. the hydrogen and carbon nmr spectra of compound 5 are as follows : 1 hnmr ( 500 mhz , cdcl 3 ): 0 . 62 ( s , 3h , h - 18 ), 0 . 87 ( d , 3h , j = 2 hz , h - 26 ), 0 . 87 ( d , 3h , j = 2 hz , h - 27 ), 0 . 94 ( d , 3h , j = 4 . 4 hz , h - 21 ), 0 . 99 ( s , 3h , h - 19 ), 2 . 04 ( s , 3h , h - 2 ′), 2 . 38 ( m , 1h , h - 4 - a ), 2 . 50 ( m , 1h , h - 4 - b ) 4 . 70 ( m , 1h , h - 3 ), 5 . 39 ( d , 1h , j = 2 hz , h - 7 ), 5 . 59 ( d , 1h , j = 2 hz , h - 6 ) 13 cnmr ( 500 mhz , cdcl 3 ): 36 . 6 ( c - 1 ), 28 . 1 ( c - 2 ), 72 . 8 ( c - 3 ), 37 . 9 ( c - 4 ), 141 . 6 ( c - 5 ), 120 . 2 ( c - 6 ), 116 . 2 ( c - 7 ), 138 . 5 ( c - 8 ), 46 . 0 ( c - 9 ), 39 . 5 ( c - 10 ), 21 . 5 ( c - 11 ), 37 . 1 ( c - 12 ), 42 . 9 ( c - 13 ), 55 . 4 ( c - 14 ), 23 . 9 ( c - 15 ), 28 . 1 ( c - 16 ), 55 . 8 ( c - 17 ), 11 . 8 ( c - 18 ), 18 . 4 ( c - 19 ), 36 . 2 ( c - 20 ), 16 . 2 ( c - 21 ), 36 . 1 ( c - 22 ), 23 . 0 ( c - 23 ), 39 . 1 ( c - 24 ), 28 . 1 ( c - 25 ), 22 . 6 ( c - 26 ), 22 . 8 ( c - 27 ), 170 . 6 ( c - 1 ′), 21 . 0 ( c - 2 ′). 7 - dehydrocholesten - 3 - ol acetate ( compound 5 ) ( 2 . 07 g , 5 mmol ), ethanol ( 50 ml ) and sodium hydroxide solution ( 10 %, 50 ml ) were placed in a reaction flask of 250 ml , reacted at 80 ° c . till no raw material is left . the reaction liquid was subjected to vacuum distillation to recover the remained ethanol , extracted once with one time amount of ethyl acetate , washed with distilled water to neutral , and dried by anhydrous sodium sulfate . after recovering of ethyl acetate , the resulting solid was subjected to repeated crystallization with ethanol to obtain 1 . 85 g of 5 , 7 - diene cholesterol , with a yield of 96 . 4 %. the hydrogen nmr spectrum of compound 6 is as follows : 1 hnmr ( 500 mhz , cdcl 3 ): 0 . 62 ( s , 3h , h - 18 ), 0 . 86 ( d , 3h , j = 2 hz , h - 26 ), 0 . 88 ( d , 3h , j = 2 hz , h - 27 ), 0 . 94 ( s , 3h , h - 19 ), 1 . 22 ( d , 3h , j = 12 hz , h - 21 ), 2 . 33 ( dd , 1h , h - 4 - a ), 2 . 49 ( dd , 1h , h - 4 - b ), 3 . 66 ( m , 1h , h - 3 ), 4 . 03 ( m , 1h , 3 - oh ), 5 . 39 ( m , 1h , h - 7 ), 5 . 68 ( dd , 1h , h - 6 ). 5 , 7 - diene cholesterol ( 1 . 15 g , about 3 mmol ), eosin y ( 200 mg , about 0 . 31 mmol , dissolved in alcohol ) and absolute ethanol ( 100 ml , 10 . 00 mmol ) were placed in a reaction flask of 250 ml . after blowing air into the reaction liquid , the latter was exposed to fluorescent light , reacted till no raw material is left , distilled to recover the absolute ethanol until a certain volume is achieved , stood for crystallization to obtain 0 . 94 g of 5α , 8α - cyclicobioxygen - 6 - cholesten - 3 - ol , with a yield of 75 . 3 %. 1 hnmr ( 500 mhz , cdcl 3 ): 0 . 80 ( s , 3h , h - 18 ), 0 . 85 ( d , 3h , j = 2 hz , h - 26 ), 0 . 88 ( d , 3h , j = 2 hz , h - 27 ), 0 . 88 ( s , 3h , h - 19 ), 0 . 91 ( d , 3h , j = 12 hz , h - 21 ), 3 . 97 ( m , 1h , h - 3 ), 6 . 23 ( d , 1h , j = 7 hz , h - 7 ), 6 . 51 ( d , 1h , j = 7 hz , h - 6 ); 13 cnmr ( 500 mhz , cdcl 3 ): 36 . 0 ( c - 1 ), 28 . 3 ( c - 2 ), 66 . 5 ( c - 3 ), 39 . 4 ( c - 4 ), 82 . 2 ( c - 5 ), 135 . 4 ( c - 6 ), 130 . 8 ( c - 7 ), 79 . 5 ( c - 8 ), 51 . 1 ( c - 9 ), 35 . 2 ( c - 10 ), 20 . 6 ( c - 11 ), 34 . 7 ( c - 12 ), 44 . 8 ( c - 13 ), 52 . 0 ( c - 14 ), 23 . 4 ( c - 15 ), 30 . 1 ( c - 16 ), 56 . 4 ( c - 17 ), 12 . 7 ( c - 18 ), 18 . 2 ( c - 19 ), 36 . 9 ( c - 20 ), 19 . 0 ( c - 21 ), 36 . 9 ( c - 22 ), 23 . 8 ( c - 23 ), 37 . 0 ( c - 24 ), 28 . 0 ( c - 25 ), 22 . 6 ( c - 26 ), 22 . 8 ( c - 27 ). 5α , 8α - cyclicobioxygen - 6 - cholesten - 3 - ol ( compound 7 ) ( 0 . 62 g , about 1 . 5 mmol ) was dissolved in acetone ( 50 ml ) in a reaction flask of 100 ml , slowly added by drops of chromic acid solution ( 1 . 6 mmol ) under ice - water bath , reacted till no raw material is left . the reaction liquid was poured into an ice - water mixture ( 600 ml ), stirred , stood for a whole night , and then subjected to air pump filtration . the filter cake was subjected to repeated crystallization with ethanol to obtain 0 . 62 g of 5α , 8α - cyclicobioxygen - 6 - cholesten - 3 - one , with a yield of 96 . 1 %. 1 hnmr ( 500 mhz , cdcl 3 ): 0 . 85 ( s , 3h , h - 19 ), 0 . 88 ( d , 3h , j = 2 hz , h - 26 ), 0 . 89 ( d , 3h , j = 2 hz , h - 27 ), 0 . 92 ( d , 3h , j = 6 . 5 hz , h - 21 ), 1 . 07 ( s , 3h , h - 18 ), 3 . 97 ( m , 1h , h - 3 ), 6 . 29 ( d , 1h , j = 8 . 5 hz , h - 7 ), 6 . 59 ( d , 1h , j = 8 . 5 hz , h - 6 ); 13 cnmr ( 500 mhz , cdcl 3 ): 36 . 7 ( c - 1 ), 35 . 3 ( c - 2 ), 207 . 0 ( c - 3 ), 43 . 6 ( c - 4 ), 83 . 4 ( c - 5 ), 134 . 2 ( c - 6 ), 131 . 6 ( c - 7 ), 80 . 0 ( c - 8 ), 51 . 1 ( c - 9 ), 39 . 4 ( c - 10 ), 20 . 5 ( c - 11 ), 37 . 3 ( c - 12 ), 44 . 9 ( c - 13 ), 51 . 4 ( c - 14 ), 23 . 8 ( c - 15 ), 28 . 2 ( c - 16 ), 56 . 4 ( c - 17 ), 12 . 8 ( c - 18 ), 18 . 5 ( c - 19 ), 35 . 2 ( c - 20 ), 17 . 5 ( c - 21 ), 35 . 9 ( c - 22 ), 23 . 5 ( c - 23 ), 39 . 3 ( c - 24 ), 28 . 0 ( c - 25 ), 22 . 5 ( c - 26 ), 22 . 8 ( c - 27 ). assessment of the effect of cl168 - 6 on the proliferation of a human hepatoma cell hepg2 , a human lung cancer cell a549 and a human immortalized fibroblast cell nih3t3 through mtt assay the human hepatoma cells hepg2 and the human lung cancer cells a549 were cultivated by the pla institute of infectious disease to assume the viability , while the human immortalized fibroblast cells nih3t3 were bought from the academy of military medical sciences . cl168 - 6 , prepared by ourselves , which had a purity of equal to or more than 98 % evaluated by high pressure liquid chromatography ( hplc ) and therefore met the experimental requirements . the powder of said cl168 - 6 , which had been previously sealed and stored in 4 ° c ., was dissolved in dimethyl sulfoxide ( dmso ) to obtain a stock solution of 1 ml / mg for later use . the human hepatoma cells hepg2 , human lung cancer cells a549 and nih3t3 cells were recovered , and subcultured in culture flasks . once the cells grew to the logarithmic phase , the experiment can be started . the cells were digested by high - pressure filtered trypsin to prepare a cell - containing suspension , dyed for 3 minutes with 0 . 4 % trypan blue , and then counted with the blood - cell counter ( living cells were not colored , while dead cells were stained blue ). the percentages of living cells evaluated by trypan blue exclusion were all up to more than 98 %. the three types of cells in logarithmic phase were seeded in 96 - well plates with a density of 1 × 10 4 / ml ( 200 μl / well ), and then cultivated for 24 hours at 37 ° c . in 5 % co 2 cultivable box . the culture media was aspirated and discarded . 200 ul cl168 - 6 solutions of different concentration ( with a final concentration respectively of 10 μg , 5 μg , 2 . 5 μg and 0 μg / ml prepared with a culture medium of 4 % calf serum in dmem ) were added , wherein for each concentration there were 6 parallel wells . after cultivating for 24 hours and 48 hours , 100 ul supernatant was carefully aspirated and discarded , respectively . mts ( 20 μl / well ) was added and mixed evenly . the mixture was cultivated for 1 hour at 37 ° c . in 5 % co 2 cultivable box . the absorbency at 492 nm was determined by quantitative enzyme - linked immunosorbent assay ( elisa ). the experiment was repeated for three times . the growth inhibition rate was calculated as follows . growth inhibition rate (%)=[( mean od value of control group − mean od value of treatment group )/ mean od value of control group ]× 100 % cl168 - 6 has a significant inhibition effect on the proliferation of the human hepatoma cell hepg2 and the human lung cancer cell a549 cultivated in vitro , and shows dose - dependent ; the relevant results are listed in table 1 - 1 . when treated by the drug with a concentration of 2 . 5 μg / ml for 24 hours , the inhibition rate is 52 . 85 % and 48 . 69 % respectively for hepg2 cells and a549 cells . the inhibition rate will increase with the increasing of the drug concentration ; when the drug concentration is 10 μg / ml , the inhibition rate to the above two types of cells is respectively up to 64 . 39 % and 62 . 40 %; when after 48 hours and the dosage is 2 . 5 μg / ml , the inhibition rate to hepg2 and a549 cells is respectively up to 59 . 83 % and 51 . 91 %; when the concentration is 10 the rate to hepg2 and a549 is respectively 73 . 67 % and 69 . 67 %. compared with the situation of nih3t3 cells , the inhibition of cl168 - 6 to hepg2 and a549 shows significant difference in groups with different concentration and treatment time ( p & lt ; 0 . 05 ). the experimental results show that the inhibition effect of cl168 - 6 to cells has a good selectivity , and the effect is positive correlated to the drug concentration and medication time . cl168 - 6 can significantly inhibit the multiplication of human hepatoma cells hepg2 and human lung cancer cells a549 . assessment of the effect of cl168 - 6 on tumor angiogenesis through cam assay german roman embryonated eggs ( each weight 50 - 60 g , obtained from the embryo experimental center of china agricultural university ). cl168 - 6 , prepared by ourselves , which had a purity of equal to or more than 98 % evaluated by high pressure liquid chromatography ( hplc ) and therefore met the experimental requirements . the powder of said cl168 - 6 was sealed and stored in 4 ° c . a sterile gelatin sponge , previously made into disks with diameter of 5 mm by a hole puncher , was used as sample carrier . cl168 - 6 was dissolved in 70 % ethanol to prepare a solution with a concentration of 2 mg / 5 ml . there were 3 dose groups , wherein 5 μl ( low dose group , with a dose volume of 2 μg / embryo ), 10 μl ( middle dose group , with a dose volume of 4 μg / embryo ), and 20 μl ( high dose group , with a dose volume of 8 μg / embryo ) of the solution were added respectively into gelatin sponge slices by a quantitative liquid transfer . the sponge slices were dried in the sterile environment . 2 . 2 embryo incubation and process for removing air chamber of the embryo egg a sterilized egg was placed into a 37 ° c . incubator with its air chamber upward . in the 7 th day , the embryo was positioned on a super - clean bench and sterilized by ethanol , and then it was drilled by a dental drill to form a little hole in the top of the embryo . egg shell and shell membrane around the hole were carefully removed to form an opening of about 1 . 2 cm × 1 . 2 cm ; after determining a sample - adding site , the air chamber membrane was carefully pricked at the separation place between the chamber and the yolk by a syringe needle ; through the prick hole 1 - 2 drops of sterilized water was injected , which made the chamber membrane and the cam membrane be separated ; after gently removing the upper layer of the chamber membrane with forceps , the cam membrane in the lower layer was exposed . a drug - containing carrier was placed , at the junction area of the cam membrane and the yolk sac membrane , on a site where vessels were less , and then sealed with sterilized transparent adhesive tape to continue to incubate for 72 hours . after the incubation , the transparent adhesive tape stopped on the top of the air chamber was gently removed by forceps ; a mixture of methanol / acetone ( 1 : 1 , 1 - 2 ml ) was gently added ; the room temperature was remained constant for 10 minutes . then , the cam membrane was carefully peeled off and placed on a glass slide for observing and taking photos . the effect of the compound on angiogenesis was assessed by counting the numbers of large , middle , small blood vessels radiated by the carrier . all the data were statistical analyzed by spss 11 . 0 software package ; the comparison of the counting data was verified by x 2 test . since p & lt ; 0 . 05 , all had statistical significance . fig1 illustrates the effect of cl168 - 6 on cam vessels and the blank control . the numbers of minute vessels of the three dose groups of cl168 - 6 are compared with that of the blank group respectively ; for all the three groups significant differences are found , and dose - dependent is showed . the results are listed in table 2 - 1 , which indicate that the compound has a certain inhibition effect on the growth of angiogenesis . statistical table about effect of cl168 - 6 on cam vessels with analysis compared with the blank control group , * p & lt ; 0 . 05 , ** p & lt ; 0 . 01 . cl168 - 6 has a significantly inhibition effect on tumor angiogenesis , and said effect is dependent on the amount of the drug . healthy female balb / c mice , each weight 18 - 22 g , were bought from experimental animal center of the academy of military medical sciences ( certification no . scxk -( military ) 2007 - 004 ). mouse hepatoma cells h22 was cultivated by our laboratory to assume the viability ; mouse sarcoma cells s180 were presented by the institute of chinese medicine of 302 hospital ; tumor - bearing ascites mice s180 , h22 were subcultured once every 7 days . cl168 - 6 , prepared by ourselves , which had a purity of equal to or more than 98 % evaluated by high pressure liquid chromatography ( hplc ) and therefore met the experimental requirements . the powder of said cl168 - 6 was sealed and stored in 4 ° c . ascites mice s180 and h22 that had been vaccinated 7 days were sacrificed by cervical , from which ascites were obtained under sterile conditions respectively ; the obtained ascites were washed twice with culture medium rpmi1640 , and prepared to a 2 × 10 7 / ml suspension in sterile physiological saline . the suspension of cell s180 was inoculated subcutaneously in the right axillas of 40 mice ( 0 . 1 ml / mouse ) to produce solid tumor models ; while the suspension of cell h22 was inoculated in abdominal cavities of 40 mice ( 0 . 2 ml / mouse ) by conditional means under sterile conditions to produce ascites tumor models . 90 mice were randomly divided into 9 groups of 3 types , wherein the first type group was a normal control group , the second type groups were s180 solid tumor groups including a positive ( cyclophosphamide ) control group , a negative control group , a low dose group and a high dose group , and the third type groups were h22 ascites groups including a positive ( cyclophosphamide ) control group , a negative control group , a low dose group and a high dose group . there were 10 mice in each group . the experiment was repeated for three times . cl168 - 6 was prepared as emulsions in corn oil . the low dose group was injected with the dose of 16 mg / kg , the high dose group was injected with the dose of 32 mg / kg , the negative control group was injected same volume of corn oil , and the positive control group was injected cyclophosphamide injection solution with the dose of 0 . 02 g /( kg . d ). the used injection volume was 0 . 1 ml / mouse and the injection was given as intraperitoneal injection every other day for 15 days . during the 15 days , general activities , fur , feces , etc . of the mice were daily observed . 24 hours after the last administration , mice that had been inoculated subcutaneously with s180 were sacrificed by cervical , from which tumors , thymus and spleen were taken out . after the last administration , mice that had been inoculated in abdominal cavities with h22 were conventionally bred continually , weighted and observed the survival time every day until all the mice in the negative group were dead . 24 hours after the inoculation of ascites , the weight and the amount of abdominal circumference of the mice in the groups of ascites models were measured . the drug administration and breeding were continued according to different groups , the weight and the abdominal circumference were measured daily until one day before death . the weight increase ( g ) and abdominal - circumference increase ( cm ) were calculated . the experiment started on the day of tumor inoculation and ended on the day when all the mice in the negative control group were dead ; the time of deaths were recorded , and the survival extending rate was calculated . survival extending rate (%)=[( mean survival days of treatment group − mean survival days of negative control group )/ mean survival days of control group ]× 100 % after finishing the administration in all mice in the solid tumor group , the mice were sacrificed and their spleens and livers were weighed by electronic balance . the spleen index was equivalent to the spleen weight ( mg ) of mice in each group divided by the weight of the mice , while the liver index was equivalent to the liver weight ( 100 g ) divided by the weight ( g ) of the mice . on the next day after drug withdrawal , the mice in the solid - tumor negative - control group were weighed and sacrificed by cervical , wherein the serum was collected by eye bleeding for later use in subsequent experiments . tumor tissues were dissected and weighed by electronic balance . the tumor inhibition rate was calculated as follows . tumor inhibition rate (%)=[( mean tumor weight of negative control group − mean tumor weight of treatment group )/ mean tumor weight of control group ]× 100 % all the data were statistical analyzed by spss 11 . 0 software package ; the comparison of the counting data was verified by x 2 test . since p & lt ; 0 . 05 , all had statistical significance . 3 . 1 change of weight , abdominal circumference and survival time of mice in the groups as shown in table 3 - 1 , mice in cl168 - 6 low and high dose groups had longer survival time than that in the negative control group , and the relevant survival extending rates were 37 . 11 % and 51 . 55 %, respectively . the mice in the treatment group had a smaller increase of abdominal circumference than that in the negative group , and the normal growth of those treated mice wasn &# 39 ; t affected by said increase . the weight of mice in the cyclophosphamide injected group increased slowly , only had an increase of 3 . 42 g , while the mice in the normal group had a weight increase of 6 . 72 g . fig2 illustrates a statistical chart on survival time of h22 ascites mice . and survival time of mice in various groups ( x ± s ) 1 . compared with the normal control group : { circle around ( 1 )} p & lt ; 0 . 05 , { circle around ( 2 )} p & lt ; 0 . 01 ; 2 . compared with the negative control group : { circle around ( 3 )} p & lt ; 0 . 05 , { circle around ( 4 )} p & lt ; 0 . 01 . 3 . 2 change of liver index and spleen index of mice in various groups as shown in table 3 - 2 , both the liver index and the spleen index of the ascites mice in cyclophosphamide group were respectively lower than that of the mice in the negative control group , therefore they had statistical significance . while all the indexes of cl168 - 6 low and high dose groups were larger than that of the negative control group . 1 . compared with the normal control group : { circle around ( 1 )} p & lt ; 0 . 05 , { circle around ( 2 )} p & lt ; 0 . 01 ; 2 . compared with the negative control group : { circle around ( 3 )} p & lt ; 0 . 05 , { circle around ( 4 )} p & lt ; 0 . 01 . cl168 - 6 had no effect on the weight increase of a s180 sarcoma mouse , while the weight increase of mice in the positive control group was a little small . the tumor inhibition rates of the tumor - bearing s180 sarcoma mice in the low and high dose group were 44 . 33 % and 54 . 58 % respectively ; and compared with the negative control group , the high dose group had statistical significance . the results are shown in table 3 - 3 . tumor bodies of mice in all the groups are illustrated in fig3 . inhibition effect of cl168 - 6 on s180 sarcoma of mice ( x ± s ) 1 . compared with the normal control group : { circle around ( 1 )} p & lt ; 0 . 05 , { circle around ( 2 )} p & lt ; 0 . 01 ; 2 . compared with the negative control group : { circle around ( 3 )} p & lt ; 0 . 05 , { circle around ( 4 )} p & lt ; 0 . 01 . 3 . 4 change of liver and spleen indexes of s180 mice in the groups as shown in table 3 - 4 , the liver and spleen indexes of the s180 mice in the cyclophosphamide group are lower than that of the negative group , and therefore have statistical significance . while the spleen indexes of mice in the cl168 - 6 low and high dose groups are higher than that of mice in the negative group , and there is significant difference therebetween ; however , there is no significant difference between the relevant liver indexes . 1 . compared with the normal control group : { circle around ( 1 )} p & lt ; 0 . 05 , { circle around ( 2 )} p & lt ; 0 . 01 ; 2 . compared with the negative control group : { circle around ( 3 )} p & lt ; 0 . 05 , { circle around ( 4 )} p & lt ; 0 . 01 . 4 . 1 cl168 - 6 can significantly inhibit the growth of s180 mouse sarcoma . 4 . 2 cl168 - 6 can improve the spleen index of a tumor - bearing mouse . 4 . 3 cl168 - 6 can extend the survival time of a tumor - bearing mouse . 4 . 4 cl168 - 6 can dissipate the ascites or delay the ascites generating in a h22 mouse . it has been a hot topic in tumor treatment research to study the mechanisms of tumor cell apoptosis and signal transduction , selectively block the signaling pathways of tumor cells , and destroy their self - controlling growth regulatory mechanisms . p53 , bcl - 2 , p21 , vegf are crucial molecules in the growth or apoptosis of tumor cells . the instant experiment studied the cl168 - 6 anti - tumor mechanism at molecular level . for the details , please refer to resulting examples 1 and 3 1 . detecting vegf in mouse - eye serum ( for the details , please refer to resulting examples 1 and 3 ) before taking tumors out , blood was collected by eye bleeding from mice in the four groups , i . e . the negative control group , the positive ctx control group , the high dose ( 32 mg / kg ) group and the low dose ( 16 mg / kg ) group . 1 . 2 adding the prepared samples and standards , and reacting for 90 minutes at 37 ° c . ; 1 . 3 washing the plate twice , adding biotinylated antibody working solution , and reacting for 60 minutes at 37 ° c . ; 1 . 4 washing the plate for three times , adding abc working solution , and reacting for 30 minutes at 37 ° c . ; 1 . 5 washing the plate for five times , adding tmb color liquid , and reacting in dark for 15 minutes at 37 ° c . ; 1 . 6 adding tmb stop solution , and measuring od value at 450 nm . 2 . 0 μg / ml cl168 - 6 worked on hepg2 cells for 24 hours and 48 hours . 2 . 1 . 1 hepg2 cells were digested by trypsin in the cell culture medium . the resulting mixture ( 6000 was centrifuged for 5 minutes at 4 ° c . to collect the cells . the supernatant was carefully aspirated and discarded . the remains were washed once with pbs , added to lysate ( 100 μl / 2 × 10 6 cells ); and then , after resuspending the precipitation , ice cracked for 15 minutes . 2 . 1 . 2 the resulting mixture ( 16000 g ) was centrifuged at 4 ° c . for 15 minutes . 2 . 1 . 3 the supernatant was transferred into a centrifugal tube that was pre - cooled by ice bath . 2 . 2 . 1 took out pna and a suitable amount of ac - devd - pna ( 2 mm ), put them on the ice bath for later use ; 2 . 2 . 3 incubating at 37 ° c . for 120 minutes , detecting caspase 3 with a405 ; 2 . 2 . 4 adding ac - ietd - pna ( 2 mm ) and ac - lehd - pna ( 2 mm ), respectively , for detecting caspase 8 , 9 3 . detecting the activity of tumor cells vegf , p53 , p21 , bcl - 2 ( taking β - actin as an internal reference ) a bean sized tumor tissue dissected previously was shredded and put into a pre - cooled tissue grinder . 400 μl tissue lysis solution was added . after 10 minutes carefully grinding , the mixture was transferred into a 1 . 5 ml centrifugal tube , and then , after intensely vortexing the tube for 15 seconds , the mixture was placed on ice for 10 minutes and repeatedly oscillated . after centrifuging 20 minutes ( 12000 rpm ), the supernatant was collected , transferred into a pre - cooled eppendorf tube , and then separately charged and frozen stored at − 80 ° c . for detecting the activity level of various antibodies . 3 . 2 . 1 preparation of standard series ( table 4 - 1 ): standard in kit was diluted in series according to the specification thereof to prepare standard solutions with concentrations of 2000 μg / ml , 1500 μg / ml , 1000 μg / ml , 750 μg / ml , 500 μg / ml , 250 μg / ml , 125 μg / ml and 25 μg / ml . 3 . 2 . 2 preparation of working solution : solution a and solution b ( 50 : 1 ) were mixed for later use . 3 . 2 . 3 the sample to be detected was diluted to 20 fold dilution . 10 μl sample and 10 μl standard were each added into three wells of a 96 - well elisa plate . 200 μl working solution was added and mixed . the mixture was reacted at 37 ° c . for 30 minutes . 3 . 2 . 4 the elisa plate was taken out , cooled to room temperature , and measured absorbance value at 562 nm . standard curve was drawn according to the standards , and protein content of the samples to be measured was calculated by using the standard curve . 3 . 3 . 1 preparation of protein samples : suitable amount of each sample was added to 4 protein sample buffer and 1 protein sample buffer , mixed to make each have a volume of 300 μl and a concentration of 3 . 7 μg / μl , heated 3 - 5 minutes in hot water for denaturation , centrifuged in short time with high speed , and then stored at − 20 ° c . for later use . 3 . 3 . 2 preparing 12 % separation gel and 4 % stacking gel and pouring gel : please refer to table 4 - 2 . when preparing separation gel and stacking gel , in order to prevent the gel from curing too early , temed should be added before pouring the gel . firstly , the separation gel was poured into interlayer of glasses ; then the upper gel surface was sealed by distilled water to maintain a flat gel surface . secondly , when the separation gel was cured and the distilled water was absorbed out , the mixture was washed with distilled water for several times to remove the acrylamide that was not polymerized . finally , when the distilled water was absorbed out again , a sample application comb was inserted in , with the front edge thereof being 0 . 5 cm away from the separation gel . 3 . 3 . 3 sample addition : when the gel cured at room temperature , an electrophoretic buffer was poured into a electrophoresis tank ; after unplugging a sample loading comb , suitable volumes of samples to be assayed were respectively added into comb wells by micropipette according to the concentrations of cytoplasmic protein . 3 . 3 . 4 electrophoresis : after adding sample , connecting power supply , firstly setting the voltage at 120v and during this period the sample was stacked as a line in the stacking gel and the front edge of the sample entered into the separation gel ; then setting the voltage at 100v and during this period conducting constant voltage electrophoresis for 120 minutes ; finally , shutting off the power supply when bromophenol blue indicator reached the bottom edge of the gel . 3 . 4 . 1 electrotransfer : pvdf film was firstly soaked in absolute methanol for 30 seconds to make it be transparent , and then soaked in distilled water for 10 minutes , finally soaked with whatman paper in transfer buffer . the gel was removed . the filter paper , gel , pvdf film and filter paper were placed in order with avoiding shortcut by ensuring the sizes of both sides of the papers , fixed and inserted into an electrotransfer tank with ensuring the gel in the cathode direction and the pvdf film in the anode direction . the electrotransfer performed for 3 hours at 80v , 4 ° c . 3 . 4 . 2 sealing : after the electrotransfer , the pvdf film was taken out , sealed by a 5 % bsa blocking buffer ( resolved in a 1 tbst solution ) at room temperature for 3 hours , and then oscillating washed with tbst for 3 times , each for 10 minutes . 3 . 4 . 3 reaction with the first antibody : the first antibody was diluted by tbst solution at a ratio of 1 : 200 , and then reacted with the pvdf film at 4 ° c . for a night . in the next day , after balanced at room temperature for one hour , the reaction mixture was washed with tbst for 3 times . 3 . 4 . 4 reaction with the second antibody : the corresponding hrp - conjugated second antibody was diluted by tbst solution at a ratio of 1 : 2000 , reacted with the pvdf film at room temperature for 2 hours , and then washed with tbst for 3 times . 3 . 4 . 5 development and fixation : substrate solutions a and b were mixed at a ratio of 1 : 1 . the mixture was dropped on the pvdf film , incubated 5 minutes at room temperature , and , after the excess liquid on the film was removed , the remaining substances were enclosed with plastic wrap to prevent babbles from existing between the pvdf film and the plastic film . the following procedures included lamination , exposure , development , 1 minute double - distilled water washing , and 1 minute snapshot . 3 . 4 . 6 the scanned developing photos were subjected to optical density analysis via the software of alpha ease fc4 . 0 , which took the average light intensity of b - actin bands as an inner reference value , and showed the results as a ratio of the corresponding protein levels to β - actin . all the data were statistical analyzed by spss 11 . 0 software package ; data of normal distribution and variance homogeneity were studied by t test . if the data did not meet normal distribution or variance homogeneity , the non - parametric test was used . as shown in table 4 - 3 and fig4 , the optical density value ( od value ) of serum vegf of mice in high dose group is 0 . 1937 , when compared with the od value 0 . 2200 of the negative control group , p = 0 . 0037 ; for the low dose group , when compared with the negative control group , p = 0 . 0259 , both have statistical significance . compared with the negative control , □ p & lt ; 0 . 05 , □ p & lt ; 0 . 01 . after cl168 - 6 working on hepg2 cells for 24 hours and 48 hours , the activity of caspase 3 , 8 , 9 was determined and the relevant results were shown in table 4 - 4 and fig6 . activities of the three caspases were not significantly increased , and therefore have no statistical significance . 3 . 1 determination of cell extract protein concentrations ( fig7 ) protein standard curve was drawn according to the concentrations ( x ) and absorbencies ( y ) of the bsa standards . linear equation y = 2 . 22x − 0 . 02 was obtained by using the standard curve , wherein y represents concentrations of the diluted samples , and x represents absorbencies . as shown in fig3 . 3 , that related coefficient r = 1 . 00 means good correlation of the linear equation . the corresponding protein concentration ( x ) was calculated based on the determined absorbance value ( y ). during protein electrophoresis , the total protein amounts of samples on each well were consistent to one another . the three groups were a negative control group , a positive control group ( ctx ) and a cl168 - 6 experimental group . β - actin was inner reference standard . for the experimental group , the relative expression level of p53 was 0 . 74 ± 0 . 03 ; while for the negative control group , it was 0 . 32 ± 0 . 05 ; there was significant difference between the two groups , p = 0 . 002 . ( fig8 ) for the experimental group , the relative expression level of bcl - 2 was 0 . 75 ± 0 . 04 ; while for the negative control group , it was 0 . 31 ± 0 . 01 ; p = 0 . 000 ; both of the two groups had statistical significance . ( fig9 ) for the experimental group , the relative expression level of vegf was 0 . 46 ± 0 . 08 ; while for the negative control group , it was 0 . 71 ± 0 . 05 ; there was significant difference between the two groups , p = 0 . 04 . ( fig1 ) for the experimental group , the relative expression level of p21 was 0 . 79 ± 0 . 07 ; while for the negative control group , it was 0 . 76 ± 0 . 06 ; there was no significant difference between the two groups , p = 0 . 73 . ( fig1 ) the present experimental study shows that cl168 - 6 can decrease the vegf level in eye blood of a tumor - bearing mouse ; at the same time , the level of vegf protein expression in the tumor had a downward trend . cl168 - 6 can inhibit tumor proliferation by reducing the activity of vefg . our experiment shows that cl168 - 6 had no significant effect on the activities of caspase 3 , 8 , 9 . it is supposed that cl168 - 6 - induced apoptosis in hepg2 cells may not depend on the activation of these three enzymes . in the present experiment , since expression levels of p21 protein of the control group and the treatment group had no statistical significance , it can be concluded preliminarily that the tumor - inhibitory effect of cl168 - 6 is not achieved by the signal transduction pathway of p53 → p21 . it was found in the experiment that , the expression level of bcl - 2 protein of the treatment group was significantly lower than that of the negative control group . it can be concluded that cl168 - 6 can achieve the tumor - inhibitory effect by reducing the expression level of bcl - 2 protein . the specific mechanism is to be further explored . p53 gene has two types . one is wild type p53 , i . e . wtp53 , the other is mutant type p53 , i . e . mtp53 . wtp53 is a tumor suppressor gene , can be involved in cell cycle regulation , and plays an important role in the procedures of maintaining normal growth of cells and inhibiting tumor proliferation . our experimental results show that the expression level of p53 protein of the treatment group is significantly higher than that of the negative control group . then it can be concluded preliminarily that , cl168 - 6 can increase the expression level of wtp53 in the tumor - bearing mouse and inhibit the protein expressions of bcl - 2 and vegf so as to achieve the anti - tumor effect . cl168 , white power ( prepared by ourselves ), diluted with salad oil , prepared before use . icr mice ( spf grade ), with a weight range of 18 - 22 g , provided by vital river laboratories ( vrl ) in beijing , china , were used . there were 5 treatment groups in total , wherein 2000 mg / kg was the highest dose , and the others decreased to 0 . 8 times , i . e . 1600 mg / kg , 1280 mg / kg , 1024 mg / kg and 819 . 2 mg / kg . the mice were randomly divided into groups . each group had 10 mice with half male and half female . each mouse was introperitoneal injected ( 0 . 21111 / 100 . observed 3 - 7 days , a variety of animal responses and the amount of dead mice in each group were recorded . ld 50 and confidence limits were calculated by the modified karber method ( korbor ) according to the mortality rate of animals in each group . in the 12 hours after administration , no death appeared . death situation of mice in each group in 7 days were listed in the following table . table in the example : intraperitoneal injection ld 50 for cl168 mouse ld 50 calculated by the modified karber method ( korbor ) for cl168 - 6 was 1479 . 11 mg / kg ; 95 % confidence interval was 1304 . 19 - 1677 . 49 mg / kg . v . it can be found from resulting example 2 that , when using a high dose ( 30 mg / kg ) of cl168 , the inhibition rate to solid tumor s180 was 54 . 58 %, the survival rate of h22 ascites cancer mice was 51 . 55 %; when using a low dose ( 15 mg / kg ) of cl168 , the inhibition rate to solid tumor s180 was 44 . 33 %, the survival rate of h22 ascites cancer mice was 37 . 11 %; in combination with toxicity example 1 , it can be seen that ld 50 of cl168 was 1479 . 11 mg / kg , and the therapeutic index ( ti ) thereof was about 49 . 3 . the fact “ the therapeutic index ( ti ) of cl168 was about 49 . 3 ” indicates that cl168 has high security and significant anti - tumor effect . 10 g cl168 - 6 and suitable excipients for injection ( including freeze - dried powder and sterile packing dry powder ) were mixed and prepared into anti - tumor injections by injection ( including freeze - dried powder and sterile packing dry powder ) process . 10 g cl168 - 6 and suitable excipients for tablet ( including slow - release tablet , matrix tablet , coated tablet , dispersible tablet , etc .) were mixed and prepared into anti - tumor tablets by tablet ( including slow - release tablet , matrix tablet , coated tablet , dispersible tablet , etc .) process . 10 g cl168 - 6 and suitable excipients for capsule were mixed and prepared into anti - tumor capsules by capsule process . 10 g cl168 - 6 and suitable excipients for emulsion ( including microemulsion , nanoemulsion , etc .) were mixed and prepared into anti - tumor emulsions by emulsion ( including microemulsion , nanoemulsion , etc .) process . 10 g cl168 - 6 and suitable excipients for granule were mixed and prepared into anti - tumor granules by granule process . 10 g cl168 - 6 and suitable excipients for controlled - release preparation were mixed and prepared into anti - tumor controlled - release preparations by controlled - release preparation process . 10 g cl168 - 6 and suitable excipients for oral liquid were mixed and prepared into anti - tumor oral liquids by oral liquid process . 10 g cl168 - 6 and suitable excipients for lipidosome were mixed and prepared into anti - tumor lipidosomes by lipidosome process . | 2 |
making initial reference to fig1 a circular knitting machine according to this invention , which may be either of the single - or double - cylinder type , comprises at least two yarn feeds f , one only of which is shown in the drawings for convenience of illustration , and at least one pattern selection device 1 , in particular of the type including a pattern drum and selection slides , in the drawing only the selection slides 2 being shown . the machine further comprises a plurality of tiltable pattern jacks 3 , associated with respective needles 4 in the grooves 5 of a needle cylinder 6 . the needles 4 are provided with conventional drive butts 7 , the jacks 3 having pattern butts 8 for selection by the selection slides 2 , as well as a lower guiding butt 9 and upper lowering butt 10 . the butts 9 are adapted to follow , in a manner known per se , the profile of a ring cam 11 formed with substantially triangular raised portions 12 at the yarn feeds f . as is known , the raised portions 12 are only climbed by those jacks which have been selected to bring their respective needles 4 to knit , i . e . those jacks 3 whose butts 8 are not subjected to the action of a respective slide 2 urged radially toward the cylinder 6 by the program set on the related pattern drum . the jacks 3 , whose butts 8 are instead interfering with a respective slide 2 moving toward the cylinder 6 , are urged into the respective groove 5 of the cylinder 6 with a tilting movement , to move to the inside of the raised portions 12 with their lower ends in contact with an inner or inboard surface 13 of the ring cam 11 , thereby the associated needles 4 are not made to knit . the jacks 3 which have climbed the raised portions 12 are lowered by downward sloping portions 14 of a cam 15 located above the ring cam 11 , said portions 14 engaging with the lowering butts 10 . above the cam 15 , there are arranged control cams for the needles 4 , not shown because of conventional design . on the inner surface 13 , ahead of the selection devices 1 , there are tilt - out cams 16 for bringing the jacks 3 in a conventional way to a selection position . in accordance with this invention , at at least one of the raised portions 12 , on the inner or inboard side thereof , there is arranged a guiding cam 17 , adapted to bring and hold radially to the inside the lower ends of the jacks 3 selected not to follow the raised portion 12 . the guiding cam 17 extends circumferentially at least as far as the proximity of the following raised portion 12 and is so configured as not to affect the jacks 3 which follow the profile of the ring cam 11 . thus , all of the inoperative jacks 3 , i . e . those selected to stay low and not bring their respective needles 4 to knit , are prevented from climbing the following raised portion 12 , and remain accordingly inoperative also at the corresponding yarn feed . on the contrary , those jacks 3 which have been selected to climb the first raised portion 12 , follow first the latter and then the contiguous one , being unaffected by any actions which can modify their positions in the radial direction to the cylinder 6 . thus , there will take place a renewal or repetition of the previously carried out selection , and no programmable pattern selection device is any longer required for the yarn feed associated with the following raised portion 12 ( in fig1 said device is in fact not shown ). according to a specially advantageous embodiment of the invention , the guiding cam 17 is formed in two parts , namely a first movable part 18 and a second fixed part 19 . the movable part 18 is configured to move radially inwardly those jacks 3 which have been selected not to bring their respective needles 4 to knit . to this aim , the movable part 18 comprises a first plate - like element 18a , extending substantially radially through a window 20 in the raised portion 12 , just above the surface 13 , and being provided , on the cylinder 6 side , with a profile 18b sloping toward the cylinder 6 , i . e . away from the raised portion 12 , in the direction of movement of the jacks 3 . rigid with the first element 18a is a second element 18c , which also extends substantially radially and passes under the ring cam 11 . the element 18c is provided with a safeguard profile 18d , facing the profile 18b and effective to limit the radial travel distance of the jacks 3 in the inward direction . advantageously , the movable part 18 is journaled to the ring cam 11 by means of a vertical axis pivot pin 21 , thereby it is movable for rotation between a working position ( fig1 ), whereat it acts with the profile 18b on the jacks 3 , and an inoperative position ( fig2 ), whereat it does not act on the jacks 3 . the fixed part 19 of the cam 17 , located downstream of the movable part 18 , defines with the latter a switching cam adapted to hold the inoperative jacks 3 radially to the inside while the movable part 18 is at its operative or working position , and return the inoperative jacks 3 radially to the outside into a selection position while the movable part 18 is at its inoperative position . the fixed part 19 is , in fact , formed , on its radially inboard side , with an arcuate profile which follows the pattern of the ring cam 11 at a distance away therefrom which is at least equal to the length of the butts 9 of the jacks 3 , and on its radially outboard side , with a profile sloping outwardly in the direction of movement of the jacks 3 , which progressively urges the jacks 3 into their selection position . the distance of said sloping profile from the ring cam 11 varies , in fact , from a maximum which corresponds to the sum of the radial dimension of the lower end of the jacks 3 plus the length of the butts 8 and 9 , to a minimum substantially corresponding to just the radial dimension of the lower end of the jacks 3 . the fixed part 19 has preferably an l - like cross - sectional configuration , with the upright leg of the &# 34 ; l &# 34 ; extending through an opening 22 in the surface 13 of the ring cam 11 , and the horizontal leg of the &# 34 ; l &# 34 ; extending under said surface 13 , attached thereto . with the movable part 18 in the operative or working position , the profile 18b is aligned with the arcuate inboard profile of the fixed part 19 , whereas in the inoperative position , the profile 18b just protrudes from the ring cam 11 , and the profile 18d is aligned with the radially outboard profile of the fixed part 19 . the construction of the guiding cam 17 in two parts advantageously enables the effectuation of any desired pattern selection where it was not provided before . fig2 illustrates that possibility . in fact , with the movable part 18 of the cam 17 in the inoperative position , all of the jacks 3 which have not climbed the raised portion 12 remain on the outside of the fixed part 19 and are returned to the selection position to be again selected by the left - hand selection device as viewed in fig2 . by contrast , with the movable part 18 of the cam 17 in the operative position , as shown in fig1 the jacks 3 which have not climbed the raised portion 12 are routed by the radially inboard side of the fixed part 19 and remain inoperative also at the following raised portion 12 . the fixed part 19 of the cam 17 extends in this case up to the pattern selection device 1 , such as not to hinder selection by the device itself . it will be understood that the possibility of a pattern selection as described hereinabove is achieved with a single movable cam , and accordingly with a limited construction expenditure . the provision of the guiding cam 17 may require more room in the radial direction at the lower portion of the cylinder 6 . it may become necessary , therefore , to form the grooves 5 with a gradually increasing depth toward the lower portion of the cylinder 6 , as shown in the sectional views of fig3 and 4 . however , it will be appreciated that it is also possible to so size the jacks 3 and cam 17 as to require no such deepening , as shown in fig5 . in the modified embodiment shown in fig6 and 7 the pattern jacks 3 &# 39 ; each have a sloping bottom portion that terminates substantially in a pointed end . the sloping portion is defined by a sloped edge of the bottom of the jacks 3 &# 39 ; at the radially inward side thereof . correspondingly , the movable part 18 &# 39 ; of the guiding cam 17 &# 39 ; has a safeguard profile which has a surface 18 &# 39 ; d inclined substantially as the sloped edge of the pattern jacks 3 &# 39 ; and the fixed part 19 &# 39 ; of the guiding cam 17 &# 39 ; also has a surface 19 &# 39 ; a inclined substantially as the sloped edge of the jacks 3 &# 39 ; for cooperation therewith when the jacks 3 &# 39 ; are guided radially outward for new selection as shown in fig7 . the reduced area of the bottom portion of the jacks 3 &# 39 ; provided by the sloped configuration advantageously reduces or eliminates the danger of impacts against the upstream end of the cam 19 &# 39 ; during control of the cam part 18 &# 39 ; from the position of fig6 to that of fig7 . the exemplary embodiments of the invention described hereinabove are susceptible to many modifications and variations , without departing from the scope of the instant inventive concept . thus , for example , as already deducible from the foregoing , the guiding cam 17 could be a single fixed cam , extended to include a number of successive raised portions 12 and so configured as not to affect those jacks 3 which follow the profile of the ring cam 11 . the movable part 18 of the guiding cam 17 could also be made , of course , movable in a radial direction . the machine could be provided with slide selection devices 2 at each yarn feed , and one or more thereof be held inoperative , i . e . with all the slides 2 drawn outwards when a preceding selection is to be renewed or repeated . | 3 |
fig1 schematically illustrates one simple exemplary embodiment of a sensor 1 according to the invention . in this case , the sensor 1 has two spring - mass - damper oscillating systems s 1 and s 2 . the springs and dampers in the spring - mass - damper oscillating systems s 1 and s 2 are sketched schematically , with self - explanatory symbols . for the sake of simplicity , the spring - mass - damper oscillating systems are referred to in the following text as oscillating systems and the spring - mass - damper oscillators that are used are referred to as oscillators . in the exemplary embodiment shown in fig1 , the oscillating system s 1 has only one oscillator 10 . the oscillating system s 2 has the oscillator 11 . the oscillating system s 1 is characterized by a high resonant frequency than that of the oscillating system s 2 . because of its higher resonant frequency , the oscillator 10 is annotated hf and the oscillator 11 is annotated nf because of its lower resonant frequency . in order to achieve the higher resonant frequency , the oscillator 10 is designed to have a smaller mass and smaller geometric dimensions than the oscillator 11 . the oscillators 10 and 11 are mounted such that they can oscillate in the direction a . the oscillators 10 and 11 are excited in the direction a by an external excitation oscillation . in this case , an amplitude x 1 occurs at the oscillator 10 and an amplitude x 2 at the oscillator 11 at the observation time , which amplitudes are not to scale but are illustrated in order to allow them to be identified . at excitation frequencies which are well below the resonant frequency of the oscillator 11 , the oscillators 10 and 11 oscillate in - phase . the oscillator 10 has moving comb structures 6 , and the oscillator 11 has moving comb structures 7 . because the comb structures 6 and 7 are connected directly to the oscillators 10 and 11 , the moving comb structures in this case oscillate in the same way as the movement of the oscillators 10 and 11 . the moving comb structures 6 and 7 engage in the fixed - position comb electrode 4 with fixed - position comb structures 5 . the rest position of the comb structures 6 and 7 is located eccentrically with respect to the center between the fixed - position comb structures 5 . the comb structures 5 , 6 , 7 can be considered to be two - dimensional plates , one of whose dimensions extends out of the plane of the illustration . comb structures which are opposite a short distance apart and are at electrical potentials form capacitances . the oscillators 10 and 11 are electrically conductively connected to one another , as a result of which the moving electrodes 6 and 7 are at the potential v m at the observation time . the capacitance c is formed in the sensor 1 by the position of the fixed - position comb electrode 4 , which is at a potential v 1 , with respect to the oscillators 10 and 11 with moving comb structures 6 and 7 , which are at a common potential v m . the capacitance c is influenced not only by the separations between the fixed - position comb structures 5 and the moving comb structures 6 but also by the separations between the fixed - position comb structures 5 and the moving comb structures 7 . an enlarged detail of a fixed - position comb structure 5 is illustrated in fig1 . the comb structures 5 have two sides a and b . in the sensor 1 according to the invention , the moving comb structures 6 are arranged on the side b of the fixed - position comb structures 5 , and the moving comb structures 7 are arranged on the side a of the fixed - position comb structures 5 . this means that the separation between the comb structures 6 and the comb structures 5 on the side b is less than the separation between the comb structures 6 and the side a of the comb structures 5 and that the separation between the moving comb structures 7 is less to the side a of the comb structures 5 than to the side b of the comb structures 5 . when the oscillator 10 is deflected from its rest position with an amplitude x 1 , the separation between the comb structures 5 and the moving comb structures 6 is increased . this reduces the capacitance between the comb structures 5 and 6 , and this capacitance element of the oscillating system s 1 within the capacitance c becomes less . the moving comb structures 7 of the oscillator 11 are arranged on the other side a of the fixed - position comb structures 5 . deflection of the oscillator 11 with an amplitude x 2 leads to a reduction in the separations between the moving comb structures 7 and the fixed - position comb structures 5 , and the proportion of the capacitance of the oscillating system s 2 within the capacitance c becomes greater . in this way , when the oscillators 10 and 11 are oscillating in phase , the oscillating system s 1 and s 2 have an inverse influence on the magnitude of the capacitance c . in - phase oscillations occur at frequencies below the resonant frequency of the oscillator 11 and above the resonant frequency of the oscillator 10 . at these frequencies , the oscillation amplitude x 2 of the oscillator 11 is greater than the oscillation amplitude x 1 of the oscillator 10 . if the oscillators 10 and 11 were to be equipped with the same number of comb structures of the same size , the oscillator 11 would change the capacitance c to a greater extent than the oscillator 10 , because of its greater oscillation amplitude . in the sensor according to the invention , the influence of the first and of the second spring - mass - damper oscillating systems on the magnitude of the capacitance is , however , compensated for . the compensation is achieved in the micromechanical sensor 1 by using a greater number of moving comb structures 6 than moving comb structures 7 . the illustrated number of three comb structures 7 and five comb structures 6 is intended only for illustrative purposes , and to assist clarity . in reality sensors generally use a much greater number of comb structures . fig2 schematically illustrates a sensor 1 ′, which can be considered to be a development of the sensor 1 shown in fig1 . components of the sensor 1 ′ with the same reference symbols as in fig1 have the same function , and have already been described with reference to fig1 . as an extension to the micromechanical sensor 1 , the micromechanical sensor 1 ′ has a fixed - position comb electrode 15 with further fixed - position comb structures 16 . the further fixed - position comb structures 16 have the two sides a ′ and b ′, which are annotated analogously to the two sides a and b of the fixed - position comb structures 5 . the further fixed - position comb electrode 15 is used in a similar manner to the fixed - position comb electrode 4 as an opposing electrode for both oscillating systems s 1 and s 2 . in their rest position , the moving comb structures 6 are arranged in the center between the fixed - position comb structures 5 and the further fixed - position comb structures 16 . in their rest position , the moving comb structures 7 are likewise arranged in the center between the comb structures 5 and 16 . the further fixed - position comb electrode 15 is at the potential v 2 at the observation time , and a further capacitance is formed between the potential v 2 and the potential v m on the oscillators . this arrangement is a differential - capacitor arrangement . if the oscillator 10 has an amplitude x 1 , the separation between the moving comb structures 6 and the fixed - position comb structures 5 is greater than when in the rest position , and the capacitance between the comb structures 5 and 6 is correspondingly reduced . at the same time , the separation between the moving comb structures 6 and the further fixed - position comb structures 16 has been reduced , and the capacitance between the comb structures 6 and 16 has been correspondingly increased . the fixed - position comb structures 5 and the further fixed - position comb structures 16 are arranged in mirror - image form in the vicinity of the moving comb structures 7 . this means that , at the amplitude x 2 , with respect to the amplitude x 1 , the separation between the comb structures 7 and 5 has been increased in relation to the rest position , and the separation between the comb structures 7 and 16 has been reduced . the moving comb structures 6 and 7 in the sensor 1 ′ are always a short distance away from one of the fixed - position comb structures 5 or 16 . this is advantageous for the operation of the sensor 1 ′. the functional advantage of the sensor 1 ′ is counteracted by a disadvantage from the production point of view . because of the physical proximity of the comb electrodes 4 and 15 , it is not possible to produce both comb electrodes 4 and 15 as simple spatial bodies on the same level as that where the comb structures 5 and 16 are also formed . instead of this , a more complex contact - making process must be provided for at least one of the fixed - position comb electrodes 4 , 15 . this additional connection is provided in the sensor 1 ′ via a connecting level which is located parallel to the plane of the drawing , and also cannot be illustrated two - dimensionally . contrary to the rest of the illustration , the electrical contact is made with the comb structures as sketched by circuitry lines . fig3 shows a further alternative micromechanical sensor 1 ″ according to the invention . the sensor 1 ″ is a preferred development of the sensor 1 shown in fig1 . in the sensor 1 ″, the oscillator 10 has second moving comb structures 6 ′, in addition to the first moving comb structures 6 . analogously , the low - frequency oscillator 11 has second moving comb structures 7 ′, in addition to the first moving comb structures 7 . the second moving comb structures 6 ′ and 7 ′ engage in a second fixed - position comb electrode 4 ′. the second fixed - position comb electrode 4 ′ has second fixed - position comb structures 5 ′, whose sides are annotated a and b , in the same way as the sides of the fixed - position comb structures 5 . the sensor 1 ″ is a different type of differential - capacitor arrangement , in which the oscillators 10 and 11 with the fixed - position electrode 4 form a capacitance as already described with reference to fig1 . in addition , in this case , the oscillators 10 and 11 form a second capacitance with the second fixed - position electrode 4 ′. in this case , the comb structures 5 , 6 , 5 ′, 6 ′, 7 , 7 ′ are arranged such that , when one oscillator moves , its influence on the magnitudes of the capacitances c and c ′ is inverse . this means that the moving comb structures are each arranged on the other side of the fixed - position comb structures . the moving comb structures 6 are arranged on the side b of the fixed - position comb structures 5 , and the moving comb structures 6 ′ are arranged on the side a of the comb structures 5 ′, while the comb structures 7 are arranged on the side a of the comb structures 5 ′, and the moving comb structures 7 ′ are arranged on the side b of the fixed - position comb structures 5 . in the sensor 1 ″, the fixed - position comb electrodes 4 and 4 ′ are physically separated from one another . this allows the fixed - position comb electrodes 4 and 4 ′ to be manufactured on the same level . the sensor 1 ″ is a functionally advantageous differential - capacitor arrangement which can be produced cost - effectively . the sensor 1 ″ is therefore a preferred embodiment of the present invention . fig4 schematically illustrates an alternative sensor 2 according to the invention . the greater oscillator amplitude of the low - frequency oscillator 11 is in this case stepped down to a lower amplitude of an electrostatic coupling element 9 by means of a mechanical coupling element 8 . the step - down ratio is governed by the ratio of the lever length l 1 , the length between a lever fulcrum 17 and the electrostatic coupling electrode 9 , and l 2 , the length between the lever fulcrum 17 and the low - frequency oscillator 11 . the movement of the electrostatic coupling electrode 9 is proportional to the movement of the oscillator 11 , and its amplitude is matched to the amplitude of the oscillator 10 . when the coupling electrode 9 and the oscillator 10 are oscillating in phase , the capacitance between the coupling electrode 9 and the oscillator 10 is therefore constant . fig5 schematically illustrates a developed micromechanical sensor 2 ′ according to the invention , which can be considered to be an extension of the sensor 2 shown in fig4 . the mechanical coupling element 8 for this sensor is lengthened beyond the fulcrum . the movement direction beyond the fulcrum 17 from the oscillator 11 on the coupling element is inverted . a further coupling electrode 9 ′ is arranged symmetrically with respect to the fulcrum , in addition to the coupling electrode 9 . while the movement of the coupling electrode 9 is proportional to the movement of the oscillator 11 , the coupling electrode 9 ′ moves inversely proportionally to the oscillator 11 . the oscillator 10 has first and second moving comb structures , which are electrically insulated from one another and are connected at the observation time to the potentials v 1 and v 2 and which , together with the coupling electrodes 9 and 9 ′, form a capacitance and a second capacitance and , overall , a differential - capacitor arrangement . fig6 shows a schematic illustration of a micromechanical sensor 3 according to a further exemplary embodiment of the present invention . in the sensor 3 , the low - frequency oscillator 12 in the spring - mass - damper oscillating system s 2 is arranged at a rotation angle α with respect to the oscillator 10 in the spring - mass - damper oscillating system s 1 . the deflection x 2 of the oscillator 12 can be represented as a vectorial subdivision into a deflection in the measurement direction a and a component at right angles to this . the vectorial subdivision of the deflection x 2 is technically implemented by orienting the comb structures 14 of the oscillator 12 with their normal to the surface in the measurement direction a . in order to ensure that the oscillator 12 is deflected in the direction x 2 and not in the measurement direction a , the oscillator 12 has appropriate guides , which are not illustrated here . in the sensor 3 , not only is the separation between the comb structures 6 and 14 varied during oscillation of the oscillators , but , additionally , the electrode coverage as well . in this case , however , the electrode separation has a considerably greater influence on the magnitude of the capacitance c than the electrode coverage . in the sensor 3 , the greater mechanical sensitivity of the low - frequency oscillator 12 is reduced in a simple and cost - effective manner to the lesser mechanical sensitivity of the high - frequency oscillator 10 . the sensor 3 can also be provided on a small area , since it does not require any area - consuming auxiliary structures . fig7 schematically illustrates a further sensor 3 ′ according to the invention , which is a development of the sensor 3 shown in fig6 . the sensor 3 ′ is a differential - capacitance arrangement , in which a low - frequency oscillator 12 is arranged such that it rotates and , with the high - frequency oscillator 10 , forms a first capacitance . a further rotated oscillator 13 is provided in the sensor 3 ′, with mirror - image symmetry with respect to the oscillator 12 , and , with the high - frequency oscillator 10 , forms a second capacitance . the comb structures of the oscillators 12 and 13 are provided on opposite sides of the comb structures of the oscillator 10 . a deflection of the oscillator 12 when the oscillator 10 is stationary therefore results in a reduction in the capacitance , and deflection of the oscillator 13 in the direction x 2 results in an increase in the second capacitance . this results in the advantages as already described of a differential - capacitor arrangement . the symmetrical arrangement of two oscillators 12 and 13 prevents the sensor 3 ′ from being unbalanced in the direction at right angles to a on the plane of the illustration . by way of example , this can have an advantageous effect on the life of the sensor 3 ′. fig8 uses a diagram to schematically illustrate essential features of the mechanical sensitivities of the two oscillating systems s 1 , s 2 which are used in sensors according to the invention . the oscillators in the oscillating systems s 1 , s 2 are excited optimally at their resonant frequencies f 1 and f 2 . at these frequencies , the oscillators achieve their maximum amplitude for a constant excitation amplitude . the resonant frequencies can be seen at the maxima of the sensitivity curves on the diagram . at low frequencies , which can be read on the left - hand ordinate in the diagram shown as a sketch , the sensitivity of the low - frequency oscillator is considerably greater than that of the high - frequency oscillator . at frequencies above the resonant frequency , the mechanical sensitivity of the oscillators decreases to a greater extent at frequencies below the resonant frequencies . in consequence , the differences between the oscillation amplitudes of high - frequency and low - frequency oscillators are also , when considered in absolute form , at high excitation frequencies . these sensitivities at excitation frequencies above the resonant frequencies can be read on the right - hand ordinate . because of the large difference between the oscillation amplitudes at low frequencies , compensation for the different oscillation amplitudes is provided in the sensor according to the invention , with the aim of equalizing the influences of the two oscillating systems on the capacitance . fig9 shows the capacitive sensitivity of a high - frequency spring - mass - damper oscillating system | h caphf ( ω )|, the capacitive sensitivity | h capnf ( ω )| of a low - frequency spring - mass - damper oscillating system , and the capacitive sensitivity | h tot ( ω )| of a sensor according to the invention , as a function of the frequency . the curves | h capnf ( ω )| and | h capnf ( ω )| represent the capacitance changes in the capacitance elements in the oscillating systems s 1 and s 2 , with the electronic coupling of the two oscillating systems being deactivated for measurement purposes . this curve is scaled in a visually similar form to the curve of the mechanical sensitivity in fig8 . the dashed line | h caphf ( ω )| represents the capacitive sensitivity of the high - frequency oscillating system s 1 . the mechanical sensitivities of this high - frequency oscillating system are matched to the capacitive sensitivities of the low - frequency oscillator both in the low - frequency range and in the area of the maximum . this means that the influences of the high - frequency and low - frequency spring - mass - damper oscillating systems on the capacitance are matched to one another , according to the invention . the dashed - dotted line | h tot ( ω )| indicates the capacitive sensitivity of the entire sensor . at low frequencies , the influence of the high - frequency oscillating system and the low - frequency oscillating system is compensated for , and the resultant total capacitive sensitivity of the sensor is zero . this means that low - frequency excitation frequencies are effectively suppressed in the sensor according to the invention . in practice , low - frequency interference is particularly important , since this occurs with high amplitudes . good suppression of low - frequency excitation frequencies is therefore a characteristic which can be considered highly advantageous for the sensors according to the invention . the sensor according to the invention reaches its maximum capacitive sensitivity in a frequency band which is defined substantially by the two resonant frequencies f 1 and f 2 of the two oscillating systems s 1 , s 2 . a sensor according to the invention can advantageously be combined with optimized evaluation electronics , based on mechanical filtering , by effectively evaluating available measurement variables , without having to take account of low - frequency interference signals . | 6 |
preferably the matrix or substrate is impregnated with a mixture comprising from 70 to 87 % w / w particulate chemically modified activated carbon and from 13 to 30 % w / w particulate activated carbon so that the ratio of chemically modified activated carbon to activated carbon is from 70 : 30 to 87 : 13 . the mixture may comprise from 70 to 80 % w / w particulate chemically modified activated carbon and from 20 to 30 % w / w particulate activated carbon so that the ratio of chemically modified activated carbon to activated carbon is from 70 : 30 to 80 : 20 . the matrix or substrate is most preferably impregnated with a mixture comprising of 75 % w / w particulate chemically modified activated carbon and 25 % w / w particulate activated carbon . alternatively the matrix may be impregnated with a mixture of particulate chemically modified activated carbon and particulate activated carbon where the ratio is from 55 : 45 to 90 : 10 , preferably from 60 : 40 to 85 : 15 , most preferably 65 : 35 . the matrix or substrate that is impregnated with the mixture of activated carbons according to the invention may be a fabric , such as a non - woven fabric , e . g . felt , or a knitted fabric . alternatively , the matrix may be a foam , for example a polyurethane foam or any other open cell or reticulated foam , or paper . when the deodorizing filter is to be used in a wound dressing the matrix may be a textile fabric or a foam . the chemically modified particulate activated carbon is prepared by impregnating a starting material , which may be wood , coconut shell or fabric , with a salt of copper , chromium , manganese or iron , or organic material such as tetra ethylenediamine before being carbonised in a furnace . the preferred salt is copper nitrate . the starting material is impregnated with from 9 to 15 % ( w / w ), preferably from 11 to 13 % ( w / w ), most preferably 12 % ( w / w ) measured as copper oxide using atomic absorption spectroscopy . following carbonisation the treated carbon is activated using steam at high pressure . activation usually takes place at 800 to 1000 ° c . under strictly controlled atmospheric conditions and in the presence of co 2 and water vapour . following activation the carbon is ground , for instance using a ball mill , to reduce the particle size such that 0 % remains on a sieve of 40 micron mesh size and 80 % will pass through a sieve having a mesh size of 32 . 5 micron . the untreated particulate activated carbon component of the filtration layer is prepared by the same method but without the impregnation step . in order to make the filter of the invention , the selected mixture of carbons i . e . particulate chemically modified activated carbon and the particulate activated carbon are weighed into a rotary mixing machine , which is allowed to operate until complete and intimate mixing is achieved . this usually takes in the order of 30 minutes . the desired matrix or substrate , which may be a felt type non - woven fabric , is passed over a conveyor . the intimate mixture of particulate carbons is applied from above and drawn into the body of the matrix by the application of a vacuum to the underside of the conveyor , using the process as described in u . s . pat . no . 5 , 281 , 437 . in order to stabilise the composite structure of matrix impregnated with the activated carbon mixture the retained particulate carbon is fixed with a binder . the binder may be applied to the impregnated matrix by means of an applicator roller that receives the binder solution or suspension from a reservoir via a spreader that spreads binder over the surface of the applicator roller . from 10 % to 25 % w / w of binder may be applied to the impregnated matrix , preferably from 15 % to 19 % w / w . binders for use in the present invention may be selected from natural or synthetic latexes , for example styrene butadiene , acrylonitrile butadiene , acrylic methyl methacrylate polyvinyl alcohol , polyvinyl acetate , melamineformaldehyde resins or they may comprise solutions of starch , carboxymethyl cellulose , methyl cellulose or sodium silicate . the preferred binder is an acrylonitrile binder . following the application of the binder a net - like thermofusible layer , which may be made from polyurethane , polyethylene , ethyl vinylacetate , nylon or similar low melting point materials , is applied to each surface of the impregnated matrix using a belt laminator to form a composite structure . a film of relatively fluid impervious material is then laminated to each surface of the composite structure to provide fluid impervious cover layers . the film of fluid impervious material comprises ethyl vinylacetate , polyvinylchloride , polyurethane , polyethylene , etc . the preferred film consists of a co - extruded film of ethyl vinyl acetate , polyvinyl dichloride and ethyl vinyl acetate known as cryovac ( registered trade mark ). the resulting multi - layer composite is cut into discs , preferably about 25 mm in diameter , using a rotary or flat bed press . an odour adsorbing filter in accordance with the invention will now be described by way of reference to the accompanying drawing ( fig1 ) which is a section through a filter attached to the wall of an ostomy bag . the filter 1 consists of a filtration layer 2 composed of a felt matrix impregnated with a mixture of 75 % particulate chemically modified activated carbon ( containing 12 % as copper oxide ) and 25 % particulate activated carbon . the matrix formed is then treated with up to 19 % w / w acrylonitrile binder . the filtration layer 2 is sandwiched between two layers , 3 and 4 , of a net - like thermofusible web composed of ethyl vinyl acetate . laminated on the outer surface of each of the thermofusible layers 3 and 4 is a 75 micron co - extruded film , 5 and 6 , composed of ethyl vinyl acetate / polyvinyl dichloride / ethyl vinyl acetate . the filter 1 which is in the form of a disc having a diameter of 25 mm is positioned on the inside of one wall 7 of an ostomy bag . the wall 7 of the ostomy bag is composed of a film of ethyl vinyl acetate / polyvinyl dichloride / ethyl vinyl acetate . in order to attach the filter 1 to the wall 7 , heat is applied using a welding tool . combined with the welding tool is a knife - edge that is positioned centrally so as to punch a hole through the bag wall 7 and through one of the co - extruded film layers 6 . thus gas can flow into the filtration layer 2 of the filter 1 around the perimeter and out of the centre of the filter 1 via a hole 8 . principally , to assess the chemisorption and physisorption properties of the filter materials supplied for the study . also , to compare the filters with a standard sample from “ charcoal cloth ” and with a dansac sample . the particulate chemically modified carbon was prepared by impregnating wood with 12 % w / w copper nitrate , which was then carbonised . following carbonisation the treated carbon was activated at 875 ° c . with steam at a pressure of 1 bar . the carbon so produced was then ground in a ball mill to reduce the particle size so that 80 % passed through a sieve having a mesh size of 32 . 5 micron . the activated carbon was prepared in a similar manner , but without the addition of copper nitrate . the test filters were prepared by impregnating a felt matrix with a mixture of particulate chemically modified activated carbon and particulate activated carbon . the matrix thus formed was treated with 19 % w / w acrylonitrile binder , following which it was sandwiched between two layers of thermofusible web composed of ethyl vinyl acetate . the charcoal cloth international ltd filters and the dansac pouch filter comprise 100 % activated carbon impregnated with salts reactive to hydrogen sulphide but differ in construction . all of the filter samples were supplied as 25 mm discs welded to a sheet of film . into one side was punched a 3 mm slit to enable the gas to pass through the filters . the filters were designed such that gas flowed in through the exposed sides of the filter and out through the central slit . the filters on the dansac pouch were squares of 20 mm × 20 mm , and were cut out of the pouch to be tested in the same manner as the other filters . the gas exit path on the dansac filters was noted to be circular with a diameter of between 4 mm - 5 mm . physisorption capacity testing at 500 ml / min . gc grade nitrogen containing 288 ± 32 ppm of menthol . the filter is deemed to have failed when 32 ppm menthol passes through the filter ( equivalent to detecting 50 ng per 50 μl sample injection ). see appendix for more information relating to the physisorption testing of the filters . h 2 s deodorising capability at 250 ml / min flow rate . a mixture of nitrogen ( 80 %) and methane ( 20 %) with 25 ± 2 ppm h 2 s . filters which are designed to use a radial gas flow path ( as in this case ) are normally tested at 500 ml / minute in order to reduce the length of time required to test the filters . however , these samples were all tested at 250 ml / min . the test ends and the filter is deemed to have failed when 2 ppm of h 2 s passes through the filter . from the graph in fig2 it can clearly be seen that the worst performing filter is the standard charcoal cloth sample , since it immediately allowed a high concentration of menthol through . the dansac filter also allowed some menthol to pass and the level rose gradually . all of the test samples “ 40 ” to “ 44 ” were considered to have performed better than either “ 01 ” ( the standard charcoal cloth ) or the dansac filter . of all the samples tested , there was a clear trend in the performance : it should be noted that , although 2 ng / 50 μl sample is chosen as the failure point , many organic odours would most likely be detectable to the human nose at lower levels , hence the failure profile shown by the dansac filters is considered to be much worse than that of ( for example ) “ 42 ” since the dansac filter allowed some menthol to pass right from the beginning of the test . “ 42 ” allowed no odour to pass until beginning to fail sharply after 40 minutes . it was possible to find a clear trend in the performance of the different types of filter in the physisorption and chemisorption tests . the standard charcoal cloth filter “ 01 ” was found to perform very poorly in every test . the dansac filter out - performed all of the other filter types in the chemisorption test , but was poor in physisorption tests . it is probably composed only of carbon which has been activated specifically to adsorb h 2 s . whilst the dansac filter appeared to be the best at adsorbing hydrogen sulphide , its performance in the physiosorption test , a test model for the adsorption of other odiferous molecules , was worse than any of the test filters . the test filters , in particular filters “ 42 ” and “ 43 ”, showed that they would adsorb both h 2 s and other odiferous molecules well justification for the use of menthol as a suitable physisorption test material : ideally , the physisorption test should consist of materials which the filter will be required to remove in real - life use . such substances would for example be indole , skatole or other organic compounds produced by the human digestive system . so far , it has not been possible to devise a suitable test method which uses such materials due to problems with low vapour pressures ( which mean that each filter test run can last for many hours ) and equipment contamination ( which makes accurate run - run reproducibility impossible ). it was therefore decided to use a substance similar in molecular weight and structure to some of these compounds but which was more suited to the test procedure . it is also important that the substance be removed from the gas stream by physisorption alone , i . e . it does not interact with the chemisorption - activated carbon . menthol satisfies these criteria : it is also apparent from the results that h 2 s and menthol are removed by different mechanisms . h 2 s - removing carbon will generally adsorb some menthol since the gas will still be attracted to the carbon ( e . g . sample “ 44 ”, above , with 100 % h 2 s activated with for example : metal compounds ( e . g . “ 40 ”, with no h 2 s - activated carbon ). odour and security of a stoma appliance are two of the most major concerns for a patient following formation of a colostomy . research from as far back as 1985 states these two concerns to be ranked in the top three concerns for a patient . the objective of the trial was to show that the new filter in accordance with the invention was more effective in dealing with the two very different types of odour that faeces produce when compared to the users usual pouch . a simple tick box questionnaire was sent to thirty ‘ ostomists ’. to date , twenty have responded . all colostomists were given five of each type of pouch to use . all trialists have all had their colostomies for varying periods of time , i . e . one to eight years and were competent in the management of their stomas . two different filters were tested . the new filter is designed to deal with the two very different types of odour that faeces produces . these being in origin , cyclic organics that are dealt with by pores in the carbon of the filter and the sulphurous chemicals eliminated by the chemically activated part of the filter . the trial involved ostomists trying two different filters . the filters had varying ratios of chemically modified and unmodified activated carbon within them . filter “ a ” consisted of a 50 / 50 blend of modified and unmodified carbon , whilst filter “ b ” consisted of 75 / 25 blend of modified and unmodified carbon . 19 / 20 90 % people found the filter on pouch b better or equivalent to that of their usual pouch ; a simple tick box questionnaire was sent to users of colostomy bags containing the new “ dual carb ” filter , which consisted of a 75 / 25 blend of modified and unmodified carbon . all the 103 people who returned their questionnaires responded positively to the question “ was the dual carb filter effective in odour control ?” the people who returned their questionnaire had previously been using the following brands of colostomy pouches :— “ this new filter is much better than the one i use at present ”. | 8 |
r 1 , r 2 , r 3 and / or r 4 may be identical or may differ from one another . in one embodiment , r 1 , r 2 , r 3 and / or r 4 may be selected from the group consisting of h ; ch 3 ; c 1 - c 3 - alkyl ; aryl , such as phenyl , benzyl , tolyl , o - xylylalkyl ; c 1 - c 3 - acyl ; amino acids ; mono -, di - or oligosaccharides . oligosaccharides contain between two and nine monosaccharide units . r 1 , r 2 , r 3 and r 4 may be identical and / or may differ from one another . one typical derivative of chicoric acid is for example the following compound : the ingredient containing chicoric acid and / or derivatives thereof may be any ingredient that contains chicoric acid and / or derivatives thereof , either naturally or in added form , but is preferably a natural foodstuff such as lettuce , chicory , dandelion , grape , grape pomace ; or combinations or extracts thereof . in a preferred embodiment , the plant material is in the form of chicory or an extract thereof . the chicory extract can be made from any suitable part of the plant material includes , for example , the root , the pulp , the like or combinations thereof . suitable extracts of chicory for the purpose of the present invention are also extracts that are commercially available , such as for example leroux ms55 ( commercially available from leroux sas , france ) in a particular preferred embodiment of the present invention , suitable extracts of chicory may be prepared by any means that are known in the art , e . g ., by steam extraction , solvent extraction , distillation , pressing or grinding . for ease of handling , the plant material is preferably in a dried and comminuted or powder form . as described below , the processes utilize dried , comminuted chicory and / or extracts thereof . however , it is to be understood that any suitable plant material may be used in any suitable form and added to the product according to the present invention . the extract is processed such that its flavor can be enhanced . for example , bitter flavors which are typically associated with plant materials , such as chicory , can be removed by processing the plant into an extract . the extract can also be prepared such that the amount of bioactive agent in the final extract product can be desirably controlled . it should be appreciated that the plant material can be processed to form an extract in a variety of different and suitable ways . in general , the plant material , such as the chicory root , is ground , powdered or provided in any suitable form . the plant material can then be further processed in a number of different stages to produce the product extract . in an embodiment , a defatting procedure is performed on the plant material to produce an extract that results from fats removed from the plant material . the defatting procedure can be conducted under any suitable defatting process conditions with any suitable types and amounts of solvents including , for example , hexane . in an embodiment , the resultant extract of the defatting procedure can be further processed via acid hydrolysis to produce another type of plant extract that can be added to the nutritional composition of the present invention . the acid hydrolysis procedure can be conducted under any suitable process condition with any suitable types and amounts of solvents , including , for example , ethyl acetate . in an embodiment , the extract from the defatting procedure can be further processed via a solvent extraction procedure . the solvent extraction can be carried out under any suitable process conditions and in the presence of any suitable amount and type of solvent . in an embodiment , the solvent includes a solution of methanol (“ meoh ”) and water mixed in a 1 : 1 volume ratio . the resultant solution of the solvent extraction procedure can be further processed by evaporation of the solvent under suitable conditions to produce another extract . alternatively , the resultant solution can be treated with an adsorbant agent , such as polyvinylpolypyrrolidone or the like , to trap polyphenols . the adsorbant agent treatment can be carried out under any suitable process conditions . the amount of chicoric acid and / or natural source thereof in the product will depend on several factors , such as the nature of the extract , the condition of the plant , the age , condition and size of the person or animal to be treated , the frequency , the product will be administered and / or the specific kind of skin disorder or damage to be treated or prevented or desired cosmetic effect . the present inventors have found that the effectiveness of chicory or an extract thereof according to the present invention is generally dose dependant and follows a dose response curve . if generally mild skin disorders or damages are to be prevented and the product will be used frequently , very small amounts of chicory or an extract thereof will be sufficient to achieve the desired effect . if a severe skin pigment disorder is to be treated , larger amounts of chicory or an extract thereof will be more appropriate , although also small amounts will produce an effect . generally , it is preferred if the ingredient is enriched in chicoric acid and / or derivatives thereof . for example , the ingredient and / or the composition may comprise chicoric acid and / or derivatives thereof in an amount in the range of 0 . 001 - 99 . 99 weight -% of dry weight , preferably 0 . 1 - 50 weight -% of dry weight , most preferred 0 . 1 - 10 weight -% of dry weight . the ingredient and / or the composition may comprise the lactic acid bacterium capable of hydrolyzing chicoric acid and / or derivatives thereof to generate tartaric and / or caffeic acid in an amount in the range of 0 . 001 - 99 . 99 weight -% of dry weight , preferably 0 , 1 - 50 weight -% of dry weight , most preferred 0 . 1 - 10 weight -% of dry weight . generally , it is preferred if the product contains chicory or an extract thereof in an amount in the range of about 0 . 1 g / l to 10 g / l , preferably in the range of 0 . 5 g / l to 3 g / l product . if the total amount of product cannot be measured in litres it is preferred if the product contains chicory or an extract thereof in an amount in the range of about 0 . 1 g / kg to 10 g / kg , preferably in the range of 0 . 5 g / kg to 3 g / kg product . preferably the product contains chicory or an extract thereof in a daily dose of 0 . 01 g - 100 g , preferably 0 . 25 g - 10 g . the compositions according to the invention may be in any of the galenical forms usually available for the method of administration selected . the compositions according to the invention may be in any of the galenical forms normally available for the method of administration selected . the carrier may be of diverse nature depending on the type of composition under consideration . in particular , the chicory or extract thereof may be incorporated into any form of food supplement , for example , it may be present in capsules , gelatin capsules , soft capsules , tablets , sugar - coated tablets , pills , pastes or pastilles , gums , or drinkable solutions or emulsions , a syrup or a gel . such a supplement might also include a sweetener , a stabilizer , an antioxidant , an additive , a flavouring agent and / or a colorant . the formulation thereof is carried out by means of the usual methods for producing sugar - coated tablets , gel capsules , gels , hydrogels for controlled release , emulsions , tablets or capsules . the products of the invention may be efficiently used for treating or preventing skin pigmentation disorders or cosmetically lightening skin tone e . g . by decreasing the production of melanin . indeed chicoric acid and chicory extracts were shown to decrease in vitro the synthesis of melanin ( example 1 , fig1 ). the production of tyrosinase was also decreased but to a limited extent ( fig2 ), suggesting that the decrease in melanin was not due to tyrosinase inhibition but rather to mechanisms acting upstream or downstream of this enzyme . the ingredients according to the present invention have further a positive effect on strengthening skin barrier and maintaining skin hydration . as a result , the pigment imperfections are reduced , the complexion becomes brighter and more homogeneous , without areas of dyschromia , or of dryness . thus , according to one subject , the invention relates to the cosmetic use of an effective amount of at least one ingredient containing chicoric acid and / or derivatives as an active agent for treating and / or preventing skin pigmentation disorders , in particular those due to age or environmental factors such as uv . the present invention is also directed towards the cosmetic use of an effective amount of at least one ingredient containing chicoric acid and / or derivatives as an active agent for whitening or lightening skin tone , which is particularly desirable for asian population . a use in accordance with the present invention may also comprises the use of at least one ingredient containing chicoric acid and / or derivatives , in combination with an effective amount of at least one active agent for improving skin hydration or skin ageing , in particular as described hereinafter . according to another of its aspects , the subject of the invention is a method , in particular a cosmetic method , for treating and / or preventing skin tone imperfections and / or disorders associated with hyper - pigmentation , in particular aesthetic disorders , in an individual , comprising at least one step of administering , to said individual , at least one ingredient containing chicoric acid and / or derivatives according to the invention . the cosmetic treatment method of the invention may be carried out in particular by orally administering at least an effective amount of at least one ingredient containing chicoric acid and / or derivatives in accordance with the invention . oral administration comprises ingesting , in one or more intakes , an oral composition as defined above . it may comprise a single application . according to another embodiment , the application is repeated , for example , 2 to 3 times a day , for one day or more , and generally for a sustained period of at least 4 , or even 1 to 15 , weeks . in addition , combinations of treatment with , optionally , oral or topical forms may be envisaged in order to supplement or reinforce the activity of the ingredients as defined by the invention . thus , a topical or oral treatment with a composition containing chicory or an extract thereof in accordance with the invention , combined with an oral or topical composition optionally containing another active ingredient , in particular a probiotic microorganism , or other probiotics in dead , live or semi - active form or an hydrating or anti - ageing agent could be imagined as a kit . the ingredients are mixed , before they are formulated , in the order and under conditions readily determined by those skilled in the art . the ingredients are mixed , before they are formulated , in the order and under conditions readily determined by those skilled in the art . further advantages and features of the present invention are apparent from the following examples and figures . the examples hereinafter are thus presented by way of non - limiting illustration of the field of the invention . in these examples , unless otherwise indicated , the percentages are percentages by weight and the ranges of values written in the form “ between . . . and . . . ” include the upper and lower limits specified . fig1 : melanin production by murine melanocytes pre - treated with chicoric acid or chicory extract vs controls ( positive / negative ). fig2 : tyrosinase production by murine melanocytes pre - treated with chicoric acid or chicory extract vs controls ( positive / negative ). fig3 : filaggrin synthesis by human primary epidermal keratinocytes pre - treated with chicoric acid or chicory extract vs controls ( positive / negative ). in order to evaluate the potential beneficial effect of ingredients towards skin de - or pro - pigmentation we used 2d culture of murine melanocytes ( b16 ) and we performed 2 tests : 1 - assessment of melanin production and 2 - assessment of tyrosinase production . b16 cells were cultured in dmem 1 g / l glucose without phenol red supplemented with 10 % foetal calf serum , in a humidified chamber at 37 ° c . and containing 5 % co 2 . 2 . the production of melanin by b16 murine melanocyte cell line . cells were incubated with the selected ingredients or the test references ( kojic acid at 400 μg / ml ) for 72 hours , in the presence or absence of ndp - msh an analog of msh . the total quantity of melanin ( extracellular and intracellular ) was evaluated by measurement of the optical density at 405 nm of each sample against melanin standards in presence or in absence of ndp - msh . 3 . the production of tyrosinase by b16 murine melanocyte cell line . cells were incubated with the selected ingredients or the test references ( kojic acid at 400 μg / ml ) for 48 hours . the production of tyrosinase was evaluated by immunolabeling . we have tested two chicory extracts ms - 55 ( concentré ms - 55 leroux ) and ms - 70 ( pâte ms - 70 leroux ) and chicoric acid . the tested concentrations are showed in table 1 below . results are expressed in percentage relative to the control . test reference ( kojic acid ) induced , as expected a decrease in melanin production . fig1 shows the melanin production by b16 melanocytes treated for 72 hours with the selected ingredients . chicory extract ms - 55 was shown to decrease in vitro the production of melanin by 60 % ( fig1 ) whereas chicoric acid decreased melanin production by 90 %. the production of tyrosinase was also decreased by these ingredients but to a limited extent ( less than 20 % for both ms - 55 and chicoric acid , fig2 ), suggesting that the decrease in melanin was not due to tyrosinase inhibition but rather to mechanisms acting upstream or downstream of this enzyme . effect of chicoric acid and chicory extract on skin barrier function and skin hydration the potential beneficial effect of the extracts of example 1 towards skin barrier function and skin hydration was evaluated by using 2d culture of human primary epidermal keratinocytes and we assessed the synthesis of filaggrin human epidermal keratinocytes were cultured in control keratinocytes - sfm medium , in a humidified chamber at 37 ° c . and containing 5 % co2 . cells were incubated with the selected ingredients or the test references ( cacl2 at 1 . 5 mm ) for 144 hours . the production of filaggrin by was evaluated by immunolabeling . the results are showed in fig3 . pre - treatment of the cells with chicory extracts ms - 55 , ms - 70 and chicoric acid resulted in an increase of filaggrin suggesting that these extracts could strengthen skin barrier ( fig3 ). a stronger skin barrier ensures a better protection of the body from the environment and pathogens &# 39 ; attack . it also limits the loss of water through the epidermis , thus ensuring an appropriate skin hydration . | 0 |
referring to fig1 - 5 , fig1 - 5 illustrate a method for fabricating semiconductor device according to a preferred embodiment of the present invention . as shown in fig1 , a substrate 12 , such as a wafer or silicon - on - insulator ( soi ) substrate is provided , in which a plurality of shallow trench isolations ( stis ) ( not shown ) could be formed in the substrate 12 . agate structure 14 is then formed on the substrate 12 by first depositing an interfacial layer ( not shown ), a high - k dielectric layer ( not shown ), a silicon layer ( not shown ), a first hard mask layer ( not shown ), and a second hard mask layer ( not shown ) on the substrate 12 . a patterned transfer is conducted thereafter by forming a patterned mask , such as a patterned resist ( not shown ) on the second hard mask layer , and a dry etching process is conducted by using the patterned resist to remove part of the second hard mask layer , part of the first hard mask layer , part of the silicon layer , part of the high - k dielectric layer , and part of the interfacial layer for forming a gate structure 14 . in other words , the gate structure 14 is preferably composed of a patterned interfacial layer 16 , a patterned high - k dielectric layer 18 , a patterned silicon layer 20 , a patterned first hard mask 22 , and a patterned second hard mask 24 . in this embodiment , the interfacial layer 16 is preferably composed of silicon material such as silicon dioxide ( sio 2 ), silicon nitride ( sin ), or silicon oxynitride ( sion ), or other dielectric material with high permittivity or dielectric constant . the silicon layer 20 is preferably composed of single crystal silicon , doped polysilicon , or amorphous polysilicon , the first hard mask 22 is composed of silicon nitride , and the second hard mask 24 is composed of silicon oxide . despite the hard mask of this embodiment is a two - layered structure , the hard mask could also be a single - layered structure selected from the group consisting of sic , sion , sin , sicn and sibn , which is also within the scope of the present invention . as the present embodiment pertains to a high - k first process from gate last process , the high - k dielectric layer 18 preferably has a “ i - shaped ” cross section and preferably be selected from dielectric materials having dielectric constant ( k value ) larger than 4 . for instance , the high - k dielectric layer 20 may be selected from hafnium oxide ( hfo 2 ), hafnium silicon oxide ( hfsio 4 ), hafnium silicon oxynitride ( hfsion ), aluminum oxide ( al 2 o 3 ), lanthanum oxide ( la 2 o 3 ), tantalum oxide ( ta 2 o 5 ), yttrium oxide ( y 2 o 3 ), zirconium oxide ( zro 2 ), strontium titanate oxide ( srtio 3 ), zirconium silicon oxide ( zrsio 4 ), hafnium zirconium oxide ( hfzro 4 ), strontium bismuth tantalate ( srbi 2 ta 2 o 9 , sbt ), lead zirconate titanate ( pbzr x ti 1 - x o 3 , pzt ), barium strontium titanate ( ba x sr 1 - x tio 3 , bst ) or a combination thereof . after the gate structure 14 is formed , a wet etching process or a wet clean is conducted to remove residues or particles on the substrate 12 , and at this stage , a native oxide 26 is also grown naturally on the surface of substrate 12 and gate structure 14 along with electron charges after the wet clean . after the wet clean is conducted , as shown in fig2 - 3 , the substrate 12 is charged to a furnace 28 for various pressure and temperature treatments , in which fig2 illustrates a perspective view of the semiconductor device during the treatments and fig3 is a flow chart diagram illustrating the treatments conducted after charging the substrate 12 into the furnace 28 . first , in step 102 , the substrate 12 is charged to the furnace 28 for pressure and temperature treatment , in which the temperature of the furnace 28 is controlled at around 400 ° c ., but not limited thereto . next , in step 104 , ambient pressure around the gate structure 14 is reduced to a base pressure , in which the base pressure is preferably less than 0 . 1 torr . next , in step 106 , ambient pressure around the gate structure 14 is increased to a predetermined pressure by injecting a low activity gas . according to a preferred embodiment of the present invention , the predetermined pressure is between 10 - 760 torr , and more preferably between 50 - 200 torr , and the injected low activity gas is selected from the group consisting of nitrogen gas , argon and helium . next , in step 108 , ambient temperature around the gate structure 14 is increased at a speed of 5 - 20 ° c ./ min from 400 ° c . to a deposition temperature , in which the deposition temperature is between 500 - 750 ° c . it should be noted that even though the ambient temperature is preferably increased after increasing the ambient pressure to the predetermined pressure as in step 106 , the ambient temperature around the gate structure 14 could also be increased at the same time while the ambient pressure is increased . in other words , the actions of increasing ambient temperature to a range between 500 - 750 ° c . and increasing ambient pressure to a range between 10 - 760 torr or between 50 - 200 torr could be carried out simultaneously , which is also within the scope of the present invention . next , in step 110 , ambient pressure is reduced to base pressure again while low activity gas is purged out from the furnace 28 , in which the base pressure is preferably less than 0 . 1 torr . next , in step 112 and as shown in fig4 , a dielectric layer 30 is formed on the substrate 12 and gate structure 14 after returning the ambient pressure to base pressure , and in step 114 , the substrate 12 is discharged from the furnace 28 . preferably , the formation of the dielectric layer 30 is accomplished by conducting a chemical vapor deposition ( cvd ) process or atomic layer deposition ( ald ) process , and the dielectric layer 30 is selected from the group consisting of silicon nitride , silicon oxide , and silicon carbon nitride . as shown in fig5 , the dielectric layer 30 is then etched back for forming a spacer 32 around the gate structure 14 . depending on the demand of the process , formation of elements including lightly doped drain , additional spacers , source / drain region , epitaxial layer , silicides , and contact etch stop layer and replacement metal gate ( rmg ) process could be conducted thereafter to complete the fabrication of a metal gate transistor , and as these processes are well known to those skilled in the art , the details of which are not explained in for the sake of brevity . this completes the fabrication of a semiconductor device according to a preferred embodiment of the present invention . overall , the present invention inserts a step of increasing ambient pressure around the gate structure by introducing low activity gas between pumping down ambient pressure to base pressure after charging wafer into furnace and ramping up ambient temperature to deposition temperature . preferably , by increasing ambient pressure around the gate structure with injection of low activity gas before deposition of dielectric layer for forming spacer , charges generated on the surface of gate structure and substrate could be neutralized significantly and exposed surfaces of the silicon layer and high - k dielectric layer from gate structure as well as substrate could also be repaired by the introduction of low activity gas . as a result , current leakage of the device is improved substantially . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims . | 7 |
for purposes of this disclosure , an ihs 100 includes any instrumentality or aggregate of instrumentalities operable to compute , classify , process , transmit , receive , retrieve , originate , switch , store , display , manifest , detect , record , reproduce , handle , or utilize any form of information , intelligence , or data for business , scientific , control , or other purposes . for example , an ihs 100 may be a personal computer , a network storage device , or any other suitable device and may vary in size , shape , performance , functionality , and price . the ihs 100 may include random access memory ( ram ), one or more processing resources such as a central processing unit ( cpu ) or hardware or software control logic , read only memory ( rom ), and / or other types of nonvolatile memory . additional components of the ihs 100 may include one or more disk drives , one or more network ports for communicating with external devices as well as various input and output ( i / o ) devices , such as a keyboard , a mouse , and a video display . the ihs 100 may also include one or more buses operable to transmit communications between the various hardware components . fig1 is a block diagram of one ihs 100 . the ihs 100 includes a processor 102 such as an intel pentium tm series processor or any other processor available . a memory i / o hub chipset 104 ( comprising one or more integrated circuits ) connects to processor 102 over a front - side bus 106 . memory i / o hub 104 provides the processor 102 with access to a variety of resources . main memory 108 connects to memory i / o hub 104 over a memory or data bus . a graphics processor 110 also connects to memory i / o hub 104 , allowing the graphics processor to communicate , e . g ., with processor 102 and main memory 108 . graphics processor 110 , in turn , provides display signals to a display device 112 . other resources can also be coupled to the system through the memory i / o hub 104 using a data bus , including an optical drive 114 or other removable - media drive , one or more hard disk drives 116 , one or more network interfaces 118 , one or more universal serial bus ( usb ) ports 120 , and a super i / o controller 122 to provide access to user input devices 124 , etc . the ihs 100 may also include a solid state drive ( ssds ) 126 in place of , or in addition to main memory 108 , the optical drive 114 , and / or a hard disk drive 116 . it is understood that any or all of the drive devices 114 , 116 , and 126 may be located locally with the ihs 100 , located remotely from the ihs 100 , and / or they may be virtual with respect to the ihs 100 . also shown in fig1 is a controller wake module 128 coupled between the controller 122 and the port 120 . operation and configuration of an embodiment of the wake module 128 are discussed in more detail below with respect to fig2 - 3 . not all ihss 100 include each of the components shown in fig1 , and other components not shown may exist . furthermore , some components shown as separate may exist in an integrated package or be integrated in a common integrated circuit with other components , for example , the processor 102 and the memory i / o hub 104 can be combined together . as can be appreciated , many systems are expandable , and include or can include a variety of components , including redundant or parallel resources . an ihs 100 may allow charging of a peripheral device battery via a usb port 120 when the ihs 100 system is in what is commonly known in the art as an advanced configuration and power interface ( acpi ) s5 power state . acpi power states are generally known as an open industry standard allowing a combination of operating system ( os ) control and / or basic input output system ( bios ) control of power management for the ihs 100 . the acpi states allow the ihs 100 to adjust to higher or lower performance states depending on system demand . using the acpi states , the ihs 100 may be put into extremely low power consumption states . from these states , the controller 122 and / or the ihs 100 may be quickly awakened by general purpose events , such as , interrupts , the clock , the keyboard , a modem , and / or a variety of other events . when a notebook - type ihs 100 is powered off , with only battery power inserted , ( e . g ., not plugged in ) the ihs 100 may be set to the acpi g3 power state , which consumes almost no power , and thus maintains a long battery life . however , supporting the usb charging feature on an ihs 100 poses a problem of how to wake from acpi g3 state to acpi s5 state to allow charging of the peripheral device battery and how to best manage the power states to maximize battery life . it should be understood that any state change may be utilized with the present disclosure . in an embodiment , a peripheral device battery may be charged via the usb port 120 while the ihs 100 is in acpi s5 state . a controller 122 ( e . g ., an embedded controller ) in the ihs 100 may “ wake - up ” via power switch inputs , when a user presses the power switch button , but previous disclosures for this are limited to waking up the controller 122 and then allowing the controller 122 to decide if the ihs 100 system should wake up . in addition , using a power switch input that is connected directly to a connector ground loop detection circuit can cause a large drain on a coin cell battery or other power source used to power the acpi g3 circuitry in the controller 122 . thus , there is no previous system and method defined for a device that uses a connector detect to wake the system , such as the usb connector port 120 . fig2 illustrates a block diagram of an embodiment of a controller wake module 128 to wake the controller 122 from a sleep mode , such as acpi g3 state . in an embodiment , the controller wake module 128 comprises a signal converter 130 and a ground loop detector , in parallel , between the controller 122 and the port 120 . fig3 illustrates a schematic diagram of an embodiment of the controller wake module 128 of fig2 . in this embodiment , the signal converter 130 includes a blocking capacitor 140 , resistors 142 , 144 , and 150 and diode 146 . resistor 142 is coupled between the capacitor 140 and the controller 122 . resistor 144 and diode 146 are coupled between node 148 and the controller 122 . resistor 150 is coupled between node 152 and node 154 . in an embodiment , nodes 148 and 152 are coupled to a first power rail , such as a g3 power rail . in this embodiment , the ground loop detector 132 includes a resistor 156 and a diode 158 . the resistor 156 is coupled between node 160 and the controller 122 . the diode 158 is coupled between the node 154 and the controller 122 . in an embodiment , the node 160 is coupled to a second power rail , such as an s5 power rail . it is to be noted that diodes 146 and 158 are optional and may be removed from the system ( e . g ., the diode 158 may be included to prevent electrical shorts from the g3 power rail to the s5 power rail ). the signal converter 130 generally enables the controller 122 to monitor the port 120 ( e . g ., a usb port ) for device insertion ( e . g ., for charging a peripheral device battery ) by transforming a high to low dc transition , seen upon insertion to the port 120 into high to low pulse of limited duration so that the controller 122 can recognize the signal through an input , such as , a power switch input on the controller 122 , as a valid power switch input assertion according to its specifications while ensuring that the controller 122 is not damaged . the ground loop detector 132 generally enables the controller to monitor the port 120 during acpi s5 , when the controller logic is operational , for example through a general purpose input on the controller 122 because the signal converter 130 limits the power switch input from being used to do so . during operation of an embodiment as illustrated in fig3 , before a device is plugged into the port 120 , the system is in a g3 state and the electrical charge on either side of the capacitor 140 is held high . upon insertion of a device into the port 120 , a detect switch in the port 120 is grounded , which results in a falling edge signal . the capacitor 140 in the signal converter converts that falling edge into a signal that the controller 122 can recognize , a high to low pulse of limited duration , ( and that will not damage the ec ), and that signal is used to awaken the controller 122 . the controller 122 then changes the system acpi state from g3 to s5 and turns on power to port 120 to allow the device that is plugged into the port 120 to be charged through that port 120 . the components of the signal converter 130 ( capacitor 140 and resistors 142 , 144 , and 150 ) may be chosen to “ tune ” the signal converter such that the signal it provides to the controller will allow the controller to recognize a single insertion event into port 120 while the system is in a g3 state . the circuit allows the controller 122 to wake the system from g3 in order to charge a peripheral device from the usb port in s5 with no other power rails turned on . as is standard in the industry , the charging signal to charge the peripheral device via the port 120 controls a charging power source ( not shown ). after the falling edge has been converted to the signal that wakes the controller 122 , the capacitor 140 charges back up on the side opposite the port 120 such that the power switch input on the controller 122 is held high . this limits the controller 122 from waking more than once from a given insertion of a device in the port 120 . this may be a problem which occurs if the capacitor 140 is not in the circuit . when the device is removed from the port 120 , the capacitor 140 quickly discharges until the charge on both sides of the capacitor 140 are again held high such that another device insertion in the usb port causing another falling edge will wake the controller 122 ( e . g ., the system is again “ armed ”.) in an embodiment of the present disclosure , a dc blocking capacitor 140 is used to transform the falling edge on the controller 122 power switch input that is caused by a usb connector insertion to the port 120 . the falling edge should be sufficiently long to wake the controller 122 once , but after that time the capacitor 140 will begin charging back up to hold the power switch input high . this will prevent the controller 140 from waking more than once from a given insertion of a usb device , and will thus save battery life and prevent hysteresis behavior . when the usb connector is removed , the capacitor 140 will discharge , and the power switch will once again be “ armed ” to wake the system . in an embodiment , a run - time ( s5 or greater ) general purpose input ( gpi ) on the controller 122 will also be connected to the usb connector ground loop detector 132 in parallel . this input will allow the controller 122 to know at run time ( s5 or greater ) that a device is still connected , because the dc blocking capacitor 140 will prevent the power switch input from being used for this purpose . thus , the gpi may enable code to allow different behaviors for ac vs . battery power , allow more complicated watchdog timer decision trees , power down as soon as a device is disconnected , and a variety of other features . in another embodiment , the gpi may allow the controller 122 to set a timer that may automatically return the system to fully off ( acpi g3 ). this may be very useful because the dc blocking capacitor 140 can prevent further wake events via the power switch input of the controller 122 . although illustrative embodiments have been shown and described , a wide range of modification , change and substitution is contemplated in the foregoing disclosure and in some instances , some features of the embodiments may be employed without a corresponding use of other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the embodiments disclosed herein . | 7 |
the drawing shows an aircraft fuselage marked with a &# 34 ; 1 &# 34 ;, of which only the lower section is visible in fig1 and which has a lower loading hatch 2 at the side , through which the cargo compartment , marked as a whole with &# 34 ; 3 &# 34 ;, is accessible . the cargo compartment 3 , which in the present example would be the cargo compartment for accommodation of passengers &# 39 ; baggage on a smaller passenger aircraft , has a loading aperture 5 next to the working area 4 in the vicinity of the loading hatch 2 , such loading aperture being formed by the free cross - section of the cargo compartment 3 at the working area 4 and an end 6 opposite to the loading aperture 5 , which is bounded in a manner not shown in more detail by a bulkhead , in the area of which a drive 8 is installed in a housing 7 . the drive 8 serves for generation of motion to and fro of a conveying device 9 which serves the purpose of moving piece goods fed in the area of the loading aperture 5 away from the loading aperture 5 in steps intermittantly towards the opposed end 6 of the cargo compartment 3 , in order thus to permit complete loading of the low and deep cargo compartment 3 from the working area 4 without it being necessary for the loading staff to leave the working area 4 . as can clearly be seen from joint inspection of fig1 as well as 6 and 7 , the conveying device has high - tensile belts 10 , which are wound around rollers 11 in the vicinity of the drive 8 ; these rollers are shown in more detail in fig1 and 17 . the belts 10 are reversed in the vicinity of the loading aperture 5 on a thin guide section 13 which is located at only a very low height , in the present example 30 mm , and is mounted slightly above the floor 14 of the cargo compartment 3 . the guide section 13 fixed in a manner described in more detail below in the vicinity of side walls 15 of the cargo compartment 3 assures , with its front reversing edge 16 , soft reversing of the belts 10 in the narrow space and thus define the distance between reversal of the belts 10 and the drive 8 . in this manner , the belts 10 can , by means of appropriate drive of the rollers 11 , be moved to and fro over the reversing edge 16 of the guide section 13 in order that a corresponding conveying movement into or out of the cargo compartment 3 is produced . in order to ensure actual conveyance of goods loaded , such as items of baggage , during this conveying movement , the intermedial space between the belts 10 is bridged by a carpet - like conveying surface 18 in flexible textile material in the area in which the goods loaded may be located . for the purpose of better illustration , this carpet - like conveying surface 18 is shown in some cases in other views as being located relatively thick on the belts 10 , but it should be noted that the conveying surface 18 can in fact consist of a single - layer nylon fabric sewn in the covering area to the belts 10 and thus scarcely accumulating any thickness . fig1 shows an intermediate position during the loading or unloading sequence , with the arrow 19 indicating the direction of loading and the arrow 20 the direction of unloading . the front end 21 of the conveying surface 18 seen in the direction of loading 19 is located in a medial area between the guide section 13 and the drive 8 on the upper side of the conveying device 9 , while the rear end of the conveying surface 18 in the direction indicated by the arrow 19 is located on the underside of the conveying device 9 and will approach the guide section 13 from below when further movement is applied to the conveying device in the direction of loading according to the arrow 19 . in the full load condition , the rear end of the conveying surface 18 can be located in the area of the reversing edge 16 of the guide section 13 , while the end 21 will come to a halt shortly before the housing 7 of the drive 8 , with the result that the conveying surface 18 covers the entire effective depth of the cargo compartment 3 . in the completely unloaded position , however , the end 21 is located within range of the working area 4 behind the loading aperture 5 and the rear end is located a short distance from the housing 7 of the drive 8 . this ensures that the drive 8 only rolls the belts 10 under all circumstances and must never attempt to roll the area of the conveying surface 18 . a rear cargo wall 23 is provided in the vicinity of the end 21 of the conveying surface 18 and delineates the utilized cargo area on the conveying surface 18 at the side opposite to the loading aperture 5 . goods to be transported can thus be stacked against the rear cargo wall 23 without a danger arising of them falling off of the conveying surface 18 towards the drive 8 . the rear cargo wall 23 is , as described in more detail below using fig1 to 12 , directly mounted on the belts 10 and is thus moved backwards and forwards with the belts 10 . connected to the rear cargo wall 23 is a floor wall 24 , which is mounted on the belts 10 and lateral extensions 25 , which take the form of lateral webs . if , as in the present example , the conveying surface 18 is drawn over the floor wall 24 up to the vertical rear cargo wall 23 , it can pass via lateral slots 26 between the floor wall 24 and the web - type extensions 25 in order to be retained in a manner described in more detail below in the vicinity of the side walls 15 of the cargo compartment 3 , or alternatively a separate mounting for the edges of the conveying surface 18 at this point on the floor wall 24 or on the web - type elements 25 can be provided . the arrangement of conveying device 9 discussed above with regard to its principle manner of function and principle structure ensures that only a minimum of effective capacity of the cargo compartment 3 is sacrificed to conveying equipment , and that nevertheless the goods for transportation are fed from the working area 4 in the vicinity of the loading aperture 5 onto the conveying device 9 and are transported into the cargo compartment 3 in stages of any required length ; step - by - step forward motion of the conveying device 9 can also be applied during unloading , in order to place the items to be unloaded in an optimum position in each case in the reach of the loading and unloading staff . due to the fact that only the belts 10 need to be handled in the vicinity of the drive 8 , even an arched configuration of the floor 14 of the cargo compartment 3 and thus also of the conveying device 9 does not cause difficulties , and the reversing of tensioned belts 10 at the reversing edge 16 of the guide section 13 permits an arched shape for the guide section 13 without difficulties , as can be seen in fig1 without the conveying surface 18 bridging the belts 10 without intrinsic tension producing any difficulties . nonetheless , the local circumstances , in particular in the cargo compartment 3 of an aircraft , produce a series of problems , particularly in conjunction with the question of support of the guide section 13 , guidance of the longitudinal edges of the carpet - like conveying surface 18 and guidance of the upper section of the rear cargo wall 23 , the solutions provided for these problems in accordance with the invention being explained in detail below . as can also be seen in detail from the view shown in fig1 , a sectional rail 31 is set into each side wall 15 and has ( cp . fig3 and 4 ) a box - type section 32 with a guide slot 33 , which can be held from behind by the bolt head 34 of a retaining bolt 35 . such a sectional rail 31 , the design and manner of function of which is described below in more detail , is customary in the side areas of aircraft cargo compartments , in order to permit the attachment of so - called lockers at the required points , such lockers being used to lash piece goods securely where necessary . the sectional rail 31 is thus a facility for anchoring , and has a high load - bearing capacity . the arrangement of the guide section 13 between the side walls 15 of the cargo compartment 3 can be seen in fig1 the conveying surface 18 not being shown in the vicinity of the guide section 13 . as can be schematically seen from the illustration in fig1 with regard to distribution of the belts 10 , the belts 10 are arranged essentially symmetrically to the longitudinal mid - plane 49 of the conveying device 9 , but are situated displaced as far as possible to the outside with reference to the longitudinal mid - plane 49 . at a given tensile force in the belts 10 , the bending moment transferred to the guide section 13 is thus minimized by means of minimization of the lever action . however , an extremely strong mounting for the guide section 13 on the side walls 15 is necessary , in order to permit trouble - free absorption of the high tensile forces and bending moments occurring . as can also be seen in fig2 to 5 , the guide section 13 features a retaining rail 50 on both sides , this retaining rail bearing retaining sections 51 at a large distance from each other , such retaining sections being used for fixing to the sectional rail 31 . the retaining section 51 are situated at such a large distance from one another because with a correspondingly large spacing of , for instance , more than 20 inches , it is no longer necessary to assume mutual interaction between the retaining sections 51 , and each retaining section 51 is then capable of transferring the full permissible force into the sectional rail 31 . as can be seen in detail in fig2 each retaining section 51 features a number of recesses 52 , 53 and 54 , in the present example three . while the centre recess 53 is of circular configuration , the outer recesses 52 and 54 each have their own external recesses 55 and 56 . as can be seen in fig3 and 4 , the recesses 52 , 53 and 54 are in alignment with corresponding recesses 41 and / or entry zones 42 of the sectional rail 31 , with the result that the bolt heads 34 of the retaining bolts 35 can pass through both recesses 52 and 54 and recesses 41 and / or entry zones 42 of the guide slot 33 of the sectional rail 31 when the retaining section 51 is placed in position on the sectional rail 31 . from this starting position , the retaining bolts 35 can be moved outwards to the side , with the result that the bolt heads 34 enter the adjacent retaining zone 43 of the sectional rail 31 , whith the bolt shanks 39 entering the vicinity of the recesses 55 and / or 56 , in which they can be accomodated , where necessary with tolerance play . in this position , a retaining plate 57 is placed in position over the retaining section 51 , such retaining plate featuring holes 58 for the bolt shanks 39 located at such a distance from one another that the bolt shanks 39 are secured when they pass through the holes 58 at a spacing equating to the spacing of the recesses 55 and 56 , and thus the retaining bolts 35 can no longer return to the area of the entry zones 42 of the guide slot 33 . the retaining plate 57 also features a central pin 59 , which enters the opening 53 of the retaining section 51 and the entry zone 42 of the guide slot 33 of the sectional rail 31 , located behind the retaining section 51 , essentially without tolerance clearance , when the retaining plate 57 is fixed with the retaining section 51 to the retaining bolt 35 by means of the retaining nuts 60 . an extension 45 of suitable dimension on the bolt head 34 is used to achieve appropriate contact with the inner side of the box - type section 32 to secure against rotation , in order that the bolt head 34 cannot rotate when the retaining nut 44 is screwed into position . in this way , the essentially non - play seating of the pin 59 in the recess 53 and the entry zone 42 assures positioning of the retaining plate 57 , and , in particular , of the retaining section 51 in the longitudinal plane of the sectional rail 31 , while the retaining nuts 60 produce retaining force on the sectional rail 31 . in this way , the two retaining sections 51 located at a large distance from one another are fixed securely to the sectional rail 31 on each side of the guide section 13 , and the guide section 13 is thus supported against the tensional forces arising from the belts 10 . as shown in fig1 a ramp 61 with the lateral retaining sections 62 is fixed on the sectional rail 31 in front of the guide section 13 viewed in the direction of loading as shown using the arrow 19 . as can be seen from fig1 and 15 , the ramp 61 serves to form an approach incline 63 to the upper side of the guide section 13 , to protect the area of the reversing edge 16 of the guide section 13 against damage and to make it possible to push goods to be transported onto the conveying device 9 in the vicinity of the loading aperture 5 . as can be seen from fig8 and 9 , a sealing device 64 or , alternatively , a sealing device 65 is attached to the ramp 61 , and serves to prevent the ingress of dirt and foreign bodies into the area below the guide section 13 . in the example shown in fig8 the sealing device 64 takes the form of a brush arrangement 66 featuring a support section 69 arranged with springs 67 in a recess 68 in the ramp ; this support section presses the bristles 70 against the conveying surface 18 under reversal at the reversing edge 16 . in the case of the variant shown in fig9 three rows of bristles 74a , 74b and 74c are supporting on a support section 71 of the bristle arrangement 72 in a recess 73 of the ramp 61 , such rows of bristles possibly possessing differing rigidities , and thus being selectively effective against dirt and foreign bodies . a dirt collection pan 75 is installed on the underside of the arrangements of the bristles 66 and / or 72 and collects the fine dirt which penetrates through the bristle arrangements 66 and / or 72 and permits easy removal of such dirt . an advantageous variant of the guide section 13 area is shown in more detail in fig6 and 7 . here , the guide section 13 has a main section 76 . since the guide section 13 is freely suspended between the lateral retaining rails 50 and leaves a design gap 83 to the floor 14 of the cargo compartment 3 for passage of the belts 10 and the conveying surface 18 , deflections of the main section 76 of the guide section 13 must be anticipated due to the high tensile forces on the belts 10 . particularly at the commencement of the unloading sequence , the belts 10 draw downwards around the reversing edge 16 with the result that the gap 83 may be closed and the belts 10 complete with the conveying surface 18 could be trapped between the floor 14 and the underside of the main section 76 , particularly in the vicinity of its reversing edge 16 , resulting in serious blockage of conveying motion . in order to counter this possibility , reversing rollers 84 are provided in the vicinity of the belts 10 at the reversing edge 16 and align with or project only slightly above the contour of the reversing edge 16 . the revesing rollers 84 , which are restricted to the area of the belts 10 , reduce friction in the belts 10 during reversal around the reversing edge 16 and thus reduce the overturning moments or pitch moments acting on the guide section . further assurance against such trapping is provided by the fact that the support rollers 85 are arranged on the underside of the main section 76 of the guide section 13 in the vicinity of the belts 10 and project slightly above the underside of the main section 76 . if the main section 76 of the guide section 13 should drop towards the floor 14 of the cargo compartment 3 , support is thus provided by the support rollers 85 and the mobility of the belts 10 thus maintained . friction with the floor can further be minimized by the fact that support rollers 86 are arranged in the floor 14 opposed to the support rollers 85 ; in a case such as that supposed , the support rollers 85 would be supported on the support rollers 86 via the belts 10 and / or the conveying surface 18 , with rolling friction occurring therefore on both sides . taking into account the particularly critical conditions prevailing at the commencement of the unloading phase , a front support roller 85 and / or 86 or a pair of rollers 85 / 86 should be installed as near as possible to the reversing edge 16 , in order to keep any deflection off the section of the main section of the guide section located in front of the support rollers 85 and / or 86 , caused by the forces occurring within the required limits . facilitation of the movement of the belts 10 on the upper side of the main section 76 of the guide section 13 can also be achieved by means of support rollers 87 , which are arranged in the area of the belts on the upper side of the guide section 13 and permit rolling friction at this point . this would further facilitate transportation of heavy goods in particular . as can be seen from fig1 the belts 10 and / or the conveying surface 18 with the loads situated on them would come into contact with each other after commencement of the loading sequence , after which the rear end passes gradually further forwards into the vicinity of the guide section 13 and mutual stressing would cease again . across the zone of possible mutual contact of the belts 10 and the conveying surface 18 with the goods located on them , which zone extends approximately halfway across the effective depth of the cargo compartment 3 , increased wear may occur due to friction , in particular at seams . in order to prevent this , a slide plate 96 is provided at the connection point to the rear edge 17 of the guide section 13 , as can be seen in fig1 ; this slide plate prevents intercontacting of the belts 10 and the conveying surface 18 in this area . the slide plate 96 , which could be made of sheet or plate metal , but which should , taking into account the requirement for weight - saving in aviation , preferably be made of plastic , will produce a low - wear sliding friction for the belts 10 and the conveying surface 18 . particularly good sliding characteristics will be obtained if the slide plate 96 has a surface in teflon or another non - friction plastic , or is , possibly , made completely in teflon . it should be pointed out that the conveying surface 18 and the belts 10 are shown in the illustration in fig1 , and in particular , in the detail shown here , as rigid elements , in order to facilitate an easily comprehensible illustration , but that the conveying surface 18 in the area between the belts 10 naturally contacts in practice , due to the pressure exerted by the load , with the slide plate 96 , and is pushed away by the slide plate 96 from the belts 10 situated below this in this area in the present example . naturally , the slide plate 96 could also be supported across a greater length than half the effective depth of the cargo compartment 3 . as can in this context be seen in fig1 , the slide plate 96 can take the form of a component of the guide section 13 and could then make an additional direct contribution to support of the reversing edge 16 of the guide section 13 , for instance , against the housing 7 of the drive 8 . if such support of the guide section 13 with a shorter slide plate 96 is desired , a lateral pressure - resistant anchoring of the slide plate 96 to the sectional rails 31 can be provided , as was already detailed in principle above for the guide section 13 . this would produce additional reinforcement of the guide section 13 , and , if necessary , separation of the belts 10 , running above and below with the conveying surface 18 , across the entire length of the cargo compartment 3 . where necessary , support rollers 97 can be provided in the vicinity of the belts on the upper side and / or underside of the slide plate 96 and / or -- in a similar manner to that explained in conjunction with fig6 and 7 -- at an appropriate point in the floor 14 of the cargo compartment 3 ; such support rollers would further improve non - friction characteristics . an essential point in this context is the fact that all support rollers 85 , 86 , 87 , 88 and 97 may only be located in the vicinity of the belts 10 , since , due to the concentration of forces in the belts 10 alone , corresponding support is of particular significance only at this point . the lateral anchoring of slide plate 96 can also be used to suspend the slide plate in a similar manner to the guide section 13 , in order that it is freely suspended without load , and preferably also at maximum rated load , but without additional centrifugal forces , between the lateral fixing areas and permits unobstructed passage of the belts 10 and the conveying surface 18 on its underside . such a concept can be seen in fig2 , which shows in diagrammatically simplified form a section through a central area of the cargo compartment 3 in front of the rear cargo wall 23 but behind the guide section 13 . the floor 14 of the aircraft fuselage 1 is bridged by a slide plate 143 , which is suspended on the lateral guide rails 31a and leaves a gap 144 between itself and the floor 14 across the entire width . the slide plate 143 thus provides the floor - side boundary of the cargo compartment 3 across its entire length and is covered on its upper and lower side by the conveying surface 18 and / or the belts 10 in a manner not described in more detail in fig2 . in this way , the belts 10 and the conveying surface 18 can move freely in the gap 144 , without such movement being obstructed by mutual contact , trapping , etc . for this purpose , the slide plate 143 must be capable of absorbing corresponding tensile forces , which can be achieved with low weight and low structural height by the use of a suitable lightweight composite structure , for instance a sandwich structure or , in particular , honeycomb structure , as is described in more detail below . the arrangement should , preferably , be made such that under maximum rated load applied , elongation of the slide plate 143 is in the worst possible case such that the gap 144 is completely closed at no point , in order that a free gap 144 is always available during loading and unloading operations . however , flight situations can occur in which considerable centrifugal forces act in the direction of the floor 14 and multiply the weight of the piece goods located on the slide plate 143 . in order to prevent damage to the slide plate 143 under such deformations , the gap 144 is designed in such a way , particularly in the mid section of the cargo compartment 3 that , under excessive loading , for instance 1 . 5 times maximum rated load , deformation of the slide plate 143 is restricted by floor supports , for instance , from the floor 14 itself . as compared to the arrangement for a non - load - bearing slide plate , such a load - bearing slide plate 143 will , of course , cause additional weight . in order to compensate for this , a section of the surface structure , the planking of the normal floor 14 in the cargo compartment 3 can be removed , with the floor support structure 145 shown only diagrammatically remaining , and could in the present example feature two supports 146 standing upright at both sides of the longitudinal centerline of the aircraft . instead of the planking in this flat section of the floor 14 , only two support rails 147 laterally braced are provided , being supported on their underside on supports 146 and serving themselves as a support for the slide plate 143 in case of excessive deformation . in this way , the deformability of the slide plate 143 in unusual flight situations can be restricted . in order , despite the attainment of an adequate height for the gap 144 , to minimize material deformation of the slide plate 143 , this slide plate is laterally supported on correspondingly hard springs 148 , as is illustrated in fig2 . for this purpose , a retaining mechanism as , for instance , already described in more detail in conjunction with fig2 to 5 , is arranged in the sectional rail 31a , and bears retaining bolts 149 which have external threads . the slide plate 143 has a thicker section 149 on its side edges , which section bears the holes 150 for the retaining bolts 149 and the local recesses 151 for the fitting of a lock nut 152 and the springs 148 , which take the form in the present example of a group of cup springs . vertical support of the edges of the slide plate 143 is achieved in the vicinity of the thicker section 149 on a support rail 153 on the sectional rail 31a . fig2 shows the fully loaded condition of the slide plate 143 , with the springs 148 completely compressed and the thicker section 149 having moved by a distance x from its most extreme opposed support point , onto which it is pressed by means of the lock bolt 152 in its initial position at a defined force via the springs 148 . in this way , a spring travel path x is available on both sides , in order to permit deflection of the slide plate 143 under extraordinary loadings , and thus to prevent deformation of its material . as is indicated in fig2 , the slide plate 143 consists in the present example of vertical honeycomb walls 154 , which , for instance , form a system of adjacent hexagons and are closed on both sides by cover plates 155 and 156 on which the conveying surface 18 runs . as can also be seen in fig2 , easy lateral securement of the position of the edges of the conveying surface 18 can be achieved . for this purpose , the lateral edges of the conveying surface 18 feature retaining elements 157 in the form of , for example , rivetted - on projecting plastic knobs , which in non - loaded condition of the conveying surface 18 are supported in their lateral position by their material rigidity . however , as soon as any forces start to act , for instance due to the piece goods , such forces causing the retaining elements 157 to pull in the direction of the center line of the aircraft , these knobs engage in a restraining edge 158 of a retaining rail 159 and their further inward motion is thus prevented . in this manner , there results in normal operation no frictional obstruction due to retainment of the lateral edges of the conveying surface 18 , but a neat lateral positional retainment under contractional forces acting from the piece goods , since these then press the retaining elements 157 into contact with the restraining edge of the retaining rail 159 projecting over the retaining elements 157 . it will in general suffice to provide the retaining rail 159 on the upper side of the slide plate 143 , whereby it can be supported on the thicker section 149 , bolted at 160 , for instance , and is then only fixed indirectly against the sectional rail 31a . on the underside , the material rigidity of the conveying surface 18 will suffice for positioning of the lateral edges , whereby the retaining elements 157 running on the underside in the gap 154 assume a position in the immediate vicinity of the thicker section 149 and are thus protected against trapping forces when the slide plate 143 deforms . of course , such a mechanical retaining mechanism for the lateral edges of the conveying surface 18 can also be used where necessary for the other variants illustrated , for instance to reduce friction in the weatherstrip retaining rails 36 . a first variant for the arrangement and support of the cargo wall 23 is shown in more detail in fig1 to 12 . as already explained , this arrangement features not only the vertical rear cargo wall 23 but also a floor wall 24 fixed to the rear wall and lateral web - type extensions 25 between which and the floor wall 24 a slot 26 for passage of the conveying surface is provided . a further guidance system for the rear cargo wall 23 in its vertical position results from the pair of support rollers 27 and 28 arranged on the extension elements 25 at a distance from one another ; these rollers engage in running slots 98 and 99 on the running rail 29 and ensure that the rear cargo wall 23 is kept in an upright position . the rollers 27 and 28 are mounted in such a way that they can be rotated around axle bolts , which are fixed to a bracket on the outer side of the extension elements 25 in such a way that the support rollers 27 and 28 act on the running rail 29 from the upper and under side . as can be seen in detail in fig1 to 12 , the belts 10 pass under the floor wall 24 of the arrangement for the rear cargo wall 23 , but are linked to the floor wall 24 via front and rear tension loops 103 . alternatively , the belts 10 , too , can , of course , enter the tension loops 103 , so that the floor wall 24 is included in the tension connection of the belts 10 . however , this would necessitate corresponding complexity and expenditure on the fixing of the belts 10 to the floor wall 24 for the transmission of major tensile forces , and it would furthermore be necessary to ensure that no stretching occurs in the area of these fixings , since such stretching would partially negate the non - elastic characteristics of the belts . the belts 10 consist of aramide fibres , for instance kevlar material , produced by du pont , and are distinguished by extremely low stretching , which could be partially negated by connecting elements if particular preventive care is not taken . the result of the arrangement selected is that the rear cargo wall 23 does not influence the behaviour of the belts 10 in any way whatsoever , but is merely carried along by the belts 10 , with lesser forces occurring in the vicinity of the tension loops 103 than would be the case if the wall was included in the tensile system . as can be seen particularly in fig1 and 12 , tension loops 103 are connected to the belts 10 by means of seams 104 and are closed by seams 105 to form the loops . the loop runs over a retaining web 106 , which can , for instance , be connected to the floor wall 24 by mens of lateral bolts 107 . while only the belts 10 are present on the side of the rear cargo wall 23 facing away from the loading aperture 5 , the textile material of the conveying surface 18 situated in front of the rear cargo wall 23 towards the loading aperture 5 is drawn over the tensioning loops 103 and the floor wall 24 and fixed , in the case of 108 ( please see fig1 ), in a similar manner to the floor wall 24 in the vicinity of the rear cargo wall 23 . there thus results a largely uniform and unhindered cargo area in the direction of loading up to the rear cargo wall 23 . for the variants shown in fig1 , it is assumed that the rear cargo wall 23 itself takes the form of a self - supporting structure , for instance as a solid sheet structure or , alternatively , a skeletal structure , which would result in a certain increase in the weight of the conveying device 9 , which is undesirable in an aircraft . this increasing weight can be reduced by a variant of a rear cargo wall 23a as shown in fig1 to 15 . here , the floor wall 24 is fitted on both sides with flexible couplings 109 , which are attached to the extension elements 25a . the extension elements 25a , as is apparent in fig1 in particular , are of web type only up to the height of the running rail 29 with the support rollers 27 and 28 , in order to permit the required support with a space towards the rear of the cargo compartment 3 , and take the form only of retaining rods 110 above this support level . the rear cargo wall 23a takes the form of a textile covering 111 , which is stretched between the floor wall 24 and the extension elements 25a and / or the retaining rods 110 . the textile covering 111 could , for instance , consist of the same nylon fabric as used for the conveying surface 18 . in order to obtain a high degree of resitance to deflection and taut tensioning , the textile covering 111 is reinforced by tapes 112 , which run between the extension elements 25a and in particular form the edge of the upper end of the textile covering 111 , which could be particularly easily deflected when goods for transport are in contact with it . as can be seen in fig1 in particular , the retaining rods 110 are laterally braced against the side walls 15 of the cargo compartment 3 , in order to place the tapes 112 running between them under a required tension . for this purpose , a further running rail 29a is installed in the upper section of the side walls 15 of the cargo compartment 3 ; if necessary , this rail can also be supported on the sectional rail 31 at this point in a manner not shown in more detail ; such sectional rails 31 are generally also installed in this section of the cargo compartment 3 . tensioning rollers 115 and 116 engage in running slots 113 and 114 of the running rail 29a , but run , in contrast to the support rollers 27 and 28 , with an aligned axis on the surface of the running slots 113 and 114 parallel to the side wall 15 and facing away from the side wall 15 , and are themselves supported by a running bogie 117 . the shanks of clamping bolts 119 engage in a floor plate 118 of the running bogie 117 ; these bolts pass through the retaining rod 110 . this arrangement produces a tensioning mechanism designated as a whole as 120 , by means of which a required force can be applied to the tape 112 fixed in the adjacent retaining rod 110 by means of corresponding screwing in of the clamping bolts 119 into the floor plate 118 of the running bogie 117 . as can be seen in fig1 , a corresponding running bogie 117 is additionally provided on the guide rail 29 , in order to correspondingly tension the lower tape 112 in the drawing , but this would not be necessary in all cases , since bracing on the upper running rail 29a introduces tensioning forces with a favourable leverage around the joints 109 . instead of a trough - type floor wall 24 , which would produce extra weight and would need to be secured by means of the running rail 29 with the rollers 27 and 28 against , for instance , the tilting force exerted on the rear cargo wall 23 or 23a by piece goods , an essentially only two - dimensional design of the rear cargo wall 23 or 23a can also be selected , in which the further construction in conjunction with the floor wall 24 in front of the retaining rod 110 shown in fig1 can be omitted . this would also produce the advantage that the rear cargo wall 23 and / or 23a will not require precise parallel guidance , but will , according to the loadings or tensile forces arising from the belts 10 , also be able to assume a position inclined with respect to the lateral plane of the aircraft , without tilting . backwards tipping of the rear cargo wall 23 or 23a under the weight of piece goods exerting a force against it can in this case be prevented by the provision on the rear of the rear cargo wall 23 and / or 23a opposite to the floor wall 24 of floor support wheels attached via appropriate extensions not shown in more detail and producing a lever force . such a structure would , in particular , be suitable in conjunction with a continuous slide plate as detailed in fig1 to 21 , since the support wheels at the rear of the rear cargo wall 23 and / or 23a would then contact directly with the upper side of the slide plate 96 and / or 143 in the area between the belts 10 and could there support the rear cargo wall 23 and / or 23a against tipping . the opposing force providing a righting moment directed against tipping motion resulting is the tensile force of the belts 10 , which in case of tipping moment occurring due to piece goods located is substantially supported by the very weight of these piece goods . slight tipping motions within the range of tolerance of the rollers 115 and 116 on the guide rails 29 and 29a are not of significance . fig1 illustrates a possibility for drive of conveying device 9 via the rollers 11 situated opposite the loading aperture 5 for each belt 10 . the variant shown in fig1 features a horizontal shaft 121 and laterally connected inclined shafts 122 , which are arranged in the housing 7 supported on pedestals 123 on the floor 14 of the cargo compartment 4 . universal bearings 124 are installed between the shafts 121 and 122 and serve to connect the shafts in order to obtain an enforced synchronous mode of rotation . drive of all the shafts 121 and 122 is achieved via an electric motor not dealt with in more detail and a gearbox which drives the shafts 121 and / or 122 driving the rollers 11 . pressure springs 125 are arranged on the housing 7 above the rollers 11 and retain the belts 10 securely on the means for rotationally entraining the rollers 11 . as can be seen from fig1 , the belts 10 are guided to a small vertical distance from one another by the rollers 11 , with the result that they can , as shown in fig1 enter the cargo space of the cargo compartment 3 , directly via corresponding apertures in the front panel of the housing 7 . an arrangement of rollers 11 for rolling up and off the belt 10 each on different parallel shafts 121 and / or 122 provides a possibility to drive the rollers 11 for the front ends and the rollers 11 for the rear ends of the belts 10 separately if necessary , in order to additionally feed belt material into the cargo area of the cargo compartment 3 and reduce tension in this area . this will make it possible to raise the conveying surface 18 complete with belts 10 , naturally with cargo compartments 3 empty , a considerable distance and provide quick and easy access for inspection purposes to the areas situated below . during operation , it will nonetheless be possible to ensure enforced synchronous running . as can be seen in fig1 , the rollers 11 on the shafts 121 and / or 122 are designed in such a way that the journal of the shaft 121 and / or 122 itself serves as the winding core or roller body , and formation of windings and / or guidance of the belt 10 is assured by means of lateral webs 129 on the shaft 121 and / or 122 . also discernable are the support for the shaft 122 on one of the pedestals 123 and the connection to the shaft 121 via the universal joint 124 . fig1 shows on a larger scale a detail of the variant described in fig1 . as can be seen here , the housing 7 features a cover 130 which can be opened around a hinge 132 ; pressure springs 125 for pressurizing the outermost winding of the windings 133 on the rollers 11 are fixed to the inside of this cover . the pressure springs 125 take the form of simple leaf springs in plastic which are pressed flatter and flatter by the increasing diameter of the windings 133 . when the housing cover 130 is opened , the top of the windings 133 is thus freely accessible . instead of the strap - type pressure springs 125 , a type of hold - down element not shown in more detail in the form of a block with a rounded contact surface which is pressed on to the outermost winding of the belt can be used . in the present case where an endless belt 10 , for instance , in the form of a toothed belt or similar is reversed on a sprocket , such a pressure block can be used in the case of rigid sprung or non - elastic support to avoid any danger of the belt 10 in the form of a toothed belt or similar , jumping out of its positive - locking engagement . the belts 10 leave the housing 7 via slots 131 at a definite height . the belts 10 are routed via the hold down clamps 126 already mentioned in the form of guide rollers , which ensure the correct attitude of the belts 10 to their respective slot 131 . with endless configuration of the belts 10 and their reversal via a single roller 11 per belt 10 , which will not wind on any belt 10 , it must only be ensured that drive forces can be applied from the rollers 11 to the respective belt 10 with as little slippage as possible . in addition to a friction - enhancing surface for the roller 11 , which will then , of course , rotate with the shaft 127 , such surface being possibly of rubber or a similar material , the belts 10 can be provided in a manner not described in more detail with a positive - locking configuration , for instance as toothed belts or belts with drive recesses into which drive elements of the rollers 11 engage . if necessary , a tensioning mechanism to maintain a minimum tension in the respective belt 10 can be installed in the section of the belts 10 between the rollers 11 and the hold - down clamps 126 , while actual drive can be achieved as described in conjunction with fig1 . the special design of the belts 10 as toothed belts , perforated belts or similar , suitable for positive - locking drive , can be provided across the entire length in order to form a genuinely complete tensile element , but is in functional terms only necessary in that section of the belts 10 which actually comes into contact with the rollers 11 during backwards and forwards movement . in the area of the conveying surface 18 , another , possibly flatter configuration for the belts 10 than that in the actual drive area can therefore be selected if required . such a multisection configuration for a continuous rotating belt 10 should also be regarded functionally as an endless belt . as in all the variants described up to now , the drive is designed in such a way that it is locked with the drive motor in standstill condition , in order that the rear cargo wall 23 is secured against movement in its respective position either by drives located at this point or via the belts 10 . the guide section 13 is with its extending slide plate 96 the only rigid component which is located above the floor 14 of the cargo compartment 3 in the vicinity of the loading aperture 5 . since the guide section 13 permits passage of the belts 10 and the conveying surface 18 between its underside and the floor 14 of the cargo compartment 3 via the gap 83 , it deflects slightly under a load located on the guide section 13 , reducing the gap 83 , particularly if the support rollers 85 and 86 are not installed or are located at such a distance apart as permits such motion . for this reason , the tension condition in the guide section 13 between the retaining rails 50 is an indicator for the load located on the conveying device 9 in standstill condition , with the result that the guide section 13 can to some extent serve as an automatic scale for the load applied . for this reason , at least one strain gauge can be installed on an area subject to tensile loading under loading of the upper side of the guide section 13 . naturally , it is appropriate to install the strain gauge in such a way that it is not exposed to load concentrations from cargo , or to other detrimental forces ; for instance , it should be set into an external surface or installed in the internal surface of the guide section 13 . alternatively , a number of strain measuring elements can be installed in the form of strain gauges and an indicator of weight determined using a suitable evaluation system . in case of excess weight , a simple electronic system can be used to actuate an indicator lamp or to disable the conveying device 9 . it would in this way be possible to prevent with certainty any overloading of the floor 14 , and appropriate multiple arrangements and individual evaluation systems for sensors would also make possible detection of local overloads if necessary . at least in those sections which are not required for fixing of the ramp 61 , the guide section 13 , the slide plate 96 or the running rail 29 , the sectional rails 31 can fulfil their basic purpose , namely the securing of cargo . it need not be stated that in such a special case in which the cargo may not be moved up using the conveying device 18 after it has been secured , it must be ensured that the drive for the conveying device 9 cannot be started with the lashings in place . as the above description indicates , many derivations and variants of the invention are possible , without departing from the basic conceptual scope of the invention . the most essential fact is in any case that the conveying device 9 covers the floor 14 of the cargo compartment 3 flatly and does not involve any substantial sacrifice of cargo volume , due to its low height . it is also important that the conveying device 9 can , if required , be moved step - by - step , and thus perform its conveying function in accordance with the circumstances prevailing in any individual case . also of particular importance is the fact that , due to the concentration of all tensile forces in the individual belts 10 arranged at intervals from one another , even an arched floor 14 of the cargo compartment 3 can be covered with not difficulty at all by means of corresponding arrangement of the shafts 121 and / or 122 on the one hand and corresponding non - flat configuration of the guide section 13 on the other hand , since the conveying device 9 can be adapted without difficulty to any floor contour . utilization of the sectional rails 31 regularly provided in aircraft cargo compartments for lashing of cargo , which rails are capable of absorbing high forces , for support if necessary of all components of the conveying device 9 in the cargo area of the cargo compartment 3 , will make it possible to dispense with additional fixing systems , which are particularly problematic in the field of aviation . | 8 |
preferred embodiment 1 as shown in fig1 and 2 the present invention includes improvements ; to the refrigeration process , by which the contents of an enclosed space are maintained at a depressed temperature ; said improvement comprising construction of the surroundings heat exchanger so as to envelop , or largely envelop , the enclosure &# 39 ; s insulation , instead of as a heat exchanger immersed in the surroundings , which increases the efficiency of a said refrigeration process ; due to the reduced difference between the operating temperatures of said surroundings heat exchanger and the enclosure heat exchanger ; afforded by the reduction in temperature differential , required to drive the transfer of heat to said surroundings from said surroundings heat exchanger ; permitted by the reduction in the amount of heat needing to be so transferred , because said enveloping , or largely enveloping , surroundings heat exchanger directly supplies much of the heat passing through said insulation ( by means comprising conduction , convection or radiation ), said directly supplied heat then not contributing to that which is transferred to said surroundings from said surroundings heat exchanger or to that which is transferred to said contents of said enclosed space from said surroundings , and / or permitted by the relatively inexpensive , and unobtrusive , increase in heat transfer surface between said surroundings heat exchanger and said surroundings , afforded by said enveloping , or largely enveloping , surroundings heat exchanger , being integral with the outer shell of said enclosure , if so desired and further comprising the effecting of said reduced temperature difference , substantially as afforded by said largely enveloping construction , between the operating temperatures of said surroundings heat exchanger and the enclosure heat exchanger , by methods comprising either equipping the refrigerating means , being the motivating device in said refrigeration process , to operate almost continuously and at rates which do not substantially exceed the minimum necessary to accomplish the design requirement or by application of heat sinks in thermal communication with the surroundings heat exchanger or the enclosure heat exchanger , so as to allow the slow heat transfer processes between solid surfaces and gaseous media to proceed almost continuously even when the motivating device operates at unnecessarily high rates and in intermittent mode . examples of such methods include : in vapor or gas compression systems ; equipping the compressor to run at volumetric suction displacement rates which do not unnecessarily exceed those needed to accomplish the design requirements , such as avoiding oversizing of fixed capacity compression systems for on / off control or providing variable capacity compression systems in variable control . in absorption systems ; equipping the heater to run at rates which do not unnecessarily exceed those needed to accomplish the design requirements , such as avoiding oversizing of fixed capacity heaters for on / off control or providing variable capacity heaters in variable control . in thermoelectric systems ; equipping the couples to run at e . m . f &# 39 ; s which do not unnecessarily exceed those needed to accomplish the design requirements , such as avoiding overrating of fixed e . m . f . banks of couples for on / off control or providing variable e . m . f . in variable control . heat sinks may comprise either robust constructions such as very heavy heat exchanger walls , alternative heat accumulators such as water or alternative forms of energy accumulaters such as phase change media such as water / ice , glauber &# 39 ; s salt or wax . in each case an objective is to provide sufficient heat , or equivalent energy , storage capacity to keep the heat transfer surfaces in thermal communication with gaseous media at more or less constant temperatures . impediments to heat transfer between the heat sink and the heat exchanger must be avoided to facilitate accomplishment of a further objective which is to keep the heat absorber or heat supplier at more or less a constant temperatures whether the motivating device is running or not . applications for the present invention are numerous and include appliances or structures such as refrigerators , freezers , refrigerator / freezers or cold storage buildings for the storage of food , medical materials , analytical samples , garments , works of art or other materials which deteriorate less readily at depressed temperatures than at ambient temperatures . applications also include the maintenance of depressed temperatures in living , working or other spaces occupied by humans or other animals when the comfort or well being of said occupants is enhanced by maintenance of said depressed temperatures . applications also include the cooling of materials in preparation for use . typically domestic refrigerators are required to maintain temperatures ( t2 ) inside the enclosure at about 33 to 38 ° f . when surrounding air temperatures ( t0 ) are at about 68 to 78 ° f . typically domestic freezers are required to maintain temperatures inside the enclosure ( t2 ) at about 0 to 5 ° f . when surrounding air temperatures ( t0 ) are at about 68 to 78 ° f . typically residential air conditioning systems are required to maintain temperatures inside the enclosure ( t2 ) at about 68 to 78 ° f . when surrounding air temperatures ( t0 ) are at about 68 to 120 ° f ., although the wide range of ambient conditions , refrigeration systems , and design options can result in substantially different operating ranges . the surroundings comprise material outside of the enclosure . in some cases the surroundings heat exchanger may exchange heat with parts of the surroundings 6 which are essentially the same as those 0 which exchange heat witt the contents of the enclosed space . in other cases the surrounding &# 39 ; s heat exchanger may exchange heat with parts of the surroundings 6 which are not the same as those 0 which exchange heat with the contents of the enclosed space . segregated parts of the surroundings may comprise heat sinks or sources such as thermal storage systems , liquids such as bodies or streams of water , solids such as the ground , waste streams , gasses such as the atmosphere , or remote sources of radiant heat such as the sun . t0 and t6 may be equal or unequal . preferred embodiment number 1 . 1 . as shown in fig1 the present invention includes an improvement ; to the refrigeration process , in accordance with embodiment number 1 , in which said enclosure heat exchanger is of the conventional immersed type . heat 11 is transferred , from the surroundings 0 , which are at temperature t0 , to the contents of the enclosed space 2 , which are maintained at depressed temperature t2 , through unenveloped parts of the enclosure 1 , such as doors or windows . the driving force for this heat transfer is the temperature differential ( t0 - t2 ). heat 14 is transferred , from the enveloping surroundings heat exchanger 5 , which is maintained at elevated temperature t5 , to the contents of the enclosed space 2 , which are maintained at depressed temperature t2 , through enveloped parts of the enclosure 4 , such as insulated walls . the driving force for this heat transfer is the temperature differential ( t5 - t2 ). heats 11 and 14 are transferred , from the contents of the enclosed space 2 to the immersed enclosure heat exchanger 3 which is maintained at depressed temperature t3 . the driving force for this heat transfer is the temperature differential ( t2 - t3 ). heat 15 is transferred , from the enveloping surroundings heat exchanger 5 , which is maintained at elevated temperature t5 , to the surroundings 6 , which are at temperature t8 . a the driving force for this heat transfer is the temperature differential ( t5 - t6 ). energy 17 , is supplied to the refrigeration system to maintain the temperature difference ( t5 - t3 ), between the enveloping surroundings heat exchanger 5 and the immersed enclosure heat exchanger 3 . preferred embodiment number 1 . 2 . as shown in fig2 the present invention includes an improvement ; to the refrigeration process , in accordance with embodiment number 1 , in which said enclosure heat exchanger is of the enveloping type disclosed in claim 1 of my application ser . no . 08 / 030 , 734 filing date mar . 12 , 1993 . heat 11 is transferred , from the surroundings 0 , which are at temperature t0 , to the contents of the enclosed space 2 , which are maintained at depressed temperature t2 , through unenveloped parts of the enclosure 1 , such as doors or windows . the driving force for this heat transfer is the temperature differential ( t0 - t2 ). heat 14 is transferred , from the enveloping surroundings heat exchanger 5 , which is maintained at elevated temperature t5 , to the enveloping enclosure heat exchanger 3 , which is maintained at depressed temperature t3 , through enveloped parts of the enclosure 4 , such as insulated walls . the driving force for this heat transfer is the temperature differential ( t5 - t3 ). heat 11 is transferred , from the contents of the enclosed space 2 to the enveloping enclosure heat exchanger 3 which is maintained at depressed temperature t3 . the driving force for this heat transfer is the temperature differential ( t2 - t3 ). heat 15 is transferred , from the enveloping surroundings heat exchanger 5 , which is maintained at elevated temperature t5 , to the surroundings 6 , which are at temperature t6 . the driving force for this heat transfer is the temperature a differential ( t5 - t6 ). energy 17 , is supplied to the refrigeration system to maintain the temperature difference ( t5 - t3 ), between the enveloping surroundings heat exchanger 5 and the enveloping enclosure heat exchanger 3 . preferred embodiment number 1 . 3 . the present invention includes the improvements of embodiment number 1 in which the functions of shell and surroundings heat exchanger are integrated in dual purpose components , either partially or completely , for reasons comprising cost containment , space utilization or efficiency . preferred embodiment number 1 . 4 . the present invention includes the improvements of embodiment number 1 in which the functions of shell and surroundings heat exchanger may be performed by separate components , for reasons comprising puncture prevention , hygiene , aesthetics , protection of materials of construction , or heat transfer enhancement . preferred embodiment number 2 as shown in fig3 and 4 the present invention includes improvements ; to the heat pumping process , by which the contents of an enclosed space are maintained at an elevated temperature ; said improvement comprising construction of the surroundings heat exchanger so as to envelop , or largely envelop , the enclosure &# 39 ; s insulation , instead of as a heat exchanger immersed in the surroundings , which increases the efficiency of said heat pumping process ; due to the reduced difference between the operating temperatures of the enclosure heat exchanger and said surroundings heat exchanger ; afforded by the reduction in temperature differential , required to drive the transfer of heat from said surroundings to said surroundings heat exchanger ; permitted by the reduction in the amount of heat needing to be so transferred , because said enveloping , or largely enveloping , surroundings heat exchanger intercepts much of the heat escaping to through said insulation ( by means comprising conduction , convection or radiation ), said intercepted heat then not contributing to that which is transferred from said surroundings to said surroundings heat exchanger or to that which is transferred from said contents of said enclosed space to said surroundings , and / or permitted by the relatively inexpensive , and unobtrusive , increase in heat transfer surface between said surroundings and said surroundings heat exchanger , afforded by said enveloping , or largely enveloping , surroundings heat exchanger being integral with the outer shell of said enclosure , if so desired . applications for the present invention are numerous and include appliances or structures for the storage of materials , which deteriorate less readily at elevated temperatures than at ambient temperatures . applications also include the maintenance of elevated temperatures in living , working or other spaces occupied by humans or other animals when the comfort or well being of said occupants is enhanced by maintenance of said elevated temperatures . applications also include the heating of materials in preparation for use . typically residential heat pumps are required to maintain temperatures inside the enclosure ( t2 ) at about 68 to 78 ° f . when surrounding air temperatures ( t0 ) are at about 35 to 65 ° f ., although the wide range of ambient conditions , refrigeration systems , and design options can result in substantially different operating ranges . the surroundings comprise material outside of the enclosure . in some cases the surroundings heat exchanger may exchange heat with parts of the surroundings 6 which are essentially the same as those 0 which exchange heat with the contents of the enclosed space . in other cases the surroundings heat exchanger may exchange heat with parts of the surroundings 6 which are not the same as those 0 which exchange heat with the contents of the enclosed space . segregated parts of the surroundings may comprise heat sinks or sources such as thermal storage systems , liquids such as bodies or streams of water , solids such as the ground , waste streams , gasses such as the atmosphere , or remote sources of radiant heat such as the sun . t0 and t6 may be equal or unequal . preferred embodiment number 2 . 1 . as shown in fig3 the present invention includes an improvement ; to the heat pumping process , in accordance with embodiment number 2 , in which said enclosure heat exchanger is of the conventional immersed type . heat 11 is transferred , to the surroundings 0 , which are at temperature t0 , from the contents of the enclosed space 2 , which are maintained at elevated temperature t2 , through unenveloped parts of the enclosure 1 , such as doors or windows . the driving force for this heat transfer is the temperature differential ( t2 - t0 ). heat 14 is transferred , to the enveloping surroundings heat exchanger 5 , which is maintained at depressed temperature t5 , from the contents of the enclosed space , which are maintained at elevated temperature t2 , through enveloped parts of the enclosure 4 , such as insulated walls . the driving force for this heat transfer is the temperature differential ( t2 - t5 ). heats 11 and 14 are transferred , to the contents of the enclosed space 2 from the immersed enclosure heat exchanger 3 which is maintained at elevated temperature t3 . the driving force for this heat transfer is the temperature differential ( t3 - t2 ). heat 15 is transferred , to the enveloping surroundings heat exchanger 5 , which is maintained at depressed temperature t5 , from the surroundings 6 , which are at temperature t6 . the driving force for this heat transfer is the temperature differential ( t6 - t5 ). energy 17 , is supplied to the refrigeration system to maintain the temperature difference ( t3 - t5 ), between the immersed enclosure heat exchanger 3 and the enveloping surroundings heat exchanger 5 . preferred embodiment number 2 . 2 . as shown in fig4 the present invention includes an improvement ; to the heat pumping process , in accordance with embodiment number 2 , in which said enclosure heat exchanger is of the enveloping type disclosed in claim 1 of my application ser . no . 08 / 030 , 734 filing date mar . 12 , 1993 . heat 11 is transferred , to the surroundings 0 , which are at temperature t0 , from the contents of the enclosed space 2 , which are maintained at elevated temperature t2 , through unenveloped parts of the enclosure 1 , such as doors or windows . the driving force for this heat transfer is the temperature differential ( t2 - t0 ). heat 14 is transferred , to the enveloping surroundings heat exchanger 5 , which is maintained at depressed temperature t5 , from the enveloping enclosure heat exchanger 3 , which is maintained at elevated temperature t3 , through enveloped parts of the enclosure 4 , such as insulated walls . the driving force for this heat transfer is the temperature differential ( t3 - t5 ). heat 11 is transferred , to the contents of the enclosed space 2 from the enveloping enclosure heat exchanger 3 which is maintained at elevated temperature t3 . the driving force for this heat transfer is the temperature differential ( t3 - t2 ). heat 15 is transferred , to the enveloping surroundings heat exchanger 5 , which is maintained at depressed a temperature t5 , from the surroundings 6 , which are at temperature t6 . the driving force for this heat transfer is the temperature differential ( t6 - t5 ). energy 17 , is supplied to the refrigeration system to maintain the temperature difference ( t3 - t5 ), between the enveloping enclosure heat exchanger 3 and the enveloping surroundings heat exchanger 5 . preferred embodiment number 2 . 3 . the present invention includes the improvements of embodiment number 2 in which the functions of shell and surroundings heat exchanger are integrated in a dual purpose component , either partially or completely , for reasons comprising cost containment , space utilization or efficiency . preferred embodiment number 2 . 4 the present invention includes the improvements of embodiment number 2 in which the functions of shell and surroundings heat exchanger may be performed by separate components , for reasons comprising puncture prevention , hygiene , aesthetics , protection of materials of construction , or heat transfer enhancement . preferred embodiment numbers 2 . 5 . as shown in fig5 and 6 the present invention includes a combination of the improvements of embodiments 1 and 2 , in which a refrigeration system &# 39 ; s heat supplier is thermally connected to the heat absorber of a heat pump , so that the rejected heat from the refrigeration system &# 39 ; s heat supplier can be absorbed , more - or - less simultaneously , by the heat pumping system &# 39 ; s heat absorber , which further reduces the quantities of heat which must be exchanged between the surroundings and the refrigeration systems . in both drawings , all of the heat exchangers are depicted as being of the enveloping type , disclosed in my application ser . no . 08 / 030 , 734 filing date mar . 12 , 1993 , but a the present invention also includes constructions in which some or all of the enclosure heat exchangers may be of the immersion type . preferred embodiment number 2 . 5 . 1 the present invention includes embodiment 2 . 5 , in which the thermal connection is effected by heat transfer between the refrigeration systen &# 39 ; s heat supplier and the heat pump &# 39 ; s heat absorber . as shown in fig5 heat 11 is transferred , from the surroundings 0 , which are at temperature t0 , to the contents of the enclosed space 2 , which are maintained at lo depressed temperature t2 , through unenveloped parts of the enclosure 1 , such as doors or windows . the driving force for this heat transfer is the temperature differential ( t0 - t2 ). heat 14 is transferred , from the enveloping surroundings heat supplier 5 , which is maintained at elevated temperature t5 , to the enclosure heat absorber 3 , which is maintained at depressed temperature t3 , through enveloped parts of the enclosure 4 such as insulated walls ( and through part of the contents of the enclosed space 2 , if the enclosure heat absorber is of the immersed type ). the driving force for this heat transfer is the temperature differential ( t5 - t3 ). heat 11 is transferred , from the contents of the enclosed space 2 to the enclosure heat exchanger 3 which is maintained at depressed temperature t3 . the driving force for this heat transfer is the temperature differential ( t2 - t3 ). heat 15 is transferred , from the enveloping heat supplier 5 , which is maintained at elevated temperature t5 , to the heat transfer medium 9 , at temperature t9 . the driving force for this heat transfer is the temperature differential ( t5 - t9 ). in the convection option , heat 19 is transferred from the heat transfer medium which is maintained at elevated temperature t9 , to the surroundings . the driving force a for this heat transfer is the temperature differential ( t9 - t6 ). in the conduction option , heat 19 is transferred from the enveloping heat supplier 5 , which is maintained at elevated temperature t5 , to the surroundings . the driving force for this heat transfer is the temperature differential ( t5 - t6 ). energy 17 , is supplied to the refrigeration system to maintain the temperature difference ( t5 - t3 ), between the enveloping heat supplier 5 and the enclosure heat exchanger 3 . heat 15 &# 39 ; ( heat 15 less intermediate losses , plus intermediate gains ) is conveyed to 5 &# 39 ; as is further shown in fig5 heat 11 &# 39 ; is transferred , to the surroundings 0 &# 39 ;, which are at temperature t0 &# 39 ;, from the contents of the enclosed space 2 &# 39 ;, which are maintained at elevated temperature t2 &# 39 ;, through unenveloped parts of the enclosure 1 &# 39 ;, such as doors or windows . the driving force for this heat transfer is the temperature differential ( t2 &# 39 ;- t0 &# 39 ;). heat 14 &# 39 ; is transferred , to the enveloping surroundings heat absorber 5 &# 39 ;, which is maintained at depressed temperature t5 &# 39 ;, from the enclosure heat exchanger 3 &# 39 ;, which is maintained at elevated temperature t3 &# 39 ;, through enveloped parts of the enclosure 4 &# 39 ; such as insulated walls ( and through part of the contents of the enclosed space 2 &# 39 ;, if the enclosure heat exchanger is of the immersed type ). the driving force for this heat transfer is the temperature differential ( t3 &# 39 ;- t5 &# 39 ;). heat 11 &# 39 ; is transferred , to the contents of the enclosed space 2 &# 39 ; from the enclosure heat exchanger 3 &# 39 ; which is maintained at elevated temperature t3 &# 39 ;. the driving force for this heat transfer is the temperature differential ( t3 &# 39 ;- t2 &# 39 ;). heat 15 is transferred , to the enveloping heat absorber 5 &# 39 ;, which is maintained at depressed temperature t5 &# 39 ;, from the heat transfer medium t9 &# 39 ;, at temperature t9 &# 39 ;. the driving force for this heat transfer is the temperature differential ( t9 &# 39 ;- t5 &# 39 ;). in the convection option , heat 19 &# 39 ; is transferred to the heat transfer medium which is maintained at elevated temperature t9 &# 39 ;, from the surroundings . the driving force for this heat transfer is the temperature differential ( t6 &# 39 ;- t9 &# 39 ;) in the conduction option , heat 19 &# 39 ; is transferred to the enveloping heat supplier 5 &# 39 ;, which is maintained at elevated temperature t5 &# 39 ;, from the surroundings . the driving force for this heat transfer is s6 the temperature differential ( t6 &# 39 ;- t5 &# 39 ;). energy 17 &# 39 ;, is supplied to the refrigeration system to maintain the temperature difference in ( t3 &# 39 ;- t5 &# 39 ;), between the enclosure heat exchanger 3 &# 39 ; and the enveloping heat absorber 5 &# 39 ;. the amounts of heat 19 and 19 &# 39 ; are relatively small since heats 15 and 15 &# 39 ; are mutually exclusive or partially mutually exclusive . consequently ( t9 - t8 ), ( t5 &# 39 ; t6 ), ( t6 &# 39 ;- t5 &# 39 ;) and ( t6 &# 39 ;- t9 &# 39 ;) are relatively small , which allows ( t5 - t3 ) and ( t3 - t5 &# 39 ;) to be relatively small , resulting in further improved operating efficiency . the means , by which heat 15 / 15 &# 39 ; is transferred through heat transfer medium 5 / 5 &# 39 ;, ray comprise conduction , radiation and / or natural or forced convection or other form of combined heat and mass transfer process . preferred embodiment number 2 . 5 . 2 the present invention includes embodiment 2 . 5 , in which the thermal connection is effected by direct union of the refrigeration system &# 39 ; s heat supplier and the heat pump &# 39 ; s heat absorber . as shown in fig6 heat 11 is transferred , from the surroundings 0 , which are at temperature t0 , to the contents of the enclosed space 2 , which are maintained at depressed temperature t2 , through unenveloped parts of the enclosure 1 , such as doors or windows . the driving force for this heat transfer is the temperature differential ( t0 - t2 ). heat 14 is transferred , from the enveloping surroundings heat supplier 5 , which is maintained at elevated temperature t5 , to the enclosure heat absorber 3 , which is maintained at depressed temperature t3 , through enveloped parts of the enclosure 4 such as insulated walls ( and through part of the contents of the enclosed space 2 , if the enclosure heat absorber is of the immersed type ). the driving force for this heat transfer is the temperature differential ( t5 - t3 ). heat 11 is transferred , from the contents of the enclosed space to the enclosure heat exchanger 3 which is maintained at depressed temperature t3 . the driving force for this heat transfer is the temperature differential ( t2 - t3 ). heat 15 is transferred , from the enveloping heat supplier 5 , which is maintained at elevated temperature t5 , to the surroundings , which are at temperature t6 . the driving force for this heat transfer is the temperature differential ( t5 - t6 ). energy 17 , is supplied to the refrigeration system to maintain the temperature difference ( t5 - t3 ), between the enveloping heat supplier 5 and the enclosure heat exchanger 3 . as is further shown in fig6 heat 11 &# 39 ; is transferred , to the surroundings 0 &# 39 ;, which are at temperature t0 &# 39 ;, from the contents of the enclosed space 2 &# 39 ;, which are maintained at elevated temperature t2 &# 39 ;, through unenveloped parts of the enclosure 1 &# 39 ;, such as doors or windows . the driving force for this heat transfer is the temperature differential ( t2 &# 39 ;- t0 &# 39 ;). heat 14 &# 39 ; is transferred , to the enveloping surroundings heat absorber 5 &# 39 ;, which is maintained at depressed temperature t5 &# 39 ;, from the enclosure heat exchanger 3 &# 39 ;, which is maintained at elevated temperature t3 &# 39 ;, through enveloped parts of the enclosure 4 &# 39 ; such as insulated walls ( and through part of the contents of the enclosed space 2 &# 39 ;, if the enclosure heat exchanger is of the immersed type ). the driving force for this heat transfer is the temperature differential ( t3 &# 39 ;- t5 &# 39 ;). heat 11 &# 39 ; is transferred , to the contents of the enclosed space 2 &# 39 ; from the enclosure heat exchanger 3 &# 39 ; which is maintained 1s at elevated temperature t3 &# 39 ;. the driving force for this heat transfer is the temperature differential ( t3 &# 39 ;- t2 &# 39 ;). heat 15 &# 39 ; is transferred , to the enveloping heat absorber 5 &# 39 ;, which is maintained at depressed temperature t5 &# 39 ;, from the surroundings , which are at temperature t6 &# 39 ;. the driving force for this heat transfer is the temperature differential ( t6 &# 39 ;- t5 &# 39 ;). energy 17 &# 39 ;, is supplied to the refrigeration system to maintain the temperature difference ( t3 &# 39 ;- t5 &# 39 ;), between the enclosure heat exchanger 3 &# 39 ; and the enveloping heat absorber 5 &# 39 ;. the amounts of heat 15 and 15 &# 39 ; which must be transferred between the surroundings heat exchanger and the surroundings 6 and 6 &# 39 ; are relatively small since much of the heat is exchanged within the interconnected surroundings heat exchanger 5 / 5 &# 39 ;. consequently ( t5 - t3 ) and ( t3 &# 39 ;- t5 &# 39 ;) are relatively small , resulting in further improved operating efficiency . preferred embodiments numbers 2 . 6 . 1 and 2 . 6 . 2 the present invention includes combination of embodiments 1 and 2 , as shown in fig1 , 3 and 4 , in which a single reversible refrigeration system is used , during some time periods as a refrigerator , to prevent elevation of the temperature of the contents of an enclosed space , and during some other time periods as a heat pump , to prevent depression of the temperature of said contents of said enclosed space . preferred embodiment number 2 . 6 . 1 . the present invention includes the improvement of preferred embodiment number 2 . 6 , in which , lo during said refrigeration of said contents of said enclosed space , heat 15 is rejected to the general surroundings 0 ( instead of 6 ); and in which , during said pumping of heat into said contents of said enclosed space , said pumped heat is obtained from said general surroundings 0 ( instead of 6 ). preferred embodiment number 2 . 6 . 2 . the present invention includes the improvement of preferred embodiment number 2 . 6 , in which , during said refrigeration of said contents of said enclosed space , heat 15 is supplied to a segregated part of the surroundings , such as a heat storage system 6 ; and in which , during said pumping of heat into the contents of said enclosed space , said heat is retrieved from said heat storage system 6 . preferred embodiment number 3 . the present invention includes alternative uses of my application ser . no . 08 / 030 , 734 filing date mar . 12 , 1993 , in which some parts of the contents of a refrigerated enclosed space , being at temperatures which are higher than the temperatures of other parts of said enclosed space , are at temperatures which are not necessarily lower than the temperature of the surroundings ; and in which some parts of the contents of a heat pumped enclosed space , being at temperatures which are lower than the temperatures of other parts of said contents of said enclosed space , are at temperatures which are not necessarily higher than the temperature of the surroundings ; and in which the contents of a refrigerated enclosed space are not necessarily colder than the immediate surroundings when the refrigeration is used to counteract the net radiant heat entering the enclosure from e remote sources such as the sun . applications include residential air conditioning , in which the comfort of living humans , being parts of the contents of an enclosed space and being at about 98 . 4 ° f ., is maintained by maintaining the atmosphere inside the residence at about 88 to 78 ° f ., while the temperature of the surrounding air might be at temperatures greater than , less than , or equal to 98 . 4 ° f . other applications include the air conditioning of living space , in which heat is removed ( by refrigeration , even though the atmosphere immediately surrounding the enclosure may be at a lower temperature than that of said contents ) from rising above the desired temperature range of about 68 ° f . to 78 ° f ., radiant heat from the sun being the source of heat flowing into the residence . also included are applications , comprising the removal of heat from heat generating electrical components or chemical reactions or the cooling of materials in preparation for use , in which those parts of the contents of an enclosed space may be maintained at desired temperatures , or cooled from undesired temperatures by refrigeration even though said temperatures may be higher than the temperature of the surroundings . also included are applications , comprising the supply of heat to heat absorbing equipment or chemical reactions or the heating of materials in preparation for use , in which those parts of the contents of an enclosed space may be maintained at desired temperatures , or heated from undesired temperatures by heat pump even though said temperatures may be lower than the temperature of the surroundings . preferred embodiment number 4 . the present invention includes the improvements of my application ser . no . 08 / 030 , 734 filing date mar . 12 , 1993 in which the functions of liner and enclosure heat exchanger nay each be performed by separate components instead of by dual purpose components , for reasons comprising puncture prevention , hygiene , aesthetics or containment of stored materials . preferred embodiment number 5 . the present invention includes an improvement to combination refrigeration and heat pumping processes , for recovering reject heat from refrigerators , typical of residential type appliances , to meet hot water demands , typical of residential type requirements ; in accordance with the present invention or my application ser . no . 08 / 030 , 734 filing date mar . 12 , 1993 ; in which the hot water temperature is set to just meet , or only slightly exceed , the maximum user demand ( 120 ° f . for example , instead of 140 ° f . for example ), thus increasing efficiency by reducing the temperature at which heat is rejected from the refrigeration system . since the objective is to increase , not decrease , energy efficiency , the reduced operating temperature is to be attained by providing sufficient heat storage capacity to meet substantially maximum demand volume , rather than by discarding surplus heat . for example the water storage tank may be sized to provide the volume of water desired by the user at the temperature desired by the user rather than a smaller volume at a higher temperature for the user to temper by mixing with cooler water . preferred embodiment number 5 . 1 . the present invention includes the improvement of preferred embodiment number 5 , in which the hot water system is segregated either into two or more heat pumping zones , or into two or more heat pumping zones and two or more usage streams , which may be operated at different temperatures , the zone / stream temperatures being set to just meet , or only slightly exceed , the maximum user demands for their respective zone / streams , thus further increasing efficiency by further reducing the temperature at which heat is rejected from one or more of the refrigeration systems . as shown in fig7 heat 8 is rejected from the freezer compartment 1 , heat 9 is rejected from the storage cabinet 2 , heat 8 &# 39 ; is absorbed by the hot water zone 3 and heat 9 &# 39 ; is absorbed by the warm water cabinet 4 . unheated water 5 is supplied to the bottom of warm water zone 4 , warm water is supplied 6 to users and 10 to the hot water zone 3 and hot water is supplied 7 to users . the freezer 1 is maintained at about 0 to 5 ° f . the is storage cabinet 2 is maintained at about 33 to 38 ° f . the hot water zone 3 is maintained at about 120 to 140 ° f . the warm water zone 4 is maintained at about 80 to 120 ° f . as shown in details numbers 5 . 1 . 1 , 5 . 1 . 2 , and 5 . 1 . 3 , the reject heat 8 from the freezer 1 may be absorbed as heat 8 &# 39 ; by the hot water zone 3 or as heat 9 &# 39 ; by the warm water zone 4 . similarly the reject heat 9 from the storage cabinet 2 may be absorbed as heat 8 &# 39 ; by the hot water zone 3 or as heat 9 &# 39 ; by the warm water zone 4 . these processes may be effected by single stage refrigeration / heat - pumping systems , absorbing heat from the refrigerator compartment and supplying heat to the water tank , as described in embodiment 2 . 6 . or my application ser . no . 08 / 030 , 734 filing date mar . 12 , 1993 . alternatively the refrigeration systems may reject heat to an intermediate system 11 , from which heat pumps absorb heat as described in embodiment 2 . 5 . the water flows may be continuous in some cases but in many residential type applications will be intermittent , in response to user demands . the warm water stream 6 may be eliminated . the resulting zoned only system ( of embodiment number 5 ), though less energy efficient than the zoned and streamed system ( of embodiment number 5 . 1 ), is more energy efficient than the single zone systems ( of the prior art ). advantages of embodiment number 5 comprise improved efficiency due to reduced temperature difference between heat suppliers and absorbers , reduced problems in controlling shower temperatures , and reduced risks of scalding . disadvantages comprise the need , in many cases , for more hot water storage capacity , which may increase initial installed cost and require more space . while lower temperatures are of little benefit , when the heat source is electrical resistance heating or combustion , benefits are substantial when heat pumping involved because heat pump efficiency increases as the heat supplier temperature decreases . general notes relating to the preferred embodiments typical temperatures , or temperature ranges , are not intended to be exhaustive . operation under different conditions is frequently possible , and applications are numerous . the refrigeration system can be : either a vapor compression system , in which case the energy input 17 is compression work to compressor 7 ( less energy which might be recovered from the expansion device 8 ) and the heat absorber and supplier are the evaporating refrigerant and the condensing refrigerant respectively ; or an absorption system , in which case the energy input 17 depicts the net effect of heat supplied to the generator 7 and heat removed at the absorber 8 , and the heat absorber and supplier are refrigerant evaporating and condensing respectively ; or a solid state system , in which case the energy input 17 depicts the electrical energy supplied to the system , and the heat absorber and supplier are cold and hot junctions respectively . the invention can a also be used with some other types of refrigeration cycle . said heat absorber and heat supplier are enclosure heat exchanger and the surroundings heat exchanger respectively for refrigeration systems . said heat absorber and heat supplier are surroundings heat exchanger and the enclosure heat exchanger respectively for heat pumping systems . the foregoing description of the preferred embodiments of the invention has been presented for the purposes off illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above is teaching . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . | 5 |
in order that the invention herein described may be more fully understood , the following detailed description is set forth . in the description , the following terms are employed : the term “ heterocyclyl ” or “ heterocycle ” refers to a stable 5 - 7 membered monocyclic heterocyclic ring which is either saturated or unsaturated , and which may be optionally benzofused if monocyclic . each heterocycle consists of one or more carbon atoms and from one to four heteroatoms selected from the group consisting of nitrogen , oxygen and sulfur . as used herein , the terms “ nitrogen and sulfur heteroatoms ” include any oxidized form of nitrogen and sulfur , and the quaternized form of any basic nitrogen . a heterocyclyl radical may be attached at any endocyclic carbon or heteroatom that results in the creation of a stable structure . examples of such groups include imidazolyl , imidazolinoyl , imidazolidinyl , quinolyl , isoqinolyl , indolyl , indazolyl , indazolinolyl , perhydropyridazyl , pyridazyl , pyridyl , pyrrolyl , pyrrolinyl , pyrrolidinyl , pyrazolyl , pyrazinyl , quinoxolyl , piperidinyl , pyranyl , pyrazolinyl , piperazinyl , pyrimidinyl , pyridazinyl , morpholinyl , thiamorpholinyl , furyl , thienyl , triazolyl , thiazolyl , carbolinyl , tetrazolyl , thiazolidinyl , benzofuranoyl , thiamorpholinyl sulfone , oxazolyl , benzoxazolyl , oxopiperidinyl , oxopyrrolidinyl , oxoazepinyl , azepinyl , isoxozolyl , isothiazolyl , furazanyl , tetrahydropyranyl , tetrahydrofuranyl , thiazolyl , thiadiazoyl , dioxolyl , dioxinyl , oxathiolyl , benzodioxolyl , dithiolyl , thiophenyl , tetrahydrothiophenyl , sulfolanyl , dioxanyl , dioxolanyl , tetahydrofurodihydrofuranyl , tetrahydropyranodihydrofuranyl , dihydropyranyl , tetradyrofurofuranyl and tetrahydropyranofuranyl . the term “ pharmaceutically acceptable salts ” refers to compounds according to the invention used in the form of salts derived from inorganic or organic acids and bases . included among acid salts , for example , are the following : acetate , adipate , alginate , aspartate , benzoate , benzenesulfonate , bisulfate , butyrate , citrate , camphorate , camphorsulfonate , cyclopentanepropionate , digluconate , dodecylsulfate , ethanesulfonate , fumarate , flucoheptanoate , glycerophosphate , hemisulfate , heptanoate , hexanoate , hydrochloride , hydrobromide , hydroiodide , 2 - hydroxyethanesulfonate , lactate , maleate , methanesulfonate , 2 - naphthalenesulfonate , nicotinate , oxalate , pamoate , pectianate , persulfate , phenylproprionate , picrate , pivalate , propionate , succinate , tartrate , thiocyanate , tosylate and undecanoate . salts derived from appropriate bases include alkali metal ( e . g . sodium ), alkaline earth metal ( e . g ., magnesium ), ammonium and nw 4 + ( wherein w is c 1 - 4 alkyl ). physiologically acceptable salts of a hydrogen atom or an amino group include salts or organic carboxylic acids such as acetic , lactic , tartaric , malic , isethionic , lactobionic and succinic acids ; organic sulfonic acids such as methanesulfonic , ethanesulfonic , benzenesulfonic and p - toluenesulfonic acids and inorganic acids such as hydrochloric , sulfuric , phosphoric and sulfamic acids . physiologically acceptable salts of a compound with a hydroxy group include the anion of said compound in combination with a suitable cation such as na + , nh 4 + , and nw 4 + ( wherein w is a c 1 - 4 alkyl group ). pharmaceutically acceptable salts include salts of organic carboxylic acids such as ascorbic , acetic , citric , lactic , tartaric , malic , maleic , isothionic , lactobionic , p - aminobenzoic and succinic acids ; organic sulphonic acids such as methanesulphonic , ethanesulphonic , benzenesulphonic and p - toluenesulphonic acids and inorganic acids such as hydrochloric , sulphuric , phosphoric , sulphamic and pyrophosphoric acids . for therapeutic use , salts of the compounds according to the invention will be pharmaceutically acceptable . however , salts of acids and bases that are not pharmaceutically acceptable may also find use , for example , in the preparation or purification of a pharmaceutically acceptable compound . preferred salts include salts formed from hydrochloric , sulfuric , acetic , succinic , citric and ascorbic acids . the term “ chemically feasible ” refers to a connectivity of atoms such that the chemical valency of each atom is satisfied . for example , an oxygen atom with two bonds and a carbon atom with four bonds are chemically feasible . the term “ tautomerization ” refers to the phenomenon wherein a proton of one atom of a molecule shifts to another atom . see , jerry march , advanced organic chemistry : reactions , mechanisms and structures , fourth edition , john wiley & amp ; sons , pages 69 - 74 ( 1992 ). the term “ tautomer ” refers to the compounds produced by the proton shift . for example , when r 1 is — oh in a compound of formula i , the compound can exist as a tautomer as shown below : in one embodiment , the present invention provides inhibitors of p38 having the general formulae : het is a 5 - 7 - membered heterocycle with 1 to 4 n , s or o atoms , which heterocycle is substituted with 1 to 3 c 1 - c 4 branched or straight chain alkyl groups . het may optionally be substituted with halo , cyano , n ( r ′) 2 , or ′, co 2 r ′, con ( r ′) 2 , and so 2 n ( r 2 ) 2 . r ′ is selected from hydrogen , ( c 1 - c 3 )- alkyl , ( c 2 - c 3 )- alkenyl or alkynyl , phenyl or phenyl substituted with 1 to 3 substituents independently selected from halo , methoxy , cyano , nitro , amino , hydroxy , methyl or ethyl ; or a 5 - 6 membered heterocyclic ring system optionally substituted with 1 to 3 substituents independently selected from halo , methoxy , cyano , nitro , amino , hydroxy , methyl or ethyl . r 1 is selected from hydrogen , ( c 1 - c 3 )- alkyl , oh , or o —( c 1 - c 3 )- alkyl . r 2 is selected from hydrogen , ( c 1 - c 3 )- alkyl , or ( c 1 - c 3 )- alkenyl ; each optionally substituted with — n ( r ′) 2 , — or ′, sr ′, — c ( o )— n ( r ′) 2 , — s ( o 2 )— n ( r ′) 2 , — c ( o )— or ′, or r 3 . r 3 is selected from 5 - 6 membered aromatic carbocyclic or heterocyclic ring systems . it will be apparent to one of skill in the art that the compounds of the present invention may exist as tautomers . such tautomers may be transient or isolatable as a stable product . these tautomers are envisioned within the scope of the invention . these compounds are also p38 inhibitors and fall within the scope of the present invention . according to a preferred embodiment for formulae i and ii , r 1 is h , n is 1 , and het is an imidazole , triazole , thiazole , oxazole , pyridyl or pyrimidyl ring substituted with 1 to 3 c 1 - c 4 branched or straight chain alkyl groups . according to a more preferred embodiment for formulae i and ii , r 1 is h , n is 1 and het is an imidazole or pyridyl ring substituted with a c 1 - c 3 alkyl group . each of q 1 and q 2 are independently selected from 5 - 6 membered aromatic carbocyclic or heterocyclic ring systems , or 8 - 10 membered bicyclic ring systems comprising aromatic carbocyclic rings , aromatic heterocyclic rings or a combination of an aromatic carbocyclic ring and an aromatic heterocyclic ring . the rings that make up q 1 are optionally substituted with 1 to 4 substituents , each of which is independently selected from j ; halo ; c 1 - c 4 alkyl optionally substituted with nr ′ 2 , or ′, co 2 r ′ or conr ′ 2 ; o —( c 1 - c 4 )- alkyl optionally substituted with a , t - c ( o ) r ′, opo 3 h 2 , nr ′ 2 , nr ′ 2 , or ′, co 2 r ′ or conr ′ 2 ; nr ′ 2 ; ocf 3 ; cf 3 ; no 2 ; co 2 r ′; conr ′; sr ′; s ( o 2 ) n ( r ′) 2 ; scf 3 ; cn ; n ( r ′) c ( o ) r 4 ; n ( r ′) c ( o ) or 4 ; n ( r ′) c ( o ) c ( o ) r 4 ; n ( r ′) s ( o 2 ) r 4 ; n ( r ′) r 4 ; n ( r 4 ) 2 ; or 4 ; oc ( o ) r 4 ; op ( o ) 3 h 2 ; or n ═ c — n ( r ′) 2 . the rings that make up q 2 are substituted with j and optionally substituted with halo , c 1 - c 4 straight chain or branched alkyl , hydroxy , methoxy , trifluoromethyl , trifluoromethoxy , cyano , or amino . j is a c 1 - c 4 straight chain or branched alkyl derivative substituted with 1 - 3 substituents selected from a , - t - c ( o ) r ′ or — opo 3 h 2 . w is selected from h ; n ( r 2 ) so 2 — n ( r 2 ) 2 ; n ( r 2 ) so 2 — n ( r 2 ) ( r 3 ); n ( r 2 ) c ( o )— or 2 ; n ( r 2 ) c ( o )— n ( r 2 ) 2 ; n ( r 2 ) c ( o )— n ( r 2 ) ( r 3 ); n ( r 2 ) c ( o )— r 2 ; n ( r 2 ) 2 ; c ( o )— r 2 ; ch ( oh )— r 2 ; c ( o )— n ( r 2 ) 2 ; c ( o )— or 2 ; or ( c 1 - c 4 ) straight or branched alkyl optionally substituted with a , t -( co ) r ′, n ( r ′) 2 , or ′, co 2 r ′, con ( r ′) 2 , r 3 , or so 2 n ( r 2 ) 2 ; or a 5 - 6 membered carbocyclic or heterocyclic ring system optionally substituted with n ( r ′) 2 , or ′, co 2 r ′, con ( r ′) 2 , or so 2 n ( r 2 ) 2 . r ′, r 2 and r 3 are definded as described above . r 4 is ( c 1 - c 4 )- alkyl optionally substituted with n ( r ′) 2 , or ′, co 2 r ′, con ( r ′) 2 , or so 2 n ( r 2 ) 2 ; a 5 - 6 membered carbocyclic or heterocyclic ring system optionally substituted with a ( c 1 - c 4 ) branched or straight - chain alkyl group , n ( r ′) 2 , or ′, co 2 r ′, con ( r ′) 2 , or so 2 n ( r 2 ) 2 ; or a ( c 1 - c 4 )- alkyl optionally substituted with the 5 - 6 membered carbocyclic or heterocyclic ring system optionally substituted with a ( c 1 - c 4 ) branched or straight - chain alkyl group , n ( r ′) 2 , or ′, co 2 r ′, con ( r ′) 2 , or so 2 n ( r 2 ) 2 . according to a preferred embodiment for compounds of formula iii , q 1 is selected from phenyl or pyridyl containing 1 to 3 substituents , wherein at least one of said substituents is in the ortho position and said substituents are independently selected from chloro , fluoro , bromo , — ch 3 , — och 3 , — oh , — cf 3 , — ocf 3 , — o ( ch 2 ) 2 ch 3 , nh 2 , 3 , 4 - methylenedioxy , — n ( ch 3 ) 2 , — nh — s ( o ) 2 - phenyl , — nh — c ( o ) o — ch 2 - 4 - pyridine , — nh — c ( o ) ch 2 - morpholine , — nh — c ( o ) ch 2 — n ( ch 3 ) 2 , — nh — c ( o ) ch 2 - piperazine , — nh — c ( o ) ch 2 - pyrrolidine , — nh — c ( o ) c ( o )- morpholine , — nh — c ( o ) c ( o )- piperazine , — nh — c ( o ) c ( o )- pyrrolidine , — o — c ( o ) ch 2 — n ( ch 3 ) 2 , or — o —( ch 2 ) 2 — n ( ch 3 ) 2 . even more preferred are phenyl or pyridyl containing at least 2 of the above - indicated substituents both being in the ortho position . most preferably , q 1 is selected from 2 - fluoro - 6 - trifluoromethylphenyl , 2 , 6 - difluorophenyl , 2 , 6 - dichlorophenyl , 2 - chloro - 4 - hydroxyphenyl , 2 - chloro - 4 - aminophenyl , 2 , 6 - dichloro - 4 - aminophenyl , 2 , 6 - dichloro - 3 - aminophenyl , 2 , 6 - dimethyl - 4 - hydroxyphenyl , 2 - methoxy - 3 , 5 - dichloro - 4 - pyridyl , 2 - chloro - 4 , 5 methylenedioxy phenyl , or 2 - chloro - 4 -( n - 2 - morpholino - acetamido ) phenyl . according to a preferred embodiment , q 2 is phenyl or pyridyl , wherein the phenyl or pyridyl contains the substituent j and 0 to 3 other substituents , wherein each of these other substituents is independently selected from chloro , fluoro , bromo , methyl , ethyl , isopropyl , — och 3 , — oh , — nh 2 , — cf 3 , — ocf 3 , — sch 3 , — och 3 , — c ( o ) oh , — c ( o ) och 3 , — ch 2 nh 2 , — n ( ch 3 ) 2 , — ch 2 - pyrrolidine and — ch 2 oh . it will be apparent to one of skill in the art that the compounds of the present invention may exist as tautomers . such tautomers may be transient or isolatable as a stable product . these tautomers are envisioned within the scope of the invention . these compounds are also p38 inhibitors and fall within the scope of the present invention . it will also be apparent to one of skill in the art that when z is ch in compounds of formula iii , a chiral compound is formed . in this case , both enantiomers are envisioned within the scope of the invention . according to another embodiment , the present invention provides methods of producing the above - identified inhibitors of p38 . a method of producing compound 11 is provided in example 1 . the activity of the p38 inhibitors of this invention may be assayed in vitro , in vivo or in a cell line . in vitro assays include assays that determine inhibition of either the kinase activity or atpase activity of activated p38 . alternate in vitro assays quantitate the ability of the inhibitor to bind to p38 and may be measured either by radiolabelling the inhibitor prior to binding , isolating the inhibitor / p38 complex and determining the amount of radiolabel bound , or by running a competition experiment where new inhibitors are incubated with p38 bound to known radioligands . cell culture assays of the inhibitory effect of the compounds of this invention may be used to determine the amounts of tnf , il - 1 , il - 6 or il - 8 produced in whole blood or cell fractions thereof in cells treated with inhibitor as compared to cells treated with negative controls . level of these cytokines may be determined through the use of commercially available elisas . an in vivo assay useful for determining the inhibitory activity of the p38 inhibitors of this invention is the suppression of hind paw edema in rats with mycobacterium butyricum - induced adjuvant arthritis . this is described in j . c . boehm et al ., j . med . chem ., 39 , pp . 3929 - 37 ( 1996 ), the disclosure of which is herein incorporated by reference . the p38 inhibitors of this invention may also be assayed in animal models of arthritis , bone resorption , endotoxin shock and immune function , as described in a . m . badger et al ., j . pharmacol . experimental therapeutics , 279 , pp . 1453 - 61 ( 1996 ), the disclosure of which is herein incorporated by reference . the p38 inhibitors or pharmaceutical salts thereof may be formulated into pharmaceutical compositions for administration to animals or humans . these pharmaceutical compositions , which comprise and amount of p38 inhibitor effective to treat or prevent a p38 - mediated condition and a pharmaceutically acceptable carrier , are another embodiment of the present invention . the term “ p38 - mediated condition ”, as used herein means any disease or other deleterious condition in which p38 is known to play a role . this includes conditions caused by il - 1 , tnf , il - 6 or il - 8 overproduction . such conditions include , without limitation , inflammatory diseases , autoimmune diseases , destructive bone disorders , proliferative disorders , infectious diseases , neurodegenerative diseases , allergies , reperfusion / ischemia in stroke , heart attacks , angiogenic disorders , organ hypoxia , vascular hyperplasia , cardiac hypertrophy , thrombin - induced platelet aggregation , and conditions associated with prostaglandin endoperoxidase synthase - 2 . inflammatory diseases which may be treat d or prevented include , but are not limited to , acute pancreatitis , chronic pancreatitis , asthma , allergies , and adult respiratory distress syndrome . autoimmune diseases which may be treated or prevented include , but are not limited to , glomerulonephritis , rheumatoid arthritis , systemic lupus erythematosus , scleroderma , chronic thyroiditis , graves &# 39 ; disease , autoimmune gastritis , diabetes , autoimmune hemolytic anemia , autoimmune neutropenia , thrombocytopenia , atopic dermatitis , chronic active hepatitis , myasthenia gravis , multiple sclerosis , inflammatory bowel disease , ulcerative colitis , crohn &# 39 ; s disease , psoriasis , or graft vs . host disease . destructive bone disorders which may be treated or prevented include , but are not limited to , osteoporosis , osteoarthritis and multiple myeloma - related bone disorder . proliferative diseases which may be treated or prevented include , but are not limited to , acute myelogenous leukemia , chronic myelogenous leukemia , metastatic melanoma , kaposi &# 39 ; s sarcoma , and multiple myeloma . angiogenic disorders which may be treated or prevented include solid tumors , ocular neovasculization , infantile haemangiomas . infectious diseases which may be treated or prevented include , but are not limited to , sepsis , septic shock , and shigellosis . viral diseases which may be treated or prevented include , but are not limited to , acute hepatitis infection ( including hepatitis a , hepatitis b and hepatitis c ), hiv infection and cmv retinitis . neurodegenerative diseases which may be treated or prevented by the compounds of this invention include , but are not limited to , alzheimer &# 39 ; s disease , parkinson &# 39 ; s disease , cerebral ischemias or neurodegenerative disease caused by traumatic injury . “ p38 - mediated conditions ” also include ischemia / reperfusion in stroke , heart attacks , myocardial ischemia , organ hypoxia , vascular hyperplasia , cardiac hypertrophy , and thrombin - induced platelet aggregation . in addition , p38 inhibitors in this invention are also capable of inhibiting the expression of inducible pro - inflammatory proteins such as prostaglandin endoperoxide synthase - 2 ( pghs - 2 ), also referred to as cyclooxygenase - 2 ( cox - 2 ). therefore , other “ p38 - mediated conditions ” are edema , analgesia , fever and pain , such as neuromuscular pain , headache , pain caused by cancer , dental pain and arthritis pain . the diseases that may be treated or prevented by the p38 inhibitors of this invention may also be conveniently grouped by the cytokine ( il - 1 , tnf , il - 6 , il - 8 ) that is believed to be responsible for the disease . thus , il - 1 - mediated diseases or conditions include rheumatoid arthritis , osteoarthritis , stroke , endotoxemia and / or toxic shock syndrome , inflammatory reaction induced by endotoxin , inflammatory bowel disease , tuberculosis , atherosclerosis , muscle degeneration , cachexia , psoriatic arthritis , reiter &# 39 ; s syndrome , gout , traumatic arthritis , rubella arthritis , acute synovitis , diabetes , pancreatic b - cell disease and alzheimer &# 39 ; s disease . tnf - mediated diseases or conditions include rheumatoid arthritis , rheumatoid spondylitis , osteoarthritis , gouty arthritis and other arthritic conditions , sepsis , septic shock , endotoxic shock , gram negative sepsis , toxic shock syndrome , adult respiratory distress syndrome , cerebral malaria , chronic pulmonary inflammatory disease , silicosis , pulmonary sarcoisosis , bone resorption diseases , reperfusion injury , graft vs . host reaction , allograft rejections , fever and myalgias due to infection , cachexia secondary to infection , aids , arc or malignancy , keloid formation , scar tissue formation , crohn &# 39 ; s disease , ulcerative colitis or pyresis . tnf - mediated diseases also include viral infections , such as hiv , cmv , influenza and herpes ; and veterinary viral infections , such as lentivirus infections , including , but not limited to equine infectious anemia virus , caprine arthritis virus , visna virus or maedi virus ; or retrovirus infections , including feline immunodeficiency virus , bovine immunodeficiency virus , or canine immunodeficiency virus . il - 8 mediated diseases or conditions include diseases characterized by massive neutrophil infiltration , such as psoriasis , inflammatory bowel disease , asthma , cardiac and renal reperfusion injury , adult respiratory distress syndrome , thrombosis and glomerulonephritis . in addition , the compounds of this invention may be used topically to treat or prevent conditions caused or exacerbated by il - 1 or tnf . such conditions include inflamed joints , eczema , psoriasis , inflammatory skin conditions such as sunburn , inflammatory eye conditions such as conjunctivitis , pyresis , pain and other conditions associated with inflammation . in addition to the compounds of this invention , pharmaceutically acceptable salts of the compounds of this invention may also be employed in compositions to treat or prevent the above - identified disorders . pharmaceutically acceptable salts of the compounds of this invention include those derived from pharmaceutically acceptable inorganic and organic acids and bases . examples of suitable acid salts include acetate , adipate , alginate , aspartate , benzoate , benzenesulfonate , bisulfate , butyrate , citrate , camphorate , camphorsulfonate , cyclopentanepropionate , digluconate , dodecylsulfate , ethanesulfonate , formate , fumarate , glucoheptanoate , glycerophosphate , glycolate , hemisulfate , heptanoate , hexanoate , hydrochloride , hydrobromide , hydroiodide , 2 - hydroxyethanesulfonate , lactate , maleate , malonate , methanesulfonate , 2 - naphthalenesulfonate , nicotinate , nitrate , oxalate , palmoate , pectinate , persulfate , 3 - phenylpropionate , phosphate , picrate , pivalate , propionate , salicylate , succinate , sulfate , tartrate , thiocyanate , tosylate and undecanoate . other acids , such as oxalic , while not in themselves pharmaceutically acceptable , may be employed in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable acid addition salts . salts derived from appropriate bases include alkali metal ( e . g ., sodium and potassium ), alkaline earth metal ( e . g ., magnesium ), ammonium and n -( c 1 - 4 alkyl ) 4 + salts . this invention also envisions the quaternization of any basic nitrogen - containing groups of the compounds disclosed herein . water or oil - soluble or dispersible products may b obtained by such quaternization . pharmaceutically acceptable carriers that may be used in these pharmaceutical compositions include , but are not limited to , ion exchangers , alumina , aluminum stearate , lecithin , serum proteins , such as human serum albumin , buffer substances such as phosphates , glycine , sorbic acid , potassium sorbate , partial glyceride mixtures of saturated vegetable fatty acids , water , salts or electrolytes , such as protamine sulfate , disodium hydrogen phosphate , potassium hydrogen phosphate , sodium chloride , zinc salts , colloidal silica , magnesium trisilicate , polyvinyl pyrrolidone , cellulose - based substances , polyethylene glycol , sodium carboxymethylcellulose , polyacrylates , waxes , polyethylene - polyoxypropylene - block polymers , polyethylene glycol and wool fat . the compositions of the present invention may be administered orally , parenterally , by inhalation spray , topically , rectally , nasally , buccally , vaginally or via an implanted reservoir . the term “ parenteral ” as used herein includes subcutaneous , intravenous , intramuscular , intra - articular , intra - synovial , intrasternal , intrathecal , intrahepatic , intralesional and intracranial injection or infusion techniques . preferably , the compositions are administered orally , intraperitoneally or intravenously . sterile injectable forms of the compositions of this invention may be aqueous or oleaginous suspension . these suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents . the sterile injectable preparation may also be a sterile injectable solution or suspension in a non - toxic parenterally - acceptable diluent or solvent , for example as a solution in 1 , 3 - butanediol . among the acceptable vehicles and solvents that may be employed are water , ringer &# 39 ; s solution and isotonic sodium chloride solution . in addition , sterile , fixed oils are conventionally employed as a solvent or suspending medium . for this purpose , any bland fixed oil may be employed including synthetic mono - or di - glycerides . fatty acids , such as oleic acid and its glyceride derivatives are useful in the preparation of injectables , as are natural pharmaceutically - acceptable oils , such as olive oil or castor oil , especially in their polyoxyethylated versions . these oil solutions or suspensions may also contain a long - chain alcohol diluent or dispersant , such as carboxymethyl cellulose or similar dispersing agents which are commonly used in the formulation of pharmaceutically acceptable dosage forms including emulsions and suspensions . other commonly used surfactants , such as tweens , spans and other emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid , liquid , or other dosage forms may also be used for the purposes of formulation . the pharmaceutical compositions of this invention may be orally administered in any orally acceptable dosage form including , but not limited to , capsules , tablets , aqueous suspensions or solutions . in the case of tablets for oral use , carriers that are commonly used include lactose and corn starch . lubricating agents , such as magnesium stearate , are also typically added . for oral administration in a capsule form , useful diluents include lactose and dried corn starch . when aqueous suspensions are required for oral use , the active ingredient is combined with emulsifying and suspending agents . if desired , certain sweetening , flavoring or coloring agents may also be added . alternatively , the pharmaceutical compositions of this invention may be administered in the form of suppositories for rectal administration . these can be prepared by mixing the agent with a suitable non - irritating excipient which is solid at room temperature but liquid at rectal temperature and therefore will melt in the rectum to release the drug . such materials include cocoa butter , beeswax and polyethylene glycols . the pharmaceutical compositions of this invention may also be administered topically , especially when the target of treatment includes areas or organs readily accessible by topical application , including diseases of the eye , the skin , or the lower intestinal tract . suitable topical formulations are readily prepared for each of these areas or organs . topical application for the lower intestinal tract can be effected in a rectal suppository formulation ( see above ) or in a suitable enema formulation . topically - transdermal patches may also be used . for topical applications , the pharmaceutical compositions may be formulated in a suitable ointment containing the active component suspended or dissolved in one or more carriers . carriers for topical administration of the compounds of this invention include , but are not limited to , mineral oil , liquid petrolatum , white petrolatum , propylene glycol , polyoxyethylene , polyoxypropylene compound , emulsifying wax and water . alternatively , the pharmaceutical compositions can be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers . suitable carriers include , but are not limited to , mineral oil , sorbitan monostearate , polysorbate 60 , cetyl esters wax , cetearyl alcohol , 2 - octyldodecanol , benzyl alcohol and water . for ophthalmic use , the pharmaceutical compositions may be formulated as micronized suspensions in isotonic , ph adjusted sterile saline , or , preferably , as solutions in isotonic , ph adjusted sterile saline , either with or without a preservative such as benzylalkonium chloride . alternatively , for ophthalmic uses , the pharmaceutical compositions may be formulated in an ointment such as petrolatum . the pharmaceutical compositions of this invention may also be administered by nasal aerosol or inhalation . such compositions are prepared according to techniques well - known in the art of pharmaceutical formulation and may be prepared as solutions in saline , employing benzyl alcohol or other suitable preservatives , absorption promoters to enhance bioavailability , fluorocarbons , and / or other conventional solubilizing or dispersing agents . the amount of p38 inhibitor that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated , the particular mode of administration . preferably , the compositions should be formulated so that a dosage of between 0 . 01 - 100 mg / kg body weight / day of the inhibitor can be administered to a patient receiving these compositions . it should also be understood that a specific dosage and treatment regimen for any particular patient will depend upon a variety of factors , including the activity of the specific compound employed , the age , body weight , general health , sex , diet , time of administration , rate of excretion , drug combination , and the judgment of the treating physician and the severity of the particular disease being treated . the amount of inhibitor will also depend upon the particular compound in the composition . according to another embodiment , the invention provides methods for treating or preventing a p38 - mediated condition comprising the step of administering to a patient one of the above - described pharmaceutical compositions . the term “ patient ”, as used herein , means an animal , preferably a human . preferably , that method is used to treat or prevent a condition selected from inflammatory diseases , autoimmune diseases , destructive bone disorders , proliferative disorders , infectious diseases , degenerative diseases , allergies , reperfusion / ischemia in stroke , heart attacks , angiogenic disorders , organ hypoxia , vascular hyperplasia , cardiac hypertrophy , and thrombin - induced platelet aggregation . according to another embodiment , the inhibitors of this invention are used to treat or prevent an il - 1 , il - 6 , il - 8 or tnf - mediated disease or condition . such conditions are described above . depending upon the particular p38 - mediated condition to be treated or prevented , additional drugs , which are normally administered to treat or prevent that condition may be administered together with the inhibitors of this invention . for example , chemotherapeutic agents or other anti - proliferative agents may be combined with the p38 inhibitors of this invention to treat proliferative diseases . those additional agents may be administered separately , as part of a multiple dosage regimen , from the p38 inhibitor - containing composition . alternatively , those agents may be part of a single dosage form , mixed together with the p38 inhibitor in a single composition . in order that the invention described herein may be more fully understood , the following examples are set forth . it should be understood that these examples are for illustrative purposes only and are not to be construed as limiting this invention in any manner . compound 1 was dissolved in a 1 : 20 ratio in a solution of concentrated sulfuric acid and glacial acetic acid ( 1 : 4 ). aqueous nano 2 was added dropwise to the solution over two hours ( h ). the reaction mixture was stirred at 60 ° c . for one hour . this solution was transferred to one equivalent of cubr and three equivalents of hbr ( stock concentration of hbr was 48 %) at 100 ° c . over one hour . the reaction mixture was stirred at 100 ° c . for one hour . the reaction mixture was poured into ice . compound 2 was precipitated , filtered and further purified by chromatography . the yield of compound 2 was 90 %. one equivalent of compound 2 and one equivalent of methyl cyanoacetate were dissoved in dimethyl formamide ( dmf ). two equivalents of k 2 co 3 were added to the dmf solution at 50 ° c . the reaction mixture was stirred at 50 ° c . overnight . the reaction mixture was poured into a hcl / crushed - ice bath . compound 3 was precipitated , filtered and directly used for next step . the yield of compound 3 was 90 %. compound 3 was dissolved in a solution of 5 % concentrated sulfuric acid , 47 . 5 % acetic acid and 47 . 5 % water . the reaction mixture was stirred at 125 ° c . for five hours . the reaction mixture was poured into an excess of crushed ice . compound 4 was precipitated , filtered and directly used for next step without further purification . the yield of compound 4 was 90 %. compound 4 was suspended in ethyl alcohol . concentrated hcl containing 4 . 5 equivalent of sncl 2 was added at 75 ° c . the reaction mixture was refluxed for 30 min . at 75 ° c . thin layer chromatography ( tlc ) indicated the reaction was completed . the reaction solution was cooled to room temperature . the precipitate was filtered , dissolved in ethyl acetate , and the organic phase was washed with saturated k 2 co 3 and nacl , then was dried with mgso 4 . the solvent was removed under reduced pressure . compound 5 was obtained pure at a yield of 90 %. one equivalent of compound 5 and one equivalent of 3 , 6 - dichloropyridazine were dissolved in tetrahydrofuran ( thf ) at 60 ° c . two equivalents of potassium t - butyl hydroxide were added . the reaction mixture was stirred at 60 ° c . for one hour . saturated nacl and ethyl acetate were added to the reaction mixture . the ph of the aqueous phase was adjusted to 7 with hcl and extracted with ethyl acetate . the organic phase was washed with saturated nacl two times and dried with mgso 4 . the solvent was removed under reduced pressure . compound 6 was purified by chromatography at a yield of 60 %. a thf solution of 2 , 4 - difluorothiophenol at 0 - 5 ° c . was added to nah . the suspension was stirred at 0 - 5 ° c . until no more bubbles were released and the reaction mixture became a clear solution . the solution was then warmed to 60 ° c . compound 6 at 60 ° c . was added to this solution . the reaction was refluxed until tlc indicated compound 6 was consumed . saturated nacl and ethyl acetate were added to the reaction mixture . the organic phase was washed with saturated nacl two times and dried with mgso 4 . the solvent was removed under reduced pressure . compound 7 was purified by chromatography at a yield of 90 %. a toluene solution of compound 7 and aldehyde 8 was refluxed for 24 h . the imine formed was purified by chromatography , dissolved in anhydrous methyl alcohol , and reduced to amine 9 with nabh 4 in the presence of catalytic amount of acetic acid . the reaction was quenched with water and extracted with ethyl acetate . the organic layer was removed under vacuum and the crude amine was stirred with concentrated sulfuric acid solution at 100 ° c . for 30 min . the amide 10 was precipitated out from a nacl / crushed - ice bath , filtered and directly used in the ring closure step . amide 10 was dissolved in thf . excess dmf - dma was added to the solution . the reaction solution was stirred at 70 ° c . for one to two hours . the product 11 was purified by crystallization from ethyl acetate . two splice variants of human p38 kinase , csbp1 and csbp2 , have been identified . specific oligonucleotide primers were used to amplify the coding region of csbp2 cdna using a hela cell library ( stratagene ) as a template . the polymerase chain reaction product was cloned into the pet - 15b vector ( novagen ). the baculovirus transfer vector , pvl -( his ) 6 - p38 was constructed by subcloning a xbai - bamhi fragment of pet15b -( his ) 6 - p38 into the complementary sites in plasmid pvl1392 ( pharmingen ). the plasmid pvl -( his ) 6 - p38 directed the synthesis of a recombinant protein consisting of a 23residue peptide ( mgss hhhhhh ssg lvprgshmle , where lvprgs represents a thrombin cleavage site ) fused in frame to the n - terminus of p38 , as confirmed by dna sequencing and by n - terminal sequencing of the expressed protein . monolayer culture of spodoptera frugiperda ( sf9 ) insect cells ( atcc ) was maintained in tnm - fh medium ( gibco brl ). supplemented with 10 % fetal bovine serum in a t - flask at 27 ° c . sf9 cells in log phase were co - transfected with linear viral dna of autographa califonica nuclear polyhedrosis virus ( pharmingen ) and transfer vector pvl -( his ) 6 - p38 using lipofectin ( invitrogen ). the individual recombinant baculovirus clones were purified by plaque assay using 1 % low melting agarose . [ 0128 ] trichoplusia ni ( tn - 368 ) high - five ™ cells ( invitrogen ) were grown in suspension in excel - 405 protein free medium ( jrh bioscience ) in a shaker flask at 27 ° c . cells at a density of 1 . 5 × 10 6 cells / ml were infected with the recombinant baculovirus described above at a multiplicity of infection of 5 . the expression level of recombinant p38 was monitored by immunoblotting using a rabbit anti - p38 antibody ( santa cruz biotechnology ). the cell mass was harvested 72 hours after infection when the expression level of p38 reached its maximum . frozen cell paste from cells expressing the ( his ) 6 - tagged p38 was thawed in 5 volumes of buffer a ( 50 mm nah2po4 ph 8 . 0 , 200 mm nacl , 2 mm β - mercaptoethanol , 10 % glycerol and 0 . 2 mm pmsf ). after mechanical disruption of the cells in a microfluidizer , the lysate was centrifuged at 30 , 000 × g for 30 minutes . the supernatant was incubated batchwise for 3 - 5 hours at 4 ° c . with talon ™ ( clontech ) metal affinity resin at a ratio of 1 ml of resin per 2 - 4 mgs of expected p38 . the resin was settled by centrifugation at 500 × g for 5 minutes and gently washed batchwise with buffer a . the resin was slurried and poured into a column ( approx . 2 . 6 × 5 . 0 cm ) and washed with buffer a + 5 mm imidazole . the ( his ) 6 - p38 was eluted with buffer a + 100 mm imidazole and subsequently dialyzed overnight at 4 ° c . against 2 liters of buffer b , ( 50 mm hepes , ph 7 . 5 , 25 mm β - glycerophosphate , 5 % glycerol , 2 mm dtt ). the his 6 tag was removed by addition of at 1 . 5 units thrombin ( calbiochem ) per mg of p38 and incubation at 20 ° c . for 2 - 3 hours . the thrombin was quenched by addition of 0 . 2 mm pmsf and then the entire sample was loaded onto a 2 ml benzamidine agarose ( american international chemical ) column . the flow through fraction was directly loaded onto a 2 . 6 × 5 . 0 cm q - sepharose ( pharmacia ) column previously equilibrated in buffer b + 0 . 2 mm pmsf . the p38 was eluted with a 20 column volume linear gradient to 0 . 6m nacl in buffer b . the eluted protein peak was pooled and dialyzed overnight at 4 ° c . vs . buffer c ( 50 mm hepes ph 7 . 5 , 5 % glycerol , 50 mm nacl , 2 mm dtt , 0 . 2 mm pmsf ). the dialyzed protein was concentrated in a centriprep ( amicon ) to 3 - 4 ml and applied to a 2 . 6 × 100 cm sephacryl s - 100hr ( pharmacia ) column . the protein was eluted at a flow rate of 35 ml / hr . the main peak was pooled , adjusted to 20 mm dtt , concentrated to 10 - 80 mgs / ml and frozen in aliquots at − 70 ° c . or used immediately . p38 was activated by combining 0 . 5 mg / ml p38 with 0 . 005 mg / ml dd - double mutant mkk6 in buffer b + 10 mm mgcl2 , 2 mm atp , 0 . 2 mm na2vo4 for 30 minutes at 20 ° c . the activation mixture was then loaded onto a 1 . 0 × 10 cm monoq column ( pharmacia ) and eluted with a linear 20 column volume gradient to 1 . 0 m nacl in buffer b . the activated p38 eluted after the adp and atp . the activated p38 peak was pooled and dialyzed against buffer b + 0 . 2 mm na2vo4 to remove the nacl . the dialyzed protein was adjusted to 1 . 1m potassium phosphate by addition of a 4 . 0m stock solution and loaded onto a 1 . 0 × 10 cm hic ( rainin hydropore ) column previously equilibrated in buffer d ( 10 % glycerol , 20 mm β - glycerophosphate , 2 . 0 mm dtt )+ 1 . 1mk2hpo4 . the protein was eluted with a 20 column volume linear gradient to buffer d + 50 mm k2hpo4 . the double phosphorylated p38 eluted as the main peak and was pooled for dialysis against buffer b + 0 . 2 mm na2vo4 . the activated p38 was stored at − 70 ° c . this assay is carried out in the presence of 10 mm mgcl2 , 25 mm β - glycerophosphate , 10 % glycerol and 100 mm hepes buffer at ph 7 . 6 . for a typical ic 50 determination , a stock solution is prepared containing all of the above components and activated p38 ( 5 nm ). the stock solution is aliquotted into vials . a fixed volume of dmso or inhibitor in dmso ( final concentration of dmso in reaction is 5 %) is introduced to each vial , mixed and incubated for 15 minutes at room temperature . egf receptor peptide , krelvepltpsgeapnqallr , a phosphoryl acceptor in p38 - catalyzed kinase reaction , is added to each vial to a final concentration of 200 μm . the kinase reaction is initiated with atp ( 100 μm ) and the vials are incubated at 30 ° c . after 30 minutes , the reactions are quenched with equal volume of 10 % trifluoroacetic acid ( tfa ). the phosphorylated peptide is quantified by hplc analysis . separation of phosphorylated peptide from the unphosphorylated peptide is achieved on a reverse phase column ( deltapak , 5 μm , c18 100d , part no . 011795 ) with a binary gradient of water and acteonitrile , each containing 0 . 1 % tfa . ic 50 ( concentration of inhibitor yielding 50 % inhibition ) is determined by plotting the % activity remaining against inhibitor concentration . this assay is carried out in the presence of 10 mm mgcl2 , 25 mm β - glycerophosphate , 10 % glycerol and 100 mm hepes buffer at ph 7 . 6 . for a typical ki determination , the km for atp in the atpase activity of activated p38 reaction is determined in the absence of inhibitor and in the presence of two concentrations of inhibitor . ki is determined from the rate data as a function of inhibitor and atp concentrations . a stock solution is prepared containing all of the above components and activated p38 ( 60 nm ). the stock solution is aliquoted into vials . a fixed volume of dmso or inhibitor in dmso ( final concentration of dmso in reaction is 2 . 5 %) is introduced to each vial , mixed and incubated for 15 minutes at room temperature . the reaction is initiated by adding various concentrations of atp and then incubated at 30 ° c . after 30 minutes , the reactions are quenched with 50 μl of edta ( 0 . 1 m , final concentration ), ph 8 . 0 . the product of p38 atpase activity , adp , is quantified by hplc analysis . separation of adp from atp is achieved on a reversed phase column ( supelcosil , lc - 18 , 3 μm , part no . 5 - 8985 ) using a binary solvent gradient of following composition : solvent a — 0 . 1 m phosphate buffer containing 8 mm tetrabutylammonium hydrogen sulfate ( sigma chemical co ., catalogue no . t - 7158 ), solvent b — solvent a with 30 % methanol . c . inhibition of il - 1 , tnf , il - 6 and il - 8 production in lps - stimulated pbmcs inhibitors are serially diluted in dmso from a 20 mm stock . at least 6 serial dilutions are prepared . then 4 × inhibitor stocks are prepared by adding 4 μl of an inhibitor dilution to 1 ml of rpmi1640 medium / 10 % fetal bovine serum . the 4 × inhibitor stocks contained inhibitor at concentrations of 80 μm , 32 μm , 12 . 8 μm , 5 . 12 μm , 2 . 048 μm , 0 . 819 μm , 0 . 328 μm , 0 . 131 μm , 0 . 052 μm , 0 . 021 μm etc . the 4 × inhibitor stocks are pre - warmed at 37 ° c . until use . fresh human blood buffy cells are separated from other cells in a vacutainer cpt from becton & amp ; dickinson ( containing 4 ml blood and enough dpbs without mg 2 + / ca 2 + to fill the tube ) by centrifugation at 1500 × g for 15 min . peripheral blood mononuclear cells ( pbmcs ), which are located on top of the gradient in the vacutainer , are removed and washed twice with rpmi1640 medium / 10 % fetal bovine serum . pbmcs are collected by centrifugation at 500 × g for 10 min . the total cell number is determined using a neubauer cell chamber and the cells are adjusted to a concentration of 4 . 8 × 10 6 cells / ml in cell culture medium ( rpmi1640 supplemented with 10 % fetal bovine serum ). alternatively , whole blood containing an anti - coagulant is used directly in the assay . 100 μl of cell suspension or whole blood is placed in each well of a 96 - well cell culture plate . then , 50 μl of the 4 × inhibitor stock to the cells is added . finally , 50 μl of a lipopolysaccharide ( lps ) working stock solution ( 16 ng / ml in cell culture medium ) is added to give a final concentration of 4 ng / ml lps in the assay . the total assay volume of the vehicle control is also adjusted to 200 μl by adding 50 μl cell culture medium . the pbmc cells or whole blood are then incubated overnight ( for 12 - 15 hours ) at 37 ° c ./ 5 % co2 in a humidified atmosphere . the next day the cells are mixed on a shaker for 3 - 5 minutes before centrifugation at 500 × g for 5 minutes . cell culture supernatants are harvested and analyzed by elisa for levels of il - 1b ( r & amp ; d systems , quantikine kits , # dbl50 ), tnf - α ( biosource , # khc3012 ), il - 6 ( endogen , # eh2 - il6 ) and il - 8 ( endogen , # eh2 - il8 ) according to the instructions of the manufacturer . the elisa data are used to generate dose - response curves from which ic50 values are derived . p38 inhibitors of this invention will inhibit phosphorylation of egf receptor peptide , and the production of il - 1 , tnf and il - 6 , as well as il - 8 in lps - stimulated pbmcs or in whole blood . this assay is carried out on pbmcs exactly the same as above except that 50 μl of an il - 1b working stock solution ( 2 ng / ml in cell culture medium ) is added to the assay instead of the ( lps ) working stock solution . cell culture supernatants are harvested as described above and analyzed by elisa for levels of il - 6 ( endogen , # eh2 - il6 ) and il - 8 ( endogen , # eh2 - il8 ) according to the instructions of the manufacturer . the elisa data are used to generate dose - response curves from which ic50 values are derived . e . inhibition of lps - induced prostaglandin endoperoxide synthase - 2 ( pghs - 2 , or cox - 2 ) induction in pbmcs human peripheral mononuclear cells ( pbmcs ) are isolated from fresh human blood buffy coats by centrifugation in a vacutainer cpt ( becton & amp ; dickinson ). 15 × 10 6 cells are seeded in a 6 - well tissue culture dish containing rpmi 1640 supplemented with 10 % fetal bovine serum , 50u / ml penicillin , 50 μg / ml streptomycin , and 2 mm l - glutamine . an inhibitor of the instant invention is added at 0 . 2 , 2 . 0 and 20 μm final concentrations in dmso . then , lps is added at a final concentration of 4 ng / ml to induce enzyme expression . the final culture volume is 10 ml / well . after overnight incubation at 37 ° c ., 5 % co2 , the cells are harvested by scraping and subsequent centrifugation , then the supernatant is removed , and the cells are washed twice in ice - cold dpbs ( dulbecco &# 39 ; s phosphate buffered saline , biowhittaker ). the cells are lysed on ice for 10 min in 50 μl cold lysis buffer ( 20 mm tris - hcl , ph 7 . 2 , 150 mm nacl , 1 % triton - x - 100 , 1 % deoxycholic acid , 0 . 1 % sds , 1 mm edta , 2 % aprotinin ( sigma ), 10 μg / ml pepstatin , 10 μg / ml leupeptin , 2 mm pmsf , 1 mm benzamidine , 1 mm dtt ) containing 1 μl benzonase ( dnase from merck ). the protein concentration of each sample is determined using the bca assay ( pierce ) and bovine serum albumin as a standard . then the protein concentration of each sample is adjusted to 1 mg / ml with cold lysis buffer . to 100 μl lysate an equal volume of 2 × sds page loading buffer is added and the sample is boiled for 5 min . proteins ( 30 μg / lane ) are size - fractionated on 4 - 20 % sds page gradient gels ( novex ) and subsequently transferred onto nitrocellulose membrane by electrophoretic means for 2 hours at 100 ma in towbin transfer buffer ( 25 mm tris , 192 mm glycine ) containing 20 % methanol . the membrane is pretreated for 1 hour at room temperature with blocking buffer ( 5 % non - fat dry milk in dpbs supplemented with 0 . 1 % tween - 20 ) and washed 3 times in dpbs / 0 . 1 % tween - 20 . the membrane is incubated overnight at 4 ° c . with a 1 : 250 dilution of monoclonal anti - cox - 2 antibody ( transduction laboratories ) in blocking buffer . after 3 washes in dpbs / 0 . 1 % tween - 20 , the membrane is incubated with a 1 : 1000 dilution of horseradish peroxidase - conjugated sheep antiserum to mouse ig ( amersham ) in blocking buffer for 1 h at room temperature . then the membrane is washed again 3 times in dpbs / 0 . 1 % tween - 20 and an ecl detection system ( supersignal ™ cl - hrp substrate system , pierce ) is used to determine the levels of expression of cox - 2 . while we have hereinbefore presented a number of embodiments of this invention , it is apparent that our basic construction can be altered to provide other embodiments which utilize the methods of this invention . | 2 |
the term &# 34 ; lower alkyl &# 34 ; as used herein means straight and branched chain alkyl radicals containing from one to six carbon atoms , preferably one to four carbon atoms , and includes methyl , ethyl , propyl , 1 - methylethyl , butyl , 1 , 1 - dimethylethyl , pentyl and the like , unless stated otherwise . the term &# 34 ; halo &# 34 ; as used herein means halo radicals and includes fluoro , chloro , bromo and iodo , unless stated otherwise . the term &# 34 ; lower alkoxy &# 34 ; as used herein means straight chain alkoxy radicals containing from one to six carbon atoms and branched chain alkoxy radicals containing three to six carbon atoms and includes methoxy , ethoxy , 1 - methylethoxy , butoxy , hexoxy and the like . the term &# 34 ; lower alkanoyl &# 34 ; as used herein means straight chain 1 - oxoalkyl radicals containing from two to six carbon atoms and branched chain 1 - oxoalkyl radicals containing four to six carbon atoms and includes acetyl , 1 - oxopropyl , 2 - methyl - 1 - oxopropyl , 1 - oxohexyl and the like . the term &# 34 ; lower alkenyl &# 34 ; as used herein means straight chain alkenyl radicals containing from two to six carbon atoms and branched chain alkenyl radicals containing three to six carbon atoms and includes ethenyl , 2 - methyl - 2 - propenyl , 4 - hexenyl and the like . the term &# 34 ; lower alkynyl &# 34 ; as used herein means straight chain alkynyl radicals containing from two to six carbon atoms and branched chain alkynyl radicals containing four to six carbon atoms and includes ethynyl , 2 - propynyl , 1 - methyl - 2 - propynyl , 3 - hexynyl and the like . the term &# 34 ; cyclo ( lower ) alkyl &# 34 ; as used herein means saturated cyclic hydrocarbon radicals containing from four to six carbon atoms and includes cyclobutyl , cyclopentyl and cyclohexyl . the term &# 34 ; complex borohydride &# 34 ; as used herein means the metal borohydrides and includes , for example , sodium borohydride , sodium cyanoborohydride , potassium borohydride , lithium borohydride and zinc borohydride . the term &# 34 ; complex metal hydride &# 34 ; as used herein means metal hydride reducing agents and includes , for example , lithium aluminum hydride , lithium aluminum hydride - aluminum chloride , diisobutylaluminum hydride , and sodium bis -( 2 - methoxyethoxy ) aluminum hydride . the term &# 34 ; lower alkanol &# 34 ; as used herein means both straight and branched chain alkanols containing from one to four carbon atoms and includes methanol , ethanol , 1 - methylethanol , butanol and the like . the term &# 34 ; organic proton acceptor &# 34 ; as used herein means the organic bases or amines , for instance , triethylamine , pyridine , n - ethylmorpholine , 1 , 5 - diazabicyclo [ 4 . 3 . 0 ] non - 5 - ene and the like . the term &# 34 ; inorganic proton acceptor &# 34 ; as used herein means the inorganic bases , preferably the alkali methyl hydroxides , carbonates and bicarbonates , for example , sodium hydroxide , potassium hydroxide , sodium carbonate , sodium bicarbonate , potassium carbonate and the like . the term &# 34 ; proton acceptor &# 34 ; as used herein means a proton acceptor selected from an organic proton acceptor and inorganic proton acceptor , as defined hereinabove . the compounds of this invention are capable of forming acid addition salts with therapeutically acceptable acids . the acid addition salts are prepared by reacting the base form of the appropriate compound of formula i with one or more equivalents , preferably with an excess , of the appropriate acid in an organic solvent , for example , diethyl ether or an ethanoldiethyl ether mixture . these salts , when administered to a mammal , possess the same pharmacologic activities as the corresponding bases . for many purposes it is preferable to administer the salts rather than the basic compounds . suitable acids to form these salts include the common mineral acids , e . g . hydrohalic , sulfuric or phosphoric acid ; the organic acids , e . g . maleic , citric or tartaric acid ; and acids which are sparingly soluble in body fluids and which impart slow - release properties to their respective salts , e . g . pamoic or tannic acid or carboxymethyl cellulose . the addition salts thus obtained are the functional equivalent of the parent base compound in respect to their therapeutic use . hence , these addition salts are included within the scope of this invention and are limited only by the requirement that the acids employed in forming the salts be therapeutically acceptable . the antihypertensive effect of the compounds of formula i or a therapeutically acceptable acid addition salt thereof is demonstrated in standard pharmacological tests , for example , in tests conducted in the spontaneously hypertensive rate ( shr ). the latter test method is as follows : male rats , okamoto - aoki strain , ranging in weight between 250 - 400 g were anesthetized with diethyl ether . their left femoral arteries and veins were cannulated with polyethylene tubing of the appropriate size . each animal was then enfolded in a rubber mesh jacket which was secured with 4 towel clamps . the animal was suspended via the towel clamps from a bar and allowed to recover from the anesthesia . the femorial arterial cannula was connected to a stratham pressure transducer ( model p23 , gould stratham instruments , hato rey , porto rico ), which in turn was attached to a polygraph for recording the mean arterial blood pressure and pulse rate . the pulse rate was considered to be the heart rate . the test compound was administered by gastric gavage in a volume of 5 ml / kg . heart rate and blood pressure were noted at 5 , 10 , 15 , 30 , 45 and 60 minutes and hourly thereafter for a period of at least 4 hours after drug administration . using this method , the following representative compounds of formula i are effective for reducing the blood pressure ( bp ) in the spontaneously hypertensive rat ( the amount of test compound and the reduction in bp are indicated in the parenthesis ): ( 4a , 12a - cis )- 1 , 4 - diethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole dihydrochloride ( described in example 5 , at a dose of 25 mg / kg of body weight caused a 20 % decrease in mean bp at 1 hour ), ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole maleate ( described in example 11 , at a dose of 10 mg / kg of body weight caused a 19 % decrease in bp at 4 hours ), ( 4a , 12a - trans )- 7 - bromo - 1 , 4 - diethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole hydrochloride ( described in example 12 , at a dose of 10 mg / kg of body weight caused a 15 % decrease in bp at 4 hours ), 4a , 12 - a - trans )- 1 -( 2 - propynyl )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole pg , 8 dihydrochloride ( described in example 13 , at a dose of 10 mg / kg of body weight caused a 14 % decrease in bp at 4 hours ), ( 4a , 12a - trans )- 1 , 4 , 5 - trimethyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole maleate ( described in example 14 , at a dose of 10 mg / kg of body weight caused a 23 % decrease in bp at 4 hours ), ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole - 1 , 4 - diethanol dihydrochloride ( described in example 15 , at a dose of 10 mg / kg of body weight caused a 34 % decrease in bp at 1 hour ), ( 4a , 12a - trans )- 1 - ethyl - 5 - methyl - 4 - propyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole hydrobromide ( described in example 17 , at a dose of 10 mg / kg of body weight caused a 42 % decrease in bp at 4 hours ), ( 4a , 12a - trans )- 4 - butyl - 1 - ethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole dihydrochloride ( described in example 17 , at a dose of 10 mg / kg of body weight caused a 36 % decrease in bp at 4 hours ), and ( 4a , 12a - trans )- 4 - ethyl - 5 - methyl -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole dihydrobromide ( described in example 17 , at a dose of 10 mg / kg caused a 43 % decrease in bp at 4 hours ). the compounds of formula i of this invention are used alone or in combination with pharmacologically acceptable carriers , the proportion of which is determined by the solubility and chemical nature of the compound , chosen route of administration and standard biological practice . for example , they are administered orally in the form of suspensions or solutions or they may be injected parenterally . for parenteral administration they can be used in the form of a sterile solution containing other solutes , for example , enough saline or glucose to make the solution isotonic . the tablet compositions contain the active ingredient in admixture with non - toxic pharmaceutical excipients known to be suitable in the manufacture of tablets . suitable pharmaceutical excipients are , for example , starch , milk sugar , certain types of clay and so forth . the tablets can be uncoated or they can be coated by known techniques so as to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period . the aqueous suspensions of the compounds of formula i contain the active ingredient in admixture with one or more non - toxic pharmaceutical excipients known to be suitable in the manufacture of aqueous suspensions . suitable excipients are , for example , methylcellulose , sodium alginate , gum acacia , lecithin and so forth . the aqueous suspensions can also contain one or more preservatives , one or more coloring agents , one or more flavoring agents and one or more sweetening agents . non - aqueous suspensions can be formulated by suspending the active ingredient in a vegetable oil , for example , arachis oil , olive oil , sesame oil , or coconut oil , or in a mineral oil , for example liquid paraffin , and the suspension may contain a thickening agent , for example beeswax , hard paraffin or cetyl alcohol . these compositions can also contain a sweetening agent , flavoring agent and antioxidant . the dosage of the compounds of formula i as antihypertensive agents will vary with the form of administration and the particular compound chosen . furthermore , it will vary with the particular host as well as the age , weight and condition of the host under treatment as well as with the nature and extent of the symptoms . generally , treatment is initiated with small dosages substantially less than the optimum dose of the compound . thereafter , the dosage is increased by small increments until the optimum effect under the circumstances is reached . in general , the compounds of this invention are most desirably administered at a concentration level that will generally afford effective results without causing any harmful or deleterious side effects . for example , the effective antihypertensive amount of the compounds for oral administration can usually range from about 0 . 05 to 100 mg per kilogram body weight per day in single or divided doses although as aforementioned variations will occur . however , a dosage level that is in the range of from about 0 . 1 to 50 mg per kilogram body weight per day in single or divided doses is employed most desirably for oral administration in order to achieve effective results . the compounds of formula i also can be used to produce beneficial effects in the treatment of hypertension , peripheral and cerebral vascular diseases and related disorders when combined with a second therapeutic agent comprising a therapeutically effective amount of a diuretic and / or antihypertensive agent commonly used in antihypertensive therapy . such diuretic and / or antihypertensive therapeutic agents include , for example , the thiazide diuretics for instance , chlorothiazide or hydrochlorothiazide ; mineralocorticoid antagonizing diuretic agents , e . g ., spironolactone ; and other diuretics such as triameterene and furosemide . examples of still other suitable antihypertensive agents are prazosine , hydralazine and centrally active antihypertensive agents such as methyldopa , clonidine , and reserpine ; as well as the β - adrenergic blocking agents , for instance , propranolol . the compound of formula i can be administered sequentially or simultaneously with the antihypertensive and / or diuretic agent . preferred antihypertensive and / or diuretic therapeutic agents are the antihypertensive agents such as the thiazides , mineralocorticold antagonizing diuretic agents and the β - adrenergic blocking agents . a combination of the foregoing antihypertensive agents are well known in the art ; for instance , &# 34 ; physician desk reference &# 34 ;, 33 ed ., medical economics co ., oradell , n . j ., u . s . a ., 1979 . for example , propranolol is administered daily to humans in a range of 80 to 640 mg , usually in the form of unit doses of 10 , 20 , 40 or 80 mg . when used in combination , the compound of formula i is administered as described previously . the compounds of formula i are prepared in the following manner . reaction scheme 1 illustrates a method for preparing some of the compounds of formula ib . ## str8 ## with reference to reaction scheme 1 , bromobutyrolactone is condensed with an ethylenediamine derivative of formula iv in which r 5 is benzyl or lower alkyl to obtain the corresponding piperazine of formula v in which r 5 is as defined herein . preferred conditions for the condensation involve reacting together about equivalent amounts of bromobutyrolactone and the compound of formula iv in the presence of an equivalent amount of a proton acceptor , preferably triethylamine , in an inert organic solvent , preferably tetrahydrofuran , at about 60 ° to 70 ° c . for about 15 to 30 hours . reaction of the piperazine of formula v in which r 5 is as defined herein with about 10 to 25 molar equivalents of thionyl chloride or bromide gives the corresponding piperazine of formula vi in which r 5 is as defined herein and x is bromo or chloro . a suitable solvent is methylene chloride and the reaction is conducted at about 0 ° to 20 ° c . for about 15 minutes to two hours . condensation of the piperazine of formula vi in which r 5 and x are as defined herein with a dihydroindole of formula vii in which r 1 and r 2 are as defined herein gives the corresponding compound of formula viii in which r 1 , r 2 and r 5 are as defined herein . a useful method of preparing the dihydroindoles of formula vii from the corresponding indole is described by a . smith and j . h . p . utley , chem . commun ., 427 ( 1965 ). preferably about 1 . 5 molar equivalents of the piperazine of formula vi is used with respect to the dihydroindole of formula vii . for the inert solvent in the condensation , toluene is preferred . the condensation is usually conducted at about 100 ° to 120 ° c . for about 15 to 30 hours . in order to form the indole ring system , the compound of formula viii in which r 1 , r 2 and r 5 are as defined herein is oxidized with a mixture of manganese dioxide and palladium on charcoal to obtain the corresponding compound of formula ii in which r 1 , r 2 and r 5 are as defined herein . preferably about equal parts by weight of manganese dioxide and about one tenth part by weight of 5 percent palladium on charcoal is used . the oxidation is maintained at about 125 ° to 150 ° c . for about 15 to 30 hours in an inert organic solvent , preferably xylene . cyclodehydration of the compound of formula ii in which r 1 and r 2 are as defined herein and r 5 is lower alkyl with phosphorus oxychloride followed by reduction of the resulting intermediate gives the corresponding compound of formula ib in which r 1 and r 2 are as defined herein , and r 3 and r 4 are the same lower alkyl . in the cyclodehydration , an excess of phosphorus oxychloride is used or usually phosphorus oxychloride also acts as the solvent for the cyclodehydration . the cyclodehydration is conducted at about 90 ° to 110 ° c . for about two to ten hours . the intermediate obtained from the cyclodehydration is immediately reduced with an excess of sodium in a lower alkanol , preferably ethanol , at about 15 ° to 25 ° c . for about 15 minutes to one hour . similarly , cyclodehydration of the compound of formula ii in which r 1 and r 2 are as defined herein and r 5 is benzyl followed by reduction of the resulting intermediate gives the corresponding compound of formula iii in which r 1 and r 2 are as defined herein . hydrogenation of the compound of formula iii in which r 1 and r 2 are as defined herein , preferably in the presence of palladium on carbon in a lower alkanol , affords the corresponding compound of formula ib in which r 1 and r 2 are as defined herein , and r 3 and r 4 are hydrogen . reaction scheme 2 illustrates a method for preparing some of the compounds of formula ia . ## str9 ## with reference to reaction scheme 2 , an indole of formula ix in which r 1 and r 2 are as defined herein , is condensed with butyrolactone to obtain the corresponding acid of formula x in which r 1 and r 2 are as defined herein . in this condensation , the indole of formula ix is first reacted with about one molar equivalent of sodium hydride at about 100 ° c . to generate the anion of the compound of formula ix . a solution of the anion in an inert organic solvent , preferably dimethylformamide , is mixed with about two molar equivalents of butyrolactone . the resulting solution is maintained at about 130 ° to 160 ° c . for about five to ten hours , and the corresponding acid of formula x is isolated . dehydrative cyclization of the acid of formula x in which r 1 and r 2 are as defined herein gives the corresponding tricyclic ketone of formula xi in which r 1 and r 2 are as defined herein . preferred conditions for the cyclization involve reacting the acid of formula x with an excess of a dehydrating agent , preferably polyphosphoric acid , which can also act as the solvent , at about 80 ° to 120 ° c . for about 30 minutes to 5 hours . a number of methods can be used to convert the tricyclic ketone of formula xi in which r 1 and r 2 are as defined herein to the halo compound of formula iv in which r 1 and r 2 are as defined herein and x is bromo or chloro . examples of such methods include use of bromine or chlorine in various inert organic solvents , for example , diethyl ether , chloroform , methylene chloride and acetic acid , at various temperatures ( i . e . - 78 ° to 20 ° c . ); n - bromosuccinimide or n - chlorosuccinimide in an inert organic solvent at 0 ° to 30 ° c . ; dioxane dibromide ; pyridinium hydrobromide perbromide ; trimethylphenylammonium tribromide ; and a mixture of trimethylphenylammonium tribomide and hydrogen bromide . for the subsequent condensation , the compounds of formula iv in which r 1 and r 2 are as defined herein an x is bromo are preferred . the preferred method of preparing the latter compounds of formula iv in which x is bromo involves reacting , in the dark , the compound of formula xi with about one molar equivalent of trimethylphenylammonium tribromide in an inert organic solvent , preferably methylene chloride , at about 10 ° to 30 ° c . for about 20 to 40 hours . condensation of the compound of formula iv in which r 1 , r 2 and x are as defined herein with ethylenediamine and followed by reduction of the resulting intermediate gives the corresponding compound of formula ia in which r 1 and r 2 are as defined herein , and r 3 and r 4 are hydrogen . in the condensation , about two to ten molar equivalents of ethylenediamine are required and an inert organic solvent , preferably dioxane , is used to dissolve the reactants . the condenation reaction is maintained at about 15 ° to 30 ° c . for about 15 to 30 hours . preferably without isolating the condensation product , the condensation reaction mixture is treated with a complex borohydride reducing agent , preferably sodium borohydride , in order to reduce the product of the condensation . for the reduction , usually the condensation reaction mixture is diluted with a lower alkanol , preferably methanol , and a small amount of water , and the reduction reaction is maintained at about 10 ° to 30 ° c . for about one to five hours . if desired , the compound of formula i ( includes compounds of formulae ia and ib ) in which r 1 and r 2 are as defined herein , and r 3 and r 4 are hydrogen can be reacted with a lower alkyl , lower alkenyl , lower alkynyl , cyclo ( lower ) alkyl , lower alkanoyl , lower alkoxycarbonyl ( lower ) alkyl , phenyl ( lower ) alkyl or phenoxy ( lower ) alkyl halide wherein the halide is selected from bromo , chloro or iodo in the presence of a proton acceptor to obtain the corresponding compound of formula i in which r 1 and r 2 are as defined herein , and r 3 and r 4 each is hydrogen , lower alkyl , lower alkenyl , lower alkynyl , cyclo ( lower ) alkyl , lower alkanoyl , lower alkoxycarbonyl ( lower ) alkyl , phenyl ( lower ) alkyl or phenoxy ( lower ) alkyl . preferred proton acceptors include potassium carbonate and triethylamine , and preferred solvents are benzene , acetonitrile , dimethylformamide and methylene chloride . the amount of halide alkylating agent can vary from about 1 . 1 to 1 . 5 molar equivalents if monosubstitution is desired and from about three to ten molar equivalents if disubstitution is desired . the reaction conditions can also vary ; usually a temperature of about 10 ° to 50 ° c . for about one to ten hours will produce monosubstitution and a temperature of about 20 ° to 120 ° c . for about 6 to 72 hours will give disubstitution . a monosubstituted compound of formula i , i . e . r 3 or r 4 is hydrogen , can then be substituted in the above manner to obtain the corresponding compound of formula i in which r 1 and r 2 are as defined herein , and r 3 and r 4 are different and are selected from lower alkyl , lower alkenyl , lower alkynyl , cyclo ( lower ) alkyl , lower alkanoyl , lower alkoxycarbonyl ( lower ) alkyl , phenyl ( lower ) alkyl and phenoxy ( lower ) alkyl . a preferred method for preparing the compound of formula i in which r 1 and r 2 are as defined herein , and r 3 and r 4 are methyl involves reacting the hydrochloride salt of the corresponding compound of formula i in which r 1 and r 2 are as defined herein , and r 3 and r 4 are hydrogen with aqueous formaldehyde at about 10 ° to 30 ° c . for about one to ten hours . the resulting intermediate is then reduced by treating the reaction mixture with the reducing agent , sodium cyanoborohydride , at about 10 ° to 30 ° c . for about 15 to 30 hours . usually , the above alkylation type reactions will preferentially first take place at one of the secondary nitrogen positions , for example , in the compound of formula ia , the secondary nitrogen at position 1 of the ring system is the more reactive . if it is desired that the alkylation type reaction take place at the less reactive secondary nitrogen , the more reactive nitrogen can be blocked by an easily removable blocking group . such a blocking group is introduced by reaction with about one molar equivalent of benzoyl chloride . after the desired alkylation type reaction is conducted at the other secondary position , the benzoyl blocking group is removed under alkaline hydrolysis . if desired , the compound of formula i in which r 1 and r 2 are as defined herein , and r 3 and / or r 4 is lower alkoxycarbonyl ( lower ) alkyl can be reduced with a complex metal hydride reducing agent to obtain the corresponding compound of formula i in which r 1 and r 2 are as defined herein , and r 3 and / or r 4 is hydroxy ( lower ) alkyl . for the reduction , about four to six molar equivalents of lithium aluminum hydride , as the preferred complex metal hydride reducing agent , is used and the reduction is conducted in an inert organic solvent , preferably diethyl ether . the reduction is maintained at about 30 ° to 50 ° c . for about 10 to 20 hours . if desired , some of the trans compounds of formula ia can be isomerized to the corresponding cis compounds of formula ib . most of the trans compounds of formula ia in which r 3 and r 4 are not hydrogen can be isomerized under acidic conditions , for example , in the presence of hydrogen chloride at 20 ° to 120 ° c ., to obtain the corresponding cis compound of formula ib . in some instances , base - catalyzed trans to cis isomerizations can occur . for example , treatment of the compund of formula ia in which r 1 is 7 - bromo , r 2 is methyl , and r 3 and r 4 are ethyl with a solution of sodium methoxide in hexamethylphosphoramide at 150 ° to 200 ° c . for 10 to 30 hours afforded the corresponding cis compound of formula ib in which r 1 is 7 - bromo , r 2 is methyl , and r 3 and r 4 are ethyl . the mixture of sym . dimethylethylenediamine ( 1 eq , 53 g ), bromobutyrolactone ( 1 eq , 100 g ) and triethylamine ( 1 eq , 120 ml ) in 1000 ml of tetrahydrofuran was refluxed overnight . the crude precipitate was filtered and thoroughly washed with diethyl ether . the ether was evaporated and the residue was purified by elution through a silica gel column using 2 % ( v / v ) methanol in chloroform to obtain the title compound . a small sample was converted into a picrate and crystallized from methanol to obtain the picrate salt of the title compound : mp 157 °- 159 ° c . ; ir ( kbr ) 3220 , 1650 , 1565 and 1330 cm - 1 ; uv max ( meoh ) 353 nm ( ε 18090 ); and nmr ( dmso - d 6 ) δ 2 . 1 ( m , 2h ), 2 . 9 and 2 . 93 ( singlets , 6h ), 3 . 5 ( m , 6h ), 3 . 95 ( m , 1h ), and 8 . 55 ( s , 2h ). in the same manner but replacing sym . dimethylethylenediamine with an equivalent amount of sym . diethylethylenediamine , the following compound of formula v was obtained , 1 , 4 - diethyl - 3 -( 2 - hydroxyethyl )- 2 - piperazinone picrate : mp 127 °- 129 ° c . ( crystallized from methanol - diethyl ether ); ir ( mineral oil ) 3290 , 1640 , 1565 and 1315 cm - 1 ; uv max ( meoh ) 354 nm ( ε 15675 ); and nmr ( dmso - d 6 ) δ 1 . 05 and 1 . 25 ( triplets , j = 7 . 5 hz , 6h ), 2 . 04 ( q , j = 5 . 5 hz , 2h ), 3 . 05 - 3 . 75 ( m , 10h ), 3 . 95 ( t , j = 5 . 5 hz , 1h ), and 8 . 55 ( s , 2h ). thionyl chloride ( 1 . 5 ml ) was added dropwise to an ice cooled methylene chloride ( 5 ml ) solution of 3 -( 2 - hydroxyethyl )- 1 , 4 - dimethyl - 2 - piperazinone ( 0 . 40 g , described in example 1 ). the reaction mixture was stirred for 30 min and poured on an ice solution of 10 % sodium bicarbonate . the mixture was extracted with methylene chloride , and the organic extract was dried and evaporated to give the title compound : ir ( chcl 3 ) 1635 cm - 1 ; and nmr ( cdcl 3 ) δ 2 . 35 ( s , 3h ) and 2 . 90 ( s , 3h ). in the same manner , but replacing 3 -( 2 - hydroxyethyl )- 1 , 4 - dimethyl - 2 - piperazinone with an equivalent amount of 1 , 4 - diethyl - 3 -( 2 - hydroxyethyl )- 2 - piperazinone ( described in example 1 ), the following compund of formula vi was obtained , 3 -( 2 - chloroethyl )- 1 , 4 - diethyl - 2 - piperazinone ; ir ( chcl 3 ) 1635 cm - 1 ; and nmr ( cdcl 3 ) δ 1 . 1 ( t , 6h ) and 3 . 65 ( t , 2h ). 2 , 3 - dihydro - 3 - methylindole ( 3 . 99 g , 1 eq , described by a . smith and j . h . p . utley , chem . commun ., 1965 , 427 ) and 3 -( 2 - chloroethyl )- 1 , 4 - dimethyl - 2 - piperazinone ( 5 . 7 g , 1 eq , described in example 2 ) were combined in toluene ( 100 ml ) and refluxed overnight . the cold mixture was poured into an ice solution of 10 % sodium bicarbonate and the product was extracted with methylene chloride . evaporation of the extract gave 9 g of crude product . the crude product was passed through a silica gel column using 3 % ( v / v ) methanol in chloroform to give the title compound ( 6 g ): ir ( chcl 3 ) 1640 cm - 1 ; uv max ( meoh ) 296 nm ( ε 2300 ) and 257 ( 5900 ); and nmr ( cdcl 3 ) δ 1 . 25 ( d , 3h ), 2 . 35 ( s , 3h ), 2 . 8 ( s , 3h ) and 6 . 35 - 7 . 1 ( m , 4h ). in the same manner , but replacing 3 -( 2 - chloroethyl )- 1 , 4 - dimethyl - 2 - piperazinone with an equivalent amount of 3 -( 2 - chloroethyl )- 1 , 4 - diethyl - 2 - piperazinone ( described in example 2 ), the following compound of formula viii was obtained , 1 , 4 - diethyl - 3 -[ 2 -( 2 , 3 - dihydro - 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone ; ir ( chcl 3 ) 1635 cm - 1 ; uv max ( meoh ) 298 nm ( ε 2800 ) and 251 ( 9500 ); and nmr ( cdcl 3 ) δ 1 . 1 ( m , 6h ), 1 . 25 ( d , 3h ) and 6 . 4 - 7 . 15 ( m , 4h ). a suspension of 1 , 4 - dimethyl - 3 -[ 2 -( 2 , 3 - dihydro - 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone ( 3 . 5 g , described in example 3 ), manganese dioxide ( 3 . 5 g ) and 5 % palladium on charcoal ( 0 . 35 g ) in xylene ( 200 ml ) was refluxed overnight . the hot suspension was filtered and the filtrate was evaporated to dryness giving 3 g of the title compound . the title compound was converted into the maleate salt and crystallized from methanol - diethyl ether : mp 130 °- 134 ° c . ; ir ( mineral oil ) 2370 , 1950 and 1665 cm - 1 ; uv max ( meoh ) 290 nm ( ε 5625 ) and 225 ( 36100 ); nmr ( dmso - d 6 ) δ 2 . 2 ( s , 3h ), 2 . 5 ( s , 3h ), 2 . 8 ( s , 3h ), 6 . 15 ( s , 2h ) and 7 . 2 ( m , 4h ); and anal . calcd for c 17 h 23 n 3 o . c 4 h 4 o 4 : c , 62 . 83 % h , 6 . 78 % n , 10 . 47 % and found : c , 62 . 41 % h , 6 . 75 %, n , 10 . 29 %. in the same manner , but replacing 1 , 4 - dimethyl - 3 -[ 2 -( 2 , 3 - dihydro - 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone with an equivalent amount of 1 , 4 - diethyl - 3 -[ 2 -( 2 , 3 - dihydro - 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone ( described in example 3 ), the following compound of formula ii was obtained , 1 , 4 - diethyl - 3 -[ 2 -( 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone : ir ( chcl 3 ) 1640 cm - 1 ; uv max ( meoh ) 290 nm ( ε 5800 ), 258 ( 5400 ), 251 ( 5500 ) and 226 ( 26400 ); and nmr ( cdcl 3 ) δ 1 . 1 ( m , 6h ), 2 . 3 ( s , 3h ), 4 . 15 ( m , 2h ), 6 . 88 ( s , 1h ), and 7 . 05 - 7 . 6 ( m , 4h ). ( 4a , 12a - cis )- 1 , 4 , 5 - trimethyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ]- pyrido [ 1 , 2 - a ] indol ( ib : r 1 = h , and r 2 , r 3 and r 4 = me ) a solution of 1 , 4 - dimethyl - 3 -[ 2 -( 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone ( 2 . 5 g , described in example 4 ) in phosphorous oxychloride ( 10 ml ) was refluxed for 3 . 5 hr . benzene ( 50 ml ) was added to the mixture and the mixture was evaporated under vacuum . the residue was dissolved in absolute ethanol and 1 . 5 g of sodium metal was added in small portions under nitrogen . water was added to the sodium free ethanolic solution and the solution was extracted with diethyl ether . evaporation of the extract gave 2 . 5 g of crude product . chromatography on silica gel using 5 % ( v / v ) methanol in chloroform yielded 0 . 7 g of the title compound . the title compound was converted to the dihydrochloride salt of the title compound and crystallized from acetonitrile : mp 210 °- 212 ° c . ; ir ( mineral oil ) 2430 ; uv max ( meoh ) 282 nm ( ε 6710 ), 276 ( 7210 ) and 225 ( 31790 ); nmr ( dmso - d 6 ) δ 2 . 35 ( s , 3h ), 2 . 65 ( s , 3h ), 3 . 0 ( s , 3h ), 5 . 2 ( br , s , 1h ), 7 . 3 ( m , 4h ) and 7 . 93 ( s , 1h ); and anal . calcd for c 15 h 23 n 3 . hcl : c , 59 . 29 % h , 7 . 90 % n , 12 . 20 % and found : c , 59 . 39 % h , 8 . 07 % n , 12 . 14 %. in the same manner , but replacing 1 , 4 - dimethyl - 3 -[ 2 -( 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone with an equivalent amount of 1 , 4 - diethyl - 3 -[ 2 -( 3 - methyl - 1h - indol - 1 - yl ) ethyl ]- 2 - piperazinone ( described in example 4 ), the following compound of formula ib was obtained , ( 4a , 12a - cis )- 1 , 4 - diethyl - 5 - pyrido [ 1 , 2 - a ] indole as the dihydrochloride salt ; mp 283 °- 240 ° c . ( crystallized from methanol - diethyl ether ); ir ( mineral oil ) 2350 cm - 1 ; uv max ( meoh ) 284 nm ( ε 7900 ), 277 ( 8325 ) and 228 ( 38430 ); nmr ( dmso - d 6 ) δ 1 . 25 ( m , 6h ), 2 . 35 ( s , 3h ), 5 . 25 ( br s , 1h ) and 7 . 3 ( m , 4h ); and anal . calcd for c 19 h 27 n 3 . 2hcl : c , 61 . 61 % h , 7 . 89 % n , 11 . 35 % and found : c , 60 . 89 % h , 8 . 19 % n , 10 . 92 %. 3 - methylindole ( 13 . 1 g ; 1 eq ) and sodium hydride ( 5 g of 50 % suspension -- 1 eq ) were melted together in a 3 - neck round bottom flask immersed in 100 ° c . oil bath until evolution of hydrogen gas ceased . the mixture was cooled down and dissolved in 250 ml of dry dimethylformamide . butyrolactone ( 17 . 2 g -- 2 eq ) was added and the solution was refluxed for 7 hr and poured on ice . the mixture was extracted with diethyl ether , and the acid was liberated with 10 % hydrochloric acid solution . the mixture was extracted with diethyl ether . evaporation of the extract gave a residue which was chromatographed on silica gel using 10 % ( v / v ) ethyl acetate in benzene . evaporation of the appropriate eluates gave 5 . 5 g of the title compound , mp 82 °- 84 ° c . 3 - methyl - 1h - indole - 1 - butanoic acid ( 5 g , described in example 6 ) was suspended in polyphosphoric acid and the mixture was heated at 100 ° c . for 1 hr , cooled , and poured on ice . the mixture was extracted with diethyl ether . the extract was washed with 10 % aqueous sodium bicarbonate , evaporated ( 4 . 4 g of crude product ) and chromatographed through silica gel using 5 % methanol in chloroform ( v / v ). the appropriate eluates were evaporated to give the title compound : mp 87 °- 89 ° c . ; ir ( chcl 3 ) 1648 cm - 1 ; uv max ( meoh ) 316 nm ( ε 21611 ) and 241 ( 26009 ); nmr ( cdcl 3 ) δ 2 . 2 ( m , 2h ), 2 . 5 ( m , 2h ), 2 . 58 ( s , 3h ), 4 . 0 ( t , 2h ), 7 . 1 ( m , 3h ) and 7 . 4 ( m , 1h ); and anal . calcd for c 13 h 13 no : c , 78 . 36 % h , 6 . 58 % n , 7 . 03 % and found : c , 78 . 16 % h , 6 . 84 % n , 7 . 07 %. aged n - bromosuccinimide ( 1 g ) was added in small portions to a solution of 10 - methyl - 6 , 7 , 8 , 9 - tetrahydropyrido [ 1 , 2 - a ] indol - 9 - one ( described in example 7 , 1 . 0 g ), in methylene chloride ( 50 ml ). the mixture was stirred at room temperature for 30 min , washed successively with water , 5 % aqueous sodium bicarbonate , and water again . after drying ( mgso 4 and filtration ), the solvent was evaporated , and the residue was crystallized from diethyl ether , mp 142 °- 144 ° c . ; yield 1 . 25 g ; nmr ( cdcl 3 ) δ 2 . 34 ( m , 2h ), 2 . 57 ( s , 3h ), 2 . 68 ( m , 2h ), 4 . 11 ( t , j = 5 . 5 hz , 2h ), 7 . 10 ( d , j 34 = 8 . 5 hz , 1h ), 7 . 37 ( dd , j 34 = 8 . 5 hz , j 13 = 2 hz , 1h ) and 7 . 75 ( d , j 13 = 2 hz , 1h ). the reaction was performed in the dark ( the flask wrapped in a tin - foil ), and with the provision for maintaining a nitrogen atmosphere . to a solution of 10 - methyl - 6 , 7 , 8 , 9 - tetrahydropyrido [ 1 , 2 - a ] indol - 9 - one ( described in example 7 , 49 . 75 g ) in methylene chloride ( 250 ml ) was added a solution of trimethylphenylammonium tribromide ( 94 g ) in methylene chloride ( 1200 ml ) as fast as possible ( over 2 min ); the inside temperature was maintained at 10 ° c . the reaction mixture was stirred at room temperature for 30 hr , evaporated in vacuo , and the solid residue was partitioned between water ( 600 ml ) and benzene - diethyl ether 1 : 1 ( 800 ml , v / v ). the separated organic layer was dried ( mgso 4 ), filtered , and the filtrate was evaporated . the crude product was dissolved in chloroform ( 55 ml ), and diethyl ether ( 600 ml ) was added at once , whereby a voluminous , dark - green material precipitated . it was quickly removed by filtration ( without suction ), and the filtrate was chilled to 0 ° c . the crystals which formed were collected by filtration ; 38 g , mp 126 °- 128 ° c . this material was recrystallized from chloroform - diethyl ether ( 1 : 8 , v / v ) to give 35 g of the title compound , mp 131 °- 133 ° c . ; ir ( chcl 3 ) 1665 - 1660 , and 1535 cm - 1 ; uv max ( meoh ) 246 and 327 nm , ( ε 16000 ) and ( 18200 ) respectively ; nmr ( cdcl 3 ) δ 2 . 67 ( br s , 3h ), overlapping with 2 . 65 ( m , 2h ), 4 . 29 ( dd , j 1 = 7 . 5 hz , j 2 = 4 . 5 hz , 2h ), 4 . 67 ( t , j = 4 hz , 1h ), 7 . 25 - 7 . 7 ( m , 4h ); anal . calcd for c 13 h 12 brno : c , 56 . 12 % h , 4 . 35 % n , 5 . 03 % and found : c , 56 . 20 % h , 4 . 32 % n , 5 . 05 %. 2 , 8 - dibromo - 10 - methyl - 6 , 7 , 8 , 9 - tetrahydropyrido [ 1 , 2 - a ] indol - 9 - one ( iv : r 1 32 2 - br , r 2 = me and x = br ). aged n - bromosuccinimide ( 4 . 89 g , 27 . 5 mmol ) was added in small portions ( over 15 min ) to a solution of 2 - bromo - 10 - methyl - 6 , 7 , 8 , 9 - tetrahydropyrido [ 1 , 2 - a ] indol - 9 - one ( described in example 8 , 5 . 0 g ) in methylene chloride ( 100 ml ) and stirring at room temperature was continued for 30 min . this crude mixture was then protected against light , and a solution of bromine ( 2 ml ) in methylene chloride ( 200 ml ) was added very slowly from a dropping funnel . the reaction mixture was washed successively with cold water , 5 % sodium bicarbonate , and water again . after drying ( mgso 4 ) and filtration , the solvent was evaporated , and the title compound was crystallized from chloroform , mp 156 ° c . ; yield 6 . 6 g ; anal . calcd for c 13 h 11 br 2 no : c , 43 . 72 % h , 3 . 10 % n , 3 . 92 % and found : c , 43 . 35 % h , 3 . 00 % n , 3 . 99 %. ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ]- pyrido [ 1 , 2 - a ] indole ( i : r 1 , r 3 and r 4 = h and r 2 = me ) a solution of ethylenediamine ( 11 ml , 9 . 9 g , 165 mmol ) in dioxane ( 11 ml ) was added at once to a solution of 8 - bromo - 10 - methyl - 6 , 7 , 8 , 9 - tetrahydropyrido [ 1 , 2 - a ] indol - 9 - one ( described in example 9 , 8 . 34 g , 30 mmol ) in the same solvent ( 75 ml ) while the inside temperature was maintained at 15 ° c . and nitrogen was being introduced in the reaction apparatus . the mixture was stirred at room temperature for 18 hr , cooled in an ice - water bath , and diluted with methanol ( 75 ml ). water ( 1 ml ) was added , and upon cooling and stirring , sodium borohydride ( 3 . 1 g , 82 mmol , pulverized ) was slowly added in portions . after the borohydride addition was complete , stirring was continued for 2 hr , the mixture was poured ( upon cooling ) into 10 % hydrochloric acid ( 90 ml ), and the ph of the resultant solution was adjusted to 2 . the solution was washed with diethyl ether ( 150 ml ), and the aqueous solution was basified ( ph 10 - 11 ) with 50 % sodium hydroxide upon strong cooling . the product was extracted with benzene - diethyl ether ( 2 : 1 v / v , 2 × 350 ml ). the combined extracts were dried ( mgso 4 ), filtered , and evaporated to give 5 . 5 g of the title compound ( mp 190 °- 192 ° c .). the title compound was crystallized from hot acetonitrile : mp 196 °- 197 ° c . ; ir ( chcl 3 ) 3340 and 3290 cm - 1 ; nmr ( cdcl 3 ) δ 1 . 67 ( s , 2h ), 1 . 90 ( m , 2h ), 2 . 44 ( s , 3h ), 2 . 98 ( m , 4h ), 2 . 5 - 2 . 9 and 3 . 15 - 4 . 4 ( m ), 7 . 10 ( m , 3h ) and 7 . 42 ( m , 1h ); anal . calcd for c 15 h 19 n 3 : c , 74 . 65 % h , 7 . 94 % n , 17 . 41 % and found : c , 74 . 37 % h , 7 . 85 % n , 17 . 22 %. a methanolic solution of the title compound ( 1 . 7 g ) was treated with a methanolic solution of maleic acid ( 1 . 4 g ); isopropanol was added until the mixture became opalescent . on standing at room temperature for 18 hr , the salt crystallized . the salt was recrystallized from methanoldiethyl ether to give the maleate salt of the title compound ; mp 229 °- 231 ° c . ; anal . calcd for c 15 h 19 n 3 . c 4 h 4 o : c , 63 . 85 % h , 6 . 48 % n , 11 . 76 % and found : c , 63 . 50 % h , 6 . 41 % n , 11 . 69 %. in the same manner but replacing 8 - bromo - 10 - methyl - 6 , 7 , 8 , 9 - tetrahydropyrido [ 1 , 2 - a ] indol - 9 - one with an equivalent amount of 2 , 8 - dibromo - 10 - methyl - 6 , 7 , 8 , 9 - tetrahydropyrido [ 1 , 2 - a ] indol - 9 - one ( described in example 10 ), the following compound of formula ia was obtained ; ( 4a , 12a - trans )- 7 - bromo - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ; mp 185 ° c . ( crystallized from acetonitrile - methanol ); nmr ( cdcl 3 ) δ 1 . 66 ( br s , 2h ), 2 . 35 ( s , 3h ), 6 . 95 l ( d , j 89 = 8 hz , 1h ), 7 . 14 ( dd , j 89 = 8 hz , j 68 = 1 hz , 1h ) and 7 . 54 ( br s , 1h ); anal . calcd for c 15 h 18 brn 3 : c , 56 . 25 % h , 5 . 66 % n , 13 . 12 % and found : c , 56 . 04 % h , 5 . 60 % n , 13 . 07 %. the latter compound was dissolved in methanol and a solution of hydrogen chloride in diethyl ether was added . the precipitate was recrystallized from acetonitrile to obtain the hydrochloride salt of the latter compound : mp 282 ° c . ; ir ( mineral oil ) 3350 and 2700 cm - 1 ; uv max ( meoh ) 233 , 286 , and 293 , ( ε 37700 ), ( 6960 ) and ( 6960 ) resp . ; nmr ( dmso - d 6 ) δ 2 . 42 ( s , 3h ), 4 . 34 ( d , j = 11 hz , 1h ), 7 . 25 ( br s , 2h ), and 7 . 67 ( s , 1h ); anal . calcd for c 15 h 18 brn 3 . hcl : c , 45 . 82 % h , 5 . 13 % n , 10 . 69 % and found : c , 45 . 59 % h , 4 . 99 % n , 10 . 87 %. ( 4a , 12a - trans )- 1 , 4 - diethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino -[ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ]- pyrido [ 1 , 2 - a ] indole ( ia : r 1 = h , r 2 = me and r 3 and r . sup . 4 = et ) a mixture of ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( described in example 11 ), dimethylformamide ( dmf , 225 ml ), ethyl iodide ( 10 g , 64 mmol ), and k 2 co 3 ( 8 . 83 g , 64 mmol ) was stirred at room temperature overnight , then heated at 70 ° c . for 4 hr , cooled , and poured into 200 ml of water . crude product was extracted with diethyl ether ( 3 × 150 ml ), and the combined extracts were washed with water , dried ( mgso 4 ), filtered , and evaporated . the residue was applied on a column of silica gel ; and elution with methylene chloride - methanol ( 20 : 1 , v / v ) afforded 3 . 5 g of the title compound : nmr ( cdcl 3 ) δ 1 . 04 and 1 . 10 ( j = 7 . 5 hz , 6h ), 1 . 3 - 2 . 1 ( m , 2h ), 2 . 43 ( s , 3h ), 2 . 55 ( m , 4h ), 3 . 15 ( overlapping quartets , j = 7 . 5 hz , 4h ), 3 . 55 - 4 . 4 ( m , 4h ), 7 . 1 ( m , 3h ), 7 . 45 ( m , 1h ). the title compound ( 6 g ) was dissolved in methanol ( 80 ml ) and a methanolic solution of hydrogen bromide ( 0 . 0574 g of hbr / ml , 30 ml = 1 . 6 g ) was added . the hydrobromide salt of the title compound crystallized out , it was collected by filtration and recrystallized from methanol - acetonitrile 15 : 85 ( v / v ) yield 5 . 76 g ; mp 237 °- 238 ° c . ; ir ( mineral oil ) 2600 cm - 1 ; uv max ( meoh ) 229 and 286 nm , ( ε 38510 ) and ( 8020 ) resp . ; nmr ( dmso - d 6 ) δ 1 . 03 and 1 . 29 ( t , j = 7 . 5 hz , 6h ), 2 . 32 ( s , 3h ), 4 . 74 ( d , j = 11 hz , 1h ); and anal . calcd for c 19 h 27 n 3 . hbr : c , 60 . 31 %, h , 7 . 46 % n , 11 . 10 % and found : c , 60 . 41 % h , 7 . 50 % n , 11 . 45 %. in the same manner but replacing ethyl iodide with an equivalent amount of propyl iodide the following compound of formula i was obtained , ( 4a , 12a - trans )- 5 - methyl - 1 , 4 - dipropyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : nmr ( cdcl 3 ) δ 0 . 81 and 0 . 93 ( t , j = 7 . 5 hz , 6h ), multiplets centered at 1 . 54 ( 4h ), 2 . 42 ( s , 3h ); and the corresponding hydrobromide salt ( crystallized from methanol ): mp 246 °- 248 ° c . ; ir ( mineral oil ) 2550 cm - 1 ; uv max ( meoh ) 285 nm ( ε 8070 ); nmr ( dmso - d 6 ) δ 0 . 80 and 0 . 97 ( t , j = 7 hz ), 4 . 76 ( d , j = 10 hz , 1h ), 6 . 75 - 7 . 55 ( m , 4h ); and anal . calcd for c 21 h 31 n 3 . hbr : c , 62 . 06 % h , 7 . 93 % h , 10 . 34 % and found : c , 62 . 11 % h , 8 . 11 % n , 10 . 33 %. similarly , use of ethyl bromoacetate gave ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole - 1 , 4 - diacetic acid diethyl ester ; nmr ( cdcl 3 ) δ 1 . 20 and 1 . 27 ( two triplets , j = 7 . 5 hz , 6h ), 2 . 35 ( s , 3h ), 3 . 47 ( br s , 4h ); and the corresponding hydrochloride salt ( crystallized from methylene chloride - diethyl ether ): mp 183 °- 184 ° c . ; ir ( mineral oil ) 2400 , 1745 , and 1740 cm - 1 ; uv max ( meoh ) 229 and 286 nm ( ε = 7470 ) and ( 7890 ) resp . ; ( dmso - d 6 ) δ 1 . 15 and 1 . 28 ( t , j = 7 . 5 hz , 6h ), 2 . 05 ( s , 3h ), 2 . 27 ( br s , 4h ), 4 . 06 and 4 . 23 ( quartets , j = 7 . 5 hz , 4h ), 5 . 00 ( d , j = 10 hz , 1h ); and anal . calcd for c 23 h 31 n 3 o 4 . hcl : c , 61 . 38 % h , 7 . 17 % n , 9 . 34 % and found : c , 60 . 96 % h , 7 . 16 % n , 9 . 30 %. similarly , condensation of ethyl iodide with ( 4a , 12a - trans )- 7 - bromo - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole gave ( 4a , 12a - trans )- 7 - bromo - 1 , 4 - diethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : mp 130 ° c . ( crystallized from diethyl ether ); and nmr ( cdcl 3 ) δ 1 . 02 and 1 . 07 ( overlapping triplets , 6h ), 2 . 35 ( br s , 3h ), 6 . 96 ( d , j 89 = 8 . 5 hz , 1h ), 7 . 14 ( dd , j 89 = 8 . 5 hz , j 68 = 1 hz , 1h ), 7 . 55 ( d , j 68 = 1 hz , 1h ); and the corresponding hydrochloride salt ( crystallized from acetonitrile ): mp 290 °- 291 ° c . ; ir ( mineral oil ) 3400 , and 2400 cm - 1 ; uv max ( meoh ) 233 , 288 , and 294 nm ( ε = 35550 ), ( 6650 ) and ( 6900 ) resp . ; nmr ( dmso - d 6 ) δ 1 . 02 and 1 . 29 ( t , j = 7 . 5 hz , 6h ), 2 . 31 ( s , 3h ), 4 . 96 ( d , j = 10 hz , 1h ), 7 . 20 ( m , 2h ), 7 . 57 ( d , j = hz , 1h ), 11 . 5 ( br , exchangeable , 1h ); and anal . calcd for c 19 h 26 brn 3 . hcl : c , 55 . 27 % h , 6 . 59 % n , 10 . 18 % and found : c , 55 . 39 % h , 6 . 52 % n , 10 . 26 %. ( 4a , 12a - trans )- 1 - ethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( ia : r 1 and r 3 = h , r 2 = me and r 4 = et ) to a solution of ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a - 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( 4 . 82 g , 20 mmol , described in example 11 ) in dmf ( 200 ml ) was added anhydrous k 2 co 3 ( 3 . 45 g , 25 mmol ), and ethyl iodide ( 3 . 9 g , 25 mmol ). the mixture was stirred at room temperature for 3 hr , and evaporated . the residue was partitioned between water and chloroform , and the organic phase was separated , dried ( mgso 4 ), filtered and evaporated . the residue was chromatographed on silica gel ( 200 g ) using chloroform - methanol ( 99 : 1 , v / v ) to give 3 . 6 g of the title compound : nmr ( cdcl 3 ) δ 1 . 06 ( t , j = 7 . 5 hz , 3h ), 1 . 83 ( br s , 1h ), 2 . 42 ( s , 3h ), 4 . 25 ( dd , 1h ). the title compound was reacted with hydrogen bromide to obtain the dihydrobromide salt of the title compound : mp 237 °- 238 ° c . ( crystallized from methanol - diethyl ether ); uv max ( meoh ) 285 nm ( ε 7 , 400 ), 277 ( 7 , 700 ), 236 ( 34 , 700 ); and anal . calcd for c 17 h 23 n 3 . 2hbr : c , 47 . 34 % h , 5 . 84 % n , 9 . 74 % and found : c , 47 . 13 % h , 6 . 01 % n , 9 . 82 %. in the same manner , but replacing ethyl iodide with an equivalent amount of 2 - iodopropane , the following compound of formula ia was obtained , ( 4a , 12a - trans )- 5 - methyl - 1 -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4 , a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : mp 125 °- 126 ° c . ( crystallized from acetonitrile ); nmr ( cdcl 3 ) δ 0 . 92 and 1 . 17 ( doublets , 6h ), 2 . 46 ( br s , 3h ), 1 . 80 ( s , 1h ); and the dihydrochloride salt thereof : mp 239 °- 241 ° c . ( crystallized from methanol ); ir ( mineral oil ) 3500 , 3420 and 2500 cm - 1 ; uv max ( meoh ) 285 , 278 , and 226 nm ( ε 7660 ), ( 7550 ), and ( 37200 ) resp . ; nmr ( dmso - d 6 ) δ 1 . 20 and 1 . 41 ( doublets , j = 7 hz , 6h ), 2 . 47 ( br s , 3h ), 5 . 33 ( d , j = 10 hz , 1h ), 6 . 9 - 7 . 6 ( m , 4h ); and anal . calcd for c 18 h 25 n 3 . 2hcl : c , 60 . 67 % h , 7 . 63 % n , 11 . 78 % and found : c , 59 . 40 % h , 7 . 55 %, n , 11 . 49 %. similarly , replacement of ethyl iodide by 3 - bromopropyne gave ( 4a , 12a - trans )- 5 - methyl - 1 -( 2 - propynyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : nmr ( cdcl 3 ) δ 2 . 51 ( s , 3h ), 2 . 84 and 2 . 91 ( doublets , 1h + 2h ); and the dihydrochloride salt thereof : mp 220 °- 221 ° c . ( crystallized from methanol - diethyl ether ); ir ( mineral oil ) 3300 , 3200 , 2660 , 2320 , and 2120 cm - 1 ; uv max ( meoh ) 227 , 277 , and 285 nm ( ε 34600 ), ( 7160 ) and ( 7020 ) resp . ; nmr ( dmso - d 6 ) δ 2 . 47 ( s , 3h ), 4 . 88 ( d , j = 11 hz , 1h ), 5 . 45 ( br , 3h ), 6 . 95 - 7 . 6 ( m , 4h ); anal . calcd for c 18 h 21 n 3 . 2hcl ; c , 61 . 36 % h , 6 . 58 % n , 11 . 93 % and found : c , 60 . 87 % h , 6 . 82 % n , 11 . 86 %. similarly , replacement of ethyl iodide by 2 -( phenoxy ) ethyl bromide gave ( 4a , 12a - trans )- 5 - methyl - 1 -[ 2 -( phenoxy ) ethyl ]- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazo [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : nmr ( cdcl 3 ) δ1 . 72 ( s , 1h ), 2 . 41 ( s , 3h ), 4 . 00 ( m , 5h ), 6 . 65 - 7 . 60 ( m , 9h ); and the maleate salt thereof : mp 177 °- 178 ° c . ( crystallized from methanol - diethyl ether ); ir ( mineral oil ) 3300 , 2500 , 1700 , and 1585 cm - 1 ; uv max ( meoh ) 224 , 272 , and 276 nm ( ε 50190 ), ( 9030 ), and ( 9500 ) resp . ; nmr ( dmso - d 6 ) δ 2 . 38 ( s , 3h ), 5 . 97 ( s , 2h ), 6 . 75 - 7 . 55 ( m , 9h ); and anal . calcd for c 23 h 27 n 3 o . c 4 h 4 o 4 : c , 67 . 90 % h , 6 . 54 % n , 8 . 80 % and found : c , 57 . 59 % h , 6 . 50 % n , 8 . 70 %. similarly , replacement of ethyl iodide by ethyl bromoacetate gave ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole - 1 - acetic acid ethyl ester : nmr ( cdcl 3 ) δ 1 . 26 ( t , 3h ), 2 . 47 ( s , 3h ), 3 . 47 ( s , 2h ), 4 . 19 ( q , 2h ), 7 . 12 ( m , 3h ) and 7 . 48 ( m , 1h ); and the maleate salt thereof : mp 203 °- 204 ° c . ( crystallized from ethanol ); and anal . calcd for c 19 h 25 n 3 o 2 . c 4 h 4 o 4 : c , 62 . 29 % h , 6 . 59 % n , 9 . 48 % and found : c , 61 . 97 % h , 6 . 66 % n , 9 . 34 %. similarly , reaction of 2 - iodopropane with ( 4a , 12a - trans )- 7 - bromo - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole gave ( 4a , 12a - trans )- 7 - bromo - 5 - methyl - 1 -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydroprazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : mp 138 ° c . ( crystallized from diethyl ether ); nmr ( cdcl 3 ) δ 0 . 93 and 1 . 18 ( doublets , j = 7 hz , 6h ), and 7 . 59 ( d , 1h ); and anal . calcd for c 18 h 24 brn 3 : c , 59 . 66 % h , 6 . 68 % n , 11 . 60 % and found : c , 59 . 49 % h , 6 . 64 % n , 11 . 58 %. ( 4a , 12a - trans )- 1 , 4 , 5 - trimethyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( ia : r 1 = h , and r 2 , r 3 and r 4 = me ) to a solution of ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( 5 . 5 g , described in example 11 ) in methanol ( 150 ml ) was added a diethyl ether solution saturated with hcl ( 20 ml ), and the mixture was evaporated . the residue was dissolved in 37 % aqueous formaldehyde and stirred at room temperature for 2 hr . upon cooling , the reaction mixture was treated dropwise with a solution of sodium cyanoborohydride ( 7 . 6 g ) in methanol ( 400 ml ). molecular sieves ( 16 . 5 g ) were added , and stirring was continued overnight . after filtration , methanol was evaporated , and the residue was partitioned between 5 % ammonium hydroxide and chloroform . the organic layer was separated , evaporated , and the oily product ( 6 . 1 g ) was chromatographed on silica gel . elution with acoet - hexane - et 3 n ( 60 : 35 : 5 , v / v ) afforded the title compound ( 4 . 2 g ) as an oil : nmr ( cdcl 3 ) δ 2 . 32 ( s , 3h ), 2 . 38 ( s , 3h ), and 2 . 42 ( s , 3h ). the corresponding monomaleate salt of the title compound was crystallized from methanol : mp 178 °- 180 ° c . ; ir ( chcl 3 ) 2400 , 1900 , 1700 , 1570 , and 1345 cm - 1 ; uv max ( meoh ) 226 , 279 , and 285 nm ( ε 42710 ), ( 7790 ), and ( 8170 ) resp . ; nmr ( cdcl 3 ) δ 2 . 35 ( br s , 6h ), 2 . 89 ( s , 3h ), 2 . 05 - 4 . 45 ( m , 9h ), 4 . 70 ( d , j = 10 hz , 1h ), 6 . 22 ( s , 3h ), 7 . 12 ( m , 3h ), 7 . 49 ( m , 1h ); and anal . calcd for c 17 h 23 n 3 . c 4 h 4 o 4 : c , 65 . 43 % h , 7 . 06 % n , 10 . 90 % and found : c , 65 . 59 % h , 6 . 99 % n , 10 . 82 %. ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole - 1 , 4 - diethanol ( ia : r 1 = h , r 2 = me , and r 3 and r 4 = ch 2 ch 2 oh ) ( 4a , 12a - trans )- 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ]- pyrido [ 1 , 2 - a ] indole - 1 , 4 - diacetic acid diethyl ester ( 2 . 07 g , described in example 12 ) was dissolved in anhydrous diethyl ether ( 50 ml ); the solution was filtered and added dropwise to a stirred suspension of lialh 4 ( 0 . 835 g ) in diethyl ether ( 30 ml ) over 5 min . the reaction mixture was refluxed for 14 hr , cooled and decomposed ( under nitrogen ) by a successive addition of water ( 4 . 17 ml ), 15 % sodium hydroxide ( 4 . 17 ml ), and water ( 4 . 17 ml ) again . the resultant slurry was stirred for 60 min , filtered , and the filtrate was dried ( mgso 4 ) and evaporated . the filter cake was extracted with chloroform , the extracts were filtered , and combined with the material obtained from the ethereal phase . there was obtained 1 . 05 g ( 64 %) of the title compound . the corresponding dihydrochloride was prepared in a chloroform solution by addition of a solution of hcl in diethyl ether , and evaporation to dryness . the residual solids were crystallized from ethanol - diethyl ether and recrystallized from methanol - diethyl ether , mp 202 ° c . ; ir ( mineral oil ) 3200 and 2600 cm - 1 ; uv max ( meoh ) 227 and 286 nm ( ε 39230 ) and ( 8010 ) resp . ; nmr ( dmso - d 6 ) δ 2 . 38 ( s , 3h ), 5 . 16 ( d , j = 11 hz , 1h ), 5 . 13 and 5 . 25 ( broad singlets , 4h ), 6 . 9 - 7 . 6 ( m , 4h ); and anal . calcd for c 19 h 27 n 3 o 2 . 2hcl : c , 56 . 71 % h , 7 . 26 % n , 10 . 44 % and found : c , 56 . 67 % h , 7 . 51 % n , 10 . 27 %. ( 4a , 12a - trans )- 4 - acetyl - 1 - ethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ]- pyrido [ 1 , 2 - a ] indole ( ia : r 1 = h , r 2 = me , r 3 = coch 3 , and r 4 = et ) ( 4a , 12a - trans )- 1 - ethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( 1 . 0 g , described in example 13 ) in 60 ml of methylene chloride was added to 6 ml of 10 % solution of sodium hydroxide , followed by dropwise addition of 0 . 8 ml of acetyl chloride . the mixture was stirred at room temperature for 1 hr , poured on ice and extracted with methylene chloride . evaporation of the solvent gave 2 . 2 g of crude product . chromatography on neutral alumina ( chloroform ) gave 1 . 15 g of the title compound . the basic product was converted to the hydrobromide salt and crystallized from methanol - diethyl ether : mp 230 °- 231 ° c . ; ir ( mineral oil ) 2600 , 1660 cm - 1 ; uv max ( meoh ) 285 nm ( ε 7750 ); 229 ( 37300 ); anal . calcd for c 19 h 26 brn 3 o : c , 58 . 16 % h , 6 . 68 % n , 10 . 71 % and found : c , 57 . 71 % h , 6 . 70 % n , 10 . 80 % and nmr ( dmso - d 6 ) δ 1 . 29 ( t , 3h ), 2 . 10 ( br s , 6h ), 5 . 20 ( m , 1h ). ( 4a , 12a - trans )- 1 - ethyl - 5 - methyl - 4 - propyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ; - 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( ia : r 1 = h , r 2 = me , r 3 = pr and r 4 = et ) a mixture of ( 4a , 12a - trans )- 1 - ethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( 7 g , 2 . 26 mmol , described in example 13 ), dmf ( 200 ml ), k 2 co 3 ( 14 . 4 g , 104 mmol ), and 1 - iodopropane ( 17 . 6 g , 10 . 4 ml , 104 mmol ) was stirred at room temperature for 48 hr . after adding k 2 co 3 ( 4 g ) and 1 - iodopropane ( 5 ml ), stirring was continued at 90 ° c . for 4 hr . the latter operation was repeated . the cold reaction mixture was poured into 200 ml of water , and extracted with diethyl ether ( 3x70 ml ). the combined extracts were washed with water , dried ( mgso 4 ), filtered , and evaporated . the residual oil ( 4 . 5 g ) was chromatographed on silica gel ; elution with a mixture of hexane - acoet - et 3 n ( 6 : 3 : 1 , v / v ) afforded 3 . 8 g of the title compound : nmr ( cdcl 3 ) δ 0 . 82 ( t , j = 7 . 5 hz , 3h ), 1 . 10 ( t , j = 7 . 5 hz , 3h ), 2 . 41 ( s , 3h ). the title compound was dissolved in methanol and converted to the corresponding hydrobromide salt : mp 252 °- 254 ° c . ( crystallized from methanol ); ir ( mineral oil ) 2600 cm - 1 ; uv max ( meoh ) 229 and 286 nm , ( ε 39200 ) and ( 7960 ) resp . ; nmr ( dmso - d 6 ) δ 0 . 8 ( t , j = 7 . 5 hz , 3h ), 1 . 29 ( t , j = 7 . 5 hz , 3h ), 2 . 32 ( s , 3h ), 4 . 79 ( d , j = 10 hz , 1h ); and anal . calcd for c 20 h 29 n 3 . hbr : c , 61 . 22 % h , 7 . 44 % n , 10 . 70 % and found : c , 61 . 20 % h , 7 . 74 % n , 10 . 87 %. similarly , but replacing 1 - iodopropane with 1 - iodobutane , the following compound of formula ia was obtained , ( 4a , 12a - trans )- 4 - butyl - 1 - 1 - ethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole and the corresponding dihydrochloride salt thereof ; mp 221 °- 222 ° c . ( crystallized from acetonitrile - diethyl ether ); ir ( mineral oil ) 3300 and 2400 cm - 1 ; uv max ( meoh ) 227 and 285 nm ( ε 34980 ) and ( 6770 ) resp . ; nmr ( dmso - d 6 ) δ 0 . 83 ( t , j = 6 hz , 3h ), 1 . 32 ( t , j = 7 hz , 3h ), 2 . 40 ( s , 3h ), 5 . 19 ( d , j = 10 hz , 1h ), 6 . 85 - 7 . 55 ( m , 4h ); and anal . calcd for c 21 h 31 n 3 . 2hcl : c , 63 . 30 % h , 8 . 35 % n , 10 . 55 % and found : c , 62 . 64 % h , 8 . 12 % n , 10 . 43 %. similarly , but replacing 1 - iodopropane with ethyl bromoacetate , the following compound of formula ia was obtained , ( 4a , 12a - trans )- 1 - ethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole - 4 - acetic acid ethyl ester : nmr ( cdcl 3 ) δ 1 . 10 and 1 . 21 ( t , j = 7 . 5 hz , 6h ), 2 . 36 ( s , 3h ), 3 . 44 ( s , 2h ), and 4 . 12 ( q , j = 7 . 5 hz , 2h ), and the corresponding hydrochloride salt thereof : mp 260 °- 261 ° c . ( crystallized from ethanol ); ir ( mineral oil ) 2460 , and 1735 cm - 1 ; uv max ( meoh ) 229 and 286 nm ( ε 33750 ) and ( 8075 ) resp . ; nmr ( dmso - d 6 ) δ 1 . 15 and 129 ( t , j = 7 hz , 6h ), 2 . 26 l ( s , 3h ), 4 . 05 ( q , j = 7 hz , 2h ), 4 . 97 ( d , j = 11 hz , 1h ), 6 . 8 - 7 . 5 ( m , 4h ); and anal . calcd for c 21 h 29 n 3 o 2 . hcl : c , 64 . 35 % h , 7 . 71 % n , 10 . 72 % and found : c , 64 . 19 % h , 7 . 69 % n , 10 . 71 %. similarly , condensation of ethyl bromide with ( 4a , 12a - trans )- 5 - methyl - 1 -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( described in example 13 ) gave ( 4a , 12a - trans )- 4 - ethyl - 5 - methyl - 1 -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : nmr ( cdcl 3 ) δ 0 . 96 and 1 . 22 ( doublets , j = 7 hz ), 1 . 04 ( t , j = 7 . 5 hz ) and 2 . 41 ( s , 3h ); and the dihydrobromide salt thereof : mp 229 °- 230 ° c . ( crystallized from methanol ); ir ( mineral oil ) 3540 , 3450 , 2600 cm - 1 ; uv max ( meoh ) 285 nm ( ε 7855 ); nmr ( dmso - d 6 ) δ 1 . 1 ( t , j = 7 hz ), 1 . 28 and 1 . 4 ( doublets , j = 7 hz ), 2 . 37 ( s , 3h ), 5 . 23 ( d , j = 10 hz , 1h ), 6 . 85 - 7 . 55 ( m , 4h ); and anal . calcd for c 20 h 29 n 3 . 2hbr : c , 50 . 75 % h , 6 . 60 % n , 8 . 79 % and found : c , 50 . 57 % h , 6 . 51 % n , 8 . 86 %. similarly , condensation of 1 - iodopropane with ( 4a , 12a - trans )- 5 - methyl - 1 -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( described in example 13 ) gave ( 4a , 12a - trans )- 5 - methyl - 1 -( 1 - methylethyl )- 4 - propyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : nmr ( dcdl 3 ) δ 0 . 8 ( t , 3h ), 0 . 96 and 1 . 16 ( doublets , 6h ) and 2 . 4 ( s , 3h ); the hydrobromide salt thereof : mp 255 °- 256 ° c . ( crystallized from methanol ): ir ( mineral oil ) 2500 cm - 1 ; uv max ( meoh ) 228 and 285 nm , ( ε 3900 ) and ( 8040 ) resp . ; nmr ( dmso - d 6 ) δ 0 . 77 ( t , j = 7 . 5 hz , 3h ), 1 . 24 and 1 . 35 ( doublets , j = 7 hz , 6h ), 2 . 30 ( s , 3h ), 4 . 92 ( d , j = 10 hz , 1h ), 6 . 8 - 7 . 45 ( m , 4h ); and anal . calcd for c 21 h 31 n 3 hbr : c , 62 . 05 % h , 7 . 93 % n , 10 . 34 % and found : c , 61 . 71 % h , 7 . 81 % n , 10 . 23 %. similarly , condensation of ethyl iodide with ( 4a , 12a - trans )- 5 - methyl1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydro - 1 -( 2 - phenoxyethyl )- pyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( described in example 13 ) gave ( 4a , 12a - trans )- 4 - ethyl - 5 - methyl1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydro - 1 -( 2 - phenoxyethyl )- pyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ; and the dihydrochloride salt thereof : mp 230 °- 231 ° c . ( crystallized from methanol - diethyl ether ); ir ( mineral oil ) 2440 cm - 1 ; uv max ( meoh ) 224 , 276 , and 285 nm ( ε 41900 ), ( 8740 ), and ( 8320 ) resp . ; nmr ( dmso - d 6 ) δ 1 . 13 ( t , j = 6 . 5 hz , 3h ), 2 . 41 ( s , 3h ), multiplets centered at 2 . 2 , 2 . 8 , 3 . 65 , and 4 . 35 ( 15h ), 5 . 3 ( d , j = 9 hz , 1h ), 6 . 7 - 7 . 55 ( m , 9h ); and anal . calcd for c 25 h 31 n 3 o . 2hcl : c , 64 . 92 % h , 7 . 19 % n , 9 . 06 % and found : c , 64 . 92 % h , 7 . 13 % n , 9 . 02 %. similarly , condensation of ethyl bromide with ( 4a , 12a - trans )- 7 - bromo - 5 - methyl - 1 -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( described in example 13 ) gave ( 4a , 12a - trans )- 7 - bromo - 4 - ethyl - 5 - methyl - 1 -( 1 - methylethyl )- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole : mp 125 ° c . ( crystallized from diethyl ether ); nmr ( cdcl 3 ) δ 0 . 95 and 1 . 16 ( doublets , j = 7 hz , 6h ), 1 . 03 ( t , 3h ), and 7 . 58 ( d , 1h ); and anal . calcd for c 30 h 28 brn 3 : c , 61 . 53 % h , 7 . 23 % n , 10 . 77 % and found : c , 61 . 47 % h , 7 . 20 % n , 10 . 77 %; and the corresponding dihydrochloride salt thereof : mp 228 ° c . ( crystallized from methanol - isopropanol ). ( 4a , 12a - cis )- 5 - methyl - 1 -[ 2 -( phenoxy ) ethyl ]- 1 , 2 , 3 , 4 , 4 , a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ; - 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( ib : r 1 and r 3 = h , r 2 = me and r 4 = ch 2 ch 2 o -- c 6 h 5 ) in the initial attemps to form the maleate and dimethansulfonate salts of ( 4a , 12a - trans )- 5 - methyl - 1 -[ 2 -( phenoxy ) ethyl ]- 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( 2 . 1 g , described in example 13 ), the latter compound was repeatedly liberated by partitioning between ch 2 cl 2 and 10 % aq . naoh . attempts to crystallize the salts involved heating in methanol , acetonitrile , and in the case of dimethanesulfonate , heating in aqueous methanol . finally , the tlc ( silica gel , chcl 3 - hexane - meoh 60 : 37 : 3 , v / v ) analysis of the recovered base showed two spots : the starting trans - product with r f 0 . 7 , and the title cis - product with r f 0 . 55 . the mixture was chromatographed , and the title compound ( 1 . 4 g ) was separated , and converted to the dihydrochloride salt ; mp 230 °- 232 ° c . ( crystallized from methanol - acetonitrile 1 : 1 , v / v ); ir ( mineral oil ) 3630 , 3440 , 2700 , and 2280 cm - 1 ; uv max ( meoh ) 224 , 272 , and 276 nm ( ε 42900 ), ( 9080 ), and ( 9430 ) resp . ; nmr ( dmso - d 6 ) δ 2 . 35 ( s , 3h ), 5 . 30 ( br s , 1h ), 6 . 8 - 7 . 65 ( m , 9h ); and anal . calcd for c . sub . 23 h 27 n 3 o . 2hcl : c , 63 . 59 % h , 6 . 73 % n , 9 . 67 % and found : c , 62 . 63 % h , 6 . 77 % n , 9 . 36 %. ( 4a , 12a - cis )- 7 - bromo - 1 , 4 - diethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( ib , r 1 = 7 - br , r 2 = me , and r 3 and r 4 = et ) a mixture of ( 4a , 12a - trans )- 7 - bromo - 1 , 4 - diethyl - 5 - methyl - 1 , 2 , 3 , 4 , 4a , 11 , 12 , 12a - octahydropyrazino [ 2 &# 39 ;, 3 &# 39 ;- 3 , 4 ] pyrido [ 1 , 2 - a ] indole ( 0 . 3 g , described in example 12 ), sodium methoxide ( 0 . 3 g ), and hexamethylphosphoramide ( 10 ml ) was heated at 190 ° c . for 24 hr . after cooling , the resulting solution was poured into water , and extracted with diethyl ether . the combined extracts were washed with water , dried ( mgso 4 ), filtered and evaporated . the residual oil was purified chromatographically on a column of silica gel . elution with methanol - chloroform ( 1 : 9 , v / v ) afforded 0 . 21 g of the title compound : mp 125 ° c . ; nmr ( cdcl 3 ) δ 0 . 89 and 1 . 10 ( triplets , j = 7 . 5 hz , 6h ), and 2 . 20 ( s , 3h ). the corresponding hydrochloride salt ( mp 246 ° c .) was crystallized from acetonitrile or methanol ; nmr ( dmso - d 6 ) δ 5 . 05 ( br , s , 1h ). | 2 |
the cartilage used in this invention may be obtained from a mixture of shark species , principally blue shark ( prionace glauca ), but may include other species such as school shark ( galeorhinus galeus ), rig or smooth dogfish ( mustelus lenticulatus ) and spiky dog fish ( squalus acanthias , squalus mitsukurii ). the meat adhering to the cartilage may first be removed by any suitable means known to a person skilled in the art such as manual scraping , mild protease treatment or high pressure water treatment . the cartilage may then be dried by freeze drying , air drying or any other suitable means . the cartilage is preferably milled , ground or pulverised to provide a powder having a particle size of less than approximately 500 microns , preferably less than 300 microns . the cartilage powder is then suspended in water or in water containing salts or electrolytes such as a phosphate buffered saline solution . the water may contain one or more water miscible organic solvents . however , it is known that the use of a mixture having greater than approximately 50 % v / v of an organic solvent results in low yields of products having low activity . chaotropic salts ( those salts which extract proteins ) are not desired as their use causes reduced angiogenesis activation of the aqueous extracts . the amount of cartilage suspended in the water is preferably in the range of between 10 and 50 mg / ml . the suspension is preferably stirred or shaken for a time suitable to enable formation of the desired aqueous extract , preferably up to 3 or 4 days , more preferably approximately 20 hours . during the extraction , the temperature of the suspension is preferably maintained between approximately 4 ° c . and 50 ° c . the extraction is typically carried out at a temperature of approximately 18 - 20 ° c . the aqueous extract and the insoluble residue may be separated by any suitable method , for example , centrifugation , decantation or filtration including ultrafiltration or dialysis . the solid residue and the aqueous extract are preferably dried , for example , by freeze drying or air drying , or they may be used directly . the aqueous extract produced by using shark cartilage that has been cleaned of adhering flesh and minced but not dried does not exhibit angiogenesis activation . the extract is preferably stored at − 18 ° c . optionally following lyophilisation . after 8 months the angiogenesis activating activity of redissolved extract was approximately 85 - 90 % of the activity of freshly prepared extract . each product of the process of this invention ( the angiogenesis activator and the angiogenesis inhibitor ), may be combined with suitable carriers to provide formulations , such as tablets , capsules , liquids , emulsions , suspensions , creams , ointments , or other formulations , suitable for use as angiogenesis activators or angiogenesis inhibitors . an angiogenesis inhibitor or an angiogenesis activator of this invention may be administered in any form suitable for the control of angiogenesis such as orally , topically , rectally , intravenously , intraperitoneally , intramuscularly , or by surgical implantation . the following examples illustrate the invention but are not to be construed as limiting : powdered shark cartilage ( 100 g ) was suspended in water ( 900 ml ). the suspension was shaken for 20 hours at room temperature ( 18 - 20 ° c .). the insoluble residue was then separated from the aqueous extract by filtration . both the insoluble residue and the aqueous extract was dried . powdered shark cartilage ( 50 g ) was suspended in water ( 1000 ml ). the suspension was stirred at 20 ° c . for 20 hours . the insoluble residue was then separated from the aqueous extract by centrifugation . both the insoluble residue and the aqueous extract was dried . powdered shark cartilage was suspended in water ( 50 mg / ml ). the suspension was stirred at 4 ° c . for 20 hours . the insoluble residue was then separated from the aqueous extract by centrifugation . both the insoluble residue and the aqueous extract were dried . powdered shark cartilage was suspended in phosphate buffered saline solution ( 50 mg / ml ). the suspension was stirred at 4 ° c . for 20 hours . the insoluble residue was then separated from the aqueous extract by centrifugation . both the insoluble residue and the aqueous extract were dried . the determination of angiogenesis modulatory activity of the fractions involved the development of an assay using rings of rat aorta . thoracic aortas were removed from male rats ( 6 - 10 weeks of age ) the excised aortas were transferred immediately to a culture dish containing culture media mcdb131 . for all experimental procedures involving mcdb131 the media was supplemented with penicillin ( 100 u / ml ), streptomycin ( 100 mg / ml ) and aminocaproic acid 300 mg / ml . the fibroadipose tissue surrounding the aorta was removed carefully with particular attention paid to minimising damage to the aortic wall . rings ( 1 mm thickness ) were sectioned from the aorta and rinsed three times with mcdb131 . the aortic rings were cultured at 37 ° c . in 3 % co 2 , 97 % air for 40 min . the assays were performed using 24 well culture plates ( nune ). each assay was run in triplicate ( at least ). in a separate tube 30 ml of thrombin ( 10 nih units / ml ) was added to mcdb131 ( 1 . 5 ml ) containing fibrinogen . following rapid mixing 0 . 4 ml of the solution was added to each well . after the gel formation , an aortic ring was placed in the centre of each well . the rings were then covered with a further 0 . 4 ml of the fibrinogenthrombin mix . the aortic rings were cultured at 37 ° c . in 3 % co 2 / 97 % air in a humidified atmosphere . for analysis of the solid residue , up to approximately 2 mg of shark cartilage or derived material was added to the assay following mixing of the thrombin with fibrinogen . for analysis of the extract , a sample of the extract was added to the assay following mixing of the thrombin with fibrinogen and / or at the time of adding the mcdb131 ( 1 . 5 ml ) to each well . the extent of angiogenesis was determined by measuring the area occupied by the new vessels using a microscope with an ocular grid or by taking a photographic record of each well and measuring the area occupied by new vessels using computer image analysis and quantification . the residue obtained after extraction of the shark cartilage was compared for angiogenesis activity with crude shark cartilage . the experiment was conducted using cartilage from four different commercial sources a to d . with the exception of source a , it was found that the residue exhibited a marked increase in angiogenesis inhibition relative to the crude cartilage . a soluble extract of shark cartilage from a single source was prepared by extraction with water and another by extraction with aqueous mcdb131 medium . by incorporating aliquots of these extracts into the mcdb131 media above the aortic rings , the angiogenesis activity of these extracts was determined at varying concentrations of the extract &# 39 ; s dry weight . analysis of the assay results below showed activation of angiogenesis relative to a control . the results show an apparent increasing correlation between concentration of shark cartilage extract and angiogenesis activation . experimental rats were fed shark cartilage at 6 g / kg of food for 11 - 12 weeks . serum from these and from control animals fed a normal diet were assessed biochemically . the serum alanine - lactate aminotransferase ( alt ) activity was found to be increased by a mean of 45 % in rats which had been fed shark cartilage not subjected to the process of this invention . for the rats fed the solid residue from the aqueous extraction process of the invention , the increase was only 27 %. alt is a marker of liver function . elevated activity is suggestive of liver dysfunction . long - term consumption of shark cartilage may result in greater elevation of alt activity indicating increased liver damage . the alt activity for animals fed the solid residue from the extraction process is reduced . thus , the extraction process appears to remove one or more hepatotoxic substances from the shark cartilage . although the invention has been described by way of example and with reference to embodiments thereof , it should be appreciated that variations and modifications may be made thereto , without the departing from the scope of the claims . the angiogenesis inhibitor of this invention is useful as a therapeutic agent for the treatment or prevention of diseases or disorders such as cancer where reduced formation of new blood vessels is desired . the angiogenesis activator of the invention is useful as a therapeutic agent where the promotion of new blood vessels is desired , for example , for wound healing . | 0 |
with reference to fig1 , the system in accordance with the present invention comprises a visualization module 10 , an acquisition module 20 and a multispectral imaging reproduction module 30 . the visualization module 10 holds an flg sample 40 and illuminates the flg sample 40 with a light source by projecting a light allowing the flg sample 40 to be optically observed . specifically , the visualization module 10 comprises a platform member 11 and an illumination member 12 . preferably , the visualization module 10 further comprises a magnification member 13 , which comprises a structure for magnifying an image of the flg sample 40 held by the platform member 11 and providing an enlarged image thereof . the platform member 11 is for holding the flg sample 40 . the illumination member 12 provides a light source from which a light is projected to the flg sample 40 held by the platform member 11 . the magnification member 13 is mounted to the platform member 11 so as to magnify an image of the flg sample 40 held . the visualization module 10 further comprises an optional filter member 14 . the filter member 14 is positioned in a light projecting path from the illumination member 12 . the filter member 14 filters a light from the illumination member 12 in order to provide a filtered light of a band suitable for detecting the flg sample 40 held by the platform member 11 . the filter member 14 comprises filters , which include red , green , blue , cyan , magenta and yellow filters , to be used alternately or in combination . in addition , in absence of the optional filter member 14 , the illumination member 12 may be an illuminating means capable of using switchable light sources to provide lights of different colors , or lights of different bands . with reference to fig2 , the illumination member 12 of the visualization module 10 , other than comprising a reflective structure to reflectively project lights to the flg sample 40 as having been shown in fig1 , may comprise a beaming structure that operates with a transparent platform member 11 for directly providing lights through the transparent platform member 11 to the flg sample 40 for observation . preferably , the illumination member 12 comprises a reflective structure as shown in fig1 and a beaming structure as shown in fig2 and is capable of switching the reflective structure and beaming structure . in other words , the illumination member 12 may comprise a reflective structure which projects a light reflectively to the platform member 11 , a beaming structure which directly provides lights through a transparent platform member 11 , or a switchable structure which comprises both the reflective structure and the beaming structure and is capable of switching the structures . the acquisition module 20 comprises a structure for performing an optical observation of the flg sample 40 . specifically , the acquisition module 20 is positioned in an output path of the visualization module 10 in which the flg sample 40 is optically observed , and comprises a ccd member 22 , a lens member 21 and a capturing member 23 . the ccd member 22 comprises an array formed with rows and columns of photosensitive units for respectively recording digital signals as pixel information of an electronic image . the ccd member 22 receives an image of the flg sample 40 of the platform member 11 which has been magnified by the magnification member 13 . the lens member 21 is operably connected to the ccd member 22 for focusing the magnified image at the ccd member 22 . preferably , the lens member 21 focuses a light from the illumination member 12 through the flg sample 40 at the ccd member 22 . the capturing member 23 is an image capturing means operably connected to the ccd member 22 for acquiring information of the magnified image focused by the lens member 21 , which may be a camera or a spectrometer . more preferably , the spectrometer is a spectrometer of model number cs1000a of konica minolta or a spectrometer of model number qe65000 of ocean optics . the reproduction module 30 is operably connected to the acquisition module 20 to provide information of detection of a number of layers of the flg sample 40 . the reproduction module 30 receives information from the capturing member 23 for the magnified image of the flg sample 40 and comprises an implementation for a spectral analyzing step 31 , an enhancing step 32 for color image categorizing , and a reproducing step 33 , so as to process and to display the magnified image of the flg sample 40 for a user to intuitively and rapidly examine a number of layers of the flg sample 40 . the method in accordance with the present invention comprises a spectral database construction process and a multispectral image reproduction process , wherein the spectral database construction process builds a database of numbers of layers of flgs , based on which a detection by a reproduced multispectral color image for a number of layers of an flg is performed in the multispectral image reproduction process . 1 . the database construction process comprises a spectra - analyzing step , a pca step and a database constructing step . ( 1 ) in the spectra - analyzing step , spectral analyses are performed for flgs of different numbers of layers on different substrates , based on which resulting information is obtained . specifically , the spectra - analyzing step comprises the following procedures : ( 1 - a ) preparing flgs formed on different substrates , for example , developing flgs on silica / silicon substrates or glass substrates ; ( 1 - b ) obtaining images of the flgs , for example , capturing images of the flgs via an acquisition means such as a microscope and a camera ; ( 1 - c ) confirming the numbers of layers of the flgs , for example , via raman spectroscopy , transmission spectroscopy , or afm ; and ( 1 - d ) performing spectral analyses of the transmission spectra of the flgs and providing resulting information thereof . ( 2 ) in the pca step , pca is performed with the resulting information to obtain a distinguishing formula . specifically , the pca step comprises the following procedures : ( 2 - a ) performing pca for the flgs of different numbers of layers on different substrates and obtaining a pca result thereof ; and ( 2 - b ) based on the pca result , a distinguishing formula as shown in the following table 1 is determined for flgs having different numbers of layers on different substrates , provided that y0 is the first principal component and y1 is the second principal component . ( 3 ) in the database constructing step , a database is built based on the resulting information of the spectral analyses and the distinguishing formula to present a relationship between a number of layers of an flg and the distinguishing formula . 2 . the multispectral image reproduction process comprises an acquisition step , an analyzing step , a categorizing step , an enhancing step , a reproducing step , and an examining step . ( 1 ) in the acquisition step , an image of an flg , of which a number of layers is to be detected , is acquired via an acquisition means such as a microscope and a camera . ( 2 ) in the analyzing step , the image is analyzed to obtain a transmission spectrum of the flg . ( 3 ) in the categorizing step , the transmission spectrum is categorized according to the aforementioned database constructed via spectral analysis and pca so as to obtain a categorization result . ( 4 ) in the enhancing step , a simulation spectrum is determined based on the categorization result . ( 5 ) in the reproducing step , a color image is reproduced with the simulation spectrum . ( 6 ) in the examining step , a number of layers of the flg is determined by examining the reproduced color image which makes possible an intuitive and rapid examination process . preferably , the method for detecting numbers of layers of flgs is implemented in the reproduction module 30 . the reproduction module 30 applies the information received from the capturing member 23 of the magnified image of the flg sample 40 to perform the aforementioned acquisition step for acquiring an image of the flg sample . after analyzing the image in the analyzing step 31 , a categorization result is obtained in the categorizing step , so as to further enhance and reproduce the magnified image of the flg sample 40 in the enhancing step 32 and reproducing step 33 , in order to provide a user with a reproduced and enhanced image to perform the examining step for detecting a number of layers of the flg sample 40 . take a 5 - layer flg on a glass substrate for example , in the case that the flg in question is analyzed with raman spectroscopy , a time - consuming and labor - intensive analyzing process would be unavoidable , which makes impossible an intuitive and rapid determination of the number of layers of the flg . with reference to fig3 , there are considerably vague zones in the results obtained with technique based on raman spectroscopy , within which the number of layers of the flg is difficult to be determined . conversely , the system and the method in accordance with the present invention rapidly distinguishes transmission spectra of flgs and employs color image reproduction to expedite detecting processes for numbers of layers of flgs , which significantly obviates the shortcomings of the conventional techniques of the prior art . in the instant example , a copper foil is employed as a catalyst for developing large - area single - layer graphene thin films under a low pressure environment , using methane as a carbon source . developed graphene thin films are then transferred with polymethylmethacrylate ( pmma ) to substrates of various types , such as silica / silicon substrates or glass substrates . details for preparing the flg are within the scope of the prior art and thus are omitted here . with reference to fig5 , a 3 - layer flg is formed on a silica / silicon substrate . on the silica / silicon substrate there are zero - layer ( marked with the symbol “ 0l ”) regions , that is , bare substrate without being covered by graphene , and one - layer ( marked with the symbol “ 1l ”), two - layer ( marked with the symbol “ 2l ”) and three - layer ( marked with the symbol “ 3l ”) regions covered respectively by corresponding layers of graphene . with reference to fig6 , a 5 - layer flg formed on a glass substrate is extremely difficult to be directly observed with an optical microscope in terms of distinguishing numbers of layers of the flg on the substrate . as shown in fig7 , in the instant example , the numbers of layers decrease from a center ribbon region to lateral regions . the ribbon regions are partitioned as shown in fig8 and areas as demonstrated in fig9 and fig1 to 14 are selected for analyses . the instant example relates to a matrix of transformation between a spectrometer and an image - acquiring device . the image - acquiring device employed in the instant example comprises an optical microscope and a ccd camera operably connected to the microscope . the spectrometer employed in the instant example is model number qe65000 spectrometer of ocean optics . the spectrometer is used to obtain transmission spectra of the 24 colors listed in macbeth colorchecker within the visible band of spectrum . a model is built by multispectral calculation based on the obtained transmission spectra of the 24 colors . the color differences between simulated colors and the image - acquiring device are shown in table 2 , which lists the 24 colors used to build modules for image reproduction as well as the 24 colors &# 39 ; respective reflection spectra and the color differences between simulation colors and microscopic colors . in table 2 , the 24 colors are numbered and listed in reversed order of the indices in the macbeth colorchecker ( journal of applied photographic engineering 2 : 95 - 99 ( 1976 )). a simulation spectrum is generated based on the simulated colors to find the correlation between the spectrometer and the image - acquiring device , for analyzing the differences of flgs of different numbers of layers . in the instant example , a process as shown in fig1 is employed to determine the matrix of transformation between the information obtained by the spectrometer and the information obtained by the image - acquiring device in order to acquire the transmission spectrum for every pixel of each image . for convenience for analyzing , in the instant example the foregoing transmission spectra are sorted into a matrix of 401 rows and 24 columns (“ 401 * 24 matrix ”). each row of the 401 * 24 matrix stands for the intensity of corresponding wavelength , while each column stands for the number of the colors . further with the process as shown in fig1 , a simulation spectrum is obtained . six sets of eigenvectors ( 6 * 401 ) and corresponding six eigenvalues ( 6 * 24 ) are obtained via eigensystem and pca , as shown in the following equation 1 . in equation 1 , “ pinv ” is a false inverse . the information simultaneously detected and acquired for these colors by the image - acquiring device with the optical microscopic environment is output in srgb jpeg format . with computational calculation , the r , g and b values ( 0 to 255 ) of the color of each image information are obtained and converted into r srgb , g srgb and b srgb within a smaller scale of 0 to 1 , which , with the following equations 2 to 4 , converts the foregoing rgb values into the xyz tristimulus of cie standard . the reference white of the srgb color space is defined as the reference white under standard illuminant d65 light source , which is different from the reference white of the reflective spectrum obtained with the spectrometer under a halogen light source . thus the rgb values have to be adjusted via chromatic adaptation . in order to accurately estimate the spectral values of the colors , calibration of the image - acquiring device is also necessary . similarly , the reflective spectrum obtained with the spectrometer is converted to the xyz tristimulus of the cie standard with the following equations 5 to 8 . after chromatic adaptation undergone , the rgb values of the camera are converted into xyz values as matrix [ a ]. the correlation between the spectrometer and the camera is obtained via 3 - degree polynomial regression . the matrix of 3 - degree polynomial regression is shown in equation 9 . [ b ]=[ 1 , r , g , b , rg , gb , br , r 2 , g 2 , b 2 , rgb , r 3 , g 3 , b 3 , rg 2 , rb 2 , gr 2 , gb 2 , br 2 , bg 2 ] t [ equation 10 ] the “ r ”, “ g ” and “ b ” are values obtained by the image - acquiring device corresponding to each color . the colors are converted from rgb to xyz tristimulus of the cie standard as matrix [ β ], and the matrix of transformation , [ m ], between the spectrometer and the image - acquiring device is obtained via equation 11 . every pixel of the image obtained by the spectrometer are multiplied by rgb to generate linear regression matrix [ c ], which gives corresponding xyz values with calculation with equations 2 to 4 . the simulation spectrum of each color ( 380 nm to 780 nm band ) is obtained via equation 12 . with the technique of the present invention , the spectrum obtained with the spectrometer under halogen light source is divided by the spectrum obtained with the image - acquiring device under the image - acquiring illumination environment and then multiplied by a spectrum of a new substitution light source . the technique of the present invention makes possible the reproduction of colors under the substitution light source , which may be any light source . in order to confirm the feasibility of color reproduction , the error between the actual spectrum and the simulation spectrum is evaluated using color difference formulae in the instant example , a process of which is demonstrated as follows : a . the tristimulus xyz values obtained with the spectrometer and the image - acquiring device are converted into chromatic coordinate values ( l *, a *, b *) of the cie 1976 space , whereas : b . the euclid distance of two points in the cie 1976 chromatic coordinate system ( or the color difference ) is calculated : δ e ab *=√{ square root over (( δ l *) 2 +( δ a *) 2 +( δ b *) 2 )}{ square root over (( δ l *) 2 +( δ a *) 2 +( δ b *) 2 )}{ square root over (( δ l *) 2 +( δ a *) 2 +( δ b *) 2 )} [ equation 17 ] the color differences of the aforementioned 24 colors are as shown in table 2 . the average color difference is 4 . 21 , which indicates that the instant example has demonstrated that the technique of the present invention is capable of providing an effect of color reproduction and thus suitable for the application of color display . the instant example relates to pca for principal component scores calculation for categorizing the spectra of a 3 - layer flg on a silica / silicon substrate and a 5 - layer flg on a glass substrate . with reference to fig1 and 18 , the principal component scores simplify high - dimensional data into lower - dimensional data for analyses with a projection in an eigenvector space . the formula of principal component scores is as shown in equation 18 . y j = a j1 ( x 1i − x 1 )+ a j2 ( x 2i − x 2 )+ . . . + a jp ( x pi − x p ) [ equation 18 ] x 1i , x 2i . . . x pi are intensities corresponding to the first , second , . . . , p - th wavelengths , while x 1 , x 2 , . . . , x p are average intensities corresponding to the first , second , . . . , p - th wavelengths . a j1 , a j2 , . . . , a jp are coefficients of the eigenvector of the covariance matrix of the spectrum . as for pca , the first principal component , being a general indicator , provides the most abundant information of the original data . the second principal component and the third principal component also demonstrate partial information of the original data , which are useful for further subdividing categorized groups . in order to gain a clear picture of the distribution of the data , succeeding pca is performed for each group to demonstrate the range of the group in an ellipse as shown in equation 19 : a 1 , b 1 , a 2 , b 2 are coefficients of the eigenvector of the inverse covariance matrix of the group , whose physical meaning is rotation around the coordinate axis . c 1 , c 2 are the averages of the data of the group . since all the data with the group are projected in pca , it is necessary to relocate the center of the ellipse back to the original space due to the projection of the original data occurring during the pca . d 1 and d 2 are eigenvalues of the covariance matrix , whose physical meanings are half of the major and minor axes of the ellipse . the instant example relates to confirmation of the effect of the present invention with raman spectroscopic analyses . raman effect may be used to observe molecular structures , molecular vibration and rotation energy levels , may be located within a molecule functional groups or chemical bonds , and quantitatively analyze complex molecular mixtures . raman scattering is due to the vibration or rotation of matrix molecules that initiate energy interchange between incident photons and matrix molecules and alter the frequency of the reflected scattering light . the instant example employs the microscopic raman spectrometer of model number invia 1000 system of renishaw , which focuses a laser beam through optical microscopic lens at a sample and allows a scattering light to enter the same microscopic lens and to obtain a spectrum therefrom for further analysis . the aforementioned raman spectrometer is used with a 8 . 6 mw 633 nm red laser beam . a 40 × objective lens is used to detect raman signals . as described in reference 22 , the raman shift of an flg are primarily shown at 1582 cm − 1 of g - band and 2676 cm − 1 of 2d - band . the raman spectroscopic analysis chart for the 3 - layer flg on a silica / silicon substrate is shown in fig1 , and the raman spectroscopic analysis chart for the 5 - layer flg on a glass substrate is shown in fig2 , from which it is evident that flgs having different numbers of layers demonstrate different raman shifts , wherein g - band signal intensities increase along with the increase of the number of layers , while the 2d - band signal intensities more significantly shift as the numbers of layers increase . in the instant example , the raman analyses performed with the 3 - layer flg on silica / silicon substrate as shown in fig5 give the results as shown in fig1 , which verify the detection results of the techniques of the present invention match the results of raman analyses . as for the 5 - layer flg on glass substrate as shown in fig6 to 14 , the results of the techniques of the present invention also match the 2d - band and g - band results of raman analyses as shown in fig2 and 21 . with further reference to fig2 , raman analyses performed on different square - areas also concur with the results obtained with the techniques of the present invention . comparing aforementioned fig3 and 4 , it is evident that the present invention makes possible an intuitive and rapid detection of numbers of layers of flgs , which is superior to the convention methods based on raman spectroscopy . the instant example relates to confirmation of the effect of the present invention with transmission spectroscopic analyses . ultraviolet - visible (“ uv - vis ”) spectroscopy is a method that employs uv - vis band of continuous electromagnetic spectrum as a light source for illuminating a sample so as to examine the relative intensity of absorbance . qualification analyses may be performed with uv - vis spectroscopy , and quantitative analyses are also possible according to lambert - beer &# 39 ; s law . when the wavelength is small , a solvent demonstrates strong absorbance , or end - absorbance . the tests are performed within the transparent limitation of the end - absorbance . with reference to fig2 and 26 , the transmission spectrometer is used to verify that flgs having different numbers of layers on different substrates demonstrate different transmission spectra . as shown in fig2 and 24 , the transmission spectroscopic analyses of the 3 - layer flg on silica / silicon substrate concur with the result of the techniques of the present invention . the results of reflective spectroscopic analyses as shown in fig2 also concur with the result of the techniques of the present invention . furthermore , with reference to fig2 , transmission spectroscopic analyses give concurring results with the result obtained with the techniques of the present invention . with further reference to fig2 , the results of reflective spectroscopic analyses also concur with the result of the techniques of the present invention . as described above , the present invention combines multispectral analysis with pca to effectively expedite the examination of optical microscopic image of flg for determining the number of layers thereof . the techniques of the present invention have been verified with conventional methods . for example , the reflection of the specific band increases with the increase of number of layers concurs with raman analyses . it is evident that the present invention provides techniques for intuitive and rapid detection of numbers of layers of flgs under low - cost and effective conditions . even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and features of the invention , the disclosure is illustrative only . changes may be made in the details , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . the following references are cited and incorporated as part of the specification . h . c . neto , f . guinea , n . m . r . peres , k . s . novoselov and a . k . geim : the electronic properties of graphene . reviews of modern physics , 81 , 109 - 162 ( 2009 ) [ 2 ] k . s . kim , y . z . houk jang , s . y . lee , j . m . kim , k . s . kim , j . h . a . p . kim , j . y . choi and b . h . hong : large - scale pattern growth of graphene films for stretchable transparent electrodes . nature , 457 , 706 - 710 ( 2009 ) [ 3 ] d . l ., marc b . m . l . scott gilje , r . b . kaner and g . g . wallace : processable aqueous dispersions of graphene nanosheets . nature nanotechnology , 3 , 101 - 105 ( 2008 )| doi : 10 . 1038 / nnano . 2007 . 451 [ 4 ] z . n . ying w . t . yu , and z . shen : raman spectroscopy and imaging of graphene . nano res 1 , 273 - 291 ( 2008 ) [ 5 ] n . mohanty , d . moore , z . xu , t . s . sreeprasad , a . nagaraja , a . a . rodriguez1 & amp ; v . berry : nanotomy - based production of transferable and dispersible graphene nanostructures of controlled shape and size . nature communications , 3 , article number : 844 ( 2012 ) [ 6 ] maher f . el - kady et al : laser scribing of high - performance and flexible graphene - based electrochemical capacitors . science 335 ( 6074 ), 1326 - 1330 ( 2012 ) [ 7 ] jae hun seol , et al : two - dimensional phonon transport in supported graphene . science , 328 ( 5975 ), 213 - 216 ( 2010 ) [ 8 ] h . yang , et al : graphene barristor , a triode device with a gate - controlled schottky barrier . science , 336 ( 6085 ), 1140 - 1143 ( 2012 ) [ 9 ] y . w ., h . w . tong , x . f . xu , b . ozyilmaz , and k . p . loh : interface engineering of layer - by - layer stacked graphene anodes for high - performance organic solar cells . adv . mater . 23 ( 13 ), 1514 - 1518 ( 2011 ) [ 10 ] w . z ., c . t . lin , k . k . liu , t . tite , c . y . su , c . h . chang , y . h . lee , c . w . chu , k . h . wei , j . l . kuo , and l . j . li : opening an electrical band gap of bilayer graphene with molecular doping . acs nano , vols no . 9 7517 - 7524 ( 2011 ) [ 11 ] s . lee , k . lee , c . h . liu and z . zhong : homogeneous bilayer graphene film based flexible transparent conductor . nanoscale , 4 , 639 - 644 ( 2012 ). doi : 10 . 1039 / c1nr11574j ( 2011 ) [ 12 ] p . blake , e . w . hill , a . h . castro neto , k . s . novoselov , d . jiang et al : making graphene visible , appl . phys . lett ., 91 , 063124 ( 2007 ) [ 13 ] i . j . matthew pelton , r . p . dmitriy a . dikin , s . s . ovich , s . w . rotone , m . hausner , and r . s . ruoff : simple approach for high - contrast optical imaging and characterization of graphene - based sheets , nano letters , 7 ( 12 ), 3569 - 3575 ( 2007 ) [ 14 ] l . gao , w . ren , f . li , and h . m . cheng : total color difference for rapid and accurate identification of graphene , acs nano 2 ( 8 ), 1625 - 1633 ( 2008 ) [ 15 ] y . y . wang , z . h . ni , t . yu , z . x . shen , h . m . wang , y . h . wu , w . chen , and a . t . shen : raman studies of monolayer graphene : the substrate effect , j . phys . chem 10637 - 10640 ( 2008 ) [ 16 ] i . j ., j . s . rhyee , j . y . son , r . s . ruoff and k . y . rhee : colors of graphene and graphene - oxide multilayers on various substrates . nanotechnology , 23 , 025708 ( 2012 ) [ 17 ] z . h . ni , h . m . wang , j . kasim , h . m . fan , t . yu , y . h . wu , y . p . feng , and z . x . shen : graphene thickness determination using reflection and contrast spectroscopy . nano lett ., 7 ( 9 ), 2758 - 2763 ( 2007 ) [ 18 ] y . w . zhu , s . murali , w . cai , x . li , ji won suk , j . r . potts , and r . s . ruoff : graphene and graphene oxide : synthesis , properties , and applications . adv . mater ., 22 ( 35 ), 3906 - 3924 ( 2010 ) [ 19 ] y . k . koh , m . h . bae , d . g . cahill , n . e . pop : reliably counting atomic planes of few - layer graphene ( n & gt ; 4 ). acs nano , 5 ( 1 ), 269 - 274 ( 2011 ) [ 20 ] w . liu , h . li , c . xu , y . khatami , k . banerjee : synthesis of high - quality monolayer and bilayer graphene on copper using chemical vapor deposition , carbon , 49 ( 13 ), 4122 - 4130 ( 2011 ) [ 21 ] j . s . park , a . reina , r . saito , j . kong , g . dresselhaus , m . s . dresselhaus : g band raman spectra of single , double and triple layer graphene , carbon , 47 ( 5 ), 1303 - 1310 ( 2009 ) [ 22 ] m . s . dresselhaus , g . dresselhaus , r . saito , a . jorio : raman spectroscopy of carbon nanotubes , physics reports , 409 ( 2 ), 47 - 99 ( 2005 ) [ 23 ] a . c . ferrari , j . c . meyer , v . scardaci , casiraghi , m . lazzeri , f . mauri , s . piscanec , d . jiang , k . s . novoselov , s . roth , and a . k . geim : raman spectrum of graphene and graphene layers , physical review letters , 97 , 187401 ( 2006 ) | 6 |
the following examples are given by way of illustration only and shall not be taken as limiting the scope of the invention . it has been surprisingly discovered that the process of the metabolism of igf1 to the tripeptide gpe and des igf is only a part of the process . the cis - isomer of the gpe can further break down to form a cyclic prolyl glycine and glutamic acid . this is shown in fig1 . the cyclic pg structure is sufficiently small to allow it to cross the blood - brain barrier . in addition , as shown in fig2 the structure of the molecule is such that it is able to provide ligands for binding metal ions such as mg 2 +, ca 2t , co 2 + and the like and as such can act as a chelating agent . the possible role of cpg as an agent is further supported by the companion break down product , glutamic acid . glutamic acid is known to be associated with brain disease . ( johnston , g . a . r . in roberts p . j . et al editors , glutamate : transmitter in the central nervous system , john wiley & amp ; sons , 1981 , pp . 77 - 87 ). as used herein , a cpg compound is a compound with biological activity similar or identical to the biological activity of cpg ; cpg compounds comprise cpg , biologically active cpg analogues , biologically active cpg mimetics , and compounds that increase the concentration of cpg and cpg analogues in a mammal . cpg compounds include cpg agonist molecules such as truncated portions of igf - i compounds as well as other chemical and biological analogues and mimetics . as used herein , “ cpg analogue ” is any analogue of cpg , naturally occurring analogue of cpg , or any variants thereof , which are capable of effectively binding to mglur receptors in the cns and of promoting an equivalent neuroprotective effect on cns nerve cells , examples of cpg analogues are c ( pg ) 3 and cgal the term “ cpg agonist molecules ” includes peptide fragments and truncated portions of longer igf - i compounds as well as other chemical and biological analogues and mimetics . cpg compounds can be used in the treatment of mammals , suffering from neutral injury or disease . in particular the cpg compounds can be used to treat human patients , suffering from neural injury or disease . still more generally , the compositions and methods of the invention find use in the treatment of mammals , such as human patients , suffering from nerve damage or potential apoptotic and / or necrotic cell death , due to injuries and diseases such as septic shock , ischemia , administration of cytokines , overexpression of cytokines , ulcers , gastritis , ulcerative colitis , crohn &# 39 ; s disease , diabetes , rheumatoid arthritis , asthma , alzheimer &# 39 ; s disease , parkinson &# 39 ; s disease , multiple sclerosis , stroke , cirrhosis , allograft rejection , transplant rejection , encephalomyelitis , meningitis , pancreatitis , peritonitis , vasculitis , lymphocytic choriomeningitis , glomerulonephritis , uveitis , glaucoma , blepharitis , chalazion , allergic eye disease , corneal ulcer , keratitis , cataract , retinal disorders , age - related macular degeneration , optic neuritis ileitis , inflammation induced by overproduction of inflammatory cytokines , hemorrhagic shock , anaphylactic shock , bum , infection leading to the overproduction of inflammatory cytokines induced by bacteria , virus , fungus , and parasites , hemodialysis , chronic fatigue syndrome , stroke , cancers , cardiovascular diseases associated with overproduction of inflammatory cytokines , heart disease , cardiopulmonary bypass , ischemic / reperfusion injury , ischemic / reperfusion associated with overproduction of inflammatory cytokines , toxic shock syndrome , adult respiratory distress syndrome , cachexia , myocarditis , autoimmune disorders , eczema , psoriasis , heart failure , dermatitis , urticaria , cerebral ischemia , systemic lupus erythematosis , aids , aids dementia , chronic neurodegenerative disease , chronic pain , priapism , cystic fibrosis , amyotrophic lateral sclerosis , schizophrenia , depression , premenstrual syndrome , anxiety , addiction , migraine , huntington &# 39 ; s disease , epilepsy , gastrointestinal motility disorders , obesity , hyperphagia , neuroblastoma , malaria , hematologic cancers , myelofibrosis , lung injury , graft - versus - host disease , head injury , cns trauma , hepatitis , renal failure , chronic hepatitis c , paraquat poisoning , transplant rejection and preservation , fertility enhancement , bacterial translocation , circulatory shock , traumatic shock , hemodialysis , hangover , and combinations of two or more thereof . in addition , cpg and its analogues , c ( pg ) 3 and cgal may be used to treat mammals suffering from white matter insult as the result of acute brain injury , such as perinatal hypoxic - ischemic injury ; or from chronic neural injury or neurodegenerative disease , such as multiple sclerosis , or from other demyelinating diseases and disorders including inflammatory involvement , such as acute disseminated encephalomyelitis , optic neuritis , transverse myelitis , devic &# 39 ; s disease , the leucodystrophies ; non - inflammatory involvement ; progressive multifocal leukoencephalopathy , central pontine myelinolysis . patients suffering from such diseases or injuries will benefit greatly by a treatment protocol able to initiate re - myelination . the present invention has application in the induction of myelin production following insult in the form of trauma , toxin exposure , asphyxia or hypoxia - ischemia , and has application in the treatment or prevention of apoptosis in response to injury or disease in the form of cancers , viral infections , autoimmune diseases , neurological diseases and injuries and cardiovascular diseases . ttreatment with cpg or its analogues , c ( pg ) 3 and cgal may be given before ( as well as alter ) an injury — as for example before elective surgery . examples of relevant elective procedures include neural surgery , in which retraction of lobes of the brain may lead to cerebral oedema , or heart operations , such as valve replacement , in which inevitable small emboli are said to lead to detectable impairment of brain function in some 75 % of cases . cpg can act as an anti - necrotic and anti - apoptotic in a process of cell death . its anti - apoptotic and anti - necrotic activity in vivo can be measured by cell counts . cpg can also be measured in vitro . ( gudasheva t . a . et al . febs letters , vol . 391 , issues 1 - 2 , 5 aug . 1996 , pp . 149 - 152 ). cns damage may for example be measured clinically by the degree of permanent neurological deficit cognitive function , and / or propensity to seizure disorders . ( rakic l . j . et al , in rakic l . j et al peptide and amino acid transport mechanisms in the central nervous system , 1988 , the macmillan press ltd . ( london ) pp . 167 - 181 ). cpg itself is used to prevent or treat cell damage and death and the induction of myelin production . usually this is effected through the direct administration of cgp to the patient . if desired , a combination of the cpg compounds and its analogues can be administered in a pharmaceutically acceptable composition . those skilled in the art will appreciate there is no intention on the part of the applicants to exclude administration of other forms of cpg . by way of example , the effective amount of cpg in the cns can be increased by administration of a pro - drug from of cpg , which comprises cpg and a carrier , cpg and the carrier being joined by a linkage which is susceptible to cleavage or digested within the patient . any suitable linkage can be employed which will be cleaved or digested to release cpg following administration . in addition , it is envisaged cpg levels may be increased through an implant that includes a cell line capable of expressing cpg in an active from within the cns of the patient . cpg and its analogues , c ( pg ) 3 and cgal can be administered as part of a medicament or pharmaceutical preparation . this can involve combining cpg with any pharmaceutically appropriate carrier , adjuvant or excipient . the selection of the carrier , adjuvant or excipient will of course usually be dependent upon the route of administration to be employed . the administration route can vary widely . an advantage of cpg is that it can be administered peripherally . this means it need not be administered directly to the cns of the patient in order to have effect in the cns . any peripheral route known in the art can be employed . these can include parenteral routes for example injection into the peripheral circulation , subcutaneous , intraorbital , ophthalmic , intraspinal , intracisternal , topical , infusion ( using e . g ., controlled release devices or minipumps such as osmotic pumps or skin patches ), implant , aerosol , inhalation , scarification , intraperitoneal , intracapsular , intramuscular , intranasal , oral , buccal , pulmonary , rectal or vaginal . the compositions can be formulated for parenteral administration to humans or other mammals in therapeutically effective amounts ( e . g ., amounts which eliminate or reduce the patient &# 39 ; s pathological condition ) to provide therapy for the neurological diseases described above . two of the preferred administration routes will be by subcutaneous injection ( e . g ., dissolved in 0 . 9 % sodium chloride ) or orally ( in a capsule ). it will also be appreciated that on occasion it may desirable to directly administer igf - i compounds to the cns of the patient . again , this can be achieved by any appropriate direct administration route . examples include administration by lateral cerebroventricular injection or through a surgically inserted shunt into the lateral cerebroventricle of the brain of the patient . the calculation of the effective amount of cpg compounds to be administered is within the skill of one of ordinary skill in the art , and will be routine to those persons skilled in the art . needless to say , the final amount to be administered will be dependent upon the route of administration and upon the nature of the neurological disorder or condition that is to be treated . preferably the cpg compound will be administered at between about 1 μg to 100 mg of cpg compound per 100 g of body weight where the dose is administered centrally . a suitable dosage for administration of cpg may be , for example , at between 0 . 1 mg to about 10 mg per 100 g of body weight , or at between about 1 mg to about 5 mg per 100 g body weight . for inclusion in a medicament , cpg compounds can be obtained from a suitable commercial source such as bachem ag of bubendorf , switzerland . alternatively , cpg can be directly synthesized by conventional methods such as the stepwise solid phase synthesis method of merrifield et al . 1963 j . amer . chem . soc . : 85 , 2149 - 2156 . alternatively synthesis can involve in the use of commercially available peptide synthesizers such as the applied biosystems model 430a . cgal may be prepared by methods such as are well - known to those of ordinary skill in the art of the synthesis of peptides and analogues . example : “ principles of peptide synthesis ” by bodanzsky , published by springer - verlag 1993 . as a general proposition , the total pharmaceutically effective amount of the cpg agonist compound administered parenterally per dose will be in a range that can be measured by a dose response curve . one can administer increasing amounts of the cpg agonist compound to the patient and check the serum levels of the patient for cpg . the amount of cpg agonist to be employed can be calculated on a molar basis based on these serum levels of cpg . specifically , one method for determining appropriate dosing of the compound entails measuring cpg levels in a biological fluid such as a body or blood fluid . measuring such levels can be done by any means , including ria and elisa . after measuring cpg levels , the fluid is contacted with the compound using single or multiple doses . after this contacting step , the cpg levels are re - measured in the fluid . if the fluid cpg levels have fallen by an amount sufficient to produce the desired efficacy for which the molecule is to be administered , then the dose of the molecule can be adjusted to produce maximal efficacy . this method can be carried out in vitro or in vivo . preferably , this method is carried out in vivo , i . e ., after the fluid is extracted from a mammal and the cpg levels measured , the compound herein is administered to the mammal using single or multiple doses ( that is , the contacting step is achieved by administration to a mammal ) and then the cpg levels are remeasured from fluid extracted from the mammal . the compound may also be suitably administered by a sustained - release system . suitable examples of sustained - release compositions include semi - permeable polymer matrices in the form of shaped articles , e . g ., films , or microcapsules . sustained - release matrices include polylactides ( u . s . pat . no . 3 , 773 , 919 ; ep 58 , 481 ), copolymers of l - glutamic acid and gamma - ethyl - l - glutamate ( sidman et al ., 1983 ), poly ( 2 - hydroxyethyl methacrylate ) ( langer et al , 1981 ), ethylene vinyl acetate ( langer et al ., supra ), or poly - d -(−)- 3 - hydroxybutyric acid ( ep 133 , 988 ). sustained - release compositions also include a liposomally entrapped compound . liposomes containing the compound are prepared by methods known per se : de patent 3 , 218 , 121 ; epstein et al ., 1985 ; hwang et al ., 1980 ; ep patent 52 , 322 ; ep patent 36 , 676 ; ep patent 88 , 046 ; ep patent 143 , 949 ; ep patent 142 , 641 ; japanese pat . appln . 83 - 118008 ; u . s . pat . nos . 4 , 485 , 045 and 4 , 544 , 545 ; and ep 102 , 324 . ordinarily , the liposomes are of the small ( from or about 200 to 800 angstroms ) unilamellar type in which the lipid content is greater than about 30 mol . percent cholesterol , the selected proportion being adjusted for the most efficacious therapy . pegylated peptides having a longer life can also be employed , based on , e . g ., the conjugate technology described in wo 95 / 32003 published nov . 30 , 1995 . if parenteral administration is preferred , the compound is formulated generally by mixing each at the desired concentration , in a unit dosage injectable form ( solution , suspension , or emulsion ), with a pharmaceutically , or parenterally , acceptable carrier , i . e ., one that is non - toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation . generally , the formulations are prepared by contacting the compound with liquid carriers or finely divided solid carriers or both . then , if necessary , the product is shaped into the desired formulation . preferably the carrier is a parenteral carrier , more preferably a solution that is isotonic with the blood of the recipient . examples of such carrier vehicles include water , saline , ringer &# 39 ; s solution , a buffered solution , and dextrose solution . non - aqueous vehicles such as fixed oils and ethyl oleate may also be used . the carrier may additionally contain additives such as substances that enhance isotonicity and chemical stability . such materials are non - toxic to recipients at the dosages and concentrations employed , and include buffers such as phosphate , citrate , succinate , acetic acid , and other organic acids or their salts ; antioxidants such as ascorbic acid ; low molecular weight ( less than about ten residues ) polypeptides , e . g ., polyarginine or tripeptides ; proteins , such as serum albumin , gelatin , or immunoglobulins ; hydrophilic polymers such as polyvinylpyrrolidone ; glycine ; amino acids such as glutamic acid , aspartic acid , histidine , or arginine ; monosaccharides , disaccharides , and other carbohydrates including cellulose or its derivatives , glucose , mannose , trehalose , or dextrins ; chelating agents such as edta ; sugar alcohols such as mannitol or sorbitol ; counter - ions such as sodium ; non - ionic surfactants such as polysorbates , poloxamers , or polyethylene glycol ( peg ); and / or neutral salts , e . g ., nacl , kcl , mgcl . sub . 2 , cacl . sub . 2 , etc . the cpg compound is typically formulated in such vehicles at a ph of between about 5 . 5 to 8 . typical adjuvants which may be incorporated into tablets , capsules , and the like are a binder such as acacia , corn starch , or gelatin ; an excipient such as microcrystalline cellulose ; a disintegrating agent like corn starch or alginic acid ; a lubricant such as magnesium stearate ; a sweetening agent such as sucrose or lactose ; a flavoring agent such as peppermint , wintergreen , or cherry . when the dosage form is a capsule , in addition to the above materials , it may also contain a liquid carrier such as a fatty oil . other materials of various types may be used as coatings or as modifiers of the physical form of the dosage unit . a syrup or elixir may contain the active compound , a sweetener such as sucrose , preservatives like propyl paraben , a coloring agent , and a flavoring agent such as cherry . sterile compositions for injection can be formulated according to conventional pharmaceutical practice . for example , dissolution or suspension of the active compound in a vehicle such as water or naturally occurring vegetable oil like sesame , peanut , or cottonseed oil or a synthetic fatty vehicle like ethyl oleate or the like may be desired . buffers , preservatives , antioxidants , and the like can be incorporated according to accepted pharmaceutical practice . the compound to be used for therapeutic administration must be sterile . sterility is readily accomplished by filtration through sterile filtration membranes ( e . g ., 0 . 2 micron membranes ). therapeutic compositions generally are placed into a container having a sterile access port , for example , an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle . the compound ordinarily will be stored in unit or multi - dose containers , for example , sealed glass ampules or vials , as an aqueous solution or as a lyophilized formulation for reconstitution . as an example of a lyophilized formulation , 10 - ml vials are filled with 5 ml of sterile - filtered 1 % ( w / v ) aqueous solution of compound , and the resulting mixture is lyophilized . the infusion solution is prepared by reconstituting the lyophilized compound using bacteriostatic water - for - injection . combination therapy with the cpg agonist compound herein and one or more other appropriate reagents that increase total cpg in the blood or enhance the effect of the cpg agonist is also contemplated . these reagents generally allow the cpg agonist compound herein to release the generated cpg . in addition , it is envisaged using gene therapy for treating a mammal , using nucleic acid encoding the cpg agonist compound , if it is a peptide . generally , gene therapy is used to increase ( or overexpress ) cpg levels in the mammal . nucleic acids , which encode the cpg agonist peptide can be used for this purpose . once the amino acid sequence is known , one can generate several nucleic acid molecules using the degeneracy of the genetic code , and select which to use for gene therapy . there are two major approaches to getting the nucleic acid ( optionally contained in a vector ) into the patient &# 39 ; s cells for purposes of gene therapy : in vivo and ex vivo . for in vivo delivery , the nucleic acid is injected directly into the patient , usually at the site where the cpg agonist compound is required . for ex vivo treatment , the patient &# 39 ; s cells are removed , the nucleic acid is introduced into these isolated cells , and the modified cells are administered to the patient either directly or , for example , encapsulated within porous membranes which are implanted into the patient . see , e . g ., u . s . pat . nos . 4 , 892 , 538 and 5 , 283 , 187 . there are a variety of techniques available for introducing nucleic acids into viable cells . the techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro , or in vivo in the cells of the intended host . techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes , electroporation , microinjection , cell fusion , deae - dextran , the calcium phosphate precipitation method , etc . a commonly used vector for ex vivo delivery of the gene is a retrovirus . the currently preferred in vivo nucleic acid transfer techniques include transfection with viral vectors ( such as adenovirus , herpes simplex i virus , or adeno - associated virus ) and lipid - based systems ( useful lipids for lipid - mediated transfer of the gene are dotma , dope and dc - chol , for example ). in some situations it is desirable to provide the nucleic acid source with an agent that targets the target cells , such as an antibody specific for a cell - surface membrane protein or the target cell , a ligand for a receptor on the target cell , etc . where liposomes are employed , proteins which bind to a cell - surface membrane protein associated with endocytosis may be used for targeting and / or to facilitate uptake , e . g ., capsid proteins or fragments thereof tropic for a particular cell type , antibodies for proteins which undergo internalization in cycling , and proteins that target intracellular localization and enhance intracellular half - life . the technique of receptor - mediated endocytosis is described , for example , by wu et al ., 1987 ; wagner et al ., 1990 ). for review of the currently known gene marking and gene therapy protocols , see anderson 1992 . see also wo 93 / 25673 and the references cited therein . kits are also contemplated for this invention . a typical kit would comprise a container , preferably a vial , for the cpg agonist compound formulation comprising cpg agonist compound in a pharmaceutically acceptable buffer and instructions , such as a product insert or label , directing the user to utilize the pharmaceutical formulation . cyclic pg prevents glutamate induced neuronal death in vitro in a dose related manner . ten coverslips were placed into a large petri dish and washed in 70 % alcohol for 5 minutes , then washed with millipore h 2 o . the coverslips were air dried , then coated with poly - d - lysine ( 1 mg / ml stock solution in pbs , 90 - 100 μl ) and incubated for 2 hours at 34 ° c . postnatal day 4 wistar rats were used for the study . rats were placed in ice for 1 minute , the heads were decapitated and the cerebellum removed on ice . cerebellum tissue was placed in 1 ml of 0 . 65 % glucose supplemented pbs ( 10 μl 65 % stock d (+) glucose / 1 ml pbs ) in a large petri dish , chopped up into smaller sections and triturate with a 1 ml insulin syringe via a 23 g ( 0 . 4 mm ) needle , and then squirted back into the glucose solution on the large petri dish . the tissue was sieved through ( 125 μm pore size gaze ) and centrifuged ( 2 minutes at 60 g ) two times for a medium exchange into serum - free bsa - supplemented start v medium ( biochrom ). the second centrifugation step was done with 1 ml of start v medium . the microexplants were reconstituted into 500 μl of start v medium and put on ice two hours after pdl - coating , the slides were washed with millipore h 2 o and air dried . each slide was placed into a small 35 mm petri dish and 40 μl of start v / cell suspension added . the tissue was incubated for 2 hours at 34 ° c . ( settlement period ). start v - medium ( 1 ml ) was then added to the petri dish and cultivated at 34 ° c ./ 5 % co2 / 100 % humidity for 48 hours . cells were rinsed in pbs and then fixed for 2 - 3 minutes in increasing concentrations of paraformaldehyde ( 5000 μl of 0 . 4 % pfa was applied ; then 1 . 2 % pfa ; then 3 % pfa and finally 4 % pfa — all fixation solutions contain 0 . 2 % glutardialdehyde ). finally , the microexplants were rinsed in pbs . 0 μl of toxin ( l - glutamate - 100 mm in millipore water ) was applied simultaneously with cpg ( from bachem , 10 mm stock prepared in pbs and diluted to final concentrations between 1 - 100 nm ) for study 1 . a delay in administration of cpg at 6 hours after glutamate treatment was performed for study 2 . study 1 : glutamate treatment resulted in 85 % loss of cerebellum neurons . cyclic pg significantly reduced the glutamate induced neuronal death in a dose response manner when administered simultaneously with glutamate ( fig3 ). the treatments with lower doses of cpg ( 10 - 100 nm ) showed significant recovery from glutamate - induced neurotoxicity . study 2 : cyclic pg showed a significantly recovery from glutamate induced neurotoxicity in a dose range of 1 - 100 nm when given 6 hours after the glutamate treatment compared to the vehicle treated group ( fig4 ). a further lower dose of cpg also showed a significant increase in neuron number compared to the normal control group , suggest a role for cpg in neuronal proliferation and differentiation . excessive glutamate can cause neuronal excitotoxicity by active nmda receptors . cyclic pg completely prevented the glutamate - induced neurotoxicity , when given either immediately or 6 hours after the glutamate treatment by acting as a direct or indirect nmda antagonist . given that cpg can agonise mglu2 / 3 receptor , which can inhibit nmda activity . gpe , the pre - hormone for cpg has been shown to be partial nmda receptor agonist in promoting pcreb , probably due to its antagonistic effect on mglu2 / 3 receptors . cpg may be involved in preventing neurons undergoing apoptosis because cpg appeared to be still effective as a delayed treatment , and promoted the neuronal proliferation . cyclic ( tri ( prolylglycyl )) or c ( pg ) 3 prevents glutamate induced neuronal death in vitro in a dose related manner . 10 μl of toxin ( l - glutamate - 100 mm in millipore water ) was applied simultaneously with cyclic ( tri ( prolylglycyl )) ( from neurobiomed chemical synthetic group , 10 mm stock prepared in pbs and diluted to final concentrations between 1 - 100 nm ) for study 1 . a delay in administration of cpg at 6 hours after glutamate treatment was performed for study 2 . study 1 : glutamate treatment resulted in 85 % loss of cerebellum neurons . eye lic ( tri ( prolylglycyl )) significantly reduced the glutamate induced neuronal death by 57 % in a dose response manner when administered simultaneously with glutamate . the treatments with lower doses of cyclic ( tri ( prolylglycyl )) ( 10 - 100 nm ) showed significant recovery from glutamate - induced neurotoxicity . study 2 : cyclic ( tri ( prolylglycyl )) showed an improvement of approximately 43 % significantly recovery from glutamate induced neurotoxicity in a dose range of 1 - 100 nm when given 6 hours after the glutamate treatment compared to the vehicle treated group . a further lower dose of cyclic ( tri ( prolylglycyl )) also showed a significant increase in neuron number compared to the normal control group , suggest a role for cpg in neuronal proliferation and differentiation . cyclic glycyl - 2 - allyl proline or cgal prevents glutamate induced neuronal death in vitro in a dose related manner . 10 μl of toxin ( l - glutamate - 100 mm in millipore water ) was applied simultaneously with cyclic glycyl - 2 - allyl proline ( obtained neurobiomed chemical synthetic group , 10 mm stock prepared in pbs and diluted to final concentrations between 1 - 100 nm ) for study 1 . a delay in administration of cpg at 6 hours after glutamate treatment was performed for study 2 . study 1 : glutamate treatment resulted in 85 % loss of cerebellum neurons . cyclic glycyl - 2 - allyl proline significantly reduced the glutamate induced neuronal death by 63 % in a dose response manner when administered simultaneously with glutamate . the treatments with lower doses of cyclic ( tri ( prolylglycyl )) ( 10 - 100 nm ) showed significant recovery from glutamate - induced neurotoxicity . study 2 : cyclic glycyl - 2 - allyl proline showed an improvement of approximately 58 % significantly recovery from glutamate induced neurotoxicity in a dose range of 1 - 100 nm when given 6 hours after the glutamate treatment compared to the vehicle treated group . a further lower dose of cyclic glycyl - 2 - allyl proline also showed a significant increase in neuron number compared to the normal control group , suggest a role for cpg in neuronal proliferation and differentiation . excessive glutamate can cause neuronal excitotoxicity by active nmda receptors . cyclic pg analogues , cyclic ( tri ( prolylglycyl )) and cyclic glycyl - 2 - allyl proline significantly prevented the glutamate - induced neurotoxicity , when given either immediately or 6 hours after the glutamate treatment by acting as a direct or indirect nmda antagonist . cyclic pg and its analogues , cyclic ( tri ( prolylglycyl )) and cyclic glycyl - 2 - allyl proline may be involved in preventing neurons undergoing apoptosis because cpg appeared to be still effective as a delayed treatment , and promoted the neuronal proliferation . twenty male wistar rats ( 280 - 310 g ) were used . after exposing the skull , 6 - ohda ( 8 μg in a base of 2 μl 0 . 9 % saline containing 1 % ascorbic acid ) was administered into the right medial forebrain bundle ( mfb ) using co - ordinates ap + 4 . 7 mm , r 1 . 6 mmv − 8 mm under 3 % halothane anaesthesia . 6 - ohda was injected through a 25g needle connected via a polyethylene catheter to a 1000 μl hamilton syringe , the 6 - ohda was infused by a microdialysis infusion pump at a rate of 0 . 5 μl / min . the needle was left in the brain for a further 3 minutes before being slowly withdrawn . the skin was sutured with 2 . 0 silk and the rats were allowed to recover from anaesthesia . the rats were housed in a holding room with free access to food and water at all times except during behavioural testing . cyclic pg was dissolved in saline . four different doses of cpg ( 0 , 0 . 1 0 . 5 1 mg / kg , bachem ) were administered intraperitoneally 2 h post lesion . at 7 days post - lesion , rats were injected with 0 . 1 mg / kg apomorphine and the number of contralateral rotations / hour was recorded and calculated using a computerised rotameter ( st diego instruments ). experimenter was blinded from the treatment groups . the group treated with lmg cpg ( n = 5 , 154 ± 64 . 1 ) showed a trend toward a reduction in the number of rotations compared to the vehicle treated group ( n = 5 , 290 . 08 ± 18 . 9 ) indicating a role for cpg in improving functional recovery in 6 - ohda induced nigrostriatal injury . ( fig5 ) cyclic ( tri ( prolylglycyl )) was dissolved in saline solution . four different doses of cyclic ( tri ( prolylglycyl )) ( 0 , 0 . 1 0 . 5 1 mg / kg , neurobiomed ) were administered intraperitoneally 2 h post lesion . the group treated with 1 mg cyclic ( tri ( prolylglycyl )) ( n = 5 , 172 + 69 ) showed a trend toward a reduction in the number of rotations compared to the vehicle treated group ( n = 5 , 290 . 08 + 18 . 9 ) indicating a role for cyclic ( tri ( prolylglycyl )) in improving functional recovery in 6 - ohda induced nigrostriatal injury . cyclic ( tri ( prolylglycyl )) improved the functional recovery after 6 - ohda induced nigral - striatal lesions in a dose related manner . this data suggested cyclic ( tri ( prolylglycyl )) has potential as a treatment for parkinson &# 39 ; s disease . effects of cyclic glycyl - 2 - allyl proline or cgal after 6 - ohda induced nigral - striatal lesion . cgal was dissolved in saline solution . four different doses of cgal ( 0 , 0 . 1 0 . 5 1 mg / kg , neurobiomed ) were administered intraperitoneally 2 h post lesion . the group treated with lmg cgal ( n = 5 , 134 ± 69 ) showed a trend toward a significant reduction in the number of rotations compared to the vehicle treated group ( n = 5 , 292 ± 21 ) indicating a role for cgalin improving functional recovery in 6 - ohda induced nigrostriatal injury . cyclic glycyl - 2 - allyl proline improved the functional recovery after 6 - ohda induced nigral - striatal lesions in a dose related manner . this data suggested cyclic glycyl - 2 - allyl proline has potential as a treatment for parkinson &# 39 ; s disease . some advantages offered by the present invention with the cyclic peptides , especially over igf - i and the gpe include : the active ingredients are easy to synthesise either in vitro or by other means such as recombinant techniques . the peptide as a small molecule can diffuse readily through the body and between compartments ( e . g . the blood - brain barrier , and mucous membranes ), aiding in the choice of methods for its administration and its ability to reach sites where injury has occurred . cpg , c ( pg ) 3 and cgal are very stable molecule and is unlikely to present a challenge to the immune system , so it may be administered over extended periods and it may be administered prophylactically . with their antagonistic and agonistic effects , gpe / cpg , the present invention provides a novel therapeutic method for preventing brain injury and degenerative diseases by regulating mglurs particularly ⅔ leading to long - term benefits of brain recovery . with a role in regulating igf - i induction , cpg will provide further neuroprotection with less potential for growth side - effects . while various embodiments of the present invention have been described above , it should be understood that they have been presented by way of examples only , and not limitation . it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present invention as defined in the appended claims . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined in accordance with the following claims and their equivalents . all publication , including patent documents and scientific articles , referred to in this application , including any bibliography , are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference . all headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading , unless so specified . | 0 |
the mine prop prestressing device 10 seen in fig1 has four components , namely a steel tube 12 , two identical cup - shaped members 14 and an inlet valve 16 . each of the cup - shaped members is deep drawn or pressed from thin gauge steel sheet and has a base 18 and a round cylindrical side wall 20 having an outside diameter slightly less than the internal diameter of the tube 12 . the members 14 are located in the tube 12 in opposition to one another , with their bases 18 in contact with one another and with their side walls 20 extending complementally along the internal surface of the wall of the tube 12 , as illustrated in fig1 . in practice , the wall thickness of the members 14 is sufficiently low for their bases 18 to be readily deformable . the extremities of the side walls 20 are welded at 22 to the wall of the tube . the inlet valve 16 is mounted in a socket on the tube 12 and serves an inlet 24 which extends through the wall of the tube to the gap 26 which is defined by the junctions of the bases and side walls of the members 14 . the valve 16 is a one - way valve which allows fluid to flow into the tube 12 but not in the reverse direction . it is described below in more detail with reference to fig1 and 12 . fig2 shows a mine prop 28 which is installed between the hanging wall 30 and the footwall 32 of a mine stope 34 and which incorporates the device 10 . in addition to the device 10 , the mine prop 28 includes two timber elements or plungers 36 and 38 of round cross - section . the timber plungers are typically lengths of saligna which have been turned to a predetermined diameter slightly greater than the internal diameter of the tube 12 and which have been forced axially into the tube from either end , typically in a press . the inner ends of the plungers 36 and 38 locate in the members 14 as illustrated , with their inner extremities against the bases 18 . the initial length of the prop 28 is slightly less than the width of the slope 34 so that , when the prop is arranged upright on the footwall 32 , the upper end of the prop , i . e . the upper end of the plunger 36 , is a short distance beneath the hanging wall . with the prop installed upright as shown in fig2 water or other hydraulic fluid is pumped under high pressure through the valve 16 into the tube 12 . the water acts against the bases 18 of the members 14 and forces them apart from one another , with the result that the plungers 36 and 38 are driven in opposite directions out of the tube . the prop 28 therefore extends in length to bring the upper end of the plunger 36 into contact with the hanging wall 30 . the water pressure is such that the prop 28 is placed under an initial preload of predetermined magnitude . the preloaded prop is now in a condition to take loading imposed on it by the hanging wall . as the hanging wall closes towards the footwall with passage of time , either or both of the timber plungers deforms to accommodate the closure while the prop continues to support the load imposed on it by the hanging wall . fig3 illustrates another embodiment 38 of the invention in which the upper deep drawn member 40 is shallower than the lower member 42 but which is similar to the first embodiment in other respects . in the assembled mine prop of fig4 a saligna plunger 44 is inserted into the lower end of the device and an element 46 is inserted into the upper end . the element 46 is made of a material able to deform , on installation and setting of the prop , to take up the shape of the hanging wall , i . e . to take account of local irregularities in the shape of the hanging wall . apart from this feature , the prop of fig5 operates in much the same way as the prop 28 of fig2 with closure of the hanging wall accommodated by deformation of the timber plunger 44 . a headboard could be fitted into the upper end of the device 28 , 38 so as to provide a real coverage for the hanging wall . fig5 and 7 illustrate a prestressing device according to a third embodiment of the invention before and after deformation of the cup - shaped members . as in the embodiment of fig1 the prestressing device 50 of fig5 has an outer steel tube 52 , two identical cup - shaped members 54 and a valve 56 . the cup - shaped members each have a base 58 and a round cylindrical side wall 60 . the cup - shaped members are located in opposition to one another at a central position in the tube 52 and are welded to the tube at the edges of the side walls 60 , as indicated by the numeral 62 . the valve 56 , which is described below in more detail , is screwed into a socket 64 projecting from the tube 52 and communicates with the interior of the tube between the bases 58 of the cup - shaped members 54 . an important difference between the embodiment of fig5 and that of fig1 is the shape of each base 58 . instead of being planar as in fig1 each base 58 has a planar central region 66 and a circumscribing , annular channel - shaped depression 68 , the outer extremity of which meets the side wall 60 . in the result the central region 66 is slightly inwardly displaced relative to the extremity of the member 54 defined by the base of the depression 68 . the presence of the depression 68 affects the manner in which the bases 58 of the cup - shaped members deform when subjected to liquid pressure through the valve 56 . in practice deformation is such that the planar central regions 66 move apart from one another in response to the internal pressure , while remaining generally parallel to one another . this is considered advantageous compared to the configuration of fig1 because the generally parallel movement of the central regions 66 ensures that contact between the bases of the cup - shaped members and the timber elements , as described below , is maintained over a relatively large area rather than over a limited area as is the case if the bases of cup - shaped members merely bulge as in fig2 . fig7 illustrates the prestressing device 50 after internal pressurisation . it will be noted that the cup - shaped members have effectively inverted themselves , while remaining connected to the tube 52 , with the central regions 66 still generally parallel to one another . fig6 illustrates a mine prop 70 incorporating the prestressing device 50 , before pressurisation . the prop 70 includes , in addition to the prestressing device 50 , an upper timber element 72 and a lower timber element 74 . the upper element is shaped in the manner of a known profile prop with a conically shaped upper end 76 , a shoulder 78 and a cylindrical portion 80 which is press - fitted into the upper end of the tube 12 so that the lower end of the portion 80 locates against the central region 66 of the upper cup - shaped member 54 . the lower element 74 is cylindrical throughout and is circumscribed near its lower end by a reinforcing steel ring 82 . the upper end of the element 74 is press - fitted into the lower end of the tube 12 so as to located against the central region 66 of the lower cup - shaped member 54 . nails 84 are driven through holes in the tube 12 into the timber elements 72 and 74 to ensure that the elements are retained firmly in their inserted positions in the tube 12 . in a practical example employing a prestressing device of the type seen in fig5 timber elements 72 and 74 turned to a nominal diameter of approximately 210 mm were press - fitted into a tube 52 of 209 mm internal diameter . the tube had a wall thickness of 4 , 5 mm and an overall length of 300 mm . the cup - shaped members 54 had a matching outside diameter and were pressed from 1 , 6 mm steel plate . the overall depth of each cup - shaped member , i . e . the dimension 86 in fig5 was 40 mm . the inward displacement of the central planar region 66 was approximately 3 mm . the steel ring 82 was formed of 5 mm diameter mild steel wire nailed to the lower timber element 74 . the timber elements were of the saligna variety . the overall length of the prop was 1 , 2 m . fig9 illustrates the performance of the prop described above in a press . the region marked &# 34 ; a &# 34 ; in the graph relates to the initial setting and preloading of the prop . at the commencement of the test , the lower end of the prop was placed on a bottom platen of the press with the upper end of the prop approximately 35 mm below the upper platen . the interior of the tube 12 was pressurised with water . this was achieved by connecting a high pressure , pneumatically operated pump to the valve 56 , described below in more detail . the internal pressurisation of the tube 12 deformed the bases 58 apart from one another to the condition seen in fig7 . the deformation of the bases increased the overall length of the prop 70 and brought the upper end of the upper timber element 72 into contact with the upper platen . internal pressurisation was sufficient to impose a preload force of approximately 27 tons ( 270 kn ) on the prop , as indicated by the point &# 34 ; b &# 34 ; in fig9 . thereafter the load decreased slightly with passage of time , as indicated by the numeral &# 34 ; c &# 34 ; in fig9 as a result of timber creep . after initial preloading as described above , the press was operated at a constant closure rate of 30 mm per minute . the performance of the prop under the imposed loading is indicated in fig9 by the numeral &# 34 ; d &# 34 ;. it will be seen that the prop continually accepted load up to a maximum level of approximately 75 tons ( 750 kn ), at a closure of approximately 200 mm , whereafter there was rapid load shedding , in the region &# 34 ; e &# 34 ; of the graph , as the timber failed in compression . referring again to fig5 and 7 , it is believed that the dimension 86 should not exceed a value of about 60 mm for cup - shaped members having a thickness of about 1 , 6 mm . in practice , when the tube is pressurised through the valve 56 , water pressure acts between the wall of the tube 12 and the side walls 60 of the cup - shaped members and forces the side walls inwardly . the side walls 60 are pressed against and clamp the ends of the timber elements during initial pressurisation and before inversion of the cup - shaped members , and this reduces the ease with which the timber elements can be driven out of the tube as the bases 58 of the cup - shaped members move apart from one another . in order to give a sufficient range of prop extension during preloading , it is expected that the dimension 86 will normally not be less than about 30 mm . fig1 illustrates a fourth embodiment of prestressing device 80 in which there is only one cup - shaped member 82 . the upper end of the tube 12 is closed by a circular plate 84 and the cup - shaped member 82 , similar in all respects to the cup - shaped members 54 of fig5 is welded in position in the tube adjacent the plate . a valve 86 , similar to the valve 56 , is screwed into a socket 88 in the side wall of the tube 81 . in operation of the embodiment of fig1 , internal pressurisation of the tube through the valve 86 drives the base of the cup - shaped member away from the plate 84 with the central region 90 of the base remaining generally parallel to the plate . a timber element 92 press - fitted into the lower end of the tube is driven out of the tube to extend the prop . the plate 84 may also deform during pressurisation , depending on its thickness . in fig1 it will be appreciated that the plate 84 will bear directly on the hanging wall of the mine working although it would of course be possible to provide a transverse headboard on the plate which would contact the hanging wall and provide a real coverage . it will also be appreciated that with a single cup - shaped member , the range of prop extension on installation will be reduced compared to the earlier embodiments employing two cup - shaped members in opposition to one another . reference is now made to fig1 and 12 which illustrate the valve 16 , 56 , 86 used in the embodiments described above . the valve has a unitary valve body 100 of glass - reinforced nylon , and a flap closure 102 . the valve body has an inner end 104 formed with an annular groove 106 , a portion 108 formed with an external thread of small pitch , a portion 110 which is hexagonal in cross - section , and an outer end portion 114 consisting of a head 116 and an annular groove 118 . a passage 120 extends through the valve body 100 from one end to the other . the flap closure 102 is made of a resilient grade of plastics material , typically nylon , and has a split ring 122 which can be prised open and located in the annular groove 106 at the inner end of the valve body 100 . attached to the ring 122 by an integral filament 124 is a flap 126 having a base section 128 and a planar closure section 130 which is joined to the base section 128 by a thin web 132 . the thinness of the web 132 allows the section 130 to pivot relative to the base section 128 as indicated by the arrow 134 . when the flap closure is mounted on the valve body with the ring 122 located in the groove 106 , the filament 124 locates in a notch 135 in the end 104 . the threaded portion 108 of the valve body is threaded tightly and in sealing fashion into an internally threaded socket 136 carried by the wall of the tube 12 . tight engagement is facilitated by the hexagonal section portion 110 which can be gripped with a spanner or like tool . when the tube is to be internally pressurised the high pressure connector of the high pressure pump or pressure intensifier is then engaged with the outer end portion 114 of the valve body . the high pressure connector is typically of a known type having an undercut flange which can be slid , by relative transverse movement between the connector and the portion 114 , into the groove 118 so as to engage behind the head 116 . after high pressure pumping has been completed , the high pressure pump connector is detached from the portion 114 by slipping it in the opposition direction . during pumping the water causes the closure section 130 of the flap closure 102 to pivot to an open position to admit the water into the tube 12 . after pumping the internal pressure of the water pivots the section 130 to a closed position in which it seats on the inner end face 140 of the valve body and prevents loss of internal pressure . the illustrated valve is of simple and economical construction . an advantage of the illustrated construction arises from the fact that even if the projecting portions of the valve body are inadvertently broken off , for instance by a hard , transverse impact or by blasting at the mining face , the flap closure 102 is protected and will remain in its seated position to prevent pressure loss . this is considered to be advantageous compared to more sophisticated one - way valve designs which incorporate internal spring loaded valve closures and in which the internal sealing components may be destroyed or fly free in the event of exposed portions of the valve being damaged by a blow or by the effects of blasting at the face . referring again to fig1 and 12 , it will be seen that the valve body also includes a portion 112 which is formed with an external thread of greater pitch than the portion 108 . the portion 112 may be engaged by a threaded connector in situations where a settable grout is used to pressurise the tube instead of water . the threaded connector will typically be carried at the end of a hose extending from a grout pump . the threaded portion 112 also provides the facility for a two - stage pressurisation in which grout is first pumped into the tube under relatively low pressure and water is then pumped into the tube under relatively high pressure . in cases where pressurisation is by water only , the threaded portion 112 may be omitted . as illustrated by fig8 the tube 12 may have a carrying handle 150 welded to it over the valve . this protects the valve against breakage should the prop fall over . it also provides protection for the valve if the prop is rolled over the ground or footwall prior to installation . a handle of the illustrated type can be provided on the tube of any of the embodiments described above . in each of the embodiments described above , the tube 12 may also be provided with hooks or other suspension points by means of which blast barricades can be suspended from the prop . during pressurisation of the tube in each embodiment , and before the prop is extended into contact with both the footwall and the hanging wall , the upper end of the prop may be lightly wedged in place to prevent the prop from toppling over . this can be achieved in practice simply by wedging a rock or the like between the upper end of the prop and the hanging wall . the rock will then be ejected sideways as preload is applied or will be crushed . it will be appreciated that many modifications may be made within the scope of the invention . for instance , in the embodiment of fig5 and 10 , a circumscribing , channel - shaped depression is provided about the central region of the base . the depression assists in causing the central region of the base to move , when the base is deformed , so as to remain normal to the axis of the tube . however in other embodiments , this objective may be achieved in other ways , possibly by weakening the periphery of the base so to induce preferential deformation at that location . | 4 |
referring now to the figures and in particular to fig1 and 2 , which shows one embodiment of the training apparatus 10 utilized by an individual to improve his strokes in racket games such as tennis , squash or the like . the training apparatus includes a frame 12 consisting of two elongated vertical members 14 and 16 disposed in an upright position and having a curved portion 16 and 18 , respectively , at the upper end thereof . two additional vertical members 20 and 22 are provided forward of members 14 and 16 . vertical members or legs 20 and 22 are preferably much shorter than members 14 and 16 . the upper end of members 20 and 22 are provided with a hook - shaped retaining member 24 and 26 whose function will be discussed shortly . horizontal support braces 28 , 30 , 32 and 34 rigidly support the vertical members 14 , 16 22 and 24 to form a rigid foundation . a rebound surface 36 extends horizontally between curved portions 16 and 18 of the vertical members 14 and 16 and is affixed thereto in a conventional manner . a flexible member 38 is affixed to the rebound surface along essentially its entire length in a conventional manner . it extends longitudinally along the frame and is retained by retaining members 24 and 26 as they pass through the eyelets 40 and 42 provided in the flexible member 38 . the flexible member 38 may be fabricated of a heavy canvas cloth material capable of standing the impact that will be explained hereinafter . this material may be manufactured of a relatively durable cloth or tightly woven netting . also suitable would be a reinforced plastic or similar material . it is also to be noted that the rebound surface may consist of a rigid material such as wood or steel or it may also be fabricated from a resilient material such as hard rubber or the like . the curved portion 16 and 18 of vertical members 14 and 15 may also be fabricated from a resilient material if desired . in the embodiment shown in fig1 and 2 the rebound surface 36 consists of a cylindrically shaped rod 44 which has the flexible member 38 affixed thereto in a conventional manner . the rod 44 is retained in the curved portion 16 and 18 at the distal end thereof by any conventional means such as , for example , by a hollow circular shaped opening 46 and 48 provided at the distal end of curved portions 16 and 18 . the flexible member 38 may be pulled rearwardly towards vertical members 14 and 15 with the aid of hook - shaped members 50 , 52 , 54 and 56 which holds the flexible member in a relatively taut position . in fig2 hook - shaped retaining members 52 and 54 are not utilized thereby providing for a different return angle , speed and timing of the returned ball . a ball 58 being struck by a racket at point 60 will travel in the direction of arrow 62 along the path 64 indicated by the broken line . the ball will impact the flexible member 38 and because of the sloped portion thereof will move in an upwardly direction until its force can be absorbed by the rebound surface 36 . the flexible member or cloth 38 will absorb a great deal of momentum ( kenetic energy ) of the ball when it impinges thereon with the remaining energy capable of being absorbed by the rebound surface 36 . the ball will then follow the return path 66 shown by the smaller broken line and will strike a second rebound surface 68 where it will rebound to the general area of impact 60 where an individual may strike the ball again and keep it in play again and again , thereby providing the opportunity for the individual to improve his skill . in the alternative embodiments shown in fig3 and 4 , the frame 70 includes two rear vertical members 72 and 74 which are provided with curved portions 76 and 78 at the upper ends thereof . a rebound surface 80 having a flexible material 82 affixed thereon is affixed at the distal ends of the curved portions 76 and 78 in a conventional manner . the other end of flexible material is provided with a pair of eyelets 84 and 86 which are placed over retaining pegs 88 and 90 provided in the two forward vertical members 92 and 94 of the frame 70 . the forward vertical members 92 and 94 are rigidly affixed to the rearward vertical members 72 and 74 by means of horizontal support members 95 , 96 , 97 and 98 thereby forming a rigid frame whose support pieces provide a different angle of incline of the flexible member 82 . flexible member 82 is maintained in a relatively taut position when the eyelets 84 and 86 of the flexible material 82 is retained by the pegs 88 and 89 at the end of vertical members 92 and 94 . a ball struck by a racket at impact point 60 will follow the direction of arrow 100 and follow the path 102 shown by the broken line . as shown the ball will strike or impinge upon the flexible material 82 and have its major portion of momentum absorbed thereby and be caused to move in an upwardly direction towards the rebound surface 80 whereupon it will be deflected outwardly in the direction of arrow 104 following path 106 where it may be struck by an individual again . thereby an individual may keep the ball in play and thus continue to practice and improve his form and skill . an alternate embodiment is shown in fig5 wherein the front and rear vertical members are fabricated in a unitary piece 110 and 112 and has therebetween a reinforcing member 114 which functions to maintain members 110 and 112 in a rigid fixed position while providing the angle support member so that the frame 116 is maintained at the desired angle . a curved portion 118 and 120 is provided at the upper end of members 110 and 112 . a support member 122 has a flexible member 124 affixed thereon in a conventional manner and is affixed to the distal ends of curved portions 118 and 120 of vertical members 110 and 112 . the flexible member 124 extends downwardly where it terminates in a rebound surface 126 which is rotatably mounted , in a conventional manner , to the upper end of the vertical portion 128 and 130 of members 110 and 112 . by adjusting the angle of rebound member 126 the path of the return ball 58 can be controlled . striking ball 58 at impact point 60 causes the ball to move in the direction of arrow 132 following the broken line path 134 until it impacts the flexible member 124 wherein the flexible member absorbs the kenetic energy imparted to the ball when it is hit by a racket ( not shown ) and thereby causes the ball 58 to fall in a downwardly direction and strike rebound surface 126 . upon hitting rebound surface 126 the ball will follow path 136 and move in the direction of arrow 138 where it returns to the general area of the impact point so that an individual may keep the ball in continuous play . it is to be noted that in this embodiment as well as the others that a major portion of the kenetic energy is absorbed at the point of impact with the flexible material . the rebound surface generally provides for the angle of return of the ball to the initial impact point , where the ball is struck by the racket . in the embodiment shown in fig6 the frame 140 is also manufactured from a tubular u - shaped member 142 and 144 which is reinforced and held in position by horizontal member 146 . a curved portion 148 and 150 is provided on the upper portion of members 142 and 144 with the distal ends being adapted to receive rebound member 152 which has affixed therein a flexible material 154 . a retaining member 156 and 158 is used to maintain flexible member 154 in a rearward most position to provide an absorbing means for the kenetic energy imparted to a ball . the flexible member 154 is extended in a downwardly direction where it is retained on retaining pegs 160 and 162 which are adapted to receive eyelets 164 and 166 provided in the corners of flexible material 154 . striking a ball 168 such as a golf ball toward the frame 140 which is disposed upon the ground and cause the golf ball to move in the direction of arrow 170 along the path 172 where it can strike the rebound surface 152 wherein it will return in the direction of arrow 174 and path 176 . thus , an individual wanting to practice golf strokes may readily use an apparatus as disclosed herein . a still further embodiment of the training apparatus according to the principles of the present invention is disclosed in fig7 . the apparatus 10 includes a tubular frame member 180 and 182 which are provided with a curved portion 184 and 186 , respectively , at the upper ends thereof . the lower end of members 180 and 182 is provided with a telescoping member 188 and 190 , respectively , which permits the length of the frame to be extended in the longitudinal direction as will be explained hereinafter . the telescoping members 188 and 190 are provided with thumb screws 192 and 194 which enables the telescoping members to be tightened in its fully extended position . preferably the frame members 180 and 182 are fabricated of tubular material . a u - shaped cross member 196 rigidly supports members 180 and 182 in a hollow tubular portion 198 and 200 provided at the distal ends thereof . the hollow tubular portion is provided with thumb screws 202 and 204 to enable the members 180 and 182 to be fixed in position ( see fig8 ). the cross member is preferably fabricated in three portions , a central portion 206 and a pair of end portions 208 and 210 as shown in enlarged detail in fig8 . the end portions 208 and 210 are rotatably fixed to the central portion 206 in a conventional manner . the ends of the central portion 206 are provided with a spring loaded detent mechanism 212 and 214 which is adapted to cooperate with a disc - shaped portion 216 and 218 that has dispersed proximate the circumference thereof a plurality of holes 220 and 222 which coooperates with the detent mechanism to permit the members 180 and 182 to be disposed at various angles relative to the horizontal ground support surface 224 on which the training apparatus is mounted . an inverted v - shaped member 226 and 228 is affixed , preferably by welding , to the central portion 206 of the cross member 196 . the ends of members 226 and 228 have hollow ends therein and are provided with thumb screws 230 , 232 , 234 , and 236 so that they may readily retain legs 238 , 240 and 242 therein . these legs may be made adjustable . thus , the support portion of the frame is capable of maintaining the frame at a plurality of angles from the horizontal depending on the position of the detent mechanisms 212 and 214 . a rebound surface 246 extends horizontally across the width of the frame 178 and is preferably affixed to the distal ends of curved portions 184 and 186 of frame members 180 and 182 by means of a hollow tubular shaped portion 248 and 250 which fits over curved portions 184 and 186 and is held thereto by means of thumb screws 252 and 254 . portions 248 and 250 are preferably welded to the rebound surface 246 which is preferably made from a hollow rectangular shaped tube which is slit longitudinally along one surface . ( see fig8 a ) the slit 256 is preferably made thick enough to receive the flexible material 258 therein . the flexible material is folded over and stitched or welded back on itself providing a looped portion 262 . a rod 260 is inserted in the looped portion 262 and then the rod and loop portion is slipped into the open area of the rebound surface retaining it therein . the flexible material 258 is permitting to extend loosely across the width of the frame . at the corners of the flexible material a pair of eyelets 264 and 266 are provided . the eyelets 264 and 266 cooperate with hooked retaining members 268 and 270 provided in the ends of telescoping members 188 and 190 . adjusting telescoping members 188 and 190 are adjusted to their full extent causing the flexible member 258 to be maintained in a relatively taut position . the flexible material may be provided with indicia 274 thereon to simulate the normal markings found on a playing court . by forcing an individual to return the ball to an area as indicated on the flexible material , his accuracy will be improved and when transferring his skills to a playing court he will find that the return strokes are generally directed to the same limited area as defined by the indicia on the flexible material . the flexible material 258 is provided with an extending portion 276 which extends downwardly toward the support surface and fills the space between the end of the frame and the support surface so that a ball when hit improperly will be deflected downwardly and not be required to be chased long distances . proximate the curved portions 184 and 186 of frame members 180 and 182 a retaining device 278 and 280 , suitably a spring member , is affixed . the retaining device 278 and 280 cooperate with eyelets 282 and 284 to pull the flexible member rearwardly to form an overhanging portion which cooperates with the rebound surface . thus , a ball striking the flexible member 258 will have its kenetic energy mostly absorbed thereby and will be caused to move upwardly moving around the curved portion of the flexible member where it can strike the rebound surface 246 whereupon it will slowly move down the flexible material leaving the end thereof and striking a second rebound surface 286 , suitably a wooden plank or a hard support surface , which is also used to support the training apparatus . a ball striking this second rebound surface will bounce upwardly toward the individual that sent the ball toward the training apparatus . thus , the ball may be kept in continual motion as explained in the earlier embodiments . a wind screen or shield 288 is affixed by any conventional means such as an eyelet and string to the curved portion 184 and 186 of frame members 180 and 182 . the wind shield hangs downwardly deflecting any wind from impinging upon the rear or backside of flexible material 258 thereby preventing the loosely fitting flexible material from moving forward and causing a ball thereon not to have its kenetic energy absorbed thereby . thus , the present invention may be readily utilized both indoors and outdoors . when the training apparatus is utilized in a small confined area , the retaining device 278 and 280 is connected to eyelets 282 and 284 , thus requiring the telescoping portions 188 and 190 of members 180 and 182 to be placed in its shortest or most upwardly position and affixed therein . when the training apparatus is used without the retaining the devices telescoping portions are extended as far as possible causing the flexible member 258 to become taut as is shown in fig9 . the training apparatus is shown tilted in its most forward detent position in which an individual 290 striking a ball , preferably a tennis ball 58 , with a racket 292 will follow the path shown by arrows 94 until it impinges upon flexible material 258 whereupon it moves to an upward direction until it strikes rebound surface 246 whereupon it follows the path shown by arrows 296 until it rebounds off the support surface 224 and returns to the vicinity of the individual 290 that struck the ball , thereby permitting him to repeat his action and continue the ball in motion , thus giving him practice in returning the tennis ball . the ball when it impinges upon the flexible material will lose most of its kenetic energy and will be delayed in time as it moves upwardly toward the rebound surface 246 . the time it takes to return to the individual will approximate the time it would take on a regular court for a second player to return the ball hit to him , thereby providing an individual with a proper time relationship and permitting him to adjust in the same amount of time that would normally occur while playing on a regulation court . this enables an individual to practice both his forehand and backhand each time positioning himself in the correct position . fig1 shows the training apparatus in a second position which permits an individual 290 to strike a ball 58 with a racket 292 toward the training apparatus . the ball will follow the path shown by arrows 298 where it will impinge upon the flexible material 258 with the majority of its kenetic energy absorbed thereby . it will then move upwardly and strike rebound surface 246 and be deflected toward the individual in the path shown by arrows 300 . here again , an individual can keep the ball returning to the training apparatus and enables an individual to practice a volley which would occur when playing on a conventional court . fig1 shows the training apparatus in its third detent position wherein an individual 290 may strike a tennis ball 58 with a racket 292 causing the ball to travel in a path shown by arrows 302 until it impinges upon the flexible material 258 where it travels towards the rebound surface 246 wherein the ball will rebound along the path shown by arrows 304 toward the individual that imparted the energy to the ball initially . thus , an individual may practice his serve and smash and practice his return of his serve thereby improving his skill . it is to be noted that the function of the curved portions 184 and 186 may be accomplished by substantially straight elements pivotally connected to the tubular members 180 and 182 of the frame by a conventional pivoting means wherein the pivots may be locked to maintain the straight elements at the desired angle equivalent to the curved portions 184 and 186 . hereinbefore has been disclosed a training apparatus for racket sports which may be utilized in a relatively confined area . the apparatus may be utilized by an individual to keep a tennis ball or the like in continuous motion by striking it toward the training apparatus and returning it thereto time after time improving his form , ability , stamina and general agility . it should be understood that various changes in the details , materials , arrangement of parts and operating conditions which have been herein described and illustrated in order to explain the nature of the invention may be made by those skilled in the art within the principles and scope of the invention . | 0 |
the preferred embodiment herein described is not intended to be exhaustive or to limit the invention to the precise form disclosed . it is chosen and described to best explain the invention so that others , skilled in the art to which the invention pertains , might utilize its teachings . referring now to the drawings in greater detail , fig1 shows a perspective view of the present invention 1 . the towing vehicle hitch is a conventional hitch having a horizontal portion 4 attached to a vertical portion 2 which is , in turn , attached to a towing vehicle ( not shown ) by any conventional method . a conventional trailer ball 3 is secured to the horizontal portion 4 in any conventional manner . since the towing vehicle hitch and the method of attachment are conventional no further description is necessary . a first camera 5 is secured to the vertical portion 2 of the towing vehicle hitch and is pointed rearwardly at the ball 3 . this camera will allow the operator to view the hitch and determine whether the operator should move the towing vehicle right or left in order to align with the corresponding hitch on the trailer . however , the single camera gives basically a two dimensional view and the operator will still have some difficulty in aligning the vehicles in order to couple the towing vehicle hitch and the trailer hitch due to a lack of perspective . in order to alleviate this difficulty a second camera 6 is mounted on the horizontal portion 4 of the towing vehicle hitch by any conventional method . the second camera is mounted approximately horizontally of the portion 4 of the towing vehicle hitch and the ball 3 . the view from the second camera along with the view from the first camera will provide the operator with a perspective view to align the towing vehicle hitch with the trailer hitch . fig2 shows a screen 8 mounted within a vehicle dashboard 7 . it should be noted that while the screen is shown as being mounted within a dashboard this is not critical . the screen could be mounted on the exterior of the dashboard and secured thereto in any conventional manner . controls 11 are mounted adjacent to the screen and will control various aspects of the screen such as brightness , contrast , etc . conventional wiring or a wireless camera will be used to electronically connect the cameras 5 , 6 to the screen 8 . the screen , as shown in fig2 , is divided by an imaginary dotted line 11 to indicate two portions . the view of camera 5 could be shown on the left hand side of the screen 9 and the view from the camera 6 could be shown on the right hand side 10 of the screen . this would give the operator views from both cameras simultaneously . it should be noted that the side of the screen showing camera 5 and the side showing camera 6 have been selected randomly and if so desired the view form camera 5 could be shown on the right side 10 of the screen and the view from camera 6 could be shown on the left side 9 of the screen without departing from the scope of the invention . if an operator found the views from both cameras at the same time to be confusing he could use one of the controls 11 to switch from showing both cameras to showing first camera 5 and then switching to camera 6 . the controls would allow him to switch from camera 5 to camera 6 manually or the controls could allow the screen to switch automatically from one camera to the other . in addition , the controls could allow the operator to select a timing sequence . for example , a timer could allow the view from camera 5 to stay on the screen for a selected period of time , then switch to the view from camera 6 for a selected period of time . the operator would be able to select the amount of time the views would appear on the screen , and then the operation would become automatic . although the trailer coupler and the method of using the same according to the present invention has been described in the foregoing specification with considerable details , it is to be understood that modifications may be made to the invention which do not exceed the scope of the appended claims and modified forms of the present invention done by others skilled in the art to which the invention pertains will be considered infringements of this invention when those modified forms fall within the claimed scope of this invention . | 1 |
referring to fig1 , an additive manufacturing machine 10 includes a workspace or chamber 12 that supports an energy transmitting device 18 and a support 14 on which a part 16 is supported during fabrication . in this example , the energy transmitting device 18 emits a laser beam 20 that melts material 24 deposited by a material application device 22 . the example material 24 is a metal powder that is applied in a layer over the support 14 and subsequent layers to produce a desired configuration of the part 16 . the laser beam 20 emits directs energy that melts the powder material in a configuration that forms the desired part dimensions . the additive manufacturing process utilizes material 24 that is applied in layers on top of the support 14 . selective portions of the layers are subsequently melted by the energy emitted from the laser beam 20 . the additive manufacturing process proceeds by melting subsequent layers of powdered material 24 that are applied to the part 16 to form the desired part configuration . as appreciated , the energy focused on the top layer of the part 16 generates the desired heat to melt and then solidify portions of the powdered metal to form the desired part configuration . the repeated localized heating and cooling of the powdered material 24 and the part 16 can result in the buildup of undesired stresses within the part 16 . stresses within the part 16 may result in undesired cracking or weaknesses within the completed part and therefore are to be avoided . the example additive manufacturing machine 10 includes a plurality of sensors 26 that are disposed within the support 14 . in this example , the sensors 26 are strain gauges that measure stress built up within the part 16 . during operating and fabrication of the part 16 , the strain gauges 26 transmit information to a controller 28 that are indicative of the condition and specifically the stress condition of the part 16 . the stress measurements that are provided by the strain gauges 26 are ongoing during the entire fabrication of the part 16 . the ongoing measurement of the stress within the part 16 provides for the detection of undesired rises in stress levels in the part 16 . the example additive manufacturing machine 10 further includes heating elements 30 for heating the chamber 12 and a cooler 34 for quickly cooling the workspace 12 . the heating elements 30 and cooler 34 provide for the implementation of a stress relieving heat treat process . in response to the controller 28 receiving signals from the strain gauges 26 of a stress built up within the part 16 that are above the desired stress level , the fabrication process can be paused to allow for a stress relieving process to be performed on the part 16 . referring to fig2 , in response to a detected stress within the part 16 during fabrication , the fabrication process is paused and the chamber 12 is readied for a stress relieving process . in this example , the stress relieving process includes a heat treat process where the part 16 is heated then cooled according to a predetermined temperature and period . as is appreciated , the heat treat process utilizes heat to transform material within the part into a more consistent composition . many heat treatment processes are known and one such process includes the heating of a part to a level to which the material will control the heating and cooling of the part to control the rate of fusion and the rate of the cooling within the microstructure of the material comprising the part 16 . as appreciated , many known heat treating processes may be utilized within the chamber 12 to provide desired properties in the completed part 16 . the example heat treating process includes heating of the part 16 in an inert atmosphere within the same chamber 12 in which part fabrication occurs . moreover , the example heat process includes heating the chamber 12 to a specific temperature and then cooling the part as is desired within a given period . in this example , the chamber 12 includes the electric resistant heaters 30 embedded in the walls of the chamber 12 and a cooler 34 mounted to provide cooling air into the chamber 12 . alternatively , inductive heaters and other heat sources may be utilized . before the heat treatment process is begun , the chamber 12 is filled with an inert gas . in this example , argon gas 44 is utilized to surround the part 16 . a cover 38 is moved to a closed position to protect the energy transmitting device 18 from the heat and environment within the chamber 12 during the heat treat process . the heat treat process then begins by heating the chamber 12 , and thereby the part through the use of the electric resistant heaters 30 to generate heat as indicated by arrow 32 . a feature of the example process provides for maintaining the part 16 on the support 14 in the same location as it sits during fabrication . accordingly , the part 16 remains in place during the heat treatment process such that fabrication is paused only briefly and the part 16 does not need to be removed from its location within the chamber 12 . in this example , the part 16 is heated to a temperature determined to relieve stresses within the part 16 . at all times during the heat treatment process the strain gauges 26 measure stresses within the part 16 and communicate that information to the controller 28 . the controller 28 processes this information and continues with the heat treatment process as it monitors the stresses within the part 16 . the controller 28 may utilize the stress information obtained from the strain gauges 26 to govern operation of the heat treatment process . the controller 28 may also implement a heat treatment routine that is defined to heat the part 16 to a desired temperature to cool that part as part of a predefined stress relieving heat treatment process . in each of the instances , the controller 28 may utilize information obtained from the strain gauges 26 . referring to fig3 , once the part 16 has been heated to a sufficient temperature to provide the desired stress relief , the part 16 is cooled by a cooler 34 that drives cooling air 36 into the chamber 12 to thereby cool the part 16 to a desired temperature required to provide the desired stress relieving function . it should be noted that in all instances , the part 16 remains on the support 14 in the same position in which fabrication had begun . by maintaining the part 16 within the chamber 12 , the specific position is maintained and a secondary set up process is not required . moreover , overall part fabrication cycle time is reduced . upon completion of the cooling operation , strain and stresses within the part 16 are measured by the strain gauges 26 that remain within the chamber 12 and continually provide information indicative of stresses within the part 16 to the controller 28 . the gauges 26 will indicate that strains and stresses within the part 16 are now within a desired range and fabrication can be restarted . however , if the strain gauges 26 continue to read stress within the part 16 above a desired limit the heat treatment process can be repeated or alternatively , other measures can be instituted to relieve stresses within the part 16 . referring to fig4 , upon an indication that stresses within the part 16 are now within acceptable ranges a measurement can be made by a measurement device 40 supported within the chamber 12 . this measurement can confirm the parts surface 42 parameters are within those desired for a return to fabrication for the part . the measurement operation can utilize any gauge or system known to provide an indication of the specific part parameters that would be of interest to confirm that re fabrication of the part may begin . in this example , the gauge 40 measures the surface 42 . upon confirmation that the surface 42 is within the desired range and includes desired attributes , the fabrication process can be restarted on the now stress relieved part 16 . the example stress relieving process can then be repeated as is necessary during the fabrication process to prevent excess stress build up within a part . accordingly , the disclosed advanced manufacturing machine and process of stress relieving a part during fabrication provides for a completed part to be fabricated in a reduced time without removal from the process and fabrication chamber 12 . although an example embodiment has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this disclosure . for that reason , the following claims should be studied to determine the scope and content of this invention . | 1 |
reference will now be made in detail to the present embodiments of the present invention , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . in fig2 , which is a block diagram illustrating a data reproducing apparatus according to an embodiment of the present invention , an analog to digital converter ( adc ) 200 , a direct current ( dc ) offset compensator 202 and an adder 204 are the same as adc 100 , dc offset compensator 102 , and adder 104 , respectively , of the conventional data reproducing apparatus of fig1 , and thus descriptions of the operations thereof will be omitted . equalizer 206 and viterbi detector 214 are the same as equalizer 106 and viterbi detector 112 , respectively ; however , certain inputs are provided differently according to the present invention as more specifically set out below . for example , where the structure of the viterbi detector 214 is a pr ( a , b , a ) type , a level error detector 208 initially sets reference values for + and − medium levels and + and − maximum levels , detects the + and − medium levels and the + and − maximum levels from an output signal y k of the equalizer 206 , and obtains an error e k between a reference value and a detected level value y k . where the structure of the viterbi detector 214 is a pr ( a , b , b , a ) type , the level error detector 208 initially sets a reference value for a zero level in addition to reference values for + and − medium levels and + and − maximum levels , detects the zero level , the + and − medium levels and the + and − maximum levels from an output signal y k of the equalizer 206 , and obtains an error e k between a reference value and a detected level value y k . where a target level value , that is , the reference value , is represented by t k , the error value e k is obtained by subtracting the level value y k detected by the level error detector 208 from the target level value t k ( e k = t k − y k ). accordingly , a filter coefficient for the equalizer 206 is obtained through an adaptive process performed by an adaptive processor 210 using equation ( 1 ) such that the error e k is minimized . where w k + 1 is an equalizer filter coefficient obtained after adaptation , w k is an equalizer filter coefficient obtained before adaptation , μ is a coefficient related to an equalizing rate ( e . g ., 0 . 001 ), e k is a level error , and x k is a signal obtained by dc offset compensating an input rf signal before equalization . in this embodiment , an adaptive fir filter coefficient for the equalizer 206 is detected using the level error detector 208 and the adaptive processor 210 , but the present invention can also be applied to a different configuration of detecting a fir filter coefficient of the equalizer 206 . a viterbi level decision unit 212 detects + and − maximum levels , + and − medium levels ( where the viterbi detector 214 is a pr ( a , b , a ) type or a pr ( a , b , b , a ) type ) and a zero level ( where the viterbi detector 214 is a pr ( a , b , b , a ) type ) from the signal y k , which has been fir filtered using a filter coefficient obtained after adaptation , in a similar manner to the operation of the level error detector 208 . the viterbi decision unit 212 obtains averages of each of the detected levels and provides each of the averages as decision levels to the viterbi detector 214 . here , the outputs of the viterbi level decision unit 212 are referred to as corrected decision levels . the viterbi level decision unit 212 is illustrated in fig3 in detail . in fig3 , first through fourth delay units 221 , 222 , 223 and 224 temporarily stores a sample data y k output from the equalizer 206 and output current sample data y k [ t + n ], 1 - sample previous data y k [ t + n − 1 ], 2 - sample previous data y k [ t + n − 2 ] and 3 - sample previous data y k [ t + n − 3 ], respectively . a level detector 230 realized as a comparative logic circuit detects + and − medium levels , + and − maximum levels and a zero level from the outputs of the first , second and third delay units 221 , 222 and 223 and provides + and − medium level enable signals en 1 and en 2 , + and − maximum level enable signals en 3 and en 4 , and a zero level enable signal en 5 to respective first through fifth averagers 251 , 252 , 253 , 254 and 255 . the level detector 230 also provides first and second selection signals sel 0 and sel 1 to a multiplexer ( mux ) 240 . the enable signals en 1 , en 2 , en 3 , en 4 and en 5 can be referred to as first through fifth level decision signals . in other words , when the viterbi detector 214 is a pr ( a , b , a ) type , the level detector 230 determines that zero cross occurs at a point where the product of two consecutive sample data is smaller than zero and detects one of the two samples as a + medium level and the other as a − medium level . where it is determined that three consecutive sample data exceed a predetermined threshold , the level detector 230 detects the central sample data among them as a + maximum level . where it is determined that three consecutive sample data are smaller than the predetermined threshold , the level detector 230 detects the central sample data among them as a − maximum level . where the viterbi detector 214 is a pr ( a , b , b , a ) type , the level detector 230 performs the same process as performed where the viterbi detector 214 is a pr ( a , b , a ) type to detect + and − maximum levels ; determines that zero cross occurs at a point where the product of two consecutive sample data is smaller than or equal to zero and detects sample data having a lower absolute value between the two sample data as a zero level ; determines that zero cross occurs at a point where the product of two consecutive sample data is smaller than or equal to zero , compares the absolute values of the two sample data to each other , detects one sample data having an absolute value equal to or larger than that of the other sample data as a + medium level if the one sample data is larger than zero , detects the one sample data having an absolute value equal to or larger than that of the other sample data as a − medium level if the one sample data is smaller than zero , detects sample data preceding to the two consecutive sample data as a − or + medium level if the latter sample data of the two consecutive sample data is larger than zero , and detects sample data succeeding the compared two consecutive sample data as a − or + medium level if the former sample data of the two consecutive sample data is larger than zero . fig4 is a table showing the + and − medium level enable signals en 1 and en 2 , + mid and − mid , respectively , + and − maximum level enable signals en 3 and en 4 , + max and − max respectively , a zero level enable signal en 5 , zer 0 , and the first and second selection signals sel 1 and sel 0 which are provided by the level detector 230 and the output of the mux 240 , where the viterbi detector 214 of fig2 is a pr ( a , b , a ) type . fig5 is a table showing the + and − medium level enable signals en 1 and en 2 , + mid and − mid , respectively , + and − maximum level enable signals en 3 and en 4 , + max and − max respectively , a zero level enable signal en 5 , zer 0 , and the first and second selection signals sel 1 and sel 0 which are provided by the level detector 230 and the output of the mux 240 , where the viterbi detector 214 of fig2 is a pr ( a , b , b , a ) type . the mux 240 selects one among the outputs d , b , c , and a , corresponding to the first through fourth delay units 221 through 224 , respectively , in response to the selection signals sel 0 and sel 1 provided from the level detector 230 and sends the selected one to the first through fifth averagers 251 through 255 . the first and second averagers 251 and 252 are enabled in response to the respective + and − medium level enable signals en 1 and en 2 . when the viterbi detector 214 is a pr ( a , b , a ) type , the product of two sample data y k [ t + n − 1 ] and y k [ t + n ] is smaller than zero , and the sample data y k [ t + n ] is larger than zero , the first averager 251 averages the outputs y k [ t + n − 1 ] of the second delay unit 222 , which are provided through the mux 240 and determined as the + medium level , and provides the averaged result as a corrected + medium level , and the second averager 252 averages the output y k [ t + n ] of the first delay unit 221 , which is provided through the mux 240 and determined as the − medium level , and provides the averaged result as a corrected − medium level . where the sample data y k [ t + n ] is equal to or smaller than zero , the first averager 251 averages the outputs y k [ t + n ] of the first delay unit 221 , which are provided through the mux 240 and determined as the + medium level , and provides the averaged result as a corrected + medium level , and the second averager 252 averages the output y k [ t + n − 1 ] of the second delay unit 222 , which are provided through the mux 240 and determined as the − medium level , and provides the averaged result as a corrected − medium level . the outputs which are averaged by the first , second , third , fourth and fifth averagers are outputs which are provided sequentially by mux 240 and which are enabled by the enable signals en 1 , en 2 , en 3 , en 4 and en 5 , respectively . when the viterbi detector 214 is a pr ( a , b , b , a ) type , the product of two successive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is equal to or smaller than zero , the absolute value of the sample data y k [ t + n − 1 ] is larger than the absolute value of the sample data y k [ t + n − 2 ], and the latter sample data y k [ t + n − 1 ] of the two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is larger than zero , the first and second averagers 251 and 252 respectively average the outputs y k [ t + n − 3 ] of the fourth delay unit 224 determined as the + medium level and the outputs y k [ t + n − 1 ] of the second delay unit 222 determined as the − medium level , which are provided through the mux 240 , and provide the averaged results as a corrected + medium level and a corrected − medium level , respectively . when the latter sample data y k [ t + n − 1 ] is equal to or smaller than zero , the first and second averagers 251 and 252 respectively average the outputs y k [ t + n − 1 ] of the second delay unit 222 determined as the + medium level and the outputs y k [ t + n − 3 ] of the fourth delay unit 224 determined as the − medium level , which are provided through the mux 240 , and provide the averaged results as a corrected + medium level and a corrected − medium level , respectively . where the product of two sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is equal to or smaller than zero , the absolute value of the sample data y k [ t + n − 2 ] is larger than that of the sample data y k [ t + n − 1 ], and the former sample data y k [ t + n − 2 ] of the two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is larger than zero , the first and second averagers 251 and 252 respectively average the outputs y k [ t + n − 2 ] of the third delay unit 223 determined as the + medium level and the outputs y k [ t + n ] of the first delay unit 221 determined as the − medium level , which are provided through the mux 240 , and provide the averaged results as a corrected + medium level and a corrected − medium level , respectively . where the former data y k [ t + n − 2 ] is equal to or smaller than zero , the first and second averagers 251 and 252 respectively average the outputs y k [ t + n ] of the first delay unit 221 determined as the + medium level and the outputs y k [ t + n − 2 ] of the third delay unit 223 determined as the − medium level , which are provided through the mux 240 , and provide the averaged results as a corrected + medium level and a corrected − medium level , respectively . the third averager 253 is enabled in response to the + maximum level enable signal en 3 . where the three consecutive sample data y k [ t + n − 2 ], y k [ t + n − 1 ] and y k [ t + n ] are larger than a threshold th , the third averager 253 averages the outputs y k [ t + n − 1 ] of the second delay unit 222 , which have been determined as the + maximum level and provided through the mux 240 , and provides the averaged result as a corrected + maximum level . the fourth averager 254 is enabled in response to the − maximum level enable signal en 4 . where the three consecutive sample data y k [ t + n − 2 ], y k [ t + n − 1 ] and y k [ t + n ] are smaller than the threshold th , the fourth averager 254 averages the outputs y k [ t + n − 1 ] of the second delay unit 222 , which have been determined as the − maximum level and provided through the mux 240 , and provides the averaged result as a corrected − maximum level . the fifth averager 255 operates only where the viterbi detector 214 is a pr ( a , b , b , a ) type and is enabled in response to the zero level enable signal en 5 . where the product of the two sample data y k [ t + n − 1 ] and y k [ t + n ] is equal to or smaller than zero , and the absolute value of the sample data y k [ t + n ] is equal to or larger than that of the sample data y k [ t + n − 1 ], the fifth averager 255 averages the outputs y k [ t + n − 1 ] of the second delay unit 222 , which have been determined as the zero level and provided through the mux 240 , and provides the averaged result as a corrected zero level . where the absolute value of the sample data y k [ t + n ] is smaller than that of the sample data y k [ t + n − 1 ], the fifth averager 255 averages the outputs y k [ t + n ] of the first delay unit 221 , which have been determined as the zero level and provided through the mux 240 , and provides the averaged result as a corrected zero level . fig6 is a flowchart illustrating a method of detecting + and − medium levels from the output value of the equalizer 206 where a viterbi detector 214 of a pr ( a , b , a ) type and a run length limited ( rll ) ( 1 , 7 ) code are used . the method is performed by the level detector 230 of fig3 . here , the minimum run length of the rll code is represented by “ d (= 1 )”, and the maximum thereof is represented by “ k (= 7 )”. in operation s 101 , it is determined whether the product of two consecutive sample data y k [ t + n − 1 ] and y k [ t + n ], which are provided from the first and second delay units 221 and 222 , is smaller than zero . if it is determined that the product is smaller than zero , one ( here , the sample data y k [ t + n − 1 ]) of the two sample data is selected , and it is determined whether the selected sample data is larger than zero , in operation s 102 . here , sample data larger than zero is determined as a + medium level , and sample data smaller than zero is determined as a − medium level . in other words , where the sample data y k [ t + n − 1 ] is larger than zero , the sample data y k [ t + n − 1 ] output from the second delay unit 222 is detected as the + medium level , and the sample data y k [ t + n ] output from the first delay unit 221 is detected as the − medium level , in step s 103 . then , in operation s 104 , a + medium level enable signal en 1 and a − medium level enable signal en 2 are output . if it is determined that the sample data y k [ t + n − 1 ] is not larger than zero in operation s 102 , the sample data y k [ t + n − 1 ] output from the second delay unit 22 is detected as the − medium level , and the sample data y k [ t + n ] output from the first delay unit 221 is detected as the + medium level , in operation s 105 . then , in operation s 106 , the + medium level enable signal en 1 and the − medium level enable signal en 2 are output . where the product of the consecutive two sample data is equal to or larger than zero in operation s 101 , or where the operation s 104 or s 106 is completed , the operations s 101 through s 106 are repeatedly performed through operation s 107 to detect + and − medium levels from a next sample . fig7 is a flowchart illustrating a method of detecting + and − maximum levels from the output value of the equalizer 206 where a viterbi detector 214 of a pr ( a , b , a ) type and a run length limited ( rll ) ( 1 , 7 ) code are used , or where a viterbi detector 214 of a pr ( a , b , b , a ) type and a run length limited ( rll ) ( 2 , 10 ) code are used . the method is performed by the level detector 230 of fig3 . in operation s 201 , three consecutive sample data y k [ t + n − 2 ], y k [ t + n − 1 ] and y k [ t + n ] output from the first through third delay units 221 through 223 are checked whether they are all larger than a threshold th . if the three successive sample data are all larger than the threshold th , the central sample data y k [ t + n − 1 ] output from the second delay unit 222 , among the three consecutive data y k [ t + n − 2 ], y k [ t + n − 1 ] and y k [ t + n ], is detected as a + maximum level in operation s 202 . then , in operation s 203 , a + maximum level enable signal en 3 is output . if it is determined that any one of the three consecutive sample data y k [ t + n − 2 ], y k [ t + n − 1 ] and y k [ t + n ] is smaller than the threshold th in operation s 201 , it is determined in operation s 204 whether the three consecutive sample data y k [ t + n − 2 ], y k [ t + n − 1 ] and y k [ t + n ] are all smaller than the threshold th . if it is determined that the three successive sample data are all smaller than the threshold th , the central sample data y k [ t + n − 1 ] output from the second delay unit 222 is detected as the − maximum level in operation s 205 . then , in operation s 206 , a − maximum level enable signal en 4 is output . where it is determined that one of the three consecutive sample data y k [ t + n − 2 ], y k [ t + n − 1 ] and y k [ t + n ] is equal to or larger than the threshold th in operation s 204 , or where the operation s 203 or s 206 is completed , the operations s 210 through s 206 are repeated through operation s 207 to detect + and − maximum levels from a next sample . fig8 is a flowchart illustrating a method of detecting a zero level from the output value of the equalizer 206 where the viterbi detector 214 of a pr ( a , b , b , a ) type and a run length limited ( rll ) ( 2 , 10 ) code are used . the method is performed by the level detector 230 of fig3 . in operation s 301 , two consecutive sample data y k [ t + n − 1 ] and y k [ t + n ] output from the first and second delay units 221 and 222 are checked to determine whether the product of the two consecutive sample data y k [ t + n − 1 ] and y k [ t + n ] is equal to or smaller than zero . if the product is equal to or smaller than zero , the absolute values of the two consecutive sample data y k [ t + n − 1 ] and y k [ t + n ] are compared in operation s 302 . in more detail , where the absolute value of former sample data y k [ t + n − 1 ] between the two consecutive sample data y k [ t + n − 1 ] and y k [ t + n ] is smaller than or equal to the absolute value of the latter sample data y k [ t + n ], the sample data y k [ t + n − 1 ] output from the second delay unit 222 is detected as a zero level in operation s 303 . then , in operation s 304 , a zero level enable signal en 5 is output . where it is determined that the absolute value of the latter sample data y k [ t + n ] is smaller than that of the former sample data y k [ t + n − 1 ] in operation s 302 , the sample data y k [ t + n ] output from the first delay unit 221 is detected as a zero level in operation s 305 . then , in operation s 306 , a zero level enable signal en 5 is output . where the product of the two consecutive sample data y k [ t + n − 1 ] and y k [ t + n ] is larger than zero in operation s 301 , or where the operation s 304 or s 306 is completed , the operations s 301 through s 306 are repeated through operation s 307 to detect a zero level from a next sample . fig9 is a flowchart illustrating a method of detecting + and − medium levels from an output value of the equalizer 206 where a viterbi detector 214 of a pr ( a , b , b , a ) type and a run length limited ( rll ) ( 2 , 10 ) code are used . the method is performed by the level detector 230 of fig3 . in operation s 401 , two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] output from the second and third delay units 222 and 223 are checked to determine whether the product of the two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is equal to or smaller than zero . if the product is equal to or smaller than zero , the absolute values of the two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] are compared with each other in operation s 402 . where the one sample data of the two consecutive sample data , whose absolute value is equal to or larger than the absolute value of the other of the two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is larger than zero , the one sample data is detected as a + medium level . where the one sample data of the two consecutive sample data , whose absolute value is equal to or larger than the absolute value of the other of the two consecutive sample data is smaller than zero , the one sample data is detected as a − medium level . where the sample data having a smaller absolute value is larger than zero , the sample data is detected as a + medium level . alternatively , where the sample data having a smaller absolute value is smaller than zero , the sample data is detected as a − medium level . in more detail , where the latter sample data y k [ t + n − 1 ] between the two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is larger than zero in operation s 403 , the latter sample data y k [ t + n − 1 ] output from the second delay unit 222 is detected as the + medium level , and sample data y k [ t + n − 3 ] output from the fourth delay unit 224 preceding the compared two sample data is detected as the − medium level , in operation s 404 . then , in operation s 405 , a + medium level enable signal en 1 and a − medium level enable signal en 2 are output . where the latter sample data y k [ t + n − 1 ] between the compared two sample data is not larger than zero in operation s 403 , the latter sample data y k [ t + n − 1 ] output from the second delay unit 222 is detected as the − medium level , and the sample data y k [ t + n − 3 ] output from the fourth delay unit 224 preceding the compared two sample data is detected as the + medium level , in operation s 406 . then , in operation s 407 , a + medium level enable signal en 1 and a medium level enable signal en 2 are output . where the former sample data y k [ t + n − 2 ] between the compared two consecutive sample data y k [ t + n − 2 ] and y k [ t + n − 1 ] is larger than zero in operation s 408 , the former sample data y k [ t + n − 2 ] output from the third delay unit 223 is detected as the + medium level , and sample data y k [ t + n ] output from the first delay unit 221 succeeding the compared two sample data is detected as the − medium level , in operation s 409 . then , in operation s 410 , a + medium level enable signal en 1 and a − medium level enable signal en 2 are output . where the former sample data y k [ t + n − 2 ] is not larger than zero in operation s 408 , the former sample data y k [ t + n − 2 ] output from the third delay unit 223 is detected as the − medium level , and sample data y k [ t + n ] output from the first delay unit 221 succeeding the compared two sample data is detected as the + medium level , in operation s 411 . then , in operation s 412 , a − medium level enable signal en 2 and a + medium level enable signal en 1 are output . where the product of the two consecutive sample data is larger than zero in operation s 401 , or where the operation s 405 , s 407 , s 410 or s 412 is completed , the operations s 401 through s 412 are repeated through operation s 413 to detect + and − medium levels from a next sample . the detecting methods illustrated in fig6 through 9 can be applied to level error detection performed by the level error detector of fig2 . fig1 is a diagram illustrating differences between outputs of the equalizer 206 and decision levels of the viterbi detector 214 where the viterbi detector is a pr ( 1 , 2 , 2 , 1 ) type , and asymmetry is 0 . 7 ( about 20 %). where the output level y k of the equalizer 206 is normal , it is supposed that the + and − maximum levels are + 1 and − 1 , the + and − medium levels are + 0 . 67 and − 0 . 67 , and the zero level is 0 . however , it actually appears that the + and − maximum levels are + 1 . 05 and − 0 . 86 , the + and − medium levels are + 0 . 58 and − 0 . 59 , and the zero level is − 0 . 007 . these differences are accumulated at the viterbi detector 214 as an error , thereby degrading the detection performance . this means that an actual output waveform of the equalizer 206 is not like a waveform that is modeled in the pr ( 1 , 2 , 2 , 1 ) type viterbi detector 214 . in particular , where a component such as asymmetry exists , an error is much larger . accordingly , the detection levels of the viterbi detector 214 are corrected to correct such an error . where decision levels corrected by the viterbi level decision unit 212 according to the present invention are used , the detection performance for an input signal having asymmetry is improved , as shown in fig1 . fig1 is a diagram comparing the detection performance for an input signal having asymmetry , where decision levels are processed only by the equalizer 206 , with the detection performance for an input signal having asymmetry , where decision levels are corrected by the viterbi level decision unit 212 . the diagram is related to a rll ( 2 , 10 ) code and a viterbi detector 214 of a pr ( 1 , 2 , 2 , 1 ) type . it can be seen that the data detection performance where the decision levels corrected by the viterbi level decision unit 212 are used in the viterbi detector 214 is better than that where the decision levels processed only by the equalizer 206 are used in the viterbi detector 214 . fig1 is a diagram illustrating the variations of the decision levels of the viterbi detector which have been corrected according to asymmetry . as asymmetry is larger , the variations of the + and − maximum levels are larger than those of the zero level and the + and − medium levels . as described above , the present invention monitors the output of an equalizer , determines + and − maximum levels , + and − medium levels and a zero level , which are the reference values of decision levels used in a viterbi detector , and uses the determined levels as the decision levels for the viterbi detector , thereby improving a data bit error rate . consequently , the present invention can improve data detection performance . although a few embodiments of the present invention have been shown and described , it would be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the invention , the scope of which is defined in the claims and their equivalents . | 6 |
in u . s . pat . no . 5 , 374 , 561 , a set of reactions was postulated that accounted for the discovery that cupric compounds could complex with creatinine and thereafter act as a pseudoperoxidase in the oxidation of a chromophoric indicator , such as 3 , 3 ′, 5 , 5 ′- tetramethylbenzidine ( tmb ). the color developed by oxidation of the indicator provided a measure of the concentration of the creatinine present in the sample being tested . for example , cupric ions were supplied as cupric sulfate plus citric acid , complexed with creatinine and then oxidized tmb while being reduced to copper ( i ) creatinine , which was reoxidized to the cupric form by diisopropylbenzene dihydroperoxide ( dbdh ). it was stated in the &# 39 ; 561 patent that the source of cupric ions could be any soluble copper salt whose anion does not detrimentally interact with the reaction for the colorimetric detection of creatinine . in the present invention the same considerations apply , except that the indicator provides a fluorescent response rather than a color change . suitable copper salts include the sulfate , acetate , chloride , phosphate and hydroxide . as in the &# 39 ; 561 patent copper salts whose anions bind too strongly to the copper interfere with the formation of the copper - creatinine complex should be avoided , for example , thiocyanate , sulfide and complexing agents such as edta . copper citrate is a preferred source of cupric ions since it best allows creatinine to form a peroxidatively active complex with copper and has a low blank reactivity . various hydroperoxides may be used to reoxidize the copper i creatinine complex . they include but are not limited to diisopropylbenzene dihydroperoxide , and cumene hydroperoxide . an excess of the hydroperoxide relative to the copper ions is supplied in order to facilitate the reaction rate . while chromophoric indicators were suitable for use in analysis of urine , a color change in response to oxidation is not always detectable when other fluids are being analyzed . thus , in the present invention fluorescent indicators are used instead . in general the fluorescent indicators will be of the 4 -( 1 - alkylhydrazino )- 7 - substituted - benzooxadiazoles - type ( sometimes also called benzofurazans ). r 1 is c 1 - c 7 r 2 is no 2 , r 3 nhso 2 , ( r 3 ) 2 nso 2 r 3 is hydrogen , alkyl , substituted alkyl , phenyl , or substituted phenyl . of these , because of ease of availability , 4 -( 1 - methylhydrazino )- 7 - nitrobenzooxadiazole ( mnbdh ) is used to demonstrate the invention . examples of potential 7 - substituents can be found in j . chem soc ., perkin trans . 2 , 1999 569 - 76 and 1999 2525 - 2532 . the concentration of the indicator used will depend upon the desired reaction rate and background . in the above formula , the alkyl group r 1 typically is c 7 or smaller , but it may be substituted to provide desired solubility or to immobilize the indicator molecule . r 3 will be an alkyl or a phenyl group , either of which may be substituted with functional groups to provide the desired solubility or optical properties . for example , r 3 could be a methyl or ethyl group , but the compound would be more lipophilic if r 3 had a longer carbon chain , e . g ., decyl or dodecyl . alternatively , the solubility of the compounds in water would be increased when r 3 is for example , 2 - sulfoethyl (— o 3 sch 2 ch 2 —), carboxymethyl (— o 2 cch 2 —), or dimethylaminopropyl [( ch 3 ) 2 n ( ch 2 ) 3 ]. both lipophilicity and water solubility would be increased when r 3 is an n -( ethyleneglycol ) ethyl [( ch 3 —, ch 3 ch 2 —, or h — o ( ch 2 ch 2 o ) n ch 2 ch 2 ]. chain lengths could be chosen to further adjust the properties of r 3 . also , other substituents could be included that would modify r 3 &# 39 ; s properties , including , but not limited to , hydroxyl , amino , and trialkylammonio . when r 3 is a phenyl group lipophilicity is increased . functional groups such as methoxy , nitro , chloride , bromide , or iodide in the 2 , 3 , or 4 positions on the phenyl ring could change the fluorescent properties . water solubility could be increased by including substituents such as sulfo , carboxy , dimethylamino , trialkylammonio , and n -( ethylene glycol ) ethyl . fig1 illustrates the response of mnbdh in a series of tests in which the concentration of creatinine was varied , using the conditions of example 1 below . when the concentration of creatinine was zero , the fluorescence measured did not significantly change during the assay . however , with the relatively low concentration of 0 . 1 mg / dl of creatinine a slight response was measured . further increases in creatinine concentration to 1 mg / dl and 10 mg / dl provided readily measured signals . since the typical concentration of creatinine in blood is expected to be about 0 . 2 to 10 mg / dl , it is evident that the fluorescent indicator provides a strong response to oxidation by the copper ii creatinine complex , making it suitable for measurement of blood and other bodily fluids where a chromophoric indicator is less satisfactory . the method of the invention will be useful in assays of various bodily fluids , particularly , but not limited to serum and blood . while the method can be used manually , that is , one could add cupric compounds , a hydroperoxide and a fluorescent indicator to a sample of blood and then measure the fluorescence developed in a cuvette , it is also possible to use other techniques , such as test strips having the reagents added . it is believed that test strips will be particularly useful for measuring creatinine in serum where optical interferences are the greatest . for example , a strip of filter paper could be dipped into a solution of the cupric compounds along with other compounds to bind potentially interfering materials in the sample , buffers and the like . then , after drying the first solution on the strip of filter paper , it could be dipped into a second solution containing the fluorescent indicator and the hydroperoxide and dried a second time . another application for the method of the invention is found in automated analyzers , such as the blood analyzers described in wo 00 / 11205 . for example , the reagents could be dissolved in a solution containing a soluble , transparent , water - permeable polymer . the resulting solution could be stripped onto a backing and dried to provide a reagent pad . passing a serum sample over the membrane allows the creatinine to absorb into the membrane and react to generate a fluorescent signal to be measured by a suitable system , such as that illustrated in wo 00 / 11205 . an aqueous solution was prepared containing 0 . 84 mm cu ii so 4 1 . 6 mm citrate as citric acid hydrate and 25 mm succinate as succinic acid and adjusted to a ph of 7 by adding sodium hydroxide . to the resulting solution was added 200 μl of 2 . 2 mg / ml of diisopropyl benzene dihydroperoxide in water containing 12 . 2 mg / ml of hydroxypropyl cyclodextrin , 0 . 5 ml of aqueous creatinine solution 20 μl of 1 mg / ml mnbdh in acetonitrile . the fluorescence produced was measured with a perkin elmer ls50b fluorimeter after 5 minutes . as seen in fig1 , the measured fluorescence ( relative units ) increased with increased creatinine concentration . | 8 |
with reference to the simple or basic embodiment illustrating broad aspects of the invention as depicted in fig1 to 3 , the generally flat conveyance deck 10 extends in a straight path at a slight downward incline from the inlet opening 12 to the outlet opening 14 in the respective end walls 16a and 16b of the insulated housing or enclosure 16 . longitudinally extending vertical partitions 18 and 20 cooperate with the end walls and floor 22 to form a single plenum 24 immediately underlying the deck 10 . details of a network of beams underlying and supporting the elongated sheet metal deck are omitted from the illustration , but will be understood to constitute a skeletal structure that leaves the deck panel largely exposed to the plenum space beneath . motor driven blowers 30 are individually energizable to blow pressurized freezing air into the plenum through blower discharge openings 28 in the partition 18 so as to pressurize the plenum space beneath the deck . these blowers are mounted in a refrigeration apparatus chamber 32 that extends from the floor 22 to the ceiling 16c of the enclosure 16 . above the conveyance deck 10 , the enclosure 16 is open , as is a side walkway region 34 accessible through an entrance door 36 for persons to enter and observe the freezing operation applied to the train of comestible containers being conveyed on the conveyance deck 10 . freezer or evaporator coils 38 mounted across the face of an inlet opening 40 in the wall or partition 18 above the deck 10 cool the air being withdrawn by blower suction from the space above the conveyance deck 10 in its return to the chamber 32 for repressurization by the blowers 30 . a large number of discharge openings 10a formed in the conveyance deck and distributed at intervals along the length thereof , as well as across the width of such deck , cause the freezing air under pressure to be delivered upwardly against the comestible containers c and preferably also in the direction of conveyance , that is , in the direction of downward slope of the conveyance deck . variably adjustable dampers 26 set in bypass openings in the partition 19 below the level of the deck provide a variable bypass control by which , with the blowers operating , it is possible to regulate the flow of pressurized freezing air in the plenum 24 passing through the deck apertures . the control means for adjusting the settings of the shutters 26 are omitted from the illustration , but may be of any suitable or conventional design . if desired , additional regulation or control over flow of pressurized freezing air through the deck apertures may also be adjusted by selective energization of one or both blowers and , if one is left inoperative , by permitting it to free - wheel or idle as an additional bypass , with or without variable dampers in its discharge opening , thereby further to regulate or vary the effectiveness of the bypass system . adjustment in the setting of the variable dampers can be effected for establishing and maintaining full - volume air circulation through the blowers and evaporator coils at all times , thereby to maintain proper heat transfer between the air and evaporator coils . otherwise , for instance if the entire air volume in the system were to be varied as the means of meeting the prevailing conveyor - freezing requirements ( accommodating light or heavier product loading ) the refrigeration system is unnecessarily penalized in heat transfer capability , efficiency and energy consumption . in other words the provision of such adjustable bypass dampers , whether set manually or automatically , permits the system to operate with full evaporator heat exchange efficiency while discharging air at the optimum rate through the discharge apertures in the conveyance deck to float and freeze the product rapidly without bouncing and jumbling the packages or containers . while not essential to the basic operation of the system , there is an advantage in establishing the transverse width of the conveyance deck 10 so as to slightly exceed a multiple of the transverse dimension of the flat - bottom packages or containers c placed on the deck to span widthwise thereof . a slight upward extension 20a of the partition wall 20 serves aas a confining sidewall or retainer wall extending the length of the conveyance deck opposite the partition wall 18 also forming a retaining wall for the side of the deck . with this arrangement , pressurized freezing air underlying the conveyance deck 10 and blowing upwardly and longitudinally through the discharge apertures 10a escapes into the region above the conveyance deck by flowing beneath the comestible containers c and upwardly through the restrictive gaps between the abutting containers , as well as between the sidewalls 20a and 18 and the adjacent side surfaces of the containers at the sides of the train . for convenience in loading and unloading the apparatus , comestible containers in the unfrozen state are brought into position adjacent inlet 12 on a loading table 50 . a similar unloading table 52 is also provided adjacent the outlet 14 . suitable doors 12a and 14a normally cover the inlet and outlet openings to prevent escape of pressurized air from the enclosure . the lower door 14a can also serve as a stop holding back the train of comestible containers between times when it is opened to remove the bottom row . in operation the apparatus is preferably loaded and unloaded , one or more rows of containerized comestibles at a time . at a point after each transversely extending row has reached the lower end of deck 10 it will have been subjected to the freezing effect of the system for the required period to permit its removal to the receiving table 52 . opening of door 14a and removal of one or more such rows allows the entire succeeding train of comestibles to descend incrementally by gravity , making space at the top for insertion of a corresponding number of unfrozen container units through door 12a at the deck &# 39 ; s upper end . during the stepwise progressive sliding descent of the containerized comestibles on the deck 10 , the pressurized freezing air discharging through apertures 10a preferably performs multifold functions . the formation of a thin layer of pressurized freezing air beneath the flat - bottom containers c raises the containers slightly from the deck surface and thereby substantially eliminates frictional restraint against gravity advancement of the train . preferably the discharge orifice 10a are formed to direct the discharge at least partly lengthwise of deck 10 in the desired direction of conveyance . this , together with the friction - reducing effect , aids gravity in advancing the columns of containers . prior art air slide conveyors as such are not new , the concept appearing , for example , in various u . s . patents for purposes that vary and in widely varied implementations . those noted as background interest herein include the following : 545 , 013 , dodge ; 662 , 574 , mcgary ; 756 , 600 , dodge ; 898 , 775 , norton ; 1 , 051 , 905 , mccord ; 1 , 515 , 965 , pardee ; 2 , 805 , 898 , willis ; 2 , 848 , 820 , wallin et al ; 3 , 131 , 974 , futer ; 3 , 890 , 011 , futer ; 3 , 180 , 688 , futer . however , in the combining of this air slide conveyance effect with flow - through freezing by means of the same pressurized air to perform both functions in the novel system of this invention , a number of distinctive benefits accrue that were not deemed obvious from prior art endeavors . thus it turns out as previously stated that the airflow patterns attending air slide conveyance suspension of the flat - bottom comestible containers overlying the generally flat conveyance deck surface are inherently formed to achieve uniformly maximized rate of heat withdrawal from the containers , which rate increases as the conveyor loads become heavier , and require more freezing . it also turns out that this effect as a factor in reducing system size and cost is enhanced by loading the conveyance deck surface to the maximum extent possible . such loading as depicted in fig1 and 3 , for instance , tends to crowd the containers closely together such that air flow is not only narrowly confined to a region of rapid flow between the deck and container bottom surfaces , but is also confined to thin regions between side walls of closely abutted containers . a rapid and continuing scouring or air turn - over effect is thus enhanced by breaking up the boundary layers of otherwise stagnant air at the very container surfaces where heat transfer can be most effective . these are the surfaces where the contents lie in contact with the inside surfaces of the containers . moreover the system avoids energy expenditures in inefficiently circulating large volumes of air across the top faces of the containers in an attempt to withdraw heat through the top walls of the containers and the immediately underlying insulating air gaps resulting from incomplete filling of the individual containers with comestibles . the arrows in fig3 depict the pattern of airflow under and upwardly alongside the packages by maintaining positive pressure in the plenum beneath the conveyance deck and negative pressure in the collection space or chamber overlying the deck . with large open plenum and collection chambers extending under and over the full length and width of the emergence deck uniform continuity of this efficient utilization of pressurized freezing air throughout the advance of containers along the deck is assured . the heavier the containers per unit area , the greater the exerted upward pressure per unit area required to elevate the containers off the deck for frictionless conveyance . when this increased pressure is developed in the plenum and attendant discharge through the apertures by appropriate operation of the blowers and bypass shutters , the result is also to increase the rate of turn - over of freezing air in the supporting layer beneath the packages and in the interpackage layers . consequently the system is essentially self - adjusting with respect to freezing rate when properly set as to the operating air pressure required to achieve the desired air slide conveyance effect , and vice - versa . any suitable means ( not shown ) may be provided so as to maintain accumulated pressure in the plenum 24 . examples include regulating devices controlling blower speed , or controlling bypass damper position or both . also , if a larger or smaller percentage of the total apertured surface area of deck 10 is covered by comestible containers tending to increase or decrease the accumulator pressure in the plenum , this too is accommodated by whatever means are provided to regulate accumulator pressure . in the preferred and main high - rate production embodiment as depicted in fig4 - 9 , the substantially transversely horizontal and longitudinally inclined conveyance deck 10 forms a substantially helical path of conveyance . descending at substantially constant slope from its upper input end accessible through the container input opening 102 in one wall 103 of enclosure 104 , the enlongated deck 10 undergoes a succession of turns to its lower end adjacent discharge opening 105 . preferably opening 105 is in the small wall 104 . the term &# 34 ; substantially helical &# 34 ; is used with reference to the conveyance deck configuration to indicate that the conveyance path need not be precisely a helix nor even closely resemble a helix throughout its full length . in fact , in the preferred form the conveyance deck descends in a straight run from inlet opening 102 to the far corner 104a of the enclosure before the first descending curve of a 90 degree circular arc or bend occurs , whereupon it descends in a straight line to the second bend , and so around the completion of the first and succeeding turns of the looping path of conveyance , until in its last stretch in this example it descends in a straight stretch to the outlet opening 105 . thus , as viewed in plan the path of conveyance in the example constitutes a succession of straight sections in rectangular relationship alternating with connecting 90 degree circular bends together forming what have been denominated &# 34 ; turns &# 34 ; of a &# 34 ; substantially helical &# 34 ; configuration . preferably the slope remains constant throughout the length of deck 100 and the deck is substantially horizontal transversely at all points along its length . however , some sections may be held flat or horizontal , such as in the corners or turns , such as for convenience of construction . nor is it required that the upper and lower end stretches of the conveyance deck 100 terminate in the same wall of the insulating enclosure 104 . as shown , the inner and outer ( opposite ) side edges of the elongated deck panel 100 having upstanding retainer rails or sides 100b and 100c . these extend the full length of the deck in order to keep the free - sliding comestible containers c on the deck throughout their descent . as in the first example , these side walls 100b and 100c also serve to partially confine the upward flow of pressurized freezing air along the upright side walls of containers c after discharge beneath the containers through deck openings 100a . these openings 100a are or may be similar in their flow directing orifice configuration to those ( 10a ) in the preceding embodiment . however , unlike the preceding embodiment employing a conveyance run extending in a straight line from end to end , the embodiment now under description has bends in the conveyance path . consequently , the train of comestible containers cannot be kept in uniformly abutted rows and columns of containers in a more or less unbroken train . instead at the bends the packages in this case , which themselves are usually rectangular or square in shape , necessarily assume varying spacings and skew angles even though they may return in some degree to an ordered and more closely and uniformly packed array in the straight stretches . it is preferred to have the advancing train of packages cover as much of the deck surface throughout the length of the deck 100 for reasons of achieving maximum utilization capacity of the system . to the extent idealized deck coverage by an unvarying closely abuttd package array overlying the entire deck area is not achieved , something less than optimized freezing efficiency is experienced . however , the system still operates substantially in the intended manner and the advantages to be gained as a trade - off by utilizing the substantially helical path configuration of the air slide conveyance deck are great in very important respects otherwise as previously indicated . in the drawings , the descending column of turns of deck 100 surround an interior space 110 and in turn are surrounded by an exterior space 112 . one of these spaces , much preferably the interior space 110 , serves as part of a plenum in which pressurized freezing air is accumulated for distribution and discharge of the air against the containers to be simultaneously conveyed and frozen . the other space , in this example space 112 , serves as a collecting chamber through which the discharging air is collected by blower suction uniformly applied in the regions overlying the conveyance deck and train of packages for recirculation back through the freezer apparatus and plenum 110 . thus the interior of enclosure 104 is divided and actually separated basically into two main chambers 110 and 112 concentrically related . to a large extent this partitioning is formed by the substantially helical conveyance deck cooperating with a transversely inclined duct - forming panel 114 also of substantially helical configuration such that its outer edge is joined to the outer edge of the deck panel 100 and the inner edge also to the inner edge of the deck panel of the next underlying turn of the deck . the exception is with top and bottom turns where the duct - forming panel is secured to the overlying and underlying partition structure , respectively . in any event , each intermediate run of the inclined duct - forming panel cooperates with the conveyance deck portion above it to form an open - sided plenum duct space 120 that opens to the main plenum chamber 110 and converges transversely away from it . such convergence represents an effective measure to conserve volumetric space in the conveyance deck columnar structure while assuring supply of freezing air to the discharge apertures at uniform flow pressures across the full width of the deck . similarly the inclined duct - forming panel 114 cooperates with the deck portion underlying it to form duct space 121 that opens and diverges outwardly to the surrounding discharge air collecting chamber 112 . thus , the interests of space conservation are further served by inclining the duct - forming panel 114 while assuring flow - inducing withdrawal ( negative ) pressure being uniformly applied to all deck apertures across the full width of the conveyance deck . in this manner , the packages share alike in the air slide support and freezing effect of the available air uniformly throughout their journey from top to bottom of the conveyor deck run . at the bottom of the hollow columnar , substantially helically formed conveyance deck structure there is annular panelling structure 116 that completes the partition or curtain between spaces 110 and 112 , extending fully to the floor 118 . a series of manually or automatically adjustable dampers 150 set by positioning actuators 151 are or may be installed in substantially annular panelling 116 to perform the deck aperture flow regulating functions referred to in connection with the preceding embodiment . at the top of the conveyance deck structure the annular partition or curtain between spaces 110 and 112 is completed by wall structure 128 extending to the enclosure ceiling surrounding the labyrinth of freezer or evaporator coils 130 and blower units 132 . the latter rests on a support structure including the cover panel 134 closing off the top of space 110 . air is drawn under suction by blowers 132 from collecting chamber 112 through the freezer coils 130 to reduce its temperature to the desired regulated value and thereupon is discharged downwardly through outlet 134 under pressure into the plenum 110 . in operation the blower 132 creates positive pressure of freezing air in the central plenum space 110 and its adjoining branch duct spaces 120 beneath all stretches or portions of the conveyance deck 100 . negative pressure is also created by the blower in the collecting chamber 112 and its branch duct spaces above all stretches or portions of the conveyance desk 110 . by the time containerized comestibles on deck 100 have slid under gravity progressively downward to outlet 105 the comestibles will have been properly frozen and ready for discharge . just inside the housing adjacent the outlet 105 an elongated horizontally mounted stop element shown as roller 140 or equivalent is mounted . in its normal position this roller , which is preferably of soft spongy material seals the opening across its full width to prevent loss of freezing air . this it does by pressing against the upper rim of opening 105 in the wall 103 and simultaneously the deck 100 . this , preferably freely - rotational roller is mounted on the downstream end of a rocker frame 142 carried by a horizontal transversely oriented pivot shaft 144 permitting it to pivot intermediate its ends . a second stop element shown as a roller 144 or equivalent is mounted on the opposite end of pivoted frame 142 and is normally held thereby above the deck sufficiently to clear the containers c so that they may slide beneath it to abut the stop roller 140 . thus , the roller 140 functions in its normal position , both to hold back the advancing train of packages on deck 100 and to close the discharge opening 105 . an actuator 146 connected to rock the pivot frame 142 about shaft 144 may then be operated to reverse the positions of the two stop elements 140 and 142 momentarily . in so doing roller 144 descends to bear on the transverse row of packages underlying it . at that point those packages on deck 100 that lie beyond stop roller 144 are released for discharge by raising of roller 140 , whereas roller 144 arrests advance of the remainder of the package train . after the incremental discharge interval the actuator reverses to restore the stop elements to their normal positions preparatory to repeating the process . the train of packages or containers is thus advanced by progressive increments as packages are released one or more rows at a time at the lower end and new or unfrozen ones added to the train at the upper end to keep the process a continuous one . in the preferred embodiment the space surrounding the helically formed conveyance deck constitutes an inspection walkway through which a person may observe and troubleshoot any problems experienced with the packages properly advancing along the deck . in this regard it will be noted that the open - sided configuration of the conveyance deck spaces is inherently convenient to observe and gain ready access to the product at all points along the run of such deck . in the modified embodiments of fig1 , 12 and 13 different arrangements of the evaporator coils , blowers and variable bypass dampers are depicted . in fig1 the dampers 250 are placed in a bottom wall of the conveyance deck plenum pressurized by blowers 232 mounted in an inner tubular wall of the plenum . the evaporator coil assembly 230 is mounted centrally beneath the interior space defined by such tubular wall to be traversed by return airflow coming from the conveyance duct spaces and from the bypass openings through dampers 250 . in fig1 the tubular wall is foreshortened and capped by sloping panels converging to a peak with the blowers 332 mounted in the sloping panels overlying the evaporator coils 330 . the dampers 350 are located similarly to those in fig1 . an open framework supports the duct - deck assembly from the floor . in fig1 the blowers are mounted immediately above the floor in upright wall panels supporting the duct - deck assembly . evaporator 432 is centrally mounted in a horizontal panel structure immediately above the space into which the blowers discharge and that opens upwardly into a central plenum through the evaporator . the dampers 450 are mounted in upright panels extending downward from the ceiling panel to the duct - deck structure . the invention having thus been described illustratively in its preferred forms , it will be appreciated that the novel concept is to be interpreted in scope in accordance with the claims stated below . | 5 |
referring now to the drawing , and in particular to fig1 thereof , therein illustrated is a substrate generally designated 10 according to the present invention having a large transparent area 12 , and optionally a plurality of mixing wells 14 . the substrate 10 is preferably substantially planar with the transparent area 12 having flat upper and lower surfaces ( excluding , of course , the mixing wells 14 , which may simply be depressions in the upper surface of the substrate 10 ). the substrate 10 is placed over an article 20 containing a design 22 ( here illustrated as a quartered pie or rosette ) to be copied . the transparent portion 12 of the substrate 10 is placed over the design 22 so that the design 22 is visible on the upper surface of the substrate 10 thereof , thereby to facilitate tracing of the design 22 thereon . it will be appreciated , however , that where the stained glass art is to be an original work of art rather than a copy of a pre - existing design , the substrate 10 may be transparent , translucent or opaque since no tracing will be involved . preferred transparent materials for the substrate are polyethylene , polypropylene , and k - resin , the latter being a styrene / butadiene copolymer . referring now to fig2 in particular , regardless of whether the work of art is to be an original or a tracing , a pattern of leading paint 30 is applied to the upper surface of substrate 10 in order to simulate the leaded portions of the stained glass work . typically the leading paint pattern peripherally defines each area which is to be colored differently in the final product . a variety of liquid leading paints may be employed for this purpose , a preferred paint being 0 . 40 parts by wt . black no . 10 - 6c - 41 - l 700 tinting black from hilton davis in 3 . 54 parts of water and 96 . 06 parts of peel - off coating no . 32457 from prime coatings , a division of prime leather finishes co . of milwaukee , wi . the leading paint 30 is flexible and opaque when dry . it is preferably black when dry to simulate leading , but may alternatively be opaque and of a different color in order to produce novel effects the leading paint 30 preferably has a brookfield viscosity of at least 5200 centipoises ( cps ) to ensure that it forms a slightly raised ridge on the upper surface of the substrate 10 when applied thereto ( see fig5 ). the leading paint 30 may be applied directly from a tube or a bottle , the tube or bottle preferably being provided with an appropriately configured dispensing spout or nozzle -- e . g ., in the shape of a truncated cone . alternatively , the leading paint 30 may be applied by a palette knife or artist &# 39 ; s paint brush . despite the relatively high viscosity of the leading paint , it remains a fluid prior to drying and thus can be used to easily and accurately trace the rosette pattern 22 to be copied or deployed freehand to create intricate curvilinear patterns ( or other patterns , as desired ). after application of the leading paint 30 , the leading paint 30 is allowed to dry , preferably at least until it is dry to the touch . depending upon the precise type of paint employed as the leading paint , adequate drying may be achieved in 2 to 3 hours at room temperature and even faster where moderate heat is applied to accelerate drying . ( caution must be exercised to ensure that the heating does not deleteriously affect the leading paint , which may be inflammable when wet .) referring now to fig3 after the leading paint 30 has dried sufficiently so that it will not mix or blend with the coloring paint 40 , the coloring paint 40 is applied as a covering over the areas 42 which are peripherally defined by the pattern of the leading paint 30 . a coloring paint 40 of a single color may be applied within a given area 42 or a plurality of coloring paints 40 of different colors may be applied within a given area 42 . if desired , a plurality of coloring paints 40 may be pre - mixed in a mixing well 14 prior to use . a variety of liquid coloring paints 40 may be employed for this purpose . the coloring paints 40 are flexible ( to facilitate peeling ), non - shrinking ( so they don &# 39 ; t separate from the leading paint upon drying ), tacky when dry ( to permit reapplication to a second substrate after removal from the first substrate ) and preferably translucent when dry ( so that light is transmitted therethrough and colored thereby ). a plurality of coloring paints 40 , each of a different color , is preferably provided for use . the preferred leading and coloring paints contain a peel - off coating such as that available under the designation no . 32457 from prime coatings , a division of prime leather finishes co . of pewaukee , wi . this peel - off coating consists of the following ingredients : ______________________________________ parts bycomponents weight______________________________________vinyl - acrylic copolymer latex 45 - 60emulsionrheology modifier 2 - 8defoamer ( mixture of petroleum 0 . 4 - 2 . 0derivative and other additives ) ph control agent ( mixture of 0 . 4 - 2 . 0alkanol amines ) u . v . light stabilizer ( hindered 0 . 2 - 0 . 9benzotriazole ) thickening agent ( acrylic 0 . 2 - 0 . 9copolymer latex emulsion ) water balance______________________________________ the various preferred paints are formed of 95 - 96 % by weight peel - off coating , 3 . 5 % water , and 0 - 1 % coloring agent ( 0 % coloring agent being used for a clear paint , and a low water the black or leading paint ). it is a critical aspect of the present invention that coloring paint 40 cover each area 42 and make contact with the leading paint 30 defining the boundary of that area 42 so that , when the coloring paint 40 is dry , it forms with the leading paint 30 an integral , flexible , self - sustaining film . to this end , the coloring paint 40 is preferably of a lower viscosity than the leading paint 30 to facilitate its application and its full coverage of the area 42 out to the border or periphery thereof defined by leading paint 30 . in view of the lower viscosity of the coloring paint 40 relative to the leading paint 30 , the coloring paint 40 may conveniently be applied using a fine artist &# 39 ; s paint brush rather than by application directly from the tube or bottle or via a palette knife . the covering of coloring paint 40 is typically thinner than the pattern of leading paint 30 ( that is , it does not extend upwardly from the upper surface of the first substrate 10 as high as the leading paint 30 ) so that the coloring paints 40 in different areas 42 are maintained distinct and separate from each other by the leading paint pattern because the coloring paint 40 , like the leading paint 30 , is a liquid prior to drying , it can be easily and rapidly applied to the desired areas 42 -- e . g ., by pouring or brushing -- with the outer edges of the covering of coloring paint 40 flowing to contact the inner edges of the surrounding pattern of leading paint 30 . after application of the coloring paint 40 , the coloring paint 40 is allowed to dry thoroughly ( and the leading paint 30 is allowed to further dry ). depending upon the particular materials used for the coloring paint 40 , overnight drying at room temperature is recommended , although faster drying times may be achieved at moderately elevated temperatures ( with the same caveat being applicable as in the accelerated drying of the leading paint 30 ). the drying period must be sufficient to enable the leading paint 30 and coloring paint 40 to establish themselves as an integral , flexible , self - sustaining unit generally designated 50 , for reasons which will become apparent hereinafter . referring now to fig4 and 5 in particular , after drying of the coloring paint 40 , the unit 50 is removed from the upper surface of the first substrate 10 while a variety of different techniques may be employed to effect removal of the unit 50 from the substrate 10 , preferably the unit 50 is lifted from the various corners thereof , with the removal proceeding inwardly towards the center of the unit depending upon the efficacy of the high release upper surface of the first substrate 10 and the composition and thickness of the paints 30 , 40 forming the unit 50 , removal may be effected using simply a fingernail or a flat instrument ( such as a paint scraper ) which facilitates gentle removal of the unit 50 without tearing thereof and preferably without damaging the upper surface of the substrate 10 so that the latter may be reused . referring now to fig6 in particular , once the unit 50 has been removed from the first substrate 10 , it is gently and carefully transported and applied to a second substrate 60 . naturally , at least a minimal amount of care should be exercised during the process of relocating the unit 50 from the first substrate 10 to the second substrate 60 in order to prevent its tearing or folding in upon itself depending upon the composition of the unit 50 and the surface of the second substrate 60 to which it is applied , the unit 50 may adhere simply by virtue of its own nature to a slick substrate 60 . on the other hand , where the dry paints 30 , 40 are not particularly clinging or the surface texture of the second substrate 60 is not conducive to sticking , a glue or adhesive , which is preferably transparent when dry , may be used to secure the unit 50 to the second substrate 60 . in order to simulate stained glass , the second substrate 60 should be light - transmitting , preferably transparent . however , where an exact simulation of stained glass is not required , the substrate 60 may be non - light - transmitting . thus , the unit 50 may be applied to a wide variety of second substrates 60 in order to produce interesting effects simulating to varying degrees stained glass works of art . additives such as glitter , pearlescence , luminescence , or other light - reflecting or - defracting characteristics can be added to the paints 30 , 40 for special effects . the final product may be a window or mirror decoration for use in the home , business or car . as a window decoration it may be used to screen the windows from sunlight or make them translucent or opaque ( where the coloring paint is opaque when dry ). the finished product may also serve as a message device for the advertisement of sales , business signs , and the like for businesses , trucks , cars , etc . if desired , the finished product may define words or pictures while , as previously noted , the second substrate is preferably transparent so as to produce a stained glass effect as light shines through the translucent coloring paint , the second substrate may also be opaque , with the finished product being used as an identity sticker for sports helmets , vehicle decorations , holiday decorations , and the like . it is possible to select leading and coloring paints which will not melt or burn at temperatures of 160 ° f . so that the finished product can be applied directly to light fixtures to reflect colors , patterns and the like it will be appreciated that the procedure of the present invention is so easy and simple as to lend itself to home use by the layman with only a minimum being required in the line of tools . accordingly , a kit may be made available containing the first substrate , a selection of coloring and leading paints , and perhaps a scraper tool or paint brush so that the layman purchaser is conveniently provided with all of the equipment necessary to practice the method and create the product of the present invention at minimum cost and with minimum effort relative to genuine stained glass art . even where the simulated stained glass work is to take the form of a window , the unit 50 need not possess the functional properties of a window pane since it would be applied to a pre - existing window pane ( as a transparent second substrate ) which presumably possesses such functionalities . because the simulated stained glass work is created from a variety of different liquids , without the use of any pre - formed components , the artist is afforded a full range of creativity , unlimited by the need to cut pre - formed pieces of plastic or the like . the creator is free to use the present method either to copy a pre - existing design by tracing ( in which case the first substrate should be transparent ) or to create his own original designs , with his creation ( the removed unit ) being easily relocated or reoriented to the final desired location and orientation . the term &# 34 ; self - sustaining &# 34 ; as used herein and in the claims refers to the ability of the film unit to sustain itself as an integral unit apart from any substrate supporting the same , as necessary during relocation of the film unit from the first substrate to the second substrate . now that the preferred embodiments of the present invention have been shown and described in detail , various modifications and improvements thereon will become readily apparent to those skilled in the art . accordingly , the spirit and scope of the present invention is to be construed broadly and limited only by the appended claims , and not by the foregoing specification . | 1 |
with reference now to fig1 , a silicon on insulator ( soi ) portion 102 is defined on a buried oxide ( box ) layer 104 that is disposed on a silicon substrate 100 . the soi portion 102 includes a soi pad region 106 , a soi pad region 108 , and nanowire portions 109 . the soi portion 102 may be patterned by the use of lithography followed by an etching process such as , for example , reactive ion etching ( rie ). fig2 illustrates nanowires 110 disposed on the box layer 104 that are smoothed to form elliptical shaped ( and in some cases , cylindrical shaped ) nanowires 110 on the box layer 104 . the smoothing of the nanowires may be performed by , for example , annealing of the nanowires 109 in hydrogen . example annealing temperatures may be in the range of 600 ° c .- 900 ° c ., and a hydrogen pressure of approximately 600 torr to 7 torr . the diameter of the nanowires 110 may be reduced by an oxidation process . the reduction of the diameter of the nanowires 110 may be performed by , for example , an oxidation of the nanowires 110 followed by the etching of the grown oxide . the oxidation and etching process may be repeated to achieve a desired nanowire 110 diameter . once the diameters of the nanowires 110 have been reduced , gates are formed over the channel regions of the nanowires 110 ( described below ). fig3 illustrates gates 402 that are formed on the nanowires 110 , as described in further detail below , and capped with a polysilicon layer ( capping layer ) 404 . a hardmask layer 406 , such as , for example silicon nitride ( si 3 n 4 ) is deposited over the polysilicon layer 404 . the polysilicon layer 404 and the hardmask layer 406 may be formed by depositing polysilicon material over the box layer 104 and the soi portion 102 , depositing the hardmask material over the polysilicon material , and etching by rie to form the polysilicon layer 406 and the hardmask layer 404 . the etching of the gate 402 may be performed by directional etching that results in straight sidewalls of the gate 402 . following the directional etching , polysilicon 404 remains under the nanowires 110 and outside the region encapsulated by the gate 402 . isotropic etching may be performed to remove polysilicon 404 from under the nanowires 110 . fig4 a illustrates a cross sectional view of a gate 402 along the line a - a ( of fig3 ). the gate 402 is formed by depositing a first gate dielectric layer ( high k layer ) 502 , such as silicon dioxide ( sio 2 ) around a channel portion of the nanowire 110 and on the soi pad regions 106 and 108 . a second gate dielectric layer ( high k layer ) 504 such as , for example , hafnium oxide ( hfo 2 ) is formed around the first gate dielectric layer 502 . a metal layer 506 such as , for example , tantalum nitride ( tan ) is formed on the second gate dielectric layer 504 . the metal layer 506 is surrounded by polysilicon layer 404 ( of fig3 ). doping the polysilicon layer 404 with impurities such as boron ( p - type ), or phosphorus ( n - type ) makes the polysilicon layer 404 conductive . the metal layer 506 is removed by an etching process such as , for example , rie from the nanowire 110 and the soi pad regions 106 and 108 that are outside of the channel region , and results in the gate 402 . fig4 b illustrates a cross sectional view of a portion of the nanowire 110 along the line b - b ( of fig3 ). fig5 illustrates the spacer portions 604 formed along opposing sides of the polysilicon layer 404 . the spacers are formed by depositing a blanket dielectric film such as silicon nitride and etching the dielectric film from all horizontal surfaces by rie . the spacer walls 604 are formed around portions of the nanowire 110 that extend from the polysilicon layer 404 and surround portions of the nanowires 110 . fig6 illustrates a cross - sectional view of fig5 following the formation of the spacers 604 . in the illustrated embodiment , the exposed dielectric layers 502 and 504 on one side of the device are doped with n - type ions 702 that are implanted at an angle ( α ), the angle α may , for example , range from 5 - 50 degrees . the implantation of the n - type ions 702 at the angle α exposes one side of the device to the n - type ions 702 , while the opposing side remains unexposed due to the height and position of the polysilicon layer 404 . once the ions 702 are implanted , an annealing process is performed to overlap the device . the annealing process results in a shallow doping gradient of n - type ions in the channel region of the device . fig7 illustrates a cross - sectional view of the device . in the illustrated embodiment the exposed dielectric layers 502 and 504 on the opposing side of the device ( the un - doped side ) is implanted with ions 802 at an angle ( β ). the ions 802 may include , for example , germanium , argon , or xenon . the implantation of the ions 802 at the angle β in the dielectric layers 502 and 504 damages the dielectric layers dielectric layers 502 and 504 on the un - doped side of the device , while the doped side of the device remains unexposed to the ions 802 . fig8 illustrates a cross - sectional view of the resultant structure following a wet etching process such as , for example , a hf chemical etch that removes the damaged dielectric layers 502 and 504 that were implanted with the ions 802 ( of fig8 ) from the nanowire 110 . the n - type doped dielectric layers 502 and 505 remain on the nanowire 110 . fig9 illustrates a cross - sectional view of the resultant structure following an etching process , such as , for example , a wet chemical or vapor etching process that etches exposed silicon , and removes the exposed silicon nanowire 110 . the etching process removes a portion of the nanowire 110 that is surrounded by the spacer wall 604 and the gate 402 to recess the nanowires 110 into the gates 402 , and form a cavity 1002 defined by the gate 402 , the nanowire 110 , the box layer 104 , and the spacer wall 604 . the lateral etching process that forms cavity 1002 may be time based . width variation in spacer 604 may lead to variations in the position of the edges of the recessed nanowire 110 . the etching rate in the cavity 1002 depends on the size of the cavity , with narrower orifice corresponding to slower etch rates . variations in the nanowire size will therefore lead to variations in the depth of cavity 1002 . fig1 illustrates cross - sectional views of the resultant structures following a selective epi - silicon growth to form nanowire extensions 1102 and 1104 . the nanowire extension 1102 is epitaxially grown in the cavity 1022 ( of fig9 ) from the exposed nanowire 110 in the gate 402 to form the nanowire extension 1102 . the nanowire extension 1104 is epitaxially grown from the soi pad region 108 . the nanowire extensions 1102 and 1104 are grown until they meet to connect the soi pad region 108 to the nanowire 110 in the channel region of the gate 402 . the nanowire extensions 1102 and 1104 are formed by epitaxially growing , for example , in - situ doped silicon ( si ), a silicon germanium ( sige ), or germanium ( ge ) that may be either n - type or p - type doped . as an example , a chemical vapor deposition ( cvd ) reactor may be used to perform the epitaxial growth . precursors for silicon epitaxy include sicl 4 , sih 4 combined with hcl . the use of chlorine allows selective deposition of silicon only on exposed silicon surfaces . a precursor for sige may be geh 4 , which may obtain deposition selectivity without hcl . precursors for dopants may include ph 3 or ash 3 for n - type doping and b 2 h 6 for p - type doping . deposition temperatures may range from 550 ° c . to 1000 ° c . for pure silicon deposition , and as low as 300 ° c . for pure ge deposition . once epi - nanowire extensions 1102 and 1104 are formed , the doping may be activated by , for example , a laser or flash anneal process . the laser or flash annealing may reduce diffusion of ions into the channel region 1105 of the gate 402 , and result in a high uniform concentration of doping in the epi - nanowire extensions 1102 and 1104 with an abrupt junction in the nanowires 110 . fig1 illustrates a cross - sectional view of the structure following the formation of a spacer 1202 . the spacer 1202 is formed by depositing a layer of spacer material such as , for example , silicon nitride or silicon dioxide and etching the spacer material using , for example , rie to form the spacers 1202 . the hardmask layer 406 may also be removed in the rie process . fig1 illustrates the resultant structure following silicidation where a silicide 1302 is formed on the soi pad region 106 ( the drain region d ) and the soi pad region 108 ( the source region s ), and over the polysilicon layer 404 ( the gate region g ). examples of silicide forming metals include ni , pt , co , and alloys such as nipt . when ni is used the nisi phase is formed due to its low resistivity . for example , formation temperatures include 400 - 600 ° c . once the silicidation process is performed , capping layers and vias for connectivity ( not shown ) may be formed and a conductive material such as , al , au , cu , or ag may be deposited to form contacts 1304 . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , element components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated the diagrams depicted herein are just one example . there may be many variations to this diagram or the steps ( or operations ) described therein without departing from the spirit of the invention . for instance , the steps may be performed in a differing order or steps may be added , deleted or modified . all of these variations are considered a part of the claimed invention . while the preferred embodiment to the invention had been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the invention first described . | 8 |
in the preferred embodiment poison bait pellets , one of which is shown in fig1 are created . the core 1 of the pellet contains the toxicant either in its solid form or , in the case of liquid toxicants , absorbed into a solid matrix , preferably common fish food . the preferred cores are commercially available feed pellets which are easily soaked in a liquid toxicant . the core may also be coated with a water resistant gel layer 2 to prevent leaching of the toxic formulation into the aqueous environment . coating may be performed by spraying or immersion or other well known methods . encapsulating or coating is well know in the art of extrusion processing where an annular concentric orifice delivers a coating to an extruded column from an enclosed central orifice . spraying or immersion are known methods . another well known method of providing water resistance is to add an hydrophobic material to the mix , e . g . a fat or oil . encapsulating the entire core is a fish - food layer 3 that may be simple fish - food but is preferably an attractant selective for the target species . the buoyancy of the poison bait pellet may be used to control its vertical displacement in the aqueous environment . lateral , as well as vertical , displacement may be controlled by feed retention devices such as 4 of fig2 . many fish feeders are commercially available . extrusion processes are known for introducing air bubbles to control specific gravity or buoyancy . in my preferred embodiment , the toxicant used was rotenone . rotenone has many advantages as a piscicide : ( 1 ) at the level of proposed use , it does not threaten mammalian species , ( 3 ) it is a natural extract of cube and derris roots and craca ? vogelii and degrades in the environment , ( 4 ) it has long been approved by the e . p . a . for fish control and , ( 5 ) it is water - insoluble , hence leaching into the aqueous environment from the bait core is virtually undetectable . negative or positive buoyancy of the poison bait pellet is controlled by the feed pellet used for the core . commercially available feed pellets that are produced by a heat extrusion process have air bubbles trapped inside them which cause the poison bait pellet to float . feed pellets made by other processes usually sink . a floating form of poison fish bait can be produced with a conventional pelleting machine . normally a pelleting machine produces feed pellets by compacting the feed . this process produces a feed pellet negatively buoyant in water . to overcome this problem , i have developed a technique that incorporates dry ice in the production of the feed . mixed with the feed , the dry ice will be trapped in the pellet as it is produced . the trapped dry ice will rapidly warm and sublimate to co2 gas , leaving microcavities in the pellet . this space of trapped air will increase the buoyancy of the pellet and allow it to float . dry ice is added at a rate of 2 - 5 % of the total feed weight . fig2 shows a feed retention device 4 floating in an aqueous environment and retaining positively buoyant poison bait pellets 5 . also shown is a feeder 6 having a timer - actuated dispenser mechanism 8 . the feeder i use is actually a commercially available turkey feeder which i have modified by adding floats 7 . at regular pre - set intervals , the dispenser mechanism 8 releases a fixed quantity of the poison bait pellets into the retention area . one of rotenone &# 39 ; s greatest advantages is its commercial availability . cube root extract having 30 - 50 percent active rotenone is readily available . in my formulations i use a rotenone resin that is produced by prentiss drug and chemical co ., inc . of floral park , n . y . and is reported to be 47 percent active rotenone . therefore , a formulation having 6 percent rotenone resin by weight will have 2 . 8 percent active rotenone by weight . finely powdered rotenone resins , when administered orally , will kill fish in the dosage range of 50 - 100 mg of resin per kilogram of fish body weight . raw powder cube root is effective in the range of 40 - 80 mg / kg . when combined with a synergist , the toxicity of rotenone is nearly doubled . preferred synergists are 2 -( 2 - ethoxyethoxy ) ethyl 3 , 4 -( methylenexioxy ) phenyl acetal of acetaldehyde , which goes by the generic name of sesamex ; 1 , 2 -( methylenedioxy )- 4 - 2 -( octylsulfinyl ) propyl ! benzene , also known as sulfoxide ; alpha - 2 - butox - yethoxy )- ethoxy !- 4 , 5 -( methylenedioxy )- 2 - propyltoluene , also known as piperonyl butoxide ; dipropyl 5 , 6 , 7 , 8 - tetrahydro - 7 - methylnaphtho 2 , 3 - d !- 1 , 3 - dioxole - 5 , 6 - dicarboxylate , also known as n - propyl isome ; 3 - alkyl - 6 - carbethoxy - 5 -( 3 , 4 - methylenedioxyphenyl ) 2 - cyclohexen - 1 - one mixed with 3 - alkyl - 5 -( 3 , 4 - methylenedioxphenyl )- 2 - cyclohexen - 1 - one , also known as piperonyl cyclonene ; and b - diethylaminoethyl diphenylpropyl acetate hcl , also known as skf - 525a . i have discovered that the killing effectiveness of rotenone is greatly increased when combined with a synergist and an adsorption agent or agents . surfactants are effective adsorption agents in that they break down the surface tension of membranes on the lining of the fish &# 39 ; s stomach and allow for greater penetration of the toxic rotenone . surfactants useful for this purpose include sorbitan derivatives , cyclodextrin , simethicone , sodium lauryl sulphate , and dioctyl sodium sulfosuccinate . also , though conventional wisdom teaches that rotenone is incompatible with alkali , i have discovered that small amounts of base ned as metal hydroxides , alkali buffer solutions such as carbonates , phosphates , acetates , borates and phthalates , or other antacids increase the effectiveness of rotenone by neutralizing the digestive acids of the target fish , thereby retarding acid hydrolysis of the toxin and aiding in the absorption ! of the toxin through the stomach lining . chelating agents have also proven successful in increasing adsorption . hydrophobic materials , such as oils , are also effective in increasing adsorption . i group all such compounds as absorption agents . effective absorption agents are sodium hydroxide , aluminum hydroxide , sodium carbonate , sodium bicarbonate , potassium hydroxide , edta ( ethylenediaminetetracetic acid ), codliver oil , mineral oils , vegetable oils and the surfactants previously mentioned . the ph of a drug or toxicant is important in determining the absorption of a toxic agent . rotenone must enter the body of the fish to kill . research has shown that rotenone will only enter the body of the fish through the gills when used as an emulsified product . to enter the body of the fish , it must be lipid soluble or , in other words , it must be soluble in the tissues of the fish . for rotenone to be lipid soluble , it must be in a non - ionic state . the ionic state of the rotenone molecule like any other is effected by the acid or base content of the environment in which it is located . so the ph of the solution is very important . conventional wisdom and 50 years of field testing show that rotenone is more effective at neutral ph values . this is because rotenone remains in the don - ionic state at neutral ph values and is , therefore , more lipid soluble . my work on rotenone as a stomach poison has shown that rotenone &# 39 ; s solubility in the gastrointestinal tract is enhanced by buffering the ph of the feed at a high ph of 8 - 10 . what this high ph buffering does is counteract the low or acidic ph of the fish stomach . this results in a more neutral ph of the gastrointestinal tract and increases the lipid solubility of the molecule and decreases the amount of rotenone needed to kill the fish . sorbitan is in a class of compound known as surfactants . surfactants decrease the surface tension of membranes and increase absorption . there are tens of thousands of surfactants that can be used . i have listed the ones that have been tested . edta is a chelating agent that binds to divalent cations . pharmacological references indicate that it functions to increase the permeability of cell membranes . by increasing the permeability of the membranes , it will act as an absorptive agent . cyclodextrine is a cyclic form of dextrin that is used as an absorptive agent . the structure of the cyclodextrine ring allows for the formation of micelles with the rotenone molecule . a micelle formed is absorbed through the stomach lining of the fish better than the rotenone molecule alone . once in the bloodstream of the fish , the micelle is easily broken and the rotenone is released to have its toxic action . the cyclodextin is also a formulation aid in that it prevents rotenone from recrystallizing in the feed , therefore , keeping the size of the rotenone particles as small as possible and increasing absorption . rotenone - cyclodextrin micelles are made by dissolving the rotenone in ethanol . the cyclodextrin is dissolved in warm water . the two liquid portions are put together in formula weight ratios that range from 3 - 1 to 1 - 1 rotenone to cyclodextrin . this is part of the entire rotenone solution that the feed is soaked in to produce the poison fish food . a typical formulation for a 300 mg core would be as follows : ______________________________________cube root resin 22 mg ( 10 mg active rotenone ) synergist 2 mgadsorption agent 7 mg______________________________________ of course , in formulations having more active rotenone , the amounts of synergist and adsorption agent are increased proportionally . these substances are dissolved in an organic solvent ( ethanol , methanol , isopropanol , acetone , or ether ) and soaked into or sprayed on commercially available feed pellets . the feed pellets are then coated with an attractant layer to form the poison bait pellet . suitable binders include gelatine , agar , kelgin ™, algin potato starch , konjack flower , gum karaya , gum guar , and cellulose gum . such binders , oils or fats may also serve to coat the pellet for water resistance , particularly if a water soluble poison is employed . kelgin ® is a trademark of merckh & amp ; co . of rahway , n . j ., a hydrophillic colloid of algin compounds extracted from brown algae . another method of creating the bait is to introduce a rotenone formulation directly into a heat extrusion process . i have determined that rotenone can withstand exposure to temperatures of 150 ° c . for more than one hour without significant degradation . this will allow for the production of floating poison fish bait with a conventional feed extruder . the heat extrusion process of floating feed production operates at a temperature range of 100 °- 129 ° c . in this type of processing , the rotenone formulation would be mixed in with the rest of the feed ingredients before the feed pellet is heat extruded to produce a floating pellet . an antioxidant is added to aid in the preservation of the rotenone - laced feed . the preferred antioxidant is ethoxyquin ( 1 , 2 - dihydro - 6 - ethoxy - 2 , 2 , 4 - trimethylquinoline ) that is approved for fish feed at a rate of 150 mg / kg of feed . the size and location of the poison bait pellets , as well as the preferred minimum quantity of active rotenone per kilogram of fish body weight , are summarized as follows : ______________________________________targetspecies poison bait aqueous minimumrotenone / kg pellet size location active______________________________________common carp 2 - 5 cm . surface 20 mg ./ kg . grass carp 2 - 5 cm . surface 10 mg ./ kg . blue gill 0 . 1 - 1 cm . bottom or surface 10 mg ./ kg . bullhead 2 - 6 cm . bottom 15 mg ./ kg . sucker 0 . 25 - 1 cm . bottom 10 mg ./ kg . tilapia 1 - 4 cm . surface 20 mg ./ kg . ______________________________________ tests have shown that it is advantageous and desirable to train fish to feed on the bait pellets . fish have a home ranging behavior where different groups of the same species respond to feeders at various locations . in a series of tests targeting sterile triploid grass carp , floating feeders were anchored 20 to 50 meters from the edge of emergent vegetation or shoreline in a lake in water depths of 1 to 3 meters . buoyant pellets were prepared with desirable food and attractant and containing everything except the toxin rotenone . the training pellets were of small nugget size and dispensed twice a day in quantities ranging from 250 to 400 grams . after the feeding response was initiated and stabilized generally requiring a period of 10 to 25 days , 125 to 300 grams of pellets containing active rotenone about 10 milligrams per kilogram bait pellets were dispensed . on the follow day the dead fish were counted using the peterson method ( ricker , w . e . 1975 computation and interpretation of biological statistics of fish populations . bulletin fishery research board of canada 191 , 382p .). recovery rates from 50 to 100 % averaging 84 % were obtained . the formula used in the peterson method is n = m × c / r where n equals the estimated number killed , and m the number marked first day , c equals number of fish collected the second day , and r number of marked fish collected the second day . the marked fish had been previously collected with landing nets , marked with fin clips and returned to the lake . non - target fish found dead during 72 trials total 16 or an average of about 1 fish in every 5 trials . no effects on non - piscine wild life were observed . species present included otter , alligator , florida soft - shell turtle , bald eagle , osprey , anhinga , black vulture , turkey vulture , sandhill crane , great blue heron , common egret , snowy egret , swallow - tale kite , common grackle , and common gallinule . grass carp and common carp both feed on the surface at a fish feeder and are typically the first and largest fish to come to the feeder in a fish population . the size of the floating poison bait pellets in the range of 2 - 5 cm . will restrict other forms of fish from feeding on the bait . both types of carp seem to prefer fish food that contains some type of bread meal . a formulation of fish feed that contains yeast or bread crumbs is a preferred attractant . blue gill frequently become a problem in fisheries when they overpopulate and do not grow to desirable size . to be selective for blue gill , the poison bait pellets are in the 0 . 1 - 1 cm . range so the smaller fish in the blue gill population will eat them . blue gills tend to feed off the bottom of the aqueous environment so a poison bait pellet that sinks is more selective for this species , but this species is also known to feed from the surface on occasion . amino acids and nucleotides can be used as attractive agents for feeds . these amino acids and nucleotides are what tell the fish through its chemo receptors in the mouth that it has a food item it can eat . so by incorporating the specific amino acids and nucleotides in the feed that blue gill know as feed items , it is possible to attract them to the feed . the preferred amino acids are betaine , proline , glycine , and the preferred nucleotides are amp ( adensine monophosphate ) and imp inosine monophosphate . bull head are bottom feeders that rely on their sense of smell to locate food . the attractant of choice is heavy fish oil , fish meal , blood meal , or beef by - products . the poison bait pellets should sink and have a relatively large size of 2 - 6 cm . sucker species are largely bottom feeders that feed on invertebrates . a soft sinking poison bait pellet of small size in a range of 0 . 5 - 1 cm . is preferred and the preferred attractant is round tubifix worms to simulate natural feeding habits . tilapia , like carp , are attracted to yeast and bread crumbs and feed at the surface . however , tilapia prefer pellets in the range of 1 - 4 cm in width . though rotenone is preferred , it is to be understood that my method of controlling fish populations is not limited to this toxin only . other known toxins are juglone , antimycin a and toxaphene , for example . it is also known that various rotenone ( metabolites ) derivatives are toxic . these include 8 &# 39 ;- hydroxyrotenolones i and ii ; 6 &# 39 ;, 7 &# 39 ;- dihydro - 6 &# 39 ;, 7 &# 39 ; dihydroxyrotenolones i and ii ; 6 &# 39 ;, 7 &# 39 ;- dihydro - 6 &# 39 ;, 7 &# 39 ; dihydroxyrotenone ; 8 &# 39 ;- hydroxyrotenone ; and rotenolones i and ii . it is to be understood that there are many variants of the described methods , apparatuses , and formulations and that the scope of the invention is to be limited only to the scope of the claims herein . | 0 |
a central aspect of the present invention is the heretofore unnoticed complex formation between polyesters and carboxyl - containing compounds . such complexes may be used to facilitate slow release of the carboxyl - containing compounds in a variety of contexts , one including a concommittance with polyester hydrolysis . polyesters specifically tested include polyglycolide , polylactide and poly ( d ) l - lactide - co - polyglycolide ). persons having ordinary skill in the art understand that other polyesters , including those of other alpha - hydroxy carboxylic acids such as , e . g ., alpha hydroxybutyrate and the like will form analogous complexes . carboxyl - containing compounds specifically found to bind polyesters include acetylsalicylic acid ( aspirin ); ( s )-(+) 4 - isobutyl - α - methylphenylacetic acid ( ibuprofen ), benzoic acid , salicylic acid , phenoxyacetic acid and phenylacetic acid . the present invention includes synthesis of a polyglycolide and aspirin composite in which aspirin molecules are bound to the repeating units of polyglycolide . experimental evidence shows that at least one aspirin molecule may be bonded to each monomeric unit of polyglycolide . this binding , when equal amounts of aspirin and polyglycolide monomeric units are used , is about 1 : 1 . a 3 : 7 ratio has also been prepared . of course , if less aspirin is used , the ratio may be decreased at will . a 1 : 10 ratio or even lower may be suitable for some purposes . the polyglycolide / aspirin composite ( pac ) releases aspirin molecules as polyglycolide is degraded . the aspirin molecules would be made available to be physiologically effective . this physiological effect will involve reducing or eliminating inflammation and / or pain . pac may be ingested or inserted close to the site of the pain origin in order to be more effective as well as to extend the effect over a longer period of time . substitutes for polyglycolide such as polylactide or other polyesters may be used : polymers rich in ester groups but not polyesters , e . g ., polymethylmethacrylate should bind aspirin and the like . however , because they are not readily hydrolysable or biodegradable , such polymer composites are viewed as of more limited use . likewise , in place of aspirin , other substances , particularly those bearing free carboxyl groups may be used . for example , phenoxyacetic acid , salicylic acid an benzoic acid all have been found to interact with polyglycolide . simple homologs and derivatives of aspirin , such as those having halogen , methyl , methoxy , nitro and like substituents on the phenyl or acetyl will also form analogous polyester complexes . the preparation of these or other composites is analogous to that of pac and the formation similarly monitored . polyglycolide , prepared as previously reported ( ginde et al ., pinkus et al . ), and acetylsalicylic acid ( 99 +%), both in fmely powdered form , were mixed intimately in the ratio of 58 . 0 g . to 180 g ., respectively corresponding to the repeating unit molar amount of polyglycolide (— ch 2 coo —) and molecular weight of acetylsalicylic acid ( c 9 h 8 o 4 ). the mixture was heated in a sand or oil bath until it melted to a clear liquid . the clear liquid was then allowed to solidify . measurements were made on this material . the 1 h nuclear magnetic resonance ( nmr ) spectrum pac ( fig1 ) showed that the peak for the ch 2 protons of polyglycolide originally at δ4 . 91 ( fig2 ) was missing except for a small residual and had shifted far upfield to about 2 . 36 ( a shift of about 2 . 6 p . p . m .) next to the acetyl ch 3 peak of acetylsalicylic acid at about 2 . 41 δ . this showed that the ch 2 protons of the polyglycolide were shielded by the aspirin molecules . a likely interpretation is that an aspirin molecule is anchored to each carbonyl oxygen of polyglycolide by hydrogen bonding with the carboxyl hydrogen so that the benzene ring π - electron cloud is above the ch 2 group , resulting in shielding and requiring a higher magnetic field to bring these protons into resonance . a 1 hnmr spectrum of acetylsalicylic acid ( fig3 ) shows that the acetyl ( ch 3 c ═ o ) and benzene ring proton signals ( at 2 . 35 and about 7 - 8 δ , respectively ) do not change position much even considering that the latter spectrum is in cdcl 3 whereas the former spectra are in a cdcl 3 / cf 3 cood solution because of the insolubility of polyglycolide in most solvents ( hariharan et al .). an infrared spectrum ( fig4 ) shows the two strong carbonyl stretching peaks expected for the acetyl ester group in aspirin and the ester group in polyglycolide at 1695 and 1751 cm − 1 and a broad band & gt ; 3000 cm − 1 indicating strong hydrogen bonding . a melting temperature (* t m )/ composition plot ( fig5 ) also furnishes evidence for the 1 : 1 ratio between each aspirin molecule and each glycolide repeating unit [—( ch 2 coo )—]. it can be noted that the minimum tm value is close to the 50 % mole ratio indicating also a 1 : 1 correspondence of molecules of aspirin to the polyglycolide repeating unit . as an example of the various possible ratios of polyglycolide - aspirin combinations , a 30 : 70 mole ratio of polyglycolide monomer : aspirin is described . polyglycolide and aspirin were finely powdered and weighed . polyglycolide ( 0 . 116 g , 2 . 00 × 10 − 3 mole ) and aspirin ( 0 . 84 g , 4 . 70 × 10 − 3 mole ) in a flask under an argon atmosphere were heated in an oil bath to a temperature at which the lower - melting aspirin melted and dissolved the polyglycolide . on cooling , the melt solidified . the solid was powdered . hydrolysis was carried out with samples of the 30 : 70 polyglycolide monomer : aspirin mole ratio and polyglycolide alone for comparison as a standard . samples of polyglycolide approximately 0 . 3 g ( table 1 ) were weighed and transferred into clean centrifuge tubes . distilled water ( 15 ml ) was added to each tube and the mixtures were shaken in a water bath / shaker at 22 ° c . for various periods of time when selected samples were removed and centrifuged for about 5 minutes . aliquots of the clear supernatant solution were taken for analysis . aliquots were titrated with 0 . 0923 n naoh solution , using bromphenol blue indicator , for the glycolic acid hydrolysis product . results are in table 1 . since varying amounts of sample and aliquots of hydrolysis solution were taken , the volumes of naoh used were normalized to 1 . 0 g of sample and 1 . 0 ml of aliquot by dividing by the weights of samples and volumes of aliquots to give a corrected volume of naoh ( table 1 ). for polyglycolide hydrolysis , the corrected volume of naoh used in the titration is plotted against time of hydrolysis in fig6 . after an initial release of acid , hydrolysis proceeds at a moderate rate with time . for hydrolysis of the polyglycolide / aspirin combination , results are plotted in fig7 . after an initial fast acid release , further release of acid product levels off and then increases for about 72 hours , after which release of acid product increases slowly with time to 120 hours . for a 90 : 10 ( asp : polygly ) combination ( tm = 123 - 125 ° c . ): for a 0 . 3004 g . sample shaken for 3 hours , a 9 . 5 ml aliquot required 1 . 1 ml of 0 . 0923 n naoh . when this volume of naoh is normalized to account for the weight of sample and volume of aliquot , the corrected volume of naoh is 0 . 39 ml per g . sample per ml . aliquot . this can be compared with the normalized volume of 0 . 12 ml of naoh required for the corresponding 3 hour hydrolysis of the 70 : 30 mole ratio combination , over a three - fold increase in the release rate on this basis of comparison . this shows that the rate of release of aspirin can be controlled by the mole ratio of the aspirin : polyglycolide combination . for the 95 : 5 ( asp : polygly ) combination ( tm - 123 - 125 ° c . ): for a 0 . 3009 g . sample shaken for 3 hours , a 9 . 5 ml aliquot required 1 . 31 ml of 0 . 0923 n naoh . when this volume of naoh is normalized to account for the weight of sample and volume of aliquot , the corrected volume of naoh is 0 . 46 ml per g . sample per ml . aliquot , an increase over the 90 : 10 combination . this is further evidence that the rate of release of aspirin can be controlled by the mole ratio of the aspirin : polyglycolide combination . it is evident that when aspirin is combined in a homogeneous manner with polyglycolide , release is substantially modified since although aspirin readily dissolves in water to the extent of 1 gram / 300 ml at 25 ° c ., for the 30 : 70 mole ratio polyglycolide : aspirin combination ( where aspirin is present to the extent of 88 % by weight ), only a small amount of aspirin and combined aspirin - glycolic acid is released even after 5 days of shaking a powdered sample with water . the rate of release can be increased by increasing the % of aspirin in the combination . using aspirin alone ( sample of 0 . 3019 g comparable to amounts used with polyglycolide combinations ), after shaking 3 hours with 15 ml of water , an aliquot of the solution ( 14 ml ) required 2 . 6 ml of 0 . 0923n naoh . on calculation , this corresponds approximately to the solubility of aspirin in water as expected . this contasts markedly with the slow release from the 30 : 70 mole % combination ( containing ˜ 88 % aspirin ). the trial runs involved only 0 . 1 g of polyglycolide in 15 ml distilled water . the hydrolysis for the recorded trials is explained here . the hydrolysis was carried out in a water bath / shaker at room temperature ( 22 ° c .). samples weighing approximately 0 . 30 g were weighed out into clean centrifuge tubes ( 1 ml ). each tube was then filled with 15 ml of distilled water . four tubes were prepared in this manner . they were labeled pg1 ( 48 and 72 hours ), pg2 ( 96 and 120 hours ), pg3 ( 24 hours ), pg4 ( 1 and 3 hours ). all the tubes were placed in the bath for their allotted times . from each tube , after centrifuging for about 5 minutes , an aliquot of about 7 . 0 - 7 . 5 ml in volume was taken . the aliquots were representative of the time that the sample was allowed to hydrolyze for . for example , pg1 was removed after 48 hours and a 7 . ml aliquot was removed and then titrated . pg1 was then put back into the bath for its remaining allotted time — 72 hours . then a second aliquot was removed and then titrated . the titrations involved the use of a 1 . 0 ml syringe to dispense the 0 . 0923 n naoh basic solution into the aliquots . since glycolic acid was the expected product of hydrolysis , an indicator was chosen to match its ph range to the pka of glycolic acid ( 3 . 83 ). bromophenol blue was chosen because its ph range is 3 . 0 - 4 . 6 . about three drops of indicator were added to the aliquots . the aliquots were titrated from a yellow color to the faintest tinge of purple . the procedure for the hydrolysis of the combination was essentially the same as for the polyglycolide . the amount of samples were the same as well as the amounts of water added and aliquots removed . time intervals were the same . fig8 and table 3 show a summary of the poly : asp hydrolysis data . note the nice straight line for the plot of mole ratio vs . normalized ( corrected ) volume of naoh per g of sample per ml of aliquot titrated . the rate of release can be determined from the polygly : asp mole ratio . ( this is for a three hour hydrolysis . further studies will be carried out for longer times and with other hydrolysis mixtures .) polylactide and copolymers of polylactide and polyglycolide are also used as biodegradable materials . in view of the success with the homogeneous dispersal of aspirin in polyglycolide , the dispersal of aspirin in polylactide and polylactide / polyglycolide copolymers was investigated . although a few references have appeared for the use of polylactide and its copolymers with polyglycolide for controlled release , none of these have incorporated aspirin according to the processes described herein . the reagents were commercially purchased compounds . the polylactide was about 96 % l - isomer . t m was determined to be about 138 ° c . the amount of polylactide used was based on the repeating unit (— chch 3 coo —) per molecule of aspirin . the aspirin ( acetylsalicylic acid or 2 - acetoxybenzoic acid ) t m was 138 - 140 ° c . the two components were mixed in powdered form in a flask protected by a drying tube in the amounts , 0 . 147 g ( 0 . 00204 mol ) polylactide and 0 . 353 g ( 0 . 00202 mol ) aspirin and heated in an oil bath until the mixture just melted to a clear homogeneous liquid , at which point the flask was allowed to cool to room temperature . the temperature was kept as low as possible and reagents were not heated any longer than necessary to liquefy them in order to avoid any possible decomposition . the solid product was powdered and t m determined to be 129 - 132 ° c . the poly [ dl - lactide - co - glycolide )] ( 65 : 35 ) ( i ) was a commercially purchased material . the mole ratio was based on the repeating unit , (— chch 3 coo —) 65 -(— ch 2 coo —) 35 assuming that each repeating unit hydrogen - bonds to two aspirin molecules or a ratio of aspirin : i of ( 180 × 2 ): 67 . 1 ( in grams ). the procedure was the same as that described above for polylactide . the two components were mixed in the ratio of aspirin ( 0 . 608 g , 0 . 00338 mol ) to i ( 0 . 138 g , 0 . 00206 mol ) or 0 . 00338 × 2 mol aspirin to 0 . 00206 mol of i or 3 . 28 aspirin : 1 . 00 mol of i . this mixture became a clear liquid with the oil bath at about 138 ° c . tm of the solid obtained after cooling was 128 - 131 ° c . other polylactide / polyglycolide copolymers are commercially available , such as poly ( dl - lactide - co - glycolide ) ( 85 : 15 ), ( 75 : 25 ), and ( 50 : 50 ). it is evident that similar combinations of these and aspirin may be prepared . based on the successful combination of aspirin and polyglycolide , the application of the method used was applied to ibuprofen as an example of another commonly used medicinal containing a carboxyl group . this experiment is described . two different brands of commercially purchased ibuprofen [( s )-(+)- 4 - isobutyl - α - methylphenylacetic acid ] were used , m . p . 51 - 53 ° c . polyglycolide was synthesized by a published procedure ( pinkus , a . g . et al . 1984 ), m . p . 212 - 214 ° c . the reagents in powdered form were mixed in the proportions , polyglycolide ( 0 . 116 g , 0 . 002 mol ) to ibuprofen ( 0 . 383 g , 0 . 00186 mol ) ( 2nd sample : 0 . 381 g , 0 . 00185 mol ) and heated in a moisture - protected flask by the procedure described above for polylactide . t m of the solid products obtained were 186 - 189 ° c . another medicinal that is commonly used for relief of pain and contains a carboxyl group is “ naproxen ” ( 6 - methoxynaphthyl - 2 - propanoic acid ). the melting point for the commercially obtained material was 157 - 158 ° c . however , when the same procedure was used with a mixture consisting of naproxen and polyglycolide , the mixture turned dark , an apparent decomposition . these were prepared by the same procedures as described above to demonstrate the generality of the method . among the carboxylic acids used were : benzoic acid , salicylic acid , and phenylacetic acid . it is thought that hydrogen - bonding of the carboxylate group of the carboxylic acid to the oxygens of the polyglycolide facilitates the combination . in the cases where the molar ratio of the acid to the repeating units of polyglycolide exceeds a 1 : 1 ratio for aspirin , additional hydrogen - bonding of the carboxylate group to the oxygens of the ortho - acetoxy group of aspirin can also take place . the following references are incorporated by reference herein for the reasons cited above . anon . ( usa ) sustained release compositions . res . discl . 1985 , 259 , 567 - 570 . ( chem . abstr ., 1986 , 104 , 116017 ) asch , r . h . ; rojas , f . j . ; tice , t . r . ; schally , a . v . studies of a controlled - release microcapsule formulation of an lh - rh agonist ( d - trp - 6 - lh - rh ) in the rhesus monkey menstrual cycle . int . j . fertil . 1985 , 30 , 19 - 26 . ( chem . abstr ., 1986 , 104 , 116019 ) bechgaard , h . ; gravensev , p . o . ; petersen , a . m . rate of drug release from intact and subdivided tablets , arch . pharm . chemi , sci . ed . 1977 , 5 , 21 - 22 . ( chem . abstr ., 1977 , 86 , 195155 ) blume , h . ; scheidel , b . ; siewert , m . ; wendt , g . bioavailability of acetylsaltcylic acid based analgesics . 6 . bioavailability of two immediate - release asa tablet formulations . pz wiss . 1993 , 6 , 59 - 64 . ( chem . abstr ., 1993 , 119 , 125048 ) blume , h . ; u . gundert - remy ; möller , h ., eds . controlled / modified release products . recommendation in support of ec - guidelines , stuttgart , ger . : wissenschaftliche verlagsgesellschaft mbh , 1991 . brantmark , b . ; waahlin - boll , e . ; melander , a . bioavailability of acetylsalicylic acid and salicylic acid from rapid and slow - release formulations , and in combination with dipyridamol . eur . j . clin . pharmacol . 1982 , 22 , 309 - 314 . ( chem . abstr ., 1982 , 97 , 98248 ) casadio , s . ; sclavi , e . ; perego , r . acetylsalicylic acid - containing drugs with sustained release , ger . offen . 2 , 149 , 699 , apr . 13 , 1972 , brit . appl . 48 , 167 / 70 , oct . 9 , 1970 . ( chem . abstr ., 1972 , 77 , 1972 ) chapman , d . g . ; shenoy , k . g . ; campbell , j . a . sustained release of drugs in certain drug - resin complexes as judged by urinary excretion rates , can . med . assoc . j . 1959 , 81 , 470476 . ( chem . abstr ., 1960 , 54 , 4904 . charles , h . sustained - release aspirin . pct int . appl . wo 84 00 , 004 , jan . 5 , 1984 , us appl . 388 , 183 , jun . 14 , 1982 . ( chem . abstr ., 1984 , 100 , 126906 ) charman , w . n . ; charman , s . a . ; monkhouse , d . c . ; frisbee , s . e . ; lockhart , e . a . ; weisman , s . ; fitzgerald , g . a . biopharmaceutical characterization of a low - dose ( 75 mg ) controlled - release aspirin formulation , br . j . clin . pharmacol ., 1993 , 36 , 470473 . ( chem . abstr ., 1994 , 120 , 14804 ) chen , c . m . controlled - release tablets comprising coated cores and peg coatings . u . s . pat . no . 5 , 458 , oct . 17 , 1995 , u . s . appl . ser . no . 205 , 005 , mar . 2 , 1994 . ( chem . abstr ., 1995 , 123 , 350294 ) chick , j . a . programmed - release compositions containing acetylsalicylic acid and dihydroergotamine . fr . demande 2 , 539 , 989 aug . 3 , 1984 , appl . 83 / 1 , 577 , jan 28 , 1983 . ( chem . abstr ., 1984 , 101 , 235613 ) chick , j . a . programmed - release pharmaceuticals containing acetylsalicylic acid . eur . pat . appl . ep 115 , 986 , aug . 15 , 1984 , fr . appl . 83 / 1 , 576 , jan . 28 , 1983 . ( chem . abstr ., 1984 , 101 , 157704 ) choudhury , s . ; mitra , a . k . kinetics of aspirin hydrolysis and stabilization in the presence of 2 - hydroxypropyl b - cyclodextrin , pharm . res ., 1993 , 10 , 156 - 159 . chowdary , k . p . r . ; rao , g . n . studies on a new technique of microencapsulation : part v . microencapsulation of aspirin by ethyl cellulose . indian drugs , 1985 , 22 , 479 - 481 . ( chem . abstr ., 1985 , 103 , 183511 ) deasy , p . b . ; murtaugh , p . w . controlled release antiplatelet product containing dipyridamole and aspirin , proc . int . symp . controlled release bioact . mater ., 20th , 1993 , 286 - 287 . ed . by roseman , t . j . et al ., controlled release soc . : deerfield , ill . ( chem . abstr ., 1993 , 119 , 233957 ) dong . c . ; rogers , j . a . acacia - gelatin microencapsulated liposomes : preparation , stability , and release of acetylsalicylic acid , pharm . res ., 1993 , 10 , 141 - 146 . ( chem abstr ., 1993 , 118 , 87535 ) dunn , j . m . sustained - release aspirin formulation . u . s . pat . no . 4 , 520 , 009 , may 28 , 1985 , appl . 555 , 700 , nov . 28 , 1983 . ( chem . abstr ., 1985 , 103 , 42671 ) dunn , j . m . ; lampard , j . f . controlled release formulations of orally - active medicaments . u . s . pat . no . 4 , 308 , 251 , dec . 29 , 1981 , us appl . 111 , 430 , jan . 11 , 1980 ; cont .- in - part of u . s . ser . no . 111 , 430 , abandoned . ( chem . abstr ., 1982 , 96 , 74636 ) dunn , j . m . ; lampard , j . f . pharmaceutical composition with a prolonged effect . fr . demande 2 , 473 , 308 , jul . 17 , 1981 , u . s . appl . ser . no . 111 , 430 , jan . 11 , 1980 . ( chem . abstr ., 1981 , 95 , 225675 ) dunn . j . m . constant order release aspirin composition and method of treating arthritis . u . s . pat . no . 4 , 375 , 468 , mar . 1 , 1983 , u . s . appl . ser . no . 282 , 544 , jul . 13 , 1981 ; cont . of u . s . ser . no . 282 , 544 , abandoned . ( chem . abstr ., 1983 , 98 , 185604 ) fong , j . w . microspheres . u . s . pat . no . 4 , 166 , 899 , sep . 4 , 1979 , u . s . appl . ser . no . 827 , 710 . ( chem . abstr ., 1980 . 92 , 28581 ) froemming , k . h . ; topaloglu , y . influence of ethanol on the in vitro and in vivo drug release from some sustained release tablets . arzneim .- forsch . 1975 , 25 , 1958 - 1964 . ( chem . abstr ., 1976 , 84 , 99089 ) fujimoto , m . aspirin - dextrin inclusion compounds . jpn . kokai tokkyo koho 78 , 124 , 607 , oct . 31 , 1978 , appl . 77 / 39 , 791 , apr . 6 , 1977 . ( chem . abstr ., 1979 , 90 , 76581 ) gaudy , d . ; michel , j . p . ; maillols , h . ; rolim , p . ; acquier , r . ; delonca , h . controlled - release acetylsalicylic acid hydrophilic matrix tablets , congr . int . technol . pharm . 6th 1992 , 3 , 365 - 372 . ( chem . abstr ., 1993 , 119 , 55997 ) ginde et al ., appl . polym . sci ., 1987 , 33 , 2411 - 2429 . guy , m . g . ; powers , r . g . timed - release aspirin u . s . pat no . 4 , 025 , 613 , may 24 , 1977 , appl . 163 , 739 . jul . 19 , 1971 . ( chem . abstr ., 1977 , 87 , 44251 ) habib , f . s . ; el - sourady , h . a . ; mohamed , s . e . effect of certain additives on the diffusion characteristics of aspirin , salicylamide , and phenacetin through a cellophane membrane . ii . effect of aliphatic acids and polyethylene glycol . bull . pharm . sci . assiut univ . 1984 , 7 , 398417 . ( chem . abstr . 1986 , 104 , 174526 ) hosoi , f . ; saito , k . ; makuuchi , k . ; koishi , m . use of porous particles for preparation of capsules containing aspirin and drug release properties . kobunshi ronbunshu , 1985 , 42 , 415422 . ( chem . abstr ., 1985 , 103 , 166045 ) hutchinson , f . g . ; furr , b . j . a ., biochem . soc . trans ., 1985 , 13 , 520 - 523 . ( chem . abstr ., 1985 , 103 , 42567 ) ikada , y . ; gen , j . sustained - release pharmaceuticals containing lactic acid polymers . jpn . kokai tokkyo koho jp 60 , 181 , 029 [ 85 , 181 , 029 ], sept . 14 , 1985 , appl . 84 / 36 , 127 , feb . 29 , 1984 . ( chem . abstr ., 1986 , 104 , 39744 ) ishii , y . ; yamakawa , i . ; watanabe , s . sustained - release preparations for bone implants . jpn . kokai tokkyo koho jp 7 , 157 , 439 , june 20 , 1995 , appl . 93 / 339 , 812 , dec . 7 , 1993 . ( chem . abstr ., 1995 , 123 , 179584 ) karahalios , w . j . ; sawyer , w . t . ; rittase , r . a . ; maynard , s . a . comparative bioavailability of sustained - release and uncoated aspirin tablets . am . hosp . pharm . 1981 , 38 , 1754 - 1756 . ( chem . abstr ., 1982 , 96 , 11606 ) kawashima , y . ; li , s . y . ; kasai , a . ; handa , t . ; takenaka , h . preparation of a prolonged - release tablet of aspirin with chitosan . chem . pharm . bull ., 1985 , 33 , 2107 - 2113 . ( chem . abstr ., 1985 , 103 , 42571 ) khan , m . h . ; alam , m . the in vitro study of sustained release aspirin tablet with polyethylene resin as insoluble matrix . pak . j . sci . ind . res . 1980 , 23 , 283 - 286 . ( chem . abstr ., 1981 , 95 , 49299 ) kitajima et al . ( ger . offen . 2 , 001 , 726 , july 23 , 1970 , japan ) chem . abstr ., 1979 , 73 , 78221 . kitajima , m . ; kondo , a . ; yamaguchi , t . ; muroya , n . encapsulation with polymeric materials , ger . offen . 2 , 001 , 726 , july 23 , 1970 , japan . appl . jan . 16 - 17 , 1969 . ( chem . abstr ., 1970 , 73 , 78221 ) kydonieus , a ., ed . treatise on controlled drug delivery , new york : marcel dekker , 1991 . li , f . ; gu , z . ; li , g . ; feng , x . copolymer of 1 -( acetylsalicyloyloxy ) ethyl methacrylate and its hydrolysis . gaofenzi tongxun , 1984 , ( 5 ), 393 - 396 . ( chem . abstr ., 1985 , 102 , 190971 ) li , s . p . ; pendharkar , c . m . ; mehta , g . n . ; karth , m . g . ; feld , k . m . sucralfate as a bioadshesive gastric intestinal retention system : preliminary evaluation , drug . dev . ind . pharm ., 1993 , 19 , 2519 - 2537 . ( chem . abstr ., 1994 , 120 , 14821 ) linhardt . r . j . biodegradable polymers for controlled release of drugs . chap . 2 , p 82 in rosoff , m . controlled release of drugs ( see ref . below ). lobeck , f . ; spigiel , r . w . bioavailability of sustained - release aspirin preparations . clin . pharm . 1986 , 5 , 236 - 238 . ( chem . abstr ., 1986 , 104 , 174521 ) molloy , t . p . ; lee , d . ; chopra , s . k . method for production of solid pharmaceutical dosage forms , ptc int . appl . wo 92 11 , 845 jul . 23 , 1992 , gb appl . 91 / 40 , jan . 3 , 1991 & gt ; ( chem . abstr ., 1993 , 118 , 27464 ) murakami , y . ; asakura , s . ; nakade , t . manufacture of sustained - release pharmaceutical microspheres . jpn . kakai tokkyo koho jp 04 , 360 , 825 [ 92 , 360 , 825 ], dec . 14 , 1992 , appl . 91 / 159 , 797 , jun . 3 , 1991 . ( chem . abstr ., 1993 , 118 , 154584 ) naplatanova , d . ; tyutyulkova , n . ; tomasini , l . depo - acetysal tablets . farmatsiya ( sofia ), 1972 , 22 , 17 - 21 . ( chem . abstr ., 1972 , 76 , 158288 ) narayanan , k . s . ; taylor , p . d . sustained - release , n - substituted pyrrolidone esters of pharmaceuticals and process for their use , u . s . pat . no . 5 , 206 , 386 apr . 27 , 1993 , appl . ser . no . 675 , 367 , mar . 20 , 1991 . ( chem . abstr ., 1993 , 119 , 160092 ) nikolayev , a . s . ; gebre - mariam , t . preparation and bioavailability studies of aspirin ethyl cellulose microcapsules . indian drugs , 1993 , 30 , 392 - 397 . ( chem . abstr ., 1993 , 119 , 210484 ) pinkus etal ., j . polym . sci ., polym . chem . ed ., 1984 , 22 , 1131 - 1140 . plaizier - vercammen , j . a . ; van den bossche , h . pharm . ind ., 1992 , 54 , 973 - 977 . ( chem . abstr ., 1993 , 119 , 55854 ) ramstack , j . m . ; herbert , p . f . ; strobel , j . ; atkins , t . j . ; hazrati , a . m . preparation of biodegradable microparticles containing a biologically active agent . pct int . appl . wo 95 13 , 799 , may 26 , 1995 , u . s . appl . ser . 154 , 409 , nov . 19 , 1993 . ( chem . abstr . 1995 , 123 , 179481 ) rehders , k . ; simrock , r . ; spahn , h . ; mutschler , e . ; breddin , h . k . plasma salicylate levels and chronic administration of slow release acetylsalicylic acid ( monobeltin ). eur . j . clin . pharmacol . 1985 , 27 , 683 - 687 . ( chem . abstr ., 1985 , 102 , 172550 ) rettenmaier , j . jr . coated cellulose particles for direct drug tableting . ger . offen . de 4 , 121 , 127 , jan . 14 , 1993 . ( chem . abstr ., 1993 , 118 , 132173 ) roberts , m . s . ; mcleod , l . j . ; cossum , p . a . ; vial , j . h . eur . j . clin . pharmacol . 1984 , 27 , 67 - 74 . ( chem . abstr ., 1985 , 102 , 12274 ) roseman , t . j . ; mansdorf , s . z ., eds . controlled release delivery systems , new york : marcel dekker , 1983 . rosoff , m ., ed . controlled release of drugs : polymers and aggregate systems , new york : vch publishers , 1989 . sakauchi , n . ; kawakami , m . sustained release pharmaceuticals . jpn . kokai tokkyo koho 79 , 154 , 515 , dec . 5 , 1979 , appl . 78 , 61 , 048 , may 1 , 1978 . ( chem . abstr . 1980 , 92 , 203591 ) schoen et al . ( ger . offen . 1 , 917 , 738 , oct . 8 , 1970 ; app . apr . 5 , 1969 ) chem . abstr ., 1971 , 74 , 4375 . schoen , n . ; pampus , g . ; schnoering , h . embedding or encapsulating solid or liquid substances in polymers containing carboxyl or carboxylate groups ( ger . offen . 1 , 917 , 738 , oct . 8 , 1970 , appl . apr . 5 , 1969 . ( chem . abstr ., 1971 , sharma , c . p . ; paul , w . poly ( vinyl alcohol ) dialysis membranes : permeability changes due to aspirin release , polym . mater . sci . eng ., 1992 , 66 , 495 - 496 . ( chem . abstr ., 1993 , 119 , 80169 ). shell , j . w . alkyl - substituted cellulose - based sustained - release oral drug dosage forms , pct int . appl . wo 93 18 , 755 . sep . 30 , 1993 , u . s . appl . ser . no . 858 , 320 , mar . 25 , 1992 . ( chem . abstr ., 1993 , 119 , 256550 ) stivic , i . ; senjkovic , r . ion exchangers and sustained release action of drugs , acta pharm . jugosl . 1974 , 24 , 249 - 258 . ( chem . abstr ., 1975 , 82 , 116048 ) streuff , b . ; puetter , j . slow - release acetylsalicylic acid oral formulations . ger . offen . de 3 , 346 , 571 , jul . 4 , 1985 , appl . dec . 23 , 1983 . ( chem . abstr ., 1985 , 103 , 129080 ) struszczyk , h . ; boldowicz , d . conception of microcrystalline application as polymeric carriers for the controlled release of the acetylsalicylic acid . cellul . chem . technol . 1986 , 20 , 201 - 207 . ( chem . abstr ., 1986 , 105 , 48903 ) super , h . et al . polymer bull ., 1994 , 32 , 509 - 515 tanner , d . w . ; gardner , r . f . g . polymeric coating of aspirin . brit . 1 , 109 , 425 , apr . 10 , 1968 , appl . jun . 16 , 1964 . ( chem . abstr ., 1968 , 68 , 107899 ) tarcha , p . j ., ed . polymers for controlled delivery , boca raton , fla . : crc press , 1991 . thanoo , b . c . ; sunny , m . c . ; jayakrishnan , a . controlled release of oral drugs from crosslinked polyvinyl alcohol microspheres . j . pharm . pharmacol . 1993 , 45 , 16 - 20 . ( chem . abstr ., 1993 , 118 , 87566 ) thanoo , b . c . ; sunny , m . c . ; jayakrishnan , a . oral sustained - release drug delivery systems using polycarbonate microspheres capable of floating on the gastric fluid . j . pharm . pharmacol . 1993 , 45 , 21 - 24 . ( chem . abstr ., 1993 , 118 , 87567 ) torrado , s . ; torrado , susana ; torrado , v . j . “ in vitro ” drug release of aas matrix tablets , proc . int . symp . controlled release bioact . mater ., 20th 1993 , 370 - 371 ; ed . by roseman , t . j . et . al . controlled release soc ., deerfield , ill . ( chem . abstr ., 1993 , 119 , 278520 ) tu , x . ; mao , f . ; li , j . sustained - release aspirin tablets . nanjing yaoxueyuan xuebao 1986 , 17 , 107 - 112 . ( chem . abstr ., 1986 , 105 , 102450 ) wang , d . p . ; tu , t . c . ; yeh , m . k . a study of slow - release dosage form ( iii ), zhonghua yaoxue zazhi , 1993 , 45 , 163 - 170 . ( chem . abstr ., 1993 , 119 , 80099 ) wheatley , t . a . ; bridges , c . i ., jr . ; steuernagel , c . r . filn - forming compositions for coating pharmaceuticals , u . s . u . s . pat . no . 5 , 206 , 030 , apr . 27 , 1993 , u . s . appl . ser . no . 484 , 309 . feb . 26 , 1990 . ( chem . abstr ., 1993 , 119 , 80229 ) wilson , c . g . ; parr , g . d . ; kennerly , j . w . ; taylor , m . j . ; davis , s . s . ; hardy , j . g . ; rees , j . a . pharmacokinetics and in vivo scintigraphic monitoring of a sustained - release acetylsalicylic acid formulation . int . j . pharm . 1984 , 18 , 1 - 8 . ( chem . abstr ., 1985 , 103 , 180025 ) yanaihara , h . ; nakano , s . ; murakami , k . ; hukuda , t . ; ogawa , n . pharnacokinetics of acetylsalicylic acid and salicylic acid from slow - release formulations of aspirin in healthy japanese volunteers . rinsho yakuri 1985 , 16 , 589 - 596 . ( chem . abstr ., 1986 , 104 , 10520 ) yoles , s . ; sartori , m . f . in controlled rel . technol . methods theory applic . 1980 , 2 , p . 1 .. ( linhardt , see ref .) it is understood that , given the directions provided herein , persons having skill in the art will , with no more than a reasonable amount of experimentation , be able to form complexes of other ester - rich polymers with other carboxyl - containing compounds . | 0 |
fig1 is a block diagram of an improved computer system 100 that benefits by the incorporation of embodiments of the present invention . the improved computer system 100 includes an nvidia nforce ™ 2 integrated graphics processor ( igp ) 110 , an nforce2 media communications processor ( mcp 2 ) 120 , memory 112 and 114 , cpu 116 , optional graphics processor 118 and frame buffer 140 , monitor 122 , scanner or camera 134 , mouse , keyboard , and printer 136 , hard drives 138 , soft modem 142 , ethernet network or lan 146 , and audio system 148 . this revolutionary system architecture has been designed around a distributed processing platform , which frees up the cpu to perform tasks best suited to it . specifically , the nforce2 igp 110 may include a graphics processing unit ( gpu ) ( not shown ) which is able to perform graphics computations previously left to the cpu 116 . alternately , the nforce2 igp 110 may interface to an optional gpu 118 which performs these computations . also , nforce2 mcp 2 120 includes an audio processing unit ( apu ), which is capable of performing many of the audio computations previously done by the cpu 116 . in this way , the cpu is free to perform its tasks more efficiently . also , by incorporating a suite of networking and communications technologies such as usb and ethernet , the nforce2 mcp 2 120 is able to perform much of the communication tasks that were previously the responsibility of the cpu 116 . in this architecture , the nforce2 igp 110 communicates with memories 112 and 114 over buses 113 and 115 . the nforce2 igp 110 also interfaces to an optional graphics processor 118 over an advanced agp bus 117 . in various computer systems , optional processor 118 may be removed , and the monitor 122 may be driven by the nforce2 igp 110 directly . in other systems , there may be more than one monitor 122 , some or all of which are coupled to optional graphics processor 118 or the nforce2 igp 110 directly . the nforce2 igp 110 communicates with the nforce2 mcp 2 120 over a hypertransport ™ link 121 . the optional graphics processor 118 may also interface with external memory , which is not shown in this example . the nforce2 mcp 2 120 contains controllers for ethernet connections 146 and soft modem 142 . the nforce2 mcp 120 also includes interfaces for a mouse , keyboard , and printer 136 , and usb ports for cameras and scanners 134 and hard drives 138 . this arrangement allows the cpu 116 , the nforce2 igp 110 , and the nforce2 mcp 2 120 , to perform processing independently , concurrently , and in a parallel fashion . embodiments of the present invention may be incorporated into an integrated circuit device that performs several functions , such as the nforce2 mcp 2 120 . also , they may be incorporated into integrated circuits that are dedicated to performing graphics functions , such as the graphics processor 118 or other dedicated graphics processor . alternately , they may be incorporated into other types of integrated circuits . fig2 is a block diagram of a shader and related circuitry that may be improved by incorporating an embodiment of the present invention . this block diagram includes a shader quad distributor 210 , x y , coverage , and state bundle fifo 220 , four shaders including quad 0 232 , quad 1 234 , quad 2 236 , and quad 3 238 , level 2 cache 240 , shader quad collector 250 , raster operations circuit 260 , and frame buffer 270 . in a typical embodiment of the present invention , the frame buffer 270 to is on a memory integrated circuit , while the other circuits are on a separate integrated circuit , such as a graphics processor . this figure , as with all the included figures , is shown for exemplary purposes only and does not limit either the possible embodiments of the present invention or the claims . pixel information is received on lines 212 by the shader quad distributor 210 from a rasterizer circuit ( not shown ), typically in groups of four that are referred to as pixel quads . shader instructions are received by the shader quad distributor 210 on lines 214 from a program compiler circuit . the shader quad distributor 210 in turn provides pixel quads to the shaders 232 , 234 , 236 , 238 . x , y , coverage , and state bundle information bypasses the shaders via fifo 220 . the shaders receive the pixel quads from the shader quad distributor 210 . the shaders 232 , 234 , 236 , and 238 receive texture information from the frame buffer 270 via the level 2 cache 240 . this texture information may be entire textures , or portions of textures . the shaders and fifo 220 provide pixels and other information to the shader quad collector 250 , which in turn provides them to the raster operations circuit 260 . completed pixels are stored by the raster operations circuit 260 in the frame buffer 270 . similarly , textures are stored in the frame buffer 270 and provided to the level 2 cache 240 for use by the shaders 232 , 234 , 236 , and 238 . fig3 is a more detailed block diagram of a shader that may be improved by incorporating embodiments of the present invention . this block diagram includes a shader attribute interpolator 310 , shader computation top 320 , texture circuit 330 , shader mapper back end 340 , shader computation bottom 350 , and shader register file 360 . pixel information is received by the shader attribute interpolator 310 from a pixel quad distributor ( not shown ). the shader attribute interpolator 310 provides pixel information to the shader computation top 320 , which in turn provides outputs to the texture circuit 330 . the texture circuit 330 receives textures or portions of textures from a frame buffer ( not shown ). in a specific embodiment , the texture circuit 330 receives textures or texture portions from a frame buffer via a level 2 cache . the texture circuit 330 performs various tasks such as bilinear or trilinear filtering . the texture circuit 330 provides outputs to the shader remapper backend 340 , which in turn provides outputs to the shader competition bottom 350 . when the pixels are completed , they are provided to a raster operations circuit ( not shown ). if processing is not complete , the shader computation bottom provides them back to the shader computation top 320 for further processing . one trip through the shader from the shader computation top 320 to the shader computation bottom 350 and back to the top is referred to as a shader pass . the texture circuit 330 receives a certain number of bits of information from the level 2 cache during each read cycle . again however , a texture may be larger than this number of bits . for example in a specific embodiment of the present invention , the texture circuit 330 reads 32 bits at a time from a level 2 cache . in this specific embodiment however , a texture may have one of at least three different sizes , specifically 32 bits , 64 bits , or 128 bits . in this specific embodiment , a 32 - bit texture is referred to as a “ thin ” texture , a 128 bit texture is referred to as a “ fat ” texture , while a 64 - bit texture is referred to as a “ semi - fat ” texture . accordingly , one , two , or four read instructions may be needed by the texture circuit 330 to read an entire texture . that is , a texture of 32 bits may be read in a single read cycle , while 64 - bit textures are read in two 32 - bit portions , while 128 bit textures are read in four 32 - bit portions . since it can take more than one read cycle to read an entire texture from memory , given the pipelined loop nature of the shader , it can take more than one shader pass to complete an instruction to read a texture . accordingly , during these extra passes , the computational potential of the other circuits , such as the shader computation top 320 , shader remapper back end 340 , and shader computation bottom 350 , are wasted . accordingly , a specific embodiment of the present invention provides instructions for a partial texture load . for example , an instruction may be issued to read one - half of a texture , or one - fourth of a texture . the textures themselves may be divided into two halves , for example , alpha and red in one - half and green and blue in the other half . the texture may then be read using two instructions . similarly , a texture may be divided in into fourths , for example alpha , red , green , and blue each in one quarter , and read using four instructions . textures may be divided in other ways as well , for example w , x , y , and z values may be separated in two or more groups , each read with an individual command . while each of these instructions is being executed by the texture circuit 330 , the other circuits may perform other instructions . for example , while the texture circuit 330 is reading a first portion of a texture , the shader computation top 320 and shader competition bottom 350 may be performing first and second instructions . during the next pass , while the texture circuit 330 is reading a second portion of the texture , the shader computation top 320 and shader computation bottom 350 may be performing third and fourth instructions . fig4 is an exemplary portion of a shader program that may be improved by incorporation of an embodiment of the present invention . in this simple example , the shader performs instructions 410 , 415 , and 420 . in this example , only instructions to read a texture are available , that is , partial texture load instructions are not available . also , there is no mechanism to reorder the three instructions into a more efficient sequence . as can be seen , five passes through the shader are required to complete the performance of these three instructions . in this specific example , values stored in registers r 0 and r 2 are available , while a texture to be stored in r 1 is unavailable to the shader and must be retrieved from a frame buffer , for example via a level 2 cache . during a first pass 430 , the shader computational top is active and performs instruction 410 , that is it multiplies the contents of register r 0 with itself and stores the result in register r 0 . the texture circuit is also active , and reads the first 32 bits of a texture to be stored in register r 1 . during a second pass 440 , the texture circuit retrieves more of the texture from memory and stores it in register r 1 . similarly , during a third pass 450 , a third texture portion read is performed . on a fourth pass 460 , the last bits of the texture are retrieved from memory and stored in r 1 . a this time , the texture stored in r 1 is available to the shader . accordingly , during the fourth pass 460 , during the next clock cycle , the shader computation bottom is active and performs the second instruction 415 , that is , it multiplies the contents in register r 0 and r 1 and stores the product in register r 1 . during a fifth pass , the shader computational top performs the third instruction 420 , that is the contents of register r 2 are multiplied and the result stored back in register r 2 . fig5 illustrates a method by which instructions may be reordered according to an embodiment of the present invention . included are an original sequence of instructions 510 and a reordered sequence of instructions 520 . the original sequence of instructions includes instruction 1 512 , which requires texture 0 , instruction 2 514 , which requires textures 0 and 1 , and instruction 3 516 , which requires texture 2 . in this particular example , textures 0 and 2 are available to the shader in registers , while texture 1 needs to be retrieved from memory . accordingly , instruction 2 514 , since it requires texture 1 , cannot be performed immediately if texture 1 requires more than one read cycle to be retrieved . accordingly , the instructions are reordered as shown in sequence 520 . sequence 520 includes instruction 1 520 , which requires texture 0 , followed by instruction 3 524 , which requires texture 2 , which is followed by the reordered instruction 2 526 , which requires textures 0 and 1 . in this order , instruction 2 526 is delayed in favor of instruction 3 524 . that is , instruction 3 524 is performed while texture 1 is retrieved into r 1 , such that instruction 2 526 can be completed . fig6 is an exemplary portion of a shader program that is improved by using partial texture load instructions according to an embodiment of the present invention . in this particular example , the three instructions , 610 , 615 , and 620 , have been reordered relative to the example shown in fig4 to make better use of the shader circuits while the texture to be stored in register r 1 is retrieved . as can be seen , only four passes through the shader are required to complete the performance of these three instructions , as compared to the five instructions required in the example of fig4 , which did not use partial texture load commands and instruction reordering . as before , texture values stored in registers r 0 and r 2 are available , while a texture to be stored in r 1 is unavailable to the shader and must be retrieved from a frame buffer , for example via a level 2 cache . during a first pass 630 , the shader computational top is active and performs instruction 610 , that is , it multiplies the contents of register r 0 with itself and stores the result in register r 0 . the texture circuit is also active , receives a partial texture load instruction , and reads the first 32 bits of a texture to be stored in register r 1 . during a second pass 640 , the shader computational top is again active , and performs the reordered second instruction 615 , that is , it multiplies the contents of register r 2 with itself and stores the result in register r 2 . the texture circuit is also active , receives a partial texture load instruction , and reads the second 32 bits of a texture to be stored in register r 1 . during a third pass 650 , a third texture portion read is performed , and the third 32 bits of the texture are stored in register r 1 . during a fourth pass 460 , the last bits of the texture are retrieved from memory and stored in r 1 . at this time , the texture stored in r 1 is available to the shader . accordingly , during the fourth pass 460 , during the next clock cycle , the shader computation bottom is active and performs the second instruction 415 , that is , it multiplies the contents in register r 0 and r 1 and stores the product in register r 1 . in this way , by using partial texture loads and instruction reordering , the number of passes through the shader that are required are reduced by one . the above description of exemplary embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form described , and many modifications and variations are possible in light of the teaching above . the embodiments were chosen and described in order to best explain the principles of the invention and its practical applications to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . | 6 |
a schematic cross - sectional view of a semiconductor device 10 in accordance with an embodiment of the invention is shown in fig1 . a substrate 14 may be silicon or silicon having an oxide layer on an upper surface thereof , for example . however , substrate 14 is not limited to silicon . a charge trapping region 20 is formed on an upper surface of substrate 14 . by way of example , charge trapping region 20 may be an insulating layer or a stack of insulating layers selected to perform a charge trapping function or a stack of insulating layers with nanocrystals embedded in it . the structure and operation of charge trapping region 20 are described in detail below . a semiconductor layer 24 is formed on an upper surface of charge trapping region 20 . a source 30 , a drain 32 and a gate 34 may be formed in semiconductor layer 34 to define a transistor . as is known in the art , gate 34 is spaced from semiconductor layer 24 by a gate oxide 36 , and a channel 38 is defined in semiconductor layer 24 beneath gate 34 . multiple semiconductor devices of the type shown in fig1 may be formed in semiconductor layer 24 to define an integrated circuit . the devices may be both n - type and p - type . the devices may be interconnected to define logic circuitry , memory circuitry , or a combination of logic circuitry and memory circuitry . each individual semiconductor device may function as a transistor or as a memory device , depending on bias conditions . the dual function of the semiconductor device is described below . a schematic cross - sectional view of a semiconductor device in accordance with another embodiment of the invention is shown in fig2 . like elements in fig1 and 2 have the same reference numerals . in the embodiment of fig2 support substrate 14 may be an n ++ silicon substrate , and semiconductor layer 24 may be a thin silicon layer . charge trapping region 20 may include a silicon dioxide injecting layer 50 , a silicon nitride charge trapping layer 52 and a silicon dioxide control layer 54 . in one embodiment , layers 50 , 52 and 54 have thicknesses of 8 , 15 and 40 nanometers , respectively . devices may be fabricated using standard cmos techniques with mixed lithography ( optical and electron beam ). while these embodiments are based on n - type devices using electrons , other embodiments , changed in polarity , are based on p - type devices using holes . integrated circuits having silicon - on - insulator substrates usually provide high performance with higher speed at lower power dissipation than comparable implementations in bulk silicon . the present invention provides methods and structures which , in some embodiments , implement silicon - on - insulator based structures in such a way that transistors and nonvolatile or long retention memories can be fabricated simultaneously with similar cross - sections and with minimum increase in the number of process steps . in these embodiments , logic devices are used at low voltages ( less than 2 . 5 volts at gate lengths below 130 nanometers ), while higher voltages in a range of about 5 - 15 volts , with appropriate biasing of the gate , drain source and substrate , are used to operate the structures as non - volatile or long retention memories . this approach allows the simultaneous fabrication of logic and memory structures appropriate to a large variety of large scale integrated circuits . in some embodiments , the invention provides methods and structures for achieving memory together with logic circuitry in a silicon - on - insulator structure , where the range of bias voltages , low for transistors and larger for memory , allows the same structure to function as a logic device or as a memory device . a feature of the structure is in placing the storage of carriers on the back side of a transistor channel . this allows one to obey the insulator thickness constraints required for long - term storage in a memory while letting the gate oxide of the transistor be scaled for good operation of the device . the silicon - on - insulator embodiments of the invention can be scaled to tens of nanometers . the storage of charge on the back side of the transistor channel , over a longer region , also allows the devices to have scalability in the memory form to dimensions that are similar to those of the transistor . the storage on the back of the transistor channel is achieved through traps , either in bulk film or in interface states . a common form of providing such carrier trapping centers is through the use of an oxide - silicon nitride interface where the oxide surfaces may or may not be pretreated . silicon nitride itself also provides trapping centers . other materials that are compatible with silicon processing technology , e . g . aluminum oxide , may be used for such trapping interface . however , silicon nitride is preferred because of its more robust properties as a diffusion barrier . additional embodiments of the charge trapping region are described below . thus , the structure includes , within a silicon - on - insulator technology , a charge trapping region under the silicon channel . if such a charge trapping region is present and is efficient - only when sufficient voltage is applied to inject charge into the interface and bulk states , then the structure can operate both as a transistor and as a memory device . in the device of fig1 for example , normal operation of the transistor occurs with low voltages on the source , drain and gate , typically less than 2 . 5 volts for technologies below 150 nanometers in gate length . the charge trapping region 20 performs a charge trapping function for memory operation . different configurations of the charge trapping region may be utilized . the charge trapping region may comprise a material that captures electrons through defects or bulk traps . the charge trapping region may comprise an insulating film or a stack of insulating films . in some embodiments , the charge trapping region comprises an injecting layer , such as silicon dioxide , on a back surface of the semiconductor layer , a charge trapping layer , such as silicon nitride , on a back surface of the injecting layer and a control layer , such as silicon dioxide , on a back surface of the charge trapping layer . the charge trapping region and the device can also be based on hole trapping . for soi implementations , the injecting layer may have a thickness in a range of about 0 . 5 nm to 50 nm , the charge trapping layer may have a thickness in a range of about 0 . 3 nm to 50 nm , and the control layer may have a thickness in a range of about 0 . 5 nm to 100 nm . however , the thicknesses of the layers and the number of layers in the charge trapping region are not limited to these ranges . the charge trapping region may comprise a silicon dioxide - silicon nitride interface and in other embodiments may comprise additional silicon nitride . in the typical case of a silicon substrate and a silicon semiconductor layer , the charge trapping region may comprise an oxide or other insulator that is compatible with silicon processing . the charge trapping region typically serves as an insulating layer between the substrate and the semiconductor layer . the charge trapping region may comprise a material selected from the group consisting of silicon nitride , aluminum oxide , hafnium oxide , zirconium oxide , hafnium silicate , zirconium silicate , and combinations thereof . the charge trapping region may comprise nanocrystals of an inorganic compound interspersed in an insulating medium . in some embodiments , the charge trapping region comprises nanocrystals of a semiconductor material in an oxide , a nitride or another insulating matrix . the charge trapping region may comprise nanocrystals of a material selected from the group consisting of silicon , germanium and their compounds . in further embodiments , the charge trapping region comprises nanocrystals in combination with an insulator that is compatible with silicon processing . nanocrystals are described , for example , in s . tiwari , f . rana , k . chan , m . manafi , w . chen and d . buchanan , “ volatile and non - volatile memories in silicon with nano - crystal storage ”, tech . dig . of iedm , p . 657 , december 1995 and u . s . pat . no . 5 , 937 , 295 , nanostructure memory device , issued aug . 10 , 1999 to w . chen , t . p . smith and s . tiwari . in preferred embodiments , the substrate and the semiconductor layer are silicon . in some embodiments , the substrate is a group iii - iv material . in further embodiments , the substrate is a polymer . in some embodiments the semiconductor layer is a group iii - v compound , or a polymer , or ge , sic or sige . the semiconductor layer 24 may be the same material as substrate 14 , typically with a different doping level , and may have a thickness in a range of 1 nm to 100 nm . a schematic diagram of a memory array incorporating semiconductor devices in accordance with an embodiment of the invention is shown in fig3 . each memory cell of the array may include a semiconductor device of the type shown in fig1 and described above . a cell for bit 00 includes a device 70 , a cell for bit 01 includes a device 72 , a cell for bit 10 includes a device 74 , and a cell for bit 11 includes a device 76 . the drains of devices 70 and 72 are connected to a bit line bl 0 . the sources of devices 70 and 72 and the drains of devices 74 and 76 are connected to a bit line bl 1 . the sources of devices 74 and 76 are connected to a bit line and bl 2 . the gates of devices 70 and 74 are connected to a word line wl 0 , and the gates of devices 72 and 76 are connected to a word line wl 1 . the substrate is connected to a reference voltage , such as ground . it will be understood that the array shown in fig3 can be replicated in two dimensions to form a memory array having a desired number of memory cells . in operation , when a negative voltage is applied to the source , a larger negative voltage applied to the drain , with the substrate grounded and the gate at the larger negative voltage , then carriers from the channel are energetically injected into the underlying charge trapping region from the electron channel formed between source and drain . this traps charge in the memory device , and the state can be stored . random access of different memory cells can be achieved by suitable biasing . thus , in fig3 bit 00 may be written with charge by biasing bit line bl 1 at − 5 volts , word line wl 0 at − 10 volts and bit line bl 0 at − 10 volts . by not biasing bit line bl 2 and word line wl 1 , only transistor 70 for bit 00 is charged . bit 00 can be erased by applying a positive voltage , such as + 10 volts , to the source , drain and gate of device 70 . it will be understood that these voltages are given by way of example only and are not limiting as to the scope of the invention . other suitable voltages that are significantly different from the voltage required for transistor operation , typically 2 volts , may be utilized . thus , for example , the voltages applied to the source and the drain can be swapped . these voltages can be translated to other voltages by a suitable shift in the substrate bias voltage . another example of suitable write and erase voltages is shown in fig4 . in the charging process , the difference in drain and source bias is provided in order to create hot electrons that can be efficiently injected into the charge trapping region . other biasing configurations can be used to achieve memory operation . bit 00 may be charged by using the substrate as the common electrode biased at ground . bit 00 is biased by hot electron injection using biasing of bit line bl 1 and bit line bl 0 for efficient injection . thus , bit line bl 1 may be biased at − 5 volts and bit line bl 0 may be biased at − 10 volts , while all other bit lines are either grounded or open . in order to prevent injection in the other cells connected to the same bit lines , those transistors can be turned off by applying a negative voltage , for example − 5 volts , to the word lines wl of the array . in addition , there are other techniques by which random access and prevention of write - disturb can be achieved in these structures , similar to those used in front - floating gate structures . measured electrical characteristics of a semiconductor device of the type shown in fig2 and described above are illustrated in fig5 - 7 . in the device tested , silicon layer 24 had a thickness of approximately 60 nanometers , and gate oxide 36 had a thickness of 7 nanometers . in charge is trapping region 20 , oxide layer 50 had a thickness of 7 nanometers , nitride layer 52 had a thickness of 20 nanometers and oxide layer 54 had a thickness of 100 nanometers . fig5 is a graph of drain current as a function of voltage on gate 34 , with drain 32 at 1 volt , and illustrates the front channel characteristics of the device . fig6 is a graph of drain current as a function of voltage on substrate 14 , with drain 32 at 1 volt , and illustrates the back channel characteristics of the device . [ 0052 ] fig7 is a graph of drain current as a function of voltage on gate 34 , with drain 32 at 1 volt , and illustrates the memory characteristics of the device . fig7 shows 10 cycles of writing and erasing of the device . the writing bias conditions were gate 34 at − 7 . 5 volts , drain 32 at − 5 volts , source 30 at − 10 volts and substrate 14 at ground for 100 ms ( milliseconds ) per write . the erasing bias conditions were gate 34 at + 10 volts , drain 32 at + 10 volts , source 30 at + 10 volts and substrate 14 at ground for 100 ms per erase . as is apparent from fig7 the threshold voltage shifts by about 0 . 5 volt between the written and erased conditions . [ 0053 ] fig8 and 9 illustrate the transistor and memory operation of a 0 . 5 micrometer device of the type shown in fig2 and described above . the charge trapping region 20 included an oxide layer 50 of thickness 7 nanometers , a nitride layer 52 of thickness 20 nanometers and an oxide layer 54 of thickness 100 nanometers . fig8 is a graph of drain current as a function of gate voltage , with drain 32 at 1 volt . curve 100 represents the transfer characteristic of the device before charging of charge trapping region 20 , curve 102 represents the transfer characteristic after writing of charge trapping region 20 , and curve 104 represents the transfer characteristic after erasing of charge trapping region 20 . the sub - threshold slope degrades from 119 millivolts per decade to 160 millivolts per decade is after charging . fig9 is a graph of drain current as a function of drain voltage in the erased state for different gate voltages . curves 120 , 122 , 124 , 126 and 128 represent values of gate voltage v g minus threshold voltage v t of 0 , 0 . 2 , 0 . 4 , 0 . 6 and 0 . 8 , respectively . [ 0054 ] fig1 and 11 illustrate transfer and output characteristics , respectively , of a semiconductor device of the type shown in fig2 having gate dimensions of 50 nanometers by 50 nanometers . fig1 is a graph of drain current as a function of gate voltage . curves 130 and 134 represent drain voltages of 0 . 1 and 0 . 2 , respectively . the transfer characteristic exhibits a sub - threshold slope of 157 millivolts per decade . fig1 is a graph of drain current as a function of drain voltage in the erased state for different values of gate voltage . curves 140 , 142 , 144 , 146 and 148 represent values of gate voltage v g minus threshold voltage v t of 0 , 0 . 1 , 0 . 2 , 0 . 3 , and 0 . 4 , respectively . [ 0055 ] fig1 and 13 show transfer and output characteristics , respectively , of a semiconductor device as shown in fig2 having gate dimensions of 100 nanometers by 100 nanometers . fig1 is a graph of drain current as a function of gate voltage . curves 150 and 152 represent drain voltages of 0 . 1 and 0 . 2 , respectively . the transfer characteristic exhibits a sub - threshold slope of 97 millivolts per decade . fig1 is a graph of drain current as a function of drain voltage in the erased state for different values of gate voltage . curves 160 , 162 , 164 , 166 and 168 represent values of gate voltage v g minus threshold voltage v t of 0 , 0 . 1 , 0 . 2 , 0 . 3 and 0 . 4 , respectively . the experimental characteristics of fabricated devices shown in fig8 and 9 illustrate the dual use properties of the semiconductor device . with low voltages ( less than 2 volts ), transistor characteristics with i on / i off gain larger than 10 7 and sub - threshold slope of 120 millivolts per decade are obtained in these devices consistent with the expected properties for the electrostatic design . fig1 - 13 show the output characteristics of the front gate transistor at 50 nanometer and 100 nanometer gate lengths , all at low drain voltages and up to a drive of 0 . 5 volt above the threshold voltage . when high voltages ( between 5 and 10 volts ) are used to inject or remove charges from the trapping region , threshold voltage shifts of approximately 0 . 5 volt are obtained . reducing the thickness of the charge trapping layers can reduce the writing and erasing voltages , but like the front floating structures , retention and non - volatility issues will be associated with such a design . semiconductor devices and integrated circuits as described herein can be fabricated in a number of different ways . first , a basic semiconductor wafer structure is fabricated . one embodiment of a process for fabricating the wafer structure is shown in fig1 a - 14 e . as shown in fig1 a , a silicon donor wafer 200 has the charge trapping region 20 formed on its surface . in the example of fig1 a , charge trapping region 20 includes silicon nitride layer 210 between oxide layers 212 and 214 . as shown in fig1 b , a high dose hydrogen implant ( from an ionized atomic or molecular beam ) or co - implantation step forms a heavily hydrogen - dosed layer 220 in donor wafer 200 . layer 220 is spaced from oxide layer 214 , by appropriate selection of implant energy , to provide a desired thickness of a semiconductor layer 222 . the hydrogen - dosed layer 220 defines a sacrificial portion of donor wafer 200 to be removed in later processing . as shown in fig1 c , an n + silicon substrate is oxidized to form an oxide layer 232 . the wafer 200 having layers 210 , 212 , 214 , 220 and 222 is flipped over and oxide layer 212 is bonded to oxide layer 232 to form a structure as shown in fig1 d . an exfoliation step is then used to cleave off a portion of donor wafer 200 through the splitting caused by excess hydrogen in layer 220 to provide the wafer structure of fig1 e . by comparing fig1 e and fig2 it is apparent that n + silicon substrate 230 corresponds to substrate 14 , oxide layer 212 , 232 corresponds to oxide layer 54 , silicon nitride layer 210 corresponds to nitride layer 52 , oxide layer 214 corresponds to oxide layer 50 , and silicon layer 222 corresponds to silicon layer 24 . by way of example only , silicon layer 222 may have a thickness of about 50 nanometers , oxide layer 214 may have a thickness of about 7 nanometers , silicon nitride layer 210 may have a thickness of about 20 nanometers and oxide layer 212 , 232 may have a thickness of about 100 nanometers . the wafer is thereby ready for fabrication of circuitry in silicon layer 222 using , for example , conventional cmos processing . the donor wafer shown in fig1 b may be fabricated as follows . starting with a p - silicon wafer 200 , a thin , dry oxide is grown on the p - wafer to form oxide layer 214 . the thickness of layer 214 may be about 7 nanometers . then , silicon nitride layer 210 , typically having a thickness less than 20 nanometers , is deposited on the p - wafer 200 . then , a low temperature oxide is deposited to form oxide layer 212 having a thickness of about 100 nanometers on the p - wafer 200 . finally , a hydrogen implantation with a dose of 6e16 atoms per square centimeter and an energy of 100 kev is performed on the p + wafer 200 to form layer 220 at a depth of about 600 nanometers . the hydrogen implantation is performed through layers 210 , 212 , and 214 . next , an oxide is grown or deposited on n ++ wafer 230 ( fig1 c ) to form oxide layer 232 . the oxides may be thin enough and smooth enough for bonding as grown or deposited . if not , oxide layers 212 and 232 are polished until each is less than about 50 nanometers in thickness . the surface roughness of layers 212 and 232 after polishing is preferably less than about 2 angstroms . then , the surfaces of layers 212 and 232 are treated in an oxygen plasma for 10 minutes . the wafers are bonded together as shown in fig1 c and 14 d by placing oxide layers 212 and 232 in contact and annealing the wafers for 12 hours at 250 ° c . exfoliation of substrate 200 and layer 220 is achieved by heating the wafer at 400 ° c . for 30 minutes to provide the semiconductor wafer structure shown in fig1 e . the silicon layer 222 can be thinned to the desired thickness by chemical mechanical polishing and / or oxidation and etching . another embodiment of a process for fabricating the semiconductor wafer structure is shown in fig1 a - 15 d . in this embodiment , the charge trapping region 20 is formed on an soi wafer . as shown in fig1 a , an soi wafer 300 includes a silicon substrate 310 , an oxide layer 312 and a silicon layer 314 . charge trapping region 20 , including an oxide layer 320 , a silicon nitride layer 322 and an oxide layer 324 , is formed on soi wafer 300 . as shown in fig1 b , an n + silicon host wafer 330 having an oxide layer 332 is provided . the soi wafer 300 , having layers 320 , 322 and 324 thereon , is flipped over , and oxide layer 324 is bonded to oxide layer 332 . the resulting structure is shown in fig1 c . then , the substrate 310 and oxide layer 312 of soi wafer 300 are removed by grinding , polishing and etching by taking advantage of the oxide / silicon selectivity to provide a wafer structure as shown in fig1 d . by comparison of fig1 d and fig2 n + silicon substrate 330 corresponds to substrate 14 , oxide layer 324 , 332 corresponds to oxide layer 54 , silicon nitride layer 322 corresponds to nitride layer 52 , oxide layer 320 corresponds to oxide layer 50 and silicon layer 314 corresponds to silicon layer 24 in fig2 . the wafer is then ready for fabrication of circuitry in silicon layer 314 using , for example , conventional cmos processing . in another embodiment , the charge trapping region may be formed by incorporating trapping centers after the semiconductor layer - insulating layer - substrate structure has been formed . for example , the trapping centers may be incorporated by ion implantation or plasma implantation of a species that forms trapping centers . with reference to fig1 d , silicon nitride layer 322 may be formed by ion implantation of nitrogen into the oxide near the back surface of silicon layer 314 . other species , such as inert gases and other elements or compounds that form trapping centers , may be implanted to form the charge trapping region . the characteristics of the charge trapping region are determined by appropriate selection of implant species , energy and dose . for introduction of nanocrystals as trapping regions , these may be formed by a process of chemical or physical deposition and annealing in any of the wafer preparation processes described . having thus described several aspects of at least one embodiment of this invention , it is to be appreciated various alterations , modifications , and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and scope of the invention . accordingly , the foregoing description and drawings are by way of example only . | 7 |
the following detailed description of preferred embodiments refers to the accompanying drawings illustrating specific embodiments of the invention . other embodiments having different structures and operations do not depart from the scope of the present invention . in the mobile application profile ( map ) for the zigbee system , three types of device are defined , they are zigbee coordinator ( zc ), zigbee mobility handler ( zmh ) and zigbee mobile device ( zmd ). fig1 shows the proposed system architecture for the map enabled zigbee network . in the network , the zc 113 is the unique device in the system , which is equipped with database 114 for managing the short address and the extended address mapping for the mobile devices . the zmhs ( eg . 101 / 109 / 110 / 111 ) are the zigbee routers ( full function device — ffd ) at the fixed location in the network to handle zmds ( eg . 103 / 104 / 105 ) moving within the system coverage . the zmds ( eg . 103 / 104 / 105 ) are the zigbee end - devices ( rfd ) in the network , they are expected to move frequently between different coverage of the zmhs . in fig1 , each zmh ( eg . 101 / 109 / 110 / 111 ) can connect to other zmhs in the neighborhood directly . the communication links establishment between zc to zmh and zmh to zmh are formed by the mesh network routing . when a zmd has joined a zmh , the zmd can communicate with other devices in the network through its parent . to enable the mobility of zmd 103 / 104 / 105 in the network , the zmd has the self - detection ability to discover that it has already been anchored to another zmh &# 39 ; s coverage and lost connection with the old parent . in the map , two mechanisms are available to accomplish detection , namely the zmd polling mechanism and the zmh broadcast mechanism . mac layer of the zigbee stack to detect the signal strength of zmd . in the example shown in fig1 , the zmd 103 joined a zmh 109 as parent , the zmd 103 sends “ poll request ” 107 to its parent 109 periodically with a frequency f . each time when the parent 109 has received the polling request , the parent needs to acknowledge 107 the corresponding child to indicate the signal strength of parent to the zmd . therefore , when a zmd is moving out of the coverage 102 of its old parent to a new parent ( from zmd 103 to zmd 104 ), its old parent 109 may either not receive the “ poll request ” from the zmd 104 or receive the “ poll request ” with weak signal strength . when the old parent 109 does not receive the “ poll request ”, zmd 104 will not receive acknowledgment from its old parent 109 . in the event that the old parent 109 has received the “ poll request ”, the old parent 109 will reply the zmd with weak signal strength . in the zmh broadcast mechanism , the parent ( zmh ) will broadcast “ poll response ” to all its children ( zmd ) periodically to indicate the signal strength of the parent to children . both the zmd polling mechanism and the zmh broadcast mechanism are used to indicate that the zmd is within the parent coverage . if the zmd 104 receives weak signal strength “ poll response ” or fails to receive “ poll response ” from its parent several times within a predefined period ts , the zmd identifies that it is already out of coverage of its old parent and it then seeks to join a new zmh as its parent . since the role of zmd in the two mechanisms is the same , the zmd polling mechanism will be described in the following context . when a zmd 104 has lost connection with its old parent 109 , the zmd keeps both the short address of the old parent and the short address of itself , which is assigned by the old parent . after the zmd 104 has joined a new zmh 110 successfully and received a new short address , it sends a notification to its old parent 109 with its former short address to inform the old parent 109 of its absence from the coverage 102 . when the old parent 109 has received the notification from the zmd 104 , it confirms that the zmd 104 is not its child , it then releases the short address for reuse and leases the pending data of the child . the short address of a device is a main identifier for communication in the zigbee system , however the mobility of zmds ( eg . 103 , 104 , 105 ) requires a frequent change of short address of a zmd . therefore , the database for address mapping 114 at the zc is devised in map to match the addresses of zmds in the network . the database stores the unique extended address with the frequently updating short address of each zmd in the network . each time when a zmd has joined a new zmh and received a new short address , the zmd will send an announcement to the zc to update the record of the zmd . therefore , when a device has found that it is unable to communicate with a zmd using its short address , the device may inquire the zc about the updated short address of the zmd by providing the corresponding extended address . fig2 shows the position of map in zigbee protocol stack . according to the zigbee specification , the application layer is divided into application support sub layer ( aps ) 207 and application framework ( af ) 206 . the af 206 is used to house the manufacturer defined application objects ( ao ), which is the proprietary application protocol , for the purpose of applying zigbee standard to different applications . the invented map 201 is a member of the aos enabling device mobility in different applications . the map provides address management 202 and mobility management 205 service to handle the movement of zmds in a zigbee network . the address management service 202 is applied to the zc , zmh and zmd , and it coordinates the procedures to update the record of the address mapping database for the newly jointed or timeout zmd . after a zmd has joined a zmh as its parent , the zmd informs the zc to update the address database with the new short address assigned to the zmd through this service 202 . the zc will check whether the zmd is a newly joined device or altered parent device in the network according to the provided extended address of the zmd . if the zmd is a newly joined device , the zc will create a new record in the database to match the short address and the extended address of the zmd ; if the zmd is not a newly joined device , and that the extended address appears in the record , the zc will update the short address of the existing record of the zmd . on the other hand , when a zmd has joined a zmh as its parent , the zmh will also start a timer to count the lifetime tl of the zmd connection . this tl is used to make sure the short address will not be held by a zmd in the event that the zmd has left the network without any notification . after the tl of a zmd is timeout and the old zmh has not been informed that the zmd has joined other a new zmh , the old zmh will assume the zmd has been turned off or left the network coverage . the zmh releases the short address of the zmd , and informs the zc to remove the record of corresponding zmd from the database through the address management service 202 by sending the short address and the extended address to the zc . then the zc will check the database record to confirm that the zmd has left or joined a new zmh . once the zc has matched a record in the database to the short address and the extended address received from the zmh , it will remove the record ; if the zc has only matched a record in the database identical with the extended address received from the zmh , it implies that the zmd has joined a new zmh since the former zmh has not received any information . the zc will inform the former zmh that the zmd has moved to a new zmh . the mobility management service 205 coordinates the procedures to manage the zmd movement and defines the parent altering procedures . the parent altering is the procedures for the zmd to inform the old parent that it has moved to another parent and the old parent will release the resources for the zmd . after the zmd has joined a new zmh , it sends the parent altering request to the former zmh through the service 205 to request the old parent to release the short address for reuse , and release the pending data of the zmd . fig3 shows the general frame format of map . the frame includes the field of command type ( cmd ) 301 , destination address ( daddr ) 302 , sequence number ( sn ) 303 , length 302 and payload 303 . the cmd 301 is a 1 - byte identifier indicating the function of the frame . the daddr 302 only appears in the frame defined as data type and it is used to confirm the identity of the receiving device . the sn is a 1 - byte sequence number value whose value will be incremented by 1 with each newly transmitted frame . the sender short address reported by the lower layer — the aps layer of zigbee stack , and the sequence number are taken as a pair used to uniquely identify a frame within the constraints imposed by the sequence number &# 39 ; s 1 - byte range . the length 304 is a 1 - byte field to indicate the length of attached data in payload 305 , and the payload 305 is used to place the application data . fig4 shows a table describing various command types with the command parameters used in map . the db - updata . request 401 is used for a zmd to update its record in the address mapping database at zc , after the zmh has accepted a zmd to join the network . the db - updata . request 401 contains the short address and the extended address of the newly joined zmd for the zc to locate the record in the database . when the zc has received the db - updata . request 401 from a zmh , it will update the database and reply the zmd with db - update . confirm 402 . if the zc has identified the zmd as a new device in the network , the replying status of db - update . confirm 402 will be “ added ”; if the zc has found the zmd as an existing device in the network , the replying status of db - update . confirm 402 will be “ success ”; if the zc cannot update the database for any reason , the replying status of db - update . confirm 402 will be “ nonsuccess ”. the db - remove . request 403 is used for a zmh to remove a certain zmd record in the address mapping database in the zc , after the zmh has found that the tl of its child is timeout and the zmh has not been informed that the zmd has joined a new zmh . the db - remove . request 403 contains the short address and the extended address of the timeout zmd for the zc to locate the record in the database . when the zc has received the db - remove . request 403 from a zmh , it will update the database and reply the zmh with db - remove . confirm 404 . if the zc has found that both the short address and the extended address of the zmd match the record in its data base , it will delete the record and the replying status of db - remove . confirm 404 will be “ success ”; if the zc has found the extended address of the zmd but the short address does not match , it implies that the zmd has joined a new parent but the old parent has not been notified , the replying status of db - remove . confirm 404 will be “ changed parent ”; if the zc cannot update the database for whatever reason , the replying status of db - remove . confirm 404 will be “ nonsuccess ”. the addrmap . request 405 is used for a device to request the updated short address of a zmd from zc when the device finds that it fails to be connected to the zmd . the addrmap . request 405 contains the extended address of the zmd which loses connection with its parent , and such extended address is used for the zc to locate the record in the database which records the lost connection of the zc . when the zc has received the addrmap . request 405 from a zmh , it will find the short address of the zmd from the database and reply the device with addrmap . confirm 406 . when the record is found , the addrmap . confirm 406 will be replied with the status of “ success ”, the updated short address and the extended address of the zmd ; if the record is not found , the addrmap . confirm 406 will be replied only with the status of “ nonsuccess ”. the altpart . request 407 is used for a zmd to inform the old parent it has joined a new parent zmh already , and the request provides the former short address and the extended address of zmd to the old parent as reference . when the zmh received the altpart . request 407 , it will release the short address and remove the pending data of the previous child , then reply the former child with altpart . confirm 408 . the data 411 indicates that the content of the frame payload is the application data . this kind of frame is used for a device within the zigbee network to send application layer data to another device in the network . the maximum size of the data in the payload of map is 64 bytes . after a device has received a frame for which the command type is data 411 , the device will reply the sender by an acknowledgment frame , and the command type is ack 412 . the details of the map operation will be described in the following paragraphs with different cases . fig5 illustrates the procedures of a zmd 503 joining the network for the first time . the zmd 503 will first initiate active scan procedure 504 to look for an available zigbee network . after the active scan procedure 504 has been completed , it will choose zmh 502 as its parent and go through the join network procedures 505 according to the zigbee specification . when the zmd 503 has joined the network successfully , the zmd 503 will send a map - am - db - update . request 507 , with its short address 508 and extended address 509 to the zc 501 , to inform the zc to update the databse . after the zc has received the update request 507 forwarded by zmh 502 , it will find the record of the zmd 503 according to the provided extended address 509 . in this case , since the zmd 503 is a newly joined device in the network , the zc creates a new record in database for this zmd with the provided short address 508 and extended address 509 . after the database is updated , the zc sends back a confirmation , namely the map - am - db - update . confirm 513 with the status of “ added ” 514 , to zhd 503 . in the event that the zc 501 found the database is full or for any other reason causing the zc 501 cannot update the database , the zc will send back a confirmation , namely the map - am - db - update . confirm 513 with the status of “ nonsuccess ” 514 , to zhd 502 to indicate that the record cannot be updated and thus other device in the network cannot retrieve the short address from the zc 501 to locate the zmd in the network . after the zmd 503 has joined the zmh 502 , the zmd 503 will perform the ieee802 . 15 . 4 mac layer polling procedure 510 / 515 periodically , with a t ( t = 1 / f ) time interval 511 , for requesting data from the network in indirect mode . fig6 shows another example of a zmd 603 joining a new parent zmh 602 after the zmd 603 has left the coverage of old parent 630 . when the zmd 603 fails to poll 604 its existing parent after a time interval 605 , it will start the orphan scan 632 from the mac layer to find its new parent . if the parent is found , the zmd 603 may resume the communication ; however , if the parent is not found , the zmd 603 shall start the active scan 606 to find a new zmh to join the network . in this example , zmh a 602 is found and the zmd 603 joins the new parent 607 zmh a 602 . after the zmd 603 has joined the new parent 602 successfully , it sends a request command , map - mm - altpart . request , 613 to the old parent 630 via zmh a 602 to inform the old parent 630 it has joined a new parent . the request command 613 contains the formerly assigned short address 614 and the extended address 615 of the zmd 603 . when the old parent 630 has received the request command 620 , it will release the short address and pending data of the zmd 603 , and replies with the confirmation command , map - mm - altpart . confirm 623 . after the old parent is notified , the zmd 603 sends request 608 to the zc 601 to update the database record . in this case , since the zmd 603 has joined the network before , the zc 601 can retrieve the record from the database , and the confirmation 611 being sent back to the zmh 602 is attached with the status “ success ” 612 . after a zmd has joined a new parent zmh , the parent will start a timer to count the lift time tl of the zmd . after the tl of the zmd is timeout and the old parent has not been informed that the zmd has joined a new parent , the old parent assumes the child has left the network . the old parent will then release the short address and pending data of the child and ask zc to remove the record of the child from the database . fig7 shows the procedures to remove the record of a zmd from the database when the zmh 702 assumes that one of its children has left the network coverage . after the old parent 702 has released the short address and pending data of the child 709 , the old parent sends a map - am - db - remove . request 712 command to the zc 701 to remove the record of the child from the database . the command 712 contains the short address 713 and the extended address 714 of the child . when the zc 701 has received the command 712 , it will find the record of the child . if both the short address 713 and the extended address 714 match with its record , the zc will remove the record and send back a confirmation 715 to the zmh 702 with the status “ success ”; if the record of the extended address is not found or for whatever reason causing the zc not finding the record , the zc will send back a confirmation 715 to the zmh 702 with the status “ nonsuccess ”. in some occasions , a zmd has may join a new parent without the old parent being notified . in this case , the old parent will also release the assigned short address and the pending data for this zmd after the tl of the zmd is timeout . in the example shown in fig8 , the zmh a 802 is the old parent of the zmd 1 and the zmh b 825 is the new parent of the zmd 1 . considering the case after the zmd 1 has joined 803 the zmh b 825 , the zmd 1 is sending back the notification 829 to the old parent zmh a 802 but the notification is lost during transmission 827 . after the tl counter of the zmd 1 under the coverage of zmh a 802 is timeout 808 and the zmh a 802 assumes the zmd 1 has left the network . zmh a 802 releases the short address and pending data 809 of the zmd 1 and ask zc 801 to remove the record of the zmd 1 from database . when the zc 801 has received the request from the zmh a 818 , it will check the database to find out the record according to the provided extended address 820 . since the record is previously updated 814 by the request 813 from zmd 1 , the zc 801 will find the provided short address 819 not matched with the database record 822 . therefore the zc 801 sends back a confirmation 823 to the zmh 802 with the status of “ changed parent ” 824 . in the application data transfer of the map , the sender shall know the short address of the receiver before sending the data . fig9 , fig1 and fig . 11 illustrate the different cases of application to send data from source to destination under the map procedures . fig9 shows a case of the sender 901 is ignorant of the short address of the receiver 903 . in this case , the sender 901 shall first send a request command , addrmap . request 912 , with the extended address 913 of the receiver 903 to zc 911 to inquire the short address of the receiver . when the zc has accepted the command 912 , it searches the database 914 to find the record of the receiver 903 . once the short address is found , the zc 911 replies the sender with the following commands : a addrmap . confirm 916 command , the status of “ success ” 915 , the short address 917 and the extended address 919 of the receiver . after the sender has received the reply 916 from zc 911 , it sends the data to the parent of the receiver according to the short address 904 . then the parent will store the data in the mac layer for data pending 905 , and in the event that the receiver 903 polls the parent 902 , the mac layer 908 of the parent will send the application data to the receiver 907 . after the receiver has received the data , it will send back an acknowledgement , map - ack 909 / 910 , to the sender according to the short address of the sender . fig1 shows another case of the of the application data transfer . in this case , the sender 1002 knows the short address of the receiver zmd a 1005 , and this former short address is used when the zmd a 1005 is joining the new parent zmh b 1003 . after the zmd a has moved out of the coverage of zmh a 1004 , the short address of the zmd a 1005 is changed , and the sender 1002 is ignorant of this information . when the sender 1002 wants to send data to the receiver according to the former short address , the sender forwards the data to the zmh b 1003 . in this situation , if the former short address is not reused , the receiver will not be found and no device will acknowledge the sender of receiving the data ; if the past short address is reused , for example it has been assigned to zmd b 1005 , the zmd b 1005 will receive the data 1016 , but the zmd b 1005 will not acknowledge the sender since the extended address attached in the data frame does not match with itself . hence , the sender finds no acknowledgement received , and the sender considers that the short address of receiver has been changed . the sender 1002 issues the request command 1008 to the zc 1001 and the zc replies 1012 with the updated short address 1014 . the sender will send the data to the receiver 1017 / 1020 and receive the acknowledgement from the receiver 1022 / 1023 . fig1 shows a case of the receiver has left the network in application data transfer . in this case , the sender 112 knows the short address of a zmd , and the former short address is used when the zmd is joining the new parent zmh 1103 . after the zmd has left the network , the sender sends data to the zmd 1110 and finds no acknowledgement has been received 1111 . the sender inquires the zc 1101 for the updated short address 1112 . in this case , if the life time count by the parent has not timeouted , the zc will retrieve the record from the database , and reply 1115 the sender with the status “ success ” 1117 , and the short address 1118 and extended address 1116 of the zmd . then the sender may verify that the short address received is identical with the record itself , and it will assume that the zmd has left the network . on the other hand , if the lift time count of the parent is not timeout , the zc will not retrieve the record from the database , and it will reply 1115 the sender only with the status “ nonsuccess ”. then the sender may confirm that the zmd has left the network . | 7 |
in the following the invention is described in detail using the preferred exemplary embodiments with the use of figures , wherein only the features necessary to understand the invention are shown . the following reference characters and abbreviations are used : 1 : ct system ; 2 : gantry housing ; 3 : x - ray radiator / x - ray tube ; 4 : detector ; 5 : heat exchanger ; 6 : coolant pump ; 7 : pressure generator ; 8 : coolant lines ; 9 : patient bed ; 10 : patient ; 11 : system axis ; 12 : control and computer system ; 13 : measurement field ; 14 : rotor ; 15 ; sight glass ; 16 : mass element ; 17 : membrane ; 18 : marking ; 19 : elastic element ; 20 : self - sealing coupling ; 21 : sensor ; 22 : lever arm ; 23 : bearing ; 24 : compensation volume ; f rot : centrifugal force ; prg 1 through prg n : computer programs ; r weight : radius of the mass element ; r pressure , min : radius of the location with minimum pressure given a rotating gantry . fig1 shows a ct system 1 in three - dimensional representation with a gantry housing 2 which has a measurement field 13 through which a patient 10 can be shifted ( with the aid of a displaceable patient bed 9 ) along the system axis 11 for examination . in this presentation a radiator / detector system arranged on the gantry is also shown schematically which consists of an x - ray radiator 3 and an opposing detector 4 . the x - ray radiator 3 is connected via cooling lines 8 with a cooling system consisting of a heat exchanger 5 and a coolant pump 6 used to transport the coolant . according to the invention , this cooling system is also connected to a pressure generator 7 which is located at the rotating gantry , and with the aid of the centrifugal force occurring in the operation of the gantry the pressure in the cooling system increases in that a mass element allows the centrifugal force acting on the mass element to affect the liquid of the cooling system . for completeness , a control and computer system 12 is also additionally shown which controls the functions of the ct system and conducts image reconstructions on the basis of the obtained detector data . for this computer programs prg 1 through prg n are recorded in memory , which computer programs are loaded and executed in the working memory of the computer system 12 as needed . to depict the invention , in fig2 a schematic section through the gantry region of a ct system is shown again , wherein here the depiction is limited only to the significant aspects of the cooling system . the cross section draws [ sic ] the rotor 14 of the gantry at which the x - ray radiator 3 is attached that is in turn connected with a heat exchanger 5 via a cooling line system 8 . the transport of the coolant takes place via a coolant pump 6 located in the conduit system 8 . to generate the desired overpressure , a device 7 — hydraulically connected with the cooling system — to increase the static pressure is located in the coolant system . this device 7 here is basically composed of a mechanically flexible membrane that forms a compensation volume 24 in the form of a sack - like protuberance at which a mass element 16 is borne , such that in the case of a rotation of the rotor 14 of the gantry this mass element 16 attempts to compress — with its centrifugal force — the membrane and the fluid volume located in the membrane , which fluid volume is connected hydraulically with the cooling system . the membrane 17 and the mass element 16 are located in a cylindrical structure , for example a sight glass 15 through which the fluid level of the cooling system can be observed either via inspection or via correspondingly arranged sensors . for information , in fig2 the radius r weight of the mass element is additionally plotted against the radius r pressure , min that corresponds to the location of the cooling system that has the smallest distance from the rotation center ( thus from the system axis 11 ). in principle , the locations that are nearest the rotation center are also simultaneously the locations at which — in the case of a bubble formation in the cooling system — these bubbles would collect . however , with the use of the device 7 the pressure in the cooling circuit should be increased such that a bubble formation does not arise . at the same time , however , this system should also be designed such that a complicated adjustment — as is typical in the prior art — does not need to take place ; rather , a desired pressure is generated based simply on the existing physical conditions due to the rotation of the rotor of the gantry and essentially independent of the fill level in the cooling system . this is achieved by the magnitude of the pressure in the cooling system being determined ( caused ) only by the centrifugal force acting on the mass element , such that adjustments of elastic forces or the like are no longer necessary . fig3 shows an excerpt of the cooling system in schematic representation . fig3 shows an x - ray tube 3 that is connected via cooling lines 8 to a cooling system with a heat exchanger 5 , with a pump 6 is integrated into the cooling lines . the pump 6 is responsible for the circulation of the cooling liquid . furthermore , the device 7 according to the invention is connected to the cooling system , and the device 7 generates a predefined pressure increase in the cooling circuit via the action of centrifugal force . the device 7 includes a protuberance of the fluid volume forming a compensation volume 24 , this fluid volume being bounded by a mechanically flexible membrane 17 . the membrane 17 is loaded by a mass element 16 as soon as the rotor of the gantry begins to rotate . both are arranged in a cylindrical sight glass 15 at which a marking 18 is provided with which the fill level of the cooling fluid can be visually observed without difficulty . as an alternative or in addition to the marking 18 , a sensor 21 can be provided that ( for example ) detects the orientation of the mass element 16 and determines the fill level of the cooling fluid , or detects a deviation of the fill level . it is advantageous for the mass element 16 to have a high specific density so that a relatively compact mass element can be used that is advantageously located within the sight glass or the cylindrical hollow space in which the protuberance of the fluid volume with the bounding membrane 17 is also located . this arrangement produces large pressure increases in the cooling system corresponding to the prevailing centrifugal force . fig4 shows the same situation as fig3 , but in the sight glass 15 an elastic element 19 is additionally arranged . thus , given an “ overhead ” standstill , for example , thus when the vector of the centrifugal force is opposite the force of gravity prevents the mass element 16 from falling downwardly , but instead it is pressed with a certain bias pressure against the membrane 17 . it should also be noted that both in fig3 and in fig4 the rotation center point of the system is arranged above the figures , such that given a rotation a centrifugal force f rot is directed outwardly , and therefore the mass element 16 presses downwardly in relation to the drawing . as mentioned , it is advantageous for the mass element 16 to have an optimally high specific density in order to be able to generate sufficient pressure in the cooling system given a small structural size . due to very cramped space relationships in the region of the rotor of the gantry , it can be particularly advantageous when the pressure - generating device is not arranged to the side of the rotation center but rather is arranged at the outlying side relative to the rotation center . furthermore , it can be advantageous for a sufficiently high pressure is generated with relatively small mass , such that the total rotating mass remains optimally low . an embodiment that satisfies these particular requirements is shown in fig5 . this shows a segment from the rotor of the gantry in the region of the cooling system and the x - ray radiator 3 . this x - ray radiator 3 here is also connected via cooling lines 8 with a heat exchanger 5 that is in turn connected with its fluid volume with a device 7 to generate an additional pressure with the aid of the occurring centrifugal force , which here however is arranged at the side of the rotating part of the gantry 14 that faces away from the rotation point . by the use of a lever , a high internal pressure in the cooling system can hereby also be generated with the aid of a relatively low weight of a mass element 16 via the existing centrifugal force . in the embodiment shown here , the mass element 16 is arranged on the long side of a lever arm 22 . the lever arm is supported by a bearing 23 so that the centrifugal force acting at the mass element 16 is transferred with a corresponding translation to the membrane 17 or the compensation volume 24 , and thus to the cooling fluid . it should be noted that , within the scope of the invention , not only a lever mechanism is shown , but also equivalent different mechanical translation mechanisms ( for example via rotation elements of different sizes ) can be used , or hydraulic translations . here in the embodiment of fig5 an additional elastic element 19 is optionally shown which — for example — can engage with the lever arm 22 in order to generate a specific base pressure at the fluid . within the scope of the present invention , self - sealing couplings 20 can be provided in the region of the hydraulic compounds of the individual elements of the cooling system . the self - sealing couplings 20 enable a component of the cooling system to be exchanged in a simple manner without having to implement a complete re - filling of the cooling system . it is noted that , in the invention described herein and in particular the embodiments specifically shown , volume changes in fact lead to a variation of the level of the cooling liquid in a compensation volume across a relatively large range , but this change is completely decoupled from the pressure charge exerted on the compensation volume by the centrifugal force . the magnitude of the additionally generated pressure due to the device according to the invention depends only on the constants ( determined by design ) of the mass of the mass element ( possibly affected by an amplification system by the action of the lever ), the area of the pressure transfer to the cooling liquid system and the rotation speed of the gantry . adjusting pressure settings as are necessary in the prior art can therefore be omitted . overall , the invention results in a ct that has a cooling device whose internal pressure no longer needs to be regulated by complicated adjustment tasks ; rather , its internal pressure is adjusted via physical conditions that do not need any readjustment . the exchange of individual components — advantageously with the assistance of self - sealing couplings — is therefore also simple to accomplish . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art . | 7 |
referring now to fig1 in the illustrated gas turbine system , fresh air which is drawn in via a line 1 is compressed to the working pressure in a compressor 2 . the compressed air is heated in a combustion chamber 3 which is fired , for example , with natural gas , and the fuel gas thus obtained is expanded in a gas turbine 4 so as to perform work . the energy thus obtained is transferred to a generator 5 or the compressor 2 . the still hot exhaust gas from the gas turbine 4 is supplied from the outlet of the gas turbine , via a line 6 , to a heat recovery steam generator plant 7 and , after the heat is transferred , the exhaust gas is led from the latter into the open via a line 8 and a stack which is not illustrated . in the water / steam circuit , a multiple casing steam turbine 9 , 10 is arranged on the same shaft as the gas turbine 4 . the working steam expanded in the low - pressure turbine 10 condenses in a condenser 11 . the condensate is conveyed from a hot well 12 by a pump 14 , 20 directly into the steam generator 7 . it is notable that the plant of the present invention is not equipped with either a condensate polishing plant or with a feedwater tank / deaerator which , as a rule , is steam heated . the heat recovery steam generator plant 7 is designed as a vertical boiler and , in the present case , works according to a dual pressure steam process . of course , a horizontal boiler could also be used . the number of pressure stages could also , of course , be varied , as would be apparent to one skilled in the art . the low - pressure system is designed as a once through system . it includes , in the flue gas path of the boiler , a low - pressure economizer 15 , into which the condensate is introduced via a feed pump 14 , a low - pressure evaporator 16 and a low - pressure superheater 19 . the superheated steam is carried over into a suitable stage of the medium pressure steam turbine 10 via a low - pressure steam line 28 . the high - pressure system is also designed as a once through system and can therefore be designed both for subcritical and for supercritical parameters . it essentially includes , in the flue gas path of the boiler , the high - pressure economizer 21 , the high - pressure evaporator 22 and the high - pressure superheater 23 . the working medium is supplied to the high - pressure economizer 21 via a high - pressure feed pump 20 . the superheated steam is carried over into the high - pressure part 9 of the steam turbine via a live steam line 24 . for phase separation , a separating bottle 25 is provided in each of the two pressure systems , the outlet of the evaporators 16 , 22 opening via a line 31 into said separating bottle , respectively . the separating bottles are connected , at their upper end , to the superheater 19 , 23 via a line 32 . at their lower end , the bottles are each provided with a return line 29 which opens into the hot well 12 . at their lower end , each of the bottles is also provided with a blowdown line 30 , through which the impurities are drawn off . the quantity of steam drawn off through line 30 is replaced by additional water which is introduced into the condenser at 35 . the separating bottle 25 ensures that the superheater 19 , 23 remains dry at all times and that superheated steam is available at the boiler outlet at an early stage . as soon as the pressure necessary for stable operation is reached in the high - pressure evaporator 22 , the live steam can be used for starting up the steam turbine in a sliding pressure mode . according to one object of the present invention as described above , it is thus possible , in principle , to dispense with a condensate polishing plant . this is based on the realization that the impurities in the water / steam circuit can be drawn off in the region of the separating bottles 25 as further explained below . the water / steam circuit of the present invention can be cleaned both under full load and under part load . under full load , the high - pressure system is overfed , that is , a larger quantity of water than is necessary is conveyed through the once through steam generator via the high - pressure feed pump 20 . as should be apparent to one skilled in the art , if a single high - pressure feed pump is used , it must be designed to be correspondingly larger for the extra quantity of water . if the plant is provided with pump redundancy , for example in the form of 2 × 100 % or 3 × 50 %, the replacement pump may be employed to accomplish this overfeeding . the conveyed water quantity is adjusted in such a way so as to ensure that wet steam passes into the bottle 25 . the impurities are bound in the water droplets of the water / steam mixture . in the bottle , the water fraction of the steam is separated by suitable means and is drawn off via the blowdown line 30 . one advantage of this method is that the impurities are largely removed from the circuit even after only a few passes , that is , within a very short time . in a variant of the invention , in which circuit cleaning can be carried out by means of the feed pump dimensioned for normal operation , the steam generator is operated under part load , for example 80 %. accordingly , as in the full load method , the high - pressure system is overfed and the procedure is the same as in the method described above . the present invention also provides a further measure which reduces the volatility of the substances present and therefore makes it easier to separate them from the circuit . this is carried out by metering a conditioning agent and results in an advantageous reduction in the distribution coefficient . since the above - described cleaning of the water / steam circuit via the separating bottle 25 requires the plant to operate in a special mode for a limited time , the metering of chemicals , i . e ., conditioning agents , is also carried out only during this cleaning period , in which the separating bottle is operated under wet conditions . the chemicals are introduced into the feed line at 34 , upstream of the feed pumps 14 , 20 , by suitable means . by virtue of this measure , the two pressure systems can be metered independently of one another as a function of their thermal states . the actual metering , that is the chemical to be used and its quantity , is carried out , in this case , as a function of the nature and degree of the impurity . metering takes place continuously during the entire cleaning process . ammonium metering ( nh 3 ) and oxygen metering ( o 2 gas ) occurring for normal operation , which likewise takes place upstream of the feed pumps 14 , 20 at 33 , are adjusted by means of conditioning agents during cleaning . however , this is not an absolute condition , but depends on the nature of the impurity and therefore on the conditioning agent to be used . the general outcome is that , during normal operation , the separating bottle 25 is dry and there is no metering of chemicals in order to reduce the volatility of particular impurities . in contrast , wet steam has to pass into the bottle for cleaning under full load or under part load . according to the method described above , the necessary moisture passes into the bottle as a result of the overfeeding of the system , this being achieved by increasing the mass flow of feedwater and / or by running down the gas turbine . the reduction in volatility by means of chemicals , which is carried out during this cleaning operation , improves the degree of separation , which is particularly important with regard to the volatile substances . moreover , this measure leads to a shortening of the cleaning operation . in the instance shown in fig1 the inlet temperature into the boiler corresponds to the condensate temperature , since no steam - heated feedwater tank / deaerator is provided . advantageously , the material for the so - called preheating surfaces of the once through steam generator is selected as a function of the gas turbine fuel and , in particular , its sulfur content and as a function of the condensate temperature , in order to prevent dew point corrosion . with a falling water - side inlet temperature , on the one hand , and / or with an increasing sulfur content , on the other hand , a transition can be made from simple carbon steel via low alloy steel to stainless steel . of course , the invention is not restricted to the plant shown and described . the invention can be used irrespective of the type and design of the heat recovery steam generator and steam turbine plant , of the condensation system , of the presence of intermediate superheating , of the gas turbine plant and of the selected startup process . a horizontal boiler may be employed in contrast to the arrangement shown and described . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . | 8 |
the first embodiment of the present invention will now be explained with reference to fig1 a to 1c . referring to fig1 a to 1c , a semiconductor substrate 100 for forming an npn transistor includes an n + - emitter layer 1 , a p - base layer 2 , a highly - resistive , n - collector layer 3 , and n + - collector layer 4 and an n + - channel cut layer 5 which are sandwiched between upper and lower principal surfaces of the substrate 100 . in the p - base 2 , the impurity concentration is highest at the surface thereof , and decreases as the depth from the surface is larger . respective end portions of a collector junction j c and an emitter junction j e are exposed to the upper principal surface of the substrate 100 to form a planar structure . further , in fig1 a to 1c , reference numeral 6 designates an emitter electrode kept in contact with n + - emitter layer 1 , 7 a base electrode kept in contact with the p - base layer 2 , 8 a collector electrode kept in contact with the n + - collector layer , 9 a channel cut electrode kept in contact with the n + - channel cut layer 5 , 10 an insulating film such as an sio 2 film , a phosphosilicate glass film , or an si 3 n 4 film , and 11 a highly - resistive , oxygen - containing amorphous silicon film provided on the insulating film 10 . as shown in fig1 b and 1c , the oxygen - containing amorphous silicon film ( hereinafter referred to as &# 34 ; ocas &# 34 ;) 11 is connected to the n + - emitter layer 1 and the highly - resistive , n - collector layer 3 through the emitter electrode 6 and the channel cut electrode 9 . however , as shown in fig1 a and 1b , the ocas 11 does not contact with the base electrode 7 . as is apparent from fig1 b and 1c , the ocas 11 is provided on the exposed end portions of the emitter and collector junctions j e and j c through the insulating film 10 . incidentally , in fig1 a showing the emitter side of the first embodiment , the electrodes 6 , 7 and 9 are indicated by hatched areas , and the ocas 11 is indicated by an area peppered with splashes . the operation of the transistor having the above structure will be explained below , with reference to fig2 a and 2b . fig2 b shows a main part of the transistor of fig1 a to 1c , and fig2 a shows the potential distribution at the main part of fig2 b . explanation of the same reference symbols as in fig1 a to 1c will be omitted for brevity &# 39 ; s sake . first , explanation will be made of the reason why the base - collector breakdown voltage bv cbo of the transistor of fig1 a to 1c is improved . when an emitter - collector voltage v ce is applied between the emitter electrode 6 and the collector electrode 8 while keeping the emitter electrode 6 at a ground potential , a leakage current flows through the ocas 11 . thus , when the positions of the emitter electrode 6 and the channel cut electrode 9 are expressed by x 2 and x 1 , respectively , a potential v s of the ocas 11 at a position x between the emitter electrode 6 and the channel cut electrode 9 can be approximated by the following equation : ## equ1 ## where x & gt ; x 1 . now , let us express threshold voltages at which strong inversion occurs on the surfaces of the n - collector layer 3 and the p - base layer 2 by the distributed potential of the ocas 11 , by and v thn and v thp , respectively . owing to the presence of the ocas 11 , an effective voltage δv n applied to the surface of the n - collector layer 3 is equal to ( v s - v ce ) , which is negative . a surface portion of the n - collector layer 3 where the absolute value of δv n is greater than the absolute value of the threshold voltage v thn , is converted into a depletion layer . in a case where the ocas 11 is not provided , the potential v s of the ocas 11 is not present , and hence the surface of the n - collector layer 3 is converted in a depletion layer only by the emitter - collector voltage v ce . that is , when the ocas 11 is provided , a depletion layer dl in the surface of the n - collector layer 3 is extended , and hence the electric field intensity in the surface of the n - collector layer 3 is reduced . thus , the surface of the layer 3 can withstand a high base - collector voltage . while , owing to the potential distribution at the ocas 11 , an effective voltage δv p applied to the surface of the p - base layer 2 is approximately equal to v s ( which is positive ), when the built - in voltage v bi of the pn junction formed between the n + - emitter layer 1 and the p - base layer 2 is neglected . a surface portion of the p - base layer 2 where the effective voltage δv p is greater than the threshold voltage v thp , is converted into a depletion layer . now , let us consider a case where the p - base layer 2 is formed by diffusion , by way of example . the p - base layer 2 has the highest impurity concentration at a position where a dopant is selectively deposited , and the impurity concentration decreases as the distance from the above position in an inward or lateral direction is larger . for example , let us suppose that the impurity concentration varies in accordance with the gaussian distribution . then , the impurity concentration n ( y , t ) is given by the following equation : ## equ2 ## where q 0 indicates the total quentity of the dopant deposited on the substrate surface at the above position , d a diffusion constant , and y the distance from the above position . further , the threshold voltage v thp is a function of the impurity concentration , and is approximately expressed by the following equation : ## equ3 ## where v fb indicates a flat band voltage , φ fp a fermi potential , ε s the relative dielectric constant of silicon , ε 0 the dielectric constant of vacuum , q the electronic charge , n a the impurity concentration at the surface of the p - base layer 2 , and c 0 the capacitance per unit area of the insulating film 10 underlying the ocas 11 . as indicated by a dotted line in fig2 a , the threshold voltage v thp is large at a surface portion having a high impurity concentration . it is to be noted that a surface portion of the p - base layer 2 where v thp & gt ; v s , is kept at an accumulation , and is not affected by the potential v s of the ocas 11 . hence , the above surface portion is remained as a neutral region even when the emitter - collector voltage v ce is applied . accordingly , if the p - base layer 2 includes a surface portion having a high impurity concentration , the present npn transistor will not be subjected to punch - through breakdown . for example , let us consider a case where the impurity concentration n a at the surface of the p - base layer 2 is equal to 1 × 10 19 atoms / cm 3 , the insulating film 10 is made of sio 2 and has a thickness of 1 . 5 μm , and the flat band voltage v fb is nearly equal to zero . in this case , the threshold voltage v thp is approximately equal to 1 , 100 v , and hence the p - base layer 2 is not readily inverted . as is evident from the above explanation , the ocas 11 can improve the base - collector breakdown voltage v cbo . next , explanation will be made of the reason why the base - collector breakdown voltage is improved . the emitter - collector breakdown voltage bv ceo is affected by the transistor action , and hence is given by the following formula : ## equ4 ## where n is a constant in a range from 2 to 5 , and h fe indicates a common - emitter current gain . the current gain h fe varies with the collector current i c as shown in fig3 . that is , the current gain h fe is small for a small collector current , increases with increasing collector current , and reaches a maximum value h femad at a collector current i c *. the collector current i c1 of the transistor of fig1 a to 1c is given by the following equation : ps where i cbo1 indicates a leakage current at the base - collector junction , and i s1 a leakage current flowing through the ocas 11 . fig4 shows a transistor according to the prior art . in this prior art transistor , an sipos 11 is provided so as to bridge the pn junction formed between the p - base layer 2 and the n - collector layer 3 , through the base electrode 7 and the channel cut electrode 9 . incidentally , in fig4 the same reference numerals as in fig1 a to 1c designate identical or equivalent parts . when the leakage current at the base - collector junction and the leakage current flowing through the sipos 11 are expressed by i cbo2 and i s2 , respectively , the collector current i c2 of the prior art transistor of fig4 is given by the following equation : when the leakage currents i cbo1 and i s1 in the equation ( 5 ) are equal to the leakage currents i cbo2 and i s1 in the equation ( 6 ), respectively , it can be supposed that the collector current i c2 is greater than the collector current i c1 , since the leakage current i s2 acts as a base current in the prior art transistor . next , it will be confirmed that the collector current i c2 is greater than the collector current i c1 . and check whether or not a term δh fe takes such a state as shown in fig3 . from the equations ( 5 ) to ( 8 ), the term δh fe is given by the following equation : ## equ5 ## since a current gain h fe is smaller than 1 ( one ), the equation ( 9 ) shows that the term δh fe is positive . accordingly , the supposition that the collector current i c2 is greater than the collector current i c1 , is correct , and the current gain h fe2 is undoubtedly greater than the current gain h fe1 . by substituting the current gains h fe1 and h fe2 in the equation ( 4 ), we can obtain the following equations : ## equ6 ## when the breakdown voltage bv cbo1 is equal to the breakdown voltage bv cbo2 , the breakdown voltage bv ceo1 is greater the breakdown voltage bv ceo2 . that is , according to the present invention , not only the collector - base breakdown voltage bv cbo but also the collector - emitter breakdown voltage bv ceo can be improved . as mentioned above , in the prior art transistor of fig4 in which the leakage current i s flowing through the sipos 11 acts as the base current causing the transistor action , owing to the presence of the sipos 11 , the base - collector breakdown voltage bv cbo is enhenced , but the emitter - collector breakdown voltage bv ceo is lowered . on the other hand , according to the present invention , the ocas 11 does not contact with the base electrode 7 as shown in fig1 a and 1b but is connected directly to the emitter electrode 6 and the channel cut electrode 9 . accordingly , the leakage current i s flowing through the ocas 11 does not cause the transistor action , and thus a reduction in emitter - collector breakdown voltage due to the ocas 11 does not occur . fig5 a and 5b show , in section , another transistor which is the second embodiment of the present invention . in fig5 a and 5b , reference numerals 1 to 11 designate the same parts as in fig1 a to 1c . the transistor of fig5 a and 5b is characterized in that a highly - doped p + - layer 12 is formed selectively in the surface of the p - base layer 2 of a semiconductor substrate 200 . usually , the p - base layer 2 is formed by selective diffusion techniques . accordingly , the p - base layer 2 has a high impurity concentration at the surface thereof , and the impurity concentration decreases as the distance from the surface in the inward direction is larger . in some cases , however , it is preferable to make low the impurity concentration of the p - base layer 2 for the purpose of enhancing the emitter - base breakdown voltage and improving switching characteristics of transistor . in more detail , when the impurity concentration of that portion of the p - base layer 2 which is kept in contact with the insulating film 10 and exists in close proximity to the emitter - base junction , is made low , the emitter - base breakdown voltage bv ebo is enhanced . further , when the impurity concentration of that portion of the p - base layer 2 which exists just beneath the n + - emitter layer 1 , is made low , the current gain h fe for large values of collector current i c increases , and thus the switching characteristics of transistor are improved . however , in order to prevent punch - through breakdown in an npn transistor , it is required to make high the impurity concentration at the surface of the p - base layer 2 . in view of the above facts , in the transistor of fig5 a and 5b , the impurity concentration of the p - base layer 2 is made low , and the p + - layer 12 is formed only in a portion of the surface of the p - base layer 2 . thus , the base - collector breakdown voltage bv cbo is further improved , and hence the advantage of the present invention is emphasized . fig6 a and 6b show a further transistor which is the third embodiment of the present invention and is a modified version of the second embodiment of fig5 a and 5b , and correspond to fig5 a and 5b , respectively . in fig6 a and 6b , the same reference numerals as in fig5 a and 5b designate like parts . the transistor of the fig6 a and 6b different from that of fig5 a and 5b , in that the emitter electrode 6 on a semiconductor substrate 300 is extended toward the channel cut electrode 9 over that portion of the pn junction formed between the p - base layer 2 and the n - collector layer 3 which is kept in contact with the insulating film 10 , and thus the whole of the above pn junction is covered with the emitter electrode 6 . accordingly , when an emitter - collector voltage v ce is applied between the electrodes 6 and 8 , a voltage applied across the pn junction formed between the n + - emitter layer 1 and the p - base layer 2 is in the order of a built - in voltage v bi of the emitter - base junction , and no voltage is applied to the surface of the p - base layer 2 by the ocas 11 . accordingly , the inversion or depletion layer which has been explained with reference to fig2 a , is not formed in the surface of the p - base layer 2 , and thus it is presented that the breakdown voltage of the npn transistor is lowered by the punch - through phenomena at the p - base layer 2 . basically , the p + - layer 12 of fig6 a and 6b is not always required , but can further improve the breakdown voltage and the reliability of the transistor . next , it will be explained on the basis of the result of experiments made by the inventors that the present invention is effective for improving the emitter - collector breakdown voltage bv ceo . fig7 shows the emitter - collector breakdown voltage bv ceo and base - collector breakdown voltage of transistor having the inventive structure of fig6 a and 6b , and the above breakdown voltages of transistors having the conventional structure of fig4 . the ocas 11 in the inventive structure was formed in the following manner . a semiconductor substrate was placed on a susceptor which was mounted in a bell jar , at atmospheric pressure . thereafter , the ocas was grown on the substrate of 650 ° c . by the chemical vapor decomposition using the reaction of nitrous oxide ( n 2 o ) and monosilane ( sih 4 ). the breakdown voltages bv cbo and bv ceo of the above transistor varied with the gas flow ratio ( namely , γ = n 2 o / sih 4 ) as shown in fig7 . incidentally , the resistivity of the n - collector 3 was made equal to 36 ω · cm in both the prior art structure of fig4 and the inventive structure of fig6 a and 6b . referring to fig7 the transistor having the prior art structure and the transistors having the inventive structure have the same base - collector breakdown voltages bv cbo indicated by a curve a . in the transistors having the prior art structure , however , when the content ratio γ of reactant gases is small , the resistance of the sipos 11 decreases , and the leakage current i s flowing through the sipos 11 increases . thus , the emitter - collector breakdown voltage bv ceo is greatly reduced by the transistor action due to the leakage current i s , as indicated by a curve b . the above fact has been already explained in detail , using the equations ( 4 ) and ( 6 ) and fig4 and hence further explanation thereof will be omitted . while , in the transistors having the inventive structure , as indicated by a curve c of fig7 the emitter - collector breakdown voltage bv ceo is not reduced by the leakage current i s but is determined only by the semiconductor substrate itself , and a ratio of the emitter - collector breakdown voltage v ceo to the base - collector breakdown voltage v cbo is nearly equal to 0 . 8 for each value of gas flow ratio γ . that is , according to the present invention , the base - collector breakdown voltage bv cbo and the emitter - collector breakdown voltage are both improved . next , explanation will be made of thyristors according to the present invention . fig8 a and 8b show a gate turn - off thyristor which is the fourth embodiment of the present invention . referring to fig8 a and 8b , a semiconductor substrate 400 has a four - layer structure of pnpn , and includes an n + - emitter layer 21 having the form of the teeth of comb , a p - base layer 22 , an n - base layer 23 , a p - emitter layer 24 , an n + - shorting layer 25 , and a p + - layer 32 . a cathode electrode 26 and a gate electrode 27 are provided on the n + - emitter layer 21 and the p - base layer 22 , respectively , and an anode electrode 28 is provided on the p - emitter layer 24 and the n + - shorting layer 25 . other reference numerals than the above - mentioned designate the same parts as in fig1 a to 1c . the ocas 11 is connected through the channel cut electrode 9 to the n - base layer 23 , which has substantially the same potential with the p - emitter layer 24 and the anode electrode 28 through the n + - shorting layer 25 . now , explanation will be made of the operation of the thyristor of fig8 a and 8b in a blocking state . an anode volta v ak is applied between the anode electrode 28 and the cathode electrode 26 so that the electrode 28 is at a positive potential with respect to the electrode 26 , while keeping the gate electrode 27 at an open state . the n + - shorting layer 25 , the n - base layer 23 and the n + - channel cut layer 5 make up an n + n n + structure , that is , a three - layer structure of the same conductivity type . in a blocking state , that is , in a state that minority carriers are prevented from being injected from the n + - emitter layer 21 and the p - emitter layer 24 into the p - base layer 22 and the n - base layer 23 , respectively , the layer 25 , 23 and 5 of the above n + n n + structure have the same potential . in other words , the anode electrode 28 has the same potential with the channel cut electrode 9 , and hence the anode voltage v ak is considered to be applied between the channel cut electrode 9 and the cathode electrode 26 . when such an anode voltage is applied to the thyristor , the leakage current i s pasing through the ocas 11 flows through the cathode electrode 26 and the channel cut electrode 9 , but does not flow through the gate electrode 27 . accordingly , an npn transistor portion made up the n + - emitter layer 21 , the p - base layer 22 and the n - base layer 23 is not operated by the leakage current i s . accordingly , as has been explained in detail for the transistor of fig1 a to 1c , a reduction in breakdown voltage due to the npn transistor action does not occur in the thyristor of fig8 a and 8b . further , even when an abruptly varying voltage ( namely , a voltage having a large value of dv / dt ) is applied between the cathode electrode 26 and the anode electrode 28 , the erroneous triggering will not take place , since the leakage current i s flows directly into the cathode electrode 26 . a gate signal which is applied between the cathode electrode 26 and the gate electrode 28 to turn on or off the thyristor , does not pass through the ocas 11 . accordingly , the turn - on and turn - off characteristics of the thyristor is never deteriorated by the ocas 11 . fig9 a to 9c show a uni - surface type thyristor which is the fifth embodiment of the present invention . referring to fig9 a to 9c , the p - emitter layer 24 is also exposed to the surface of a semiconductor substrate 500 on the cathode side , and a second anode electrode 82 which is provided on the exposed surface of the p - emitter layer 24 on the cathode side , is connected to the ocas 11 . other reference numerals designate the same parts as in fig8 a and 8b . now , the operation of the thyristor of fig9 a to 9c will be explained below . when an anode voltage v ak1 is applied between the anode electrode 28 and the cathode electrode 26 so that the electrode 28 is at a positive potential with respect to the electrode 26 , while keeping the gate electrode 27 at an open state , that is , the thyristor is put into a forward blocking state , the anode voltage v ak1 is applied to a pn junction j 2 formed between the p - base layer 2 and the n - base layer 3 , and thus a depletion layer is extended from the pn junction j 2 mainly into the n - base layer 23 . when an end portion 82a of the second anode electrode 82 is extended toward the cathode electrode 26 over that portion of a pn junction j 1 formed between the p - emitter layer 24 and the n - base layer 23 which is exposed to the surface of the substrate 500 on the cathode side , the second anode electrode 82 acts as a field plate , and the above - mentioned depletion layer is not extended across the end portion 82a of the second anode electrode 82 . therefore , the punch through does not occur in a pnp structure made up of the p - base layer 22 , the n - base layer 23 and the p - emitter layer 24 . moreover , the ocas 11 does not contact with the gate electrode 27 but is connected directly to the cathode electrode 26 and the second anode electrode 82 , similarly to the structures of fig1 a to 1c and fig8 a to 8b . accordingly , the ocas 11 does not cause a transistor action in an npn transistor portion made up of the n + - emitter layer 21 , the p - base layer 22 and the n - base layer 23 , and hence the npn transistor portion has an ideal breakdown voltage . further , even when an anode voltage v ak2 is applied between the cathode electrode 26 and the anode electrode 28 so that the electrode 26 is at a positive potential with respect to the electrode 28 , that is , the thyristor is put into a reverse blocking state , the ocas 11 according to the present invention can exhibit the same effect as in the forward blocking state . accordingly , the present invention is applicable to a thyristor having both the forward blocking state and the reverse blocking state . fig1 a to 10c show a thyristor which is a modified version of the thyristor of fig9 a to 9c and is the sixth embodiment of the present invention . the thyristor of fig1 a to 10c is greatly different from that of fig9 a to 9c , in that the n + - channel cut layer 5 is provided in the surface of the n - base layer 23 at a position spaced apart equally from the pn junctions j 1 and j 2 , and an opening 100 is provided in the insulating film 10 at a position just above the channel cut layer 5 . incidentally , the same reference numerals as in fig9 a to 9c designate like parts . now , the operation of the thyristor of fig1 a to 10c will be explained below . first , let us consider a case where the thyristor is put into a forward blocking state , that is , the anode voltage v ak1 is applied between the anode electrode 28 and the cathode electrode 26 so that the electrode 28 is at a positive potential with respect to the electrode 26 . in this case , the pn junction j 1 is applied with a forward bias voltage , and the pn junction j 2 is applied with a reverse bias voltage . further , in a pnn + structure formed of the p - emitter layer 24 , the n - base layer 23 and the n + - channel cut layer 5 , a potential difference between the p - emitter layer 24 and the channel cut layer 5 is substantially equal to a built - in voltage of about 0 . 7 v at the pn junction j 1 . accordingly , almost the whole of the anode voltage v ak1 is applied across the pn junction j 2 . in other words , the anode voltage v ak1 is applied , as a reverse bias voltage , to a pnn + diode portion made up of the p - base layer 22 , the n - base layer 23 and the n + - channel cut layer 5 . accordingly , that surface portion of the n - base layer 23 which is sandwiched between the p - emitter layer 24 and the n + - channel cut layer 5 is not converted into a depletion layer but exists as a neutral region . when the width of the above surface portion behaving as the neutral region is made large , the current gain of the pnp transistor portion in lateral directions decreases . accordingly , even when the leakage current i s flows between the n + - channel cut layer 5 and the n + - emitter layer 21 through the ocas 11 , the breakdown voltage of the thyristor is scarcely lowered by the transistor action of the pnp transistor portion in lateral directions . further , the thyristor of the fig1 a to 10c can produce the effect of the present invention such as explained previously with reference to fig1 a to 1c . that is , as is apparent from fig1 a and 10b , the leakage current i s flowing through the ocas 11 does not pass through the p - base layer 22 . accordingly , a reduction in breakdown voltage of the thyristor due to the transistor action of the npn transistor portion is not accelerated by the leakage current i s . further , in a case where the anode voltage v ak2 is applied between the anode electrode 28 and the cathode electrode 26 so that the electrode 26 is at a positive potential with respect to the electrode 28 , that is , the thyristor is put into a reverse blocking state , a reverse bias voltage is applied not to the pn junction j 2 but to the pn junction j 1 , and the thyristor can exhibit the same effect as in the forward blocking state . fig1 a to 11c show a thyristor which is a modified version of the sixth embodiment of fig1 a to 10c and is the seventh embodiment of the present invention . the seventh embodiment is different from the sixth embodiment of fig1 a to 10c in the following points . referring to fig1 a to 11c , the channel cut electrode 9 is provided on a semiconductor substrate 700 so as to be kept in contact with the n + - channel cut layer 5 . further , the channel cut electrode 9 is kept in contact not only with an ocas 11 from the second anode electrode 82 but also with another ocas 11 from the cathode electrode 26 . the fundamental operation of the seventh embodiment is the same as that of the sixth embodiment having been explained with reference to fig1 a to 10c , and therefore detailed explanation thereof will be omitted . in the seventh embodiment , those end portions of two ocas &# 39 ; s 11 which are both spaced apart substantially equally from the second anode electrode 82 and the cathode electrode 26 , have the same potential with the channel cut electrode 5 . further , the seventh embodiment has an advantage that the channel cut electrode 9 can be formed at the same time as the cathode electrode 26 , the gate electrode 27 and the second anode electrode 82 are formed . fig1 a and 12b show a bi - directional thyristor which is fabricated in accordance with the present invention and is the eighth embodiment of the present invention . referring to fig1 a and 12b , a semiconductor substrate 800 includes an n + - emitter layer 41 , a p - base layer 42 , an n - base layer 43 , a p - emitter layer 44 , a second n + - emitter layer 45 , and an auxiliary n + - emitter layer 46 . a t 1 - electrode 47 is provided on the n + - emitter layer 41 and the p - base layer 42 ; a t 2 - electrode 48 is provided on the p - emitter layer 44 and the second n + - emitter layer 45 , a gate electrode 49 is provided on the p - base layer 42 and the auxiliary n + - emitter layer 46 , and a second t 2 - electrode 50 is provided on that exposed surface of the p - emitter layer 44 which exists on the upper principal surface side of the substrate 800 . that portion of the upper principal surface of the substrate 800 which is not provided with the electrodes 47 , 49 and 50 , is coated with the insulating film 10 . further , the ocas 11 is provided on that portion of the insulating film 10 which is sandwiched between the t 1 - electrode 47 and the second t 1 - electrode 50 , in accordance with the present invention . the bi - directional thyristor of fig1 a and 10b has a uni - surface , center - gate structure , and the pn junctions j 2 and j 1 block forward and reverse voltages , respectively . the ocas 11 is provided over the p - base layer 42 , the n - base layer 43 and the p - emitter layer 44 . accordingly , when a voltage is applied between the t 1 - electrode 47 and the t 2 - electrode 48 so that the t 1 - electrode is at a positive or negative potential with respect to the t 2 - electrode , the leakage current i s flows through the ocas 11 but does not cause a transistor action which lowers the breakdown voltage of the thyristor . further , even when an abruptly varying voltage ( namely , a voltage having a large value of dv / dt ) is applied between the t 1 - electrode and the t 2 - electrode , an erroneous triggering will not occur for the same reason as explained previously for the thyristor of fig8 a and 8b . as has been explained in the foregoing , the present invention is applicable to semiconductor devices having a semiconductor substrate which is provided with a control electrode and includes at least a three - layer structure of pnp or npn , such as a transistor , an ordinary thyristor , a gate turn - off thyristor and a bi - directional thyristor . it is needless to say that the present invention is applicable to semiconductor devices which are opposite in the conductivity type of each semiconductor layer to the embodiments . in the embodiments , the ocas 11 is provided on the upper principal surface of the semiconductor substrate . alternatively , the ocas 11 may be provided on that side surface of the semiconductor substrate where a pn junction is exposed . although , in the embodiments , the ocas is used as a resistive material film according to the present invention , the sipos and other resistive films may be used in place of the ocas . in the foregoing , it has been explained that according to the present invention , the breakdown voltage of a semiconductor device can be improved . the inventors carried out a high - temperature , reverse - bias life test , to check the stability of the breakdown voltage , leakage current and current gain . a large change in each of these factors was not found in the above test . further , the inventors carried out a pressure cooker test and a high - pressure , high - humidity storage test to check the moisture resistance of a semiconductor device according to the present invention . any change in the characteristics of the semiconductor device was not found in these tests . thus , it has been confirmed that a semiconductor device according to the present invention is very reliable . as has been explained in the foregoing , according to the present invention , there is provided a semiconductor device which has a high breakdown voltage and is highly reliable . | 8 |
the present invention is predicated in part of the recognition that , contrary to the traditional view , the response time of a photoconductive - type detector is enhanced as the electrode spacing is reduced . this improvement amounts to a few picoseconds in the detector response and is not easily observed except when using a fast - recovering semiconductor , such as lt - gaas . in addition to requiring a fast material , a subpicosecond measurement technique is necessary to observe the change in the response time . to operate the photoconductive - type detector at its highest sensitivity requires a bias voltage close to the dc breakdown . at sufficiently high field , the responsivity can approach that of a conventional photodiode . for the present detector , the intrinsic carrier lifetime for the semiconductor was determined to be 0 . 5 - 1 . 0 ps using an all - optical reflectivity measurement technique . then , the following design formula was applied : ## equ1 ## where : ______________________________________1 . sub . p = photo - induced current hv = photon energyq = charge of electron μ . sub . n = electron mobilityn = quantum efficiency τ = carrier lifetimep . sub . opt = incident optical power e = electric field l = electrode spacing______________________________________ which states that by matching the carrier transit time to the previously measured carrier lifetime , the sensitivity of a photoconductive - type detector can reach that of an ideal photodiode . a carrier transit time of 1 ps would require an electrode spacing on the order of 100 nm for this condition to be satisfied . with an electrode spacing & gt ; 500 nm , a regime of non - steady - state charge transport is achieved . in that case , the electron velocity , μ n , for the case of gaas is not the conventional steady - state saturation value of ˜ 10 7 cm / s , but instead can be as high as 2 - 3 × 10 7 cm / s . this means that an electrode spacing of 200 nm should be sufficient to achieve photodiode - like sensitivity ( responsivity ˜ 0 . 5 a / w ). at an electrode spacing of 200 nm , a bias voltage of 10 v dc has been applied without breakdown . this corresponds to 500 kv / cm , and is the highest electric field yet applied across a semiconductor - based metal - semiconductor - metal ( msm ) structure . at this field strength , a responsivity of 0 . 1 a / w has been measured experimentally , without accounting for losses resulting from optical reflections at the surface . using electro - optic sampling technique , the decay time for the detector was fast at all bias voltage settings , even at the highest . this was a surprising result . the same material with 1000 nm electrode spacing showed an increase in decay time as the e - field was increased from 50 to 200 kv / cm . although it would appear that higher sensitivity could be obtained from the larger , 1000 nm - electrode - spaced detector , the would also be an accompanying loss in detector response . from eq . 1 one can determine that in order to achieve unity photocurrent gain , for a carrier lifetime τ = 1 ps , and a mobility μ n = 100 cm 2 / vs , requires a value for e / l = 10 10 v / cm 2 . for electrode spacing of l ˜ 1000 nm ( 10 - 6 cm ) the required e - field is ˜ 10 6 v / cm . at this electrode spacing , broadening of the response time was observed when the e - field was above 10 5 v / cm . however , with the electrode spacing reduced to ˜ 200 nm , the required e - field to achieve unity photocurrent gain is ˜ 2 × 10 5 v / cm . at this electrode spacing , no degradation to the response was observed even for e - fields as high as 5 × 10 5 v / cm . therefore , reducing the electrode spacing to 200 nm simultaneously achieves near - unity photocurrent gain and holds the response time to 1 . 2 ps . fig1 is a side view of a photoresponsive probe system 10 constructed in accordance with the invention . as shown in this figure , probe system 10 is provided with an interdigitated photoresponsive gate 12 which is shown in greater detail in the insert to fig1 . the photoresponsive gate arrangement is described in detail in the related patent application , filed on even date herewith , and identified hereinabove . photoresponsive gate 12 is interposed between an electrode 11 on which is deposited a probe tip 16 , and an electrode 13 which , in this embodiment , is coupled electrically to a lock - in amplifier ( not shown ). electrodes 11 and 13 , as well as photoresponsive gate 12 , are arranged on a layer of semiconductor material 18 which is active in that it has a band - gap characteristic which induces the generation of photocarriers in response to incident light , such as light pulse 14 which is delivered to the underside of photoresponsive gate 12 via a lens 19 . the light of light pulse 14 is propagated through transparent layer 17 of semiconductor material . this light pulse therefore controls the on - and - off state of photoresponsive gate 12 , and therefore , the electrical communication between electrode 13 and probe tip 16 . in addition to serving as a high - sensitivity photodetector , the inventive device can also be used as a high - efficiency switch for electrical pulse generation or gating operation . experimental measurements show that , with a modest amount of light , i . e ., tens of pj , the photoresponsive gate of the present invention can be driven from 10 7 ω down to about 10 ω , with only slight broadening of the response , i . e ., from 1 . 2 to 1 . 5 ps . therefore , the same switch can function in dual mode as either a sensitive photodetector with a responsivity of 0 . 1 a / w , or at a higher light level , as an efficient pulse generator or gate . in pulse generation mode , peak electrical signals of 13 v have been generated into 90 ω using 21 pj / pulse , corresponding to an optical - to - electrical power conversion of & gt ; 10 %. fig2 is a schematic representation of a pulser system constructed in accordance with the principles of the invention and showing the interrelationship between the interdigitated electrode structure , an integrated low - pass filter , and an integrated capacitor . elements of structure which bear analogous correspondence to those discussed hereinabove with respect to fig1 are similarly designated . this figure shows a reference electrode in the form of a wire bond pad 23 which is coupled electrically to bias electrode 13 via a storage capacitor 21 . electrode 11 , on which the probe tip ( not shown ) is arranged , is also coupled to wire bond pad 23 via a low - pass filter 20 . low - pass filter 20 is integrally formed with the interdigitated photoresponsive gate 12 . capacitor 21 also is integrally formed and has a value less than 10 pf . this capacitor supplies a charge to the photoconductive gate which is coupled as a pulse to electrode 11 and the probe tip via the photoresponsive gate . such coupling is responsive to the receipt of incident light as discussed hereinabove with respect to fig1 . a low - pass filter 22 receives a dc voltage which is conducted to a further wire bond pad 25 . wire bond pad 25 is electrically coupled to electrode 13 , which in this embodiment of the invention , functions as a bias electrode . in a practical embodiment of the invention , a prototype interdigitated structure having 0 . 2 μm interdigital spacing has been fabricated which has been shown to hold off a bias of some 10 v dc . this corresponds to 500 kv / cm , and is the highest electric field yet applied across a semiconductor - based metal - semiconductor - metal ( msm ) structure . fig3 is a representation of the underside of a specific illustrative embodiment of the invention which comprises a gaas - based picosecond pulser / sampler probe 30 . probe 30 is formed on a transparent substrate 31 on which is deposited a photoresponsive layer 32 which is capable of generating photo - induced carriers . electrodes 33 and 34 are coupled to probe tip 36 via respective ones of photoresponsive gates 37 and 38 . the photoresponsive gates are each coupled to a contact electrode 39 on which the probe tip is arranged . in addition to the foregoing , a conductor couples contact electrode 39 to a bonding pad 41 . this arrangement of pad 41 and conductor 40 can be used to provide a dc termination resistance which facilitates determination of a system impedance . in operation , electrode 33 may function as an input electrode which provides pulses to probe tip 36 for delivery to the device under test ( not shown ). in such an arrangement , photoresponsive gate 37 may be provided with a storage capacitor , as discussed hereinabove with respect to fig2 . photoresponsive gate 38 may function as a sampling switch which couples to electrode 34 which serves as the output electrode . this electrode may be attached to a low impedance lock - in amplifier ( not shown in this figure ). in a further possible mode of operation of the structure of fig3 electrode 33 may function as an input or bias electrode which communicates electrically via photoresponsive gate 37 . this photoresponsive gate is modulated optically at a frequency f 2 . electrode 34 serves as an output electrode , and its associated photoresponsive gate is modulated as a sampling switch at a frequency f 1 . the lock - in amplifier ( not shown in this figure ) would then be tuned to a frequency of f 2 - f 1 . fig4 is a schematic representation which illustrates the operation of the arrangement of fig2 in a system context . a frequency controller 50 issues a pulse train f 1 at a pulse output thereof which is subjected to an optical delay 52 , illustratively in the form of a prism . the frequency controller additionally produces at a further pulse output a sequence of pulses at a frequency f 2 . both outputs , f 1 and f 2 , control respective optical choppers 54 and 55 . the outputs of the optical choppers are combined in a splitter / combiner 57 , and the combined outputs having components f 1 and f 2 is connected to lens 19 via an optical fiber 60 . the combined optical signals are directed to photoresponsive gate 12 , which as previously indicated , is arranged electrically intermediate of electrode 13 and electrode 11 on which the probe tip ( not shown in this figure ) is disposed . frequency controller 50 produces at an output 61 a signal which is responsive to the difference between the frequencies f 2 and f 1 . this signal is conducted to a lock - in amplifier 65 which in tuned to amplify only in a narrow frequency band in the vicinity of f 2 - f 1 . lock - in amplifier 65 produces an output signal which is directed to a display system 67 . the display system therefore provides a visual indication which is indicative of the response of a device under test when it is subjected to a pulser train of optical pulses chopped at a frequency f 1 combined with a gate train of optical pulses chopped at f 2 . fig5 is a schematic representation which illustrates the manner in which piezoelectric bimorphous materials can be employed to cause movement in the z - direction . fig5 shows an arrangement 70 wherein a microscope 71 , which may be a scanning tunneling microscope or an atomic force microscope is installed on a common support 72 with a photoconductive probe 73 , constructed as discussed hereinabove . microscope 71 and probe 73 are each installed on respective piezoelectric elements 75 and 76 which facilitate independent translation with respect to one another in the z - direction . although the invention has been described in terms of specific embodiments and applications , persons skilled in the art can , in light of this teaching , generate additional embodiments without exceeding the scope or departing from the spirit of the claimed invention . accordingly , it is to be understood that the drawing and description in this disclosure are proffered to facilitate comprehension of the invention , and should not be construed to limit the scope thereof . | 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.